Datasets:

LeaBresson

/

pubmed-summarization-sample2

like 1

the world health organization estimates that there were between 8.8 and 9.2 million new tuberculosis cases in 2010 . ( ) in addition , it is estimated that 1.2 million of those cases are infected by hiv . furthermore , it is estimated that 1.1 million deaths occurred in hiv - negative tuberculosis patients , which equates to 15 deaths per 100,000 population . mortality is the most sensitive indicator of tuberculosis control measures ( ) ; tuberculosis remains among the top ten causes of death worldwide . the goal of curing 85% of tuberculosis cases , set by the world health assembly in 1991 , was not achieved in 2009 in 7 of the 22 countries with the highest burden of the disease , including brazil ( at 72% ) . ( ) diagnosis in an early stage of the disease is of paramount importance for treatment initiation , with direct consequences for individual disease control and , therefore , for public health initiatives aimed at the prevention of tuberculosis transmission . therefore , it is necessary that clinical microbiology laboratories be able to quickly identify mycobacteria by means of microscopy and culture . however , sputum smear tests , although rapid and cost - effective , have low sensitivity and specificity , particularly in paucibacillary samples , and culture , even though it is considered the gold standard due to its high sensitivity , requires several weeks to produce a result.(- ) currently , brazil is one of the countries that , together , accounts for 80% of tuberculosis cases , with an incidence of 70,977 cases in 2010 . ( , ) for the majority of those cases , the diagnosis was based only on sputum smear test results ; chest x - rays , cultures , and biochemical tests for mycobacterium spp . were only carried out in patients with negative sputum smear results but with respiratory symptoms . ( , ) these diagnostic limitations have encouraged the use of molecular tools with improved sensitivity , specificity , and speed , in order to detect mycobacteria in all clinical specimens.(- , ) the new technologies that are being developed have recently redefined the diagnosis of tuberculosis , providing a basis for diagnostic laboratory techniques.(5,8 ) the molecular diagnosis of tuberculosis by polymerase chain reaction ( pcr ) and primers with high specificity ( 98% ) , with high variations in sensitivity ( 20 - 100% ) , has been used in order to identify genetic targets in the bacillus . ( , , ) despite the widespread use of conventional pcr , modifications in the technique , such as the addition of one extra reaction ( nested pcr ) , have increased its sensitivity and specificity . ( ) this might be due to the fact that it dilutes potential pcr inhibitors , which are commonly present in biological samples . ( ) therefore , the possibility of having access to a molecular tool that leads to a more rapid diagnosis and that is effective for the detection of cases that are difficult to elucidate by conventional tests certainly helps decrease morbidity and improve tuberculosis control . the aim of the present study was to evaluate the technique of nested pcr targeting the insertion sequence is6110 in mycobacterium tuberculosis and to compare the results with those obtained in cultures of samples from patients suspected of having pulmonary or extrapulmonary tuberculosis . this study was carried out between february and december of 2009 . the patients included in the study were submitted to physical evaluation and sample collection at the hospital de base , a referral center for the diagnosis and treatment of tuberculosis located in the city so jos do rio preto , brazil . epidemiological and clinical data were obtained from medical records in accordance with a protocol approved by the research ethics committee of faculdade de medicina de so jos do rio preto ( so jos do rio preto school of medicine ; protocol no . the presence of hiv antibodies , identified by elisa and confirmed by western blot , indicated hiv seropositivity . all of the patients included in the study were over 18 years of age , were immunosuppressed ( due to immunosuppression therapy , autoimmune disease , organ transplantation , or hiv - positivity ) , and presented with clinical symptoms and signs suggestive of pulmonary or extrapulmonary tuberculosis . our sample comprised 67 hospitalized patients , and 98 clinical specimens were collected , of which 20 were pulmonary specimens ( sputum , bal fluid , or gastric lavage fluid ) , and 78 were extrapulmonary specimens ( blood , cerebrospinal fluid , lymph node aspirate , urine , pleural fluid , secretion from ganglia , pleura fragment , liver fragment , ascitic fluid , bone marrow aspirate , or biopsy specimens ) . the number of specimens collected from the patients ranged from one to three , according to physician requests . the diagnostic confirmation of tuberculosis was based on the following criteria : clinical and radiological evidence of tuberculosis confirmed by laboratory tests , isolation of m. tuberculosis in clinical specimens by direct smear microscopy or culture ( gold standard ) , and evident clinical improvement after antimycobacterial treatment . in brief , direct smear microscopy was performed using ziehl - neelsen staining , and an automated microbial system ( bact / alert mp ; organon teknika corp . , durham , nc , usa ) was used for the identification of mycobacterium spp . in cultures . ( ) genotyping was carried out by pcr - restriction enzyme analysis in accordance with chimara et al . , ( ) although with modifications . blood samples were collected in 5-ml tubes containing edta , and peripheral blood mononuclear cells were isolated by density gradient centrifugation ( ficoll - histopaque ) for future extraction of the dna.(- ) for solid organs , 2.0-mm punch biopsy samples were collected . all clinical samples were kept at 20c until dna extraction , which was performed in accordance with the method described by rossetti et al . ( , , ) in brief , a 500-l aliquot of the sample was centrifuged at 13,000 rpm for 10 min and washed three times in tris - edta ( te ) . the pellet was resuspended in 100 l of te and heated at 100c for 10 min . the supernatant was transferred to a different tube , and 5 l of resin were added ( sephaglas bandprep kit ; amersham - pharmacia biotech , uppsala , sweden ) ; an aliquot of sodium iodide solution ( 0.9 g / ml ) was added to the final volume . the tube was shaken for 5 min and incubated at room temperature for 5 min . after centrifuging the tube for 1 min and discarding the supernatant , we added 200 l of iced 70% ethanol ; the tube was then shaken , after which it was centrifuged for 1 min . the resulting pellet was kept at room temperature for 60 min , in order to complete the drying process , and resuspended in 40 l of 1te . subsequently , the tube was centrifuged for 1 min , and the supernatant was transferred to another tube and stored at 20c until processing . ( , ) for the nested pcrs , is6110 of m. tuberculosis was used as the target sequence ( genbank accession no . 215310.1 ) . ( ) the following primers were used : sense ( tj3 5'-atc ccc tat ccg tat ggt g-3 ' ) ; antisense ( tj5 5'-ccg caa agt gtg gct aac-3 ' ) ; sense ( stan3 5'-gtc gag tac gcc ttc ttg tt-3 ' ) ; and antisense ( oli 5 5'-aac ggc tga tga cca aac-3 ' ) . the pcr used a final volume of 50 l ( 1 buffer , 50 mm mgcl2 , 10 pmol/l of each oligonucleotide , 0.2 m dntp , and 2 u taq dna polymerase [ invitrogen life technologies , carlsbad , ca , usa ] ) . the amplification process consisted of an initial denaturation step of 94c for 3 min , 30 denaturing cycles ( at 94c for 1 min , 57c for 1 min , and 72c for 1 min ) , followed by a final extension at 72c for 5 min . the second pcr was performed using 3 l of the product of the first pcr under similar conditions to those described above , but with an annealing temperature of 60c . dna of the h37rv strain of m. tuberculosis and pcr mix alone were used as positive and negative controls , respectively . the result was analyzed by electrophoresis on 2% agarose gel , stained with ethidium bromide , and visualized in an ultraviolet transilluminator ( fisher - biotech , fairlawn , nj , usa ) , resulting in a 316-bp fragment . the kappa statistic was used in order to assess the level of agreement among the results . the mean age of the patients was 40.10 3.66 years ( range , 18 - 87 years ) . tuberculosis was diagnosed in 11 individuals ( 16.41% ) , 5 being diagnosed with pulmonary tuberculosis and the remaining with extrapulmonary tuberculosis ( pleural tuberculosis in 3 , meningeal tuberculosis in 2 , and miliary tuberculosis in 1 ) . all culture isolates were confirmed by m. tuberculosis genotyping . nested pcr was positive in all of the cases of confirmed tuberculosis , as shown in table 1 . in 4 of the tuberculosis patients , positive laboratory results were obtained only by the molecular technique ( p = 0.110 ; fisher 's exact test ) . table 1 clinical , epidemiological , and laboratory data of the eleven patients with confirmed pulmonary or extrapulmonary tuberculosis . of the 98 clinical specimens analyzed , 6.00% , 8.16% , and 13.26% , respectively , showed positive results in smear microscopy , culture , and nested pcr , as summarized in table 1 . culture was negative in 2 of the samples with positive smear microscopy results , whereas smear microscopy was negative in 4 of the samples with positive culture results . by comparing the results of nested pcr with those of cultures in pulmonary samples ( table 2 ) , we found that the sensitivity and specificity of nested pcr were 100% and 83% , respectively . the positive and negative predictive values were 40% and 100% , respectively , with good concordance between the tests ( kappa = 0.50 ; p = 0.25 ; mcnemar 's test ) . regarding extrapulmonary samples ( table 2 ) , sensitivity , specificity , positive predictive value , and negative predictive value were , respectively , 83.0% , 96.0% , 62.5% , and 98.5% , with good concordance between the tests ( kappa = 0.6867 ; p = 0.625 ; mcnemar 's test ) . table 2 culture and nested polymerase chain reaction for the detection of mycobacterium tuberculosis in pulmonary and extrapulmonary samples . the early diagnosis of tuberculosis is essential for prompt treatment and effective control of the disease . ( ) this is particularly true in cases of extrapulmonary tuberculosis , because various factors can complicate the diagnosis of the disease . due to the paucibacillary nature of extrapulmonary tuberculosis , studies have shown a variability in positive culture results ( from 12% to 80% ) and a variety of clinical samples / biological tissues , which implies a non - uniform distribution of the bacillus , as well as the presence of nonspecific signs and symptoms.(,,- ) in our study , pleural tuberculosis was diagnosed in 2 hiv - negative patients , corroborating the findings of a study reporting that pleural tuberculosis is prevalent in extrapulmonary cases in hiv - negative patients . ( ) approximately 50% of hiv - positive individuals with tuberculosis develop extrapulmonary forms . ( , , , ) despite the small number of hiv - positive patients included in the present study , our results show a predominance of extrapulmonary tuberculosis ( 57% ) . various tests based on pcr techniques using commercial kits and in - house tests are being evaluated . the nested pcr technique , by targeting is6110 in order to identify the m. tuberculosis complex , ( ) provides variable sensitivity and specificity , depending on the laboratory , clinical specimen , bacillary load , cell lysis , and technical parameters . ( ) molecular techniques have greatly improved the detection of mycobacteria in lymph nodes and in various body fluids ( aspirates , cerebrospinal fluid , ascitic fluid , and pleural fluid ) . however , due to the variable sensitivity and specificity in different studies , positive results should be interpreted in conjunction with clinical findings . ( ) in the present study , the proportion of positive results in the individuals diagnosed with pulmonary or extrapulmonary tuberculosis using nested pcr ( 100% ) was higher than in other studies using the same target gene and carried out in brazil , ( ) india , ( ) and greece . ( ) the discordance between the molecular method and smear microscopy in pulmonary and extrapulmonary samples in our study ( in 1 and in 6 samples , respectively ) might be directly related to the low sensitivity of the phenotyping technique , the paucibacillary nature of samples , or even the absence of infection by afb , as observed by other authors . ( ) reported that a molecular technique targeting is6110 showed high positivity in pulmonary and extrapulmonary samples ( 90% and 77% , respectively ) , whereas smear microscopy showed low positivity ( 49% and 24% , respectively ) . ( ) when studying 19 pulmonary and 104 extrapulmonary samples , obtained higher positivity with a molecular technique targeting is6110 and tcr4 than with the smear method ( 17 similar and 12 divergent results ) . it is of note that a reported 50% of tuberculosis cases are classified as negative on the basis of smear microcopy results . ( ) in addition , smear microcopy was not performed in 32.43% of the reported cases of tuberculosis in brazil in 2010 . ( ) when we compared nested pcr and culture results in pulmonary samples , we found that 3 of the samples showed positive nested pcr results but negative culture results . the negative results in the cultures might be due to co - infection with hiv in 2 of the patients and kidney transplantation in 1 ( table 1 ) or to the characteristics of paucibacillary infections . ( , ) various factors can influence the result of cultures , such as the number of organisms present in the specimen , the methods of sample collection , previous treatments , and the processing method . in addition , the solutions used for digestion / decontamination of the samples can damage the mycobacteria . ( , ) in the present study , the molecular results supported the clinical and diagnostic criteria widely accepted for the diagnosis of tuberculosis . the sensitivity and specificity found for nested pcr in our study ( 100% and 83% , respectively ) are higher than those reported in previous studies using molecular techniques targeting the is6110 gene in sputum samples ( 88 - 98% and 15 - 100% , respectively ) . ( , , ) this difference might be attributable to the volume and type of samples , as well as to the different molecular typing protocols employed in different laboratories . ( , , ) hence , the correlation of the results with the clinical profile of the patient is essential for the diagnosis of tuberculosis , and the definition of the disease can therefore be established from negative cultures after the therapeutic test . ( ) this was found in 3 of our patients who had positive nested pcr results and negative culture results in their pulmonary samples , 2 of whom were cured after treatment and 1 of whom was noncompliant with the treatment . in addition , 2 patients died before the beginning of the recommended tuberculosis treatment . as to the concordance between nested pcr and culture , although the kappa coefficient ( 0.50 ) was lower than that reported in other studies , carried out in india ( kappa = 0.6 - 0.8 ) and in brazil ( kappa = 0.78 ) , the concordance was good . regarding extrapulmonary samples , nested pcr was positive in 3 of the blood samples with negative culture results , and negative in 1 of the cerebrospinal fluid samples with a positive culture result . this false - negative result in a cerebrospinal fluid sample ( table 1 ) might be related to the absence of copies of the is6110 gene , as previously described in studies conducted in southeast asia , denmark , tunisia , india , and vietnam , indicating the need to incorporate additional targets , such as trc4 , in order to improve molecular detection . ( , ) however , to our knowledge , no study to date has reported the absence of this element in m. tuberculosis strains in brazil , and various studies have reported that this sequence is the most sensitive in order to detect the m. tuberculosis complex . ( , ) another factor could be the presence of molecular reaction inhibitors in up to 18.6% of extrapulmonary specimens . ( ) in brazil , the prevalence of m. tuberculosis isolated in cultures ranges from 15.0% to 25.6% , ( , ) the highest values being obtained prior to the highly active antiretroviral therapy era . positive nested pcr results in blood samples led to the diagnosis of pulmonary tuberculosis in 2 hiv - negative patients and in 1 hiv - positive patient , as well as to the diagnosis of extrapulmonary tuberculosis in 1 hiv - negative patient and in 1 hiv - positive patient . in those blood samples , smear microscopy and culture were positive in only 1 and 2 samples , respectively ; this might be due to the small number of bacilli in the circulation . ( , ) in fact , the sensitivity of pcr in peripheral blood mononuclear cells , as used here , has been reported to be better than is that of culture , both having similar specificity . ( , , ) in addition , clinical specimens , such as cerebrospinal fluid , blood , and sputum , have been described as good substrates for pcr ( ) with good concordance ( kappa = 0.6867 ; p = 0.625 ; mcnemar 's test ) , as in our results , in which the level of positivity in extrapulmonary samples was higher when nested pcr was used ( p = 0.0042 ) , thus corroborating the findings of noussair et al . ( ) different rates of sensitivity were described using the molecular methodology for this type of sample in studies conducted in france ( ) and india ( ) ( 86.6% and 90% , respectively ) . if standardization studies using the same molecular target , dna extraction method , and pcr optimization were validated in different laboratories , the sensitivity of the test could be improved and , consequently , so could its concordance . in the present study , a positive nested pcr result , associated with the clinical features , was used as the single laboratory criterion for the diagnosis of 4 patients ( 2 with pulmonary tuberculosis and 2 with extrapulmonary tuberculosis ) , because it was the only test producing positive results ( table 1 ) ; the lack of isolates in cultures might be mainly due to the paucibacillary character of the samples . although the difference is not significant in this situation , diagnosis is often established only by clinical and radiological data , even if the culture and sputum smear testing are negative . in such cases , molecular analysis can help establish specific antimycobacterial therapy and , consequently , contribute to reduce empirical treatment , which has been currently used in almost 27% of suspected pulmonary tuberculosis cases . in addition , it can help control the spread of the bacillus ( ) and prevent more severe clinical evolution , mainly in hiv - positive patients . however , the current brazilian guidelines on tuberculosis do not include positive molecular results in the definition of tuberculosis cases ; as a rule , the use of this method has been restricted to certain referral and research centers in brazil . ( ) it is worth mentioning that clinical screening that is carefully designed to study the disease caused by mycobacteria , together with similar attention to the collection and transport of biological samples , are factors that contributed to the isolation of a higher rate of m. tuberculosis strains than was expected at our hospital . the present study corroborates the results obtained at a referral center for the diagnosis of tuberculosis in the city of so jos do rio preto ( xv subdivision of the so paulo state health department ) , in which a 50% increase in the number of isolates was observed during the study period . ( ) the results of the nested pcr assay revealed good agreement with those of the culture . the specificity and sensitivity achieved with this relatively simple molecular approach can be seen as an important contribution to the future establishment of a protocol for the molecular detection of m. tuberculosis complex in pulmonary and extrapulmonary samples . in addition , this methodology could reduce the time required for the appropriate diagnosis of tuberculosis . comparar o desempenho da tcnica nested polymerase chain reaction ( npcr ) com aquele de culturas na deteco do complexo mycobacterium tuberculosis em espcimes pulmonares e extrapulmonares . analisamos 20 e 78 espcimes pulmonares e extrapulmonares , respectivamente , de 67 pacientes hospitalizados com suspeita de tuberculose . , e m. tuberculosis is6110 foi utilizada como sequncia alvo na npcr . a estatstica kappa foi utilizada para verificar a concordncia entre os resultados . entre os 67 pacientes , 6 e 5 , respectivamente foram diagnosticados com tuberculose pulmonar e extrapulmonar , e a npcr foi positiva em todos os casos . entre os 98 espcimes clnicos , a baciloscopia , cultura e npcr foram positivas em 6,00% , 8,16% e 13,26% , respectivamente . comparando - se os resultados da npcr com aqueles da cultura ( padro ouro ) nos espcimes pulmonares , a sensibilidade e a especificidade foram 100% e 83% , respectivamente , enquanto essas nos espcimes extrapulmonares foram 83% e 96% respectivamente , com boa concordncia entre os testes ( kappa , 0,50 e 0,6867 , respectivamente ) . embora a npcr tenha se mostrado uma ferramenta muito til na deteco do complexo m. tuberculosis , no entanto , os resultados positivos da npcr devem ser associados clnica , dados clnicos , epidemiolgicos e outros dados laboratoriais devem tambm ser considerados no diagnstico e tratamento da tuberculose pulmonar e extrapulmonar . a organizao mundial da sade estima que houve entre 8,8 e 9,2 milhes de casos novos de tuberculose em 2010 . ( ) alm disso , estima - se que 1,2 milho desses casos estejam infectados pelo hiv . ademais , estima - se que 1,1 milho de bitos ocorreram em pacientes com tuberculose hiv negativos , o que equivale a 15 bitos por 100.000 habitantes . a mortalidade o indicador mais sensvel de medidas de controle da tuberculose ( ) ; a tuberculose continua a figurar entre as dez principais causas de bito em todo o mundo . a meta de cura de 85% dos casos de tuberculose , estabelecida pela assembleia mundial da sade em 1991 , no foi alcanada em 2009 em 7 dos 22 pases com maior carga da doena , incluindo o brasil ( 72% ) . ( ) o diagnstico em fase precoce da doena de suma importncia para o incio do tratamento , com consequncias diretas para o controle individual da doena e , consequentemente , para aes de sade pblica voltadas preveno da transmisso da tuberculose . portanto , necessrio que os laboratrios de microbiologia clnica sejam capazes de identificar rapidamente as micobactrias por meio de microscopia e cultura . porm , o exame de escarro , embora rpido e custo - efetivo , tem baixa sensibilidade e especificidade , particularmente em amostras paucibacilares , e a cultura , embora seja considerada o padro ouro em razo de sua alta sensibilidade , requer vrias semanas para produzir um resultado.(- ) atualmente , o brasil um dos pases que , juntos , concentram 80% dos casos de tuberculose no mundo , com uma incidncia de 70.977 casos em 2010 . ( , ) para a maioria desses casos , o diagnstico foi baseado apenas nos resultados dos exames de escarro ; radiografias de trax , culturas e testes bioqumicos para mycobacterium spp . apenas foram realizados em pacientes com exames de escarro negativos mas com sintomas respiratrios . ( , ) essas limitaes diagnsticas tm estimulado o uso de ferramentas moleculares com maior sensibilidade , especificidade e velocidade com o objetivo de detectar micobactrias em todos os espcimes clnicos.(- , ) as novas tecnologias que esto sendo desenvolvidas redefiniram recentemente o diagnstico de tuberculose , fornecendo uma base para tcnicas laboratoriais de diagnstico . ( , ) o diagnstico molecular da tuberculose por polymerase chain reaction ( pcr , reao em cadeia da polimerase ) com primers de alta especificidade ( 98% ) , com amplas variaes de sensibilidade ( 20 - 100% ) , tem sido utilizado para a identificao ( , , ) apesar do uso difundido da pcr convencional , modificaes na tcnica , tais como o acrscimo de uma reao adicional ( nested pcr ) , aumentaram sua sensibilidade e especificidade . ( ) possvel que isso se deva ao fato de que so diludos potenciais inibidores da pcr , que comumente esto presentes em amostras biolgicas . ( ) portanto , a possibilidade de acesso a uma ferramenta molecular que leva a um diagnstico mais rpido e que eficaz na deteco de casos difceis de elucidar por meio de testes convencionais certamente ajuda a diminuir a morbidade e melhorar o controle da tuberculose . o objetivo do presente estudo foi avaliar a tcnica de nested pcr dirigida sequncia de insero is6110 no mycobacterium tuberculosis e comparar os resultados com aqueles obtidos em culturas de amostras de pacientes com suspeita de tuberculose pulmonar ou extrapulmonar . os pacientes includos no estudo foram submetidos a avaliao fsica e coleta de amostras no hospital de base , um centro de referncia para o diagnstico e tratamento da tuberculose localizado na cidade de so jos do rio preto ( sp ) . de pronturios mdicos de acordo com um protocolo aprovado pelo comit de tica em pesquisa da faculdade de medicina de so jos do rio preto ( protocolo n 064/2009 ) . a presena de anticorpos anti - hiv , identificada por elisa e confirmada por western blot , foi indicativa de soropositividade para hiv . todos os pacientes includos no estudo eram maiores de 18 anos de idade , eram imunossuprimidos ( em razo de terapia de imunossupresso , doena autoimune , transplante de rgos ou positividade para hiv ) e apresentavam sintomas e sinais clnicos sugestivos de tuberculose pulmonar ou extrapulmonar . nossa amostra foi composta por 67 pacientes hospitalizados , e 98 espcimes clnicos foram coletados , dos quais 20 eram espcimes pulmonares ( escarro , lba ou lavado gstrico ) e 78 eram espcimes extrapulmonares ( sangue , lquido cefalorraquidiano , aspirado de linfonodo , urina , lquido pleural , secreo ganglionar , fragmento pleural , fragmento heptico , lquido asctico , aspirado de medula ssea ou espcimes de bipsia ) . o nmero de espcimes coletados dos pacientes variou de um a trs , de acordo com as solicitaes mdicas . a confirmao do diagnstico de tuberculose baseou - se nos seguintes critrios : evidncias clnicas e radiolgicas de tuberculose confirmadas por testes laboratoriais , isolamento de m. tuberculosis em espcimes clnicos por baciloscopia direta ou cultura ( padro ouro ) e melhora clnica evidente aps tratamento com agentes antimicobacterianos . em suma , a baciloscopia direta foi realizada com a colorao de ziehl - neelsen , e utilizou - se um sistema automatizado de deteco microbiana ( bact / alert mp ; organon teknika corp . , ( ) a genotipagem foi realizada por meio de anlise por enzimas de restrio por pcr de acordo com chimara et al . , amostras de sangue foram coletadas em tubos de 5 ml contendo edta , e clulas mononucleares de sangue perifrico foram isoladas por centrifugao em gradiente de densidade ( ficoll - histopaque ) para futura extrao de dna . ( - ) para rgos slidos , foram coletadas amostras de puno de bipsia ( 2.0 mm ) . todas as amostras clnicas foram mantidas a 20c at a extrao do dna , que foi realizada de acordo com o mtodo descrito por rossetti et al . ( , , ) em suma , uma alquota de 500 l da amostra foi centrifugada a 13.000 rpm por 10 min e submetida a trs lavagens com tris - edta ( te ) . o sedimento foi ressuspenso em 100 l de te e aquecido a 100c por 10 min . o sobrenadante foi transferido para um tubo diferente , e foram adicionados 5 l de resina ( sephaglas bandprep kit ; amersham - pharmacia biotech , uppsala , sucia ) ; uma alquota de soluo de iodeto de sdio ( 0,9 g / ml ) foi adicionada ao volume final . o tubo foi agitado por 5 min e incubado temperatura ambiente por 5 min . aps a centrifugao do tubo por 1 min e o descarte do sobrenadante , foram adicionados 200 l de etanol gelado a 70% ; o tubo foi ento agitado , sendo posteriormente centrifugado por 1 min . o sedimento resultante foi mantido temperatura ambiente por 60 min , para completar o processo de secagem , e ressuspenso em 40 l de 1te . em seguida , o tubo foi centrifugado por 1 min , e o sobrenadante foi transferido para outro tubo e armazenado a 20c at o processamento . ( , ) para as nested pcrs , utilizou - se is6110 do m. tuberculosis como sequncia alvo ( genbank n de acesso np 215310.1 ) . as reaes foram realizadas de acordo com ritis et al . ( ) os seguintes primers foram utilizados : sense ( tj3 5'-atc ccc tat ccg tat ggt g-3 ' ) ; antisense ( tj5 5'-ccg caa agt gtg gct aac-3 ' ) ; sense ( stan3 5'-gtc gag tac gcc ttc ttg tt-3 ' ) ; e antisense ( oli 5 5'-aac ggc tga tga cca aac-3 ' ) . a pcr utilizou um volume final de 50 l ( 1 tampo , 50 mm de mgcl2 , 10 pmol/l de cada oligonucleotdeo , 0,2 m de dntp e 2 u de taq dna polimerase [ invitrogen life technologies , carlsbad , ca , eua ] ) . o processo de amplificao consistiu em uma etapa inicial de desnaturao a 94c por 3 min , 30 ciclos de desnaturao ( a 94c por 1 min , 57c por 1 min e 72c por 1 min ) , seguidos de uma extenso final a 72c por 5 min . a segunda pcr foi realizada com 3 l do produto da primeira pcr em condies semelhantes s descritas anteriormente , mas com temperatura de recozimento de 60c . dna da cepa de m. tuberculosis h37rv e mistura de pcr isoladamente foram utilizados como controles positivo e negativo , respectivamente . o resultado foi analisado por eletroforese em gel de agarose 2% , corado com brometo de etdio e visualizado em transiluminador de luz ultravioleta ( fisher - biotech , fairlawn , nj , eua ) , resultando em um fragmento de 316 bp . as anlises estatsticas foram realizadas com o pacote estatstico epi info , verso 6.0 . nossa amostra foi composta por 67 indivduos , sendo que 63,7% eram do sexo masculino . a mdia de idade dos pacientes foi de 40,10 3,66 anos ( variao : 18 - 87 anos ) . a tuberculose foi diagnosticada em 11 pacientes ( 16,41% ) , sendo que 5 foram diagnosticados com tuberculose pulmonar e os restantes , com tuberculose extrapulmonar ( tuberculose pleural em 3 , tuberculose menngea em 2 e tuberculose miliar em 1 ) . todos os isolados de cultura foram confirmados por genotipagem de m. tuberculosis . a nested pcr foi positiva em todos os casos de tuberculose confirmada , como mostra a tabela 1 . em 4 dos pacientes com tuberculose , resultados laboratoriais positivos foram obtidos apenas pela tcnica molecular ( p = 0,110 ; teste exato de fisher ) . tabela 1 dados clnicos , epidemiolgicos e laboratoriais dos onze pacientes com tuberculose pulmonar ou extrapulmonar confirmada . dos 98 espcimes clnicos analisados , 6,00% , 8,16% e 13,26% , respectivamente , apresentaram resultados positivos na baciloscopia , cultura e nested pcr , como resumido na tabela 1 . a cultura foi negativa em 2 das amostras com baciloscopia positiva , enquanto a baciloscopia foi negativa em 4 das amostras com cultura positiva . ao se comparar os resultados da nested pcr com aqueles das culturas em amostras pulmonares ( tabela 2 ) , constatou - se que a sensibilidade e a especificidade da nested pcr foram 100% e 83% , respectivamente . os valores preditivos positivo e negativo foram 40% e 100% , respectivamente , com boa concordncia entre os testes ( kappa = 0,50 ; p = 0,25 ; teste de mcnemar ) . com relao s amostras extrapulmonares ( tabela 2 ) , a sensibilidade , a especificidade , o valor preditivo positivo e o valor preditivo negativo foram , respectivamente , 83,0% , 96,0% , 62,5% e 98,5% , com boa concordncia entre os testes ( kappa = 0,6867 ; p = 0,625 ; teste de mcnemar ) . tabela 2 cultura e nested polymerase chain reaction para deteco de mycobacterium tuberculosis em amostras pulmonares e extrapulmonares . o diagnstico precoce da tuberculose essencial para o tratamento imediato e o controle efetivo da doena . ( ) isso particularmente verdadeiro em casos de tuberculose extrapulmonar , pois vrios fatores podem complicar o diagnstico da doena . em razo da natureza paucibacilar da tuberculose extrapulmonar , estudos mostram uma variabilidade nos resultados positivos em cultura ( de 12% a 80% ) e uma variedade de amostras clnicas / tecidos biolgicos , o que implica uma distribuio no uniforme do bacilo , bem como a presena de sinais e sintomas no especficos . ( , , ) em nosso estudo , a tuberculose pleural foi diagnosticada em 2 pacientes hiv negativos , corroborando os achados de um estudo que revelou que a tuberculose pleural prevalente em casos extrapulmonares em pacientes hiv negativos . ( ) cerca de 50% dos indivduos hiv positivos portadores de tuberculose desenvolvem formas extrapulmonares . ( , , , ) apesar do pequeno nmero de pacientes hiv positivos includo no presente estudo , nossos resultados mostram uma predominncia de tuberculose extrapulmonar ( 57% ) . vrios testes baseados em tcnicas de pcr com uso de kits comerciais e testes in house esto sendo avaliados . a tcnica nested pcr , ao visaris6110 com o objetivo de identificar o complexo m. tuberculosis , ( ) proporciona sensibilidade e especificidade variveis , dependendo do laboratrio , do espcime clnico , da carga bacilar , da lise celular e dos parmetros tcnicos . ( ) as tcnicas moleculares melhoraram muito a deteco de micobactrias em linfonodos e em vrios fluidos corporais ( aspirados , lquido cefalorraquidiano , lquido asctico e lquido pleural ) . porm , em razo da sensibilidade e especificidade variveis em diferentes estudos , os resultados positivos devem ser interpretados em conjunto com os achados clnicos . ( ) no presente estudo , a proporo de resultados positivos na nested pcr nos indivduos diagnosticados com tuberculose pulmonar ou extrapulmonar ( 100% ) foi maior do que em outros estudos utilizando o mesmo gene alvo realizados no brasil , ( ) ndia ( ) e grcia . ( ) possvel que a discordncia entre o mtodo molecular e a baciloscopia nas amostras pulmonares e extrapulmonares em nosso estudo ( em 1 e em 6 amostras , respectivamente ) esteja diretamente relacionada baixa sensibilidade da tcnica de fenotipagem , natureza paucibacilar das amostras ou at ausncia de infeco por baar , como observado por outros autores . ( , , ) negi et al . ( ) relataram que uma tcnica molecular direcionada a is6110 apresentou alta positividade em amostras pulmonares e extrapulmonares ( 90% e 77% , respectivamente ) , enquanto a baciloscopia apresentou baixa positividade ( 49% e 24% , respectivamente ) . da mesma forma , barani et al . , ( ) ao estudarem 19 amostras pulmonares e 104 amostras extrapulmonares , obtiveram maior positividade com uma tcnica molecular direcionada a is6110 e tcr4 do que com o mtodo baciloscpico ( 17 resultados semelhantes e 12 resultados divergentes ) . vale ressaltar que foi relatado que 50% dos casos de tuberculose so classificados como negativos com base em resultados de baciloscopia . ( ) alm disso , a baciloscopia no foi realizada em 32,43% dos casos de tuberculose notificados no brasil em 2010 . ( ) quando se compararam os resultados da nested pcr e da cultura em amostras pulmonares , constatou - se que 3 das amostras apresentaram resultados positivos na nested pcr mas negativos na cultura . possvel que os resultados negativos nas culturas se devam a coinfeco pelo hiv em 2 dos pacientes e transplante de rim em 1 ( tabela 1 ) ou s caractersticas das infeces paucibacilares . tais como o nmero de organismos presentes no espcime , os mtodos de coleta de amostras , tratamentos anteriores e o mtodo de processamento . alm disso , as solues utilizadas para a digesto / descontaminao das amostras podem danificar as micobactrias . ( , ) no presente estudo , os resultados moleculares corroboraram os critrios clnicos e diagnsticos amplamente aceitos para o diagnstico da tuberculose . a sensibilidade e a especificidade encontradas para a nested pcr em nosso estudo ( 100% e 83% , respectivamente ) so maiores do que as relatadas em estudos anteriores utilizando tcnicas moleculares direcionadas ao gene is6110 em amostras de escarro ( 88 - 98% e 15 - 100% , respectivamente ) . ( , , ) possvel que essa diferena seja decorrente do volume e tipo de amostras , bem como dos diferentes protocolos de tipagem molecular empregados nos diferentes laboratrios . ( , , ) por isso , a correlao dos resultados com o perfil clnico do paciente essencial para o diagnstico da tuberculose , e a definio da doena pode , portanto , ser estabelecida a partir de culturas negativas aps o teste teraputico . ( ) isso ocorreu em 3 de nossos pacientes com resultados positivos na nested pcr e negativos na cultura em amostras pulmonares , 2 dos quais foram curados aps o tratamento e 1 dos quais abandonou o tratamento . alm disso , 2 pacientes faleceram antes do incio do tratamento recomendado da tuberculose . quanto concordncia entre nested pcr e cultura , embora o coeficiente kappa ( 0,50 ) tenha sido menor do que o relatado em outros estudos , realizados na ndia ( kappa = 0,6 - 0,8 ) e no brasil ( kappa = 0,78 ) , ela foi boa . com relao s amostras extrapulmonares , a nested pcr foi positiva em 3 das amostras de sangue com resultados negativos na cultura e negativa em 1 das amostras de lquido cefalorraquidiano com resultado positivo na cultura . possvel que esse resultado falso - negativo em uma amostra de lquido cefalorraquidiano ( tabela 1 ) esteja relacionado ausncia de cpias do gene is6110 , como descrito anteriormente em estudos realizados no sudeste da sia , dinamarca , tunsia , ndia e vietn , indicando a necessidade de incorporao de alvos adicionais , tais como trc4 , para que se melhore a deteco molecular . ( , ) porm , at onde sabemos , nenhum estudo at hoje relatou a ausncia desse elemento nas cepas de m. tuberculosis no brasil , e vrios estudos relataram que essa sequncia a mais sensvel para a deteco do complexo m. tuberculosis . ( , ) outro fator poderia ser a presena de inibidores para as reaes moleculares em at 18,6% dos espcimes extrapulmonares . ( ) no brasil , a prevalncia de m. tuberculosis isolados em cultura varia de 15,0% a 25,6% , ( , ) sendo que os maiores valores foram obtidos antes da era da terapia antirretroviral altamente ativa . resultados positivos na nested pcr em amostras de sangue levou ao diagnstico de tuberculose pulmonar em 2 pacientes hiv negativos e em 1 paciente hiv positivo , bem como ao diagnstico de tuberculose extrapulmonar em 1 paciente hiv negativo e em 1 paciente hiv positivo . naquelas amostras de sangue , a baciloscopia e a cultura foram positivas em apenas 1 e 2 amostras , respectivamente ; possvel que isso se deva ao pequeno nmero de bacilos na circulao . ( , ) na verdade , foi relatado que a sensibilidade da pcr em clulas mononucleares de sangue perifrico , como aqui utilizada , melhor do que a da cultura , sendo que ambas apresentam especificidade semelhante . ( , , ) alm disso , espcimes clnicos , tais como lquido cefalorraquidiano , sangue e escarro , tm sido descritos como bons substratos para pcr ( ) com boa concordncia ( kappa = 0,6867 ; p = 0,625 ; teste de mcnemar ) , como em nossos resultados , nos quais o nvel de positividade nas amostras extrapulmonares foi maior quando a nested pcr foi utilizada , corroborando assim os achados de noussair et al . ( ) diferentes taxas de sensibilidade foram descritas utilizando a metodologia molecular para esse tipo de amostra em estudos realizados na frana ( ) e ndia ( ) ( 86,6% e 90% , respectivamente ) . se estudos de padronizao utilizando o mesmo alvo molecular , mtodo de extrao do dna e otimizao da pcr fossem validados em diferentes laboratrios , a sensibilidade do teste poderia ser melhorada e , consequentemente , tambm sua concordncia . no presente estudo , um resultado positivo na nested pcr , associado a caractersticas clnicas , foi utilizado como nico critrio laboratorial para o diagnstico de 4 pacientes ( 2 com tuberculose pulmonar e 2 com tuberculose extrapulmonar ) , pois ela foi o nico teste que produziu resultados positivos ( tabela 1 ) ; possvel que a ausncia de isolados na cultura seja principalmente devida ao carter paucibacilar das amostras . embora a diferena no seja significativa nessa situao , o diagnstico geralmente estabelecido apenas com base em dados clnicos e radiolgicos , mesmo que a cultura e o exame de escarro sejam negativos . em tais casos , a anlise molecular pode ajudar a estabelecer a terapia especfica com agentes antimicobacterianos e , consequentemente , contribuir para a reduo do tratamento emprico , que tem sido utilizado atualmente em quase 27% dos casos suspeitos de tuberculose pulmonar . alm disso , ela pode ajudar a controlar a disseminao do bacilo ( ) e evitar uma evoluo clnica mais grave , principalmente em pacientes hiv positivos . porm , as atuais diretrizes brasileiras para a tuberculose no incluem resultados moleculares positivos na definio dos casos de tuberculose ; em regra , o uso desse mtodo tem sido restrito a certos centros de referncia e pesquisa no brasil . ( ) vale mencionar que a triagem clnica cuidadosamente elaborada para o estudo da doena causada por micobactrias , juntamente com ateno semelhante coleta e transporte das amostras biolgicas , so fatores que contriburam para o isolamento de uma maior taxa de cepas de m. tuberculosis do que era esperado em nosso hospital . o presente estudo corrobora os resultados obtidos em um centro de referncia para o diagnstico da tuberculose na cidade de so jos do rio preto ( xv diviso regional de sade do estado de so paulo ) , no qual se observou um aumento de 50% no nmero de isolados durante o perodo de estudo . ( ) os resultados do ensaio de nested pcr mostraram boa concordncia com aqueles da cultura . a especificidade e a sensibilidade alcanadas com essa abordagem molecular relativamente simples podem ser vistas como uma importante contribuio para o futuro estabelecimento de um protocolo para a deteco molecular do complexo m. tuberculosis em amostras pulmonares e extrapulmonares . alm disso , essa metodologia poderia reduzir o tempo necessrio para o diagnstico adequado da tuberculose .

objective : to compare the performance of nested polymerase chain reaction ( npcr ) with that of cultures in the detection of the mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens . methods : we analyzed 20 and 78 pulmonary and extrapulmonary specimens , respectively , of 67 hospitalized patients suspected of having tuberculosis . an automated microbial system was used for the identification of mycobacterium spp . cultures , and m. tuberculosis is6110 was used as the target sequence in the npcr . the kappa statistic was used in order to assess the level of agreement among the results . results : among the 67 patients , 6 and 5 , respectively , were diagnosed with pulmonary and extrapulmonary tuberculosis , and the npcr was positive in all of the cases . among the 98 clinical specimens , smear microscopy , culture , and npcr were positive in 6.00% , 8.16% , and 13.26% , respectively . comparing the results of npcr with those of cultures ( the gold standard ) , we found that npcr had a sensitivity and specificity of 100% and 83% , respectively , in pulmonary specimens , compared with 83% and 96% , respectively , in extrapulmonary specimens , with good concordance between the tests ( kappa , 0.50 and 0.6867 , respectively ) . conclusions : although npcr proved to be a very useful tool for the detection of m. tuberculosis complex , clinical , epidemiological , and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis .

glucocorticoids have been extensively characterized as being anti - inflammatory and/or immunosuppressive in therapeutic settings and are generally discussed as opposed to the development of inflammation and limiting of production or maturation of some effector immune cell types , in a physiological context . nevertheless , there is a well - established association between stress and allergic diseases , including asthma [ 4 , 5 ] . glucocorticoids , which are an essential part of systemic stress responses , play coadjuvant roles in promoting inflammation and may promote th2-type immunity through differential effects on th1 th2 cytokine production [ 5 , 6 ] . chronically stimulated eosinophil production ( eosinopoiesis ) is an important feature of human asthma and of murine allergic asthma models . in both cases , allergen challenge of sensitized subjects increases eosinopoiesis in the bone - marrow [ 7 , 8 ] . this effect is antigen - specific and can be abolished by inducing oral tolerance to the allergen , which affects both eosinophils and neutrophils in bone - marrow . the effects of oral tolerization in bone - marrow neutrophil and eosinophil granulocytes can be duplicated by transfer of splenic t lymphocyte subpopulations from tolerized / sensitized / challenged donors to histocompatible naive recipients . these observations highlight the importance of acquired cellular immunity in regulating the hematological response to allergen sensitization and challenge . they further suggest the possibility that granulopoiesis , encompassing both eosinophil and neutrophil production , might be regulated by lymphocyte populations in nonsensitized subjects as well . in an allergic asthma model , we demonstrated a critical role for endogenous glucocorticoids in the hematological response to allergen challenge : challenge induces a corticosterone surge that is paralleled by increased eosinophilia of bone - marrow in vivo and by increased responsiveness to il-5 , the major eosinopoietic cytokine , ex vivo ; the bone - marrow response to challenge is abolished by blockade of glucocorticoid signaling or glucocorticoid production . on the other hand , in the absence of allergen sensitization and challenge , we have also obtained evidence of a link between the corticosterone surge induced by mild surgical trauma and short - term bone - marrow eosinophilia ; again , blockade of endogenous glucocorticoid production or action abolished the bone - marrow eosinophilia induced by trauma . these in vivo effects of corticosterone , an endogenous glucocorticoid released by the adrenal glands , are paralleled by those of exogenously provided corticosterone or dexamethasone on murine bone - marrow [ 12 , 13 ] and of other glucocorticoids on human hemopoietic cells . in balb / c mice , dexamethasone increases eosinophil production in murine bone - marrow culture [ 12 , 13 ] and primes bone - marrow cells in vivo for increased ex vivo responses to il-5 . during further screening of inbred mouse strains for differences in the granulopoietic responses to dexamethasone , we observed bone - marrow eosinophilia in mice of the c57bl/6 ( b6 ) background injected with dexamethasone , which was undetectable in perforin - deficient b6 mutants submitted to the same treatment . perforin is a major mediator of cellular immunity [ 1519 ] , expressed in lymphocyte populations which fight viral and bacterial pathogens [ 16 , 17 ] as well as malignant cells in the context of both innate and acquired immune responses . perforin is also expressed by murine bone - marrow neutrophils , which have a critical regulatory role in t cell - mediated contact hypersensitivity . perforin deficiency is known to induce complex changes in leukocyte populations in humans and mice [ 16 , 17 , 20 ] , including a classical presentation of familial hemophagocytic lymphohistiocytosis , characterized by early life onset , high mortality , and multiple immunological defects , including uncontrolled activation and proliferation of cd4 + and cd8 + t cells , cytokine storm , macrophage activation and proliferation , pancytopenia , and anemia . here we report that perforin deficiency also presents a selective defect in granulocyte production , which can be corrected by wild - type lymphocyte transfer . sh30088.03 ) , rpmi1640 ( sh30011.01 ) , and imdm ( sh30228.01 ) were from hyclone ( logan , ut , eua ) ; l - glutamine ( g7513 ) , penicillin - streptomycin solution ( p4333 ) , essential amino acids solution ( 50x ) ( m5550 ) , methylcellulose ( m0387 ) , dexamethasone ( 21-phosphate , disodium salt , d1159 ) , mifepristone ( ru486 , m8046 ) , and histopaque-1083 ( 10831 ) were from sigma - aldrich corporation ( st . louis , mo , eua ) ; agar noble ( 0142 - 15/21422 ) was from difco ( detroit , mi , eua ) ; nonessential amino acids solution ( 100x ) , ( 11140 - 050 ) and mem vitamin solution ( 100x ) ( 11120 - 052 ) were from gibco life technologies ( carlsbad , ca , usa ) ; recombinant murine il-5 ( 405-ml-025 ) was from r&d systems ( minneapolis , mn , usa ) ; recombinant murine gm - csf ( 315 - 03 ) was from preprotech ( rocky hill , nj , usa ) ; rat antimouse cd8b ( clone : ebioh35 - 17.2 , 12 - 0083 - 82 , 0.2 mg / ml ) was from ebioscience ( san diego , ca , usa ) ; magnetic microspheres conjugated to antimouse cd4 ( l3t4 , 130 - 049 - 20 ) and to goat antirat igg ( 130 - 048 - 501 , as secondary antibody to primary rat antimouse cd8b ) were from miltenyi biotec ( ambriex , sp , brazil ) . wild - type c57bl/6 , perforin - deficient ( pfp ) mutants of the b6 background , and wild - type b6.129 mice were bred by cecal - fiocruz , rio de janeiro , brazil . the pfp stock was derived from the original b6.129s6-pfp stock by backcrossing to c57bl/6 at fiocruz . unless otherwise indicated , the wild - type controls for the experiments shown were c57bl/6 ; in selected experiments , b6.129 wild - type controls were used and yielded the same results as c57bl/6 ( not shown ) . the animals were housed and handled following institutionally approved guidelines under license l-00209 from ceua - fiocruz . routinely , female mice were used for the experiments , since male mice characteristically fight for dominance in the same cage , and the stress associated with fighting may confound the interpretation of the results . we have no evidence , however , that the granulopoietic responses described here , including the strain differences , are restricted to females . dexamethasone in saline solution was injected i.p . ( 200 l , i.p . , amounting to 5 mg / kg ; ) . ru486 in 0.1% methylcellulose was given intragastrically 2 h before dexamethasone with a gavage needle ( 200 l , amounting to 100 mg / kg ) . for lymphocyte transfers , 10 nylon - wool purified cells from naive c57bl/6 donors in a 100 l volume of sterile saline were injected into the tail vein of pfp recipients , once . controls received an equal number of cells from pfp donors . where lymphocytes depleted of cd4 + or cd8 + cells were used , the amount of cells injected was that recovered from 10 initial unseparated lymphocytes , in 100 l sterile saline , i.v . dexamethasone was administered to the recipients , in both cases , 48 h after lymphocyte transfer . where indicated , bone - marrow , peripheral blood from the abdominal vena cava , spleens , and whole thymuses were collected , for enumeration of cells or determination of relative weight of the thymus ( mg / g body weight ) [ 21 , 23 ] . bone - marrow collected from both femurs of each mouse in 5 ml rpmi1640 medium/1% fbs with a 22-gauge needle and kept on ice was used for total and differential counts and cell culture ( see below ) . spleen mononuclear cells were the source for isolation of lymphocytes ( see below ) [ 24 , 25 ] . differential counts were carried out in cytocentrifugates after fixation in pbs-10% formaldehyde and staining for eosinophil peroxidase ( epo [ 26 , 27 ] ) followed by counterstaining with harris ' hematoxylin . liquid bone - marrow cultures were established at 37c , with 10 bone - marrow cells in 1 ml rpmi1640/10% fbs , in 5% co2/95% air , plated in 24-well plates ( cat . n : 142475 , nunc brand products ) with il-5 ( 1 ng / ml ; 7 days ) . where indicated , dexamethasone was added ( 10 l / well , to 10 m final concentration ) . absolute numbers were calculated from total cell counts in turk 's solution multiplied by the % of epo+ cells ( eosinophil - lineage cells , both mature and immature ) in cytocentrifuge smears . triplicate semisolid ( clonal ) bone - marrow cultures were established for 7 days with 2 10 cells adjusted to 1 ml of 1 : 1 imdm / agar mix , in 35 mm tissue culture plates ( nunc ) , in the presence of gm - csf ( 2 ng / ml final ) , with or without dexamethasone ( 10 m ) , at final 20% fbs and 0.3% agar concentrations . total colonies ( defined as aggregates > 50 cells derived from a single progenitor cell ) [ 8 , 12 ] were scored at day 7 under an inverted microscope ( 400x , phase contrast ) . for lymphocyte isolation , spleens were collected and minced in rpmi1640/1% fbs on tissue culture plates . spleen mononuclear cells ( 2 10 in 10 ml rpmi1640/1% sfb ) were isolated by centrifugation on a 1.083-density ficoll - hypaque cushion ( 3 ml , at 400 g , for 30 minutes , at room temperature , following manufacturer 's instructions ) [ 24 , 25 ] . cells recovered from the medium / ficoll - hypaque interface were collected , washed in serum - free medium , resuspended , counted , and further separated on nylon - wool columns [ 24 , 25 ] at 4 10 cells/2 ml / g nylon wool . cells eluted in a total 25 ml warm medium , dropwise , were washed and counted before cytocentrifugation / staining or incubation with antibodies . depletion of cd4 + cells was done with 10 l l3t4/10 nylon - wool purified lymphocytes in 100 l serum - free rpmi1640 , on ice , following manufacturers ' instructions . depletion of cd8 + cells was in two steps , with rat antimouse cd8b conjugated with pe , followed by goat antirat igg ( 20 l/10 lymphocytes in 80 l medium , on ice ) . columns were eluted with 9 ml medium , dropwise , over a 5-minute period . the numbers of experiments ( n ) are indicated in the caption of the figures , to avoid overcharging the figures and captions . for comparisons of two groups ( figures 1 and 2 ) , we used the two - tailed t - test with separate variances ( systat for windows , version 5 , systat inc . , evanston , il ) . for multiple comparisons ( figures 3 , 4 , 5 , and 6 ) , we used anova , with the tukey hsd correction for groups of equal size ( systat for windows ) or with bonferroni 's correction for groups of unequal size ( using prisma 5 for windows , graph pad , la jolla , ca ) , unless otherwise indicated in section 3 . following preliminary experiments ( not shown ) that evidenced a positive response to dexamethasone in b6 wild - type mice , as well as the absence of any response , positive or negative , in pfp mutants of the b6 background , we reviewed data on freshly harvested bone - marrow from a large number of mice of both strains ( n = 44 and n = 48 , resp . ) , to look for evidence of strain differences in bone - marrow steady - state parameters , in the absence of dexamethasone exposure ( figure 1 ) . a significant difference was observed in this large series , with pfp mice having lower bone - marrow cellularity than wild - type controls ( figure 1(a ) ; p < 0.001 ) . the data available for epo+ cells ( figure 1(b ) ; p = 0.033 ) and neutrophils ( figure 1(c ) ; p = 0.010 ) of the mice in the large series showed significant differences as well , with lower counts in pfp mutants . as the two groups were defined only on the basis of genetic differences ( presence or absence of functional perforin genes ) , these differences could still be accounted for , in principle , by variance due to nongenetic factors within these groups , especially those which influence growth and development . because bone - marrow cellularity is roughly proportional to the size of the animal , we next evaluated whether these differences would disappear in the comparison between groups of control and mutant mice matched by weight ( figures 1(d)1(f ) ) . significant differences were still observed for total cells ( figure 1(d ) ; p = 0.001 ) , eosinophils ( figure 1(e ) ; p = 0.004 ) , and neutrophils ( figure 1(f ) ; p = 0.011 ) , all three parameters being lower in the mutant mice . because age might affect bone - marrow function through mechanisms unrelated to body weight gain ( as senescence may have an earlier onset in some strains ; furthermore , age is a major determinant of incidence of many pathological processes , such as malignancies ) , we next examined whether matching by age ( all animals at 12 weeks ) would eliminate the differences . significant differences were still found for all three parameters ( for figures 1(g)1(i ) , resp . , p = 0.001 , p = 0.006 , p = 0.001 ) , which were lower in the mutant mice . even matching by both weight and age ( for figures 1(j)1(l ) , resp . , p = 0.022 , p = 0.032 , p = 0.001 ) failed to eliminate these significant differences between controls and mutants for any of the three parameters , which were all lower in the mutant mice . overall , this suggests that bone - marrow cellularity , as well as bone - marrow eosinophil and neutrophil counts , is significantly lower in pfp mutants than in b6 mice and that this difference can not be dismissed as created by undue comparisons of two groups differing in body weight , age , or both . we further examined ( figure 2 ) the counts of total cells , lymphocytes , neutrophils , and eosinophils in peripheral blood of weight - matched ( median 21 g , range 1923 g ) b6 and pfp mice . unlike bone - marrow , peripheral blood total nucleated cell counts did not differ significantly between these strains ( figure 2(a ) , p = 0.795 ) , nor did lymphocyte counts ( figure 2(b ) , p = 0.417 ) . by contrast , both neutrophil ( figure 2(c ) , p = 0.025 ) and eosinophil ( figure 2(d ) ; p = 0.030 ) counts were significantly different , and , like in bone - marrow , lower in pfp mice . together , the data in figures 1 and 2 suggest that , even in the absence of dexamethasone , pfp mice have reduced granulocyte numbers both inside and outside of bone - marrow , relative to wild - type controls of comparable body weight . our original observation of this strain difference was increased % eosinophils in cultured bone - marrow from b6 , but not pfp , mice when both il-5 and dexamethasone were present ( jones and cardoso de mendona , unpublished observations ) . this is , however , insufficient to characterize a strain difference in response to dexamethasone , because the % of a given cell type in a bone - marrow sample , which has a highly heterogeneous composition , can be increased artifactually by a corresponding decrease in another cell type , rather than by a positive effect of dexamethasone on the cell type of interest . to confirm a positive effect of il-5 and dexamethasone in stimulation of wild - type and mutant eosinopoiesis , liquid cultures were established from the same number of bone - marrow cells ( 10 ) from b6 or pfp donors , in the presence of il-5 , alone or associated with dexamethasone , and the absolute numbers of eosinophils in the culture were determined . as shown in figure 3 , eosinophils were produced in cultures of il-5-stimulated wild - type and mutant bone - marrow ( figure 3(a ) ) . control cultures lacking il-5 do not contain eosinophils at the end of the culture period ( not shown ; ) . counts of epo+ cells recovered at the end of the culture were increased in the presence of dexamethasone ( 10 m ) , relative to il-5 controls , in cultures from b6 controls , but not from pfp mutants ( figure 3(a ) , p < 0.001 ) . nevertheless , the il-5 present was sufficient to sustain eosinopoiesis in the absence of dexamethasone by pfp bone - marrow to the same level observed in b6 control cultures . on the other hand , data from semisolid cultures , which allowed us to examine the effects of dexamethasone on several classes of progenitors ( colony - forming cells ) , including the granulocyte ( g ) and granulocyte - macrophage ( gm ) progenitors , which produce neutrophils , are also shown in figure 3 . the total counts of colonies formed by gm - csf - stimulated pfp bone - marrow progenitors , in the absence of dexamethasone , also differed significantly from those of b6 controls ( p 0.001 ) : even though identical numbers of bone - marrow cells were plated , less colonies were made by perforin - deficient bone - marrow ( figure 3(b ) ) . furthermore , dexamethasone ( 10 m ) significantly stimulated colony formation by b6 bone - marrow ( p = 0.002 ) but failed to stimulate ( p = 0.558 ) pfp bone - marrow in the same conditions ( figure 3(b ) ) . these observations show that bone - marrow progenitors from pfp mice differ significantly from those of b6 controls , because they form less colonies and do not respond to dexamethasone , which significantly enhances colony formation in the wild - type cultures . we next examined the effect of dexamethasone ( 5 mg / kg injection ) on bone - marrow eosinophils and neutrophils , as well as on the relative weight of the thymus , which is significantly reduced by glucocorticoids . as shown in figure 4 , dexamethasone injection increased the numbers of bone - marrow eosinophils ( figure 4(a ) , p = 0.003 ) and neutrophils ( figure 4(b ) , p = 0.019 ) in vivo , relative to saline - injected controls , in wild - type b6 mice , but not in pfp mice . the effect of dexamethasone on eosinophil numbers in wild - type b6 mice was abolished by ru486 pretreatment , while ru486 had no effect of its own in the absence of dexamethasone , in either b6 or pfp mice ( not shown ) . the relative weight of the thymus was significantly different ( p = 0.010 ) between body weight - matched pfp mice and wild - type controls , suggesting a decreased thymic cellularity in mutant thymus , even without exogenous glucocorticoid administration ( figure 4(c ) ) . importantly , dexamethasone injection did reduce significantly the relative weight of the thymus in both wild - type ( p = 0.007 ) and mutant ( p = 0.001 ) mice ( figure 4(c ) ) . again , the effect of dexamethasone on the thymus was abolished in both cases by ru486 pretreatment ( not shown ) . together , these observations show that pfp bone - marrow is unresponsive to dexamethasone stimulation in vivo , although dexamethasone significantly increases eosinophil and neutrophil numbers in the bone - marrow of wild - type controls . they also show that lack of responsiveness to dexamethasone in pfp bone - marrow is not due to a general lack of response to glucocorticoids , because the thymus of pfp mice responds to dexamethasone injection as expected . because perforin is mainly expressed in various effector / regulatory lymphocyte subsets , it was important to test whether the perforin - related defect in bone - marrow response to dexamethasone could be corrected by introducing b6 lymphocytes in pfp mice . we have done so with splenic lymphocytes from naive b6 donors , because both the baseline granulopoiesis defect and the defective granulopoietic response to dexamethasone were observed in the absence of allergic sensitization . the number ( 10 ) of lymphocytes for transfer into individual mice was defined on the basis of similar reconstitution studies . to define whether elimination of a particular lymphocyte subpopulation defined by standard surface markers ( cd4/cd8 ) prevented reconstitution of the dexamethasone response , 10 total lymphocytes purified from spleen were submitted to alternative depletion protocols with marker - specific microbeads , and the depleted cells in the column effluent , corresponding to the number of cells negative for the selection marker present in the original lymphocyte sample , were injected . as shown in figure 5 , pfp recipients of wild - type lymphocytes ( unseparated ) show a significant in vivo response to dexamethasone injection , by increased total cell ( figure 5(a ) ; p = 0.032 , t - test ) , eosinophil ( figure 5(b ) ; p = 0.04 ) , and neutrophil ( figure 5(c ) ; p < 0.001 ) counts in the bone - marrow , sharply contrasting with observations in pfp mice in the absence of wild - type cell transfer ( compare figure 4 ) . on the other hand , depletion of cd4 + or cd8 + cells in the wild - type lymphocyte preparation gave distinct results in the reconstitution assay , depending on the granulocyte population examined : while depletion of either subset abolished the ability of splenic lymphocytes to reconstitute the eosinopoietic response to dexamethasone ( figure 5(b ) ) , depletion of cd4 + cells did not prevent reconstitution of the neutropoietic response ( figure 5(c ) ; p = 0.013 ) , while depletion of cd8 + cells prevented reconstitution . as a further control , we performed transfer of pfp lymphocytes into pfp recipients and obtained no reconstitution of dexamethasone responses , judged by any of these three parameters ( figure 6 ) . in these controls , dexamethasone reduced significantly the relative weight of the thymus , showing that dexamethasone was able to reach systemically active levels even if bone - marrow showed no evidence of responding to it . overall , these observations suggest that lymphocytes from the spleen of naive wild - type mice , but not pfp mice , are able to reconstitute in the short term the granulopoietic responses to dexamethasone , but different cells may be involved in reconstitution of lineage - specific ( eosinophilic versus neutrophilic ) responses . this is , to our knowledge [ 1520 ] , the first description of a selective defect in granulopoiesis associated with perforin deficiency in mice and of its correction by the intravenous transfer of wild - type lymphocytes . as such , it extends the range of manifestations associated with perforin deficiency and raises the issue of how perforin contributes to regulation of granulocyte lineages in vivo . because the wild - type lymphocyte populations interact with a drug ( dexamethasone ) which initiates signaling through the ru486-inhibitable glucocorticoid receptor , to stimulate in vivo eosinophil and neutrophil production , these observations may be relevant to processes in which bone - marrow is stimulated by immune responses or trauma with involvement of the same receptor and of endogenous glucocorticoids released by the adrenal glands . perforin is a well - characterized effector protein , mainly ( but not exclusively ) expressed in lymphocytes which share the ability to induce cell - mediated cytotoxicity [ 1520 ] . perforin deficiency was initially characterized by the loss of important cytotoxic lymphocyte functions [ 1520 ] . however , it was soon realized that perforin deficiency entails other , more complex , functional consequences , leading to the development of type ii familial hemophagocytic lymphohistiocytosis [ 16 , 17 , 20 ] , which shares pathophysiological features with the macrophage activation syndrome , including interferon- ( ifn- ) overproduction . hence , perforin deficiency has broader consequences in addition to impairment of cytotoxic lymphocyte function , and ifn- , alone or in association with other cytokine storm components , may transduce its effects on other leukocyte lineages . one of the issues raised by our findings is whether the lower granulocyte numbers in blood and bone - marrow of pfp mice are due to the progression of the murine equivalent of the human familial hemophagocytic lymphohistiocytosis [ 16 , 17 , 20 , 28 ] . it should be noted that the human familial hemophagocytic lymphohistiocytosis is a severe condition , presenting early in life in most cases and associated with important mortality [ 20 , 28 ] . also , phenotypically distinct forms correspond to different mutations with perforin expressed at lower levels and/or with altered properties , a situation that is not applicable to the present study , which employed perforin null mice . the perforin - deficient mice in the original walsh et al . study ( from which the mice used in this study descend ) were described as healthy for at least 5 months . in our study , mice were certified spf and maintained in microisolator units , with no evidence of mortality , stunting , or signs of infection during the entire observation period of up to 3 months ( 12 weeks ) . on the other hand , pfp defect in response to dexamethasone could be corrected by transfer of as few as 10 lymphocytes 48 h before the stimulus . the prompt reconstitution of this defect argues against the lack of dexamethasone response in pfp animals being caused by a chronic inflammatory disease of the bone - marrow , such as familial hemophagocytic lymphohistiocytosis , which in humans is challenging for therapy . because correction was achieved by simple transfer of lymphocytes from naive donors , we think it is more likely that the transferred lymphocytes provided something that was lacking in the recipient . neutrophils were reduced in bone - marrow and blood of pfp mice relative to b6 controls . this not only shows that the neutrophil deficiency has peripheral expression but further argues against reduced numbers in bone - marrow being due to an increased export of neutrophils to the periphery . the evidence from colony - forming assays suggests , instead , that production is greatly reduced in pfp relative to b6 mice , as there were less gm - csf - responsive progenitors in an identical number of bone - marrow cells . reduced production would explain the decrease in granulocyte counts both outside and inside of bone - marrow . on the other hand , normal numbers of lymphocytes and total leukocyte counts show that the defect is selective for granulocytes , which are not the major circulating leukocyte subpopulation in mice , so that reduction in their numbers does not have a major impact on total circulating leukocyte counts . neutropenia is associated with increased susceptibility to bacterial and fungal infection , provided it is severe enough . this was not observed in our study , so presumably the pfp mice were capable of coping with the microorganisms present in a rather clean environment ( spf conditions , microisolator housing ) . it remains to be seen , however , whether following a more severe infectious exposure , such as that associated with sepsis induction , pfp mice would prove more vulnerable to bacterial dissemination . this will be addressed in future studies , since emergency granulopoiesis , as opposed to baseline granulopoiesis , is driven by gm - csf and related hemopoietic cytokines . the lack of appropriate response to gm - csf , both in the absence and in the presence of dexamethasone , would predict that emergency granulopoiesis would be defective in pfp mice and might therefore negatively influence the outcome of sepsis . the hypothalamus - pituitary - adrenal axis is activated in sepsis , and therefore it is possible that emergency granulopoiesis is driven by endogenous glucocorticoids , in a way consistent with our observations . the prediction , in this case , is that perforin would be required for normal host response to bacterial sepsis through an effect on glucocorticoid - mediated signaling in the bone - marrow . the ability of lymphocyte preparations to reconstitute responses to dexamethasone was abolished by depletion of cd4 + and/or cd8 + cells before transfer , depending on the granulocyte population . for neutrophils , cd8 while this suggests that different mechanisms are involved for eosinophils and neutrophils , it certainly raises the issue of the lymphocyte subpopulation involved . since naive lymphocytes are sufficient , it is not likely that conventional t cells , cd4 + or cd8 + , are responsible , for they would not be activated in this isolation protocol [ 24 , 25 , 31 ] . conventional nk cells would not be a strong candidate , since cd4 + or cd8 + lymphocyte depletion would probably not eliminate them [ 32 , 33 ] . innate lymphocytes other than conventional nk cells , however , would be expected to be present in naive mouse spleens [ 32 , 33 ] . natural killer t cells , which include subsets expressing cd4 and cd8 , are found in significant numbers in b6 spleen , present an activated memory phenotype without known activating exposure , and exert multiple regulatory functions through rapid secretion of large amounts of cytokines [ 32 , 33 ] , might perhaps account for some of our observations . regardless of innate or adaptive lymphocyte population involved , two questions which require further study are as follows : ( a ) is perforin the missing component that is brought by the transferred lymphocytes ? and ( b ) do these lymphocytes act by homing to the recipients ' bone - marrow and interacting locally with granulocyte progenitors / precursors ? both questions , however , require a more complex experimental design and resources to allow us to detect and modify perforin expression inside living lymphocytes , as well as monitor their homing to the bone - marrow compartment . for this reason , such experiments fall outside the scope of this paper , which is limited to the demonstration of the defect and of its correction . finally , it should be noted that lymphocyte transfer restored the short - term response to dexamethasone but did not bring the baseline counts of eosinophils and neutrophils to the same level of the b6 controls . this might be interpreted as evidence that steady - state granulopoiesis and response to dexamethasone are unrelated processes ( i.e. , their perforin deficiency entails two distinct defects in granulopoiesis , rather than one defect with distinct manifestations ) . we do not support this interpretation , however , because the duration of the experiment might be insufficient for an effect of lymphocyte transfer alone on steady - state granulocyte numbers to become noticeable . it is also possible that demonstration of a durable effect on steady - state granulocyte numbers would require not only an extended observation period but also an increased or repeated input of wild - type lymphocytes and an interaction of exogenous lymphocytes with endogenous adrenal glucocorticoids as well .

exogenously administered glucocorticoids enhance eosinophil and neutrophil granulocyte production from murine bone - marrow . a hematological response dependent on endogenous glucocorticoids underlies bone - marrow eosinophilia induced by trauma or allergic sensitization / challenge . we detected a defect in granulopoiesis in nonsensitized , perforin - deficient mice . in steady - state conditions , perforin- ( pfp- ) deficient mice showed significantly decreased bone - marrow and blood eosinophil and neutrophil counts , and colony formation in response to gm - csf , relative to wild - type controls of comparable age and/or weight . by contrast , peripheral blood or spleen total cell and lymphocyte numbers were not affected by perforin deficiency . dexamethasone enhanced colony formation by gm - csf - stimulated progenitors from wild - type controls , but not pfp mice . dexamethasone injection increased bone - marrow eosinophil and neutrophil counts in wild - type controls , but not pfp mice . because perforin is expressed in effector lymphocytes , we examined whether this defect would be corrected by transferring wild - type lymphocytes into perforin - deficient recipients . short - term reconstitution of the response to dexamethasone was separately achieved for eosinophils and neutrophils by transfer of distinct populations of splenic lymphocytes from nonsensitized wild - type donors . transfer of the same amount of splenic lymphocytes from perforin - deficient donors was ineffective . this demonstrates that the perforin - dependent , granulopoietic response to dexamethasone can be restored by transfer of innate lymphocyte subpopulations .

candidemia is the fourth most common microbial bloodstream infection . since the 2000s , caspofungin and micafungin have been employed as first - line treatment and prophylaxis for invasive candidiasis . increasing use of these drugs has led to the emergence of echinocandin resistance , , . even though several case reports have been written here , we report the case of a 37-year - old man , hospitalized for extensively drug - resistant tuberculosis disease ( xdr tb ) , who was diagnosed with candidemia due to three different candida species ( c. glabrata , c. albicans and c. tropicalis ) , bacteremia and fungal endocarditis due to c. tropicalis . usually , the recommended treatment for candidemia due to c. glabrata is an echinocandin , the choice being due to the intrinsic fluconazole resistance of this species . but in cases of combined echinocandin - resistance , a switch to amphotericin b or the association of two antifungals could be necessary . the patient was hospitalized six month before candidemia ( day 0 ) for xdr tuberculosis disease . of note , bacteremias were also diagnosed 4 month before day 0 by klebsiella pneumonia and one month before day 0 by enterobacter cloacae . in brief , three peripheral blood cultures were positive for c. glabrata on day 0 . the antifungal susceptibility profile of the isolate ( cnrma13.446 ) tested using eucast broth microdilution method was normal for the species , , , . on day 32 , the patient developed a second infection caused by c. tropicalis isolated from blood cultures ( seven positive blood cultures ) . this isolate recovered ( cnrma13.526 ) was resistant to azoles ( table 1 ) . on day 93 and 94 , three peripheral blood cultures and a broncho - alveolar lavage ( bal ) were positive with c. albicans and c. tropicalis . both c. albicans ( cnrma13.695 ) and c. tropicalis ( cnrma13.694 ) isolates were resistant ( table 1 ) to the three echinocandins tested , , , , . a missense mutation s645p in the hot spot ( hs)1 region of the fks gene ( table 2 ) , coding the betaglucan synthase , target enzyme of the echinocandins , was found for both isolates , , , , , , , , , . on day 139 , a trans - thoracic cardiac ultrasound confirmed an infective endocarditis , with large vegetation > 15 mm . culture of the vegetations was positive with c. albicans ( cnrma13.779 ) and c. tropicalis ( cnrma13.778 ) . both isolates had the same antifungal susceptibility profiles and the same missense mutation as the previous isolates ( table 1 ) . the three consecutive isolates of c. tropicalis ( cnrma13.778 , cnrma13.694 , cnrma13.526 ) were genotyped using multilocus sequence typing . first , caspofungin was administered between day 3 and day 18 and then between day 33 and day 67 ( 70 mg loading dose , followed by 50 mg / day ) . third candidemia was treated with : from day 93 to day 97 by caspofungin , with mic we decided switch by voriconazole during ten days ( day107 ) , treatment was changed to liposomal amphotericin b iv ( 3 mg / kg / day associated with flucytosin iv ( 25 mg / kg / day ) from day 107 to day 163 . on day 148 , a surgical resection of vegetation was performed and the patient underwent a surgical anuloplasty without replacement of the heart valve . on day 163 , liposomal amphotericin b iv ( 3 mg / kg / day ) was administered alone until day 178 . thereafter and for three months , oral fluconazole ( 400 mg / day ) was administered . at the end of day 270 and after seven sequential blood cultures were found negative , the patient was considered as cured . this case report illustrates the first mutation s645p in the hot spot coding the beta glucansynthase target enzyme of the echinocandin in c. tropicalis ( genbank accession number kp313858 ) . on the identification of species , all isolates were subcultured on chromagar candida medium ( develeped by becton dickinson gmbh , heidelberg , germany ) to ensure purity and viability . isolates were identified at the species level by standard mycological procedures including the assimilation patterns obtained with the commercialized strips id32c ( developed by biomrieux , marcy - letoile , france ) . for all candida albicans isolates a specific pcr amplification was performed to distinguish this species from c. dubliniensis . about sequencing , parts of the fks orf , containing hotspot 1 and 2 regions , were sequenced and analyze by using primers previously described ( table 2 ) . the 7 mlst loci described by tavanti et al . for genotyping of candida tropicalis , were sequenced for the three isolates ( cnrma13.526 , cnrma13.694 , cnrma13.778 ) ( table 3 ) . the three isolates have same allelic profile suggesting that they are genetically linked ( table 3 ) . this profile is not known in the mlst database . in this case , a catheter was essential to the treatment of xdr tb . the recurrence of candidemia and the multiple species involved were puzzling , probably explained by : a wide spectrum of antibiotics and careful questioning of the patient uncovered the fact that through the cvc , he had been injecting himself with heroin during hospitalization . it was prescribed again for the second candidemia due to c. tropicalis , because of the high azole mics of the isolates and the absence of endocarditis based on normal trans - thoracic cardiac ultrasound . during the third episode of candidemia , a switch to voriconazole was decided because of the high caspofungin mics of c. albicans and c. tropicalis isolates and their susceptibility to azoles . the discovery of fungal endocarditis led to a combination of liposomal amphotericin b and flucytosine 15 days after surgical anuloplasty , and then to liposomal amphotericin b alone ( side effect at flucytosine ) . echinocandin - susceptible and resistant genetically linked isolates of c. tropicalis were recovered suggesting that the protein mutation was due to the caspofungin treatment as already described for candida spp , , . for c. albicans , this mutation has previously been described in the literature and associated with decreased in vitro echinocandin susceptibility after caspofungin treatment but for c. tropicalis , it is a novel missense mutation . even though endocarditis was diagnosed in september 2013 , we did not accept the indication for emergency operative intervention , the reasons being that the patient was hemodynamically stable and that his drug addiction and lack of cooperation during treatment rendered cardiac surgery in our opinion inadvisable . our decision may be objectionable inasmuch as conventional recommendations on candidemia endocarditis specify that whenever feasible and whatever the size of vegetation on the heart valve , emergency surgery should be carried out to reduce inoculum levels and to restrict the growth of resistant mutants . furthermore a cvc thrombosis was discovered by ultrasound , and the heart vegetations probably provided an ideal environment for biofilm formation , which is known to contain isolates exhibiting antifungal drug resistance . in conclusion , we describe a patient who experienced recurrent infections due to common candida species . his drug addiction and prior antifungal treatments favored the emergence of resistance and of multiple and sometimes mixed infections . novel missense mutation in the target fks gene was uncovered for c. tropicalis isolates ( fig . dr godet : received consultancy or speaker fees , travel support from pfizer , astellas , gilead , msd , basilea , sos oxygene and isis medical . pr cazenave - roblot is the head of french infectious diseases society and received consultancy or speaker fees , travel support from janssen , pfizer , astellas , gilead , msd .

mixed fungal infection and acquired echinocandin resistance of candida spp . remain infrequent . in this study we have reported the case of a patient hospitalized for tuberculosis who experienced multiple infections due to three common candida species ( c. albicans , c. glabrata , c. tropicalis ) . furthermore , consecutive isolates from blood cultures and heart valve were found resistant to azoles ( c. tropicalis ) and to echinocandin with either novel ( c. tropicalis ) or previously described ( c. albicans ) missense mutations in the fks gene .

dr . jacqueline a. noonan originally defined noonan syndrome in 1963 in a study of nine children . there were six boys and three girls that had a rare type of heart defect , valvular pulmonary stenosis and characteristics of their physical appearance included short stature , webbed neck , wide - spaced eyes , low - set posteriorly rotated ears and chest deformities . the first reported case of this syndrome was actually in 1883 by kobylinski who reported a 20-year - old patient with a webbed neck . noonan syndrome ( ns ) is an autosomal dominant disorder with great variability in expression of its characteristic features . the features of noonan syndrome change with age , as they are more prominent in infants and are less striking as they enter into early childhood . the diagnosis of noonan syndrome has typically been clinically identified , but due to the variability of expression in the syndrome currently , patients can be tested for mutations in the ptpn11 , sos1 , kras , nras , raf1 , braf , shoc2 , mek1 or cbl genes to help in the diagnosis . however , the absence of a mutation does not exclude the diagnosis , and new undiscovered mutations may also cause noonan syndrome . the patient was a dichorionic twin male that was born at 33 weeks gestation by vaginal delivery to a 26-year - old g5p4 mother after an abrupt onset of premature labor and rupture of membranes . the co - twin was a female that was delivered by a cesarean section due to a breech presentation and had no problems after delivery . neither of the neonates had dysmorphic features nor was there any history of any genetic abnormalities in the family . our patient developed subcostal retractions shortly after birth and was admitted to the neonatal intensive care unit ( nicu ) and given nasal continuous positive airway pressure . the chest x - ray revealed a small right - sided pleural effusion that resolved spontaneously over the following days . initial echocardiogram showed a small ventricular septal defect , left ventricular hypertrophy , systolic anterior motion of mitral valve with left ventricular outflow tract obstruction and dysplastic aortic / pulmonary valves without stenosis . at about 2 weeks of age , the neonate again developed respiratory distress and was transferred to our tertiary care nicu to better manage his respiratory failure and to rule out infectious causes . right - sided pleural effusion reappeared on chest x - ray at six weeks of age and progressively worsened . it needed to be drained by thoracentesis , then by chest tube thoracotomy and later by pleurodesis . the clinical diagnosis of chylothorax was made based on the pleural fluid having elevated lymphocyte count , protein and ldh levels . a positive culture for streptococcus viridans was found in the lymphocyte - rich , milky , pleural fluid and treated with systemic antibiotics . he developed anasarca , hypoproteinemia , severe lymphopenia , systemic hypotension and pulmonary hypertension , which subsequently led to his death at 80 days of life despite aggressive medical and surgical management . the clinical underlying cause of death consisted of massive chylothorax , pulmonary lymphangiectasia and hypertrophic cardiomyopathy . they were dilated throughout the entire pleural surface of both lungs , as well as around the pulmonary septa within the lung parenchyma ( figure 1b ) . a d2 - 40 immunohistochemistry stain identified the lymphatics supporting the diagnosis of pulmonary lymphangiectasis and a cause for the refractory to treatment pleural effusion ( figure 1c ) . the lymphatic vessels within the mesentery were prominently identifiable and dilated ( figure 1d ) . a d2 - 40 immunohistochemistry also confirmed these mesenteric vessels as lymphatics ; therefore , the baby also had intestinal lymphangiectasis ( figure 1e & f ) . a. the lungs after 24 h of formalin fixation . when fresh , they were pale pink with a slightly bumpy pleural surface . the aorta is horizontally placed at the upper portion of the photograph . b. hematoxylin - and eosin ( h&e)-stained photograph taken from the lung with the 4 -lens depicts the pleural surface and part of the pulmonary parenchyma . notice the dilated vessels . c. same field of view and magnification as in 1-b , but stained by immunohistochemistry for d2 - 40 highlights the lymphatic origin of dilated vessels . d. the upper part of the abdominal organs demonstrates the liver with gallbladder , intestine and congested mesenteric vessels . e. the h&e - stained photomicrograph from intestine and mesentery with the 4 -lens shows the intestine in the right lower corner and numerous dilated mesenteric vessels . f. same field of view and magnification as in 1-e , but stained by immunohistochemistry for d2 - 40 highlights the lymphatic nature of dilated vessels . congenital lymphangiectasis possibly results from a failure of pulmonary interstitial connective tissues to regress ( this normally occurs in the fifth month of fetal life ) leading to dilation of pulmonary lymphatic capillaries . that developmental disorder interferes with the function of the lymphatic system and eventually causes effusion of chylous fluid or lymph into either the pleural or peritoneal cavity . the presence of lymphedema , intestinal lymphangiectasis and chylothorax associated with pulmonary lymphangiectasis is a congenital developmental disorder called generalized lymphatic dysplasia . this entity resulted in protein - losing enteropathy , electrolyte imbalance and severe respiratory distress , which led to our patient s demise . the cause of death of the patient was generalized lymphatic dysplasia . due to the current recommendations on patients with pleural effusions , edema and a normal karyotype , a genetic workup for noonan syndrome it revealed a heterozygous mutation for the g503r in the ptpn11 gene consistent with the diagnosis of noonan syndrome ( p.gly503arg ( ggg > cgg ) : c.1507 g > c in exon 13 of the ptpn11 gene ( nm_002834.3 ) . turner syndrome consists of an abnormality of the sex chromosome with more renal anomalies , left - sided heart defects and less developmental delay compared to the abnormalities seen in noonan syndrome . the cardinal features of ns are short stature , congenital heart defect ( dysplastic / stenotic pulmonic valve , hypertrophic cardiomyopathy and septal defects are most common ) , developmental delay , webbed neck , scoliosis , pectus carinatum or excavatum , low - set nipples and cryptorchidism in males . the facial features in neonates consists of a broad and high forehead , hypertelorism , epicanthal folds , low - set posteriorly rotated ears , micrognathia , short neck and low posterior hairline . as the child grows , some of the features might change , such as the triangular - shaped face , down - slanting eyes , strabismus , amblyopia , refractive vision errors and high nasal bridge . in about 80% of the patients , the average height of an adult male with ns is 5 foot 5 inches and 5 foot in females . other less common features seen are pyeloureteric stenosis , coagulation disorders , leukemias , lymphatic dysplasias , pigmented nevi , hearing loss and hepatosplenomegaly . there have been diagnostic criteria developed by van der burgt to help in the investigation and management of patients with noonan syndrome . she describes six major criteria : typical face dysmorphology , pulmonary valve stenosis / hypertrophic cardiomyopathy / typical ecg , percentile of height according to age < p3 , pectus carinatum / excavatum , first - degree relative with definitive ns and mental retardation / cryptorchidism / lymphatic dysplasia . the minor criteria consist of suggestive facial dysmorphology , another cardiac defect not previously described , percentile of height according to age < p10 , broad thorax , first - degree relative with suggestive ns and one of either mental retardation , cryptorchidism and/or lymphatic dysplasia . in our patient , who was less than 3 months of age , certain characteristic features such as short stature and developmental delay could not be assessed . he did not have any dysmorphic features , chest deformities , relatives with ns or cryptorchidism . the three features that our baby did display were short neck ( no webbed ) , dysplastic pulmonary valve without stenosis and lymphatic dysplasia ( pulmonary and intestinal lymphangiectasis ) . it has been suggested that ns should be considered in all fetuses with polyhydramnios , pleural effusions , edema and increased nuchal fluid with a normal karyotype . there are a group of distinct syndromes with partially overlapping phenotypes in which causative mutations are found in genes of the ras - mapk signal transduction pathway , which include noonan , leopard , cardio - facio - cutaneous ( cfc ) and costello syndromes . a panel that evaluates braf , cbl , hras , kras , map2k1 , map2k2 , nras , ptpn11 , raf1 , shoc2 and sos1 genes was performed to help identify a possible mutation and a ptpn11 mutation was reported . it encodes shp-2 , a cytoplasmic protein tyrosine phosphatase ( ptp ) characterized by two tandemly arranged src homology 2 ( sh2 ) domains at the n - terminus , a catalytic domain and a c - terminal tail containing a proline - rich region and two tyrosyl residues that undergo reversible phosphorylation . shp-2 is a critical component of signal transduction for several growth factor- , hormone- , and cytokine - signaling pathways controlling developmental processes and hematopoiesis as well as energy balance and metabolism . individuals with leopard syndrome ( lentigines , ecg conduction abnormalities , ocular hypertelorism , pulmonic stenosis , abnormal genitalia , retardation of growth and sensorineural deafness ) may have distinct mutations in ptpn11 that lead to a diminished catalytic activity of these shp-2 mutants . costello syndrome ( short stature , development and intellectual disability , redundant skin of neck , hands and feet , unusually flexible joints , distinctive facial features , cardiac problems and perioral or perinasal papillomas ) is caused by mutations in hras . cfc syndrome ( cardiac abnormalities , high forehead , short nose , hypertelorism , down slanting palpebral fissures , ptosis , low - set ears , dry skin with nevi and keratosis pilaris ) is by mutations in braf , kras and mek1/2 . the missense mutation in the ptpn11 gene is seen in 50% of noonan syndrome cases , while sos1 in 13% , raf1 in 317% and kras in fewer than 5% . within the cases of ns , 59% of them are familial cases , while 37% are sporadic . noonan syndrome is a genetic disorder that is passed down in an autosomal dominant pattern . with no family history , and an atypical or incomplete phenotype , because of these recommendations and criteria , we were able to diagnose our patient with noonan syndrome , but unfortunately the results became available after his demise . nowadays , with the availability of improved genetic testing , it is possible to make a more precise diagnosis in cases with incomplete morphologic features . the implication of genetic testing for syndromes is very high , not only for early and adequate treatment , but also for genetic counseling .

noonan syndrome is an autosomal dominant disorder characterized by short stature , congenital heart defects , developmental delay , dysmorphic facial features and occasional lymphatic dysplasias . the features of noonan syndrome change with age and have variable expression . the diagnosis has historically been based on clinical grounds . we describe a child that was born with congenital refractory chylothorax and subcutaneous edema suspected to be secondary to pulmonary lymphangiectasis . the infant died of respiratory failure and anasarca at 80 days . the autopsy confirmed lymphatic dysplasia in lungs and mesentery . the baby had no dysmorphic facial features and was diagnosed postmortem with noonan syndrome by genomic dna sequence analysis as he had a heterozygous mutation for g503r in the ptpn11 gene .

there has been a persistent increase in the rate of incidence of breast cancer across many european countries over the last 30 years ( bray et al . , 2004 ; ferlay et al . , although national breast cancer screening initiatives temporarily inflated rates by diagnosing a cohort of patients previously undetected , there remained a general trend towards an average annual increase of 12% across many european countries for much of this period ( berrino et al . a primary concern for clinical decision making and resource allocation decisions relates to the greater demand on hospital services . health service and system responses have focused upon the priority setting of effective healthcare treatments and technologies . productivity and efficiency in which services are delivered remain a significant policy concern whilst striving to maximise population health outcomes . one consequence of the renewed policy focus on productivity and efficiency gains is that the average length of stay for postoperative breast cancer has been reduced in some european countries ( marla et al . , 2013 ) . it is unclear whether there are any changes in breast cancer resource use because of the greater demand from increasing incidence or whether this is offset by shorter length of stay . there is greater recognition that breast cancer is a complex disease , and this has had a direct impact on the changing nature of treatments . wholegenome sequencing and other technological advancements in breast cancer screening have changed the clinical pathway for many patients ( polyak , 2011 ) . the treatment pathway for a representative , or average , patient has been displaced by clinical evidence , which explicitly accommodates the heterogeneity among breast cancer patients , prognoses and outcomes . analysis of breast cancer resource use should reflect the individualised approach to treatment in order to offer more pertinent health policy insights . the eurohope project aims to investigate healthcare outcomes , performance and efficiency across seven european countries for five health conditions . using routine individual level breast cancer data from finland , the metropolitan area of turin ( italy ) , norway , scotland and sweden , this paper the key aim will be to explore whether conditional mean effects provide a suitable representation of the national variation in hospital costs whilst confining the analysis to variables that are routinely recorded in administrative hospital databases . oneyear cumulative hospital costs are used as a surrogate measure of breast cancer patient resource use . econometric analysis of cost data has been extensively applied in empirical research , and the methodological challenges in terms of estimation are , therefore , well documented ( for example , mullahy , 1998 ; manning and mullahy , 2001 ; nixon and thompson , 2004 ; jones , lomas and rice , 2014 ) . much of this literature is concerned with the analysis of costs within trialbased economic evaluations . within this setting , interest is confined to inferences about the population mean cost in the presence of skewed cost distributions . firstly , data sharing restrictions among some of the eurohope partner countries ruled out the pooling of data and confined analysis to remote access . secondly , there is uncertainty regarding whether conditional mean effects are the most salient message given policy interest is often focused upon the tails of the distribution in terms of extreme costs or outliers . to address both of these points , a flexible approach to the econometric analysis of cost data is adopted in which no prior assumption is made regarding location scale and shape effects for each eurohope country . ordinary least squares ( ols ) regression models are used to estimate conditional mean effects for the 1year cumulative hospital costs for each country . as cost data are commonly characterised by a long righthand tail , a natural log transformation was undertaken for all cost data prior to analysis to address this distributional feature . our linear regression model for the conditional mean is lncosti=+1di+2pi+uiwhere costi is the 1year cumulative hospital cost of patient i. di is a vector of demographic and diagnosisspecific variables , including patient age , icd10 diagnosis and breast cancer severity as measured by stage . pi is a vector of process variables , such as number of hospital procedures performed , length of stay in the previous year of diagnosis , whether the patient was treated in a university / teaching hospital and a dummy variable for patient mortality . no countryspecific dummy variables are included as each regression is run separately for each country due to data sharing restrictions . by extension , the quantile regression model for the conditional quantiles is qcosti|xi=+1xi+uiwhere x is a vector including demographic and diagnosis specific , di , and process variables , pi . the quantile of interest is estimated for each ( 0 , 1 ) ( koenker and hallock , 2001 ; koenker , 2005 ) . we use routinely collected individual breast cancer data from five european countries to derive a cohort of patients using a predefined methodology across eurohope partners ( douglas , 2012 ) . we focus on those patients with a primary diagnosis of invasive breast cancer ( icd9 codes 174 and icd10 c50 codes ) in the financial year 2005 , with the exception of norway which uses 2009 data . 1data from 2009 for norway was used as it was not possible to link data on resource use to patient records before 2008 ( the year prior to the index admission of 2009 ) . each individual record contains data on both demographic ( age and gender ) and clinical variables ( stage and diagnosis and number of procedures performed ) as well as linked data on administrative variables of interest ( e.g. hospital type ) . cumulative hospital costs cover the period from admission to 1 year followup using linked hospital discharge data as well as death and cancer registers . only finland , norway and sweden were able to include prescription data in the calculation of cumulative hospital costs . using the predefined methodology , each country excluded patients that were either male or under 25 years of age at presentation and had recurrence of breast cancer of same histology / laterality that was first diagnosed before the start of data collection . in addition , only patients with complete hospital identification numbers were included in the study . data from 2009 for norway was used as it was not possible to link data on resource use to patient records before 2008 ( the year prior to the index admission of 2009 ) . the first hospital episode for breast cancer is defined as the first hospital inpatient record following a diagnosis of breast cancer using the relevant icd9/icd10 codes . cumulative hospital costs are defined as any patient breast cancer resource use as an inpatient , day patient or outpatient up to 1 year after the recorded date of diagnosis of breast cancer . this includes surgical and nonsurgical treatments , such as chemotherapy , radiotherapy and hormone therapy , with the exception of norway , which were unable to include hormone therapy . hospital inpatient , including day surgery , is classified by diagnosisrelated groups for all countries with the exception of scotland , which is based on healthcare resource groups for all inpatient activity . costs for all countries have been converted to 2011 uk pound sterling ( s ) 2the interpretation and magnitude of the coefficients reported in the regression analyses remain the same for other currencies , such as the euro ( ) , with the exception of the intercept which will be sensitive to the currency selected . using organisation for economic cooperation and development ( oecd ) purchasing power parities ( oecd , 2012 ) . although hungary and the netherlands are also participating in the wider eurohope project , neither country supplied data for the breast cancer cost analysis reported in this paper . the netherlands did not contribute data for the breast cancer analysis as it was not possible to link patient records from the national cancer register to hospital discharge records . hungary was only able to provide data on length of stay due to difficulties in record linkage to discharge registers needed to calculate hospital costs . the sample for the cost analysis is , therefore , confined to finland , the metropolitan area of turin ( italy ) , norway , scotland and sweden . the interpretation and magnitude of the coefficients reported in the regression analyses remain the same for other currencies , such as the euro ( ) , with the exception of the intercept which will be sensitive to the currency selected . independent variables include patient characteristics such as breast cancer stage , icd10 diagnosis , mortality , hospital length of stay in the year prior to the breast cancer diagnosis , age in years and a quadratic function for age to accommodate nonlinear relationships . dummy variables are used to control for differing icd10 diagnoses as well as a separate variable to capture patient mortality using survival as the reference category ( e.g. survival = 0 ; died = 1 based on the date of death with followup up to december 2010 for all countries except finland who had followup up to december 2011 ) . breast cancer stage is used as a measure of severity using stage 1 as the reference category . the number of days spent in hospital in the previous year prior to diagnosis is used as a proxy for comorbidities in addition to the mortality dummy variable . we also control for the number of procedures performed to account for the possibility of variation in treatment pathways depending on hospital type and locality . hospital type is included as a dummy variable to estimate whether there are differences between university teaching hospitals / specialist breast cancer centres relative to other hospitals in terms of length of stay and costs . a comparison of the mean and standard deviation for the length of stay variable illustrates the variation in the patterns of breast cancer care across countries . despite the use of a predefined methodology for data collection and analysis for the eurohope project , table 1 the magnitude of some of the differences across countries may simply be a manifestation of registry data access or quality and , therefore , observed differences may be spurious . notable examples outlined in table 1 include the mortality dummy variable for norway and the costs estimates across all countries , which include a mixture of diagnosisrelated groups ( finland , italy , norway and sweden ) and healthcare resource group ( scotland ) episodebased costing methodologies . to minimise spurious conclusions , interpretation of all results presented should focus on national parameter heterogeneity rather than crosscountry comparisons . descriptive statistics for the key variables of interest for finland , italy , norway , scotland and sweden los = first hospital episode ; lost1 = length of stay in the previous year ; mortality = patient mortality dummy variable ; no . of procedures = number of procedures performed ; hospital dummy = dummy variable for whether the patient was treated in a university teaching hospital or specialist breast cancer centre . as illustrated , the cost distributions across countries are skewed with a long righthand tail . kernel density of the 1year cumulative hospital costs for finland , italy , norway , scotland and sweden table 2 presents the estimated coefficients from the ols regression model for the 1year cumulative hospital costs for each country . cost estimates for patients diagnosed using icd10 code c508 ( overlapping lesion of breast ) are 11% lower , on average , relative to the reference category of icd10 code c500 ( nipple and areola ) . for patients classified with stage 2 breast cancer , estimated costs are 25% higher relative to stage 1 patients . this rises to a 38% and 31% increase in costs for stage 3 and 4 patients , respectively , compared with stage 1 . the proxy for comorbidities in finland results in a 3% increase in costs for each additional day spent in hospital in the previous year . patient mortality is associated with an 11% increase in 1year hospital costs relative to patients that survived . ols regression coefficients ( conditional mean ) for 1year cumulative hospital costs for finland , italy , norway , scotland and sweden se = standard errors ; c501 = central portion of breast ; c502 = upperinner quadrant of breast ; c503 = lowerinner quadrant of breast ; c504 = upperouter quadrant of breast ; c505 = lowerouter quadrant of breast , c506 = axillary tail of breast ; c508 = overlapping lesion of breast ; c509 = breast unspecified ; stage 24 = breast cancer severity ; lost1 = length of stay in the previous year ; mortality = patient mortality dummy ; no . of procedures = no . of procedures performed ; hospital type = university / specialist centre dummy . figures 2 , 3 , 4 , 5 , 6 present the conditional mean and conditional quantile results for each country . the quantile regression results are used to explore evidence of parameter heterogeneity around the conditional mean effect reported in table 2 . each figure is constructed with the conditional mean effect represented by the thick black dashed line with corresponding 95% confidence interval denoted by the upper and lower dotted lines . heterogeneity in the response of covariates for breast cancer costs across conditional quantiles is represented by the thick solid line , and the grey shaded area denotes the corresponding uncertainty in terms of the quantile confidence interval . if the conditional quantile effect exceeds the bounds of the ols confidence interval , then this provides support for parameter heterogeneity . to supplement figures 2 , 3 , 4 , 5 , 6 , the coefficients and standard errors for the quantile regression model results at the median ; lower and upper quartile are presented in tables s3s7 in the supporting information . a comparison of the conditional mean ( represented by the thick black dashed line with corresponding 95% confidence interval denoted by the upper and lower dotted lines ) and the conditional quantile effects ( denoted by the thick solid line and the grey shaded area corresponding to the quantile confidence interval ) for 1year cumulative hospital costs for finland a comparison of the conditional mean ( represented by the thick black dashed line with corresponding 95% confidence interval denoted by the upper and lower dotted lines ) and the conditional quantile effects ( denoted by the thick solid line and the grey shaded area corresponding to the quantile confidence interval ) for 1year cumulative hospital costs for italy a comparison of the conditional mean ( represented by the thick black dashed line with corresponding 95% confidence interval denoted by the upper and lower dotted lines ) and the conditional quantile effects ( denoted by the thick solid line and the grey shaded area corresponding to the quantile confidence interval ) for 1year cumulative hospital costs for norway a comparison of the conditional mean ( represented by the thick black dashed line with corresponding 95% confidence interval denoted by the upper and lower dotted lines ) and the conditional quantile effects ( denoted by the thick solid line and the grey shaded area corresponding to the quantile confidence interval ) for 1year cumulative hospital costs for scotland a comparison of the conditional mean ( represented by the thick black dashed line with corresponding 95% confidence interval denoted by the upper and lower dotted lines ) and the conditional quantile effects ( denoted by the thick solid line and the grey shaded area corresponding to the quantile confidence interval ) for 1year cumulative hospital costs for sweden figure 2 presents the conditional mean and conditional quantile results for finland . there is a 13% increase in the costs for patients diagnosed using icd10 code c504 ( upperouter quadrant of breast ) at the lower conditional quartile but no significant differences at the conditional mean , median or upper quartile . the conditional mean effect for stage 2 patients provides a good approximation of the relative increase in costs compared with stage 1 patients across conditional quantiles . in contrast , the conditional mean effect for stage 3 patients masks response heterogeneity across the conditional quantiles . for example , the costs for stage 3 patients are estimated to be 43% higher at the lower conditional quartile , 32% higher at the upper quartile and 38% higher , on average , relative to stage 1 patients . hospital costs for stage 4 patients are estimated to be 24% higher at the lower conditional quartile , 40% higher at the median and 31% higher for both the conditional mean and upper conditional quartile relative to stage 1 patients . although the conditional mean effect for the comorbidity variable estimates each additional day spent in hospital in the previous year to increase costs by 3% , conditional median results suggest each day is associated with a 2% increase and upper quartile estimates consider an increases in costs of 4% per day in the previous year . patient mortality is associated with a 7% increase in 1year hospital costs at the conditional median , 20% increase in costs at the upper quartile but the estimated coefficient is not significant at the lower conditional quartile relative to patients that survived . the number of breast cancer procedures performed is not significant at any conventional level for both the conditional median and lower quartile . however , the sign and magnitude of the coefficients change between the lower and upper quartile with the upper conditional quartile estimating each additional procedure performed to increase hospital costs by 5% . column ( 2 ) in table 2 reports the estimated coefficients for the ols cost regression model for the metropolitan area of turin ( italy ) . cost estimates for breast cancer stage monotonically increase with the level of severity . for patients classified with stage 2 breast cancer , this rises to a 78% and 151% increase in costs for stage 3 and 4 patients , respectively , compared with stage 1 . each additional breast cancer procedure performed in hospitals in italy is estimated , on average , to increase costs by 32% . the conditional mean and conditional quantile results for italy are presented in figure 3 . as illustrated in figure 3 , the conditional mean effect for all breast cancer stage variables provides a good approximation of the relative increase in costs compared with stage 1 patients across conditional quantiles . in contrast , there is evidence of parameter heterogeneity for both the number of procedures performed and hospital type across conditional quantiles . however , costs are increased by 32% for each additional breast cancer procedure performed at the conditional mean and median as well as a 39% increase in costs at the lower quartile . the costs for patients treated in university teaching hospitals or specialist breast cancer centres in italy is not significant at any conventional level at the conditional mean , median or lower quartile . in contrast , patients treated in university teaching hospitals or specialist breast cancer centres at the upper conditional quartile is estimated to reduce costs by 25% relative to other hospital types . the estimated coefficients from the norway ols regression model for 1year cumulative hospital costs are presented in column ( 3 ) of table 2 . for patients classified with stage 2 and stage 4 breast cancer , the proxy for comorbidities in norway results in a 0.7% increase in costs for each additional day spent in hospital in the previous year . patient mortality is associated with a 14% increase in 1year hospital costs relative to patients that survived . each additional breast cancer procedure performed in hospitals in norway is estimated , on average , to reduce costs by 7% . furthermore , the costs for patients treated in university teaching hospitals or specialist breast cancer centres in norway is estimated to be 7% lower relative to other hospital types . figure 4 presents the conditional mean and conditional quantile results for norway . the conditional mean effect for stage 3 patients provides a good approximation of the relative increase in costs compared with stage 1 patients across conditional quantiles . in contrast , the average treatment response based on the ols regression model for stage 2 and stage 4 patients fails to uncover important heterogeneity across the conditional quantiles . for example , the costs for stage 2 patients are estimated to be 22% higher at the lower conditional quartile , 32% higher at the upper quartile and 26% higher , on average , relative to stage 1 patients . the costs for stage 4 patients are not significant at the lower quartile but are estimated to be 28% higher at the median , 41% higher at the upper conditional quartile and 26% higher at the conditional mean relative to stage 1 patients . although the conditional mean response is the same for both stage 2 and stage 4 patients , there is a greater variation in the most severe breast cancer category represented by stage 4 . the comorbidity variable estimates each additional day in hospital in the previous year to increase costs by 0.7% for the conditional mean , 1% for conditional median and 1.4% at the upper conditional quartile . patient mortality is associated with a 20% increase in 1year hospital costs at the conditional median and 24% increase in costs at the upper quartile , but the estimated coefficient is not significant at the lower conditional quartile relative to patients that survived . however , costs are reduced by 9% for each additional procedure performed at the median , reduced by 19% at the lower quartile , whilst the conditional mean effect reported a reduction of 7% . the costs for patients treated in university teaching hospitals or specialist breast cancer centres in norway is estimated to be 6% lower at the conditional median and this increases to a reduction in costs by 14% at the lower quartile relative to other hospital types . column ( 4 ) in table 2 reports the estimated coefficients for the cost regression model for scotland . for patients classified with stage 2 , 3 or 4 breast cancers , the estimated costs are 52% , 68% and 55% higher , respectively , relative to stage 1 patients . patient mortality is associated with a 16% increase in 1year hospital costs relative to patients that survived . each additional breast cancer procedure performed in hospitals in scotland there is a 31% and 32% reduction in costs for patients diagnosed using icd10 codes c503 ( lowerinner quadrant of breast ) and c506 ( axillary tail of breast ) at the lower conditional quartile but no significant differences at the conditional mean , median or upper quartile . the conditional mean effect for all breast cancer staging variables does not provide a good approximation of the relative increase in costs compared with stage 1 patients . oneyear hospital costs for stage 2 patients are estimated to be 57% higher at the lower conditional quartile , 60% higher at the median and 49% higher at the upper conditional quartile relative to stage 1 patients . costs for stage 3 patients are estimated to be 78% higher at the lower conditional quartile , 77% higher at the median and 58% higher at the upper conditional quartile relative to stage 1 patients . hospital costs for stage 4 patients are estimated to be 54% higher at the lower conditional quartile , 61% higher at the median and 56% higher for the upper conditional quartile relative to stage 1 patients . patient mortality is associated with a 15% , 19% and 16% increase in 1year hospital costs at the lower conditional quartile , median and upper conditional quartile relative to patients that survived . hospital costs are increased by 43% , 30% and 17% for each additional breast cancer procedure performed in scotland at the lower conditional quartile , median and upper conditional quartile , respectively . although hospital type is not significant at the conditional mean or lower quartile , the costs for patients treated in university teaching hospitals or specialist breast cancer centres in scotland is estimated to be 7% lower at the conditional median and 9% lower at the upper quartile relative to other hospital types . the national conditional mean effects for sweden for 1year hospital costs based on the ols regression model are reported in column ( 5 ) of table 2 . cost estimates for breast cancer stage monotonically increase with the level of severity . for patients classified with stage 2 breast cancer , estimated costs this rises to a 30% and 40% increase in costs for stage 3 and 4 patients , respectively , compared with stage 1 . the proxy for comorbidities in sweden results in just under a 5% increase in costs for each additional day spent in hospital in the previous year . each additional breast cancer procedure performed in hospitals in sweden is estimated , on average , to increase costs by 63% . figure 6 presents the conditional mean and conditional quantile results for sweden . the conditional mean effect for all breast cancer staging variables does not provide a good approximation of the relative increase in costs compared with stage 1 patients . oneyear hospital costs for stage 2 patients are estimated to be 11% higher at the lower conditional quartile , 14% higher at the median and 13% higher at the upper conditional quartile relative to stage 1 patients . costs for stage 3 patients are estimated to be 18% higher at the lower conditional quartile , 24% higher at the median and 31% higher at the upper conditional quartile relative to stage 1 patients . hospital costs for stage 4 patients are estimated to be 15% higher at the lower conditional quartile , 25% higher at the median and 40% higher for the upper conditional quartile relative to stage 1 patients . the comorbidity variable estimates each additional day in hospital in the previous year to increase costs by just under 5% for the conditional mean , just over 5% for conditional median , less than 2% at the lower quartile and over 3.5% at the upper conditional quartile . patient mortality is associated with a 5% increase in 1year hospital costs at the conditional median , 11% increase in costs at the upper quartile , but the estimated coefficient is not significant at the lower conditional quartile or conditional mean relative to patients that survived . hospital costs are increased by 59% , 44% and 32% for each additional breast cancer procedure performed in sweden at the lower conditional quartile , median and upper conditional quartile , respectively . this paper considers whether conditional mean effects provide a suitable representation of national data on 1year breast cancer cumulative hospital costs . point estimates based on conditional mean effects provide a good approximation of treatment response for some key demographic and diagnosticspecific variables ( e.g. age and icd10 diagnosis ) across the conditional quantile distribution . for many policy variables of interest , however , there is a considerable evidence of parameter heterogeneity that is concealed if decisions are based solely on conditional mean results . mortality , breast cancer stage and hospital type are all important variables in determining patient treatment , outcomes , access and service delivery . this paper has illustrated that these key variables are also important for determining the location scale and shape of breast cancer cumulative hospital costs over a 1year period . although there have been national policy initiatives to reduce breast cancer length of stay , heterogeneity still exists . the quantile regression results reinforce the need to consider beyond an average effect given the results of parameter heterogeneity . data sharing restrictions across eurohope countries imposed constraints in terms of analysis as the pooling of data was not feasible . instead , the eurohope project relied on a common methodology across countries to ensure consistency in reporting and analysis of national data as outlined by douglas ( 2012 ) . there remains a large proportion of missing data across countries , particularly in terms of the variables used to derive breast cancer staging categories . the methodological challenges in terms of breast cancer staging in crosscountry studies is well established , and potential solutions have been proposed ( e.g. walters et al . , 2013 ) . despite this literature , attempts to follow the recommended guidelines did not address the challenges associated with imputing missing stage data . in particular , the imputation of missing stage data following the approach by walters et al . ( 2013 ) still resulted in around 50% missing stage data for both finland and sweden because of breast cancer stage coding discrepancies . the reported results are , therefore , confined to complete case analysis for all countries given the uncertainty in the pattern of missingness across key variables . statistical methods for addressing missing data , such as multiple imputations by chained equations , are further inhibited by the data sharing restrictions across eurohope partner countries , large percentage of missing data for some key variables ( i.e. breast cancer stage ) as well as uncertainty about whether the data are missing ( not ) at random . a number of countries were also constrained in terms of linking data to other registries which resulted in certain covariates being excluded from regression models as well as the loss of countries from the sample . 3for example , information relating to the fourth digit of the icd10 diagnosis variable for norway was not collated at the time of data retrieval and , therefore , absent from the final analysis dataset . beral and peto ( 2010 ) have previously raised concerns about the quality of breast cancer registry data although woods et al . ( 2011 ) posit a more optimistic outlook through a simulation study of the national cancer registry data from england and wales . in light of the methodological challenges , caution is needed for the interpretation and generalisability of the regression results presented in this paper as part of the eurohope project . for example , information relating to the fourth digit of the icd10 diagnosis variable for norway was not collated at the time of data retrieval and , therefore , absent from the final analysis dataset . the costing methodology adopted by each eurohope country relied on the best available data and estimates . as a result , differences exist in terms of episodebased costing estimates with a mixture of diagnosisrelated groups as well as healthcare resource groups geue et al . ( 2012 ) have previously demonstrated the sensitivity of results to the costing methodology adopted . it is worth reiterating that the aim of the paper was to explore parameter heterogeneity in national breast cancer cost data rather than crosscountry disparities in hospital costs . however , the difference in costing methodology across countries could explain some of the differences in magnitude and sign for certain covariates included in the regression models . the number of procedures performed changes in sign and magnitude across countries and may simply be a manifestation of the underlying costing methodologies adopted . for this reason , interpretation should focus upon parameter heterogeneity across conditional quantiles within countries rather than between eurohope countries . a common methodology was adopted for the eurohope project in terms of model selection based on available data across all countries . important covariates were included in the regression models to control for patient casemix and characteristics that may influence hospital costs . it was not possible to include a common measure of socioeconomic status across eurohope countries , which may have an impact on study results . in addition , there may be other forms of unobserved patient heterogeneity that the regression models are unable to accommodate . this may include patient frailty , engagement and treatment preferences which could bias results in either direction in terms of los as well as hospital costs . for many forms of unobserved heterogeneity , there is an inevitable interaction with observable characteristics . the use of quantile regression methods , in this setting , becomes particularly salient as a means of exploring potential exogenous shifts in the regressors across the conditional distribution ( miranda , 2008 ) . one final consideration relates to the presence of potential endogenous regressors in the model specification , such as the mortality dummy variable . the methodological challenges associated with the identification of suitable instruments to address the endogeneity problem with crosssectional observational data are well established in the literature ( staiger and stock , 1997 ) . as a result , a pragmatic approach was adopted by focusing on the ols estimates in light of the absence of suitable instruments collected in national breast cancer registers . although tests for weak instruments are available for single ( stock and yogo , 2005 ) or multiple endogenous regressors ( sanderson and windmeiejer , 2013 ) , the consequences of weak instruments can induce greater bias . in this setting , the cure to the endogeneity problem can be worse than the diagnosis itself ( hahn and hausman , 2003 ) . the direction of future research should focus upon the possible determinants of heterogeneity in outcomes as well as treatment response across the conditional distribution . one important contribution to the literature would be to consider the dependency between hospitals within countries in light of the heterogeneity reported in this paper . gravelle , santos and siciliani ( 2013 ) have recently demonstrated the significance of spatial dependence between hospitals in determining quality . crosscountry studies , such as eurohope , need to consider the appropriate spatial unit to capture any dependency between hospitals . for example , geographic , administrative or health system units may all represent a clustering of outcomes in terms of healthcare performance , quality and efficiency . jones and spiegelhalter ( 2011 ) acknowledge the methodological challenges in the identification of extreme hospital outcomes or outliers and offer possible strategies to overcome these difficulties . the incorporation of national treatment guidelines with expert opinion from clinicians and healthcare providers across all participating countries offers a fruitful means of benchmarking european hospital outcomes prior to the analysis of data to identify extremes or outliers .

abstractwe investigate parameter heterogeneity in breast cancer 1year cumulative hospital costs across five european countries as part of the eurohope project . the paper aims to explore whether conditional mean effects provide a suitable representation of the national variation in hospital costs . a cohort of patients with a primary diagnosis of invasive breast cancer ( icd9 codes 174 and icd10 c50 codes ) is derived using routinely collected individual breast cancer data from finland , the metropolitan area of turin ( italy ) , norway , scotland and sweden . conditional mean effects are estimated by ordinary least squares for each country , and quantile regressions are used to explore heterogeneity across the conditional quantile distribution . point estimates based on conditional mean effects provide a good approximation of treatment response for some key demographic and diagnostic specific variables ( e.g. age and icd10 diagnosis ) across the conditional quantile distribution . for many policy variables of interest , however , there is considerable evidence of parameter heterogeneity that is concealed if decisions are based solely on conditional mean results . the use of quantile regression methods reinforce the need to consider beyond an average effect given the greater recognition that breast cancer is a complex disease reflecting patient heterogeneity . 2015 the authors . health economics published by john wiley & sons ltd .

our institutional review board ( catholic medical center , seoul , korea ) approved the protocol of this retrospective study , and the requirement for informed consent was waived . the study was comprised of outside abdominal ct scans referred to our five hospitals from outside hospitals , from 2003 to 2007 . the five hospitals are affiliated with the catholic medical center of the catholic university of korea . we randomly chose two months per year , for a total of 10 selected months , and all of the abdominal ct scans from outside hospitals or clinics during these months were included as part of the analysis . a total of 1,011 ct scans were collected ; of which , 582 were from male patients , 419 were from female patients , and 10 were from patients of unidentified genders . the ages of the patients ranged from one to 97 ( mean , 56.6 ) years old , and 23 of the subjects ' ages were unidentified . we used kiami 's clinical test image data sheet ( 2 , 4 ) to evaluate the clinical images ( table 1 ) . two experienced radiologists from each hospital ( a total of 10 abdominal radiologists with 5 to 31 years of experience ) reviewed the outside abdominal ct scans , and both reviewers graded them using the modified clinical test image data sheet in consensus . testing of the ct images was performed using the clinical test image data sheet generated by kiami in korea . the clinical test image data sheet is prepared separately according to the areas of the body ( head / neck , chest , abdomen regions ) . table 1 shows the clinical test image data sheet for abdominal cts , as conducted by kiami ( 2 , 4 ) . the two main categories are the general and imaging parameters , followed by the scores set by each sub - category . the general parameters are divided into four sub - categories , namely the identifying data ( 6 points ) , display parameter ( 8 points ) , scan parameter ( 4 points ) , and film quality ( 2 points ) , yielding a total potential score of 20 points . the passing grade for this program is a score over 12 points , which is 60% of the perfect score . the imaging parameters are divided into six sub - categories ; namely , the artifact ( 12 points ) , scan length ( 7 points ) , spatial and contrast resolution ( 20 points ) , window width and level ( 10 points ) , optimal contrast enhancement ( 21 points ) , slice thickness ( 10 points ) , which add up to a potential total score of 80 points . a passing grade for this program is a score over 48 points , which is 60% of the perfect score . the total score is the sum of the general parameters and the imaging parameters , which adds up to a potential of 100 points . however , the total score is not the important factor to consider for passing the test of the program . as stated above , the general and imaging parameters should each be over 60% of the perfect score to pass the test of the accreditation program . one separate box at the bottom of the sheet , which is not present on the clinical test image data sheet designed by kiami , was added to facilitate conducting research . the box on the bottom has an item to check for the subjective 3-point scale : grade 1 , unacceptable when degraded image quality is significant enough for impairment of diagnosis ; grade 2 , fair when there is some degraded image quality but no impairment of diagnosis ; grade 3 , optimal when the ct image quality is optimal before subjective scoring the ct images . the reviewers found and agreed in consensus on the ct images of each score , and these images were used as a standard for scoring . the ct images were divided into two periods of ' before ' ( 2003 and 2004 ) and ' after ' ( from 2005 to 2007 ) the implementation of the accreditation program . we evaluated any changes between the two periods according to the parameters of the clinical image evaluation and subjective assessment . we correlated the subjective assessment of image quality with the score from the clinical image evaluation . we also analyzed the results according to the size of the medical institution : general hospital , hospital , or clinic . general hospitals are defined as medical institutions equipped with more than 100 beds , and more than nine medical departments . hospitals are defined as medical institutions established by medical doctors and equipped with facilities having more than 30 beds . clinics are defined as medical institutions which do not otherwise meet the criteria for a hospital or general hospital . we evaluated the appropriateness of the kvp and mas of the ct images from before and after implementation of the ct accreditation program . finally , we compared the failure rate and average score of the imaging parameters in the failed group , before and after the program . we defined failure as not passing either general parameters ( less than 12 points ) or imaging parameters ( less than 48 points ) . we analyzed the ' before ' and ' after ' time periods and among groups according to the size of medical institution data by the student 's t test and one - way anova ( analysis of variance ) using the spss software ( version 13.0 , statistical package for the social sciences , chicago , il ) . we used the medcalc software ( medcalc 10.4.8 , mariakerke , belgium ) for comparisons of the proportion of soft copies and unidentified institutions between the two periods . we used the mann - whitney u test for the comparison of the subjective assessment and the failure rate between the two periods ( before , after ) . testing of the ct images was performed using the clinical test image data sheet generated by kiami in korea . the clinical test image data sheet is prepared separately according to the areas of the body ( head / neck , chest , abdomen regions ) . table 1 shows the clinical test image data sheet for abdominal cts , as conducted by kiami ( 2 , 4 ) . the two main categories are the general and imaging parameters , followed by the scores set by each sub - category . the general parameters are divided into four sub - categories , namely the identifying data ( 6 points ) , display parameter ( 8 points ) , scan parameter ( 4 points ) , and film quality ( 2 points ) , yielding a total potential score of 20 points . the passing grade for this program is a score over 12 points , which is 60% of the perfect score . the imaging parameters are divided into six sub - categories ; namely , the artifact ( 12 points ) , scan length ( 7 points ) , spatial and contrast resolution ( 20 points ) , window width and level ( 10 points ) , optimal contrast enhancement ( 21 points ) , slice thickness ( 10 points ) , which add up to a potential total score of 80 points . a passing grade for this program is a score over 48 points , which is 60% of the perfect score . the total score is the sum of the general parameters and the imaging parameters , which adds up to a potential of 100 points . however , the total score is not the important factor to consider for passing the test of the program . as stated above , the general and imaging parameters should each be over 60% of the perfect score to pass the test of the accreditation program . one separate box at the bottom of the sheet , which is not present on the clinical test image data sheet designed by kiami , was added to facilitate conducting research . the box on the bottom has an item to check for the subjective 3-point scale : grade 1 , unacceptable when degraded image quality is significant enough for impairment of diagnosis ; grade 2 , fair when there is some degraded image quality but no impairment of diagnosis ; grade 3 , optimal when the ct image quality is optimal before subjective scoring the ct images . the reviewers found and agreed in consensus on the ct images of each score , and these images were used as a standard for scoring . the ct images were divided into two periods of ' before ' ( 2003 and 2004 ) and ' after ' ( from 2005 to 2007 ) the implementation of the accreditation program . we evaluated any changes between the two periods according to the parameters of the clinical image evaluation and subjective assessment . we correlated the subjective assessment of image quality with the score from the clinical image evaluation . we also analyzed the results according to the size of the medical institution : general hospital , hospital , or clinic . general hospitals are defined as medical institutions equipped with more than 100 beds , and more than nine medical departments . hospitals are defined as medical institutions established by medical doctors and equipped with facilities having more than 30 beds . clinics are defined as medical institutions which do not otherwise meet the criteria for a hospital or general hospital . we evaluated the appropriateness of the kvp and mas of the ct images from before and after implementation of the ct accreditation program . finally , we compared the failure rate and average score of the imaging parameters in the failed group , before and after the program . we defined failure as not passing either general parameters ( less than 12 points ) or imaging parameters ( less than 48 points ) . we analyzed the ' before ' and ' after ' time periods and among groups according to the size of medical institution data by the student 's t test and one - way anova ( analysis of variance ) using the spss software ( version 13.0 , statistical package for the social sciences , chicago , il ) . we used the medcalc software ( medcalc 10.4.8 , mariakerke , belgium ) for comparisons of the proportion of soft copies and unidentified institutions between the two periods . we used the mann - whitney u test for the comparison of the subjective assessment and the failure rate between the two periods ( before , after ) . we reviewed a total of 1,011 outside abdominal ct scans , with 328 before and 683 after the implementation of the accreditation program . before program implementation , there were 171 hard copies ( 52% ) and 157 soft copies ( 48% ) , as opposed to 217 hard copies ( 32% ) and 466 soft copies ( 68% ) after program implementation . we collected significantly more soft copies of outside abdominal ct scans after the implementation of the program ( p < 0.001 ) compared to before . the identifying data and display parameters were significantly greater after implementation of the program ( p < 0.001 ) . the scan parameters and the film quality were not statistically different before or after implementation . of the imaging parameters evaluated , scan length , spatial and contrast resolution , window width and level , and slice thickness were significantly greater after program implementation . the average scores for the sums of general parameters ( p = 0.004 ) , imaging parameters ( p < 0.001 ) , and the total score ( p < 0.001 ) after the implementation of the accreditation program , were significantly higher than those from before . after implementing the accreditation program , there was a decrease in percentage in grade 2 ( 30% before , 19% after ) and an increase in grade 3 ( 60% before , 70% after ) , with an overall statistically significant improvement in scores ( p = 0.013 ) for the subjective assessment . however , although not statistically significant , grade 1 showed a slightly greater percentage ( 10% before , 12% after , p = 0.646 ) . table 3 shows the average scores of the general parameters , imaging parameters , and total score according to the grade of the subjective assessment . as for the unaccepted cases , the means of the general parameters and total score were 17.6 points , and 63.6 points , respectively , which are both higher than the passing grades ( 12 and 60 points ) , however the mean of the imaging parameters was 46.0 points , which is not higher than the passing grade ( 48 points ) . we also analyzed the results according to the size of the medical institution . before the implementation of the accreditation program , 217 ct images ( 66% ) were referred from general hospitals , 37 ( 11% ) from hospitals , and 33 ( 10% ) from clinics . we could not find any information on the medical institution for the remaining 41 ct images ( 13% ) , which were classified as the unidentified group . after the accreditation program , 444 ct images ( 65% ) were referred from general hospitals , 88 ( 13% ) from hospitals , 82 ( 12% ) from clinics , and 69 ( 10% ) from unidentified medical institutions . the proportion of collected ct scans according to the size of the medical institution and the proportion from unidentified institutions are not statistically different between the ' before ' and ' after ' time periods ( p = 0.190 ) . figure 1 shows the average total scores for the outside abdominal cts from each group according to the size of the medical institution . after the implementation of the ct accreditation program , the average total scores from the general hospital ( before : 86.2 10.93 points , after : 90.2 8.48 points , p < 0.001 ) and the hospital ( before : 80.8 9.06 points , after : 85.0 12.69 points , p = 0.041 ) were significantly higher than the scores prior to program implementation . however , the average total scores from clinics ( before : 74.8 12.20 points , after : 74.5 16.48 points , p = 0.925 ) and the unidentified group ( before : 74.4 15.30 points , after : 78.1 16.48 points , p = 0.241 ) showed no significant difference between the ' before ' and ' after ' time periods . the total scores among groups according to the size of the medical institutions were compared and the total score from general hospitals was found to be significantly higher than at hospitals , clinics , or unidentified groups both before ( p = 0.042 ) and after ( p < 0.001 ) the accreditation program implementation . however , the total score from hospitals was not different from that of clinics or unidentified groups prior to the implementation of the accreditation program . after implementing the accreditation program , a significant difference in scores was shown between hospitals and clinics ( p < 0.001 ) , as well as between hospitals and unidentified groups ( p = 0.001 ) . the total scores from before and after implementation of the accreditation program were not different between the clinics and unidentified groups . the average peak kilovoltage ( kvp ) and milliampere second ( mas ) prior to the implementation of the accreditation program were 120.87 and 271.54 , respectively , compared to 121.92 and 249.32 , respectively after the program , which were both not significantly different ( p = 0.622 , p = 0.458 ) . the failure rates before and after the implementation of the program were 10% and 9% , respectively and were not significantly different ( p = 0.967 ) . the average scores of the imaging parameter in the failed group were 38.5 7.6 points before and 37.6 6.8 points after and was not significantly different ( p = 0.442 ) . during the 10 selected months taken from 2003 to 2007 , 1,011 outside abdominal ct scans referred to our five hospitals from outside hospitals . more soft copies were collected after the implementation of the ct accreditation program , thereby suggesting that , over these years in korea , with the increased use of the pacs , the number of soft copies increased compared to hard copies . in addition , this pattern suggests that , to pass the newly initiated ct accreditation program , old ct equipment was to be replaced with the pacs rather than with a printer . after the implementation of the ct accreditation program , the scores of the identifying data and display parameters in the general parameters were noticeably improved . the reason for this improvement is likely that these parameters could be readily inserted without special equipment . nonetheless , among the general parameters , the scores of the scan parameter and the film quality were not significantly improved . the kvp and mas values could not be shown in a lot of old equipment . using the old equipment , these parameters were not automatically displayed on the image , and some institutions added these parameters as a text on the image . moreover , some equipment was not adjusted to the new standards after the year 2000 , for instance for y2k . therefore the film quality was not a problem in either time period . among the imaging parameters , the scan length , window width and level , and slice thickness were significantly greater after the implementation of the accreditation program . these parameters are notably closely related to the protocol of ct scanning . these improvements can be interpreted as the result of efforts by each institution to be accredited by the kiami program through the education of responsible technologists . furthermore , this improvement implies that the program has an educational effect and that it should be a part of the recommended standard ct protocol . even after the implementation of the ct accreditation program these parameters are related to equipment performance and are different from parameters that could be improved simply by reorganizing the protocol and educating radiology technicians . the improvement of parameters such as artifacts and optimal contrast enhancement requires the replacement of old machines with new ones , or better maintenance of quality control , both of which take time and money . the parameters of the documentation of the lung window setting on the basal lung and information about contrast injection require little effort for improvement , but they are constantly a low scoring category . institutions give this only minor attention , probably due to the low scoring and the pass / fail nature of the program . the grading score of the subjective assessment , added by us , improved after the program 's implementation , as did the average scores of the general parameters , imaging parameters , and total score . because the kiami program is one with pass / fail scoring and is not used for the grading of imaging quality , the average scores of the general parameters and total scores of outside abdominal cts that were graded as unacceptable by the subjective assessment were shown to be higher than the passing grade set by the kiami program . however , the average score of the imaging parameters of outside abdominal ct images that were graded as unacceptable was comparable to passing grade ( 48 points ) set by kiami . considering that the imaging parameters are very important factors in the evaluation of ct images , kiami 's abdominal ct accreditation program could sufficiently function as the proper standard of evaluation of ct imaging quality . in addition , adding a new program for quality grading would be helpful for the continuous improvement of image quality . when the total scores were compared according to the size of the institution , general hospitals and hospitals significantly improved their total scores after the implementation of the program , but the total score of clinics did not improve . this demonstrates that ct quality control has not been improved in clinics , which is likely due to the limitation of personnel and financial resources . in addition , according to current korean law , it is clearly stated that a ct could be performed without a full - time radiologist and with only one radiology technician when using cts installed prior to 2003 . furthermore , a ct could be performed even with the supervision of just one part - time radiologist for cts installed after 2004 . this may not be a big problem in general hospitals or hospitals ; however , in clinics without a radiologist or with a part - time radiologist , ct image quality control may not be performed properly , and this may be responsible for the delay in improvement of ct quality in clinics . considering that clinics contribute the most basic service in the korean medical service , appropriate actions may be needed for quality improvement . after implementing the accreditation program , the failure rate of clinical image evaluation according to kiami 's sheet was approximately 10% , with no significant difference with the period prior to the implementation of the accreditation program . furthermore , there was no significant difference in the percentage of unacceptable subjective image quality between the two periods . the reason for this is possibly due to the fact that most of the ct equipment that failed before continued to be used after optimizing and passing the test ; however , these machines possibly also often failed the following year . so perhaps a specific new accreditation program targeting prior failed ct equipment is needed , because these machines are intrinsically of poor quality and are temporarily passing the accreditation criteria . one limitation of our study is the difference in the evaluated time periods ( two years before and three years after the implementation of kiami ) . we chose three years for the ' after ' time period because the kiami clinical image evaluation is performed three years after accreditation . on the other hand , the pacs implementation began after 2003 , and any evaluation of film from before this period was logistically difficult ; thus , the only choice for the ' before ' period was two years . the other limitation of our study is that the results of the scan parameter category of kvp and mas indicated no significant change before and after the imposition of kiami . thus we can presume no reduction in dose as a result of this quality improvement . because the amount of radiation received during a ct exam may be harmful , it is important to reduce the dose in concurrence with keeping on the image quality for proper diagnosis . though kiami has no references about radiation dose , the new standards for radiation dose such as ct dose index and dose length product should be incorporated into the kiami program . in conclusion , after the implementation of the ct accreditation program , the quality of outside abdominal cts improved markedly , especially for parameters that were directly related to the ct protocols . the accreditation program by national law improved the quality of abdominal cts and had a measurable educational effect on radiologists and radiology technicians .

objectivethe purpose of this study was to evaluate any improvement in the quality of abdominal cts after the utilization of the nationally based accreditation program.materials and methodsapproval was obtained from the institutional review board , and informed consent was waived . we retrospectively analyzed 1,011 outside abdominal cts , from 2003 to 2007 . we evaluated images using a fill - up sheet form of the national accreditation program , and subjectively by grading for the overall ct image quality . ct scans were divided into two categories according to time periods ; before and after the implementation of the accreditation program . we compared ct scans between two periods according to parameters pertaining to the evaluation of images . we determined whether there was a correlation between the results of a subjective assessment of the image quality and the evaluation scores of the clinical image.resultsthe following parameters were significantly different after the implementation of the accreditation program : identifying data , display parameters , scan length , spatial and contrast resolution , window width and level , optimal contrast enhancement , slice thickness , and total score . the remaining parameters were not significantly different between scans obtained from the two different periods : scan parameters , film quality , and artifacts.conclusionafter performing the ct accreditation program , the quality of the outside abdominal cts show marked improvement , especially for the parameters related to the scanning protocol .

urinothorax , first described in 1968 , refers to the presence of urine within the pleural cavity , results from either traumatic or obstructive causes . in 2004 , garcia - pachon and padilla - navas found only 53 cases of urinothorax documented in the literature . isolated diaphragmatic injuries are uncommon and occur only in 4 - 5% of cases requiring laparotomy , but combined injuries of diaphragm and urinary bladder seldom occur . no single investigation provides a reliable diagnosis , but high index of suspicion and careful clinical evaluation with appropriate radiological investigations will help . once diagnosis is confirmed , the management depends on the general condition of the patient and the local surgical expertise available . even though open laparotomy still plays a major role in the management of combination intraabdominal injuries , laparoscopy is evolving both as a good diagnostic and therapeutic tool . a 25-year - old male , presented in the emergency , with a history of road traffic accident with complaints of severe pain right side chest , breathing difficulty and not able to void . bilateral intercostal tube drains were placed , drained 1500 ml and urethral catheter drained 400 ml of blood - stained urine . contrast - enhanced computed tomography ( cect ) scan demonstrated bilateral hydrothorax , diaphragmatic rupture with stomach inside thorax and intraperitoneal rupture of the urinary bladder . laparoscopic repair of bladder rupture was done with interrupted 00 absorbable suture [ figure 2a ] . with the placement of extra ports for liver retraction , stomach reduced from the thorax . diaphragmatic defect identified and closed with interrupted 0 non - absorbable suture [ figure 2b ] . abdominal drain and per - operative picture showing defects in the urinary bladder and diaphragm per - operative picture showing laparoscopic repair of ( a ) urinary bladder and ( b ) diaphragm urinothorax most commonly develops after obstructive uropathy with hydronephrosis or traumatic diaphragmatic disruption by blunt abdominal trauma . diaphragmatic injury is a marker of severity of trauma , but frequently overlooked . in our case , the mechanism involved is blow out type : as a result of a sudden increase in intra - abdominal pressure due to blunt abdominal injury with a full urinary bladder . physical examination and history play very little role in diagnostic accuracy in patients with multiple trauma , and injuries involving diaphragm or bladder can be easily missed without high index of suspicion . in patients with difficulty in voiding urine with or without hematuria , high reliability of cect scan in diagnosing diaphragmatic rupture and bladder rupture has been proved but has no role in haemodynamically unstable patient . meticulous inspection and proper visualisation of every part of the abdominal cavity have to be done , not to miss minor defects . the bladder injury usually occurs at its dome , giving the advantage of easy amenability for repair . in the past , the standard of care for bladder injury is laparotomy , considering the usual occurrence of associated other abdominal organ injuries . with the advancement of laparoscopic surgery , even in multiple trauma patients , laparoscopic repair of multiple abdominal organ injuries has become the appropriate first - line management in selected group of patients . in the literature , 21 cases have been reported so far for laparoscopic isolated bladder repair , but none with an associated diaphragmatic repair . the role of laparoscopy has been expanded from a mere diagnostic tool into playing a major therapeutic role . laparoscopic evaluation of the blunt abdominal trauma in selected cases is a rewarding procedure for both the patient and the doctor . being a wonderful diagnostic tool , it can double up as a treatment procedure as in our case . even in cases where laparotomy is inevitable , it may assist to plan the site and reduce the size of the incision . with increasing experience of the surgeon , it offers to accomplish surgical therapeutic goals with minimal somatic and psychological trauma . we recommend this technique should be used more frequently in selected patients with multiple organ injuries .

isolated diaphragmatic or urinary bladder injuries are uncommon , but rare are combination of these injuries . we report a rare case of urinothorax occurred as a result of combination injury of diaphragm and urinary bladder and our successful laparoscopic only management . a 26-year - old male presented with a history of trauma and features suggestive of bilateral pleural effusion . radiological investigations revealed diaphragmatic and urinary bladder rupture . laparoscopic examination of the abdomen confirmed the presence of ruptures and successful repair of both defects were done laparoscopically . high index of suspicion and early diagnosis are crucial for a better outcome in the management of diaphragmatic rupture . laparoscopic management is a feasible and successful method in trained hands .

regular physical activity can promote physical and psychological wellbeing and reduce risk of disability and vulnerability to chronic diseases in older adults [ 15 ] . nevertheless , adults over 50 years of age are the least physically active segment of the us adult population [ 68 ] . evidence - based exercise programs designed for older adults show promise as a way to increase opportunities for safe and effective physical activity . however , little is known about how well these programs , which were tested and evaluated using controlled trials , are translated for wider use in community settings . it is important to know if research - based programs will maintain their effectiveness when they are implemented in community settings . further , accurate interpretation of outcomes depends on knowing which aspects of the intervention were delivered and how faithful the delivery was to original program design . the healthy aging regional collaborative ( harc ) was established by the health foundation of south florida ( hfsf ) to increase the adoption of evidence - based programs that promote and preserve the health of older adults in south florida . among the programs selected was enhancefitness ( ef ) , which is an evidence - based group exercise program for older adults of all fitness levels [ 13 , 14 ] . intervention studies have documented the efficacy of ef and have shown that ef improves performance on fitness assessments , perceived physical functioning , social functioning , mental health , and decreases bodily pain [ 1518 ] . limited evidence exists demonstrating that ef can be translated to community - based settings and still achieve improvements in fitness and wellbeing . therefore , we investigated the ability of harc to implement and sustain the ef program in south florida over a three - year period . we examine if harc was able to retain program fidelity , recommended dosage and exposure to the program , and comparable gains in functional fitness . the healthy aging regional collaborative was created to increase local community capacity to offer accessible health promotion programs to older adults in south florida . harc was established by the hfsf and was designed to ( 1 ) disseminate evidence - based health promotion programs to address inactivity and chronic health conditions in older adults in south florida ; ( 2 ) establish a local group of trained professionals and lay leaders with the capacity to provide a range of evidence - based health promotion programs to older adults on an ongoing basis ; and ( 3 ) provide a foundation for planning , coordination , technical assistance , and peer learning for present and future collaborative members . community - based agencies that were interested in participating in harc had to apply to hfsf and received funding to offer evidence - based programs , including ef . funding covered licensing for use of the selected evidence - based program , instructor training , program implementation materials and equipment , and support for the administrative costs of implementation , including procurement of sites , instructors and participants , data collection , and data entry . funded agencies were responsible for delivering ef . agencies identified suitable sites to offer ef classes ( i.e. , churches , senior housing , senior centers , community centers , and parks ) as well as recruited program participants . a one - hour ef class includes a 5-minute warm - up , a 20-minute low impact aerobic workout , a 5-minute cooldown , a 20-minute strength training workout , and 10 minutes of stretching and is offered three times per week . instructors who were certified by a nationally recognized fitness organization ( i.e. , ymca , ace , or acsm ) and who received training in ef procedures at a two - day training conducted by ef program developers and ef master trainers led classes . all instructors were required to teach ef as outlined in ef training materials provided by the program developer . individuals over the age of 50 who were interested in participating in ef were enrolled by agencies as long as they were cognitively and physically able to participate in the ef program . multiple sources of data were collected to evaluate how well harc agencies were able to implement ef . descriptive / demographic data form , a health history , a fitness check ( fc ) , and program satisfaction survey were collected . participant data were collected at enrollment , with a second fc and the evaluation scheduled to be completed 16 weeks after enrollment as prescribed by the ef program . all staff who administered the forms and collected data were trained regarding the meaning and importance of the items and shown the correct way to administer the three functional tests included on the fc during ef training sessions . program managers submitted class registrations , new and ongoing participant data , and participant attendance records to harc 's evaluation team . program fidelity was monitored by trained observers who observed randomly selected classes and then completed a fidelity observation checklist aimed at identifying implementation issues . prior to receiving any data from agencies , harc 's evaluation team received approval from the institutional review board at florida international university to conduct the evaluation of harc . the number of agencies , sites , classes , and participants were tracked as measures of ef implementation . demographic characteristics of participants were self - identified on a form that included questions regarding gender , age , race and ethnicity , highest level of education , annual personal income , living situation ( alone or with others ) , marital status , and primary spoken language . effectiveness of the ef program was assessed based on changes in measures of functional fitness ( 30-second arm curl to assess upper extremity strength , the 30-second chair stand to measure lower extremity strength , and the timed eight - foot up - and - go circuit to measure balance and mobility ) , self - reported general health , and self - reported frequency ( days per week ) of exercise of at least 30-minute duration . additional measures included ( 1 ) the brfss general health measure , with a response scale from 1 = poor to 5 = excellent ; ( 2 ) self - reported number of days of exercise of at least 30-minute duration in a week , including ef sessions ; and ( 3 ) a single item on the second fc to measure the self - reported degree of improvement in physical abilities ( walking , bending , strength , moving around , and doing the activities you want to do ) as a result of ef program participation , reported on a 10-point scale where 1 is no improvement and 10 is great improvement . attendance records provided data regarding dose , average number of sessions attended by participants , and average duration of participant enrollment the annual survey of harc program coordinators served as a process evaluation tool and identified implementation issues that agencies in harc experienced . questions specific to implementing ef were included each year and only agencies who offered the ef program completed these items . items assessed ease of implementing the ef program , challenges with implementation , assessed participant recruitment activities , and also assessed long - term adoption and sustainability . observers were staff members of the evaluation team and were trained on program specifications through a detailed review of the instructor manual . as part of the training , observers would accompany an experienced observer and interrater reliability would be assessed . observers used a structured checklist that was based on the instructor manual and was developed by the evaluation team , ef master trainers , and harc member agencies . the checklist specified observable elements related to the class environment , instructor , duration , and site . discrepancies from the prescribed exercise routine were noted in a comment section . of the 4,490 enrolled participants , 1,146 received the dose of the intervention proposed by belza and colleagues ( figure 1 ) . exclusion criteria for the current study include ( 1 ) no data for the pretest , the posttest , or both ; ( 2 ) a first fc that did not fall within 30 days before and seven days after the first attendance date ( to assure that baseline data reflected actual abilities prior to any benefits received from attending ef sessions ) ; ( 3 ) a second fc completed before the recommended dose was attained ; and ( 4 ) more than six months between the first and second fitness checks . with these exclusions , the sample used to calculate data on participant satisfaction , self - reported improvement in physical abilities , participant characteristics , participant attendance metrics , and program manager survey and fidelity observation data were analyzed using descriptive statistics . to test specific hypotheses about program effectiveness , the general linear model ( glm ) was chosen to assess within - subject changes in outcome measures ( arm curls , chair stands , and 8-foot up - and - go ) at baseline and 6 weeks and controlled for potential differences in performance site . a total of 4,490 older adults enrolled and attended at least one ef session between october 1 , 2009 , and december 31 , 2012 . participant ages ranged from 29 to 107 , with a mean age of 74.8 years ( sd 9.9 ) . the racial / ethnic composition of participants was diverse , with non - hispanic whites and hispanics making up the two largest groups ( table 1 ) . the number of agencies , classes , sites , and participants , tracked in each of the first three years of the harc as measures of ef implementation , are shown in table 2 , by year . after an expected reduction of new participants in year 2 , the number of new participants increased in year 3 , but not to the year 1 level . at the end of the three - year period , nine agencies were funded and active , offering 70 ongoing ef classes at 56 sites ( table 2 ) . sixty - nine ef classes were observed for fidelity by the evaluation team between , accounting for nearly 33% of all ef classes offered during the time period . almost half of the observed classes , 47.8% , had no significant fidelity concerns in the measured dimensions . the most frequently cited concerns related to instructors not using key phrases developed to ensure participant safety , including checking if participants could see and hear the instructor ( 30% ) , and reminding participants not to do exercises their physician advised against ( 30% ) , not to do any exercises that were painful ( 16% ) , and to exercise at a pace that was comfortable ( 14% ) . additionally , 41% of observed sessions lasted less than 60 minutes ( figure 2 ) . of 4,490 participants enrolled in the harc ef program between october 1 , 2009 , and december 31 , 2012 , who attended at least one session , an average of 26% received the minimum recommended dose ( table 2 ) . the ratio of completers to new participants enrolled declined in each of the three years . three percent of enrolled participants attended only one session and 38% stopped attending within the initial 16 weeks . the average number of sessions attended per participant was 59 . in the year 1 program manager survey , six of seven program managers responsible for implementing ef reported that implementation was difficult or very difficult on a five - point scale from very easy to very difficult . in the year 2 and year 3 surveys , more than half of the program managers indicated that implementation was moderate , that is , half - way between very easy and very difficult on the measurement scale , showing that ease of implementation improved over time . implementation barriers most frequently cited over the three years remained relatively constant and included funding , inadequate staff , inadequate client interest , cultural norms of the community , and difficulty in recruiting class instructors . the most frequent barriers identified for recruiting participants included difficulty maintaining consistent participation and the seasonal residence of some participants in the south florida area . the most frequent barriers to instructor recruitment included availability for the three weekly one - hour sessions , finding individuals who were committed to the ef program , and lack of transportation . analysis revealed that participants who completed the recommended dose and received a posttest after participating in the program for four months significantly improved their scores on the three physical ability measures , self - reported general health , and frequency of daily exercise of at least 30-minute duration after participating in ef program ( table 3 ) . when asked on the second fc about improvements in physical abilities as a result of their ef participation , 71.5% of participants indicated improvement . among the 2,565 ef participants who completed a program evaluation , additionally , 97% responded that they would take the class again and 92% would recommend the class to a friend . the harc initiative described here is the largest scale translation of ef to a broad cross section of community agencies and settings within the same geographical area to date in the united states . data reported here suggest that harc was able to successfully implement ef throughout south florida and reach a large number of older adults over the three - year period . these findings indicate that this effort to form a collaborative , sharing resources , training , and knowledge , was an effective approach for translating an evidence - based program to a wide array of community settings and sites . unlike controlled trials of ef , data reported here are based on the real world implementation of ef in a variety of community settings throughout south florida . it was important to investigate if the community - based ef implementation produced participant changes similar to those reported in controlled ef efficacy studies . our findings are consistent with prior controlled studies of ef and other fitness programs [ 13 , 15 , 16 ] . participants in this study demonstrated statistically significant improvements in upper body strength , lower body strength , functional mobility , self - reported health status , and frequency of daily exercise of at least 30-minute duration over the follow - up period . as with any adoption of a health promotion program , the potential for changes and deviations in the curriculum is a concern . adaptation is a normal process , yet it can cause a program to be less effective if changes are made that undermine the program 's effectiveness . in our evaluation , we assessed fidelity to determine how accurately ef agencies and instructors implemented the program . the majority of observed concerns involved safety warnings that instructors are supposed to use throughout the class . a participant recruitment challenge relating to male participants existed . only about 15% of participants were male , while the percentage of males in the total population in the three targeted florida counties is much higher , at nearly 44% . this rate of male participation is similar to findings of other programs that serve older adults , although there is limited knowledge regarding why older men do not participate in health promotion programs [ 23 , 24 ] . there is a need for research that explores how to overcome male resistance to such participation . additionally , of the process issues identified , perhaps the most significant were frequency of attendance and attrition . there appears to be a problem with participants achieving the recommended dosage ( 32 ) sessions within a 16-week period that has been associated with functional fitness and mobility benefits . almost 41% of all ef participants in this region stopped attending within the initial 16-week period . moreover , for those who did continue through the initial 16 weeks and beyond , only 26% attended at least 32 sessions in the first 16 weeks . in both cases , participants did not receive the dose that has been suggested as being optimal to obtain all the benefits associated with exercise and strength training . subsequently , more research is warranted to better understand the elements that affect attendance patterns of older adults at ongoing exercise programs and to explore strategies that effectively address these attendance barriers . although findings show that ef can be effectively implemented by a collaborative in south florida and that participants can achieve benefits consistent with clinical trials if they participate regularly , this evaluation has certain limitations . as this was a community - based implementation and not a controlled research study , a randomized design could not be used . participants self - selected into the program , so they may not be representative of the larger older adult population in south florida . bias could also be an issue if functional test results reflect the impact of health - promoting activities that participants engaged in other than ef . a large number of participants did not have documented follow - up measures , which reduced data available for analysis of fitness test results . finally , functional test data are potentially subject to measurement bias because different instructors collected data on outcome measures . however , the rigorous training on data collection tools prior to being certified to teach an ef class , use of the same tool , and ongoing fidelity monitoring of instructors reduces the chances of measurement bias . even with these limitations , this study had strengths . the program was implemented by multiple agencies , and the diverse racial / ethnic mix of the south florida participants is likely different than demographic profiles found in previously described evaluations . many measures of implementation used indicated successful introduction of the programs and ongoing fidelity to program design . a longer - term retrospective study of sustained fidelity and the program 's impact on participant physical fitness , health status , frequency of exercise , and healthcare costs is needed to confirm that outcomes reported here endure over longer time periods . health promotion efforts targeting older adults are essential for improvement in quality of life , functional ability , and healthcare cost savings . harc 's innovative approach to rapid ef implementation on a wide scale shows that ef can be introduced in many different settings and delivered successfully . moreover , there is reason to believe that community - based ef programs have the potential to offer access to an evidence - based physical activity with proven health benefits to a large percentage of older adults in the community . however , efforts are needed to ensure that community - based agencies that offer ef reinforce the importance of continued attendance to ensure the most benefit to program participants and that implementers continue to assess implementation fidelity of the program to the original design tested in controlled trials .

introduction . this study aimed to examine how well an evidence - based physical activity program could be translated for wide scale dissemination and adoption to increase physical activity among community - dwelling older adults . methods . between october 2009 and december 2012 , reach , fidelity , dosage , ease of implementation , and barriers to translation of enhancefitness ( ef ) were assessed . to assess effectiveness , a pretest - posttest design was used to measure increases in functional fitness ( chair stands , arm curls , and the up - and - go test ) . results . fourteen community - based agencies offered 126 ef classes in 83 different locations and reached 4,490 older adults . most participants were female ( 72% ) . thirty - eight percent of participants did not complete the initial 16-week ef program . the 25% who received the recommended dose experienced an increase in upper and lower body strength and mobility . further , participants reported high satisfaction with the program . conclusion . ef was successfully implemented in a variety of settings throughout south florida and reached a large number of older adults . however , challenges were encountered in ensuring that those who participated received a program dose that would lead to beneficial gains in functional fitness .

systemic lupus erythematosus ( sle ) is a multisystem autoimmune disease characterized by periods of clinical quiescence punctuated by acute disease flares . a five - year population - based study highlighted the striking disease excess among women of african descent , with crude incidence rates ( per 100,000 ) of 0.4 for white males , 3.5 for white females , 0.7 for african - american males , and 9.2 for african - american females . mortality rates follow a similar pattern , with several studies indicating higher rates of lupus deaths among black women compared to their caucasian counterparts [ 25 ] . some of the regions with the highest disease burden and mortality rates are also the least equipped to diagnose and manage the disease . barbados , a caribbean nation with a population of 288,000 persons , 93% of african origin , has one of the highest documented incidence rates of sle among women ( 12.21 per 100,000 person - years ; 95% ci 10.4614.18 ) . similar to the experience of african - americans , sle in barbadian patients has been reported to run a clinically aggressive course , with a 5-year survival rate of 79.9% ( 95% ci 69.687.1 ) . in this barbados cohort , 47 percent of patients developed lupus nephritis , which reduced survival in this subpopulation to 68% ( 95% ci 5180 ) . despite the documented clinical impact of lupus in barbados , routine monitoring using internationally accepted disease activity indices such as the systemic lupus erythematosus disease activity index ( sledai ) is not feasible for most patients , as two principal markers of disease activity , the complement levels and anti - dsdna titres , are not routinely available . recommendations for sle management developed by the european league against rheumatism ( eular ) and the american college of rheumatology ( acr ) focus on international best practice . however , the financial resources and available infrastructure in many countries do not allow for these guidelines to be achieved in practice [ 8 , 9 ] . a report of an international symposium at the 9th international congress on sle in 2010 highlighted the disparities in the management of sle worldwide and sought to establish a consensus on the minimum best practice guidelines which may be employed in resource - poor clinical settings . the systemic lupus activity questionnaire ( slaq ) was considered a suitable screening tool which could guide the more in - depth assessment by the clinician . the slaq is a self - administered questionnaire which has been developed to monitor disease activity in populations with financial constraints and has been compared to the systemic lupus activity measure ( slam ) with promising results . this contrasts with its reported poor correlation with the sledai and with the physician global assessment ( pga ) which is considered the best evaluation of disease activity . differing statistical methods used in previous questionnaire comparisons and the structural differences between questionnaires ( slaq and sledai , for example , use different patient recall times ) hamper the ability to compare studies . in view of the possible application of the slaq , but its varying agreement with the other instruments , our aim was to assess the ability of the slaq to measure disease activity compared to the sledai and the pga , utilizing a single statistical measures of agreement and providing a simple sensitivity analysis of agreement by standardizing questionnaire items and questionnaire recall time . ethical approval was obtained from the ministry of health / university of the west indies ethics review board and the queen elizabeth hospital ethics committee . the barbados lupus registry was established in 2007 . in december 2009 , there were 226 persons alive with definite sle ( acr 4 criteria ) of whom 98% were of black ancestry and the majority ( 94% ) were female . the 32 participants involved in this pilot were a convenience sample from this cohort selected for a companion investigation . each participant completed the slaq , and a thorough systematic examination including administration of the sledai was performed by the study rheumatologist . the slaq is a self - reporting tool that assesses the presence and severity of twenty - four clinical indices over the previous three months . it carries a weighting regime identical to the slam with 0 points awarded for absent disease , 1 for mild , 2 for moderate , and 3 for severe disease , yielding a range from 044 points . in addition , there is a single question assessing the presence and severity of lupus activity with a score ranging from 0 ( no flare ) to 3 ( severe flare ) and a single numerical rating of disease activity from 0 ( no activity ) to 10 ( most activity ) . the sledai is a physician - administered instrument accounting for the preceding 10 days . the weight which has been applied to each index gives this tool a range of 0105 points . all participants in this study completed the full sledai including the dsdna titres and the complement 3 levels . there are considerable similarities between the slaq and sledai with 15 of the 24 slaq and 12 of the 24 indices of sledai overlapping . these were ( sledai descriptor / slaq question ) seizure / seizure , organic brain syndrome / forgetfulness , lupus headache / unusual headaches , cva / stroke , vasculitis / white fingers or toes in cold , arthritis / joint pain or swelling or stiffness , myositis / muscle pain or weakness , new rash / other rash , alopecia / bald patches on scalp , mucosal ulcers / rash in mouth or nose , pleurisy / shortness of breath or chest pain on deep breathing , and fever / fever ( table 1 ) . it is a composite of disease activity tools , other clinical or laboratory markers not included within the tools , and the physician 's knowledge of the patient disease history . it carries the score of 0 for no disease , 1 for mild disease , 2 for moderate disease , and 3 for severe disease . agreement between slaq and sledai was assessed using the concordance coefficient for approximately continuous scores ( slaq score , sledai scores ) or using kendall 's w agreement for ordinal scores ( pga , slaq flare ) . agreement was assessed under various data restrictions , each designed to increase the clinical comparability of the two tools . then , in a simple sensitivity analysis , agreement was further assessed ( a ) using only indices that were included in both slaq and sledai this reduced each tool to 12-items and ( b ) analyzing responses from participants exhibiting symptoms within the sledai 10-day participant recall window . agreement was also assessed between the slaq flare rating ( i.e , the single question assessing the presence and severity of lupus activity ) and the pga . fifty - nine percent of the 32 participants reported disease activity using the original slaq , compared to 78% identified by the sledai . based on the matched item scale , only 22% of participants reported activity with the sledai whereas the slaq result did not change ( 59% ) . concordance between the original activity scores was 0.62 ( 95% ci : 0.42 to 0.81 ) ( figure 1(a ) ) . restricting the tools to common items increased the concordance to 0.70 ( 0.57 to 0.83 ) ( figure 1(b ) ) . reanalysis with the removal of the scores from these 2 patients further increased the agreement between the slaq and sledai instruments to 0.72 ( 0.59 to 0.84 ) ( figure 1(c ) ) . agreement between the slaq flare rating and the physician global assessment was 0.56 ( 0.32 to 0.80 ) . the sledai is widely accepted as a tool for monitoring sle activity both in clinical practice and in research . however , the sledai includes laboratory measures not routinely available in resource - constrained settings as experienced in barbados , and therefore , the resulting clinical assessments are often incomplete . the slaq is a self - administered questionnaire that is inexpensive but gives variable results when compared to other instruments measuring lupus activity . firstly , although both tools monitor lupus activity , they assess different disease domains and are therefore not expected to be in total agreement . for example , psychosis , visual disturbance , cranial nerve disorder , pericarditis , and laboratory markers are assessed by sledai but not by slaq , whereas weight loss , fatigue , malar rash , lymphadenopathy , and photosensitivity are assessed by slaq and not by sledai . to partly overcome this , an altered questionnaire which mapped only indices common to both was used ( table 1 ) . the sledai takes into account the previous 10 days whereas the slaq covers a 3-month period . two participants experienced flares between the 10-day and 3-month window ( measured by the slaq but not the sledai ) . exclusion of the scores of these 2 patients resulted in better agreement between the scores of the slaq and the sledai ( figure 1(c ) ) . in spite of the usefulness of the disease activity measures , the pga is still considered the best assessment of disease activity . concordance between the slaq flare rating and the pga was 0.56 ( 0.32 to 0.80 ) , significantly lower than the slaq - sledai scores concordance of 0.72 ( 0.59 to 0.84 ) , indicating that a collection of multiple indices is more accurate than a single self - reported measure of disease activity over the previous three months . fifty - nine percent of participants reported disease activity with the slaq compared to 78% identified by the sledai . this seemed to dispel the notion that the subjective nature of slaq leads to the over - reporting of symptoms ; however , this difference could be attributed to the disparity in reporting laboratory indices . laboratory indices are only assessed by the sledai , and it is reasonable to expect that more indicators of disease would be identified by this method . to adjust for the inequity in the indices being assessed , we investigated these summary measures using the matched item scale . however , the proportion reporting disease activity now decreased to 22% ( from 78% ) with the reduced item sledai . this indicated two things ; firstly , it highlighted the inadequacy of disease activity indices that do not include laboratory measures ; in this case , there was a 56% point reduction in the disease markers identified . all cases of proteinuria , which is critical to diagnosis of nephritis which affects nearly half of barbadian patients , would have been missed . the mandatory inclusion of basic laboratory measures , for example , full blood count and urinalysis in the monitoring of sle suggested during the 9th international congress on sle in 2010 , was aimed at rectifying this gap . secondly , it underscored the difference in outcome between physician - rated and patient - reported conclusions , even when matched clinical indices are being compared . in this pilot , more disease activity was recounted with the slaq suggesting that its subjective nature might lead to over - reporting by patients who do the reporting . with the support of the barbados lupus cohort , we intend to examine these potential deficiencies in a longitudinal comparison of the slaq and sledai questionnaires , where both tools will be administered to participants at predetermined intervals . this follow - up study will allow for further investigations to identify particular domains of the slaq which promote over - reporting . with the additional statistical power in this longitudinal investigation , we will examine the agreement of individual matched questionnaire items from slaq and sledai . those slaq indices that exhibit low agreement with the matched sledai indices would be flagged for deletion or substitution . construction of this tool is even more relevant now with the thrust towards the treat - to - target initiative , which has proven to be beneficial in the management of rheumatoid arthritis [ 13 , 14 ] . using this method , clinical targets for each follow - up time - point is established , and at the time of follow - up , therapy is adjusted based on the realisation ( or not ) of the predefined disease activity goal . measuring the identified target the current slaq is inadequate as a disease monitoring tool because of its lack of laboratory measurements and its patient - based subjective reporting which might lead to inadvertent over - reporting of symptoms . this leaves us still in need of a sle disease monitoring tool which is accessible to resource - limited populations . the aim of our future study is to transform the current slaq into a clinically relevant but accessible tool by adding basic , cheap laboratory measurements and reducing over - reporting of symptoms .

in barbados , use of the systemic lupus erythematosus ( sle ) disease activity index ( sledai ) is limited by the unavailability of serologic markers . the sle activity questionnaire ( slaq ) excludes laboratory measurements and is therefore more accessible . here , we investigate the agreement between the slaq , the sledai , and the physician global assessment ( pga ) . a pilot of 32 participants completed the slaq and sledai . the tools were compared ( 1 ) in their original format , ( 2 ) limited to common indices , and ( 3 ) limited to the same patient recall period . we compared the proportions of persons reporting disease activity and the concordance between calculated activity scores for slaq versus sledai and for slaq versus pga . seventy - eight percent versus 59% of participants reported disease activity with the original sledai versus slaq , respectively . the relationship was reversed to 22% versus 59% when the matched item tools were compared . concordance was 0.62 ( 95% ci 0.420.81 ) between the original scores , 0.70 ( 0.570.83 ) when restricted by matched items , and 0.72 ( 0.590.84 ) when further restricted by recall period . concordance between the slaq and pga was 0.56 ( 0.320.80 ) . reversal of the disease activity percentage in the matched items comparison highlights the inadequacy of tools that exclude laboratory measurements and suggests that the subjective nature of slaq may contribute to over - reporting . further work is needed to produce a robust disease activity tool apt for resource - constrained environments .

the binding of aflatoxin b1 , afb1 , a potent hepatocarcinogen , to various high molecular weight ( hmw ) dnas from human normal liver and two liver cancer cell lines , alexander primary liver carcinoma ( plc ) and mahlavu hepatocellular carcinoma ( hhc ) and from nih/3t3 cell have been investigated . the kinetics of afb1 binding to these dnas showed similar initial rates but the extents of binding to the plc and hhc dnas seemed to be slightly higher . preferential afb1 bindings were identified in both plc and hhc dnas compared to normal liver dna when analyzed by restriction endonuclease digestions and agarose gel electrophoresis . a critical afb1 binding dosage , ranging 100 to 460 fmole / microgram dna , was found to activate the carcinogenic effect of the mahlavu hhc hmw dna , but not normal liver hmw dna , rendering it capable of inducing focal transformation in nih/3t3 cell . excessive afb1 binding on the hhc and plc hmw dnas resulted in an " over - kill " of both cell transformation capability and templating activity of the dna.imagesfigure 4.figure 5 .

several factors influence the color stability of contemporary lightactivated materials , such as the photoinitiator system , the resin matrix , the light - curing unit used for polymerization , and the irradiation times . the phenomena of sorption and solubility may serve as precursors to a variety of chemical and physical processes that create biological concerns as well as produce deleterious effects on the structure and function of a resin matrix . these effects include swelling , plasticization and softening , oxidation and hydrolysis . as a consequence , there is a decrease of the color stability , promoting higher susceptibility to staining . thus , for suitable performance , longevity and good clinical success of esthetic restorations , the material of choice should present adequate intrinsic characteristics that are specific for each procedure and also that its polymerization is ideal , with this aspect directly related to the light - curing units and their use . some light - emitting diode ( led ) light - curing units show a similar performance to quartztungsten- halogen curing units , while others seems to be less efficient . these properties included depth of cure ( doc ) , compressive strength , flexural strength , hardness , and degree of polymerization or double - bond conversion . however , some researchers have reported lower hardness or lesser degree of double - bond conversion in resin - based composites polymerized using some led curing units and this was attributed to low power density of 1 generation . for 2 and 3 generation of leds , these properties were similar to that obtained by the halogen curing units . color maintenance throughout the functional lifetime of restorations is important for the durability of a treatment . composite resin discoloration is multifactorial , including factors such as intrinsic discoloration and extrinsic staining . nevertheless , a correlation is established between color stability and conversion rate , with incomplete polymerized composite resins showing reduced mechanical properties and greater discoloration susceptibility . many studies have shown certain beverages and foods affecting the esthetics as well as the physical properties ( microhardness , surface roughness ) of composite resins , undermining the quality and longevity of restorations . it may cause a reduction of knoop microhardness in composite resin after coffee consumption , which suggests that prolonged immersion in a high - temperature solution may lead to significant alterations in certain properties of the composites . accordingly , this study investigated the performance of led technology in comparison to halogen curing units for the photoactivation of an esthetic restorative material regarding its color stability after immersion in different media . little research is available on the influence of this type of light source on color stability of composite resins when exposed to different media and immersion time . the factors under study were : light sources , at three levels ( conventional halogen unit , high - power - density halogen unit and led ) and immersion media at four levels ( coffee , tea , coke and artificial saliva ) . the association between light sources and solutions resulted in 12 groups with 15 specimens each , totalizing 180 specimens . the specimens had their color stability and luminosity evaluated at eight immersion times ( t0 - 24 h of immersion in artificial saliva , t1 - after 24 h of immersion in different media ; t2 - after 48 h ; t3 - after 7 days ; t4 - after 14 days ; t5 - after 21 days ; t6 - after 30 days and t7 - after 60 days ) . the quantitative response variable was the color change values ( e ) and luminosity values ( l ) , from ciela*b * system . a nanofilled composite resin was used ( filtek supreme xt ; 3m / espe , st . paul , mn , usa ; shade b1e ) ( figure 1 ) , and the light - curing units selected for the study are presented in figure 2 . composite resin characteristics description of tested light curing units the composite resin specimens were randomly subdivided into 4 groups : the control group was maintained in artificial saliva and the three experimental groups were submitted to cycling in selected beverages ( figure 3 ) . the specimens were kept immersed in artificial saliva at 37c1c in the interval between cycles . the drinks were used in their usual temperature of consumption , i.e. , coke 10c , tea 70c , and coffee 70c . one hundred and eighty samples were prepared using a 10-mm diameter x 2-mm thick stainless steel mold placed on a glass plate with a transparent polyester strip . these samples were prepared by inserting the composite resin into the mold cavity . to compact and remove the excess material from the sample surfaces , the mold containing the resin was covered with another polyester strip and a glass plate placed on top of it with a 1 kg weight for 30 s. next , the weight and the glass plate were removed and the composite resin was light - cured with one of the light curing units selected from the polymer strip for 40 s , and then , the resin specimen was removed from the matrix . there was no polishing on the specimen surface because most of the superficial smoothness was obtained with the polyester strip . it is important to emphasize that the light tip of curing units had compatible size with the specimens ' diameter to obtain complete polymerization of composite resin . the color of the specimens was analyzed with a portable colorimetric spectrophotometer ( color guide 45/0 , pcb 6807 byk - gardner gmbh gerestsried , germany ) using an optical geometry of 45/0. the color was evaluated according to the color system ciela*b * , in which l indicates color luminosity ( ranging from 0 to 100 , that means black to white ) ; a * determines the amount of red ( positive values ) and green ( negative values ) ; b * determines the amount of yellow ( positive values ) and blue ( negative values ) . color change was obtained through hunter equation eab*=[(l * ) + ( a * ) + ( b * ) ] , while luminosity values ( l * ) , were reached using l*=l*(tx)-l*(t0 ) , where ( tx ) represents immersion time and ( t0 ) baseline . the literature is not in agreement with respect to the limitations of the human eye in terms of acknowledging differences in color , considering that this limit differs from individual to individual . the adopted classification of e values was determined by the national bureau of standards ( nbs ) that considers : 0.0 to 0.5 values : extremely slight change ; 0.5 to 1.5 : slight change ; 1.5 to 3.0 : perceivable change ; 3.0 to 6.0 : marked change ; 6.0 to 12.0 : extremely marked change ; 12.0 or more : change to another color . to determine the statistical method to analyze the data concerning the color and light change , the normal curve adherence test was performed to verify the sample distribution regarding its normality . as data distribution was not normal , the non - parametric kruskal - wallis test was used for comparison of the light source factors and immersion media . regarding the immersion time , each subgroup was analyzed separately according to the immersion media to study the color variation with time . as data distribution was normal and homoscedastic , two - way anova ( immersion medium and immersion time , with 1 linked factor ) , and fisher 's exact test were used . table 1 shows the mean standard errors of the color ( e ) and light ( l ) change of the specimens , according to the light sources . mean and standard error for color and light changes depending on the light sources e - gl=2 ; h=6.343928 ; p=0.041920 l - gl=2 ; h=8.291655 ; p=0.015830 similar letters indicate vertical statistical similarity ( column ) . considering the light source factor alone , table 1 shows that there was a statistically significant difference between the light - curing units , with ultralume led 5 showing less color change ( e ) when compared to the xl3000 , and similar to jet lite 4000 plus ( j morita corporation , tarumi - cho suita city , osaka , japan ) , with the last two similar to each other ( p<0.05 ) . regarding the light sources , the light - curing units ultralume led 5 and xl 3000 ( 3m / espe , st . paul , mn , usa ) showed less change when compared to jet lite plus 4000 , which had a negative value of l . table 2 shows the means and standard errors of color ( e ) and light ( l ) change analyzed by the different immersion media . mean and standard error for color and light changes according to the immersion media e - gl=3 ; h=423.0867 ; p=0.000000 l - gl=3 ; h=475.5569 ; p=0.000000 similar letters indicate vertical statistical similarity ( column ) . considering only the immersion media , there was influence of the medium in the color change of the material . the color change ( e ) results showed that the coke medium was the one that least affected the composite resin color , indicating a statistically different mean value , and lower than the other mediums . the artificial saliva and tea showed intermediate color change values , which were statistically similar to each other and different from the coffee values , which showed the highest e value . regarding the light change in the material , all elements were statistically different , with coffee promoting the greatest change of these optical properties , with negative l followed by tea media , while for the saliva and coke , the specimens showed positive values of l . the interaction of the factors time x immersion medium on the color and light change of the composite resin are shown in table 3 . distribution of means and standard deviations ( sd ) of color change ( e ) and light ( l ) of the studied composite resin as a function of the time x immersion medium interaction similar letters indicate vertical statistical similarity ( column ) there were statistically significant differences between the e values in the time comparison of 24 h and 60 days of immersion for all studied media ( table 2 ) . note that this assessment was performed intragroup and not intergroup . among the media tested , coke showed the lowest values of e as a function of time and coffee presented the highest values . regarding the light change , table 3 shows that , in general , comparing the initial ( 24 h ) and the final ( 60 days ) l values , only coke did not present a statistically significant difference of that property over time . it is also important to emphasize that of the four studied media , the one that showed the lowest values of l was coke , followed by tea , while coffee was the one that showed the highest changes . regarding the artificial saliva , it was observed that by the 14 day of immersion , the values of e were statistically similar . the highest changes were observed after 21 days , showing a statistically significant difference when compared to the 60 day . regarding light , little change was observed up to 21 days , increasing at times of 30 and 60 days of immersion . the e values of coffee were similar up to 48 h of immersion , and presented a statistically significant difference between 48 h and 7 days , 7 and 14 days , 21 and 30 days , and 30 and 60 days . similar e values of tea were found between 24 and 48 h and 48 h to 14 days . the immersion times of 21 , 30 and 60 days showed different e values among themselves and also different when compared to the previous time frames . also , there were similar light values up to 21 days of immersion , but for times of 30 and 60 days , these values increased significantly . for coke , there was a statistically significant difference in color change ( e ) only at the end of experiment ( 60 days of immersion ) , while for light , there was little change observed at the time of 21 days , with the other times remained similar to each other . composite resins are restorative materials that have been widely adopted for esthetic procedures due to their excellent properties and power of union to enamel and dentin . however , one of their disadvantages is the color change with time , which is a major reason for replacing restorations . there are many extrinsic and intrinsic factors that influence color stability of composite resins . in this study , the light source and immersion medium were analyzed as influential factors to optical alterations of a resin . it is known that the efficiency of polymerization may influence discoloration , since the higher degree of conversion , the smaller the amount of residual monomers available to form colored degraded products . observing light sources as an isolated factor , it was noted that this might cause color alteration to the studied composite resin . the led unit showed the lowest color alteration ( e=1.91 ) when compared to qth units ( xl3000 - e=2.28 and jet lite - e=2.05 ) . this probably occurred because the light source interfered with the effectiveness of the polymeric conversion , because the quality of the polymerization reaction associated to the composition of the resin matrix and the degree of conversion of the photoinitiator are the elements responsible for the aesthetic restorative materials ' color stability . results of this study were similar to those found by pires - de - souza , et al . ( 2007 ) , who found that the tested led equipment also showed lower color changes for a hybrid resin , when compared to a conventional halogen unit . nevertheless , a research showed no statistically significant difference in the color change results when the different types of light sources were compared . ( 2007 ) observed chemical changes in the resinous matrix of the resins polymerized by led , which produced more staining of the composite when that device was compared to the halogen light source . although the technology of led curing units has been widely studied , there are few studies in literature comparing the influence of this light source and and halogen lamps on the color stability of composite resins . this fact contributes to the lack of consensus about the equipment that produces the best results . in this study , it is believed that the advantage of led over conventional halogen lamp was because we used a high - power density led unit ( 790 mw / cm ) , which according to bala , lmez and kalayci ( 2005 ) promotes a higher degree of monomer conversion and hence better results . in the aforementioned works , low and mean power density led sources ( 130 - 175 mw / cm and 285 mw / cm , respectively ) were used . another important factor is that led has more spectral purity than the conventional one , as it has a narrow band of light emission with a wavelength between 450 and 490 nm , with peak emission at 470 nm , and this is the coincident blue light band with the absorption spectrum of most of the photoinitiators included in the composite resins , which allows full use of the light emitting diodes . moreover , the process of obtaining light energy and its use by leds is greater than that of the halogen lamp , given that this can only convert 1% of the total energy produced into light , while the rest is dissipated in the form of heat , which can cause adverse thermal effects . besides the color change , the light source also affected the light change of the resin studied , drawing attention to the negative value for jet lite ( l=-0.23 ) . as jet lite is a high - power halogen light device ( greater power than ultralume 5 and xl3000 ) , during the accelerated curing , it can promote the formation of polymer chains with lower molecular weight and residual monomers and , consequently , partial polymerization of the material , with part of the photoinitiator remaining idle . camphoroquinone , which is the photoinitiator of filtek supreme , has a yellow coloring and its color changes when photoactivated , thus becoming " transparent " . however , when the irradiation is not sufficient , a small amount of camphoroquinone remains inactive , causing a residual yellow in the final color of the composite resin , which may give a darker color to the material and this could be one of the factors that might have interfered in the composite resin light when photoactivated by the unit . therefore , the light source is an important factor to be taken into account when an esthetic restoration is performed with composite resin . nevertheless , this is not the only factor that influences the color stability of this material , taking into account other aspects , such as the means of imersion . additional polymerization is not efficient for all materials and can be compensated by cross - linking reactions extending for 1 week after initial photoactivation . in this case , in general only coffee surpassed the clinical acceptable limit , considering this an extremely perceptive change , while the other immersion media promoted slightly perceptible changes ( saliva and tea ) or imperceptible changes ( coke ) . comparing the results of this work with those of patel , et al . ( 2004 ) , the values of e found for the specimens immersed in coffee were higher , however , those subjected to coke , were similar . ( 2006 ) , comparing the immersion of the composite resin filtek supreme in various media ( coffee , tea , red wine , coke and water ) , found that both water and coke showed a mild color change , while tea , coffee and wine had greater influence on the staining of this material . ( 2009 ) observed that after 1 week of immersion in coffee , yerba mate or water , specimens did not show significant differences for e values from the baseline , but the group immersed in grape juice presented significant color change on the nanofill composite resin studied . ( 2010 ) observed that among various children 's drinks in contact with microhybrid composites , cola drink was able to promote the highest color change compared with grape juice , chocolate milk and distilled water . according to this study , the artificial saliva also promoted a slight color change in the specimens ( e=1.73 ) , classified as slightly perceptible . ( 2006 ) , when comparing the color change of composite resin specimens immersed in distilled water and artificial saliva , which observed that the distilled water group did not undergo any color change , while the artificial saliva did . besides the light source and immersion medium , another factor to be considered in the color stability of the composite resin is the immersion time . however , the analysis of immersion time alone showed that the most pronounced color change occurred after 30 days and not in the initial hours . this finding disagrees with those of a previous work , which showed that the composite resins evaluated underwent greater staining in the first 24 h and 7 days . this discrepancy can be attributed to the difference among the methodologies . in all studies cited in this work , however , in his work , as well as that performed by garcia , et al . ( 2008 ) , a clinical situation was simulated and accordingly the sample specimens were immersed in their immersion media for 15 min daily . analyzing the interaction between the factors in this work ( light source and immersion medium ) and time , it can be observed that the immersion medium was the one that influenced the color change of the composite resin . for coffee , there was a color change in the resin since the first 24 h of immersion , similar to that observed by yazici , et al . this change progressed at each evaluation period until reaching the value of e=17.49 after 60 days , which , according to the classification issued by the national bureau of standards - nbs , means changing to another color . although there was also a significant color change in the specimens immersed in tea , they underwent minor color change until 30 days and only changed in the period from 30 days to 60 days of immersion , when the e ranged from 4.95 to 10.19 . ( 2007 ) observed the same behavior for tea . regarding the time of immersion , the artificial saliva also influenced significantly the color stability of the composite resin ( e24h=1.22 ; e60days = 9.25 ) . in contrast , coke was the medium that had the lowest influence on the color stability of the composite resin ( e24h=1.34 ; e60days=2.66 ) . according to soares , et al . ( 2006 ) , the staining capacity of the composite resin is related to extrinsic factors , such as the pigment agent is subjected to , and to intrinsic factors , such as loading particles and resinous matrix . in this study , the extrinsic factors related to color change were observed . however , the intrinsic factors can not be left aside , since a recently developed composite resin was used . ( 2009 ) has shown that the effect of the staining solutions might be different for distinct materials and found that a nanofilled composite resin ( filtek supreme ) had the least discoloration among other tested composite materials ( filtek z250 , charisma and quadrant ) . the structure of the composite resin and the characteristics of its particles have a direct impact on its surface smoothness and its susceptibility to staining by external agents . in this work , the composite resin filtek supreme was studied , which is a nanocomposite containing primary silica particles of 20 nm and silica / zirconia nanoagglomerates with size ranging from 0.6 m to 1.4 m . their resinous matrix is composed of bis - gma , udma , bis - ema and tegdma . the cluster of particles - nanoclusters - found in filtek supreme , seems to produce less resistance to color change than the micrometric particles of silicazirconia found in microhybrid resins , and this can provide a high susceptibility feature to the water absorption of the studied resin . udma is more resistant to staining than the bis - gma due to its low sorption and water solubility characteristics . in the microhybrid resin system , in addition to these , there is still a small amount of tegdma , hydrophilic monomer , mixed with the udma and bis - ema , promoting a hydrophobicity characteristic to the composite resin . filtek supreme has the same resinous matrix formulation as filtek z250 and p60 ( both microhybrids ) , but has a greater amount of tegdma , which only bis - gma mixed in it . according to ertas , et al . ( 2006 ) , this seems to be the factor responsible for its high water absorption and greater susceptibility to staining . although in this work filtek supreme was not compared to other types of composite resin , the hypothesis can be raised that the high staining caused by coffee , tea and artificial saliva may have also occurred due to the aforementioned characteristics of this new resin . thus , although the nanoparticled composite resins were developed to improve the physical and optical properties of the composite , there are still few studies in this regard , hence suggesting that their performance should be further and better studied . this in vitro study provided information on the color stability of a direct esthetic restorative material when photopolymerized by different light sources and subjected to immersion in various media . the obtained results are intended to help professionals working with esthetic dentistry in order to alert them of the need to choose the most favorable light source for each type of restorative material and patient , taking into account their eating habits and consumption of beverages containing dyes . a future research could be developed with an in vivo sample to simulate clinical reality . based on the employed methodology and the obtained results , it may be concluded that : there was no significant difference between light sources on promoting changes of color stability of the composite resin ; coffee was the tested immersion medium that had the most influence on color stability of the composite resin , followed by tea ; the immersion time gradually influenced the color stability of the composite resin up to 30 days of immersion , with the highest activity observed in the 30 to 60 day period .

objectivethis study evaluated the influence of light sources and immersion media on the color stability of a nanofilled composite resin.material and methodsconventional halogen , high - power - density halogen and high - power - density light - emitting diode ( led ) units were used . there were 4 immersion media : coffee , tea , coke and artificial saliva . a total of 180 specimens ( 10 mm x 2 mm ) were prepared , immersed in artificial saliva for 24 h at 371c , and had their initial color measured with a spectrophotometer according to the cielab system . then , the specimens were immersed in the 4 media during 60 days . data from the color change and luminosity were collected and subjected to statistical analysis by the kruskall - wallis test ( p<0.05 ) . for immersion time , the data were subjected to two - way anova test and fisher 's test ( p<0.05).resultshigh - power - density led ( e=1.91 ) promoted similar color stability of the composite resin to that of the tested halogen curing units ( jet lite 4000 plus - e=2.05 ; xl 3000 - e=2.28 ) . coffee ( e=8.40 ; l=-5.21 ) showed the highest influence on color stability of the studied composite resin.conclusionthere was no significant difference in color stability regardless of the light sources , and coffee was the immersion medium that promoted the highest color changes on the tested composite resin .

scoliosis is a three dimensional deformation resulting from axial rotation of the vertebrae and is defined as a lateral spinal curvature with a cobb angle of 10 degrees or more1 . scoliosis is classified into an infantile type that appears before the age of 3 , a juvenile type that appears at ages between 3 and 10 , an adolescent type from the age of 10 when the musculoskeletal system growth is almost complete , and an adult type after the musculoskeletal system growth has been completed . about 80% of scoliosis is idiopathic , and the incidence rate of idiopathic scoliosis is increasing in adolescents across the world2 . idiopathic scoliosis is a progressive growth disease that severely affects the anatomical structure of the spine , range of motion , and left and right asymmetry3 . this condition is observed much in adolescence when the growth of the musculoskeletal system is more vigorous than that of the muscle growth , and genetic factors , collagen metabolism , and abnormality in the vestibular system , and imbalance and weakening of the muscles aggravate its symptoms4 . guo et al.5 noted that idiopathic scoliosis patients in their adolescence exhibit balance and gait characteristics different from those of healthy subjects and this should be considered in the initial diagnosis of scoliosis patients ; if a precise clinical examination of the characteristics of idiopathic scoliosis is made and subject are appropriately educated , about precautions to take in their daily lives , great advances could be made in the prevention and treatment of scoliosis . accordingly , this study aimed to clearly understand the effects of idiopathic scoliosis on the body s balance ability to provide basic evidentiary material for the optimal growth and development of adolescents by comparing degrees of idiopathic scoliosis and postural balance of adolescents . the subjects of this study were 128 adolescents who were diagnosed with scoliosis on x - ray by orthopedists among those who visited b hospital located in s region . the subjects were divided into a 10 to 19 degree group , 20 to 29 degree group , and 30 degree and over group according to the degree of scoliosis . for comparison , 15 normal adolescents without orthopedic injury within the past 6 months were selected as a control group . the subjects were divided into four groups : group i had a cobb angle between 10 and 20 degrees , group ii had a cobb angle between 20 and 30 degrees , and group iii had a cobb of 40 degrees or higher , and the normal group . the normal group ( ng ) group ( n=15 ) was 14.70 1.70 years old in age , had a height of 1.600.06 cm , a weight of 65.2010.37 kg , a bmi of 22.82.69 , and a cobb angle of 1.00.11 degrees . the i group was 15.501.78 years old in age , had a height of 1.600.06 cm , a weight of 51.209.12 kg , a bmi of 19.32.61 , and a cobb angle of 13.72.63 degrees . the ii group was 15.101.64 years old in age , had a height of 1.600.06 cm , a weight of 47.308.11 kg , a bmi of 18.302.85 , and a cobb angle of 23.93.23 degrees . the iii group was 15.501.85 years old in age , had a height of 1.600.07 cm , had a weight of 50.08.54 kg , a bmi of 19.02.44 , and a cobb angle of 36.405.79 degrees . a dk2 525r ( dongkang medical : korea ) was used to measure the cobb and a multifunktional traininggeraete device ( mft , germany ) was used of the spine balance . one line was drawn to the spinal upper end of the upper part and the other line was drawn to the lower end . lines were drawn from each line at right angles and the angle of their intersection was measured as the degree of scoliosis6 . the mft balance tester ( mft balance test - basic , multifunktionale trainsgerate , germany ) consists of a force plate and a visual target program . the subjects balance abilities were measured twice , the adaptation stage and actual measurement , in the forward , backward , left , and right directions according to the measurement protocol . in order to measure balance ability without shoes , the target of the balance ability test is a circle which is divided into sections 1 , 2 , 3 , 4 , and 5 from the center . the subjects were encouraged to locate their center of gravity at the center of the target , and the areas where the center is located during 30 seconds are calculated as percentages of the whole . left and right balance and forward and backward balance were derived from the absolute values by subtracting the rate of the opposite direction from the rate of the selected direction , and dynamic balance was calculated using a right - angled triangle that drawn by locating the absolute value of left and right balance to the x - axis , and the absolute value of the forward and backward balance to the y - axis , on a two - dimensional plane and connecting the two points . one - way variance of analysis was conducted in order to examine differences among the four groups in left and right balance , forward and backward balance , and overall postural balance . when there were differences , they were compared in detail using duncan s post - hoc test . all the participants understood the purpose of this study and provided their written informed consent prior to their participation in the study in accordance with the ethical standards of the declaration of helsinki . comparison of bmi between the groupsnogroupmsd ( kg / m)1ng ( n=15)22.83 2.692gi ( n=57)19.31 2.613gii ( n=34)18.33 2.854giii ( n=37)19.02 2.44ng : normal group ( cobb angle below 10 ) . giii : group iii ( cobb angle above 30 ) , differences in body mass index ( bmi ) between the groups were examined and the normal group s bmi was higher at 22.832.69 than those of the scoliosis groups , and the difference was very statistically significant ( p<0.001 ) . in particular , the scoliosis group s bmi was less than 20 , which meant that their weight was relatively small compared to their height . according to the posthoc test result , there were no differences among the scoliosis groups but their bmi was smaller than that of the normal group . comparison of left and right balance between the groupsnogroupmsd ( kg / m)1ng ( n=15)2.38 1.962gi ( n=57)12.57 9.553gii ( n=34)13.4711.544giii ( n=37)12.3310.68 g : normal group ( cobb angle below 10 ) . giii : group iii ( cobb angle above 30 ) , differences in lateral balance between the left side and the right side were examined , and there were statistically significant differences among the groups ( p<0.01 ) . according to the posthoc test result , there were no difference among the scoliosis groups , but the scoliosis groups left and right lateral balance was unstable compared to the normal group . comparison of forward and backward balance between the groupsnogroupmsd ( kg / m)1ng ( n=15)10.37 8.512gi ( n=57)20.4412.913gii ( n=34)22.1418.034giii ( n=37)16.2811.43ng : normal group ( cobb angle below 10 ) . gi : group i ( cobb angle 1019 ) . giii : group iii ( cobb angle above 30 ) , differences in forward and backward balance among the groups were examined , and there were statistically significant differences among the groups ( p<0.01 ) . according to the post - hoc test result , there were no differences between the scoliosis groups but the scoliosis group s forward and backward balance was more unstable than the normal group s . comparison of postural balance between the groupsnogroupmsd ( kg / m)1ng ( n=15)10.37 8.512gi ( n=57)20.4412.913gii ( n=34)22.1418.034giii ( n=37)16.2811.43ng : normal group ( cobb angle blow 10 ) . gi : group i ( cobb angle 1019 ) . giii : group iii ( cobb angle above 30 ) , differences in postural balance between the groups were examined and there were statistically significant differences between the groups ( p<0.01 ) . according to the result of the posthoc test , there were no difference between the scoliosis groups but the scoliosis groups forward and backward balance was more unstable than that of the normal group . giii : group iii ( cobb angle above 30 ) g : normal group ( cobb angle below 10 ) . giii : group iii ( cobb angle above 30 ) ng : normal group ( cobb angle below 10 ) . giii : group iii ( cobb angle above 30 ) ng : normal group ( cobb angle blow 10 ) . today , with the advent of the information society , physical activities have decreased and sedentary lifestyles have rapidly increased the number of cases of spinal diseases , which are becoming a social problem7 . accordingly , this study systematically examined differences in postural balance according to the degree of adolescents idiopathic scoliosis and discusses treatment for them . in a previous study of the relationship between scoliosis and balance ability , nault et al.8 reported that mobility of weight and the center of pressure were considerably higher in the scoliosis group than in the normal group , and the reason for this was that compensation occurred in the muscular system to maintain static balance due to the characteristics of unstable postural balance . in other words , when adolescents with idiopathic scoliosis sit in a wrong position , the unbalanced weight load on the upper body affects the arrangement and angle of the spine . guo et al.5 noted that scoliosis patients were abnormal in a one - sided somatosensory evoked potential test , and that their balance control ability was abnormal . the present study compared the balance ability of normal students and students with scoliosis , and there were significant differences between the two groups in right and left balance , forward and backward balance , and whole body balance . the results of the present study are consistent with those of by simoneau9 who reported there were differences between a normal group and scoliosis patients in the visual sense and somato - sense . summarizing the results of previous studies and the present study , a major cause of scoliosis is asymmetric posture of the trunk , decrease in physical activity , is a major risk factor for scoliosis , and a larger cobb angle , is associated with a larger deviation from balance . according to previous studies , patients with moderate scoliosis early examination and scoliosis risk factors , and 3 to 22 percent of curvatures of larger than 5 degrees naturally disappeared through efforts to correct the posture and self - exercise after they had been diagnosed10 . most of those with hawthorne effect had a curvature of less than 10 degrees . follow - up research will be necessary to verify differences in postural habits according to the degree of adolescent idiopathic scoliosis . also , research to examine multidimensional causes that affect the psychological and social characteristics of adolescents and to develop effective rehabilitation programs for adolescents with idiopathic scoliosis as well as to verify their effects will be needed .

[ purpose ] the purpose of this study was to verify the effects of idiopathic scoliosis on the human body by comparing the postural balance of adolescents with and without idiopathic scoliosis , to provide basic data for the optimal desirable growth and development of adolescents . [ subjects ] the subjects were 128 adolescents diagnosed with scoliosis on x - ray by orthopedists . the subjects were divided into a 10 to 19 degree group , 20 to 29 degree group , and 30 degree and over group according to the degree of scoliosis . for comparison , 15 normal adolescents without orthopedic injury within the last 6 months were selected as a control group . [ methods ] as measurement tools , dk2 525r ( dongkang medical : korea ) was used to measure the cobb angle and a multifunktional traininggeraete device ( mft , germany ) was used to measure balance . one - way variance of analysis was conducted in order to examine differences among the four groups in left and right balance , forward and backward balance , and overall postural balance , and when there were differences , they were compared in detail using duncan s post - hoc test . [ results ] the results of scoliosis angle and body mass index ( bmi ) showed significant differences between the normal group ( ng ) and the scoliosis groups ( gi , g ii , g iii ) , but there were no significant differences among the scoliosis groups . the scoliosis groups showed a significantly lower bmi than that of the normal group . in addition , the results of the left / right and the front / rear balance abilities showed significant differences between the normal group and the scoliosis groups . furthermore , the results of whole body balance ability were showed significant differences between the normal group and the scoliosis groups .

the central nervous system ( cns ) is composed of multiple , interconnected neural circuits . one way to elucidate the complex wiring of the brain is to use tracer substances ( dyes or proteins ) , which are taken up by neurons and carried by axonal transport . in cases where the tracer is transported retrogradely , such as fast blue , diamidino yellow or fluorogold , neurons projecting to the injected site will be labeled . such methods potentially visualize the complete set of converging inputs to a particular brain region . the combination of two retrograde tracers which can be distinguished , for example by different fluorescence wavelength ( kuypers et al . , 1980 ) this method is useful to assess whether a particular brain region has divergent projections to several regions . moreover , one can reveal whether the projections originate from single neurons ( divergent projection ) or from nearby distinct neurons ( parallel projection ) . these tracing techniques have provided us remarkable insights into the afferent and efferent connections of brain regions . since the early 1990 s , viruses have also been used to visualize neuronal connections ( kuypers and ugolini , 1990 ) . unlike most conventional chemical retrograde tracers , more importantly , they replicate in infected neurons , resulting in strong amplification of signals . these features enable precise tracing of chains of neurons connected via synapses ( figure 1 ) . a variety of neurotropic viruses have been used for such transsynaptic tracing , namely , herpes simplex virus type 1 ( hsv-1 ) , pseudorabies ( prv ) , and rabies virus ( rv ) . among these viruses , the bartha strain of prv ( prv - bartha ) and the challenge virus standard ( cvs ) of rv are used often as transsynaptic retrograde tracers ( for reviews , see aston - jones and card , 2000 ; kelly and strick , 2000 ) . schematic diagram of the comparison of viral and conventional tracers in tracing neural circuits which converge to region a. ( a ) by injecting a retrograde viral tracer into region a , the virus will first infect the neurons that directly project to the injection site ( first - order neuron ) in region b , and then spread further to the synaptically connected upstream neurons ( second - order neuron ) in region c. therefore , transsynaptic labeling enables us to trace chains of specific neurons , such as projection neurons which interconnect distinct brain regions or interneurons which modulate the activity of such projection neurons . ( b ) by using conventional non - transsynaptic tracers , several experiments with different injection sites must be conducted in order to reveal the afferent neural circuits : injection to region a to detect first - order neurons , and injection to region b to detect second - order neurons . however , in this way , neurons that are not connected with the circuit a may also be stained , such as the neuron in region d. to further elucidate the complicated neural networks in the cns , such as the interaction of multiple neural circuits , a method which combines double retrograde labeling with viral transsynaptic tracing would be useful . the idea of this method , dual viral tracing , is explained in figure 2 . two strains of recombinant viruses are used as transsynaptic tracers , each of which expresses a unique marker protein . with this method , two different neuronal circuits can be labeled distinctly , and a single neuron , from which the two diverging circuits are originating , can be visualized by co - expression of two marker proteins ( double labeling ) . in our original paper ( ohara et al . , 2009 ) , we described dual viral tracing in the rat cns using recombinant strains of rv . in this article , we will review the reported use of various dual viral tracer approaches , the advantages of dual viral tracing using rv recombinants and point out potential weaknesses and promises of the latter method . ( a ) neurons which have a divergent projection to two brain regions will be infected by retrograde transsynaptic transport of the two recombinant viruses , and will be double - labeled by the co - expression of the two marker proteins . ( b ) two rv recombinants were generated for dual viral tracing by inserting different marker genes encoding either -gal or egfp . ( c ) neuron double - labeled by -gal ( magenta , left panel ) and egfp ( green , center panel ) can be seen in white in the merged image ( right panel ) . prv - bartha is an attenuated strain of prv which transports along the axon in a retrograde direction . unlike other -herpesviruses ( hsv-1 and prv ) , prv - bartha is less likely to induce cell lysis and therefore will hardly infect anatomically non - connected nearby cells by local spread of the virus . because of these features ( 1995 ) used two recombinants of prv - bartha which express unique markers [ gc viral glycoprotein and -galactosidase ( -gal ) ] to address a longstanding issue : whether there are neurons which regulate the functions of two distinct autonomic systems . the two recombinant strains were injected , respectively , into one of two peripheral organs , adrenal gland and stellate ganglion ( the major sympathetic source that innervates the heart ) . the distribution of double labeled neurons in the hypothalamus and brainstem demonstrated the existence of neurons which innervate these two peripheral structures . however , the rate of successful double infection in this first study was very low ( 8 out of 256 rats ) since the virus strains used in this study were nonisogenic strains that differ in their invasive properties . the strain with stronger invasive properties spreads within neural circuits faster than the other strain and prevents the other strain from subsequently infecting the same neuron ( kim et al . , 1999 ) . the low rate of successful double infection due to this interference problem ( viral interference ) has been settled partially by using two isogenic prv recombinants which present similar invasive properties ( cano et al . , 2004 ) . dual viral tracing with these isogenic strains , which express either -gal or enhanced green fluorescent protein ( egfp ) as a marker protein , has been used to identify brainstem neurons that control the simultaneous activation of multiple muscles that are involved in certain actions , such as respiration and emesis ( billig et al . , 2000 ) . this method has also been used to demonstrate the existence of neurons which simultaneously coordinate the activations of both motor and autonomic systems ( krout et al . , 2003 ; kerman et al . , 2006 ) . in the original paper ( ohara et al . , 2009 ) , we used recombinant strains of rv instead of the previously used prv recombinants . similar to prv - bartha , rv transports along the axon exclusively in the retrograde direction and spread to neurons that are synaptically connected ( iwasaki and clark , 1975 ; charlton and casey , 1979 ) . however , there are several differences in the infection properties in these two viruses . unlike prv infection furthermore , rv does not induce cellular lysis and subsequent local viral spread ( ugolini , 1995 ) . one further prominent characteristic of rv is that it can infect primates in addition to rodents whereas prv can not ( callaway , 2008 ) . these features make rv a powerful tool to reveal the complicated connections within the cns especially in non - human primates , such as connections of the basal ganglia , cerebellum and cerebral cortex ( kelly and strick , 2003 ; hoshi et al . , 2005 ) , or specifically in the visual pathway ( nassi and callaway , 2006 ) . we developed a recombinant rv which was derived from a vaccine strain of rv ( hep - flury ) except that the glycoprotein ( g ) gene was taken from the cvs strain ( inoue et al . furthermore , the morphological features of the infected neurons were clearly visualized by using antibodies against the expressed marker protein , such as egfp or -gal . we used this recombinant rv and achieved dual transsynaptic tracing in the entorhinal - hippocampal network of the rat . the entorhinal cortex and hippocampal region are known to contribute to encoding , consolidation and retrieval of declarative memories . the afferent and efferent connections within these regions have been well studied ( for an overview , see witter and amaral , 2004 ) . briefly , the areas of hippocampus , including the dentate gyrus , areas ca3 , ca1 and the entorhinal cortex ( ec ) , exhibit a series of connections that are ideal to test the potential of our recombinant strains of viruses for single and double labeling ( figure 3a ) . axons of pyramidal cells in the hippocampal ca3 region projects bilaterally to ca1 ( swanson et al . , 1980 ; laurberg and sorensen , 1981 ; li et al . , 1994 ) . in turn , ca1 pyramidal cells project to ec , and with the exception of those in the most dorsal tip of ca1 , all neurons project strictly ipsilaterally ( van groen and wyss , 1990 ) . on the basis of this established anatomy , we hypothesized that a single ca3 cell influences ec bilaterally , with only one ca1 synapse in between . our new dual viral tracing technique would be perfectly suited to confirm this connection in a straightforward way . ( a ) rhep5.0-cvsg- -gal and rhep5.0-cvsg - egfpx2 were injected to the left and right mec , respectively . the viruses , transsynaptically transported from the bilateral mec will go through ca1 and will first meet in the hippocampal ca3 region . ( b ) in field ca1 , neurons are labeled only by the virus ( rhep5.0-cvsg- -gal ) injected into the ipsilateral mec , whereas -gal ( magenta ) and gfp ( green ) labels intermingle in ca3 region . note that there are double - labeled neurons ( white ) in ca3 . we created two recombinant strains of virus , each expressing one of two distinct marker proteins , -gal and egfp ( phep5.0-cvsg- -gal and phep5.0-cvsg - egfpx2 ) , and injected each of these two strains to the left and right medial entorhinal cortex ( mec ) separately . 6 days after injection , which is an approximate time required for the recombinant virus to infect the second - order upstream neurons , many labeled neurons were observed in the dorsal hippocampus . ca1 neurons were predominantly labeled by the recombinant strain that was injected into the ipsilateral mec , whereas -gal and egfp labels intermingled in the bilateral ca3 region . 12.521.7% of the labeled ca3 neurons were double - labeled ( figure 3b ) . in some double - labeled neurons , the level of expression of at least one of the two marker proteins was high enough to visualize the morphological feature of the neuron . the results demonstrate that single neurons in ca3 are connected to mec bilaterally , with only one synaptic relay at the ca1 . in view of the known organization of this neuronal chain , the present finding was expected , but is the first direct demonstration of this transsynaptic connection from individual ca3 neurons to mec bilaterally . this study also demonstrated the potential use of this dual viral tracing method using rv recombinants to reveal the complicated circuits in the cns . although the dual viral tracing method using rv recombinants is powerful in dissecting multiple circuits , a number of issues should be considered . viral specificity occurs in case of granule cells in the dentate gyrus , which can not be infected by rv ( jackson and reimer , 1989 ) , and ca3 pyramidal cells will not be infected through synapses of schaffer collaterals by prv - bartha ( sik et al . , second , it is important to assess the possibility of multiple transsynaptic routes between two brain structures . an efficient way is to carry out single viral tracing experiments first and to compare the results with established connectivity . in case of the connections between ca3 and ec , single tracing experiments indicated that a possible connection mediated by the lateral septum ( witter and amaral , 2004 ) was an unlikely explanation for the reported transsynaptic labeling in ca3 following injections in ec . the use of these single tracing experiments also allowed assessing the temporal progression of the two viral strains in the targeted circuit , which is essential to realize efficient double - labeling . as shown in the prv studies , false negative results may arise in dual viral tracing : neurons which innervate the two injection regions may not be double - labeled due to viral interference . we have demonstrated the effect of this interference on double labeling in an in vitro preparation , and showed that the efficiency of double labeling decreases as the interval between the two infections increases , in accordance with previous report using prv recombinants ( banfield et al . , 2003 ) . thus , for efficient double labeling using viral tracers , two strains of viruses must infect a neuron with only a few hours difference . to achieve this , we must consider the time required for the two recombinant strains to infect the neurons of interest . this difference is determined by the propagation speed of the two strains and by the infection pathways , such as the number of synapses , the length of the axon , and the strength of connections ( lycke and tsiang , 1987 ; ugolini , 1995 ) . therefore , in order to realize efficient double - labeling the timing of the two injections should be adjusted , taking into account the specifics of each of the two strains such that the two viral strains reach the neurons of interest within a short time period . dual transsynaptic tracing using recombinant rv is a powerful method since rv specifically infects neural circuits in a retrograde manner in a broad range of animals including rodents and primates . although there still are some problems in the use of this method as described above , recent developments in genetic techniques regarding rv provides the hint of solutions to these problems . ( 2007 ) reported an elegant technique to label neurons that project to a single , genetically targeted neuron in vitro by applying two modifications to rv : ( 1 ) deleting the g gene from the genome , and ( 2 ) providing the virus with an avian virus envelope ( enva ) . this modified virus can only infect specific neurons expressing the enva receptor ( tva ) , and spread transsynaptically to directly connected neurons only if the infected cell is also transfected with g gene . this strategy may be used to restrict the infection pathway of the virus to a certain route and will facilitate the interpretation of the transsynaptic labeling . genetic modification may also provide a solution to the problem of false negative results due to viral interference . a previous study in vesicular stomatitis virus , which belongs to the same family , rhabdoviridae , as rv , has shown that the g protein interferes with the viral uptake of a subsequent virus ( whitaker - dowling et al . , 1983 ) . therefore , recombinant rv with low g protein expression may diminish the effect of viral interference , but right now this problem has not been solved . we must further realize that quantitative analysis is difficult in dual viral tracing since the results may underestimate the real number of collateralized neurons , due to interference . on the good side , those neurons that express both marker proteins undoubtedly have anatomical connections to both of the infected target areas . furthermore , since our recombinant rv can reveal the morphological characteristics of the labeled neurons , the double - labeled neuron can be morphologically typed . the method can also be combined with antibody staining against neural cell markers to classify the cell in more detail . it may also be interesting to combine this method with anterograde tracing , which visualizes inputs from a certain region to the virally - infected neurons . we thus expect that this dual viral tracing with recombinant rv , for which we provided proof of principle in the entorhinal - hippocampal system , will be of use to untangle complex connections in the cns and to visualize the complex architectures that underlie a variety of brain functions . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

using recombinant rabies virus ( rv ) , we developed a dual transsynaptic retrograde tracing technique in the rat central nervous system . two strains of recombinant rv , injected into two separate loci of the brain , were taken up through axon terminals and carried retrogradely and transsynaptically from neuron to neuron . each viral strain expresses a unique marker in infected neurons . therefore , neurons that project transsynaptically to two brain loci can be detected by double - labeling . in this review , we will introduce the advantage of dual viral tracing by recombinant rv , and will also address some potential weaknesses of this technique . although false negative results may arise due to interference between two strains of rv , the ability of the recombinant rv to visualize the morphology of the infected cell and to infect primates in addition to rodents will make this technique a potential tool to provide new insights into the complex organization of brain networks .

alzheimer s disease ( ad ) is the most common form of dementia , affecting over 44 million people worldwide . ad is a progressive brain disorder that damages synapses and brain cells and causes decline of memory , loss of cognitive and executive functions , and eventually death . there is no known cure for ad , and the etiology of the disease is not well understood . previous studies have shown that amyloid -protein ( a ) plays an important role in ad pathogenesis . a is , in reality , not one but a group of peptides derived from the type-1 transmembrane protein , amyloid -protein precursor ( app ) , through cleavage by - and -secretases . a exists in vivo primarily as 40 or 42 amino acid long peptides with a40 constituting 90% and a42 9% of all a species . even though a42 is a relatively minor constituent , it has been found to be the primary component of amyloid plaques , which are an important pathologic hallmark of ad . in the plaques formation of a fibrils in vitro and in vivo is a complex process involving multiple intermediate oligomeric species , which are highly neurotoxic and are believed to be the proximal neurotoxins acting in ad . immediately upon dissolution in vitro , a42 forms small oligomers , including dimers and tetramers , as well as paranuclei ( pentamers and hexamers ) that self - associate to form decamers and dodecamers . among these species , the 56 kda dodecamer has been identified as a plausible cause of memory deficits in the ad brain and in transgenic mice . thus , targeting and remodeling a42 oligomers is a primary therapeutic strategy for ad . one strategy for ad treatment and prevention is preventing a formation , which could be achieved by inhibiting or modulating the - and/or -secretase enzymes . however , this approach has been problematic because both secretases cleave substrates other than app , which are important in other functional biological processes . another potential strategy is enhancing clearance of a oligomers and aggregates from the brain . this can be accomplished either by facilitating degradation of a by proteases or other clearance mechanisms , or by directly remodeling the aggregation of a into clearance - prone structures using suitable peptides or small molecules . many natural proteins , peptides , and small molecules have been discovered to interact with a and modulate a self - assembly . among them , small molecules are particularly attractive as a direct therapeutic strategy for the treatment of ad . for instance , biologically active molecules from green - tea ( ( )epigallocatechin-3-gallate , egcg ) or the indian spice turmeric ( curcumin ) have been found to prevent a aggregation and inhibit a-induced toxicity . inositol stereoisomers have been found to interact with a and attenuate its neurotoxic effects . z - phe - ala - diazomethylketone ( padk ) , which acts as a lysosomal modulator up - regulating the expression of cathepsin b in lysosomes , has been shown to interact with a42 directly and modulate a42 oligomerization . c - terminal fragments of a42 and many polyphenol molecules have been shown to inhibit a oligomerization , aggregation , and toxicity , and molecules have been specially designed to inhibit not only aggregation of a but also its metal binding and oxidation . molecular tweezers ( mts ) , which possess a torus - shaped cavity with a surrounding belt of alternating aromatic and aliphatic rings , were designed to serve as host molecules binding specifically to lysine and to a lesser extent to arginine residues . mts were shown to be modulators of the aggregation of a and other amyloidogenic proteins and effective inhibitors of the toxicity of these proteins . a lead mt derivative , clr01 ( figure 1a ) , was shown to inhibit the toxicity of multiple amyloidogenic proteins in cell viability assays using cell lines and primary cell cultures and protected synaptic integrity and function of hippocampal and cortical neurons against the synaptotoxicity of a42 . in addition , peripheral administration of clr01 in transgenic mice led to a decrease in amyloid plaques , neurofibrillary tangles , and brain inflammation , suggesting that it is a promising candidate for therapeutic development . mechanistic investigation showed that disruption of a self - assembly is mediated by clr01 binding to the two lysine and the single arginine residues in a. dynamic light scattering ( dls ) and electron microscopy ( em ) experiments suggested that clr01 does not prevent oligomer formation but rather modulates a self - assembly into formation of structures that are neither amyloidogenic nor toxic . interestingly , by the relatively low resolution of dls and em , these structures were similar in size to the toxic and amyloidogenic oligomers of a alone , suggesting that subtle conformational changes in a might account for the apparent loss of amyloidogenic potential and toxic activity . however , the low - resolution methods could not provide information about what these changes might be . in addition , whether clr01 binds a monomers , oligomers , and/or larger aggregates has not been demonstrated directly . in several previous studies , a derivative called clr03 ( figure 1b ) was used as a negative control . this compound shares the polar bridgehead structure with clr01 but lacks the hydrophobic arms , and therefore is not expected to bind specifically to lysine or arginine . consequently , clr03 indeed acted as a negative control and was not found to inhibit the aggregation and/or toxicity of amyloidogenic proteins . nonetheless , how clr03 interacts with a and whether it has any effect on early a oligomerization of a remains to be uncovered . to address all these questions , here we used ion mobility spectrometry coupled mass spectrometry ( ims - ms ) to investigate the effect of clr01 and clr03 on a assembly . ims - ms has been utilized successfully in the past to study a and amyloid assembly and the effects of various small molecules on the assembly process . full - length a40 and a42 were synthesized by n-9-fluorenylmethoxycarbonyl ( fmoc ) chemistry . the peptides were purified by reverse - phase hplc and their integrity validated by mass spectrometry and amino acid analysis as described previously . the samples were prepared in 10 mm ammonium acetate , and the ph was adjusted to 7.4 . samples contained 10 m a42 and molecular tweezers at different concentration ratios . an a42 sample without mts microscopic analysis was performed using a fei t-20 transmission electron microscope operating at 200 kv . the a samples with and without molecular tweezers were prepared using the same procedure as that for the mass spectrometry analysis . the samples were kept at 4 c for 2 weeks . for tem measurements , 10 l aliquots of samples were spotted on glow - discharged , carbon - coated copper grids ( ted pella , inc . ) . the samples were stained with 10 mm sodium metatungstate for 10 min and gently rinsed twice with deionized water . samples were analyzed on a home - built ion mobility spectrometry - mass spectrometer which is composed of a nanoelectrospray ionization ( nano - esi ) source , an ion funnel , a temperature - controlled drift cell , and a quadrupole mass filter followed by an electron multiplier for ion detection . briefly , for ion - mobility measurements , ions are generated continuously by a nano - esi source , focused and stored in the ion funnel . a pulse of ions is injected into a temperature - controlled drift cell filled with 35 torr helium gas , where they gently pass through under the influence of a weak electric field . the injection energy can be varied from 20 to 150 ev , but it is usually kept as low as possible to minimize thermal heating of the ions during the injection process . the ions exiting the drift cell are mass analyzed with a quadrupole mass filter , detected by the conversion dynode and channel electron multiplier , and recorded as a function of their arrival time distribution ( atd ) . the ions in the drift cell experience a constant force from the electric field , e. this force is balanced by a retarding frictional force due to collisions with the buffer gas , resulting in a constant drift velocity , vd . the drift velocity is proportional to the electric field:1here , the proportionality constant k is termed the ion mobility . the absolute ion mobility is dependent on the temperature ( t ) and the pressure ( p ) of the buffer gas , so it is typically converted to the reduced mobility k0:2the ions exiting the drift cell are mass analyzed and detected as a function of the arrival time , ta . the reduced mobility k0 can be determined from the instrument parameters by using eq 3 and plotting ta versus p / v3 in eq 3 , l is the length of the drift cell ( 4.503 cm ) , v is the voltage across the drift cell , and t0 is the time the ions spend outside the drift cell before hitting the detector . all of these quantities are either known constants or are measured for each experiment . the reduced ion mobility k0 can be related to the collision cross section using kinetic theory4here , q is the ion charge , n is the buffer gas number density at stp , is the reduced mass of the ion he collision , and kb is the boltzmann constant . the measured reduced mobility ( k0 ) and the collision cross section ( ) provide information about the three - dimensional configurations of the ions . for peptide and protein ions , the secondary and tertiary structural information and the oligomeric states experimental arrival time distributions can be fitted by calculating the flux of ions exiting the drift tube using ion transport theory . the ion packet is taken as a periodic delta function , and the flux is given by eq 5:5here z is the ion charge , r0 is the radius of the initial ion packet , a is the area of the exit aperture , dl and dt are the longitudinal and transverse diffusion coefficients , s is the initial ion density , and is the loss of ions due to reactions in the drift cell . the fitted feature represents the theoretical atd for one species with a given cross section . if a feature in the experimental atd is broader than the fitted one , then the feature possibly represents a family of structures , rather than a single structure . for the ims - ms experiments performed here , a and the molecular tweezers were prepared in ammonium acetate buffer , in contrast to previous experiments in which they were studied in sodium phosphate buffer . this change in condition was not expected to cause major changes in a assembly or its inhibition . to verify this expectation experimentally , we assessed samples of a42 in the absence or presence of clr01 or clr03 by tem . a42 was incubated with clr01 at 1:1 or 1:10 concentration ratio , respectively , and with clr03 at 1:10 concentration ratio . as shown in figure s1 ( supporting information ) , a42 shows long fibrils in the absence of tweezers or in the presence of clr03 , as observed previously in sodium phosphate buffer . in the presence of an equimolar concentration of clr01 , the a42 sample shows a few protofibril - like structures and amorphous structures . at 1:10 a42:clr01 concentration , these tem results show that clr01 inhibits the fibril formation by a42 , whereas clr03 does not , which is consistent with previous studies in sodium phosphate buffer . these results indicate that the change of buffer has a minimal effect on a fibrillogenesis and the way it is impacted by clr01 or clr03 , supporting the comparison between the data shown below and previous biophysical investigations of these systems . mass spectra of a42 samples in the absence or presence of mts are shown in figure 1 . in the mass spectrum of a42 alone ( figure 1e ) , there are four peaks , which correspond to a42 species with charge states z / n = 4 , 3 , 5/2 , and 2 ( where z represents charge and n represents oligomer order ) , respectively , as described previously . in the mass spectrum of a 1:10 mixture of a42 and clr01 ( figure 1c ) , there are three sets of peaks which correspond to 4 , 5 , and 6 charge states of the complexes of a42 with one , two , three , or four clr01 molecules bound . as the mass spectrometry study was conducted in negative ion mode , the binding form of clr01 is with loss of sodium ions , which results in producing a42 and clr01 complexes with higher charge states . note that no 5/2 a42 peak ( m / z = 1805 ) , which represents dimer or higher order oligomers , is observed . this indicates that clr01 disrupts the formation of a42 dimers and higher order oligomers . no peaks of uncomplexed a42 are observed in the mass spectrum , suggesting that clr01 binds to a42 directly with high affinity and there are no clr01-free a42 species present in solution . ( a , b ) molecular structures of clr01 and clr03 compounds ; ( c e ) mass spectra of a42 samples : ( c ) 1:10 mixture of a42 and clr01 ; ( d ) 1:10 mixture of a42 and clr03 ; ( e ) a42 alone . each species is noted in brackets where the first number is the number of a42 molecules and the second number represents the number of bound small molecules . in contrast , the spectrum of a 1:10 mixture of a42 and clr03 ( figure 1d ) shows four peaks corresponding to the 4 , 3 , 5/2 , and 2 a42 species , similarly to a42 alone ( figure 1e ) . there are two additional small peaks tailing the 3 and 4 a42 peaks corresponding to the 3 and 4 complex species of a42 with one clr03 bound , respectively . the intensities of these two complex peaks are much lower than those with clr01 bound , suggesting that the affinity of clr03 binding to a42 is much lower than that of clr01 . to better understand the effects of clr01 on a42 , the mass spectra of a42 with different ratios of clr01 ( 1:1 , 1:2 , 1:5 , and 1:10 ) were recorded . the mass spectrum of a 1:1 mixture is shown in figure 2d as an example , and others are provided in figure s2 ( supporting information ) . the mass spectrum of the 1:5 mixture of a42 and clr01 is similar to that of the 1:10 mixture ( figure 1c ) with peaks corresponding to complex species a42 and clr01 with charge states 4 , 5 , and 6 . as the concentration of clr01 decreases ( 1:2 and 1:1 ratios ) , the complex species of a42 and clr01 with lower charge states ( 4 , 3 , 5/2 ) are observed in the mass spectra . one possible explanation is that clr01 itself is slightly basic in aqueous solution and the observed binding form of clr01 is clr01 with loss of sodium ions ; therefore , the complexes tend to carry more charges in the presence of high concentration clr01 . note that no z / n = 5/2 clr01-free a42 dimer peak is observed in any of the mixtures . however , in the low - ratio mixtures ( 1:1 and 1:2 , see figure 2d and figure s2 , supporting information ) , the 5/2 complex peaks of a42 oligomers with clr01 molecules bound are observed ( m / z = 1950 , 2096 , and 2241 representing [ 2 + 1 ] , [ 2 + 2 ] , and [ 2 + 3 ] a42clr01 complexes , respectively ) . these results suggest that clr01 not only binds to a42 monomers but also to small a42 oligomers with relatively high affinity , thereby disrupting the formation of larger a42 oligomers even at 1:1 ratio . as the concentration of clr01 increases , the a42 oligomers decrease in abundance or altogether disappear . atds of ( a ) z / n = 5/2 a42 ( m / z = 1805 ) in an a42 sample without clr01 ; ( b ) z / n = 5/2 a42 and clr01 complex ( m / z = 1950 ) ; and ( c ) z / n = 5/2 a42 and clr01 complex ( m / z = 2096 ) in a 1:1 mixture of a42 and clr01 . each atd is fit with multiple features using the procedure described in the experimental methods section , and the oligomer order ( n ) is noted for each feature . ( d ) a mass spectrum of the 1:1 mixture of a42 and clr01 is shown as an example . each species is noted in brackets where the first number is the number of a42 molecules and the second number represents the number of bound clr01 molecules . mass spectra of mixtures of a42 and clr01 with different ratios are shown in figure s2 ( supporting information ) . ( e ) cross sections of dimer and tetramer in the uncomplexed or clr01-complexed 5/2 a42 . the error for the cross sections reported here is between 0 and 1% . to better understand the effects of clr01 on a42 oligomerization no atds for the z / n = 5/2 a42 peak ( m / z = 1805 ) could be recorded , as it was not observed in any of the mixtures of a42 and clr01 ( figures 1c and 2d and figure s2 , supporting information ) . the atds of the [ 2 + 1 ] and [ 2 + 2 ] complex peaks were recorded and are shown in figure 2b and c ( the signal of [ 2 + 3 ] complex species was too weak to obtain a reliable atd ) . the atd of the 5/2 a42 peak of pure a42 ( figure 2a ) shows four features with arrival times of 712 , 680 , 620 , and 540 s , which were previously assigned as a42 dimer , tetramer , hexamer , and dodecamer , respectively , based on their cross section values ( see refs ( 12 ) and ( 45 ) for a detailed discussion of the 5/2 peak assignment ) . in contrast , in the 1:1 mixture of a42 and clr01 , the atd of the m / z = 1950 peak ( figure 2b , labeled as [ 2 + 1 ] species ) shows only two features with arrival times of 690 and 640 s , which are assigned as dimer and tetramer , respectively . this indicates there is one clr01 molecule bound to the a42 dimer and two clr01 molecules bound to the a42 tetramer , respectively . no features at lower arrival times are observed , suggesting there are no a42 hexamers , dodecamers , or other larger oligomers formed in the presence of clr01 . the atd of the m / z = 2096 peak ( figure 2c , labeled as [ 2 + 2 ] species ) also shows two dominant features with arrival times of 700 and 660 s , which correspond to a42 dimer and tetramer , respectively . this indicates that there are two clr01 molecules bound to the a42 dimer and four clr01 molecules bound to the a42 tetramer . again , the highest oligomers with clr01 bound observed are tetramers and absence of features at lower arrival times indicates no hexamer , dodecamer , or higher order oligomer formation . these results indicate that clr01 not only binds to a42 monomers but also to small oligomers and inhibits the formation of hexamer and higher order oligomers . interestingly , the cross sections of dimers with one or two clr01 molecules bound are significantly smaller than those of the dimer with no ligands attached , even though their mass has increased . this result suggests clr01 induces more interaction between the two monomers , leading to a compact conformation and overall size reduction . similarly , the cross sections of tetramers with two or four clr01 molecules bound are smaller than those of the tetramer with no clr01 bound . in addition , the tetramer atd peaks with clr01 bound ( figure 2b , c ) are much narrower than in wild type a42 . this indicates there is little structure variation in the clr01 bound tetramer while in wt a42 the tetramer family of structures is both larger and more varied . the unbound a42 tetramer normally adopts a family of structures that have a bent arrangement ( 120 angle ) . it is likely that the tetramers with clr01 bound adopt either a more closed square ring structure or a pyramidal structure accounting for the fact they are smaller than clr01-free a42 tetramers and that dimer can not be added to form hexamer . a similar effect prevents a40 from growing beyond tetramer and explains its greatly reduced toxicity relative to a42 . to explore whether clr01 can remodel the early oligomerization of a42 not only immediately upon dissolution but also after the oligomers have already formed , a42 was incubated for 4 h on ice , following which clr01 was added to the samples . the samples were incubated at a low temperature to allow quasi - equilibrium of small oligomers to be reached but avoid extensive aggregation , which happens at higher temperatures and leads to clogging of the nano - esi capillaries , preventing further analysis . ( a ) mass spectrum of a42 alone with 4 h of incubation on ice ; ( b ) mass spectrum of the a42 sample immediately after the addition of 1:1 clr01 . each species is noted in brackets where the first number is the number of a42 and the second number represents the number of bound clr01 molecules . ( c ) atd of the z / n = 5/2 a42 peak for the a42 in the absence of clr01 after 4 h of incubation on ice . ( d ) atd of the z / n = 5/2 a42 peak after addition of 1:1 clr01 . ( e and f ) atds of 5/2 a42 oligomer complexes after addition of 1:1 clr01 to the preaggregated a42 sample . each atd is fit with multiple features using the procedure described in the experimental methods section , and the oligomer order following incubation , the mass spectrum of a42 ( figure 3a ) shows four peaks with charge states of z / n = 4 , 3 , 5/2 , and 2 . the atd of the 5/2 peak shows four features corresponding to dimer , tetramer , hexamer , and dodecamer , similar to figure 2a . upon addition of clr01 at 1:1 concentration ratio , new peaks appeared corresponding to z / n = 4 , 3 monomer complexes and z / n = 5/2 oligomer complexes ( figure 3b ) . overall , the spectrum was similar to the one obtained in the inhibition study ( figure 2d ) , with the exception that no peaks were observed with 3 or 4 clr01 molecules bound . the data indicate that clr01 binds to a42 monomers and preformed a42 oligomers directly , mostly with 1:1 or 1:2 stroichiometry , whereas binding of additional clr01 molecules is less likely after incubation . this suggests the existence of two main binding sites for clr01 on a , lys16 , and lys28 . interestingly , the atd of the z / n = 5/2 unbound a42 peak ( figure 3d ) showed only three features representing dimer , tetramer , and a small amount of hexamer after the addition of equimolar clr01 . the feature representing a42 dodecamer was eliminated after the addition of clr01 , suggesting that the binding of clr01 dissociated the preformed a42 dodecamer . moreover , the relative intensity of the hexamer decreased significantly compared to that before clr01 addition ( figure 3c ) , suggesting clr01 began to also dissociate hexamers . the atds of the z / n = 5/2 a42:clr01 oligomer complex peaks ( figure 3e , f ) showed only the two features corresponding to dimer and tetramer with clr01 molecules bound , as observed immediately upon mixing of a42 and clr01 ( figure 2b and c ) , suggesting that binding of clr01 to a42 dimers or tetramers changes their structure so that additional dimers can not be added to form hexamers . the atds of the z / n = 5/2 peaks were monitored again after 1 day of incubation at 4 c , and the results ( see figure s3 , supporting information ) were similar to those obtained following 4 h of incubation , suggesting that clr01 maintained the distribution of a42 oligomers , in which dodecamers were excluded and hexamers were a minor species . to test the effect of the a42:clr01 concentration ratio on the remodeling of a42 oligomerization , higher ratios of clr01 ( 1:5 and 1:10 , respectively ) the mass spectrum of the 1:5 mixture is shown in figure s4c ( supporting information ) ( the result of the 1:10 ratio was similar to that of the 1:5 mixture and therefore is not shown ) . the mass spectrum of the 1:5 mixture showed mostly complexes of a42 monomer with clr01 molecules . no z / n = 5/2 peak of clr01-free or clr01-complexed a42 was observed . taken together , these results indicate that clr01 remodels a42 oligomerization both at low and high concentration ratios . the atds of z / n = 3 of a42 monomer in the absence or presence of clr01 ( 1:1 ) are shown in figure s5 ( supporting information ) . in the atd of the 3 monomer peak of a42 alone , there are two dominant peaks with arrival times of 640 and 680 s , previously identified as a solvent - free conformer and a solution - like conformer , respectively . the atd for the 3 peak of a42 complexed with one clr01 molecule shows two similar features with arrival times of 668 and 712 s . by analogy , these are assigned as the solvent - free and solution - like conformers of a42 monomer with one clr01 bound , respectively . the atds of z / n = 4 and 5 complexes of a42 with one , two , three , or four clr01 molecules bound in a 1:5 mixture , respectively , are shown in figure s6 ( supporting information ) . those for z / n = 4 have two features in their atds , and as the number of bound clr01 molecules increases , the intensity of the compact , shorter - time feature increases , relative to the more extended , longer - time feature . overall , there are no features with shorter arrival times detected which indicates that only monomer with clr01 complexed is present in solution . the cross sections of the a42:clr01 monomer complexes are shown in figure s6c ( supporting information ) . addition of each clr01 ligand increases the size of the complex by an amount comparable to the size of clr01 , suggesting that no major structural transitions occur in the monomers upon clr01 binding . a40 has an identical sequence to that of a42 except for absence of ile41 and ala42 residues at the c - terminus but has very different assembly and pathological properties . thus , it is interesting to examine how clr01 affects its early oligomerization in comparison to a42 . the mass spectra of a40 alone and a40 mixed with clr01 at different ratios are provided in figure s7 ( supporting information ) . the mass spectrum of a40 alone shows three peaks which correspond to z / n = 4 , 3 , and 5/2 , similar to the spectrum of the a42 . the mass spectra of mixtures of a40 and clr01 at different ratios show sets of peaks at charge states 3 , 4 , 5 , and 6 corresponding to a40:clr01 complexes . up to four clr01 molecules are observed bound to a40 . at lower clr01 concentration ( 1:1 ratio , figure s7b , supporting information ) , there are three z / n = 5/2 peaks at m / z = 1876 , 2021 , and 2167 , corresponding to [ 2 + 1 ] , [ 2 + 2 ] , and [ 2 + 3 ] oligomer complexes of a40 and clr01 . at higher concentrations of clr01 ( 1:5 and 1:10 ratios ) , no 5/2 oligomer complexes were detected , suggesting that no dimer or higher - order oligomers formed . the atds of these 5/2 oligomer peaks are shown in figure 4 ( the signal of the [ 2 + 3 ] complex was too weak to obtain a reliable atd and therefore is not shown ) . the 5/2 peak of a40 ( m / z = 1731 , figure 4a ) shows two features with arrival times of 690 and 620 s which previously were assigned as a40 dimer and tetramer ( see ref ( 12 ) for a detailed discussion of the 5/2 peak assignment ) . for the 1:1 mixture of a40 and clr01 , the atds of 5/2 [ 2 + 1 ] and [ 2 + 2 ] oligomer complexes ( figure 4b and c ) show two primary features , which can be assigned as dimer and tetramer based on their cross sections . these results indicate that there are one or two clr01 molecules bound to a40 dimers and two or four clr01 molecules bound to a40 tetramers . no features at shorter arrival times were observed , indicating that there are no hexamer or larger oligomers formed . interestingly , the intensities of the tetramer feature for [ 2 + 1 ] and [ 2 + 2 ] complex species ( figure 4b and c ) are lower than that of the 5/2 , clr01-free a40 tetramer feature , which indicates that the formation of tetramer is slower in the presence of clr01 in the a40 sample than in its absence . ( a ) atd of z / n = 5/2 a40 ( m / z = 1731 ) for a40 alone ; ( b and c ) atds of z / n = 5/2 a40 and clr01 complexes ( m / z = 1876 and 2021 ) in the 1:1 mixture of a40 and clr01 . each atd is fit with multiple features using the procedure described in the experimental methods section , and the oligomer order ( n ) is noted for each feature . note the atds with clr01 bound , panels b and c , are significantly narrower than wild type , panel a. the atds of monomer complexes with charge states z / n = 3 , 4 , 5 , or 6 are shown in figures s8 and s9 ( supporting information ) . the z / n = 4 species ( figure s9a , supporting information ) show two features in their atds corresponding to the solvent - free conformer and the solution - like conformer of a40 complexed with clr01 . taken together , these results indicate that clr01 binds to a40 with relatively high affinity and inhibits its early oligomerization . the cross sections of a40 monomer complexes are shown in figure s9b ( supporting information ) . similarly to the a42 case , addition of each clr01 ligand increases the size of the monomer complex by an amount comparable to the size of clr01 , suggesting that no major structural transitions occur in the monomers upon clr01 binding . as noted above , clr03 has been used as a negative - control compound , which was not expected to inhibit a oligomerization or aggregation . hence , we felt it was important to do similar experiments that are reported here . time - dependent ion mobility study of the effects of clr03 on a42 early oligomerization . ( a c ) atds of the 5/2 a42 peak ( m / z = 1805 ) for the 1:10 mixture of a42 and clr03 at different time points ; ( d f ) atds of the 5/2 a42 peak ( m / z = 1805 ) for a42 alone at different time points . each atd is fit with multiple features using the procedure described in the experimental methods section . the oligomer order ( n ) and cross section are noted for each feature . a time - dependent study of the atds of the 5/2 a42 peak ( m / z = 1805 ) of a42 alone and the 1:10 mixture of a42 and clr03 is shown in figure 5 . the atd of the 5/2 a42 peak for the 1:10 mixture of a42 and clr03 at 30 min ( figure 5a ) shows four features that can be assigned as a42 dimer , tetramer , hexamer , and dodecamer based on their cross sections , which is similar to the results of a42 alone at 30 min ( figure 5d ) . interestingly , the intensity of the dodecamer feature of the 5/2 peak for the mixture of a42 and clr03 is relatively higher than other features , whereas the intensity of the dodecamer feature of a42 alone at 30 min is relatively lower than other features , suggesting that the growth of dodecamer in the presence of clr03 is faster than in its absence . after up to 24 h of incubation , the dodecamer in the a42 and clr03 mixture becomes an even more dominant feature in the atds ( figure 5b and c ) , whereas the clr01-free a42 sample does not change substantially and appears to be in a state of quasi - equilibrium ( figure 5e and f ) . the observation of dodecamer and the significant rapid growth of dodecamer in the a42 sample in the presence of clr03 suggest that clr03 not only does not inhibit the formation of a42 dodecamer but actually facilitates the dodecamer formation . atds of z / n = 3 and 4 peaks for a42 alone and a 1:1 mixture of a42 and clr03 are shown in figure 6 . the atd of the z / n = 3 a42 peak for the mixture of a42 and clr03 ( figure 6b ) shows two features at 640 and 680 s corresponding to the compact and extended conformers , respectively , which is similar to those of a42 alone ( figure 6a ) . remarkably , there is another feature at a substantially shorter arrival time ( 500 s ) as noted by the arrow in addition to the two monomer features , which is not observed for a42 alone . this indicates the presence of relatively large oligomers ( n 2 ) formed in the presence of clr03 . a similar feature is observed in the atd of the z / n = 3 peak of a42 with one clr03 bound , which corresponds to large oligomers ( n 2 ) . in figure 6e and f , dominant features with shorter arrival times are observed in the atds for z / n = 4 peaks of a42 with and without clr03 bound , in addition to the monomer feature , indicating the presence of large oligomers ( n 2 ) . these results are consistent with the results of the atds of the z / n = 5/2 a42 peak ( m / z = 1805 , figure 5 ) and further support the fact that clr03 facilitates self - assembly of a42 . clr03 facilitates a42 oligomer formation : ( a ) atd of the z / n = 3 peak for a42 alone , ( b and c ) atds of z / n = 3 a42 without and with clr03 bound for a 1:10 mixture of a42 and clr03 , ( d ) atd of the z / n = 4 peak for a42 alone , ( e and f ) z / n = 4 a42 without and with clr03 bound for a 1:10 mixture of a42 and clr03 . each atd is fit with multiple features using the procedure described in the experimental methods section . the arrows indicate the formation of oligomers ( n 2 ) in the mixture of a42 and clr03 . the effect of clr03 on a40 oligomerization is shown in figure 7 . the mass spectrum of a 1:10 mixture of a40 and clr03 shows peaks corresponding to z / n = 3 and z / n = 4 monomer with one clr03 bound but no clr03 attachment to the z / n = 5/2 peak ( figure s10b , supporting information ) . however , the atd of the 5/2 a40 peak ( m / z = 1731 ) in the presence of clr03 ( figure 7b ) shows formation of both a40 hexamer and dodecamer based on their cross sections . in figure 7c , the cross sections for the dimers and tetramers of a40 are given for a40 alone and for a40 mixed with clr01 and clr03 . note that clr03 significantly increases both cross sections , whereas clr01 significantly decreases both cross sections . ( a , b ) atds of the 5/2 a40 peak ( m / z = 1731 ) for the a40 samples in the absence or presence of clr03 . each atd is fit with multiple features using the procedure described in the experimental methods section , and the oligomer order ( n ) is noted for each feature . ( c ) cross sections of 5/2 a40 oligomers for samples of a40 in the absence or presence of clr01 or clr03 . the atds of z / n = 3 and 4 peaks of the 1:10 a40:clr03 mixture ( figure s11 , supporting information ) show features at arrival times shorter than those of monomers , suggesting formation of large oligomers ( n 2 ) in the presence of clr03 . our mass spectrometry study of the lead molecular tweezer , clr01 , and the related derivative , clr03 , provides novel observations that could not have been obtained previously due to the low resolution of the methods used . our investigation reveals that clr01 and clr03 bind to a with very different affinities . three clr01 molecules bind with relatively higher affinity and a fourth weakly , but only one clr03 molecule binds weakly to a. the a:clr01 stoichiometry found in our study is consistent with previous data suggesting that there are three possible binding sites for molecular tweezers on a at arg5 , lys16 , and lys 28 . possible explanations for our observation of a fourth clr01 molecule weakly binding to a40 and a42 could simply stem from differences in instrumentation , or might reflect nondiscriminating electrostatic and/or aromatic interactions between a and clr01 molecules , which might have been broken under harsher ionization conditions in the study by sinha et al . these nonspecific dispersive interactions could also explain the weak binding of one clr03 molecule to a , which was not observed within the limits of nmr detection in the previous study . the observation of three z / n = 5/2 oligomer complexes in the 1:1 and 1:2 mixtures of a42 and clr01 , respectively , suggests that clr01 not only binds to a42 monomers but also to small a42 oligomers ( dimers and tetramers ) . this is important , as dodecamers have been identified as probable toxic agents in ad . understanding the mechanism of how clr01 blocks dodecamer formation is crucial for developing a therapeutic strategy for ad . remarkably , the cross sections of the dimer and tetramer decreased substantially upon binding of clr01 ( see figure 2e ) . these results suggest that clr01 interacts with a42 to change the folding of the monomer , which in turn changes the binding interface in dimer and tetramer formation , resulting in compact structures that resist further aggregation . once multiple clr01 ligands bind to the monomer , even dimer formation is prevented . the ability of clr01 to remodel early a42 oligomerization after the oligomers had an opportunity to form and reach a quasi - equilibrium state for 4 h was assessed by ims as well . interestingly , even at low concentration ( 1:1 ratio ) , clr01 was capable of removing preformed a42 dodecamers and hexamers . at high concentrations ( 1:5 and 1:10 ratios ) these data are consistent with the inhibition results immediately upon mixing a42 and clr01 . it is possible that clr01 binds to a42 monomers and oligomers and redirects them into either a slower aggregation process or an off - pathway set of structures . in either case , the resulting structures are nonamyloidogenic and nontoxic . our data reveal for the first time that the loss of amyloid - formation propensity and toxicity correlate with disruption of the oligomerization process and compaction of oligomers formed in the presence of clr01 . surprisingly , the related derivative , clr03 , was found to facilitate the early aggregation of a42 , especially promoting the formation of hexamers and dodecamers . perhaps even more surprisingly , clr03 also facilitated the formation of hexamers and dodecamers in a40 , which does not form these oligomers on its own . given the fact that clr03 is an organic phosphate , we wondered whether it is possible the addition of clr03 has a simple salting out-like effect , which would thereby promote a aggregation . to address this possibility , an organic phosphate , p - nitrophenylphosphate ( pnpp ) , was added to a samples and was found not to induce significant changes in a oligomerization ( see figure s12 , supporting information ) . this result implies a simple salting out-like effect is not occurring for clr03 and that clr03 interacts with a in a specific manner . a major difference between the structures of clr01 and clr03 is that clr01 has a torus - shaped cavity whereas clr03 does not have a cavity structure . clr03 carries a bridge - like structure with negatively charged phosphate groups on each side . it is possible that one of the phosphate groups on clr03 interacts with positively charged residues ( lys , arg , n - terminus ) of a through coulombic interactions . the other phosphate group on the other side of clr03 could then attract a positively charged residue of another a or a oligomer . thus , by attracting positively charged residues in a , clr03 could facilitate a oligomerization and aggregation . alternatively , clr03 may interact weakly with two positively charged groups in a single a , resulting in no observation of peaks for single a with multiple clr03 in the mass spectra ( figure 1d ) . as a consequence this is a form of salting out , and it may be more effective than pnpp . however , the fact that assembly is promoted to structures similar to wt a42 speaks against salting out as a dominant assembly mechanism . clr01 , which also carries two phosphate groups , however , does not catalyze a oligomerization . this suggests that inclusion of lysine or arginine inside the cavity of clr01 is of paramount importance for clr01 s mode of action . the central hydrophobic region of a is regarded to be important for the hydrophobic clustering of a. recently , a macrocyclic inhibitor cucurbituril has been shown to inhibit amyloid fibrillation by hydrophobic interactions with nonpolar phenylalanine residues of a. clr01 , which has hydrophobic arms , is likely to have additional hydrophobic interactions with lysine residues . the binding of clr01 to lysine residues , especially lys16 which is close to the central hydrophobic region of a , may result in conformation change of a and compaction of a oligomers . our data suggest that binding of clr01 causes a monomers to either resist oligomer formation altogether or to redirect them to nontoxic oligomer assembly . previous detailed analysis showed that a40 formed a nearly closed planar tetramer that resisted further dimer addition . here , we found that adding clr01 to a40 significantly reduced the cross sections of both the dimer and tetramer , leading to nearly isotropic assembly and reducing the likelihood of even forming the tetramer , much less higher - order oligomers . on the other hand , the presence of clr03 in the solution significantly extended both the dimer and tetramer , yielding cross sections similar to those of the corresponding a42 oligomers and leading to hexamer and dodecamer formation . the essential features of these results are given in cartoon style in figure 8 . a42 wt rapidly forms dodecamer , but addition of the molecular tweezer clr01 eliminates dodecamer formation by inducing the dimer and tetramer to form compact species that can not add additional a42 . a40 wt forms terminal compact tetramers , but addition of clr03 leads to open tetramer formation and eventual dodecamer formation . these contrary effects are potentially of great importance in a assembly and require further study to reveal the details involved . these studies , which will include both high level molecular dynamics modeling and additional direct sampling of structures of a oligomers , are underway . oligomerization of ( a ) a42 wild type , ( b ) a42 with the presence of clr01 , ( c ) a40 wild type , and ( d ) a40 with the presence of clr03 . a42 and a40 are represented with blue and red balls , respectively .

the early oligomerization of amyloid -protein ( a ) has been shown to be an important event in the pathology of alzheimer s disease ( ad ) . designing small molecule inhibitors targeting a oligomerization is one attractive and promising strategy for ad treatment . here we used ion mobility spectrometry coupled to mass spectrometry ( ims - ms ) to study the different effects of the molecular tweezers clr01 and clr03 on a self - assembly . clr01 was found to bind to a directly and disrupt its early oligomerization . moreover , clr01 remodeled the early oligomerization of a42 by compacting the structures of dimers and tetramers and as a consequence eliminated higher - order oligomers . unexpectedly , the negative - control derivative , clr03 , which lacks the hydrophobic arms of the tweezer structure , was found to facilitate early a oligomerization . our study provides an example of ims as a powerful tool to study and better understand the interaction between small molecule modulators and a oligomerization , which is not attainable by other methods , and provides important insights into therapeutic development of molecular tweezers for ad treatment .

this is in contrast to the regular cytotoxic chemotherapy drugs that either damage the deoxyribonucleic acid or inhibit the microtubules and kill or inhibit the rapidly dividing cancer cells . maximum tolerated doses ( mtd ) of these drugs are designed to kill as many tumor cells as possible . such doses require prolonged periods of break between successive therapies so as to allow the normal tissues to recover and also to allow recovery from the harmful side - effects . though the cure rate is high , relapses are commonly seen in more aggressive tumors . in the past decade , the concept that smaller individual doses other than the mtd could be used emerged ; which could be more effective with lesser toxic effects . this concept of regular chemotherapy scheduling in low doses , below the mtd with no prolonged drug - free breaks is called mc . this type of chemotherapy inhibits tumor growth by anti - angiogenic mechanisms and also reduces the undesirable side - effects . few studies have shown that in patients with cancer that are either refractory to treatment or which have relapsed after conventional chemotherapy , mc can induce satisfactory tumor stabilization , also the duration of clinical benefit is longer with this type of low dose scheduling than the conventional chemotherapy with high doses . the conventional chemotherapy targets the proliferating tumor cells , whereas in the low dosage metronomic therapy the target is the endothelial cell of the growing vasculature of a tumor . thus , mc is also called as anti - angiogenic chemotherapy as coined by browder et al . this low dose mc is one of the most efficient anti - angiogenic chemotherapy and also has beneficial immunologic effects . this type of treatment leads to a long term asymptomatic control of the disease by inducing angiogenic dormancy . many clinical trials have shown favorable results in patients who were untreated or had earlier received conventional chemotherapy in various types of cancer . few studies have shown that no improved patient survival was seen in patients on mc , but mc does induce tumor stabilization and the duration of clinical benefit can be longer than the benefit obtained with the conventional chemotherapy . most of these studies have assessed clinical parameters in assessing response of this low dose anti - angiogenic chemotherapy . with this background , we undertook this retrospective analysis to evaluate whether anatomic imaging modality like computed tomography ( ct ) scan or a functional imaging modality like positron emission tomography ( pet ) should be used for assessment of treatment response in patients on mc . all patients on metronomic therapy who were referred to our department for a pet ct study prior to start of the treatment and for a response evaluation after 12 - 14 weeks , between may 08 and january 12 were included in this retrospective evaluation . a total of 43 patients of various cancers , on metronomic therapy who underwent pet ct were assessed by ct and pet using new response evaluation criteria in solid tumors ( recist 1.1 ) and pet response criteria in solid tumors ( percist 1.0 ) criteria . there were 22 patients of breast cancer , 7 of musculoskeletal cancer ( soft tissue sarcoma-2 , primitive neuroectodermal tumor [ pnet]-5 , osteogenic sarcoma-1 ) , 4 of head and neck cancer ( nasopharyngeal-3 , tongue-1 ) , 2 of non hodgkins lymphoma , 2 of esophageal and 1 each of gall bladder , ovarian cancer , hemangiopericytoma , ganglioneuroblastoma and 1 a paraganglioma [ table 1 ] . patient characteristics all patients were asked to fast for 4 - 6 h prior to the study and blood glucose levels were checked and confirmed to be < 150 mg / dl . the studies were performed 60 - 90 min following intravenous administration of 5 mbq / kg of f - fluorodeoxyglucose ( f - fdg ) . imaging was performed on a discovery st pet - ct system ( general electric medical systems ) . it combines a 16 slice ct scanner with a dedicated pet scanner ( bismuth germanium oxide crystal ) . ct was performed over 5 - 8 bed positions from the skull base to the mid - thigh ; using multislice ( 16 slice ) ct component of the system . ct parameters included 140 kv , 110 - 210 ma , 0.8 s / rotation , pitch of 1.75:1 , field of view ( fov ) 50 cm , length of scan 1.0 - 1.6 m , 0.625 spatial resolution and slice thickness of 3.75 mm . intravenous and oral contrast was not routinely administered in all patients unless there was a specific indication and request to do so . this was followed immediately by acquisition of pet data in the same anatomic locations with 15.4 cm axial fov acquired in 3d mode with 3 min / bed position . the images were reconstructed using a standard vendor provided reconstruction algorithm which incorporated ordered subset expectation maximization . image fusion was performed using co - ordinate based fusion software and subsequently reviewed at a workstation that provided multiplanar reformatted images and displayed pet images , ct images and pet - ct fusion images . the images were evaluated by experienced radiologist and nuclear medicine physician blinded to each other 's results . the ct findings were analyzed using the recist 1.1 and the pet findings by percist 1.0 criteria respectively . any area with intensity greater than background that could not be identified as physiological activity or which on ct correlation did not fit into benign ( infective / inflammatory / degenerative ) the response criteria as per recist 1.1 was as follows - complete response ( cr ) was disappearance of all target lesions , partial response ( pr ) as 30% or more decrease in sum of diameters of target lesions , progressive disease ( pd ) as 20% or more increase in sum of diameters of target lesions and also an absolute increase of at least 5 mm and/or appearance of one or more new lesions , stable disease ( sd ) who did not qualify for either sufficient shrinkage to qualify for pr nor sufficient increase to qualify for pd . complete resolution of fdg uptake within the measurable target lesion that is less than the mean liver activity and indistinguishable from surrounding background , with appearance of no new lesion , was labeled as complete metabolic response ( cmr ) . reduction of minimum of 30% of standardized uptake value lean ( sulpeak ) in the target volume in the same lesion as the baseline measurement was grouped under partial metabolic response ( pmr ) . progressive metabolic disease ( pmd ) was a 30% increase in the sulpeak of the fdg uptake or appearance of fdg avid new lesions that was morphologically typical of cancer . stable metabolic disease ( smd ) was disease , which did not qualify for cmr , pmr or pmd . the sul was calculated by a 1.2 cm diameter volume region of interest ( roi ) placed on the hottest site of the tumor . it was also determined whether the sulpeak of the tumor was higher than 1.5 times the liver sul mean + 2 sds ( in a 3 cm - diameter spheric roi in the normal right lobe of liver ) . the responses were graded as follows : pd-1 , sd-2 , pr-3 , cr-4 and non - classifiable 0 for recist and pmd-1 , smd-2 , pmr-3 , cmr-4 and non - classifiable-0 for percist . a total of 43 patients of various cancers , on metronomic therapy who underwent pet ct were assessed by ct and pet using new response evaluation criteria in solid tumors ( recist 1.1 ) and pet response criteria in solid tumors ( percist 1.0 ) criteria . there were 22 patients of breast cancer , 7 of musculoskeletal cancer ( soft tissue sarcoma-2 , primitive neuroectodermal tumor [ pnet]-5 , osteogenic sarcoma-1 ) , 4 of head and neck cancer ( nasopharyngeal-3 , tongue-1 ) , 2 of non hodgkins lymphoma , 2 of esophageal and 1 each of gall bladder , ovarian cancer , hemangiopericytoma , ganglioneuroblastoma and 1 a paraganglioma [ table 1 ] . all patients were asked to fast for 4 - 6 h prior to the study and blood glucose levels were checked and confirmed to be < 150 mg / dl . the studies were performed 60 - 90 min following intravenous administration of 5 mbq / kg of f - fluorodeoxyglucose ( f - fdg ) . imaging was performed on a discovery st pet - ct system ( general electric medical systems ) . it combines a 16 slice ct scanner with a dedicated pet scanner ( bismuth germanium oxide crystal ) . ct was performed over 5 - 8 bed positions from the skull base to the mid - thigh ; using multislice ( 16 slice ) ct component of the system . ct parameters included 140 kv , 110 - 210 ma , 0.8 s / rotation , pitch of 1.75:1 , field of view ( fov ) 50 cm , length of scan 1.0 - 1.6 m , 0.625 spatial resolution and slice thickness of 3.75 mm . intravenous and oral contrast was not routinely administered in all patients unless there was a specific indication and request to do so . this was followed immediately by acquisition of pet data in the same anatomic locations with 15.4 cm axial fov acquired in 3d mode with 3 min / bed position . the images were reconstructed using a standard vendor provided reconstruction algorithm which incorporated ordered subset expectation maximization . image fusion was performed using co - ordinate based fusion software and subsequently reviewed at a workstation that provided multiplanar reformatted images and displayed pet images , ct images and pet - ct fusion images . the images were evaluated by experienced radiologist and nuclear medicine physician blinded to each other 's results . the ct findings were analyzed using the recist 1.1 and the pet findings by percist 1.0 criteria respectively . any area with intensity greater than background that could not be identified as physiological activity or which on ct correlation did not fit into benign ( infective / inflammatory / degenerative ) the response criteria as per recist 1.1 was as follows - complete response ( cr ) was disappearance of all target lesions , partial response ( pr ) as 30% or more decrease in sum of diameters of target lesions , progressive disease ( pd ) as 20% or more increase in sum of diameters of target lesions and also an absolute increase of at least 5 mm and/or appearance of one or more new lesions , stable disease ( sd ) who did not qualify for either sufficient shrinkage to qualify for pr nor sufficient increase to qualify for pd . complete resolution of fdg uptake within the measurable target lesion that is less than the mean liver activity and indistinguishable from surrounding background , with appearance of no new lesion , was labeled as complete metabolic response ( cmr ) . reduction of minimum of 30% of standardized uptake value lean ( sulpeak ) in the target volume in the same lesion as the baseline measurement was grouped under partial metabolic response ( pmr ) . progressive metabolic disease ( pmd ) was a 30% increase in the sulpeak of the fdg uptake or appearance of fdg avid new lesions that was morphologically typical of cancer . stable metabolic disease ( smd ) was disease , which did not qualify for cmr , pmr or pmd . the sul was calculated by a 1.2 cm diameter volume region of interest ( roi ) placed on the hottest site of the tumor . it was also determined whether the sulpeak of the tumor was higher than 1.5 times the liver sul mean + 2 sds ( in a 3 cm - diameter spheric roi in the normal right lobe of liver ) . the responses were graded as follows : pd-1 , sd-2 , pr-3 , cr-4 and non - classifiable 0 for recist and pmd-1 , smd-2 , pmr-3 , cmr-4 and non - classifiable-0 for percist . these values were statistically compared using wilcoxon signed - rank test . there was concordance in 75% of patients and discordance in 25% of patients [ table 2 ] . in patients with concordant result , 2 patients showed pr / pmr , 8 patients showed sd / smd and 22 patients showed pd / pmd , as assessed by recist 1.1 for morphologic criteria and percist for metabolic criteria , respectively . pr / pmr was seen in two patients of breast cancer as there was decrease in size and metabolic activity of the lesions by > 30% [ figure 1a c ] . a case of carcinoma ( a ) maximum intensity projection image shows left internal mammary node ( block arrow ) and left chest wall deposit ( arrow ) . subsequent scan shows complete resolution of the internal mammary node and partial metabolic response in the chest wall deposit ( arrow ) . ( b ) transaxial images of hypermetabolic internal mammary node ( arrows ) with complete metabolic and morphologic regression . ( c ) transaxial images of hypermetabolic left chest wall deposit ( block arrow ) with residual disease ( arrow ) sd / smd was seen in 8 patients as there was no significant change in size and metabolic activity of the lesions to classify for either pr / pmr or pd / pmd . out of the 22 patients who showed pd / pmd by both the morphologic and metabolic criteria , 17 showed pd by virtue of new lesions , which were hypermetabolic [ figure 2a and b ] . in 5 patients , there was increase in sum total of the diameter and sulpeak of the target lesions by > 20% and > 30% respectively . ( a ) transaxial images show new hypermetabolic liver lesion in lower panel ( arrows ) suggesting progressive disease . ( b ) new hypermetabolic nodules in the left lung in the lower panel ( arrow ) , suggesting progressive disease by new response evaluation criteria in solid tumors and pet response criteria in solid tumors in 11 patients ( 25% ) there was discordance in the result assessed by morphologic ( recist 1.1 ) and metabolic criteria ( percist ) [ table 3 ] . totally 5 patients had sd by recist 1.1 , of which 4 showed pmd by percist . in all these 4 patients , there was an increase in the metabolism ( change in sulpeak between 32 and > 100% ) with no significant change morphologically . on follow - up , 2 of them had pd both morphologically and metabolically on subsequent follow - up and 1 patient expired due to disease progression . in the fourth patient , there was pmr decrease in metabolism of liver lesions by 61.7% with no change morphologically [ figure 3 ] . results of patients with discordant result transaxial computed tomography ( ct ) and fused positron emission tomography ct images of a patient with carcinoma breast [ patient no . the lower panel shows mild decrease in the uptake visually , with no significant morphologic change . stable disease ( sd ) and partial metabolic response ( pmr)-discordant result in 3 patients , the disease was non - pd ( all three had sclerotic bone lesions ) . out of these , 1 showed cmr as the sclerotic sternal lesion was non - metabolic . , there was an increase in metabolism with no morphologic change and hence showed a pmd . on follow - up imaging , both these patients had metabolic and morphologic progression of disease . in 1 patient of breast cancer [ table 3 , patient 9 ] , there was increase in number of sclerotic lesions in the vertebrae and hence showed pd as per recist 1.1 whereas there was no metabolic activity in these lesions and showed cmr as per percist . in this particular case , it is likely that pet may have missed the lesions as it is known that sclerotic lesions in patients with breast cancer may not be hypermetabolic . however there is no follow - up imaging that is available , but the patient remains asymptomatic . in a 12-year - old girl , a case of ganglioneuroblastoma [ table 3 , patient no . 10 ] , a new hypermetabolic marrow lesion in the ischium was detected on pet ( pmd ) and not seen on ct with other lesions showing no morphologic change ( pr ) . in another patient of pnet [ table 3 , patient 11 ] , a sacral marrow lesion was not detected on ct but was picked up by pet- thus the disease was cr by recist and pmd by percist . on subsequent follow up imaging when the patient was on metronomic treatment , there was sclerosis ( healing response ) in the sacral marrow lesion and was then evident on ct [ figure 4 ] . transaxial computed tomography ( ct ) and fused positron emission tomography ( pet ) ct images of a patient with primitive neuroectodermal tumor [ patient no . the upper panel shows no lesion in the sacrum on the ct image with a hypermetabolic marrow lesion in the left sacral ala in the fused pet ct image ( arrow ) ( complete response and progressive metabolic disease - discordant result ) . the lower panel is follow up study showing minimal sclerosis in the left sacral ala in the ct image with no hypermetabolism in the fused pet ct image ( arrow ) suggesting response pet upstaged the disease in 81% of patients ( 9/11 ) and down staged the disease in 19% of patients ( 2/11 ) . wilcoxon signed - rank test was used to compare the response evaluation using recist and percist , using the above - mentioned grades . using a 2-tailed hypothesis , the p < 0.05 ( z-0.0445 , p-0.9681 ) and was thus not significant . wilcoxon signed - rank test was used to compare the response evaluation using recist and percist , using the above - mentioned grades . using a 2-tailed hypothesis , the p < 0.05 ( z-0.0445 , p-0.9681 ) and was thus not significant . though recist is a widely applied tumor response criteria being dependent on morphological changes , it has limitations . as the assessment done by pet based criteria like percist uses metabolic changes which are closely related to changes occurring in a malignant tissue ; it would be a more accurate modality for assessing response . furthermore pet can detect metabolic changes when there are no or minimal morphological changes as seen in our study , particularly in detection of metastatic marrow lesions . our results show that in patients with discordant result , pet appropriately assessed the response as was evident by follow - up imaging in most patients . pet showed morphologic progression ( pmd ) in 8 patients ; 4 out of these on follow - up imaging had both morphologic and metabolic progression of disease ( patient no . 2 , 3 , 7 , 8) . one patient ( patient no 1 ) expired due to disease progression . in one patient ( patient no 4 ) , the increased metabolism persisted . an important observation made in this study is that , in two patients [ patient no . on subsequent follow - up imaging one of these patients [ patient no 11 ] , showed morphologic and metabolic resolution of the disease on metronomic therapy ( mc ) . this indicates that though mc is used in a palliative setting with effective pain palliation and tumor stabilization ; it may also have a curative effect in few patients . this was a retrospective observational study and a statistical difference between the response evaluation by the two methods could not be achieved . this can also be attributed to the low sample size and moreover there were 32 ties ( concordance ) and only 11 patients showed differences in response . it is well - known that metabolic response depicted by fdg pet - ct well precedes the anatomic response and has been well - demonstrated in few studies . the pet response is depicted by a decrease in the glycolytic metabolism of a tumor unlike anatomic response criteria which are based on size of the tumor which lags weeks and months behind the metabolic response . many newer cancer therapies including metronomic therapy are mainly cytostatic and achieving a long standing sd is the more beneficial outcome . such effects have been seen in patients of gastrointestinal stromal tumors treated with tyrosine kinase inhibitors where though the shrinkage in size of tumor is less the survival of patients is improved with sd . major limitations of this study are the retrospective nature of the data collection and heterogeneous group of patient population ( the response may vary depending on the type of cancer ) . a better evaluation in a prospective trial setting is warranted . also this study does not assess clinical outcomes , but was undertaken to look at better response assessing modality . in conclusion , as this type of metronomic treatment brings about tumor or angiogenic dormancy it is natural that the treatment response criteria based on morphologic characteristics will not be evident soon after therapy and thus using functional imaging criteria like percist would be the best to monitor the treatment response . our study shows that metabolic response is a more appropriate way of assessing the response to metronomic therapy . tumorostatic treatment regimens like metronomic therapy where alteration in morphological features would take time to manifest , assessment of metabolic response using fdg pet would be more appropriate . we thus recommend that pet should the imaging modality of choice in response assessment of patients of metronomic therapy . though metronomic therapy is used as a palliative therapy , if response evaluation by pet shows cr , this form of treatment has the potential to become a mode of treatment rather than palliation in some tumors and this has to be evaluated with larger , homogenous patient population in a prospective mode .

introduction : metronomic chemotherapy ( mc ) is a novel therapeutic variation for resistant cancers , wherein chemotherapeutic drugs are administrated in low doses with no prolonged drug - free break . it lessens the level of toxicity , is better tolerated and enhances the quality of life . this retrospective analysis was undertaken to evaluate whether anatomical ( computed tomography [ ct ] ) or functional ( positron emission tomography [ pet ] ) imaging be used for response assessment in patients on mc.materials and methods : a total of 16 males and 27 females with age range of 12 - 83 years on mc who underwent pet / ct were assessed by new response evaluation criteria in solid tumors ( recist 1.1 ) and pet response criteria in solid tumors ( percist 1.0).results : concordance between recist 1.1 and percist was seen in 32 ( 75% ) patients . there was discordance in 11 ( 25% ) patients . in patients with discordance , the results were confirmed by follow - up imaging . pet upstaged the disease in 81% of patients ( 9/11 ) and down - staged the disease in 19% of patients ( 2/11).conclusions : metabolic response accurately identified the disease status as assessed by clinical or imaging follow - up . alteration in morphology takes time to manifest , which is demonstrated by ct or magnetic resonance ; whereas in mc which brings about tumor dormancy , assessing metabolic response by pet would be more appropriate . mc is usually given in palliative setting but in few cases complete metabolic response was demonstrated in our study . in such a scenario this form of treatment has the potential to become an adjunct mode of treatment in some tumors . this needs to be evaluated with larger , homogenous patient population in a prospective mode .

recently , endoscopic papillotomy ( e.p.t . ) has achieved wide acceptance as an alternative to surgery for the management of choledocholithiasis . however , there are several of problems , one of which relates to the size of the stone . a stone larger than 2.5 cm in diameter has been regarded as a contraindication of endoscopic papillotomy due to complications and frequent failures . a new method in which the stone is partially crushed in place and then extracted has been developed and has been successfully used on large stones . we experienced a patient who had a cholecystectomy and presented with a very large stone ( 6 2 2 cm ) ( fig . although endoscopic papillotomy was contraindicated in this case , it was performed with the usual lithotripter , because the patient refused surgery . a 34 year - old man was admitted to the department of internal medicine complaining of a colicky right - upper abdominal pain accompanied by chills and fever of 2 days duration . he was healthy until 5 months earlier when he experienced the abrupt onset of right - upper abdominal pain accompanied by mildly icteric sclera . under the impression of postcholecystectomy syndrome , endoscopic retrograde cholangiopancreatography was performed which revealed a large stone in the distal common bile duct . endoscopic papillotomy and irrigation of common bile duct were done in the endoscopic room at that time . thereafter he was healthy until 2 days prior to his present admission , when right - upper abdominal pain accompanied by chills , fever and cold sweats recurred . all vital signs were within normal limits except body temperature which was 38c . on physical examination his sclera was icteric , the hepatic edge was not palpable and no other abnormal findings were noted . laboratory data included wbc 11,600 with 76% neutrophils ; alkaline phosphatase , 21.6 ka / u ( normal 2.710 ) ; serum asparate aminotransferase ( got / gpt ) , 351/318 iu./l ; and total bililubin / direct bililubin 3.7/1.5 mg / dl . initially the patient s condition was diagnosed as obstructive jaundice with cholangitis . on the 2nd hospital day , endoscopic retrograde cholangiography was performed revealing a large stone ( 622.0 ) ( fig . 1 ) in the common bile duct which was partially removed by endoscopic papillotomy and lithotripsy with irrigation . 4 days later , right - upper abdominal pain returned and a follow - up e.r.c.p . showed a large stone ( 333 ) impacted in the orifice of the papillotomy site ( fig . after widening the papilla by cauterization and incision a wire was inserted through the papillotomy site into the bile duct , and by repeated crushing and extraction the remaining stones were removed ( fig . 3 ) . the e.r.c.p . performed 2 days after those procedures showed air bubbles in the common bile duct but no definite stone shadows were visualized ( fig . the development of endoscopic retrograde cholangiography as a diagnostic tool for biliary tract and pancreatic disease , has resulted in nonsurgical treatment for diseases of the biliary tract ( 14 , 8) . since endoscopic papillotomy was performed succefully in 1973(9 ) , it has also contributed to the therapeutic procedures for common bile duct stone and papillary stenosis . the main indication for endoscopic papillotomy is the extraction of common bile duct stones from cholecystectomized elderly or high risk patients . however , endoscopy should not be routinely performed in patients with common bile duct stones larger than 2.5 cm in diameter because of complications and frequent failures ( 5 , 6 ) . following papillotomy the majority of common bile duct stones were extracted with the aid of a basket or passed spontaneously ( 6 ) , but more than 10% of the stone were not extracted easily due to their large size or a narrowing of the bile duct above the papilla . although there is a report that some large stones may pass spontaneously ( 10 , 11 ) , most can not be extracted despite a large papillotomy which may result in complications . to overcome these problems , nonsurgical mechanical procedures such as electrohydraulic lithotripsy , dissolution therapy , and lithotripter have been developed with varing sucess(12 ) . while ejectrohydraulic lithotripsy and dissolution therapy have failed to gain wide acceptance because of technical problems and adverse reactions(13 , 14 ) , mechanical lithotripsy has proved to be of value(14 , 15 ) . presently some centers report a high suscess rate(97% ) with few complications using this method(12 ) . it is difficult to conclude that the endoscopic papillotomy is always more effective than surgical procedures for the treatment of common bile duct stones ( including large ones ) , but it has definite advantages in some selected cases .

a previously cholecystectomized man presented on endoscopic retrograde cholangiography with a large stone ( 622 cm ) in the common bile duct.the patient refused surgical removal of the stone , so although endoscopic papillotomy was contrainicated , it was attempted . herein is presented a case report of successful removal of a large stone by endoscopic papillotomy and lithotripsy with no significant complications .

barrett s oesophagus ( bo ) was endoscopically defined by the presence of at least 2 to 3 cm of columnar epithelium in the lower oesophagus . recently , the global evidence - based consensus of montreal defined barrett oesophagus as columnar metaplasia lining the distal oesophagus , with specialized intestinal metaplasia ( i m ) with goblet cells , or gastric metaplasia with cardial type or fundi - coxyntic type mucosa . the main feature of intestinal metaplasia is the presence of alcian blue - positive mucin - producing goblet cells . moreover , in clinical practice , the finding of cardial and/or fundic mucosa without intestinal metaplasia in the distal oesophagus is frequent and it has been reported as columnar - lined oesophagus ( clo ) . however , it probably represents an early reflux - lesion preceding an evident barrett phenotype with goblet cells , in keeping with previous studies showing that ck7 is a marker related to early phase of gastroesophageal reflux , and it is present also in clo biopsies lacking of i m . bo with i m represents an important risk factor for oesophageal adenocarcinoma , in keeping with the progression sequence metaplasia - dysplasia - adenocarcinoma . hypothesized that patients with cardial metaplasia could potentially progress towards dysplasia and adenocarcinoma through i m . instead , few and controversial data are reported in the literature about the progression risk of clo lacking of i m , giving rise to a question about the clinical management of this lesion . on this basis , we studied a series of oesophageal biopsies from patients with endoscopic abnormalities related to columnar metaplasia , by performing some double and triple immunohistochemical / histo - chemical stains ( ck7/alcian / pas , p53/alcian/ pas , aurora a / alcian / pas ) in order to simultaneously assess the mucinous histochemical features of the cells with aberrant expression of such antigens . the aim of the study was to evaluate if some immunophenotypic changes were present in clo cases without i m and if these changes could precede the appearance of the goblet cells or may be present independently of them . aurora a maps in 20q13.2 , a chromosomal region frequently amplified and over - expressed in several human malignancies ( breast , bladder , prostate , ovary , colon and pancreas ) . recently its expression was evidenced in barrett adenocarcinoma and in clo . in experimental studies , the over - expression of aurora a was oncogenic and constantly associated with mutation of the gene tp53 that , becoming unable to block the kinase activity of the aurora a , leads to a strong accumulation of extra - copies of centrosomes . cells without a functional p53 and with high levels of aurora a are characterized by repeated cell cycles , until they become aneuploid . these observations identify the protein aurora a as a prognostic marker , being itself an accomplice of carcinogenesis . to our knowledge , this is the first study in which a combined immunohistochemical/ histochemical method has been applied in the study of barrett pathology . this is a retrospective study performed on 57 biopsies obtained from h. pylori - free patients showing columnar metaplasia of the lower oesophagus at the endoscopy . the cases were retrieved from broader clinical records , consisting of 819 oesophageal biopsies collected between june 2006 and june 2012 and comprising 228 cases ( 27.8% ) of columnar metaplasia ( 135 with bo and 93 with clo ) and 26 cases of adenocarcinoma ( 3.1% ) . formalin - fixed , paraffin - embedded specimens were retrieved from the archives of the department of pathology , university of palermo ( italy ) . for each patient , 4-quadrant biopsy specimens have been taken every 2 cm and stained with hematoxylin - eosin and alcian - pas . the patients were divided into three groups : i ) group a , 20 bo cases consisting of i m , with alcian blue - positive goblet cells ; ii ) group b , 17 cases of clo consisting of pas+ columnar metaplasia without alcian blue positive goblet cells ; iii ) group c , 20 cases with intermediate features of transitional metaplasia ( tm ) , consisting of pas+ columnar mucosa with only few cells showing initial production of acid - alcian blue positive - mucins , but devoid of goblet cell morphology . the combined staining method consists of two steps : in the first step an immunohistochemical staining was performed , according to the manufacturer s instructions ( universal lsaab kit , dako ) . primary antibodies used in this study were : ck7 ( clone sp52 ; 1:100 ; ventana ) , p53 ( clone do7 ; 1:200 ; ventana ) and aurora a ( clone ep1008y ; 1:100 ; epitomics ) . immunohisto -chemical positivity was considered significant when it was cytoplasmic for ck7 , nuclear for p53 and nuclear or nuclear / cytoplasmic for aurora a. as positive control for aurora a and p53 , we referred to a case of adenocarcinoma arising in the lower oesophagus ( barrett adenocarcinoma ) . for aurora a and p53 , the positivity in at least 3% of the nuclei was considered significant . for ck7 , cytoplasmic staining in at least one gland negative controls , lacking primary antibody incubations , were included for each immunohistochemical run . in the second step , a histochemical staining was performed on the same sections previously subjected to the immunohistochemical assay . at first , alcian blue staining was performed and the results of this double immunohistochemical / histochemical staining were observed . subsequently , pas staining was added ( triple staining ) and the results were observed again . the histochemical stainings were performed with only minor modifications according to poletti et al . for alcian blue staining , the sections were stained with alcian blue solution ( ph 2.5 ) for 30 min at room temperature , washed in running tap water for 10 min , rinsed in di water , counterstained in mayer s hematoxylin for 5 min and washed in di water . the acetic acid as mordant was not used because it has no effect on the final results . for pas staining , sections were oxidized in 0,5% periodic acid solution for 5 min , rinced in di water , placed in schiff reagent for 15 min , washed in tap water for 5 min , counterstained in mayer s hematoxylin for 1 min and washed in di water . finally , the slides were dehydrated , cleared and mounted . differentiation with hydrochloric acid was omitted because it markedly reduces tissue antigenicity and causes fading of the chromogenic reaction when the immunohistochemical staining is performed before pas staining . a case of adenocarcinoma of the lower oesophagus ( barrett adenocarcinoma ) is showed in figure 1a . the tumor exhibited strong nuclear positivity for p53 and aurora a ( figure 1b ) and it was used as positive control for the immunohistochemical stains with these antibodies . ck7 was positive in all the three groups ; it was more diffusely and strongly expressed in group a , while focally and more weakly in groups b and c. group a. both aurora a and p53 immunostainings were positive in the nuclei of alcian blue+ goblet cells in 6 of 20 cases ( figure 2a ) . noteworthy , they were positive also in nuclei of pas+/alcian blue negative columnar cells , whereas adjacent alcian blue+ goblet cells were negative [ figure 2b ] . group b. eight of 17 cases showed focal nuclear positivity for aurora a and p53 in pas+/alcian blue negative columnar cells ( figure 3 b , c ) . noteworthy , ck7 was expressed just in the same aurora a / p53 positive areas ( figure 3d ) . group c. four of 20 cases showed positive immunostaining both for aurora a and p53 . aurora a was positive both in alcian blue - negative cells ( figure 4a ) and in cells with initial production of alcian blue - positive mucins , but lacking of goblet cell morphology ( cells with intermediate features between i m and clo ) ( figure 4b ) . as in the previous group , p53 and ck7 were expressed in the same areas , despite the absence of i m . noteworthy , the sequential histochemical steps of the double and triple staining did not affect the immunohistochemical results obtained in the previous step . the combined use of immunohistochemical / histochemical staining methods has rarely been reported in the literature . wong et al . used the double alcian blue / chromogranin a and alcian - blue / mib-1 staining in specimen of gastric mucosa with intestinal metaplasia and neuroendocrine hyperplasia , to distinguish the proliferating cellular component . to our knowledge , a double histochemical / immunohistochemical method has not been applied to the study of oesophageal pathology . in our study , all the cases stained positively , at least focally , for ck7 , considered an early marker of gastroesophageal reflux because it is usually absent in normal fundic and cardial mucosa , but present in columnar metaplastic mucosa of the oesophagus , including cases lacking of i m . furthermore , our study showed nuclear expression of aurora a kinase in columnar metaplasia lacking of goblet cells ( group b ) , often correlating with p53 nuclear expression . the aurora a kinase belongs to serine / threonine group of kinases that operate as key regulators of mitosis and it has a role in the cell cycle progression . several studies showed that a deregulation in the expression and activity of this protein leads to defects in the assembly of the centrosome and of the mitotic spindle , aneuploidy , genetic instability and tumourigenesis . nuclear positivity has been reported in hormone - related ( breast , ovary and prostate ) human cancers associated with a poor outcome , but not in non - hormone responsive conditions , such as in the oesophageal columnar metaplasia and in the barrett adenocarcinoma . previously , we evidenced the overexpression of aurora a with rt - pcr in cases of columnar mucosa with and without i m . in the present study , we evidenced aurora a immunohistochemical overexpression in the nuclei of pas+ cells . in the group a we found nuclear aurora a - positive staining in some alcian blue+ goblet cells of barrett mucosa , but , noteworthy , other goblet cells did not stain for aurora a , whereas the adjacent pas+ columnar cells stained positively . this is in keeping with the findings of group b cases , lacking of i m , in which aurora a was present in the nuclei of pas+ columnar cells . the over - expression of aurora a in non - goblet cells may support the recently introduced conception of bo without intestinal metaplasia , in contrast with the definition in which the goblet cells represented an essential prerequisite for the diagnosis of bo and an obliged step in the cancer progression . in fact , the definition of bo is still confusing and ambiguous . according to the american college of gastroenterology and to the american gastroeneterological association , intestinal metaplasia is the only type of oesophageal columnar epithelium that clearly predisposes to malignancy and it is still required for the diagnosis of bo . furthermore , our findings are in keeping with kelty et al . , who observed that patients with clo lacking of i m on biopsy have a similar cancer risk to those with specialized i m , so they conclude that i m is not essential for cancer risk . of course , since the carcinogenesis is a multistep process consisting of many overlapping mutations , the over - expression of aurora a in the columnar mucosa , with or without i m , should not be considered a condition necessarily leading to the tumour , but a potentially reversible condition after stopping or decreasing of the stimulus . the appearance of aurora a and p53 nuclear positivity , together with the reflux - related ck7 cytoplasmic positivity , in areas lacking of i m , could suggest another way besides the traditional im - dysplasia - adenocarcinoma sequence . in keeping with our immunophenotypical findings , we hypothesize a cancer sequence , in which ck7/ auroraa / p53/pas+ columnar mucosa could represent an intermediate step of the carcinogenesis , independently from the presence of intestinal alcian blue+ goblet cells ( figure 5 ) . recently , in fact , adenocarcinoma of gastroesophageal junction arising from cardial type metaplasia have been described , suggesting again the hypothesis of a double pathway previously reported by us . noteworthy , in our study , consisting of 819 oesophageal biopsies collected between june 2006 and june 2012 , we found 26 cases of adenocarcinoma ( 3.1% ) , 25 of which aroused in patients without a known clinical history of bo , lacking previous endoscopy and never treated with gerd therapy . on the contrary , none of 228 patients with endoscopic and histologic columnar - lined oesophagus ( 135 with bo and 93 with clo ) , treated with constant therapy for gerd symptoms , developed a high - grade dysplasia / adenocarcinoma , during a mean follow - up of 5 years ( range 1 - 12 ) with bi - annual endoscopy and biopsy . only one case of clo , untreated , progressed to bo with dysplasia ( figure 6 ) . given our results , we think that the immunophenotypical alterations ( such as aurora a and p53 expression ) in some cells of clo cases could be by themselves responsible of a risk progression , despite the absence of i m . therefore , in our view , also clo patients require an appropriate management , because the outcome is not ab initio predictable . of course , in consideration of the low risk of cancer progression , both in clo and bo patients treated with ppi therapy , and of the necessity to refine the surveillance program to obtain a good cost / benefit ratio , we think that a more long - term interval of endoscopies ( e.g. , a 3-year interval ) could be enough if bo and clo cases are properly treated . ppi therapy , in fact , could be useful not only for the gerd symptoms but also to reduce the risk of cancer progression . in conclusion , the combined staining method allowed us to simultaneously evidence the type of mucins produced by the columnar cells and the immunophenotypical expression of aurora a , p53 and ck7 that may be indicative of an early phase of the carcinogenetic pathway independently from the i m step .

intestinal metaplasia in barrett s oesophagus ( bo ) represents an important risk factor for oesophageal adenocarcinoma . instead , few and controversial data are reported about the progression risk of columnar - lined oesophagus without intestinal metaplasia ( clo ) , posing an issue about its clinical management . the aim was to evaluate if some immunophenotypic changes were present in clo independently of the presence of the goblet cells . we studied a series of oesophageal biopsies from patients with endoscopic finding of columnar metaplasia , by performing some immunohistochemical stainings ( ck7 , p53 , auroraa ) combined with histochemistry ( alcian - blue and alcian / pas ) , with the aim of simultaneously assess the histochemical features in cells that shows an aberrant expression of such antigens . we evidenced a cytoplasmic expression of ck7 and a nuclear expression of aurora a and p53 , both in goblet cells of bo and in non - goblet cells of clo , some of which showing mild dysplasia . these findings suggest that some immunophenotypic changes are present in clo and they can precede the appearance of the goblet cells or can be present independently of them , confirming the conception of bo as the condition characterized by any extention of columnar epithelium . this is the first study in which a combined immunohistochemical / histochemical method has been applied to barrett pathology .

among the many causes of dyspnea associated with ph in a patient with history of cancer , paraneoplastic thrombotic pe is the most common aetiology and must be considered in priority . but tumour cells can metastasize in the pulmonary vasculature in three mechanisms : occlusion of the small pulmonary arteries , pulmonary tumour thrombotic microangiopathy , or reach the lymphatic system . a 72yearold woman was admitted to a hospital 2 months ago for exerciseinduced dyspnea . she had history of left breast cancer pt2pn1m0 treated 2 years before with mastectomy , chemotherapy , and chest radiation . ddimer serum level was elevated , so a ct angiogram was performed and showed no evidence of pulmonary embolus , whereas ventilation perfusion lung scan revealed two perfusion defects throughout superiors lobes with normal ventilation . distal pe was suspected , and oral anticoagulation therapy was initiated and the patient discharged . two months later , an echocardiogram revealed elevated right ventricular systolic pressure at 78 mmhg . the right ventricle was moderately dilated ( 30 mm ) , nonhypertrophic , with good systolic function . she had severe hypoxemia of 52 mmhg , a ph of 7.46 , a pc02 of 34 , and hco3 of 24 mmol / l with 10 l / min of oxygen . the pulmonary function tests , the viral serologies , and the immune checkup were normal . a second chest ct showed nonspecific groundglass opacities and lung fibrosis consistent with previous radiation therapy but no sign of pe , nor interlobular septal thickening , adenopathy , or mass . right cardiac catheterization established precapillary ph with mean pa pressure of 48 mmhg and not elevated pulmonary wedge pressure ( 4 mmhg ) . atrial pressure was low ( 5 mmhg ) , cardiac output was normal ( 2.66 l / min / m ) , and pulmonary vascular resistance were increased at 8.6 wood units . a specific ph tritherapy was administrated ( sildenafil , ambrisartan , and epoprostenol ) , but her condition worsened rapidly with acute rhf , respiratory distress , acute renal failure , and microangiopathic hemolytic anaemia . in this context , in absence of diagnostic , we decided to withhold invasive ventilator support . the autopsy showed three etiologies of ph consistent with hematogenous metastasis of breast cancer in pulmonary vasculature : carcinomatous cell inside lymph vessels ( lymphangitis carcinomatosis ) ( figure 1 ) , tumour cell embolization inside small arteries ( tumoural cells emboli ) ( figure 2 ) and pulmonary tumour thrombotic microangiopathy ( pttm ) ( figures 3 and 4).this latter is histologically characterized by intimal and medial fibromuscular thickening with accumulation of carcinomatous cells in the residual lumen of the small arteries and arterioles . ( haematoxylin and eosin ) : tumoural cells inside lymph vessels ( black arrow ) ; pleura ( dotted arrow ) . ( haematoxylin and eosin ) : tumoural cells inside arteriole lumen ( black arrow ) ; intimal fibroblastic proliferation ( black star ) ; fibrinrich thrombus ( * ) ; internal elastic lamina destruction . ( haematoxylin and eosin ) : tumoural cells inside arteriole lumen ( black arrow ) ; intimal fibroblastic proliferation ( black star ) ; internal elastic lamina destruction ( dotted black arrow ) ; hypertrophic arteriole wall ( double black arrow ) . it was first described in 1990 in 3.3% of an autopsic series of patients , who had died of metastatic adenocarcinoma , mostly of gastric origin.1 recently , a large case series estimated the incidence of 1.4% among 2215 autopsy patients with carcinoma and confirmed the stomach as the primary site of cancer associated with pttm . most of the time , there is evidence of metastatic disease , but many occult cancers have been reported as in our description . previous studies have shown that tumour cells have the abilities to activate coagulation pathway and local thrombus formation and trigger fibroblastic intimal proliferation via production of cytokines such as tissue factor,2 vascular growth factor , or plateletderived growth factor.3 high vegf expression associated with gastric cancer could explain the high incidence of pttm . in addition to mechanical occlusion , these phenomena rapidly lead to arterioles remodelling and stenosis , increased pulmonary vascular resistance , and ph . the tumoural cells are beyond the resolution of the ct angiogram , but their presence explains the perfusion defect on lung scan . recently , a treeinbud pattern , usually seen in bronchiolitis and characterized by small centrilobular nodules and branching linear opacities , was reported on thinsection ct of pttm patients.4 disseminated intravascular coagulation5 or cancer associated hemolytic anaemia has often been described consistent with elevated ddimer . a study has estimated the median survival as 5 days from admission to hospital.6 pttm may be identified using videoassisted thoracoscopic surgery , transbronchial biopsy , right heart catheterization , and ctguided biopsy.7 in the rare antemortem diagnosis case , specific chemotherapy was administrated often associated with empiric treatment such as corticosteroids or anticoagulation . the best survival reported was 15 months probably because diagnosis was made prior to the development of ph.8 chronic pe is the main cause of unexplained progressive dyspnea with precapillary ph in the context of cancer . but when large proximal pe is absent in ct angiogram whereas lung scan show multiple perfusion defects , clinicians must consider other tumoural embolic causes in the differential , especially pttm . thereby , they will be able to perform pulmonary cytology or biopsy before the patient 's condition deterioration . a rapid specific chemotherapy administration is the only way to improve the survival of patients .

abstracta 72yearold woman with history of breast cancer only treated surgically was referred to our department for pulmonary hypertension ( ph ) suspicion . echocardiogram revealed elevated right ventricular systolic pressure . computed tomography ( ct ) angiogram showed no pulmonary embolism ( pe ) , but lung scan revealed two ventilationperfusion mismatch areas . right cardiac catheterization established precapillary ph . despite treatment with ph specific therapy ( sildenafil , ambrisentan , and epoprostenol ) , her condition worsened rapidly with acute right heart failure ( rhf ) . she died 22 days after admission . postmortem microscopic examination showed a rare combination of ph etiologies consistent with metastasis of breast cancer in pulmonary vasculature including the rare pulmonary tumour thrombotic microangiopathy ( pttm ) .

pancreatic fistula is a disease state that is characterized by the extrapancreatic leakage of pancreatic juice caused by pancreatic duct disruption , resulting from acute pancreatitis , chronic pancreatitis , trauma , and postoperative complications . pancreatic fistulas can be caused by acute pancreatitis , an acute exacerbation of chronic pancreatitis , traumatic disease , postoperative complications , and pancreatic tumors . apart from postoperative complications , the most common causes of pancreatic fistula are pancreatitis and trauma . as for the pathogenesis of pancreatic fistula , local acute inflammation occurring around the primary branch of the pancreatic duct and occlusion of the pancreatic duct by a protein plug are thought to disrupt the peripheral pancreatic ducts , causing the formation of a pancreatic pseudocyst , which ruptures , leading to the development of a pancreatic fistula ( 1,2 ) . an external pancreatic fistula communicates with the body surface , and an internal pancreatic fistula communicates with other organs in the body cavity . pancreatic pleural effusion results from the leakage of pancreatic fluid from the backside to the head of the pancreas into the thoracic cavity ( 2 - 4 ) . the symptoms of a pancreatic fistula are diverse and depend on the site of the fistula . we herein describe our experience with a patient who had a pancreatic fistula that extended into the thigh . the fistula was caused by the rupture of an intraductal papillary mucinous neoplasm ( ipmn ) of the pancreatic head . the patient was an 80-year - old man who presented at the department of orthopedics in our hospital because of a fever of several days in duration and pain , swelling , and redness of the right thigh ( fig . as for the patient 's life history , the patient had smoked 10 cigarettes per day for 10 years and consumed 33 g of alcohol per day for 40 years . blood tests ( on admission showed ) an elevated c - reactive protein level , hypoalbuminemia , and high serum levels of lactic acid dehydrogenase , creatine phosphokinase , amylase , glucose , and creatinine ( table 1 ) . magnetic resonance imaging ( mri ) fat - suppressed t2-weighted images showed high signal intensity in the quadriceps femoris muscle , the gracilis muscle , and the semimembranosus muscle , suggesting the presence of necrotizing fasciitis . blood tests on day 5 ( table 2 ) showed that the serum amylase level ( 1,627 although there was no abdominal pain , the possibility of acute pancreatitis could not be excluded . abdominal computed tomography ( fig . fluid retention was seen in the region from the pancreatic head to the region around the right kidney and the right iliopsoas muscle , suggesting the presence of inflammatory changes caused by pancreatitis . the amylase levels in the exudate of the right thigh and the ascitic fluid were very high ( 21,802 the cause of prolonged inflammation of the right thigh was suspected to be a pancreatic fistula that had been caused by the rupture of an ipmn of the pancreatic head . on day 14 , endoscopic retrograde cholangiopancreatography was performed in order to place a pancreatic stent ( fig . although we could not find an obvious leak from the pancreatic ducts , the contrast medium washed out quickly and was suspected to have leaked into the retroperitoneal space . we chose to perform internal drainage because of the risk of self - removal associated with external drainage . subsequently , the patient 's general condition deteriorated despite conservative therapy , and he died of septic shock on day 23 . a picture of the right femoral region on admission . after a tentative incision was made , redness and swelling were observed in the right femoral region . a : a t1-weighted image , showing moderate - to - high signal intensity around the muscle . b : a fat - suppressed t2-weighted image , showing high signal intensity in the quadriceps femoris muscle , the gracilis muscle , and the semimembranosus muscle . the laboratory data on day 5 . a , b : atrophy and degeneration associated with a lack of parenchyma were observed in part of the uncinate process and the body of the pancreas . c , d : fluid retention extended from the duodenum to the right anterior pararenal space , the perirenal space , and the posterior pararenal space ( circle ) . e : fluid retention ( circle ) extended to the thigh over the ilium at the level of the femoral artery and vein ( arrowheads ) . magnetic resonance cholangiopancreatography . this image was not clear because of an artifact and the presence of a large amount of ascites . a : pancreatography showed the cystic dilation of a branch of the pancreatic duct at the head of the pancreas ( arrow ) . mild stricture was found in the main pancreatic duct at the head of the pancreas . b : although we could not find an obvious leak from the pancreatic ducts , the contrast medium washed out quickly . c : endoscopic pancreatic sphincterotomy was performed and a 7-french , 12-cm pancreatic stent was placed in the main pancreatic duct . macroscopically , an elastic soft mass ( 685 cm ) was found to extend from the pancreatic head and surround gerota 's fascia of the right kidney . the cut surface of the mass showed cystic lesions of various sizes at the pancreatic head and discharged milky - white viscous fluid ( fig . the structures of the body and tail of the pancreas were relatively well preserved ( fig . histologically , atypical papillary proliferation was observed in some of the cystic lesions at the pancreatic head , indicating the presence of an intraductal papillary mucinous adenoma ( ipma ) of the pancreas ( fig . some of these cystic lesions were contiguous with the connective tissue around the pancreas , suggesting that the partial rupture of the ipma caused the pancreatic fistula . accessory lesions , including intraperitoneal fat necrosis , extensive fat necrosis in gerota 's fascia of the right kidney , extensive necrosis of the right retroperitoneum , necrosis that was predominantly located around the subcutaneous tissue of the right thigh and femoral muscle were observed , and 4,000 ml of transparent yellow ascites was present . these findings demonstrated that rupture of the ipmn of the pancreatic head had caused the pancreatic fistula extending into the right thigh . the pathological findings . a : an elastic soft mass ( 685 cm , circle ) extended from the pancreatic head and surrounded gerota s fascia of the right kidney . b : the cut surface of the pancreatic head showed the presence of cystic lesions of various sizes , with the leakage of milky - white viscous fluid ( arrowhead ) . the rupture point of the ipmn could not be located due to the presence of inflammation , necrosis , and fibrosis . c : an enlarged view of the square area of b. d ( 20 ) : the histological findings of pancreatic head showed the presence of cystic lesions of various sizes . e : macroscopic findings showed that the structures of the tail ( circle ) of the pancreas were relatively well preserved . f ( 200 ) : the histological findings showed that the acinar structures of the tail of the pancreas were relatively well preserved ; small regions of fat necrosis were sporadically found and hyalinization of the islets of langerhans had occurred due to diabetes mellitus . g ( 200 ) : atypical papillary proliferation was found in some of the cystic lesions at the pancreatic head , indicating the presence of an intraductal papillary mucinous adenoma ( ipma ) of the pancreas . we searched the pubmed / medline and embase databases using the terms ipmn and rupture as keywords and found 2 previously reported cases in which the leakage of pancreatic juice into the peritoneal cavity was caused by the rupture of an ipmn . the ipmn was located in the head of the pancreas in 1 patient , the body and tail of the pancreas in 1 patient , and the tail of the pancreas in 1 patient . the tumor diameters were 20.0 cm , 8.5 cm , and 8.0 cm , respectively . right femoral pain was the initial symptom in 1 patient ; the other 2 patients had no symptoms . the pathological diagnosis was adenoma in 1 patient , a borderline lesion in 1 patient , and cancer in 1 patient . two patients were alive at the time of the reports , and 1 patient had died . no previous studies have reported that the leakage of pancreatic juice due to the rupture of an ipmn had effects on organs other than those located around the pancreas . to our knowledge , this is the first report of the rupture of an ipmn causing a pancreatic fistula extending into the right thigh . ns : not stated , dp : distal pancreatectomy , b : borderline ( moderate dysplasia ) , iv : invasive carcinoma , a : adenoma , sc : systemic chemotherapy , dwd : dead with disease pancreatic fistulas are often associated with symptoms that suggest the involvement of other organs , which makes them difficult to diagnose . our patient had thigh pain and elevated levels of pancreatic enzymes , but no abdominal pain . a considerable amount of time was therefore required to reach a diagnosis . some patients with pancreatic pleural effusion have only respiratory symptoms caused by pleural effusion , which may lead to a delayed diagnosis ( 7 ) . maule et al . described a patient who had a fistula extending from the retroperitoneum to the inguinal region that was caused by a pancreatic pseudocyst . the patient had only inguinal pain and elevated levels of pancreatic enzymes , but no abdominal pain ( 8) . other case reports have documented a patient with a urethral obstruction caused by a pancreatic fistula that developed after pancreatitis ( 2 ) , and a patient with dyspnea and bloody sputum caused by a pancreatic fistula that extended to the bronchi ( 9 ) . in our patient , the amylase levels in the ascitic fluid and the exudate from the thigh were high . we had observed the ipmn of pancreas head and the background pancreas showed no evidence of chronic pancreatitis ( a possible cause of a pancreatic pseudocyst ) . at autopsy , the cystic lesions in the pancreatic head were found to be contiguous with the connective tissue around the pancreas . these findings suggested that the rupture of part of the cystic component of the ipmn caused the pancreatic fistula . the leaked pancreatic juice might have passed through the retroperitoneum and moved along the right kidney and the iliopsoas muscle to arrive at the thigh ( fig . we thought that there were two main reasons why the pancreatic fistula extended into the thigh . first , the iliopsoas muscle originates along the lateral surfaces of the vertebral bodies of t12 and l1-l3 and the iliac fossa of the pelvis , and crosses the hip joint , inserting into the lesser trochanter of the femur . secondly , the force of gravity and vibration might have caused the leaked pancreatic juice to descend from pancreatic head towards the thigh because the patient had walked all day before the appearance of the symptom . as for the cause of ipmn rupture , pancreatography showed no distinct evidence of a filling defect , which would have suggested a protein plug . however , pancreatic duct stenosis was present at the head of the pancreas , and the flow of pancreatic juice was interrupted by a protein plug and mucus , which most likely increased the internal pressure of the ipmn , leading to its rupture ( 2 - 4 ) . a patient in whom a rupture of the main pancreatic duct was caused by pancreatic duct obstruction due to mucus produced by ipmn ( 4 ) and a patient in whom a pancreatobiliary fistula was caused by ipmn have also been reported ( 10 ) . in our patient , a pancreatic fistula was suspected , and a pancreatic stent was placed on day 14 in order to prevent the leakage of pancreatic juice into the fistula . studies showing that the use of a pancreatic stent was effective for the management of pancreatic fistulas associated with surgery or trauma have been sporadically reported ( 11 - 14 ) . in our patient , iu / l to 435 iu / l after the placement of the pancreatic stent , suggesting that the pancreatic stent suppressed the leakage of pancreatic juice into the fistula ( fig . however , considerable time was required to diagnose the pancreatic fistula , which resulted in the deterioration of the patient 's general condition and death . we described our experience with a patient who had a pancreatic fistula extending into the thigh that was caused by rupture of an ipmn of the pancreas . pancreatic fistulas occasionally present with symptoms related to other organs , causing difficulty in diagnosis . the possibility of a pancreatic fistula should be considered when patients with nonpancreatic symptoms present with elevated levels of pancreatic enzymes in their serum or pancreatic fluid . a schematic illustration of the pancreatic fistula extending into the right thigh . the leaked pancreatic juice might have passed through the retroperitoneum and moved along the right kidney and the iliopsoas muscle to arrive at the thigh . a : frontal view . ( p : pancreas , k : kidney , i : iliopsoas ) the time course of the serum amylase level . the serum amylase level increased after admission due to the worsening of the patient s pancreatitis , and decreased after the opening of the incised wound in the femoral region .

we herein report the first case of a pancreatic fistula extending into the thigh caused by the rupture of an intraductal papillary mucinous neoplasm ( ipmn ) of the pancreas . an 80-year - old man was suspected to have necrotizing fasciitis because of right femoral pain . computed tomography showed fluid retention from the pancreatic head to the right iliopsoas muscle and an ipmn at the pancreatic head . the findings of endoscopic retrograde pancreatography led to the suspicion of a minor leak and a pancreatic stent was placed . the patient died due to an uncontrollable infection . a pathological autopsy showed a pancreatic fistula extending into the thigh that had been caused by the rupture of the ipmn .

the purpose of this study was to define the frequency of fasting and incidence of complications among libyan diabetic patients during ramadan . benghazi is the second largest city in libya with population of about 670,797 inhabitants and 14.1% prevalence rate of diabetes mellitus ( dm ) ( 6 ) , with type-1 constituting about 6% of all cases . we interviewed and reviewed the records of 493 consecutive diabetic patients who attended the benghazi diabetes and endocrine center ( bdec ) during the first week after eid elfitr 1429 hijri ( 2008 ) , and a standard form was filled by the authors . the following parameters were assessed : age , sex , type of diabetes , duration of diabetes , type and doses of treatment before and during ramadan , level of hba1c within three months before ramadan , number of non - fasted days , causes of breaking the fast , number and time of self - reported hypo- and hyperglycemic episodes , and any history of hospital admission during the preceding ramadan and the reason for it . hypoglycemia was defined as symptoms that were perceived by the patient as hypoglycemia and urged him / her to break fast with or without documented low blood glucose , and it was categorized as severe or mild . a severe hypoglycemic episode was defined as the episode that could not be treated by the patient alone , but required assistance from another person , whether a physician or not . mild hypoglycemia was defined as a hypoglycemic episode that was treated by the person with diabetes alone without need for assistance . severe hyperglycemia was defined as a self - reported blood glucose level 300 mg / dl . data were expressed as meanstandard deviation ( sd ) and differences between groups were tested using the chi - squared test and independent - samples t - test . data were expressed as meanstandard deviation ( sd ) and differences between groups were tested using the chi - squared test and independent - samples t - test . of the 493 patients , 95% were type-2 diabetics , 50.3% were males and 39% had their hba1c checked within three months before ramadan . mean age was 5911.7 years , mean duration of diabetes was 11.310 years , and mean hba1c ( for those who had hba1c results ) was 7.81.6 . about 70.4% of patients completed 30 days of fasting and 97.5% fasted at least 15 days ( table 1 ) . the main reason of breaking the fast was hypoglycemia ( 43.4% of causes ) followed by severe hyperglycemia ( 27% ) , while other causes constituted about 30% ( fig . about 14.6% experienced mild hypoglycemia , 3.2% had severe hypoglycemia and 11.2% had severe hyperglycemia . there was no significant difference between type-1 and type-2 diabetics regarding number of days fasted , frequency of hypoglycemia or severe hyperglycemia , or admission rate during ramadan ( table 2 ) . among type-2 diabetic patients during ramadan fasting , 77.3% were on insulin therapy , 20.5% were on oral anti - diabetics , and 2.2% were on diet control alone . there was no significant difference between those who were treated with insulin or with oral anti - diabetic agents in the mean hba1c , mean number of fasted days , admission rate or incidence of hypoglycemia , or severe hyperglycemia ( table 3 ) . hba1c checked 3 m : percent of patients who had their hba1c checked within three months before ramadan . comparison between type-1 and type-2 diabetics comparison between type-2 patients according to the type of treatment the incidence of hypoglycemia during ramadan was 31 episodes/100 patients , while the incidence of severe hyperglycemia was 17 episodes/100 patients ( table 4 ) . about 74% of hypoglycemic episodes and 79% of hyperglycemic episodes occurred during the first two weeks of ramadan ( fig . 2 ) , and about 90% of all hypo- and hyperglycemic episodes occurred during the daytime . females had a significantly higher frequency of severe hypoglycemic episodes ( 4.9% vs. 1.6% , p=0.04 ) and a lower mean number of fasting days than males ( 27.85.9 vs. 29.242.6 , p=0.001 ) . patients who experienced severe hyperglycemia had a significantly higher baseline hba1c than other patients ( 8.41.1% vs. 7.61.6% , p=0.02 ) . they also had a significantly lower mean number of fasting days ( 26.95.7% vs. 294 , p=0.001 ) . both type-1 and type-2 diabetic patients in benghazi managed to fast more frequently than diabetics in other muslim countries , with a remarkably lesser frequency of hypo- and hyperglycemia ( table 5 ) . it is possible that libyan diabetics are more motivated to fast than those in other muslim countries . more likely , however , is that about three - quarters of the libyan patients had some treatment adjustment during ramadan as compared to less than one - third of those in the epidiar study ( 1 ) , which probably contributed to the lower rate of hypo- and hyperglycemia , and hence to a lower frequency of breaking the fasting . comparison between bdec study and epidiar study the most common complications that occurred during ramadan were hypoglycemia followed by hyperglycemia , and these were the main two reasons for breaking the fast , as reported elsewhere ( 1 ) . however , both types of episodes were remarkably less frequent during the last two weeks as compared to the first two weeks , perhaps because patients adjust their dietary habits and schedules to suit their condition as the days go by . the definition of hypoglycemia used in this study depended mainly on patients ' perception of symptoms , which means that in principle episodes of hypoglycemia might go unnoticed . however , patients are probably unlikely to miss feeling a hypoglycemic episode because it would become exacerbated as the fasting continued during the day . on the other hand , we might have included some non - hypoglycemic episodes that were interpreted as hypoglycemia by the patients . therefore , we believe that the reported figure of the frequency of hypoglycemic episodes might be a slight overestimate rather than an underestimate of the frequency of these episodes . there was no significant difference between type-1 and type-2 diabetics regarding fasting rate , admission rate and frequency of hypo- and hyperglycemic episodes during ramadan . these results are contrary to the reported higher risk of complications in type-1 patients during ramadan fasting ( 7 ) . the mean hba1c in type-1 patients was 8.21.7% , which is above the currently recommended goal of < 7% . if type-1 patients had a strict glycemic control with mean hba1c level lower than 7% , it would be more likely that they will get a more frequent hypoglycemic episodes . nevertheless the number of type-1 diabetics in this study was too few to draw conclusions . patient education and adjustment of doses throughout ramadan is needed to decrease the risk of both hypo- and hyperglycemia . further large studies are needed to study the effects of ramadan fasting on type-1 diabetic patients in libya . the authors have not received any funding or benefits from industry to conduct this study .

backgroundthe epidemiology of diabetes and ramadan fasting was reported from many muslim countries , but not from libya.methodologywe interviewed 493 consecutive diabetic patients at benghazi diabetes and endocrine center for the potential complications of fasting during ramadan.resultswe found 70% of diabetic patients completed the 30 days of ramadan fasting . hypo- and hyperglycemia was the most commonly reported complications especially during the first two weeks of ramadan month.conclusionit seems majority of diabetic patients in libya manage to fast during ramadan month . patient education and early planned adjustment of diabetic medication is needed to decrease the frequency of diabetic complication during ramadan month .

lightning provides the most powerful natural accelerator available on earth for producing high - energy particles . intense millisecond - scale bursts of gamma - rays produced by upward moving electrons accelerated to energies of tens of mev or more have been detected with satellite instruments . these terrestrial gamma flashes ( tgfs ) have been shown to be associated mainly with positive polarity intracloud lightning , with the particle acceleration occurring at altitudes of 1015 km . we show here that negative polarity cloud - to - ground lightning accelerates particles downward and produces gamma - rays with energies of at least 2 mev . we present a sample of 24 tgfs detected at ground level associated with nearby ( < 5 km ) lightning observed over approximately 2.6 years mainly during spring and summer thunderstorms in louisiana . tgfs were first observed by the burst and transient source experiment ( batse ) aboard the compton gamma - ray observatory [ fishman et al . , 1994 ; gjesteland et al . , 2012 ] and have now been observed by five additional satellite detectors the reuven ramaty high energy solar spectroscopic imager ( rhessi ) [ smith et al . , 2005 ; grefenstette et al . , 2009 ] , the gamma - ray imaging detector [ marisaldi et al . , 2010 ] and minicalorimeter [ marisaldi et al . , 2011 ; tavani et al . , 2011 ] on astro - rivelatore gamma a immagini leggero ( agile ) , and the gamma - ray burst monitor ( gbm ) [ cohen et al . , 2010 ; fishman et al . , 2011 ; briggs et al . , 2013 ] and large area telescope [ grove et al . , events are typically detected close to the subsatellite point [ grefenstette et al . , 2009 ] and are correlated both with regions of high thunderstorm activity [ cohen et al . 2011 ] and with individual positive polarity intracloud ( + ic ) and possibly positive cloud - to - ground ( + cg ) lightning discharges to within 12 ms [ inan et al . , 2006 ; ( positive polarity is needed to produce the upward beam of electrons and secondary photons necessary for detection of tgfs from space [ dwyer , 2003 ; cohen et al . , lightning flashes are known to emit a large fraction of their electromagnetic energy into low - frequency ( 0.330 khz ) atmospheric radio signals ( sferics ) , which can be located accurately by arrival time measurements in a worldwide radio receiver network [ rodger et al . , tgfs are well correlated both with sferics [ inan et al . , 2006 ; connaughton et al . , 2013 ] and the lightning imaging sensor - optical transient detector and world wide lightning location network ( wwlln ) high - resolution lightning data [ hazelton et al . , 2009 ; smith et al . , 2010 ; fuschino et al . , gbm has also demonstrated that in some cases , as the original gammas propagate upward through the atmosphere , they produce secondary e via pair production [ cohen et al . , 2010 ; briggs et al . , these secondaries are then able to spiral around magnetic field lines to the spacecraft far from the lightning location , producing terrestrial electron beams characterized by 511 kev signals and both long - duration pulses and delayed pulses resulting from particles moving past the spacecraft and then reflecting from magnetic mirror points and returning to be detected by gbm . given the altitude of the satellites around 500 km , the observations point to beaming of the photons upward with a 30 half - angle cone coupled with attenuation of wide - angle photons passing through greater atmospheric path lengths [ grefenstette et al . 2005 ] , dwyer and smith performed detailed monte carlo simulations showing that the spectra were consistent with bremsstrahlung from electrons accelerated by the relativistic runaway electron avalanche ( rrea ) mechanism [ gurevich et al . , 1992 ; dwyer , 2003 ] at altitudes near thunderstorm tops . over the 0.110 mev range , the spectrum observed by agile [ marisaldi et al . , 2011 ] has been well fit by a cutoff power law of the form f(e ) e e with eo compatible with the 7 mev electron energies predicted by rrea , but the observation of individual gamma - rays with energies in excess of 40 mev has posed a challenge for the emission models [ tavani et al . , 2011 ; celestin et al . , rrea models of tgfs in the atmosphere [ dwyer , 2003 , 2008 ; gjesteland et al . , 2011 ] start with mev seed electrons accelerated when lightning - associated electric fields overcome local energy losses . these accelerated electrons produce photons , secondary electrons , positrons , and x - rays by bremsstrahlung , pair creation , and compton scattering . the avalanche may be further seeded by the relativistic feedback mechanism , in which backward propagating positrons and x - rays lengthen the tgf durations up to several milliseconds as seen in satellite observations [ dwyer , 2008 ; dwyer et al . , ground - based lightning observations and comparisons of model calculations with the measured spectra indicate that the tgfs are produced at altitudes 1025 km [ dwyer and smith , 2005 ; grefenstette et al . , 2008 ; shao et al . , 2010 ; gjesteland et al . , 2010 ; cummer et al . a more detailed review of tgf models and observations is presented by dwyer et al . tgf observations from satellite platforms are limited to events apparently beamed upward and large enough to be detected even in the presence of attenuation and compton scattering by the atmosphere . although these events observed from space are extremely intense ( gamma - ray rates in excess of 300 khz measured with batse ) , the bulk of the events are presumably smaller events which can only be observed much closer to the lightning i.e . , at aircraft or balloon altitude or at ground level [ smith et al . , 2011 ; briggs et al . , 2013 ; gjesteland et al . , 2012 ; [ dwyer , 2012 ] has suggested a possible downward directed positron and gamma - ray signature from tgfs . observations at ground level are necessary to observe the downward component , to better understand the tgf intensity distribution and emission pattern , to understand whether the observed 30 beaming is intrinsic to the emission process or is the result of atmospheric attenuation , and to measure the spectrum versus altitude relationship . as a practical consideration , it has been suggested that lightning - induced gamma - rays might produce a significant radiation exposure for airplane passengers flying close to a lightning stroke [ dwyer et al . , the majority of ground - level observation projects currently focus on correlating satellite - observed tgfs with lightning and measuring possible associated magnetic signatures [ cummer et al . , 2011 ; lu et al . , the international center for lightning research and testing ( iclrt ) project , however , has reported two gamma - ray bursts , one in association with triggered lightning of negative polarity [ dwyer et al . , 2004 ] and another in association with nearby negative polarity cloud - to - ground ( cg ) lightning [ dwyer et al . , tgfs associated with negative polarity lightning strikes , as with these iclrt events , produce downward beams of photons which can be detected from the ground . iclrt operates in a triggered mode , requiring either a triggered lightning current above 6 ka or the simultaneous trigger of two optical sensors . the array of particle detectors at aragats space environment center has detected thunderstorm - associated ground enhancements above 7 mev with timescales of microseconds and tens of minutes [ chilingarian et al . these have been detected approximately once per year and seem to be correlated with ic lightning . in addition , a mountaintop detector has observed 3 ms bursts of x - rays associated with cg lightning [ moore et al . , 2001 ] . longer duration ( 40 s to minutes or longer ) x - ray and gamma - ray events have been reported previously from the ground [ tsuchiya et al . , 2011 , 2013 ] , but the only other case in which a tgf - like event with millisecond emission of mev gammas has been observed from within the atmosphere is the observation by the airborne detector for energetic lightning emissions aboard an aircraft at an altitude of 14 km [ smith et al . , we present observations from july 2010 through february 2013 of 24 tgf - like events in which 50 kev2 mev gamma - rays are observed at ground level in shorter than 5 ms bursts associated with nearby negative polarity lightning . the tgf and energetic thunderstorm rooftop array ( tetra ) consists of an array of twelve 19 cm 19 cm 5 mm nai(tl ) scintillators designed to detect the gamma - ray emissions from nearby lightning flashes over the range 50 kev2 mev . the scintillators are mounted in four detector boxes , each containing three nai detectors viewed by individual photomultiplier tubes ( pmts ) . the boxes are spaced at the corners of a 700 1300 m area on four high rooftops at the baton rouge campus of louisiana state university ( lsu ) at latitude 30.41 and longitude 91.18. unlike iclrt , tetra operates in a self - triggered mode , allowing for events to be recorded without requiring the direct detection of lightning . each tetra detector box contains three nai scintillator plates oriented at 30 from the zenith direction and separated by 120 in azimuth . each nai(tl ) crystal is hermetically sealed between a 6.4 mm thick glass optical window on one flat face and a 0.75 mm thick aluminum entrance window on the other face . an ultraviolet transmitting lucite light guide is coupled to the glass window , and the light is viewed by an electron tubes 9390 kb 130 mm photomultiplier tube with a standard bialkali photocathode . the scintillator - pmt assemblies are housed in 2.5 cm thick plastic foam insulation to prevent rapid temperature changes . electronics boards in each detector box supply high voltage , amplify and shape the pmt outputs , provide an internal trigger for the data acquisition software , digitize the data , assign timestamps , and record adc values for each event . once triggered , each pmt anode output is integrated and assigned a 12 bit analog - to - digital converter ( adc ) value . a 32 channel adc board , a lassan iq gps board , and a mesa field - programmable gate array ( fpga ) board are incorporated onto a pc104 stack controlled by a microcomputer systems vdx-6357 800 mhz 486 cpu board running a qnx operating system . the fpga is programmed to handle trigger logic , clock functionality , and event time stamping . we refer to the mesa board together with its fpga as the trigger logic module . each is capable of detecting events at a sustained rate of 30 khz and a burst rate of up to 70 khz . the data are then transferred over a wireless link to a central station for analysis . the initial version of the data acquisition software , used from october 2010 to january 2013 , utilized a network time protocol to keep timestamps accurate to within approximately 2 ms and to monitor the absolute timing uncertainty . the current version of the software , implemented in january 2013 , uses a gps - disciplined clock to produce timestamps accurate to within 200 ns . the adc - to - energy conversion is calibrated with radioactive sources ( na , cs , and co ) . individual detector energy resolution ranges from 9 to 13.5% full width at half maximum ( fwhm ) at 662 kev and from 5.5 to 10.8% at 1.3 mev . the total interaction probability in the nai scintillators is 95% at 100 kev , 82% at 500 kev , and 10% at 1 mev ( with photoelectric interaction probabilities 93% , 26% , and 0.63% , respectively ) . in addition to the three nai scintillators , one detector box contains a 2.5 cm diameter by 2.5 cm thick cerium - doped lanthanum bromide ( labr3:ce ) scintillator that provides high - energy - resolution measurements ( 3.5% fwhm at 662 kev ) of intense events . beginning in october 2012 , data are accumulated for a day at a time for each of the four detector boxes individually . the daily analysis software selects events with signals corresponding to at least 50 kev deposited energy within 1 s . tetra triggers are selected with counts/2 ms at least 20 standard deviations above the mean for the day . once days with excessive electronic noise or other instrumental problems are removed , there are 835.09 days of live time and 1303 tetra triggers . in figure 1 , the heavy black line shows a time history of the count rates for the three nai photomultiplier tubes of > 50 kev events in a single detector box for 1 day . the total count rate , plotted in counts per minute , is reasonably constant for the first 17 h and then increases by a factor of approximately 2 beginning at about 1800 cst . the small peak in the count rate seen at about 1200 cst is due to noise in the system seen only in a single pmt on a 60 s timescale . the thin black histogram near the bottom shows the local radar reflectivity in decibels acquired from www.wunderground.com , indicating rain , thunderstorms , hail , or strong winds . the gamma - ray spectrum , measured during a rain event with the high - resolution labr3:ce detector mounted together with the nai detectors in one of the detector boxes , shows a clear indication of 295 , 352 , 609 , 1120 , and 1764 kev bi and pb lines characteristic of radon decay ( figure 2 ) . summed nai counting rate per minute in box 3 on 18 august 2011 ( heavy black line , left - hand scale ) . thin black histogram near the bottom ( right - hand scale ) shows radar reflectivity . the row of filled circles near the top marks intervals in which the count rate in 60 s bins exceeds the day 's average by 3 ; the open square marks the tetra trigger , i.e. , the interval when the rate in 2 ms bins exceeds the day 's average by 20 . labr3:ce rain spectrum . labr3:ce background - subtracted spectrum during a 6 h precipitation event showing radon lines at 295 kev , 352 kev , 609 kev , 1120 kev , and 1764 kev . the filled rectangle near the bottom of figure 1 at approximately 1800 cst marks the times of lightning strikes detected by the u.s . precision lightning network ( uspln ) unidata program within 8 km of the lsu campus . these are mainly cloud - to - ground events with positions accurate to approximately 0.4 0.8 km . in the upper section of the diagram , the line of filled circles marks 60 s intervals in which the nai detector count rate is 3 standard deviations higher than the average rate for the day ; these are correlated with the peak of the extended rise at the time of the rainstorms . tetra triggers are defined as intervals during which the rate in a 2 ms window exceeds the day 's average by 20 . the tetra trigger observed is indicated near the top of the plot as an open square . ( for a typical average counting rate of 8900 min in a detector box above 50 kev , a 20 excess corresponds to 10 counts in the three pmts in a detector box within a 2 ms window . ) . figure 3 shows an expanded view of the data on the same day , illustrating the correlation of the triggers in individual boxes with lightning and cloud density overhead . figure 3b shows the rate per second of lightning strikes within 8 km of the detectors , and figure 3c shows the distance of all lightning strikes recorded by the uspln network within 160 km . ( a ) triggers detected on 18 august 2011 ( nai signals above 50 kev in a single detector box with count rate per 2 ms in excess of 20 above the 18 august 2011 daily mean counting rate ) . box 1 triggers are indicated by plus signs , box 3 by triangles , and box 4 by squares . ( b ) rate per second of uspln lightning strikes within 8 km ( c ) distance to each recorded lightning strike within 160 km ( d ) overhead cloud density . from july 2010 through february 2013 , tetra has recorded a total of 24 events with triggers occurring within several minutes of thunderstorm activity producing at least one lightning flash within 8 km of the detectors . such events are classified as event candidates ( ecs ) and are listed in table 1 . in this table each event trigger time is listed , along with the number of lightning flashes detected within 2.5 min and 8 km and the cloud density above tetra . also listed for each ec is the time difference to the lightning stroke closest in time to the event trigger , the distance to that lightning stroke , the current , the number of gamma - rays detected in the ec , and the t90 duration of the event ( i.e. , the time over which a burst emits from 5% to 95% of its total measured counts in a single detector box ) . the number of sigma above the mean is listed in the second to last column for each event . ( for the first three events in the table , observed simultaneously in multiple detector boxes , the smallest number of sigma above the mean is listed . these coincident events , labeled coincident event candidates cecs are discussed in more detail below . ) . properties of the 24 event candidatesa cecs are listed in the top section ; ecs for which the absolute timing uncertainty is known are listed in the middle section ; and ecs for which the absolute timing uncertainty is unknown are listed in the bottom section of the table . the date and time of each ec trigger are listed , along with the properties of the storm associated with each event . the properties of the associated lightning , event duration , number of gamma - rays detected , total energy , and event significance are also listed for each event . the probability of each cec occurring is listed in the last column for the cecs . tetra 's events , with an average of 20 2 photons detected , are significantly smaller than the typical events observed in space . for tetra 's events , the t90 duration was calculated by considering all events detected within a 3 ms window around the trigger time , discarding the first and last 5% of timestamps for each event , and recording the time difference between the first and last events remaining . the uncertainty in the t90 determination is approximately 200 s based on monte carlo simulations of the data . in each of the 24 events , 7 to 45 -rays were detected within a time window of less than 5 ms , with the total energy deposited per event ranging from 2 to 32 mev . the distances to the nearest lightning flashes were 0.64.7 km . for 14 events , absolute timing was available with 2 ms accuracy . for each of these 14 events , lightning was observed within 7 s of the trigger time . nine of these events were associated with cg lightning detected within 6 ms of the trigger . july 2012 during a period when accurate trigger - lightning time differences were not recorded due to network timing difficulties . eight of the ecs during that period were correlated with two intense thunderstorms that passed directly over tetra on 6 june 2012 . the accidental rate of triggers coincident within 7 s of a lightning flash that is less than 8 km distant ( i.e. , events masquerading as ecs ) is calculated based on the rate of tetra triggers ( due mainly to cosmic ray showers ) , the live time , and the duration of storm activity . the storm activity time is taken to be the sum of all time windows where there was lightning within 8 km and 7 s , and there was no electronic noise or other instrumental problems . for a total storm time of 12.65 h , we calculate the expected number of ecs due to accidental triggers to be 0.82 . the efficiency of the uspln in our area has not been tested ; however , if we assume a similar sensitivity to that measured by jacques et al . for cloud - to - ground lightning with peak current in excess of 20 ka of approximately 25% to account for undetected lightning flashes figure 4 compares data acquired within 7 s of lightning to the remaining data with accurate timing information . the distribution of events versus within 7 s of a uspln lightning strike within 8 km is shown in black . the significance distribution of the remaining data has been normalized to the total storm activity time of the lightning distribution for comparison , shown in grey . the excess of events above 20 sigma in the lightning distribution ( black ) as compared to the normalized distribution ( grey ) indicates the association of the gamma - ray events with nearby lightning . ( note that since three events involve seven separate coincident triggers in individual detector boxes , there are 18 individual triggers shown in figure 4 compared to the 14 ecs with accurate timing information in table 1 . ) a kolmogorov - smirnov test of the two distributions results in a d parameter of 0.25 , corresponding to high confidence that the two distributions are distinct . distribution of events with significance . distribution of events within 7 s of nearby ( < 8 km ) lightning is shown in black . distribution of all data , normalized to 0.52 days of live time , is shown in grey , showing excess of lightning - associated ecs at > 20 . the dark solid line in figure 5 shows the deposited energy spectrum of the 24 event candidates , with events observed up to 2.7 mev deposited energy . it should be emphasized that with tetra 's thin detectors , only a portion of the incident gamma - ray energy is actually detected . between 200 kev and 1.2 mev , the ec spectrum is fit with a power law e , with = 1.20 0.13 and /degree of freedom = 0.4 ( dashed dark line ) . on the same figure , the grey line shows the spectrum of non - ec triggers ( i.e. , triggers not associated with lightning within 5 mi and 7 s ) ; this spectrum is softer , with a best fit power law index = 1.79 0.04 and /degree of freedom = 1.0 ( dashed grey line ) . the associations of the events reported here with negative polarity lightning strikes and the low likelihood that these are background events , along with the durations observed , are indicative of downward directed tgfs produced by the rrea mechanism . spectrum of non - ec tetra triggers ( triggers not associated with lightning nearby in time and distance ) is shown in grey . power law fits between 200 kev and 1200 kev of the form e are shown with dotted lines , where = 1.20 0.13 and 1.79 0.04 for ec and non - ec events , respectively . in three of the 24 ecs , triggers were recorded in two or more boxes separated by 1000 m within less than 2 ms . all three of these coincident event candidates ( cecs ) occurred in july and august of 2011 , when storms in southern louisiana tend to be associated with disturbances in the gulf of mexico rather than frontal lines . the plot shows a 50 ms window centered on the event trigger time , defined as the center of the first 2 ms bin containing a trigger . the counts for each box ( i.e. , the number of phototubes detecting a signal with amplitude in excess of 50 kev within the 1 s pmt anode output integration time ) are plotted versus time relative to the event trigger time . for the two events on 31 july 2011 ( figures 6a and 6b ) , the lightning strikes closest in time occurred within approximately 6 and 4 ms of the event trigger . for those cases , the time of the lightning strike is shown as a cross with a timing uncertainty of 2 ms near the top of the plot . in the first 31 july 2011 event ( figure 6a ) , one pmt in box 3 fired , followed by two pmts in box 4 2.3 ms later . the distance between the two boxes was 1500 m , corresponding to a gamma - ray travel time difference of up to 5 s . in fact , we believe the differences between the event times in the separate boxes in figure 6 are a direct measure of the absolute timing differences between the boxes . nai time histories over 50 ms window centered on the trigger time for each cec . lightning strikes within 8 km in the 50 ms window have a 2 ms timing uncertainty and are shown with crosses . the box 3 time history is centered at 0 ms and box 4 at 2 ms . a uspln lightning strike within 8 km is indicated by the cross at 6 ms . the box 3 time history is centered at 0 ms and box 4 at 2 ms . a uspln lightning strike within 8 km is indicated by the cross at 4 ms . ( c ) the event on 18 august 2011 at 17:57:38.984 cst with the box 3 time history centered at 0 ms , box 1 at 2 ms , and box 4 at 4 ms . no uspln lightning was detected within 8 km within this 50 ms window . the expected number of cecs due to random triggers is small : given an initial ec with counting rate in one box in excess of 20 above the daily average , the likelihood that a second or third trigger occurred at random in another box within the timing uncertainty of 2 ms on the same day is estimated as ( 4 ms n/86,400 s ) , where n is the total number of random 20 triggers detected per day through february 2013 and b is the number of boxes triggered in the event . ( for simplicity , we neglect here the increase in trigger rate during a thunderstorm shown in figure 1 . ) multiplying by the number of ecs then gives the expected number of spurious cecs involving two boxes occurring by chance as 1.7 10 , as listed in table 1 . a composite energy spectrum summed over the three cecs is shown in figure 7 . a total of 80 gamma - ray pulse heights above 50 kev and within the t90 interval of each coincidence trigger are shown . the average photon energy detected is approximately 0.5 mev , an energy at which the fraction that passes through a nominal 1.6 km of atmosphere at ground level ( stp ) without interaction is 10 . this average energy is low compared to the typical energies observed by the orbiting detectors [ dwyer et al . , 2012a ] and is presumably biased to low energies by the 0.5 cm thickness of the tetra nai scintillators . eighty photons were detected within the t90 interval of each individual detector box 's trigger time . figure 8 shows the distance from the detectors and the measured current for each lightning flash within 8 km of tetra from 1 july 2010 to 28 february 2013 . there were a total of 5360 flashes within 8 km . for each of the 10 ecs and cecs with lightning within 8 km and 100 ms of the trigger time , although all the tetra events correspond to lightning less than 5 km away , the two lightning flashes within 100 ms of a cec are both more than 2 km away . if all discharges produce tgfs [ stgaard et al . , 2012 ] , then the rate of detection and the cec distances point to either a range of intensities extending below the sensitivity limit of tetra , strongly nonisotropic emission , or the possibility that the gamma - ray emission is only indirectly associated with the lightning [ connaughton et al . , 2013 ] . this can also occur if some gamma - ray events are produced by intracloud ( ic ) strikes , since the uspln data record primarily cloud - to - ground strikes . all lightning activities within 8 km of tetra from 1 july 2010 to 28 february 2013 . the current and distance for all uspln lightning flashes within 8 km of tetra are indicated by grey crosses . lightning strikes that are within 8 km and 100 ms of an ec or cec are considered coincident strikes and are plotted with black crosses . the vertical line at 0 ka indicates ic lightning . out of the 10 ecs shown in figure 7 , nine were found to be within 6 ms of a negative polarity cg lightning strike within 5 km with current above 20 ka ( table 1 ) . for the two cecs that occurred on 31 july 2011 , lightning strikes are recorded at 6 ms and 4 ms before the tetra triggers . in both cases , these were nearby , cloud - to - ground events at 2.3 km distance with current 43.6 ka and 2.9 km distance with current 29.1 ka . for four ecs with accurate timing information , the lightning strikes closest in time to the tetra triggers were in excess of 100 ms before or after the nai signal and so are not considered coincident with a uspln observed strike . again , this can occur if some gamma - ray events are produced by intracloud ( ic ) strikes or if the gamma - rays are not all directly associated with the lightning . the gamma - ray events described here have durations ranging from 24 s to 4.2 ms . the similarity of these event durations observed by tetra to those reported by batse , rhessi , agile , fermi , and iclrt suggests that the tetra events are also generated by the rrea mechanism . dwyer et al . [ 2012b ] compared the spectrum of x - rays from lightning to gamma - rays from tgfs , showing a marked difference above 2 mev , but the restricted energy range of tetra and the low statistics make it impossible to draw strong conclusions from the observed tetra spectra . fermi gbm data suggest that wwlln detects shorter duration tgfs more efficiently than the longer ones because of the frequency constraints of the network ( between 6 and 18 khz ) . for the sferic signals found within a 400 s window around the tgf gammas , the stronger sferics appear due to the tgf itself while the weaker sferics are due to associated + ic lightning [ connaughton et al . , the brightest tgfs seen by batse , rhessi , and gbm produce 10 runaway electrons with a source altitude 13 km [ briggs et al . , in contrast , the two tgfs previously reported from the ground by iclrt are associated with cg lightning [ dwyer et al . , 2004 , 2012b ] . the 2009 iclrt event produced 10 runaway electrons and was observed at a distance of 2 km . if the tetra events are characterized by typical energy 500 kev and distance 1.6 km , then atmospheric absorption attenuates the flux by a factor of 4 10 at sea level . assuming isotropic emission at a distance of 1.6 km , a typical total of 20 photons observed in an event by tetra then requires in excess of 10 photons at the source . either the ground level tetra events are beamed or they are distinctly different from the iclrt events . here we have presented data for a series of gamma - ray events observed with a self - triggered ground array , suitable for observing weak events from nearby distances without a bias caused by a lightning trigger , and find that events with durations < 5 ms and detected individual photon energies up to at least 2 mev appear to be produced in conjunction with nearby cg lightning . in two cecs , these are most closely associated with cg events 2.3 and 2.9 km away . in the other cec event , the nearest detected lightning strike in time is more than 6 s after the gamma - ray event . either this gamma - ray event is not correlated with nearby lightning , the associated cg lightning strike was missed by the lightning network , or the event was due to ic lightning that was not detected by the lightning network .

[ 1 ] terrestrial gamma - ray flashes ( tgfs)very short , intense bursts of electrons , positrons , and energetic photons originating from terrestrial thunderstorms have been detected with satellite instruments . tgf and energetic thunderstorm rooftop array ( tetra ) , an array of nai(tl ) scintillators at louisiana state university , has now been used to detect similar bursts of 50 kev to over 2 mev gamma - rays at ground level . after 2.6 years of observation , 24 events with durations 0.024.2 ms have been detected associated with nearby lightning , three of them coincident events observed by detectors separated by 1000 m. nine of the events occurred within 6 ms and 5 km of negative polarity cloud - to - ground lightning strokes with measured currents in excess of 20 ka . the events reported here constitute the first catalog of tgfs observed at ground level in close proximity to the acceleration site .

carboxylic acids are pervasive in nature and are produced industrially on a large scale . therefore , methods of employing them in organic preparations have received a lot of attention . hard uv ( 250 nm ) irradiations generate carbon - centered radicals but also induce much degradation . conventionally , decarboxylative alkylations have relied on preparations of unappealing precursors such as peroxides , barton esters , or hunsdieker salts . recently attention shifted toward discovering catalytic systems capable of utilizing them in target - oriented syntheses . decarboxylative copper - catalyzed reactions of carboxylic acids with carbonyls and with aldimines , and of amino acids with alkynes have been reported . photoredox methods have also been used for this purpose but can suffer from difficulties in removing the catalyst . interest in heterogeneous photoredox methods for carboxylates dates back to the 1970s and the photo - kolb reaction . the chosen semiconductor can be nontoxic and can easily be removed by filtration , and when visible or soft uva light is used , the procedure can be convenient and benign . most applications of tio2 scpc have utilized aerobic conditions , resulting in selective oxidations of organic substrates or more complete substrate mineralizations . under anhydrous , anaerobic conditions and with certain substrates , tio2 scpc can lead to the generation of specific radicals adapted for molecular assembly applications . to date , however , only a modest number of such processes have been identified and developed . notably , scpc additions of enol ethers to various acceptors have been investigated , and successful additions of tertiary amines to electron - deficient alkenes , some bearing chiral auxiliaries , have been described . we recently discovered that under dry , anaerobic conditions , tio2 mediation with carboxylic acid precursors could result in carbon alkylations and annulations were achieved when photolyses of certain acid precursors were carried out in the presence of suitable electron - deficient alkenes . this paper reports advances in crucial aspects of this process in the following areas : ( 1 ) structural features in the carboxylic acids that are necessary and sufficient ; ( 2 ) the range of functionality in the alkene acceptors that can be tolerated ; ( 3 ) how the reactions respond to modifications to the catalyst form and the catalyst support ; and ( 4 ) the mechanism followed by the reaction . in our preliminary study , we discovered an experimental protocol with reasonably wide applicability utilizing degussa ( evonik ) p25 as a 15 mg ml dispersion in dried acetonitrile . this dispersion , with added carboxylic acid and substrate , in an oven - dried pyrex tube was purged with argon and then irradiated by two face - to - face sunlamp arrays ( uva ) at ambient temperature . after photolysis , the catalyst was removed by filtration and the products were isolated by conventional organic techniques . during initial investigations , n - phenylmaleimide ( 2 ) was found to be an ideal radical acceptor in this system , as it is symmetrical and photostable , its photodimerization is negligible ( under our experimental conditions ) , and its electron - withdrawing character favors addition by weakly nucleophilic radicals . this alkene was therefore chosen to test the applicabliity of our process with simple aliphatic carboxylic acids 1 . standard unoptimized conditions were adopted so a clear comparison of behavior from acid to acid could be obtained ( table 1 ) . in all instances , 0.1 mmol of 1 and 0.2 mmol of 2 were photolyzed in a suspension of the p25 catalyst ( 12 mg , 0.15 mmol ) in ch3cn ( 12 ml ) for 18 h. the reactions did indeed lead to the formation of adducts 3 incorporating the r moiety of the carboxylic acid and an additional h atom , together with significant amounts of succinimide 4 ( scheme 1 ) . for acids that decarboxylated to give methyl ( entry 1 ) or primary radicals ( entries 2 and 3 ) , the yields were low ; however , increased yields were obtained with secondary and tertiary radicals ( entries 4 and 5 ) . negligible adduct was detected for the destabilized , -type cf3 radical ( entry 6 ) . the efficiency of the process evidently increased as the stabilization energy of the released radical increased ( see the supporting information for a plot of radical stabilization energy vs yield ) . the observation of a significant amount of 4 in each case suggested that alkene 2 plays the role of an electron sink , consuming electrons in two sequential reduction protonations . we next examined a set of addition reactions with n - phenylmaleimide involving more diverse carboxylic acids ( scheme 2 ) . primary alkyl radicals stabilized by -alkoxy groups proved to be a good deal more reactive than the simple alkyl radicals . methoxy- and tert - butoxyacetic acids gave the corresponding adducts ( 3 g and 3h ) in reasonable yields of 54% and 57% , respectively , while 2-tetrahydrofuroic acid furnished a 1:1 mixture of the two diastereomers of 3i in a very pleasing yield of 75% . however , methylthioacetic acid returned only a disappointing 34% yield of the desired product 3j . moderate and poor yields were obtained with benzyl ( 57% ) and 2-thienylmethyl acids ( 22% ) , but these adducts ( 3k and 3l ) were accompanied by the dimers bibenzyl ( 18% ) and 1,2-bis(thiophen-2-yl)ethane ( 27% ) , respectively . accompanied by dimers ( see the text ) . decarboxylative additions also worked with boc - protected -amino acids , and the bottom row in scheme 2 displays the adducts and the useful yields obtained . while boc - proline was transformed into adduct 3n in a fine yield of 75% , boc - alanine and the unnatural -amino acid boc - piperidinecarboxylic acid gave much more modest yields of 38% and 29% , respectively . no retention of chirality was observed when optically pure amino acids were employed because the released radicals have planar , or close to planar , configurations at their reactive centers . surprisingly , vinylacetic , ethynylacetic , and cyanoacetic acids failed to react , even though the released radicals would be strongly stabilized . to compare the efficiencies of different forms of the titania catalyst , the reaction of phenoxyacetic acid with acrylamide , which was clean and efficient ( 82% adduct isolated ) was chosen . for each photolysis , suboptimum conditions of phenoxyacetic acid ( 0.1 mmol ) and acrylamide ( 0.2 mmol ) with irradiation for 17 h in anhydrous ch3cn ( 12 ml ) were employed . where applicable , tio2 ( 12 mg ) was employed in a 1 mg ml dispersion ( see the supporting information for full details ) . with p25 itself ( table 2 , entry 1 ) , a 47% yield of the 4-phenoxybutanamide adduct was recorded . with millenium pc500 titania , having about 6 times the surface area , the yield dropped slightly ( entry 2 ) . reactions were also carried out in schlenk tubes coated with a fine internal layer of tio2 by a sol gel process ( see the supporting information for details ) . these proved to be very efficient and led to the best yield ( entry 3 ) . tio2 photospheres consisting of hollow pyrex beads coated externally with rutile titania delivered lower conversion and adduct yields ( entry 4 ) . this was attributed to difficulties in dispersing the photospheres satisfactorily throughout the reaction flask . because of their buoyancy , they tended to accumulate at the top , and this was compounded by the fact that the high rate of magnetic stirring used in attempts to overcome this tended to result in their becoming damaged . an isolated yield of 68% was achieved upon scale - up of the reaction in the coated tube ( entry 3 ) . incorporation of 4-tert - butyl and 4-trifluoromethyl substituents in the aryl ring of the acid component furnished the corresponding adducts in similarly pleasing yields of 68% and 66% , respectively . although the sol gel - coated tubes gave the best yields and conversions , the coatings tended to detach , so they could only be used about three times . we therefore concluded that for ease of handling with conventional organic techniques , scale - up , and efficient product formation , the orthodox p25 catalyst was the best compromise . isolated yield from 5:1 acid / acrylamide irradiated for 62 h. millenium pc500 ( anatase , surface area 300 m g , particle size 510 nm ) . hollow glass spheres ( mean diameter 45 m , density 0.22 g / ml ) coated with tio2 , from microsphere technology . the reaction of aryloxyacetic acids ( 5 ) with n - substituted maleimides ( 2 ) led to n - substituted-3,4-dihydrochromenopyrrole-1,3-dione derivatives 6 , each accompanied by a significant amount of the expected adduct 7 ( scheme 3 ) . tricyclics 6 presumably resulted from cyclization of the initial adduct radical onto the aryl ring followed by rearomatization . good to excellent overall yields were obtained under all conditions ( table 3 ) . a moderate amount of succinimide ( 1143% yield ) was also formed in each case . dispersion of 1 mg ml except for dd = dense dispersion of 5 mg ml . table 3 shows that the process worked well with both electron - releasing and electron - withdrawing substituents in the aromatic ring and for methyl- and phenyl - substituted maleimides . the reactions with just p25 generally gave a slight excess of the chromenopyrrole 6 ( entries 1 , 4 , 6 , 8 , and 10 ) , except in the case of the cf3 substituent ( entry 12 ) , for which an excess of adduct 7 was observed . the selectivity for chromenopyrroles 6 was improved by using a more dense dispersion of p25 ( entries 2 , 7 , and 11 ) . on the other hand , gel tio2-coated tubes ( entries 3 , 5 , 9 , and 13 ) led to a reversal in selectivity with predominant formation of adduct 7 . the possibility to tune h coupling constants between the two protons at the junction of the pyran and dihydropyrrole rings within the range of 9.29.3 hz . this indicated a cis arrangement , in agreement with the conclusion that the reaction selectively formed the cis isomer in every case . very few syntheses of dihydrochromenopyrrole-1,3-diones 6 have been reported , but compounds with the corresponding reduced ring system , chromenopyrrolidines , are well - known biologically active species . three types of acid framework with different acceptor groups were prepared to test the applicability of p25-mediated ring closures . 2-(2-vinylphenoxy)acetic acids having alkene acceptors with ester ( 8a ) , nitrile ( 8b ) , and ketone ( 8c ) substituents ( scheme 4 ) were obtained by treatment of 2-formylphenoxyacetic acid with the appropriate phosphorane ( see the experimental section ) . c having aromatic acceptors were prepared by coupling of the appropriate 1,1-biphenyl-2-ol with methyl bromoacetate and subsequent hydrolysis of the ester with lioh in meoh / h2o . acids 13a and 13b having oxime ether acceptor groups were prepared by condensation of 2-formylphenoxyacetic acid with the appropriate alkoxylamine hydrochloride . the second used 1 ml aliquots of acid solutions ( 10 mm ) in cd3cn ( 5 ml ) in sol gel - coated nmr tubes . the tubes were purged with argon and then placed in an overhead stirrer ( turned on its side ) , which was then spun at 250 rpm . the tube was held at a slight angle with respect to horizontal in the chuck of the overhead stirrer so that , when rotated , it described a small ( ca . 2 cm ) circle at its non - chuck - held end so as to agitate the reaction solution . irradiation was performed using a photoreactor with twelve 8 w black light blue ( blb ) uv lamps ( max = 365 nm ) ( see the supporting information for a graphic ) . periodically the tube was removed for nmr analysis . this was repeated until all of the starting material had been consumed or the product concentration plateaued . for acids 8a c with alkene acceptors , control photolyses in the absence of tio2 showed that e / z isomerization was significant ( 5279% ) . in conventional p25-mediated reactions , 8a c all gave rather complex product mixtures containing unreacted alkene as a mixture of e and z isomers ( 8/9 ) as well as the 5-exo ring - closed dihydrobenzofurans 10 . nmr and gc ms analyses showed complex product mixtures containing possible trace amounts of the cyclized 6h - benzo[c]chromenes 12a c . the 2,3-dihydrobenzofuran core of 10 is found in many natural products and pharmaceutically relevant molecules and has generated much interest . yields in brackets are maximum yields from nmr monitoring of sol gel tube reactions . the reaction profile from irradiation of acid 8a in a sol gel - coated tube obtained by nmr monitoring ( figure 1 ) shows the sharp decrease in 8a ( the e isomer ) , which was all consumed in < 150 min . the z isomer 9a initially increased , passed through a maximum at about 25 min , and then steadily decreased as it too was converted to cyclic product 10a . analogous reaction profiles were obtained for the sol gel tube reactions of 8a c , 11b , and 13a . gel tube reactions of 11a and 11b . a significant yield ( 28% ) of the cyclized product n-(2,3-dihydrobenzofuranyl)-o - methylhydroxylamine ( 14a ) was found in the sol gel tube reaction of oxime ether - functionalized acid 13a ( scheme 4 ) . however , attempts to isolate and fully characterize this alkoxyamine were not successful . reaction profile for acid 8a obtained by nmr monitoring . hole capture at the tio2 surface by a carboxylate creates the corresponding acyloxyl radical . radicals of this type were directly observed by cw x - band epr spectroscopy of frozen suspensions of p25 and t - buco2h in ch3cn . transient t - bu radicals and phoch2 radicals were observed during uv irradiation of the acids t - buco2h and phoch2co2h , respectively , with pc-500 in fluid phh at 300 k. in similar epr experiments with vinylacetic acid and 2,2,2-triphenylacetic acid , we were also able to detect and characterize allyl and triphenylmethyl radicals , respectively ( see the supporting information ) . the isotropic character of the solution epr spectra of all the rxch2 radicals established that in the main they were freely tumbling and not attached to the tio2 surface ( scheme 5 ) . literature precedents imply that weakly nucleophilic rxch2 radicals should add rapidly to the electron - deficient double bonds of maleimides ( and similar acceptors ) . most likely the resulting adduct radicals 15 will be converted to enolates 16 by electron transfer from the tio2 particles . , addition produces electrophilic imidoalkyl radicals 15 , for which a competition exists between reduction to adducts 7 or homolytic closure ( 6-endo - trig ) onto the aryl ring . as radicals 15 are weakly electrophilic in character , this annulation should be favored by increasing the electron density in the ring and , conversely , disfavored by decreasing it . in agreement with this , the proportion of 6 increased when an electron - releasing tert - butyl group was introduced to the ring , whereas it decreased when an electron - withdrawing trifluoromethyl group was introduced . the resonance - stabilized cyclohexadienyl - type radicals 17 will rearomatize to yield the functionalized chromenes 6 . this aromatization could result from hole capture from tio2 by the radicals 17 and subsequent proton loss as shown . alternatively , electron transfer to maleimide might take place , as suggested in related work by hoffmann . protonation of the resulting maleimide radical anions , followed by further electron capture and protonation steps , would explain the significant yields of succinimides obtained in our reactions . however , as greater amounts of succinimides than cyclized products 6 were generally formed , it is thought that direct reduction of the maleimide acceptor by the conduction band of the p25 also initiates this process . from the results described in schemes 1 and 2 and table 1 , it can be deduced that the stability of the initial radicals is an important factor in this system . carboxylic acids dissociate on the tio2 surface to give the corresponding surface - bound carboxylate and a proton . hole pair , which can migrate through the bulk of the semiconductor to the surface . the tio2 surface is extensively hydroxylated , and it is thought that these species act as surface trapping sites for the valence - band holes . electron transfer from the system of the carboxylate to a hole trap site furnishes the surface - bound rxch2co2 radical . we propose that a competition exists between -scission of this surface - bound species to yield the desired free rxch2 radical and back transfer of the electron , either from the trap site or from trapped conduction - band electrons , to the carboxylate . for acid precursors that generate stabilized rxch2 radicals , such as those depicted in scheme 2 , the decarboxylation step is more favorable , thus explaining the improved yields and conversions recorded . conversely , for the simple aliphatic acids of table 1 , the radical stabilization energy from the rx groups is minimal , so back transfer of an electron to the tio2 will take precedence over the loss of co2 . it should be noted that while we believe radical stability to be a key aspect in this system , it is clear that there are other factors at play as well and that these take precedence in deciding the reaction outcome in a few instances . for example , vinylacetic acid would be expected to generate the allyl radical very readily in the presence of photoexcited tio2 . while we did observe the allyl radical in our epr experiments , no products at all were observed in the preparative photolysis involving vinylacetic acid and 2 . in this case , other as yet unknown factors at the tio2 surface must come into play . a crucial feature of the process is that in the formation of adducts 3 and 7 a hydrogen atom is gained from some source within the dispersion . this is not the proton lost from the aromatic ring because reduced adducts were formed equally well from acids lacking aromatic rings . the reaction of phenoxyacetic acid with acrylamide was again chosen as a test - bed process ( scheme 7 ) because it was clean and practically quantitative . when this reaction was carried out in d3-ch3cn solvent , the isolated adduct was screened for d incorporation by h and h nmr spectroscopy and gc ms . reaction with d1-phenoxyacetic acid also yielded adduct with no detectable d incorporation . thus , unless the acidic d atom of 5a rapidly and completely exchanges , the source of the additional h atom is neither the acid nor the solvent . however , it is well - established that h2o molecules and ho groups are attached to the surface of the tio2 particles . drying p25 in a vacuum at 150 c removes a significant amount of the surface h2o while leaving the chemically attached ho groups . when p25 dried in this way was used , the yield of 18 was scarcely reduced , suggesting that the oh groups were likely the proton donors . attempts were made to deuterate the h2o and oh groups on the p25 surface by refluxing in degassed d2o in a glovebox . however , it was found that back exchange occurred immediately upon exposure to air and rapidly with any moisture traces in solvents or on surfaces . when the partly deuterated p25d was photolyzed with the undeuterated acid , the phenoxybutanamide product contained no deuterium . it seemed possible , however , that p25 surface od groups could have rapidly exchanged with protons from the cooh groups of 5a . experiments with partly deuterated p25d and 5a - cood were also carried out , but deuterated 19d was again not found . in view of the partially deuterated nature of the p25d and the ease with which it reverts to the protiated form , making handling difficult , our tentative conclusion is still that the p25 is the source of the h atoms . we have found that photochemical reactions employing p25 and carboxylic acids under dry anaerobic conditions generate c - centered radicals that can be deployed in several types of c c bond - forming processes . acids that yielded alkoxyalkyl , alkylthioalkyl , and benzyl radicals alkylated electron - deficient alkenes in moderate to good yields . boc - protected amino acids furnished aminoalkyl radicals that alkylated n - phenylmaleimide in useful yields . the reactions of aryloxyacetic acids with maleimides resulted in a cascade process in which a pyrrolochromene derivative accompanied the alkylated succinimide . selectivity for one or other of these products could be tuned to some extent by employing the tio2 catalyst under different conditions . aryloxyacetic acids adapted for intramolecular ring closures by the inclusion of 2-alkenyl , 2-aryl , or 2-oximinyl functionality reacted rather poorly , especially the 2-aryl acceptor types . the mechanism ( scheme 5 ) is supported by epr spectroscopic evidence of the intermediates . experiments with deuterium - labeled solvent and reactants implied that this was the hydroxyl groups on the surface of the p25 . it appears that the titania supplies electrons and holes upon photostimulation but also donates protons from surface hydroxyl groups , thus acting as both a catalyst and a reaction partner . these photoredox reactions are cleanly , safely , and cheaply carried out in the laboratory , and the heterogeneous catalyst is simply filtered off during workup . thus , with the exception mentioned above , they constitute a useful synthetic protocol . to a suspension of semiconductor ( 15 mg ml ) in mecn ( freshly distilled over cah2 ) in an oven - dried pyrex tube were added known amounts of the desired carboxylic acid and alkene . the mixture was then irradiated with eight 29 cm 15 w philips cleo tubes ( = 350 nm ) for the desired reaction time at ambient temperature . following irradiation , the solvent was removed under reduced pressure , and the reaction mixture was purified by chromatography . yields were determined from the amounts of isolated products and/or from the h nmr spectra by reference to ch2br2 as an internal standard . a photoreactor consisting of two lots of six 8 w blb uv lamps ( emission max = 365 nm ) , each arranged in a semicylinder with an aluminum reflector , was used to irradiate the contents of the nmr tube . the two photoreactor semicylinders were brought together to surround the nmr tube ( see the supporting information for a graphic ) . for a typical reaction , a stock solution comprising acid ( 10 mm ) in d3-ch3cn was prepared . this solution was purged with argon for 5 min , and then 1 ml was pipetted into an argon - flushed sol gel - coated nmr tube . the loaded nmr tube was placed in an overhead stirrer ( turned on its side ) , which was spun at 250 rpm . the tube was held at a slight angle with respect to horizontal in the chuck of the overhead stirrer so that , when rotated , it described a small ( ca . 2 cm ) circle at its non - chuck - held end so as to agitate the reaction solution . once the nmr tube was in place , the irradiation was started , and the tube was periodically removed and analyzed by nmr . these experiments were carried out in a similar fashion to the photoredox experiments outlined above . following photolysis , the reaction mixtures were scrutinized for deuterium incorporation by h and h nmr spectroscopy and gc ms . further details of these experiments are provided in the supporting information . acetic acid ( 6 mg , 0.1 mmol ) , n - phenylmaleimide ( 34.7 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) were reacted in accordance with the general procedure to yield 3a ( 24% by nmr ) as a white solid . h nmr ( 400 mhz , cdcl3 , 296 k ) : 1.44 ( d , j = 7.2 hz , 3h ) , 2.472.54 ( m , 1h ) , 2.973.14 ( m , 2h ) , 7.277.30 ( m , 2h ) , 7.367.42 ( m , 1h ) , 7.447.50 ( m , 2h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 16.9 , 34.9 , 36.7 , 126.4 , 128.6 , 129.2 , 132.0 , 175.5 , 179.6 . hr - esims : m / z 190.0861 ( calcd for c11h12no2 , 190.0863 ) . also observed was n - phenylsuccinimide ( 41% by nmr ) . n - hexanoic acid ( 11.6 mg , 0.1 mmol ) , n - phenylmaleimide ( 34.7 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) were reacted in accordance with the general procedure . following irradiation , a yield of 4% ( 0.04 mmol ) was determined for 3b . yields were determined by assigning peaks a and b by analogy with the previously characterized 3-ethyl adduct.h nmr ( 500 mhz , cdcl3 , 295 k ) : 2.60 ( dd , j = 3.3 , 17.0 hz , 1h ) , 2.973.07 ( m , 1h ) . also observed were n - phenylsuccinimide ( 4% by nmr ) and unreacted n - hexanoic acid ( 65% conversion by nmr ) . tert - butylacetic acid ( 11.6 mg , 0.1 mmol ) , n - phenylmaleimide ( 34.7 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) were reacted in accordance with the general procedure to yield 3c ( 18% by nmr ) as a white solid . h nmr ( 400 mhz , cdcl3 , 296 k ) : 0.94 ( s , 9h ) , 1.36 ( dd , j = 10.7 , 14.0 hz , 1h ) , 2.12 ( dd , j = 2.0 , 13.9 hz , 1h ) , 2.54 ( dd , j = 5.3 , 18.1 hz , 1h ) , 3.03 ( dd , j = 9.1 , 18.1 hz , 1h ) , 2.842.92 ( m , 1h ) , 7.197.22 ( m , 2h ) , 7.297.34 ( m , 1h ) , 7.377.42 ( m , 2h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 29.6 , 29.7 , 31.0 , 37.6 , 45.9 , 126.4 , 128.6 , 129.2 , 132.1 , 175.8 , 179.8 . hr - esims : m / z 246.1486 ( calcd for c15h20no2 , 246.1489 ) . also observed was n - phenylsuccinimide ( 40% by nmr ) . isobutyric acid ( 8.1 mg , 0.1 mmol ) , n - phenylmaleimide ( 34.7 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) were reacted in accordance with the general procedure to yield 3d ( 25% by nmr ) as a white solid . h nmr ( 400 mhz , cdcl3 , 297 k ) : 0.99 ( d , j = 6.8 hz , 3h ) , 1.07 ( d , j = 6.9 hz , 3h ) , 2.322.40 ( m , 1h ) , 2.56 ( dd , j = 4.4 , 18.3 hz , 1h ) , 2.79 ( dd , j = 9.4 , 18.3 hz , 1h ) , 2.872.92 ( m , 1h ) , 7.187.21 ( m , 2h ) , 7.297.34 ( m , 1h ) , 7.377.43 ( m , 2h ) . c nmr ( 100 mhz , cdcl3 , 300 k ) : 17.3 , 20.0 , 29.2 , 30.6 , 45.8 , 126.5 , 128.6 , 129.2 , 131.9 , 175.9 , 178.4 . hr - esims : m / z 218.1178 ( calcd for c13h16no2 , 218.1176 ) . also observed was n - phenylsuccinimide ( 25% by nmr ) . pivalic acid ( 10.2 mg , 0.1 mmol ) , n - phenylmaleimide ( 34.7 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) were reacted in accordance with the general procedure to yield 3e ( 38% by nmr ) as a white solid . h nmr ( 400 mhz , cdcl3 , 300 k ) : 1.12 ( s , 9h ) , 2.672.80 ( m , 2h ) , 2.89 ( dd , j = 8.8 , 17.6 hz , 1h ) , 7.247.26 ( m , 2h ) , 7.367.41 ( m , 1h ) , 7.457.49 ( m , 2h ) . c nmr ( 100 mhz , cdcl3 , 300 k ) : 27.2 , 32.0 , 33.8 , 49.9 , 126.6 , 128.6 , 129.2 , 132.0 , 175.6 , 177.4 . hr - esims : m / z 232.1326 ( calcd for c14h18no2 , 232.1332 ) . also observed was n - phenylsuccinimide ( 31% by nmr ) . trifluoroacetic acid ( 11.4 mg , 0.1 mmol ) , n - phenylmaleimide ( 34.7 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) were reacted in accordance with the general procedure to yield 3f ( 1% by nmr ) . h nmr ( 400 mhz , cdcl3 , 295 k ) : 2.86 ( dd , j = 5.5 , 18.6 hz , 1h ) , 2.99 ( dd , j = 9.5 , 18.6 hz , 1h ) , 3.61 ( m , 1h ) , 7.10 ( m , 2h ) , 7.39 ( m , 3h ) . f nmr ( 375 mhz , cdcl3 , 296 k ) : 69.3 ( s , 3f ) methoxyacetic acid ( 54.4 mg , 0.63 mmol ) , n - phenylmaleimide ( 433.6 mg , 2.50 mmol ) , and tio2 ( 75 mg , 0.94 mmol ) were reacted in accordance with the general procedure . following irradiation for 18 h , the reaction mixture was purified by column chromatography on silica gel ( eluent : 30% etoac in petroleum ether 4060 ) to yield 3 g as a white powder ( 74.4 mg , 54% ) . h nmr ( 400 mhz , cdcl3 , 299 k ) : 2.862.99 ( m , 2h ) , 3.083.15 ( m , 1h ) , 3.38 ( s , 3h ) , 3.36 ( dd , j = 3.3 , 9.1 hz , 1h ) , 3.91 ( dd , j = 3.9 , 9.1 hz , 1h ) , 7.267.30 ( m , 2h ) , 7.367.41 ( m , 1h ) , 7.447.49 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 298 k ) : 31.9 , 41.2 , 59.3 , 70.8 , 126.6 , 128.6 , 129.1 , 132.1 , 175.8 , 177.3 . tert - butoxyacetic acid ( 87.3 mg , 0.66 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.0 mmol ) were reacted in accordance with the general procedure . following irradiation for 17 h , h nmr analysis revealed that n - phenylmaleimide had been consumed entirely while a significant quantity of tert - butoxyacetic acid remained . a further 462.3 mg of n - phenylmaleimide was hence added , and the reaction was photolyzed for another 18 h. the reaction mixture was then purified by column chromatography on silica gel ( eluent : 25% etoac in pentanes ) to yield 3h as a yellow oil ( 97.8 mg , 57% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 1.18 ( s , 9h ) , 2.852.89 ( m , 2h ) , 3.073.11 ( m , 1h ) , 3.59 ( dd , j = 2.9 , 8.5 hz , 1h ) , 3.91 ( dd , j = 3.5 , 8.5 hz , 1h ) , 7.27 ( d , j = 7.4 hz , 2h ) , 7.39 ( t , j = 7.4 hz , 1h ) , 7.48 ( t , j = 7.4 hz , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 27.4 , 32.3 , 41.3 , 60.7 , 73.3 , 126.6 , 128.6 , 129.2 , 134.2 , 176.3 , 178.0 . hr - esims : m / z 262.1440 ( calcd for c15h20no3 , 262.1438 ) . 2-tetrahydrofuroic acid ( 76.6 mg , 0.66 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 18 h , the reaction mixture was purified by column chromatography on silica gel ( eluent : et2o ) to yield a 1:1 mixture of the two diastereoisomers of 3i as a yellow oil ( 121.8 mg , 75% ) . diastereomer 1 : h nmr ( 400 mhz , cdcl3 , 295 k ) : 1.922.02 ( m , 2h ) , 2.022.12 ( m , 2h ) , 2.792.84 ( m , 1h ) , 2.99 ( dd , j = 9.3 , 18.3 hz , 1h ) , 3.263.30 ( m , 1h ) , 3.763.84 ( m , 2h ) , 4.234.27 ( m , 1h ) , 7.267.32 ( m , 2h ) , 7.377.42 ( m , 1h ) , 7.457.51 ( m , 2h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 25.9 , 27.9 , 32.7 , 43.4 , 68.8 , 79.1 , 126.6 , 128.6 , 129.1 , 132.0 , 175.7 , 175.9 . diastereomer 2 : h nmr ( 500 mhz , cdcl3 , 295 k ) : 1.631.71 ( m , 1h ) , 1.922.02 ( m , 2h ) , 2.102.19 ( m , 1h ) , 2.792.84 ( m , 2h ) , 3.083.12 ( m , 1h ) , 3.863.94 ( m , 2h ) , 4.394.44 ( m , 1h ) , 7.267.32 ( m , 2h ) , 7.377.42 ( m , 1h ) , 7.457.51 ( m , 2h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 25.9 , 29.7 , 29.8 , 44.4 , 68.8 , 77.3 , 126.6 , 128.6 , 129.1 , 132.0 , 176.5 , 177.4 . gc ms : for tr = 15.75 min , m / z ( % ) 245 ( 38 ) , 217 ( 10 ) , 202 ( 58 ) , 175 ( 100 ) , 147 ( 10 ) , 119 ( 28 ) , 111 ( 11 ) , 71 ( 98 ) ; for tr = 16.20 min , m / z ( % ) 245 ( 51 ) , 217 ( 11 ) , 202 ( 33 ) , 175 ( 81 ) , 147 ( 6 ) , 119 ( 22 ) , 111 ( 12 ) , 71 ( 100 ) . hr - esims : m / z 246.1127 ( calcd for c14h16no3 , 246.1125 ) . methylthioacetic acid ( 70.8 mg , 0.67 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 42 h , the reaction mixture was purified by column chromatography on silica gel ( eluent : gradient of 2040% etoac in petroleum ether 4060 ) to yield 3j as a white powder ( 53.6 mg , 34% ) . h nmr ( 500 mhz , cdcl3 , 299 k ) : 2.14 ( s , 3h ) , 2.84 ( dd , 1h , j = 5.0 , 18.4 hz ) , 2.92 ( dd , 1h , j = 7.4 , 13.5 hz ) , 3.01 ( dd , 1h , j = 9.2 , 18.4 hz ) , 3.04 ( dd , 1h , j = 4.1 , 13.5 hz ) , 3.213.28 ( m , 1h ) , 7.227.27 ( m , 2h ) , 7.357.39 ( m , 1h ) , 7.427.47 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 16.5 , 33.7 , 35.5 , 40.1 , 126.5 , 128.7 , 129.2 , 131.9 , 175.2 , 177.5 . hr - esims : m / z 236.0741 ( calcd for c12h14no2s , 236.0740 ) . 2-thiopheneacetic acid ( 93.9 mg , 0.66 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 17 h , the reaction mixture was purified by column chromatography on silica gel ( eluent : 20% etoac in pentanes ) to yield 3k as a yellow oil ( 45.9 mg , 26% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 2.72 ( dd , j = 4.8 , 18.4 hz , 1h ) , 2.98 ( dd , j = 9.2 , 18.4 hz , 1h ) , 3.303.35 ( m , 1h ) , 3.373.45 ( m , 2h ) , 6.89 ( m , 1h ) , 6.98 ( m , 1h ) , 7.20 ( m , 2h ) , 7.39 ( m , 1h ) , 7.46 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) 30.7 , 33.4 , 41.3 , 125.0 , 126.5 , 127.0 , 127.3 , 128.7 , 129.2 , 131.8 , 138.2 , 175.2 , 177.8 , 177.5 . hr - esims : m / z 272.0743 ( calcd for c15h14no2s , 272.0740 ) . 1,2-bis(thiophen-2-yl)ethane was also isolated as a clear oil ( 14.1 mg , 22% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 3.20 ( s , 4h ) , 6.80 ( d , j = 3.4 hz , 2h ) , 6.916.94 ( m , 2h ) , 7.14 ( d , j = 5.2 hz , 2h ) . data are consistent with literature values . phenylacetic acid ( 89.9 mg , 0.66 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 22 h , the reaction mixture was purified by dry flash chromatography on silica gel ( eluent : gradient of 1020% etoac in ch2cl2 ) to yield 3l as a white powder ( 99.3 mg , 57% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 2.65 ( dd , j = 4.7 , 18.5 hz , 1h ) , 2.88 ( dd , j = 9.2 , 18.5 hz , 1h ) , 3.08 ( dd , j = 8.0 , 13.8 hz , 1h ) , 3.25 ( dd , j = 4.4 , 13.8 hz , 1h ) , 3.303.35 ( m , 1h ) , 7.17 ( m , 2h ) , 7.22 ( m , 2h ) , 7.29 ( m , 1h ) , 7.34 ( m , 2h ) , 7.39 ( m , 1h ) , 7.46 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 33.5 , 36.7 , 41.4 , 77.2 , 126.6 , 127.4 , 128.8 , 129.0 , 129.3 , 129.4 , 132.0 , 136.8 , 175.4 , 178.4 . data are consistent with literature values . bibenzyl ( 10.9 mg , 18% ) was observed by nmr prior to purification of the reaction mixture . h nmr ( 500 mhz , cdcl3 , 298 k ) : 2.95 ( s , 4h ) , 7.217.24 ( m , 6h ) , 7.307.33 ( m , 4h ) . n - boc - l - alanine ( 126.2 mg , 0.67 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 18 h , the mixture was purified by column chromatography on silica gel ( eluent : gradient of 2040% etoac in petroleum ether 4060 ) to yield two diastereomers of 3 m . diastereomer 1 was isolated as a white powder ( 36.7 mg , 18% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 1.29 ( d , j = 6.9 hz , 3h ) , 1.38 ( s , 9h ) , 2.78 ( dd , j = 4.8 , 18.6 hz , 1h ) , 2.89 ( dd , j = 9.1 , 18.5 hz , 1h ) , 3.153.20 ( m , 1h ) , 4.084.18 ( m , 1h ) , 4.53 ( bs , 1h ) , 7.187.22 ( m , 2h ) , 7.307.35 ( m , 1h ) , 7.387.43 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 18.7 , 28.3 , 32.2 , 45.3 , 47.7 , 80.2 , 126.5 , 128.7 , 129.2 , 131.8 , 155.5 , 175.3 , 176.6 . hr - esims : m / z 341.1467 ( calcd for c17h22o4n2na , 341.1472 ) . diastereomer 2 ( 20% wrt ch2br2 standard ) was obtained as a 1:1 mixture with n - phenylsuccinimide . h nmr ( 500 mhz , cdcl3 , 297 k ) : 1.25 ( d , j = 6.8 hz , 3h ) , 1.44 ( s , 9h ) , 2.63 ( dd , j = 4.5 , 18.6 hz , 1h ) , 3.00 ( dd , j = 9.6 , 18.5 hz , 1h ) , 3.173.23 ( m , 1h ) , 4.134.17 ( m , 1h ) , 5.20 ( bs , 1h ) , 7.277.30 ( m , 2h ) , 7.397.42 ( m , 1h ) , 7.467.50 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 17.1 , 28.5 , 31.9 , 45.1 , 47.1 , 80.0 , 126.6 , 128.8 , 129.3 , 131.8 , 155.2 , 175.2 , 177.5 . hr - esims : m / z 341.1475 ( calcd for c17h22o4n2na , 341.1472 ) . n - boc - l - proline ( 144.3 mg , 0.67 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 17 h , the crude mixture was purified by dry flash chromatography on silica gel ( eluent : gradient of 2060% etoac in petroleum ether 4060 ) to yield an inseparable mixture of two diastereomers of 3n ( 171 mg , 75% , 1:1 ratio ) that also contained 7% n - phenylsuccinimide . h nmr ( 500 mhz , cdcl3 , 326 k ) : diastereomer 1 1.44 ( s , 9h ) , 1.941.99 ( m , 2h ) , 2.182.24 ( m , 2h ) , 2.732.75 ( m , 1h ) , 2.83 ( dd , j = 3.8 , 9.4 hz , 1h ) , 3.53 ( dd , j = 7.3 , 11.1 hz , 1h ) , 3.793.85 ( m , 2h ) , 4.344.39 ( m , 2h ) , 7.277.47 ( m , 5h ) ; diastereomer 2 1.49 ( s , 9h ) , 2.142.17 ( m , 2h ) , 1.661.71 ( m , 2h ) , 2.692.71 ( m , 1h ) , 2.86 ( dd , j = 4.3 , 9.7 hz , 1h ) , 3.30 ( dd , j = 3.4 , 7.8 hz , 1h ) , 3.953.99 ( m , 2h ) , 4.314.35 ( m , 2h ) , 7.277.47 ( m , 5h ) . c nmr ( 75 mhz , cdcl3 , 300 k ) : 23.324.0 , 27.9 , 28.4 , 28.5 , 29.730.1 , 31.8 , 43.744.1 , 47.247.8 , 57.157.8 , 79.980.5 , 126.5126.8 , 128.4129.2 , 131.2132.0 , 155.0156.0 , 174.1177.3 . gc ms : for tr = 19.81 min , m / z ( % ) 344 ( 2 ) , 288 ( 19 ) , 271 ( 17 ) , 243 ( 48 ) , 175 ( 16 ) , 114 ( 50 ) , 70 ( 100 ) 57 ( 41 ) ; for tr = 20.09 min , m / z ( % ) 344 ( 2 ) , 288 ( 19 ) , 271 ( 17 ) , 243 ( 48 ) , 175 ( 16 ) , 114 ( 50 ) , 70 ( 100 ) 57 ( 41 ) . hr - esims : m / z 367.1632 ( calcd for c19h24n2o4na , 367.1628 ) . n - boc - d / l-2-piperidinecarboxylic acid ( 151.4 mg , 0.67 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 18 h , the crude mixture was purified by column chromatography on silica gel ( eluent : 30% etoac in pentanes ) to yield two diastereomers of 3o . diastereomer 1 was isolated as an off - white solid ( 32.7 mg , 14% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 1.39 ( s , 9h ) , 1.461.59 ( bm , 2h ) , 1.671.79 ( bm , 4h ) , 2.52 ( dd , j = 3.0 , 18.2 hz , 1h ) , 2.98 ( dd , j = 8.9 , 18.2 hz , 1h ) , 3.04 ( t , j = 13.2 hz , 1h ) , 3.263.30 ( m , 1h ) , 4.06 ( d , j = 13.2 hz , 1h ) , 4.344.37 ( m , 1h ) , 7.327.36 ( m , 3h ) , 7.417.45 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 18.9 , 24.8 , 27.0 , 28.4 , 34.2 , 38.1 , 40.2 , 53.3 , 79.9 , 126.7 , 128.4 , 128.9 , 132.1 , 155.5 , 174.9 , 176.1 . hr - esims : m / z 381.1787 ( calcd for c20h26n2o4na , 381.1785 ) . diastereomer 2 ( 15% wrt ch2br2 standard ) was obtained as a 1:2 mixture with n - phenylsuccinimide . h nmr ( 500 mhz , cdcl3 , 295 k ) : 1.42 ( s , 9h ) , 1.53 ( m , 1h ) , 1.681.72 ( m , 1h ) , 1.901.96 ( m , 1h ) , 2.212.23 ( m , 1h ) , 2.402.45 ( m , 1h ) , 2.542.58 ( m , 1h ) , 2.95 ( dd , j = 4.4 , 19.0 hz , 1h ) , 3.05 ( dd , j = 9.6 , 17.6 hz , 1h ) , 3.26 ( dd , j = 9.1 , 19.0 hz , 1h ) , 3.35 ( dd , j = 6.3 , 17.6 hz , 1h ) , 3.373.42 ( m , 1h ) , 3.943.98 ( m , 1h ) , 7.387.42 ( m , 3h ) , 7.447.49 ( m , 2h ) . c nmr ( 125 mhz , cdcl3 , 295 k ) : 19.6 , 24.4 , 24.6 , 28.3 , 33.4 , 37.8 , 39.5 , 46.1 , 82.5 , 126.4 , 128.5 , 129.1 , 131.4 , 152.6 , 175.2 , 175.5 . hr - esims : m / z 381.1787 ( calcd for c20h26n2o4na , 381.1785 ) . cyanoacetic acid ( 56.2 mg , 0.67 mmol ) , n - phenylmaleimide ( 462.3 mg , 2.67 mmol ) , and tio2 ( 80 mg , 1.00 mmol ) were reacted in accordance with the general procedure . following irradiation for 18 h , the reaction mixture was scrutinized by h nmr and gc ms , but none of the desired product was obtained . phenoxyacetic acid ( 100 mg , 0.65 mmol ) , n - methylmaleimide ( 145 mg , 1.3 mmol ) , and tio2 ( 75 mg , 0.98 mmol ) were reacted in accordance with the general procedure . following irradiation for 20 h , the crude mixture was purified by column chromatography on silica gel ( eluent : 20% etoac in petroleum ether 4060 ) to yield 7a as a colorless oil ( 32.6 mg , 23% ) . h nmr ( 400 mhz , cdcl3 , 297 k ) : 2.882.90 ( m , 2h ) , 3.04 ( s , 3h ) , 3.173.23 ( m , 1h ) , 4.17 ( dd , j = 3.4 , 9.2 hz , 1h ) , 4.40 ( dd , j = 4.4 , 9.2 hz , 1h ) , 6.87 ( d , j = 8.8 hz , 2h ) , 6.98 ( t , j = 7.4 hz , 1h ) , 7.28 ( t , j = 7.4 hz , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 25.4 , 32.1 , 41.1 , 66.4 , 115.1 , 122.0 , 130.0 , 158.5 , 177.0 178.0 . 6a was also obtained as a white powder ( 77.8 mg , 55% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 3.00 ( s , 3h ) , 3.363.40 ( m , 1h ) , 4.01 ( dd , j = 4.2 , 11.4 hz , 1h ) , 4.07 ( d , j = 9.2 hz , 1h ) , 4.62 ( dd , j = 2.9 , 11.4 hz , 1h ) , 6.89 ( d , j = 8.2 hz , 1h ) , 7.05 ( t , j = 7.5 hz , 1h ) , 7.21 ( t , j = 7.7 hz , 1h ) , 7.58 ( d , j = 7.4 hz , 1h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 27.8 , 40.1 , 42.7 , 64.3 , 118.1 , 118.3 , 123.2 , 129.4 , 130.5 , 155.7 , 176.6 , 177.2 . data are consistent with literature values . phenoxyacetic acid ( 100 mg , 0.65 mmol ) , n - phenylmaleimide ( 230 mg , 1.3 mmol ) , and tio2 ( 75 mg , 0.98 mmol ) were reacted in accordance with the general procedure . following irradiation for 11 h , the crude mixture was purified by column chromatography on silica gel ( eluent : 20% etoac in petroleum ether 4060 ) to yield 7b as a yellow oil ( 71.5 mg , 39% ) . h nmr ( 400 mhz , cdcl3 , 297 k ) : 3.013.07 ( m , 2h ) , 3.333.39 ( m , 1h ) , 4.28 ( dd , j = 3.2 , 9.0 hz , 1h ) , 4.55 ( dd , j = 4.1 , 9.1 hz , 1h ) , 6.91 ( d , j = 8.8 hz , 2h ) , 7.00 ( t , j = 7.3 hz , 1h ) , 7.287.33 ( m , 2h ) , 7.41 ( t , j = 7.4 hz , 1h ) , 7.48 ( d , j = 7.2 , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 32.4 , 41.1 , 66.9 , 115.1 , 122.1 , 127.0 , 129.2 , 129.7 , 130.0 , 132.4 , 158.5 , 175.9 , 177.1 . 6b was also obtained as a white powder ( 72.8 mg , 40% ) . h nmr ( 400 mhz , cdcl3 , 297 k ) : 3.543.58 ( m , 1h ) , 4.11 , ( dd , j = 4.4 , 11.4 hz , 1h ) , 4.23 ( d , j = 9.3 hz , 1h ) , 4.7 ( dd , j = 3.3 , 11.4 hz , 1h ) , 6.94 ( d , j = 8.2 hz , 1h ) , 7.07 ( t , j = 7.5 hz , 1h ) , 7.227.27 ( m , 2h ) , 7.37 ( t , j = 7.4 hz , 2h ) , 7.44 ( t , j = 7.1 hz , 1h ) , 7.63 ( d , j = 7.4 hz , 1h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 40.2 , 42.6 , 64.4 , 77.1 , 77.5 , 77.9 , 117.7 , 118.3 , 123.3 , 126.7 , 129.2 , 129.5 , 129.6 , 130.7 , 132.1 155.7 175.5 , 176.1 . 4-(tert - butyl)phenoxyacetic acid ( 130.3 mg , 0.62 mmol ) , n - methylmaleimide ( 275.6 mg , 2.48 mmol ) , and tio2 ( 75 mg , 0.98 mmol ) were reacted in accordance with the general procedure . following irradiation for 22 h , the reaction mixture was purified by column chromatography on silica gel ( eluent : 20% etoac in petroleum ether 4060 ) to yield 7c as a clear oil ( 18.4 mg , 11% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 1.29 ( s , 9h ) , 2.842.89 ( m , 2h ) , 3.03 ( s , 3h ) , 3.213.16 ( m , 1h ) , 4.16 ( dd , j = 3.4 , 9.2 hz , 1h ) , 4.39 ( dd , j = 4.4 , 9.2 hz , 1h ) , 6.81 ( d , j = 8.8 hz , 2h ) , 7.29 ( d , j = 8.8 hz , 2h ) . c nmr ( 100 mhz , cdcl3 , 296 k ) : 25.0 , 29.7 , 31.5 , 34.1 , 40.7 , 66.1 , 114.2 , 126.4 , 144.4 , 155.8 , 176.6 , 177.6 . hr - esims : m / z 276.1599 ( calcd for c16h22no3 , 276.1594 ) . 6c was also obtained as a white powder ( 77.2 mg , 46% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 1.32 ( s , 9h ) , 2.98 ( s , 3h ) , 3.333.37 ( m , 1h ) , 3.98 ( dd , j = 4.1 , 11.3 hz , 1h ) , 4.05 ( d , j = 9.2 hz , 1h ) , 4.59 ( dd , j = 3.0 , 11.3 hz , 1h ) , 6.82 ( d , j = 8.6 hz , 1h ) , 7.23 ( dd , j = 2.4 , 8.6 hz , 1h ) , 7.58 ( d , j = 2.4 hz , 1h ) . c nmr ( 75 mhz , cdcl3 , 296 k ) : 25.8 , 31.9 , 34.8 , 40.3 , 42.7 , 64.3 , 117.1 , 117.6 , 126.5 , 127.3 , 146.0 , 153.3 , 176.7 , 177.3 . hr - esims : m / z 274.1442 ( calcd for c16h20no3 , 274.1438 ) . 4-(tert - butyl)phenoxyacetic acid ( 70 mg , 0.33 mmol ) , n - phenylmaleimide ( 117 mg , 0.66 mmol ) , and tio2 ( 40 mg , 0.5 mmol ) were reacted in accordance with the general procedure . following irradiation for 19 h , the crude mixture was purified by column chromatography on silica gel ( eluent : 20% etoac in petroleum ether 4060 ) to yield 7d as a clear oil ( 31.2 mg , 28% ) . h nmr ( 300 mhz , cdcl3 , 295 k ) : 1.30 ( s , 9h ) , 2.983.13 ( m , 2h ) , 3.303.37 ( m , 1h ) , 4.23 ( dd , j = 3.2 , 9.1 hz , 1h ) , 4.53 ( dd , j = 3.9 , 9.1 hz , 1h ) , 6.85 ( d , j = 8.9 hz , 2h ) , 7.277.33 ( m , 3h ) , 7.407.51 ( m , 4h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 29.7 , 31.5 , 34.2 , 40.8 , 66.6 , 114.2 , 126.4 , 126.6 , 128.7 , 129.2 , 132.0 , 144.6 , 155.8 , 175.6 , 176.8 . hr - esims : m / z 338.1755 ( calcd for c21h24no3 , 338.1751 ) . 6d was also obtained as a clear oil ( 50.3 mg , 46% ) . h nmr ( 300 mhz , cdcl3 , 296 k ) : 1.32 ( s , 9h ) , 3.513.56 ( m , 1h ) , 4.10 ( dd , j = 4.3 , 11.4 hz , 1h ) , 4.23 ( d , j = 7.3 hz , 1h ) , 4.66 ( dd , j = 3.3 , 11.5 hz , 1h ) , 6.87 ( d , j = 8.1 hz , 1h ) , 7.247.29 ( m , 2h ) , 7.337.48 ( m , 4h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 31.5 , 34.4 , 40.0 , 42.3 , 64.1 , 116.4 , 117.3 , 126.3 , 127.0 , 128.7 , 129.1 , 131.8 , 134.2 , 145.7 , 153.0 , 175.2 , 175.7 . hr - esims : m / z 336.1598 ( calcd for c21h22no3 , 336.1600 ) . 4-(trifluoromethyl)phenoxyacetic acid ( 143 mg , 0.65 mmol ) , n - methylmaleimide ( 145 mg , 1.3 mmol ) , and tio2 ( 75 mg , 0.98 mmol ) were reacted in accordance with the general procedure . following irradiation for 16 h , the reaction mixture was purified by two rounds of column chromatography on silica gel ( eluent : 20% etoac in petroleum ether 4060 and subsequently 10% etoac in ch2cl2 ) to yield 7e as a clear oil ( 54.7 mg , 29% ) . h nmr ( 400 mhz , cdcl3 , 300 k ) : 2.822.96 ( m , 2h ) , 3.05 ( s , 3h ) , 3.203.26 ( m , 1h ) , 4.22 ( dd , j = 3.4 , 9.2 hz , 1h ) , 4.46 ( dd , j = 4.3 , 9.2 hz , 1h ) , 6.94 ( d , j = 8.5 hz , 2h ) , 7.54 ( d , j = 8.5 hz , 2h ) . c nmr ( 75 mhz , cdcl3 , 300 k ) : 25.1 , 31.6 , 40.5 , 66.1 , 114.6 , 123.9 ( q , jc f = 32.9 hz , 1c ) , 124.4 ( q , jc f = 271.2 hz , 2c ) , 127.0 ( q , jc f nmr ( 376 mhz , cdcl3 , 300 k ) : 62.1 . hr - esims : m / z 288.0838 ( calcd for c13h13no3f3 , 288.0842 ) . 6e was also obtained as a clear oil ( 60.1 mg , 32% ) . h nmr ( 400 mhz , cdcl3 , 298 k ) : 3.01 ( s , 3h ) , 3.403.44 ( m , 1h ) , 4.044.10 ( m , 2h ) , 4.64 ( dd , j = 3.2 , 11.5 hz , 1h ) , 6.98 ( d , j = 8.6 hz , 1h ) , 7.46 ( d , j = 8.5 hz , 1h ) , 7.87 ( s , 1h ) . c nmr ( 75 mhz , cdcl3 , 298 k ) : 25.5 , 39.4 , 41.8 , 64.0 , 117.9 , 118.4 , 123.9 ( q , jc f = 271.7 hz , 1c ) , 125.1 ( q , jc f = 33.1 hz , 1c ) , 127.2 ( q , jc f = 3.5 hz , 1c ) , 127.6 ( q , jc f = 3.8 hz , 1c ) , 157.7 , 175.3 , 176.1 . f nmr ( 376 mhz , cdcl3 , 298 k ) : 62.3 . hr - esims : m / z 286.0687 ( calcd for c13h11no3f3 , 286.0686 ) . 4-(trifluoromethyl)phenoxyacetic acid ( 143 mg , 0.65 mmol ) , n - phenylmaleimide ( 230 mg , 1.3 mmol ) , and tio2 ( 75 mg , 0.98 mmol ) were reacted in accordance with the general procedure . following irradiation for 16 h , the reaction mixture was purified by column chromatography on silica gel ( eluent : 25% etoac in petroleum ether 4060 ) to yield 7f as a colorless solid ( 52.9 mg , 40% ) . h nmr ( 400 mhz , cdcl3 , 297 k ) : 2.983.13 ( m , 2h ) , 3.353.40 ( m , 1h ) , 4.28 ( dd , j = 3.1 , 9.1 hz , 1h ) , 4.57 ( dd , j = 4.0 , 9.1 hz , 1h ) , 6.97 ( d , j = 8.5 hz , 2h ) , 7.29 ( d , j = 7.2 hz , 2h ) , 7.41 ( t , j = 7.3 hz , 1h ) , 7.49 ( t , j = 7.2 hz , 2h ) , 7.56 ( d , j = 8.6 hz , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 31.9 , 40.6 , 66.6 , 114.7 , 124.0 ( q , jc f = 32.8 hz , 1c ) , 124.3 ( q , jc f = 271.1 hz , 1c ) , 126.5 , 127.1 ( q , jc f = 3.7 hz , 2c ) , 128.8 , 129.3 , 131.9 , 160.4 , 175.2 , 176.3 . f nmr ( 376 mhz , cdcl3 , 297 k ) : 62.1 . hr - esims : m / z 367.1269 ( calcd for c18h18n2o3f3 , 367.1275 ) . h nmr ( 400 mhz , cdcl3 , 297 k ) : 3.573.61 ( m , 1h ) , 4.15 ( dd , j = 4.2 , 11.4 hz , 1h ) , 4.25 ( d , j = 9.3 hz , 1h ) , 4.71 ( dd , j = 3.4 , 11.4 hz , 1h ) , 7.04 ( d , j = 8.5 hz , 1h ) , 7.247.27 ( m , 2h ) , 7.367.51 ( m , 4h ) , 7.93 ( s , 1h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 39.5 , 41.7 , 64.1 , 117.7 , 118.5 , 123.9 ( q , jc f = 271.8 hz , 1c ) , 125.2 ( q , jc f = 33.0 hz , 1c ) , 126.2 , 126.4 ( q , jc f = 3.5 hz , 1c ) , 127.7 ( q , jc f = 3.7 hz , 1c ) , 128.9 , 129.2 , 131.5 , 157.8 , 174.3 , 175.0 . f nmr ( 376 mhz , cdcl3 , 297 k ) : 62.3 . hr - esims : m / z 365.1114 ( calcd for c18h16n2o3f3 , 365.1108 ) . a thf ( 60 ml ) solution of methyl bromoacetate ( 0.62 ml , 6.54 mmol , 1.0 equiv ) and triphenylphosphine ( 1.715 g , 6.54 mmol , 1.0 equiv ) was heated at reflux for 4 h until a white precipitate formed . the suspension was allowed to cool to room temperature before filtration ; the precipitate was washed with et2o ( 3 50 ml ) , and the precipitate was then redissolved in ch2cl2 ( 30 ml ) and h2o ( 20 ml ) . then 2 m naoh ( 10 ml ) was added , and the biphasic mixture was stirred overnight . the reaction mixture was extracted with ch2cl2 ( 3 100 ml ) , and the combined organic layers were washed with brine , dried ( mgso4 ) , and concentrated under reduced pressure to yield the phosphorane as a colorless powder ( 1.923 g , 88% ) . h nmr ( 400 mhz , cdcl3 , 295 k ) : 2.90 and 3.51 ( br , 3h ) , 7.437.48 ( m , 6h ) , 7.527.57 ( m , 3h ) , 7.627.70 ( m , 6h ) . c nmr ( 100 mhz , cdcl3 , 298 k ) : 49.9 , 128.5 ( d , j = 12.0 hz ) , 128.8 ( d , j = 12.2 hz ) , 131.9 ( d , j = 2.7 hz ) , 132.1 ( d , j = 9.8 hz ) , 132.9 , 133.0 ( d , j = 10.2 hz ) . hr - esims : m / z 335.1200 ( calcd for c21h20o2p , 335.1195 ) . a chcl3 ( 200 ml ) solution of phosphorane ( 1.893 g , 5.66 mmol , 1.1 equiv ) and 2-formylphenoxyacetic acid ( 0.927 g , 5.15 mmol , 1.0 equiv ) was heated at reflux for 18 h. the solvent was removed under reduced pressure , and the crude residue was purified by column chromatography ( eluent : gradient of petroleum ether to 1:1 etoac / petroleum ether ) to yield 8a as a colorless powder ( 1.037 g , 85% ) . h nmr ( 300 mhz , cdcl3 , 295 k ) : 3.80 ( s , 3h ) , 4.77 ( s , 2h ) , 6.61 ( d , j = 16.2 hz , 1h ) , 6.81 ( d , j = 8.3 hz , 1h ) , 7.03 ( t , j = 7.6 hz , 1h ) , 7.33 ( td , j = 1.7 , 7.5 hz , 1h ) , 7.54 ( dd , j = 1.6 , 7.7 hz , 1h ) , 8.04 ( d , j = 16.2 hz , 1h ) , 8.899.30 ( br , 1h ) . c nmr ( 75 mhz , cdcl3 , 298 k ) : 52.2 , 65.4 , 112.5 , 119.5 , 122.5 , 124.4 , 129.8 , 131.8 , 140.4 , 156.7 , 168.6 , 173.8 . hr - esims : m / z 235.0610 ( calcd for c12h11o5 , 235.0612 ) . prepared in the same manner as 8a . bromoacetonitrile ( 0.88 ml , 12.5 mmol ) and pph3 ( 3.28 g , 12.5 ml ) were reacted to give the salt ( 4.580 g , 96% ) . the phosphorane was prepared as before to give a colorless powder ( 3.422 g , 91% ) . h nmr ( 300 mhz , cdcl3 , 297 k ) : 7.457.70 ( m , 15h ) . c nmr ( 121 mhz , cdcl3 , 297 k ) : 128.9 ( d , j = 12.1 hz ) , 129.5 ( d , j = 12.4 hz ) , 132.3 ( d , j = 2.6 hz ) , 132.5 ( d , j = 9.9 hz ) , 133.0 ( d , j = 2.1 hz ) , 133.2 ( d , j = 10.1 hz ) . 8b was prepared from the phosphorane ( 3.346 g , 11.11 mmol ) and 2-formylphenoxyacetic acid ( 1.819 g , 10.10 mmol ) to give a colorless powder ( 1.477 g , 72% ) . mp : 118 c. h nmr ( 400 mhz , cdcl3 , 297 k ) : 4.67 ( s , 3h ) , 6.31 ( d , j = 16.8 hz , 1h ) , 6.83 ( d , j = 1.1 hz , 1h ) , 7.01 ( t , j = 7.6 hz , 1h ) , 7.337.39 ( m , 2h ) , 7.62 ( d , j = 16.8 hz , 1h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 65.1 , 98.0 , 112.2 , 119.1 , 121.9 , 123.0 , 129.8 , 132.2 , 146.5 , 156.5 , 170.5 . hr - esims : m / z 202.0511 ( calcd for c11h8o3n1 , 202.0510 ) . prepared in the same manner as 8a . 1-bromo-2-butanone ( 1.0 g , 6.62 mmol ) and pph3 ( 1.737 g , 6.62 mmol ) were reacted to give the salt ( 2.613 g , 96% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 1.18 ( t , j = 7.6 hz , 3h ) , 2.33 ( qd , j = 1.3 , 7.6 hz , 2h ) , 7.437.47 ( m , 6h ) , 7.527.56 ( m , 3h ) , 7.627.67 ( m , 6h ) . 8c was prepared from the phosphorane ( 1.712 g , 5.15 mmol ) and 2-formylphenoxyacetic acid ( 0.843 g , 4.70 mmol ) to give a colorless powder ( 0.829 g , 75% ) . h nmr ( 400 mhz , cdcl3 , 295 k ) : 1.17 ( t , j = 7.3 hz , 3h ) , 2.73 ( q , j = 7.3 hz , 2h ) , 4.78 ( s , 2h ) , 6.82 ( d , j = 6.82 hz , 1h ) , 6.90 ( d , j = 16.4 hz , 1h ) , 7.04 ( t , j = 7.1 hz , 1h ) , 7.35 ( td , j = 1.7 , 7.4 hz , 1h ) , 7.58 ( dd , j = 1.7 , 7.7 hz , 1h ) , 7.96 ( d , j = 16.4 hz , 1h ) . c nmr ( 100 mhz , cdcl3 , 298 k ) : 8.3 , 33.5 , 65.4 , 112.2 , 121.8 , 124.0 , 127.2 , 128.9 , 131.5 , 137.8 , 156.7 , 170.6 , 202.5 . hr - esims : m / z 233.0820 ( calcd for c13h13o4 , 233.0819 ) . 2-bromophenol ( 6.4 ml , 60.5 mmol ) , tert - butyldimethylsilyl chloride ( 10.0 g , 66.5 mmol ) , and imidazole ( 8.23 g , 121.0 mmol ) were dissolved in the minimum volume of dmf , and the mixture was allowed to stir at room temperature overnight . the dmf was removed under reduced pressure , and the resultant residue was taken up in etoac and washed with 1 m hcl , sat . the solvent was then removed under reduced pressure to yield ( 2-bromophenoxy)(tert - butyl)dimethylsilane ( 17.29 g , 99% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 0.25 ( s , 6h ) , 1.05 ( s , 9h ) , 6.806.84 ( m , 1h ) , 6.87 ( dd , j = 1.5 , 8.1 hz , 1h ) , 7.147.19 ( m , 1h ) , 7.51 ( dd , j = 1.7 , 7.9 hz , 1h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 4.2 , 18.4 , 25.8 , 115.4 , 120.3 , 122.4 , 128.2 , 133.4 , 152.6 . hr - esims : m / z 287.0461 ( calcd for c12h20obrsi , 287.0461 ) . the aforementioned silane ( 0.54 g , 1.9 mmol ) was coupled with phenylboronic acid ( 0.27 g , 2.2 mmol ) by refluxing overnight in toluene ( 20 ml ) and ethanol ( 5 ml ) with pd[p(ph)3]4 ( 0.2 g , 0.2 mmol ) and k2co3 ( 0.9 g , 6.5 mmol ) . the solvent was then removed under reduced pressure , and the reaction mixture was taken up in h2o before being extracted with etoac . the resultant mixture was subjected to column chromatography on silica gel ( eluent : 25% ch2cl2 in petroleum ether 4060 ) to yield [ 1,1-biphenyl]-2-yloxy)(tert - butyl)dimethylsilane ( 0.39 g , 73% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 0.05 ( s , 6h ) , 0.83 ( s , 9h ) , 6.92 ( dd , j = 1.2 , 8.0 hz , 1h ) , 7.04 ( td , j = 1.2 , 7.5 hz , 1h ) , 7.217.24 ( m , 1h ) , 7.307.33 ( m , 2h ) , 7.367.40 ( m , 2h ) , 7.50 ( dd , j = 1.5 , 8.5 hz , 1h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 4.6 , 18.1 , 25.6 , 120.4 , 121.6 , 126.7 , 127.8 , 128.3 , 129.8 , 130.9 , 133.6 , 139.2 , 152.6 . the aforementioned biphenylsilane ( 0.36 g , 1.3 mmol ) was treated overnight with acetyl chloride ( 0.3 ml , 0.4 mmol ) in methanol ( 15 ml ) . following removal of the solvent under reduced pressure , the reaction mixture was subjected to column chromatography on silica gel ( eluent : ch2cl2 ) to yield [ 1,1-biphenyl]-2-ol ( 0.19 g , 86% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 5.13 ( bs , 1h ) , 6.886.92 ( m , 2h ) , 7.147.19 ( m , 2h ) , 7.287.32 ( m , 1h ) , 7.367.42 ( m , 4h ) . the aforementioned biphenyl alcohol ( 0.19 g , 1.11 mmol ) , methyl bromoacetate ( 0.16 ml , 0.26 mmol ) , and k2co3 ( 0.76 g , 5.5 mmol ) were refluxed overnight in thf ( 20 ml ) . the solvent was then removed under reduced pressure , and the resultant residue was taken up in ch2cl2 before being washed with h2o and dried over mgso4 . the solvent was removed under reduced pressure , and the resultant mixture was subjected to column chromatography on silica gel ( eluent : 25% ch2cl2 in petroleum ether 4060 ) to afford methyl 2-([1,1-biphenyl]-2-yloxy)acetate ( 0.25 g , 94% ) . h nmr ( 300 mhz , cdcl3 , 294 k ) : 3.82 ( s , 3h ) , 4.66 ( s , 2h ) , 6.94 ( d , j = 8.3 hz , 1h ) , 7.15 ( td , j = 1.0 , 7.5 hz , 1h ) , 7.337.51 ( m , 5h ) , 7.69 ( dd , j = 1.4 , 8.4 hz , 1h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 52.2 , 65.8 , 112.8 , 122.2 , 127.1 , 128.1 , 128.6 , 129.7 , 131.3 , 131.4 , 138.1 , 154.8 , 169.6 . hr - esims : m / z 243.1020 ( calcd for c15h15o3 , 243.1016 ) . the aforementioned ester ( 0.19 g , 0.8 mmol ) was hydrolyzed with lioh ( 0.13 g , 3.2 mmol ) in a 3:1 mixture of meoh and h2o . following overnight stirring at room temperature , the reaction mixture was concentrated to ca . the combined extracts were dried over mgso4 and concentrated under reduced pressure , and the resultant residue was chromatographed on silica gel ( eluent : ch2cl2 ) to yield 11a ( 0.13 g , 73% ) . h nmr ( 300 mhz , cdcl3 , 294 k ) : 4.63 ( s , 2h ) , 6.92 ( dd , j = 1.1 , 8.2 hz , 1h ) , 7.13 ( td , j = 1.1 , 7.5 hz , 1h ) , 7.297.46 ( m , 5h ) , 7.57 ( dd , j = 1.5 , 8.4 hz , 2h ) , 8.8010.10 ( br , 1h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 65.9 , 113.4 , 123.1 , 127.7 , 128.7 , 129.1 , 129.9 , 131.8 , 131.9 , 138.3 , 154.6 , 173.7 . hr - esims : m / z 227.0707 ( calcd for c14h11o3 , 227.0714 ) . prepared in the same manner as 11a . ( 2-bromophenoxy)(tert - butyl)dimethylsilane ( 0.95 g , 3.3 mmol ) , 4-(trifluoromethyl)phenylboronic acid ( 0.75 g , 4.0 mmol ) , pd[p(ph)3]4 ( 0.38 g , 0.33 mmol ) , and k2co3 ( 1.2 g , 9.9 mmol ) were reacted and then columned on silica gel ( eluent : 25% ch2cl2 in petroleum ether 4060 ) to afford 3-(trifluoromethyl)-[1,1-biphenyl]-2-ol ( 0.13 g , 14% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 4.985.10 ( br , 1h ) , 6.96 ( d , j = 8.5 hz , 1h ) , 7.03 ( td , j = 1.1 , 7.5 hz , 1h ) , 7.267.31 ( m , 2h ) , 7.577.65 ( m , 2h ) , 7.71 ( d , j = 7.5 hz , 1h ) , 7.78 ( s , 1h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 116.2 , 121.3 , 126.9 , 129.3 , 129.7 , 130.5 , 132.5 , 138.3 , 152.4 . hr - esims : m / z 237.0526 ( calcd for c13h8of3 , 237.0533 ) . the aforementioned biphenyl alcohol ( 0.13 g , 0.55 mmol ) was alkylated as before with methyl bromoacetate ( 0.1 ml , 1.1 mmol ) and k2co3 ( 0.38 g , 2.7 mmol ) and columned on silica gel ( eluent : 50% ch2cl2 in petroleum ether 4060 ) to afford methyl 2-((3-(trifluoromethyl)-[1,1-biphenyl]-2-yl)oxy)acetate ( 0.14 g , 84% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 3.79 ( s , 3h ) , 4.65 ( s , 2h ) , 6.89 ( d , j = 7.7 hz , 1h ) , 7.12 ( td , j = 1.0 , 7.5 hz ) , 7.327.39 ( m , 2h ) , 7.54 ( t , j = 7.7 hz , 1h ) , 7.60 ( d , j = 7.8 hz , 1h ) , 7.81 ( d , j = 7.6 hz , 1h ) , 7.92 ( s , 1h ) . f nmr ( 376 mhz , cdcl3 , 296 k ) : 62.9 . c nmr ( 100 mhz , cdcl3 , 297 k ) : 52.3 , 65.5 , 112.3 , 122.3 , 123.8 ( q , jcf = 3.7 hz ) , 124.4 ( q , jcf = 272.2 hz ) , 126.5 ( q , jcf = 3.7 hz ) , 128.5 , 129.4 , 129.7 , 130.4 ( q , jcf = 32.1 hz ) , 131.2 , 133.0 , 138.8 , 154.6 , 169.2 . hr - esims : m / z 328.1162 ( calcd for c16h17no3f3 , 328.1155 ) . the aforementioned ester ( 0.14 g , 0.5 mmol ) was hydrolyzed with lioh ( 0.08 g , 1.8 mmol ) to afford 11b ( 0.13 g , 95% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 4.68 ( s , 2h ) , 6.91 ( d , j = 8.2 hz , 1h ) , 7.14 ( td , j = 1.0 , 7.5 hz , 1h ) , 7.347.39 ( m , 2h ) , 7.54 ( t , j = 7.7 hz , 1h ) , 7.60 ( d , j = 7.8 hz , 1h ) , 7.76 ( d , j = 7.6 hz , 1h ) , 7.87 ( s , 1h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 65.0 , 112.4 , 122.6 , 123.9 ( q , jcf = 3.3 hz ) , 124.2 ( q , jcf = 272.4 hz ) , 126.4 ( q , jcf = 3.6 hz ) , 128.5 , 129.4 , 129.7 , 130.6 ( q , jcf = 32.5 hz ) , 131.2 , 132.8 , 138.6 , 154.1 , 173.0 . hr - esims : m / z 314.1001 ( calcd for c15h15no3f3 , 314.0999 ) . prepared in the same manner as 11a . ( 2-bromophenoxy)(tert - butyl)dimethylsilane ( 0.63 g , 2.2 mmol ) , 4-(trifluoromethyl)phenylboronic acid ( 0.5 g , 2.6 mmol ) , pd[p(ph)3]4 ( 0.22 g , 0.22 mmol ) , and k2co3 ( 0.9 g , 6.5 mmol ) were reacted and then columned on silica gel ( eluent : 25% ch2cl2 in petroleum ether 4060 ) to afford 4-(trifluoromethyl)-[1,1-biphenyl]-2-ol ( 0.43 g , 82% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 4.99 ( s , 1h ) , 6.97 ( dd , j = 0.5 , 8.1 hz , 1h ) , 7.04 ( td , j = 1.1 , 7.5 hz , 1h ) , 7.267.32 ( m , 2h ) , 7.64 ( d , j = 8.6 hz , 2h ) , 7.74 ( d , j = 8.6 hz , 2h ) . f nmr ( 376 mhz , cdcl3 , 296 k ) : 63.05 . c nmr ( 100 mhz , cdcl3 , 297 k ) : 116.2 , 121.3 , 124.1 ( q , jcf = 272.0 hz ) , 125.9 ( q , jcf = 3.7 hz ) , 126.9 , 129.4 ( q , jcf = 32.4 hz ) , 129.6 , 129.8 , 130.4 , 141.1 , 152.3 . hr - esims : m / z 237.0539 ( calcd for c13h8of3 , 237.0533 ) . the aforementioned biphenyl alcohol ( 0.4 g , 1.66 mmol ) was alkylated as before with methyl bromoacetate ( 0.24 ml , 2.5 mmol ) and k2co3 ( 1.15 g , 8.3 mmol ) and columned on silica gel ( eluent : 25% ch2cl2 in petroleum ether 4060 ) to afford methyl 2-((4-(trifluoromethyl)-[1,1-biphenyl]-2-yl)oxy)acetate ( 0.529 g , 99% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 3.78 ( s , 3h ) , 4.64 ( s , 2h ) , 6.88 ( d , j = 8.2 hz , 1h ) , 7.10 ( td , j = 1.0 , 7.5 hz , 1h ) , 7.327.36 ( m , 2h ) , 7.67 ( d , j = 8.1 hz , 2h ) , 7.73 ( d , j = 8.1 hz , 2h ) . f nmr ( 376 mhz , cdcl3 , 296 k ) : 62.9 . c nmr ( 100 mhz , cdcl3 , 297 k ) : 52.2 , 65.5 , 112.3 , 122.2 , 124.4 ( q , jcf = 271.6 hz ) , 124.9 ( q , jcf = 3.7 hz ) , 129.1 ( q , jcf = 32.4 hz ) , 129.4 , 129.8 , 129.9 , 131.2 , 141.7 , 154.6 , 169.2 . hr - esims : m / z 328.1158 ( calcd for c16h17no3f3 , 328.1155 ) . the aforementioned ester ( 0.49 g , 1.6 mmol ) was hydrolyzed with lioh ( 0.26 g , 6.3 mmol ) to afford 11c ( 0.44 g , 95% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 4.68 ( s , 2h ) , 6.91 ( dd , j = 1.1 , 8.9 hz , 1h ) , 7.13 ( td , j = 1.0 , 7.6 hz , 1h ) , 7.337.39 ( m , 2h ) , 7.667.72 ( m , 4h ) . c nmr ( 100 mhz , cdcl3 , 297 k ) : 65.5 , 112.9 , 123.0 , 125.0 ( q , jcf = 273.5 hz ) , 125.4 ( q , jcf = 3.9 hz ) , 129.7 ( q , jcf = 31.2 hz ) , 129.9 , 130.3 ( 2 ) , 131.7 , 142.0 , 154.6 , 173.2 . hr - esims : m / z 295.0592 ( calcd for c15h10o3f3 , 295.0588 ) . a suspension of 2-formylphenoxyacetic acid ( 0.515 g , 2.86 mmol , 1.0 equiv ) , methoxylamine hydrochloride ( 0.478 g , 5.72 mmol , 2.0 equiv ) , and sodium acetate ( 0.469 g , 5.72 mmol , 2.0 equiv ) in ethanol ( 30 ml ) was heated at reflux for 18 h. the solvent was removed under reduced pressure , and the crude residue was redissolved in h2o ( 100 ml ) and extracted into ch2cl2 ( 3 100 ml ) . the combined organic layers were dried ( mgso4 ) , concentrated under reduced pressure , and purified by column chromatography ( 5% etoac / ch2cl2 ) to yield 13a as a colorless solid ( 0.390 g , 65% ) . h nmr ( 300 mhz , cdcl3 , 294 k ) : 4.01 ( s , 3h ) , 4.72 ( s , 2h ) , 6.91 ( d , j = 8.2 hz , 1h ) , 7.12 ( m , 1h ) , 7.34 ( d , j = 7.6 hz , 1h ) , 7.40 ( m , 1h ) , 8.15 ( s , 1h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 61.9 , 66.6 , 114.2 , 120.6 , 123.0 , 131.7 , 132.4 , 148.8 , 155.4 , 169.5 . hr - esims : m / z 208.0614 ( calcd for c10h10no4 , 208.0615 ) . a suspension of 2-formylphenoxyacetic acid ( 1.00 g , 5.55 mmol , 1.0 equiv ) , benzoxylamine hydrochloride ( 1.773 g , 11.11 mmol , 2.0 equiv ) , and sodium acetate ( 0.911 g , 11.11 mmol , 2.0 equiv ) in ethanol ( 60 ml ) was heated at reflux for 18 h. the solvent was removed under reduced pressure , and the crude residue was redissolved in h2o ( 100 ml ) and extracted into ch2cl2 ( 3 100 ml ) . the combined organic layers were dried ( mgso4 ) , concentrated under reduced pressure , and purified by column chromatography ( 5% etoac / ch2cl2 ) to yield 13b as a colorless solid ( 0.422 g , 26% ) . h nmr ( 300 mhz , cdcl3 , 294 k ) : 4.70 ( s , 2h ) , 5.25 ( s , 2h ) , 6.90 ( d , j = 8.2 hz , 1h ) , 7.11 ( t , j = 6.6 hz , 1h ) , 7.327.44 ( m , 7h ) , 8.26 ( s , 1h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 66.5 , 76.2 , 114.0 , 120.6 , 122.9 , 128.2 , 128.5 , 128.5 , 131.7 , 132.2 , 136.6 , 149.3 , 155.3 , 169.5 . hr - esims : m / z 284.0923 ( calcd for c16h14no4 , 284.0928 ) . phenoxyacetic acid ( 304 mg , 2.0 mmol ) and socl2 ( 0.74 ml , 10.0 mmol ) were refluxed in chcl3 for 72 h. the volatiles were removed under reduced pressure to yield phenoxyacetyl chloride . h nmr ( 400 mhz , cdcl3 , 296 k ) : 4.95 ( s , 2h ) , 6.93 ( m , 2h ) , 7.09 ( m , 1h ) , 7.35 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 64.9 , 77.2 , 114.8 , 122.3 , 129.9 , 157.5 , 174.2 . this compound was immediately treated with d2o ( 0.9 ml , 5.0 mmol ) in anhydrous ch3cn ( 10 ml ) , and the mixture was allowed to stir overnight under an argon atmosphere . the solvent was removed under reduced pressure , and the resultant residue was recrystallized from anhydrous et2o to yield 5ad as a white crystalline solid ( 141 mg , 46% ) . h nmr ( 500 mhz , cdcl3 , 295 k ) : 4.70 ( s , 2h ) , 6.93 ( m , 2h ) , 7.03 ( m , 1h ) , 7.32 ( m , 2h ) . h nmr ( 76 mhz , chcl3 , 315 k ) : 10.13 ( bs , 1d ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 64.9 , 114.8 , 122.4 , 129.9 , 157.4 , 172.8 . hr - esims : m / z 153.0543 ( calcd for c8h8o3d , 153.0513 ) . phenoxyacetic acid ( 100 mg , 0.66 mmol ) and acrylamide ( 93.9 mg , 1.32 mmol ) in mecn ( 45 ml ) were reacted in accordance with the general procedure in a tio2 sol gel - coated tube . following irradiation for 24 h , the reaction mixture was purified by dry flash chromatography on silica gel ( eluent : gradient of 210% meoh in ch2cl2 ) to yield 19h as an off - white solid ( 79.8 mg , 68% ) . h nmr ( 300 mhz , cdcl3 , 294 k ) : 2.13 ( m , 2h ) , 2.45 ( t , j = 7.2 hz , 2h ) , 4.02 ( t , j = 6.0 hz , 2h ) , 5.63 ( bs , 1h ) , 5.82 ( bs , 1h ) , 6.90 ( d , j = 8.8 hz , 2h ) , 6.95 ( t , j = 7.4 hz , 1h ) , 7.29 ( t , j = 7.4 hz , 2h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 25.4 , 32.6 , 67.1 , 114.9 , 121.2 , 129.9 , 159.2 , 175.4 . 4-(tert - butyl)phenoxyacetic acid ( 137.5 mg , 0.66 mmol ) and acrylamide ( 93.9 mg , 1.32 mmol ) in mecn ( 45 ml ) were reacted in accordance with the general procedure in a tio2 sol gel - coated tube . following irradiation for 30 h , the reaction mixture was purified by dry flash chromatography on silica gel ( eluent : gradient of 27.5% meoh in ch2cl2 ) to yield the title compound as an off - white solid ( 105.4 mg , 68% ) containing 5% 4-(tert - butyl)phenol . h nmr ( 400 mhz , cd3od , 297 k ) : 1.30 ( s , 9h ) , 2.042.11 ( m , 2h ) , 2.43 ( t , j = 7.3 hz , 2h ) , 4.00 ( t , j = 6.3 hz , 2h ) , 6.85 ( d , j = 8.9 hz , 2h ) , 7.30 ( dd , j = 3.2 , 11.5 hz , 1h ) . c nmr ( 75 mhz , cdcl3 , 297 k ) : 27.0 , 32.4 , 33.4 , 35.3 , 68.5 , 115.5 , 127.6 , 144.8 , 158.5 , 179.0 . hr - esims : m / z 236.1647 ( calcd for c14h22no2 , 236.1645 ) . 4-(trifluoromethyl)phenoxyacetic acid ( 145.3 mg , 0.66 mmol ) and acrylamide ( 93.9 mg , 1.32 mmol ) in mecn ( 45 ml ) were reacted in accordance with the general procedure in a tio2 sol gel - coated tube . following irradiation for 24 h , the reaction mixture was purified by dry flash chromatography on silica gel ( eluent : 5% meoh in ch2cl2 ) to yield the title compound as an off - white solid ( 108.4 mg , 66% ) . h nmr ( 500 mhz , d6-acetone , 295 k ) : 2.062.11 ( m , 2h ) , 2.41 ( t , j = 7.2 hz , 2h ) , 4.14 ( t , j = 5.9 hz , 2h ) , 6.30 ( bs , 1h ) , 6.86 ( bs , 1h ) , 7.14 ( d , j = 8.7 hz , 2h ) , 7.63 ( d , j = 8.7 hz , 2h ) . c nmr ( 75 mhz , d6-acetone , 297 k ) : 29.9 , 36.3 , 72.7 , 120.0 , 127.2 ( q , jc f = 33.1 hz , 1c ) , 130.0 ( q , jc f nmr ( 470 mhz , d6-acetone , 295 k ) : 61.8 . hr - esims : m / z 248.0896 ( calcd for c11h13no2f3 , 248.0896 ) . a suspension of 8c ( 0.050 g , 0.21 mmol , 1.0 equiv ) and tio2 ( p25 , 0.025 g , 0.32 mmol , 1.5 equiv ) in mecn ( 20 ml ) was reacted in accordance with the general procedure for 9 h. following removal of the solvent under reduced pressure , the mixture was subjected to analysis by h nmr and gc ms . gc ms indicated four major components , and one of these ( tr = 10.7 min ) had the correct mass and fragmentation pattern for the cyclized product 10c : m / z ( % ) : 190 ( 40 ) , 161 ( 36 ) , 146 ( 18 ) , 133 ( 23 ) , 119 ( 38 ) , 118 ( 100 ) , 91 ( 41 ) . h nmr ( 400 mhz , cd3cn , 298 k ) : 0.98 ( t , j = 7.3 hz , 3h ) , 2.47 ( q , j = 7.3 hz , 2h ) , 3.263.29 ( m , 1h ) , 4.37 ( dd , j = 2.3 , 8.4 hz , 1h ) , 4.94 ( dd , j = 5.2 , 9.4 hz , 1h ) , 7.037.17 ( m , 2h , ) , 7.507.54 ( m , 2h ) . attempts to isolate and thoroughly characterize 10c were not successful . photoisomerization of 8c to its z isomer was observed during the course of this experiment . h nmr ( 400 mhz , cd3cn , 298 k ) : 7.38 ( d , j = 7.3 hz , 1h ) , 7.30 ( t , j = 7.3 hz , 1h ) , 7.02 ( d , j = 12.0 hz , 1h ) , 6.95 ( t , j = 7.6 hz , 1h ) , 6.88 ( d , j = 8.3 hz , 1h ) , 6.28 ( d , j = 12.5 hz , 1h ) , 4.69 ( s , 2h ) , 2.47 ( q , j = 7.3 hz , 2h ) , 0.97 ( t , j = 7.3 hz , 3h ) . a suspension of 11a ( 0.052 g , 0.23 mmol , 1.0 equiv ) and tio2 ( p25 , 0.027 g , 0.34 mmol , 1.5 equiv ) in mecn ( 20 ml ) was reacted in accordance with the general procedure for 18 h. following removal of the solvent under reduced pressure , h nmr analysis of the reaction mixture showed mainly unreacted 11a together with a small amount of the cyclized product 12a ( 0.01 mmol , 5% wrt ch2br2 ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 5.05 ( s , 2h ) , 6.906.95 ( m , 2h ) , 7.007.10 ( m , obscured by sm ) , 7.607.70 ( m , 3h ) . attempts to isolate and thoroughly characterize 12a were unsuccessful . a suspension of 8a ( 0.050 g , 0.21 mmol , 1.0 equiv ) and tio2 ( p25 , 0.025 g , 0.32 mmol , 1.5 equiv ) in mecn ( 20 ml ) was reacted according to the general procedure for 9 h to yield 10a as a colorless powder ( 20% by nmr ) . h nmr ( 400 mhz , cdcl3 , 294 k ) : 2.52 ( dd , j = 9.5 , 16.5 hz , 1h ) , 2.73 ( dd , j = 5.3 , 16.5 hz , 1h ) , 3.72 ( s , 3h ) , 3.843.91 ( m , 1h ) , 4.18 ( dd , j = 6.3 , 9.2 hz , 1h ) , 4.68 ( t , j = 9.0 hz , 1h ) , 6.80 ( d , j = 7.7 hz , 1h ) , 6.86 ( t , j = 8.3 hz , 1h ) , 7.087.17 ( m , 2h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 38.7 , 39.7 , 52.3 , 110.2 , 114.1 , 121.0 , 124.6 , 129.1 , 129.5 , 160.2 , 172.7 . hr - esims : m / z 215.0674 ( calcd for c11h12o3na , 215.0679 ) . photoisomerization of 8a to its z isomer was observed during the course of this experiment . h nmr ( 400 mhz , cd3cn , 298 k ) : 7.48 ( dd , j = 7.6 , 1.8 hz , 1h ) , 7.31 ( t , j = 7.8 hz , 1h ) , 7.19 ( d , j = 12.5 hz , 1h ) , 6.97 ( t , j = 7.6 hz , 1h ) , 6.88 ( d , j = 8.3 hz , 1h ) , 6.01 ( d , j = 12.3 hz , 1h ) , 4.69 ( s , 2h ) , 3.63 ( s , 3h ) . a solution of 8b ( 0.050 g , 0.246 mmol ) in mecn ( 15 ml ) in a tio2 sol gel - coated tube the solvent was removed under reduced pressure , and the crude residue was purified by column chromatography ( ch2cl2 ) to yield 10b as a colorless powder ( 0.007 g , 28% ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 2.582.71 ( m , 2h ) , 3.743.82 ( m , 1h ) , 4.34 ( dd , j = 4.8 , 9.6 hz , 1h ) , 4.69 ( dd , j = 8.7 , 9.6 hz , 1h ) . 6.84 ( d , j = 8.1 hz , 1h ) , 6.93 ( td , j = 1.0 , 7.5 hz , 1h ) , 7.22 ( m , 1h ) , 7.32 ( d , j = 7.5 hz , 1h ) . c nmr ( 75 mhz , cdcl3 , 295 k ) : 22.8 , 38.8 , 75.4 , 110.3 , 117.7 , 121.2 , 124.4 , 127.1 , 129.7 , 159.7 . hr - esims : m / z 159.0676 ( calcd for c10h9no , 159.0679 ) . photoisomerization of 8b to its z isomer was observed during the course of this experiment . h nmr ( 400 mhz , cd3cn , 298 k ) : 8.01 ( dd , j = 7.6 , 1.6 hz , 1h ) , 7.66 ( d , j = 12.5 hz , 1h ) , 7.44 ( t , j = 8.0 hz , 1h ) , 7.11 ( t , j = 7.5 hz , 1h ) , 6.97 ( d , j = 8.3 hz , 1h ) , 5.64 ( d , j = 12.3 hz , 1h ) , 4.74 ( s , 2h ) . a suspension of 11c ( 59 mg , 0.20 mmol , 1.0 equiv ) and tio2 ( p25 , 0.024 g , 0.30 mmol , 1.5 equiv ) in mecn ( 20 ml ) was reacted in accordance with the general procedure for 18 h. following removal of the solvent under reduced pressure , h nmr analysis of the reaction mixture showed mainly unreacted acid ( 79% ) together with a small amount of the cyclized product 12c ( 0.01 mmol , 5% wrt ch2br2 ) . h nmr ( 400 mhz , cdcl3 , 296 k ) : 5.07 ( s , 2h ) , 6.936.96 ( m , 2h ) , 6.987.04 ( m ; obscured by sm ) , 7.727.65 ( m , 3h ) . gc ms analysis of the reaction mixture showed 12c as the main product : tr = 11.76 min ; m / z ( % ) 250 ( 58 ) , 249 ( 100 ) , 231 ( 6 ) , 201 ( 10 ) , 181 ( 10 ) , 152 ( 16 ) . also observed was a trace of what was probably the direct reduction product 2-methoxy-4-(trifluoromethyl)-1,1-biphenyl : tr = 11.84 min ; m / z ( % ) 252 ( 82 ) , 251 ( 48 ) , 250 ( 61 ) , 249 ( 100 ) , 237 ( 20 ) , 201 ( 16 ) , 183 ( 26 ) , 152 ( 32 ) . attempts to isolate and thoroughly characterize 12c were unsuccessful . a suspension of 13a ( 51 mg , 0.24 mmol , 1.0 equiv ) and tio2 ( p25 , 0.029 g , 0.36 mmol , 1.5 equiv ) in mecn ( 29 ml ) was reacted in accordance with the general procedure for 24 h. following removal of the solvent under reduced pressure , h nmr analysis of the reaction mixture showed that 13a had been entirely consumed and that a complex mixture of products had been formed . ms analysis of the mixture revealed that 14a had been formed : tr = 8.15 min ; m / z ( % ) 165 ( 29 ) , 133 ( 12 ) , 119 ( 100 ) , 91 ( 77 ) 77 ( 26 ) . also observed were benzofuran-3(2h)-one o - methyl oxime [ tr = 7.93 min ; m / z ( % ) 163 ( 100 ) , 118 ( 91 ) , 91 ( 52 ) ] , 2,3-dihydrobenzofuran [ tr = 7.87 min ; m / z ( % ) 120 ( 27 ) , 119 ( 100 ) , 91 ( 57 ) ] , 2,3-dihydrobenzofuran-3-amine [ tr = 5.06 min ; m / z ( % ) 135 ( 7 ) , 134 ( 74 ) , 119 ( 100 ) , 117 ( 11 ) ] , and benzofuran [ tr = 3.43 min ; m / z ( % ) 118 ( 100 ) , 90 ( 22 ) , 84 ( 30 ) ] . attempts to isolate and thoroughly characterize 14a , or any other products , were unsuccessful . a suspension of 13b ( 62 mg , 0.22 mmol , 1.0 equiv ) and tio2 ( p25 , 0.026 g , 0.33 mmol , 1.5 equiv ) in mecn ( 26 ml ) was reacted in accordance with the general procedure for 24 h. following removal of solvent under reduced pressure , h nmr analysis of the reaction mixture showed that 13b had been entirely consumed and that a complex mixture of products had been formed . gc ms analysis of the mixture revealed that 14b had been formed : tr = 15.53 min ; m / z ( % ) 241 ( 9 ) , 210 ( 9 ) , 133 ( 6 ) , 91 ( 100 ) , 77 ( 14 ) . also observed were benzofuran-3(2h)-one o - benzyl oxime [ tr = 15.37 min ; m / z ( % ) 239 ( 37 ) , 222 ( 4 ) , 148 ( 3 ) , 119 ( 7 ) , 91 ( 100 ) , 77 ( 12 ) ] , 2,3-dihydrobenzofuran-3-amine [ tr = 5.04 min ; m / z ( % ) 135 ( 7 ) , 134 ( 74 ) , 119 ( 100 ) , 117 ( 11 ) ] , benzyl alcohol [ tr = 3.77 min ; m / z ( % ) 108 ( 100 ) , 107 ( 73 ) , 79 ( 76 ) ] , benzofuran [ tr = 3.41 min ; m / z ( % ) 118 ( 100 ) , 90 ( 22 ) , 84 ( 30 ) ] , and benzaldehyde [ tr = 2.90 min ; m / z ( % ) 106 ( 87 ) , 105 ( 100 ) , 77 ( 66 ) ] . tio2 ( 12 mg , 0.15 mmol ) was dried overnight at 150 c under a continuous vacuum in an oven - dried schlenk tube . phenoxyacetic acid ( 15.2 mg , 0.1 mmol ) and acrylamide ( 14.2 mg , 0.2 mmol ) in mecn ( 12 ml ) were added via syringe , and the resultant mixture was irradiated for 18 h. h nmr analysis of the resultant mixture revealed 19h ( 39% by nmr ) . phenoxyacetic acid ( 15.2 mg , 0.1 mmol ) , acrylamide ( 14.2 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) in d3-mecn ( 12 ml ) were irradiated for 18 h. h nmr analysis of the resultant mixture revealed 19h ( 55% by nmr ) . d1-phenoxyacetic acid ( 15.3 mg , 0.1 mmol ) , acrylamide ( 14.2 mg , 0.2 mmol ) , and tio2 ( 12 mg , 0.15 mmol ) in mecn ( 12 ml ) were irradiated for 19 h. h nmr analysis ( wrt ch2br2 standard ) of the resultant mixture revealed 19h ( 49% by nmr ) . an oven - dried schlenk tube , complete with magnetic stirrer , was connected to a vacuum line , evacuated , and then back - filled with argon while still hot from the oven . in a glovebox , tio2 ( p25 , 0.15 mmol , 12 mg ) was added , and the tube was then heated at 150 c for 3 h under vacuum . in a separate oven - dried vessel , 10 ml of d2o ( freshly opened ) was degassed by three freeze pump thaw cycles before being transferred by cannula to the tube containing the tio2 once it had cooled to ambient temperature . the resultant mixture was allowed to stir overnight before the d2o was removed under reduced pressure . at this point the tio2 was again dried for 3 h at 150 c under vacuum . in a separate oven - dried vessel , phenoxyacetic acid ( 0.1 mmol , 15.2 mg ) and acrylamide ( 0.2 mmol , 14.2 mg ) were dissolved in mecn ( 12 ml ) that had been freshly collected after distillation over calcium hydride . the resultant mixture was degassed for 15 min by bubbling with argon and then transferred via cannula to the tube containing the tio2 once it had cooled to ambient temperature . the resultant mixture was then irradiated in accordance with the general procedure for 19 h. h nmr analysis of the resultant mixture revealed 19h ( 58% by nmr ) . this reaction was performed as above using d1-phenoxyacetic acid ( 15.3 mg , 0.1 mmol ) for 19 h. h nmr analysis of the resultant mixture revealed no clear signals indicating the formation of 19h or 19d .

photochemical reactions employing tio2 and carboxylic acids under dry anaerobic conditions led to several types of c c bond - forming processes with electron - deficient alkenes . the efficiency of alkylation varied appreciably with substituents in the carboxylic acids . the reactions of aryloxyacetic acids with maleimides resulted in a cascade process in which a pyrrolochromene derivative accompanied the alkylated succinimide . the selectivity for one or other of these products could be tuned to some extent by employing the photoredox catalyst under different conditions . aryloxyacetic acids adapted for intramolecular ring closures by inclusion of 2-alkenyl , 2-aryl , or 2-oximinyl functionality reacted rather poorly . profiles of reactant consumption and product formation for these systems were obtained by an in situ nmr monitoring technique . an array of different catalyst forms were tested for efficiency and ease of use . the proposed mechanism , involving hole capture at the tio2 surface by the carboxylates followed by co2 loss , was supported by epr spectroscopic evidence of the intermediates . deuterium labeling indicated that the titania likely donates protons from surface hydroxyl groups as well as supplying electrons and holes , thus acting as both a catalyst and a reaction partner .

cytochrome b5 ( cyt b5 ) reacts with myoglobin ( mb ) as part of a physiological repair system in which autooxidized and inactive femb is reduced to its active femb o2-storage form by electron transfer ( et ) from fecyt b5 . the [ mb : cyt b5 ] complex has served as a paradigm for interprotein et between dynamically docked partners whose binding and reactivity are decoupled ; many conformations of the complex contribute to binding but few to et . in recent years , we have demonstrated that binding and reactivity can be enhanced and coupled in the [ mb : cyt b5 ] complex through mutations on the mbwt surface and/or heme neutralization . these generate a suite of positively charged mb s whose binding to the negatively charged b5 increases with the charge product of the proteins ( qmbqcyt b5 ) ; et between the mb s and cyt b5 was probed through replacement of the heme group in mb with a porphyrin containing a closed - shell metal ion ( zn ) , with the focus being photooxidation of the photoexcited triplet state , znmb . most of this work studied znmb by fecyt b5 on the time scale of milliseconds seconds . however , photoexcitation of znmb directly populates the first - excited singlet state , s1 , and we discovered interprotein photooxidative singlet et within a redesigned [ znmb : cyt b5 ] complex at rate constants that approach those occurring within the photosynthetic reaction centers , ket = 2.1 10 s. in the rich history of photoinitiated interprotein et where one partner is a metal - substituted hemoprotein ( m = h2 as well as mg , zn ) , the exclusive focus has been on oxidative et quenching of the photoexcited protein partner , despite the fact that photoreduction of m - porphyrins is energetically favorable , and that there have been reports of reductive and oxidative quenching of photoexcited zn - substituted proteins by small molecules . we report here that photoinitiated electron flow involving a metal - substituted hemoprotein and its physiological partner protein can indeed be the [ mb : cyt b5 ] complex stabilized by three d / e k mutations on mb ( mmb(d44k / d60k / e85k ) , denoted mmb ; m = mg or zn ) exhibits both oxidative and reductive et quenching of both the singlet and triplet photoexcited mmb states , the direction of flow being determined by the oxidation state of the cyt b5 partner . we find that the first - excited singlet state , s1 , of the mb - incorporated metalloporphyrin , denoted mmb , undergoes nanosecond - time scale reductive et quenching in which an electron is transferred tommb from fecyt b5 , as well as nanosecond - time scale oxidative et quenching in which an electron is transferred frommmb to fecyt b5 . surprisingly , the rate constants for the two intracomplex reactions are the same within error , with average rate constants , kf 10 s , a phenomenon that is explainable on energetic grounds . the progress curves in both cases are nonexponential and viscosity independent , implying the presence of ensembles of structures that do not interconvert on the time scale of the measurement . the triplet state of the mutant , mmb , created by intersystem crossing ( isc ) from mmb likewise undergoes reductive et quenching by the fecyt b5 as well as oxidative et quenching by the fecyt b5 . again , surprisingly , the rate constants for the two intracomplex reactions are the same within error , kf 10 s , despite a large disparity in driving forces . however , in this case the shape and viscosity dependence of the progress curves indicate that et is gated by intracomplex conversion among a conformational ensemble . the protocols for expression , reconstitution with the desired metalloporphyrin , m ( m is mg - protoporphyrin ix = mg or zn - deuteroporphyrin ix = zn ) , and purification of mb(d44k / d60k / e85k ) have been outlined elsewhere , and are briefly described in the expanded materials and methods section in supporting information ( si ) . the tryptic fragment of bovine cyt b5 was isolated and purified as described previously . aerobic cyt b5 prefers the ferric state because of its slight negative redox potential ( 0.006 v vs nhe ) . however , for oxidative quenching experiments in which cyt b5 served as the oxidizing agent , it was further treated with excess k3[fe(cn)6 ] and then washed thoroughly with working buffer ( 5 mm kpi , ph 6 ) . for reductive quenching experiments in which cyt b5 served as the reducing agent , it was treated with excess na2s2o4 and then washed thoroughly with working buffer . the working buffer ( 5 mm kpi , ph 6.0 or 70% w / w glycerol in 5 mm kpi , ph 6 ) was syringe - filtered and allowed to deoxygenate in the glovebox for at least 24 h before the samples were made . protein stock solutions were exchanged into the anaerobic working buffer using corning spin - x uf concentrators immediately prior to the measurements . three types of sample were prepared : mmb by itself , cyt b5 by itself , and the complex , [ mmb : cyt b5 ] . the details concerning sample volumes and concentrations for femtosecond- and nanosecond - transient absorption ( ta ) can be found in si . the 120 fs pulses were produced with a commercial ti : sapphire oscillator / amplifier ( tsunamic / spitfire , spectra - physics ) , generating 1 w at 827 nm , operating at 1 khz . about 40% of this output was frequency - doubled and directed to a two - stage opa producing pulses of 540 nm ( znmb samples ) or 598 nm ( mgmb samples ) . five percent of the amplified pulse was sent up and down a motorized delay track which provided the desired time resolution , then was focused onto a sapphire disk to create a white - light continuum probe with coverage from 430 to 850 nm . after passing through the sample , the probe beam was dispersed onto a cmos array detector for the collection of spectral data at multiple delay times following photoexcitation of the sample . transient absorption spectra were obtained by chopping the pump beam at 500 hz and subtracting pump - on versus pump - off spectra . progress curves were generated at multiple wavelengths from the ta spectra and fit using an exponential ( for mmb decay ) or a stretched exponential ( for mmb reaction with cyt b5 ) ( see results and discussion ) . samples were excited with a nd : yag quanta - ray indi laser ( spectra - physics ) tuned to 532 nm . the output power was set to approximately 20 mw for the mgmb samples . triplet measurements were performed with an lks.60 laser flash photolysis spectrometer ( applied photophysics ) fitted with a xenon lamp with pulsing capabilities as the probe source . millisecond collection mode uses an agilent infiniium 600 mhz digitizer with a five - stage 1p28 photomultiplier tube as the detector . the triplet decay time courses were monitored at 465 nm , the maxima for the triplet - ground spectra difference for these samples . as decay traces span several orders of magnitude in time , 50100 shots were averaged for each time - segment and then merged into single files to obtain full kinetic progress curves for analysis . the driving forces ( g ) for the charge separation reactions generated by the photoinitiated oxidation or reduction of mgmb by ferric cyt b5 or ferrous cyt b5 , calculated as described in si , are presented within the et cycle of scheme 1 and in table 1 . the driving forces for charge recombination follow from closing the thermodynamic cycle and are also given in scheme 1 and table 1 . both oxidative and reductive et quenching of mgmb by fecyt b5 ( right side of scheme 1 ) and fecyt b5 ( left side of scheme 1 ) , respectively , the photoinitiated oxidation or reduction charge separation reactions of znmb by ferric or ferrous cyt b5 are comparably energetically favorable ( scheme s1 in si ) . the corresponding driving forces ( g ) for mgmb oxidation or reduction charge separation reactions with ferric or ferrous cyt b5 were calculated analogously ; again , both oxidative and reductive et quenching of mgmb by cyt b5 are highly favorable ( table 1 ; scheme s2 in si ) . mgmb forms 1:1 cyt b5 complexes with dissociation constant , kd 10 m , as does znmb . figure 1 displays the absorbance - difference spectra in the 450600 nm region , collected subsequent to laser excitation over the time scale of s1 decay for ( i ) mgmb by itself ( top panel , figure 1 ) and for complexes with ( ii ) fecyt b5 ( middle , figure 1 ) and ( iii ) fecyt b5 ( bottom , figure 1 ) ; the concentrations of cyt b5 were chosen so that 90% of the mmb was in complex . as can be seen , the singlet - ground absorbance - difference spectra at t = 1 ps for the free mgmb and for the two complexes are essentially the same ; the same is true for znmb ( figure s1 in si ) . the traces of figure 1 show the mgmb difference spectrum collected out to 5.2 ns ; the absorbance difference persisting after this time is due to the triplet - ground difference generated by mgmb that undergo isc to mgmb , which does not decay on the ns singlet time scale . difference spectra for mgmb by itself ( top ) , in complex with fecyt b5 ( middle ) , and in complex with fecyt b5 ( bottom ) . as clearly seen in figure 1 , the mgmb excited state is strongly quenched by complex formation with the cyt b5 partner protein in both its fe and fe oxidation states . analogous behavior is observed for znmb ( figure s1 in si ) , but mgmb decays approximately 5 times more slowly than znmb , allowing for relatively clearer characterization of mgmb et quenching , and consequently , we focus on this variant here . the progress curves for the decay of mgmb , both free and in the two complexes were assembled from the absorbance - difference spectra slices at 465 nm and are shown in figure 2 . see figure s2 in si for progress curves of free znmb and in complex with fecyt b5 and fecyt b5 . the free mmb ( m = mg , zn ) decays exponentially ( eq 1),1where a0 is the singlet - ground absorbance difference , kd is the singlet decay constant , and c is the absorbance difference associated with the triplet state , which does not decay measurably on this time scale progress curves for singlet to ground decay for mgmb ( gray ) , reductive quenching of mgmb in the presence of fecyt b5 ( blue ) , and oxidative quenching of mgmb in the presence of fecyt b5 ( red ) . the mgmb trace is described by eq 1 , while the [ mgmb : fecyt b5 ] and [ mgmb : fecyt b5 ] traces are best described by eq 2 . for both the [ mmb : fecyt b5 ] and [ mmb : fecyt b5 ] complexes , the strong quenching of mmb by the cyt b5 ( figure 1 , figure s1 in si ) generates rapidly decaying progress curves ( figure 2 , figure s2 in si ) that are well described by augmenting the intrinsic decay with a stretched exponential ( eq 2).2 this formulation describes an ensemble of complexes that exhibit a distribution in quenching constants around an average value , kf , the breadth of the distribution is reflected in the distribution exponent , 0 < n 1 , with smaller values for n corresponding to greater breadth of the distribution . the quenching constants for both mmb s obtained by globally fitting the progress curves of figures 2 and s2 in si at multiple wavelengths to eq 2 are presented in table 2 ; we note that the quenching constants for znmb are less reliably obtained because of the more rapid singlet decay . given the high driving forces for both oxidative and reductive et ( table 1 and scheme 1 ) we attribute the s1 quenching in both [ mgmb : cyt b5 ] complexes to intracomplex et : to photooxidation of the strongly reducing singlet excited state of mgmb through mgmb fecyt b5 et ( scheme 1 , right - side of the photocycle ) with the rate constant of kf , ox ; to photoreduction of the s1 state by fecyt b5 mgmb et ( scheme 1 , left - side of the photocycle ) with the rate constant of kf , red . likewise , the s1 quenching in znmb complexes is attributed to intracomplex et due to photooxidation or photoreduction with fecyt b5 or fecyt b5 , respectively ( si ) . as confirmation , analysis presented in si demonstrates that resonance energy transfer from the excited mgmb / znmb to fe or fecyt b5 can not be a significant component of the quenching . due to less cleanly resolved quenching in the znmb complexes , the distribution exponent was fixed in eq 2 for [ znmb : fecyt b5 ] to the value obtained from fits to the [ mgmb : fecyt b5 ] progress curves . efforts to measure the rate constant for charge recombination of the charge separated intermediates generated by et between mgmb / znmb and cyt b5 were not successful . such measurements were carried out in an earlier study of photooxidation of a more tightly bound mmb variant , but that study showed that the charge recombination ( back et ) reactions are faster than the charge separation ( or forward et ) reactions , suppressing accumulation of the intermediate on the singlet time scale as well as the triplet time scale as discussed below . in the present study , this obstacle was compounded by the fact that in the wavelength range monitored ( 450750 nm ) there is no singlet / ground isosbestic point that could be used to optimally detect and monitor the intermediate , and the absorbance - difference for the charge - separated species is small relative to the singlet - ground absorbance difference throughout the range . surprisingly , the average rate constants for the photooxidation and photoreduction of mgmb , respectively within the complexes with fecyt b5 and fecyt b5 , are roughly equal , kf , ox kf , red , despite the fact that the driving forces for the two charge separation processes differ by 0.4 ev ( table 1 ) . likewise , the average photooxidation and photoreduction rate constants of znmb are also similar ( table 2 ) . in short , the average et quenching rate constant appears surprisingly insensitive to the direction of the electron flow being essentially the same when mmb is oxidized by fecyt b5 or reduced by fecyt b5and kf is further insensitive to the identity of m ( table 2 ) . the fits of the et quenching to a stretched exponential with n < 1 imply the presence of an ensemble of complexes with a distribution of singlet et rate constants . brownian dynamics ( bd ) simulations , indeed predict the presence of such an ensemble , with m fe distances that range from 15 to 20 and a shortest reactivity distance of 15.3 for the complexes between the mb mutant and cyt b5 . however , the observation of a distribution of quenching constants , rather than an average over the rate constants of the ensemble , further implies that the ensemble of bound complexes do not undergo conformational interconversion on the et time scale . to test this implication , et was measured for the [ mgmb : fecyt b5 ] and [ mgmb : fecyt b5 ] complexes in 70% w / w glycerol buffer , where the viscosity is 20 greater than that of aqueous buffer . figure 3 shows that the singlet kinetic data collected in glycerol and aqueous buffers overlay well for both oxidative and reductive quenching , and et kinetic parameters for the two solvents differ insignificantly , confirming the absence of any role for conformational interconversion within the ensemble of structures during the nanosecond duration of the singlet et charge separation process . progress curves for oxidative ( red ) and reductive ( blue , offset by 0.3 arbitrary absorbance units ) quenching of mgmb by fe and fecyt b5 , respectively in 70% gly and aqueous buffer . we now show that , when the et energetics for oxidation and reduction charge separation processes ( table 1 ) are incorporated in the marcus equation , they fully account for the unexpectedly similar rate constants for the photooxidation and photoreduction of mmb within the complexes with fecyt b5 and fecyt b5 , respectively . marcus showed that an et rate constant can be written as the product of two terms the tunneling matrix element ( hda2 ) and the franck the former is a joint function of the distance between the donor and acceptor and the electron - transfer pathways ( dictated by the protein as the intervening medium in this case ) , while the latter is a function of the driving force ( g ) for the electron transfer reaction , eqs 3,3a3bfc ( eq 3b ) is a simple parabolic function of the driving force ( g ) for et with maximum at g = ( where is the reorganization energy ) . figure 4 plots fc as a function of g for 1 ev ; previous reports have demonstrated that the same value is applicable to both oxidative and reductive charge recombination reactions for the same photoexcitable species . fc term as a function of driving forces ( g ) and = 1.0 ev for et in the mgmb complexes with cyt b5 . oxidative quenching or et from mgmb to fecyt b5 is in red and reductive quenching or et from fecyt b5 tomgmb is in blue . since g = 0.8 ev ( see table 1 ) for reductive quenching due to singlet et and oxidative quenching due to triplet et , the fc terms for these two processes are offset by 0.1 in opposite directions for clarity . while the [ mgmb : fecyt b5 ] and [ mgmb : fecyt b5 ] complexes are expected to exhibit a similar ensemble of structures and electron - transfer pathways ( due to the same ranges of reactivity distances and the same protein media ) and , therefore , comparable hda2 , the driving forces for the oxidative and reductive mgmb et charge separation processes differ by (g ) 0.4 ev ( table 1 ) . however , figure 4 highlights the unexpected fact that the two driving forces ( depicted by circles ) are symmetrically placed around and near the maximum of the parabola at g = , oxidation being in the inverted region , g > < . as a result , fc for the two processes is fortuitously the same . moreover , since the two driving force values fall near the fc maximum , slight adjustments of either the g s or would likely result in the same set of kinetic observations . thus , the apparently surprising similarities in the kf for the oxidative and reductive quenching of mgmb are understandable on simple energetic grounds . s for singlet et charge separation processes in the [ znmb : fecyt b5 ] and [ znmb : fecyt b5 ] complexes are symmetrically related to ( figure s4 in si ) , again explaining why the oxidative and reductive singlet et quenching reactions have similar kf s ( table 2 ) . additionally , the respective oxidative and reductive et charge separation processes for the [ znmb : cyt b5 ] complexes have driving forces that are within (g ) 0.1 ev ( scheme s1 in si ) of those for the [ mgmb : cyt b5 ] complexes ( scheme 1 ; table 1 ) , accounting for the m - independence of et rate constants . examination of the parameter characterizing the breadth of the distribution in structures ( n , eq 2 ) does , however , reveal a slight oversimplification in the above comments about hda2 . for both m = mg and zn , the distribution parameter for oxidative singlet et quenching ( n 0.75 ) appears to be meaningfully different than that for reductive singlet et quenching ( n 0.50 ) suggesting a broadening of the distribution of rate constants for reductive quenching in the complex , [ mgmb : fecyt b5 ] , relative to oxidative quenching in the complex , [ mgmb : fecyt b5 ] ( table 2 ) . this dissimilarity can be attributed to a subtle variance in the ensemble of binding geometries resulting from the difference by a single charge in the two oxidation states , ferrous and ferric , of the highly negative cyt b5 partner in the two types of complexes . conformations of the [ mgmb : cyt b5 ] complexes that do not react via singlet et ( or relax to ground ) instead undergo isc to the [ mgmb : cyt b5 ] state , which can react via photooxidation or photoreduction of mgmb by the fecyt b5 and fecyt b5 , respectively , on the much longer ( ms ) triplet - state time scale . figure 5 presents progress curves for triplet decay monitored at 465 nm , the maximum triplet - ground difference absorption wavelength , for samples of the [ mgmb : fecyt b5 ] complex and the [ mgmb : fecyt b5 ] complex in aqueous and 70% w / w triplet progress curves monitored at 465 nm : mgmb by itself in the absence of cyt b5 quencher in gray ; in the presence of fecyt b5 in blue ; in the presence of fecyt b5 in red . triple et slows down with increased viscosity as noted by the rightward shift ( toward kd ) of the progress curves in 70% gly relative to the ones in aqueous buffer . in the absence of cyt b5 , mgmb decays to the ground state with first - order rate constant , kd = 400 s independent of solvent ( figure 5 ) . as previously reported , the [ mb : cyt b5 ] complex is in the slow - exchange regime on the triplet et time scale where et is significantly faster than dissociation of the complex , ket koff . as a result , triplet decay traces for the complex are biphasic ( figure 5 ) and can be fit to a double exponential ( eqs 4 ) : the rapidly decaying majority phase corresponds to the [ mgmb : cyt b5 ] complex ( fraction r ) , which decays with rate constant , kobs , f = kd+kf where kf is the intracomplex triplet et rate constant ; the minority phase represents free mgmb , which undergoes slower bimolecular quenching ( k2 ) with pseudo - first - order rate constant kobs , s = kd+k2*[cyt b5].4awhere the kinetic parameters resulting from fits to eqs 4 are listed in table 3 . monitoring the triplet / ground isosbestic points yielded no quantifiable charge - separated intermediate signals for either the oxidative or reductive quenching charge separation triplet et reactions , supporting the expectation that the accumulations of the respective charge - separated species are even smaller on the triplet time scale relative to the singlet time scale due to the relative lifetimes of the charge separation and charge recombination processes . the rate constants for intracomplex triplet et , kf s , are essentially the same for the oxidative and reductive processes in the same type of solvent ( table 3 ) , but in this case the identity is not in agreement with predictions of the marcus theory based on the energetics for triplet et quenching . as with singlet et , triplet et is energetically favorable for both oxidative quenching ( g = 0.8 ev ) and reductive quenching ( g = 0.4 ev ) of the mgmb with the difference between these two driving forces also being 0.4 ev ( table 1 ) . at the same time , the relative driving forces ( g ) are not symmetrically positioned around the estimated ( figure 4 ) , and the fc , and ket is predicted to differ by more than an order of magnitude for the two charge separation processes : ket , ox > ket , red . the similarity of the two kf s instead are explained by comparing the progress curves for the complexes in aqueous ( 1 ) and 70% w / w glycerol buffers ( 20 ) . as expected , the diffusion - limited second - order process slows in 70% w / w gly relative to water for both the photooxidative and photoreductive reactions with k2 decreasing by a factor of 20 as the viscosity increases by about this factor ( table 3 ) . unexpectedly , the rate constants for both oxidative and reductive intracomplex et decrease by roughly the same factor ( table 3 ) . this equality and viscosity - dependence of the rate constants for intracomplex oxidative and reductive triplet et , kf , ox kf , red , demonstrates that the measured intracomplex rate constant for charge separation reflects not the et process itself but rather the rate constant for interconversion among conformations of the bound complex ; conformational interconversion on the s ms time scale serves as a gate to the intracomplex charge separation triplet et . we have shown that photoinitiated electron flow within the [ mmb : cyt b5 ] complex ( m = mg or zn ) that is stabilized by three d / e k mutations of mb can indeed be symmetrized ; the complex exhibits both oxidative and reductive et quenching of both the singlet and triplet photoexcited mmb states , with the direction of electron flow being determined by the oxidation state of the cyt b5 partner , fecyt b5 or fecyt b5 . despite a large disparity in driving force in favor of photooxidation relative to photoreduction ( (g ) 0.4 ev , m = mg ; 0.2 ev , m = zn ) , the ultrafast intracomplex reductive and oxidative et quenchings of mmb surprisingly have the same average et rate constants of kf 10 s. equally surprising , the intracomplex reductive and oxidative et quenchings of mmb are again the same within error , kf 10 s. the equality of the rate constants for photooxidation and photoreduction of mmb is explainable on energetic grounds ; the driving forces for the two reactions have values symmetrically displaced above and below that of the reorganization energy , , and thus equal franck condon factors ( fc ) within the marcus equation . the progress curves for both directions of electron flow during et quenching of mmb are nonexponential and viscosity independent , implying the presence of an ensemble of structures that do not interconvert on the time scale of the measurement . the rate constants for photooxidation and photoreduction of mmb are again equal despite a large difference in driving force , but in this case the driving force difference predicts a large difference in fc and thus in rate constant . this behavior is explained by the findings that the progress curves are exponential and the rate constants decrease inversely with viscosity , which indicate that the quenching constants are not et rate constants at all , but instead that the reactions are gated by intracomplex conformational interconversion . the control of et on the time scale of triplet - state quenching by conformational interconversion underscores the important point that protein motions can control even intracomplex et reactions when they occur on the s ms time scale , suggesting that reconsideration of numerous such earlier studies might be productive , whereas the independence of the singlet - state et from such motions indicates that they are not likely to affect the relatively few et reactions on the ns time scale .

we report here that photoinitiated electron flow involving a metal - substituted ( m = mg , zn ) myoglobin ( mb ) and its physiological partner protein , cytochrome b5 ( cyt b5 ) can be symmetrized : the [ mb : cyt b5 ] complex stabilized by three d / e k mutations on mb ( d44k / d60k / e85k , denoted mmb ) exhibits both oxidative and reductive et quenching of both the singlet and triplet photoexcited mmb states , the direction of flow being determined by the oxidation state of the cyt b5 partner . the first - excited singlet state of mmb ( 1mmb ) undergoes ns - time scale reductive et quenching by fe2+cyt b5 as well as ns - time scale oxidative et quenching by fe3+cyt b5 , both processes involving an ensemble of structures that do not interconvert on this time scale . despite a large disparity in driving force favoring photooxidation of 1mmb relative to photoreduction ( (g0 ) 0.4 ev , m = mg ; 0.2 ev , m = zn ) , for each m the average rate constants for the two reactions are the same within error , 1kf > 108 s1 . this surprising observation is explained by considering the driving - force dependence of the franck condon factor in the marcus equation . the triplet state of the myoglobin ( 3mmb ) created by intersystem crossing from 1mmb likewise undergoes reductive et quenching by fe2+cyt b5 as well as oxidative et quenching by fe3+cyt b5 . as with singlet et , the rate constants for oxidative et quenching and reductive et quenching on the triplet time scale are the same within error , 3kf 105 s1 , but here the equivalence is attributable to gating by intracomplex conversion among a conformational ensemble .

many stroke patients with stroke have a balance problems while standing because they tend to put their weight on their non - paralyzed lower limb to increase swing of their upper body1 . falling accidents due to such decline in balance ability is on the increase annually . even when there is no injury from falling , frequent falling can sufficiently disrupt physical and social activities2 . because deterioration of muscular strength and balance ability increases the risk of falling , it is significantly important to perform exercises to promote upper limb muscular strength and training for balance3 . regular exercise of walking and for muscular strength and balance may increase muscular strength and balance to prevent falling of patients4 . walking , in particular , is known to be a safe type of aerobic exercise for patients , having the merit that it can be performed gradually by considering appropriate intensity , frequency , period , and phases of exercise for abilities of each patient5 . recently efficiency of walking training using a treadmill has attracted more attention as when such training has been reported to have better effects than walking on even ground . some researchers reported that walking on a treadmill is effective in improving balance and walking ability6 , 7 . with recent developments of relevant computer programs , new methods of rehabilitation exercise such exercises can increase interest and participation of patients in treatment and improve their significant functions by enabling them to perform various forms of tasks appropriate for goals of individual patients in virtual reality . virtual reality indicates a type of interactive simulation using computer hardware and software , in which users can have close - to - reality experiences8 . virtual reality training using visual feedback enables the participants to undergo the training while seeing their movements with their own eyes , a feature that helps them adjust their inaccurate body center caused by body image damage suffered by most stroke patients . in addition , training serves as a catalyst in active participation and performance of tasks by inducing interest and pleasure , providing immediately visual feedback on the result to enhance motor education ability9 . many recent researches of virtual reality games with higher accessibility reported that such games showed significant effects on voluntary control and coordination of children with cerebral palsy and increases in the motor ability of patients with parkinson disease10 . those types of games were also effective on recovery of upper limb functions and induced significant improvement in balance and walking of stroke patients , showing that the games can be used as an effective method of intervention11 , 12 . as a means of overcoming limitations of the existing intervention methods , virtual reality shows an availability it has to being applied in the rehabilitation of stroke patients . however , devices of virtual reality in previous studies are so large that they are difficult to be used in general social institutes or homes in terms of scale and cost . furthermore , they are targeted to a small number of patients . in this context , the purpose of this study was to perform treadmill exercise and virtual reality training exercise using nintendo wii , a device that can be easily used without regard to place or facility , in order to investigate the effects on balance and walking of stroke patients . all of the subjects were sufficiently explained of this study and voluntarily consented to their participation in the experiment . this study was approved by the research agency , and all participants provided written informed consent . those who could perform communication , comply with instructions in this study , perform balancing and walking independently , had no pain limiting execution of exercise , and had no disability in sight , hearing , and the vestibular organs were selected to be the subjects of this study . the forty stroke patients were randomly divided into two exercise program groups with one group using virtual reality training ( n=20 ) and another group using a walking exercise program using a treadmill ( n=20 ) . age for the virtual reality group , the age was 62.2 7.2 years old , the height was 162.8 6.7 cm , the weight was 58.1 5.4 kg , and the onset period was 30.4 5.4 months . age for the treadmill group , the age was 63.2 5.4 years old , the height was 164.7 7.5 cm , the weight was 60.2 4.5 kg , and the onset period was 31.6 7.4 months . the virtual reality group underwent training using the wii - fit software by nintendo , japan . when playing the nintento wii , the participants used wireless controllers to interact with the avatars on the screen via the virtual reality motion detection system . the controllers were attached by acceleration detecting sensors responding to changes in direction and speed . due to the detector being installed on the television , the screen showed the movements of the controller just as the player performed the movements13 . the virtual reality system used in this study was the wii board balance system , in which users played games while the balancing board sensed weight shift and distribution . the subjects of the virtual reality group performed yoga , muscular strength exercise , aerobic exercise , and balancing exercise , all for 10 minutes each for a total of 40 minutes . the treadmill group used low - speed treadmills for patients to directly control their speed based on their walking ability while walking for 40 minutes . the treadmills were equipped with handles on the front and on both sides , which the users could grip when they lost balance walking . we used a pedoscan ( rsscan 1 m , germany ) to measure balance of the subjects . the device consisted of 4,096 sensors for measuring pressures on both feet in static standing , computerizing left / right weight - bearing and anterior / posterior weight - bearing by separating each area . the patients were asked to stand up straight on the device without any movement for 30 seconds . the device was attached to the dominant foot of a subject , measuring the anterior and posterior pressures of the foot by the pressure detecting sensors on its insole . the insole between the foot and the board sensed the vertical reaction force to measure the stance phase , swing phase , cadence of the dominant foot . the measured signals were temporarily saved by the portable compact controller attached to the ankle by receiving the walking data of the subject and then were computerized and calculated . before the walking exercise , the smart step insoles were inserted in the shoes and were injected with air to maintain appropriate pressure . after putting on the shoes and being attached to the controller on their ankles , the subjects walked along a straight footpath for 10 meters , looking straight ahead . a paired t - test was used for before and after comparisons , and an independent t - test was used for a between group comparison with a significance level of =0.05 . for balance , there were significant differences in both the virtual reality group and the treadmill group after completing of the exercise program . for walking , the virtual reality group showed significant differences after completing of the exercise program . significant differences between the groups were shown in balance after completing of the exercise program ( table 1table 1.the comparison of balance and gait in virtual reality and treadmillperiodvirtual reality group ( n=20 ) treadmill group ( n=20)m sdm sdleft / right weight - bearing ( % ) pre17.1 5.516.9 6.5post10.6 4.8**13.1 5.8*anterior / posterior weight - bearing ( % ) pre15.4 6.715.7 4.6post10.3 4.7**12.9 5.1*affected side stance phase ( % ) pre53.7 6.454.2 7.6post57.5 5.7 * 55.3 6.4affected side swing phase ( % ) pre46.2 6.445.7 7.6post42.4 5.7 * 44.6 6.4cadence ( steps / min)pre44.2 5.443.7 6.4post48.1 6.1 * 45.2 6.1*paired t - test , independent t - test , * p<0.05 , * * p<0.01 ) . * paired t - test , independent t - test , * p<0.05 , * * p<0.01 falling can occur in all age groups , but older people and patients show higher frequency of falling . planned and consistent exercise is needed to prevent falling and strengthen muscles , and exercises promoting weight bearing , resistance , and aerobic process are known to be effective for such purposes14 . exercises for lower limb muscular strength and balancing exercises are effective for the prevention of falling and improvement of stamina of patients , but such exercises have some demerits because the content is simple and thus boring . to supplement the demerits , new methods of exercise owing to development of scientific techniques have been recently introduced where patients can perform various tasks in virtual reality15 , 16 . therapeutic intervention via virtual reality is more advantageous than other intervention methods in that it can provide relatively easy environmental control , availability in selecting environments , training based on patients abilities via phase - in task difficulty , rapid and precise feedback on performing tasks , and self - learning in safe environment17,18,19 . we applied an eight - week exercise program to stroke patients who were divided into a virtual reality exercise group and a treadmill walking group , in order to investigate effects of each exercise on balance and walking . the results of measuring balance and walking effects as the purpose of the virtual reality exercise program showed that significant differences were shown in all the domains of the left / right and anterior / posterior weight - bearing in balancing and the stance phase , the swing phase , and the cadence in walking . for the treadmill group , significant differences were displayed in the left / right and anterior / posterior weight - bearing in balancing . although the walking exercise program using a treadmill showed significant differences in balancing ability , the exercise program using virtual reality training displayed significant differences in balancing and walking because the patients could directly adjust their weight center and shift due to visual feedback . in addition , various similar programs such as jogging may further influence their balancing and walking . the results of this study suggest that virtual reality training may be appropriate to provide planned and consistent exercises for stroke patients who need improved balance and walking ability by giving visual feedback to induce their interest . meanwhile , the results of this study are consistent with those reporting increases in left / right , anterior / posterior stability of stroke patients who performed of virtual reality training , or reporting significant improvement in the berg balance test for the elderly who underwent a training using virtual reality games20 . in addition , there were researches in which significant differences were observed in balancing ability of the elderly with their eyes open after they underwent a virtual reality exercise program , or in which significant differences were found in balancing ability of the elderly after an eight - week virtual reality exercise program . meanwhile , the increase in walking ability shown in this study was consistent with the results of studies in which electrotherapy based on virtual reality significantly increased walking speed of stroke patients , or in which exercise using visual feedback was effective on the walking ability of stroke patients8 , 14 , 21 . in this study also , virtual reality training was effective in producing positive improvements in balance and walking of stroke patients . however , there remains insufficient research related to virtual reality because the technology has not been fully commercialized yet . further studies are needed to deal with virtual reality for many patients to use it in performing various indoor exercise programs and developing their abilities . the results of this study may indicate that virtual reality training providing visual feedback enables stroke patients to directly adjust their wrong weight center and shift visually , and that it is appropriate for the patients who need improved balance and walking ability by inducing their interest for them to perform planned exercise on a consistent basis .

[ purpose ] the purpose of this study is to investigate the effects of virtual reality training using nintendo wii on balance and walking for stroke patients . [ subjects and methods ] forty stroke patients with stroke were randomly divided into two exercise program groups : virtual reality training ( n=20 ) and treadmill ( n=20 ) . the subjects underwent their 40-minute exercise program three times a week for eight weeks . their balance and walking were measured before and after the complete program . we measured the left / right weight - bearing and the anterior / posterior weight - bearing for balance , as well as stance phase , swing phase , and cadence for walking . [ results ] for balance , both groups showed significant differences in the left / right and anterior / posterior weight - bearing , with significant post - program differences between the groups . for walking , there were significant differences in the stance phase , swing phase , and cadence of the virtual reality training group . [ conclusion ] the results of this study suggest that virtual reality training providing visual feedback may enable stroke patients to directly adjust their incorrect weight center and shift visually . virtual reality training may be appropriate for patients who need improved balance and walking ability by inducing their interest for them to perform planned exercises on a consistent basis .

all participants of both cohorts were followed as part of demographic surveillance and were tested for hiv at each sero - survey . if an individual died between follow - ups , an attempt was made to perform verbal autopsy . an individual 's hiv status at death was assumed to be the same as at his / her most recent test , which was a maximum of 3 years prior . the manicaland project includes a population - based open cohort study in the rural province of manicaland in eastern zimbabwe.9 the study population were residents in two forested small towns , four tea and coffee estates and six rural areas ( including four subsistence farming and two roadside trading centres ) . a baseline survey took place from 1998 to 2000 , with two follow - ups occurring 3 and 5 years later ( the intersurvey periods are referred to here as phase i and phase ii ) . of the households , 8376 and 7102 identified in the survey areas at phase i and phase ii , respectively , were enumerated . male and female participation rates in the individual cohort study survey were 78% ( 4320/5561 ) and 80% ( 5134/6419 ) at phase i and 77% ( 3047/3958 ) and 80% ( 3972/4936 ) at phase ii , respectively . verbal autopsies were conducted for 94% of all deaths,9 with 53% of the verbal autopsy reports obtained from close relatives ( spouse 19% , child 7% , parent 16% and sibling 10% ) . at each follow - up of the study , testing for the presence of hiv antibody was performed.13 the kisesa hiv cohort is located in magu district , mwanza region , in northwestern tanzania . the cohort was established in 1994 ( when baseline studies were conducted ) and data collection is based on a biannual dss that had conducted 14 phases by 2002 and sero - surveys repeated approximately every 3 years , with three testing surveys completed before 2002.10 1417 the population in the dss area grew from 19 354 in 1994 to 24 403 by 2002 . participation in the dss is more than 98% , with proxy reporting accepted for absent household members . the average participation rate in sero - surveys was 72% in the first three surveys . deaths identified in the dss are followed up with a verbal autopsy interview between 6 weeks and 6 months later , if a reliable informant can be identified who cared for the deceased during the final illness . verbal autopsy interviews were completed for 67% ( 420/629 ) of the adult male deaths and 64% ( 424/667 ) of the adult female deaths recorded in the dss between 1994 and 2002 ; 94% of the verbal autopsy reports were obtained from close relatives ( spouse 30% , child 28% , parent 21% and sibling 15% ) . the study teams identified deaths through the use of checklists of all individuals interviewed at the previous phase and discussions with village health workers , employers and surviving household members present at follow - up . data were collected on the signs , symptoms and circumstances preceding death using a structured , closed , interviewer - led questionnaire . the verbal autopsy questionnaire was originally developed in kisesa and contained specific questions related to symptoms of late - stage hiv and opportunistic infections14 and was used in that site from 1994 to 2002 . a nearly identical questionnaire was adapted in manicaland in both phase i and phase ii . the questionnaires were administered in local languages ( shona , the predominant local language in zimbabwe , and swahili , in tanzania ) . interviewers were clinical officers / certified nurses who received special training on how to administer the verbal autopsy questionnaire . verbal autopsy informants were parents , spouse , other relatives or a neighbour ( in rare circumstances when close relatives were not available ) . the interviews were conducted after the recognised mourning period , in a respectful and unhurried manner . in kisesa , the interviewer gave a small , culturally appropriate gift ( a bar of soap ) to the person with whom the interview was conducted , as a token of appreciation of the time devoted to answering the lengthy questionnaire . ethical approval for the dss and all related procedures ( such as the verbal autopsy interviews ) was granted by the tanzanian medical research co - ordinating committee for the kisesa study and by the zimbabwe medical research council for the manicaland study . we developed a computer algorithm that creates a set of criteria for classifying aids deaths based on verbal autopsy data.12 seventy - five per cent of deaths from manicaland phase i were randomly assigned to a training dataset . from this training dataset , all signs / symptoms with a likelihood ratio > 1.92 in univariate analyses were considered as potential identifiers of aids death ( as defined below ) . signs / symptoms were added to a list of criteria one at a time , based on the highest specificity . verbal autopsy deaths with that sign / symptom were then removed from the dataset , and specificities of the remaining signs / symptoms were recalculated . ( the roc is a tool used to select an optimum cut - off for a diagnostics test based on the trade - off of sensitivity and specificity . ) these steps were repeated until the ( equally weighted ) sensitivity and specificity of the list of symptoms was maximised ( ie , the point closest to the top left hand corner of the roc plot ) . deaths were classified as hiv / aids associated if the deceased had one or more of the criteria on the list . the sensitivity and specificity of the list was then tested on the manicaland phase i test data ( the remaining 25% of deaths ) , all phase ii and all kisesa data . aids death in the gold standard was defined as an individual who was ( a ) hiv positive at baseline survey based on antibody testing ; ( b ) was not reported to have suffered major injury from motor vehicle accident , self - inflicted ( suicide ) , or accidentally ( accident ) or deliberately inflicted by another person ( homicide ) in the 2 weeks before death ; and ( c ) did not die from direct obstetric causes ( death during labour).12 preliminary analyses highlighted that hiv prevalence among the deceased was markedly lower among the relatively older adults , so analyses were stratified at age 45 years . the study teams identified deaths through the use of checklists of all individuals interviewed at the previous phase and discussions with village health workers , employers and surviving household members present at follow - up . data were collected on the signs , symptoms and circumstances preceding death using a structured , closed , interviewer - led questionnaire . the verbal autopsy questionnaire was originally developed in kisesa and contained specific questions related to symptoms of late - stage hiv and opportunistic infections14 and was used in that site from 1994 to 2002 . a nearly identical questionnaire was adapted in manicaland in both phase i and phase ii . the questionnaires were administered in local languages ( shona , the predominant local language in zimbabwe , and swahili , in tanzania ) . interviewers were clinical officers / certified nurses who received special training on how to administer the verbal autopsy questionnaire . verbal autopsy informants were parents , spouse , other relatives or a neighbour ( in rare circumstances when close relatives were not available ) . the interviews were conducted after the recognised mourning period , in a respectful and unhurried manner . in kisesa , the interviewer gave a small , culturally appropriate gift ( a bar of soap ) to the person with whom the interview was conducted , as a token of appreciation of the time devoted to answering the lengthy questionnaire . ethical approval for the dss and all related procedures ( such as the verbal autopsy interviews ) was granted by the tanzanian medical research co - ordinating committee for the kisesa study and by the zimbabwe medical research council for the manicaland study . we developed a computer algorithm that creates a set of criteria for classifying aids deaths based on verbal autopsy data.12 seventy - five per cent of deaths from manicaland phase i were randomly assigned to a training dataset . from this training dataset , all signs / symptoms with a likelihood ratio > 1.92 in univariate analyses were considered as potential identifiers of aids death ( as defined below ) . signs / symptoms were added to a list of criteria one at a time , based on the highest specificity . verbal autopsy deaths with that sign / symptom were then removed from the dataset , and specificities of the remaining signs / symptoms were recalculated . ( the roc is a tool used to select an optimum cut - off for a diagnostics test based on the trade - off of sensitivity and specificity . ) these steps were repeated until the ( equally weighted ) sensitivity and specificity of the list of symptoms was maximised ( ie , the point closest to the top left hand corner of the roc plot ) . deaths were classified as hiv / aids associated if the deceased had one or more of the criteria on the list . the sensitivity and specificity of the list was then tested on the manicaland phase i test data ( the remaining 25% of deaths ) , all phase ii and all kisesa data . aids death in the gold standard was defined as an individual who was ( a ) hiv positive at baseline survey based on antibody testing ; ( b ) was not reported to have suffered major injury from motor vehicle accident , self - inflicted ( suicide ) , or accidentally ( accident ) or deliberately inflicted by another person ( homicide ) in the 2 weeks before death ; and ( c ) did not die from direct obstetric causes ( death during labour).12 preliminary analyses highlighted that hiv prevalence among the deceased was markedly lower among the relatively older adults , so analyses were stratified at age 45 years . there were a total of 376 and 219 deaths in phase i ( 19982003 ) and phase ii ( 20032005 ) , respectively , of the manicaland study and 197 in kisesa ( 19942002 ) , among 1959-year - olds for whom there was a verbal autopsy and a conclusive hiv test done within 3 years of death . a minority of deaths occurred in the 4559-year age group ( 13% , 17% and 19% ) in manicaland phase i , phase ii and kisesa cohorts , respectively ( table 1 ) . in manicaland , approximately 75% of deaths were caused by aids , compared with 51% in kisesa 1544-year - olds and 33% among kisesa 4559-year - olds . herpes zoster , acute respiratory tract infections , abscesses and sores , acute diarrhoea and tuberculosis were all less commonly reported in kisesa than in manicaland ( table 2 ) . for deaths under the age of 45 years , weight loss , jaundice , tumours , respiratory tract infections and tuberculosis were less common among hiv - positive deaths in kisesa compared with manicaland . prevalence of aids mortality in kisesa and manicaland verbal autopsy subjects sensitivity and specificity of individual signs and symptoms for aids deaths in manicaland and kisesa cohorts , stratified at age 45 years arti , acute respiratory tract infections ; se , sensitivity ; sp , specificity ; tb , tuberculosis . recent tuberculosis is shown for information but was not included in the final algorithm due poor specificity . in applying the previously developed algorithm to kisesa data , the sensitivity in classifying aids deaths was low ( 67% ) , mainly because of poor sensitivity ( 46% ) in the 4559-year age group . based on this observation , the algorithm was re - trained on manicaland phase i data , restricted to 1544-year - olds . this resulted in a different ordering of symptoms compared with the original algorithm and in the inclusion of a ninth symptom since the addition of diarrhoea gave a slightly higher mean sensitivity and specificity ( nine symptoms : 75.1% compared with eight symptoms : 74.7% ) . using this new algorithm , a set of nine criteria with a sensitivity of 75.0% and specificity of 75.2% receiver operator characteristic ( roc ) curve of algorithm on deaths of 1544-year - olds from manicaland phase i. the newly trained algorithm performed consistently based on sensitivity and specificity of data for 1544-year - olds from manicaland phase i ( sensitivity 79% ; sensitivity 79% ) , manicaland phase ii ( sensitivity 83% ; specificity 75% ) and kisesa ( sensitivity 75% ; specificity 74% ) tests . although a reasonable specificity was maintained on 4559-year - olds , the sensitivity dropped markedly in manicaland phase i ( sensitivity 73% ; specificity 73% ) , manicaland phase ii ( sensitivity 68% ; specificity 80% ) and kisesa ( sensitivity 54% ; specificity 62% ) tests in this older age group ( figure 2 ) . sensitivity and specificity of the trained algorithm . panels e and f use a smaller set of five signs / symptoms available from the current indepth tool . the indepth network is an association of health and dsss in african , asian and oceania countries ( http://www.indepth-network.org/ ) . the network has developed a widely used verbal autopsy questionnaire , although the tool does not collect information on herpes zoster , abscesses or sores , vaginal tumours or oral candidiasis ( table 3).18 we measured the value of using the five signs / symptoms that are available from the indepth questionnaire . in the 1544-year - old age group , using only these five signs / symptoms resulted in a sensitivity and specificity of 64% and 82% , respectively ( figure 2 ) . the reduction in sensitivity was less than expected , using the same five criteria in phase ii manicaland data and earlier kisesa data sensitivity had decreased to 50% and 44% respectively . signs and symptoms for surveillance of aids mortality , and the availability in indepth another widely used verbal autopsy questionnaire tb , tuberculosis ; va , verbal autopsy . we developed a tool that consistently measures aids mortality using verbal autopsy . through slight modification to our previously proposed criteria , the algorithm performs similarly in zimbabwe and tanzania settings with different hiv prevalence ( approximately 20% and 7% , respectively9 10 ) and aids mortality and different distribution of other causes of death . the algorithm is robust in that it performs consistently when prevalence is above approximately 5% . this method of measuring aids mortality produced reliable estimates only in the 1544-year age group . this is due to increasing levels of other - cause mortality in older ages . in manicaland , where the proportion of deaths due to hiv in the older age groups remained high,11 but in kisesa , where hiv prevalence is lower , aids mortality begins to drop off after 35 years of age , especially in women.6 14 19 20 and other causes also increase in the 4559-year age groups . tuberculosis , in particular , reduces the specificity marginally and the sensitivity markedly 21 22 because tuberculosis symptoms overlap substantially with hiv symptoms resulting in misclassification . given the sensitivity and specificity of the method from the training data , we would predict that 88% and 53% of deaths of 1544-year - olds in manicaland and kisesa were aids deaths , respectively . ( the formulae for this calculation are described by lopman et al.12 ) this compares with directly measured values of 76% and 51% . the overestimate in manicaland is a result the algorithm actually performing better in phase ii ( higher specificity ) than it did on the training dataset . to calculate the prevalence of aids death , the level of misclassification is corrected ; however , the level of misclassification was actually smaller than calculated on the training data . this approach to estimation of aids deaths can be applied to other verbal autopsy data for which a gold standard is not available ; however , the accuracy of the prediction will not be known . the indepth verbal autopsy is a widely used tool that used a shorter symptom list than ours and does not collect information to identify herpes zoster , oral candidiasis , abscesses / sores or vaginal tumours.21 these symptoms were commonly reported in our studies and ( excluding vaginal tumours ) were prevalent in aids deaths with a sensitivity of approximately 20% for zoster and abscesses / sores and we found that the indepth shortlist would perform less well and have higher levels of misclassification of aids deaths.23 the newly released who instrument includes signs and symptoms associated with herpes zoster , abscesses / sores and oral candidiasis.4 in general , verbal autopsy have only proved accurate enough to assign cause of death in very broad categories in adults . however , statistical or algorithmic approaches , such as the method used here , have been shown to perform adequately for determining prevalence of a specific cause , such as hiv . unfortunately , causes of death other than hiv could not be validated , as neither physician assessment nor diagnostics data were routinely available . our analyses show that in areas of generalised epidemics , verbal autopsy can consistently measure aids mortality . both studies had hiv prevalence levels exceeding 5% , which is commonly found in eastern and southern africa . in settings where prevalence is less than 5% , getting aids mortality from verbal autopsy may be difficult and will require further validation studies . even in higher prevalence settings , analyses should be restricted to age groups in which competing causes of mortality , especially other infectious causes , are relatively low . especially for the tanzanian population , the verbal autopsy method was much less accurate for deaths over the age of 45 years . based on our analyses , we recommend surveillance of deaths in populations with severe hiv epidemics be undertaken in the 1544-year age group . addition of a handful of questions related to opportunistic infections would enable other widely used verbal autopsy tools ( who and indepth ) to apply this validated method in areas where hiv testing and hospital records are unavailable or incomplete . verbal autopsy is currently the best option for obtaining cause of death information in populations without comprehensive civil registration systems . verbal autopsy is generally used to assign deaths to broad categories and estimate cause - specific mortality . we demonstrate that verbal autopsy can consistently measure aids mortality with a simple set of nine criteria . surveillance should focus on deaths that occur in the 1544-year age group for which the method performs reliably . adding just a handful of questions related to opportunistic infections would enable other widely used verbal autopsy tools to apply this validated method to asses aids mortality in areas where hiv testing and hospital records are unavailable or incomplete .

backgroundverbal autopsy is currently the only option for obtaining cause of death information in most populations with a widespread hiv / aids epidemic.methodswith the use of a data - driven algorithm , a set of criteria for classifying aids mortality was trained . data from two longitudinal community studies in tanzania and zimbabwe were used , both of which have collected information on the hiv status of the population over a prolonged period and maintained a demographic surveillance system that collects information on cause of death through verbal autopsy . the algorithm was then tested in different times ( two phases of the zimbabwe study ) and different places ( tanzania and zimbabwe).resultsthe trained algorithm , including nine signs and symptoms , performed consistently based on sensitivity and specificity on verbal autopsy data for deaths in 1544-year - olds from zimbabwe phase i ( sensitivity 79% ; specificity 79% ) , phase ii ( sensitivity 83% ; specificity 75% ) and tanzania ( sensitivity 75% ; specificity 74% ) studies . the sensitivity dropped markedly for classifying deaths in 4559-year-olds.conclusionsverbal autopsy can consistently measure aids mortality with a set of nine criteria . surveillance should focus on deaths that occur in the 1544-year age group for which the method performs reliably . addition of a handful of questions related to opportunistic infections would enable other widely used verbal autopsy tools to apply this validated method in areas for which hiv testing and hospital records are unavailable or incomplete .

to report a rare case of leucine - rich , glioma inactivated 1 ( lgi1 ) antibody mediated autoimmune encephalopathy clinically overlapping with pathologically confirmed sporadic creutzfeldt - jakob disease ( cjd ) . the patient was investigated with repeated brain mri , eeg , csf examination , whole - body fluorodeoxy - glucose positron emission tomography , genetic analysis of the prion protein gene ( prnp ) , and extensive serologic screening for paraneoplastic and autoimmune encephalopathy markers . written informed consent was obtained from the patient 's next of kin for access to clinical files for research purposes and for publication . the patient was a 77-year - old man who presented with faciobrachial dystonic seizures ( fbds ) secondary to lgi1 antibody mediated autoimmune encephalopathy , with suggestive mri findings and a complete response to treatment with combinatorial immunosuppression . stereotactic biopsy of a nonenhancing t1 hyperintense basal ganglia lesion during the initial fbds phase , albeit following immunosuppression , did not disclose evidence of lymphocytic inflammation . following full remission of the fbds , the patient manifested a rapidly progressive dementia associated with gross motor decline confirmed to be cjd at autopsy ( molecular subtype vv3 ) , with no evidence of a pathogenic prnp mutation . our patient highlights that these rare diseases are not invariably mutually exclusive and underscores the benefits of comprehensive neuropathologic examination of the brain to achieve an accurate diagnosis , especially in complex cases when the clinical trajectory dramatically deviates and a concomitant disease may need to be conscientiously considered to best explain the new clinical course . we propose that the 17-month illness to the time of death in our patient most likely comprised 2 overlapping neurologic illnesses : anti - lgi1 autoantibody - mediated encephalopathy predominantly manifesting as fbds and inexorable cognitive and gross motor decline due to vv3 sporadic cjd ( scjd ) . while the fbds was completely responsive to immunosuppression , the patient 's early cognitive impairment was only partially responsive , and although recognized for lgi1 antibody encephalopathy raises the possibility that at least some of this impairment may have related to scjd before more dramatic cognitive decline and accompanying features were evinced . although we consider it unlikely , due to the response of the fbds to immunosuppression in the setting of anti - lgi1 antibodies and typical mri changes , we can not exclude the possibility that the patient 's illness reflected an atypical cjd phenotype from the time of first presentation with fbds . fbds is a recently described immunotherapy - responsive seizure disorder characterized by highly stereotyped clinical features and the presence of autoantibodies to lgi1 , a protein component of the vgkc complex . furthermore , fbds is considered to be a highly specific phenotype and almost pathognomonic for lgi1 autoantibody mediated disease . fbds have also been recognized as a frequent prodromal sign preceding lgi1 antibody limbic encephalitis , a neuroinflammatory condition characterized by a clinical triad of fbds , cognitive impairment , and hyponatraemia . the absence of cognitive deficits at presentation with fbds renders it more likely that our patient was in the prodromal phase prior to the onset of limbic encephalitis , which is consistent with the absence of t2/fluid - attenuated inversion recovery signal increase in the mesiotemporal lobes typically seen in limbic encephalitis . in the early stage of the illness , mri demonstrated a nonenhancing t1 hyperintensity in the right bg , typical of what is observed in a sizeable proportion of patients presenting with fbds secondary to anti lgi1 antibody encephalopathy . in a recent retrospective case series of 26 patients with fbds and positive serology for lgi1 autoantibodies , 10 of these patients had the novel finding of contralateral bg t1 hyperintensity , thereby providing evidence for bg t1 hyperintensity as a useful mri biomarker of anti - lgi1 autoimmune fbds . our patient also developed hyponatremia ( na 122 mm ) , a common finding in fbds and limbic encephalitis . lgi1 antibody mediated fbds and limbic encephalitis have been reported to show variable response rates to immunotherapy , with most cases reporting at least partial improvement of fbds and cognitive symptoms . moreover , early initiation of immunotherapy at the fbds stage can prevent progression to limbic encephalitis . our patient demonstrated an initial good response of the fbds to combination immunotherapy and anticonvulsant medication , with partial improvement in cognition , before eventually manifesting inexorable intellectual , behavioral , and gross motor decline almost certainly due to co - occurrence of scjd . although positive vgkc complex ( and in retrospect lgi1 ) antibodies were present at the early stage of our patient 's illness , there have been reports of elevated vgkc complex antibody levels in patients with cjd , albeit with no symptoms of fbds or other evidence of autoimmune encephalopathy , with subsequent uncertainty about the significance of antibody levels in these clinical situations . further illustrating the diagnostic challenges that can arise in the evaluation of patients with neurologic illnesses with positive serology for autoimmune encephalopathies , previous case series have discussed autoimmune vgkc complex limbic encephalitis ( vgkcc - le ) as a mimic of cjd , with patients initially thought to have cjd but later confirmed to have immunotherapy - responsive vgkcc - le , and conversely , cjd has been reported as a mimic of vgkcc - le and of morvan syndrome associated with elevated vgkcc and glycine receptor autoantibodies . our patient was somewhat different from the usual clinical reports , manifesting a dramatic biphasic illness punctuated by a period of incomplete recovery , rather than a predominantly monophasic course , until an accurate diagnosis was achieved . development of refractory cognitive and gross motor decline in our patient prompted some uncertainty and reconsideration of the diagnosis but was construed as probably reflecting treatment - unresponsive lgi1 antibody encephalopathy rather than representing the development of a second neurologic illness such as scjd , especially when there was no definite objective investigational evidence to clearly support such an alternative diagnosis . the absence of inflammation in the brain at biopsy and autopsy examinations is without definite explanation but we conjecture most likely represents the effects of immunosuppressant treatment in a patient who appeared to have at least a partially responsive anti our patient underscores the benefits of comprehensive neuropathologic examination of the brain to achieve an accurate diagnosis , especially in complex cases when the clinical trajectory dramatically deviates and vigilance for a concomitant disease is arguably the best approach to explain the new clinical course . in addition , our patient exemplifies the utility of recognizing bg t1 hyperintensity in patients with brief adventitious face and limb movements suggestive of fbds , which should prompt investigation for vgkc complex antibodies and in particular anti - lgi1 antibodies , which may be responsive to immunosuppressive therapy . b. kim : involved in the collection of patient information and creation of figure 1 and contributed to the manuscript writing , drafting , and reviewing process . p. yoo : involved in the collection of patient information and creation of figure 1 and contributed to the manuscript writing , drafting , and reviewing process . t. sutherland : reviewed clinical images , assisted in the creation of figure 1 , and contributed to the drafting and review of the manuscript . a. boyd : assisted in collection of patient clinical files and in the manuscript drafting and review process . c. stehmann : assisted in collection of patient clinical files and in the manuscript drafting and review process . c. mclean : reviewed the pathologic details of the case and contributed to the drafting and review process and creation of figure 2 . s. collins : provided overall guidance in the direction of the case report and contributed to the writing , drafting , and reviewing process . the australian national creutzfeldt - jakob disease registry ( ancjdr ) is funded by the commonwealth department of health . boyd received research support from australian commonwealth department of health . c. stehmann holds a patent for albumin depletion technology . c. mclean reports no disclosures . s. collins is an associate editor for journal of alzheimer disease and received research support from nhmrc , rebecca cooper foundation , brain foundation , and commonwealth department of health .

objective : to report a rare case of leucine - rich , glioma inactivated 1 ( lgi1 ) antibody mediated autoimmune encephalopathy clinically overlapping with pathologically confirmed sporadic creutzfeldt - jakob disease ( cjd).methods : the patient was investigated with repeated brain mri , eeg , csf examination , whole - body fluorodeoxy - glucose positron emission tomography , genetic analysis of the prion protein gene ( prnp ) , and extensive serologic screening for paraneoplastic and autoimmune encephalopathy markers . written informed consent was obtained from the patient 's next of kin for access to clinical files for research purposes and for publication.results:the patient was a 77-year - old man who presented with faciobrachial dystonic seizures ( fbds ) secondary to lgi1 antibody mediated autoimmune encephalopathy , with suggestive mri findings and a complete response to treatment with combinatorial immunosuppression . stereotactic biopsy of a nonenhancing t1 hyperintense basal ganglia lesion during the initial fbds phase , albeit following immunosuppression , did not disclose evidence of lymphocytic inflammation . following full remission of the fbds , the patient manifested a rapidly progressive dementia associated with gross motor decline confirmed to be cjd at autopsy ( molecular subtype vv3 ) , with no evidence of a pathogenic prnp mutation.conclusions:our patient highlights that these rare diseases are not invariably mutually exclusive and underscores the benefits of comprehensive neuropathologic examination of the brain to achieve an accurate diagnosis , especially in complex cases when the clinical trajectory dramatically deviates and a concomitant disease may need to be conscientiously considered to best explain the new clinical course .

the degradation of mineralized extracellular matrix of bone requires acid secretion by osteoclast membrane . in most of cases disturbances of osteoclast specific subunit of vacuolar proton pump ( tcirg1 ) . usually patient present with parental concern regarding child vision , failure to achieve normal milestones , roving eyeball movements with or without squint , failure to thrive , and recurrent infections . less commonly associated features are hypocalcemic seizures , excessive bruising , bone fracture , nasal congestion , and abnormal facial appearance . here we report a rare case presented with evidence of failure to achieve normal milestones , roving eyeball movements without squint , failure to thrive , recurrent infections , short stature , anemia , thrombocytopenia , hepatosplenomegaly , rickets , aqueductal stenosis , and hydrocephalus with resultant optic atrophy . bone marrow transplantation is the only effective treatment for osteopetrosis ; it provides hematopoietic stimulus that can differentiate into normal osteoclasts along with supportive treatment related to complications . a 6-month - old male child was first child of third - degree consanguineous marriage born by vertex vaginal delivery with birth weight 2.75 kg presented with intermittent fever and abdominal distension since 1 month , developmentally delayed able to hold neck partially , cooing but not able to recognize mother and transfer objects from one hand to other hand . anthropometry wise weight was 5.6 kg , length was 60 cm , and head circumference was 44 cm with upper segment / lower segment ratio maintained . on clinical examination , the following were determined : pale , bulging anterior fontanelle 3 2 cm with dilated prominent veins over scalp , frontoparietal bossing , roving eyeball movements with sunset sign , and hepatosplenomegaly . laboratory workup shows anemia with hb 9.3 gm / dl ( after blood transfusion ) , hct 27% , reduced platelets , and rbcs on smear with leucocytosis ( 26,900/mm ) . a radiographic skeletal survey revealed diffuse bony sclerosis and bone in bone appearance involving long bones , spine , and skull , and significant metaphyseal freying and cupping with increased distance between metaphysic and epiphysis s / o osteopetrosis with rickets [ figures 1 and 2 ] . magnetic resonance imaging of the brain showed bilateral moderate dilatation of lateral and third ventricle with funneling of proximal portion of aqueduct of sylvious s / o aqueductal stenosis . aneurysmal dilatation of great cerebral vein of gallen and straight sinus and significant dilatation of other sinuses . paucity of white matter in bilateral cerebral hemisphere with thinning of corpus callosum [ figure 3 ] . x - ray showing thickening of skull bones , bone in bone appearance involving all bones with freying and cupping at the ends of long bones x - ray showing osteopetrosis with rickets mri brain showing paucity of white matter with thinning of corpus callosum , moderate dilatation of lateral and third ventricles with aqueductal stenosis malignant osteopetrosis is an autosomal recessive disorder common in consanguineous population with 25% risk ( i.e. , 1 in 4 ) of having another child affected in subsequent pregnancy . the age at diagnosis was 318 months , and mean life expectancy without bone marrow transplant was 3.7 years . this leads to narrowing of cranial foramina and encroachment on marrow spaces resulting in optic nerve , facial nerve dysfunction , and anemia accompanied by compensatory extramedulary hematopoiesis in liver and spleen results as hepatosplenomegaly , leucopenia , and thrombocytopenia . our case presented with evidence of failure to achieve normal milestones , roving eyeball movements without squint , failure to thrive , recurrent infections , short stature , rickets , anemia , thrombocytopenia , hepatosplenomegaly , aqueductal stenosis , and hydrocephalus with resultant optic atrophy . rickets is a paradoxical complication in osteopetrotic bones due to inability of osteoclasts to maintain calcium and phosphate balance in extracellular fluid . recurrent infections are due to defect in generation of superoxide by leucocytes along with anemia , poor nutrition and recurrent hospitalization . another unusual complication associated with osteopetrosis is aqueductal stenosis with progressive hydrocephalus . in our case there was a progressive blindness due to optic nerve compromise , possibly from increased intracranial pressure as a consequence of hydrocephalus and venous outflow obstruction at the constricted skull base , in addition to direct compression within the optic canal . management of osteopetrosis is multidimentionary involving pediatrician , ophthalmologist , orthopedician , otorhinologist , physiotherapist , and so on . treatment of rickets with calcitriol ( 1,25-hydroxyvitamin d3 ) and high levels of dietary calcium decrease the prevalence of lethargy , irritability , poor feeding , and upper respiratory tract infection in these patients . our patient treated with antibiotics for infection , vitamin d , and calcium supplement given and bone marrow transplant is planned .

malignant osteopetrosis is a rare autosomal recessive bone disease usually present with short stature , severe anemia , thrombocytopenia , hepatosplenomegaly , and macrocephaly . here we report a rare case of malignant osteopetrosis presented with evidence of short stature , anemia , thrombocytopenia , hepatosplenomegaly , rickets , aqueductal stenosis , and hydrocephalus with resultant optic atrophy .

moyamoya disease ( mmd ) , characterized by progressive stenosis or occlusion of the bilateral intracranial internal carotid arteries , is associated with abnormal vascular networks at the base of the brain , termed the " moyamoya " vessels.13)15 ) " probable mmd " is characterized by unilateral hemispheric involvement and exclusion of the following basic diseases ( arteriosclerosis , autoimmune disease , meningitis , brain neoplasm , down syndrome , recklinghausen 's disease , head trauma , irradiation to the head.1 ) mmd generally peaks at two different ages , the second and fifth decades.8 ) a number of studies have reported that surgical revascularization for symptomatic mmd is effective in pediatric patients.2)12)14 ) owing to disease progression , early surgical interventions in pediatric patients can reduce morbidity resulting from stroke even in the absence of symptoms.7)10 ) however , evidence regarding the incidence and natural course of asymptomatic mmd in adults is limited . the prevalence of asymptomatic adult mmd has recently increased due to development of noninvasive diagnostic techniques and the increase in regular medical checkups.11 ) given the lack of guidance regarding treatment in these patients , the aim of this study was to document the natural course of asymptomatic adult mmd to aid in treatment decisions . we reviewed data from may 2003 to december 2012 in the clinical database of our institute for identification of patients who were diagnosed with mmd or probable mmd according to published guidelines.1 ) we included probable mmd in this study because we think that mmd and probable mmd are inseparable diseases . of the 587 mmd patients identified , 459 patients were adults ( aged 20 years ) at the time of diagnosis . patients were considered to have asymptomatic mmd when it was detected without the presence of an ischemic event , a hemorrhagic event , or a focal neurological deficit . as a result , 42 patients were included in this retrospective cohort study . clinical records were reviewed retrospectively , and follow - up data from september 2013 were evaluated . all of the patients had complained of a simple headache and underwent subsequent brain magnetic resonance imaging ( mri ) and magnetic resonance angiography ( mra ) . diagnosis of mmd was based on mri and mra findings , and 21 patients underwent conventional angiography to confirm the diagnosis . cerebral perfusion was measured in 41 patients using 99mtc - hexamethylpropylene amine oxime single photon emission computed tomography ( spect ) , xenon computed tomography ( ct ) , or positron emission tomography ( pet ) , and cerebral reserve capacity was assessed after an intravenous injection of acetazolamide . cerebral perfusion and reserve capacity images were interpreted as normal or decreased status , respectively , by the same competent professor of nuclear medicine . analysis of the relationships between disease progression and associated factors was performed using tests . ibm spss v. 21 ( ibm corp . , armonk , ny , united states ) was used in performance of statistical analyses . of the 42 patients identified with asymptomatic adult mmd , 33 patients had bilateral mmd , and nine patients had probable mmd , resulting in inclusion of 75 hemispheres . the sample included 32 ( 76.2% ) women and 10 ( 23.8% ) men ( table 1 ) . the mean age at the time of diagnosis was 41.2 years ( range , 23 - 64 years ) . the mean follow - up period was 37.3 months ( range , 7.4 - 108.7 months ) , during which time none of the patients underwent bypass surgery . additional patient characteristics are shown in table 1 . according to the initial mris , 12 patients ( 28.6% ) had old lacunar infarcts or microbleeding without symptoms . reduced cerebrovascular reserve capacity ( cvrc ) was detected in the initial spect in 15 patients ( 23 hemispheres , 30.7% ) ( table 2 ) . disease progression was divided according to two categories : symptomatic progression , in which any neurological symptom developed , and asymptomatic radiographic progression , in which abnormal findings were detected in a follow - up radiological evaluation . symptomatic is frequently referred to as " clinical progression " in other reports.11 ) of the 42 patients and 75 hemispheres , there were 12 patients ( 28.6% ) and 13 hemispheres ( 17.3% ) with either category of disease progression . there were no relationships with sex , diabetes , hypertension , thyroid disease , family history of mmd , or family history of stroke . however , the initial cvrc was reduced in six patients ( 14.3% ) and seven hemispheres ( 9.3% ) in the patients with disease progression ( table 2 ) . symptomatic progression ( hemorrhagic or ischemic stroke ) occurred in four patients , all women . the mean sd duration from mmd diagnosis to event occurrence was 20.8 15.7 months ( range , 7.6 - 41.1 months ) . two patients underwent decompressive craniectomy and removal of a hematoma due to a large amount of hemorrhage . the fourth patient experienced a transient ischemic attack after cesarean delivery , followed by intermittent occurrence of symptoms . therefore , we recommended bypass surgery , but the patient did not make a decision . eight patients ( nine hemispheres , 12.0% ) showed asymptomatic radiographic progression during the follow - up period . in six patients , a silent cerebral infarction on the left corona radiate was detected in one patient , and the follow - up mri showed focal microbleeding at the left cingulate gyrus , without symptoms , in the final patient . the results of kaplan - meier event free survival analysis and log - rank test showed a significant difference ( p = 0.05 ) between patients with reduced initial cvrc and those with normal initial cvrc ( tables 1 and 2 ) . of the 42 patients identified with asymptomatic adult mmd , 33 patients had bilateral mmd , and nine patients had probable mmd , resulting in inclusion of 75 hemispheres . the sample included 32 ( 76.2% ) women and 10 ( 23.8% ) men ( table 1 ) . the mean age at the time of diagnosis was 41.2 years ( range , 23 - 64 years ) . the mean follow - up period was 37.3 months ( range , 7.4 - 108.7 months ) , during which time none of the patients underwent bypass surgery . according to the initial mris , 12 patients ( 28.6% ) had old lacunar infarcts or microbleeding without symptoms . reduced cerebrovascular reserve capacity ( cvrc ) was detected in the initial spect in 15 patients ( 23 hemispheres , 30.7% ) ( table 2 ) . disease progression was divided according to two categories : symptomatic progression , in which any neurological symptom developed , and asymptomatic radiographic progression , in which abnormal findings were detected in a follow - up radiological evaluation . symptomatic is frequently referred to as " clinical progression " in other reports.11 ) of the 42 patients and 75 hemispheres , there were 12 patients ( 28.6% ) and 13 hemispheres ( 17.3% ) with either category of disease progression . there were no relationships with sex , diabetes , hypertension , thyroid disease , family history of mmd , or family history of stroke . however , the initial cvrc was reduced in six patients ( 14.3% ) and seven hemispheres ( 9.3% ) in the patients with disease progression ( table 2 ) . symptomatic progression ( hemorrhagic or ischemic stroke ) occurred in four patients , all women . the mean sd duration from mmd diagnosis to event occurrence was 20.8 15.7 months ( range , 7.6 - 41.1 months ) . two patients underwent decompressive craniectomy and removal of a hematoma due to a large amount of hemorrhage . the other patient received conservative treatment . the fourth patient experienced a transient ischemic attack after cesarean delivery , followed by intermittent occurrence of symptoms . therefore , we recommended bypass surgery , but the patient did not make a decision . eight patients ( nine hemispheres , 12.0% ) showed asymptomatic radiographic progression during the follow - up period . in six patients , a silent cerebral infarction on the left corona radiate was detected in one patient , and the follow - up mri showed focal microbleeding at the left cingulate gyrus , without symptoms , in the final patient . the results of kaplan - meier event free survival analysis and log - rank test showed a significant difference ( p = 0.05 ) between patients with reduced initial cvrc and those with normal initial cvrc ( tables 1 and 2 ) . of the 42 patients included in this study , mmd progression was evident in 12 patients ( 13 of 75 hemispheres ) , representing almost a third of the sample . three of the four patients suffered an intracerebral hemorrhage , while the fourth experienced a transient ischemic stroke . in general , child mmd is considered to be progressive while adult mmd is relatively stable.15 ) however , the current results and those of a previous study that reported disease progression in 15 of 120 adult patients ( 12.5% ) suggest otherwise.9 ) further , higher rate of hemorrhagic stroke in adult mmd than that in children has been well documented.3)13 ) there are differences in disease presentation and features between adults and children with moyamoya.13 ) in addition , in children , disease diagnosis can be delayed and symptoms classified inaccurately owing to an inability to communicate.5 ) suzuki and takaku proposed an angiographic staging system for mmd.15 ) however , the stages are not correlated with disease severity . instead , cvrc has been known to be more effective for monitoring the progression of the disease ; the patients are often in a chronic state of cerebral vasodilation , and maintenance of cerebral blood flow is necessary.4 ) therefore , we evaluated the cvrc of the patients . despite a lack of differences in the majority of factors between patients with and without disease progression , a relationship was observed with cvrc ; decreased cvrc was evident with more progressed disease ( table 2 ) . this was supported by the results of the kaplan - meier cumulative event - free survival analysis , in which a significant difference was observed between patients with progressive disease and a reduced initial cvrc and those with progressive disease and a normal initial cvrc ( fig . , cvrc may be an important indicator for patients with asymptomatic mmd , and closer observation or early revascularization surgery may be necessary in patients with reduced cvrc . in our institute , however , in this study , none of the patients underwent surgery during the follow - up period . only one patient for whom an operation was recommended did not make a decision regarding surgery . however , another study conducted with patients with asymptomatic mmd reported that disease progression did not occur after revascularization surgery.9 ) this is an interesting finding for this treatment modality ; early revascularization surgery may be considered for asymptomatic mmd patients who had initial decreased cvrc . this study is one of only a few studies conducted with adult patients with asymptomatic mmd . a multicenter survey conducted in 2007 included 40 patients with asymptomatic mmd ; however , patients were all older adults.9 ) in a study investigating 40 patients ( 74 hemispheres ) for a median follow - up period of 32 months , jo et al . however , in this report , stroke rate was 0% , but in our study , three patients ( 3/42 , 7.1% ) had stroke during the follow - up period.6 ) this study has certain limitations . in addition , the sample size was small ; however , mmd itself , particularly in the asymptomatic state , is very rare . therefore , we plan to conduct future multi - center studies to guide treatment in adult , asymptomatic adult mmd patients . the aim of this study was to document the disease course and factors related to disease progression in adults with asymptomatic mmd . based on our results and those of previous studies , we conclude that asymptomatic adult mmd can no longer be considered a permanent stable disease . therefore , close observation with regular brain imaging study is required for asymptomatic adult mmd patients , particularly patients with reduced cvrc .

objectivethe aim of this study was to document the natural course of asymptomatic adult moyamoya disease ( mmd ) and the factors related to disease progression to aid in treatment decisions.materials and methodsamong 459 adult mmd patients ( aged 20 years ) , 42 patients were included in this retrospective cohort study . clinical records of adult asymptomatic mmd patients ( n = 42 ) and follow - up data from september 2013 were reviewed to determine the factors related to disease progression.resultsthe mean age of patients at the time of diagnosis was 41.2 years ( range , 23 - 64 years ) , and the mean follow - up period was 37.3 months ( range , 7.4 - 108.7 months ) . of the 42 patients and 75 hemispheres , there were 12 patients ( 28.6% ) and 13 hemispheres ( 17.3% ) with disease progression . there were four hemispheres ( 5.3% ) with symptomatic progression ( three hemorrhage , one transient ischemic attack ) and nine hemispheres ( 12.0% ) with asymptomatic radiographic progression . there were no relationships with sex , diabetes , hypertension , thyroid disease , family history of mmd , or family history of stroke . however , reduced initial cerebrovascular reserve capacity was observed in seven hemispheres ( 9.3% ) in patients with disease progression . a relationship was found between disease progression and initial cerebrovascular reserve capacity ( p = 0.05 ) . none of the patients underwent bypass surgery during the follow - up period.conclusionit appears that asymptomatic adult mmd is not a permanent stable disease . in particular , reduced cerebrovascular reserve capacity is an indication of mmd progression , so close regular observation is needed .

cardiovascular disease ( cvd ) is the most common cause of morbidity and mortality in patients with kidney failure ( kf ) accounting for nearly half of all deaths . the prevalence of cardiac disease in chronic hemodialysis patients is as high as 80 % . left ventricular hypertrophy ( lvh ) is an independent risk factor for cardiac death and is present in greater than 70 % of patients at the initiation of hemodialysis . as such , many outcome studies in hemodialysis patients use lvh as a surrogate marker for cardiovascular events [ 47 ] . in addition to traditional cardiovascular risk factors including hypertension and diabetes mellitus , patients with chronic kidney disease ( ckd ) exhibit non - traditional risk factors unique to the uremic environment . these risk factors include elevated pro - inflammatory cytokines , abnormal lipid and bone metabolism , hyperparathyroidism , anemia , volume overload , retention of uremic toxins , and sleep disorders [ 812 ] . most often , patients undergo hemodialysis three times per week for 4 h at a time , although this dialysis dose has rarely been rigorously evaluated in prospective rct s . this regimen often results in complications such as large solute and volume shifts causing unstable blood pressures and pulmonary edema . nocturnal home hemodialysis ( nhd ) is a form of renal replacement therapy in which hemodialysis is performed in the home for at least 6-h overnight and at least 4 days per week . nhd has not only been shown to cost up to 20 % less than conventional hemodialysis , but it also provides multiple clinical benefits related to blood pressure control and mineral metabolism [ 1315 ] . the cardiovascular effects of nhd , as assessed by transthoracic echocardiography ( tte ) and cardiac magnetic resonance ( cmr ) imaging , have been a subject of recent interest . chan et al . first reported an improvement in left ventricular mass by tte in an observational study of 28 patients on nhd over a mean follow - up of 3.4 years . a subsequent randomized controlled trial of 52 patients in alberta also demonstrated a decrease in lv mass by cmr over a 6-month follow - up . however , a more recent study randomizing 87 patients to conventional hemodialysis vs. nhd did not demonstrate any difference in lv mass as assessed by cmr in nhd patients after 1 year . little is known , however , about the effects of nhd on both atrial and ventricular remodeling as assessed by tte and cmr in an incident nhd population the primary objective of the study was to determine the effects of nhd on cardiovascular remodeling over a one - year follow - up using both tte and cmr . all patients enrolled in the nhd training program at a single tertiary care center were asked to participate in the study from january 2009 to december 2011 inclusive . for inclusion into the training program , patients were required to be able to perform nhd , have a life expectancy greater than 12 months , and have no reliable expectation of receiving a kidney transplant within 12 months . the study protocol was approved by the university of manitoba research ethics board ( reb protocol number h2008:279 ) . upon enrollment into the nhd training program , patients underwent 610 weeks of one - on - one training with a nurse . the patients went on to perform daytime home hemodialysis for 14 weeks , followed by overnight extended hours hemodialysis . all patients had tte and cmr studies performed at baseline and after 1 year of nhd . all cardiac imaging parameters were performed the day following an overnight hemodialysis run when patients are closest to their prescribed dry weight . transthoracic echocardiography was performed using a standard echocardiography machine ( ge vivid 7 , milwaukee , wi , usa ) at baseline and 12-month follow - up . cardiac chamber dimensions and function were determined according to the american society of echocardiography guidelines . transmitral left ventricular ( lv ) filling velocities were measured at the tips of the mitral valve leaflets using the apical four - chamber view and pulsed - wave doppler . manual tracing of the transmitral lv filling signal was performed to obtain peak early ( e ) and late ( a ) transmitral velocities , e / a ratio , and e wave deceleration time . tissue doppler - derived indices at the lateral mitral annulus included systolic velocities ( s ) , early diastolic velocities ( e ) , and late diastolic velocities ( a ) . echocardiographic analysis was performed by two independent reviewers , blinded to the clinical data , using dedicated computer software ( echopac , version 110.0.0 , ge medical , milwaukee , wi , usa ) . all patients underwent a cmr study at baseline and at 12 months following initiation of nhd . all cmr studies were performed using a 1.5-t siemens scanner ( magnetom sonata , siemens medical systems , erlangen , germany ) . cardiac parameters of interest included chamber dimensions , volumes , and systolic function which were analyzed in accordance with guidelines of the society for cardiovascular magnetic resonance . end - systolic and end - diastolic volumes of the left and right ventricle were obtained using manual tracing of ventricular walls in multiple short axis slices . end diastole was defined as the slice in which the ventricle was at its largest volume , while end systole was defined as the slice with the smallest volume . stroke volume ( sv ) was calculated as the difference between the end - diastolic volume ( edv ) and end - systolic volume ( esv ) . left and right ventricular mass were determined using the summation of slices method . endocardial and epicardial borders of the left and right ventricle , excluding papillary muscles , were manually traced in each image slice used to calculate edv and esv . myocardial mass was then determined by multiplying each volume by 1.05 g / cm . analysis of cmrs was conducted by two independent reviewers , blinded to the clinical data , using dedicated computer software ( cmr42 , version 1.0.0 , circle cardiovascular imaging , calgary , ab , canada ) . all parametric data were reported as mean standard deviation ( sd ) . whitney u test was used to measure the intra- and inter - observer variability for lv end - diastolic volume and lv mass for both imaging modalities . all patients enrolled in the nhd training program at a single tertiary care center were asked to participate in the study from january 2009 to december 2011 inclusive . for inclusion into the training program , patients were required to be able to perform nhd , have a life expectancy greater than 12 months , and have no reliable expectation of receiving a kidney transplant within 12 months . the study protocol was approved by the university of manitoba research ethics board ( reb protocol number h2008:279 ) . upon enrollment into the nhd training program , patients underwent 610 weeks of one - on - one training with a nurse . the patients went on to perform daytime home hemodialysis for 14 weeks , followed by overnight extended hours hemodialysis . all patients had tte and cmr studies performed at baseline and after 1 year of nhd . all cardiac imaging parameters were performed the day following an overnight hemodialysis run when patients are closest to their prescribed dry weight . transthoracic echocardiography was performed using a standard echocardiography machine ( ge vivid 7 , milwaukee , wi , usa ) at baseline and 12-month follow - up . cardiac chamber dimensions and function were determined according to the american society of echocardiography guidelines . transmitral left ventricular ( lv ) filling velocities were measured at the tips of the mitral valve leaflets using the apical four - chamber view and pulsed - wave doppler . manual tracing of the transmitral lv filling signal was performed to obtain peak early ( e ) and late ( a ) transmitral velocities , e / a ratio , and e wave deceleration time . tissue doppler - derived indices at the lateral mitral annulus included systolic velocities ( s ) , early diastolic velocities ( e ) , and late diastolic velocities ( a ) . finally the e / e index was determined . echocardiographic analysis was performed by two independent reviewers , blinded to the clinical data , using dedicated computer software ( echopac , version 110.0.0 , ge medical , milwaukee , wi , usa ) . all patients underwent a cmr study at baseline and at 12 months following initiation of nhd . all cmr studies were performed using a 1.5-t siemens scanner ( magnetom sonata , siemens medical systems , erlangen , germany ) . cardiac parameters of interest included chamber dimensions , volumes , and systolic function which were analyzed in accordance with guidelines of the society for cardiovascular magnetic resonance . end - systolic and end - diastolic volumes of the left and right ventricle were obtained using manual tracing of ventricular walls in multiple short axis slices . end diastole was defined as the slice in which the ventricle was at its largest volume , while end systole was defined as the slice with the smallest volume . stroke volume ( sv ) was calculated as the difference between the end - diastolic volume ( edv ) and end - systolic volume ( esv ) . left and right ventricular mass were determined using the summation of slices method . endocardial and epicardial borders of the left and right ventricle , excluding papillary muscles , were manually traced in each image slice used to calculate edv and esv . myocardial mass was then determined by multiplying each volume by 1.05 g / cm . analysis of cmrs was conducted by two independent reviewers , blinded to the clinical data , using dedicated computer software ( cmr42 , version 1.0.0 , circle cardiovascular imaging , calgary , ab , canada ) . all parametric data were reported as mean standard deviation ( sd ) . whitney u test was used to measure the intra- and inter - observer variability for lv end - diastolic volume and lv mass for both imaging modalities . a total of 11 patients ( mean age 48 16 years ) were enrolled in the study , of which 6 were male ( table 1 ) . ten patients underwent conventional , thrice - weekly facility - based hemodialysis at baseline ( prior to enrollment ) , while one patient performed home peritoneal dialysis . the most frequent etiology of kidney failure was glomerulonephritis ( 55 % ) , followed by diabetic nephropathy ( 18 % ) and polycystic kidney disease ( 18 % ) . cardiac comorbidities included hypertension ( 63 % ) , ischemic heart disease ( 27 % ) , diabetes mellitus ( 36 % ) , and valvular heart disease ( 9 % ) .table 1baseline characteristics of the nhd patient populationcharacteristicpatient population ( n = 11)age ( years ) , mean sd48 16male6female5ethnicity caucasian7 ( 64 % ) first nations3 ( 27 % ) asian1 ( 9 % ) bmi ( kg / m ) , mean sd23 4prior renal transplant4 ( 36 % ) baseline dialysis modality hemodialysis10 ( 91 % ) peritoneal dialysis1 ( 9 % ) vascular access av fistula10 ( 91 % ) tunneled catheter1 ( 9 % ) cause of esrd diabetic nephropathy2 ( 18 % ) glomerulonephritis6 ( 55 % ) polycystic kidney disease2 ( 18 % ) unknown1 ( 9 % ) comorbidities hypertension7 ( 64 % ) ischemic heart disease3 ( 27 % ) diabetes mellitus4 ( 36 % ) valvular heart disease1 ( 9 % ) smoker1 ( 9 % ) weight dry weight ( kg ) 0 months , mean sd65.62 14.02 dry weight ( kg ) 12 months , mean sd66.23 14.50 interdialytic weight gain ( kg ) 0 months , mean sd1.74 1.18 interdialytic weight gain ( kg ) 12 months , mean sd1.54 0.77 baseline characteristics of the nhd patient population the echocardiographic measurements for the study population are listed in table 2 . there was a significant reduction in interventricular septal ( ivs ) thickness ( 11 1 to 9 2 mm , p < 0.05 ) as well as in posterior wall thickness ( pwt ) , ( from 12 1 to 9 1 mm , p < 0.05 ) by tte over the one - year follow - up . in addition , there was a 15 % reduction in left ventricular mass index ( lvmi , 152 7 to 129 8 g / m , p < 0.05 ; fig . 1 ) on long - term nhd . there were significant reductions in both left atrial volume index ( lavi , 41 5 to 34 4 ml / m , p < 0.05 ) and right atrial volume index ( ravi , 39 5 to 31 4 ml / m , p < 0.05 ) . finally , diastolic dysfunction improved from a baseline grade of 3.4 to 1.2 after one - year follow - up ( p < there was a decrease in the e wave velocity with no change in the a wave velocity over time , resulting in a decrease in the e / a ratio over 1-year follow - up . the lv filling pressures , as reflected by the e / e , also improved over time . there were no significant changes in left ventricular end - systolic and end - diastolic dimensions , nor any change in left ventricular ejection fraction ( lvef ) or cardiac output ( co ) at one - year follow - up . there was good intra - observer and inter - observer variability for the measurement of lvmi ( table 4).table 2cardiac chamber parameters by tte and cmr at baseline and 1-year follow - up in total population ( n = 11 ) ttecmrbaseline1 year follow - up p baseline1 year follow - up p lv parameters lvedd ( mm)45 446 40.8646 147 20.82 lvesd ( mm)31 232 30.8331 332 30.71 lvedv ( ml)96 998 100.8599 6100 70.82 lvesv ( ml)29 730 60.7730 532 50.81ivs ( mm ) 11 1 9 2 < 0.05 12 1 9 1 < 0.05 pwt ( mm ) 12 1 9 1 < 0.05 12 1 9 1 < 0.05 sv ( ml)63 1165 70.6864 666 80.76hr ( bpm)70 774 90.6273 875 60.82co ( l / min)4.2 0.94.6 0.70.544.4 0.24.5 0.40.81lvef ( % ) 69 870 50.7664 365 40.75lv mass index ( g / m ) 152 7 129 8 < 0.05 162 4 124 4 < 0.05 rv parameters rvedd ( mm)33 534 40.8234 535 30.76 rvef ( % ) 63 364 30.80rv mass index ( g / m ) 75 4 62 3 < 0.05 rv fac ( % ) 45 446 50.76tapse ( mm)3.2 0.33.2 0.40.91pasp ( mmhg)32 333 40.72atrial parameters la diameter ( mm)32 333 40.7232 233 30.81 la volume index ( ml / m ) 41 5 34 4 < 0.05 42 2 33 2 < 0.05 ra volume index ( ml / m ) 39 5 31 4 < 0.05 40 2 33 4 < 0.05 bold values indicate that p < 0.05 are significant compared to baselinefig . 1cardiac dimensions by transthoracic echocardiography ( tte , a ) and cardiac magnetic resonance imaging ( cmr , b ) at baseline and after 1 year of nocturnal home hemodialysis ( nhd ) . ivs interventricular septum , pwt posterior wall thickness , lvmi left ventricular mass index , rvmi right ventricular mass index , lavi left atrial volume index , ravi right atrial volume index . * p < 0.05table 3diastolic parameters by tte at baseline and 1-year follow - up in total population ( n = 11)baseline1 year follow - up p diastolic grade e wave velocity ( m / s)1.4 0.30.7 0.3<0.05 a wave velocity ( m / s)0.4 0.30.5 0.3<0.05 e / a ratio3.5 0.21.4 0.2<0.05 deceleration time ( m s)195 40208 25<0.05 diastolic grade3.41.2<0.05tdi parameters ( lv ) lateral s ( cm / s)9.8 0.310.2 0.40.77 lateral e ( cm / s)8.2 0.58.2 0.40.91 lateral a ( cm / s)7.9 0.68.0 0.30.82 medial s ( cm / s)9.6 0.79.4 0.50.81 medial e ( cm / s)8.0 0.58.3 0.60.83 medial a ( cm / s)8.5 0.48.1 0.30.76 e / e17 18 1<0.05tdi parameters ( rv ) lateral s9.3 0.49.1 0.30.80 lateral e8.1 0.38.0 0.20.77 lateral a7.9 0.37.7 0.40.82data are expressed as mean sd e wave early diastolic filling , a wave late diastolic filling , tdi tissue doppler imaging , s systolic myocardial velocity , e early diastolic myocardial velocity , a late diastolic myocardial velocity * p < 0.05 , 1-year follow - up vs. baselinetable 4intra - observer and inter - observer variability for lv mass index ( n = 11)intra - observerinter - observerabsolute%absolute%lv mass index ( g / m)tte12.2 3.410.3 4.211.1 3.39.5 3.9cmr7.6 3.15.7 1.88.4 2.25.5 1.4 cardiac chamber parameters by tte and cmr at baseline and 1-year follow - up in total population ( n = 11 ) bold values indicate that p < 0.05 are significant compared to baseline cardiac dimensions by transthoracic echocardiography ( tte , a ) and cardiac magnetic resonance imaging ( cmr , b ) at baseline and after 1 year of nocturnal home hemodialysis ( nhd ) . ivs interventricular septum , pwt posterior wall thickness , lvmi left ventricular mass index , rvmi right ventricular mass index , lavi left atrial volume index , ravi right atrial volume index . * p < 0.05 diastolic parameters by tte at baseline and 1-year follow - up in total population ( n = 11 ) data are expressed as mean sd e wave early diastolic filling , a wave late diastolic filling , tdi tissue doppler imaging , s systolic myocardial velocity , e early diastolic myocardial velocity , a late diastolic myocardial velocity * p < 0.05 , 1-year follow - up vs. baseline intra - observer and inter - observer variability for lv mass index ( n = 11 ) as compared to tte , there were similar reductions in ivs thickness ( 12 19 1 mm , p < 0.05 ) and pwt ( 12 19 1 mm , p there was a significant reduction in lvmi by 23 % by cmr ( 162 4124 4 in addition , there were significant decreases in lavi ( 42 233 2 ml / m , p < 0.05 ) and ravi ( 40 233 4 ml / m , p < 0.05 ) with narrower confidence intervals using cmr as compared to tte ( table 2 ; fig . 1 ) . moreover , right ventricular mass index ( rvmi ) showed significant regression after one - year follow - up ( 75 462 3 there were no significant changes in left ventricular end - systolic and end - diastolic dimensions , lvef , nor co at one - year follow - up using cmr . there was good intra - observer and inter - observer variability for the measurement of lvmi ( table 4 ) . data regarding blood pressure , mineral metabolism , anemia and albumin levels are summarized in table 5 . overall , there were no significant differences in any of these parameters after 1 year of nhd.table 5secondary endpoints at baseline and after 1 year of nhd ( n = 11)parameterbaseline ( mean sd)one - year follow - up ( mean ( mmhg)126.5 19.6122.3 18.60.66pre - dialysis dbp ( mmhg)74.9 11.968.6 7.30.23pre - dialysis serum calcium ( mmol / l)2.39 0.222.42 0.150.74pre - dialysis serum phosphate ( mmol / l)1.48 0.291.46 0.380.87hemoglobin ( g / l)112 11.5113.5 11.10.76albumin ( g / l)38.9 1.838.2 3.00.51parathyroid hormone379 232249 1690.18 secondary endpoints at baseline and after 1 year of nhd ( n = 11 ) a total of 11 patients ( mean age 48 16 years ) were enrolled in the study , of which 6 were male ( table 1 ) . ten patients underwent conventional , thrice - weekly facility - based hemodialysis at baseline ( prior to enrollment ) , while one patient performed home peritoneal dialysis . the most frequent etiology of kidney failure was glomerulonephritis ( 55 % ) , followed by diabetic nephropathy ( 18 % ) and polycystic kidney disease ( 18 % ) . cardiac comorbidities included hypertension ( 63 % ) , ischemic heart disease ( 27 % ) , diabetes mellitus ( 36 % ) , and valvular heart disease ( 9 % ) .table 1baseline characteristics of the nhd patient populationcharacteristicpatient population ( n = 11)age ( years ) , mean sd48 16male6female5ethnicity caucasian7 ( 64 % ) first nations3 ( 27 % ) asian1 ( 9 % ) bmi ( kg / m ) , mean sd23 4prior renal transplant4 ( 36 % ) baseline dialysis modality hemodialysis10 ( 91 % ) peritoneal dialysis1 ( 9 % ) vascular access av fistula10 ( 91 % ) tunneled catheter1 ( 9 % ) cause of esrd diabetic nephropathy2 ( 18 % ) glomerulonephritis6 ( 55 % ) polycystic kidney disease2 ( 18 % ) unknown1 ( 9 % ) comorbidities hypertension7 ( 64 % ) ischemic heart disease3 ( 27 % ) diabetes mellitus4 ( 36 % ) valvular heart disease1 ( 9 % ) smoker1 ( 9 % ) weight dry weight ( kg ) 0 months , mean sd65.62 14.02 dry weight ( kg ) 12 months , mean sd66.23 14.50 interdialytic weight gain ( kg ) 0 months , mean sd1.74 1.18 interdialytic weight gain ( kg ) 12 months , mean sd1.54 0.77 baseline characteristics of the nhd patient population there was a significant reduction in interventricular septal ( ivs ) thickness ( 11 1 to 9 2 mm , p < 0.05 ) as well as in posterior wall thickness ( pwt ) , ( from 12 1 to 9 1 mm , p < 0.05 ) by tte over the one - year follow - up . in addition , there was a 15 % reduction in left ventricular mass index ( lvmi , 152 7 to 129 8 g / m , p < 0.05 ; fig . 1 ) on long - term nhd . there were significant reductions in both left atrial volume index ( lavi , 41 5 to 34 4 ml / m , p < 0.05 ) and right atrial volume index ( ravi , 39 5 to 31 4 ml / m , p < 0.05 ) . finally , diastolic dysfunction improved from a baseline grade of 3.4 to 1.2 after one - year follow - up ( p < 0.05 ) as shown in table 3 . there was a decrease in the e wave velocity with no change in the a wave velocity over time , resulting in a decrease in the e / a ratio over 1-year follow - up . the lv filling pressures , as reflected by the e / e , also improved over time . there were no significant changes in left ventricular end - systolic and end - diastolic dimensions , nor any change in left ventricular ejection fraction ( lvef ) or cardiac output ( co ) at one - year follow - up . there was good intra - observer and inter - observer variability for the measurement of lvmi ( table 4).table 2cardiac chamber parameters by tte and cmr at baseline and 1-year follow - up in total population ( n = 11 ) ttecmrbaseline1 year follow - up p baseline1 year follow - up p lv parameters lvedd ( mm)45 446 40.8646 147 20.82 lvesd ( mm)31 232 30.8331 332 30.71 lvedv ( ml)96 998 100.8599 6100 70.82 lvesv ( ml)29 730 60.7730 532 50.81ivs ( mm ) 11 1 9 2 < 0.05 12 1 9 1 < 0.05 pwt ( mm ) 12 1 9 1 < 0.05 12 1 9 1 < 0.05 sv ( ml)63 1165 70.6864 666 80.76hr ( bpm)70 774 90.6273 875 60.82co ( l / min)4.2 0.94.6 0.70.544.4 0.24.5 0.40.81lvef ( % ) 69 870 50.7664 365 40.75lv mass index ( g / m ) 152 7 129 8 < 0.05 162 4 124 4 < 0.05 rv parameters rvedd ( mm)33 534 40.8234 535 30.76 rvef ( % ) 63 364 30.80rv mass index ( g / m ) 75 4 62 3 < 0.05 rv fac ( % ) 45 446 50.76tapse ( mm)3.2 0.33.2 0.40.91pasp ( mmhg)32 333 40.72atrial parameters la diameter ( mm)32 333 40.7232 233 30.81 la volume index ( ml / m ) 41 5 34 4 < 0.05 42 2 33 2 < 0.05 ra volume index ( ml / m ) 39 5 31 4 < 0.05 40 2 33 4 < 0.05 bold values indicate that p < 0.05 are significant compared to baselinefig . 1cardiac dimensions by transthoracic echocardiography ( tte , a ) and cardiac magnetic resonance imaging ( cmr , b ) at baseline and after 1 year of nocturnal home hemodialysis ( nhd ) . ivs interventricular septum , pwt posterior wall thickness , lvmi left ventricular mass index , rvmi right ventricular mass index , lavi left atrial volume index , ravi right atrial volume index . * p < 0.05table 3diastolic parameters by tte at baseline and 1-year follow - up in total population ( n = 11)baseline1 year follow - up p diastolic grade e wave velocity ( m / s)1.4 0.30.7 0.3<0.05 a wave velocity ( m / s)0.4 0.30.5 0.3<0.05 e / a ratio3.5 0.21.4 0.2<0.05 deceleration time ( m s)195 40208 25<0.05 diastolic grade3.41.2<0.05tdi parameters ( lv ) lateral s ( cm / s)9.8 0.310.2 0.40.77 lateral e ( cm / s)8.2 0.58.2 0.40.91 lateral a ( cm / s)7.9 0.68.0 0.30.82 medial s ( cm / s)9.6 0.79.4 0.50.81 medial e ( cm / s)8.0 0.58.3 0.60.83 medial a ( cm / s)8.5 0.48.1 0.30.76 e / e17 18 1<0.05tdi parameters ( rv ) lateral s9.3 0.49.1 0.30.80 lateral e8.1 0.38.0 0.20.77 lateral a7.9 0.37.7 0.40.82data are expressed as mean sd e wave early diastolic filling , a wave late diastolic filling , tdi tissue doppler imaging , s systolic myocardial velocity , e early diastolic myocardial velocity , a late diastolic myocardial velocity * p < 0.05 , 1-year follow - up vs. baselinetable 4intra - observer and inter - observer variability for lv mass index ( n = 11)intra - observerinter - observerabsolute%absolute%lv mass index ( g / m)tte12.2 3.410.3 4.211.1 3.39.5 3.9cmr7.6 3.15.7 1.88.4 2.25.5 1.4 cardiac chamber parameters by tte and cmr at baseline and 1-year follow - up in total population ( n = 11 ) bold values indicate that p < 0.05 are significant compared to baseline cardiac dimensions by transthoracic echocardiography ( tte , a ) and cardiac magnetic resonance imaging ( cmr , b ) at baseline and after 1 year of nocturnal home hemodialysis ( nhd ) . ivs interventricular septum , pwt posterior wall thickness , lvmi left ventricular mass index , rvmi right ventricular mass index , lavi left atrial volume index , ravi right atrial volume index . * p < 0.05 diastolic parameters by tte at baseline and 1-year follow - up in total population ( n = 11 ) data are expressed as mean sd e wave early diastolic filling , a wave late diastolic filling , tdi tissue doppler imaging , s systolic myocardial velocity , e early diastolic myocardial velocity , a late diastolic myocardial velocity * p < 0.05 , 1-year follow - up vs. baseline intra - observer and inter - observer variability for lv mass index ( n = 11 ) as compared to tte , there were similar reductions in ivs thickness ( 12 19 1 mm , p < 0.05 ) and pwt ( 12 19 1 mm , p there was a significant reduction in lvmi by 23 % by cmr ( 162 4124 4 in addition , there were significant decreases in lavi ( 42 233 2 ml / m , p < 0.05 ) and ravi ( 40 233 4 ml / m , p < 0.05 ) with narrower confidence intervals using cmr as compared to tte ( table 2 ; fig . 1 ) moreover , right ventricular mass index ( rvmi ) showed significant regression after one - year follow - up ( 75 462 3 there were no significant changes in left ventricular end - systolic and end - diastolic dimensions , lvef , nor co at one - year follow - up using cmr . there was good intra - observer and inter - observer variability for the measurement of lvmi ( table 4 ) . data regarding blood pressure , mineral metabolism , anemia and albumin levels are summarized in table 5 . overall , there were no significant differences in any of these parameters after 1 year of nhd.table 5secondary endpoints at baseline and after 1 year of nhd ( n = 11)parameterbaseline ( mean sd)one - year follow - up ( mean sd ) p pre - dialysis sbp ( mmhg)126.5 19.6122.3 18.60.66pre - dialysis dbp ( mmhg)74.9 11.968.6 7.30.23pre - dialysis serum calcium ( mmol / l)2.39 0.222.42 0.150.74pre - dialysis serum phosphate ( mmol / l)1.48 0.291.46 0.380.87hemoglobin ( g / l)112 11.5113.5 11.10.76albumin ( g / l)38.9 1.838.2 3.00.51parathyroid hormone379 232249 1690.18 secondary endpoints at baseline and after 1 year of nhd ( n = 11 ) cardiovascular disease is the leading cause of death in patients with kidney failure on dialysis . although nhd is associated with significant clinical benefits in this patient population , its effects on cardiovascular remodeling remain unclear . while previous studies have investigated the effect of nhd on left ventricular mass alone by either tte or cmr , the results have been conflicting . this is the first study to comprehensively evaluate cardiac remodeling using both tte and cmr in an incident cohort of patients who have converted from conventional thrice - weekly hemodialysis to nhd . following one year of compliant use of nhd , there was an improvement in biventricular mass index , biatrial volume index , and the degree of diastolic dysfunction in our esrd population . left ventricular hypertrophy is very common in kidney failure , affecting more than 70 % of patients at initiation of hemodialysis . in addition to traditional risk factors for the development of lvh including hypertension , age , and valvular heart disease , there are a number of risk factors unique to patients with chronic kidney disease ( ckd ) . hemodynamic abnormalities due to volume overload , anemia , vascular calcification , and the presence of an arterio - venous fistula are important determinants of lv mass . additional contributing factors include hyperphosphatemia , hyperparathyroidism , and hypovitaminosis d . in the current study , we demonstrated significant regression of lvh after 1 year of nhd , by both tte and cmr . two previous randomized studies of nhd using cmr alone have shown conflicting results with respect to regression of lvh [ 4 , 7 ] . while culleton et al . demonstrated an 8 % reduction in lvmi by cmr after 6 months of nhd , a more recent study by rocco et al . . did not find any difference in lvmi by cmr in a larger cohort of patients after 1 year of nhd . our study population was slightly younger , with a lower prevalence of hypertension compared to these two trials . a unique finding of our study was that the regression of lvh was not associated with any improvement in blood pressure control . this could be due to the small sample size or the low prevalence of hypertension in our study population . it is plausible that factors other than blood pressure play an important role in lv remodeling in the esrd population on nhd . regression of lvh has been shown to improve systolic function , and reduce the risk of ventricular arrhythmias and atrial fibrillation [ 2022 ] . moreover , in patients with and without kidney failure , regression of lvh is associated with decreased all - cause mortality , rendering this a valid surrogate health outcome in this population [ 23 , 24 ] . left atrial enlargement is a common echocardiographic finding in patients with esrd , affecting greater than 40 % of asymptomatic patients with stage 3 to 5 ckd . multiple factors may lead to la enlargement including extracellular volume overload , lv dysfunction , lvh and valvular heart disease , all of which are common in esrd patients . observational studies in dialysis patients have shown that la enlargement is significantly correlated with mortality risk , independent of lvmi and lv ejection fraction [ 26 , 27 ] . right atrial enlargement has also been shown to be an independent risk factor for the development of atrial fibrillation . to our knowledge , this is the first tte and cmr study to report the effect of nhd on atrial size . in our study , there was a significant decrease in ravi and lavi by tte and cmr after 1 year of nhd . these results suggest that atrial remodeling may be reversed with nhd , thus potentially lowering the risk of future cardiovascular complications , including atrial rhythm disturbances in the ckd population . diastolic dysfunction is an independent predictor of mortality and is the most common echocardiographic finding in asymptomatic dialysis patients [ 19 , 29 ] . diastolic dysfunction is strongly associated with hypertension , lvh , coronary artery disease , and diabetes mellitus , all of which are common in patients with esrd . the increase in left ventricular stiffness causes a shift of the pressure volume curve to the left , leading to an increased sensitivity to changes in lv volume . small increases in lv volume can lead to pulmonary congestion while small decreases in lv volume can lead to hypotension . while previous studies have shown regression of lvh in esrd patients who convert to nhd [ 4 , 6 ] , no study has reported the effect of nhd on diastolic function . this study is the first to show a significant improvement in diastolic dysfunction from a grade of 3.4 to 1.2 after 1 year of nhd with an improvement in overall lv filling pressures . while regression of diastolic dysfunction has been associated with lvh regression in prior studies , it is not known whether this leads to improved survival or a reduction in cardiovascular events [ 20 , 30 ] . first of all , due to the limited sample size , our study may have been underpowered to detect differences in our secondary endpoints . secondly , this was an observational cohort study . while randomized controlled study design is considered the gold standard , it may be difficult to ethically justify randomizing patients to a modality of renal replacement therapy considered by many to be inferior either in terms of clinical parameters , costs or most likely patient preference . difficulty in randomizing patients to receive home nocturnal hemodialysis versus conventional facility - based hemodialysis in the contemporary era of increased availability for home hemodialysis has been reported . finally , our study reported surrogate outcomes for cardiovascular endpoints such as morbidity and mortality . to date , no studies have reported improvement in cardiovascular outcomes with nhd ; however , the one study that reported cardiovascular outcomes was likely underpowered to detect a difference . an adequate study of the effect of nhd on cardiovascular outcomes would need to include a large number of patients over a long follow - up period , which is logistically challenging . long - term nocturnal hemodialysis leads to favorable cardiovascular remodeling as measured by a number of parameters and two imaging modalities ; tte and cmr . after 1 year of nhd , patients experience a regression of lvh as well as an improvement in diastolic dysfunction , atrial enlargement , and right ventricular mass index .

backgroundcardiovascular disease is the leading cause of morbidity and mortality in patients with kidney failure . nocturnal home hemodialysis ( nhd ) is a form of kidney replacement therapy whereby hemodialysis is performed for at least 6-h overnight , at least 4 days per week . little is known about the effects of nhd on cardiovascular remodeling as assessed by transthoracic echocardiography ( tte ) and cardiac magnetic resonance imaging ( cmr).objectivesthe primary objective of the study was to determine the long - term effects of nhd on cardiovascular remodeling using different imaging modalities over a one - year follow-up.methods and resultsa total of 11 patients were included in the study ( 6 males , mean age 48 16 years ) between 2009 and 2011 inclusive at a single tertiary care center . all patients underwent tte and cmr at baseline and after 1 year of nhd . left ventricular mass index decreased significantly at 1 year by both tte ( 152 7129 8 g / m2 , p < 0.05 ) and cmr ( 162 4124 4 g / m2 , p < 0.05 ) . there was also a significant decrease in both left and right atrial volume as well as in right ventricular mass index over 1 year of follow - up . diastolic dysfunction , graded from 0 to 4 , improved from a baseline grade of 3.4 to 1.2 at 1-year follow-up.conclusionslong-term nocturnal hemodialysis leads to favorable cardiovascular remodeling with a reduction in cavity dimensions , regression of left ventricular hypertrophy , and an improvement in diastolic function , as assessed by both tte and cmr .

one of many possible medical emergencies in newborns is genital ambiguity that has significant importance both immediately after birth , such as congenital adrenal hyperplasia and certain malformation syndromes that may present potential risk to child 's life , and in the long term , such as unresolved sex definition that may cause irreversible psychosocial effects for patients and their families [ 1 , 2 ] . an experienced multidisciplinary team is required for the proper care of children with ambiguous genitalia , which is usually found in tertiary and university care centers [ 13 ] . the incidence of disorders of sex development ( dsd ) is not fully known . in 2000 , fausto - sterling suggested that it corresponds to 1.7% of live births . however , two years later sax questioned this estimative arguing that the author had included patients without genital ambiguity , such as those with turner and klinefelter syndromes and the nonclassical form of congenital adrenal hyperplasia and suggested that the incidence of dsd with genital ambiguity would be actually 0.0018% . the chicago consensus in 2006 , updated in 2016 , established a classification for dsd based on karyotype . however , some authors have questioned this classification and proposed a different classification based on type of gonadal tissue [ 69 ] . therefore it is evident that several issues on dsd are still under discussion . in order to add insights to the dsd study , such as classification , frequency of different diagnoses , sex definition , and sex reassignment , the aim of this study was to describe the experience of the interdisciplinary group of study of sex determination and differentiation ( giedds ) in the school of medicine ( fcm ) and clinical hospital ( hc ) at the state university of campinas ( unicamp ) , brazil , over 23 years in the care of newborns , children , adolescents , and adults with dsd and genital ambiguity , analyzing the frequency of each cause , the age at diagnosis , the sex of rearing , and reassignment all cases of ambiguous genitalia seen at the outpatient clinic of giedds , fcm , hc , unicamp , between january 1989 and december 2011 were included in the study . during this period , the same medical team of pediatric endocrinologists , geneticists , psychologists , and pediatric surgeons had followed every case . karyotyping had been performed in the cytogenetics laboratory in the department of medical genetics at fcm , unicamp , scoring at least 30 metaphases . hormonal and biochemical tests were performed in the laboratory of physiology at hc , unicamp . molecular tests were performed at the laboratory of human molecular genetics at the center of molecular biology and genetic engineering ( cbmeg ) , unicamp . the criteria used for the definition of genital ambiguity were those set by the chicago consensus in 2006 . the cases were classified in four major groups based on karyotype and gonadal tissue : ( 1 ) disorders of gonadal development ( dgd ) irrespective of the karyotype ; ( 2 ) 46,xx ovarian dsd ; ( 3 ) 46,xy testicular dsd ; and ( 4 ) complex malformations of the external genitalia , defined in this study as others ( see supplementary material available online at http://dx.doi.org/10.1155/2016/4963574 ) . we evaluated the following data : age ( in months ) at the first visit , birth weight ( in grams ) , social sex at the first and last visit , and etiologic diagnosis . the mann - whitney test was used to analyze age differences between the four major groups of diseases , with = 0.05 . over the 23 years of the study , our team attended 408 cases of genital ambiguity . among them , 189 ( 46.3% ) had 46,xy testicular dsd , 105 ( 25.7% ) 46,xx ovarian dsd , 95 ( 23.3% ) a dgd , and 19 ( 4.7% ) other complex malformations ( table 1 ) . regarding the karyotypes , 250 ( 61.3% ) were 46,xy , 124 ( 30.4% ) were 46,xx , and 34 ( 8.3% ) had numerical or structural abnormalities of sex chromosomes with or without mosaicism . among the 105 cases of 46,xx ovarian dsd , the great majority had congenital adrenal hyperplasia ( n = 69 , 65.7% ) ; 68 had 21-hydroxylase deficiency distributed between simple virilizing form including one case with associated 45,x/46,xx turner syndrome ( n = 17 ) and salt - wasting form ( n = 51 ) and one case of p450 oxidoreductase deficiency ; all had molecular confirmation . among patients with syndromic features ( n = 10 , 9.5% ) , three had vater association , one had seckel syndrome , one had wolf - hirschhorn syndrome [ 46,xx , del(4p ) ] , one had caudal regression , and four remained with unknown etiology ( table 1 ) . in the 46,xy testicular dsd group ( n = 189 ) , most were syndromic ( n = 40 ) or idiopathic ( n = 77 ) . it is relevant to mention that 42 idiopathic cases ( 22% ) presented birth weight < 2,500 g ( from 700 to 2,500 g ; mean = 1,934 g ) . regarding the group with a defined diagnosis , androgen receptor defects ( n = 25 ) , 5-reductase type 2 deficiency ( n = 20 ) , and hypogonadotropic hypogonadism ( n = 12 ) , including six with associated hypopituitarism , were found with higher frequencies , followed by the group of defects in testosterone synthesis that included one patient with hsd3b2 deficiency , one with cyp17a1 deficiency , and two with hsd17b3 deficiency . cases of syndromic features included vater association ( n = 3 ) , charge syndrome ( n = 3 ) , aarskog syndrome ( n = 3 ) , foetal alcohol syndrome ( n = 3 ) , robinow syndrome ( n = 1 ) , gbbb syndrome ( n = 1 ) , noonan syndrome ( n = 1 ) , and four with autosomal chromosome abnormalities [ 46,x , add(1)(q43 ) , 46,xy , del(4p ) , 46,xy , add(10)(q26 ) , 46,xy , t(13;14)(q11;q11 ) ] ; 21 remained with unknown etiology ( table 1 ) . regarding 95 cases included in the dgd group , there was a predominance of partial and mixed gonadal dysgenesis , followed by ovotesticular dsd . the distribution of different karyotypes in ovotesticular dsd was 46,xx ( n = 8) , 46,xy ( n = 6 ) and 46,xx/46,xy ( n = 2 ) ; other karyotypes such as 47,xxy , 46xx/47,xxy/48,xxyy , 45,x/46,xy , 45,x/47,xyy , 45,x/46,x+mar(y+ ) , and 45,x/47,xy,+mar(y+ ) were also found ( n = 1 , resp . ) . different karyotypes were also observed within the group of patients with mixed gonadal dysgenesis . from a total of 25 patients 12 were 45,x/46,xy , and the remainders had numerical and/or structural abnormalities : 45,x/46,x+mar(y+ ) ( n = 4 ) , 45,x/46,xy/47,xy,+mar(y+ ) ( n = 3 ) , and 45,x/46,xi(yq ) , 45,x/46,x , del(yq ) , 45,x/46,x , idic(yq ) , 45,x/46,xi(yq)/47,xi(yq),i(yq ) , 45,x/46,xi(yq)/46,x , r(y)/47,xi(yq),r(y ) , and 45,xinv(9)(p13;q21)/46,xy , inv(9)(p13 ) ( one case of each ) . among patients with testicular regression syndrome , finally , the distribution of the diagnosis for the remaining 19 cases was as follows : five cases of penis malformation including partial penoscrotal inversion ( n = 2 ) , penis agenesis ( n = 1 ) , abnormal penis rotation ( n = 1 ) , and penoscrotal adherence ( n = 1 ) ; clitoral malformation included clitoris agenesis ( n = 4 ) , severe clitoris hypoplasia ( n = 1 ) , and lipoma on the clitoris ( n = 1 ) ; diagnosis in cases with multiple complex malformations included exstrophy of the cloaca and cardiomyopathy ( n = 2 ) , prune - belly syndrome ( n = 1 ) , and perineal lipoma ( n = 1 ) ( table 1 ) . analysis of sex definition in the 408 patients with ambiguous genitalia revealed that 111 ( 27.2% ) patients came to the first consultation without sex definition ; after clinical and laboratorial investigation 52 were assigned as male and 59 female ( figure 1 ) . we also observed that 15 cases from the total of 189 who had initial registration as male were reassigned as female ; from 108 who had initial registration as female 12 were reassigned as male ( figure 1 ) . therefore , 6.6% ( 27 cases ) had sex reassignment , all of the them before one year of age , except for the patients with 5-reductase type 2 deficiency . table 2 shows the distribution according to initial and final sex and clinical and laboratorial diagnosis . considering those 15 cases that were initially registered as male and were reassigned as female , seven had 46,xx ovarian dsd due to congenital adrenal hyperplasia , four had mixed gonadal dysgenesis , three had ovotesticular dsd , and one had 46,xy idiopathic testicular dsd . in turn , among the 12 females who were reassigned as males seven had 5-reductase type 2 deficiency , two had partial gonadal dysgenesis , one had mixed gonadal dysgenesis , one had ovotesticular dsd , and one had syndromic 46,xy testicular dsd . all cases of 46,xx ovarian dsd had female final sex assignment . in the 46,xy testicular dsd group , the great majority had male final sex assignment , except for cases of lhcg receptor defect , defects of testosterone synthesis , and complete androgen insensitivity . within the dgd group , there was not a predominance of either sex , except for 46,xx testicular dsd and testicular regression syndrome ( except one case of agonadism ) , all of them assigned as males . for other causes of genital ambiguity , in general , the final sex followed the genotypic sex . one hundred and ninety - three ( 47.3% ) out of 408 cases had the first visit in giedds , unicamp , before six months of age ( table 2 ) . the distribution according to karyotype was 46,xx ( n = 82 ) , 46,xy ( n = 95 ) , and numerical or structural abnormalities of sex chromosomes ( n = 16 ) . among them , 105 did not have a sex assignment ; 51 were male and 37 female ; 95 and 98 had final sex assignment as male and female , respectively . in this group the diagnosis was as follows : 46,xx ovarian dsd ( n = 74 ) , 46,xy testicular dsd ( n = 74 ) , dgd ( n = 37 ) , and other malformations ( n = 8) . the average age at the first visit was 31.7 months ( about three years ) ; it was significantly lower in the 46,xx ovarian dsd group than in the group of 46,xy testicular dsd ( mann - whitney test , p < 0.0001 ) and dgd ( mann - whitney test ; p < 0.0001 ) , but it did not differ significantly from the group of other malformations ( mann - whitney test , p = 0.06 ) . the 46,xy testicular dsd group did not differ from the dgd group ( mann - whitney test , p = 0.975 ) and from the group of other malformations ( mann - whitney test , p = 0.125 ) ; the dgd group did not differ from the group of other malformations ( mann - whitney test , p = 0.19 ) ( table 3 ) . this is a descriptive study with a large case series of dsd with genital ambiguity , investigated over a long period by the same clinical and laboratory staff . to our knowledge , this is the largest consecutive series of dsd cases with genital ambiguity under a single service in the literature . over 23 years , 408 cases of genital ambiguity had been studied with a predominance of 46,xy karyotype ( 61.3% ) , twice as frequent as 46,xx ( 30.4% ) . numerical or structural abnormalities of sex chromosomes with or without mosaicism were found in less than 10% . our results were similar to those described by cox et al . , who analyzed 649 cases of an international register and found that 460 ( 71% ) were 46,xy and 121 ( 19% ) 46,xx and 68 ( 10% ) had sex chromosomes abnormalities , confirming that dsd with genital ambiguity are more frequent in patients with 46,xy karyotype , due to the complexity of male sexual differentiation . one - fourth of the total number of patients had a diagnosis of 46,xx ovarian dsd , mainly congenital adrenal hyperplasia due to 21-hydroxylase deficiency , confirming the high frequency of this disease in all dsd samples [ 10 , 12 ] . the frequency of the salt - wasting form was also similar to that found in several population studies , confirming that it is the most relevant etiology of dsd due to both its high frequency and the high risk of death . isolated clitoromegaly and syndromic features were also observed , which shows the importance of a wide range of clinical , hormonal , and molecular investigation for dsd , as well as the significance of the finding of dysmorphisms and associated malformations in cases of genital ambiguity [ 10 , 14 , 15 ] . when it concerns dsd with 46,xy karyotype , there are many challenges for the medical staff and for patients and families , because male sexual differentiation is complex and many differential diagnoses require time and experienced medical staff to establish an accurate diagnosis as quickly as possible . almost half of the cases ( 189/408 ) were of 46,xy testicular dsd and within this group prevalent diagnoses were those of defects in androgen receptor ( both partial and complete forms ) and 5-reductase type 2 deficiency [ 1618 ] . such differential diagnoses are challenging in the newborn , especially when there is no history of consanguinity or similar cases in the family [ 16 , 19 , 20 ] , which challenges sex definition for those children . furthermore , among 46,xy testicular dsd , we should also highlight cases of hypogonadotropic hypogonadism with or without hypopituitarism , in which the presence of micropenis with cryptorchidism and without hypospadias strongly suggests this diagnosis . among less frequent etiologies of 46,xy testicular dsd with a monogenic origin there were defects in the lhcg receptor and in testosterone synthesis and persistence of mllerian ducts . even less frequent were those cases associated with the use of drugs by the mother during pregnancy . on the other hand , among the most frequent cases in the 46,xy dsd testicular group were those with syndromic features , once again showing the importance of assessment of dysmorphic features of these patients and the idiopathic forms . in the latter , half of the patients weighed less than 2,500 grams at birth . the association of small for gestational age and genital ambiguity in newborns with 46,xy karyotype is frequently reported in the literature [ 10 , 15 , 23 , 24 ] , but the explanation is still unclear . fetal gonadal determination is influenced by many genes ( sry , nr5a1 , wt1 , sox9 , etc . ) and may be disrupted by abnormalities in sex chromosomes [ 811 ] . with techniques of genomic sequencing , new genes are emerging as participants in the complex process of gonadal development . the dgd group includes diseases in which gonadal differentiation was inadequate or incomplete ; therefore diagnoses required histological confirmation by an experienced pathologist . for diseases associated with chromosomal and genetic abnormalities , it was necessary to perform laboratorial tests using conventional cytogenetic , molecular cytogenetic , and molecular genetic techniques . among 95 cases of dgd , we observed a prevalence of the 46,xy karyotype , followed by sex chromosomes abnormalities ; in turn , the 46,xx karyotype was less frequent . among dgd cases , partial gonadal dysgenesis was the most frequent , followed by mixed gonadal dysgenesis and ovotesticular dsd . mutations were identified in a specific gene in only 16 out of the 39 cases of partial gonadal dysgenesis [ 2833 ] . the identification of a mutation in the specific gene is important for the follow - up of these cases , particularly mutations in wt1 that are associated with risk of kidney cancer and gonadal and renal failure [ 30 , 31 ] . nr5a1 mutations are associated with risk of adrenal insufficiency and primary ovarian failure [ 3234 ] . in a family with mutation in sry , there was a wide spectrum of xy gonadal dysgenesis manifestation , varying from partial to complete forms . other cases with no known mutations are candidates for genomic approaches . in cases of partial gonadal dysgenesis cases of mixed gonadal dysgenesis , mainly those with 45,x mosaicism , require follow - up for diseases associated with turner syndrome and short stature . cases of ovotesticular dsd , which may occur in the presence of any chromosomal constitution , represent a challenge for the sex of rearing definition , prognosis , and etiologic diagnosis [ 3739 ] . clinical management in cases of ovotesticular dsd depends on the patient 's age at diagnosis and data of the internal and external genitalia , as in most cases of genital ambiguity . when diagnosed at early ages , the best option is female sex of rearing , trying to maintain the ovarian portion of the gonads when possible , regarding the possibility of spontaneous female puberty and fertility , especially in patients with chromosomal 46,xx constitution . cases of 46,xx ovotesticular dsd and 46,xx testicular dsd were seen in the same family , in monozygotic twins , suggesting that these two disorders can have one etiology with a broad phenotypic spectrum . less frequent etiologies of dgd in this series were 46,xx testicular dsd and testicular regression syndrome furthermore , there were 19 that were evaluated by presenting a genital complex malformation ( not ambiguous genitalia ) especially associated with vertebral , urinary , and intestinal tract alterations . abnormal development of external genitalia may be an isolated anomaly but can also be part of abnormalities in the development of the lower abdominal wall or perineum . as described by cox et al . and hutson et al . , the investigation of dsd defects in these patients is essential and possibly more often necessary than described in the literature . sex assignments before referral to our service and before etiological investigation , in addition to older age at the first visit to our hospital ( average of 31.7 months ) , show that pediatricians need to understand better the concept of dsd and its etiologies as well as clinical and psychosocial implications . the average age at first visit was significantly lower in the 46,xx ovarian dsd group , which may be explained by the large number of cases of 21-hydroxylase deficiency in the salt - wasting form , for whom the risk of death is high if it is not early diagnosed . only 27 cases ( 6.6% ) have sex reassignment , 15 from male to female ( mainly cases of congenital adrenal hyperplasia , mixed gonadal dysgenesis , and 46,xx ovotesticular dsd ) and 12 from female to male ( mainly 5-alpha - reductase type 2 deficiency ) . sex reassignment occurred in the first year of life in all cases , except for patients with 5-reductase type 2 deficiency . about half of the cases of sex reassignment were due to the possibility of normal female puberty and fertility in patients with congenital adrenal hyperplasia ( seven cases ) and to personal request of adolescents with 5-reductase type 2 deficiency ( seven cases ) , as recommended by consensus of dsd [ 1 , 2 ] . in patients with genital ambiguity due to mixed gonadal dysgenesis or ovotesticular dsd , sex definition is a challenge involving prognosis about adult gender identity , anticipated quality of sexual function , surgical options and risks , fertility potential , evidence of fetal cns exposure to androgens , gonadal malignancy risk , and psychosocial factors ( familial , social , and cultural ) [ 1 , 2 ] . in this present study , five patients with mixed gonadal dysgenesis and four patients with ovotesticular dsd ( three with 46,xx karyotype e and one with 46,xy karyotype ) had sex reassignment , based on surgical options ( severity of genital ambiguity ) , presence of normal uterus , and decision of the family . overall , the predominant sex assigned was male ( 238 cases ) , following the increased frequency of karyotype 46,xy and the high number of cases of 46,xy testicular dsd . with the experience of treating and following 408 dsd patients with genital ambiguity over 23 years in an interdisciplinary care center , we may conclude that individuals with genital ambiguity represent an urgent problem that must be solved quickly and accurately , as early as possible . the management of these patients requires empathy and should be performed by a skilled multidisciplinary team , in order to reach a correct diagnosis without confusion about the child 's sexual identification . making a diagnosis properly before the sex assignment in most cases gives the patient and the family a better understanding of the condition and the proper definition of gender of rearing and allows more satisfaction with treatment . this study with a large sample shows that it is essential for the general pediatricians , who are the first professionals to evaluate the child , to have at least basic knowledge of dsd . inadequate sex assignments and ineffective treatments may occur if these rare conditions are not properly evaluated . it can also be concluded that the 46,xy karyotype was more frequent among cases of dsd whereas congenital adrenal hyperplasia was the most common etiology of monogenic inheritance . cases of 46,xy dsd and dgd require much attention and accurate laboratorial tests for the correct etiological diagnosis . several cases without etiologic diagnosis or with syndromic features need advanced technique like next generation sequencing , with either panels of candidate genes or whole exome , making it possible to clarify the etiologic diagnosis and to discover new candidate genes , mainly in 46,xy testicular dsd . the average age at the first visit was 31.7 months and was lower in the 46,xx dsd group . the final sex of rearing was male in 238 cases and female in 170 , and only 6.6% had sex reassignment . finally , we want to emphasize the importance of knowing the prevalence of each etiologic diagnosis of dsd with ambiguous genitalia and the use of both karyotype and gonadal tissue in the classification of dsd groups .

objective . to evaluate diagnosis , age of referral , karyotype , and sex of rearing of cases with disorders of sex development ( dsd ) with ambiguous genitalia . methods . retrospective study during 23 years at outpatient clinic of a referral center . results . there were 408 cases ; 250 ( 61.3% ) were 46,xy and 124 ( 30.4% ) 46,xx and 34 ( 8.3% ) had sex chromosomes abnormalities . 189 ( 46.3% ) had 46,xy testicular dsd , 105 ( 25.7% ) 46,xx ovarian dsd , 95 ( 23.3% ) disorders of gonadal development ( dgd ) , and 19 ( 4.7% ) complex malformations . the main etiology of 46,xx ovarian dsd was salt - wasting 21-hydroxylase deficiency . in 46,xx and 46,xy groups , other malformations were observed . in the dgd group , 46,xy partial gonadal dysgenesis , mixed gonadal dysgenesis , and ovotesticular dsd were more frequent . low birth weight was observed in 42 cases of idiopathic 46,xy testicular dsd . the average age at diagnosis was 31.7 months . the final sex of rearing was male in 238 cases and female in 170 . only 6.6% ( 27 cases ) needed sex reassignment . conclusions . in this large dsd sample with ambiguous genitalia , the 46,xy karyotype was the most frequent ; in turn , congenital adrenal hyperplasia was the most frequent etiology . malformations associated with dsd were common in all groups and low birth weight was associated with idiopathic 46,xy testicular dsd .

hallucinations have been described since antiquity , and are well - recognized as components of mental illness . chronic hallucinatory psychosis is one entity which falls under other nonorganic psychotic disorder in international classification of disease-10 revision . while auditory hallucinations are more commonly encountered in nonorganic psychotic disorders , visual hallucinations can be seen in a range of neurological , psychiatric and ophthalmological conditions . antipsychotic medications are the principle mode of treatment but they often fail to exert any response in persistent visual hallucinations . it has been reported that antiepileptics are useful to treat visual hallucinations in charles bonnet syndrome , but their efficacy in functional cases is less studied and less reported . we present a case of successfully treated , antipsychotic resistant visual hallucinations in a patient with chronic hallucinatory psychosis by carbamazepine . mh , a 45-year - old male , residing in urban jharkhand , india from a poor socioeconomic background , with nil - significant past or family history and no known psychoactive substance use , was admitted to central institute of psychiatry with 4 years continuous history of seeing images of two - dimensional human figures or faces with associated fearfulness and suspiciousness . the patient had developed low mood and occasional death wishes for last 6 months secondary to these symptoms . initial evaluation revealed a depressed affect , hopelessness , death wishes , delusion of persecution and reference , and complex visual hallucinations . routine investigations including neuroimaging ( computed tomography brain , magnetic resonance imaging brain and electroencephalogram ) were also within normal range . he had been treated earlier with an adequate dose of atypical ( risperidone 6 mg for 6 months and olanzapine 15 mg for 3 months ) and typical antipsychotics ( fluphenazine decanoate 25 mg long - acting depot every 2 weeks for 9 months ) with no improvement in the visual hallucinations . after admission , he was started on haloperidol ( initial dose of 10 mg / day , hiked up to 15 mg / day ) and fluoxetine ( initial dose of 20 mg / day , hiked up to 40 mg / day ) . after 6 weeks of treatment , patient showed improvement in persecutory delusions and depressive symptoms , but the visual hallucinations persisted unabated . considering case reports of persistent visual hallucinations that responded to antiepileptic medications in organic hallucinosis , patient was started on 100 mg of carbamazepine per day that was increased to 800 mg / day over a period of 1 week . the frequency and duration of the hallucination improved , and within 4 weeks , visual hallucinations resolved completely . in clinical settings , complex visual hallucinations have varied etiologies , and the treatment varies accordingly . recent literature suggests that visual hallucinations result from release phenomenon due to the modulation of the thalamo - cortical network . pattern completion in the neural network model of thalamus has been hypothesized in visual hallucinations of various etiologies such as charles bonnet syndrome , psychedelic drug consumption , somatic hallucinations in phantom limbs , cognitive hallucinations in schizophrenia , and other psychotic disorders . in this model , hallucinations are postulated to be produced when the thalamus fills deprived areas in order to complete patterns , and hence effective treatment of some of these disorders involve peripheral stimulation along with central inhibition and hence that the neural circuits generating the disorders are depressed according to the proposed model of synaptic plasticity . the ability of carbamazepine to decrease gamma - aminobutyric acid turnover and increase glutamate turnover probably inhibit the hyper - excited neuronal circuits responsible for visual hallucinations , resulting in the required central inhibition . contrary to our present report , few reports on the development of visual and auditory hallucinations following treatment with carbamazepine and other antiepileptics have been published in the past . more recently , complex visual hallucinations have been described with carbamazepine and phenytoin sodium ; auditory hallucinations have been reported with carbamazepine at therapeutic serum levels . in these cases , after extensive investigation , the authors concluded that the hallucinations resulted from a direct effect of the antiepileptic drugs and ruled out all other possibilities including migraine and seizures . though in our patient visual hallucinations resolved with carbamazepine , rather than having worsened , this is not in contradiction with the past reports . the hallucinations reported in the past are likely to have occurred due to a faulty central inhibition , where the inhibitory neurons were affected instead of hyper - excited neurons , in vulnerable individuals ( seizure or migraine diathesis or genetic predisposition ) with rapid changes in serum drug concentrations resulting in release hallucinations . this proposal of vulnerability factors giving rise to paradoxical responses is further supported by the rare occurrence of such hallucinations with carbamazepine use in general clinical practice . thus , our case illustrates a novel use of carbamazepine in the treatment of visual hallucinations in the nonorganic psychosis . often the most challenging cases faced in clinical psychiatry are those with treatment - resistant symptoms , which can prove distressing to patients . our approach in this case was to combine contemporary ideas in neurophysiology and therapeutic evidence in related disorders and apply these to clinical practice in a targeted way . we recognize this to be a single case of novel therapeutic use of carbamazepine ; however , we feel that further research in this field is indicated .

visual hallucinations are commonly present in various neurological and psychiatric conditions such as schizophrenia and other hallucinatory psychosis . current conceptualization of hallucinations assume pattern completion model of thalamus to be responsible for the origin of this type of the perceptual abnormality and proposes that central inhibition of such circuits may treat hallucinations . we present a case of chronic hallucinatory psychosis with significantly distressing visual hallucinations , resistant to antipsychotics , which successfully responded to carbamazepine . this case illustrates the novel use of an antiepileptic in the treatment of resistant visual hallucinations . targeted therapy of this kind can be considered in the future , although more evidence is required in this field .

at the end of the 20 century , the practice of running increased considerably 1,2 and , as a result , there were increases in the incidence of injuries in the lower limbs.3 a retrospective study with 2002 runners , showed that plantar fasciitis ( pf ) was the third most common injury in runners4 for about 20% of the athletes.5 tauton et al.4 reported that out of 267 cases of investigated pf in various sport modalities , 160 involved only running . pf is characterized by musculoskeletal disorders of the plantar fascia from inflammatory and degenerative origins , such as in the medial tubercule of the calcaneus , the most common clinical symptoms of which are typical pain of the inferior and medial calcaneal areas.6,7 according to greve et al.,8 morning pain is an important evaluation criterion . there are several intrinsic and extrinsic factors related to pf.9 however , some specific intrinsic factors have been explored more thoroughly for the development of pf , among them obesity,10 decreases in the range of motion of ankle dorsiflexion,1012 plantar longitudinal arch configurations,6,1315 rearfoot pronations4,9,16 and increased plantar loads.1719 however , some controversies regarding these factors still remain , mainly regarding their involvement in the etiology of this injury.9 some studies attributed the influences of plantar longitudinal arch and rearfoot pronation to the development of pf.6,14,2022 the pioneering research of hicks 23,24 demonstrated that the height and length of the plantar longitudinal arch could be implicated in the development of pf . hicks studied a model in different lower limbs of cadavers which characterized the tension forces absorbed by the plantar fascia and found important functions of the longitudinal arches for plantar load distributions . most previous gait studies observed that the pain stimulus for the feet of individuals with pf promoted changes in foot roll - over patterns , thus causing load reductions in the rearfoot and load increases in other plantar regions , such as the midfoot , possibly owing to the protective mechanisms of pain.19 however , during bipedal static support , studies which evaluated athletes with pf still have contradictory results concerning the types of the longitudinal arch and rearfoot angles , especially when the pain stimulus is under consideration . using subjective static evaluations , tauton et al.4 observed that the plantar longitudinal arch was more elevated in runners with pf and that 55% demonstrated excessive rearfoot pronation ; other studies also reported similar findings.6,14,25 an elevated arch could induce greater stiffness of the feet , which would result in an inefficient capacity to dissipate foot impact forces with the ground and , thus , place the plantar fascia in a position of greater mechanical stress.14 excessive pronation , for instance , could lead to greater loads on the medial areas of the calcaneus and greater tensions in the plantar area;6,14,25 however , pain was not quantified in theses studies . on the other hand , studies which evaluated the plantar longitudinal arch,9,11 rearfoot alignment9 and calcaneal pain with long - distance runners did not demonstrate significant differences regarding these factors when compared to controls . in a study of non - athletes , prichasuk and sbhadrabandhu26 observed that 82 individuals with symptomatic calcaneal spurs had lower plantar arches , which were considered important factors for the development of pf . in a retrospective review of 1000 x - rays of subjects with calcaneal pain , shama et al.16 found that 81% demonstrated rearfoot pronation . a more recent study by pohl et al.,15 revealed that female runners with a history of pf had lower medial longitudinal arches and rearfoot valguses , similar to control runners . however , they pointed out the need for future studies to evaluate runners with pain symptoms , as their subjects had over two years of diagnoses , which is a phase for possible remissions of these symptoms . it is well known that complaints of pain most often occur during the acute phase . according to wearing et al.,19 karr27 also reported that the adaptations of the foot could be demonstrated not only by the lowering of the arch , but also in its elevation , associated with the onset of micro - traumas of the plantar fascia . considering the controversial results regarding the effects of the presence or absence of pain on the rearfoot and longitudinal plantar arch configurations in runners with pf , the present study was conducted . the importance of these results relies on a better understanding of the rearfoot angles and medial longitudinal arch indices during the static posture of runners with pain symptoms and histories of pf . another question which motivated the present study was : would pain caused by pf induce postural adaptations of the feet and ankle ? the hypotheses were that the conditions of symptomatic pf would be associated with decreases in rearfoot pronations and elevated longitudinal arches . it was expected that lower arches and excessive rearfoot pronations in runners with histories of pf , compared to control runners , would be found . one hundred and five recreational runners of both genders , ranging in age from 20 to 55 years,18 were evaluated over the period of 1 year . for inclusion in this study , the runners had to have been running at least 20 km weekly for at least one year,28 had to be experienced in running long distance competitions , had to have regular rearfoot strike patterns , and had to have maximum leg length discrepancies of 1 cm . the exclusion criteria for both groups included histories of previous foot surgeries , trauma or fractures of less than three months previously , neuropathies , obesity and musculoskeletal disorders , such as arthritis , tendinitis , bursitis , ankylosing spondylitis and heel spurs . the pf runners were recruited from the rehabilitation center in sport rheumatology of the university hospital in sao paulo , brazil . diagnoses were made by the same experienced physician , which were confirmed by ultra - sound images taken by an experienced technician . all runners signed a term of informed consent approved by the local ethics committee ( protocol 1227/07 ) . forty - five runners had diagnoses of unilateral pf confirmed by ultrasonography to verify thickening of the plantar fascia , hypoechoic changes , perifascial fluid collection and bony spurs.29 thirty runners had symptoms of heel pain ; the pf group with symptoms ( pfs ) of more than four months ' duration was considered to be in the acute phase of injury , which was also clinically diagnosed by ultra - sound . they must have had pain from palpation of the plantar fascia , complaints of pain in the morning during standing and after assuming sitting and standing positions for long durations.18,30 fifteen runners had previous histories of pf ( pfh group ) , with the time of the first diagnosis within a mean ( sd ) of 1.5 ( 3.3 ) years . these runners were free from pain symptoms in the heel for more than two months and were considered to be in the remission phase of the injury . the control group ( cg ) was composed of 60 runners with no histories or symptoms of pf . the mean weekly training volumes were 40 ( 12 ) km for the pfh group and 45 ( 10 ) km for the pfs group , whereas their mean time practice running was 7 ( 5 ) and 6 ( 5 ) years for the pfh and pfs , respectively . for the cg , the mean weekly training volume was 45(6 ) km and the mean weekly time of training of 4 ( 3 ) years . the mean running speed reported by the subjects , regarding their last 10-km competition , was 11.7 ( 0.6 ) km / h . all runners were interviewed using a previously developed questionnaire to characterize their histories and clarify their exclusion criteria . this questionnaire was divided into four items : personal data , anthropometric characteristics , pf data and physical activity data for running . the level of pain in all subjects was assessed by a 10 cm visual analogue scale ( vas ) . before the plantar pressure measurements , the subjects rated the pain they felt at the moment of evaluation , ranging from none to unbearable . according to jensen et al.,31 the scale is valid and reliable and has already been used in several pf studies.18,19 to evaluate the alignment of the calcaneal tendons in the posterior view of the frontal plane , the runners stood over a 45 cm platform , keeping their feet 7.5 cm apart . with a dematographic pen and white marks of 9 mm , the following anatomical points were identified on the inferior and posterior aspects for both legs : 1 ) the posterior calcaneal tuberosity ; 2 ) the second point above the calcaneus ; and , 3 ) the lower third of the leg.32,33 ( figure 1a ) . the center of each marker in the medial - lateral axis was obtained with a digital caliper , a metallic device with graduations in cm , used to measure the distances between the two symmetrically opposing sides with a ruler . the images were then obtained with a digital camera positioned anterior and perpendicular to the subjects at a distance of 90 cm and at a height of 45 cm . autocad 2005 software was used to quantify calcaneal tendon alignments . to obtain these measures , a line was first drawn from the first ( 3 cm ) to the second ( 7 cm ) markers . then , another line was drawn from the highest marker to the floor ( 22 cm ) , which passed through the center of the third marker ( 13 cm ; figure 1b).32,33 the intersections of the extensions of these lines resulted in angles which were classified as normal ( 05 ) , varus ( < 0 ) and valgus ( > 5 ) alignment values.34 to assess the plantar arch , the runners were positioned barefoot on a podoscope ( carci ) with a distance of 7.5 cm between feet . footprints were captured with a digital camera which was positioned in front of the podoscope at a distance of 24 cm and a height of 45 cm ( figure 2a ) , following valid and reliable procedures described by ribeiro et al . and mall et al.35,36 the distance of 7.5 cm between feet to scale the image in autocad 2005 was taken as a reference and used for the measurements . with the autocad 2005 software , a vertical straight line ( l ) then , the ( l ) line was divided into three parts for the delimitation of the forefoot , middlefoot and rearfoot areas . to measure the medial longitudinal arch , the middlefoot area was divided by the total foot area : forefoot + middlefoot + rearfoot ( figure 2b ) . for values between 0.22 and 0.25 , the foot was classified as normal ; values < 0.21 indicated varus foot ; and > 0.26 valgus foot.37 the sample power was calculated by gpower 3.0 software . the sample size calculation was based upon the two outcome measures ( plantar arch and rearfoot angles ) , considering a statistical design of the f test for repeated measures ( between and within effects ) , with a moderate size effect ( f = 0.25 ) , a power of 80% and an alpha error of 5% . the rearfoot angle and medial longitudinal arch index data were normally distributed ( shapiro - wilk ) and the variances were homogeneous ( levene 's tests ) . for statistical purposes , the rearfoot angle and arch index data of only one foot per subject were randomly selected for the analyses of the differences between groups . anovas followed by tukey post - hoc tests ( p<0.05 ) were employed to investigate differences between groups . to analyze the intra - rater reliability of the rearfoot angle , measurements were obtained by the same examiner in two evaluation moments , at a one - week interval , and the intra - class correlation coefficients ( icc3,1 ) were calculated.38 to investigate the inter - rater reliability , icc2,1 were calculated using the data collected during the first week by two independent examiners.38 the intra- and inter - rater reliability analyses for the anatomical marker data were performed only by the first examiner , following previous recommended procedures.35,36 one hundred and five recreational runners of both genders , ranging in age from 20 to 55 years,18 were evaluated over the period of 1 year . for inclusion in this study , the runners had to have been running at least 20 km weekly for at least one year,28 had to be experienced in running long distance competitions , had to have regular rearfoot strike patterns , and had to have maximum leg length discrepancies of 1 cm . the exclusion criteria for both groups included histories of previous foot surgeries , trauma or fractures of less than three months previously , neuropathies , obesity and musculoskeletal disorders , such as arthritis , tendinitis , bursitis , ankylosing spondylitis and heel spurs . the pf runners were recruited from the rehabilitation center in sport rheumatology of the university hospital in sao paulo , brazil . diagnoses were made by the same experienced physician , which were confirmed by ultra - sound images taken by an experienced technician . all runners signed a term of informed consent approved by the local ethics committee ( protocol 1227/07 ) . forty - five runners had diagnoses of unilateral pf confirmed by ultrasonography to verify thickening of the plantar fascia , hypoechoic changes , perifascial fluid collection and bony spurs.29 thirty runners had symptoms of heel pain ; the pf group with symptoms ( pfs ) of more than four months ' duration was considered to be in the acute phase of injury , which was also clinically diagnosed by ultra - sound . they must have had pain from palpation of the plantar fascia , complaints of pain in the morning during standing and after assuming sitting and standing positions for long durations.18,30 fifteen runners had previous histories of pf ( pfh group ) , with the time of the first diagnosis within a mean ( sd ) of 1.5 ( 3.3 ) years . these runners were free from pain symptoms in the heel for more than two months and were considered to be in the remission phase of the injury . the control group ( cg ) was composed of 60 runners with no histories or symptoms of pf . the mean weekly training volumes were 40 ( 12 ) km for the pfh group and 45 ( 10 ) km for the pfs group , whereas their mean time practice running was 7 ( 5 ) and 6 ( 5 ) years for the pfh and pfs , respectively . for the cg , the mean weekly training volume was 45(6 ) km and the mean weekly time of training of 4 ( 3 ) years . the mean running speed reported by the subjects , regarding their last 10-km competition , was 11.7 ( 0.6 ) km / h . all runners were interviewed using a previously developed questionnaire to characterize their histories and clarify their exclusion criteria . this questionnaire was divided into four items : personal data , anthropometric characteristics , pf data and physical activity data for running . the level of pain in all subjects was assessed by a 10 cm visual analogue scale ( vas ) . before the plantar pressure measurements , the subjects rated the pain they felt at the moment of evaluation , ranging from none to unbearable . according to jensen et al.,31 the scale is valid and reliable and has already been used in several pf studies.18,19 to evaluate the alignment of the calcaneal tendons in the posterior view of the frontal plane , the runners stood over a 45 cm platform , keeping their feet 7.5 cm apart . with a dematographic pen and white marks of 9 mm , the following anatomical points were identified on the inferior and posterior aspects for both legs : 1 ) the posterior calcaneal tuberosity ; 2 ) the second point above the calcaneus ; and , 3 ) the lower third of the leg.32,33 ( figure 1a ) . the center of each marker in the medial - lateral axis was obtained with a digital caliper , a metallic device with graduations in cm , used to measure the distances between the two symmetrically opposing sides with a ruler . the images were then obtained with a digital camera positioned anterior and perpendicular to the subjects at a distance of 90 cm and at a height of 45 cm . autocad 2005 software was used to quantify calcaneal tendon alignments . to obtain these measures , a line was first drawn from the first ( 3 cm ) to the second ( 7 cm ) markers . then , another line was drawn from the highest marker to the floor ( 22 cm ) , which passed through the center of the third marker ( 13 cm ; figure 1b).32,33 the intersections of the extensions of these lines resulted in angles which were classified as normal ( 05 ) , varus ( < 0 ) and valgus ( > 5 ) alignment values.34 to assess the plantar arch , the runners were positioned barefoot on a podoscope ( carci ) with a distance of 7.5 cm between feet . footprints were captured with a digital camera which was positioned in front of the podoscope at a distance of 24 cm and a height of 45 cm ( figure 2a ) , following valid and reliable procedures described by ribeiro et al . and mall et al.35,36 the distance of 7.5 cm between feet to scale the image in autocad 2005 was taken as a reference and used for the measurements . with the autocad 2005 software , a vertical straight line ( l ) then , the ( l ) line was divided into three parts for the delimitation of the forefoot , middlefoot and rearfoot areas . to measure the medial longitudinal arch , the middlefoot area was divided by the total foot area : forefoot + middlefoot + rearfoot ( figure 2b ) . for values between 0.22 and 0.25 , the foot was classified as normal ; values < 0.21 indicated varus foot ; and > 0.26 valgus foot.37 the sample size calculation was based upon the two outcome measures ( plantar arch and rearfoot angles ) , considering a statistical design of the f test for repeated measures ( between and within effects ) , with a moderate size effect ( f = 0.25 ) , a power of 80% and an alpha error of 5% . the rearfoot angle and medial longitudinal arch index data were normally distributed ( shapiro - wilk ) and the variances were homogeneous ( levene 's tests ) . for statistical purposes , the rearfoot angle and arch index data of only one foot per subject were randomly selected for the analyses of the differences between groups . anovas followed by tukey post - hoc tests ( p<0.05 ) were employed to investigate differences between groups . to analyze the intra - rater reliability of the rearfoot angle , measurements were obtained by the same examiner in two evaluation moments , at a one - week interval , and the intra - class correlation coefficients ( icc3,1 ) were calculated.38 to investigate the inter - rater reliability , icc2,1 were calculated using the data collected during the first week by two independent examiners.38 the intra- and inter - rater reliability analyses for the anatomical marker data were performed only by the first examiner , following previous recommended procedures.35,36 no differences between the groups were found for demographic and anthropometric characteristics ( table 1 ) . the symptom plantar fasciitis ( spf ) group of runners reported mean times since the onset of pain of seven ( two ) months , and pain levels on the vas of five ( two ) cm . as shown in table 2 , all three groups demonstrated rearfoot valgus , and no significant differences were found between the groups regarding rearfoot alignments ( 0.93<p<0.98 ) . however , regarding plantar medial longitudinal arch index , significant differences were observed between the pfs , pfh , and cg groups . the plantar arches were more elevated in both groups with pf ( pfs and pfh ) , compared to the controls ( p = 0.008 ) . the reliability analyses for the rearfoot alignment angles for the pfs group resulted in icc values of 0.96 and 0.98 , respectively , for the intra- and inter - rater reliabilities . the purpose of the present study was to evaluate and compare rearfoot alignment and medial longitudinal arch indices during static postures in runners with and without symptoms and histories of pf . however , the plantar medial longitudinal arch indices were higher for both the pf groups ( pfs and pfh ) , compared to the controls , but no differences were found between the pf groups . the similarity of the valgus misalignments for runners with pfs and pfh corroborated the findings of pohl et al.,15 who , besides doing static evaluations , also performed dynamic analyses during running . they did not find differences regarding the valgus misalignments of the calcaneus or the variables related to the peaks , times and movement excursions of calcaneal eversion in a group of female runners with pf histories . however , they emphasized the importance of studies which investigated pain symptoms , which could have invariably affected the results . in the present study , the aspects of pain were considered and , as a result , it was observed that valgus misalignments remained the same for the pf and control groups . it was expected that the symptom of pain would lead to less support on the medial heel as an analgesic strategy during bipedal standing positions . consequently , the reduction in weight bearing on this region of the calcaneus would decrease the effects on the rearfoot valgus . however , similarly to controls , the presence of pain in the symptomatic runner group was not enough to reduce natural support that caused this static valgus rearfoot behavior . rome et al.9 also reported similar findings when evaluated runners with complaints of calcaneal pain were compared to control groups . they did not observe differences in rearfoot alignments ; however , a limitation of this study was that they did not assess the level and duration of pain associated with pf . the innovative aspects of the present study were to better understand how runners with pain levels of 5 ( 2 ) cm , over a duration of seven months , did not show differences in their rearfoot alignments compared to runners with histories of pf and controls . these findings suggest that valgus misalignments of the rearfoot do not appear to be a risk factor involved in the development of pf in runners . in contrast , tauton et al.4 reported excessive rearfoot pronation in 55% of athletes with pf . however , their assessments only included subjective clinical measures of alignment which were visually determined and were less valid and reliable . prichasuk and sbhadrabandhu,26 employed quantitative x - ray measures to investigate the calcaneal lateral tilt angles in non - athletic subjects with symptomatic calcaneal spurs . they found that , compared to controls , the symptomatic group demonstrated decreases of tilt angles and their results corroborated those of shama et al.16 one possible explanation for the differences between their results and those in the present study could be the sample selection , as only runners without diagnoses of calcaneal spurs were evaluated . it is possible that the presence of spurs in the chronic stages of pf could result in excessive rearfoot valgus misalignments during static postures . one limitation of the present study was that dynamic analyses of the rearfoot and midfoot were not carried out . even though , pohlet al.15 had already reported that rearfoot movements did not change in female runners with a history of pf , the inclusion of dynamic measures would be important for the demonstration of movements of these segments with the presence of pain . also , these authors did not try to assess the relationships between midfoot pronation and pf , as previously reported by chang et al.39 the inclusion of these assessments could have explained the dynamic involvement of the rearfoot and midfoot during conditions of pain in runners with pf . according to riddle et al.,10 there are potential relationships between the increases in pain and decreases in ankle range of motion , which are of extreme importance for the foot rocking mechanisms during running . cornwall and mcpoil40 postulated that excessive pronation could occur as a result of structural changes in the plantar arches , or to compensatory mechanisms , which could result from decreases in dorsiflexion . however , as in the diabetic neuropath , the literature is not yet clear regarding the relationship between the smaller ankle range of motion and the foot roll - over mechanism.41 this study also evaluated the behaviors of the plantar arch with the presence of pain in runners with pf . according to huang and kitoaka,42 the crucial function of the plantar fascia is to maintain the integrity of the plantar arch . thus , the literature hypothesizes that lowered plantar arches could induce greater stretching of the plantar fascia.6,15,21,43,44 in the present study , the initial hypothesis was that the presence of pain would result in increases of the plantar medial longitudinal arch index . however , it was observed that plantar arch configurations appeared to be more related to the genesis of pf and not specifically to pain symptoms . compared to the cg , arches were more elevated in the groups with pf , both symptomatic and with histories . a possible explanation for these findings could be the fact that the elevation of the plantar arch would lead to greater strains of the plantar fascia to maintain arch architecture during static positions . the maintenance of this posture for long periods could lead to micro - traumas of the plantar fascia and , consequently , to the onset of pf , which is characterized by periods of crises and remissions.45 it is well documented that individuals with pf have decreases in their ankle dorsiflexion range of motion10,12 associated with less flexibility of the triceps surae muscular group,12 and decreases in extension of the toes.46 these changes could suggest that the plantar fascia would be kept in a more shortened position and , thus , would be exposed to greater tensions to be able to support the plantar arch , as found in the present study . based on this , the majority of treatments for pf recommend the use of shoe wedges with the objective of supporting the plantar medial longitudinal arch and to relax the plantar fascia , which could result in relief of the pain symptoms.4750 another proposed intervention which reinforces the previous idea , is the support of the plantar medial longitudinal arch by means of functional bandages.51 according to wearing et al.19 , the thickening of the plantar fascia and the levels of pain associated with pf are factors which could impose stresses on the static structures of the plantar arch . however , the present findings demonstrate that the presence of pain in the group with pf , did not promote changes in the configuration of the plantar arch , which suggests that more elevated plantar arches could be better related to the development of pf . messier and pittala52 evaluated the plantar arch of 15 runners with pf by means of plantar impressions and did not find statistically significant differences , compared to the cg . however , they reported the tendency of more elevated plantar arches in the pf group . in the present study , 45 runners , 30 with symptoms and 15 histories of pf were evaluated and the plantar impressions were obtained with podometry , whose reliability35 and validity36 are well established . with a larger sample size , the results demonstrated more elevated arches in both groups of runners with pf , as was reported by messier and pittala.52 according to krivikas,14 a more elevated arch , besides promoting greater stresses on the plantar fascia , whose function is to provide support to the plantar arch , would reduce the attenuation of the impact forces of the calcaneus on the ground . this mechanism would lead to greater loads on the medial and posterior areas of the feet . taking into consideration the fact that running could cause high repetitive impacts on the calcaneus and , that if these impacts were repeated about 625 times / km,53 elevated plantar medial longitudinal arches would cause greater tensions and micro - traumas on the plantar fascia in runners . according to karr,27 both elevated and lowered arches could predispose individuals in the development of pf . in the present study , the runners with symptoms and histories of pf demonstrated higher elevated configurations of the plantar medial longitudinal arch , compared to the controls . these findings are in disagreement with those reported by pohl et al.,15 who found lower plantar longitudinal arches in female runners with pf , although they did not take pain symptoms into consideration . first , they only evaluated runners with histories of pf with a mean onset time of 2.5 years . this could explain if the plantar medial longitudinal arch was being re - structured and , thus , the differences between the present results , in which the subjects in the pf groups received treatments over a shorter period of time ( mean = 6 months ) . based on these findings , the relevance of this study was that it attempted to clarify that the presence of pain did not affect rearfoot misalignments and plantar medial longitudinal arch configurations of runners with pf . wearing et al.19 observed that pain symptoms promoted adaptations in the foot roll - over mechanisms during gait in individuals with pf . however , ribeiro et al.54 observed that pain symptoms did not promote any adaptations in foot roll - over mechanisms during running in recreational runners with pf . in the present study , the evaluations were carried out in bipedal static support and did not find any effects of pain on plantar arch shapes or rearfoot alignments . it is important to note that the elevated architecture of the plantar arch in runners with pf could lead to greater strain on the plantar fascia during static and , mostly , dynamic activities , such as running , because of the repetitive foot impacts with the ground during practice . chronically , these stresses could cause micro - traumas in the plantar fascia and probably lead to the progression of symptoms , or even to the onset of pf . a limitation of this study was that dynamic analyses of the rearfoot and midfoot were not included ; thus , future studies are necessary for a better understanding of pf in runners . regarding the plantar arch , studies evaluating interventions employing wedges , functional bandages and other physical therapy resources are necessary for a better understanding of the mechanical effects on the plantar medial longitudinal arch configurations in individuals with pf . runners with symptoms or histories of pf did not differ in their rearfoot valgus alignment but showed increases in longitudinal medial plantar arches during bipedal static support , regardless of the presence of pain . the authors are thankful to all the runners who participated in the study and also acknowledge the financial support of brazilian government funding agency capes ( coordenao de aperfeioamento de pessoal de ensino superior ) .

objective : to evaluate and compare rearfoot alignment and medial longitudinal arch index during static postures in runners , with and without symptoms and histories of plantar fasciitis ( pf).introduction : pf is the third most common injury in runners but , so far , its etiology remains unclear . in the literature , rearfoot misalignment and conformations of the longitudinal plantar arch have been described as risk factors for the development of pf . however , in most of the investigated literature , the results are still controversial , mainly regarding athletic individuals and the effects of pain associated with these injuries.methods:forty-five runners with plantar fasciitis ( 30 symptomatic and 15 with previous histories of injuries ) and 60 controls were evaluated . pain was assessed by a visual analogue scale . the assessment of rearfoot alignment and the calculations of the arch index were performed by digital photographic images.results:there were observed similarities between the three groups regarding the misalignments of the rearfoot valgus . the medial longitudinal arches were more elevated in the group with symptoms and histories of pf , compared to the control runners.conclusions:runners with symptoms or histories of pf did not differ in rearfoot valgus misalignments , but showed increases in the longitudinal plantar arch during bipedal static stance , regardless of the presence of pain symptoms .

parastomal hernia ( ph ) is a frequent complication following creation of colostomy and ileostomy . the development of ph does not always necessitate repair , but when surgical intervention is undertaken , recurrence is common . standard surgical approaches include local suture repair , local prosthetic mesh placement , and stoma transposition with or without midline laparotomy . using these approaches favorable outcomes following laparoscopic ( lap ) ph repair with mesh have been reported in case reports and small case series . we report our experience with lap ph repair in a colorectal patient population and propose that lap ph repair is a suitable and effective approach in the management of this disease . a retrospective chart review was performed on all patients with ph at the site of an ileostomy or colostomy who underwent lap or open surgical repair at our institution between november 1999 and november 2006 . data were taken from the time of first open repair in the open group and first lap repair in the lap group . patients were sorted into groups on an intent - to - treat basis , and the one converted lap patient was kept in the lap group . data collected included patient demographics , indication for initial stoma creation , operative time , length of stay ( los ) , postoperative complications , recurrence , and follow - up . a retrospective chart review was performed on all patients with ph at the site of an ileostomy or colostomy who underwent lap or open surgical repair at our institution between november 1999 and november 2006 . data were taken from the time of first open repair in the open group and first lap repair in the lap group . patients were sorted into groups on an intent - to - treat basis , and the one converted lap patient was kept in the lap group . data collected included patient demographics , indication for initial stoma creation , operative time , length of stay ( los ) , postoperative complications , recurrence , and follow - up . all patients were placed in the supine position with an ioban drape ( 3 m , st . peritoneal access was achieved with an 11-mm optical trocar ( optiview , ethicon , cincinnati , oh ) placed diagonally to the hernia . one 5-mm port was placed opposite the 11-mm port , superior to the ostomy , and one 5-mm port was placed inferiorly to the 11-mm port ( figure 1 ) . the herniated bowel and omentum were carefully reduced from the hernia defect ( figure 2a ) . a polytetrafluoroethylene ( ptfe ) mesh ( dual mesh , gore & associates , newark , de ) large enough to create at least a 4-cm overlap in all directions was used for all repairs . the mesh was then rolled and inserted into the abdomen through the 11-mm port . an endoclose device ( us surgical , norwalk , ct ) was used to grasp the prolene sutures for tying over the fascia in the subcutaneous space . for the 7 most recent patients , a nonslit flap configuration was used with the bowel ( stoma ) exiting laterally . a protack device ( us surgical , norwalk , ct ) was used to fix the edges of the mesh circumferentially except laterally , where the bowel came around the mesh . the bowel was pinned against the lateral anterior abdominal wall by the mesh to create a modified sugarbaker hernia repair ( figure 2b ) . alternatively , in the first 3 patients , a keyhole was cut , and a 3-cm aperture for the bowel was created in the mesh prior to implantation . in another patient , also operated on early within the reviewed time period , a diagonal , lateral slit was made to accommodate passage of the intestine . in the 4 patients with cut or slit mesh , a protack device was then used to circumferentially secure the mesh around the bowel and perimeter . tacks were also placed lateral to the mesh to close the slit , thus creating a 3-cm to 4-cm aperture around the bowel . at the conclusion of the repair , the fascia at the optiview port site was closed with figure - of - eight vicryl suture . location of trocar placement for repair of left - sided ph ( a ) and for repair of right - sided ph ( b ) . colostomy ( black arrow ) with associated parastomal fascial defect ( white arrow ) following reduction of herniated bowel ( a ) ; intact gore - tex dual mesh against anterior abdominal wall with underlying bowel limb ( black , dashed line ) obliquely exiting from mesh ( white arrow ) ( b ) . a midline incision through the prior incision site at the level of the stoma or a circumstomal , curvilinear incision outside the limits of the stomal faceplate was created . following subcutaneous dissection and identification of the hernia defect , the hernia sac was entered and freed circumferentially from the stoma . the fascial defect was closed with interrupted figure - of - eight or simple stitches of either # 1 prolene or 0 ethibond . in one case , the soft tissue defect was closed with interrupted vicryl suture , and the skin was closed with running subcuticular vicryl suture . all patients were placed in the supine position with an ioban drape ( 3 m , st . peritoneal access was achieved with an 11-mm optical trocar ( optiview , ethicon , cincinnati , oh ) placed diagonally to the hernia . one 5-mm port was placed opposite the 11-mm port , superior to the ostomy , and one 5-mm port was placed inferiorly to the 11-mm port ( figure 1 ) . the herniated bowel and omentum were carefully reduced from the hernia defect ( figure 2a ) . a polytetrafluoroethylene ( ptfe ) mesh ( dual mesh , gore & associates , newark , de ) large enough to create at least a 4-cm overlap in all directions was used for all repairs . the mesh was then rolled and inserted into the abdomen through the 11-mm port . an endoclose device ( us surgical , norwalk , ct ) was used to grasp the prolene sutures for tying over the fascia in the subcutaneous space . for the 7 most recent patients , a nonslit flap configuration was used with the bowel ( stoma ) exiting laterally . a protack device ( us surgical , norwalk , ct ) was used to fix the edges of the mesh circumferentially except laterally , where the bowel came around the mesh . the bowel was pinned against the lateral anterior abdominal wall by the mesh to create a modified sugarbaker hernia repair ( figure 2b ) . alternatively , in the first 3 patients , a keyhole was cut , and a 3-cm aperture for the bowel was created in the mesh prior to implantation . in another patient , also operated on early within the reviewed time period , a diagonal , lateral slit was made to accommodate passage of the intestine . in the 4 patients with cut or slit mesh , a protack device was then used to circumferentially secure the mesh around the bowel and perimeter . tacks were also placed lateral to the mesh to close the slit , thus creating a 3-cm to 4-cm aperture around the bowel . at the conclusion of the repair , the fascia at the optiview port site was closed with figure - of - eight vicryl suture . location of trocar placement for repair of left - sided ph ( a ) and for repair of right - sided ph ( b ) . colostomy ( black arrow ) with associated parastomal fascial defect ( white arrow ) following reduction of herniated bowel ( a ) ; intact gore - tex dual mesh against anterior abdominal wall with underlying bowel limb ( black , dashed line ) obliquely exiting from mesh ( white arrow ) ( b ) . a midline incision through the prior incision site at the level of the stoma or a circumstomal , curvilinear incision outside the limits of the stomal faceplate was created . following subcutaneous dissection and identification of the hernia defect , the hernia sac was entered and freed circumferentially from the stoma . the fascial defect was closed with interrupted figure - of - eight or simple stitches of either # 1 prolene or 0 ethibond . in one case , the soft tissue defect was closed with interrupted vicryl suture , and the skin was closed with running subcuticular vicryl suture . a total of 25 patients with ileostomies or colostomies underwent ph repair by the open approach or laparoscopic mesh placement between november 1999 and november 2006 . the lap repairs were all performed by 2 surgeons ( rh and ts ) who had completed minimally invasive surgery fellowships . all of the open repairs were performed by 2 board - certified colon and rectal surgeons ( wk and lp ) . twelve patients ( mean age 60 , range 25 to 80 years ) underwent lap approaches , with one patient requiring conversion to laparotomy with primary suture repair of the ph secondary to small - bowel enterotomy . thirteen patients ( mean age 54 ; range , 35 to 71 years ) underwent open ph repair . characterization of 25 patients having undergone laparoscopic or open parastomal repair se = standard error ; los = length of stay . diverticulitis , gist , paget 's disease , radiation proctitis , strangulated abdominal wall abscess , anismus . indications for initial stoma creation were ulcerative colitis ( 3 lap , 6 open ) , crohn 's disease ( 2 open ) , rectal cancer ( 4 lap , 3 open ) , diverticulitis ( 1 lap ) , anismus ( 1 lap ) , radiation proctitis ( 1 lap ) , gastrointestinal stromal tumor ( gist ) ( 1 open ) , paget 's disease ( 1 lap ) , strangulated abdominal wall abscess ( 1 open ) , and rectal cancer in the setting of crohn 's disease ( 1 lap ) . five patients had previously undergone open ph repairs : 4 in the lap group and 1 patient in the open group . twenty - three of the twenty - five ph repairs ( 92% ) were performed electively . indications for elective repair included chronic discomfort or progressive pain ( 7 lap , 7 open ) , bulging contributing to difficult maintenance of stomal appliances ( 4 lap , 3 open ) , and chronic obstruction ( 1 lap , 1 open ) . operative time for repair was not statistically significant between the 2 groups [ 17210.0 min ( lap ) versus 13719.1 min ( open ) ] , p=0.14 . the difference between los for the lap group ( 3.10.4 days ) and open group ( 5.10.8 days ) approached significance , p=0.05 . immediate postoperative complications occurred in 4 lap patients ( 33.3% ) and 2 open patients ( 15.4% ) , p=0.38 . in the lap group , complications were 2 wound infections , parastomal cellulitis , and a seroma beneath the mesh . no complications secondary to mesh erosion into bowel or mesh infection were seen in the lap group . the 2 complications in the open group were wound infections , one of which was a perineal wound infection separate from the ph repair site following a completion proctectomy that was simultaneously performed with the ph repair . the second complication was a parastomal abscess with subsequent fistula development , subsequently repaired by laparotomy , transection of the fistula tract , and resiting of the ileostomy . of these recurrences , 4 ( 33% ) were in the lap group and 7 ( 54% ) were in the open group . recurrences were evenly distributed among ileostomies and colostomies within the 2 groups ( 2 para ileostomal and 2 para - colostomal recurrences in the lap group ; 3 para - colostomal and 4 ileostomal recurrences in the open group ) . in the lap patients repaired by a modified sugarbaker technique , one of these patients developed a respiratory infection following her repair and experienced severe cough , which may have contributed to an increase in intraabdominal pressure , thus promoting her recurrence . this patient underwent a subsequent laparoscopic repair , and it was noted that one transfascial suture appeared to have torn through the mesh . among the 3 patients who had undergone mesh repair utilizing a keyhole - cut mesh , 2 recurred , resulting in a 67% recurrence rate among the total of 3 keyhole repairs . among our 13 patients who had local suture repairs , 7 recurred ( 54% ) , although one recurrence was associated with a motor vehicle collision at 10 months postoperative time in which the patient was a restrained driver . recurrences in the lap group occurred after 10.53.48 months versus 20.36.99 months in the open group . mean length of follow - up was 13.94.50 months for the lap group and 14.04.30 months for the open group . ph , the protrusion of abdominal contents through the fascial defect surrounding a stoma , represents a common complication of stoma construction that remains challenging to manage when they are diagnosed , they can often be managed without surgery using a hernia support belt , weight loss , avoidance of lifting heavy objects , observation , and patient education . larger , symptomatic hernias that cause pain , obstruction , and difficulty with maintenance of the appliance , as well as create cosmetic and other quality of life issues , warrant surgical repair . classically , 3 methods have been utilized to repair ph : local primary fascial repair , local mesh repair , and stoma transposition . recurrence rates of 46% to 76% following simple fascial repair have been described , with associated complication rates up to 71% , including death . in our study , we found a recurrence rate with open fascial repair similar to that reported in the literature at 53.8% , but had a much lower complication rate than that occurring in most studies at 15.4% . the incorporation of synthetic mesh into local ph repairs results in a lower recurrence rate but can be associated with serious complications , such as dense adhesion formation to the mesh , mesh infection , abscess development , and perforation or mesh erosion into the bowel . since the 1970s , the preference for type of mesh used in ph repair has changed from polyethylene to polypropylene to ptfe to expanded polytetrafluoroethylene ( eptfe ) , the last being a softer , smoother , low - porosity membrane that promotes minimal inflammation and adhesion formation while allowing tissue ingrowth . one consideration in mesh repair is whether to create an opening in the mesh through which the bowel may exit or pin the bowel against the abdominal wall with the mesh . several studies utilizing mesh through different open approaches and with alternative modifications have reported varying success rates . tekkis et al described a modified thorlakson technique that incorporated an incomplete circumferential mesh to reinforce fascial repair . this technique was performed on 5 patients in whom , in a short - term follow - up of less than 2 years , ph had not recurred , though 40% experienced complications of hematoma or prolapse . saclarides et al reviewed their experience with in situ y - split mesh repair and noted an 11% recurrence and complications of hematoma and delayed resumption of oral intake . stelzner et al reported a similar recurrence rate of 15% after repair of paracolostomy hernia with prosthetic nonslit mesh , after a mean follow - up of 3.5 years . longman and thompson showed promising results with a modification of in situ split mesh repair that included tacking back the triangular flaps from the opening created in the mesh . over a median follow - up period of 30 months , no recurrences had developed and only one complication of superficial wound breakdown had occurred . alternatives to local repair , such as transposition , or resiting of the stoma with repair of the fascial defect , are also not without challenge . failure rates following stoma resiting are reported to range from 15% to 57% , rates that are improved compared with those associated with fascial repair , but many of which are associated with higher complication rates , up to 88% . regardless of type of ph repair , no one method has emerged as ideal with which to set the standard of surgical treatment . in recent years , expanding knowledge of and experience with laparoscopic techniques have heralded innovative approaches to this dilemma . results of the first laparoscopic approaches to ph repair with mesh reinforcement were case reports published in 1998 and 1999 , by porcheron et al and bickel et al , respectively . a small case series of 4 patients undergoing laparoscopic ph repair with mesh reinforcement was published by kozlowski et al in 2001.operative time was long , an average of 4.3 hours , but no recurrences had developed at 2 months to 33 months . leblanc et al went on to incorporate the use of overlapping prosthesis in a comparison of single mesh onlay with double - patch techniques of 2 different types versus 2 identical pieces of eptfe mesh . of 7 onlay repairs , none recurred ; of 5 2-patch repairs , one parastomal hernia recurred . twenty - five percent of patients experienced complications of intraoperative enterotomy , ileus , seroma , obstruction , and death . in 2007 , hansson et al performed a multi - center trial using funnel - shaped eight cases were converted due to dense adhesions or contamination secondary to full - thickness bowel injury . two patients ( one conversion secondary to bowel injury ) required mesh removal secondary to mesh infection or abscess . in our study , we sought to review our experience with ph repair . early in our laparoscopic experience more recent laparoscopic repairs ( subsequent 7 patients ) were based on a modified sugarbaker technique through which 3 essential elements were incorporated : intraperitoneal placement of nonslit mesh , lateralization of the bowel limb between the mesh and abdominal wall , and fixation of transfascial sutures no more than 5 cm apart . the first was a full thickness small bowel injury necessitating conversion to an open procedure . the second was a serosal thermal injury to the colon that was repaired by oversewing the injury laparoscopically , thus avoiding conversion . the 3 lap patients who developed wound infections or parastomal cellulitis recovered with antibiotics and wound care . no patient in our lap group had mesh infection or mesh erosion into the bowel . it can also be argued that bowel lateralization following mesh placement can potentially lead to bowel obstruction . however , in our study , no postoperative bowel obstructions were seen , suggesting that securing the intestine against the abdominal wall does not cause obstruction and that a slit may be unnecessary . overall , our laparoscopic recurrence rate was 33% . early in our experience , we used a keyhole mesh technique , resulting in a 67% recurrence rate . we then changed our approach to utilize a modified sugarbaker technique and have since experienced a recurrence rate of 29% . we believe that this improvement in recurrence rate is due both to increasing experience and a better technique . our experience with the laparoscopic modified sugarbaker technique in the repair of ph continues to increase . this approach provides an alternative strategy to open repair with which to treat the common and difficult problem of ph .

background / objectives : despite multiple options for operative repair of parastomal hernia , results are frequently disappointing . we review our experience with parastomal hernia repair.methods:a retrospective chart review was performed on all patients with parastomal hernia who underwent lap or open repair at our institution between 1999 and 2006 . information collected included demographics , indication for stoma creation , operative time , length of stay , postoperative complications , and recurrence.results:twenty-five patients who underwent laparoscopic or open parastomal hernia repair were identified . laparoscopic repair was attempted on 12 patients and successfully completed on 11 . thirteen patients underwent open repair . operative time was 17210.0 minutes for laparoscopic and 13719.1 minutes for open cases ( p=0.14 ) . lengths of stay were 3.10.4 days ( laparoscopic ) and 5.10.8 days ( open ) , p=0.05 . immediate postoperative complications occurred in 4 laparoscopic patients ( 33.3% ) and 2 open patients ( 15.4% ) , p=0.38 . parastomal hernia recurred in 4 laparoscopic patients ( 33.3% ) and 7 open patients ( 53.8% ) after 13.94.5 months and 21.44.3 months , respectively , p=0.43.conclusion : laparoscopic modified sugarbaker technique in the repair of parastomal hernia affords an alternative to open repair for treating parastomal hernia .

microgastria is a very rare anomaly characterized by a small tubular stomach and is almost always associated with other congenital anomalies.1 to date , less than 100 cases of microgastria have been described in the literature.2 patients invariably encounter severe gastroesophageal reflux disease ( gerd ) due to the small reservoir capacity of the stomach and absence of esophagogastric angle of his . there have been various surgical procedures described as a choice of reconstruction for microgastria , including gastric augmentation with roux - en - y jejunal pouch anastomosed to the stomach , the hunt lawrence pouch.3 however , adequate control of gerd remains a concern in these patients.2 tegd first described as a salvage procedure for failed fundoplications in neurologically impaired children due to the high rate of failures of repeat operations in this group of patients,4 and can offer a superior solution to eliminate gerd . we present a patient with microgastria treated with tegd and esophageal jejunal anastomosis after a failed fundoplication . a male baby , born at term via a normal vaginal delivery presented at 3 weeks of age with dyspnea , poor feeding , and growth below the third percentile for weight for age . he was noted to have a ventriculoseptal defect ( vsd ) on echocardiography with moderate left to right shunting and a respiratory tract infection for which he received treatment . he was also noted to have a left preauricular sinus , a hypoplastic left thumb and radius , and abnormal left sacral hemivertebrae but chromosomal studies were normal . milk scan ( nuclear scintigraphy with technetium labeled formula feed ) and contrast study of the upper gastrointestinal tract demonstrated significant reflux with a suspected sliding hiatal hernia ( fig . 1 ) . there was no improvement of the infant 's general condition with various medical interventions , and at this stage , no suspicion of microgastria had been entertained . contrast swallow image at the age of 2 months demonstrating a distended distal esophagus with a small tubular stomach consistent with microgastria . initially , the findings were thought to show significant reflux with a suspected hiatal hernia . at 3 months , he was taken to operating room for an open antireflux procedure . a long tubular stomach was observed with insufficient fundus for nissen fundoplication and a decision was made to perform a partial anterior fundoplication.5 the spleen was thought to be mal - positioned . no hiatal hernia was observed . postoperatively , he was commenced on feeds but continued to show clinical signs of ongoing gastroesophageal reflux . fiberoptic esophagogastroscopy showed a reasonably snug wrap with the scope passing with ease , a tubular stomach and normal duodenum . in view of the recurrent respiratory tract infections , one of which required intensive care ward admission and ventilation , and ongoing reflux demonstrated on radiographic contrast studies , it was thought that the fundoplication procedure had failed . it was then decided to undertake a tegd at 7 months of age and 4 months after the initial operation . the esophagus was divided at the esophagogastric junction and the stomach fundus oversewn with 5/0 pds ( ethicon , somerville , new jersey , united states ) suture in a single layer . the vagal nerves were not preserved . a 35-cm roux - en - y segment of jejunum was passed posterior to the colon and stomach ( retrocolic - retrogastric ) and anastomosed primarily to the esophagus in an end - to - end fashion with 5/0 pds suture . a heine mikulicz pyloroplasty was also done to achieve adequate gastric emptying ( fig . e , esophagus ; pj , proximal jejunum ; ryj , roux - en - y segment of jejunum ; s , stomach ; tc , transverse colon ; tegd , total esophageal gastric dissociation . he was started on gradually increasing nasojejunal feeds once the contrast meal showed no hold up or reflux and no retrograde entry of contrast into the proximal gastroduodenojejunal arm of the roux - en - y loop . his respiratory symptoms had completely disappeared , and he had achieved a good recovery of all growth parameters with an age - appropriate diet tolerated without vomiting . at 4 years , 10 months of age , the latest follow - up showed his height and weight for age were both around 10th percentile ( 100.5 cm/15.5 kg ) . it has been described in patients as an isolated anomaly or in association with various degrees of limb - reduction ( amelia ) defects ; in association with the vacterl complex ( vertebral anomalies , anorectal malformations , cardiac , trachea esophageal fistula , renal agenesis , limb anomalies ) ; the pierre robin sequence ( micrognathia ) ; and in association with other foregut developmental anomalies such as asplenia , splenic malposition , and intestinal malrotation.1 6 7 8 treatment for microgastria - associated gerd has ranged from conservative expectant nonsurgical management to various forms of antireflux procedures with good long - term results being recorded from the hunt lawrence jejunal pouch to augment the stomach.1 3 6 9 10 11 since the first report of the hunt lawrence pouch for microgastria in 1980,11 several case reports have suggested such favorable outcomes compared with conservative treatments that early hunt lawrence pouch procedure is thought to be the choice of operation.10 however , in these reports , age - appropriate growth catch up was rarely achieved or otherwise nutritional support such as a feeding tube were needed.2 10 in addition , gerd remains a concern in these patients . tegd has been reported as achieving good outcomes not only as a salvage procedure for failed antireflux procedures in children with severe neurological impairment but as a primary antireflux procedure in those populations.4 12 13 14 15 gatti et al showed a marked reduction in reflux symptoms and an improved quality of life with tegd when compared with fundoplication in neurologically impaired patients.16 buratti et al suggested tegd be reserved only for repeated failed antireflux procedures.17 repeat operations , however , may pose a challenge due to multiple adhesions and numerous postoperative complications may be encountered . a primary procedure would thus be less challenging , with an equally good outcome . in their follow - up of 50 patients , lall et al showed a good outcome with a primary tegd despite some complications.15 upon review of the literature , we found at least two very similar cases in which the children with microgastria were treated by tegd.2 15 in these two cases , one child was able to tolerate all food orally and a gastrostomy used for supplementary feeding could be removed,2 and the other one had been able to eat normally without any food alternation or restrictions.15 most of the tegd published cases have included a gastrostomy in the procedure . we believe that microgastria cases without severe neurological impairment should not need a gastrostomy in the antireflux procedures . in fact , these patients have normal swallowing abilities that enable them to feed normally after the successful antireflux procedures . complications that have been associated with tegd include early anastomotic leaks , esophagojejunal anastomosis dehiscence , subphrenic collections , stricture formation , bowel obstruction from adhesions , dumping syndrome , and long - term nutritional and metabolic complications.15 17 in addition , a recent publication described esophagojejunal anastomotic stricture and gastric metaplasia as long - term complications after tegd in the patients with esophageal atresia repair.18 in our patient , we have not encountered any complications related to the surgery . the quality of life of patients post - tegd has been shown to be markedly improved with reduction of reflux symptoms as with our patient.2 6 furthermore , neurologically normal patients who underwent tegd , even with microgastria , were reported to be tolerating full oral feeds without symptoms of dumping.2 15 we present the long - term follow - up of tegd for microgastria . in our experience with this good result , we would suggest that tegd be added to the armamentarium of procedures that can be used in the treatment of microgastria . despite the high complication rates in redo operations reported in the literature , it may be the only effective antireflux surgery for recurrent microgastria - associated gerd . in addition , we suggest it can be explored as a primary treatment at the surgeon 's disposal in the treatment of microgastria - associated gerd . this report highlights microgastria - related reflux and a failed fundoplication who was treated with total esophageal gastric dissociation ( tegd ) resulting in an excellent outcome . we believe this is the first report revealing the long - term outcome of tegd being used in the treatment of microgastria .

microgastria is a very rare anomaly characterized by a very small tubular stomach that presents with severe gastroesophageal reflux disease due to the small reservoir capacity of the stomach . we present a patient with microgastria - related reflux and a failed fundoplication who was treated with total esophageal gastric dissociation ( tegd ) resulting in an excellent outcome . in our experience with this good long - term result , we would suggest that tegd be added to the armamentarium of procedures that can be used in the treatment of microgastria .

renal micropuncture studies have greatly changed our views on the pathophysiology of acute renal failure caused by nephrotoxins . formerly , this type of renal insufficiency was attributed to a direct effect of the nephrotoxins on tubule epithelial permeability . according to that theory , glomerular filtration was not greatly diminished , the filtrate formed being absorbed almost quantitatively and nonselectively across damaged tubule epithelium . studies in a wide variety of rat models have now shown glomerular filtration to be reduced to a level which will inevitably cause renal failure in and of itself . passive backflow of filtrate across tubular epithelium is either of minor degree or nonexistent even in models where frank tubular necrosis has occurred . this failure of filtration can not be attributed to tubular obstruction since proximal tubule pressure is distinctly subnormal in most models studied . instead , filtration failure appears best attributed to intrarenal hemodynamic alterations . while certain facts tend to incriminate the renin - angiotensin system as the cause of the hemodynamic aberrations , others argue to the contrary . the issue is underactive investigation.imagesfigure 7 .

congenital epulis ( also known as congenital gingival granular cell tumour ) is a rare benign congenital growth of the newborn . it was first described in 1871 by neumann , hence the alternative name is newmanns ' tumour . it usually presents at birth with an obvious mass arising from the gingival mucosa of the maxilla or mandible . the size of the mass varies from a few millimetres to 9 cm in diameter . the recommended treatment is surgical excision under local or general anaesthetic , although spontaneous regression has been reported . there are no reports of recurrence , even if incomplete margins are excised , malignant change , or future disruption to teeth or gums . an otherwise healthy 1-day - old girl was referred to a large teaching hospital in cardiff for diagnosis and treatment of two large masses protruding from her mouth . the baby had normal antenatal scans at weeks 12 and 20 , and pregnancy had been unremarkable , other than mother being group b streptococcus positive from a high vaginal swab . mother was fit and well gravida 2 para 1 , with no drug history or family history of note . baby was born at term plus eight days weighing 3.85 kg , pink and breathing spontaneously ( apgar : 9 - 10 ) . on examination there were two fleshy , pedunculated masses arising from the upper and lower alveolar ridges measuring 4 3 3 cm just to the right of the midline . she was booked for excision of these masses under general anaesthesia ( figure 1 ) . both masses were removed with an eliptical insion to the peduncles ( figure 2 ) . the child was breastfeeding the day after surgery , and discharged home the following day . the two masses were fixed and examined histologically ( figures 3 and 4 ) . they showed sheets and clusters of cells containing abundant granular eosinophlic cytoplasm and small uninform nuclei , along with some myxoid areas and areas of haemorrhage and ulceration , confirming the diagnosis of congenital epulis . it commonly presents in the neonate , although prenatal diagnosis with ultrasound has been reported as early as 26 weeks gestation . the lesion usually arises over the incisor - canine region of the maxilla ( maxillary / mandibular ratio 3:1 ) . simultaneous involvement of both maxillary and mandibular alveolar ridges occurs in approximately 10% of reported cases . the diagnosis is usually made on clinical grounds alone , although difficulties may arise when the size of the lesion is small , or the index of suspicion is low . mri is useful for diagnosis , and superior to ultrasound , showing the gingival origin of congenital epulis without local extension . epulis is a greek term literally meaning of the gums and is used to describe a wide variety of gum lesions , regardless of their pathological origin . histologically , congenial epulis shows remarkable similarity with the more common granular cell tumours ( gcts ) [ 2 , 11 ] . there are , however , many distinguishing features , such as occurrence solely in the neonate , typical location , plexiform arrangement of capillaries , and lack of pseudoepitheliomatous hyperplasia . gcts are ubiquitous neoplasms occurring in all age groups , very rarely affecting the gingiva , and can occasionally show malignant change . immunohistochemical studies have revealed further differences , demonstrating the reactivity of gcts to s-100 protein and laminin , and their absence in congenital epulis . vered et al . have also recently expanded the immunophenotypic distinction between the two , showing gcts stain positive for ngfr / p75 and inhibin- , whereas congenital epulis does not . cgts are considered to arise from schwann cells , and hence show strong reactivity to s-100 protein . various theories of the origin of congenital epulis include myoblastic , neurogenic , odontogenic , fibroblastic , and histocytic . it has been suggested that the occurrence of congenital epulis solely in neonates , and more commonly in females , implies a hormonal mechanism of development . however , numerous reports have shown no evidence of either oestrogen or progesterone receptors , and as such suggest an alternative histogenesis [ 11 , 14 ] . in a review of 33 lesions , conclude that the immunohistochemical profile does not imply any specific cell types for the histogenetic origin of congenital epulis . no estimation of incidence of congenital epulis has been made to date , to the best of our knowledge . one centre in the usa saw only two cases over the period of 21 years . in university hospital of wales , a tertiary referral centre for otolaryngology and neonatology , this is the only recorded case of congenital epulis since 1980 , a total of 28 years . using incidence of live births ( 157,454 ) within that time period , we calculate an incidence of 0.0006% ( upper 95% confidence interval : 0.0035% , the inverse of the cumulative beta distribution ) . although most likely an underestimate , this calculation will serve as an approximation of incidence before a more thorough estimation can be undertaken .

congenital epulis , also known as neumann 's tumour , is a rare congenital growth affecting the gingival mucosa of neonates . it is benign condition , seen more frequently in females , with multiple epuli occurring in only 10% of cases . the cause and origin of congenital epulis remains unclear . in this article we present a case report of an otherwise healthy female neonate with two congenital epuli arising from the upper and lower gingival margin , which were successfully treated with surgical excision . we also present a review of the literature and an estimation of the incidence of congenital epulis based on our institutions figures , of 0.0006% ( upper 95% confidence interval : 0.0035% ) .

congenital anomalies of the kidney and urinary tract are relatively common , accounting for approximately 20%-30% of all anomalies identified in the prenatal period ( 1 ) . among the congenital anomalies of the kidney and urinary tract , reflux nephropathy , obstructive uropathy , and renal agenesis / hypoplasia / dysplasia are responsible for 30%-50% of end - stage renal disease in children ( 2 ) . renal hypoplasia is defined as congenitally small kidneys with a reduced number of nephrons but normal architecture , and can be clinically diagnosed based on renal ultrasonography findings as a small - sized kidney of 2 standard deviations below the expected mean of an age - matched normal individual ( 3 ) . in addition , mild renal hypoplasia at the lower expected normal range is associated with hypertension and chronic kidney disease ( ckd ) in adults ( 3 ) . therefore , it is important to clinically diagnose renal hypoplasia in children . to diagnose renal hypoplasia in children , the size of the kidneys should be measured . while renal volume is the most accurate parameter of kidney size , kidney length is the most useful parameter for clinical measurement of kidney size because it is simple to obtain and is minimally affected by interobserver variability ( 45 ) . kidney length is also useful to distinguish patients with acute kidney injury from those with ckd ( 6 ) . it is known that the renal length and calculated volume are influenced by the overall body size of the individual , including the age , height , weight , and body surface area ( bsa ) ( 789 ) . since 1980 , several researchers have reported the renal length in normal children ; however , korean reference data from national studies are lacking . therefore , we conducted the present study to determine the renal size in children by ultrasound . here , we present our results along with a review of the available literature on kidney size measurements . this prospective observational study involved 437 healthy children aged less than 13 years who were born at full - term and were examined in the national health screening program for infants and children in korea , who visited for vaccination or were discharged after admission for unrelated health problems between july 2012 and may 2014 . subjects whose weight - for - age and height - for - age were in the 5th to 95th percentiles based on the 2007 korean national growth charts ( 10 ) , without any clinical history of precocious puberty ; urinary tract infection ; chronic illness , including neurologic , oncologic , immunologic , gastroenterologic , or nephrologic conditions ; and abnormal kidney ultrasonography findings ( e.g. , single kidney , dysplastic kidney , renal cyst , hydronephrosis , ureter duplication ) were included . all 437 patients were scanned using an iu22 ultrasound machine ( philips , bothell , wa , usa ) with 4 - 9 mhz convex transducers . the largest longitudinal dimension of both kidneys was measured in the longitudinal view , passing through the renal hilum , with the subjects in the prone or supine oblique position ( fig . maximum longitudinal length of the left kidney passing through the renal hilum ( yellow arrow ) . the relationships of renal length with age , sex , body weight , height , bsa , and body mass index ( bmi ) were analyzed , and renal growth curves according to age , height , weight and bsa were obtained . linear regression analysis was used to assess the correlations of renal length with age , sex , body weight , height , bsa , and bmi . right - left asymmetry in renal length was assessed using the paired t - test . the study protocol was approved by the institutional review board in jeju national university hospital ( irb file no . the study protocol was approved by the institutional review board in jeju national university hospital ( irb file no . 2012 - 05 - 007 - 004 ) . written informed consent was obtained from all subjects . there were 247 ( 56.5% ) and 190 ( 43.5% ) males and females , respectively . there were 228 ( 52.2% ) and 209 ( 47.8% ) subjects aged less and more than 2 years , respectively . the left kidney was significantly longer than the right ( p < 0.001 ) ; the mean values of the right and left kidneys were 6.8 1.5 cm and 7.0 1.5 cm , respectively . however , there were good correlations between kidney length and other somatic values , including age , weight , height , and bsa ( fig . 2 ; linear regression analysis , p < 0.01 for all ) . on the other hand , the correlation between bmi and kidney length was not significant , with low r correlation coefficients of 0.093 and 0.097 for the right and left kidney , respectively . renal growth curve according to the child s age , height , weight , and body surface area . the renal length curve for age showed different patterns before and after 20 months of age ( fig . 2 ) . in other words , the kidney was growing rapidly during the first 24 months , while the growth rate slowed down thereafter . the following linear regression equation was obtained : right kidney length ( cm ) = 0.051 height ( cm ) + 2.102 ; left kidney length ( cm ) = 0.051 height ( cm ) + 2.280 . renal sonography can provide important information regarding for example renal anomalies and indirect renal function . for this reason , accurate reference values of renal length measured by sonography are important in children . a major strength of the present study is the analysis of a pediatric healthy cohort ; therefore , the measurement values can be considered representative . moreover , the most valuable point of the present study is that almost 50% of the enrolled children were aged less than 24 months ; hence , more accurate reference values could be obtained for these subjects . many studies have shown that height is the strongest factor related with kidney length ( 7111213 ) . furthermore , according to the current study , the renal growth curve might be biphasic , with 20 months as its starting point , indicating that height should be considered an important factor correlating with kidney length ( fig . 2 ) . in fact , a previous study concluded that the reason for this important relationship is that the rapid growth in height during the first 2 years of life is intimately associated with a similar increase in kidney length ( 7 ) . our renal growth curve showed a biphasic pattern for the relationship with age , and a linear pattern for the relationship with height . therefore , our linear regression equation for bilateral renal length according to height is simpler than similar equations from prior studies ( 111314 ) . of note , therefore , there was no null hypothesis about pre - specified estimated 95% confidence intervals and total width ( precision ) for determining the appropriate sample size . the tolerance probability is 0.900 that a sample size of 437 from approximately 85,000 children aged less than 13 years on jeju island , according to the 2010 census , will produce a two - sided 95% confidence interval with a distance from the mean to the limits that is 0.060 if the population standard deviation is 0.600 . in terms of renal growth according to age , it is known that the renal volume changes around 1 year of age ( 9 ) , with a rapid but gradually decreasing growth rate observed in the initial 7 months after birth , followed by a constant and slower rate ( 15 ) . in infants under 12 months , kidney length has been reported to be poorly estimated with an age - based simple formula ( 16 ) . in other studies , the renal length has been shown to increase rapidly until 24 months , while the growth rate is reduced thereafter ( 1317 ) , whereas our data showed a statistically significant difference before and after 20 months of age . the reference values for the renal lengths according to age are presented in tables 1 and 2 . compared with in a previous study ( 13 ) , our data provide more accurate values in subjects aged less than 24 months , owing to the fact that these subjects were subdivided according to the age distribution . according to our study , the average renal lengths tended to be slightly larger than the previously reported values ( 13 ) , by as much as 1 - 2 mm in subjects aged less than 24 months . especially , these differences tended to be greater in subjects aged more than 4 - 5 years . it can be speculated that renal growth is affected by the proportion of their current height , which was taller in the present study ( 18 ) . of note , although our findings differed from those obtained in an indian study in 2012 , they showed no differences compared to the american reference values in 2011 ( 1619 ) . we believe that this lack of difference is due to the fact that the height growth of korean children has recently been reported to be similar to that of western children ( 1618 ) . the other values of age and weight also showed good correlations with kidney length in children from 2 to 12 years of age in the present study . the left kidney was significantly longer than the right , as has been previously reported ( 111314 ) . on the other hand , there were no significant sex - specific differences . in conclusion we believe that these data may help facilitate the diagnosis of renal hypoplasia or pediatric ckd and help estimate the appropriate donor kidney length in children by our simple linear regression equation in which only the height of the donor needs to be applied .

kidney length is the most useful parameter for clinical measurement of kidney size , and is useful to distinguish acute kidney injury from chronic kidney disease . in this prospective observational study of 437 normal children aged between 0 and < 13 years , kidney length was measured using sonography . there were good correlations between kidney length and somatic values , including age , weight , height , and body surface area . the rapid growth of height during the first 2 years of life was intimately associated with a similar increase in kidney length , suggesting that height should be considered an important factor correlating with kidney length . based on our findings , the following regression equation for the reference values of bilateral kidney length for korean children was obtained : kidney length of the right kidney ( cm ) = 0.051 height ( cm ) + 2.102 ; kidney length of the left kidney ( cm ) = 0.051 height ( cm ) + 2.280 . this equation may aid in the diagnosis of various kidney disorders .

lateral bending of the thoracic spine does not involve pure lateral bending but accompanies rotation1 . motions accompanying unintended movements or motions in unintended directions , are named coupled motions1 , 2 , and when they have certain patterns , these are called coupled motion patterns . manual therapists evaluate and treat their patients thoracic pathologies based on their coupled motions1 , 3 , 4 ; therefore , accurate knowledge of their patients coupled motions is very important . however , researchers have often presented conflicting research outcomes on the directions of coupled motions , which are the theoretical background for manual treatment of the thoracic spine . according to the theory of coupled motion proposed by different clinicians , panjabi et al.3 noted that during lateral bending of the thoracic spine in the neutral position , the coupled axial rotation occurrs in the opposite direction ( e.g. left lateral bending with right rotation ) . kaltenborn5 and stoddard4 observed that in a extended position , coupled motion occurs in the opposite direction during lateral bending , while in a flexed position , coupled rotation occurrs in the same direction during lateral bending . in the area of osteopathy , when rotation occurs in the opposite direction during lateral flexion , it is named type 1 , and when rotation occurs in the same direction during lateral flexion , it is named type 2 . gibbons et al.1 and kaltenborn5 applied joint mobilization and manipulation based on the coupled motion theory . however , if the coupled motion theory is not accurate , evaluation and treatment based on it would not be accurate either , and treatment effects would not be guaranteed . in recent research , oxland et al.3 observed that coupled axial rotation did not occur at all in the t11t12 and t12l1 during lateral bending . willems and jull6 reported variations in accordance with the regions of the thoracic spine in subjects in a neutral position . also , during lateral bending , the rates of coupled axial rotation in the same direction were 47% in the t1t4 , and 83% in the t4t8 , and 68% in the t8t12 . their conclusion was that lateral bending of the thoracic spine in the same direction was more prominent than in the opposite direction in a flexed position , while lateral bending of the thoracic spine in the opposite direction was more prominent , both in the neutral and extended positions7 . in previous research , coupled motions of the thoracic spine have been measured by 2-dimensional ( 2d ) radiation imaging , often using cadavers3 , 8 , 9 . 2d techniques have been criticized for incorrect readings , magnification errors , or misinterpretation of projected bone movements as rotations . it has been reported that experiments on cadavers with their muscles removed have merits , in that researchers can precisely measure thoracic coupled motions , but they can not accurately reflect muscular activities of each position , or the exact load effects . from the above , we can infer that the reports of lateral bending of the thoracic spine have been inconsistent among researchers , and have been subject to a lot of controversies , due to lack of validation7 . panjabi et al.8 noted , movement of the spine is made in three dimensions and in order to measure coupled motions of the spine intervertebral motions should be measured in three dimension to effectively show actual spinal movements . this study was conducted in order to provide biomechanical data on coupled motions ( t14 , t48 , t812 ) using 3-dimensional ( 3d ) motion capture analysis during lateral bending of the thoracic spine by 20 healthy korean male college students , in the neutral , flexed and extended postures . most theories of coupled motion are based on western studies . while some recent studies have reported that coupled motions do not exhibit a specific pattern , there are few studies of the coupled motions of koreans . therefore , the purpose of this study was to provide the biomechanical information necessary for performing orthopedic manipulative therapy for koreans , by examining the coupled motions of the backbones of korean college student in their 20s . the study subjects were recruited open application from students at k university located in geonbuk province . thirty subjects applied , and those who had a history of pain or damage to the thoracic vertebrae area within the previous one year , who had restrictions in their daily life due to spinal problems , had a respiratory problem for a long time , or had received a surgery of the spinal area were excluded , 20 subjects ( men ) were finally selected . the purpose and content of this study was explained to the subjects and their consent to participation in this experiment was obtained . 3d research on coupled motions is accepted as being more accurate than 2d research at capturing thoracic spinal movement patterns3 . this study used a 3d motion capture system ( lukotronic , lutz - kovacs - electronics , austria ) in order to analyze coupled motions of the thoracic spine . this system consists of three infrared cameras and dynamic infrared reflective skin markers . at a distance of 2.8 meters from the rear of the subject , the 3d motion analysis system was installed in order to photograph thoracic coupled motions . the system s optical axis was installed at a height of around 1.1 meters and maintained as horizontal as possible , parallel to the ground . a computer ( averatec 7100 , trigem computer , korea ) and a motion analysis program ( as202 , lutz - kovacs - electronics , austria ) were used to analyze coupled motions during lateral bending of the thoracic spine . the width , length , and height of the chair , specially designed for this study , were , respectively , 50 cm , 77 cm , and 46 cm , and the height of the lumbar support was 24 cm . the chair was designed to move forward and backward to adjust to each subject s femoral length . for the reflective marker attachment they initially had their skin surface sterilized with alcohol , so that the reflective markers could be attached well . first , two reflective markers were attached to the upper back of the lumbar support ( each marker evenly spaced at 2 cm to the right and left of the support s vertical midline ) to provide a reference value for coupled motions occurring during lateral bending . to minimize the displacement of the subject s reflective markers , that might have resulted from skin movement , three markers per vertebrae , were attached to the spinous processes and to the right and left transverse processes of t1 , t4 , t8 , and t12 while subjects were in a 30 flexed position . the spinous process of t1 was found at one level below c7 ; that of t4 was detected by palpating three spinous processes below t1 ; that of t8 was detected by palpating four spinous processes below t4 . the fourth point , t12 , was found by palpating four spinous processes below t8 and its location was confirmed by counting upward from the central point ( the second sacrum ) of the line connecting the posterior superior iliac spine . the t1 transverse process were detected by palpating the points 1.5 cm lateral to either side of the c7 spinous process , the t4 transverse processes at 2 cm symmetrically lateral to the t3 spinous process , the t8 transverse processes at 2 cm symmetrically lateral to and also vertically between the t6 and t7 spinous processes , and the t12 spinous processes at 2 cm symmetrically lateral to the t11 spinous process . a skillful physical therapist who had completed orthopedic manual therapy of kaltenborn - evjenth concept , and spinal management courses , performed the palpation and attached all of the reflective markers . therefore , the reflective markers attached to the transverse processes well reflected lateral flexion and coupled rotation of the thoracic vertebrae during the dynamic movements this study examined . a 3d motion analysis system was used to analyze the coupled motions of the thoracic spine . regarding the three - dimensional coordinate system , the y - axis was defined as vertical to the horizontal plane , the x - axis as the anteroposterior direction , and the z - axis as the mediolateral direction . the lateral flexion angle of t1t4 was calculated as the angle between the line which horizontally connected the reflective marker attached to the lumbar supporter from the coronal plane ( y , z ) and the line which connected the t1-t4 spinous process ( sp ) . the lateral flexion angle of t4t8 was calculated as the angle between the line that horizontally connected the reflective marker attached to the lumbar supporter and the line that connected the t4t8 sp . the lateral flexion angle of t8t12 was calculated as the angle between the line that horizontally connected the reflective marker attached to the lumbar supporter and the line that connected the t8t12 sp . as for the coupled rotation angles of t1t4 , t4t8 , and t8t12 , the rotation angle of the line that connected the bilateral transverse processes of t1 , t4 , t8 , and t12 with the vertical axis as the center was derived . then the angle between the lines that horizontally connected the reflective marker attached to the lumbar supporter was calculated . the t1t4 coupled rotation angle was obtained by subtracting the t4 rotation angle from the t1 rotation angle ; the t4t8 coupled angle was obtained by subtracting the t8 rotation angle from the t4 rotation angle ; and the t8t12 coupled angle was obtained by subtracting the t12 rotation angle from the t8 rotation angle . when the rotation angle was positive , it was defined as ipsilateral rotation , and when the rotation angle was negative , it was defined as contralateral rotation . for analysis of coupled motions of the thoracic spine , we referred to the experimental method of willems and jull . a neutral posture was defined as a comfortable straight sitting position with the pelvis and waist fixed on the support , a flexed posture as a position with the thoracic spine flexed to the maximum level ( pelvis and waist fixed ) , and an extended posture as a position with the thoracic spine extended to the maximum level ( pelvis and waist fixed ) . sitting straight on the wooden chair with the lumbar support , the subject had the knee joints flexed at 90 , with both feet placed close together and maintained flat on the floor . the right arm was comfortably placed on the left shoulder and the left arm on the right shoulder . in order to observe motions that occur purely due to the thoracic spine , excluding lumbar spinal and pelvic movements during flexion and extension , each of the regions was fixed to the chair using the lumbar support , a pelvic belt , and a femoral belt . a location board was placed at a distance of 60 cm in front of the subject , so that the subject s trunk could be returned to the same location when returning to the starting position after lateral bending . the subject returned to the starting position each time , after lateral bending was performed to the maximum level in the neutral , flexed and extended postures ( fig . each lateral bending period was 1 minute so as to minimize subjects trunk muscle fatigue . the means and standard deviations of all measured variables were calculated using spss 15.0 . a one - way anova was performed to examine differences between each of the three positions and the bonferroni correction was conducted as a post - hoc test . lateral bending angles of the thoracic spine ( t1t4 ) were larger in the neutral posture than in the flexed and extended postures of the thoracic spine , but they were not significantly different statistically ( neutral : 30.75.9 , flexed : 28.811.7 , and extended : 28.44.8 ) . also , lateral bending angles of the thoracic spine ( t4t8 ) were larger in the neutral posture than in the flexed and extended postures , but they were not significantly different ( neutral : 24.65.4 , flexed : 20.710.9 , and extended : 22.15.0 ) . likewise , lateral bending angles of the thoracic spine ( t8t12 ) were larger in the neutral posture than in flexed and extended postures , but they were not significantly different ( neutral : 17.46.4 , flexed : 12.96.5 , and extended : 13.86.2 ) ( table 1table 1 . subjects lateral bending and coupled rotation ( n=20)posturet14t48t812lbcrlbcrlbcrneutral30.7 ( 5.9)1.6 ( 1.5)24.6 ( 5.4)3.0 ( 2.4)17.4 ( 6.4)2.7 ( 2.8)flexion28.8 ( 11.7)2.8 ( 2.3)20.7 ( 10.9)2.0 ( 2.4)12.9 ( 6.5)4.4 ( 2.4)extension28.4 ( 4.8)1.9 ( 1.1)22.1 ( 5.0)0.7 ( 2.8)13.8 ( 6.2)1.0 ( 2.0)lb : lateral bending ; cr : coupled rotation ; value are mean ( sd ) . : : significant difference between flexion and extension position , p<0.05 + : indicates the same direction as lateral bending for coupled rotation and flexion . : indicates the opposite direction to lateral bending for coupled rotation and extension ) . lb : lateral bending ; cr : coupled rotation ; value are mean ( sd ) . : : significant difference between flexion and extension position , p<0.05 + : indicates the same direction as lateral bending for coupled rotation and flexion . : indicates the opposite direction to lateral bending for coupled rotation and extension lateral bending of the thoracic spine ( t1t4 ) was accompanied by coupled axial rotation in the same direction in the neutral , flexed , and extended postures . coupled axial rotation was larger in the neutral and extended postures than in the flexed posture , but the differences were not statistically significant ( neutral : 1.61.5 , flexion : 2.82.3 , and extension : 1.91.1 ) . the directions of coupled axial rotation of the thoracic spine ( t4t8 ) were similar to those of the thoracic spine ( t1t4 ) ; lateral bending of the thoracic spine ( t4t8 ) accompanied coupled axial rotation in the same direction in the neutral , flexed , and extended postures . coupled axial rotation was larger in the neutral posture than in the flexed and extended postures , but the differences were not statistically significant ( neutral : 3.02.0 , flexion : 2.02.4 , and extension : 0.72.8 ) . meanwhile , lateral bending of the thoracic spine ( t8t12 ) accompanied coupled axial rotation in the same direction as that of the neutral and flexed postures and in the opposite direction in the extended posture . coupled axial rotation was larger in the neutral and flexed postures than in the extended posture , but the differences were not statistically significant ( neutral : 2.72.8 , flexed : 4.42.4 , and extended : 1.02.0 ) ( p<0.05 ) ( table 1 ) . bending and axial rotation accompany each other and such motions are called coupled motions2 . according to a study of cadavers , coupled motions are most prominent between lateral bending and rotation , and between rotation and lateral bending5 . for easy understanding of coupled motions , flexion - extension , axial rotation , and lateral bending motions should be explained through simple angles or numbers , or illustrated by a three - dimensional animation using a 3d motion capture system10 . this study was able to measure the angles and directions of coupled motions during lateral bending using a 3d motion capture system . in the thoracic however , in the orthopedic manual therapy , when mobility of the thoracic vertebrae is evaluated or its treatment is made , the subject is laid in a side lying position and lateral flexion is made to the right and left directions to examine the coupled motion . therefore , this study also conducted lateral flexion first and observed the coupled motion accompanying it . panjabi et al.9 noted that in the neutral posture lateral bending of the thoracic spine ( t1t4 ) , ( t4t8 ) , and ( t8t12 ) accompanied coupled axial rotation in the same direction , in the opposite direction , and in the same or opposite direction , respectively . scholten and veldhuizen11 noted that the displacement of each thoracic region was due to the vertebral bodies being in the sagittal plane . also , if the thoracic region had an anterior tilt , coupled axial rotation occurred in the same direction , but if they had a posterior tilt , coupled axial rotation occurred in the opposite direction , suggesting that controversies in the literature arise from diverse definition of the sagittal plane . kaltenborn6 noted that in c2t3 of the cervical and thoracic spines coupled axial rotation was in the same direction regardless of whether the subject was in a flexed or extended posture , while in the t4l5 , the directions of coupled axial rotation differed according to postures , with coupled axial rotation occurring in the same direction in a flexed posture and in the opposite direction in an extended posture . greenman12 observed that coupled rotation occurred in the opposite direction during lateral flexion in the thoracic vertebrae with kyphosis in the middle area , and when rotation was made first , lateral flexion occurred in the same direction . however , willems and jull6 reported that 47% of the motion in t1t4 , 83% in t4t8 , and 68% in t8t12 involved coupled axial rotation occurring in the same direction as lateral bending , showing that coupled axial rotation in the same direction as lateral bending occurred most prominently in the t4t8 in neutral position . in the present study , especially , in the t1t4 and t4t8 , lateral bending accompanied coupled axial rotation in the same direction regardless of position ( neutral , flexed , and extended positions ) the while in t8t12 , lateral bending accompanied coupled axial rotation in the same direction with the subject in the neutral and flexed postures , and in the opposite direction with the subject in an extended posture . overall , coupled axial rotation occurring in the same direction was more prominent than that in the opposite direction . the results of this study are consistent with those of willems and jull6 , in that coupled axial rotation in the same direction was more prominent than that in the opposite direction in t4t8 and t8t12 during lateral bending , and the rates of coupled axial rotation that occurred in t1t4 in the same direction and in the opposite direction were similar . coupled motions during lateral bending of the thoracic spine may be explained by the structural form and movement of the posterior articular surface8 . during lateral bending , one side of the articular surface moves upward and forward , while the other side moves downward and backward . lateral bending , a combination of upward movement in one direction and downward movement on the other side of the spine , automatically creates forward movement in one direction and backward movement in the other direction , resulting in coupled axial rotation occurring in the same direction . therefore , left axial rotation is coupled with left lateral bending . penning and wilmink9 proposed that the rib head plays the same role as that of the uncinate processes of the cervical spine , which regulate coupled axial rotation occurring in the same direction during lateral bending . in the present study , coupled axial rotation occurred in the same direction more often than in the opposite direction during lateral bending as by penning and wilmink9 . in the present study , this is because the present study attached reflective marks to the subjects skin and measured coupled motions during active lateral flexion . however , the cadaver study performed tests during passive lateral flexion created by the researcher . in particular , in the present study , the involvement of the subject trunk muscles in the processes of lateral flexion may have had , at least , a minor level of impact on the coupled motions of the subjects . the present experiment did not investigate how muscular activities of the body influenced coupled motions . nonetheless , it is meaningful in that research on active coupled motions was performed with the subjects costal bones , muscles , and other soft tissues intact and under apparently normal neurological conditions . according to our present results , coupled motion did not always have a certain pattern , and lateral flexion and coupled motion were ipsilaterally predominant . it can be inferred that the subjects subtle anatomical differences and soft tissue tension and asymmetry of motor control exerted effects . this study is meaningful in that it employed a 3-dimensional motion analysis system to observe coupled motion of the thoracic vertebrae . however , whether anatomical structure and motor control affected coupled motion was not investigated . therefore , relevant additional research is considered necessary . in addition , the subjects were limited to healthy male college students in their 20s , and therefore additional research with females , subjects of different ages , and those with pathological problems is necessary . finally , each subject has a different direction of coupled motion and clinicians need to be cautious when applying orthopedic manual therapy based on coupled patterns , and we consider a new approach of customized orthopedic manual therapy suitable for subjects is necessary .

[ purpose ] the purpose of this study was to investigate thoracic coupled motions of 20 korean young individuals . [ methods ] thoracic motion of twenty healthy male college students aged 23.23.1 was examined . the coupled motions of the thoracic regions t14 , t48 , t812 were measured using a three dimensional motion capture system . [ results ] coupled axial rotation in the same direction as lateral bending was observed in t1t4 and t4t8 in the neutral , flexed , and extended postures of the thoracic spine . in t8t12 , coupled axial rotation in the same direction as lateral bending were observed in the neutral and flexed postures , while coupled axial rotation in the opposite direction was observed in an extended posture . [ conclusion ] the patterns of coupled motions in the thoracic spine demonstrated some variability between postures and regions in vivo . however , coupled motions in the same direction were predominantly lateral flexion or axial rotation in the three postures .

a 28-year - old lady presented to us with history of decreased vision in her right eye of one month duration . one month prior to her presentation to our clinic , the patient had visited two different ophthalmologists , who diagnosed her as having papilledema . her vision in the right eye was 20/200 ( refractive error of 1.00 spherical 1.50 cylinder axis 180 ) and the left eye vision was 20/40 ( 1.25 spherical 2.00 cylinder axis 165 ) at the time of presentation . dilated pupillary examination in the right eye showed optic disc edema , more obvious in the inferior half of the disc with faint splinter hemorrhage in the parapapilary area . further refined examination of the right optic disc same disc showed a circumscribed pale yellow lesion buried in the disc suggestive of disc drusen [ fig . the optic disc in the left eye showed an irregular disc margin with minimal elevation and disc vessels showed anomalous branching pattern [ fig . visual fields in the right eye showed superior altitudinal defect [ fig . 2 ] and left eye was normal . ultrasound b scan confirmed the presence of onhd in both eyes [ fig . 3 ] . a diagnosis of onhd in both eyes , with anterior ischemic optic neuropathy in the right eye was made . our patient was seen again after 6 weeks and right eye disc showed pallor suggestive of optic atrophy [ fig . 4 ] and spectral domain optical coherence tomography also confirmed the presence of onhd with retinal nerve fiber layer ( rnfl ) loss [ fig . 5 ] . ( a ) right eye disc showing edema and blurring of disc margins , attenuation of peripapillary arterioles and evidence of drusen ( black arrow ) in the superior pole of the disc margins ( b ) left eye disc showing anomalous branching pattern of the vessels and faintly visible drusen at the superior pole superior altitudinal defect corresponding to the severe disc edema in the inferior pole of the right disc ultrasound b scan showing drusen after 6 weeks , right eye disc showing optic atrophy and attenuation of the arterioles spectral domain oct showing the internal dome shaped contour of the drusen ( white arrow ) and abrupt end of the pigment epithelium and photoreceptor layer onhd pose a diagnostic dilemma especially in young patients who concomitantly have headache as a presenting complaint . our patient had earlier consulted two different ophthalmologists who had made diagnosis of papilledema in both eyes , with resulting optic atrophy in the right eye . the patient was further referred to a neurologist where both magnetic resonance imaging ( mri ) and mri venogram were normal . optic nerve head drusen mimic papilledema especially in young patients . clinical symptoms and disc examination offer clues that can help differentiate the two entities . tortuosity of optic disc venules , fiery looking disc vessels associated with congestion and hemorrhagic capillaries will favor a diagnosis of papilledema . in onhd , the disc vessels are usually normal in caliber and disc elevation is not associated with congestion and hyperemia of the disc . long - standing papilledema can also lead to optic atrophy , which can be confusing at times . our patient had visual loss only in her right eye ; the optic disc showed features suggestive of anterior ischemic optic neuropathy . visual field testing showed altitudinal defect in the right eye and was normal in the left eye . young patients with onhd may develop ischemic optic neuropathy in a way similar to the elderly age group patients because of the crowding and compressive effect on the axons by the drusen . disc swelling in our patient 's right eye resolved without any treatment after 3 months , but the visual field defect persisted with supporting rnfl thinning on optical coherence tomography ( oct ) . a high index of suspicion is needed when young patients present with disc edema and loss of vision . spectral domain optical coherence tomography ( sdoct ) is helpful in imaging onhd because of its better axial resolution and it quantifies the rnfl loss with greater reproducibility . oct features observed in onhd are subretinal hyporeflective space within 0.7 mm radius of the disc and smooth dome shaped lesions in the disc with a lumpy internal contour and a hyporeflective space between the retinal pigmented epithelium and photoreceptor layers that has an abrupt end . computed tomography ( ct ) of the orbits can also help in establishing the diagnosis [ fig . this case highlights the fact that establishing the diagnosis of disc drusen sooner in this patient could have avoided the unnecessary neurological workup .

optic nerve head drusen ( onhd ) are incidental ophthalmologic finding in the optic nerve . patients with onhd are often asymptomatic , but sometimes present with transient visual obscuration 's ( tvo ) , the reported incidence of which is 8.6% . optic nerve head drusen are of two types : superficial ; visible and deep . the deep - buried drusen mimic papilledema . because of the varied presentation deep - buried drusen pose a diagnostic challenge to the ophthalmologists . in young patients , they are mistaken for papilledema as it is clinically difficult to detect a buried drusen in the optic nerve head , but are seen on the surface with aging as the retinal nerve fiber layer thins out . they are observed as pale yellow lesions more often located towards the poles . clinical examination aided with diagnostic tests like computed tomography ( ct ) orbits and ultrasound b scan can help establish the diagnosis . herein , we report a rare case of optic nerve head drusen in a young lady , who presented with loss of vision and clinical evaluation and investigations suggested onhd with anterior ischemic optic neuropathy .

atherosclerotic vascular disease starts to develop early in life and continues to progress for decades as a silent process . this condition , so - called subclinical atherosclerosis , is highly prevalent in the general adult population . during this period , nonobstructive atherosclerotic plaques may not cause ischemia , but promote functional changes in vascular tone , related to vasoactive mediators release and impaired production of nitric oxide by a dysfunctional endothelium . computed tomographic coronary artery calcium score ( cacs ) is a surrogate for coronary atherosclerosis burden and independently predicts future cardiovascular ( cv ) risk . abnormal diastolic filling of the left ventricle ( lv ) , as evaluated by transthoracic echocardiography ( tte ) , is associated with worse prognosis . diastolic function ( dd ) is the first cardiac function to be impaired in ischemic heart disease . it is possible that the pathophysiological process of subclinical atherosclerosis , usually not sufficient to reduce systolic function , is able to alter the dd of the lv . the relationship between subclinical stages of atherosclerosis and dd has not well been established in subjects without prior coronary artery disease ( cad ) . there is limited and contradicting evidence suggesting that atherosclerotic burden may or may not have an inverse relationship with measurements of diastolic dysfunction . thus , the objective of this analysis is to investigate the relationship between cad and cacs on coronary computed tomography angiography ( ccta ) and measures of left ventricular diastolic dysfunction ( dd ) on echocardiography . this is retrospective crosssectional study , conduct in a tertiary care center between 2012 - 2013 , which included consecutive patients who underwent a clinically indicated ccta and tte within 1-month apart . patients with prior history of cad ( prior myocardial infarction , prior percutaneous stenting or coronary artery bypass grafting surgery ) , patients with systolic dysfunction with ejection fraction < 50% , severe valvular heart disease , severe restrictive , constrictive or hypertrophic cardiomyopathy , and patients with congenital heart disease were excluded . all data were collected after obtaining king abdallah international medical research center ( kaimrc ) approval . the past medical history , clinical characteristics , and computed tomography ( ct ) finding were obtained by trained research associates . systemic hypertension was defined as the presence of a known to be hypertensive or use of antihypertensive treatment . diabetes mellitus was defined as abnormal fasting blood sugar and/or positive history of oral or insulin treatment . hyperlipidemia was defined as a total serum cholesterol > 200 mg / dl or the presence of appropriate drug therapy . family history of cad was considered positive if there were men aged < 55 years or women aged < 65 years old with coronary heart disease . smoking status was positive if the patient was smoking within 1-year and the past if the patient stopped smoking for > 1-year . they received intravenous metoprolol to achieve a heart rate of 65 beats / min and 0.4 mg of sublingual nitroglycerin before ccta . all ccta scans were performed by 64-detector row ct scanners ( ge healthcare , milwaukee , wi ) or a dual source second generation scanner ( flsh , siemens , erlangen , germany ) with double - phase contrast protocol as follows : 60 ml of iodixanol , followed by a 50 ml saline flush . cctas were scanned from the carina to the cardiac apex with the use of high pitch scanning or prospective gating for which the scan parameters were 64 , 0.625 mm collimation , tube voltage of 120 mv , and 350750 ma . multiphasic reconstruction , postprocessing , and image interpretation were performed by a cardiologist blinded to clinical history and echo findings . all images were examined on an advantage workstation ( ge healthcare , milwaukee , usa ) . coronary segments showing coronary disease were visually scored as mild ( 149% , score 1 ) , moderate ( 5069% , score 2 ) , or severe ( > 70% , score 3 ) . intraluminal stenosis using the 16-segment coronary model was recommended by the society of cv ct . the segment involvement score ( sis ) was calculated as the total number of coronary artery segments exhibiting plaque , irrespective of the degree of luminal stenosis within each segment ( minimum = 0 ; maximum = 16 ) . in addition to standard m - mode , two - dimensional and color doppler imaging , continuous - wave doppler examination of tricuspid flow , pulsed - wave doppler examination of mitral inflow , and doppler tissue imaging of the septal and lateral mitral annulus in 4-chamber view were performed in each subject in accordance with american society of echocardiographic and european association of echocardiography guidelines . mitral e and a waves were measured , with an e wave - to - a wave ratio ( ear ) calculated to determine dd . dd by ears were assessed to consider the presence of other supporting metrics of dd including septal and lateral axial excursion by tissue doppler imaging , deceleration time , isovolumic relaxation time , pulmonary venous systolic - to - diastolic ratio , and left atrial enlargement . in addition , chamber dimensions and lv ejection fraction will be measured by m - mode echocardiogram and left atrium ( la ) volume was determined by simpson 's rule using the 4-chamber view indexed to body surface area . lv mass will be calculated according to devereux 's equation and indexed to body surface area . dd was categorized as normal , abnormal relaxation ( stage i ) , pseudo normalization ( stage ii ) , and restrictive ( stage iii ) as per the guidelines . descriptive statistics was expressed as a mean and standard deviation for continuous variables and as frequencies and percentages for categorical variables and used to summarize baseline patient characteristics . a two sample t - test was used for two - level variables , one - way analysis of variance used for three - level to four - level variables . pearson 's correlation test was used to determine the correlation between continuous variables . to determine if diastolic dysfunction was independently associated with cad , a multivariable logistic regression was used adjusting for potential confounder . for all multivariate modeling , the threshold for variable entry into models was p < 0.05 and the threshold for variable removal was p > 0.20 . a selection of variables for entry consideration was based on the clinical judgment , results of previous publications , and the expertise of the investigators . care was given to avoid model over fitting by maintaining an events - to - covariate ratio of at least 10:1 . this is retrospective crosssectional study , conduct in a tertiary care center between 2012 - 2013 , which included consecutive patients who underwent a clinically indicated ccta and tte within 1-month apart . patients with prior history of cad ( prior myocardial infarction , prior percutaneous stenting or coronary artery bypass grafting surgery ) , patients with systolic dysfunction with ejection fraction < 50% , severe valvular heart disease , severe restrictive , constrictive or hypertrophic cardiomyopathy , and patients with congenital heart disease were excluded . all data were collected after obtaining king abdallah international medical research center ( kaimrc ) approval . the past medical history , clinical characteristics , and computed tomography ( ct ) finding were obtained by trained research associates . systemic hypertension was defined as the presence of a known to be hypertensive or use of antihypertensive treatment . diabetes mellitus was defined as abnormal fasting blood sugar and/or positive history of oral or insulin treatment . hyperlipidemia was defined as a total serum cholesterol > 200 mg / dl or the presence of appropriate drug therapy . family history of cad was considered positive if there were men aged < 55 years or women aged < 65 years old with coronary heart disease . smoking status was positive if the patient was smoking within 1-year and the past if the patient stopped smoking for > 1-year . all patients underwent ccta by a standard protocol . they received intravenous metoprolol to achieve a heart rate of 65 beats / min and 0.4 mg of sublingual nitroglycerin before ccta . all ccta scans were performed by 64-detector row ct scanners ( ge healthcare , milwaukee , wi ) or a dual source second generation scanner ( flsh , siemens , erlangen , germany ) with double - phase contrast protocol as follows : 60 ml of iodixanol , followed by a 50 ml saline flush . cctas were scanned from the carina to the cardiac apex with the use of high pitch scanning or prospective gating for which the scan parameters were 64 , 0.625 mm collimation , tube voltage of 120 mv , and 350750 ma . multiphasic reconstruction , postprocessing , and image interpretation were performed by a cardiologist blinded to clinical history and echo findings . all images were examined on an advantage workstation ( ge healthcare , milwaukee , usa ) . coronary segments showing coronary disease were visually scored as mild ( 149% , score 1 ) , moderate ( 5069% , score 2 ) , or severe ( > 70% , score 3 ) . intraluminal stenosis using the 16-segment coronary model was recommended by the society of cv ct . the segment involvement score ( sis ) was calculated as the total number of coronary artery segments exhibiting plaque , irrespective of the degree of luminal stenosis within each segment ( minimum = 0 ; maximum = 16 ) . in addition to standard m - mode , two - dimensional and color doppler imaging , continuous - wave doppler examination of tricuspid flow , pulsed - wave doppler examination of mitral inflow , and doppler tissue imaging of the septal and lateral mitral annulus in 4-chamber view were performed in each subject in accordance with american society of echocardiographic and european association of echocardiography guidelines . mitral e and a waves were measured , with an e wave - to - a wave ratio ( ear ) calculated to determine dd . dd by ears were assessed to consider the presence of other supporting metrics of dd including septal and lateral axial excursion by tissue doppler imaging , deceleration time , isovolumic relaxation time , pulmonary venous systolic - to - diastolic ratio , and left atrial enlargement . in addition , chamber dimensions and lv ejection fraction will be measured by m - mode echocardiogram and left atrium ( la ) volume was determined by simpson 's rule using the 4-chamber view indexed to body surface area . lv mass will be calculated according to devereux 's equation and indexed to body surface area . dd was categorized as normal , abnormal relaxation ( stage i ) , pseudo normalization ( stage ii ) , and restrictive ( stage iii ) as per the guidelines . descriptive statistics was expressed as a mean and standard deviation for continuous variables and as frequencies and percentages for categorical variables and used to summarize baseline patient characteristics . a two sample t - test was used for two - level variables , one - way analysis of variance used for three - level to four - level variables . pearson 's correlation test was used to determine the correlation between continuous variables . to determine if diastolic dysfunction was independently associated with cad , a multivariable logistic regression was used adjusting for potential confounder . for all multivariate modeling , the threshold for variable entry into models was p < 0.05 and the threshold for variable removal was p > 0.20 . a selection of variables for entry consideration was based on the clinical judgment , results of previous publications , and the expertise of the investigators . care was given to avoid model over fitting by maintaining an events - to - covariate ratio of at least 10:1 . the mean cacs was 28 69 ( ranging from 0473 ) and 384 ( 89.5% ) patients has a cacs < 100 . on ccta , the sis ranged from 0 to 12 with mean of 1.9 2.8 , and 263 ( 61.3% ) patients has sis < 2 . baseline characteristics and demographic data the mean mitral inflow e / a ratio was 1.2 0.4 ( minimum 0.4 and maximum 4.1 ) , mean la volume index was 15.7 6.7 , while e / e ' ratio ranged from 0.6 to 27.1 with mean of 8.1 3.1 . in univariate analysis , comparison of the absence and presence of cacs and dd with characteristics and risk factors of patients were shown in tables 2a and b. there was a significant relationship between cacs and dd grade [ figure 1a ] . patients with a zero cacs on ccta have a higher prevalence of normal dd ( 54.7% vs. 76.7% , p = 0.001 ) . conversely , patients had a cacs > 100 on ccta have a higher prevalence of diastolic dysfunction ( 17% vs. 7% , p = 0.001 ) [ figure 1b ] . comparison of the study cohort based on the calcium score comparison of the study cohort based on the diastolic function bar graphs shows measurement of diastolic dysfunction and relation with multiple parameters , ( a ) mean coronary calcium score and different types of diastolic dysfunction , ( b ) diastolic dysfunction in categorizing groups of coronary calcium score , relationship between coronary calcium score ( ccs ) and diastolic dysfunction ( dd ) , ( c ) diastolic dysfunction in categorizing groups of segment involvement score , a correlation between segment involvement score ( sis ) and diastolic dysfunction ( dd ) similarly , patients with sis more than two have a higher prevalence of diastolic dysfunction ( 43.3% vs. 20.8% , p < 0.001 ) . oppositely , patients with zero sis have a higher prevalence of normal dd ( 34.1% vs. 59.2% , p < 0.001 ) [ figure 1c ] . the increased cacs was associated with higher e / e ' ratio , higher mitral e / a ratio , and larger left atrial volume index [ figure 2a - c ] . ( a ) correlation between total calcium score with left atrial volume index , ( b ) correlation between total calcium score with mitral inflow e / a ratio , ( c ) correlation between total calcium score with e average e ' ratio using multivariate logistic regression adjusting for age , sex , diabetes , hypertension , and body mass index , there was no independent association between ccs ( odds ratio [ or ] = 1.003 , ( 95% confidence interval [ ci ] = 0.998 1.009 ) , p value = 0.225 ) , obstructive cad ( or = 1.26 , ( 95% ci= 0.712.24 ) , p = 0.423 ) , and sis ( or = 1.14 , ( 95% ci = 0.911.42 ) , p = 0.259 ) and diastolic dysfunction . the mean cacs was 28 69 ( ranging from 0473 ) and 384 ( 89.5% ) patients has a cacs < 100 . on ccta , the sis ranged from 0 to 12 with mean of 1.9 2.8 , and 263 ( 61.3% ) patients has sis < 2 . baseline characteristics and demographic data the mean mitral inflow e / a ratio was 1.2 0.4 ( minimum 0.4 and maximum 4.1 ) , mean la volume index was 15.7 6.7 , while e / e ' ratio ranged from 0.6 to 27.1 with mean of 8.1 3.1 . in univariate analysis , comparison of the absence and presence of cacs and dd with characteristics and risk factors of patients were shown in tables 2a and b. there was a significant relationship between cacs and dd grade [ figure 1a ] . patients with a zero cacs on ccta have a higher prevalence of normal dd ( 54.7% vs. 76.7% , p = 0.001 ) . conversely , patients had a cacs > 100 on ccta have a higher prevalence of diastolic dysfunction ( 17% vs. 7% , p = 0.001 ) [ figure 1b ] . comparison of the study cohort based on the calcium score comparison of the study cohort based on the diastolic function bar graphs shows measurement of diastolic dysfunction and relation with multiple parameters , ( a ) mean coronary calcium score and different types of diastolic dysfunction , ( b ) diastolic dysfunction in categorizing groups of coronary calcium score , relationship between coronary calcium score ( ccs ) and diastolic dysfunction ( dd ) , ( c ) diastolic dysfunction in categorizing groups of segment involvement score , a correlation between segment involvement score ( sis ) and diastolic dysfunction ( dd ) similarly , patients with sis more than two have a higher prevalence of diastolic dysfunction ( 43.3% vs. 20.8% , p < 0.001 ) . oppositely , patients with zero sis have a higher prevalence of normal dd ( 34.1% vs. 59.2% , p < 0.001 ) [ figure 1c ] . the increased cacs was associated with higher e / e ' ratio , higher mitral e / a ratio , and larger left atrial volume index [ figure 2a - c ] . ( a ) correlation between total calcium score with left atrial volume index , ( b ) correlation between total calcium score with mitral inflow e / a ratio , ( c ) correlation between total calcium score with e average e ' ratio using multivariate logistic regression adjusting for age , sex , diabetes , hypertension , and body mass index , there was no independent association between ccs ( odds ratio [ or ] = 1.003 , ( 95% confidence interval [ ci ] = 0.998 1.009 ) , p value = 0.225 ) , obstructive cad ( or = 1.26 , ( 95% ci= 0.712.24 ) , p = 0.423 ) , and sis ( or = 1.14 , ( 95% ci = 0.911.42 ) , p = 0.259 ) and diastolic dysfunction . our analysis showed that despite sharing common risk factors , atherosclerotic measures on ccta , and measures of diastolic dysfunction are not independently correlated . many of the same factors that contribute to atherosclerosis may also result in left ventricular dd by either direct mechanisms ( e.g. hypertension and age - related vascular stiffening ) or secondarily via cad progression and resulting changes in myocardial ischemia . because at least half of these patients have prevalent cad , in the form of angina , previous myocardial infarction , or previous coronary artery bypass surgery , cad is commonly cited as a mechanism underlying diastolic dysfunction . however , the association of dd with stable or nonflow - limiting asymptomatic cad , independent of other known risk factors , is not well - established . some of the prior data have shown that cad has an inverse relationship with measurements of dd . garcia et al . demonstrated that early stage of subclinical atherosclerotic disease is negatively associated with dd parameters in healthy individuals , regardless of age and clinical characteristics . however , they used carotid intima - media thickness as a surrogate for subclinical atherosclerosis instead of cacs . in another study , eleid et al . did not find consistent relation between coronary artery plaque burden as assessed by cacs and echocardiographic grade of lv dd in the population of asymptomatic adults with normal lv ejection fraction and negative cardiac stress test results . their study population had lower risk factor profile than our study : only 6% are diabetic and 36% hypertensive . recently , lin et al . concluded that the extent and severity of obstructive as well as nonobstructive cad by coronary cta are associated with increased lv end diastolic pressure and measures of worsening dd . in addition , patients with known cad or lv dysfunction were not excluded from their analysis , which may have contributed to their positive findings . in our study , we observed a direct relationship between coronary artery plaque burden and measures of dd on univariate analysis . however , many risk factors , such as age , hypertension , diabetes mellitus , and dyslipidemia , contribute to both cad and dd . after adjusting for these confounders prospective longitudinal studies are needed to bring more insights about the relationship between atherosclerotic burden and diastolic dysfunction . in addition , both cacs and echocardiography provide different prognostic information for future adverse cv events . our analysis lacks outcomes data , and it is not clear from this analysis if diastolic dysfunction adds incremental prognostic value over cad on ccta . prospective longitudinal studies are needed to bring more insights about the relationship between atherosclerotic burden and diastolic dysfunction . in addition , both cacs and echocardiography provide different prognostic information for future adverse cv events . our analysis lacks outcomes data , and it is not clear from this analysis if diastolic dysfunction adds incremental prognostic value over cad on ccta . our analysis suggests that cacs , as well as cad by ccta , is not independently associated with measures of dd on echocardiography among patients without prior cad or lv dysfunction .

aims : we investigated the relationship between coronary artery calcium score ( cacs ) and coronary artery disease ( cad ) on coronary computed tomography angiography ( ccta ) , and measures of left ventricular diastolic function ( dd).methods : we included 429 consecutive patients ( 39% women ; mean age 49 12 years ) without known cad , who underwent ccta and transthoracic echocardiography ( tte ) within 1-month . evaluation of ccta was per vessel , and per segment basis for intraluminal diameter stenosis . we also used the 16-segment model to determine overall coronary plaque burden with segment involvement score ( sis ) . dd on tte was assessed using mitral inflow e wave - to - a wave ratio ( ear ) and tissue doppler early mitral annual tissue velocity axial excursion.results:a total of 293 ( 68.4% ) patients had dd , 15.4% had more than stage 2 dd . the presence of dd was associated with increasing cacs ( p < 0.001 ) . similarly , there was a statistically significant correlation between ear and ccs ( r = 0.147 , p = 0.004 ) and sis ( r = 0.536 , p < 0.001 ) . the prevalence of more than stage 2 dd was associated with higher prevalence of obstructive cad ( 26.2% vs. 11.7% , p < 0.0001 ) . in multivariable analyses , the independent predictors of more than stage 1 dd are the age ( p < 0.001 ) , and diabetes ( p = 0.010 ) , while the cacs and sis were not independently associated with dd.conclusion:our analysis suggests that cacs , as well as cad by ccta , are not independently associated with measures of dd on echocardiography .

benign tumours , such as leiomyomas account for less than 1% of all hypopharyngeal and oesophageal tumours ( 1,2 ) . leiomyoma is the most common benign oesophageal neoplasm , the reported post - mortem incidences range from 0.005% to 5.1% . however in comparison to oesophageal carcinoma they are relatively rare . usually presenting in the 3rd-5th decade with a male : female ratio of 2:1 ( 3 ) . we report on a 48-year old female ex - smoker who presented to the emergency department with a sizeable right - sided oral cavity mass associated with audible stertor , but no significant airway compromise in the upright position . the mass appeared after an episode of forceful vomiting having had a cough for two weeks . the remainder of the history was unremarkable apart from an alcohol intake of up to 27 units of wine a week . this demonstrated that the large pedunculated necrotic mass was in fact , appearing to arise from the right piriform fossa and not the tonsil confirmed by rigid pharyngolaryngo - upper oesophagoscopy . the upper oesophagoscopy was limited to 20 centimetres ( cm ) due to mucosal oedema . the mass was ligated at its base ( silk suture ) and sent for further analysis ( figure 1 ) . it is likely that the mass had acutely twisted and protruded into the upper oesophagus causing obstructive symptoms leading to the history of sudden - onset vomiting . the patient s post - operative recovery was uneventful and an outpatient review was arranged . histology confirmed a benign leiomyoma macroscopically measuring 5 x 3.5 x 3 cm , which had been shelled out of a squamous covering with no evidence of dysplastic or malignant change . further imaging [ computerised tomography ( ct ) of neck ] demonstrated a remnant of the base of the lesion low in the piriform fossa possibly going up to the upper oesophagus and a barium swallow revealed some oesophageal mucosal irregularity at approximately 21 cm . further flexible nasoendoscopy assessment in clinic was concerning and unhelpful in assessing the piriform fossa ( right side erythematous and oedematous ) , prompting a further general anaesthetic rigid laryngopharyngo - upper oesophagoscopy procedure to exclude a synchronous tumour . this revealed a normal piriform fossae and a stump in the left posterior upper oesophagus at approximately 19 cm , with the original silk suture attached to it suggesting that the mass was in fact an oesophageal leiomyoma . the patient was kept under close review jointly with the general surgeons for flexible oesophageal endoscopy and eventually underwent a flexible endoscopy whereby the stump was removed , confirming the same histology ( oesophageal mucosa ) . our case presented with leiomyoma emanating from the upper oesophagus , which is rare as they are most frequently found in the mid to lower oesophagus correlating with the predominant muscular composition found in each of the regions ; smooth muscle in the lower third and mixed ( smooth / skeletal ) muscle in the middle third . they usually appear intramurally our case presented intraluminally as a pedunculated mass with sudden onset symptoms of nausea and vomiting as opposed to the usual non - specific , longer duration symptoms of dysphagia , pain and weight loss ( 3 ) . macroscopically leiomyomas are characterised as well circumscribed , smooth or nodular masses with a whorled cut surface ( figure 2 ) and microscopically with bundles of smooth muscle cells intermingled with collagenous stroma ( 4 ) . imaging modalities may include ct scanning to assess extra - oesophageal extent , barium swallow ( filling defect ) and endoscopic ultrasonography to assess which oesophageal layer the mass is in and its size , extent and nature ( sold or cystic ) . management options are non - operative ( asymptomatic ) or operative from enucleation via endoscopic , open or thorascopic methods to oesophageal resection and reconstruction for select tumours ( greater than 8 cm or adherent to the mucosa etc . ) anecdotally , a similar case was described by simpson , 1934 of a lady coughing up a mass , which was subsequently swallowed . the patient was erroneously diagnosed as having globus hystericus and presented ten months later with a similar picture associated with sudden onset dysphagia . furthermore , direct laryngoscopy confirmed a mass suspended by a pedicle from the area of the right piriform fossa hanging into the oesophageal entrance . this appeared to have twisted causing a haemorrhagic necrosis and the acute symptoms ( 5 ) . our case describes the rare occurrence of an upper oesophageal leiomyoma presenting acutely as a large mass in the oral cavity . this diagnosis should be entertained as a differential in the circumstance of an odd - sounding referral of a patient who is reported to have coughed up their tonsil.

we report on a case of oesophageal leiomyoma presenting as a potential cause of sudden airway obstruction . the patient presented with a large mass in the oral cavity after an episode of forceful vomiting . the operative findings and histology of which confirmed this to be an oesophageal leiomyoma emanating from the upper oesophagus , a rare finding . the mass was excised and the patient s subsequent post - operative recovery and follow - up has been unremarkable.this diagnosis should be borne in mind when one is referred the odd sounding case of a patient who appears to have coughed up their tonsil.

according to the world health organization ( who ) , odontogenic myxoma is classified as an odontogenic tumor of the ectomesenchymal origin . the mandible is involved more frequently than the maxilla , and most reports show a slight predilection for females . therefore , it reaches considerable size before being detected , and perforation of the cortices of the involved bone may be seen . the evidence for its odontogenic origin arises from its almost exclusive location in the tooth - bearing areas of the jaws , its occasional association with missing or unerupted teeth , and the presence of an odontogenic epithelium . radiographically , the tumor presents as a unilocular or multilocular radiolucent lesion with well - defined borders and fine , bony trabeculae within its interior structure expressing a honeycombed, soap bubble, or unilocular appearance may be seen more commonly in children and in the anterior part of the jaws . displacement of teeth is a relatively common finding , root resorption is rarely seen and the tumor is often scalloped between the roots . application of a computed tomography ( ct ) scan allows the production of panaromic , radial and axial 2d reconstruction . the extent of the lesion 's relationship to teeth , root resorption , internal structure , cortical expansion and erosion , the boundary of the lesion and the presence of multiple lesions can all be evaluated . microscopically , the tumor consists of rounded , spindled , and stellate cells arranged in loose , myxoid stroma , with few collagen fibrils . small islands of apparently inactive epithelial odontogenic rests may be scattered through the myxoid stroma . complete surgical excision can be difficult as the lesion is not encapsulated and the myxomatous tissue infiltrates the adjacent osseous tissue . this also accounts for the high recurrence rate of myxomas , which range from 10 - 30% with an average of 25% . a 19-year - old patient reported to the outpatient department of the department of periodontics , faculty of dental sciences , chatrapati sahuji maharaj medical university ( erstwhile king george 's medical college ) , lucknow , with a complaint of swelling in the left upper jaw region since one year . her history revealed exfoliation of a deciduous tooth in that area at the age of 12 years . two months after exfoliation , the patient noticed a white mass in the canine premolar area , which resembled a nodule . one year back , the patient observed reddening of the nodule with a sudden increase in its size . the patient 's records revealed that five months prior she had an incisional biopsy for the growth , which was diagnosed as chronic inflammatory enlargement . intraoral examination revealed a diffuse erythematous swelling in between the left maxillary canine and first premolar [ figures 1 and 2 ] . the swelling measured 2.6 cm anteroposteriorly , 4.2 cm buccopalatally , and extended to the occlusal level superoinferiorly . the intraoral periapical , panoramic , and occlusal radiographs revealed a multilocular lesion with diffuse radio - opacity [ figure 3 ] . intraoral periapical view of the swelling as the radiographs were non - diagnostic , dentascan was done for further clarification . act scan revealed multilocular radiolucency along with slight cortical expansion and cortical perforation [ figures 46 ] . computed tomographic scan showing multilocular radiolucency in between 23 and 24 cortical expansion and perforation seen multilocular radiolucency seen in three sections of the computed tomographic scan after thorough scaling and root planing of the adjoining teeth , the patient was scheduled for excisional biopsy . complete excision of the swelling along with slight osseous resection was done extending well beyond the swelling margin [ figure 7 ] . immediate post excision the histopathological examination revealed fragments of a myxomatous tissue [ figures 8 and . the myxomatous tissue was even found infiltrating the osseous tissue , suggestive of a fibro - osseous lesion . small islands of odontogenic epithelium were diagnostic of om . highly cellular myxomatous tissue ( h and e , 10 ) myxomatous tissue infiltrating osseous lamellae ( h and e , 40 ) collaborating the clinical , radiological , and histological findings , the patient has been put on a periodic recall program every month and recurrence has not been observed in the last six months [ figures 1012 ] . one week post operation postoperative palatal view at six months postoperative buccal view at six months odontogenic myxoma is a rare tumor of the bone , and almost exclusively of the jaws , comprising of around 3 - 6% of all odontogenic tumors . om is found to occur most commonly in young patients with a predilection for females . incisional biopsy of the patient was suggestive of a chronic inflammatory lesion . in all probability a superficial biopsy from the tumor margin may have resulted in a false conclusion . panoramic and occlusal radiographs were not very diagnostic . as is reported in the literature , the tumor presents a variable radiographic picture . zhang et al . examined 41 cases of om and found that on conventional radiographs , odontogenic myxomas presented varying radiographic appearances , which could be divided into six types as follows : type i unilocular ; type ii multilocular ( including honeycomb , soap bubble , and tennis racquet patterns ) ; type iii involvement of local alveolar bone ; type iv involvement of the maxillary sinus ; type v osteolytic destruction , and type vi a mix of osteolytic destruction and osteogenesis . in the present case a type vi mixed picture of radiolucency and radiographically , a number of lesions resemble om and should be differentially diagnosed from ameloblastoma , intraosseous hemangioma , aneurysmal bone cyst , central giant cell granuloma , metastatic tumor , and in some cases , of unilocular lesions , simple cysts . microscopically , spindle and stellate fibroblasts are associated with a basophilic ground substance and myxomatous tissue . a spectrum of fibrous connective tissue stroma is present : from myxoid to densely hyalinized and from relatively acellular to cellular . the lack of a capsule and infiltrative growth pattern is responsible for a high rate of recurrence when conservative enucleation and curettage are performed complete surgical excision of the lesion was performed . periodic recall visits for the patient are planned , as the recurrence rate of the lesion is high . to conclude , the odontogenic myxoma may present variable features on radiographs and superficial biopsies may be misleading . due to the scarcity of studies using mr imaging , the characteristics of the myxoma have not been established satisfactorily . therefore , additional studies are necessary to improve the diagnosis of this lesion , using the new imaging techniques that are now available to image this pathology . an innocuous gingival enlargement presentation may sometimes be a disguise for a more serious pathology . thorough exploration of the swelling and utilization of the available diagnostic tools may help screen such pathologies .

odontogenic myxoma ( om ) is a rare and locally invasive benign neoplasm found exclusively in the maxillofacial region . the radiographic and clinical features are variable , and the diagnosis is therefore not easy . a case of om of the maxilla is described in a 19-year - old female , previously diagnosed as inflammatory gingival enlargement . clinical , histological , radiographic , and computed tomographic ( ct ) scan assessments were done , which were confirmatory for om . surgical excision of the lesion was done . the patient was put on periodic recall , as the recurrence rate of the lesion was high . the biological spectrum of om was highly variable and diagnosis at an early stage was very difficult . gingival enlargement presentation might not always be an inflammatory reaction . all possible differential diagnosis should be explored and various diagnostic tools utilized , to screen the enlargement .

approval of the ethics committee of the institutional review board of kyungpook national university hospital was obtained for this retrospective study ( irb number : 2013 - 06 - 016 ) . from january 2007 to june 2011 , 25 patients ( 26 cases ) underwent a two - stage revision arthroplasty using mobile cement prosthesis at our institute , after receiving a diagnosis of chronic infection post tka . of these , 19 patients ( 20 cases ) , with a minimum follow - up of two years , were enrolled in this retrospective study . this clinical series consisted of 16 women and 3 men , having mean age 71 years ( range , 63 to 75 years ) . mean follow - up was 29 months ( range , 24 to 49 months ) . other underlying diseases at index surgery were hypertension ( 13 cases ) , diabetes mellitus ( 8 cases ) , and renal failure , asthma , tuberculosis , or cerebral infarction ( 1 case each ) . to diagnose infection after tka , the presence of swelling , erythema , and heat sensation were checked by a physical examination . we also determined whether the patients presented with clinical symptoms , such as pain and tenderness . laboratory tests included complete blood count , white blood cell ( wbc ) count , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) . in addition , radiography , joint fluid cell counts , blood culture , intraoperative findings , histopathologic findings of synovial membranes , and culture results were considered . based on the results obtained , a diagnosis of infection after tka was established . in this series , the pathogenic bacteria were identified in 9 cases by culture ; these included 3 cases of methicillin - sensitive staphylococcus aureus , 2 cases of methicillin - resistant s. epidermidis , 2 cases of -hemolytic streptococcus , 1 case of methicillin - resistant s. aureus ( mrsa ) , and 1 case of escherichia coli ( table 1 ) . all surgical procedures were performed by a single orthopedic surgeon ( hsk ) . during the first - stage of revision , a medial parapatellar approach was used , and access was via the previous surgical scar . necrotized bone , soft tissue , and synovium presumed to be infectious were all removed . if possible , en bloc resection was performed , and this was followed by histopathologic examination and culture of the resected soft tissue and synovium . using an osteotome , the polyethylene , femoral , tibial , and patellar prostheses were removed and complete debridement of the intramedullary region , which was presumed to be infected , was performed . these procedures were followed by massive irrigation with normal saline . using an osteotome , all cement components attached to the femoral prosthesis were removed as much as possible , after which they were washed and autoclaved at 132 for 30 minutes . a pack of cement was then mixed with antibiotics , and this cement paste was applied to the autoclaved femoral prosthesis , which was subsequently fixed to the femur . another pack of antibiotic - impregnated cement was prepared and inserted in the tibia at a thickness that maintained the knee joint gap . beads were also inserted in the intramedullary canal , if needed . to achieve joint congruency , a deep dish - like molding if the causative bacteria had been identified preoperatively , appropriate antibiotics were mixed with the powder component of the bone cement ; however , if no causative bacteria were identified , a pack of cement ( 40 g ) was mixed with vancomycin ( 4 g ) and first - generation cephalosporin ( 4 g ) before application . the bone cement used was refobacin ( biomet orthopaedics , ried b. kerzers , switzerland ) , which contained 0.5 g gentamicin per pack ( figs . after the first revision stage , drainage was maintained for 3 - 5 days and splinting for a week , during which time the pain was managed with medication . thereafter , passive joint movement was performed using a continuous passive motion unit , and this was accompanied by active joint movement . at 2 weeks postoperatively , patients were gradually allowed to perform gait tasks with partial weight - bearing . before the sample culture test results were acquired after the first - stage revision , suitable antibiotics were administered , based on the bacterial strains identified in joint aspirates obtained prior to hospitalization . thereafter , these were replaced with suitable antibiotics after obtaining the intraoperative culture and sensitivity results , and consultation with a board - certified specialist in infectious diseases . second - stage revision arthroplasty was conducted based on the current , and later the systemic , status of the patient . the factors considered were : esr had decreased , crp had normalized ( at < 0.5 mg / dl ) , complete blood wbc count had normalized , and no sign of infection was evident by clinical examination . initially , soft tissue and synovium around the joint were biopsized , and if the number of multinuclear leukocytes by frozen section biopsy was < 10 at high magnification , it was considered that no acute inflammation was present . during second - stage revision arthroplasty , metal blocks , cement prosthesis , and an allobone graft were used to restore the bone defects . a cruciate ligament - substituting knee prosthesis and a constrained type knee prosthesis were used in 12 and 8 cases , respectively . cement was used to fix the prostheses ; it was prepared by mixing appropriate antibiotics with the cement powder component if causative bacteria had been identified , and if not , a pack of cement ( 40 g ) was mixed with vancomycin ( 1 g ) and first - generation cephalosporin ( 1 g ) . range of motion was determined prior to the first and second stages of revision arthroplasty , and at the last follow - up . in addition , hospital for special surgery ( hss ) knee scores and knee society ( ks ) knee score and functional score ( fs ) were determined after the two surgical stages . after second - stage revision arthroplasty , plain radiography was performed at 2 weeks , 3 months , and 6 months , and later annually . to evaluate the degree of joint contracture between the first stage and second stage , the authors used the frequency of rectus snip during second - stage revision arthroplasty . in addition , patients were also examined during follow - up for complications or infection recurrence . 21 ( ibm co. , armonk , ny , usa ) was used for all analysis . approval of the ethics committee of the institutional review board of kyungpook national university hospital was obtained for this retrospective study ( irb number : 2013 - 06 - 016 ) . from january 2007 to june 2011 , 25 patients ( 26 cases ) underwent a two - stage revision arthroplasty using mobile cement prosthesis at our institute , after receiving a diagnosis of chronic infection post tka . of these , 19 patients ( 20 cases ) , with a minimum follow - up of two years , were enrolled in this retrospective study . this clinical series consisted of 16 women and 3 men , having mean age 71 years ( range , 63 to 75 years ) . mean follow - up was 29 months ( range , 24 to 49 months ) . other underlying diseases at index surgery were hypertension ( 13 cases ) , diabetes mellitus ( 8 cases ) , and renal failure , asthma , tuberculosis , or cerebral infarction ( 1 case each ) . to diagnose infection after tka , the presence of swelling , erythema , and heat sensation were checked by a physical examination . we also determined whether the patients presented with clinical symptoms , such as pain and tenderness . laboratory tests included complete blood count , white blood cell ( wbc ) count , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) . in addition , radiography , joint fluid cell counts , blood culture , intraoperative findings , histopathologic findings of synovial membranes , and culture results were considered . based on the results obtained , a diagnosis of infection after tka was established . in this series , the pathogenic bacteria were identified in 9 cases by culture ; these included 3 cases of methicillin - sensitive staphylococcus aureus , 2 cases of methicillin - resistant s. epidermidis , 2 cases of -hemolytic streptococcus , 1 case of methicillin - resistant s. aureus ( mrsa ) , and 1 case of escherichia coli ( table 1 ) . all surgical procedures were performed by a single orthopedic surgeon ( hsk ) . during the first - stage of revision , a medial parapatellar approach was used , and access was via the previous surgical scar . necrotized bone , soft tissue , and synovium presumed to be infectious were all removed . if possible , en bloc resection was performed , and this was followed by histopathologic examination and culture of the resected soft tissue and synovium . using an osteotome , the polyethylene , femoral , tibial , and patellar prostheses were removed and complete debridement of the intramedullary region , which was presumed to be infected , was performed . these procedures were followed by massive irrigation with normal saline . using an osteotome , all cement components attached to the femoral prosthesis were removed as much as possible , after which they were washed and autoclaved at 132 for 30 minutes . a pack of cement was then mixed with antibiotics , and this cement paste was applied to the autoclaved femoral prosthesis , which was subsequently fixed to the femur . another pack of antibiotic - impregnated cement was prepared and inserted in the tibia at a thickness that maintained the knee joint gap . beads were also inserted in the intramedullary canal , if needed . to achieve joint congruency , a deep dish - like molding if the causative bacteria had been identified preoperatively , appropriate antibiotics were mixed with the powder component of the bone cement ; however , if no causative bacteria were identified , a pack of cement ( 40 g ) was mixed with vancomycin ( 4 g ) and first - generation cephalosporin ( 4 g ) before application . the bone cement used was refobacin ( biomet orthopaedics , ried b. kerzers , switzerland ) , which contained 0.5 g gentamicin per pack ( figs . after the first revision stage , drainage was maintained for 3 - 5 days and splinting for a week , during which time the pain was managed with medication . thereafter , passive joint movement was performed using a continuous passive motion unit , and this was accompanied by active joint movement . at 2 weeks postoperatively , patients were gradually allowed to perform gait tasks with partial weight - bearing . before the sample culture test results were acquired after the first - stage revision , suitable antibiotics were administered , based on the bacterial strains identified in joint aspirates obtained prior to hospitalization . thereafter , these were replaced with suitable antibiotics after obtaining the intraoperative culture and sensitivity results , and consultation with a board - certified specialist in infectious diseases . second - stage revision arthroplasty was conducted based on the current , and later the systemic , status of the patient . the factors considered were : esr had decreased , crp had normalized ( at < 0.5 mg / dl ) , complete blood wbc count had normalized , and no sign of infection was evident by clinical examination . initially , soft tissue and synovium around the joint were biopsized , and if the number of multinuclear leukocytes by frozen section biopsy was < 10 at high magnification , it was considered that no acute inflammation was present . during second - stage revision arthroplasty , metal blocks , cement prosthesis , and an allobone graft were used to restore the bone defects . a cruciate ligament - substituting knee prosthesis and a constrained type knee prosthesis were used in 12 and 8 cases , respectively . cement was used to fix the prostheses ; it was prepared by mixing appropriate antibiotics with the cement powder component if causative bacteria had been identified , and if not , a pack of cement ( 40 g ) was mixed with vancomycin ( 1 g ) and first - generation cephalosporin ( 1 g ) . range of motion was determined prior to the first and second stages of revision arthroplasty , and at the last follow - up . in addition , hospital for special surgery ( hss ) knee scores and knee society ( ks ) knee score and functional score ( fs ) were determined after the two surgical stages . after second - stage revision arthroplasty , plain radiography was performed at 2 weeks , 3 months , and 6 months , and later annually . to evaluate the degree of joint contracture between the first stage and second stage , the authors used the frequency of rectus snip during second - stage revision arthroplasty . in addition , patients were also examined during follow - up for complications or infection recurrence . 21 ( ibm co. , armonk , ny , usa ) was used for all analysis . a total of 20 knee surgeries were studied : 7 had undergone primary tka at kyungpook national university hospital , and 13 at another institution . a mean of 35 months ( range , 2 to 132 months ) had elapsed before the prosthesis was removed from the onset of infection , and the mean time between the first and second stages of revision arthroplasty was 25 weeks ( range , 4 to 116 weeks ) . the mean range of motion of knee joints was 70 ( range , 15 to 100 ) prior to first - stage revision , 72 ( range , 40 to 120 ) prior to second - stage revision arthroplasty , and 113 ( range , 90 to 135 ) at final follow - up , indicating a significant improvement following revision arthroplasty ( p < 0.05 ) . however , no significant difference in mean range of motion was observed after the first stage ( p = 0.703 ) . there were no occurrences of fracture of the cement spacer during the interim in - between stages . mean hss score was 40 points ( range , 5 to 68 points ) prior to the first stage and 86 points ( range , 56 to 100 points ) at the final follow - up ( p < 0.05 ) . the mean ks knee score and fs were also significantly increased from 43 to 82 and from 30 to 54 , respectively ( p < 0.05 ) . on the final follow - up radiographs , only 1 patient with a recurrent infection exhibited a radiolucent line and osteolytic lesion . in this case , extensive muscle necrosis and a severe abscess were observed on gross examination during the first - stage revision surgery . two - stage revision arthroplasty was re - performed , and the infection was controlled . both cases were deep vein thrombosis in small - sized veins distal to the knee joint , which were detected using a 64-channel multidetector row computed tomography - indirect venography.15 ) both cases were treated using mechanical treatment modalities , such as active joint movement and pneumatic pump therapy . no patient required a resection of the quadriceps femoris ( rectus snip ) or tibial tuberosity osteotomy , which is routinely performed for joint access in cases of joint contracture . in this study , the two - stage revision arthroplasty involves recycling of the femoral prosthesis after removal from the infected knee joint , and implantation of a mobile prosthesis by intraoperative molding of antibiotic - impregnated cement ; this technique provided an excellent clinical and radiological outcome . a two - stage tka can be performed using an articulating or a non - articulating spacer , although it has been suggested that a non - articulating spacer is likely to be more effective at controlling infections , based on the outcomes of infected joint stability.4 ) however , it causes great discomfort due to limited range of motion prior to the second - stage surgery ; also , due to soft tissue contracture around the knee joint and the quadriceps femoris , the surgical approach is more difficult during the second stage.41617 ) an articulating spacer has been developed to resolve the disadvantages of the non - articulating spacer , thus making it possible for patients to perform joint movements between the first and second stages of revision , which in turn reduces discomfort and prevents soft tissue contracture . thus , this spacer simplifies the surgical approach during the second stage and produces excellent functional outcomes . several comparative studies have also reported that use of an articulating spacer is more effective in infection control.71018 ) articulating spacers can be classified by their joint surfaces as metal - on - polyethylene , cement - on - cement , or cement - on - polyethylene types . surgeons that used metal - on - polyethylene spacers have reported that several methods can be used to recycle the hardware . in the first report on this topic , hofmann et al.19 ) described a method for recycling previous femoral prosthesis using an autoclaving process , and their reimplantation using new polyethylene spacers . these authors reported excellent treatment outcomes and no case of reinfection among 26 cases over a mean follow - up period of 30 months . thereafter several authors also reported excellent treatment outcomes for the same method.11172021 ) however , kalore et al.22 ) used new femoral prostheses and a polyethylene insert due to concerns regarding the recycling of knee joint prostheses recommended for disposable use . in a study over a mean follow - up of 19 months in 16 cases , they reported no significant difference in infection control when femoral prostheses were autoclaved , but noted that the cost burden was appreciably greater when a new femoral prosthesis was used . kim et al.13 ) recycled femoral and polyethylene prostheses after autoclaving , and reported one case of re - infection over a mean follow - up of 52.2 months in 25 cases . all patients achieved excellent treatment outcomes , with ks knee scores and fss of 82 and 50 points , respectively . cement - on - cement and cement - on - polyethylene spacers provide the advantage of controlling and stemming infections by using antibiotic - loaded cement ; however , they produce fragments , can not be easily prepared in the operation room , and may prolong the operating time.232425 ) to resolve these shortcomings , customized spacers have been devised , but they are expensive . also , the selection of appropriate antibiotics is limited.4101620 ) in the present study , we used metal - on - cement spacers , which have not been previously described in literature , but which are cost - effective as compared with a new femoral component on polyethylene prosthesis . these metal - on - cement spacers are also advantageous in terms of preventing severe abrasion of the recycled polyethylene , because the mechanical strength of the recycled metal - on - polyethylene spacer is reduced during autoclaving.2627 ) in addition , as compared with the reimplantation of a polyethylene insert , metal - on - cement spacers allow a larger amount of antibiotics to be used . the surface area of cement mixed with antibiotics is also increased , and these characteristics probably afford more effective infection control . furthermore , when compared with conventional cement spacers , metal - on - cement spacers require no specific technique when the cement is molded , since they can easily be molded by simple flexion and extension of the knee joint . unlike a polyethylene prosthesis , the range of motion is limited between the first and second stages of revision . in the present study , the mean range of motion was 72 prior to second - stage revision arthroplasty , and did not reach the 102.2 as reported by kim et al.13 ) however , at final follow - up , the mean range of joint motion was 113 and mean hss score was 86 points , which are similar to the results reported for polyethylene prostheses . additionally , previous surgical sites and a medial parapatellar surgical approach were employed in all cases , and none of the patients required a rectus snip or tibial osteotomy for exposure , which indicates that excellent treatment outcomes were accomplished since no difficulty was encountered during second - stage revision arthroplasty due to joint contracture or quadriceps stiffness . our technique might be used when the advisability of using recycled polyethylene is doubted after autoclaving , and when polyethylene can not be recycled because of severe wear . in addition , it could also be useful in cases requiring a higher concentration of local antibiotics , such as in cases of mrsa infection . drainage was maintained for 3 - 5 days and splinting for a week , after the first revision stage . in previous studies , 28 ) maximal concentration of the antibiotics in the bone marrow was at 7 days after surgery . in our procedure , the maximal release of the antibiotics from the antibiotics mixed cement beads was on the very first day after surgery . also , the bactericidal activity of the antibiotics in the bone marrow tissue was maintained for 6 weeks . if the drainage was removed within 2 days after surgery , it had an added advantage of maintaining the high concentration of the antibiotics within the joint . however , longer maintenance of the drainage for 3 - 5 days would be helpful in removal of the remaining debris , according to severity of the infection . it was a retrospective and not a comparative study , and we had a small number of cases . the preoperative bacterial culture could be identified in only 9 out of the 20 cases , thus indicating that the diagnosis of infection for all cases can be difficult . of the 13 patients transferred from the other hospital , most of them had already been administered antibiotics , resulting in a difficulty to identify the causative bacteria immediately.29 ) however , considering the clinical symptoms , laboratory tests , radiography , intraoperative findings , and histopathologic findings,30 ) we were able to diagnose the presence of an infection . in summary , a two - stage revision arthroplasty involving autoclaving of the femoral prosthesis after removal from the infected knee joint prosthesis , followed by mobile prosthesis implantation by intraoperative molding of antibiotic - impregnated cement , provides excellent radiological and clinical outcomes . this novel technique offers a high surface area of antibiotic - impregnated cement as well as range of motion between first and second - stage revision surgery for the treatment of chronic infection after tka .

backgroundthe purpose of this study was to determine the degree of infection control and postoperative function for new articulating metal - on - cement spacer.methodsa retrospective study of 19 patients ( 20 cases ) , who underwent a two - stage revision arthroplasty using mobile cement prosthesis , were followed for a minimum of 2 years . this series consisted of 16 women and 3 men , having an overall mean age of 71 years . during the first stage of revision , the femoral implant and all the adherent cement was removed , after which it was autoclaved before replacement . the tibial component was removed and a doughy state , antibiotic - impregnated cement was inserted on the tibial side . to achieve joint congruency , intraoperative molding was performed by flexing and extending the knee joint . each patient was evaluated clinically and radiologically . the clinical assessments included range of motion , and the patients were scored as per the hospital for special surgery ( hss ) and knee society ( ks ) criteria.resultsthe mean range of knee joint motion was 70 prior to the first stage operation and 72 prior to the second stage revision arthroplasty ; following revision arthroplasty , it was 113 at the final follow - up . the mean hss score and ks knee and function scores were 86 , 82 , and 54 , respectively , at the final follow - up . the success rate in terms of infection eradication was 95% ( 19/20 knees ) . no patient experienced soft tissue contracture requiring a quadriceps snip.conclusionsthis novel technique provides excellent radiological and clinical outcomes . it offers a high surface area of antibiotic - impregnated cement , a good range of motion between first and second stage revision surgery for the treatment of chronic infection after total knee arthroplasty , and is of a reasonable cost .

atrial fibrillation ( af ) is the most common sustained arrhythmia requiring treatment and is one the major causes of ischemic stroke worldwide . the incidence of ischemic stroke among patients with nonvalvular af is approximately 5% per year and increases with age , resulting in higher morbidity and mortality because af - induced ischemic stroke is more disabling and fatal than other types of ischemic stroke . the treatment of af includes rhythm correction , rate control , and anticoagulant therapy , and aims to improve the symptoms and reduce the complications . although warfarin has been commonly used in the past few decades to reduce stroke risk in patients with af , recent phase iii clinical trials have shown that new oral anticoagulants are superior or noninferior to warfarin , with respect to their efficacy in preventing ischemic stroke and systemic embolism . a cohort study showed that digoxin , a rate control agent , was associated with an increased risk of stroke in patients with nonvalvular af . increased expression of cd62p in platelets and platelet - leukocyte conjugates , and endothelial activation markers , was proposed as a possible mechanism to explain the higher risk of stroke in these patients . furthermore , although the new rhythm control agent dronedarone restores sinus rhythm and reduces hospitalization or death in af patients , it also maintains sinus rhythm with an efficacy of approximately 40% but increases the rate of stroke from cardiovascular causes in patients with permanent af . despite these adverse effects , maintenance of sinus rhythm is considered an important goal in af patients because it improves their prognosis by enhancing cardiac function and relieving symptoms . although electrical cardioversion shows a superior success rate ( 88% ) , it entails a risk of thromboembolism ( up to 5.6% ) when it is performed without anticoagulation . the efficacy of pharmacological cardioversion to maintain sinus rhythm using amiodarone is around 50% to 60% and better than other agents , including dronedarone . however , although neurological effects have been reported , large studies investigating the relationship between amiodarone and ischemic stroke among patients with nonvalvular af are lacking . therefore , in this study we aimed to investigate the association between amiodarone and the risk of stroke among a nationwide population - based cohort of 7548 patients with nonvalvular af . for this study , we used data from the longitudinal health insurance database ( lhid ) , which is a part of the taiwan national health insurance research database ( nhird ) . the nhird was set up on march 1 , 1995 by the bureau of national health insurance of taiwan . the lhid includes all medical claims reported between 1996 and 2011 from 1 million beneficiaries randomly selected from among all insurants . disease definition was based on the international classification of diseases , 9th revision , clinical modification ( icd-9-cm ) , as recorded in the nhird . medication definitions were based on the anatomical therapeutic chemical ( atc ) classification system . in accordance with the personal information protection act , this study was approved by the institutional review board of the china medical university hospital , taiwan . we evaluated 16,091 patients who were diagnosed with af ( icd-9-cm 427.31 and 427.32 ) between 1998 and 2011 with the date of af diagnosis set as the index date . patients with a history of stroke ( icd-9-cm 430438 ) who received amiodarone before the index date or during the following 30 days , or who experienced stroke within 30 days of receiving amiodarone were excluded . finally , 7548 patients with af were included in this study and divided into 2 groups according to whether they received amiodarone ( atc code c01bd01 ) during the study period . hospitalized ischemic stroke ( icd-9-cm 433 and 434 ) was defined as the outcome of interest , and cases due to accident were excluded . the first event of hospitalized ischemic stroke was defined as the endpoint event in our study population . coding of ischemic stroke in the nhird was based on the neurologist 's diagnosis , brain computer tomography , or brain magnetic resonance imaging findings . all study subjects were followed from the index date to the date on which the outcome was recorded , to the time at which they withdrew from this insurance program , or to the end of 2011 , whichever occurred first . covariates in this study included age ( < 65 , 6574 , and 75 + years ) , sex , comorbidities , and medications . comorbidities included ischemic heart disease , diabetes , hypertension , heart failure , and hyperlipidemia with icd-9-cm codes 410414 , 250 , 401405 , 428 , and 272 , respectively . medications used included the antiplatelet agents aspirin , clopidogrel , and dipyridamole ; warfarin ; digoxin , with atc codes b01ac06 , b01ac04 , b01ac07 , b01aa03 , and c01aa05 , respectively . cardiac conversion ( procedure code 18028b ) and transcatheter radiofrequency ablation ( procedure code 33091a ) were also analyzed . the and student t tests were used to examine differences in categorical and continuous variables respectively , between the 2 groups . as not all patients received amiodarone during the study period , we used a cox proportional hazard model with time - dependent exposure covariates to reduce the bias resulting from overestimation of the effect of amiodarone on ischemic stroke risk . model 1 controlled for age , sex , ischemic heart disease , diabetes , hypertension , heart failure , hyperlipidemia , antiplatelet agent , warfarin , and digoxin covariates . model 2 controlled for cha2ds2vasc score , hyperlipidemia , antiplatelet agent , warfarin , and digoxin covariates . the age- , sex- , comorbidity- , and cha2ds2vasc - score - specific risks of ischemic stroke in patients who received amiodarone was compared with those who did not receive amiodarone . the joint effect of amiodarone- and af - associated medications on ischemic stroke was also analyzed . all statistical analyses were performed using sas software version 9.3 ( sas institute inc , carey , nc ) . for this study , we used data from the longitudinal health insurance database ( lhid ) , which is a part of the taiwan national health insurance research database ( nhird ) . the nhird was set up on march 1 , 1995 by the bureau of national health insurance of taiwan . the lhid includes all medical claims reported between 1996 and 2011 from 1 million beneficiaries randomly selected from among all insurants . disease definition was based on the international classification of diseases , 9th revision , clinical modification ( icd-9-cm ) , as recorded in the nhird . medication definitions were based on the anatomical therapeutic chemical ( atc ) classification system . in accordance with the personal information protection act , this study was approved by the institutional review board of the china medical university hospital , taiwan . we evaluated 16,091 patients who were diagnosed with af ( icd-9-cm 427.31 and 427.32 ) between 1998 and 2011 with the date of af diagnosis set as the index date . patients with a history of stroke ( icd-9-cm 430438 ) who received amiodarone before the index date or during the following 30 days , or who experienced stroke within 30 days of receiving amiodarone were excluded . finally , 7548 patients with af were included in this study and divided into 2 groups according to whether they received amiodarone ( atc code c01bd01 ) during the study period . hospitalized ischemic stroke ( icd-9-cm 433 and 434 ) was defined as the outcome of interest , and cases due to accident were excluded . the first event of hospitalized ischemic stroke was defined as the endpoint event in our study population . coding of ischemic stroke in the nhird was based on the neurologist 's diagnosis , brain computer tomography , or brain magnetic resonance imaging findings . all study subjects were followed from the index date to the date on which the outcome was recorded , to the time at which they withdrew from this insurance program , or to the end of 2011 , whichever occurred first . covariates in this study included age ( < 65 , 6574 , and 75 + years ) , sex , comorbidities , and medications . comorbidities included ischemic heart disease , diabetes , hypertension , heart failure , and hyperlipidemia with icd-9-cm codes 410414 , 250 , 401405 , 428 , and 272 , respectively . medications used included the antiplatelet agents aspirin , clopidogrel , and dipyridamole ; warfarin ; digoxin , with atc codes b01ac06 , b01ac04 , b01ac07 , b01aa03 , and c01aa05 , respectively . cardiac conversion ( procedure code 18028b ) and the and student t tests were used to examine differences in categorical and continuous variables respectively , between the 2 groups . as not all patients received amiodarone during the study period , we used a cox proportional hazard model with time - dependent exposure covariates to reduce the bias resulting from overestimation of the effect of amiodarone on ischemic stroke risk . model 1 controlled for age , sex , ischemic heart disease , diabetes , hypertension , heart failure , hyperlipidemia , antiplatelet agent , warfarin , and digoxin covariates . model 2 controlled for cha2ds2vasc score , hyperlipidemia , antiplatelet agent , warfarin , and digoxin covariates . the association between ischemic stroke and amiodarone dosage was also assessed . the age- , sex- , comorbidity- , and cha2ds2vasc - score - specific risks of ischemic stroke in patients who received amiodarone was compared with those who did not receive amiodarone . the joint effect of amiodarone- and af - associated medications on ischemic stroke was also analyzed . all statistical analyses were performed using sas software version 9.3 ( sas institute inc , carey , nc ) . during the study period , 2587 ( 34.3% ) patients with af received amiodarone and 4961 ( 65.7% ) did not . the mean age in both the groups was comparable ( 66.0 vs 65.8 years , respectively ) ( table 1 ) . patients who received amiodarone had more comorbidities than those who did not receive the drug , including ischemic heart disease ( 50.7% vs 41.9% ) , hypertension ( 66.3% vs 58.4% ) , heart failure ( 66.3% vs 17.6% ) , and hyperlipidemia ( 27.2% vs 23.4% ) . moreover , amiodarone - treated patients received more medications , including antiplatelet agents ( 67.3% vs 45.9% ) , warfarin ( 20.2% vs 12.0% ) , and digoxin ( 67.4% vs 56.7% ) , and underwent more cardiac conversions ( 2.63% vs 1.21% ) and transcatheter radiofrequency ablations ( 4.56% vs 1.65% ) than nonamiodarone - treated patients . patient demographic characteristics furthermore , the results of the crude , model 1 and model 2 cox proportional hazard regression analyses showed that the risk of ischemic stroke was 1.81-fold ( 95% confidence interval [ ci ] 1.522.16 ) , 1.81 ( 95% ci 1.502.17 ) , and 1.80-fold ( 95% ci 1.512.15 ) higher , respectively , in patients who received amiodarone ( p < 0.001 for all models ; table 2 ) . in model 1 , af patients aged 75 and between 65 and 74 years had an increased risk of stroke compared with those aged < 65 years ( age 75 years , hazard ratio [ hr ] 2.09 , ci 1.712.56 , p < 0.001 ; age 6475 years , hr 1.79 , ci 1.472.17 , p < 0.001 ) . in addition , af patients with diabetes or hypertension had a higher risk of ischemic stroke ( hr 1.44 and 1.41 , 95% ci 1.201.73 and 1.171.70 , p < 0.001 ) . patients who also received digoxin had a 1.69-fold increase in the risk of stroke ( 95% ci 1.412.03 ) , whereas those who received an antiplatelet agent or warfarin had a lower risk ( hr 0.71 and 0.66 , 95% ci 0.610.84 and 0.530.82 , p < 0.001 ) . moreover , cardiac conversion had no effect , but transcatheter radiofrequency ablation reduced stroke risk ( hr 0.33 , 95% ci 0.090.50 ) . the results of model 2 show that the risk of stroke increased with increasing cha2ds2vasc scores ( scores 23 , hr 2.44 , 95% ci 1.932.10 , p < 0.001 ; scores 45 , hr 3.36 , 95% ci 2.624.30 , p < 0.001 ; scores > 5 , 0.001 ) compared with patients with cha2ds2vasc scores of 0 to 1 . hrs and 95% ci for stroke in time - depended models analysis of the risk of stroke stratified by age , sex , or comorbidity showed that patients who received amiodarone had a significantly higher risk than those who did not ( table 3 ) . moreover , significant differences were observed between the 2 cohorts when patients were stratified by cha2ds2vasc score , except in those with a cha2ds2vasc score > 5 . hrs and 95% ci for stroke stratified by demographic and clinical covariates in time - dependent models compared with patients who did not receive amiodarone and an antiplatelet agent , patients receiving amiodarone alone had a higher risk of stroke than those taking amiodarone and antiplatelet agents , but this difference was not significant in model 1 . a similar trend was observed in patients who received amiodarone and warfarin , compared with those who received neither . furthermore , patients who received amiodarone and digoxin had the highest risk of ischemic stroke , followed by those who only received amiodarone , and those who only received digoxin , an effect seen in both the models . amiodarone displays multiple effects , including sodium , potassium , and calcium channel blocking , and noncompetitive -blocking . it is the most commonly used drug for rhythm control with superior effects in restoring and maintaining sinus rhythm , reducing the af recurrence rate , and improving patient quality of life . however , cardiac and noncardiac adverse events have been reported in patients receiving amiodarone therapy . the european society of cardiology recommends the use of the cha2ds2vasc score to guide the administration of antithrombotic therapy to patients with af . this scoring system includes 2 risk factor categories : major and clinically relevant nonmajor risk factors for stroke . the 2 major risk factors are age 75 years , and prior stroke , transient ischemic attack , or thromboembolism , whereas clinically relevant nonmajor risk factors include congestive heart failure , hypertension , diabetes mellitus , vascular disease ( myocardial infarction , complex aortic plaque , and peripheral arterial disease ) , age 65 to 74 years , and female sex . similarly , the american college of cardiology foundation and american heart association ( aha ) guidelines include diabetes mellitus , hypertension , dyslipidemia , smoking , obesity , and a family history of premature coronary artery disease ( cad ) as classical risk factors for cad . in our population - based cohort of 7548 patients with nonvalvular af , we found that amiodarone and digoxin use , age , diabetes , hypertension , and cha2ds2vasc score were independent risk factors for stroke , but the use of antiplatelet agents or warfarin had a protective effect . although amiodarone use was associated with a 1.81-fold increase in the risk of stroke , a higher daily dose of the drug did not increase this risk . af patients who were taking amiodarone and had no relative comorbidities had a higher risk of stroke than those who had comorbidities ( hr 2.79 , 95% ci 1.644.74 , p < 0.001 , vs hr 1.72 , 95% ci 1.422.07 , p < 0.001 , table 3 ) . based on the cha2ds2vasc score , age 75 and 65 to 74 years are considered a major and a classical risk factor , respectively . accordingly , in our study , we found that the risk of stroke increased with age ( table 2 ) . moreover , after adjustment for sex , comorbidities , and medications used , patients who were aged 75 years and received amiodarone treatment had a higher risk of stroke than those aged 65 to 74 years ( hr 1.85 , 95% ci 1.362.51 , p < 0.001 , vs hr 1.49 , 95% ci 1.102.02 , p < 0.05 , table 3 ) . however , compared with older patients , those < 65 years who received amiodarone had a greater risk of stroke ( hr 2.17 , 95% ci 1.573.00 , p < 0.001 ) . the stroke risk remained similar after adjustment for cha2ds2vasc score , hyperlipidemia , and medications used . these results suggest that compared with older patients , amiodarone treatment in patients < 65 years of age could be associated with a higher stroke risk . in addition , sex is considered another classical risk factor , with women with af considered to be at a higher risk of stroke . furthermore , amiodarone use was associated with a higher risk of stroke in women with af ( table 3 ) . according to the cha2ds2vasc score , oral anticoagulation as shown in table 2 , we also found that the stroke risk in af patients increased significantly with the cha2ds2vasc score . however , focusing on the interaction between amiodarone use and cha2ds2vasc score , amiodarone use in af patients with a cha2ds2vasc score of 0 to 1 was associated with a higher risk of stroke ( hr 2.89 , 95% ci 1.784.71 , p < 0.001 , table 3 ) . furthermore , although the stroke risk associated with amiodarone use in af patients decreased with increasing cha2ds2vasc scores , the stroke risk was not significant in patients with a cha2ds2vasc score > 5 ( hr 1.39 , 95% ci 0.712.74 , table 3 ) . one possible explanation may be that the effect of amiodarone use on stroke risk is weaker in af patients who are already at a higher risk , including those with more comorbidities , aged 75 years , and with a cha2ds2vasc score > 5 . these findings , that is , the interaction of amiodarone with age , sex , comorbidities , and cha2ds2vasc score suggest that amiodarone should be used with caution in af patients who have a low risk of stroke because of the higher stroke risk associated with amiodarone use . chang et al observed that digoxin use increased the risk of stroke in patients with af , suspecting that the increase in intracellular calcium levels may contribute to digoxin - mediated platelet activation . moreover , chirinos et al observed increased levels of cd62p expression in platelets and platelet - leukocyte conjugates , and endothelial activation markers in patients receiving digoxin . in this study , further examination of the interaction between amiodarone and digoxin revealed that digoxin use was an independent risk factor for stroke in af patients , whether adjusted for amiodarone use , age , sex , comorbidity , and medication used , or for amiodarone use , hyperlipidemia , cha2ds2vasc score , and medication used ( hr 1.69 , 95% ci 1.412.03 , p < 0.001 ; hr 1.77 95% ci 1.472.12 , p < 0.001 ; table 2 ) . as shown in table 4 , we found that the combined use of digoxin and amiodarone had a cumulative effect on stroke risk in af patients . however , although the mechanisms underlying this effect are not yet clear , a possible explanation may be that , due to the multiple effects of amiodarone , a crossover effect with digoxin may enhance intracellular calcium levels , thus contributing to digoxin - mediated platelet activation . as prevention of thromboembolism is an important measure to reduce in af patients , several guidelines for the administration of antithrombotic therapy have been published to address this issue , including the cha2ds2vasc score published by the european society of cardiology . in addition , according to the canadian cardiovascular society guidelines for the management of atrial fibrillation , oral anticoagulant therapy is indicated in af patients with prior stroke , hypertension , heart failure , and diabetes mellitus , whereas acetylsalicylic acid ( aspirin ) was recommended to af patients with cad but without a history of prior stroke , hypertension , heart failure , and diabetes mellitus . in our study , 44.89% patients had ischemic heart disease ( or cad ) , and antiplatelet agent use among all patients was around 53.23% ( 4018/7548 ) . moreover , we found that the ratio of antiplatelet agent use was proportional to the ratio of patients with ischemic heart disease , a finding that resulted in antiplatelet agents and warfarin having a similar protective effect in decreasing the stroke risk of amiodarone . furthermore , our results show that when administering amiodarone , af patients should also receive oral anticoagulation therapy with warfarin or antiplatelet agents according to their cha2ds2vasc score to decrease stroke risk ( table 4 ) . hrs and 95% ci for stroke and stroke - associated medications used in time - dependent models furthermore , after analysis of cardiac conversion and transcatheter radiofrequency ablation status , we found that the ratio of patients receiving cardiac conversion and transcatheter radiofrequency ablation was low in our study population . from our results , it appeared that undergoing cardiac conversion had no effect on stroke risk among af patients , but transcatheter radiofrequency ablation had a protective effect . our study had some limitations associated with retrospective cohorts . for example , the affirm study concluded that the majority of strokes in rhythm correction and rate control groups occurred in patients who had stopped taking warfarin or whose international normalization ratio ( inr ) was subtherapeutic at the time of the stroke . however , although a limitation of our study was that warfarin use status and actual inr level could not be evaluated , even though warfarin was not used by the majority of patients ( 14.82% , 1119/7548 ) ( table 1 ) , it had a protective effect in stroke risk among af patients ( table 2 ) . a second limitation is that smoking status and family history of stroke could not be analyzed because this information was not available in the nhird . third , we could not classify hyperlipidemia based on high - density lipoprotein , low - density lipoprotein , and triglyceride levels because this information was also not available in the nhird . amiodarone shows the highest rates of conversion to sinus rhythm , and the cardioversion of atrial fibrillation study in the international registry of poland reported a success rate of up to 75% . moreover , maintenance of sinus rhythm leads to a superior prognosis by improving cardiac function and relieving symptoms in af patients . although in our study , patients with or without any comorbidity treated with amiodarone had a significantly higher risk of stroke ( hr 1.79 and 1.78 , 95% ci 1.502.14 and 1.492.13 , p < 0.001 ) , the addition of an antiplatelet agent or warfarin appeared to reduce this risk . this finding suggests that the high sinus rhythm conversion rates of amiodarone may not reduce the risk of stroke in af patients . however , we are not able to fully explain the mechanism by which amiodarone increases stroke risk in af patients , and further basic science research and randomized controlled studies are needed to understand the underlying mechanisms behind this association . in conclusion , our results suggest that af patients receiving amiodarone treatment are at an increased risk of stroke , especially those with an initially low risk , but this risk may be reduced with the addition of antiplatelet drugs and warfarin . however , as the combination of digoxin and amiodarone further increases the risk of stroke , its administration to af patients should be avoided .

abstractatrial fibrillation ( af ) , the most common sustained arrhythmia requiring treatment worldwide , is one of the major causes of ischemic stroke . although amiodarone is commonly used for rhythm control in af , its relationship with stroke has rarely been addressed.we evaluated 16,091 patients who were diagnosed with af ( classification of diseases , 9th revision , clinical modification [ icd-9-cm ] 427.31 and 427.32 ) between 1998 and 2011 ; the date of af diagnosis was set as the index date . patients with a history of stroke ( icd-9-cm 430438 ) who received amiodarone before the index date or during the following 30 days , or who experienced stroke within 30 days of receiving amiodarone were excluded . finally , 7548 patients with af were included in this study and divided into 2 groups according to whether they received amiodarone ( anatomical therapeutic chemical code c01bd01 ) during the study period.the risk of ischemic stroke in af patients receiving amiodarone was 1.81-fold ( 95% confidence interval [ ci ] 1.522.16 ) , 1.79-fold ( 95% ci 1.502.14 ) , and 1.78-fold ( 95% ci 1.492.13 ) higher than in those who did not receive amiodarone , according to crude , model 1 , and model 2 cox proportional hazard regression models , respectively . in a demographically stratified analysis , the risk of ischemic stroke was significantly higher in patients aged < 65 years , with no comorbidities , who were also taking digoxin or had a low cha2ds2vasc score.amiodarone treatment is associated with an increased risk of stroke in patients with af , especially in those who have an initial low risk of stroke . antiplatelet drugs and warfarin could reduce the stroke risk in af patients receiving amiodarone . however , as the combination of digoxin and amiodarone increases the risk of stroke in these patients , the combination of these 2 drugs should be avoided .

overall , a total of 13,971 male employees and their spouses , after 12 h of fasting , underwent health check - ups during a baseline survey performed in 2004 and 2005 at the hitachi health care center in ibaraki prefecture . of these , 2,655 men received a computed tomography scan . the final analysis involved 1,106 men from the initial study who participated in a 3-year follow - up survey performed in 2007 and 2008 ( aged 3072 years in the baseline survey ) . the mean age of the men for whom follow - up data were available was younger than that of the men for whom follow - up data were not available . in addition , the mean age of the men who received a computed tomography examination in the baseline survey was greater than the mean age of the men who did not receive the computed tomography examination . no significant differences were seen between the other characteristics when age - adjusted comparisons were performed . self - reporting questionnaires were used to investigate whether the subjects were currently receiving medical treatment for hyperlipidemia , hypertension , or diabetes at the time of both surveys . body height and weight were measured using an automated scale ( bf-220 ; tanita ) , and the bmi was defined as the weight in kilograms divided by the square of the height in meters . vfa , sfa , and waist circumference were measured using a computed tomography scanner and protocols previously described ( 20 ) . in brief , single - slice imaging was performed at the umbilical level in a spine position using a redix turbo ct machine ( hitachi medico ) . the imaging conditions were 120 kv , 50 ma , and a slice thickness of 5 mm . vfa , sfa , and waist circumference were calculated using fatpointer software ( hitachi medico ) . triglyceride and hdl cholesterol levels were measured using the oxygen method with a hitachi 7600 device ( sekisui medical ) . blood glucose levels were measured using the glucose electrode technique with an adams glucose ga-1170 device ( arkrey ) . blood pressure was measured using an oscillometric method with a kentaro advance bp-203rv iii a / b device ( colin ) while the patient was in a sitting position and after the patient had rested for 3 min . informed consent was obtained from each examinee regarding the use of his or her data for research purposes . the current study was approved by the ethics review committee of the national center for global health and medicine . subjects with two or more of the following four factors , defined by the national cholesterol education program 's adult treatment panel iii guidelines ( 21 ) , with the exception of waist circumference , were defined to have clustering of metabolic risk factors : 1 ) triglyceride 150 mg / dl ( 1.69 mmol / l ) , 2 ) hdl cholesterol < 40 mg / dl ( 1.03 mmol / l ) , 3 ) systolic blood pressure ( sbp ) 130 mmhg or diastolic blood pressure ( dbp ) 85 mmhg , or 4 ) fasting plasma glucose 110 mg / dl ( 6.11 mmol / l ) . subjects currently receiving treatment for hyperlipidemia , hypertension , or diabetes were deemed as having the respective risk factor , regardless of the biochemical value . the baseline data and the 3-year changes ( ) in cvd risk - related variables ( i.e. , bmi , vfa , sfa , vfa / sfa , waist circumference , sbp , dbp , triglyceride , hdl cholesterol , and glucose ) were calculated for subjects who had not received a medical treatment in both surveys . the p value between baseline and the 3-year follow - up period was calculated using a paired t test . pearson correlation coefficients for the changes in the anthropometric and cvd risk variables were calculated . to establish the independent contribution of each anthropometric variable , multiple linear regression analyses were used to obtain the standardized partial regression coefficients , where the change in the cvd risk variable was the dependent variable and the changes in the anthropometric indices were the independent variables ; a stepwise procedure was used to select significant variables . all analyses were performed using spss ( version 15.0 ; spss , chicago , il ) . subjects with two or more of the following four factors , defined by the national cholesterol education program 's adult treatment panel iii guidelines ( 21 ) , with the exception of waist circumference , were defined to have clustering of metabolic risk factors : 1 ) triglyceride 150 mg / dl ( 1.69 mmol / l ) , 2 ) hdl cholesterol < 40 mg / dl ( 1.03 mmol / l ) , 3 ) systolic blood pressure ( sbp ) 130 mmhg or diastolic blood pressure ( dbp ) 85 mmhg , or 4 ) fasting plasma glucose 110 mg / dl ( 6.11 mmol / l ) . subjects currently receiving treatment for hyperlipidemia , hypertension , or diabetes were deemed as having the respective risk factor , regardless of the biochemical value . the baseline data and the 3-year changes ( ) in cvd risk - related variables ( i.e. , bmi , vfa , sfa , vfa / sfa , waist circumference , sbp , dbp , triglyceride , hdl cholesterol , and glucose ) were calculated for subjects who had not received a medical treatment in both surveys . the p value between baseline and the 3-year follow - up period was calculated using a paired t test . pearson correlation coefficients for the changes in the anthropometric and cvd risk variables were calculated . to establish the independent contribution of each anthropometric variable , multiple linear regression analyses were used to obtain the standardized partial regression coefficients , where the change in the cvd risk variable was the dependent variable and the changes in the anthropometric indices were the independent variables ; a stepwise procedure was used to select significant variables . all analyses were performed using spss ( version 15.0 ; spss , chicago , il ) . the anthropometric and cvd risk variables at the baseline survey and changes at the 3-year follow - up period are shown in table 1 . the mean ( sd ) age of the subjects was 52.7 ( 8.4 ) years at baseline . kg / m , the mean vfa was 120.0 ( 52.2 ) cm , and the mean waist circumference was 85.6 ( 8.1 ) cm at baseline . anthropometric and cvd risk variables at baseline and changes during the 3-year follow - up period ( n = 1,106 ) pearson correlation coefficients for the changes in the anthropometric measurements and cvd risk variables are shown in table 2 . strong correlations among the changes in the four adiposity indices were observed , with a colinearity observed among the indices . correlations among the body weight , sfa , and waist circumference were also strong , but the correlation between the body weight and vfa was weak . these findings suggested that the body weight was not an exact surrogate marker of vfa . significant correlations between the log triglyceride and vfa , the log triglyceride and body weight , the sbp and sfa , the sbp and body weight , and the glucose and body weight were observed . the correlation coefficients were essentially unchanged after adjustments for age ( data not shown ) . pearson correlation coefficients among changes in anthropometric and cvd risk variables ( n = 1,106 ) multiple linear regression analyses showed that the changes in vfa , sfa , body weight , and waist circumference were independently associated with the changes in cvd risk factors during the 3-year follow - up period ( table 3 ) . the dbp , glucose , log triglyceride , and hdl cholesterol were significantly affected by both the vfa and sfa . the log triglyceride and hdl cholesterol values were more strongly affected by the vfa than by the sfa . these results suggest that the vfa and sfa contribute differently to the cvd risk variables . a multiple regression analysis showed that the vfa were significantly related to the log triglyceride and hdl cholesterol and were independent of the body weight and waist circumference . independent associations of changes in vfa , sfa , body weight , and waist circumference with changes in the cvd risk factors during the 3-year follow - up period according to multiple linear regression analyses this study investigated the change in metabolic risk factors between a baseline examination and a 3-year follow - up examination , measured using computed tomography . the changes in body weight and vfa showed weak correlation , suggesting that changes in body weight are not an exact surrogate marker of changes in vfa . a multiple regression analysis showed that the vfa was significantly related to triglyceride and hdl cholesterol independently of body weight and waist circumference , suggesting the importance of monitoring vfa over time . in previous cross - sectional studies , positive correlations between vfa and sbp and between vfa and serum triglyceride were reported to be significant when vfa was measured by computed tomography ( 14 ) . in previous longitudinal studies , the effects of changes in bmi ( 22 ) , weight ( 23 ) , and waist circumference ( 24,25 ) on metabolic risk factors were examined . one such report showed a strong linear trend between increasing bmi and a worsening of various variables of metabolic risk factors , including blood pressure and lipid profiles ( 24 ) . likewise , another report showed that weight changes were linearly related to all measurements of each component of the metabolic risk factors ( 23 ) . other studies have shown that a reduction in the waist circumference and the vfa achieved through lifestyle modifications is closely linked to an improvement in metabolic risk factors ( 19,25 ) . these studies suggest that the changes in bmi , weight , waist circumference , and vfa are related to risk factors for cvd . however , the impact of the change in the vfa ( measured twice in the same person ) , which is regarded as the strongest indicator of cvd risk among the anthropometric variables , has remained uncertain . to our knowledge , this is the first study to analyze the relationships between changes in vfa and changes in metabolic risk factors , compared with other anthropometric variables , in a large population . our findings clearly showed that the vfa were significantly related to the log triglyceride and hdl cholesterol and were independent of the body weight and waist circumference . in previous studies ( 22 ) , the mean value of each component of metabolic risk factors or the prevalence of metabolic risk factors and its components were compared according to changes in bmi , body weight , and waist circumference . this is the first study that compared the strength of the association of metabolic risk factors with the change in vfa in a large population . the current study has the following strengths : the study had a longitudinal design and examined the relationships between metabolic risk factors and the change in vfa using computed tomography scans performed twice on the same subject . the number of subjects was relatively large , with > 1,000 subjects being followed over a 3-year period . our study is thought to have a small measurement bias because vfa and sfa were measured using the same computed tomography machine , in the same region , and at the same state of expiration during both the baseline examination and the 3-year follow - up examination . a random measurement error could have diluted the relationship between vfa and the metabolic risk factors . the study subjects were limited to men , and further studies in women are needed . in conclusion , the current study of japanese men showed that changes in the vfa were associated with changes in metabolic risk factors . the vfa was significantly related to log triglyceride and hdl cholesterol and was independent of body weight and waist circumference , suggesting the importance of measuring the vfa repeatedly over time . the adoption of a lifestyle that does not result in an increase in vfa is important in preventing metabolic syndrome .

objectivethe effects of longitudinal changes in the visceral fat area ( vfa ) , and other anthropometric indices , on the risk factors of metabolic syndrome were not studied . we calculated the changes in metabolic risk factors in relation to changes in certain anthropometric indices in a large - scale study of japanese men.research design and methodsthe subjects were 1,106 men participating in the hitachi health study who received a computed tomography examination in both 2004 and 2007 . vfa , subcutaneous fat area ( sfa ) , and waist circumference were measured using the computed tomography . we examined how longitudinal changes in each anthropometric index over a 3-year period influenced the value of each metabolic risk factor.resultschanges ( ) over a 3-year period in body weight , sfa , and waist circumference strongly correlated , while the changes in body weight and vfa were weakly correlated . changes in the vfa were associated with changes in metabolic risk factors , especially changes in triglyceride and hdl ; we found these changes to be independent of the body weight and waist circumference.conclusionschange in body weight is not a precise surrogate marker of vfa , and repeated vfa measurements over time are useful . adopting a lifestyle that does not increase the vfa is important in preventing metabolic syndrome .

resistance exercise helps improve the strength of all the muscles of the body and can be performed continuously at any location . well - designed resistance exercise programs have been reported to effectively improve muscle strength and the ability to perform exercise , increase fat - free mass , and decrease body fat1 . the most important aspect of resistance exercise is identifying the appropriate intensity for the exercise , and repetition maximum ( rm ) is most frequently determined for identifying the appropriate intensity . during resistance exercises , 1rm should be changed depending on exercise intensities in order for the exercise to be effective2 . resistance exercise at 80% rm or higher are classified as muscle strengthening exercise , that at 75% rm as muscle strength exercise , and that at 60% rm as muscle endurance exercise . although resistance exercises at 7080% rm are effective for muscle strength enhancement in beginners , those at 85% rm or higher are effective for muscle strength enhancement in experts3 . however , resistance exercises performed without considering a participant s ability can result in injury . the degrees of muscle damage are similar during high- , medium- , and low - intensity resistance exercises4 . however , different degrees of muscle damage have been reported to occur according to the type of muscle resistance exercise , the degree of muscle contraction , and exercise load5 . based on the findings of studies on muscle damage , muscle fatigue , and changes in hormone levels after muscle resistance exercise , studies that aim to minimize side effects after exercise should be performed . vibrations of muscles before exercise have positive effects on motor skill improvement , and are used to increase the metabolic and blood flow rates of individuals in the fields of sports and rehabilitation6 . the effects of vibrations vary with frequency , and frequencies of 1550 hz have been reported to promote oxidation , increase oxygen uptake , help blood circulation , and raise skin temperature7 . one study reported that muscle pain reduced after stretching on a machine vibrating at a frequency of 35 hz before resistance exercises8 . another study with 20 adults showed that blood flow through the quadriceps femoris and gastrocnemius increased with the application of vibrations , which caused the inflow of blood into the muscles9 . additionally , a study reported that muscle pain and creatine phosphokinase ( cpk ) level decreased significantly with the application of vibrations at a frequency of 50 hz before treadmill exercise10 . although studies on the positive effects of vibrations on muscles have been performed , no study has evaluated the effects of vibrations before resistance exercise at different intensities on the levels of stress hormones . therefore , the purpose of the present study was to determine whether vibrations should be applied before resistance exercise by examining changes in stress hormones levels with the application of vibrations resistance exercises at different intensities . the present study included 18 healthy male subjects in their 20s , having less than 6 months of experience in weight training and residing in k city , south korea . the subjects were randomly divided into 1rm 50% group ( 50%rmg , n = 6 ) , 1rm 70% group ( 70%rmg , n = 6 ) , and 1rm 90% group ( 90%rmg , n = 6 ) . subjects in the 50%rmg had a mean age , height , and weight of 21.5 2.42 years , 170.2 6.68 cm , and 71.1 14.11 kg , respectively . those in the 70%rmg had a mean age , height , and weight of 22.3 2.40 years , 172.9 6.14 cm , and 70.5 7.23 kg , respectively . additionally , those in the 90%rmg had a mean age , height , and weight of 21.12 2.13 years , 172.1 5.35 cm , and 70.38 6.35 kg , respectively . the subjects voluntarily participated in the study after receiving explanations about the intent and purpose of the study . the three groups had no statistically significant differences of physical characteristic of subjects such as age , height , body weight and body fat ( p < 0.05 ) ; therefore , the groups were homogeneous . the smith squat exercise for resistance training was used to examine changes in the levels of stress hormones with the application of vibrations before resistance exercises at the following intensities : 1rm 50% ( maximum number of repetitions 30 ) , 1rm 70% ( maximum number of repetitions 1215 ) , and 1rm 90% ( maximum number of repetitions 34 ) . the subjects performed three sets of smith squats , and vibrations were applied for 1 min before each set . a vibratory apparatus sky life - sm290 ( maxton , korea ) capable of frequencies of 260 hz was used . the frequency was fixed at 30 hz , and vibrations were applied at knee flexion to sufficiently stimulate the quadriceps femoris and gastrocnemius . blood was collected at rest , immediately after exercise , and 24 h after recovery from exercise to analyze levels of the stress hormones epinephrine , norepinephrine , and dopamine . to examine changes in the levels of the stress hormones in each group , one - way repeated anova was performed using spss 20.0 for windows on the basis of the levels at rest in each group . all of the subjects understood the purpose of this study and provided written informed consent prior to their participation in the study in accordance with the ethical standards of the declaration of helsinki . epinephrine levels were significantly higher immediately after exercise than at rest in the 50%rmg ( p < 0.05 ) ; however , no significant changes were noted in these levels in the 70%rmg and 90%rmg . the levels of norepinephrine were significantly higher immediately after exercise than at rest in all the three groups ( p < 0.05 ) . however , no significant changes in the levels of dopamine were noted in any of the three groups ( table 1table 1.changes in stress hormones ( in pg / ml ) after the application of vibrations during resistance exercises at different intensitiesgroupat restimmediately after exerciseat 24 hours after exerciseepinephrine50%rm44.7 16.599.9 30.0 * 52.2 28.470%rm70.2 27.3112.3 48.062.7 20.390%rm56.5 13.868.5 26.659.6 30.4norepinephrine50%rm403.8 192.31196.1 659.6 * 362.0 156.670%rm466.9 174.01219.7 542.4 * 336.9 93.390%rm489.7 255.4815.6 434.4 * 295.6 89.5dopamine50%rm32.7 6.045.4 12.431.7 3.270%rm33.6 5.932.0 3.232.2 3.590%rm34.8 5.839.1 15.531.5 2.6 * statistically significant difference between rest ( p<0.05 ) ) . physiological stress in the body is determined by assessing changes in catecholamines and cortisol levels , and epinephrine and norepinephrine are considered representative catecholamines11 . epinephrine and norepinephrine levels increase when the sympathetic system is activated by physical activities . during exercise , epinephrine is secreted from the adrenal medulla and norepinephrine from the sympathetic terminal12 . the major function of epinephrine includes promoting glycogenolysis and lipolysis during energy metabolism , and norepinephrine is a precursor of epinephrine , which is secreted from the sympathetic terminal to function as a neurotransmitter . the arterial plasma levels of these two hormones are known to continuously increase with exercise time and intensity . epinephrine levels do not increase during low - intensity exercise not involving mental stress , and its levels increase when oxygen uptake rises to at least 60% of the maximum oxygen uptake . norepinephrine levels increase at exercise intensities that increase oxygen uptake to > 50% of the maximum oxygen uptake , and its levels have been reported to increase by up to six times those at rest during maximum intensity exercise13 . therefore , measurement of the levels of stress hormones help evaluate the degree of physiological stress in the body according to the intensity of resistance exercise , and enable the identification of changes in the levels after vibrations are applied . in the present study , epinephrine levels were significantly higher immediately after exercises than at rest in the 50%rmg ( p < 0.05 ) , and no significant changes in these levels were noted in the 70%rmg and 90%rmg . therefore , the application of vibrations at a frequency of 30 hz before the 70%rm and 90%rm resistance exercises did not result in significant changes in epinephrine levels immediately after exercise . the use of vibrations at frequencies of 2050 hz is recommended because vibrations at frequencies below 20 hz induce excessive relaxation of muscles and those at frequencies over 50 hz cause muscle pain14 . in general , vibration of muscles at 2545 hz is used to increase muscle strength and mass15 , and the application of vibrations has been reported to have positive effects on the muscle function recovery of delayed - onset muscle soreness16 . vibrations suppress interneuronal activities of the skin and spinal cord receptors that reduce pain signals crossing -exercise nerves and c fibers and instead cause the migration of these signals to the spinal cord and brain8 . in addition , vibrations have been shown to affect capillary vessels and reduce lactic acid levels9 , and a study has presented the mechanism underlying the activation of the neuromuscular system that may improve the ability of the neuromuscular system to function appropriately18 . the activation of muscle spindle receptors with vibrations has been reported to have positive effects not only on the directly stimulated muscles but also on the surrounding muscles.19 a study of 29 male subjects who ran downhill for 40 min reported that the levels of the inflammatory markers il-6 and histamine , as well as muscle pain in the femoral region decreased significantly in the group in which vibrations were applied before the run20 . on the basis of the results , vibrations of muscles before activities may help reduce epinephrine levels . in the present study , vibrations applied at a frequency of 30 hz before 70%rm and 90%rm resistance exercises suppressed increases in epinephrine levels immediately after exercise . in the future , studies on the effects of vibrations on muscles and the areas of application should be performed by using different intensities of resistance , frequencies of vibration , and physiological variables .

[ purpose ] the purpose of the present study was to determine whether vibrations should be applied before resistance exercises by examining changes in stress hormone levels with vibrations applied before different exercise intensities . [ subjects ] eighteen male subjects in their 20s were included , and were randomly divided into one - repetition maximum ( 1rm ) 50% group ( 50% rmg , n = 6 ) , 1rm 70% group ( 70%rmg , n = 6 ) , and 1rm 90% group ( 90% rmg , n = 6 ) . [ methods ] three sets of smith squats were performed at 1rm 50% , 70% , and 90% according to resistance intensities , and vibrations were applied for 1 min at a fixed frequency of 30 hz before each set . epinephrine , norepinephrine , and dopamine stress hormone levels were analyzed . [ results ] epinephrine levels were significantly higher immediately after exercise than at rest in the 50%rmg ; however , no significant changes were noted in the 70%rmg and 90%rmg . norepinephrine levels were significantly higher immediately after exercise than at rest in all three groups . however , no significant changes in dopamine levels were noted in the three groups . [ conclusion ] the application of vibrations at a frequency of 30 hz before 70%rm and 90%rm resistance exercises suppressed increases in the stress hormone epinephrine levels immediately after exercise .

clientowned dogs diagnosed with ckd were prospectively recruited from the patient population referred to the ohio state university veterinary medical center ( osuvmc ) between january 2014 and july 2015 . a diagnosis of ckd was made based on the presence of at least 2 episodes , over at least 3 months , of minimally concentrated urine ( urine specific gravity [ usg ] < 1.030 ) with or without azotemia in the absence of other diseases likely to cause polyuria or polydipsia . additional factors used to determine eligibility included the presence of renal proteinuria , ultrasonographic changes consistent with ckd ( e.g , loss of corticomedullary distinction ) or both . dogs were not consistently enrolled at the time of diagnosis , nor were all dogs enrolled in fasted states because of the manner in which dogs were presented to the teaching hospital . based on serum creatinine concentrations , dogs were assigned to 1 of 4 ckd iris stages : < 1.4 mg / dl stage 1 ; 1.42.0 mg / dl stage 2 ; 2.15.0 mg / dl stage 3 ; and > 5.0 mg / dl stage 4 , respectively.21 dogs < 1 year of age , those diagnosed primary hyperparathyroidism or primary hypoparathyroidism , proteinlosing enteropathy , or neoplasia were excluded . dogs receiving corticosteroids and dogs diagnosed with acute kidney injury or suspected acute exacerbation of ckd were excluded . dogs enrolled as controls , recruited specifically for this study , were deemed healthy based on normal history , physical examination , cbc , serum biochemistry profile , and urinalysis with a usg > 1.030 . the study was approved by the ohio state university 's institutional animal care and use committee and the clinical research advisory committee , and all owners signed a consent form before dogs were enrolled in the study . after determining eligibility , each ckd dog had a complete physical examination performed , including body weight , body condition score ( bcs ) , and muscle condition score ( mcs ) . blood was collected by jugular venipuncture , and urine was collected by cystocentesis for cbc , serum biochemistry profile , serum ionized calcium concentration , urinalysis , urine culture , and urine protein : creatinine ( upc ) ratio . additional serum was stored at 80c for analysis of vitamin d metabolite and pth concentrations , and edta plasma was stored at 80c for fgf23 analysis . information regarding medications , diets , and dietary supplements was recorded , and nutrient profiles of the diets the dogs were eating were obtained from the manufacturers . serum 25hydroxyvitamin d [ 25(oh)d ] and 1,25dihydroxyvitamin d [ 1,25(oh)2d ] were measured by radioimmunoassay , and 24,25(oh)2d by liquid chromatographymass spectrometry by a vitamin d external quality assessment scheme ( dequas)certified laboratory.1 serum whole pth concentrations were measured with an immunoradiometric assay utilizing a polyclonal 184 pth antibody.2 interassay coefficient of variation is reported to be 10% , intraassay coefficient of variation is reported to be 3% , and functional sensitivity is reported to be 0.3 pmol / l for this assay . plasma fgf23 concentrations were measured using a humanspecific elisa,3 previously validated for measurement in dogs . analysis of variance was used to compare outcomes by iris stage , utilizing a tukeykramer adjustment for multiple comparisons . multivariable linear regression also was used to explore the relationship between vitamin d metabolites and the other relevant biomarkers , taking care to not include predictors that were collinear . statistical analysis was performed using a commercial statistical software package.4 pvalues .05 were considered statistically significant . clientowned dogs diagnosed with ckd were prospectively recruited from the patient population referred to the ohio state university veterinary medical center ( osuvmc ) between january 2014 and july 2015 . a diagnosis of ckd was made based on the presence of at least 2 episodes , over at least 3 months , of minimally concentrated urine ( urine specific gravity [ usg ] < 1.030 ) with or without azotemia in the absence of other diseases likely to cause polyuria or polydipsia . additional factors used to determine eligibility included the presence of renal proteinuria , ultrasonographic changes consistent with ckd ( e.g , loss of corticomedullary distinction ) or both . dogs were not consistently enrolled at the time of diagnosis , nor were all dogs enrolled in fasted states because of the manner in which dogs were presented to the teaching hospital . based on serum creatinine concentrations , dogs were assigned to 1 of 4 ckd iris stages : < 1.4 mg / dl stage 1 ; 1.42.0 mg / dl stage 2 ; 2.15.0 mg / dl stage 3 ; and > 5.0 mg / dl stage 4 , respectively.21 dogs < 1 year of age , those diagnosed primary hyperparathyroidism or primary hypoparathyroidism , proteinlosing enteropathy , or neoplasia were excluded . dogs receiving corticosteroids and dogs diagnosed with acute kidney injury or suspected acute exacerbation of ckd were excluded . dogs enrolled as controls , recruited specifically for this study , were deemed healthy based on normal history , physical examination , cbc , serum biochemistry profile , and urinalysis with a usg > 1.030 . the study was approved by the ohio state university 's institutional animal care and use committee and the clinical research advisory committee , and all owners signed a consent form before dogs were enrolled in the study . after determining eligibility , each ckd dog had a complete physical examination performed , including body weight , body condition score ( bcs ) , and muscle condition score ( mcs ) . blood was collected by jugular venipuncture , and urine was collected by cystocentesis for cbc , serum biochemistry profile , serum ionized calcium concentration , urinalysis , urine culture , and urine protein : creatinine ( upc ) ratio . additional serum was stored at 80c for analysis of vitamin d metabolite and pth concentrations , and edta plasma was stored at 80c for fgf23 analysis . information regarding medications , diets , and dietary supplements was recorded , and nutrient profiles of the diets the dogs were eating were obtained from the manufacturers . serum 25hydroxyvitamin d [ 25(oh)d ] and 1,25dihydroxyvitamin d [ 1,25(oh)2d ] were measured by radioimmunoassay , and 24,25(oh)2d by liquid chromatographymass spectrometry by a vitamin d external quality assessment scheme ( dequas)certified laboratory.1 serum whole pth concentrations were measured with an immunoradiometric assay utilizing a polyclonal 184 pth antibody.2 interassay coefficient of variation is reported to be 10% , intraassay coefficient of variation is reported to be 3% , and functional sensitivity is reported to be 0.3 pmol / l for this assay . plasma fgf23 concentrations were measured using a humanspecific elisa,3 previously validated for measurement in dogs . analysis of variance was used to compare outcomes by iris stage , utilizing a tukeykramer adjustment for multiple comparisons . multivariable linear regression also was used to explore the relationship between vitamin d metabolites and the other relevant biomarkers , taking care to not include predictors that were collinear . statistical analysis was performed using a commercial statistical software package.4 pvalues .05 were considered statistically significant . breeds represented among ckd dogs were mixed breed ( n = 15 ) , labrador retriever ( n = 4 ) , and golden retriever ( n = 3 ) . there were 2 cocker spaniels , 2 shetland sheepdogs , and 1 each of the following breeds : australian cattle dog , boxer , doberman , fox terrier , greyhound , german shepherd , jack russell terrier , miniature schnauzer , pekingese , pomeranian , shih tzu , vizsla , weimaraner , welsh terrier , and whippet . sixteen male ( 15 castrated ) and 21 female ( 20 spayed ) dogs were included . control dogs included mixed breed ( n = 4 ) , american pit bull terrier ( n = 3 ) , german shepherd ( n = 2 ) , and rottweiler ( n = 1 ) . median body weight of ckd dogs was 20.0 kg ( range , 3.658.7 kg ) . using the 9point scoring system , median bcs was 6 ( range , 28 ) . three dogs were underconditioned ( bcs < 4 ) , 15 dogs had an ideal bcs ( 45 ) , and 19 dogs were overconditioned ( bcs > 5 ) . body condition score was negatively correlated with serum creatinine concentration ( r = 0.45 ; p = .002 ) . muscle loss was noted to be mild in 8 dogs , moderate in 1 dog , and severe in 2 dogs . median body weight of control dogs was 26.2 kg ( range , 13.547.0 kg ) . all control dogs had normal mcs . according to the iris ckd staging system ( table 1 ) , dogs were classified as stage 1 ( n = 10 ) , stage 2 ( n = 9 ) , stage 3 ( n = 12 ) , or stage 4 ( n = 6 ) . median serum creatinine concentration was 2.0 mg / dl ( range , 0.512.9 mg / dl ) . median urine protein : creatinine ratio ( upc ) was 0.6 ( range , 0.19.6 ) . based on iris substages , dogs were classified as nonproteinuric ( n = 11 ) , borderline proteinuric ( n = 7 ) , or proteinuric ( n = 19 ) . one dog had light growth ( 600 colonyforming units [ cfu ] per ml ) , 1 had 30,000 cfu / ml , and 1 had > 100,000 cfu / ml . median systolic blood pressure was 148 mm hg ( range , 115240 mm hg ) . each dog received a blood pressure substage : minimal risk ( n = 18 ) , low risk ( n = 5 ) , moderate risk ( n = 7 ) , or high risk ( n = 6 ) laboratory parameters of chronic kidney disease ( ckd ) and healthy control dogs median serum total calcium concentration was 10.8 mg / dl ( range , 8.113.0 mg / dl ) . it was within reference range ( 9.311.6 mg / dl ) for 31 ckd dogs , low in 1 dog , and high in 5 dogs . median serum ionized calcium concentration was 5.31 mg / dl ( range , 4.036.02 mg / dl ) . serum ionized calcium concentrations were within reference range ( 4.95.8 mg / dl ) in 32 ckd dogs , low in 4 dogs and high in 1 dog . median serum phosphorus concentration in ckd dogs was 4.3 mg / dl ( range , 1.614.4 mg / dl ) . a recent expert panel suggested that maintenance of serum phosphate concentrations within the following ranges is optimal management for dogs with ckd : 2.54.5 mg / dl for dogs with stages 1 and 2 ckd , 2.55.0 mg / dl for stage 3 , and 2.56.0 mg / dl for stage 4.5 based on these recommendations , 3 of 10 stage 1 ckd dogs were hypophosphatemic and 7 of 10 were normophosphatemic . of stage 2 ckd dogs , 1 of 9 was hypophosphatemic , 6 of 9 were normophosphatemic , and 2 of 9 were hyperphosphatemic . of stage 3 ckd dogs , 7 of 12 were normophosphatemic , and 5 of 12 were hyperphosphatemic . of stage 4 ckd dogs , 1 of 6 was normophosphatemic and 5 of 6 were hyperphosphatemic . serum cpp were determined . median cpp for ckd dogs was 39.3 ( range , 27.060.5 mg / dl ) . of those dogs , stage 2 ( n = 1 ) , stage 3 ( n = 3 ) , and stage 4 ( n = 5 ) ckd were represented . serum cpp was negatively correlated with all vitamin d metabolites ( table 2 ; p < .001 ) . serum cpp was positively correlated with creatinine , pth , and fgf23 ( p < .001 ) . pearson correlations ( r ) between vitamin d metabolites and other parameters * p < .05 ; ^p < .01 ; p < 0.001 . all vitamin d metabolites were lower in ckd compared to healthy control dogs ( table 1 ) , reaching statistical significance with iris stages 3 and 4 ( all adjusted pvalues < .05 ) . vitamin d metabolite concentrations were not significantly different between controls and dogs with stages 1 and 2 ckd ( figs 1 , 2 , 3 ) . pearson correlation coefficients between vitamin d metabolites and creatinine , fgf23 , pth , calcium , and phosphorus are listed in table 2 . serum 25(oh)d concentrations based on international renal interest society stage ( 14 ) and healthy control dogs . the boxes represent the 25th and 75th percentiles , and the central lines in the boxes represent the median values . serum 1,25(oh)2d concentrations based on international renal interest society stage ( 14 ) and healthy control dogs . the boxes represent the 25th and 75th percentiles , and the central lines in the boxes represent the median values . the double asterisk represents significantly different from control and iris stages 1 and 2 dogs . serum 24,25(oh)2d concentrations based on international renal interest society stage ( 14 ) and healthy control dogs . the boxes represent the 25th and 75th percentiles , and the central lines in the boxes represent the median values . the single asterisk represents significantly different from control and iris stages 1 and 2 dogs . the double asterisk represents significantly different from control and iris stages 1 and 2 dogs . serum 25(oh)d concentration was negatively correlated with phosphorus ( r = 0.55 ; p < .001 ) , pth ( r = 0.42 ; p = .003 ) , fgf23 ( r = 0.39 ; p = .009 ) , and cpp ( r = 0.43 ; p = .002 ) . a doubling of serum creatinine concentration was associated with a 14% decrease in 25(oh)d ( p = .005 ) ( fig 4 ) . positive correlations were found between 25(oh)d and total calcium ( r = 0.33 ; p = .02 ) and ionized calcium ( r = 0.33 ; p = .047 ) . serum 1,25(oh)2d concentration was negatively correlated with fgf23 ( r = 0.64 ; p < .001 ) , phosphorus ( r = 0.61 ; p < .001 ) , and pth ( r = 0.50 ; p < .001 ) . serum 24,25(oh)2d concentration was negatively correlated fgf23 ( r = 0.55 ; p < .001 ) , phosphorus ( r = 0.55 ; p < .001 ) , and pth ( r = 0.48 ; p < .001 ) . serum pth was significantly higher in iris stage 3 ( p = .0065 ) and stage 4 ( p < .001 ) ckd dogs compared to healthy control dogs . eight dogs had pth concentrations above the upper limit of the laboratory 's reference range of 5.8 pmol / l . of these 8 dogs , 3 were classified as stage 3 ckd and 5 were classified as stage 4 ckd . these dogs had a median serum phosphorus concentration of 8.4 mg / dl ( range , 2.714.4 mg / dl ) , notably higher than observed in dogs with lower stages of ckd . one control dog had a serum pth concentration above the upper limit of the laboratory 's reference range . there was no additional serum available to recheck this result from the time of enrollment , but approximately 18 months later , the dog had a normal serum pth concentration of 1.2 pmol / l . using this repeated result , we hypothesize that this dog 's blood was collected early in the morning and was affected by diurnal variation in serum pth concentration in dogs.22 median fgf23 concentration in 34 ckd dogs was 467 pg / ml ( range , 14241,265 pg / ml).6 as compared to control dogs , fgf23 concentrations were significantly higher in ckd dogs with iris stages 3 and 4 disease ( p < .001 ) , but not between controls and earlier stages . compared to the upper range of 449 pg / ml in the control dogs , 19 of 34 ckd dogs had high fgf23 concentrations with a median of 2,520 pg / ml ( range , 45441,265 pg / ml ) . all iris stages were represented : stage 1 ( n = 1 ) , stage 2 ( n = 2 ) , stage 3 ( n = 10 ) , and stage 4 ( n = 6 ) . three ckd dogs , iris stage 1 ( n = 1 ) and stage 3 ( n = 2 ) , did not have their fgf23 concentrations measured . dogs with ckd were receiving a variety of medications , including enalapril ( n = 9 ) , antibiotics ( n = 6 ) , aluminum hydroxide ( n = 5 ) , famotidine ( n = 5 ) , tramadol ( n = 5 ) , gabapentin ( n = 4 ) , omeprazole ( n = 4 ) , amlodipine ( n = 3 ) , ondansetron ( n = 3 ) , sc fluids ( n = 3 ) , diphenhydramine ( n = 3 ) , heartworm preventative ( n = 3 ) , mirtazapine ( n = 2 ) , phenylpropanolamine ( n = 2 ) , diethylstilbestrol ( des ; n = 2 ) , nonsteroidal antiinflammatory drug ( nsaid ; n = 2 ) , flea / tick preventative ( n = 2 ) , sevelamer ( n = 1 ) , maropitant ( n = 1 ) , soloxine ( n = 1 ) , trazodone ( n = 1 ) , aspirin ( n = 1 ) , and cyclosporine ( n = 1 ) . at the time of enrollment , 17 dogs were reported to be eating 1 veterinary therapeutic renal diets and 18 dogs were eating a variety of other commercial diets . ten dogs ate a combination of dry and canned diets , and 1 dog ate canned food exclusively . almost all dogs ( n = 34 ) were reported to receive a variety of treats and foods intended for human consumption . the specific amount of ingested cholecalciferol could not be determined given the variability in daily intake and the lack of many owners ' abilities to provide exact amounts fed . to assess for a relationship between dietary cholecalciferol intake and serum 25(oh)d concentrations , dietary intake was defined by the iu/100 kcal of cholecalciferol from the dog 's primary diet source . the amount of dietary cholecalciferol ingested was unavailable for 6 dogs , 4 that were eating commercial diets and 2 that were eating variable homeprepared diets . there was no relationship between cholecalciferol intake and serum 25(oh)d ( r = 0.19 , p = .25 ) . supplements that were administered included fish oil ( n = 10 ) , joint health supplements ( n = 7 ) , multivitamin ( n = 2 ) , cranberry supplement ( n = 2 ) , symbiotic ( n = 2 ) , probiotic ( n = 1 ) , sadenosylmethionine / silybin ( n = 1 ) , niacinamide ( n = 1 ) , calcium carbonate ( n = 1 ) , calcitriol ( n = 1 ) , and vitamin e ( n = 1 ) . according to the iris ckd staging system ( table 1 ) , dogs were classified as stage 1 ( n = 10 ) , stage 2 ( n = 9 ) , stage 3 ( n = 12 ) , or stage 4 ( n = 6 ) . median serum creatinine concentration was 2.0 mg / dl ( range , 0.512.9 mg / dl ) . median urine protein : creatinine ratio ( upc ) was 0.6 ( range , 0.19.6 ) . based on iris substages , dogs were classified as nonproteinuric ( n = 11 ) , borderline proteinuric ( n = 7 ) , or proteinuric ( n = 19 ) . one dog had light growth ( 600 colonyforming units [ cfu ] per ml ) , 1 had 30,000 cfu / ml , and 1 had > 100,000 cfu / ml . median systolic blood pressure was 148 mm hg ( range , 115240 mm hg ) . each dog received a blood pressure substage : minimal risk ( n = 18 ) , low risk ( n = 5 ) , moderate risk ( n = 7 ) , or high risk ( n = 6 ) . median serum total calcium concentration was 10.8 mg / dl ( range , 8.113.0 mg / dl ) . it was within reference range ( 9.311.6 mg / dl ) for 31 ckd dogs , low in 1 dog , and high in 5 dogs . median serum ionized calcium concentration was 5.31 mg / dl ( range , 4.036.02 mg / dl ) . serum ionized calcium concentrations were within reference range ( 4.95.8 mg / dl ) in 32 ckd dogs , low in 4 dogs and high in 1 dog . median serum phosphorus concentration in ckd dogs was 4.3 mg / dl ( range , 1.614.4 mg / dl ) . a recent expert panel suggested that maintenance of serum phosphate concentrations within the following ranges is optimal management for dogs with ckd : 2.54.5 mg / dl for dogs with stages 1 and 2 ckd , 2.55.0 mg / dl for stage 3 , and 2.56.0 mg / dl for stage 4.5 based on these recommendations , 3 of 10 stage 1 ckd dogs were hypophosphatemic and 7 of 10 were normophosphatemic . of stage 2 ckd dogs , 1 of 9 was hypophosphatemic , 6 of 9 were normophosphatemic , and 2 of 9 were hyperphosphatemic . of stage 3 ckd dogs , 7 of 12 were normophosphatemic , and 5 of 12 were hyperphosphatemic . of stage 4 median cpp for ckd dogs was 39.3 ( range , 27.060.5 mg / dl ) . of those dogs , stage 2 ( n = 1 ) , stage 3 ( n = 3 ) , and stage 4 ( n = 5 ) ckd were represented . serum cpp was negatively correlated with all vitamin d metabolites ( table 2 ; p < .001 ) . serum cpp was positively correlated with creatinine , pth , and fgf23 ( p < .001 ) . pearson correlations ( r ) between vitamin d metabolites and other parameters * p < .05 ; ^p < .01 ; p < 0.001 . all vitamin d metabolites were lower in ckd compared to healthy control dogs ( table 1 ) , reaching statistical significance with iris stages 3 and 4 ( all adjusted pvalues < .05 ) . vitamin d metabolite concentrations were not significantly different between controls and dogs with stages 1 and 2 ckd ( figs 1 , 2 , 3 ) . pearson correlation coefficients between vitamin d metabolites and creatinine , fgf23 , pth , calcium , and phosphorus are listed in table 2 . serum 25(oh)d concentrations based on international renal interest society stage ( 14 ) and healthy control dogs . the boxes represent the 25th and 75th percentiles , and the central lines in the boxes represent the median values . serum 1,25(oh)2d concentrations based on international renal interest society stage ( 14 ) and healthy control dogs . the boxes represent the 25th and 75th percentiles , and the central lines in the boxes represent the median values . the double asterisk represents significantly different from control and iris stages 1 and 2 dogs . serum 24,25(oh)2d concentrations based on international renal interest society stage ( 14 ) and healthy control dogs . the boxes represent the 25th and 75th percentiles , and the central lines in the boxes represent the median values . the single asterisk represents significantly different from control and iris stages 1 and 2 dogs . the double asterisk represents significantly different from control and iris stages 1 and 2 dogs . serum 25(oh)d concentration was negatively correlated with phosphorus ( r = 0.55 ; p < .001 ) , pth ( r = 0.42 ; p = .003 ) , fgf23 ( r = 0.39 ; p = .009 ) , and cpp ( r = 0.43 ; p = .002 ) . a doubling of serum creatinine concentration was associated with a 14% decrease in 25(oh)d ( p = .005 ) ( fig 4 ) . positive correlations were found between 25(oh)d and total calcium ( r = 0.33 ; p = .02 ) and ionized calcium ( r = 0.33 ; p = .047 ) . serum 1,25(oh)2d concentration was negatively correlated with fgf23 ( r = 0.64 ; p < .001 ) , phosphorus ( r = 0.61 ; p < .001 ) , and pth ( r = 0.50 ; p < .001 ) . serum 24,25(oh)2d concentration was negatively correlated fgf23 ( r = 0.55 ; p < .001 ) , phosphorus ( r = 0.55 ; p < .001 ) , and pth ( r = 0.48 ; p < .001 ) . median pth concentration in ckd dogs was 2.5 pmol / l ( range , 0.8229 pmol / l ) . serum pth was significantly higher in iris stage 3 ( p = .0065 ) and stage 4 ( p < .001 ) ckd dogs compared to healthy control dogs . eight dogs had pth concentrations above the upper limit of the laboratory 's reference range of 5.8 pmol / l . of these 8 dogs , 3 were classified as stage 3 ckd and 5 were classified as stage 4 ckd . these dogs had a median serum phosphorus concentration of 8.4 mg / dl ( range , 2.714.4 mg / dl ) , notably higher than observed in dogs with lower stages of ckd . one control dog had a serum pth concentration above the upper limit of the laboratory 's reference range . there was no additional serum available to recheck this result from the time of enrollment , but approximately 18 months later , the dog had a normal serum pth concentration of 1.2 pmol / l . using this repeated result , we hypothesize that this dog 's blood was collected early in the morning and was affected by diurnal variation in serum pth concentration in dogs.22 median fgf23 concentration in 34 ckd dogs was 467 pg / ml ( range , 14241,265 pg / ml).6 as compared to control dogs , fgf23 concentrations were significantly higher in ckd dogs with iris stages 3 and 4 disease ( p < .001 ) , but not between controls and earlier stages . compared to the upper range of 449 pg / ml in the control dogs , 19 of 34 ckd dogs had high fgf23 concentrations with a median of 2,520 pg / ml ( range , 45441,265 pg / ml ) . all iris stages were represented : stage 1 ( n = 1 ) , stage 2 ( n = 2 ) , stage 3 ( n = 10 ) , and stage 4 ( n = 6 ) . three ckd dogs , iris stage 1 ( n = 1 ) and stage 3 ( n = 2 ) , did not have their fgf23 concentrations measured . dogs with ckd were receiving a variety of medications , including enalapril ( n = 9 ) , antibiotics ( n = 6 ) , aluminum hydroxide ( n = 5 ) , famotidine ( n = 5 ) , tramadol ( n = 5 ) , gabapentin ( n = 4 ) , omeprazole ( n = 4 ) , amlodipine ( n = 3 ) , ondansetron ( n = 3 ) , sc fluids ( n = 3 ) , diphenhydramine ( n = 3 ) , heartworm preventative ( n = 3 ) , mirtazapine ( n = 2 ) , phenylpropanolamine ( n = 2 ) , diethylstilbestrol ( des ; n = 2 ) , nonsteroidal antiinflammatory drug ( nsaid ; n = 2 ) , flea / tick preventative ( n = 2 ) , sevelamer ( n = 1 ) , maropitant ( n = 1 ) , soloxine ( n = 1 ) , trazodone ( n = 1 ) , aspirin ( n = 1 ) , and cyclosporine ( n = 1 ) . eight control dogs were receiving heartworm and flea / tick preventatives . at the time of enrollment , 17 dogs were reported to be eating 1 veterinary therapeutic renal diets and 18 dogs were eating a variety of other commercial diets . ten dogs ate a combination of dry and canned diets , and 1 dog ate canned food exclusively . almost all dogs ( n = 34 ) were reported to receive a variety of treats and foods intended for human consumption . the specific amount of ingested cholecalciferol could not be determined given the variability in daily intake and the lack of many owners ' abilities to provide exact amounts fed . to assess for a relationship between dietary cholecalciferol intake and serum 25(oh)d concentrations , dietary intake was defined by the iu/100 kcal of cholecalciferol from the dog 's primary diet source . the amount of dietary cholecalciferol ingested was unavailable for 6 dogs , 4 that were eating commercial diets and 2 that were eating variable homeprepared diets . there was no relationship between cholecalciferol intake and serum 25(oh)d ( r = 0.19 , p = .25 ) . supplements that were administered included fish oil ( n = 10 ) , joint health supplements ( n = 7 ) , multivitamin ( n = 2 ) , cranberry supplement ( n = 2 ) , symbiotic ( n = 2 ) , probiotic ( n = 1 ) , sadenosylmethionine / silybin ( n = 1 ) , niacinamide ( n = 1 ) , calcium carbonate ( n = 1 ) , calcitriol ( n = 1 ) , and vitamin e ( n = 1 ) . in our study , we found ckd in dogs to be associated with a decrease in several vitamin d metabolites . our results are consistent with previous studies that found 25(oh)d and 1,25(oh)2d concentrations to be decreased in advanced iris stages.4 , 5 vitamin d metabolites were negatively correlated with pth and fgf23 concentrations , suggesting that these hormones interact in the development of rhpt . the development of hypovitaminosis d is likely multifactorial . decreased concentrations of 25(oh)d may relate to decreased nutritional intake , proteinuria , increased inflammatory cytokines , and increased fgf23 . dietary intake of parent vitamin d compounds ( i.e , cholecalciferol [ vitamin d3 ] , ergocalciferol [ vitamin d2 ] ) does affect 25(oh)d status in people and dogs.23 , 24 , 25 , 26 dietary cholecalciferol was quite variable in the diets ckd dogs were consuming , ranging from 10 to 91 international units ( iu ) per 100 kilocalories ( kcal ) . the veterinary therapeutic renal diets provided 2591 iu cholecalciferol per 100 kcal . at the time of study enrollment , the association of american feed control officials ( aafco ) recommended that adult maintenance diets for dogs provide a minimum of 12.5 and a maximum of 75 iu vitamin d3 per 100 kcal . the control dogs were eating diets with 25110 iu cholecalciferol per 100 kcal . in our study , there was no welldefined relationship between dietary cholecalciferol intake , as defined by the iu/100 kcal of cholecalciferol from the dog 's primary diet source , and 25(oh)d concentrations . the ckd dogs were eating a wide variety of diets , treats , and foods intended for human consumption , and did not consistently eat the same amounts on a daily basis . it has been shown that 82 healthy dogs eating the same diet can have quite variable serum 25(oh)d concentrations ( personal communication , dr . it would have been ideal to determine what , if any , effect appetite and specific caloric intake had on serum 25(oh)d concentration . one ckd dog was receiving calcium carbonate and calcitriol supplements , but this dog was eating an unbalanced homecooked diet that was deficient in many essential nutrients , and it is unlikely that the calcium and calcitriol supplements were contributing any relevant quantities to affect systemic status . one ckd dog was receiving a glucosaminechondroitin supplement that contained 500 iu cholecalciferol per tablet.7 based on the dog 's estimated daily caloric intake , this added < 0.5 iu/100 kcal , so it was unlikely to have made a relevant impact on systemic 25(oh)d status . both dogs receiving multivitamin supplements were eating veterinary therapeutic renal diets , and it is unknown why they were receiving additional vitamin and mineral supplementation . another factor that could account for low 25(oh)d is that cholecalciferol may not be absorbed well in dogs with ckd . one study proposed that there may be a breedassociated effect related to intestinal absorption of cholecalciferol.25 none of the dogs had known intestinal disease . yet another possibility is that cholecalciferol is not as readily transformed in the liver to 25(oh)d in animals with ckd . decreased transformation of cholecalciferol to 25(oh)d has been demonstrated in rats with induced kidney disease as a result of decreased hepatic cytochrome p450 isoforms that affect 25hydroxylase activity.27 proteinuria may influence 25(oh)d concentrations in dogs.6 , 8 in people , it has been suggested that 25(oh)d metabolites may decrease as a result of urinary loss when bound to vitamin d binding protein.28 decreased megalin expression in renal tubules could contribute to this loss of 25(oh)d into urine,29 but a recent report in people failed to show a difference in serum 25(oh)d and 1,25(oh)2d concentrations despite decreased urinary loss of vitamin d binding protein.30 because vitamin d metabolism and synthesis are different in dogs , this area requires additional investigation . additionally , chronic inflammation , a hallmark of ckd , may contribute to decreased 25(oh)d concentrations . the relationship between hypovitaminosis d and inflammatory markers ( e.g , interleukin6 , creactive protein ) has been established in people.31 , 32 lastly , it has been postulated that increased fgf23 concentrations may contribute to decreased 25(oh)d by upregulation of 24hydroxylase , the enzyme responsible for converting both 25(oh)d and 1,25(oh)2d to 24,25(oh)2d.33 this idea recently was refuted in a study that prospectively monitored vitamin d metabolites and fgf23 in people with ckd receiving cholecalciferol supplementation because 24,25(oh)2d concentrations did not increase.34 our study also failed to support this hypothesis because serum 24,25(oh)2d concentrations decreased with ckd progression despite increasing fgf23 concentrations . it is likely that 24,25(oh)2d decreased as a result of lesser availability of its 25(oh)d substrate . additionally , decreased serum 1,25(oh)2d concentrations should preferentially shunt metabolism of 25(oh)d toward 1,25(oh)2d.35 serum 24,25(oh)2d concentrations have been reported infrequently in the veterinary literature . healthy control dogs in our study had similar concentrations as were observed in control and stagestop racing sled dogs in another study.36 both studies highlight the fact that dogs typically consume a substantially higher amount of dietary vitamin d than do humans , ultimately resulting in substantially higher vitamin d metabolite concentrations . this variability is reflected in what is considered normal or sufficient serum 25(oh)d concentrations , which is controversial in both species.25 , 37 , 38 decreased 1,25(oh)2d has been documented previously in dogs with ckd . several consequences of ckd affect 1hydroxylase activity , the enzyme responsible for converting 25(oh)d to 1,25(oh)2d . however , both pth and fgf23 also influence this enzyme . increased pth concentrations ( 1 ) stimulate 1hydroxylase activity to ultimately increase calcitriol synthesis and subsequently intestinal calcium and phosphorus absorption , and ( 2 ) decrease 24hydroxylase activity . conversely , fgf23 , which is in part stimulated by 1,25(oh)2d , downregulates 1hydroxylase and upregulates 24hydroxylase . both total and ionized this is not surprising because 25(oh)d is metabolized to 1,25(oh)2d , which then positively influences intestinal calcium absorption and subsequently serum calcium concentrations . similar to what has been documented previously,17 , 39 serum total calcium concentration was not a good predictor of serum ionized calcium status in the ckd dogs , thus highlighting the importance of evaluating serum ionized calcium for ckd dogs . it is probably more useful to monitor and report trends in cpp than individual timepoints . lastly , bcs was negatively correlated with iris stage ( i.e , serum creatinine concentration ) . the finding of poor condition with later stage ckd is likely multifactorial , resulting from decreased caloric intake and increased catabolic inflammatory cytokines . in a retrospective study , dogs with poor bcs ( i.e , 3/9 ) had shorter survival than dogs with a bcs 4/9.40 there was no association between bcs and vitamin d metabolites . it remains to be determined whether vitamin d metabolites are associated with survival in ckd dogs . limitations of this study included a relatively small number of dogs represented in each iris stage , especially stage 4 . some dogs may have been classified incorrectly based on the iris staging system , but we consider this unlikely . other diseases that can cause polyuria and polydipsia could have been incorrectly classified as having iris stage 1 ckd . many dogs did have abdominal ultrasound examinations performed , but dogs were not required to have this test performed nor were they required to have hyperadrenocorticism excluded . dogs with neoplasia were excluded because there may be aberrations in calcium , vitamin d , and pth metabolism in various types of cancers.38 , 41 , 42 another limitation is that control dogs were not agematched , but there was no difference in serum 25(oh)d concentration by age in 1 study of 320 dogs.25 three dogs had documented e. coli lower urinary tract infections , with mixed patterns of growth , ranging from mild ( < 600 cfu / ml ) to heavy ( > 100,000 cfu / ml ) quantitative growth . infection is reported to affect upc concentrations , although it is interesting to note that the dog with the heaviest growth had the lowest upc ( 0.7 ) among the 3 dogs . none of the dogs exhibited overt clinical signs of pyelonephritis , but this possibility can not be excluded . although it is possible that these dogs may have been misclassified by iris stage , we consider this to be unlikely . in summary , our study shows that vitamin d metabolites are decreased in ckd dogs and related to ckd severity . an inverse relationship exists between vitamin d metabolites and serum pth , fgf23 , and phosphorus concentrations , supporting the complex relationship these hormones play in the development of rhpt . additional studies are needed to determine whether targeted regulation of vitamin d metabolite status in dogs with ckd is warranted and the best way to increase vitamin d concentrations and decrease pth and fgf23 concentrations while avoiding toxicity ( e.g , hypercalcemia ) . historically , emphasis has been placed on supplementation with calcitriol,43 but other potential options include nutritional vitamin d ( e.g , cholecalciferol , ergocalciferol ) or even 25(oh)d.44

backgroundhypovitaminosis d is associated with progression of renal disease , development of renal secondary hyperparathyroidism ( rhpt ) , chronic kidney diseasemineral bone disorder ( ckdmbd ) , and increased mortality in people with ckd . despite what is known regarding vitamin d dysregulation in humans with ckd , little is known about vitamin d metabolism in dogs with ckd.objectivesthe purpose of our study was to further elucidate vitamin d status in dogs with different stages of ckd and to relate it to factors that affect the development of ckdmbd , including parathyroid hormone ( pth ) , fibroblast growth factor23 ( fgf23 ) , calcium , and phosphorus concentrations.methodsthirtyseven dogs with naturally occurring ckd were compared to 10 healthy dogs . serum 25hydroxyvitamin d [ 25(oh)d ] , 1,25dihydroxyvitamin d [ 1,25(oh)2d ] , and 24,25dihydroxyvitamin d [ 24,25(oh)2d ] , and pth and fgf23 concentrations were measured . their association with serum calcium and phosphorus concentrations and iris stage was determined.resultscompared to healthy dogs , all vitamin d metabolite concentrations were significantly lower in dogs with international renal interest society ( iris ) stages 3 and 4 ckd ( r [ creatinine ] : 0.49 to 0.60 ; p < .05 ) but not different in dogs with stages 1 and 2 ckd . all vitamin d metabolites were negatively correlated with pth , fgf23 , and phosphorus concentrations ( r : 0.39 to 0.64 ; p < .01).conclusions and clinical importanceckd in dogs is associated with decreases in all vitamin d metabolites evaluated suggesting that multiple mechanisms , in addition to decreased renal mass , affect their metabolism . this information could have prognostic and therapeutic implications .

in this report , we present our experience and results of treatment of lumbar canal stenosis that involved only fixation of the involved segments of the lumbar spine using two interarticular screws or double insurance screws for each joint . the proposed treatment is based on the hypothesis that vertical instability that results in telescoping of the facets on physical activity forms the basis of pathogenesis of lumbar canal stenosis . the rationale of treatment is presented and the literature on the subject has been briefly reviewed . during the period march 2011-september 2011 , we treated seven cases of lumbar degenerative spinal disease using the proposed technique . these patients were analyzed prospectively . there were four males and three female patients and their ages ranged from 50 to 65 years ( average 56 years ) . the patients had characteristic lumbar degenerative disease that resulted in manifestations of lumbar canal stenosis . patients having manifest instability on dynamic imaging that resulted in any degree of spondylolisthesis were excluded . all patients were investigated with dynamic ( flexion and extension views ) plain radiography , computerized tomography scan and magnetic resonance imaging before and after surgery [ figures 1 and 2 ] . one patient underwent a two level , four patients underwent three level and two patients underwent a four - level treatment . the presenting clinical symptoms , radiological features and the outcome are enumerated in tables 13 . oswestry disability index ( odi ) and visual analog score ( vas ) were used to evaluate the patients before and after surgery and at last follow - up . the radiographic analyses that were performed included assessment of bone fusion and status of the spinal canal dimensions . ( a ) sagittal t2 weighted magnetic resonance imaging image showing features of lumbar canal stenosis . ( a ) sagittal magnetic resonance imaging showing unbuckling of the ligamentum flavum and reduction of the dural compression . ( e ) lateral x - ray of the lumbar spine showing the four level fixation . ( f ) antero - posterior x - ray of the lumbar spine showing the screws oswestry disability index the patient was placed in the standard prone position that flattened the lumbar lordosis . midline incision was taken and by employing sub - periosteal dissection the articular joints were exposed widely on both sides . the spinal level of the surgery was confirmed with the help of intra - operative fluoroscopy . based on our experience in dealing with facets and articular joints , the facets having clear evidence of instability and excessive abnormal movements on direct visual and manual inspection were considered suitable for the proposed operation . these findings were valuable and were correlated with clinical symptoms and findings on images , whilst considering the levels and extent of fixation . the articular capsule was opened and the facets were distracted using varying sizes of osteotomes that were introduced with their flat - sharp edge and then turned 90 to affect distraction . essentially , the distraction involved superior elevation of the facet of the rostral vertebra . the articular capsule and end plate cartilage was widely denuded using screwing motion of the osteotome and whenever necessary using micro - drill . transarticular screw insertion was then done under direct vision on the superior and inferior halves of joint . the sectioning of the spinous process provided an inferior and direct angle for insertion of the screws . after the screw insertion , bone graft pieces are placed over the appropriately prepared host bone area of laminae . the patient is then advised bed rest for a period of 8 weeks and only minor activities were permitted during this time with lumbar restraint . after this period , and confirmation of spinal fusion , all routine activities were permitted . midline incision was taken and by employing sub - periosteal dissection the articular joints were exposed widely on both sides . the spinal level of the surgery was confirmed with the help of intra - operative fluoroscopy . based on our experience in dealing with facets and articular joints , the facets having clear evidence of instability and excessive abnormal movements on direct visual and manual inspection were considered suitable for the proposed operation . these findings were valuable and were correlated with clinical symptoms and findings on images , whilst considering the levels and extent of fixation . the articular capsule was opened and the facets were distracted using varying sizes of osteotomes that were introduced with their flat - sharp edge and then turned 90 to affect distraction . essentially , the distraction involved superior elevation of the facet of the rostral vertebra . the articular capsule and end plate cartilage was widely denuded using screwing motion of the osteotome and whenever necessary using micro - drill . transarticular screw insertion was then done under direct vision on the superior and inferior halves of joint . the sectioning of the spinous process provided an inferior and direct angle for insertion of the screws . after the screw insertion , bone graft pieces are placed over the appropriately prepared host bone area of laminae . the patient is then advised bed rest for a period of 8 weeks and only minor activities were permitted during this time with lumbar restraint . after this period , and confirmation of spinal fusion , the follow - up period ranged from 24 to 30 months , average being 26.9 months . the degree of improvement was monitored as per the odi and vas and is elaborated in tables 2 and 3 . the evaluation included the location and degree of preoperative and postoperative pain using an analog scale . in one patient , significant pain persisted in the low back , but the character was not of claudication type and the degree of pain appeared shade less then preoperative pain . all other patients are satisfied with the surgery and are back into their preoperative profession . in none of the other cases , the operation was repeated or any additional surgical maneuver done on the same surgical level or at any other lumbar spinal level . fusion of the spinal segment was defined when there was clear radiological evidence of bone fusion across the facets and when there was the absence of all kinds of motion and alterations in the interlaminar and intervertebral body distances on flexion - extension x - ray films done at a follow - up of at - least 6 months . bone formation was observed within and over the facet joint . as per this criterion , decompression of lumbar spinal canal by laminectomy has stood the test of time , is still considered to be a gold standard in treatment and is employed by most surgeons . spinous process and laminar distraction techniques using specially designed implants are currently gaining increasing popularity . we recently described facetal distraction as an option for the treatment of lumbar canal stenosis . the most accepted view of pathogenesis is that it is related to a cascade of processes that start with degeneration of the disc due to its dehydration or herniation . it has been generally accepted that following this primary event , there occurs loss of disc space height , bulge of the posterior annulus / posterior longitudinal ligament , overriding of the facets and/or infolding of the ligamentum flavum and similar such events that ultimately lead to stenosis of the spinal canal and intervertebral neural foramina . although the issue of instability in lumbar canal stenosis has been discussed on several occasions , its role as the primary factor in the pathogenesis of lumbar canal stenosis has not been appropriately addressed . on the basis of our observations , we identified that instability of the spinal segment , probably related to muscle weakness , had a profound impact on the pathogenesis of the entire spectrum of spondylosis or degeneration of the spine . the symptoms of lumbar canal stenosis are related to posture and often increase on extension and on prolonged standing or walking . considering that the symptoms occur only after physical activity , and only rarely at rest , it appears that the canal is not inherently stenosed , but the physical activity or posture initiates a phenomenon that leads to stenosis . after a period of rest or on altering the posture , the canal stenosis is reversed . it is apparent that weakness of the muscles of the back leads to their fatigue on exercise and subsequent incompetence may lead to facetal override or telescoping . it appears that the phenomenon of lumbar canal stenosis is dynamic in nature and local spinal instability plays a major role in its genesis . standing human posture , ageing muscles , heavy body weight and sedentary life style may have contributory effects on pathogenesis of lumbar canal stenosis . it does appear that the muscles have a role in keeping the spinal segments apart . reduction of the articular cavity space and subsequent facetal overriding or telescoping and consequent ligamental laxity and buckling might occur on activity . physiotherapy and traction over the back have been successfully used for decades in the management of lumbar spinal degeneration . we identified that such a form of treatment that involved facetal distraction resulted in reversal of several pathologic events that are related to spondylosis . in the presented series , we fixed the affected spinal segments using transarticular screws , without physically distracting the facets . however , the fixation of the facets was done in a prone position that obliterated the lumbar lordosis , widened the inter - facet distance and resulted in flexion of the spinal segment . our successful outcome in the presented group of patients suggests that stabilization of the spinal segment has a role in the treatment of lumbar canal stenosis . stabilization of the facets might assist in the alleviation of dynamic events that are associated with lumbar canal stenosis . fixation of the involved motion segment assists in eliminating subtle movements that could probably be the cause of pain in the segment . a number of biomechanical studies are available that suggest that transarticular screws provide satisfactory stability to the lumbar spinal segment . however , such screws have not become a popular mode of spinal stabilization as lumbar pedicular screw - rod stabilization has become a standard form of fixation and seem clearly stronger . this procedure provided a possibility of insertion of transarticular screw with a wider and inferior angle . the screw could now travel in the lamina and subsequently through the facets and ended in the base of the transverse process . wider exposure of the facets following the spinous process resection and the relatively large size of the facets facilitated insertion of two screws in a transarticular fashion . although navigation provided accuracy to the procedure , even free - hand screw insertion under direct surgical vision seemed to be safe . the remarkable strength of the transarticular screws could be appreciated during the process of screw tightening and was also evident by the fact that not a single screw seemed to malfunction or changed its initial deployment position during the period of follow - up . mineral density of the bones of the facets is significantly superior to that of any other part of the vertebra , imparting greater strength to the process of fixation . the spinous process was shredded into small multiple pieces , was placed in the articular cavity after denuding the articular cartilage and was placed over the appropriately prepared host area of laminae . the technique of deployment of screws is simple and significantly quick when compared with most other methods of decompression and fixation . the procedure can be done in isolation or can be employed as a supplement to all other techniques . the drawback of this study is that a comparative cohort of patients who had undergone either a traditional decompressive laminectomy or other types of decompressive surgery was not performed . moreover , the exact inclusion / exclusion criteria for deployment of the technique will need to be assessed , evaluated and determined on the basis of further clinical experience . fixation of the spinal segment using double insurance screws can be a rational , relatively simple , safe and effective surgical option for lumbar canal stenosis .

study design and objective : the author reports experience with treatment of degenerative lumbar canal stenosis that involved fixation - arthrodesis of the affected spinal segment using double insurance transarticular screws for each joint . no direct bone , ligament or disc resection is done for decompression of the spinal dural tube or root canal.methods and summary of background data : during the period march 2011-september 2011 , seven patients having lumbar canal stenosis were treated with a modification of transarticular method of screw fixation that involved insertion of two or double insurance screws at each articular joint . the operation involved section of the spinous process at its base , opening up of the facet joint , denuding of articular cartilage , insertion of intra - articular bone graft and insertion of two transarticular screws at each facet joint . the fixation was done in four levels in two patients , at three levels in four patients and at two levels in one patient . oswestry disability index and visual analog scale were used to clinically assess the patients before and after the surgery and at follow-up.results:during the average period of follow - up of 26.9 months ( range 24 - 30 months ) , there was varying degree of recovery of symptoms . the procedure resulted in firm stabilization and fixation of the spinal segment and provided a ground for arthrodesis . during the period of follow - up , one patient underwent re - exploration and decompressive laminectomy as she continued to have significant pain symptom.conclusions:vertical instability and telescoping , listhesis or overriding of the facets on physical activity seems to be the defining phenomenon in the pathogenesis of lumbar canal stenosis . the clinical outcome in our patients suggest that fixation of the spinal segment can be a rationale form of treatment . double insurance transarticular method of treatment is a simple , safe , and effective method of spinal stabilization .

metal organic frameworks ( mofs ) are polymeric crystalline materials comprising of metal ions bridged via co - ordination bonds by polydentate organic linkers . mofs are typically formed by solvothermal reaction of the metal salts with the ligand , and have attracted great interest due to their potentially high internal surface area and porosity , which have great technological potential for gas storage and capture , sensing and catalysis . a wide range of organic molecules have been used as linkers for the construction of mof materials , offering the potential for structures with highly tailored properties and topologies through the systematic control of the geometry and porosity as well as the integration of chemical functionality into the structure of the organic linker . it is also possible to grow mof materials on substrates to form surface - mounted mofs , so - called surmofs . surmofs have been grown with thicknesses varying from a few monolayers up to several microns and are of particular interest since they provide a route to the integration of porous functional materials with thin film devices . for example , surmof materials are promising candidates for fabricating highly responsive gas sensors since they strongly , and in some cases selectively , adsorb various gases . there have also been recent advances in the fabrication of surmof prototype semiconductor devices , and optical sensors based on interferometry . several different approaches to the growth of surmof thin films have been reported . in the simplest method , a substrate is introduced into the solvothermal reaction solution leading , under suitable conditions , to the growth of a thin film of crystallites . it was further demonstrated that the termination of noble metal and oxide surfaces with , respectively , functionalized thiol and silane self - assembled monolayers ( sams ) can promote the growth of surmof films . in addition the crystallographic orientation of the film may be controlled through the use of sams with a specific end - group such as a cooh or oh termination . functionalization of substrates with sams may be combined with lithographic techniques to pattern the substrate surface , for example using microcontact printing ( cp ) , to locally inhibit or promote surmof growth . while representing significant progress , this approach of direct solvothermal growth onto a substrate often results in rough , polycrystalline films or , alternatively , an inhomogeneous coverage of isolated crystals . ( lbl ) technique represents an alternative approach to the growth of surmofs and has been investigated as a possible route to improving the morphology of growth , and also the formation of surmof heterostructures . in the lbl method a substrate undergoes cyclic sequences of immersion in a solution of the metal ion , followed by immersion into a solution of the organic ligand ( or vice versa ) with potential rinsing steps between immersion . variations on this implementation include exposure to metal / ligand solutions in flow reactors , and through spray deposition . importantly , the substrate is only exposed to one component ( metal or ligand ) of the framework at each step in contrast to the solvothermal method which exposes the surface to both simultaneously . it has been proposed that only one monolayer forms in each cycle of immersion in framework component solutions and the surmof is thus grown in a controllable layer - by - layer manner . the lbl method can be combined with lithographic techniques and surface chemical functionalization using sams to enhance further the degree of control of the lateral , vertical and crystallographic geometry of mof material . extensions to this idea include the growth of mof on mof structures by changing the metal or ligand used during the growth process to create a layered material , and post - synthetic modification of linkers to change the chemical functionality of the linker molecules while preserving the mof crystalline structure . the lbl method has been widely described as an epitaxial mode of growth and many of the more exotic approaches to surmof growth such as 3-component pillared structure mofs or heteroepitaxial structures implicitly assume that the growth interface is , at least approximately , parallel to the substrate , analogous to the frank van der merwe mode of thin film growth , and advances by a monolayer in each growth cycle . quartz crystal microbalance ( qcm ) measurements of the mass uptake during each step offer some support for this idealized model of growth , while images acquired using atomic force microscopy ( afm ) have confirmed that the surmof thickness increases with the number of cycles , as expected . however , the growth rate in some cases vastly exceeds that predicted by the ideal lbl model , and there is no direct evidence for the addition of precisely one monolayer in each growth cycle . indeed a recent scanning tunnelling microscopy ( stm ) study has shown no clear evidence for epitaxial features during the growth of the first few monolayers of mof growth . overall the growth of surmofs using the lbl method appears to be more complicated than that suggested by the idealized model . this has motivated the current study of the very early stages of the growth of surmofs by sequential dipping . in particular , we focus on the nucleation and subsequent growth which occurs in the first 10 growth cycles and use amplitude - modulated tapping ( ac ) mode afm to acquire images of the surface after each of the first five cycles of growth , and then again after the tenth cycle . we use a variety of oriented and polycrystalline au surfaces terminated , in some cases , by thiol layers . for most samples it is possible to return to exactly the same position on the surface allowing the repeated imaging of individual nanocrystals and subsequent characterization of their dimensions and orientation relative to the substrate at each stage of the growth process . the use of oriented gold surfaces complicates a direct comparison with other work although it is clear that our results agree with some aspects of previous work , notably the influence of thiol layers . however , under the growth conditions used here we do not observe the sequential addition of single mof layers , and we find that the growing surface which is , in general , not parallel to the substrate . hkust-1 was chosen for this study since it has been studied extensively both as a bulk material and as a surmof thin film grown on thiol or silane functionalized surfaces . in addition due to the relative lability of cu(ii ) centers , hkust-1 can be deposited under ambient conditions at room temperature from dilute ethanolic solutions of both metal salt and ligand using a sequential exposure technique . surmofs of hkust-1 were grown on au(111 ) ( 300 nm epitaxial au(111 ) layer on mica , georg albert pvd , heidelberg , germany ) . thiol sams were deposited by immersion for 30 min in 0.2 mm ethanolic solutions of either 16-mercaptanhexadecanoic acid ( mhda ) or 11-mercaptanundecanol ( muda ) to terminate the surface with , cooh and oh functional groups , respectively . this was followed by rinsing in a stream of ethanol for approximately 30 s and drying in a n2 stream . once the substrates had been prepared , a registration mark was formed in the au layer using a pair of tweezers ( cleaned by flame - annealing in a butane flame for 30s and allowed to cool ) . the substrate was loaded into an asylum research cypher - s afm and the cantilever repeatedly aligned to the registration mark using the inbuilt optics and the coarse xy movement of the sample stage . images of the substrate were acquired in repulsive ac mode using olympus ac240ts silicon cantilevers ( resonant frequency 70 khz , spring constant 2 n / m ) . surmof was grown by immersion in separate 1 mm solutions of cu(o2cch3)2 and benzene-1,3,5-tricarboxylic acid ( tma ) in ethanol ( fisher 99.95% ) ( figure 1 ) . substrates were immersed for 1 min after which the substrates were rinsed in ethanol , dried using n2 and subsequently immersed in the ligand solution for 1 min . the sample was again rinsed in ethanol to remove unreacted ligands and dried with n2 . after each cycle of immersion in metal and ligand solutions the substrates were returned to the afm for further imaging . the optics of the afm were used to align the cantilever with the registration mark to an accuracy in the range 1020 m . the region of interest was found through further alignment using the grain structure and terrace morphology on the au(111 ) surface acquired in previous scans to provide registration . films of hkust-1 on polycrystalline au were prepared ( figure 1 ) using the same preparative and sequential dipping processes on wafers of 300 nm au on si(100 ) with a 50 nm ti bonding layer ( georg albert pvd ) . in the case of the polycrystalline au , the lack of an easily identifiable grain structure and the isotropy of the au surface structure prevented the repeated imaging of the same area . figure 2 shows afm images at different stages of the growth process on various thiol - terminated au(111)/mica substrates . each row shows a sequence of images acquired for au(111 ) substrates prepared in different ways : the top row ( figure 2a ) is a clean au(111 ) surface ; in the second row ( figure 2b ) the au(111 ) surface is pretreated with mhda to give a cooh termination ; in the bottom row ( figure 2c ) the au(111 ) surface has an oh termination through pretreatment with muda . within each row afm images are presented of the surface prior to deposition of the mof in the left - hand column , followed by images acquired after , running from left to right , 1 , 2 , 3 , 4 , 5 , and 10 cycles of sequential dipping . thus , a comparison of images within a row provides a comparison of surfaces at different stages of growth , while the columns provide a comparison of images acquired after the same cycle of growth but with different surface functionalization . afm images of hkust-1 growth on ( a ) au(111 ) , ( b ) mhda on au(111 ) , and ( c ) muda on au(111 ) at different stages during the growth process ; the number of cycles of growth is shown along the horizontal axis and varies from 0 ( i ) to 10 ( vii ) . the arrows in the images a c parts i vii indicate specific surface features to provide registry between successive images . all scale bars are 1 m . the use of registration marks to obtain images of the same region of the surface is highlighted in , for example figure 2a(i , ii ) and figure 2c(i iv ) . in these images the terrace structure of the gold surface may be readily resolved and , further , the detail of this structure is immediately recognizable in successive images ( across the rows ) . as the mof layers grow in the subsequent dipping cycles , the contrast in the images is dominated by the mof crystallites when their height is greater than the variation in height of the underlying gold surface ( typically less than 2 nm over a 1 m area from afm data of clean au(111 ) surfaces ) . the terrace structure is not immediately visible in such images ( see for example figure 2a(iii vii ) ) , although it may be readily discerned in processed images . to aid the identification of the registry in figure 2 , particularly for surfaces where there has been significant growth , we include on each image an arrow identifying a specific surface feature as a reference . note that the loss of contrast of the gold terraces provides an approximate indication of the point where there has been significant surmof growth . the images therefore highlight the differing growth rates due to surface functionality with the muda surface having little growth until at least five cycles , whereas in the case of the mhda terminated surface the loss of contrast occurs after a single cycle indicating significant growth has already occurred . interestingly , we also reproducibly observe hkust-1 growth on the bare au(111 ) metal surface as shown in figure 2a . there have been several reports that mof growth on bare ( i.e. , in the absence of functionalization by thiol sams ) gold does not occur , for example in attempts to grow mof-5 under solvothermal conditions , or hkust-1 using the lbl technique on a polycrystalline au surface , but our results confirm that growth of hkust-1 is possible on au(111 ) . in figure 3 figure 3a shows the fraction of the surface covered by the growing mof film with increasing cycles of growth . for the cooh terminated surface there is already > 5% coverage after 1 cycle and this value increases monotonically over subsequent cycles , although the rate of increase drops between 5 and 10 cycles when the overall surface coverage is > 50% . on the unfunctionalized au(111 ) surface there is very little growth after one cycle and the subsequent rate of increase of surface coverage is also lower than for the cooh surface . for the oh terminated au(111 ) surface there is still a very low fraction of the surface covered even after four growth cycles ; after which the coverage increases very rapidly . these data confirm that growth occurs immediately for the cooh terminated surface , much more slowly for the oh terminated surface , while the clean au(111 ) is an intermediate case . ( a ) surface coverage , ( b ) island density , ( c ) average lateral island size , and ( d ) volume of material per unit area ( or equivalently average thickness ) deposited during the growth process plotted as a function of the number of growth cycles . there are further differences in the morphology of the growing surface , for example related to the number of nucleated islands of mof crystallites . in figure 3b , we show the number of mof islands per unit area . for the cooh terminated surface there are 80 islands per square micron after one cycle corresponding to an average center center island separation of 110 nm . this increases to 130 islands m after 4 cycles , which then decreases after further cycles indicating that islands have started to merge at this point . the island density on the clean au(111 ) the growth on the oh terminated surface differs markedly with very few islands after three cycles followed by a sharp increase in areal density . from the data in figure 3 , parts a and b , we derive the average lateral island size ( figure 3c ) . from our afm images it is also possible to estimate the total volume of material deposited and this is shown in figure 3d as a volume measured in nm adsorbed per area ( in nm ) of substrate ( equivalent to the average height of the film in nanometres ) . for the cooh terminated surface we observe a near - linear increase in both the island size and the total volume of material deposited . this implies that for this surface a near constant amount of material is added in each growth cycle , consistent with previous studies of polycrystalline gold terminated by cooh . from the gradient of the data in figure 3d ) we estimate a growth rate ( averaged across the sample ) of 1.7 nm per cycle , which is much greater than the thickness of a single cu / tma layer , 0.6 nm ( the lattice constant of the unit cell of cubic hkust-1 , which contains four layers of cu / tma is 2.6 nm ; note that in ref ( 28 ) a cycle is defined as two immersions in the metal and ligand , rather than a single immersion in each solution as adopted here , so that in ref ( 28 ) the expected growth rate within the layer - by - layer model is 1.3 nm / cycle for a half - layer comprising two layers of metal ions and two layers of molecules ) . in previous work a constant growth rate has been interpreted as supporting evidence for layer - by - layer growth in the direction perpendicular to the substrate , but it is clear that in this case a constant growth rate occurs in combination with the locally accelerated growth of nanocrystallites , rather than an extended even growth of homogeneous layers . the growth rate on the oh terminated surface is much lower compared with the case of the cooh terminated substrate and , in agreement with previous studies , more nonlinear . this results in a more inhomogeneous distribution of island sizes leading to , after 10 growth cycles , a combination of a small number of large crystallites and a large number of very small crystallites . overall our results indicate that nucleation of mof on these surfaces does not occur immediately but is likely preceded by an accumulation of physisorbed material , possibly mediated by inhomogeneities on the surface . we therefore focus our discussion on the cooh surface on which , as we show below , we can monitor the progressive growth of individual crystallites . this is also the most common choice of termination for growth of hkust-1 on surfaces . figure 4 shows images ( figure4a d ) of a single 1 m region on mhda terminated au(111 ) acquired over 4 stages of the growth process , together with selected height profiles ( figure4e h ) which are extracted from the same positions in successive afm images ( shown as colorised lines in figure 4a d ) . these images confirm unequivocally that we are able to image the same area on the substrate due to the presence of identical , growing features , for example the two bright ( topographically high ) features close to the top of each image . afm images of the same 1 m region on an mhda functionalized au(111 ) region shown in figure 2 b at ( a ) 1 , ( b ) 3 , ( c ) 5 , and ( d ) 10 cycles of growth , respectively . the blue and white boxes in part d correspond to and oriented crystallites respectively that can be traced throughout the entire growth process . ( e h ) line profiles across the features illustrated in parts a d , respectively , showing the growth of material across this region . we identify four distinct types of surface feature ; the first of these are high features with a near circular shape and no obvious faceting . examples include the islands mentioned above and also the feature through which a blue line passes ; the blue height profiles are acquired along this trajectory and show the height of these islands . surprisingly even after one growth cycle the profile indicates a height , and apparent width , of 65 nm . this feature grows so that after three cycles ( figure 4b , f ) the height is 110 nm ; the vertical size of this island is approximately constant after this cycle . it is possible that this feature corresponds to a noncrystalline material , or a three - dimensional aggregate , since there are no obvious facets as expected for a crystallite . we have investigated control samples which were exposed to only the metal , or only the ligand ; from these controls it is clear that all the features which we observe are formed only after immersion in both the metal and the ligand , ruling out the possibility that any features are due to one of these single components . we also observe linear islands ; see for example figure 4b where many linear features are observed . a comparison with the surface earlier ( figure 4a ) and later ( figure 4c ) in the growth process shows that these features grow rapidly in one lateral direction in the first few growth cycles ( they are clearly present , but shorter in figure 4a ) . however , after an initial stage of growth the sizes of these features saturate at a typical length of 150 nm and , from the profiles , a width of 50 nm and a height of 30 nm ( see green and red profiles ) . the other two types of surface features are highly faceted with either a triangular or square base . these features are seen most clearly in figure 4d where they are identified with white ( triangular ) or blue ( square ) outlines . unlike the linear and globular features , these crystallites become progressively larger through the cycles of growth ; their size increases and does not saturate . for example , the red profile in figure 4 extends over two triangular islands on either side of the linear island on which the profile is centered ; these triangular islands become higher and wider as the growth progresses . as we show below , the pyramidal features correspond to oriented islands terminated by { 111 } planes , while the triangles correspond to oriented crystallites , also terminated by { 111 } surfaces . it is possible to identify all of these features at earlier stages of growth ( for example the triangular features in figure 4c , and , more difficult to resolve on the scale of these images , figure 4b ) . to highlight the history of a particular crystallite we show in figure 5a the progressive growth of a pyramidal ( upper row ) and triangular ( lower row ) crystallite . the square and triangular bases of these structures are very clearly resolved after 10 growth cycles and it is possible to track these features back to earlier stages in their growth ; the faceted shape is apparent after 3 cycles , but is poorly resolved after 2 cycles . after 1 cycle , we can resolve the presence of a nucleated island but the shape can not be identified with confidence at this stage . ( a ) afm images of two crystallites highlighted in figure 1d ) after successive growth steps ; ( b ) plot of the height for each crystallite in part a vs the number of growth cycles with a linear fit to the data measured from line profiles across the crystallites relative to the surrounding substrate . these images allow the determination of the growth rate of individual crystallites which complements the average growth rates discussed above . in figure 6 , we show the variation of height with growth cycle for the square and triangular islands highlighted in figure 4d . although there is some variation between individual crystallites the rate of increase in height is 4.9 nm per cycle and 3.2 nm per cycle for the square and triangular islands , respectively . again , we emphasize that this is not consistent with a model in which the growing interface advances uniformly by one layer per cycle . ( a ) height as a function of growth cycles for individual oriented hkust-1 crystallites measured by afm and ( b ) for type crystallites ; ( c ) height vs width ( see inset for location of measurement ) for type crystallites and ( d ) height vs width for type crystallites . we attribute the exposed facets for both island shapes to { 111 } planes given their triangular symmetry ; in addition this is consistent with the formation of free surfaces of bulk hkust-1 crystals by { 111 } planes . the geometry of the square features is consistent with a crystallite growing with the direction oriented normal to the surface , leading to a pyramidal structure ( a square base formed by a { 100 } plane and four faces formed by { 111 } planes ; see for example ref ( 48 ) ) . the ratio of height to the half - diagonal width of the base is expected to be 1:1 for a face centered cubic crystallite with this geometry . this is consistent with observations shown in figure 6c , where this ratio is plotted for the square islands highlighted in figure 4d at different stages of their growth . the presence of a orientation is consistent with previous data for hkust-1 grown on polycrystalline au substrates functionalized with cooh end groups . we assign the triangular features to oriented crystallites terminated by a { 111 } surface . for these crystallites the growing surface is near parallel to the substrate , but we do not see a preferred in - plane orientation implying that there is no epitaxial relationship with au(111 ) surface . the presence of these crystallites is not expected from previous studies of hkust-1 on mhda terminated au . however , in these previous studies polycrystalline gold films were used as substrates , rather than the oriented gold films used here . to check whether this difference is significant we have investigated a surface grown using the protocols described above on mhda - terminated polycrystalline gold . the results , shown in figure 7 , indicate the presence of many islands with typical dimensions 540 nm which have a faceted shape similar to that of the pyramidal oriented islands discussed above , but the triangular islands are not observed ; this observation is consistent with previous work showing the selective growth of crystallites on similar surfaces and other recent afm studies . the pyramidal shape implies that these crystallites are terminated by { 111 } planes . afm image of 10 cycles of growth of hkust-1 on polycrystalline au on si coated with mhda . the afm image shows a predominantly square based pyramid nanocrystallite structure indicating a preferential orientation normal to the surface in agreement with the literature . the growth of hkust-1 on au(111)/mica islands shows significant differences to previous work using polycrystalline gold substrates . first , we observe some growth even on clean au(111)/mica , but the more interesting effects relate to growth on the mhda - terminated surface which introduces a cooh functionality . here we observe the growth of four distinct types of island of which two may be readily identified as and oriented crystallites . using afm it is possible to measure not only the average growth rate across the surface , but also the local growth rate both horizontally and vertically to the surface for individual crystallites . both these rates are greater than one layer / per cycle , while the local increase in height per cycle , measured to be 4.9 and 3.2 nm for , respectively , and type crystallites , is significantly greater than the thickness of a single cu / tma layer , 0.6 nm . this observation demonstrates that in local regions of the surface multiple ( 510 ) layers of mof are grown in each cycle . interestingly the largest crystalline features which are identified in figure 5d may be traced all the way back to the first deposition step in figure 4a . this implies that the nucleation of all these islands has already occurred after the first cycle of growth . furthermore , we can address the question of whether the growing crystallites are redissolved or significantly redistributed when the substrates are reimmersed in the relevant solutions . the reproducible appearance of growing islands and traceability of the location of structures on this highly inhomogeneous surface implies that very little reorganization or solvent - assisted recrystallization of material occurs under the conditions used here . for hkust-1 grown on polycrystalline gold , we observe significant differences ; the lateral size of individual crystallites is considerably smaller , and we do not observe triangular islands . the larger crystallite size on au(111)/mica may be due to the presence of larger , flatter terraces , as compared to the rougher evaporated gold surfaces on which we observe a higher density of nucleated islands , and thus smaller crystallites . this enhancement in nucleation density may be due to inhomogeneities in the gold film , or in the mhda termination . however , our observation of oriented growth is consistent with previous studies of thicker film growth on this surface . the termination of the faceted crystallites by { 111 } planes of hkust-1 is observed for both the and crystallites , and , in addition , for the pyramidal shapes resolved on polycrystalline gold . as stated above , the free and therefore lowest energy , surfaces of bulk hkust-1 crystals are formed by { 111 } planes , and the termination of the surmofs by these same planes is therefore expected . this implies that for growth under near - equilibrium conditions , for which the lowest energy surface will dominate , the growing interface is only parallel to the substrate surface if the crystallographic orientation is normal to the lowest energy surface plane . this is observed for the triangular oriented islands , but not for the pyramidal crystallites and implies that the growing interface of crystallites on both au(111 ) and polycrystalline gold , can not be parallel to the substrate . our afm results also show that under these conditions the rate of propagation of the growing interface is not homogeneous across a surface , and that local rates vary significantly . accordingly the incorporation of single layers of mof can not be inferred from rates averaged across a surface measured , for example , using a qcm to measure mass uptake . the results presented here highlight the very significant contribution that high resolution afm can contribute to the understanding of surmof growth and in particular to monitor the local growth of individual crystallites from the very early stages of nucleation . it is clear that this afm approach allows us to determine whether the layer - by - layer method for surmof growth is valid under the conditions used here ; we find that it is not and observe nanocrystalline growth . we hope that these results will motivate other working in the field to adopt this technique to evaluate other surmofs to provide a rigorous test of the assumptions of the layer - by - layer method . our results suggest that this approach to growth would be best suited to materials for which it is possible to select , for example using self - assembled monolayers , a crystallographic orientation that is normal to the lowest energy surface of the mof . under these circumstances ,

high resolution atomic force microscopy ( afm ) is used to resolve the evolution of crystallites of a metal organic framework ( hkust-1 ) grown on au(111 ) using a liquid - phase layer - by - layer methodology . the nucleation and faceting of individual crystallites is followed by repeatedly imaging the same submicron region after each cycle of growth and we find that the growing surface is terminated by { 111 } facets leading to the formation of pyramidal nanostructures for [ 100 ] oriented crystallites , and triangular [ 111 ] islands with typical lateral dimensions of tens of nanometres . afm images reveal that crystallites can grow by 510 layers in each cycle . the growth rate depends on crystallographic orientation and the morphology of the gold substrate , and we demonstrate that under these conditions the growth is nanocrystalline with a morphology determined by the minimum energy surface .

from october 2006 to may 2008 , pta of the infrapopliteal arteries was attempted in 386 limbs ( 200 consecutive patients , 243 procedures ) of patients presenting with limb ischemia . in 143 patients , the patient ages ranged from 56 to 89 years ( mean 76 years ) and there were 118 women and 82 men . a total of 182 patients ( 91% ) were diabetics , 147 ( 74% ) had hypertension , 45 ( 23% ) had coronary artery disease , 16 ( 8% ) had cerebral vascular disease , and 41 ( 21% ) were smokers . clinical symptoms included rest pain in 69 ( 18% ) patients , intermittent claudication in 245 ( 64% ) , ulcers in 54 ( 14% ) , and gangrene in 18 ( 5% ) limbs . the mean ( se ) ankle brachial pressure index ( abi ) was 0.53 0.17 ( range 0.36 - 0.81 ) before the intervention . we generally defined arterial abnormalities as follows : foot pulse reduced or absent , abi < 1 ( in the absence of arterial calcification ) , or duplex scanning revealing stenosis > 50% of the vessel lumen . if two of the three criteria are confirmed , then a lower extremity mr angiography ( mra ) was performed to confirm these abnormalities and evaluate the vasculature and collateral compensation in all patients who were supposed to receive pta treatment . all mri examinations were performed on a 3.0 t mr system ( achieva 3.0 t , philips medical systems , the netherlands ) . automatic table movement bolus chase 3d contrast - enhanced mra was employed to perform a four - station protocol ( lower abdomen - thigh - lower leg - foot ) by using an integrated whole body coil with additional infragenual cuff - compression ( end pressure of 50 mmhg ) during the mri examination . a biphasic injection of gadodiamide was chosen at an initial volume of 20 ml and at a flow rate of 2.5 ml / s , and was immediately followed by a second volume of 20 ml at a flow rate of 2.0 ml / s . for all stations , the 3d mobiflex-3.0 t sequence in the coronal slice order was used with the following parameters : tr = 3.5 - 4.4 ms , te = 1.28 - 1.64 ms , flip angle = 20 , field of view = 375 mm , voxel size = 0.98 . antegrade or retrograde puncture of the femoral artery was decided according to the mra results and discussed between the two vascular interventional radiologists . digital subtraction angiography ( dsa ) was then performed , and a subsequent pta procedure was performed if necessary . the antegrade puncture of the femoral artery was used in all but 33 limbs . in those 33 limbs , pta was performed with a cross - over technique from the contralateral side because of the severe stenotic lesions in the ipsilateral puncture site or extreme obesity of the patient . all interventions were performed through a 6 fr access system ( terumo co. , tokyo , japan ) . a 4-fr vertebral catheter ( cook , bloomington , in ) was subsequently introduced and an angiography was performed . the tip of the catheter was placed at the proximal end of the occlusive vessel under the guidance of a road map . the outflow tract in the distal end of the occlusive lesion was an indication that an angioplasty was necessary . we used a low friction hydrophilic 0.035-inch guidewire ( terumo co. , tokyo , japan ) for the recanalization of the total occlusions . the tip of the guidewire was shaped into and allowed to form a ' u ' shape with the aid of a 4-fr catheter and collateral branch vessel in the proximal part of the occluded lesion . the ' u ' shape of the guidewire could ensure a wider profile , thus preventing the guidewire to exit the arterial wall or enter into the subintimal area . the 0.035-inch hydrophilic guidewire was replaced with a 0.014-inch skipper exchange guidewire ( skipper deep ; invatec , brescia , italy ) . hemi - compliance low - profile balloons ( amphirion deep ; invatec , brescia , italy ) with a balloon length of 80 or 120 mm and a diameter ranging from 2.0 to 3.5 mm were used for dilating the occluded vessel . the dilating pressure ranged from 6 to 10 atm and was maintained for three minutes . immediate postangioplasty angiograms were obtained in all cases . intravenous heparin ( a bolus of 4,000 iu followed by 1,000 iu ) was injected to maintain an activated clotting time of 250 to 300 seconds during the procedure . an additional 5,000 iu of low molecular weight heparin was administered subcutaneously every 12 hours for three days after the procedure . upon ambulation , the patients were to receive life - time antiplatelet ( aspirin , bayer co. , 100 mg daily ) treatment . technical success was defined as at least one anterior or posterior tibial artery with less than 50% residual stenosis that could be recanalized to the malleolar or dorsal foot along with no immediate severe complications . clinical success was defined in the wound group as complete healing of ulcers or dry and painless toe gangrene . in the intermittent claudication or rest pain group , success was defined as significant improvement in terms of distance walked or relief from rest pain for at least six months . a total of 417 occluded or severe stenotic lesions were treated by pta . among the 386 limbs treated , there were 305 lesions of the anterior tibial artery , 89 lesions of the posterior tibial artery , and 23 lesions of the peroneal artery ( table 1 ) . the lesion length varied from 2 to 32 cm , including 294 ( 71% ) lesions that were > 10 cm and 123 ( 29% ) lesions that were < 10 cm ( p < 0.0001 ) . altogether , 238 ( 57% ) lesions had an obvious outflow tract , whereas the rest did not . the patients were followed by clinical examinations at one , six and twelve months after the endovascular treatment . mras were supposed to be performed at six months in all patients . for those who were reluctant to undergo an mra follow - up , a doppler ultrasound examination was performed instead . at each follow - up examination , pain and wound healing were evaluated and palpated leg pulses were recorded . the visual analogue scale method was used to compare the pain levels before and after the procedure . pain relief was considered to have occurred if patients marked a 0.2-cm drop in pain level on a 0 to 10-cm scale . from october 2006 to may 2008 , pta of the infrapopliteal arteries was attempted in 386 limbs ( 200 consecutive patients , 243 procedures ) of patients presenting with limb ischemia . in 143 patients , the patient ages ranged from 56 to 89 years ( mean 76 years ) and there were 118 women and 82 men . a total of 182 patients ( 91% ) were diabetics , 147 ( 74% ) had hypertension , 45 ( 23% ) had coronary artery disease , 16 ( 8% ) had cerebral vascular disease , and 41 ( 21% ) were smokers . clinical symptoms included rest pain in 69 ( 18% ) patients , intermittent claudication in 245 ( 64% ) , ulcers in 54 ( 14% ) , and gangrene in 18 ( 5% ) limbs . the mean ( se ) ankle brachial pressure index ( abi ) was 0.53 0.17 ( range 0.36 - 0.81 ) before the intervention . we generally defined arterial abnormalities as follows : foot pulse reduced or absent , abi < 1 ( in the absence of arterial calcification ) , or duplex scanning revealing stenosis > 50% of the vessel lumen . if two of the three criteria are confirmed , then a lower extremity mr angiography ( mra ) was performed to confirm these abnormalities and evaluate the vasculature and collateral compensation in all patients who were supposed to receive pta treatment . all mri examinations were performed on a 3.0 t mr system ( achieva 3.0 t , philips medical systems , the netherlands ) . automatic table movement bolus chase 3d contrast - enhanced mra was employed to perform a four - station protocol ( lower abdomen - thigh - lower leg - foot ) by using an integrated whole body coil with additional infragenual cuff - compression ( end pressure of 50 mmhg ) during the mri examination . a biphasic injection of gadodiamide was chosen at an initial volume of 20 ml and at a flow rate of 2.5 ml / s , and was immediately followed by a second volume of 20 ml at a flow rate of 2.0 ml / s . for all stations , the 3d mobiflex-3.0 t sequence in the coronal slice order was used with the following parameters : tr = 3.5 - 4.4 ms , te = 1.28 - 1.64 ms , flip angle = 20 , field of view = 375 mm , voxel size = 0.98 . antegrade or retrograde puncture of the femoral artery was decided according to the mra results and discussed between the two vascular interventional radiologists . digital subtraction angiography ( dsa ) was then performed , and a subsequent pta procedure was performed if necessary . the antegrade puncture of the femoral artery was used in all but 33 limbs . in those 33 limbs , pta was performed with a cross - over technique from the contralateral side because of the severe stenotic lesions in the ipsilateral puncture site or extreme obesity of the patient . all interventions were performed through a 6 fr access system ( terumo co. , tokyo , japan ) . a 4-fr vertebral catheter ( cook , bloomington , in ) was subsequently introduced and an angiography was performed . the tip of the catheter was placed at the proximal end of the occlusive vessel under the guidance of a road map . the outflow tract in the distal end of the occlusive lesion was an indication that an angioplasty was necessary . we used a low friction hydrophilic 0.035-inch guidewire ( terumo co. , tokyo , japan ) for the recanalization of the total occlusions . the tip of the guidewire was shaped into and allowed to form a ' u ' shape with the aid of a 4-fr catheter and collateral branch vessel in the proximal part of the occluded lesion . the ' u ' shape of the guidewire could ensure a wider profile , thus preventing the guidewire to exit the arterial wall or enter into the subintimal area . the 0.035-inch hydrophilic guidewire was replaced with a 0.014-inch skipper exchange guidewire ( skipper deep ; invatec , brescia , italy ) . hemi - compliance low - profile balloons ( amphirion deep ; invatec , brescia , italy ) with a balloon length of 80 or 120 mm and a diameter ranging from 2.0 to 3.5 mm were used for dilating the occluded vessel . the dilating pressure ranged from 6 to 10 atm and was maintained for three minutes . immediate postangioplasty angiograms were obtained in all cases . intravenous heparin ( a bolus of 4,000 iu followed by 1,000 iu ) was injected to maintain an activated clotting time of 250 to 300 seconds during the procedure . an additional 5,000 iu of low molecular weight heparin was administered subcutaneously every 12 hours for three days after the procedure . upon ambulation , the patients were to receive life - time antiplatelet ( aspirin , bayer co. , 100 mg daily ) treatment . technical success was defined as at least one anterior or posterior tibial artery with less than 50% residual stenosis that could be recanalized to the malleolar or dorsal foot along with no immediate severe complications . clinical success was defined in the wound group as complete healing of ulcers or dry and painless toe gangrene . in the intermittent claudication or rest pain group , success was defined as significant improvement in terms of distance walked or relief from rest pain for at least six months . a total of 417 occluded or severe stenotic lesions were treated by pta . among the 386 limbs treated , there were 305 lesions of the anterior tibial artery , 89 lesions of the posterior tibial artery , and 23 lesions of the peroneal artery ( table 1 ) . the lesion length varied from 2 to 32 cm , including 294 ( 71% ) lesions that were > 10 cm and 123 ( 29% ) lesions that were < 10 cm ( p < 0.0001 ) . altogether , 238 ( 57% ) lesions had an obvious outflow tract , whereas the rest did not . the patients were followed by clinical examinations at one , six and twelve months after the endovascular treatment . mras were supposed to be performed at six months in all patients . for those who were reluctant to undergo an mra follow - up , a doppler ultrasound examination was performed instead . at each follow - up examination , pain and wound healing were evaluated and palpated leg pulses were recorded . the visual analogue scale method was used to compare the pain levels before and after the procedure . pain relief was considered to have occurred if patients marked a 0.2-cm drop in pain level on a 0 to 10-cm scale . in this study , a technically successful pta in at least one artery that could be recanalized directly to the malleolar or dorsal foot was achieved in 322 limbs ( 89% ) ( fig . 2 ) . altogether , 374 of 417 ( 90% ) infrapopliteal occluded or severely stenotic lesions were successfully recanalized . the loop technique was attempted in 393 of 417 lesions ( 94% ) in 361 limbs , and the technique success rate attained 90% ( 352 of 393 lesions ) . in certain cases , the loop guidewire could not cross over the occlusion segments because of severe calcification ; this situation occurred in 41 lesions longer than 10 cm . vessel rupture occurred in 19 segments and we treated 142 compound stenoses or occlusions in the iliac - femoral - popliteal axis arteries of 98 patients , which were subsequently followed by the implantation of 28 self - expanded stents . there were a total of 38 major immediate post - procedure complications that were noted . one patient suffered a retroperitoneal hematoma four hours after the procedure , which required an emergency surgical intervention . distal emboli were found in 24 vessels ( 6% ) , all of which were treated with urokinase and thrombosuction . ischemia did not improve in one patient , and he subsequently required a below - ankle amputation two weeks later ( fig . vessel rupture was identified in 19 of 393 ( 5% ) segments of 19 limbs because the guidewire perforated the wall of the vessel . for these patients , the heparin was immediately balanced out with protamine sulfate , and in 15 of these limbs , a successful intraluminal angioplasty was eventually performed . no other treatments were required for the remaining four limbs from the four patients , but their symptoms of limb ischemia did not improve . there were 46 ( 12% ) minor local dissections at sites after the dilatation , of which 21 were left untreated because no retrograde flap was detected by the antegrade angiography . the remaining serious detected intimal flaps were treated by re - dilation with a balloon of the same diameter , but at a higher pressure ( an additional 1 - 2 atm ) . the mean follow - up period for this study was 10.5 6.2 months ( range : 1 to 12 months ) . altogether , clinical success , including improvement of intermittent claudication or rest pain and wound healing , was achieved in 186 of the 200 ( 93% ) patients . after the procedure , rest pain was relieved in 58 of 69 ( 84% ) limbs and 207 of 245 ( 85% ) limbs showed improvement for intermittent claudication . complete wound healing was noted in 21 of 54 ( 39% ) limbs and 20 of 54 ( 37% ) limbs showed improvement in the wound size or depth . of these cases of improvement , a repeat pta on the same leg was performed on 43 limbs in 35 patients . in the healed / improved group , twenty - two patients had subsequent minor leg amputations , but the level of amputation was lower than previously estimated . the non - symptomatic patients did not undergo a diagnostic angiography during the follow - up period . mra data could be obtained from 144 patients , while 35 patients underwent a doppler ultrasound examination follow - up . the mra follow - up at six months found re - stenosis ( stenosis 50% ) in 34 of 264 segments , but the majority of these patients did not show any symptoms . in this study , a technically successful pta in at least one artery that could be recanalized directly to the malleolar or dorsal foot was achieved in 322 limbs ( 89% ) ( fig . 2 ) . altogether , 374 of 417 ( 90% ) infrapopliteal occluded or severely stenotic lesions were successfully recanalized . the loop technique was attempted in 393 of 417 lesions ( 94% ) in 361 limbs , and the technique success rate attained 90% ( 352 of 393 lesions ) . in certain cases , the loop guidewire could not cross over the occlusion segments because of severe calcification ; this situation occurred in 41 lesions longer than 10 cm . vessel rupture occurred in 19 segments and we treated 142 compound stenoses or occlusions in the iliac - femoral - popliteal axis arteries of 98 patients , which were subsequently followed by the implantation of 28 self - expanded stents . there were a total of 38 major immediate post - procedure complications that were noted . one patient suffered a retroperitoneal hematoma four hours after the procedure , which required an emergency surgical intervention . distal emboli were found in 24 vessels ( 6% ) , all of which were treated with urokinase and thrombosuction . ischemia did not improve in one patient , and he subsequently required a below - ankle amputation two weeks later ( fig . vessel rupture was identified in 19 of 393 ( 5% ) segments of 19 limbs because the guidewire perforated the wall of the vessel . for these patients , the heparin was immediately balanced out with protamine sulfate , and in 15 of these limbs , a successful intraluminal angioplasty was eventually performed . no other treatments were required for the remaining four limbs from the four patients , but their symptoms of limb ischemia did not improve . there were 46 ( 12% ) minor local dissections at sites after the dilatation , of which 21 were left untreated because no retrograde flap was detected by the antegrade angiography . the remaining serious detected intimal flaps were treated by re - dilation with a balloon of the same diameter , but at a higher pressure ( an additional 1 - 2 atm ) . the mean follow - up period for this study was 10.5 6.2 months ( range : 1 to 12 months ) . altogether , clinical success , including improvement of intermittent claudication or rest pain and wound healing , was achieved in 186 of the 200 ( 93% ) patients . after the procedure , rest pain was relieved in 58 of 69 ( 84% ) limbs and 207 of 245 ( 85% ) limbs showed improvement for intermittent claudication . complete wound healing was noted in 21 of 54 ( 39% ) limbs and 20 of 54 ( 37% ) limbs showed improvement in the wound size or depth . of these cases of improvement a repeat pta on the same leg was performed on 43 limbs in 35 patients . in twenty - two patients had subsequent minor leg amputations , but the level of amputation was lower than previously estimated . the non - symptomatic patients did not undergo a diagnostic angiography during the follow - up period . mra data could be obtained from 144 patients , while 35 patients underwent a doppler ultrasound examination follow - up . the mra follow - up at six months found re - stenosis ( stenosis 50% ) in 34 of 264 segments , but the majority of these patients did not show any symptoms . peripheral artery occlusive disease is estimated to occur in 3% of people aged 40 - 59 years and in 20% of people over 70 years , as documented by noninvasive testing ( 3 , 4 ) . percutaneous endovascular procedures are increasingly applied to treat symptomatic peripheral artery occlusive disease . despite the fact that advances in balloon catheters have made the infrapopliteal pta procedure easier than before for long or multi - segment occluded vessels , it is still difficult for the catheter to cross over occluded segment(s ) . if the occluded vessel is relatively short , it is easier for the guidewire to cross over to the distal true lumen simply with a straight head . , the straight tip guidewire could easily perforate into the intima or outside the arterial wall and eventually result in dissection or vascular rupture . thus we remolded a ' u ' shape loop out of a 0.035-inch hydrophilic guidewire and made the guidewire and a 4-fr catheter cross the occlusive segment . next , the guidewire was withdrawn and an angiography was performed to confirm that the catheter was in the true lumen . following this , the diameter of the compatible guidewire for the new infrapopliteal balloon catheter was 0.014 inches , which provided insufficient support compared to the commonly used 0.035-inch hydrophilic guidewire . in the early stages , we nevertheless tried to cross through the lesion with the skipper guidewire , but the tip was too soft to cross over . the first method involved the use of a remoldable guidewire ( terumo co. , japan ) . we can remold the tip to a ' j ' type in advance and then insert the catheter . this ' j ' type could recover in the larger diameter vessels such as the superficial femoral artery . this method was sometimes not effective because the remolded guidewire was inserted into the infrapopliteal target vessel with difficulty , especially into the anterior tibial artery . the other method relies on assistance from the catheter and vascular branch . under most circumstances , we can first insert the hydrophilic guidewire into a proximal branch and then make the ' u - shaped ' loop by continually rotating and advancing the guidewire . when using the 0.035-inch stiff guidewire to penetrate long occlusion lesions , we generally looped the head wire into a ' u ' shape by letting the head of the wire enter one of branches and then twisting the wire to form the loop . this technique helps to guarantee that the guidewire stays in the arterial lumen , prevent the guidewire from perforating the vessel , and hence reduce damage to the vessel wall during advancing . this technique also provides strength when penetrating an organized thrombus or calcified plaque as well as reduce the likelihood that the wire will enter the subintima as occurs when using the ' j - shaped ' guidewire head . this intraluminal angioplasty technique allows us to reduce the thrombosis occurrence and also provides a better long - term patency of the recanalized vessel compared to the subintimal angioplasty , according to our study ( 5 , 7 ) . however , this technique may have a high manipulation requirement and result in a somewhat higher vessel perforation rate ( 5% ) . careful advance must be maintained to prevent the guidewire from perforating the proximal vascular branch . sometimes we need to rotate the guidewire to better facilitate its passing through the lesion . the loop tip of the guidewire should be kept straight before it arrives at the dorsal artery of the foot or arteria plantaris , because its diameter is close to that of the guidewire ( fig . ( 8) report that a emergency surgical intervention was required after 31 of 1,377 procedures ( 2% ) with acute limb ischemia and hemorrhagic complications . in our group , only one patient with a retroperitoneal hematoma required emergency surgical treatment . the hemorrhage caused by infrapopliteal vessel perforation required no further treatment and no calf hematoma was found . distal embolic events may be inevitable in the procedure of recanalization of an occluded vessel . distal embolization of a plaque or thrombus may cause organ ischemia following percutaneous peripheral interventions , especially in the superficial femoral or iliac artery . this event may occur at various phases of intervention such as guidewire crossing , balloon angioplasty , stent deployment , and so on ( 9 ) . thrombolytic or thrombosuction therapy was usually effective and amputation was performed in only one patient after an angioplasty because of distal limb ischemia . ( 8) . to date , stent deployment below the knee is rare ; lam et al . ( 9 ) monitored the whole procedure during a superficial femoral artery intervention and found that embolic signals were noted in every patient during wire crossing , angioplasty , stent deployment , and atherectomy . however , patency was restored angiographically after thrombolysis . despite the frequency of these events , only one patient developed an angiographically and clinically significant embolization . in our patients , distal embolic events were noted angiographically in 24 vessels , however only one patient suffered from significant ischemia of a limb requiring below - the - knee amputation . an ipsilateral antegrade common femoral artery ( cfa ) puncture is usually preferred to a contralateral retrograde femoral access for the below - the - knee pta . in our group , procedures on all but antegrade puncture refers to the placement of an angiographic needle in the cfa in the direction of arterial flow . the puncture is made in the skin above the inguinal ligament , but the tip of the needle should always enter the cfa below the inguinal ligament . this procedure allows for the insertion of a vascular sheath for balloon angioplasty of the superficial femoral and/or popliteal arteries ( 10 ) . because of the frequent difficulty with providing sufficient manual pressure at the puncture site , an antegrade puncture is complicated by a high number of local bleeding complications , including retroperitoneal hematoma ( 11 ) . hemostasis of the puncture sites at the end of the procedure in all of our patients was achieved by manual compression . arterial access can be complicated by a ' hostile groin ' ( scarring , obesity , or previous failed cfa puncture ) ( 12 ) . it is a challenging procedure with a learning curve for the interventional radiologist ( 13 ) . a high puncture ( above the inguinal ligament ) is associated with increased incidence of groin hematoma and retroperitoneal hemorrhage , whereas a low puncture is associated with increased incidence of arteriovenous fistula and pseudoaneurysm formation ( 14 , 15 ) . a fluoroscopy is a helpful technique in guiding the arterial puncture towards the mid - femoral head . in obese patients , local bleeding may cause ecchymoma , which could be relieved via physical treatment . to date , femoral artery closure devices such as the angio - seal collagen plug and anchor device have been approved and shown to benefit patients after femoral artery catheterization . only a few studies in the literature have examined such closure devices of a post - antegrade puncture ( 11 , 16 - 18 ) . these vascular closure devices may be a safe , efficient and uncomplicated means of achieving arteriotomy closure of a post - antegrade puncture . in conclusion , in our experience , pta of infrapopliteal vessels is effective in treating infrapopliteal arterial occlusive disease , while also being associated with a low risk for major medical and surgical complications . based on our findings , the guidewire looping technique is safe and effective for the recanalization of occlusive segments of vessels . as far as we know , this paper is the first report on this technique applied to below - the - knee vessels .

objectiveto determine the efficacy , safety and primary follow - up results of a guidewire looping technique for the treatment of infrapopliteal arteries.materials and methodsfrom october 2006 to may 2008 , an intraluminal angioplasty of the infrapopliteal arteries was attempted in 200 consecutive patients . altogether , 417 infrapopliteal lesions , with lengths varying from 2 cm to 32 cm , were treated as part of this study , including 305 lesions in the anterior tibial arteries , 89 in the posterior tibial arteries , and 23 in the peroneal arteries . the ' u'-shaped guidewire technique was attempted in 393 lesions from 361 limbs . the tip of a hydrophilic 0.035-inch guidewire was formed into a ' u ' shape with the aid of a 4-fr catheter and collateral branch vessel to recanalize the completely occluded long segment lesions.resultsa successful angioplasty with at least one artery recanalized directly to the malleolar or dorsal foot was achieved in 322 limbs ( 89% ) . the looping technique had a success rate of 90% ( 352 of 393 lesions ) . after the procedure , the rest pain was relieved in 58 of 69 patients , while 207 of 245 limbs ( 85% ) showed improvement for intermittent claudication . complete wound healing was noted in 21 of 54 patients , while 20 of 54 patients showed an improvement in the wound size or depth . a total of 38 major immediate procedure - related complications were noted , including retroperitoneal hematoma , distal emboli , and vessel rupture.conclusionthe results of this study suggests that the guidewire looping technique is a safe and effective method for the recanalization of the occluded lesions in infrapopliteal vessels .

approximately , 85% of patients with primary hyperparathyroidism ( phpt ) suffer from a single parathyroid adenoma . development and improvement of pre - operative noninvasive imaging techniques , particularly the planar tc - sestamibi - scintigraphy ( mibi ) and additional single - photon emission computed tomography ( spect ) , and improvements in high - resolution ultrasonography ( us ) led to the implementation and further development of focused and minimally invasive surgical techniques.[24 ] in addition , intra - operative rapid parathyroid hormone monitoring ( iopth ) allows for assessing the completeness of parathyroid resection without visualizing all parathyroid glands.[57 ] cure rates of the minimally invasive parathyroidectomy ( mip ) are equal compared to the conventional bilateral cervical exploration ( bce ) , which was considered for many decades as the standard approach in patients with phpt . recent literature underlines the importance of preoperative us in patients undergoing surgery for phpt as a highly specific tool to identify parathyroid tumors and potential concomitant thyroid pathologies . it may also provide detailed information regarding the exact site of the suspected parathyroid gland related to adjacent anatomic structures . contrast - enhanced ultrasonography ( ceus ) is a well - established diagnostic tool regarding parenchymatous organs such as liver , kidney , or spleen.[1113 ] however , the significance of ceus in patients with phpt prior to the initial surgery has been hardly investigated . the aim of this study was to determine the applicability and significance of ceus in patients with phpt . 25 patients with proven phpt , preoperative us as well as mibi / spect scans were selected for further evaluation using ceus at the university hospital marburg , germany . once informed consent was obtained and exclusion criteria were ruled out [ table 1 ] , ceus was performed according to the european federation of societies for ultrasound in medicine and biology ( efsumb ) guidelines . us and ceus were performed by two different sonographers with expertise in head and neck us and both were blind to results obtained by the other . inclusion and exclusion criteria used to select patients considered for a minimally invasive or focussed unilateral parathyroidectomy for ceus investigations us was performed using a high - resolution scanner with a high frequency ( 7 - 13 mhz ) linear - array transducer with conventional color and power doppler capability ( digital gaia sa-8800 , kretztechnik ag , zipf , austria ) , including adjustable pulse repetition frequency ( scale ) , focus , and color gain . all findings suspicious of a parathyroid adenoma , such as , size , echogenicity , and site in relation to adjacent structures subsequently , ceus was performed using a suspension of phospholipid - stabilized sulfur - hexafluoride ( sf6 ) microbubbles ( sonovue , bracco spa , milan , italy ) in combination with a special 12 mhz linear us probe ( acuson sequonia , siemens medical solution , erlangen , germany ) . before intravenous application of the contrast agent , a conventional b - mode and color doppler us of the thyroid region were done . the contrast agent was administered intravenously via a 20-gauge cannula at a concentration of 45 g / ml , containing 8 l / ml sf6 microbubbles . according to the manufacturer 's instructions , a total volume of 2.4 ml was administered followed by a 5 ml saline flush . the agent was administered within 2 - 3 s , while the us probe focused on the suspected area in the neck . however , intermittent instead of continuous us scanning was performed to avoid us wave triggered damage to the microbubbles , which might influence the significance of the investigation . the ceus investigation was divided into the wash - in and wash - out periods . the wash - in or arterial the wash - out or parenchymatous phase ranges from 30 to 120 s. echogenicity , vascularization , and wash - in and wash - out characteristics of the suspected formation were defined and compared to the adjacent thyroid tissue within both phases . results of us and ceus were evaluated by well - experienced sonographers , who were blind to the other 's findings [ table 2 ] . results of pre - operative localization procedures and intra - operative findings in patients with ceus and surgery for phpt figures 14 clearly show color - coded doppler us ( 1 ) , conventional b - mode us ( 2 ) , the wash - in phase ( 3 ) , and wash - out phase ( 4 ) of a suspected parathyroid adenoma ( arrow ) next to the thyroid ( t ) and carotid artery ( a ) . color - coded doppler ultrasonography shows a parathyroid adenoma ( arrow ) , thyroid lobe ( t ) , carotid artery ( a ) . conventional b - mode us scan shows a parathyroid adenoma ( arrow ) , thyroid lobe ( t ) , carotid artery ( a ) . contrast - enhanced ultrasonography ceus in wash - in phase shows a parathyroid adenoma ( arrow ) , thyroid lobe ( t ) , carotid artery ( a ) . contrast - enhanced ultrasonography ceus in wash - out phase shows a parathyroid adenoma ( arrow ) , thyroid lobe ( t ) , carotid artery ( a ) . in addition , results of us and ceus were compared to results of mibi / spect investigations . planar scintigraphy was performed 5 , 15 , and 120 min after intravenous injection of 740 mbq of tc - mibi . static images in anterior view with a 128 128 matrix were acquired of the cervical and thoracic area using a dual head gamma camera equipped with a low - energy high - resolution ( lehr ) collimator ( symbia , siemens , erlangen , germany ) . spect acquisition was performed at the late phase ( 90 min after intravenous injection ) and all 128 views were acquired with an acquisition time of 30 s per view using the same system . positive preoperative localization was followed by an open minimally invasive parathyroidectomy ( omip ) or focused unilateral parathyroidectomy . in patients with inconclusive or negative results , rapid iopth was used to confirm complete removal of all hyper - functioning parathyroid tissue in patients who underwent omip or focused parathyroid surgery . frozen sections were prepared and definite histopathological investigation done on all specimens that were removed during surgery . preoperative localization studies were performed in 17 female and eight male patients suffering from phpt . characteristics , clinical , and pre - operative data of 24 patients with pre - operative ceus and surgery for sporadic phpt in 17 patients ( 68% ) , preoperative mibi / spect , us , and ceus showed consistent results . a bce was done because preoperative localization results suggested a double adenoma with one enlarged parathyroid gland on each side in one patient , and bce was necessary because us provided evidence of concomitant thyroid pathology in the other patient . in all 17 patients , frozen section confirmed the diagnosis of a parathyroid adenoma and in all patients , an adequate pth drop was documented using iopth . in eight patients ( 32% ) , one of these patients suffered from mild phpt with only slightly elevated calcium and pth values ( ca , 2.7 mmol / l ; pth , 78 ng / l ) . in this 81-year - old asymptomatic female patient , spect was positive , whereas the planar mibi - scan was negative . us suggested an enlarged bilateral multinodular goiter without evidence of a suspected parathyroid gland . in this patient , results of preoperative localization procedures , including characteristics of the suspected parathyroid glands during us and ceus and intra - operative findings are summarized in table 3 . ceus was done in all 25 patients but did not reveal additional information regarding suspected or discordant findings of conventional cervical sonography or mibi / spect . in summary , echogenicity of the suspected parathyroid adenomas was inconsistent as 11 out of 25 glands were hypoechoic and 13 out of 25 patients were isoechoic compared to the thyroid gland . in 11 patients , vascularization was described as less or significantly less , whereas it was equal in 13 patients compared to the thyroid . in one patient , we were not able to compare echogenicity and vascularization of the presumed parathyroid adenoma with the thyroid gland , due to previous thyroidectomy , since the presence of thyroid disease or the absence of thyroid gland might interfere with the diagnostic accuracy of ceus . results of the eight patients with inconsistent us and mibi / spect results are shown in table 4 . in these patients , results of pre - operative localization procedures in eight patients with inconclusive pre - operative us and mibi / spect and intraoperative site of the parathyroid adenoma in the era of focused and minimally invasive parathyroid surgery , pre - operative localization procedures are of utmost importance and the success of a focused approach is dependent on accurate preoperative imaging . during the past decade , preoperative localization procedures , especially planar mibi and additional spect and high - resolution us , have significantly improved.[1618 ] thus , mip became the treatment of choice in patients with preoperatively localized sporadic phpt . several prospective trials showed success rates of focused parathyroid operations that were similar to success rates of the bce . us and mibi / spect show sensitivity rates of up to 90%.[171922 ] taking these facts into account , the question arises , whether additional complex and cost expensive preoperative localization tools are needed . ceus is an important addition in the diagnostic workup routine of parenchmatous organs , such as , liver , spleen , and kidney.[2325 ] despite the use of considerably improved contrast agents , we were not able to provide evidence for a significant gain of information using ceus in patients suffering from phpt . moreover , we were not able to prove the promising results of mazzeo and colleagues . in their study , ceus was performed using a galactose - based microbubble contrast agent , which requires a high mechanical index ( mi>0.7 ) that leads to a rapid destruction of the microbubbles , and therefore prevents real - time investigation of the suspected structures . furthermore , the authors were able to compare preoperative localization results with intra - operative findings in a rather small group of patients : only 10 out of 13 patients underwent surgery for phpt and in only nine patients a parathyroid adenoma was detected intra - operatively . the rather heterogeneous results of color doppler us and ceus investigations , the use of an inappropriate , water - soluble contrast agent with a less intense signal enhancement with the less valuable characteristic of diffusing into the extracellular matrix , and the small number of patients included do not allow for definite conclusions from this pilot study . despite a comparable cohort of patients , almost equal technical requirements ( e.g. us probe , mi<0.17 ) , and the use of the same , considerably improved , non - water - soluble contrast agent , our results are contradictory to the promising results reported by agha et al . , who were able to localize all suspected parathyroid glands in 30 patients suffering from phpt . in this study , all patients underwent conventional us , color doppler us , scintigraphy , and magnetic resonance imaging ( mri ) together with ceus . however , it remains unclear whether the ceus performing ultrasonographer was blind to the accompanying localization results . moreover , the authors do not provide information regarding the time schedule of the localization procedures performed and the number of patients with completely negative us , mibi , and mri results . ceus has all the disadvantages of conventional us , including the high dependency on the individual skill of the investigator . it is implicitly necessary to identify a suspected lesion before ceus can be applied because there is a given time frame of the wash - in and wash - out phases that does not allow for an extensive scanning of the thyroid region . in addition , intermittent instead of permanent us scanning after application of the contrast agent is recommended due to us wave triggered burst of the microbubbles . our results show that ceus does not give helpful additional information in cases when us and mibi / spect results are inconsistent or negative . knowledge of a retrosternal , intra - thoracic , or deep mediastinal position of the suspected gland is of utmost importance for planning the surgery , but neither us nor ceus are able to detect these glands . however , mibi / spect is able to reliably visualize parathyroid tumors in extra - cervical positions . ceus seems to be easy to apply and might be less expensive compared to scintigraphy or mri investigations . however , to perform ceus , ultrasonic devices have to be equipped with specific us probes and software and investigators have to undertake a special training . therefore , us and mibi / spect are still the standard preoperative localization procedures in our institution , complying with requirements to definitely localize a suspected solitary parathyroid gland in patients suffering from phpt . in patients with inconclusive or negative mibi / spect and us results , a bce of the neck should be performed by an experienced endocrine surgeon , whereas additional noninvasive and invasive localization procedures , such as , mri , ct , methionine - pet , or preoperative selective venous sampling , are only recommended before re - operation in the neck due to recurrent phpt or following thyroid surgery . a potentially promising application of ceus in patients with preoperatively localized phpt might be a specific application of antibodies on microbubbles ( microbubble coating ) , that target parenchymatous organs or endocrine tissue . this might lead to a highly selective accumulation in a particular tissue and in case of preoperative parathyroid localization may help to definitely differentiate between parathyroid glands and surrounding tissue . ceus is a well - established diagnostic tool for investigating parenchymatous organs such as , liver , kidney , or spleen . in this limited cohort of patients , no additional information could be obtained using the costly ceus compared to results of us and mibi / spect . however , additional investigations are necessary to finally estimate potential advantages of an additional use of ceus in parathyroid or thyroid surgery .

objective : pre - operative localization studies are inevitable in patients with primary hyperparathyroidism ( phpt ) , who are eligible for focused or minimally invasive parathyroidectomy ( mip ) . high - resolution ultrasonography ( us ) in combination with planar 99mtc - sestamibi - scintigraphy ( mibi ) and additional single - photon emission computed tomography ( spect ) are the standard procedures to localize enlarged parathyroid glands . our aim was to evaluate the practicability and significance of contrast - enhanced ultrasonography ( ceus ) in patients with phpt.materials and methods : all investigations were performed at the university hospital marburg . totally , 25 patients with biochemical proven phpt underwent preoperative us , mibi / spect , and ceus . for ceus , a suspension of phospholipid - stabilized sulfur - hexafluoride ( sf6 ) microbubbles in combination with a special 12 mhz linear us probe was used . all patients were investigated by two sonographers , who did not get to view the findings noted by the other . finally , surgery was performed and histopathological results were obtained from 24 patients.results:in 17 ( 68% ) patients , us and mibi / spect already raised suspicion of parathyroid lesions and all suspected lesions were reassessed by ceus . however , no additional information was obtained using ceus . especially in eight patients with negative or inconsistent us and mibi / spect results , ceus did not provide additional information regarding the site of the suspected parathyroid adenoma . overall , no side effects were observed using ceus . surgical cure was achieved in all patients.conclusion:in this limited cohort of patients , no additional information could be obtained using the costly ceus compared to results of us and mibi / spect .

a 57-year - old man with newly diagnosed chronic myelomonocytic leukaemia ( cmml ) receiving etoposide chemotherapy presented to his primary medical doctor with a two - month history of abdominal pain and altered bowel habit . subsequent investigation with colonoscopy and computed tomography ( ct ) scan revealed a primary neoplasm of the sigmoid colon with tethering of the small bowel and no evidence of widely metastatic disease . his pre - operative blood film showed features consistent with stable cmml in the absence of acute leukaemic transformation or disseminated intravascular coagulation ( dic ) . two weeks following his last dose of etoposide the patient underwent an operation which demonstrated a large sigmoid mass adherent to the terminal ileum and both ureters . a high anterior resection , en bloc small bowel resection and loop ileostomy were performed taking 180 min . it was at this point that the patient became profoundly and inexplicably hypotensive ( 60/40 mm hg ) with bradycardia ( 40 bpm ) and evolution of st depression on the two lead cardiac monitor . the patient was also noted to have copious oozing of frank blood from the incision site despite having achieved adequate intra - operative haemostasis . as part of the intra - operative resuscitation he received two 500 ml boluses of colloids and a single dose of 0.3 mg intravenous adrenaline . he was transferred as an unplanned admission directly to the intensive care unit ( icu ) for further management . on arrival to the icu , he presented in hypovolemic shock and clinical dic ( table 1 ) . serial troponin i results reflected an ischaemic myocardial event , peaking at 14.68 mol / l ( reference range < 0.10 ) on icu day 3 . a twelve lead electrocardiogram demonstrated sinus tachycardia and st depression in leads v4-v6 with new onset right bundle branch block . trans - thoracic echocardiogram revealed a hyperdynamic and hypovolemic left ventricle without segmental wall motion abnormality implicative of a global ischemic insult . table 1laboratory results on admission to the intensive care unit.resultunitsreference rangefull blood picture haemoglobin65g / l(115165 ) white cell count148.0109/l(4.011.0 ) platelets67109/l(150400)serum biochemistry sodium133mmol / l(134146 ) potassium5.3mmol / l(3.45.0 ) urea5.7mmol / l(3.08.0 ) creatinine201mol / l(53106 ) cardiac troponin i2.0mol / l(<0.10)arterial blood gas ph7.05(7.357.45 ) po2136 mm hg(8095 ) pco244 mm hg(3545 ) bicarbonate12mmol / l(2228 ) base excess17mmol / l(3+3 ) lactate7.2mmol / l(0.21.8)coagulation profile international normalised ratio ( inr)4.7(0.91.1 ) > activated partial thromboplastin time96sec(2133 ) fibrinogen0.9g / l(2.04.0 ) the patient remained intubated , ventilated and required inotropic support with a noradrenaline infusion . his profound coagulopathic state necessitated the administration of seven units of fresh frozen plasma , six units of cryoprecipitate , six units of packed red cells and four pools of platelets in the first 24 h of his icu admission . after consultation with the patient 's haematologist , he was also given 100 mcg / kg of recombinant activated factor vii . by the third post - operative day , the patient was extubated but required total parenteral nutrition for a prolonged ileus and was commenced on continuous venovenous haemodiafiltration for an evolving acute kidney injury due to his initial pre - renal insult . on day 6 he had further intra - abdominal bleeding manifested by a slowly falling haemoglobin and repeat ct abdomen revealing a large abdominal collection . his coagulation profile and given the ongoing difficulty with haemostasis , the patient was deemed too high - risk for further surgical intervention . on day 10 the patient 's blood film demonstrated acute leukaemic transformation in the form of a myeloid crisis based on cytological features , which would require urgent chemotherapy to avert a rapidly fatal outcome . as it was unlikely to alter management in this setting , cytological analysis of the myeloid crisis similarly a bone marrow biopsy was not pursued at this point , and was contraindicated in the acute phase when the patient was coagulopathic . given the patient 's ongoing dialysis needs , agitation and overall debilitated state a frank discussion with family was held and a unanimous decision was made to redirect management priorities towards patient comfort . palliative measures were given priority , and the patient subsequently died on day 13 post - operation . histological examination of the resected portion of the sigmoid colon found a well - differentiated adenocarcinoma extending through the muscularis propria into the subserosal fat without lymph node involvement ( 0/39 ) . adjacent to this tumour was a florid atypical myelomonocytic infiltrate consistent with a differentiating myeloid sarcoma and evidence of early transformation into acute myeloid leukaemia . the infiltrate consisted of blasts as well as a progression of more differentiated cells of both the myeloid and monocyte lineage . these cells were positive for myeloperoxidase and cd68 , but were negative for cd3 , cd20 and cd117 ( figures 14 ) . figure 1macroscopic image of a portion of the resected sigmoid colon with adherent small bowel . the myeloid sarcoma is demonstrated by the tissue exhibiting a green colour due to the presence of myeloperoxidase , hence the traditional term chloroma . the myeloid sarcoma is demonstrated by the tissue exhibiting a green colour due to the presence of myeloperoxidase , hence the traditional term chloroma . figure 2microscopic image of the resected sigmoid colon illustrating the adenocarcinoma ( left ) with an adjacent infiltrate of immature myeloid cells consistent with myeloid sarcoma ( right ) . microscopic image of the resected sigmoid colon illustrating the adenocarcinoma ( left ) with an adjacent infiltrate of immature myeloid cells consistent with myeloid sarcoma ( right ) . figure 3microscopic image demonstrating the differentiating myeloid sarcoma at a higher magnification . microscopic image demonstrating the differentiating myeloid sarcoma at a higher magnification . myeloid sarcoma [ also termed chloroma , granulocytic sarcoma and extramedullary acute myeloid leukaemia ( aml ) ] is characterised as an extramedullary collection of immature myeloid cells , which may develop de novo , or on the background of acute myeloid leukaemia , myelodysplastic or myeloproliferative diseases . it is a rare neoplasm , with a reported incidence of 3.1% in myelogenous leukaemia . cases of myeloid sarcoma have been described at various stages of aml from the initial presentation , relapse and it has even been recognised to herald an impending blast crisis in myeloproliferative disease . the broad clinicopathological features of this entity was a subject of review during a workshop held in indianapolis in , usa by the society for hematopathology / european association in november 2007 . while myeloid sarcoma commonly develops in the skin , bone and lymph nodes it can occur in any anatomical location including the gastrointestinal system . as a result diagnosis is therefore dependent on clinical suspicion and should be considered in any patient with aml presenting with an extramedullary mass lesion . indeed the manifestations of myeloid sarcoma within the bowel are usually no different to that of any other tumour . one of the cases examined in the society of hematopathology 's workshop was a de novo colonic myeloid sarcoma in a patient who presented with abdominal pain and was preoperatively diagnosed with adenocarcinoma . intra - operatively , this was reported as a non - ulcerating mass of the transverse colon with invasion into the surrounding fat and soft tissue which was subsequently diagnosed as myeloid sarcoma . however such a catastrophic event arising from tumour - induced coagulopathy has not been previously documented in myeloid sarcoma . a similar case of colonic myeloid sarcoma with a fatal outcome following resection was reported in a 60-year - old female in france however again , the process here was attributed to toxic shock and not a consumptive coagulopathy . acute dic complicating this patient 's high anterior resection was attributed to intra - operative manipulation of the myeloid sarcoma . acute dic is a well - recognised systemic process characterised by activation of the coagulation system resulting in widespread thrombosis and haemorrhage . the clinical consequences of dic vary depending on the clinical setting , but multi - organ failure due to thromboembolism and bleeding is not uncommon . four mechanisms have been defined as giving rise to dic including increased thrombin generation , suppression of physiological anticoagulation , impaired fibrinolysis and activation of the inflammatory pathway . sepsis , trauma , malignancy and obstetric complications are the major initiating factors for dic . whilst this coagulopathic process is driven by tissue factor in sepsis , it is thought that cancer procoagulant is responsible for dic in the setting of malignancy . cancer procoagulant is a calcium - dependent cysteine proteinase expressed by malignant cells and foetal tissue which activates factor x independently of the tissue factor - factor viia complex . cancer procoagulant along with increased expression of annexin ii receptor has been implicated in the development of dic in acute promyelocytic leukaemia ( apml ) . the presence of annexin ii receptor on the surface of leukaemic promyelocytes has been shown to stimulate the production of t - pa - dependent plasmin more efficiently . the presentation in this case report is not dissimilar to previous accounts of colonic myeloid sarcoma . the complicated post - operative course due to acute dic however raises two main issues . firstly , the coagulopathy that was triggered by direct surgical manipulation of this tumour has not been previously reported . acute dic is known to be mediated by cancer procoagulant in the setting of malignancy , and the role of annexin ii receptor has been highlighted in apml . it is conceivable that a peripheral promyelocytic blast crisis in this case may have accounted for the dic that ensued . however this was not clearly demonstrated on cytology , and furthermore the clinical onset of dic preceded that of myeloid crisis by ten days . resection of the tumor and systemic spread of promyelocytic cells could also be hypothesized as the mechanism for this phenomenon , but again such a finding was not demonstrated on analysis of the peripheral blood . further studies are therefore needed to understand the mechanisms causing dic in myeloid sarcoma , which in this case was severe and very difficult to control . the second issue pertains to diagnosis and management in view of the complications that were observed . while clinical suspicion is important , the detection of myeloid sarcoma ultimately requires tissue for a formal diagnosis . to complicate matters , myeloid sarcoma occurring in the shadow of a more sinister malignancy this case clearly demonstrates that making a pre - operative diagnosis is very difficult in the context of another , more obvious malignancy . finally , this begs the question as to whether management might have been modified if the diagnosis of myeloid sarcoma ( and the prospect of a haemorrhagic complication ) had been established in advance of surgery . the impending transformation into acute leukaemia in this patient may suggest a role for preoperative chemotherapy , but there is no evidence that this would necessarily avert intra - operative dic . furthermore , this is the only known report of dic from surgical resection of myeloid sarcoma and probably represents a very rare outcome . although there are no firm grounds to anticipate similar complications occurring in similar circumstances , such a possibility is at least worthy of consideration in any patient with a myelogenous leukaemia who is undergoing surgery for an extramedullary tumour .

myeloid sarcoma is a rare extramedullary tumour consisting of immature myeloid cells . it can arise at any anatomical location and often develops in the bowel . this report describes a case of severe acute disseminated intravascular coagulation ( dic ) with multi - organ failure occurring in a 57-year - old man with chronic myelomonocytic leukaemia during bowel resection for newly diagnosed adenocarcinoma of the sigmoid colon . histopa thology however revealed a differentiating myeloid sarcoma encompassing a well - differentiated adenocarcinoma . this is the first documented case of acute dic to be triggered following surgical manipulation of myeloid sarcoma .

ludwig 's angina is a rare consequence of periodontal infection that can result in severe upper airway obstruction and potentially death . prior to our report , there have only been two cases reported in pregnant women . we report the first case that required immediate delivery secondary to worsening fetal and maternal health status . this patient is a 24-year - old with a history of hepatitis c infection , intravenous drug use , and ten - pack year smoking history who presented as transfer of care during her thirty - third week of gestation . initially , she presented with a tooth abscess that was treated with outpatient medication therapy that included oral antibiotic ( amoxicillin - clavulanate ) and analgesic medications . despite reported compliance , she represented two days later at a community hospital with a low - grade fever and left - sided neck swelling consistent with angioedema . she was counseled and consented for elective endotracheal intubation given the concern for significant airway compromise . her diagnosis was ludwig 's angina in pregnancy and she was transferred to our tertiary hospital 's obstetrical intensive care unit . upon admission , the patient was arousable , responsive to commands , and able to communicate despite the in situ endotracheal tube . she was normotensive , mildly tachycardic , and saturating well on room air without the need for assisted ventilation . her palate and dentition were not fully visible , but her trachea appeared midline . antenatal testing revealed a reactive fetal heart rate tracing , sonographic fetal biometry was consistent with her dates , and the fetus had a normal anatomic survey . the otolaryngology service at our center confirmed the diagnosis of ludwig 's angina , initiated parenteral piperacillin - tazobactam therapy , and recommended against steroids to prevent further maternal immunosupression . an incision and drainage of her neck abscess was performed in the operating room followed by removal of her endotracheal tube and placement of a tracheotomy tube . a gram stain of the abscess revealed gram - negative rods and her antibiotic therapy was continued . throughout this therapy , antenatal testing on the first postoperative day , secondary to presumed septic shock , she became hypotensive with increasing oxygen demands that required vasopressive and ventilatory support . she was additionally diagnosed with acute respiratory distress syndrome ( ards ) based on her presentation and chest radiographic findings of bilateral opacities . despite several efforts , the patient 's status did not improve and the fetal heart rate tracing became persistently nonreassuring with repetitive late decelerations . at this time , the maternal fetal medicine specialist proceeded with cesarean delivery for nonreassuring fetal indications . she had an urgent repeat lower transverse cesarean section , delivering a female infant weighing 2120 grams with apgars of 2 , 6 , and 7 . the newborn was intubated , admitted to the neonatal intensive care unit , and started on empiric ampicillin and gentamicin therapy . immediately following delivery of the neonate , the patient returned to the medical intensive care unit . on postpartum day number one , she was weaned off of vasopressor therapy and transitioned to a trach collar . the tracheotomy was first used continuously for five days , then intermittently , and successfully removed on postpartum day number eight . the newborn did well in the neonatal intensive care unit : her blood cultures were negative , antibiotics were discontinued , she was extubated on day of life 2 , and she was progressively weaned off of oxygen therapy . the patient was then discharged home on postoperative day nine with oral antibiotic therapy and plans for follow - up . karl ludwig who observed deadly forms of tooth infection , ludwig 's angina is a rare case found in medicine . typically , as an odontogenic infection of the 2nd and 3rd molars , it has direct spread , rather than hematogenous or lymphatic , to the submandibular , sublingual , and submental spaces . this can lead to rapid and profound neck swelling and in some cases death by airway compression . the infection and edema are limited by the deep cervical fascia , mandible , and hyoid . as a result , the tongue and floor of the mouth are elevated and posteriorly displaced with compromise of the airway , which can result in abrupt asphyxiation . infection often results from streptococci , staphylococci , or bacteroides , although 50% of infections are polymicrobial . management of a patient with ludwig 's angina requires early aggressive therapy with antibiotics , incision and drainage of any abscess , and protection of the airway [ 1 , 2 ] . fifty percent of pregnant women annually in the united states are affected by periodontal disease involving chronic anaerobic oral infection . the pregnant patient with a maxillofacial infection requires special attention given the physiologic changes of pregnancy , which puts the patients at increased risk of complications . such changes include increased sodium retention , dilutional anemia , decreased colloid pressure , and an upper airway that is affected by capillary engorgement and subsequent edema of the nasal passages , larynx , oropharynx , and trachea . chronic gingivitis , friable oral mucosa , and mild immunosuppresion of pregnancy play an important role in outcome . further , changes in gastrointestinal motility and other physiologic systems put the pregnant patient at increased risk of acute respiratory distress syndrome , pneumonia , sepsis , amniotic fluid embolism , disseminated intravascular coagulation , and pulmonary edema secondary to aspiration . adverse pregnancy outcomes such as preterm birth , low birth weight , fetal growth restriction , preeclampsia , and perinatal mortality are associated with periodontal disease [ 36 ] . there are only 2 prior case reports of pregnant women with ludwig 's angina in the present literature , neither of which required delivery as part of the treatment plan [ 7 , 8 ] . in our case , delivery was indicated given the nonreassuring fetal tracing that was likely associated with fetal hypoxia or acidosis . the physiological changes associated with this preterm delivery may have resulted in improved ventilation status . functional residual capacity ( frc ) decreases on average by 18% in the third trimester and is further compromised in the case of ards . given the increase in frc that occurs postpartum , this improvement in gas exchange may have improved her hypoxemic state . respiratory compliance may also improve post delivery following a downward displacement of the diaphragm . a case series of 10 intubated pregnant patients demonstrated a 28% reduction in fraction of inspired oxygen requirement by 24 hours after delivery . delivery is also associated with improved hemodynamic changes , specifically related to cardiac output , when the delivery of the neonate relieves compression placed on the vena cava . broad - spectrum antibiotic coverage , including the addition of vancomycin therapy , likely contributed to resolution of this patient 's septic condition . it is unclear as to whether these physiological changes imply a direct cause and effect relationship for the improvement of our patient 's health status . it is controversial whether pregnant patients with acute respiratory failure such as ards will improve with delivery in situations when immediate delivery is not indicated [ 10 , 11 ] . delivery should continue to be reserved for obstetrical indications [ 10 , 11 ] . for this rare antepartum medical presentation of ludwig 's angina , the decision to perform a cesarean section avoided a potentially fatal outcome for the neonate .

at 33 weeks of gestation , a 24-year - old developed ludwig 's angina that worsened despite aggressive therapy . this is the first reported case of ludwig 's angina in pregnancy that required an emergent cesarean section for fetal indications . delivery may have contributed to improvement in the mother 's health status .

endoscopic mucosal resection ( emr ) is emerging as one of the most important techniques to be incorporated into gastrointestinal endoscopy ( 1 ) . however , en bloc resection is often not achieved using conventional techniques such as the strip biopsy or cap emr ( 2 ) . in an attempt to overcome this limitation , endoscopic submucosal dissection ( esd ) techniques using a variety of knives , such as the insulated - tip or the triangle - tip models , esd can completely remove affected mucosa by dissecting through the middle or deeper part of the submucosa ( 6 ) . the large specimen extending into the submucosa attained by submucosal dissection techniques permits definitive pathological assessment of resection margins and invasion depth even for large tumors greater than 20 mm in diameter . this would almost certainly result in a lower recurrence rate than piecemeal resection ( 1 ) . esd can achieve a complete resection in a majority of patients , but it is associated with a higher risk of bleeding than classic emr ( 7 ) . although bleeding during esd is usually treated with procedures such as electrocoagulation and hemoclipping and poses no clinical problem , postoperative or delayed bleeding , on the other hand , has been reported otherwise ( 8) . prevention of bleeding after esd is therefore an important clinical issue . for preventing bleeding after esd , histamine2-receptor antagonists ( h2ras ) or proton pump inhibitors ( ppis ) have been administered . however , few studies have been made to investigate the effectiveness of h2ras or ppis for preventing bleeding after esd . therefore , the aim of this study was to compare the relative effectiveness of pantoprazole and famotidine for the prevention of delayed bleeding after esd . all patients undergoing esd for gastric neoplasm between september 2005 and september 2006 were included in this prospective study . they were randomly assigned , before gastric esd , to pantoprazole or famotidine medication . in the pantoprazole group , pantoprazole 80 mg ( a loading dose ) was given intravenously 2 hr before esd , and 8 mg / hr of intravenous pantoprazole was given continuously for the first 24 hr ( maintenance ) . at the second day , pantoprazole 40 mg was given intravenously twice . from the third day after esd , famotidine 20 mg was given intravenously twice daily for 2 days , starting 2 hr before esd . from the third day after esd , the indications for esd were followings : gastric adenoma ( no limitation in size ) and an early gastric adenocarcinoma ( well or moderately differentiated ; size < 2 cm if elevated , < 1 cm if depressed ; no ulceration ; and no lymph node involvement or metastasis by ct ) ( 6 ) . patients were excluded if they had a previous history of upper gastrointestinal surgery or vagotomy ; known hypersensitivity to pantoprazole or famotidine ; current use of aspirin , non - steroidal anti - inflammatory drugs , or corticosteroids . possible complications of esd were discussed with the patients and their relatives , and written informed consent was obtained before entry into the trial . the allocation of patients to treatment was done by drawing sequentially numbered envelopes , each containing a previously determined , randomly selected assignment based on a table of random numbers . patients were evaluated for helicobacter pylori infection by rapid urease test and endoscopic biopsy specimens . the presence of h. pylori infection was considered negative only if rapid urease test and biopsy specimen were both negative . esd was performed by endoscopic submucosal dissection method using an insulated - tip diathermic knife for en bloc resection . after the procedure , the size of tissue specimen , any immediate complications , and histopathologic findings were recorded . esd was considered complete when the neoplastic tissue was circumferentially surrounded by mucosal and submucosal non - neoplastic tissue ( 2 ) . esd was considered to be incomplete when neoplastic tissue was present at the mucosal and/or submucosal margins of the esd specimen and no additional resections at the periphery of tumor had been taken that showed tumor - free margins on histologic examination ( 2 ) . bleeding encountered during esd was termed immediate , and bleeding after esd was termed delayed ( 8) . delayed bleeding was suspected as one or more of the ongoing bleeding signs including fresh hematemesis , hematochezia , instability of vital signs , or a reduction of globin by more than 2 g / dl after esd . endoscopic findings determined to indicate bleeding after esd were 1 ) active bleeding during re - endoscopy ; 2 ) exposed vessels and/or fresh clots that were not seen immediately after initial esd ; and 3 ) evident increase in clots in stomach at the re - endoscopy compared with esd ( 10 ) . if bleeding or visible vessel was found during esd and re - endoscopy , thermal coagulation or endoscopic hemoclipping was performed as required . the delayed bleeding rate as a primary outcome was compared between two groups , and immediate bleeding rate , en bloc resection rate , complete resection rate , need for surgery , and mortality , as secondary outcomes , were also compared between two groups . follow - up endoscopy was performed at 1 month and 3 months after esd to check the healing process of the ulcer . the student t - test was utilized to compare the mean values of continuous variables . the chi - square test with yates ' correction for continuity and the fisher 's exact test were utilized as appropriate for the comparison of categorical variables . univariate and forward stepwise multivariate logistic regression analysis were performed to assess the potential predicting factors of delayed bleeding after esd . the analysis was performed with statistical software package ( spss 12.0 version for windows , spss , chicago , il , u.s.a . ) . this study hypothesized a reduction of delayed bleeding rate from 20% to 5% by acid suppression therapy . according to the sample size calculation the type i error and type ii error were set to 0.05 and 0.2 , respectively . all patients undergoing esd for gastric neoplasm between september 2005 and september 2006 were included in this prospective study . they were randomly assigned , before gastric esd , to pantoprazole or famotidine medication . in the pantoprazole group , pantoprazole 80 mg ( a loading dose ) was given intravenously 2 hr before esd , and 8 mg / hr of intravenous pantoprazole was given continuously for the first 24 hr ( maintenance ) . at the second day , pantoprazole 40 mg was given intravenously twice . from the third day after esd , famotidine 20 mg was given intravenously twice daily for 2 days , starting 2 hr before esd . from the third day after esd , the indications for esd were followings : gastric adenoma ( no limitation in size ) and an early gastric adenocarcinoma ( well or moderately differentiated ; size < 2 cm if elevated , < 1 cm if depressed ; no ulceration ; and no lymph node involvement or metastasis by ct ) ( 6 ) . patients were excluded if they had a previous history of upper gastrointestinal surgery or vagotomy ; known hypersensitivity to pantoprazole or famotidine ; current use of aspirin , non - steroidal anti - inflammatory drugs , or corticosteroids . possible complications of esd were discussed with the patients and their relatives , and written informed consent was obtained before entry into the trial . the allocation of patients to treatment was done by drawing sequentially numbered envelopes , each containing a previously determined , randomly selected assignment based on a table of random numbers . patients were evaluated for helicobacter pylori infection by rapid urease test and endoscopic biopsy specimens . the presence of h. pylori infection was considered negative only if rapid urease test and biopsy specimen were both negative . esd was performed by endoscopic submucosal dissection method using an insulated - tip diathermic knife for en bloc resection . after the procedure , the size of tissue specimen , any immediate complications , and histopathologic findings were recorded . esd was considered complete when the neoplastic tissue was circumferentially surrounded by mucosal and submucosal non - neoplastic tissue ( 2 ) . esd was considered to be incomplete when neoplastic tissue was present at the mucosal and/or submucosal margins of the esd specimen and no additional resections at the periphery of tumor had been taken that showed tumor - free margins on histologic examination ( 2 ) . bleeding encountered during esd delayed bleeding was suspected as one or more of the ongoing bleeding signs including fresh hematemesis , hematochezia , instability of vital signs , or a reduction of globin by more than 2 g / dl after esd . endoscopic findings determined to indicate bleeding after esd were 1 ) active bleeding during re - endoscopy ; 2 ) exposed vessels and/or fresh clots that were not seen immediately after initial esd ; and 3 ) evident increase in clots in stomach at the re - endoscopy compared with esd ( 10 ) . if bleeding or visible vessel was found during esd and re - endoscopy , thermal coagulation or endoscopic hemoclipping was performed as required . the delayed bleeding rate as a primary outcome was compared between two groups , and immediate bleeding rate , en bloc resection rate , complete resection rate , need for surgery , and mortality , as secondary outcomes , were also compared between two groups . follow - up endoscopy was performed at 1 month and 3 months after esd to check the healing process of the ulcer . the student t - test was utilized to compare the mean values of continuous variables . the chi - square test with yates ' correction for continuity and the fisher 's exact test were utilized as appropriate for the comparison of categorical variables . univariate and forward stepwise multivariate logistic regression analysis were performed to assess the potential predicting factors of delayed bleeding after esd . the analysis was performed with statistical software package ( spss 12.0 version for windows , spss , chicago , il , u.s.a . ) . this study hypothesized a reduction of delayed bleeding rate from 20% to 5% by acid suppression therapy . according to the sample size calculation the type i error and type ii error were set to 0.05 and 0.2 , respectively . during the study period , a total of 176 patients were enrolled and randomly assigned equally to the two groups . among them , 8 patients ( 2 in pantoprazole group and 6 in famotidine group ) were excluded from the final analyses because they were lost to follow - up . four patients ( 1 in the pantoprazole group and 3 in the famotidine group ) were excluded because of a failure to meet the requirements of the final analyses . finally , 85 patients in the pantoprazole group and 79 patients in the famotidine group were analyzed . data regarding the clinical and endoscopic features of the patients are outlined in table 1 . there were no significant differences between two groups with respect to age , gender , comorbidity , histology , location of lesion , positive h. pylori , lesion size , specimen size , and procedure time . there was no significant difference in the immediate bleeding rate during esd between the two groups ( 62.4% vs. 57.0% , p>0.05 ) . however , the delayed bleeding rate after esd was significantly lower in the pantoprazole group than in the famotidine group ( 3.5% vs. 12.7% , p=0.031 ) . most of delayed bleeding occurred within 7 days after esd ( 11/13 , 84.6% ) . the use of pantoprazole was very effective in preventing bleeding within 24 hr after esd ( 0% vs. 6.3% , p= 0.024 ) . active bleeding ( spurting or oozing ) was noted in 7/13 ( 53.8% ) of the patients . there were no differences in the en bloc resection rate , complete resection rate , perforation rate , necessity of surgery , and mortality between two groups . delayed gastric perforation was found in one famotidine - treated patient on the third day after esd , and he was promptly treated by surgery . two patients in each group underwent surgery due to vertical margin - positive adenocarcinoma in the resection specimen . during follow - up , no significant side effects induced by drug administration were found in either treatment groups . univariate analysis ( table 3 ) showed that the delayed bleeding was significantly related to the use of preventive pantoprazole ( relative hazard : 0.252 , p=0.042 ) , adenocarcinoma ( relative hazard : 3.765 , p=0.026 ) , and specimen size ( 34 mm , relative hazard : 3.652 , p=0.030 ) . on multivariate analysis , the use of preventive pantoprazole ( relative hazard : 0.220 , 95% ci : 0.051 - 0.827 , p=0.026 ) and specimen size ( 34 mm , relative hazard : 4.178 , 95% ci : 1.229 - 14.197 , p=0.022 ) were two independent predicting factors of delayed bleeding ( table 4 ) . emr shows a promising therapeutic option for the removal of early - stage gastric cancer because it is less invasive for patients compared with surgery . to accomplish ultimate cure by emr , en bloc resection is critical for gastric neoplasm because it may permit accurate histologic diagnosis , definitive pathological assessment of resection margins and invasion depth , and prediction of presence of lymph node metastasis esd is a new emr technique , which has major advantages in comparison with conventional emr ; first , no limitations in location and shape of the lesion ; second , en bloc resection is possible even in a large tumor ; and third , the tumors with ulcer also are resectable ( 9 ) . although esd can increase en bloc and complete resection rate and may reduce the local recurrence rate , esd has been reported to have a higher bleeding rate than conventional emr ( 7 ) . in esd , the rate of bleeding after the procedure was reported to be 7% to 38% ( 3 , 10 - 13 ) . a larger and deeper artificial ulceration by esd is believed to increase the risk of bleeding in comparison with classic emr . in general , ppis or h2ras an intragastric ph of greater than 6 has been shown to lower the risk of recurrent bleeding in patients with bleeding peptic ulcers ( 14 ) . an intravenous bolus followed by continuous - infusion ppi is effective in decreasing rebleeding in patients who have undergone successful endoscopic therapy ( 15 , 16 ) . therefore , it can be assumed that ppis in duce ulcer healing more rapidly and prevent bleeding episodes more efficiently than h2ras after esd . however , to date there have been no studies indicating the effectiveness of ppis or h2ras for preventing bleeding after esd . in a recent study , no difference was found between famotidine and omeprazole in bleeding rates after emr ( 17 ) . in that study , bleeding after emr was seen in five ( 17.9% ) of the 28 patients treated with famotidine and in four ( 13.8% ) of the 29 patients treated with omeprazole ( 17 ) . however , in the present study , the delayed bleeding rate after esd was significantly lower in the pantoprazole group than in the famotidine group ( 3.5% vs. 12.7% , p<0.05 ) . first , the sample size in the previous study was relatively small ( 28 patients in the famotidine group and 29 patients in the omeprazole group ) . second , this may be because of the difference of ppi regimen . the dose of omeprazole ( 20 mg , i.v . , twice a day ) was only 40 mg for the first day of emr in the previous study , but the dose of pantoprazole ( initial 80 mg bolus injection , followed by 8 mg / hr continuous infusion ) was 280 mg for the first day of esd in the present study . it has been already known that the median ph of 6.3 could be achieved by 80 mg+8 mg / hr pantoprazole infusion ( 18 ) . mg / hr pantoprazole infusion is more useful for preventing bleeding through clot stabilization at an elevated gastric ph . and , a single oral dose of pantoprazole , 40 mg , resulted in significantly more inhibition of gastric acid secretion than omeprazole , 20 mg , over a 24-hr period ( 19 ) . in the present study , 80 mg+8 mg / hr pantoprazole infusion was used only in the first day of esd , and then 40 mg pantoprazole was used intravenously twice in the second day . in patients after emr , the risk of delayed bleeding is highest mainly within 24 hr after emr ( 20 ) . therefore , the assumption of the current study was that 80 mg+8 mg / hr pantoprazole infusion in the first day of esd would have the most important clinical significance for preventing bleeding after esd . in this study , the use of 80 mg+8 mg / hr pantoprazole infusion is very effective in preventing bleeding within 24 hr after esd ( 0% vs. 6.3% , p=0.024 ) . in the present study , the delayed bleeding rate within 24 hr after esd was significantly lower in the pantoprazole group than in the famotidine group . several factors , including location , lesion size , specimen size , emr method , histologic type of gastric tumors , and presence of immediate bleeding , have been implicated in bleeding by emr ( 20 - 22 ) . esd was performed only by endoscopic submucosal dissection method using an insulated - tip diathermic knife in both groups . therefore , the difference in the delayed bleeding rate within 24 hr after esd is unlikely to have been influenced by these factors . in the present study , the use of preventive pantoprazole ( relative hazard : 0.220 ) and specimen size ( 34 mm , relative hazard : 4.178 ) were two independent predicting factors of delayed bleeding ( table 4 ) . a larger and deeper artificial ulceration by esd was easy to bleed because bleeding incidence may depend on the size of the specimen ( 23 ) . and , a recent study demonstrated that ppis may be superior to h2ras in terms of converting active stage ulcers into the healing stage , especially in case with a large iatrogenic ulcers after esd ( 24 ) . the present study also suggests that ppis may be more effective than h2ras for preventing bleeding after esd by inducing rapid healing of large artificial ulcers . however , in the present study , high - dose ppi was compared with usual - dose famotidine . therefore , larger clinical tirals comparing high - dose ppi and high - dose famotidine ( or usual - dose ppi and usual - dose famotidine ) should be performed to find the best effective method for preventing delayed bleeding after esd . in the present study extensive analyses have demonstrated that famotidine has no clinically significant interactions with theophylline , diazepam , or phenytoin ( 25 ) . these results are consistent with famotidine 's very limited ability to alter the activity of cytochrome p450 isoenzymes ( 25 ) . pantoprazole did not interact with digoxin , nifedipine , theophylline , diazepam , warfarin , phenytoin , or oral contraceptives ( 26 ) . pantoprazole has been reported to have few clinical significant drug - drug interactions ( 26 ) . in conclusion , pantoprazole is more effective than famotidine for the prevention of delayed bleeding after esd .

endoscopic submucosal dissection ( esd ) has been reported to have a higher bleeding rate than conventional methods . however , there are few reports on whether a proton pump inhibitor or a histamine2-receptor antagonist is the more effective treatment for preventing bleeding after esd . in a prospective trial , patients undergoing esd due to gastric adenoma or adenocarcinoma were randomly assigned to pantoprazole or famotidine . both drugs were given intravenously for the first 2 days , thereafter by mouth . eighty - five in the pantoprazole group and 79 in the famotidine group were included for analysis . primary outcome measure was the delayed bleeding rate . clinical characteristics were not different between the two groups . the delayed bleeding rate was significantly lower in the pantoprazole group compared with the famotidine group ( 3.5% vs. 12.7% , p=0.031 ) . on multivariate analysis , the preventive use of pantoprazole ( relative hazard : 0.220 , 95% ci : 0.051- 0.827 , p=0.026 ) and the specimen size ( 34 mm , relative hazard : 4.178 , 95% ci : 1.229 - 14.197 , p=0.022 ) were two independent factors predictive of delayed bleeding . there were no significant differences in en bloc and complete resection rate between the two groups . in conclusion , pantoprazole is more effective than famotidine for the prevention of delayed bleeding after esd .

a 17-year - old south indian female was reported of a complaint of a pain in mandibular molar for three months . she had the asymmetry since the birth , however she was unaware of any progression of the asymmetry . she also reported of absence of both deciduous and permanent teeth in left posterior region of the upper jaw . there was no history of trauma or extractions in the region . due to the absence of teeth , she never chewed on her left side . her peri - natal history revealed a full term normal delivery and there was no history of any serious childhood illness . on general examination extraoral examination revealed a marked facial asymmetry with flattening of left middle third of her face . she exhibited a straight facial profile and a deficiency of muscle bulk on the left side of her cheek associated with hypertrichosis . a slight reduction in mouth opening ( approximately 25 mm inter - incisal opening ) was noted . the mandible deflected to the right side with maximum mouth opening and maxillary midline shifted to the left side at rest position . intraorally , hard tissue examination revealed clinical absence of all premolars and molars in the left maxilla . the left mandibular first molar showed severe dental caries involving the pulp and exhibited tenderness on vertical percussion . a panoramic radiograph of the jaws confirmed the absence of the left maxillary premolars and molars with severe underdevelopment of the left maxillary alveolar process . a posteroanterior projection of the skull also revealed the deficiency in the middle third of the face on the left side . no other abnormalities of the lower jaw or any other facial skeletal defects were noted ( fig . 4 ) . after confirming the absence of any other abnormalities , a diagnosis of segmental odontomaxillary hypoplasia was made . the patient was advised to have endodontic treatment of the dental caries in mandibular molar , followed by prosthetic rehabilitation of the maxillary missing teeth . the patient underwent the endodontic treatment , however chose not to have any intervention for the missing teeth or the facial symmetry as she had adapted to the situation . this case provided some unusual observations of regional congenital missing teeth with rudimentary type of alveolar process in the left maxilla . also a prominent reduction of muscular bulk on the same side of the face causing facial asymmetry was notable although all other facial bones including mandible were normal . the alveolar process of the jaw bones develop in response to the presence of tooth buds . as the teeth develop and erupt , the alveolar processes develop and increase in height with bone deposition on the superior margin , which in turn grows in height and thickness of maxillary body . therefore in our case , the absence of dental development seems to be the contributing factor in the failure of alveolar bone development in this region . the activity of a facial muscle primarily affects jaw growth in the following two ways ; first , bone formation occurring at the point of muscle attachment depends on the muscle activity . second , the musculatures are a part of the total orofacial soft tissue complex and they take a key role during jaws growth and maturation.1 in the present case , the patient had not been used the left side for the mastication because of left posterior maxillary teeth missing , and this disuse might have contributed to atrophy of left side facial musculature . thereby , further bone growth of the upper jaw might be hindered . facial asymmetry may be a feature of various syndromes such as hemifacial microsomia , crouzon 's syndrome , facial clefting syndrome , and craniosynostosis syndrome.1 however , in this case there were no other abnormalities to suggest a syndromic manifestation . except the left maxillary posterior alveolar ridge hemimaxillofacial dysplasia ( hmd ) and segmental odontomaxillary dysplasia ( sod ) are two other rare non - syndromic conditions causing facial asymmetry.2 in 1990 , danforth et al3 proposed the term " segmental odontomaxillary dysplasia " for a more precise description of hemimaxillofacial dysplasia . the common features of these conditions were facial asymmetry , unilateral maxillary enlargement coupled with ipsilateral dental abnormalities such as congenitally missing molars and premolars and ipsilateral skin changes such as hypertrichosis or erythematous skin.4 they also demonstrated the posterior buccolingual expansion and dense sclerotic bone changes on the radiographs . even though our patient also showed unilateral facial asymmetry , hypertrichosis and congenitally missing molars and premolars similar to hmd / sod , buccolingual bone expansion and sclerotic bone changes were not observed . instead , a rudimentary / hypoplastic posterior alveolar process on the left side was recognized clinically and radiographically . however , it was designated as hypoplasia due to her incomplete development of alveolar ridge , rather than abnormality . in 1996 , packota et al5 analyzed the radiographic features of segmental odontomaxillary dysplasia by studying the radiographs of 12 cases . they found that the most common findings were missing premolar teeth , a smaller maxillary sinus , sclerosis and thickening of bony trabeculae , abnormal spacing of primary molars and vertical orientation of bony trabeculae . in 2000 , prusack et al2 reported a case of young child with facial asymmetry and reported a lack of right maxillary premolars , delayed eruption of right maxillary first permanent molar , abnormal shape of maxillary right primary molar roots , and decreased the size of right maxillary sinus . in contrast to our case , they also reported the enlargement of the corresponding alveolus associated with gingival hyperplasia . in 2003 , drake6 reported a case of 7-year - old boy with unusual maxillary asymmetry . he also had superior canting of the left maxillary alveolus associated with insufficient vertical growth . a thorough search of literature revealed a total of 31 cases of sod / hmd reported until 2002,4 however to the best of our knowledge , segmental odontomaxillary hypoplasia has never been reported . the etiological factor for the present condition this agenesis might cause the segmental odontomaxillary hypoplasia of left maxilla and disuse atrophy of corresponding facial musculature as we believe . therefore , this report attempts to add another unusual cause of facial asymmetry , which is not yet been discussed in the literature .

facial asymmetry is not an uncommon occurrence in day to day dental practice . it can be caused by various etiologic factors ranging from facial trauma to serious hereditary conditions . here , we report a rare case of non - syndromic facial asymmetry in a young female , who was born with this condition but was not aware of the progression of asymmetry . no relevant family history was recognized . she was also deficient in both deciduous and permanent teeth in the corresponding region of maxilla . hence , the cause of this asymmetry was believed to be a segmental odontomaxillary hypoplasia of left maxilla accompanied by agenesis of left maxillary premolars and molars and disuse atrophy of corresponding facial musculature . this report briefly discussed the comparative features of segmental odontomaxillary hypoplasia , hemimaxillofacial dysplasia , and segmental odontomaxillary dysplasia and justified the differences between segmental odontomaxillary hypoplasia and the other two conditions .

mr images of the temporal bone and medical records were retrospectively reviewed in 179 patients [ m : f=72:107 ; average age , 44 ( range , 1 - 77 ) years ] with facial or audiovestibular dysfunction . the results of audiometry , auditory brain stem response and vestibular function tests , performed in our otolaryngologic department and interpreted by experienced audiologists and vestibular physiologists under the supervision of an experienced otologic surgeon , were also available for review in 143 , 21 , and 95 patients , respectively . fifteen patients presented with peripheral facial palsy , 104 with audiometrically proven sensorineural hearing loss , 109 with vertigo , and 92 with tinnitus as an isolated symptom or in combination . the average interval between the onset of symptoms and mr imaging was 11 ( range , 0 - 100 days ) days . for all mr imaging , a 1.5-t scanner ( signa advantage horizon ; ge medical systems , milwaukee , wis . our routine mr imaging protocol for these patients included the acquisition of axial fast spin - echo t2-weighted [ 4000/98/2 ( repetition time msec / echo time msec / excitations ) ] images of the brain , and axial spin - echo t1-weighted ( 400/9/3 ) and fast spin - echo t2-weighted ( 4000/98/4 ) images of the temporal bone , followed by axial , coronal , and sagittal spin - echo t1-weighted ( 400/9/3 ) imaging of the temporal bone , all after the administration of 0.1 mmol / kg gadopentetate dimeglumine ( magnevist ; schering ag , berlin , germany ) . for brain imaging , a 20 cm 20 cm field of view , 256 256 matrix size , and 7 mm slice thickness with no interslice gap were used , and a standard head coil . for temporal bone imaging , the parameters were a 16 cm 16 cm field of view , 512 256 matrix size , and 2 mm slice thickness with no interslice gap , together with a 3-inch dual , circular , temporomandibular joint coil . all mr images were interpreted by two neuroradiologists who were blinded to the varying clinical manifestations and diagnoses , and final decisions were reached by consensus . positive mr imaging findings possibly responsible for the patients clinical manifestations were categorized according to the anatomic sites and presumed etiologies of the lesion , with particular attention paid to assessing the contribution of contrast enhancement to lesion detection at mr imaging . any enhancement in the inner ear and along the course of the vestibulocochlear nerve and its branches was regarded as positive . as for the facial nerve , we considered the findings positive only when there was enhancement of the segment within the cerebellopontine angle cistern or the internal auditory canal . within the labyrinth , we also documented unusually high signal intensity at t1-weighted imaging , as well as unusually low signal intensity at t2-weighted imaging : the former might represent intralabyrinthine fluid in which there was evidence of hemorrhage , or with high - protein content , and the latter might indicate obliterative labyrinthitis . vascular loop or contact was considered significant if a prominent vasculature obviously impinged on the root exit or entry zone , or the cisternal segment of the facial or vestibulocochlear nerve , or if an unequivocal compression deformity of the brain stem caused by nearby vasculature was apparent . the results of mr imaging according to the presenting symptoms and presumed causes of positive mr imaging findings are shown in tables 1 and 2 , respectively . overal , mr images demonstrated positive findings , thought to account for the presenting symptoms , in 78 ( 44% ) of 179 patients . positive findings were demonstrated in all 15 patients ( 100% ) with peripheral facial palsy ( fig . 1 ) , in 43 of 104 ( 41% ) with sensorineural hearing loss ( figs . 2 - 7 ) , and in 40 of 109 ( 37% ) with vertigo ( figs . 2 , 3 , 5 , and 6 ) , and causative lesions were apparent in 39 of 92 ( 42% ) with tinnitus ( figs positive findings were demonstrated by mr imaging , 30 ( 38% ) had lesions that could be recognized with confidence only at contrast - enhanced mr imaging ( table 2 ) . without the use of contrast material , lesions would have been overlooked in 14 of 15 patients with peripheral facial palsy , 15 of 43 with sensorineural hearing loss , 15 of 40 with vertigo , and 8 of 39 with tinnitus . ten patients were found to have tympanogenic ( n=8 ) or viral ( n=2 ) labyrinthitis : in the eight former cases , chronic middle ear infection was present and mr imaging revealed abnormal enhancement of the labyrinth ( fig . 3 ) ; in the other two , the results of a serological test for mumps antibody were abnormal and contrast - enhacned mr imaging also demonstrated abnormal labyrinthine enhancement ( fig . the intralabyrinthine fluid of 11 other patients showed either evidence of hemorrhage or high protein content , as suggested by the high signal intensity seen at precontrast t1-weighted mr imaging ( fig . 4 ) . in these 11 , neither a past medical history of significant head trauma nor laboratory evidence of hematologic disorder was elucidated . three patients had congenital inner ear malformations , all of which were clearly demonstrated by t2-weighted mr imaging . in 18 , focal or linear enhancement along the vestibulocochlear nerve or at the fundus of the internal auditory canal was seen at contrast - enhanced mr imaging , and various forms of neuritis , namely bell 's palsy ( n=8 ) ( fig . 1 ) , ramsay - hunt syndrome ( n=4 ) , traumatic neuritis ( n=1 ) , and neuritis of undetermined origin ( n=5 ) were diagnosed . for the first three conditions , diagnosis was based on the clinical history and typical symptoms and signs , while patients were assigned to the last category if the onset of symptoms was acute , but ameliorated by steroid treatment . five patients had vestibular schwannomas , the presence of all of which was surgically proven ( fig . 5 ) , and in six , significant vascular loop or contact responsible for the presenting symptoms was observed . one patient had a surgically proven epidermoid cyst in the cerebellopontine angle cistern and two were found to have postsurgical meningitis ( fig . fifteen were suffering from various diseases of the brain , including supratentorial ( n=9 ) and infratentorial ( n=4 ) ischemic or hemorrhagic diseases , adrenoleukodystrophy involving the periventricular white matter and the brain stem ( n=1 ) , and venous angioma of the cerebellar hemisphere ( n=1 ) ( fig . seven patients with tinnitus had diseases confined to the middle ear ( table 2 ) . the results of mr imaging according to the presenting symptoms and presumed causes of positive mr imaging findings are shown in tables 1 and 2 , respectively . overal , mr images demonstrated positive findings , thought to account for the presenting symptoms , in 78 ( 44% ) of 179 patients . positive findings were demonstrated in all 15 patients ( 100% ) with peripheral facial palsy ( fig . 1 ) , in 43 of 104 ( 41% ) with sensorineural hearing loss ( figs . 2 - 7 ) , and in 40 of 109 ( 37% ) with vertigo ( figs . 2 , 3 , 5 , and 6 ) , and causative lesions were apparent in 39 of 92 ( 42% ) with tinnitus ( figs positive findings were demonstrated by mr imaging , 30 ( 38% ) had lesions that could be recognized with confidence only at contrast - enhanced mr imaging ( table 2 ) . without the use of contrast material , lesions would have been overlooked in 14 of 15 patients with peripheral facial palsy , 15 of 43 with sensorineural hearing loss , 15 of 40 with vertigo , and 8 of 39 with tinnitus . ten patients were found to have tympanogenic ( n=8 ) or viral ( n=2 ) labyrinthitis : in the eight former cases , chronic middle ear infection was present and mr imaging revealed abnormal enhancement of the labyrinth ( fig . 3 ) ; in the other two , the results of a serological test for mumps antibody were abnormal and contrast - enhacned mr imaging also demonstrated abnormal labyrinthine enhancement ( fig . the intralabyrinthine fluid of 11 other patients showed either evidence of hemorrhage or high protein content , as suggested by the high signal intensity seen at precontrast t1-weighted mr imaging ( fig . 4 ) . in these 11 , neither a past medical history of significant head trauma nor laboratory evidence of hematologic disorder was elucidated . three patients had congenital inner ear malformations , all of which were clearly demonstrated by t2-weighted mr imaging . in 18 , focal or linear enhancement along the vestibulocochlear nerve or at the fundus of the internal auditory canal was seen at contrast - enhanced mr imaging , and various forms of neuritis , namely bell 's palsy ( n=8 ) ( fig . 1 ) , ramsay - hunt syndrome ( n=4 ) , traumatic neuritis ( n=1 ) , and neuritis of undetermined origin ( n=5 ) were diagnosed . for the first three conditions , diagnosis was based on the clinical history and typical symptoms and signs , while patients were assigned to the last category if the onset of symptoms was acute , but ameliorated by steroid treatment . five patients had vestibular schwannomas , the presence of all of which was surgically proven ( fig . 5 ) , and in six , significant vascular loop or contact responsible for the presenting symptoms was observed . one patient had a surgically proven epidermoid cyst in the cerebellopontine angle cistern and two were found to have postsurgical meningitis ( fig . fifteen were suffering from various diseases of the brain , including supratentorial ( n=9 ) and infratentorial ( n=4 ) ischemic or hemorrhagic diseases , adrenoleukodystrophy involving the periventricular white matter and the brain stem ( n=1 ) , and venous angioma of the cerebellar hemisphere ( n=1 ) ( fig . seven patients with tinnitus had diseases confined to the middle ear ( table 2 ) . in this study , the diagnostic yields of mr imaging of the temporal bone [ overall , 44% ( 78/179 ) ] in patients with facial and audiovestibular dysfunction were relatively high . the diagnostic yields for individual symptoms of such dysfunction , namely peripheral facial paralysis , sensorineural hearing loss , vertigo , and tinnitus were 100% ( 15/15 ) , 41% ( 43/104 ) , 37% ( 40/109 ) , and 42% ( 39/92 ) , respectively . as for idiopathic peripheral facial paralysis , so - called bell 's palsy , the reported frequency with which contrast - enhanced mr imaging has shown positive findings , revealing abnomal enhancement along various segments of the facial nerve , has been relatively high , ranging from 43% to 100% ( 7 - 9 ) . in this respect , care should be taken not to mistake normal enhancement of the intratemporal facial nerve for abnormal enhancement caused by a pathologic condition such as neuritis or a tumor . in their study involving 93 patients with 186 clinically normal bilateral facial nerves , gebarski et al . ( 10 ) reported that at contrast - enhanced mr imaging , 142 nerves ( 76% ) were visibly enhanced along at least one segment within the facial canal , and that enhanced images of the nerves of 64 of the 93 ( 69% ) showed right - left asymmetry . this normal enhancement of the intratemporal facial nerve is attributed to the circumneural arteriovenous plexus which is inhomogeneously distributed along the facial canal , and is most prominently observed in the region of the geniculate ganglion ( fig . however , enhancement of the facial nerve in the cerebellopontine angle cistern and the internal auditory canal should always be considered abnormal ( 2 , 10 ) . in contrast to peripheral facial paralysis , the role of neuroimaging in patients referred for the evaluation of audiovestibular dysfunction is less clear - cut . after reviewing the neuroimaging studies and results of audiovestibular testing in 118 patients with audiovestibular dysfunction , levy and arts ( 11 ) concluded that clinical presentation and audiovestibular testing could not sensitively predict the outcome of neuroimaging . only 15 of 118 ( 13% ) patients had positive neuroimaging findings related to their presenting symptoms . if account is taken of the fact that in 11 of these 15 patients , vestibular schwannoma was either proven or presumed to be present , the diagnostic yield of imaging studies for demonstrating pathology other than vestibular schwannoma was surprisingly low in their series . with regard to sensorineural hearing loss , levy and arts ( 11 ) demonstrated the presence of a pathological condition in only 18% ( 12/65 ) of patients , while in another series of 78 patients with sudden hearing loss , abnormal imaging findings were demonstrated in 24 ( 31% ) ( 12 ) . the role of neuroimaging in patients referred for the evaluation of vertigo is more perplexing . in a study of 20 elderly patients with dizziness , day et al . ( 13 ) reported that the mr findings in these patients were not different from those in an age - matched control group . according to levy and arts ( 11 ) , in only 9% ( 6/65 ) of patients with vertigo / dizziness / balance difficulty / dysequilibrium did neuroimaging studies showed positive findings . in a study involving 167 patients with vertigo and/or abnormal findings at vestibular testing , casselman et al . ( 14 ) reported that mr imaging was able to detect the presence of a pathological condition , potentially explaining vertigo in 54 ( 32% ) patients . in another series of 79 patients referred for dizziness or rotatory vertigo , neuroimaging studies were positive in 27 ( 34% ) ( 15 ) . to our knowledge , none of the literature except the abovementioned article by levy and arts ( 11 ) has mentioned the outcome of neuroimaging in patients with tinnitus . in their series , neuroimaging demonstrated positive findings possibly responsible for tinnitus in only eight ( 15% ) of 55 patients , as compared with 42% in this study , a surprisingly high positive rate which seems to be attributable in part to the analytical method used in this study , that is , rather generous inclusion of middle ear disease as a possible cause of tinnitus . however , because tinnitus can be generated by any lesion or disturbance involving the auditory pathway from the external auditory canal to the central auditory cortex , and also because - except in the case of extra - auditory tinnitus , as commonly seen where the condition is vasculogenic or musculogenic - it is hard to distinguish the different origins of tinnitus by the physical characteristics , it seemed reasonable not to exclude lesions of the middle ear as its possible causes . we believe that the wide variations in positive imaging results in patients with audiovestibular dysfunction is most probably caused by the different fractions of disease entity included in different studies . the high prevalence of positive mr imaging results in this study is attributed to the use of contrast material . we believe that 30 of the 78 ( 38% ) patients whose mr imaging findings were positive would have been overlooked if contrast material had not been used . non - identification is especially likely in cases in which an inflammatory condition involving the facial or vestibulocochlear nerve and the membranous labyrinth , one that at contrast - enhanced mr imaging can simulate a neoplasm , is present ( 16 ) . although several authors have advocated limited studies of the temporal bone using noncontrast high - resolution t2-weighted mr imaging in order to rule out vestibular schwannomas , and have done so principally on the basis of cost effectiveness ( 17 ) , it is clear from the findings of this study and those of others ( 5 , 12 ) that such an approach would fail to demonstrate significant numbers of inflammatory lesions of the facial or vestibulocochlear nerve and the membranous labyrinth . in this study , contrast - enhanced mr imaging was most effective in patients with peripheral facial palsy ; in 14 of 15 with this condition , lesions were demonstrated only by this modality . as mentioned above , a diagnosis of bell 's palsy on the basis of enhancement of the facial nerve within the facial canal can be erroneous ( 2 ) ; enhancement of the internal auditory canal ( most commonly at the fundus ) or cisternal portion of the facial nerve should instead be relied upon . sometimes , a lesion in which the mr findings are identical to those observed in bell 's palsy may eventually prove to be malignant ( 18 ) . while contrast - enhanced mr imaging is a valuable tool in the evaluation of patients with facial paralysis , its limitation should be recognized and the findings must be interpreted in conjunction with the clinical presentation . in contrast to the imaging of patients with peripheral facial paralysis , the imaging of those with audiovestibular dysfunction has been reported to yield no positive findings in more than half of all patients , even though contrast material is used . although enhancement of the membranous labyrinth is reported to be a highly specific finding of labyrinthine pathology , and there is close correlation between labyrinthine enhancement and audiovestibular symptoms , the sensitivity of this finding remains to be determined ( 4 , 19 ) . a possible explanation for this is that the offending deformity may reside at the level of the hair cells of the organ of corti or the cupula , far beyond the resolution of current mr imaging . in addition , hearing loss in elderly patients is often secondary to presbycusis , for which there is no imaging correlate ( 20 ) . as with enhancement in the meninges , there may be a threshold effect with only the most severe inflammatory processes consistently producing labyrinthine or neural enhancement ( 4 ) . if contrast material had not been used in this study , lesions would have been overlooked at mr imaging in 15 of 43 patients with sensorineural hearing loss , 14 of 39 with vertigo , and eight of 39 with tinnitus . sometimes , if precontrast images are not obtained , lesions containing a hemorrhagic or lipid component can mimic enhancing lesions at contrast - enhanced mr imaging . typically , this is so in cases of labyrinthine hemorrhage and intracanalicular lipoma ( 21 ) . in this study , high signal intensity was observed at precontrast t1-weighted mr imaging in 11 of 78 patients with positive mr imaging findings . in all patients , clinical and laboratory findings were unremarkable for head trauma and hematologic disorder . although clinical and histologic proof is lacking , we believe that the intralabyrinthine high signal intensity seen at precontrast mr imaging was caused by either hemorrhagic fluid resulting from forgotten minor head trauma or highly proteinaceous fluid resulting from labyrinthitis due to any cause . in the hope of clarifying this issue in the near future , a prospective study is warranted . we suggest that precontrast t1-weighted mr imaging procedures should be included in the evaluation of patients with suspected intralabyrinthine pathology . although rare , vascular lesions in the cerebellopontine angle cistern or internal auditory canal , such as vertebrobasilar dolichoectasia , aneurysm , and vascular loops , can produce facial palsy , sensorineural hearing loss , vertigo , or tinnitus ( 1 , 2 ) . in this study , although our criteria governing the inclusion of lesions were rather strict , a specific cause - and - effect relationship between these vascular lesions seen at mr imaging and the patients clinical symptoms may be clear only when there is surgical evidence for this . mr imaging using a three - dimensional fast gradient - echo technique such as constructive interference in steady - state mr imaging , which was not used in this study , may prove useful in this clinical setting . in conclusion , mr imaging of the temporal bone is a useful diagnostic procedure for the evaluation of patients with facial and audiovestibular dysfunction , even though there were positive findings in less than half the patients involved . because it was only at contrast - enhanced mr imaging that a significant number of patients showed positive imaging findings which explained their clinical manifestations , the use of contrast material is highly recommended . in a considerable number of patients , however , the supposed cause of audiovestibular symptoms can not be identified even after contrast - enhanced mr imaging . a knowledge of the benefits and limitations of contrast - enhanced mr imaging of the temporal bone can help guide radiologists towards a correct interpretation of what they have observed at mr imaging . in this study , the diagnostic yields of mr imaging of the temporal bone [ overall , 44% ( 78/179 ) ] in patients with facial and audiovestibular dysfunction were relatively high . the diagnostic yields for individual symptoms of such dysfunction , namely peripheral facial paralysis , sensorineural hearing loss , vertigo , and tinnitus were 100% ( 15/15 ) , 41% ( 43/104 ) , 37% ( 40/109 ) , and 42% ( 39/92 ) , respectively . as for idiopathic peripheral facial paralysis , so - called bell 's palsy , the reported frequency with which contrast - enhanced mr imaging has shown positive findings , revealing abnomal enhancement along various segments of the facial nerve , has been relatively high , ranging from 43% to 100% ( 7 - 9 ) . in this respect , care should be taken not to mistake normal enhancement of the intratemporal facial nerve for abnormal enhancement caused by a pathologic condition such as neuritis or a tumor . in their study involving 93 patients with 186 clinically normal bilateral facial nerves , gebarski et al . ( 10 ) reported that at contrast - enhanced mr imaging , 142 nerves ( 76% ) were visibly enhanced along at least one segment within the facial canal , and that enhanced images of the nerves of 64 of the 93 ( 69% ) showed right - left asymmetry . this normal enhancement of the intratemporal facial nerve is attributed to the circumneural arteriovenous plexus which is inhomogeneously distributed along the facial canal , and is most prominently observed in the region of the geniculate ganglion ( fig . however , enhancement of the facial nerve in the cerebellopontine angle cistern and the internal auditory canal should always be considered abnormal ( 2 , 10 ) . in contrast to peripheral facial paralysis , the role of neuroimaging in patients referred for the evaluation of audiovestibular dysfunction is less clear - cut . after reviewing the neuroimaging studies and results of audiovestibular testing in 118 patients with audiovestibular dysfunction , levy and arts ( 11 ) concluded that clinical presentation and audiovestibular testing could not sensitively predict the outcome of neuroimaging . only 15 of 118 ( 13% ) patients had positive neuroimaging findings related to their presenting symptoms . if account is taken of the fact that in 11 of these 15 patients , vestibular schwannoma was either proven or presumed to be present , the diagnostic yield of imaging studies for demonstrating pathology other than vestibular schwannoma was surprisingly low in their series . with regard to sensorineural hearing loss , levy and arts ( 11 ) demonstrated the presence of a pathological condition in only 18% ( 12/65 ) of patients , while in another series of 78 patients with sudden hearing loss , abnormal imaging findings were demonstrated in 24 ( 31% ) ( 12 ) . the role of neuroimaging in patients referred for the evaluation of vertigo is more perplexing . in a study of 20 elderly patients with dizziness , day et al . ( 13 ) reported that the mr findings in these patients were not different from those in an age - matched control group . according to levy and arts ( 11 ) , in only 9% ( 6/65 ) of patients with vertigo / dizziness / balance difficulty / dysequilibrium did neuroimaging studies showed positive findings . in a study involving 167 patients with vertigo and/or abnormal findings at vestibular testing , casselman et al . ( 14 ) reported that mr imaging was able to detect the presence of a pathological condition , potentially explaining vertigo in 54 ( 32% ) patients . in another series of 79 patients referred for dizziness or rotatory vertigo , neuroimaging studies were positive in 27 ( 34% ) ( 15 ) . to our knowledge , none of the literature except the abovementioned article by levy and arts ( 11 ) has mentioned the outcome of neuroimaging in patients with tinnitus . in their series , neuroimaging demonstrated positive findings possibly responsible for tinnitus in only eight ( 15% ) of 55 patients , as compared with 42% in this study , a surprisingly high positive rate which seems to be attributable in part to the analytical method used in this study , that is , rather generous inclusion of middle ear disease as a possible cause of tinnitus . however , because tinnitus can be generated by any lesion or disturbance involving the auditory pathway from the external auditory canal to the central auditory cortex , and also because - except in the case of extra - auditory tinnitus , as commonly seen where the condition is vasculogenic or musculogenic - it is hard to distinguish the different origins of tinnitus by the physical characteristics , it seemed reasonable not to exclude lesions of the middle ear as its possible causes . we believe that the wide variations in positive imaging results in patients with audiovestibular dysfunction is most probably caused by the different fractions of disease entity included in different studies . the high prevalence of positive mr imaging results in this study is attributed to the use of contrast material . we believe that 30 of the 78 ( 38% ) patients whose mr imaging findings were positive would have been overlooked if contrast material had not been used . non - identification is especially likely in cases in which an inflammatory condition involving the facial or vestibulocochlear nerve and the membranous labyrinth , one that at contrast - enhanced mr imaging can simulate a neoplasm , is present ( 16 ) . although several authors have advocated limited studies of the temporal bone using noncontrast high - resolution t2-weighted mr imaging in order to rule out vestibular schwannomas , and have done so principally on the basis of cost effectiveness ( 17 ) , it is clear from the findings of this study and those of others ( 5 , 12 ) that such an approach would fail to demonstrate significant numbers of inflammatory lesions of the facial or vestibulocochlear nerve and the membranous labyrinth . in this study , contrast - enhanced mr imaging was most effective in patients with peripheral facial palsy ; in 14 of 15 with this condition , lesions were demonstrated only by this modality . as mentioned above , a diagnosis of bell 's palsy on the basis of enhancement of the facial nerve within the facial canal can be erroneous ( 2 ) ; enhancement of the internal auditory canal ( most commonly at the fundus ) or cisternal portion of the facial nerve should instead be relied upon . sometimes , a lesion in which the mr findings are identical to those observed in bell 's palsy may eventually prove to be malignant ( 18 ) . while contrast - enhanced mr imaging is a valuable tool in the evaluation of patients with facial paralysis , its limitation should be recognized and the findings must be interpreted in conjunction with the clinical presentation . in contrast to the imaging of patients with peripheral facial paralysis , the imaging of those with audiovestibular dysfunction has been reported to yield no positive findings in more than half of all patients , even though contrast material is used . although enhancement of the membranous labyrinth is reported to be a highly specific finding of labyrinthine pathology , and there is close correlation between labyrinthine enhancement and audiovestibular symptoms , the sensitivity of this finding remains to be determined ( 4 , 19 ) . a possible explanation for this is that the offending deformity may reside at the level of the hair cells of the organ of corti or the cupula , far beyond the resolution of current mr imaging . in addition , hearing loss in elderly patients is often secondary to presbycusis , for which there is no imaging correlate ( 20 ) . as with enhancement in the meninges , there may be a threshold effect with only the most severe inflammatory processes consistently producing labyrinthine or neural enhancement ( 4 ) . if contrast material had not been used in this study , lesions would have been overlooked at mr imaging in 15 of 43 patients with sensorineural hearing loss , 14 of 39 with vertigo , and eight of 39 with tinnitus . sometimes , if precontrast images are not obtained , lesions containing a hemorrhagic or lipid component can mimic enhancing lesions at contrast - enhanced mr imaging . typically , this is so in cases of labyrinthine hemorrhage and intracanalicular lipoma ( 21 ) . in this study , high signal intensity was observed at precontrast t1-weighted mr imaging in 11 of 78 patients with positive mr imaging findings . in all patients , clinical and laboratory findings were unremarkable for head trauma and hematologic disorder . although clinical and histologic proof is lacking , we believe that the intralabyrinthine high signal intensity seen at precontrast mr imaging was caused by either hemorrhagic fluid resulting from forgotten minor head trauma or highly proteinaceous fluid resulting from labyrinthitis due to any cause . in the hope of clarifying this issue in the near future , a prospective study is warranted . we suggest that precontrast t1-weighted mr imaging procedures should be included in the evaluation of patients with suspected intralabyrinthine pathology . although rare , vascular lesions in the cerebellopontine angle cistern or internal auditory canal , such as vertebrobasilar dolichoectasia , aneurysm , and vascular loops , can produce facial palsy , sensorineural hearing loss , vertigo , or tinnitus ( 1 , 2 ) . in this study , although our criteria governing the inclusion of lesions were rather strict , a specific cause - and - effect relationship between these vascular lesions seen at mr imaging and the patients clinical symptoms may be clear only when there is surgical evidence for this . mr imaging using a three - dimensional fast gradient - echo technique such as constructive interference in steady - state mr imaging , which was not used in this study , may prove useful in this clinical setting . in conclusion , mr imaging of the temporal bone is a useful diagnostic procedure for the evaluation of patients with facial and audiovestibular dysfunction , even though there were positive findings in less than half the patients involved . because it was only at contrast - enhanced mr imaging that a significant number of patients showed positive imaging findings which explained their clinical manifestations , the use of contrast material is highly recommended . in a considerable number of patients , however , the supposed cause of audiovestibular symptoms can not be identified even after contrast - enhanced mr imaging . a knowledge of the benefits and limitations of contrast - enhanced mr imaging of the temporal bone can help guide radiologists towards a correct interpretation of what they have observed at mr imaging .

objectiveto evaluate the clinical utility of mr imaging of the temporal bone in patients with facial and audiovestibular dysfunction with particular emphasis on the importance of contrast enhancement.materials and methodswe retrospectively reviewed the mr images of 179 patients [ 72 men , 107 women ; average age , 44 ( range , 1 - 77 ) years ] who presented with peripheral facial palsy ( n=15 ) , audiometrically proven sensorineural hearing loss ( n=104 ) , vertigo ( n=109 ) , or tinnitus ( n=92 ) . positive mr imaging findings possibly responsible for the patients clinical manifestations were categorized according to the anatomic sites and presumed etiologies of the lesions . we also assessed the utility of contrast - enhanced mr imaging by analyzing its contribution to the demonstration of lesions which would otherwise not have been apparent . all mr images were interpreted by two neuroradiologists , who reached their conclusions by consensus.resultsmr images demonstrated positive findings , thought to account for the presenting symptoms , in 78 ( 44% ) of 179 patients , including 15 ( 100% ) of 15 with peripheral facial palsy , 43 ( 41% ) of 104 with sensorineural hearing loss , 40 ( 37% ) of 109 with vertigo , and 39 ( 42% ) of 92 with tinnitus . thirty ( 38% ) of those 78 patients had lesions that could be confidently recognized only at contrast - enhanced mr imaging.conclusioneven though its use led to positive findings in less than half of these patients , mr imaging of the temporal bone is a useful diagnostic procedure in the evaluation of those with facial and audiovestibular dysfunction . because it was only at contrast - enhanced mr imaging that a significant number of patients showed positive imaging findings which explained their clinical manifestations , the use of contrast material is highly recommended .

acute aortic coarctation with occlusion of the aorta is rare condition that has an extremely poor prognosis and high incidence of neurovascular complications . paraplegia may be caused by intraspinal subarachnoid hemorrhage and spinal cord ischemia caused by aortic thrombosis and occlusion1,10,13 ) . we present two cases admitted to our emergency department with flaccid paraplegia that were diagnosed with acute aortic coarctation and occlusion . a 45-year - old male was admitted for abrupt paraplegia that occurred during exercise in a fitness club . the patient had loss of pain and temperature sensation and absence of tendon reflexes below the 156t4 level . on radiographic examination , a chest x - ray showed cardiomegaly , pulmonary congestion , and mediastinal widening . 1 ) revealed an acute spinal subarachnoid hematoma extending from c2 to t4 with spinal cord compression and numerous dilated anterior spinal arteries at the c6-t3 level . the patient was hemodynamically stable and showed gradual improvement in the neurological deficit of the upper extremities following anti - edematous therapy including intravenous corticosteroid injections ; however , the treatment failed to reverse the neurological condition . endovascular intervention was recommended , and the patient was referred for surgical repair of the aortic coarctation . however , he refused and was transferred to another tertiary hospital . a 58-year - old male admitted to the emergency department complaining of acute weakness in both low extremities and severe low back pain after jumping to the ground from a height of one meter 30 min before arriving at the hospital . the patient had loss of pain and temperature sensation and the absence of tendon reflexes below the l1 level . lumbar ct revealed spondylolysis on l5 and the lumbar mri revealed disc degeneration at l4 - -5 and l5 - -s1 without spinal cord compression or cord swelling ( fig . 4 ) and the absence of the dorsalis pedis arterial pulse . a ct angiography of the abdominal aorta and lower extremities performed immediately revealed aortoiliac thrombotic occlusion with renal infarction ( fig . however , he died 2 days later as a result of multiple organ failure caused by compartment syndrome . a 45-year - old male was admitted for abrupt paraplegia that occurred during exercise in a fitness club . the patient had loss of pain and temperature sensation and absence of tendon reflexes below the 156t4 level . on radiographic examination , a chest x - ray showed cardiomegaly , pulmonary congestion , and mediastinal widening . 1 ) revealed an acute spinal subarachnoid hematoma extending from c2 to t4 with spinal cord compression and numerous dilated anterior spinal arteries at the c6-t3 level . the patient was hemodynamically stable and showed gradual improvement in the neurological deficit of the upper extremities following anti - edematous therapy including intravenous corticosteroid injections ; however , the treatment failed to reverse the neurological condition . endovascular intervention was recommended , and the patient was referred for surgical repair of the aortic coarctation . a 58-year - old male admitted to the emergency department complaining of acute weakness in both low extremities and severe low back pain after jumping to the ground from a height of one meter 30 min before arriving at the hospital . the patient had loss of pain and temperature sensation and the absence of tendon reflexes below the l1 level . initial routine laboratory tests revealed no abnormal findings . on radiographic examination , the lumbar spine radiographs showed spondylosis with aortic calcification . lumbar ct revealed spondylolysis on l5 and the lumbar mri revealed disc degeneration at l4 - -5 and l5 - -s1 without spinal cord compression or cord swelling ( fig . 4 ) and the absence of the dorsalis pedis arterial pulse . a ct angiography of the abdominal aorta and lower extremities performed immediately revealed aortoiliac thrombotic occlusion with renal infarction ( fig . 5 ) . however , he died 2 days later as a result of multiple organ failure caused by compartment syndrome . the development of collateral circulation and a connection between the prestenotic and poststenotic thoracic aorta are signs of coarctation . furthermore , collateral vessels may form aneurysmal dilatations as a result of deficiencies in muscle and elastic tissue , as occurs in long - standing arterial hypertension , which may cause a rupture4 ) . intracranial hemorrhage of an aneurysm occurs in approximately 12% of untreated cases , and intracranial subarachnoid hemorrhage accounts for 7% of deaths in patients with aortic coarctation2,5 ) . spinal hemorrhage as a complication of coarctation is rare compared with intracranial hemorrhage , and few cases have been reported . the clinical presentation includes sudden back or neck pain and neurological deficits as serious as paraplegia or quadriplegia . most cases involve spinal arachnoid hemorrhage following rupture of an aneurysm and an abnormally dilated spinal artery or collateral vessel2,8,14,22 ) . mri is a noninvasive technique with immense diagnostic potential that is a suitable primary imaging method for patients with spontaneous paraparesis . however , mri images can not reliably identify the blood / arachnoid interface when they are in close proximity . moreover , as in cases of ventral hematoma , it is not possible to determine whether the hematoma is located in the epidural , subdural , and subarachnoid space . surgical decompression is often necessary when the patient 's neurological status is compromised or in rapid deterioration , whereas conservative treatment is sufficient for patients in good general and neurological condition . about 50% of surgically indicated patients are treated conservatively as a result of poor general conditions5 ) . the patient in our first case had abrupt paraplegia and was in good general health ; however , the hematoma was located ventrally , and the patient was reluctant to undergo surgery , thus conservative treatment was commenced . surgery is the conventional treatment for aortic coarctation ; however , recent evidence suggests that percutaneous endovascular stents are associated with a low - residual gradient and a low rate of restenosis immediately and at follow - up , and are a good alternative to surgery in anatomically suitable adolescents and adults7 ) . we chose surgery as the first - line treatment because of the tortuous and stenotic nature of the coarctation . acute aortic occlusion is rare in patients with no history of peripheral vascular disease , and the condition is associated with high morbidity and mortality rates . possible etiologies include in situ thrombosis , aortic saddle embolus , and an intimal flap that causes aortic dissection and thrombosis9,16,19 ) . aortic dissection and reparative vascular surgery are well - established causes of spinal cord ischemia1,9,10,11,16 ) . investigations of the relationship between paraplegia and acute aortic thrombosis have suggested that aortic thrombosis may be caused by in situ thrombosis , cancer , chemotherapy ischemic cardiomyopathy13,18,19,21,23 ) . in our case , the ct angiography from the ninth thoracic vertebra to the lower extremities confirmed aortoiliac thrombotic occlusion . however , we can not exclude the possibility of abdominal thrombosis related to thoracic aortic dissection because the area above t9 was not included in the ct angiogram . the classic signs and symptoms of acute aortic occlusion are called the " five ps " : pain , pulselessness , pallor , paresthesias , and paralysis . aggressive medical treatment must be administered to patients who show evidence of intestinal ischemia on radiographic evaluation . the initial symptoms are generally paralysis of the lower extremities caused by a lesion that compresses the spinal cord ventrally , and an incorrect diagnosis may delay definite treatment21 ) . absence of the femoral or more distal arterial pulse can be an important differential diagnostic indicator . in our case , the patient complained of lower extremity weakness and was initially referred to an emergency medicine physician . the admitting physician was unsure of the origin of the symptoms and initially consulted several departments including orthopedic surgery and neurology . however , despite several initial tests , including lumbar ct and mri , the correct diagnosis was not made until the physician observed coldness and pallor in the lower extremities and the absence of the dorsalis pedis arterial pulse . in our view , a rare disease entity , such as our cases , reveals a weakness in departmentalized clinical services in the hospital . it is likely that a number of clinical departments have treated cases aortic thrombotic occlusion . upon re - examination , we suspected that the symptoms were the result of spinal cord ischemia , such as anterior spinal artery syndrome . spinal cord ischemia is characterized by segmental necrosis of the gray and adjacent white matter , whereas the peripheral white matter is spared . axonal swelling , myelin degeneration , petechial hemorrhage , and macrophage infiltration are histological indicators of spinal cord ischemia12 ) . it is important to note that pallor , pulselessness , and coldness are the primary symptoms that distinguish vascular lesions from other cardinal diseases that cause pain or weakness in the lower extremities . however , there may be an 8-h timeframe before the results of revascularization are poor3 ) . breakdown products of rhabdomyolysis such as myoglobin , lactic acid dehydrogenase , creatine phosphokinase , and excessive potassium and newly formed clots in the venous system of a previously ischemic limb are released into the circulation and may damage the lungs , myocardium , liver , and kidneys . we believe a minor impact , such as jumping to the ground , may have induced a thoracic embolus in our second patient , and the massive aortic occlusion caused simultaneous rupture of the artery of adamkiewicz , the anterior spinal artery , and segmental spinal arteries resulting in acute hypoperfusion of the spinal cord and ischemia . however , we can not rule out the possibility of the original occlusion below the artery of adamkiewicz or a thoracic aortic dissection . the patient did not feel pain in the lower extremities as a result of the subsequent paraplegia , and because the condition is rare , the clinician , who was an emergency room specialist , overlooked the possibility of aortic occlusion . it is critically important that clinicians recognize the possibility of a vascular event in such cases because delayed diagnosis may contribute to a poorer prognosis . we report here two rare cases of acute paraplegia resulting from acute coarctation and occlusion of the aorta . coarctation and occlusion of the aorta must be considered for patients complaining of acute lower extremity weakness with or without pain because early diagnosis and appropriate treatment are essential for a favorable outcome . from this point of view , the clinician must carefully examine the patient , palpate the affected area , and consider the possibility of vascular origin . in our experience , coldness of the lower extremities the most important early sign of aortic thrombotic occlusion with the exception of the five ps : pain , pulselessness , pallor , paresthesias , and paralysis .

coarctation and occlusion of the aorta is a rare condition that typically presents with hypertension or cardiac failure . however , neuropathy or myelopathy may be the presenting features of the condition when an intraspinal subarachnoid hemorrhage has compressed the spinal cord causing ischemia . we report two cases of middle - aged males who developed acute non - traumatic paraplegia . undiagnosed congenital abnormalities , such as aortic coarctation and occlusion , should be considered for patients presenting with nontraumatic paraplegia in the absence of other identifiable causes . our cases suggest that spinal cord ischemia resulting from acute spinal subarachnoid hemorrhage and can cause paraplegia , and that clinicians must carefully examine patients presenting with nontraumatic paraplegia because misdiagnosis can delay initiation of the appropriate treatment .

upper thigh subcutaneous emphysema manifested by swelling , crepitus and cellulitis is a common orthopaedic presentation , usually related to underlying musculoskeletal problem or penetrating wound . in a few situations , this can be related to abdominal pathology rather than limb pathology and most of these cases we present a case of subcutaneous emphysema of the thigh secondary to para - caecal abscess . this was managed by laparotomy alone for abdominal pathology without the need for surgical debridement or thigh exploration . a 75- year old female was admitted as an emergency with right iliac fossa pain . clinical examination was inconclusive . during her over - night stay , she developed tachycardia and hypotension which responded to fluids . the patient had a ct abdomen , pelvis and upper thigh that showed gas containing fluid collection in the right iliac fossa in keeping with either diverticular or appendicular abscess ( figure 1 ) . it also showed inferior extension of the gas into the right ilio - psoas muscle , groin and upper thigh ( perivascular ) raising the possibility of necrotising fasciitis ( figure 2 ) . right iliac fossa abscess subcutaneous thigh emphysema on laparotomy , an abscess was found in close proximity to a caecal mass . there was no pus tracking retroperitoneally or along the psoas muscle and the muscle looked healthy . most likely cause of the subcutaneous emphysema in thigh was thought to be gas in the abscess cavity tracking along fascial planes . no exploration of the thigh was performed and the plan was to review the thigh swelling the next day . however , this settled down completely following laparotomy alone . post operatively the patient recovered well , no further surgery was done and the patient went home after a slow convalescence . . this collection can trickle down by gravity along fascial planes posterior to the inguinal ligament and both of them can lead to subcutaneous emphysema and possibly thigh abscess ( 2,3,4,5 ) . perforated appendix is the commonest cause of bowel - related right thigh emphysema , whereas on the left side it is usually caused by diverticular disease or perforated rectal cancer ( 2,3,4,5 ) . due to the nature of the disease enteric flora are usually detected but chances of developing gas gangrene is usually remote ( 4 ) . the subcutaneous emphysema may result from several mechanisms : first many of the colonic flora are gas producing , and perhaps more important passage of intestinal gas from gastrointestinal tract in to tissues as the result of positive gradient between bowel lumen and subcutaneous space ( 5 ) . the diagnosis like in our case is often delayed or missed due to paucity of localising signs . if no necrotic tissue or dead muscle is found next to primary pathology , provided that primary pathology is treated timely , subcutaneous emphysema of the thigh may herald a benign course . on the other hand if necrotic muscles are found in the abdomen or pus tracks in to the thigh , exploration of thigh is mandatory to ensure complete debridement and to avoid missing necrotising infections of the thigh . in our case the patient was managed conservatively ( without thigh exploration ) as once the abdominal pathology has been treated , the thigh subcutaneous emphysema started to improve with antibiotics and with close monitoring of the patient . subcutaneous emphysema of the thigh , secondary to abdominal pathology when associated with healthy psoas muscle is a condition that follows a benign course . this can be treated conservatively without exploration of the thigh as long as the abdominal pathology is promptly managed . good imaging modalities including ct and mri are strongly recommended when the underlying pathology of the thigh subcutaneous emphysema is not clear .

thigh subcutaneous emphysema is an usual orthopaedic presentation normally associated with musculoskeletal problems or penetrating wounds . but , sometimes it can be related to abdominal pathology . we present a case of subcutaneous emphysema of the thigh secondary to para - caecal abscess .

cervical cancer is the third most common cancer in women , and the seventh of overall cancers worldwide , with an estimated 529,000 new cases in the year 2008.1 it has been estimated that more than 87% of the global burden occurs in developing countries , where it accounts for 13% of all female cancers . high - risk regions include the eastern and western africa regions.1 in sudan cervical cancer ranks as the second most common cancer among women with age - standardized incidence of 15 per 100,000 and age - standardized mortality of 25 per 100,000.2 substantial reduction in cervical cancer will only be realized if sustainable cervical cancer screening programs are implemented on a global scale to assure early detection and treatment of precancerous lesions . effective programs must meet three targets : at least 70% of the targeted population should be screened at least once in a lifetime ; screening assays and diagnostic tests must be reproducible and sufficiently sensitive ; and specificity for the detection of high - grade precursor lesions and effective treatment must be provided.3 screening with use of pap smear and liquid - based cytology has contributed significantly to the reduction of cervical cancer in developed countries.4 in addition , screening for human papillomavirus with use of dna testing has proven useful in early detection of the disease.5 nevertheless , these methods of screening are very difficult to implement in low - resource countries due to the lack of laboratory infrastructure and trained professionals . therefore there is a vital need for alternative preventive methods for cervical cancer in developing countries.6 recently , interest in visual inspection with acetic acid ( via ) has increased . numerous studies have been conducted on its accuracy and its ability to detect cervical lesions when compared with other techniques , both conventional and non - conventional . this test is easy , cost - effective , and fits well to low resource countries.8 via is based on the premise that the majority of preinvasive and invasive cervical lesions are visible on examination by the naked - eye after application of acetic acid . it involves insertion of a vaginal speculum and application of 3%5% acetic acid solution using a cotton swab . if there is an acetowhitening area present , the result of the test is positive . the normal squamous epithelium tissue of the cervix is pink . on application of acetic acid , cervical intraepithelial neoplasia ( cin ) lesion takes on a white color due to the increased precipitation of nuclear proteins and cytokeratins in the cervical epithelium.9 this study aimed to determine feasibility of the via screening method for cervical cancer as an alternative to a pap smear in the primary health care setting in sudan , and to compare performance of via and pap smear . a cross - sectional study of 1250 asymptomatic women living in khartoum , sudan , was conducted in primary health care centers in khartoum state , sudan , during the period of december 2009 to april 2010 . healthy married women aged 2550 years , living in khartoum state and who were willing to participate in screening , were included in the study . pregnant women , women with absent menstrual periods , and women with a previous history of cervical cancer , abnormal cytology , or hysterectomy , were excluded from the study . eligible women were included in the study after they were given information about the study s objectives , screening test procedures , and the benefits to be gained from screening . the women who agreed to participate in the study provided written consent . a questionnaire focusing on sociodemographic , obstetrics and gynecological variables , and other risk factors was filled in by each participant with the assistance of registered nurses . the women then underwent a complete physical and gynecological examination , and pelvic assessment performed by a physician trained in early detection of cancer . the pap smear sampling and via testing were performed by the same physician . the via test was performed by application of 3%5% acetic acid into the cervix uteri by using sterile forceps and a small piece of cotton . after 5 minutes a naked - eye assessment was performed under direct illumination of a 100-watt halogen lamp . a positive via test was defined as well - marginated , raised , opaque , acetowhite lesion(s ) observed on the cervix uteri within the squamo - columnar junction zone ( the region in the uterine cervix in which the squamous lining of the vagina is replaced by the columnar epithelium typical of the body of the uterus and which is a common site of neoplastic change).10 the pap smear sample was obtained by using a spatula . the pap smear was fixed with ethanol for 30 minutes and sent to a cytologist for investigation . the cytological results of the pap smear were reported according to the bethesda system.10 positive cytology diagnosis was considered when any of these pathological changes were detected : a typical squamous cell of undetermined significance , cin , or invasive cancer . the total number of women who were invited to participate in the study was 1250 . of them , 985 women agreed to participate , giving a response rate of 79% . of the total number of responding women , 51 ( 5.2% ) were excluded due to varying reasons : 25 had an absence of menstrual periods , 16 were not sure about their last menstrual period , three had a previous history of cervical cancer treatment , and 6 were under fertility treatment . women with positive via or positive pap smears were referred to a gynecological oncologist at a specialized oncology center for colposcopy and biopsy . the obtained biopsies were examined by a histopathologist for confirmation of the results of both screening tests . the time interval between the screening test and colposcopy was 212 days for women with positive via and 721 days for women with a positive pap smear ; the delay of pap smear results was due to the laboratory process , which took a longer time to investigate the smear specimens . data were entered into stata ( v9.2 ; stata corp , college station , tx ) . descriptive statistics were used to analyze the demographic data and to compare the results of both screening tests . t - tests were used to detect any significant difference between continuous variables ( age , age of becoming sexually active , and number of deliveries ) . the chi squared test was used to detect any significant difference between categorical variables and positive results of via and pap smear tests in the screened women in each group . sensitivity , specificity , positive and negative predictive values were compared for both screening tests . the number of women who fulfilled the eligibility criteria , offered informed consent , and agreed to participate in the study , was 934 ( 95% of total number of the respondents ) . the mean age of the eligible 934 participants was 34.8 years for those that screened negative and 32.8 years for those that screened positive ( table 1 ) . the number of deliveries ranged from one to seven live births , with a mean of two births for the study sample ; 35.2% were nulliparous . the main education level was primary school , and the majority of participating women were principally unpaid domestic workers . the place of residence was urban for 62.1% , and rural for 37.9% of the women . the majority of women ( 76% ) in the study sample used an oral contraceptive pill , and 76% of women had an episiotomy during vaginal delivery ( table 1 ) . all women had undergone counseling and clinical assessment before screening ; 86 ( 9.2% ) of them had signs of cervical infection such as chlamydia , bacterial , and candida albican infections . the results of all screened women revealed that 71 ( 7.6% ) women were positive when via tested , and according to the later pap smear results 48 ( 5.1% ) were positive ( table 2 ) . there was an overlap between via and pap smear in positive results of 24 samples . comparisons between the study sample characteristics , via test positive results , and pap smear positive results revealed that there was a significant difference in the age of women who tested positive by via and pap smear ( mean age 32.3 years versus 38.3 years , respectively ) . there was a significant difference between positive results of via and pap smear in relation to women who had gone through female genital mutilation ( 93.0% versus 79.2% ; p = 0.05 ) . there was also a significant difference between women who had cervical infection and positive results of via versus pap smear ( 33.9% versus 54.2% ; p = 0.04 ; table 2 ) . the results of histopathology revealed that 88 of 119 ( 73.9% ) confirmed positive , of which 53 of 71 ( 74.6% ) had a positive via and 35 ( 72.9% ) had a positive pap smear . moreover , classification of the positive specimens showed that ( 75% ) of cases were cin and ( 25% ) were in stage 1 . the categories of histopathological findings differed based on the screening test , via significantly detected more cases in stage 1 than pap smears ( 19 versus 3 ; p = 0.001 ; table 3 ) . there were 24 overlapping positive cases of via and pap smear , of which 52.6% , 31.6% , 10.5% , and 5.3% were cin1 , cin2 , cin3 , and stage 1 , respectively . comparison of the performance of two via and pap smears in terms of sensitivity and specificity , and in positive and negative predictive values brought varied results ( table 4 ) . via had higher sensitivity than pap smear but lower specificity . via / pap combined had higher sensitivity and specificity than via and pap smear alone . african countries rank second highest for morbidity and mortality of cervical cancer after asia.1 sudan occupies the top level of cervical cancer morbidity and mortality in northern african countries.2 in these countries there are no screening programs , or the programs are ineffectively developed and poorly organized . the majority of the screening programs are using the pap smear method and attempt to imitate the excellent outcome achieved in developed countries ( finland is the best worldwide example for decrease in cervical cancer incidence as a result of a well - organized screening program).27 nevertheless , the results of these programs have been very poor due to lack of infrastructure , inadequate training for medical staff , poor organization , lower coverage of women at risk , no standardized quality control systems , and a lack of follow - up and treatment of positive cases.12 therefore , in recent years , screening using a new method has emerged as an alternative to the conventional pap smear , which involves visual inspection with use of acetic acid.7 via has become a promising alternative for developing countries because it is inexpensive , rapid , requires brief training , and does not require laboratory equipment . a number of earlier studies have reported that via has a comparable or superior result to pap smears in the detection of cervical cancer.8 this is the first study carried out to determine the feasibility of via as a screening method for cervical cancer in the primary health care setting in sudan . the study was preceded by a pilot study which showed that 16% of screened women were positive when screened by via.13 the result of the final study is lower ( 7.6% ) . the findings of this study revealed that via detected significantly more positive women than pap smears ( 7.6% versus 5.1% ; p = 0.004 ) with an overlap between the two screening tests in 19% of positive results . via had higher sensitivity and positive predictive values than pap smears but lower specificity and negative predictive values , respectively . via detected more confirmed diagnosed cases of intraepithelial cervical intraepithelial neoplasia than pap smears ; however , the difference was not statistically significant and in the confirmed diagnosed cases of invasive cervical cancer in stage 1 , via detected significantly more cases than pap smears ( 35.8% versus 8.6% ; p = 0.001 ) . the result of screened - positive women by via in this study ( 7.6% ) was higher than that found in bangladesh ( 4.8%)14 and in angola ( 6.6%),15 but lower than in kenya ( 13.9%)16 or in honduras ( 14%),17 and it was much lower than found in el salvador ( 26.5%),18 or in thailand ( 38.1%).19 in our study the sensitivity of via was 60.2% . this finding is similar to that reported in tanzania ( 60.6%),20 higher than in colombia ( 53.6%),21 but lower than in india ( 80.0%),22 in angola ( 70.7%),15 and , again , in india ( 98%).23 sensitivity and specificity of the via test in this study was consistent with pooled via sensitivity that was described by an international agency on research for cancer multicenter study in india and africa.24 the specificity of the via test in our study was 42% ; it was lower compared to pap smears ( 65% ) , and lower than found for via in kenya ( 75%)25 and in angola ( 94.5%).15 there was only a small ( although marginally significant , p = 0.05 ) difference in the total proportion of confirmed cases by colposcopy ( 74.6% versus 72.9% ) for via and pap respectively . there was no significant difference in confirmed cases of cin1 , cin2 , and cin3 among the via positive tests than among the pap positive tests . in turn , via detected significantly more ( p < 0.001 ) cases of cervical cancer in stage 1 ( 35.8% ) than pap smears ( 8.6% ) . the sensitivity value for via in our study is higher than that found by basu et al in calcutta , india ; 74.6% and 55.7% respectively . 26 in our study via detected more cases of cin than pap smear ( 36 versus 32 ) . nevertheless , the results of this study delineate the potential benefits of using via within the primary health care setting in low resource countries . via increases detection of premalignant lesions of the cervix and diminishes the probability of women defaulting before they are appropriately followed - up and treated . we believe that via can be used as a screening tool in low resource countries , not only in the primary health care setting but also in general hospitals . the results of this study showed that via has higher sensitivity , but lower specificity , compared to pap smears . a combination of via / pap increased sensitivity and specificity of detection of cervical cancer . the findings of the study indicate that via is useful for the screening of cervical cancer in the primary health care setting in khartoum state , sudan .

objectiveto determine the feasibility of visual inspection with the use of acetic acid ( via ) as a screening method for cervical cancer , an alternative to the pap smear used in primary health care setting in sudan , and to compare sensitivity , specificity , positive and negative predictive values , and histological diagnosis of positive cases of both tests.methodsa cross - sectional study of 934 asymptomatic women living in khartoum , sudan , was conducted during 20092010 . a semi - structured questionnaire containing socio - economic and reproductive variables was used to collect data from each participant . methods of screening used were via and conventional pap smear , followed by colposcopy and biopsy for confirmation of the positive results of both screening tests.resultsthe tests identified altogether 119 ( 12.7% ) positive women . via detected significantly more positive women than pap smear ( 7.6% versus 5.1% ; p = 0.004 ) , with an overlap between the two screening tests in 19% of positive results . there was no significant difference between via and pap smear findings and sociodemographic and reproductive factors among screened women . use of colposcopy and biopsy for positive women confirmed that 88/119 ( 73.9% ) were positive for cervical intraepithelial neoplasia . via had higher sensitivity than pap smear ( 74.2% versus 72.9% ; p = 0.05 ) respectively . out of 88 confirmed positive cases , 22 ( 25.0% ) cases were invasive cervical cancer in stage 1 , of which 19 versus three were detected by via and pap smear respectively ( p = 0.001 ) . via had higher sensitivity and lower specificity than pap smear ( 60.2% versus 47.7% ) and ( 41.9% versus 83.8% ) respectively . the combination of via / pap has better sensitivity and specificity than each independent test ( 82.6% and 92.2%).conclusionthe findings of this study showed that via has higher sensitivity and lower specificity compared to pap smear , but a combination of both tests has greater sensitivity and specificity than each test independently . it indicates that via is useful for screening of cervical cancer in the primary health care setting in sudan , but positive results need to be confirmed by colposcopy and biopsy .

herpes simplex virus ( hsv ) mastitis in a nonlactating female is extremely rare . to the best of our knowledge , we describe the first case of herpes simplex mastitis diagnosed on scrape cytology smears prepared from the ulcer over the nipple of the left breast . possible modes of infection and the importance of distinguishing these cases from other causes of mastitis are also discussed . a 36-year - old lady presented to the outpatient department with pain and swelling in the left breast since two days . she had been given oral ciprofloxacillin and topical mupirocin by the local physician , but there was no improvement in her condition . , there was 10 cm area of indurated erythema on the medial aspect of the left breast along with an ulcer measuring five mm in diameter on the medial aspect of the nipple . air - dried smears prepared from the scrapings of the ulcer were sent to us for cytological examination . microscopic examination of scrape cytology smears revealed isolated as well as aggregates of keratinocytes showing marked nuclear pleomorphism and nuclear enlargement . these keratinocytes revealed homogenous opaque nucleus and dense basophilic cytoplasm with well - defined cell boundaries [ figure 1 ] . numerous multinucleated giant cells with ground glass nucleus and nuclear molding were also seen [ figure 1 ] . keratinocytes showing marked nuclear pleomorphism and nuclear enlargement ( giemsa , 200 ) ; inset shows multinucleated giant cells with ground - glass nucleus and nuclear molding ( giemsa , 400 ) . however , herpes simplex can affect any skin or mucous membrane surface , in addition to the eyes , central nervous system and viscera . few cases of maternal infant transmission of the virus during breastfeeding resulting in nipple lesions have been documented[46 ] and only rare cases have been reported in nonlactating women . furthermore , development of breast lesions as the first and the sole manifestation of clinically apparent hsv infection without oral or genital herpes is uncommon . there is little information regarding transmission of hsv to the breast except in cases associated with neonatal breast feeding . in the present case , further enquiry failed to reveal the source of hsv infection and we are left to speculate the mode of infection . the first possibility is that the virus was transmitted to the breast through autoinoculation from an asymptomatic oral or genital lesion . autoinoculation to other body sites such as face , fingers and eyes has been documented . the second possibility is that the present lesion may be a primary infection of the breast from recent sexual contact with an asymptomatic hsv carrier . the infected asymptomatic carrier can carry the virus in the saliva and can transmit the virus through close personal contact . kobayashi et al . have described the cytologic changes in the smears from nipple discharge of two cases with hsv infections . the cytology of nipple discharge smears of their cases revealed the ground - glass appearance of the nuclei with multinucleated syncytial cells . in addition , positive hybridization was found with intense staining for the hsv dna in the nuclei of cells having a ground - glass appearance . they concluded that cytologic observation together with an in situ hybridization procedure may be a rapid and valuable tool for the detection and final demonstration of hsv infections . in contrast to impression cytology , the scrape cytology is a traumatic procedure . scraping the lesion collects in situ cells . a certain degree of expertise is required for scraping and making the smear . in scrape cytology smear , cell - to - cell relation is not maintained . to compensate for all these drawbacks , scrape cytology offers a better cell yield even in keratinising lesions and small focal lesions . results of scrape cytology are likely to be more specific and sensitive . in our case , air - dried scrape cytology smears stained with giemsa stain revealed characteristic cytological features of hsv infection . it is important to establish the correct clinical diagnosis and confirm it with cytology smears . it is also important to distinguish herpes mastitis from bacterial mastitis since herpes mastitis heals spontaneously in 710 days without scarring , whereas bacterial abscess requires surgical drainage with residual scarring . in addition , it is important to distinguish herpes simplex mastitis from varicella zoster mastitis , because zoster infection can become confluent , hemorrhagic , heal slowly with scarring and can be associated with residual neuralgia . to conclude , in suspected cases , scrape smears can be of great value in the early diagnosis of herpes simplex mastitis .

herpes simplex virus ( hsv ) is a rare cause of breast infection . few cases of maternal - infant transmission of the virus during breastfeeding resulting in nipple lesions have been documented . only three cases have been reported in nonlactating women . we report an additional case of hsv mastitis in a 36-year - old nonlactating female who was diagnosed on scrape cytology smears .

each cell in the human body receives tens of thousands of dna lesions per day by a variety of sources . therefore , cells have evolved a multifaceted response to counteract the potentially deleterious effects of dna damage . the cellular response to dna damage involves execution of dna repair and activation of a repertoire of dna damage signalling molecules ( dna damage response , ddr ) . the main dna repair pathways , nucleotide excision repair ( ner ) , base excision repair ( ber ) , mismatch repair ( mmr ) , homologous recombination ( hr ) , and nonhomologous end - joining ( nhej ) , are devoted to the repair of specific dna alterations and complementary in some respects . ner is a multistep process that deals with damage causing significant distortion of dna structure , such as uv - induced damage and bulky adducts ( reviewed in ) . ber corrects dna from oxidation , deamination , and alkylation including single - strand breaks ( ssb ) which are all lesions that cause little distortion to the dna helix structure ( reviewed in ) . mmr is an evolutionarily highly conserved repair pathway that corrects mismatches generated during dna replication and escape proofreading ( reviewed in ) . recombinational repair deals with the most lethal form of dna damage , double strand breaks ( dsb ) , by using an homologous dna sequence as in the case of hr or requiring little or no sequence homology for efficient repair as in the case of nhej ( reviewed in ) . the appropriate repair of dna damage and resolution of replication problems is orchestrated by the ddr , through the action of sensors , transducers , and effectors that coordinate dna repair with ongoing cell physiology . signal transducers include atm and atm - rad3-related ( atr ) that are dna damage - activated kinases that respond to different types of dna lesions . downstream of these proteins is two families of checkpoint kinases ( chk ) , the chk1 and chk2 kinases , that are targets of regulation by atr and atm kinases , respectively ( reviewed in ) . dna breaks arising from oxidative damage are a major threat for the genome stability of mature neurons . this type of damage is mostly repaired by ber / ssbr . in this review , the plasticity of dna repair during neurogenesis , the key role of ber / ssbr , and its brain region selectivity in neurological diseases will be specifically addressed by providing an update of recent findings . moreover , original data on the characterization of the response to oxidative stress in neurons from different brain areas will be presented . the regulatory networks of differentiation programs include genes that are involved in the response to dna damage and cell death execution . as a consequence of this gene reprogramming , the mechanisms that deal with the maintenance of genome stability can change substantially in the transition from neurogenesis to nervous system maturation . by using in vitro cell differentiation systems , several studies have shown that dna repair is downregulated during differentiation ( reviewed in ) . indeed , the first evidence of differentiation - associated downregulation of dna repair was provided by hanawalt 's laboratory in human hnt neurons . in particular , when the repair of uv - induced dna lesions was compared between terminally differentiated human hnt neurons and their precursor nt2 cells , it was clear that postmitotic neurons display attenuated global dna repair but efficiently repair expressed genes ( a pathway that was later called transcription - domain associated repair ) . also , the mechanisms that control chromosome integrity , namely , telomerase and telomere - associated proteins , function as distinct telomere protection mechanisms during the processes of neurogenesis and neuronal maturation because of differentiation - associated transcriptional control . this impacts the response to dna damaging agents as shown by the extreme sensitivity to telomere damage of newly generated neurons that are deficient in both the telomerase and the trf2 telomere - binding protein . the dna damage response ( ddr ) , the sophisticated cell network that monitors genome integrity , is also affected by differentiation - associated gene reprogramming . . showed that the differentiation of immortalized human neural stem cells in vitro is accompanied by an upregulation of atm and the dna - dependent kinase dna - pk , sharp downregulation of atr and chk1 , transient induction of p53 , and the onset of apoptosis in a fraction of cells . the response to ionizing radiation ( ir ) , including apoptosis , was dependent on atm as shown by its attenuation following targeted silencing of atm . similarly , it was shown that ddr signalling and radiosensitivity were altered in terminally differentiated astrocytes as compared to their progenitors , neural stem cells ( nsc ) . while nsc activated canonical ddr upon exposure to ir , astrocytes lacked functional ddr signalling with transcriptional repression of atm leading to radioresistance . astrocytes retained the expression of nhej genes and dna - pk was shown to be the key player in the response to dna damage . they showed that terminally differentiated human sh - sy5y neuroblastoma cells are more sensitive to oxidative damage than their undifferentiated counterparts . this is at least partially due to attenuated ber in postmitotic neurons that correlates with diminished protein levels of long - patch ber components ( that are shared by dna replication ) , such as flap endonuclease-1 ( fen1 ) , proliferating cell nuclear antigen ( pcna ) , and dna ligase 1 ( lig1 ) ( figure 1 ) . the evidence for the plasticity of dna repair / ddr during cell differentiation , as inferred from these in vitro studies , is strengthened by in vivo studies in animal models where the effects of specific defects in dna repair / ddr on neural development have been specifically investigated . during neural development , neural progenitors undergo symmetric divisions that expand the size of the progenitor pool before switching to an mode of division wherein each round produces one progenitor cell and one postmitotic neuron . newborn neurons then migrate from the proliferative zones to various cns regions where they undergo further differentiation and become integrated into functional networks . in the early developmental stages , dna repair plays a key role in the formation of a functional nervous system and the integrity of specific repair pathways is required along the developmental program . this is well illustrated by mouse models with germline deletions of either xrcc2 or dna ligase 4 ( lig4 ) , which are essential for the repair of dsb through hr and nhej , respectively . xrcc2 embryos display massive apoptosis in the brain by e10.5 when neural progenitor proliferation occurs , whereas no apoptotic cells are detectable in the brains of lig4 embryos until e12.5 when neural progenitors are differentiating into neurons . indeed in these different stages , cells are susceptible to different types of dna damage . during proliferation , the most common type of damage is replication stress that is acted upon by hr and nhej . hr requires the presence of a sister chromatid and therefore this pathway is not available in neurons that have exited the cell cycle . in this cell type , nhej becomes the pathway responsible for dsb repair . challenging examples of the effect of the type of damage and its subsequent processing on the pathological outcome are two human syndromes , ataxia telangiectasia ( a - t ) , a childhood neurodegenerative syndrome , and atr - seckel syndrome that presents severe neurodevelopmental defects . these syndromes involve full or partial inactivation of the kinases atm and atr , respectively . these kinases respond to different types of damage that occur frequently during neural development : atm to dsb while atr is activated by rpa - coated single - stranded dna , a lesion that may occur during replication fork collapse . their lack of function leads to very different clinical outcomes : in the case of atm to neurodegeneration and in the case of hypomorphic mutations of atr to neurodevelopmental defects . oxidative dna lesions , including ssb , are expected to be a frequent type of damage encountered by noncycling cells . targeted deletion of dna polymerase ( pol ) , the main ber polymerase , causes neonatal lethality in mice . histological examination of the embryos showed extensive cell death in newly generated postmitotic neuronal cells in the developing central and peripheral nervous systems . in conclusion , the plasticity of dna repair / ddr during neurogenesis sets the tolerance to different types of dna damage at different levels depending on the cell stage . ros and reactive nitrogen species ( rns ) are generated by cellular metabolism and by exogenous agents . almost 50 years ago , the first evidence was provided showing that the respiratory chain of mitochondria produces ros . the electrochemical gradient produced by the respiratory chain is used to synthesize atp ; however , some of these electrons inevitably leak out of the pathway leading to the production of o2 . these radical species can be very dangerous when produced in excess , but they are also important in redox signalling from the organelle to the rest of the cells . controlled ros generation is indeed necessary for optimal functioning of the cns through fine - tuning of redox - sensitive signalling pathways . brain mitochondria can also absorb large amounts of hydrogen peroxide when they utilize glycolysis as energy source . under the condition of neuronal cell damage mitochondria act as platforms for the activation of caspases during apoptosis and participate in the dysregulation of ca homeostasis during necrosis . another important source of ros in damaged neurons are the nonmitochondrial nicotinamide adenine dinucleotide phosphate ( nadph ) oxidases ( nox family ) . nox enzymes are not only restricted to microglia but also expressed in neurons , astrocytes , and neurovascular system . ros - induced dna damage has little , if any , specificity along the dna strand . ros - induced dna damage includes base modification , deoxyribose modification , dna cross - links , abasic sites , ssb , and dsb . ssb can occur directly by the disintegration of the oxidized sugar or indirectly during ber of base damage as repair intermediates . ssb can also arise as a result of incorrect activity of dna topoisomerase 1 ( top1 ) in which the enzyme remains covalently attached to the 3 end of the break ( top1 cleavage complex ) ( reviewed in ) . the 3- and/or 5-termini of most ssb must be restored to conventional 3-hydroxyl and 5-phosphate moieties to allow gap - filling and dna ligation ( figure 1 ) . defective ssb repair ( ssbr ) can result in neurological diseases ( see below ) . although less frequently than ssb , dsb can also arise following replication past unrepaired ssb or when ssb encounter the transcription machinery or arise in close proximity . if not repaired they may have a dramatic impact on development . ber / ssbr is the main dna repair mechanism in the removal of oxidized dna bases and oxidized dna break termini that are formed at high frequency in neuronal cells . ber proceeds through five steps : ( i ) base removal by a specific dna glycosylase ( dg ) ; ( ii ) incision at the resulting abasic site by an ap - endonuclease ( ape1 ) ; ( iii ) processing of the produced blocked termini of the gap ; ( iv ) gap - filling by a dna polymerase ; and ( v ) resealing of the damaged dna strand by a dna ligase [ 2628 ] ( figure 1 ) . a brief biochemical characterization of the enzymes involved in these steps is provided below with special emphasis on their role in neurogenesis as inferred from in vitro and in vivo studies . the first and most specific step of ber is the recognition of damaged dna bases by distinct dgs . eleven dgs have been identified in mammals and all of them recognize the specific dna base by the same mode of action , that is , flipping base out of the dna helix into an active site pocket . monofunctional dgs , such as uracil - dna glycosylases ( udgs ) and thymine dna glycosylase ( tdg ) , present only glycosylase activity and catalyze the base lesion excision mainly by hydrolyzing the n - glycosidic bond to generate an ap site . the bifunctional dgs have an additional lyase activity and process the ap site via or / elimination reaction . they include the dgs specific for oxidized bases , such as 8-oxoguanine ( 8-oxog ) dna glycosylase ( ogg1 ) and endonuclease viii - like proteins . mammalian cells have five distinct udgs : nuclear ung2 is devoted to the repair of incorporated uracil ( u : a base pair ) whereas ung1 , smug1 , tdg , and probably mbd4 all contribute to the repair of uracil in the u : g base pair ( formed by the deamination of cytosine ) . humans and mice have two different ung isoforms , ung1 and ung2 localized in the mitochondria and in the nucleus , respectively . the role of ung1 in neurodegeneration is shown by the phenotype of conditional transgenic mice expressing a mutated version of ung1 that present decreased mitochondrial respiration , apoptosis , neurodegeneration , and altered behaviour . feeding animals with a folate - deficient diet induced the degeneration of ca3 pyramidal neurons in ung ko mice but not in wild - type animals . furthermore , folate depletion increased nuclear mutation rates in ung ko mouse embryo fibroblasts ( mefs ) due to high levels of uracil in dna as a consequence of pool imbalance and/or cytosine deamination due to decreased levels of s - adenosylmethionine . depletion of ung1 in cultured rat hippocampal neurons was also sufficient to induce dna damage , upregulation of p53 , and apoptosis . four different splice forms of ogg1 are present in mammalian cells , but only two of them are involved in the repair of 8-oxog : ogg1 - 1a in nuclear dna and ogg1 - 2a in mitochondrial dna . ogg1 initiates a canonical ber pathway that proceeds by the action of ape1 , pol , and xrcc1/lig3 to repair the damaged base [ 38 , 39 ] . ko mice have been used to examine the role of oxidative dna damage in neuropathology . liu et al . reported that ogg1 protects neurons against cell death and its absence determines poorer functional outcome in mice under ischemic conditions . aged ogg1 ko mice showed a decreased spontaneous locomotor behaviour and a decrease in striatal dopamine levels . during replication , the bypass of 8-oxog by pol determines the formation of the mismatch 8-oxog : a that is recognized by mutyh that mediates the removal of the adenine mispaired with 8-oxog . subsequently , pol reconstitutes the correct 8-oxog : c pair , thus allowing the intervention of ogg1 . the analysis of single ( ogg1 ko or mutyh ko ) or double ( ogg1/mutyh dko ) mutant mice revealed that ogg1 ko mice exhibited severe striatal neurodegeneration , whereas mice lacking mutyh or both ogg1 and muthy were resistant to neurodegeneration under the condition of oxidative stress . these findings clearly indicate that 8-oxog accumulation in neurons and microglia leads to neurodegeneration and suggest that the lack of mutyh may protect the brain from oxidative stress by preventing ssb accumulation . the mammalian homologs of the escherichia coli endonuclease viii , encoded by the nei gene , are termed nei - like ( neil ) 1 , nei - like 2 , and nei - like 3 . neil1 and neil2 recognize oxidized pyrimidines such as thymine glycol , 5-hydroxycytosine , dihydrothymine , dihydrouracyl , and 5-hydroxyuracyl . neil2 seems to have a crucial role in the repair of oxidized bases in active genes ( transcription - coupled ber , tc - ber ) as suggested by its interaction with rna polymerase ii , tfiih , csb , and lig3 both in vitro and in vivo [ 47 , 48 ] . neil2 ko mice indeed accumulate oxidative dna damage mostly in transcribed regions of their genome . tc - ber has been suggested also for the repair of 8-oxog , requiring the involvement not only of ogg1 and rna pol ii but also of ner factors such as xpa , csb , and uvssa , indicating the need for strict control of oxidative damage in active genes . neural stem / progenitor cells from adult neil3 ko mice are impaired in proliferation and hippocampal neurons present synaptic irregularities . moreover , neil3 ko mice are affected by learning and memory deficits , demonstrating that neil3 is pivotal for maintaining adult neurogenesis [ 51 , 52 ] . the alkyladenine dna glycosylase ( aag ) mediates alkylation - induced tissue damage and whole - animal lethality . in transgenic mice overexpressing aag ( aag - tg mice ) interestingly , these effects are prevented in aag ko mice [ 54 , 55 ] suggesting that aag activity , in the presence of alkylation damage , determines an accumulation of toxic ber intermediates , while loss of aag prevents their formation and promotes cell survival . ape1 is a multifunctional protein that has a central role in ber by processing the ap sites and in transcriptional regulation by redox activation of transcription factors . ape1 cleaves the dna sugar - phosphate backbone at a position immediately 5 of ap sites to prime dna repair synthesis but it can also correct oxidized abasic sites ( reviewed in ) . ape1 knockdown in cortical neurons induced the accumulation of oxidative dna damage after glutamate treatment , suggesting that ape1 has a pivotal role in the repair of oxidative dna damage in neurons . on the other hand , overexpression of ape1 moreover , the dna repair function of ape1 protects differentiated neuroblastoma cells from apoptosis induced by hydrogen peroxide . ape1 interacts with cdk5 , which in turn phosphorylates ape1 at thr 232 , thus reducing its endonuclease activity and resulting in the accumulation of dna damage in cortical neurons and in neuronal death after treatment with the neurotoxin 1-methyl-4-phenylpyridinium ( mpp+ ) . besides ape1 , the processing of ssb with 3 and/or 5 blocked termini generated by ros involves end - processing factors that are instrumental in completing repair . their function and role will be addressed in the section on the role of ber / ssbr in human pathology ( see below ) . the scaffold protein xrcc1 orchestrates the coordination of the whole ber / ssbr process [ 26 , 63 ] . xrcc1 interacts with several enzymes involved in ber / ssbr such as lig3 , ape1 , polynucleotide kinase / phosphatase pnkp , fen1 , and dna glycosylase ogg1 . moreover , xrcc1 interacts with pcna and this interaction plays a central role in the dna repair during dna replication . xrcc1 ko mice die early in embryogenesis , indicating an essential role of xrcc1 in development . cerebellar granule cells from xrcc1 heterozygous mice and xrcc1 knockdown in human neuroblastoma cells show an accumulation of ssb and reduced survival following oxidative stress . neural - specific inactivation of xrcc1 in mice induces loss of cerebellar interneurons , which causes a strong neuropathology . moreover , loss of xrcc1 leads to the accumulation of ssb in the whole nervous system and abnormal hippocampal function . once damaged termini at ssb are restored to their conventional hydroxyl configuration , gap - filling and ligation will continue either via short - patch ( sp ) or long - patch ( lp ) ber , with distinct repair patches : one nucleotide in sp - ber and two or more nucleotides in lp - ber ( figure 1 ) . pol is involved in the resynthesis step in sp - ber while in lp - ber it incorporates the first nucleotide and pol and pol [ 71 , 72 ] are possibly involved in the elongation step . pcna participates in lp - ber , but a pcna - independent and pol-dependent lp - ber has also been reported [ 73 , 74 ] . in the sp - ber , after the dnmp insertion , the deoxyribose - phosphate ( drp ) is removed by the drp - lyase activity of pol and the repair is completed by ligation by the lig3/xrcc1 complex . in lp - ber , the drp is displaced and pol/pol polymerize tracts of dna longer than one base [ 71 , 76 ] . the strand displacement produces a flapped substrate that is refractory to ligation ; this structure is recognized and excised by fen1 [ 77 , 78 ] , followed by ligation by dna ligase 1 ( lig1 ) . disruption of the coordination between pol and fen1 in the processing of the flap structure leads to cag repeat expansion that results in mutant huntingtin protein expression in huntington 's disease ( hd ) [ 80 , 81 ] . the choice of the ber subpathway is determined by multiple factors such as the type of lesion and the dna glycosylase involved in its removal [ 38 , 72 , 82 ] , protein - protein interaction , cell - cycle phase [ 65 , 83 ] , and/or differentiation status [ 13 , 84 ] . as mentioned above , sykora et al . showed that differentiated human neuroblastoma cells are more sensitive to oxidative damage and present lower levels of proteins involved in lp - ber , such as fen1 , pcna , and lig1 , thus relying mostly on pol-dependent ber for protection from endogenous damage . more recently , it has been shown that 50% pol reduction in a mouse model of alzheimer accelerates synaptic and cognitive deficits determined by impaired autophagy and neurodegeneration . its capacity to remove 3-phosphate generates 3-oh termini , thus rendering dna termini accessible for polymerases after base excision by the bifunctional glycosylases neil1 or neil2 . pnkp interacts not only with the scaffold protein xrcc1 [ 86 , 87 ] but also with xrcc4 , a factor involved in nhej for the repair of dsb [ 8891 ] . mutations in pnkp have been recently identified as the cause of microcephaly with seizures ( mcsz ) , a syndrome characterized by profound neurodevelopmental microcephaly and early - onset seizures [ 9294 ] . pnkp inactivation in murine neural progenitors induced neurodevelopmental abnormalities and postnatal death . in mice , in which a tamoxifen - inducible promoter was used to inactivate pnkp after neurogenesis in different neural compartments , specific neural populations , including oligodendrocytes , were affected . these findings indicate that pnkp is required not only for neurogenesis but also for genome maintenance in mature neuronal cells , involving both ber and nhej . aprataxin ( aptx ) removes amp from the 5-termini of dna breaks resulting from abortive dna ligation events [ 9698 ] . loss of aptx in neuronal cells induces a defect in ssbr and sensitivity to genotoxic agents . patients with loss of functional aptx are affected by ataxia with oculomotor apraxia-1 ( aoa1 ) , with progressive cerebellar ataxia [ 100 , 101 ] . tyrosyl - dna phosphodiesterase 1 ( tdp1 ) removes trapped topoisomerase peptides from 3-termini of dna breaks resulting from abortive topoisomerase 1 activity and is involved also in the cleaning of others 3-modified termini [ 103 , 104 ] . tdp1 ko mice show late onset progressive atrophy in the cerebellum and patients with loss of tdp1 are affected by spinocerebellar ataxia with axonal neuropathy ( scan1 ) . defective dna repair has also been associated with age - related neurodegenerative disorders [ 106109 ] such as alzheimer 's disease ( ad ) and parkinson 's disease ( pd ) ; however , the specific contribution of dna damage to the etiology of these disorders has yet to be determined . dopaminergic neurons in the substantia nigra ( sn ) pars compacta of pd brains have high levels of mitochondrial dna deletions , possibly related to respiratory chain deficiency . in addition , an upregulation of the mitochondrial isoforms of the dna glycosylases mutyh and ogg1 was found in sn of pd patients [ 112 , 113 ] . a significant proportion of dopaminergic neurons from pd patients was positive for phosphorylated ape1 , while the proportion of dopaminergic neurons positive for total ape1 is similar in pd patients and normal individuals . moreover , neurons from ad patients accumulate oxidized dna bases both in nuclear and mitochondrial dna . wang et al . have shown high levels of the oxidized dna bases 8-oxog in both nuclear and mitochondrial dna from brains of mild cognitive impairment ( mci ) patients , the phase between normal aging and early dementia . this finding suggests that oxidation of dna bases is an early event in ad pathology and may play a role in neurodegeneration . analysis of peripheral leukocytes derived from ad and mci patients revealed increased levels of ros - induced dna damage . furthermore , treatment of human primary fibroblasts with oxidizing agents induces a gene expression pattern typical of fibroblasts from ad patients . an alteration in gene expression of dna repair genes has been observed in ad by several authors . a decrease of ogg1 activity has been described in brains from ad patients compared to healthy individuals . lower levels of udg are also present in brains from ad patients compared to healthy controls . mutt homolog 1 ( mth1 ) , which is critical to avoid the incorporation of oxidized dna bases in nuclear dna during replication , is downregulated in the hippocampus from ad patients compared to controls . huang et al . have shown that ape1 levels are similar in ad and healthy individuals , but ad brains have higher levels of phosphorylated ape1 . an impairment of ber function has been described in sporadic ad patients : both udg activity and pol activity are decreased in cell extracts from ad brain tissues . ber impairment is also present in mci brains , where it correlates with the severity of the disease . further , both affected and nonaffected brain regions have a diminished ber activity , suggesting that ber dysfunction is a general feature of ad brains that could occur at the earliest stages of the disease and be pivotal in the progression of ad . a study of ber capacity in mitochondrial extracts from ad brains shows that 5-hydroxyuracyl incision and dna ligase activity are lower in ad brains . a recent study has evaluated markers of oxidative dna damage , dna repair , and cell cycle in hippocampus from three groups : ( i ) clinical - pathological ad , with ad neuropathology and clinical dementia ( cp - ad ) , ( ii ) pathological ad , with neuropathology without clinical dementia ( p - ad ) , and ( iii ) normal aging . oxidative dna damage was high in all groups , but subjects with cp - ad present reductions of dna repair and cell - cycle inhibition markers and increases in cell - cycle progression and cell death markers when compared to both p - ad and normal subjects . no differences in all the markers were present between p - ad patients and normal subjects . these results indicate that cognitive decline may be associated with dna repair impairment and cell - cycle deregulation . the brain is the most complex organ of the human body and is characterized by different regions having distinct and specific functions . investigation of dna repair activities in the brain showed differential activity patterns related both to the specific dna repair system and the brain region analysed . an additional element , which distinguishes the dna repair systems operating in the human brain , is the subcellular compartment where they act . analysis of ber in five mouse brain regions , namely , caudate nucleus , frontal cortex , hippocampus , cerebellum , and brain stem showed that the activities of three major dgs , ogg1 , udg , and nth1 are higher in the nucleus with respect to mitochondria and that the cerebellum is the region having the highest levels of nuclear dg activity . in contrast , mitochondrial glycosylase activities showed a pronounced variation among the brain regions analysed , which manifested a general decline associated with age . analysis of mrna expression pattern of neil1 , neil2 , ogg1 , and nth1 glycosylases confirmed a wide distribution of ber enzymes both in human and rodent brain regions , except for neil3 whose expression was revealed in a few cell populations and at early stages of postnatal development . again , the cerebellum is one of the brain areas showing the highest levels of dg transcripts . the preferential activity / expression of ber in the cerebellum could be related to the marked vulnerability and susceptibility of this brain region to neurodegenerative events observed in different human neurodegenerative syndromes associated with ber / ssbr defects . for instance , aoa1 and scan1 are characterized by a marked cerebellar atrophy leading to progressive ataxia . aptx , the gene mutated in aoa1 , is widely expressed in the nervous system and it has been detected in cerebellum , basal ganglia , cerebral cortex , and spinal cord [ 100 , 101 ] . for many neurological aspects , aoa1 resembles a - t but lacks typical extraneurological features such as immunodeficiency and cancer susceptibility . as revealed in two autopsied cases , the pronounced atrophy of aoa1 patients cerebellum is caused by a severe loss of purkinje cells [ 125 , 126 ] . degeneration of posterior columns , spinocerebellar tracts , and anterior horn cells of the spinal cord was also observed . apart from cerebellar ataxia , other prominent clinical phenotypes of aoa1 patients are axonal sensorimotor neuropathy , cognitive defects , and chorea . the presence of aprataxin in the caudate nucleus , the in vivo detection of caudate nucleus hypoperfusion , and a reduction of dopamine transporter density in caudate and putamen of aoa1 brains suggested that aprataxin mutations in basal ganglia could affect the function of this brain region , thus leading to choreoathetosis . however , it should be noted that morphological alterations of basal ganglia have not been observed in aoa1 patients . cognitive disturbances have also been found in aoa1 patients which are consistent with a possible disruption of the frontocerebellar pathways . scan1 has a later onset compared to aoa1 . in the human brain , tdp1 , the gene mutated in scan1 , is highly expressed in different regions including the cerebellum ( granule and purkinje cells ) , dentate nucleus , spinal cord , and dorsal root ganglia , similar to mouse brain . although there are not reported autopsy studies from scan1 patients , the brain expression profiles of tdp1 in nondiseased brains together with progressive ataxia and axonal sensorimotor neuropathy typical of scan1 individuals are consistent with the involvement of the tdp1 expressing regions in the pathogenesis of scan1 . it is noteworthy that scan1 patients do not manifest cognitive defects as compared to aoa1 individuals . another gene involved both in nuclear and mitochondrial ber and associated with cerebellar dysfunction is pnkp . recently , the finding of severe cerebellar atrophy in two dutch siblings affected by mscz with a homozygous mutation in pnkp and in 11 individuals of nine portuguese families affected by early - onset recessive aoa confirmed the cerebellum as one of the most vulnerable brain regions in dna repair syndromes . as reported in aoa1 patients , beside ataxia , cognitive impairments were also observed [ 93 , 130 ] in several individuals , leading even to severe dementia in some cases . although pnkp has been identified in normal and pathological human cerebellum , a detailed analysis of expression levels and/or activity of pnkp in human brain is not yet available . a clear picture emerging from the analysis of these diseases is that the cerebellum appears to be the brain region with the highest vulnerability to defects in ber / ssbr activities . the high expression / activity levels of ber core proteins ( ogg1 , udg , nth1 , neil1 , and neil2 ) and end - processing dna repair factors such as aptx and tdp1 in the cerebellum could be suggestive of a high susceptibility of this brain region to dna lesions and especially to oxidative dna damages . consistently , it has been shown that cerebellar granule neurons and ca1 neurons are particularly vulnerable to oxidative stress stimuli compared to other neurons such as cortical and ca3 neurons [ 132 , 133 ] . this feature correlates with the marked loss of cerebellar granule cells in aged individuals [ 134 , 135 ] and the decline of ber glycosylase activities specifically detected in the cerebellum during aging . importantly , data derived from transcriptomic analyses on cerebellar granules and cortical neurons showed that some genes related to the dna damage response and repair ( such as hmgb2 and pold1 ) are markedly more active in the cerebellar neurons . the finding that , under basal conditions , cerebellar granule neurons have 25% lower atp levels with respect to cortical neurons could also account for the selective vulnerability of cerebellum to oxidative stress , a condition requiring a high energy demand to cope with dna damages . as described for scan1 and aoa1 , clinical phenotypes characterizing age - related neurodegenerative diseases are associated with the specific brain regions and population of neurons targeted , even though important causality issues remain to be addressed . in ad , early memory deficits are caused by the selective degeneration of pyramidal neurons in the entorhinal cortex , subiculum and ca1 of the hippocampus , and accumulation of -amyloid in frontal , temporal , and parietal cortex . dopaminergic neurons of the sn are targeted and their degeneration accounts for the major clinical manifestations of pd . another neuronal type specifically targeted in neurodegenerative diseases is gabaergic neuron , whose loss characterizes both spinocerebellar ataxia-1 ( sca1 ) and huntington 's disease ( hd ) , two polyglutamine diseases . it is noteworthy that the cell population affected in sca1 is represented by giant purkinje cells of the cerebellum , whereas spiny neurons of the striatum degenerate in hd . interestingly , the genes causing sca1 and hd are expressed in both cerebellum and striatum ; however , the reason why both regions are not affected in both diseases is not known . although there is no evidence for a region- and neuron - specific dna damage response in neurodegenerative diseases , it is tempting to speculate that neurons that are selectively affected in these diseases could be both selectively vulnerable to specific dna damage inducers ( e.g. , ros ) and/or less responsive to dna repair . to address this issue , we have compared the response to oxidative dna damage of different types of neurons derived from mouse cortex , cerebellum , and hippocampus . all three types of neurons showed a significant h2o2 dose - related decrease in survival ( figure 2 ) . neurons from cerebellum seem to be more sensitive ( lc50 = 29.8 m ) to oxidative stress when compared to neurons from cortical and hippocampal regions ( lc50 = 41.5 and 55.2 m , resp . ) . the number of foci - positive nuclei immediately after treatment was lower in cortical neurons as compared with neurons from cerebellum and hippocampus , suggesting a less effective ddr in cortex ( figure 3(a ) , left ) . during the posttreatment repair time , the percentage of h2ax foci - positive cells declined in all three types of neurons with the same rate ( figure 3(a ) , right ) and at 24 hr posttreatment the repair was almost completed in all neuronal cell types . the presence of the specific atm kinase inhibitor ku55933 fully abolished the appearance of h2ax foci ( figure 3(b ) ) , indicating that this kinase is activated following h2o2-induced dna damage in neurons from the three brain regions analysed . an atm - dependent ddr has also been described following h2o2 treatment in postmitotic myotubes strengthening the importance of this kinase in the signalling of dna breaks . finally , when the protein levels of key ber enzymes , such as ape1 , xrcc1 , pol , lig3 , and fen1 , were measured ( figure 4 ) , no significant differences were found by comparing neurons derived from the three different brain regions . a notable exception is fen1 that was higher in neurons from the cerebellum and the cortex as compared with neurons from hippocampus . it has been shown that the expression levels of dna replication / repair proteins , including fen1 , predict regional somatic repeat instability in the brain . we confirm elevated expression of fen1 in the cerebellum , thus supporting the hypothesis that in this brain region it may account for the reduced somatic instability as compared with other regions ( e.g. , striatum ) . therefore , our data support the hypothesis that brain region differences in ber / ssbr activities and/or ddr efficiency may contribute to the brain region selectivity and neuronal vulnerability in neurological diseases . there is emerging evidence for an important role of ber / ssbr in the control of genome stability in the nervous system . indeed , a malfunction of almost all the key players of this pathway has been associated with neurological alterations . this finding confirms that neuronal cells need to be protected from oxidative damage that is mostly repaired by ber . oxidative damage is produced at high levels in the brain due to high level of tissue oxygen consumption . ssb that are produced during ber are a major threat to mature brain as shown by the neurological consequences of defective ssbr . there is some evidence that the mechanisms that control dna damage in neurons may vary depending on the brain region . in ssbr - associated neurological syndromes , specific brain areas are affected , with the cerebellum being the most vulnerable one . in contrast , further investigation is required to determine if differences in response to dna damage underlie the brain region selectivity observed in neurodegenerative diseases . a better understanding of dna repair / ddr mechanisms in the nervous system may open new avenues in the design of innovative therapies .

there is a growing body of evidence indicating that the mechanisms that control genome stability are of key importance in the development and function of the nervous system . the major threat for neurons is oxidative dna damage , which is repaired by the base excision repair ( ber ) pathway . functional mutations of enzymes that are involved in the processing of single - strand breaks ( ssb ) that are generated during ber have been causally associated with syndromes that present important neurological alterations and cognitive decline . in this review , the plasticity of ber during neurogenesis and the importance of an efficient ber for correct brain function will be specifically addressed paying particular attention to the brain region and neuron - selectivity in ssb repair - associated neurological syndromes and age - related neurodegenerative diseases .

desmoplastic fibroma ( df ) , a benign locally aggressive lesion of the bone is recognized as an intra - osseous counterpart of soft tissue fibromatosis and is usually seen affecting the long bones , pelvis and only occasionally presents itself as a jaw lesion . mandible is most commonly affected when compared to the maxilla and the cranium in the head and neck region . a systematic literature search of the pubmed database of national library of medicine using df and mandible as keywords revealed a total of 57 published cases occurring in the mandible alone from the year 19692014 . the cause for df is unknown and is stipulated to have a varied pathogenesis ranging from genetic , endocrine and traumatic factors to an exuberant reactive proliferation . when differentiating it from other neoplasms that behave aggressively , a history of expansion or perforation of the cortical plates along with the histopathological confirmation would be a pointer in the right direction . a 35-year - old female patient visited the department of oral medicine and radiology , with the chief complaint of slowly growing painless swelling in the left lower back tooth region since 3 years [ figure 1 ] . clinical extra - oral examination revealed expansion of the left inferior border of the mandible and intra - oral examination revealed a solitary bony hard swelling measuring about 4.0 cm 5.0 cm in size with obliteration of the left buccal vestibule in relation to 37 and 38 [ figure 2 ] . clinical image showing swelling of left side of lower jaw intra - oral photograph showing obliteration of the left buccal vestibule in relation to 37 , 38 a left lateral oblique view of radiograph showed multilocular radiolucencies with fine trabeculations leading to a soap bubble appearance extending from the left angle of the mandible to the mesial root of the mandibular left first molar . no displacement of teeth or resorption of the root was seen [ figure 3 ] . left lateral oblique view of radiograph showing multilocular radiolucencies a computerized tomography ( ct ) scan demonstrated buccal and lingual cortical plate expansion and a soap bubble appearance [ figure 4 ] . computed tomography scan showing buccal and lingual cortical plate expansion surgical excision of the lesion the hematoxylin and eosin stained tissue section showed hypo and hyper - cellular areas with proliferation of plump fibroblasts arranged in interlacing fascicles and dense collagen . focal areas of the section also revealed dense collagenous stroma with foci of hyalinization [ figure 8 ] . photomicrograph showing hypo - cellular and hyper - cellular areas with spindle cells arranged in interlacing fascicles ( h&e stain , 10 ) photomicrograph showing hyper - cellular area with proliferating plump fibroblasts , ( h&e stain , 20 ) photomicrograph showing proliferating plump , spindle - shaped fibroblasts in a collagenous stroma ( h&e stain , 40 ) photomicrograph showing a focus of dense collagenous stroma with focal areas of hyalinization ( h&e stain , 10 ) a final diagnosis of df was arrived at after histopathological examination . df is a rare , locally aggressive myofibroblastic benign tumor of connective tissue origin . as an intra - osseous lesion df was first described by jaffe in 1958 and named as df . in 1965 , the first report about a df of the jaw was presented by griffith und irby . the histologic criteria for df as defined by the world health organization is a rare benign bone tumor composed of spindle - shaped cells with minimal cytological atypia and abundant collagen production . desmoid tumor also called as aggressive fibromatosis , was described before df . about 69% of desmoid tumors are abdominal ; the extra - abdominal variety occurring in the bone is the df . although df can affect any age group , most patients are affected in the first three decades of life . in our case , the average age of patients at the time of the final diagnosis is 15.1 years . metaphysis of long bones especially tibia , scapula and femur are the most frequent sites of involvement . mandible is the fourth most common site of involvement and sex predilection remains unclear . in the mandible , the lesions tend to occur posteriorly at the ramus - angle region . this is similar to our case report , where the lesional tissue is in relation to the second and third molars . the symptoms are nonspecific including diffuse , moderate pain in the region of the tumor , both at rest and on movement or when bone bears any weight . in the maxillofacial region , dfs usually are painless , slow - growing firm masses . a similar history of a painless radiographic appearance may vary from uni - locular to multi - locular , with or without expansion or perforation of cortical plates according to frick et al . radiographs showed osteolytic lesions with coarsened ridge - like trabeculae in 63% of cases , osteolytic lesions in 24% of cases and mixed lytic and mildly sclerotic lesions in 13% cases . ct revealed radiolucent ( 65% ) or mixed radiolucent and mildly sclerotic ( 35% ) matrix patterns . the ct in our case clearly showed cortical expansion without any resorption or displacement of adjacent teeth . t1-weighted sequences in mri showed that the signal intensities within the lesions were isointense or hypointense to adjacent normal muscle . the hypocellular areas of the tumors with abundant collagen are responsible for the areas of t2-shortening while hyper - cellular parts filled with fibroblasts or necrotic areas are responsible for the higher intensity parts within the lesions . on gross examination , the desmoid tumor appears as firm , rubbery , white , nonencapsulated fibrous growth . histologically , the df contains mature fibrous connective tissue , low to variable cellularity and spindle - shaped fibroblasts / myofibroblasts with uniform long nuclei in an abundant stroma of collagenous matrix lacking cellular pleomorphism , nuclear hyperchromatism or mitoses . the differential diagnosis to be considered histologically would be spindle cell tumors of which low - grade fibrosarcoma is the most important . tumors such as fibrous histiocytoma , fibrous dysplasia , or a low - grade intra - osseous osteosarcoma ; tumor - like lesions such as aneurysmal bone cyst and the juvenile bone cyst can also present with a similar clinical picture . though fibrosarcoma exhibits a highly cellular stroma along with high grades of polymorphism and mitosis , the low - grade variant shows a collagen rich tissue with low cell count and no mitotic activity . this is very similar to the histopathological picture of the df and a definitive diagnosis is possible only with postoperative clinical development . found that df has no immunoreactivity of cd117 , estrogen and progesterone receptors ; and 50% cases showed positivity for muscle - specific markers and the -catenin pathway does not seem to have the same essential role in the tumorigenesis of df , as it has in desmoid type fibromatosis . found that the majority of the tumor cells express the mesenchymal marker vimentin and no immunoreactivity for antidesmin and anti - s-100 protein . df of maxilla or mandible with extra - osseous extensions is treated with complete excision including a margin of uninvolved soft tissue . the recurrence rate of about 40 - 47% is seen in lesions treated by curettage or intra - lesional resection making follow - up a necessity .

desmoplastic fibroma ( df ) is a benign intra - osseous neoplasm , that is , recognized as the intra - osseous counterpart of soft tissue fibromatosis in both gnathic and extra - gnathic sites . it has a propensity for locally aggressive behavior and local recurrence . an occurrence of intra - osseous lesion other than that of odontogenic origin is rare in the jaws . in this case report , we define the clinico - pathological and radiographic features of df of the mandible in a 35-year - old female , who presented to the outpatient department with a 3-year history of a slowly expanding painless mass in the left mandibular posterior region . thus , we present a classic case of df exhibiting characteristic features along with a review of the literature .

examination revealed a respiratory rate of 28 , a heart rate of 160 , and oxygen saturations of 87% on room air . this man 's transverse colon , stomach , and head of pancreas are lying in his chest below the arch of his aorta ( figs . 1 , 2 , 3 ) . chest xray : bowel is visualized in the thorax coronal ct scan : green arrow arch of aorta , red arrow transverse colon sagittal ct scan : there is clear evidence of thoracic spine kyphosis . green arrow arch of aorta , red arrow transverse colon , blue arrow diaphragmatic defect .

key clinical messagediaphragmatic hernias are typically congenital or caused by trauma . delayed presentation is not uncommon . repair can be undertaken through an open or minimally invasive abdominal or thoracic approach . small defects can be repaired with sutures , while larger defects require a mesh repair . this patient 's comorbidities precluded him from surgery .

circumcaval ureter is an uncommon congenital cause of obstructive hydronephrosis , caused by the ureter coursing around the inferior vena cava ( ivc ) . the radiological diagnosis of circumcaval ureter has evolved from intravenous urography ( ivu ) , venacavography , and ureteral catherization to less - invasive and more informative modalities like computed tomographic urography ( ctu ) and magnetic resonance urography ( mru ) . while ctu is admittedly superior in ruling in or out possible common causes of a non - specific urological presentation , mru is finding its niche in the diagnosis of causes of obstructive hydronephrosis . the mru findings of circumcaval ureter were first described in a case in 2002 and more recently in a dog . while the diagnosis of circumcaval ureter in an excreting kidney can be made by ctu or in a non - excreting kidney might be suggested by a non - contrast ct , this series of seven cases illustrates the ability of mru to clearly depict relevant anatomic relationships and provide confirmatory diagnosis without radiation exposure or the use of contrast medium . to the authors knowledge , this is the largest series describing mru findings of circumcaval ureter . over a 2-year period from 2005 to 2007 , all patients suspected to have circumcaval ureter on ivu subsequently underwent mru . the study was approved by the institute ethics committee and informed consent was taken from the patients prior to the procedures . static mru was performed in a 1.5 t magnetom scanner ( siemens , erlangen , germany ) using a phased - array body coil . heavily t2-weighted sequences like half - fourier acquisition single - shot turbo spin echo ( haste ) and fast imaging with steady - state precession ( trufisp ) in axial and coronal planes , with thin and thick coronal maximum intensity projection ( mip ) reconstructions were employed . contrast was not administered , and as is our routine in assessing hydronephrotic systems , patients were not required to undergo oral or intravenous hydration prior to the scan . a 34-year - old man presented with intermittent right flank pain for 6 months . preliminary ultrasound for suspected calculus disease showed right hydroureteronephrosis with a dilated proximal ureter but no evidence of calculi . excretory urography showed right - sided grade 4 hydroureteronephrosis , the ureter being dilated up to the l4 vertebral level , with a tapered segment seen coursing superiomedially . mru showed grade 4 hydronephrosis with the medialized segment of the ureter coursing around the ivc , and axial sections clearly depicted the anatomy [ figure 1 ] . ( a ) the sea horse appearance of a type 1 circumcaval ureter seen on thick slab t2 turbo spin echo coronal mru image . ( b ) axial t2-weighted haste mru depicting the ureter coursing around the ivc a 20-year - old man presented with intermittent right flank pain for 1 year and dysuria for 1 week . sonography revealed right - sided hydronephrosis , and excretory urography showed a mid - ureteric medialization with grade 4 hydronephrosis and the rest of the ureter was not visualized . mru was subsequently performed , which showed the right upper ureter conically dilated and tapering into a normal caliber ureter that made an s - shaped curve around the ivc . a 12-year - old boy was incidentally found to have right hydronephrosis on routine sonography , and the left kidney was not visualized . an excretory urogram showed grade 3 hydronephrosis on the right , with a dilated proximal ureter and a short distal medialized segment . mru confirmed a solitary right kidney with grade 3 hydronephrosis , and the acute medialization was seen to be due to the ureter winding around the ivc at l3 vertebral level . the patient , being asymptomatic , was not operated , and is on regular sonographic follow - up . a 40-year - old woman presented with right flank pain and fever for 2 weeks . excretory urography done after treatment of the infection showed right - sided grade 3 hydronephrosis with a mru images and mip reconstructions showed a similar appearance , but axial sections clearly depicted a circumcaval course of the ureter . a 25-year - old man presented to the emergency department with acute severe right flank pain for a day and history of similar milder pain for the last year . ivu showed right grade 4 hydronephrosis with a calculus overlying the pedicle of l3 vertebra . ct showed right hydronephrosis with renal and proximal ureteric calculi , but the intimate relation of ureter and ivc raised the possibility of a circumcaval ureter . mru unequivocally depicted the circumcaval course of the ureter and two calculi proximal to the obstruction [ figure 2 ] . ( a ) ivu showing grade-4 hydronephrosis and an opacity adjacent to l3 vertebral pedicle ( arrow ) . ( b ) axial mru section clearly showing the ureteric segment posterior to the ivc with a signal void of a calculus in that segment ( arrow ) . ( c ) t2-turbo spin echo coronal thick slab mru showing the calculus as a signal void ( upper arrow ) and the circumcaval course of the ureter ( lower arrow ) a 41-year - old man presented with dysuria of 6 months duration . ultrasound showed right - sided hydronephrosis with a prominent pelvis , the ureter not traceable . ivu showed right grade 2 hydronephrosis , and the reverse j shape of the collecting system suggested circumcaval course of the ureter . mru showed grade 2 obstruction due to hooking of the proximal ureter around the ivc [ figure 3 ] . grade-2 hydronephrosis with circumcaval ureter seen on thick slab t2-turbo spin echo coronal mru image . the hooking of the proximal ureteric segment can be appreciated ( arrow ) a 43-year - old man presented with flank pain for 2 months . retrograde pyelogram ( rgp ) was performed , which showed only the distal normal ureter , up to l4 vertebral level , the tip of the catheter being more medial than expected , causing circumcaval ureter to enter the differential . ct was performed to exclude radiolucent calculus , and the proximity of the ureter and ivc was noted , though there was no retrocaval segment . mru was performed , and though the procedure had to be terminated prematurely owing to the patient 's claustrophobia , the obtained sections excluded a circumcaval course of the ureter and were suggestive instead of a crossing vessel [ figure 4 ] . ( a ) ivu showing grade-2 to -3 hydronephrosis with a grossly dilated pelvi - urteric segment and no cause for obstruction . ( b ) retrograde pyelography showing the catheter tip ( upper arrow ) to be superior and medial to the obstructed ureter ( lower arrow ) suggesting that this segment might be hooked around the ivc . ( c ) coronal mru section showing a vessel ( arrow ) crossing at the site of ureteric narrowing , yielding the diagnosis preliminary ultrasound for suspected calculus disease showed right hydroureteronephrosis with a dilated proximal ureter but no evidence of calculi . excretory urography showed right - sided grade 4 hydroureteronephrosis , the ureter being dilated up to the l4 vertebral level , with a tapered segment seen coursing superiomedially . mru showed grade 4 hydronephrosis with the medialized segment of the ureter coursing around the ivc , and axial sections clearly depicted the anatomy [ figure 1 ] . ( a ) the sea horse appearance of a type 1 circumcaval ureter seen on thick slab t2 turbo spin echo coronal mru image . a 20-year - old man presented with intermittent right flank pain for 1 year and dysuria for 1 week . sonography revealed right - sided hydronephrosis , and excretory urography showed a mid - ureteric medialization with grade 4 hydronephrosis and the rest of the ureter was not visualized . mru was subsequently performed , which showed the right upper ureter conically dilated and tapering into a normal caliber ureter that made an s - shaped curve around the ivc . a 12-year - old boy was incidentally found to have right hydronephrosis on routine sonography , and the left kidney was not visualized . an excretory urogram showed grade 3 hydronephrosis on the right , with a dilated proximal ureter and a short distal medialized segment . mru confirmed a solitary right kidney with grade 3 hydronephrosis , and the acute medialization was seen to be due to the ureter winding around the ivc at l3 vertebral level . the patient , being asymptomatic , was not operated , and is on regular sonographic follow - up . a 40-year - old woman presented with right flank pain and fever for 2 weeks . excretory urography done after treatment of the infection showed right - sided grade 3 hydronephrosis with a mru images and mip reconstructions showed a similar appearance , but axial sections clearly depicted a circumcaval course of the ureter . a 25-year - old man presented to the emergency department with acute severe right flank pain for a day and history of similar milder pain for the last year . ivu showed right grade 4 hydronephrosis with a calculus overlying the pedicle of l3 vertebra . ct showed right hydronephrosis with renal and proximal ureteric calculi , but the intimate relation of ureter and ivc raised the possibility of a circumcaval ureter . mru unequivocally depicted the circumcaval course of the ureter and two calculi proximal to the obstruction [ figure 2 ] . ( a ) ivu showing grade-4 hydronephrosis and an opacity adjacent to l3 vertebral pedicle ( arrow ) . ( b ) axial mru section clearly showing the ureteric segment posterior to the ivc with a signal void of a calculus in that segment ( arrow ) . ( c ) t2-turbo spin echo coronal thick slab mru showing the calculus as a signal void ( upper arrow ) and the circumcaval course of the ureter ( lower arrow ) ultrasound showed right - sided hydronephrosis with a prominent pelvis , the ureter not traceable . ivu showed right grade 2 hydronephrosis , and the reverse j shape of the collecting system suggested circumcaval course of the ureter . mru showed grade 2 obstruction due to hooking of the proximal ureter around the ivc [ figure 3 ] . grade-2 hydronephrosis with circumcaval ureter seen on thick slab t2-turbo spin echo coronal mru image . retrograde pyelogram ( rgp ) was performed , which showed only the distal normal ureter , up to l4 vertebral level , the tip of the catheter being more medial than expected , causing circumcaval ureter to enter the differential . ct was performed to exclude radiolucent calculus , and the proximity of the ureter and ivc was noted , though there was no retrocaval segment . mru was performed , and though the procedure had to be terminated prematurely owing to the patient 's claustrophobia , the obtained sections excluded a circumcaval course of the ureter and were suggestive instead of a crossing vessel [ figure 4 ] . ( a ) ivu showing grade-2 to -3 hydronephrosis with a grossly dilated pelvi - urteric segment and no cause for obstruction . ( b ) retrograde pyelography showing the catheter tip ( upper arrow ) to be superior and medial to the obstructed ureter ( lower arrow ) suggesting that this segment might be hooked around the ivc . ( c ) coronal mru section showing a vessel ( arrow ) crossing at the site of ureteric narrowing , yielding the diagnosis circumcaval ureter , which has also been called retrocaval ureter , is a rare congenital anomaly , which is found in about 1 in 1100 cadavers . this abnormality is traced embryologically to the anomalous development of the infrarenal ivc from the ventrally located right posterior cardinal vein rather than from the supracardinal vein which is dorsal to the ureter . left - sided circumcaval ureter has been reported in association with a left - sided ivc , as well as in situs inversus , and there is also a report of bilateral circumcaval ureters in association with ivc duplication . many anatomic variants of the circumcaval ureter have been described , but radiologically there are two types . type 1 , the common type , shows moderate to severe hydronephrosis with extreme ureteral medialization , usually beyond the pedicle at l3 vertebral level . , there is milder obstruction , with less medialization of the ureter , and a the diagnosis of circumcaval ureter can be suggested on ivu , which demonstrates the medialization of the ureter at l3 or l4 vertebral level with sharp hooking toward the pedicle . rarely , there may not be obstruction , or the obstruction may be of a lower grade , when the diagnosis might be overlooked . the distal ureter is usually not visualized on ivu , and in some cases , other causes of medialization of the ureter can not be adequately excluded . inferior venography , though rarely performed today , has also been used in the past to strengthen the diagnosis . contrast - enhanced ct with delayed images has been found to be able to depict the ureteral relations to the ivc , and unlike earlier methods , can also adequately exclude extrinsic compression or displacement of the ureter . like ivu , this also requires adequate excretion by the kidney , which might not be present in a chronically obstructed system . the mru appearance of circumcaval ureter was first described in 2002 , and several studies have shown the diagnostic reliability of heavily t2-weighted sequences in depiction of an obstructed system . while coronal mip images provide the closest similarity to an ivu film , it is the axial sections that we found to be most useful in confirming the circumcaval course of the ureter . indeed , while coronal images often suffered from bowel and other image degrading artifacts , the latter did not hamper tracing the path of the ureter in axial sections . the intrinsic contrast of urine in heavily t2-weighted images enabled easy diagnosis irrespective of excretory ability of the kidney . static mru using heavily t2-weighted images is , however , prone to flow artifacts misdiagnosed as filling defects , and the bright signal of fluid is known to obscure small calculi , which require a ct for a definitive diagnosis . in our series , while cases 1 , 2 , 4 , 5 , and 6 showed the reverse j appearance described as type 1 circumcaval ureter , case 3 showed a more gradual tapering and less medialization , characteristic of type 2 circumcaval ureter . while the diagnosis was suspected in most of the cases by ivu , case 5 might have been misconstrued as obstruction due to ureteral calculus if not for the medial location of the calculus , overlying the pedicle . on ivu , a medially directed short segment of ureter of normal diameter immediately distal to the dilated segment was a good pointer to the diagnosis . however , this finding is not always present , or may be very subtle , as seen in case 3 . grades of hydronephrosis varied from grade 4 in cases 1 , 2 , and 5 ; grade 3 in cases 3 , 4 , and 7 ; and grade 2 in case 6 , raising the possibility that though a congenital condition , the onset of obstruction might be delayed . one explanation of the fewer reports of this condition in literature than its incidence could thus be the absence of symptomatic obstruction . pyonephrosis as seen in case 4 and calculi as in case 5 are two of the potential complications of circumcaval ureter . while the infection in case 4 subsided with antibiotics , the calculi in case 5 required a pyelolithotomy prior to curative surgery . the diagnosis of circumcaval ureter , so far in the domain of ivu and other invasive methods , can be readily made with static mru . while circumcaval ureter can have a variety of appearances and grades of hydronephrosis on ivu , the diagnosis can be confidently made or excluded with mru , as can other causes of obstruction be suggested . the absence of contrast usage , lack of ionizing radiation , and multiplanar imaging capability make mru an attractive option in the workup of suspected cases where these would want to be avoided , like in the pediatric population , in patients requiring long - term follow - up , in pregnancy , renal failure , non - excreting renal systems , and to corroborate or confirm doubtful ct findings . this series shows the particular usefulness of axial sections in depicting the abnormal ureteric course , even if standard coronal images and reconstructions are equivocal . valuable anatomical and pathological information can be obtained to guide surgeons and thus affect outcome .

objectives : to describe magnetic resonance urography ( mru ) appearances of the circumcaval ureter , a rare congenital cause of hydronephrosis.materials and methods : seven cases of circumcaval ureter , suspected on intravenous urography ( ivu ) , underwent subsequent static mru using heavily t2-weighted sequences.results:the various appearances of circumcaval ureter on ivu and mru were studied and compared . the circumcaval portion of the ureter was especially well seen on axial mru sections , though this portion was routinely not visualized on ivu . in one case with a ureteric calculus , mru also depicted a circumcaval course of the ureter , thus providing a complete diagnosis . in yet another case , where a circumcaval ureter was suspected on ivu , mru proved the actual cause of ureteric obstruction to be a crossing vessel.conclusion:static mru using heavily t2-weighted coronal and axial sequences can make or exclude the diagnosis of circumcaval ureter unequivocally .

primary adenocarcinoma of rete testis is an extremely rare intrascrotal extratesticular neoplasm occurring most frequently in elderly males but has a wide age range of 8 - 91 years . although near about 60 cases of rete testis carcinoma have been published till date , less than 30 cases had fulfilled the strict diagnostic criteria required for true rete testis adenocarcinoma . the diagnosis of this unusual lesion is based largely on documenting its origin from the rete testis and excluding other primary and metastatic neoplasms . we present a very unique and possibly the third case of primary rete testis adenocarcinoma in a young male , that also featured a malignant spindle cell component predominantly in a biphasic pattern . a 32-year - old farmer presented with a gradually enlarging painful right scrotal swelling and heaviness of 1 year duration . there was no history of cryptorchidism , abnormal sexual development or trauma in the inguinoscrotal region . on examination , the clinician suspected an underlying testicular mass for which the patient underwent ultrasonography ( usg ) of the scrotum and abdominopelvic computed tomography ( ct ) . usg revealed a solid well - delineated echogenic mass in right scrotum with collection of small amount of fluid surrounding the right testicular region . serum alpha - fetoprotein , alkaline phosphatase , prostate - specific antigen , carcino - embryonic antigen ( cea ) and beta - human chorionic gonadotropin levels were in the normal range . routine pre - operative investigations were otherwise normal . an 18-fludeoxyglucose positron emission tomography / computed tomography ( fdg - pet / ct ) scan failed to demonstrate any unknown primary site . , there was blood - mixed fluid in the scrotal sac with thickening of the tunica vaginalis . the resected specimen comprised of the right testicle with its appendages and a 5 cm segment of spermatic cord . on cut section , a whitish - tan solid mass measuring 10.2 cm 7.4 cm 5.6 cm with focal cystic and hemorrhagic areas were found which almost replaced the normal testicular tissue [ figure 1a ] . a small area of compressed brownish testicular tissue was present peripherally in the upper pole . histopathological examination displayed a combination of a pure adenocarcinoma , a biphasic pattern consisting of intimate admixture of malignant epithelial and spindle cell components and also predominantly sarcoma - like areas . a distinct but gradual transition from normal rete testicular lining to dysplastic and malignant epithelium was noted [ figure 1b ] . the epithelial tumorous part demonstrated varied patterns namely tubules and cords ( sertoliform ) in desmoplastic stroma , elongated and compressed branching tubules ( retiform ) , solid areas with tiny slit - like channels ( kaposiform ) and slender papillae with thin fibrovascular cores [ figures 1c , d and 2a ] . the epithelial tufts projecting into the large cyst - like dilated epithelium - lined channels of rete testis , morphologically mimicking renal glomeruli was also appreciated [ figure 2b ] . the epithelial lining cells were cuboidal to columnar with eosinophilic cytoplasm , focal areas of nuclear stratification and moderate pleomorphism [ figure 2c ] . solid cords of tumor infiltrated into the seminiferous tubules that showed maturation arrest , but appeared to spare the epididymis and ductuli efferentes [ figure 2d ] . predominantly sarcoma - like areas revealed mostly storiform pattern and short fascicles of moderately atypical spindle cells with brisk mitotic figures , areas of necrosis and metaplastic bone formation [ figure 3a c ] . on immunohistochemical analysis , malignant epithelium expressed diffuse , strong cytoplasmic positivity for cytokeratin ( ck ) with focal positivity of spindle cells . vimentin was strongly and diffusely positive in spindle cells of sarcomatoid areas [ figure 3d ] . however , calretinin was negative throughout . the patient was well and without any evidence of local recurrence or metastatic disease 6 months after surgery . ( a ) orchiectomy specimen showing a solid whitish mass with focal cystic and hemorrhagic areas and residual normal testicular tissue in upper pole ( star ) ( b ) photomicrograph showing gradual transition from normal rete testicular lining to dysplastic and malignant lining in the direction of arrow ( h and e , 40 ) ( c ) photomicrograph showing tubules and cords of malignant cells in desmoplastic stroma infiltrating the seminiferous tubules ( broken arrow ) ( h and e , 100 ) ( d ) photomicrograph showing retiform tubules and solid areas with kaposiform ( broken arrow ) channels ( h and e , 100 ) ( a ) biphasic area of the adenocarcinoma showing papillary structures with fibrovascular core along with spindle cell component arranged in fascicles ( h and e , 100 ) ( b ) photomicrograph showing epithelial tufts projected into the large dilated epithelium - lined channels of rete testis mimicking renal glomeruli ( h and e , 100 ) ( c ) photomicrograph of lining cuboidal to columnar epithelial cells showing moderate pleomorphism ( h and e , 400 ) ( d ) photomicrograph demonstrating epididymis ( solid arrow ) and ductuli efferentes ( broken arrow ) free from infiltrating tumor mass ( h and e , 100 ) ( a ) photomicrograph of sarcoma - like area of the tumor mass displaying spindle cells arranged in storiform pattern and compressed seminiferous tubules ( h and e , 100 ) ( b ) photomicrograph showing spindle cells in storiform pattern , brisk mitotic activity and moderate pleomorphism ( h and e , 400 ) ( c ) photomicrograph showing metaplastic bone formation and necrosis in sarcoma - like area ( h and e , 100 ) ( d ) photomicrograph showing diffuse and strong positivity of vimentin in sarcoma - like area ( 100 ) most patients with adenocarcinoma of rete testis present with scrotal pain and/or swelling and frequently tumors are masked by a hydrocele , hematocele , inguinoscrotal hernia , epididymitis etc . the differential diagnosis includes entities most importantly malignant mesothelioma of tunica vaginalis , ovarian - type ( mullerian ) tumors of testis and paratestis , metastatic adenocarcinoma , epididymal adenocarcinoma , malignant sertoli cell tumors , etc . despite remarkable architectural similarity , grossly mesothelioma , as opposed to rete adenocarcinoma , certainly involves the tunica vaginalis and even the scrotal skin in a multifocal fashion ; microscopically display typical tubulopapillary pattern , minimal cytological atypia and positivity for mesothelioma related markers such as calretinin , wt-1 , ck5/6 and negativity for adenocarcinoma - related antibodies . mullerian type tumors are positive for cea and cancer antigen 125 but negative for ck5/6 and calretinin . metastatic adenocarcinomas are mostly bilateral , multifocal and most importantly have a detected source of primary . the strict criteria of nochomovitz and orenstein for rete adenocarcinoma includes involvement of testicular hilum by the tumor , demonstrable transition from normal rete testis to neoplastic rete epithelium , absence of histologically similar extra - scrotal tumor as well as testicular or paratesticular tumor , immunohistochemical exclusion of other possibilities , particularly malignant mesothelioma . demonstration of a transition from normal to neoplastic rete epithelium is perhaps the strongest evidence for the diagnosis but large masses often obliterate the normal anatomy such that a transition is not evident . thus to sum up , the fatally deceptive clinical presentation , plethora of differential diagnosis and the seemingly complex criteria of nochomovitz and orenstein all together make the diagnosis of this rare entity a real challenge . in our case , the transition from normal to malignant rete epithelium was surely the strongest feature supporting the diagnosis , besides others such as characteristic glomeruloid and other patterns , lack of scrotal skin and epididymal involvement , negative serum biomarkers , negativity for calretinin with positive vimentin and absence of any other primary site of tumor . in the present case , a biphasic and also a predominantly sarcoma - like component harboring metaplastic ossification besides a purely adenocarcinomatous component added to the diagnostic challenge due to extreme scarcity of such findings in literature . thus , the biphasic pattern along with the young age of the patient added to the uniqueness of the case .

primary adenocarcinoma of rete testis is one of the rarest intrascrotal tumors . very few cases have been reported in the literature . in addition , presence of biphasic component creates difficulty in the diagnosis . we present here a unique third case of rete testis adenocarcinoma having distinct cytologically malignant spindle cell component in a young male who presented with recurrent hydrocele .

peach is one of the most well - liked fruits in the world because of their flavor , dietary value , attractive color , and medicinal worth . it is enriched with ascorbic acid , flavonoid , and phenolic compounds , which were considered prime sources for antioxidants [ 1 , 2 ] . however , peaches have a very short shelf life because they are highly susceptible to pathogenic infection and physiological deterioration during storage time under ambient temperature . cold storage remains the main method to slow the product deterioration in terms of consumer perception and nutritional value . however , low temperature results in chilling injury symptoms in some peach cultivars during or after cold storage [ 3 , 4 ] . chemical treatments have been used to prevent insect attack and prolong shelf life of postharvest peach . however , the use of chemicals has been minimized for food safety and environmental reasons . many physical methods including modified atmosphere packaging , heat , and uv - c pretreatments are being extensively studied as substitutes for current chemical methods in the commercial applications of peach [ 58 ] . carbon monoxide ( co ) is a simple diatomic gas molecule with low water solubility . it easily combines hemoglobin , thus delaying oxygen transport and leading to death of organisms . so in the past , it was considered a toxic gas to environment and biology . however , recent researchers found that , similar to no and h2s , co might serve as a gaseous signal molecule to involve in stomata close regulated by plant guard cell and the formation of lateral root . meanwhile , co may relieve plant tissue oxidation damage caused by a variety of abiotic stresses such as heavy metal , salt , and active oxygen donor [ 913 ] . it has been reported that exogenous co donor treatment might postpone the senescence of cut flower through regulating active oxygen metabolism and inhibiting lipid peroxidation . our previous study found that exogenous co treatment could restrain the browning of fresh cut lotus root and prolong the shelf life of postharvest jujube [ 15 , 16 ] . at present , there are few reports about the effect of co on plant senescence and fruit preservation , and the physiological mechanism of co on plant senescence stress is still unclear . in this work , the postharvest peaches were fumigated with exogenous co gas at different concentrations , and the presentation quality , nutrients , and antioxidant activity of peaches were determined periodically during the storage time . this research aims to investigate the effect of co treatment on postharvest peach and try to explore a novel method for fresh peach preservation . yanhong ) were purchased from an orchard situated in yaodu district , linfen city , shanxi province . peaches with uniform shape , size , and color , as well as no insect pest and mechanical damage , were selected and quickly transported to the laboratory of shanxi normal university in open cartons . co gas with a purity of 99.99% was purchased from beijing huaneng special gases co. , ltd . oxalic acid , gallic acid , rutin , potassium ferricyanide , trichloroacetic acid , and sodium hydroxide ( analytical grade ) were purchased from sinopharm chemical reagent co. , ltd . analytical - grade 1,1-diphenyl-2-picrylhydrazyl radical , 2,2-diphenyl-1-(2,4,6-trinitrophenyl ) hydrazyl , and 2,6-dichloroindophenol were purchased from sigma ( usa ) . other reagents of analytical grade were purchased from alfa aesar company ( tianjin , china ) . the peaches were fumigated with co gas at different concentrations ( 0.5 , 5 , 10 , or 20 about 10 kg of peaches were placed into a glass container , and then the container was sealed with lid . the diameter and height of used container are 40 cm . peaches that had not been fumigated with co gas were also sealed in glass container for 2 hours , serving as control sample . after treatment , all samples were then placed in plastic bags and stored under ambient temperature with 90% of relative humidity . each sample was about 180 peaches and the relevant parameters for the analyses of peaches were measured periodically . firmness was determined using a fruit digital sclerometer 8 mm in diameter for the head ( gy-4 , chendu bsida instrument co. , ltd . , chendu , china ) . for each fruit , two readings were taken in the equatorial region of the fruit after the skin was removed . the firmness of six fruits during storage was regularly measured and expressed as kg / cm . it was determined visually in the fruits from three trays and rated as 0 = absent ; 1 = very slight ( 1% surface 10% ) ; 2 = slight ( 10% surface 25% ) ; 3 = moderate ( 25% surface 50% ) ; 4 = severe ( 50% surface 100% ) . the decay incidence for the treatment unit was calculated as follows : decay incidence = [ ( rank quantity)/(4 soluble solids content and titratable acidity were assayed according to the method of mignani with modifications . tissues ( 50 g ) from ten fruits were homogenised and then centrifuged at 8000 g for 20 min using an eppendorf 5417r centrifuge ( germany ) . the supernatant was collected to measure soluble solids content ( brix ) using a refractometer ( wyt - ii , qingyang optical instrument co. , ltd . , chendu , china ) . titratable acidity expressed as citric acid on a fresh weight basis was determined by titration with 0.1 mol / l naoh to ph 8.2 . the ph of the supernatant was measured using a ph meter ( phs-3tc , shanghai leici instrument inc . , pal activity was determined as per the method of hussain et al . with modification . 5 g of sample from six fruits was homogenized in 5 ml of borate buffer ( 0.05 m , ph 8.0 ) containing 5 mm -mercaptoethanol and 1 mm edta . about 1.0 ml of enzyme extract was incubated with an assay medium containing 2 ml of 200 mmol / l sodium borate buffer ( ph 8.0 ) , 1 ml of distilled water , and 1 ml of 50 mmol / l 1-phenylalanine as substrate at 30c for 1 h. the reaction was terminated by adding 0.2 ml of 6 mol l hcl . one unit was defined as the change 0.01 absorbance at 290 nm per h. vitamin c content was measured through 2,6-dichloriondophenol titration . briefly , tissues ( 5 g ) from 6 fruits were homogenised in 10 ml of 2% oxalic acid solution and then centrifuged at 8000 g for 15 min at 4c . afterwards , 2 ml of the supernatant was titrated to a permanent pink colour using 0.1% of 2,6-dichlorpphenolindophenol . vitamin c concentration was calculated according to the titration volume of 2,6-dichloriondophenol and expressed as g g fresh weight . total polyphenol content was determined using folin - ciocalteu 's phenol reagent via spectrophotometric analysis . tissues ( 5 g ) from 10 fruits were homogenised in 20 ml of 50% aqueous methanol and then centrifuged at 3000 g for 20 min . an aliquot ( 1 ml ) of a standard solution of gallic acid with 0 , 10 , 20 , 30 , 40 , and 50 mg / l aqueous methanol or supernatant was added to a 25 ml volumetric flask containing 9 ml of water . approximately 1 ml of folin - ciocalteu 's phenol reagent was added to the mixture and then shaken . after 8 min , 2 ml of 7.5% aqueous na2co3 solution was added . the solution was immediately diluted with water to a final volume of 25 ml and thoroughly mixed . after incubation for 30 min at 25c , the absorbance versus the prepared blanks was read at 765 nm . tissues ( 5 g ) from 10 fruits were homogenised in 20 ml of 80% ethanol and then centrifuged at 3000 g for 20 min . an aliquot ( 1 ml ) of a standard solution of rutin with different concentrations ( 0 , 10 , 20 , 30 , 40 , and 50 mg / l ) or supernatant was added to 10 ml volumetric flasks containing 4 ml of water . at the onset of each experiment immediately , the solution was diluted with water to a final volume of 10 ml and thoroughly stirred . the absorbance of the mixture was determined at 510 nm versus the prepared blanks . total antioxidant activity ( taa ) was quantified according to the method of sayyari et al . with modifications , which enables one to determine taa due to both hydrophilic and lipophilic compounds in the same extraction . briefly , for each subsample , tissues ( 10 g ) from 10 fruits were homogenized in 10 ml of 50 mm phosphate buffer , ph 7.8 , and 5 ml of ethyl acetate and then centrifuged at 10000 g for 15 min at 4c . the upper fraction was used for taa due to lipophilic compounds ( l - taa ) and the lower for taa due to hydrophilic compounds ( h - taa ) . in both cases , taa was determined using the 2,2-diphenyl-1-(2,4,6-trinitrophenyl ) hydrazyl ( dpph ) radical scavenging activity and reducing power , respectively . the reducing power of the fruit samples was determined using the method of jayaprakasha et al . . a 0.2 ml aliquot of the supernatant was mixed with 2.5 ml of phosphate buffer ( 0.2 m , ph 6.6 ) and 2.5 ml of 1% potassium ferricyanide in 10 ml test tubes . after incubation , 1 ml of 10% trichloroacetic acid was added to the mixtures , followed by centrifugation at 5000 g for 10 min . the upper layer ( 2.5 ml ) was mixed with 2.5 ml of distilled water and 1 ml of 0.1% ferric chloride . the increase in absorbance of the reaction mixture indicated the reducing power of the samples . h - rp stands for hydrophilic compounds reducing power , and l - rp stands for lipophilic compounds reducing power . dpph radical scavenging capacity was assayed as described by yang et al . with slight modifications . briefly , 0.2 ml of the supernatant was added to 3 ml of dpph ( 120 shanghai , china ) was used , and the absorbance at 517 nm was after the reaction mixtures were incubated for 1 h at 30c in the dark . the scavenging rate of dpph radicals was calculated as scavenging rate ( % ) = [ 1 ( a1 as)/a0 ] 100 , where a0 is the absorbance of the control solution ( 3 ml of phosphate - buffered saline in 3 ml of dpph solution ) , a1 is the absorbance of the supernatant in dpph solution , and as , which is used for error correction arising from unequal colour of the sample solutions , is the absorbance of the sample extract solution without dpph . h - drsc represents the dpph radical scavenging capacity of hydrophilic compounds , and l - drsc represents the dpph radical scavenging capacity of lipophilic compounds . each treatment was repeated three times , and the data were processed by analysis of variance using dps7.05 statistical software ( refine information tech . the treatments were compared at p = 0.05 using tukey 's test , which indicates the multicomparison value in each case . pearson correlations were used to determine the relationship among measured variables ( physical and physiological responses and antioxidant contents and activity ) . the cultivar peach of yanhong belongs to melting - flesh fruit and its firmness decreased rapidly with fruit senescence . as shown in figure 1(a ) , the firmness of postharvest peach decreased quickly during the first 3 days of storage and then declined slowly from 3 to 6 days . when peaches were fumigated with concentration of co ( 0.510 mol / l ) , the decrease of firmness became slow with the co concentration enhancement . whereas the peaches were treated with higher concentration co ( 20 mol / l ) , the firmness of peaches fumigated with 5 or 10 mol / l co was significantly higher than that of control samples . particularly the peaches treated with 10 mol / l co demonstrated the slowest rate of firmness decline , and its firmness was 2.24 times of control fruit on day 6 . as described in figure 1(b ) , peaches began to rot at day 2 , and its decay incidence increased rapidly after 3 days . on day 6 , fortunately , co fumigation might restrain the decay of postharvest peaches . during the whole storage time , the decay incidence of all treated samples was lower than that of control fruits . of all these samples , peaches treated with 10 mol / l co showed the lowest increase of decay incidence , and there was significant difference compared to that of control samples ( p < 0.01 ) . at day 6 , the decay incidence of 10 mol / l co treated peaches was 40.50% , which was only 49.73% of control samples . as shown in figure 2(a ) , the soluble solids content of postharvest peaches first gradually increased and then slowly decreased during the storage time . both control sample and 0.5 mol / l co treated sample appeared to have the maximum value at day 3 , and 20 mol / l co treated peaches displayed the peak value at 2 day . while 5 or 10 mol / l co treated sample exhibited the maximum value on day 4 , postponing 1 day compared to that of control sample . from 4 to 6 days , the soluble solids content of 10 mol / l co treated fruits decreased the slowest . therefore , fumigating peaches with 10 mol / l co could effectively reduce the decrease of soluble solids content . the titratable acid of postharvest peaches decreased during storage time ( figure 2(b ) ) . / l co treated peaches showed the fastest decrease followed by the control sample and 0.5 mol / l co treated sample . the titratable acid of 5 or 10 mol / l co treated sample decreased the least during storage time , which is higher than that of other samples from 3 to 6 days ( p < 0.05 ) . at day 6 , the titratable acid content of 10 mol / l co treated peaches was 72.8% higher than that of control samples . the vitamin c of postharvest peaches showed increasing trend in the first two days and then decreased from 2 to 6 days ( figure 3(a ) ) . the vitamin c content of 20 mol / l co treated peaches reached the peak value at day 1 and then decreased . it was the lowest during the storage time compared to control and all other treated samples . other samples appeared to have the maximum value of vitamin c at day 2 , and the vitamin c contents of treated samples with 0.510 mol / l co were higher than those of control samples . furthermore , the peaches treated with 10 mol / l co showed the highest vitamin c content among all samples during the storage time , and significantly higher than that of control samples ( p < 0.01 ) . as described in figure 3(b ) , the total flavonoid content of peaches first increased and then decreased during the whole storage time . the peaches treated with 0.5 or 20 mol / l co and control sample appeared to have the maximum of total flavonoid content at day 2 , and there was no difference among them . 5 or 10 mol / l co exhibited peak value of total flavonoid content at day 3 , but the total flavonoid content of peaches treated with 10 mol / l co was significantly higher than that of other samples from 4 to 6 days ( p < 0.05 ) . similar to total flavonoid content , the total polyphenol content firstly increased and then decreased as well ( figure 3(c ) ) . 0.5 or 20 mol / l co treated peaches appeared to have the peak value of total flavonoid content on day 3 , but the total polyphenol content of peaches treated with 20 mol / l co was significantly lower than that of other samples . the total polyphenol content of peaches treated with 5 or 10 mol / l co increased the slowest , and it reached the maximum at day 4 . obviously , treating peaches with 5 or 10 mol / l co might restrain the decrease of total polyphenol content of postharvest peaches . as shown in figure 4 , the pal activity of postharvest peaches showed an obvious peak value during storage time . the sample treated with 0.5 or 20 mol / l co and control sample appeared to have maximum of pal activity at day 3 , but the rising and falling speed of pal activity of peaches treated with 0.5 or 20 mol / l co was lower than that of control sample . peaches treated with 5 and 10 mol / l co demonstrated peak value of pal activity at days 4 and 5 , and they were postponed at 1 and 2 days , respectively . apparently , peaches treated with 10 mol / l co maintained higher pal activity during the last storage time . the h - rp and l - rp of postharvest peaches all firstly promptly decreased and then gradually increased during the storage time , but there were some differences between them ( figures 5(a ) and 5(b ) ) . at 0 day , the h - rp was slightly lower than l - rp . however , it was significantly higher than l - rp during the storage time and was about 2.85.6 times compared to l - rp . moreover , at the end of storage , the h - rp still maintained high level , while the l - rp decreased less 1/6 than that of original level . compared to that of control sample , the h - rp or l - rp in all co treated samples was higher . obviously , exogenous co fumigation was beneficial to maintaining the reducing power of postharvest peach , and 10 mol / l co treatment demonstrated the best effect . as shown in figure 5(c ) , the h - drsc of postharvest peach began to increase at day 2 and slightly decreased at day 6 . all co treated samples showed significantly higher h - drsc between 2 and 6 days compared to that of control sample ( p < 0.05 ) . the l - drsc of postharvest peach firstly decreased , then increased , and decreased again during the whole storage period ( figure 5(d ) ) . after 2 days , the l - drsc of control sample was lower than that of co treated samples . at day 6 , 10 mol / l co treated sample showed the highest dpph radical scavenging activity , which was about 1.6 times of control samples . compared with h - drsc of postharvest peach , the l - drsc was markedly lower , yet it could be significantly improved after the peaches were fumigated with co. peach , a respiratory climacteric fruit , is easy to soften and rot under ambient temperature after harvest . therefore , firmness and decay incidence were important indexes of postharvest peaches . the results showed that the firmness of postharvest peaches rapidly decreased under ambient temperature , from 14.18 kg / cm at day 0 to 2.74 kg / cm at day 3 . so the peach used in our experiment belonged to the typical cultivar of melting - flesh type . after exogenous co fumigation , the firmness decrease and decay incidence increase of postharvest peaches were restrained during storage time . furthermore , in low concentration ( 0.510 mol / l ) , the firmness of co treated fruit decreased slowly and decay incidence increased slowly as well with co concentration enhancement . mol / l , the firmness of postharvest quickly decreased and accordingly the decay incidence fast increased . as shown in table 1 , there were significant negative correlations between firmness variation and decay incidence of postharvest peaches during storage time . the reason was probably that gradual fruit senescence led to the decomposition of intercellular pectin of flesh and cell separations with storage time extension . thus , peaches softening occurred and the integrity of fruit cell wall structure was destroyed . afterward , fruit physiological metabolism was disordered and the resistance to exogenous pathogen was gradually lost . as a result , postharvest peach eventually appeared to have some physiological changes owing to respiratory metabolism and ethylene production during senescence process . these changes included flesh softening , starch degradation , flavor variation , and organic acid content decrease . soluble solids and titratable acid content represented the quality of postharvest peaches , and their ratio was also an important index to reflect the maturity and senescence of postharvest fruit . the soluble solids content of cultivar peach yanhong firstly increased and then decreased during storage period . the amylase of postharvest peaches catalyzed the starch into soluble sugar and soluble solids content increased accordingly . after storage for some time , the starch became less and the sugar production gradually lessened . meanwhile , the physiological metabolism of postharvest peaches continued to consume sugar . as a result , the soluble solids content decreased with storage time extension . 0.510 mol / l exogenous co might inhibit the decrease of titratable acid content , postpone the variation of soluble solids and vitamin c content , and effectively maintain the qualities of postharvest peaches . peach has good flavor and abundant nutrients , preventing many diseases of mankind induced owing to the accumulation of reactive oxygen compounds in organism [ 30 , 31 ] . flavonoid and polyphenol , as main antioxidant substance originating from plant , are important functional phytochemicals of peach fruit . the experimental result showed that co treating could postpone the flavonoid and polyphenol variation of postharvest peach and maintain them in higher level . the correlation coefficients of pal activity relating with total flavonoid , total polyphenol , and total flavonoid + total polyphenol , were 0.48 , 0.72 , and 0.64 , respectively . it catalyzes the deamination of l - phenylalanine to yield ammonia and transcinnamic acid , from which phenolic compounds including flavonoid , phenolic acid , and anthocyanin , are produced . therefore , co probably increased the flavonoid and polyphenol content through heightening pal activity , maintaining the physiological function of postharvest peach . these have hydrogen with activity that causes the hydrogen exchange reaction with free radical and structure of resonance stabilized . research suggested that the antioxidant activity of postharvest peaches closely related with flavonoid and polyphenol content . as shown in table 1 , the flavonoid content of postharvest peaches significantly correlated h - drsc ( r = 0.89 ) and moderately correlated t - drsc ( r = 0.70 ) . polyphenol content closely correlated h - drsc , l - drsc , and t - drsc , and these correlation coefficients were 0.72 , 0.73 , and 0.81 , respectively . in addition , the content of total flavonoid + total polyphenol also significantly positively correlated with h - drsc and t - drsc ( r = 0.87 and r = 0.81 ) . obviously , co treating could increase the flavonoid and polyphenol content of postharvest peach , and accordingly the antioxidant activities of flesh were enhanced in terms of dpph radical scavenging capacity . the experimental result also exhibited that the content of total flavonoid and polyphenol slightly correlated with reducing power including h - rp and l - rp ( |r | < 0.5 ) . this probably related with the specific category and property of flavonoid and polyphenol contained in particular peach . table 1 suggested that the decay incidence of postharvest peaches had few correlation with total flavonoid content , total polyphenol content , and drsc , but it had significantly negative correlation with vitamin c content ( r = 0.73 ) and positive correlation with h - rp ( r = 0.85 ) . though vitamin c contributed little to antioxidant activities in terms of dpph radical scavenging ability and reducing power , it was related with the enhancement to resist decay incidence . therefore , exogenous co might restrain the decay incidence through maintaining vitamin c content . correlation analysis suggested that firmness was moderately negative correlation with total flavonoid , total polyphenol , and total flavonoid + total polyphenol content , and their correlation coefficients were 0.53 , 0.67 , and 0.64 , respectively ; it was high negative correlation with h - drsc , l - drsc , and t - drsc , and the correlation coefficients were 0.53 , 0.67 , and 0.64 , respectively . therefore , co might maintain the firmness and postpone the shelf life through inducing pal activity of flesh . this result is similar to zhang and li who treated jujube with exogenous co . with research depth , people found that plant could generate co. heme oxygenase oxidation , lipid peroxidation , and ureide metabolism were probably the potential sources of plant co . similar to no and h2s , co takes part in various abiotic stresses and physiological processes such as stomatal movement and lateral root . in plant postharvest physiology , co was used to protect the green of vegetable and inhibit the browning of lotus root slices . our results exhibited that exogenous co might postpone the softening and decay incidence of postharvest peaches , maintain the nutrients and quality , and prolong the shelf life through increasing functional nutrients such as flavonoid , polyphenol , and vitamin c. without doubt , the exact mechanism should be further investigated in future . in general , oxidative regulation is a dynamic balancing process between systems that produce and scavenge ros ; the initial tissue response to stress leads to ros production ( step i ) , and this in turn , triggers antioxidant protection systems to ameliorate ros ( step ii ) but in case the tissue can no longer cope with stress then subcellular or cellular damage occurs ( step iii ) . protection systems mainly include phenolics , ascorbate , glutathione , peroxidase , ascorbate peroxidase , glutathione peroxidase and reductase , and catalase . in particular , there are many mechanisms by which phenolics can act either as antioxidants ( as agents for free radical scavenging , hydrogen donation , singlet oxygen quenching , and metal ion chelation ) or as substrates for attack by superoxide . thus , we presumed that co probably indirectly adjusted the oxidative stress of tissue producing during fruit ripening and senescence process through regulating the flesh polyphenol content , thereby delaying fruit ripening and senescence . the antioxidant defense system induced by co comprise of ascorbate peroxidase , glutathione reductase , superoxide dismutase , monodehydroascorbate reductase , ascorbic acid reductase , and so on , regulating reactive oxygen species and restraining oxidative stress through the transcription and expression of these enzymes . in our previous study , a similar result about the effect of co fumigation on the active oxygen metabolism of jujube was acquired ( unpublished ) . therefore , co also probably maintained peach quality through regulating active oxygen [ 41 , 42 ] . as a signal molecule , co of plant similar to no might play a physiological role through cgmp pathway . xuan et al . found that the growth elongation of wheat root induced by co associated with cgmp signal pathway . many evidences suggest that co controls the response process to abiotic stresses via molecular interaction with other signal moleculars , such as no . currently , the research about co in plant postharvest physiology was limited . since no as a useful gas to preserve fruit had been widely recognized , whether it participates in co regulating plant senescence process and whether co plays a role on plant ripening and senescence via the cgmp pathway need to be further investigated in the future . treating postharvest peaches with co demonstrated dual effect . in low concentration co ( 0.510 mol / l ) , exogenous co could delay the decrease of firmness and titrable acid content , restrain the increase of decay incidence , and postpone the variation of soluble solids content , and the positive effect was more obvious with co concentration enhancement . however , treating peaches with high concentration of co ( 20 mol / l ) demonstrated adverse effect . further researches exhibited that exogenous co might induce the pal activity , maintain nutrient contents such as vitamin c , flavonoid , and polyphenol , and enhance antioxidant activity according to reducing power and dpph scavenging ability . this result suggested that treating peaches with appropriate concentration of co was beneficial to quality , nutrients , and antioxidant activity of postharvest peaches during storage period .

peaches ( prunus persica cv . yanhong ) were fumigated with carbon monoxide ( co ) at 0 , 0.5 , 5 , 10 , and 20 mol / l for 2 hours . the result showed that low concentration co ( 0.510 mol / l ) might delay the decrease of firmness and titrable acid content , restrain the increase of decay incidence , and postpone the variation of soluble solids content , but treating peaches with high concentration co ( 20 mol / l ) demonstrated adverse effects . further research exhibited that exogenous co could induce the phenylalnine ammonialyase activity , maintain nutrient contents such as vitamin c , total flavonoid , and polyphenol , and enhance antioxidant activity according to reducing power and 2,2-diphenyl-1-(2,4,6-trinitrophenyl ) hydrazyl radical scavenging activity . treating peaches with appropriate concentration co was beneficial to the quality , nutrients , and antioxidant activity of postharvest peaches during storage time . therefore , co fumigation might probably become a novel method to preserve postharvest peach and other fruits in the future .

nitrogen vacancy centers ( nvcs ) in diamond have great promise for applications in quantum computing , fluorescence labeling , and electric and magnetic field sensing . several exciting advances have been recently reported including nuclear magnetic resonance spectroscopy on nanometer length scales and fluorescence imaging with 20 nm spatial resolution . when nvcs are embedded in diamond nanocrystals ( nds ) , they can be dispersed on biological samples and their fluorescence tracked continuously over many hours . to transform fluorescent nds into targeted biological probes , methods are needed to functionalize their surfaces with solubilizing ligands and biological tags that afford labeling specificity . most strategies to functionalize nds have been developed using detonation nanodiamond ( dnd ) that is prepared in a however , dnds generally do not support nvcs , and recent efforts to prepare soluble diamond probes have focused on nds that are fabricated in a top - down fashion from bulk chemical vapor deposited ( cvd ) diamond or high - pressure , high - temperature diamond ( hpht ) where less is known about surface structure ( figure 1 ) . dnd surfaces are known to be terminated by many types of functional groups including carboxylic acid moieties , which are abundant and can be used to form amide bonds or to graft layers of silicon dioxide after reduction . however , dnd surface structure is distinct from oxidized bulk single crystal diamonds , where alcohol and ether functionalities are typically found . thus , it remains an interesting and important question whether surfaces of oxidized hpht nds and other nanocrystals produced by top - down fabrication methods will have surface chemistry akin to bulk crystals or dnd . bulk hpht diamond is type ib and contains approximately 100200 ppm of nitrogen that produces its yellow color . ball milling and size fractionation yield a black powder composed of nanometer scale crystallites ranging in size from 5 to 50 nm . graphitic and amorphous carbons can be removed from unoxidized hpht nds by aerobic oxidation , causing the powders to become progressively lighter in tone as the oxidation temperature increases to 575 c . commercially available samples of dnd and hpht nds are complex mixtures of diamond and graphitic carbons . high temperature oxidation of this mixture is typically performed prior to surface functionalization or photophysical investigations to selectively remove the graphitic carbons . the oxidation step produces a number of desirable properties : ( 1 ) reduction of background fluorescence , ( 2 ) termination of the nd surface with carbon oxygen functionalities useful for derivatization , ( 3 ) increased solubility in aqueous environments afforded by readily ionized surface functionalities , and ( 4 ) in the case of hpht nds stabilization of the nv charge state . using a suite of spectroscopic techniques and transmission electron microscopy , we investigate the structure of hpht nds after aerobic oxidation and demonstrate that their surface structure is similar to chemical vapor deposited ( cvd ) single crystal diamond and distinct from dnd . hence , functionalization strategies that target alcohols would improve soluble magnetic resonance probes fabricated using top - down strategies . hpht nds used in this study were aerobically oxidized at temperatures between 475 and 575 c to remove graphitic carbons . at these temperatures the oxidation proceeds quickly ( 224 h ) and selectively , preserving a high fraction of the starting diamond . diamonds were analyzed before and after oxidation using transmission electron microscopy ( tem ) at accelerating voltages from 80 to 200 kev . irregularly shaped crystallites are observed with a broad distribution of dimensions in the range of 550 nm ( figure 2 and figure s4 ) . a minor amount of amorphous carbon was visible that is eliminated by aerobic oxidation of the samples prior to imaging ( 2 h at 575 c ) . crystallite sizes used in this study were measured with tem and found to center around 13 and 15 nm before and after aerobic oxidation ( figure s4 ) . figure 2a c shows several crystallites where an abundance of derived terraces , edges , and facets are visible . using an environmental tem , we monitored oxidative etching of the diamond in real time by introducing oxygen into the sample chamber ( figure 2d and supporting information ) . etching of the diamond occurred in a layer by layer fashion that revealed a facet , a pattern observed previously in studies of bulk diamond . thus , we conclude that hpht nds are terminated by a significant fraction of facets produced by crystallite cleavage during ball - milling and aerobic oxidation . ( a ) tem image ( 200 kev ) of an oxidized hpht nd with ( 111 ) and ( 111 ) facets at 70 , very near the theoretical angle of 70.5. ( b ) a higher magnification image of a crystallite edge with ( 111 ) termination . white lines highlight the ( 111 ) and ( 111 ) planes that are indexed to = 70.5. a lattice spacing of 0.210 nm is consistent with that predicted for 111 interplanar spacing . ( c ) aberration - corrected image taken with 80 kev accelerating voltage give enhanced atomic resolution . inset shows electron diffraction with ( 200 ) and ( 111 ) reflections consistent with a zone axis along . lattice fringes of 0.182 and 0.217 nm are near that expected for the ( 200 ) and ( 111 ) lattice spacing . ( d ) one frame from a movie of in situ oxidation where etching occurs along the and facet directions ( see supporting information for full movie ) . removal of graphitic carbon impurities after oxidation at temperatures from 475 to 575 c is conveniently monitored using uv - raman and visible - raman spectroscopies ( excit = 325 and 633 nm ) ( figure 3 ) . after 2 h of oxidation at 575 c , the broad vibrational bands from graphitic carbons decrease in intensity , leaving a single sharp signal that is characteristic of cubic phase diamond ( = 1332 cm , fwhm = 5.1 cm ) . this spectrum is nearly indistinguishable from that of bulk cvd diamond , except for a slightly broader line width ( 5.1 cm vs 2.8 cm ) , implying that hpht nds have long - range crystallographic order . in comparison , the uv - raman spectrum of dnds oxidized for 5 h at 475 c is broad and red - shifted ( = 1327 cm , fwhm = 19.2 cm ) and displays a tail on the low - energy side of the diamond vibration . these effects have been previously ascribed to lattice strain , defects , and phonon confinement ( figure 3 ) . in addition , signals derived from graphitic carbons remain after oxidation ( 15001800 cm ) . ( a ) visible - raman spectrum ( excitation = 633 nm ) of hpht nds aerobically oxidized at 575 c for 2 h. ( b ) uv - raman spectra ( excitation = 325 nm ) of hpht nds aerobically oxidized at 575 c for 2 h , ( c ) unoxidized hpht nds , and ( d ) dnds after 2 h of aerobic oxidation at 475 c . raman spectroscopy at visible wavelengths is not typically used to analyze nds because absorption , fluorescence , and resonance enhancement of disordered graphitic carbons obscure the signal from diamond . as a result , raman spectra of dnds have only been obtained in the uv where there is stronger resonance enhancement of the diamond signal . however , oxidized hpht nds produced in this study showed a sharp signal from diamond at visible wavelengths ( excit = 633 nm ) . several vibrational modes from graphitic carbons are also visible including signals at 1280 , 1370 , 1400 , 1620 , and 1660 cm . these features are distinct in line width and energy from the broader band of graphitic carbons prior to oxidation as well as those found in dnd samples ( figure 3 ) . we attribute these signals to olefinic species formed at nd surfaces during the ball - milling and/or aerobic oxidation processes . undercoordinated atoms on diamond surfaces are known to reorganize producing chains of sp - hybridzed carbons known as a pandey reconstruction . a theoretical study predicts the vibrational modes of the c(111)-(2 1 ) and c(110)-(2 1 ) reconstructions to appear in the range of 11001500 cm , consistent with the signals in our raman data . however , these reconstructions typically occur above 900 c on bulk diamond facets and requires an effect such as the surface tension of the nanocrystallite to lower the barrier if these signals are to be explained by a c(111)-(2 1 ) reconstruction . raman bands at 1620 and 1660 cm are near the frequency of the e2 g mode of olefinic carbons that result from in - plane motion of pairs of sp atoms . in diamond - like carbons this band shifts from the frequency of crystalline graphite ( 1581 cm ) toward the frequency of isolated sp dimers ( 1630 cm ) as the graphitic domains shrink and the sp content increases . the frequency of this band in our oxidized samples suggests that the graphitic carbons do not cluster to form extended domains . similarly , the lack of a d band ( 1370 cm ) arising from the a1 g breathing mode argues against the presence of complete six - membered rings . a previous study of dnd concluded that raman bands at 1620 and 1660 cm can arise from o h stretching modes of surface alcohols or acids , but deuterium exchange reactions ( oh od ) on our samples did not affect the raman spectrum , arguing against this assignment . despite the relatively large intensity of these bands in the visible - raman spectrum , x - ray absorption and photoelectron spectroscopy indicate that graphitic carbons are found in low abundance compared to other oxygen containing functional groups ( see below ) . to investigate both the graphitic and oxygen containing functionalities in greater detail , we turned to k - edge nexafs spectroscopy ( figure 4a , b ) . carbon and oxygen k - edge nexafs probe the unoccupied density of states with p - orbital character . at these energies and in total electron yield mode , the technique has a 510 nm probe depth and can be used to measure the types and ratios of functional groups . for example , carbon k - edge spectra of unoxidized and oxidized hpht nds show several pre - edge features including *(c = c ) ( 285.0 ev ) and *(c = o ) ( 286.7 and 288.3 ev ) resonances ( figure 4a ) . the energies of the *(c = o ) resonances ( 286.7 and 288.3 ev ) are consistent with those expected for carboxylic acids or acid anhydrides rather than other carbonyls . a signal of low intensity ( 530.0 ev ) in the oxygen k - edge spectra is distinct from the *(c o ) and *(c = o ) shape resonances and at an energy expected for carbonyl species ( *(c = o ) ) including ketones , acids , and acid anhydrides ( figure 4b ) . while in principle the ( c o):(c = o ) functional group ratio can be measured by integrating the peak areas in this spectrum , it is complicated by overlap of *(c o ) and *(c = o ) shape resonances in the 536540 ev range . however , the much weaker intensity of the *(c = o ) signal compared to the *(c o ) and *(c = o ) resonances supports a surface primarily terminated by singly bonded c o bonded functional groups such as alcohols and ethers and minor amounts of carbonyls and graphitic carbons . carbon ( a ) and oxygen ( b ) k - edge nexafs spectra of hpht nds oxidized at 575 and 475 c ( red ) compared with unoxidized hpht nanocrystals and aerobically oxidized dnd . the sharp signal from a core hole exciton is visible at 289.0 ev in samples of hpht and absent in samples of dnd . signals from *(c = c ) and *(c = o ) ( 285.0 , 286.7 , and 288.3 ev ) decrease as the oxidation temperature is increased . oxygen k - edge spectra show a decrease in the *(c = o ) resonances at 530 and 534.3 ev as the oxidation temperature increases . ( c ) wavelength - dependent xps spectra of a partially oxidized sample ( 500 c , 2 h ) showing the expected change in the ratio of signals from bulk ( c c ) and surface ( c = c , c o , c = o ) species as the excitation energy increases ( 410 950 ev ) and the electron mean free path of the photoelectrons increases . the spectra are dominated by signals from bulk diamond ( c c ) and alcohol and ether functional groups ( c o ) . a minor signal from ( c = o ) is visible , while signals from ( c = c ) were not detected . two signatures of crystalline diamond are also clearly visible in the carbon k - edge spectra including the sharp signal of a core hole exciton ( 289.0 ev ) as well the second bandgap in the diamond band structure ( 302.1 ev ) ( figure 4a ) . the excitonic feature , in particular , is characteristic of high quality diamond and a fingerprint of its periodic electronic structure . while this signal has been observed in nanocrystalline diamond films ( 2100 nm grain size ) , this is the first observation in colloidal diamond nanocrystals . this signature is absent from previous nexafs studies of dnd nanocrystals as well as our own measurements ( figure 4a ) because of its more defected lattice . this observation together with the raman features clearly demonstrates the higher crystallinity of hpht nd compared to dnd . nexafs can be used to monitor the amount of graphitic carbon present before and after aerobic oxidation . by integrating the *(c = c ) ( 284.0286.0 ev ) and *(c c ) resonances ( 293.0302.0 ev ) and comparing it with the analogous ratio from a reference spectrum of highly oriented pyrolytic graphite ( hopg ) , the ratio of graphitic and sp - hybridized carbons can be estimated ( see supporting information ) . for example , as the oxidation temperature is increased ( 475 575 c ) and progressively greater amounts of graphitic carbons are removed , the *(c = c ) resonance decreases compared to the *(c the spectra shows that hpht nds are composed of 87% sp - hybridized carbon that increases to 95% after 2 h of aerobic oxidation at 575 c . however , this estimate is a lower limit because the nexafs measurement is surface - sensitive ; the probe depth is estimated at 510 nm and may not include all bulk diamond signal . this high diamond content is on par with other highly purified nanodiamond samples . to obtain a quantitative measure of the relative abundances of the c o , c = o , and c = c functional groups , we turned to x - ray photoelectron spectroscopy . by tuning the excitation wavelength for example , using 410 ev synchrotron radiation , photoelectrons derived from the carbon 1s orbitals escape with 125 ev of kinetic energy and have a mean free path of 0.5 nm , enough to escape from the first few lattice planes ( 23 lattice planes along the direction ) . photoelectrons generated with 910 ev photons , on the other hand , have increased mean free paths ( 1.0 nm ) such that changes in signal intensity as a function of photon energy can be used to distinguish signals from the surface functional groups and the signal from the bulk diamond lattice . typical spectra after oxidation at 500 c contain signals from graphitic carbons ( 282.5 ev ) , c o ( 286.0 ev ) , and c = o ( 289.0 ev ) functional groups as well as bulk diamond ( 284.5285.0 ev ) ( figure 4c ) . the signal from graphitic carbon and c o and c = o functional groups smoothly increase in intensity as the photoexcitation energy is lowered , as is expected from a surface species ( figure 4c ) . the signal from graphitic carbons is not detectable in samples oxidized at 575 c , and instead the spectrum is dominated by bulk diamond and oxygenated functional groups ( figure 4d ) . spectral deconvolution indicates that carboxyl carbons make up a small fraction of surface functionalities ( 2% ) , while the majority of the signal derives from functional groups with single c while the precise amounts of each signal will be influenced by the sample roughness , the lack of signal from graphitic carbons and carboxyls unambiguously demonstrates that they are not the dominant surface functionality on hpht nds after 2 h of oxidation at 575 c . after 2 h of aerobic oxidation at 575 c singly bonded oxygen containing functional groups are the dominant surface species ; however , differentiating between carboxylic acids and anhydrides or ethers and alcohols was not possible using the binding energies alone . diffuse reflectance infrared fourier transform spectroscopy ( drifts ) , on the other hand , provides a complementary method to assign the types of functional groups and adsorbates present . drifts spectra clearly showed a number of signals that derive from o h and c o vibrations , including ( 1 ) the stretching vibrations of adsorbed water and hydroxyls ( o h = 30003700 cm ) , ( 2 ) the bending mode of water ( o h = 1630 cm ) , ( 3 ) a dominant signal from c o single bonds in the fingerprint region ( c o = 10501150 cm ) , and ( 4 ) a weak signal from a carbonyl ( c o = 1790 cm ) ( figure 5 ) . the o h stretching band is similar in intensity to previously studied diamond powders and is primarily due to adsorbed water . water was desorbed in situ by heating the sample in an infrared cell under a flowing n2 atmosphere ( figure 5 , inset ) leaving remaining o h signal that we assign to surface hydroxyls ( o h 36503700 cm ) . beyond 400 c surface functional groups begin to desorb as co and co2 in line with previous reports ( see supporting information ) . in addition to the intense signals from surface bound hydroxyls , a weak carbonyl vibration at 1790 cm falls within the range expected for acid anhydrides ( 17501800 cm ) , although strained ketones such as cyclobutanone can also appear at this frequency . the strong bands in the o h and fingerprint regions clearly indicate that the dominant surface functionality is a hydroxyl group a conclusion that is consistent with the xps and nexafs analysis . however , we can not rule out the presence of ethers , which may also contribute to the band in the fingerprint region as has been proposed by others . drifts spectra of hpht nds oxidized at 575 c ( top ) , 475 c ( middle ) , and prior to oxidation ( bottom ) . inset shows spectra acquired at different temperatures under flowing nitrogen , where desorption of water from the nanodiamond surface is responsible for the decrease in intensity of the stretching v(o h ) = 30003700 cm and bending (o h ) = 1630 cm modes . remaining signal near v(o h ) = 30003400 cm is consistent with remaining surface bound hydroxyl functionalities and adsorbed water . previous studies of dnd attribute vibrational bands in the carbonyl region to carboxylic acids and conclude they are the dominant surface functionality . however , in our case , the relatively weak signal in this region is likely due to carboxylic anhydrides . in addition to the carbonyl vibration at 1790 cm , other stretching modes consistent with acid anhydrides are observed at 940 , 1290 , and 1370 cm , the intensity of which correlates with the signal at 1790 cm . for example , if hpht nds are oxidized with persulfuric acid prior to aerobic oxidation at 575 c , both sets of signals are nearly eliminated , leaving only vibrational signatures from alcohols ( figure s8 ) . using the relative extinction of the c o vibrational transition from tertiary alcohols and the symmetric stretch of carboxylic anhydrides , we estimate that the ( c o):(c = o ) ratio is 30:1 after 2 h of aerobic oxidation at 575 c and 90:1 after persulfuric acid treatment and aerobic oxidation . these estimates are consistent with the low carbonyl content measured by xps above ( figure 4 ) . the low abundance of acid anhydrides maybe due to the high oxidation temperature used in our study , which is known to cause decarboxylation from diamond surfaces in the range of 400700 c . indeed , the signals from carbonyls decrease in the carbon and oxygen nexafs , xps , and drifts spectra when the temperature of oxidation is increased from 475 to 575 c ( figures 4 and 5 and figure s6 ) . however , carboxyls are minor functional groups on unoxidized hpht nds as well as those oxidized at lower temperatures , while dnd maintains a higher carboxylate coverage under similar oxidation conditions . the distinct surface termination of dnd and hpht nds may stem from different underlying crystallinity or crystallite size . while the raman and nexafs spectra of hpht nds display a sharp diamond vibration and a core hole exciton , the same spectra of dnd are broad and red - shifted and lack the signal from a core hole exciton . these observations may explain why dnds generally do not support nvcs , while oxidized hpht nds , including those prepared in this study , support nvcs in the nv state that can be manipulated with optical electron spin resonance methods ( see supporting information ) . hpht nds used in this study are also larger ( 1316 nm ) than typical dnds ( 5 nm ) and have larger area facets and fewer edge and vertex atoms that may influence the functional group types . together the nexafs , xps , and drifts measurements support a consistent picture ; aerobically oxidized hpht nds are primarily terminated with hydroxyls , rather than carboxylic anhydrides which are present in < 5% abundance ; olefinic functionalities are the smallest component despite the intensity of their vibrational bands in the visible - raman spectrum . the abundance of alcohols is consistent with studies of ( 111)-terminated single crystals oxidized in the presence of h2o where hydroxyl termination has been observed experimentally and predicted by computational models . the surfaces of hpht nds are similar to bulk diamond surfaces , and efforts to functionalize hpht nds and other diamond nanostructures fabricated from bulk material using top - down approaches must address the hydroxyl termination to append a high coverage of surface ligands . among possible methods silanization of nd surfaces the highly crystalline structure of hpht nds is apparent from the energy and line width of the raman spectrum , high resolution tem images , and the signature of a core moreover , we show that their surfaces are terminated with oxygenated functional groups analogous to those found on single crystal , , and facets . both observations indicate that after 2 h of aerobic oxidation at 575 c the surface structure of hpht nds is very similar to bulk single crystals where hydroxyl and possibly ethers are the dominant functional groups . graphitic carbons are present in very low quantities compared to the oxygenated functional groups ( < 2% ) , leaving a sample whose raman spectrum could be measured using visible wavelength excitation . each of these observations support a structure that is distinct from dnd and indicate that new functionalization strategies are needed that target the singly bonded c o h functional groups . advances along these lines will aid in the transformation of hpht nds and cvd derived nanostructures into versatile biological labeling agents and particularly those that utilize nvcs for magnetic and electric field sensing . hpht nd powders ( monocrystalline diamond powder msy 00.05 m , microdiamant ag ) and detonation nanodiamond powders ( cluster diamond xp 0.251 m , microdiamant ag ) , bulk hpht diamond crystals ( van moppes , frd - a 40/50 and sk-90 20/25 ) , and deuterium oxide ( cambridge isotope laboratories ( 99.9% cas 7889 - 20 - 0 ) ) were used as received . single crystal type iia cvd diamond terminated at a ( 100 ) facet ( element six , frankfurt , germany ) was submerged in persulfuric acid solution ( 3:1 sulfuric acid and hydrogen peroxide ) for 10 min , rinsed with 18 m water , dried under stream of nitrogen , and stored in a closed container in air prior to analysis . silicon wafers with a native sio2 oxide layer ( p - type ; 1 cm , sqi , san jose , ca ) were washed with persulfuric acid solution prior to use . nanodiamond powder was placed in a ceramic boat , loaded into a tube furnace , left open to the air , and heated to the desired temperature ( 475575 c ) for 2 h. after cooling to room temperature , oxidized hpht nds could be dispersed in water , methanol , or ethanol ( 0.11.0 mg / ml ) with sonication for 5 min at 10% power using a tip sonicator ( branson sonifier 450 ) . in some cases , nanodiamond powders were first oxidized in persulfuric acid ( 100 mg of hpht nds per 60 ml of 3:1 , h2so4:h2o2 ) by heating the suspension to 80 c for 12 h in a round - bottom flask equipped with a reflux condensror . vigorous bubbling was observed for 30 min and then gradually subsided . nd solids were separated via centrifugation and rinsed with 18 m water three times prior to aerobic oxidation as described above . colloidal dispersions of nanodiamonds in water or methanol were drop - cast onto ultrathin holey carbon grids ( ted pella # 08124 ) . standard hrtem was performed on a jeol jem2100f at the center for functional nanomaterials at brookhaven national laboratory . the accelerating voltage was 200 kev , and the sample was at 0 tilt during imaging . in situ oxidation of hpht nds was performed on an environmental hrtem microscope ( fei titan 80 - 300 ) at an accelerating voltage of 80 kev with aberration correction . oxygen was introduced into the imaging chamber at a pressure of 1 10 torr and then sealed . images were collected at a rate of 4 frames / s with continuous manual focusing . samples were prepared by placing 3 mg of hpht nd powder between two glass slides and lightly pressing the slides together to flatten the sample for normal spectral aquisition . visible - raman scattering spectroscopy was performed on a renishaw invia microscope with a diode laser at 633 nm and a 1800/mm grating and a spectral range of 9002100 cm . uv - raman at 325 nm and visible - raman scattering at 633 nm were performed on a horiba jobin yvon labram aramis microscope with uv and visible objectives of 20. spectra were collected by averaging 2040 spectra from 5 s exposures at 120 w / cm with using a 20 olympus objective . sample location and focus were manually controlled , and raman scattering calibration was performed on an internal si wafer . nd powders ( 50 mg ) were placed into a 25 ml three - neck flask and dried under vacuum ( 5 mtorr ) at room temperature . 10 ml of d2o was then injected into the three - neck flask under ar , and the mixture was sonicated for 3 min , stirred for an additional 10 min , and then dried under vacuum . this procedure was repeated three times , and the dry powder was brought into an inert atmosphere glovebox where it was immediately sealed under nitrogen in a linkham thms600 stage . the stage was continuously purged with n2 during the acquisition of raman spectra . samples were prepared on gold - coated si wafers with a native oxide layer ( # 720204 ; p - type ; 1 cm ) by drop - casting an aqueous dispersion of nanodiamonds ( 1 mg / ml ) and then drying the sample at 80 c under flowing argon . samples were covered by a glass dish and stored in clean teflon containers prior to spectroscopic investigations . nexafs and xps measurements were performed at beamline 10 - 1 at the stanford synchrotron radiation lightsource , slac national accelerator laboratory , and at beamline u7a at the national synchrotron light source using spot sizes of < 1 mm and 1.5 mm , respectively . at 10 - 1 , carbon k - edge xas was measured in total electron yield ( tey ) mode using 30 50 um slits . all experiments were conducted under ultrahigh - vacuum conditions ( 5 10 torr ) . after focusing the optics , the reference absorption intensity of the incoming x - ray beam was measured using a sample of gold coated mesh and used to correct for beam instability . carbon k - edge nexafs spectra were collected at u7a in partial electron yield ( pey ) mode using a grid bias of 200 v. oxygen k - edge was also performed in partial electron yield mode with a grid bias of 300 v. nexafs data were collected at an incident electric field vector of 54.7. spectra were treated with a linear pre - edge background subtraction from a region before the absorption edge of carbon and oxygen at 260280 and 510530 ev , respectively . a post - edge normalization was also performed in the continuum region at 340 ev for carbon and 580 ev for oxygen . xps spectra were measured at beamline 10 - 1 with a hemispherical electron spectrometer ( ses - r3000 , vg - scienta ) using a total energy resolution better than 100 mev . incident x - rays were selected at 410 , 520 , 650 , and 950 ev with a spherical grating monochromator . energy calibration was performed using the signal from the gold substrate ( au 4f5/2 = 85.0 ev ) after argon ion sputtering under ultrahigh - vacuum conditions ( 5 10 torr ) within a commercial 5700 phi electronics x - ray photoelectron spectrometer using identical samples . samples were prepared on substrates freshly cleaned in persulfuric acid solution and deposited from 18 m water to minimize contamination from adventitious hydrocarbons . details of escape depth estimations and peak fitting are described in the supporting information . nanodiamond powder ( 10 mg ) and anhydrous kbr ( 500 mg ) were ground in a mortar and pestle and loaded in the reflectance cup and leveled with a spatula . drifts was performed on a thermo - nicolet 7800 ftir equipped with a liquid nitrogen cooled mct detector , a kbr beamsplitter , and a praying mantis diffuse reflectance apparatus that can be heated under vacuum or flowing gas . variable temperature spectra ( 25700 c ) were acquired after allowing the temperature to equilibrate for 20 min . spectra of a kbr blank were acquired at each temperature and used to correct the data . a linear background correction was applied , and the data transformed to be linear with respect to concentration of the analyte according to kubelka and munk ( see supporting information for more detail ) . temperature - programmed desorption ( tpd ) studies were performed on a tg 209 f1 iris from netzsch with an ar carrier gas from 25 to 1000 c at ambient pressure . tpd was carried out at a ramp rate of 10 c / min and tracked by a thermocouple attached to the aluminum carrier . 10 mg of highly purified hpht nd powder ( 575 c for 2 h ) was loaded into an alumina sample carrier and introduced into the tga - ms . mass spectroscopy of the ionized products was tracked at mass charge values of 1 ( h ) , 2 ( h2 ) , 12 ( c ) , 18 ( h2o ) , 28 ( co ) , 32 ( o2 ) , and 44 ( co2 ) . these measurements were carried out at the analytical and diagnostics laboratory at suny binghamton .

we investigate the aerobic oxidation of high - pressure , high - temperature nanodiamonds ( 550 nm dimensions ) using a combination of carbon and oxygen k - edge x - ray absorption , wavelength - dependent x - ray photoelectron , and vibrational spectroscopies . oxidation at 575 c for 2 h eliminates graphitic carbon contamination ( > 98% ) and produces nanocrystals with hydroxyl functionalized surfaces as well as a minor component ( < 5% ) of carboxylic anhydrides . the low graphitic carbon content and the high crystallinity of hpht are evident from raman spectra acquired using visible wavelength excitation ( excit = 633 nm ) as well as carbon k - edge x - ray absorption spectra where the signature of a core hole exciton is observed . both spectroscopic features are similar to those of chemical vapor deposited ( cvd ) diamond but differ significantly from the spectra of detonation nanodiamond . the importance of these findings to the functionalization of nanodiamond surfaces for biological labeling applications is discussed .

the classic immunogenic vaccines represent one of the most successful and cost - effective interventions in the history of medicine . the field of vaccination is now rapidly expanding to encompass a new class of vaccines ( i.e. , the tolerogenic vaccines ) that induce immunological tolerance to alleviate the inflammatory autoimmune diseases as well as other inflammatory diseases of metabolism , neurodegeneration , allergic hypersensitivity , and transplantation rejection . first , immunogenic vaccines have had unparalleled clinical success , including the elimination of smallpox and the near - eradication of polio and are credited with saving untold millions of lives . conversely , tolerogenic vaccines are largely experimental and are currently pursued in pre - clinical settings or in early - phase clinical trials and are studied based on their future potential rather than their clinical actuality . second , classic immunogenic vaccination is based on the activation , expansion , and differentiation of memory t cell clones specific for particular infectious antigens that then provide rapid immunity to any re - exposure of that infectious pathogen . likewise , tolerogenic vaccines are contingent upon the generation of long - lasting memory , but this memory is due to the activation , expansion , and differentiation of antigen - specific regulatory t cells that mediate antigen - specific inhibitory activity by mechanisms of active , dominant tolerance . passive tolerance marked by immunological anergy and the functional and/ or physical elimination of pathogenic t cell clones and the consequent creation of a hole in the repertoire marked by the passive lack of t cell reactivity to a given self antigen . third , immunogenic vaccines usually require strong immunological adjuvants to prime the initial immunization via stimulatory interactions with innate immune receptor systems that recognize pattern - associated molecular patterns or pamps that are shared among large classes of infectious pathogens . activation of receptor systems such as the toll - like receptors ( tlr ) or nod - like receptors ( nlr ) on mononuclear phagocytes triggers immunogenic presentation of the associated antigens on mhc class ii molecules together with strong co - stimulation to elicit activation and differentiation of nave t cells as the founding event in the adaptive immune response . in contrast , tolerogenic vaccines are designed to have minimal adjuvant activity so that the vaccine antigens are recognized in non - activated , non - inflammatory environments that favor self - tolerance . fourth , immunogenic vaccines in current practice are largely based on the generation of humoral immunity with an emphasis on disease prevention rather than therapy of pre - established disease . in contrast , tolerogenic vaccines must counter ongoing pathogenic t cell - mediated memory , and the emphasis is on therapy of established chronic disease rather than prevention of future disease . the use of experimental autoimmune encephalomyelitis ( eae ) as the prototypic model of ms has fundamentally shaped the core expectations and predictions of ms , including the presumption that ms is an inflammatory autoimmune disease mediated by pathogenic cd4 t - helper cells specific for myelin proteins of the central nervous system ( cns ) such as myelin basic protein ( mbp ) , proteolipid protein ( plp ) , and myelin oligodendrocyte glycoprotein ( mog ) . myelin - specific cd4 t cells may also recruit additional effector subsets with shared anti - myelin protein reactivity such as b cells and cd8 t cells to partake in the autoimmune destruction of the cns target tissue . the purpose here is not to debate the merits of the eae model but rather to discuss the essential considerations inherent to this model for developing tolerogenic vaccines for ms . these vaccine strategies for ms require consideration on three levels , including ; ( a ) the identity and diversity of target cns antigens , particularly the peptide epitopes of major myelin protein antigens , ( b ) the inherent efficiency by which these clones recognize their target self antigens , and ( c ) the qualitative activity of the vaccine in the midst of a pro - inflammatory local environment . this model predicts that chronic or recurring infectious agents are the etiological instigators of ms . the prediction is that such etiological agents have overlapping and partially shared antigenic epitopes with major myelin proteins . in the context of chronic or recurrent infection , these infectious pathogens are postulated to stimulate strong t cell - mediated immunity against the foreign mimicry after clonal expansion and differentiation into memory/ effector subsets , through mechanisms of immune surveillance , these crossreactive t cell clones are postulated to find and react to the endogenous crossreactive myelin epitopes in the cns to mediate ms ( fig . 1 ) . these infectious agents , upon repeated re - emergence from latency , may drive relapses of ms and the chronic relapsing - remitting disease course of ms . endogenous myelin autoantigens and other crossreactive self antigens shape development of the t cell repertoire so that conventional t cells recognize self with an efficiency that is below the threshold necessary to drive differentiation of memory/ effector subsets . together , the two mechanisms ( low efficacy recognition of self by conventional t cells and active , dominant inhibitory action of regulatory t cells ) prevent differentiation of myelin - specific t cells into memory or effector subsets and thereby prevent autoimmune disease . the mechanism of molecular mimicry is represented in red . a crossreactive foreign antigen from a recurrent or chronic infectious pathogen drives crossreactive clones with sufficiently high efficacy to override homeostatic regulatory mechanisms . these high efficiency foreign mimic antigens drive the differentiation of myelin - crossreactive t cells into memory/ effector subsets . the potential consequence is the initiation of a potentially self - sustaining autoimmune response against myelin and induction of ms . a potential beneficial effect is that these crossreactive clones may eliminate or suppress the etiological infection and thereby clear the antigenic stimulus of the autoimmune disease . tolerogenic vaccines are postulated to reinforce myelin - specific regulatory t cell subsets and cause anergy/ apoptosis of myelin - reactive nave and memory/ effector t cell subsets , even in the midst of an inflammatory environment . the molecular mimicry model gives rise to a range of possibilities in regard to the nature of the autoantigens that drive the disease process . the key crossreactivities may be chance occurrences , and only one or two crossreactive epitopes may be responsible for initiation of the ms disease process . conversely , the molecular mimicry may be driven by directed evolutionary pressures by which the infectious agent has adapted to a specialized infectious niche . for example , the infectious agent may be evolutionarily adapted to persist in an organ such as the cns by bearing camouflage comprised of many epitopes that resemble and are crossreactive with the local host tissue . epitope spreading refers to a mechanism by which the instigating myelin - reactive clones drive cns inflammation and recruit new , distinct clonotypes of nave myelin - reactive clones into the cns , where the latter clones differentiate into memory/ effector t cells upon recognition of a distinct set of cns antigens to cause additional neurologic damage . thus , over time , the anti - myelin t cell repertoire may broaden and diversify , and may acquire sufficient clonotypic diversity to sustain a chronic or progressive autoimmune course independent of any recurring infectious disease trigger . these considerations underlie key unanswered questions that will shape the future of tolerogenic vaccine research in ms . can effective tolerogenic vaccination be accomplished by targeting a limited number of myelin epitopes or will such vaccines need to cover a wide diversity of antigenic targets ? a parallel question is the degree of patient - to - patient variability of the antigenic specificities that drive ms . the potential answers to these questions cover a wide range of possibilities , including the possibility of a common ms vaccine bearing a limited number of dominant myelin epitopes that will be effective for most ms patients . on the opposite side of the spectrum , ms vaccines may need to be individualized vaccines that cover numerous and highly diverse myelin epitopes based on unique sets of reactivities for each patient . this range of possibilities addresses important issues of feasibility and experimental approach in the design and testing of experimental vaccines . whether pauci - clonal or broadly polyclonal t cells mediate ms if ms is mediated by t cells of restricted clonotypic diversity and little patient - to - patient variability in myelin specificities , then standard tolerogenic vaccine strategies may suffice for many ms patients . however , if ms is mediated by an ever - broadening repertoire of autoreactive t cells with substantial inter - patient variation , then new vaccine strategies will be needed to match therapy with a dynamically changing landscape of t cell autoreactivities . if the latter scenario is the case , early diagnosis and intervention will be key considerations for effective tolerogenic vaccination . new technologies will be needed to identify clonally - expanded , smoking - gun myelin - reactive clones . because one will not want to introduce vaccines that are off - target and not relevant to a given patient , vaccines will need to have a modular design so that epitopes can be readily added or subtracted from a vaccine cocktail to tailor the therapy to the reactivities of particular patients . alternatively , new vaccine strategies could be developed to include full - length myelin proteins , including hydrophobic transmembrane domains . most tolerogenic vaccine strategies have focused on defined encephalitogenic epitopes that are hydrophilic for practical reasons of solubility . vaccines that include full length myelin proteins would need to be produced by technologies that do not result in protein aggregation , because aggregated proteins would likely cause the adverse side - effect and the strongly contraindicated production of anti - myelin autoantibodies . the assumption of a common dominant ms antigen can serve as the basis to test experimental strategies designed to maximize the efficacy of tolerogenic vaccines . the assumption of myriads of vaccine targets with substantial inter - patient variation would be a compelling rationale to test novel modular vaccine designs or approaches based on full - length myelin proteins . the second consideration is the efficiency by which the myelin - reactive t cells recognize the relevant crossreactive foreign and self antigens ( fig . 1 ) . mimicry epitopes of the infectious agent with qualitatively superior efficiency compared with self myelin epitopes . the differential reactivity is simply a consequence of self tolerance induction during development of the immune system , which precludes clones with strong reactivity to self . the strength of foreign antigen recognition is considered sufficient to drive activation and the differentiation of nave t cells into memory or effector t cells . in contrast , the less efficient myelin epitopes are postulated to lack the capacity to drive differentiation of nave t cells . the relevant myelin - reactive clones , even after achieving effector status , would continue to recognize endogenous myelin epitopes with low efficiency . once the foreign mimicry antigen caused effector cell formation , the low efficiency recognition of myelin by effector/ memory t cells is postulated to be sufficient to elicit tissue damage but may be insufficient to sustain the immune response . the myelin - specific regulatory t cell networks that were overridden by the strong foreign stimulus are thought to be intact and capable of restoring homeostasis once the foreign mimicry has been cleared from the tissue ( fig . 1 ) . the important concept is that the repertoires of the myelin - reactive regulatory t cells and the myelin - reactive conventional t cells most likely share a common myelin reactivity ( representing the normal mechanism of homeostasis ) , but the regulatory t cells most likely do not recognize the foreign mimicry antigens due to the absence of these foreign antigens during development . if regulatory t cells per chance did crossreact with the mimicry antigens , then the immune system would not respond to these foreign mimicry epitopes , and the individual would not suffer from an autoimmune disease . because tolerogenic vaccines contain native myelin epitopes , tolerogenic vaccination would predictably reinforce regulatory t cell function and the low efficiency interactions that promote tolerance rather than immunity , even after differentiation of the conventional myelin - reactive t cells into memory and effector subsets . as a case in point , one of the most profoundly tolerogenic vaccines studied by our laboratory is comprised of the cytokine gm - csf fused to the major encephalitogenic epitopes from mbp , mog , or plp in rat and mouse models of eae . the gmcsf - neuroantigen ( nag ) vaccine requires covalent linkage of the cytokine and nag domains for tolerogenic efficacy . conversely , a substantial number of studies have shown that gm - csf fusions with foreign antigens act as immunogenic vaccines and can be used to augment immune responses against foreign antigens . taken together , these studies suggest that the antigenic domain aside from the gm - csf domain may bias the inherent activity of the vaccine . thus , the self or nonself origins of the antigenic domain may play an important role in controlling the balance between tolerance and immunity . an important functionality of the gm - csf domain may simply involve targeting of the vaccine to dendritic cells to promote more efficient presentation of the antigenic domain . the self nag domains of gmcsf - nag fusion proteins , by engaging developmentally established regulatory networks , would be predicted to promote tolerance . conversely , the foreign - antigen domains of gmcsf - antigen fusion proteins would predominantly engage a repertoire of conventional t cells rather than regulatory t cells and thereby would drive immunogenic responses . these predictions are consistent with the experimental observations that gm - csf may amplify the intrinsic tolerogenic or immunogenic activity of the antigenic domain . the inherent tolerogenic activity of self antigens , even in the midst of an ongoing autoimmune disease , may appear paradoxical but is a key element in the feasibility and potential success of tolerogenic vaccines . one of the primary concerns regarding tolerogenic vaccines is the possibility that administration of a tolerogenic vaccine to particular patients may be immunogenic rather tolerogenic and worsen the ms disease course , as may have occurred in clinical trials of altered peptide ligands or apl . underlying this concern is the concept that tolerogenic vaccines have tolerogenic activity because these vaccines are administered without adjuvants and thus are presented to the immune system in a quiescent , non - activated environment . the idea is that antigen presentation in the absence of costimulatory molecules and without a complement of proinflammatory cytokines is critical for inhibitory vaccine activity . however , the environment of the vaccine recipient will be difficult to control in a clinical setting because at least some patients will have inapparent infections or exposure to other pro - inflammatory stimuli either locally or systemically . if a tolerogenic vaccine is administered into such a pro - inflammatory environment , the vaccine would perhaps adversely worsen the disease course . the extent to which this issue applies to a tolerogenic vaccine platform represents a critical consideration regarding the projected success of that vaccine platform . the notion is widely - held that a vaccine is either tolerogenic or immunogenic based on whether the vaccine is administered into a quiescent or pro - inflammatory environment . however , this idea can be challenged on theoretical and experimental grounds and may differentially apply to distinct tolerogenic vaccine platforms . autoreactive t cells circulate in normal individuals but do not cause autoimmunity in the vast majority of persons even though the host is continually subjected to infectious disease , injury , and various inflammatory insults . indeed , regulatory networks comprised of foxp3cd4cd25 may be strengthened by antigen recognition in the presence of b7-mediated costimulation and various cytokines , particularly il-2 . thus , one can not conclude that the inhibitory activity of a tolerogenic vaccine would be preempted within a pro - inflammatory environment . as a case in point , a gmcsf - nag tolerogenic vaccine was administered at the same time and at sites immediately adjacent to the encephalitogenic peptide/ complete freund s adjuvant ( cfa ) immunization . in this paradigm , gmcsf - nag retained inhibitory activity and prevented eae in a majority of immunized mice . thus , the gmcsf - nag vaccine retained inhibitory activity even in the midst of a cfa - polarized inflammatory environment . thus , a critical test of a tolerogenic vaccine platform is the deliberate introduction of the vaccine in a proinflammatory environment , either administered after disease onset or together with adjuvants or other pro - inflammatory stimuli during encephalitogenic immunization . in this regard , gmcsf - nag effectively inhibited disease when delivered into the same lymphatic drainage at the same time as the encephalitogenic/ cfa immunization . the gmcsf - nag vaccine also inhibited eae when given at disease onset , or alternatively , when given during established chronic eae . a primary prediction of the eae model of ms is that the study of the myelin - specific t cell repertoire of ms patients should reveal the key specificities that underlie ms . however , many studies have shown that ms patients had similar frequencies of myelin reactive t cells compared with healthy age- and gender - matched controls . the myelin - specific repertoire in ms nonetheless appears to show some evidence of clonal expansion and a more pronounced expression of an activation / memory phenotype . the cause or consequence question however has yet to be answered , and no clear consensus has emerged regarding the diversity and inter - patient variability of the antigenic determinants that drive the ms disease process . the questions of which peptides cause pathogenesis in ms are particularly vexing . a clinical trial of an altered peptide ligand of mbp8399 was designed to inhibit ms but instead appeared to aggravate disease . other cns proteins aside from the myelin antigens might be critical antigenic targets in ms , just as aquaporin-4 appears to be a major antigenic target in neuromyelitis optica , and the inward - rectifying kir4.1 potassium channel appears to be a major target of the humoral immune response in many adult ms patients . humoral responses to mog are apparent in patients with acute disseminated encephalomyelitis and pediatric ms . human t cell antigen receptor chains specific for myelin peptides have been expressed in mice as transgenes together with the human mhc class ii restriction alleles , and these transgenic mice show spontaneous eae . these and other approaches provide compelling evidence that particular antigen specificities are associated with ms and related neurologic diseases . however , the true encephalitogenic drivers of ms remain unknown . as a key question for the future of the field , consideration must be given to those experimental approaches that might best reveal causal links between a given antigenic specificity and ms pathogenesis . a central goal of the field is to devise and test tolerogenic vaccines as interventions in ms . a major step forward would be a successful clinical trial of an efficacious tolerogenic vaccine . such an accomplishment would verify the tolerogenic efficacy of the vaccine approach , and the identity of the vaccine nag domain would definitively link that nag specificity as a foundation of ms pathogenesis . thus , clinical trials of tolerogenic vaccines may be a key experimental venue to not only treat ms but to reveal the underlying pathogenesis of ms . thus , over the course of the next decade , the hope is that tolerogenic vaccines will begin to reveal the nature of the beast that is ms .

tolerogenic vaccines represent a new class of vaccine designed to re - establish immunological tolerance , restore immune homeostasis , and thereby reverse autoimmune disease . tolerogenic vaccines induce long - term , antigen - specific , inhibitory memory that blocks pathogenic t cell responses via loss of effector t cells and gain of regulatory t cell function . substantial advances have been realized in the generation of tolerogenic vaccines that inhibit experimental autoimmune encephalomyelitis in a preclinical setting , and these vaccines may be a prequel of the tolerogenic vaccines that may have therapeutic benefit in multiple sclerosis . the purpose here is to provide a snapshot of the current concepts and future prospects of tolerogenic vaccination for multiple sclerosis , along with the central challenges to clinical application .

the application of genomics to biology and medicine requires an understanding how specific gene variants contribute to phenotypes , in combination with a comprehensive knowledge of the parts list of a cellular system and how these components are assembled into functional units ( 1 ) . mitochondria are ubiquitous and defined substructures of nucleated cells and lend themselves to systems biology approaches . however , in generic databases the annotation of mitochondrial proteins is often incomplete and does not always distinguish between proteins which have a confirmed mitochondrial subcellular localization and those which are only candidates according to preliminary experimental results or in silico predictions . for the human species , about half of the estimated 1500 proteins localized or functionally associated with mitochondria are known ( 2 ) . since the mitochondrial organelle is an evolutionarily conserved entity , systematic studies in model organisms are powerful to identify mitochondrial proteins in other organisms ( 3 ) . the mitop2 database was created to consolidate and structure public information on mitochondrial proteins , their functions and associated human diseases ( 4,5 ) . mitop2 provides a wide variety of search functions to explore and download information and to access references in pubmed and other public databases . we have further expanded the manually annotated reference sets of mitochondrial proteins in yeast ( 522 proteins ) and human ( 624 proteins ) , and have now added the section mitop2-mouse ( 615 proteins ) . for these three species , we integrated data from genome - wide approaches applied to the study of mitochondria , and assigned an evidence score of a candidate protein being mitochondrial ( 3 ) . with the help of mitop2 , proteins involved in mitochondrial biogenesis and function have been identified and characterized ( 6,7 ) . in addition , mitop2 has enabled the identification of disease genes using positional candidate approaches ( 810 ) . a wealth of information has been collected over the past several years from single gene and genome - wide studies of saccharomyces cerevisiae ( 11 ) . the list of yeast orfs and protein annotations in mitop2-yeast are based on information in the saccharomyces genome database ( sgd ; ) ( 12 ) . this mitop2-yeast update now provides annotated information for 522 mitochondrial reference proteins , which are based on experimental validation of each of these proteins . recently , systematic cellular sublocalization studies estimated a total of 800 mitochondrial proteins presenting 12% of the currently known yeast genes ( 13,14 ) . therefore , 250300 mitochondrial proteins are still missing . in order to identify these missing genes , we have validated and integrated genome - wide approaches applied to the study of mitochondria ( 3 ) . mitop2-yeast datasets in table 1 show 20 systematic approaches used for this purpose : phenotypes of single gene deletion mutant phenotypes ( 15,16 ) ; systematic subcellular localization studies ( 13,14 ) ; transcriptome datasets of differentially expressed genes including fermentable and non - fermentable growth conditions , the response to diauxic shift , and hap4 transcription factor screening ( 3,17,18 ) ; proteome analyses of purified mitochondrial organelles ( 3,19,20 ) ; protein abundance measurements ( 21 ) ; and data from protein in addition to experimental datasets , mitochondrial proteins can be predicted in silico based on the presence of mitochondrial targeting sequences ( 2326 ) , and by sequence similarity to a known mitochondrial protein from other species ( defined as bidirectional best blast hit or best blast hit with a score < 1 10 ) ( 27 ) . data from each of these systematic studies can be searched and downloaded . using the mitop2-yeast reference proteins , it is possible to analyze the specificity and sensitivity of the data from genome - wide studies ( figure 1 ) . specificity is defined as the proportion of proteins of a dataset which are part of the reference set , while sensitivity is the proportion of reference set proteins which is covered by the dataset . in order to identify putative mitochondrial proteins , we calculated a mitop2 score for each protein , reflecting the specificity of combined approaches which identified the particular protein ( 3 ) . to further improve these predictions , we used a new approach utilizing a support vector machine ( svm , ) . the svms are learning machines based on statistical learning theory used for solving classification tasks . we trained the svm using the mitop2-yeast reference set ( 522 proteins ) and a set of 519 proteins with a known localization to other cellular compartments collected from sgd ( ) . for each of the 1041 proteins , we defined a 20-dimensional vector using the datasets of 20 systematic studies ( see table 1 ) . this resulted in a 20-dimensional input matrix , which was used to train the svm ( see also supplementary figure s1 ) . after training , the svm predicts mitochondrial proteins with a specificity of 78% and a sensitivity of 80% ( svm score > 1 ) . this analysis shows that a combination of datasets from genome - wide studies significantly increases the power of predicting mitochondrial proteins beyond the level achieved by any single study ( figure 1 ) . we manually annotated mitochondrial reference proteins for human ( 624 ) and mouse ( 615 ) that now cover about half of the estimated mitochondrial proteins in these two species . these reference proteins present a subset of all the protein entries in the database : mitop2-human contains 36 504 proteins and mitop2-mouse contains 32 422 proteins . these datasets have been downloaded from the swiss - prot database ( ) ( 28 ) . to identify putative orthologue proteins between human and mouse we calculated a bidirectional best blast hit or a best blast hit with score < 1 10 between the two datasets . for each mitop2 protein , we extracted descriptions , chromosomal positions , subcellular localization and literature references from swiss - prot . in addition , functional annotations such as biological processes and functional categories were extracted from the gene ontology database ( go ; ) . for mitop2-mouse , we annotated functional descriptions according to the mips functional catalogue ( 29 ) , and provided access to dna and protein sequence information . phenotypic information on available mouse models are provided by the mouse genome informatics database ( mgi ; ) ( 30 ) . to date , more than 50 mouse models carrying mutations or deletions of mitochondrial genes have been investigated . for researchers interested in studying these models , mitop2 provides links to the international gene trap consortium ( igtc ; ) to access the related mouse cell lines . mitop2-mouse and mitop2-human provide similar search options that allow single or combined searches for individual database components ( figure 2 ) . database searches and downloads can be performed using keywords , genes names and the selection of datasets from systematic studies . for mitop2-human , two proteome studies on mitochondrial organelles purified from heart tissue are available , which have been integrated under the proteome category ( 31,32 ) . for mitop2-mouse , we integrated the datasets from three high - throughput studies that include two proteome experiments ( 33,34 ) and a subcellular localization study using split - enhanced green fluorescent protein ( egfp ) ( 35 ) . for mouse proteins identified using these approaches , we identified the respective putative orthologue proteins in human , and vice versa . the number of proteins in human and mouse datasets differ in part due to missing proteins in either one of the species in swiss - prot . the mitop2 category transcriptome predicts gene relationships based on similarities of their expression profiles ( 34 ) . in addition to sequence similarity searches between human , yeast and mouse , mitop2 provides in silico predictions for mitochondrial proteins utilizing established algorithms such as mitoprot ii ( 23 ) , psort ii ( 25 ) , predotar ( 26 ) and mitopred ( 24 ) . these programs allow the prediction of subcellular localizations of proteins based on their amino acid sequences . to illustrate the different search functions , users can select psort ii under mitop2-mouse to extract 4321 proteins that include 323 entries from the mitochondrial reference set ( 7% ) . alternatively , one can perform combined searches , for example , by selecting psort ii and a human proteome dataset hprot_01 ( 31,32 ) , which then generates a list of 176 proteins that includes 56% of the mitochondrial reference set . this comparison demonstrates the trade - off between sensitivity and specificity : the combination of datasets reduces the total number of proteins ( sensitivity ) , while it increases the specificity for mitochondrial proteins . each entry in mitop2-human and mitop2-mouse corresponds to a swiss - prot identifier with protein descriptions , annotated subcellular localization and sequence map positions according to ucsc genome browser ( ) . in addition , the single protein entry summarizes the information from in silico predictions , high - throughput experiments , the availability of mouse gene trap clones and the predictive mitop2 score . an example for a single protein entry in mitop2-mouse , the adenine nucleotide ( adp / atp ) translocator 2 , is shown in figure 3 . this figure shows in a matrix lane , the information available for this protein extracted from swiss - prot and the integrated genome - wide approaches , a list of functional annotations compiled from the mips catalogue that are linked to the mouse functional genome database ( ) , pubmed links to the references , and a list of similar sequences from other species . the other parts of this entry , which are not shown in this figure , include a phenotype description of the associated mouse mutant , the gene ontology annotations for molecular protein functions and biological processes , literature references on protein functions and variants that are listed by author names and title and a table of swiss - prot references . for genes implicated in a hereditary disease , mitop2 provides a link to the corresponding entry in the online mendelian inheritance in man database ( omim ; ) ( 36 ) . to date , more than 120 of the 624 human mitochondrial proteins are known to be involved in a hereditary disease . mitochondrial disorders have a diversity of debilitating phenotypes and include a wide variety of neurodegenerative processes , cardiovascular disorders , diabetes mellitus and several cancer types . many of these disease genes function in the metabolism of amino acids , nucleic acid , fatty acids and lipids , and energy production . the mitop2 database enables the systematic identification of candidate genes to study mitochondrial diseases ( 5 ) . ( 8) , for example , mapped a locus for hereditary mtdna depletions associated with mitochondrial encephalomyopathy to a 21 mb interval on chromosome 13 . the mapping coordinates ( i.e. 13:40878920 and 13:61359487 ) were used as a selection criteria to prioritize mitop2 candidate genes among the 113 genes predicted in this region . in combination with a mitop2 score one of these genes ( sucla2 ) , a mitochondrial reference protein identified in two proteome experiments , was found to be mutated in affected members of the linkage family . this study demonstrates that human disease genes can be identified using information provided by mitop2 . each point represents a dataset whose position is determined by benchmarking against the 522 reference proteins from mitop2-yeast . the different groups of approaches are highlighted using distinct colours : the bioinformatics datasets ( purple ) are psort ( 25 ) , mitoprot > 90 ( 23 ) , bayesian prediction ( 37 ) , predotar ( 26 ) and yeast proteins with human mitochondrial orthologs ( mitop2 database ) ; the experimental datasets ( blue ) are as follows : hap4 expression ( 18 ) , respiration induced expression ( 3 ) , mitochondria localized ribosomes ( 38 ) , deletion phenotype screen ( 16 ) , tag localization ( 14 ) , gfp localization ( 13 ) , pet phenotypes ( 15 ) , four mass spectrometry proteome studies ( 3,19,20,39 ) and high and medium confidence protein protein interactions ( ppi ) ( 22 ) defined by interactions with known mitochondrial proteins ( mitop2 database ) . the predictive score for a mitochondrial protein ( mitop2 score ; green ) was based on the combination of the systematic datasets , calculated for different thresholds . the mitop2 query page is structured according to various groups of search parameters provided by the database . the search options are either linked to the online references or an explanation for this selection is provided . example for protein entry in mitop2-mouse . as illustrated for the mitochondrial adp / atp carrier protein 2 ( adt2 ) . mitop2 provides for each protein entry the swiss - prot name and description , the chromosomal localization , results from mitochondrial prediction programs , data from proteome studies , available gene trap clones , functional annotations according to mips , pubmed reference links and homologous proteins in other species . comparison of specificity and sensitivity for various approaches integrated in mitop2 in determining the mitochondrial localization of proteins datasets used for svm training . recently integrated datasets . defined as bidirectional best blast hit or best blast hit < 1 10 .

the mitop2 database ( ) integrates information on mitochondrial proteins , their molecular functions and associated diseases . the central database features are manually annotated reference proteins localized or functionally associated with mitochondria supplied for yeast , human and mouse . mitop2 enables ( i ) the identification of putative orthologous proteins between these species to study evolutionarily conserved functions and pathways ; ( ii ) the integration of data from systematic genome - wide studies such as proteomics and deletion phenotype screening ; ( iii ) the prediction of novel mitochondrial proteins using data integration and the assignment of evidence scores ; and ( iv ) systematic searches that aim to find the genes that underlie common and rare mitochondrial diseases . the data and analysis files are referenced to data sources in pubmed and other online databases and can be easily downloaded . mitop2 users can explore the relationship between mitochondrial dysfunctions and disease and utilize this information to conduct systems biology approaches on mitochondria .

angiogenesis is a hallmark for tumorigenesis , and vascular endothelial growth factor ( vegf ) is a crucial mediator for this process . vegf binds to its receptors , vegf receptor 1 ( vegfr1 ) and vegf receptor 2 ( vegfr2 ) to trigger cell proliferation , migration and metastasis [ 2 , 3 ] . agents blocking the vegf axis have been successfully used as anti - cancer therapies . among various approaches to targeting angiogenesis , inhibiting vegf ligand and receptor interactions to prevent vegf from binding to its receptors , aflibercept ( vegf trap ; regeneron pharmaceutical and sanofi - aventis pharmaceuticals ) was developed for sequestering circulating vegf . aflibercept is a soluble protein that fuses the second immunoglobulin ( ig ) domain of the vegfr1 and the third ig domain of the vegfr2 to the fc domain of human ig g1 . antitumor activities of aflibercept have been demonstrated in preclinical studies and in recent clinical trials [ 614 ] . in clinical studies , aflibercept has been administered via an intravenous ( iv ) or subcutaneous ( sc ) route . tew et al reported a phase i study using an aflibercept sc formulation of 25 mg / ml in patients with refractory solid tumors . in that study , the maximum tolerated dose ( mtd ) of aflibercept was not reached due to the volume of the drug to be administered via the sc route . to achieve the sc administration of a higher dose of aflibercept , a new formulation of 100 mg / ml was generated and tested along with the iv formulation in a separate phase i study . it was determined that the sc dose should be 4 mg / kg every 2 weeks because of the similar bioavailability of aflibercept via the sc and iv routes . lockhart et al reported on the toxicity data , pharmacokinetic profile and efficacy results of the iv formulation of aflibercept , and a dose of 4 mg / kg administered every 2 weeks was recommended for further phase ii or iii trials . here , we report our experience with the toxicity , pharmacokinetic profile and efficacy of the new 100 mg / ml sc formulation of aflibercept administered sc at 4 mg / kg every 2 weeks . the study was a phase i clinical trial evaluating aflibercept iv and sc formulations in patients with refractory solid tumors at vanderbilt university medical center and memorial sloan - kettering cancer center . the same eligibility criteria were used for the iv and sc cohorts , and were reported previously . lyophilized aflibercept ( 200 mg ) in a 20-ml glass vial was reconstituted under sterile conditions by addition of 2.3 ml water for sc injection to ultimately produce a concentration of 100 mg / ml . aflibercept 4.0 mg / kg was administered sc every 2 weeks using a 0.3 or 1.0 ml syringe with a fixed 29-gauge needle . dose reduction to 3.0 mg / kg and/or 2.0 mg / kg was allowed for protocol specified toxicity . the body sites for injections were rotated between the anterior abdominal wall , the deltoid region and the anterior thigh . to ensure uniformity of drug absorption , all patients received the first injection to the anterior abdominal wall . plasma concentrations of free aflibercept and aflibercept : vegf complexes ( bound aflibercept ) were measured by direct enzyme - linked immunosorbent assay ( elisa ) methods , as previously published . the limits of quantitation of free aflibercept and bound aflibercept were 31 ng / ml and 44 ng / ml , respectively . immunogenicity testing was performed by measuring the presence of anti - aflibercept antibodies via elisa 2 months after the last dose of aflibercept . patients were observed on a regular basis for toxicities which were graded by the national cancer institute common terminology criteria for adverse events ( version 3.0 ) . tumor response was assessed by recist criteria every two cycles by magnetic resonance imaging ( mri ) or computed tomography ( ct ) . patients continued in the study until disease progression , unacceptable toxicity or consent withdrawal occurred . descriptive statistics including median , minimum , maximum and percentage were used in this study . a total of 13 patients were screened for the sc cohort ; 10 patients were enrolled and received 4 mg / kg of aflibercept every 2 weeks . of the 10 patients receiving 4 mg / kg every 2 weeks , 8 were female . median treatment duration was 30 days with the maximal duration being 184 days . two of the 10 patients received 1113 doses of aflibercept.table 1patient demographic and clinical characteristicscharacteristicn = 10no . ( % ) age , years median58 range3775gender female8 ( 80% ) male2 ( 20%)performance status ( ecog ) 05 ( 50% ) 14 ( 40% ) 21 ( 10%)tumor type ovary5 ( 50% ) liver3 ( 30% ) breast1 ( 10% ) headhead and neck1 ( 10%)prior chemotherapy median2.5 range112treatment duration ( days ) median30 min : max15 : 184number of doses administered 2 doses3 ( 30.0% ) 4 doses4 ( 40.0% ) 610 doses1 ( 10.0% ) 1113 doses2 ( 20.0% ) patient demographic and clinical characteristics the safety - evaluable population was defined as patients who received at least one dose of aflibercept . among 10 patients treated at 4 mg / kg every 2 weeks , 9 patients ( 90% ) experienced a treatment - emergent event that was possibly related to aflibercept . the common toxicities attributed to aflibercept at 4 mg / kg every 2 weeks were fatigue , dysphonia , hypertension , nausea , myalgia , and arthralgia ( table 2 ) . two patients experienced severe adverse events ( sae ) ( hypertension and abdominal pain ) possibly related to aflibercept . among the patients taking sc aflibercept , no deaths designated as possibly related to the drug were observed , and no patients were discontinued from the study due to treatment - related toxicity.table 2common adverse events and severe adverse events ( grade 3/4 ) possibly related to aflibercept sc 4 mg / kgadverse eventpatients ( n = 10)all gradegrade 3/4no . % general disorder and administration site7 ( 70%) fatigue7 ( 70%) early satiety1 ( 10%) edema peripheral1 ( 10%)musculoskeletal and connective tissue disorder7 ( 70%) arthralgia4 ( 40%) myalgia4 ( 40%) back pain2 ( 20%) joint stiffness1 ( 10%) muscle spasms1 ( 10%) muscular weakness1 ( 10%) musculoskeletal pain1 ( 10%) pain in extremity1 ( 10%)respiratory , thoracic and mediastinal disorders7 ( 70%) dysphonia7 ( 70%) nasal dryness2 ( 20%) dyspnea1 ( 10%) dyspnea on exertion1 ( 10%) nasal congestion1 ( 10%) cough1 ( 10%) pharyngolaryngeal pain1 ( 10%)gastrointestinal disorders5 ( 50%) nausea4 ( 40%) constipation2 ( 20%) abdominal pain1 ( 10%) diarrhea1 ( 10%) glossodynia1 ( 10%) oral pain1 ( 10%)*vascular disorder5 ( 50%)1 ( 10% ) hypertension5 ( 50%)1 ( 10%)metabolism and nutrition disorder4 ( 40%) anorexia2 ( 20%) decreased appetite2 ( 20%)skin and subcutaneous tissue disorder4 ( 40%) rash3 ( 30%) dry skin2 ( 20%) erythema1 ( 10%) nail disorder1 ( 10%) onychoclasis1 ( 10%)nervous system disorder3 ( 30%) headache3 ( 30%)*renal and urinary disorder1 ( 10%) proteinuria1 ( 10%)common adverse event is defined by that the frequency of the adverse event of all grades in that class is 15% or greater * typical side effects associated with the angiogenesis inhibitors common adverse events and severe adverse events ( grade 3/4 ) possibly related to aflibercept sc 4 mg / kg common adverse event is defined by that the frequency of the adverse event of all grades in that class is 15% or greater * typical side effects associated with the angiogenesis inhibitors we examined toxicities possibly related to inhibition of vegf . hypertension was seen in 5 out of 10 patients with one subject experiencing grade 3 hypertension . the same subject also developed grade 1 proteinuria , as confirmed by 24 h urine collection . pk data of sc aflibercept at 4 mg / kg every 2 weeks were collected from 7 patients who had received at least 2 doses of aflibercept and completed by day 22 . at the steady state , the mean plasma concentrations of the free aflibercept and bound aflibercept were 8.69 g / ml and 4.49 g / ml , respectively ( fig . 1 ) . the free / bound ratios at steady state was 1.74 , indicating an excess of free over bound aflibercept at sc dose levels of 4.0 mg / kg every 2 weeks . the first group demonstrated a pk profile with a cmax around 20 g / ml and t 1/2 ranging between 7 and 9 days , while the second group showed a cmax rround 35 g / ml . 1mean free and bound aflibercept sc ( n = 7 ) and iv ( n = 6 ) at 4 mg / kg concentration at steady state mean free and bound aflibercept sc ( n = 7 ) and iv ( n = 6 ) at 4 mg / kg concentration at steady state treatment efficacy was assessed in 5 patients who received at least one dose of aflibercept and had at least one post baseline assessment . among 5 evaluable patients , 2 demonstrated stable disease . a 69-year - old woman with papillary serous carcinoma of the ovary had stable disease for 203 days . she was previously treated with multiple lines of chemotherapy including carboplatin , paclitaxel , liposomal doxorubicin , gemcitabine , and topotecan . the second patient was a 58-year - old woman with granulosa cell tumor of the ovary , and she had stable disease for 50 days . the benefit of depleting of vegf by aflibercept has been demonstrated in preclinical studies and early phase clinical trials [ 614 ] . currently , multiple phase iii clinical trials using the aflibercept iv formulation in combination with other agents are ongoing . a dose of 4 mg / kg administered iv every 2 weeks has been recommended for future clinical trials . here , we report the toxicity , pk data and efficacy of the new sc formulation of aflibercept at 100 mg / ml from a phase i study . the sample size of 10 patients is adequate to assess toxicity of the new formulation , and the toxicities were found to be tolerable and reversible . hypertension of any grade was seen in 5 patients ( 50% ) in the sc group , compared with 5 ( 71.4% ) out of 7 patients receiving intravenous aflibercept at 4 mg / kg . moreover , grade 3 and 4 hypertension was seen in 1 ( 10% ) out of 10 patients receiving sc aflibercept , compared with 3 ( 42.9% ) out of 7 patients receiving iv aflibercept . grade 3 and 4 proteinuria possibly related to aflibercept were see in 1 out 10 sc patients and 1 out 7 iv patients , respectively . pk data of aflibercept suggest adequate depletion of free circulating vegf . at steady state , plasma concentrations of free aflibercept were higher than bound aflibercept indicating maximum ligand blockade and were generally similar to iv aflibercept administered at the same dose . furthermore , the mechanisms contributing to two distinct pk profiles of sc aflibercept need to be further explored . tumor control ( stable disease ) was seen in two out of five evaluable patients . for future development , the sc route of aflibercept delivery may provide advantages over iv formulations , including time and resource conservation . sc administration may allow self - administration by patients at home , sparing the need for intravenous access , for specialized nursing care and a reduction in visits to the physician s office . based on our study , further investigation of sc aflibercept in combination with chemotherapy

summarytargeting angiogenesis is a valid anti - cancer strategy . aflibercept is designed to sequester circulating vascular endothelial growth factor ( vegf ) by preventing vegf from binding to its receptors . this phase i study was to evaluate a new formulation of subcutaneously administered aflibercept in patients with advanced solid tumors . here we report our experience with the toxicity , pharmacokinetic profile and efficacy of the new 100 mg / ml subcutaneous ( sc ) formulation of aflibercept administered at a dose of at 4 mg / kg every 2 weeks .

monoclonal antibodies ( mabs ) undoubtedly belong to the most prominent therapeutics of the last two decades . since 1986 , more than 40 mabs have been approved by the food and drug administration ( fda ) for the use in various diseases , including cancer , immune disorders , and infectious diseases , and many more are in clinical trials , with fullsize igg still representing the majority of these approved mabs . however , based on the success of these drugs , several different antigenbinding formats such as antibody fragments or domains ( i.e. antibodybased scaffolds ) and nonantibody protein scaffolds have been investigated for their potential as binding molecules . the postulated advantage of such molecules is the reduced size that potentially leads to enhanced tissue penetration and facilitated production . for example , three fullsize antigenbinding fragments ( fab ) of igg have been approved by the fda for clinical use so far [ certolizumab pegol 1 , ranibizumab 2 , and abciximab 3 ] . at a considerable smaller size , singlechain variable fragments ( scfv ) comprise the variable domains of heavy and light chain connected by a polypeptide linker and therefore contain the complete binding sites of antibodies . it has been reported that scfvs can be readily expressed in various hosts like bacteria , yeasts , and plants 4 , 5 , 6 . an advancement of this technology was the construction of bispecific tcell engagers [ bites 7 ] , comprising two scfvs with specificities for cd3 and a target antigen expressed as one polypeptide chain . dualaffinity retargeting molecules ( darts ) follow a similar principle : as a further development of the diabody technology 8 , a cterminal disulfide bond covalently links two scfvs that are expressed as separate polypeptides to generate a more stable bispecific molecule 9 . reported the selection of molecules based on the isolated ch2 domain of igg1 binding to the hiv1 envelope glycoprotein 10 . another concept uses nanobodies , i.e. the singledomain antigenbinding fragments of camelid heavy chain antibodies , which , for example , have the potential for application in oral immunotherapy due to the increased resistance to extreme ph and proteolytic digest as compared to conventional antibodies 11 , 12 . darpins are small , singledomain proteins derived from natural repeat proteins that can be engineered to bind diverse antigens 13 . and finally , the immunoglobulinlike structure of the tenth type iii unit of human fibronectin ( fn3 ) has served as the basis for the engineering of one further novel binding scaffold 14 . the potential therapeutic value of these formats is , however , largely reduced due to the absence of the crystallizable fragment ( fc ) and the resulting inability to trigger effector functions such as antibodydependent cellular cytotoxicity ( adcc ) or complementdependent cytotoxicity ( cdc ) . accordingly , the in vivo halflife is limited due to the absence of the fclocated binding site of the neonatal fc receptor fcrn , and a lot of effort is necessary to overcome these drawbacks , which to some degree outweighs the advantage of the smaller size . in 2009 , rker and wozniakknopp 15 reported the engineering of the structural loops of immunoglobulin constant domains to generate novel binding sites ( modular antibody engineering ) . based on the observation that immunoglobulinlike domains are structurally conserved in the sandwich core regions while at the same time exhibiting high variability of the loops 16 , the three cterminal loops of the ch3 domain of igg1fc were engineered to bind diverse antigens in initial studies , yielding antigenbinding fc fragments termed fcabs. in this review , the therapeutic potential of such fcabs and efforts in functional engineering as well as the engineering of biophysical properties will be discussed . there will be no focus on the engineering of individual antibody domains like monomeric ch2 or ch3 domains as scaffolds for the design of novel binders , as this topic has been reviewed recently 17 . the structure and function of human iggfc has been described extensively . however , it is necessary to provide the background for discussion in the present review . immunoglobulins of isotype g are the predominant antibody class in circulation and comprise two identical light ( l ) and heavy ( h ) chains forming a yshaped structure 18 . an igg molecule can be dissected into two distinct fragments ( fab , fc ) that are responsible for the in vivo properties ( fig . 1 ) : an antigenbinding fragment ( fab ) is a heterodimeric protein composed of one light chain and the nterminal half of one heavy chain . it encompasses two variable ( v ) domains ( vh , vl ) whose complementaritydetermining regions ( cdrs ) form the antigenbinding site , and two constant ( c ) domains ( cl , ch1 ) ( fig . 1 ) . by contrast , the crystallizable fragment ( fc ) is a homodimeric glycoprotein with one monomer consisting of two constant immunoglobulin domains ( ch2 , ch3 ) from the cterminal half of one heavy chain ( fig . 1 ) . through interaction with its ligands [ fc receptors ( fcr ) , c1q and fcrn ] it mediates various immune effector functions and increases the halflife of the antibody molecule 19 . the fc and the two fab fragments meet at a central flexible segment , the hinge region , which plays an important role in the mediation between antigen recognition and effector functions and forms interchain disulfide bonds between the two heavy chains . 1 ) normally reveals structure for residues 238443 , underlining that the hinge region is highly flexible 21 , 22 , 23 , 24 . in addition , the conformation of the hinge proximal region of the ch2 domain is shown to be soft , i.e. to be relatively mobile in comparison to the more defined structure observed at the ch2ch3 interface . schematic representation of homodimeric human igg1fc ( pdbid 1oqo ) , generated using pymol , with the corresponding amino acid sequence . igg1 is composed of two heavy and two light chains , with the fab region carrying the antigenbinding sites and the fc part mediating various effector functions . the homodimeric fc part comprises the ch2 and ch3 domains , where strands are depicted in green , and helices and random coils are shown in gray . the cterminal loops of the ch3 domain are colored in red ( ab loop ) , orange ( cd loop ) , and purple ( ef loop ) . the asparagine at position 297 carries the glycan ( nanafbi ) , graphically represented according to anthony et al . the amino acid sequence of the ch2 and ch3 domain of wildtype igg1fc is shown and numbered according to eu numbering system 20 . on top of the sequence , the secondary structure elements of ch2 and ch3 according to the crystal structure ( pdbid 1oqo ) are shown . four distinct igg subclasses differing in their heavy chains ( and consequently in their fc ) , exist in humans ( higg14 ) , and in mice ( migg1 , 2a , 2b , 3 ) . this review will mainly focus on the structure function relationships of the fc of human igg1 as a basis for engineering strategies for the design of novel therapeutic proteins . in the following , iggfc and igg1fc will always mean the basic homodimeric scaffold including two monomers , each being composed of the nterminal hinge region followed by ch2 and ch3 domains ( i.e. thr225 to lys446 ; for amino acid numbering and assignment of secondary structures , see fig . 1 ) . a single nlinked glycan is attached to asparagine 297 ( ch2 domain ) of each heavy chain . the glycan has a complex biantennary structure ( fig . 1 ) and can vary by the addition of sugar residues to specific parts of the core structure . the latter is composed of nacetylglucosamine and mannose and can be modified by the addition of fucose , bisecting nacetylglucosamine , and two arms defined by 1,3 and 1,6 mannose linkages ( fig . 1 ) . there is a tremendous heterogeneity in the iggfc glycan , with over 30 distinct glycans detected on circulating igg in healthy individuals 25 . the two fc glycans are essential for the structural integrity of fc ( and igg ) by contributing mainly to the interface of the ch2 domains , where they face the center of the fc with the 1,3 arm protruding into the cavity between the heavy chains and the 1,6 arm extending along the heavy chain backbone 26 , 27 . crystal structures of iggfc reveal a distinct conformation for the oligosaccharide resulting from multiple noncovalent interactions with the protein 23 . this was confirmed by molecular dynamics ( md ) simulations demonstrating that the glycans form more hydrogen bonds with the individual protein chains at the cost of glycan glycan interactions 28 . the thermodynamic parameters ( obtained by differential scanning calorimetry ) describing the unfolding of igg1fc reflect these interactions , with the thermal unfolding of the ch2 domains showing a progressive reduction in stability with loss of sugar interactions while the unfolding of the ch3 domain is unaffected 29 . typically , igg1fc exhibits two thermal transitions ( best modeled using two sequential twostate transitions ) with the lower temperature transition ( tm1 approximately 71c ) reflecting unfolding of the ch2 domain and the second transition ( t m2 approximately 82c ) unfolding of the ch3 domain at ph 7.4 30 . the latter underlines the importance of the extensive hydrophobic ch3ch3 interface for the stabilization of igg1fc . during unfolding , the ch2 domains behave as a single cooperative unit , and unfolding is reversible as long as the protein sample is taken to approximately 75c at maximum , whereas unfolding of the ch3 domains is irreversible . typically , the thermal stability of the fc fragment decreases with decreasing ph as demonstrated experimentally 31 and by computational means 28 . based on the importance of glycosylation for the conformational and thermal stability of igg1fc , yeast surface display has been the method of choice to screen igg1fc libraries for variants with desired properties 32 . the advantage of yeast display over phage , bacterial , and ribosome display is the existence of a eukaryotic protein production machinery that is necessary for posttranslational modifications ( including glycosylation ) and quality control of expressed proteins in the endoplasmic reticulum ( er ) and the golgi complex of eukaryotes 33 . also , in contrast to phage and ribosome display , yeast display selections usually include one or more flow cytometric sorting steps , facilitating quantitative analysis during selection . the most obvious advantage of iggfc over other antibodyderived or nonantibody binding scaffolds is its quality of combining all essential antibody functions except for antigen recognition , including binding to fcrs . these may be expressed constitutively on hematopoietic cells ( e.g. macrophages , eosinophils , neutrophils , natural killer cells , lymphocytes ) and other tissues and may be induced or upregulated , differentially , on each cell type when exposed to cytokines or other activating agents 21 . stimulation of cells through fcrs may result in the activation or deactivation of one or more of a variety of effector functions , including adcc , cdc , phagocytosis , oxidative burst , release of inflammatory mediators , etc . 35 . due to the high sequence homology between the fcr types and between the subclasses of igg , spatial homology for interaction sites is found . in general , binding sites are located at the lower hinge and adjacent regions in the ch2 domain 36 , 37 ( fig . 2 ) . representation of secondary structural elements with transparent molecular surface of igg1fc and its binding ligands . dashed arrows mark the binding site of the neonatal fc receptor [ pdbid 1i1a 50 ] ; fc gamma receptor i [ pdbid 4w4o 119 ] ; the miniz domain of protein a ( pdbid 1oqo ) ; a globular head of the complement system protein c1q [ pdbid 1pk6 47 ] ; the cterminal pryspry domain of trim21 [ pdbid 2iwg 120 ] ; and the antich2 antibody ( clone mk 1 a6 , abd serotec ) . the epitope of c1q was obtained by docking studies combined with md simulations by schneider et al . 86 defined the binding site of the antich2 antibody to be located at the cterminal part of the ch2 domain . the proportions regarding size of all shown crystal structures are true to scale . a dynamic model of fc fcr recognition was proposed in which oligosaccharide / protein interactions within the fc protein generate an equilibrium population of conformers , with distinct structures that recognize and bind individual ligands 21 . besides contribution to the conformational and thermal stability , the two glycan chains of fc are an absolute requirement for binding of fc ( and igg ) to fcrs , as this interaction is lost after deglycosylation 27 . the fc glycan apparently maintains an open conformation of the fc heavy chains required for interaction with fcrs as supported by the structure of aglycosylated fc 38 . in the latter , the two heavy chains arrange in a closed conformation and therefore lack the fcrbinding pocket . however , it was demonstrated that mutations in the fc backbone can alter the overall structure of aglycosylated fc and restore binding to fcrs to some extent , suggesting that the fc glycan chains primarily affect protein protein interactions by altering the fc backbone conformation 39 . the interplay between the primary and secondary nacetylglucosamine residues with the protein structure seems to be particularly critical for fcr recognition 40 . the human fcri ( cd64 ) is expressed on monocytes and macrophages and a number of myeloid cell lines and binds to igg1 and igg3 with similar affinity at the lower hinge region around residues 234238 and residues in the hinge proximal region of the ch2 domain 41 , 42 . in humans , both are widely expressed on multiple cell types , constitutively and/or following induction or upregulation 43 and bind to igg1 and igg3 with similar affinity . while their external domains are highly homologous they transduce opposite signals ( activating versus inhibitory ) via their intracytoplasmatic domains . the binding site at the fc is similar to that of fcri 21 . finally , fcriii ( cd16 ) is a lowaffinity receptor either expressed as an intrinsic ( fcriiia ) or glycosphingolipidlinked protein ( fcriiib ) . binding of natural killer ( nk ) cellexpressed fcriiia to the lower hinge region activates adcc 37 . as mentioned above there is some variation in composition of iggfc glycans in vivo and this may directly contribute to modulation of interaction ( and affinity ) with individual fcrs classes , thereby mediating activating , inhibitory , or antiinflammatory processes . for example , increase in fucosylation and decrease in sialylation and galactosylation on the fc glycan were observed during inflammatory conditions 45 . there is an ongoing discussion whether these modifications are related to the expression of glycanmodifying enzymes like glycosyltransferases or whether other regulatory mechanisms are involved . further studies are necessary to dissect the regulation of antibodies in vivo and this knowledge will also lead to the design and production of more efficient ( glycoengineered ) therapeutics , i.e. fullsize mabs or fcabs , respectively . fig . 2 illustrates that c1q , the recognition subunit of c1 ( i.e. the complex triggering activation of the classical pathway of complement ) also binds at the ntermini of the ch2 domains . similar to fcrs , binding depends on the presence and mode of glycosylation at asn297 . it includes acidic and basic residues at ch2 but might also involve in vivo interaction with the cl domains of the fab arms 46 , 47 . there are six heads on c1q , connected by collagenlike stems to a central stalk , and the isolated heads bind to the fc rather weakly . recently , it has been shown that antigenbinding on cell surfaces can facilitate the formation of igghexamers and that these igghexamers engage the headgroups of c1q 48 . the igghexamers are formed by noncovalent fc fc interactions involving residues i253 , h433 , and n434 . moreover , the authors also defined mutations in the iggfc molecule that increased the formation of hexamers and thus resulted in improved activation of cdc . thus , this study not only defined the molecular mechanism that triggers the classical pathway of complement but it also enabled the construction of fcmutants that activate the complement system more potently . as mentioned above , one of the advantages of iggfcbased therapeutic antibody fragments is the presence of a natural binding site for the neonatal fc receptor fcrn ( fig . 2 ) . fcrn mediates the transport of maternal igg across the placenta in humans , thereby conferring humoral immunity to the fetus against antigens encountered by the mother 49 . in addition , fcrn binds igg with nanomolar affinity at acidic ph ( 6.5 ) in intracellular vesicles and releases it upon encountering the basic ph of the bloodstream ( 7.4 ) . the fcrn / fcbinding interface spans a large surface area at the ch2ch3 interdomain region . the center of the fcrn / fc interface includes a hydrophobic core with surrounding salt bridges . at the fc , the interface encompasses residues in the ab loop and the ef loop of the ch2 domain , as well as the gstrand of the ch3 domain 50 . another highly specific receptor binding to the iggfc region via its cterminal pryspry domain ( fig . this cytosolic receptor recognizes antibodyopsonized pathogens and targets them to the proteasome through autoubiquitylation of e3 ubiquitin ligase . the neutralization mechanism of trim21 is thought to link the adaptive immune system with intracellular defense 51 , 52 . the most prominent example is staphylococcus aureus protein a that binds with high affinity at the ch2ch3 interface of igg1 and igg2 and is used for purification of mab formats containing fc ( e.g. fcabs ) . as outlined above , binding of ligands to iggfc involves the ntermini of the ch2 domains as well as the ch2ch3 interface ( fig . each ch3 domain provides three cterminal ( structural ) loops that can be diversified for the generation of novel antigenbinding sites : residues 358 to 362 ( ab loop ) , residues 383 to 391 ( cd loop ) and residues 413 to 422 ( ef loop ) ( fig . 1 ) . these loops correspond to regions with the most pronounced flexibility within igg1fc 28 . upon engineering the loops , fcabs , homodimeric five residues in each the ab loop ( 358362 ) and the ef loop ( 413415 , 418419 ) of the ch3 domain ( compare with fig . 1 ) were randomized using nnb degenerate codons and five additional random residues were inserted at position 415 to enlarge the potential binding surface . a 7.4 10 yeast surface display library was constructed and probed for binding to protein a and fcri for comparison with surfacedisplayed wildtype igg1fc . it was shown that a considerable amount of clones retained the binding to these proteins , suggesting structural integrity of the displayed molecules . fc fragments binding to the extracellular domain of her2 ( an oncoprotein of the erbb receptor family ) were selected by fluorescenceactivated cell sorting ( facs ) using decreasing concentrations of the antigen . next , the fcab exhibiting the highest binding affinity was matured , yielding the final clone h10036 , for which specific binding to her2 at a k d value of 8.6 nm could be determined by surface plasmon resonance ( spr ) spectroscopy . moreover , h10036 was shown to elicit adcc in an experiment involving a her2expressing cell line and primary human nk cells to an extent that was approximately 20fold lower than for trastuzumab , a monoclonal antibody binding to her2 which is applied in the treatment of certain breast cancers 54 . importantly , no adverse effect of loop engineering on the in vivo halflife of the molecule could be determined after injection of h10036 or wildtype igg1fc in balb / c mice . the correlation of fcriiiabinding affinity and adcc in fcabs was further investigated by kainer et al . , who performed mutational studies to modulate adcc potency . in a similar experiment as described above , her2 overexpressing cells and nk cells were mixed and treated with variants of a her2binding fc fragment carrying mutations that were previously reported to affect the affinity for fcriiia . the authors concluded that known effects of the affinitypotency correlation can be assumed for the fcab format 55 . a recently published study describes a more elaborate investigation of the in vivo and in vitro activity of h10036 with a special emphasis on the comparison with the clinically approved antiher2 antibody trastuzumab 56 . complementing the work described above , the authors demonstrated the simultaneous binding of fcriiia and her2 to h10036 in an sprspectroscopic experiment as well as binding of fcriiia to h10036 on the surface of her2expressing skbr3 cells . interestingly , a human tumor cell proliferation assay revealed that , in contrast to trastuzumab , h10036 is not able to inhibit proliferation in a dosedependent manner . however , when a preclinical in vivo tumor xenotransplant model using human her2 expressing bt474 cells was used to confirm tumorkilling via adcc , a significant retardation of tumor growth could be determined which provided proof of the biological activity of the fcab despite its obvious differences in functionality compared to trastuzumab . a complementary study on the adcc potency of h10036 57 , who expressed the fcab in human cells as well as wildtype and glycoengineered plants to generate four different glycoforms of h10036 . the authors describe the crucial importance of the glycosylation pattern on adcc activity , thereby confirming the applicability of concepts reported for fullsize igg to the fcab format . recently , the discovery and preclinical activity of a novel her2targeting fcab , fs102 , was reported 58 . residues 358362 and 413419 in the ab and ef loops , respectively , were randomized to construct a yeast surface display library , which was screened for binding to the extracellular domain of her2 . the structural integrity of specific clones was confirmed by their uncompromised binding to antich2 , fcri , and protein a. one resulting fcab , fs102 , contained a total of nine amino acid substitutions in both loops ( compared to wildtype igg1fc ) but exhibited similar biophysical properties , meaning no major structural deviation between the two molecules . fs102 binds her2 with high affinity comparable to that of trastuzumab and pertuzumab , but does not compete with either mab in binding to the receptor , suggesting that it is targeting a different epitope . interestingly , fs102 induces profound her2 internalization and degradation and , finally , tumor cell apoptosis , which is an important mode of action for antibody therapeutics . the antitumor effect of fs102 in patientderived xenografts correlated strongly with the her2 amplification status of the tumors . at gene copy numbers of > 10 her2 per cell , superior activity of fs102 over trastuzumab or the combination of trastuzumab and pertuzumab was observed both in vitro and in vivo , and fs102 induced complete and sustained tumor regression in a significant portion of her2high patientderived xenograft tumor models . the mode of action of fs102 is still under discussion but might be related to the structure of the fcab and its two potential her2binding sites that are close together ( 2040 ) and relatively inflexible compared to the two typical igg antigenbinding sites ( 120170 ) . it is possible that the fcab favors a more ordered and tightly packed interaction with the antigen and thereby initiates pronounced aggregation and internalization of the fcab / antigen complexes . binding of the fcab might also favor a conformation of her2 that is more susceptible to degradation . aside from the successful introduction of novel binding sites into igg1fc , it was demonstrated that the cterminal loops in the ch3 domains can also be engineered to generate phdependent binding between the fcab and the respective antigen . as serum halflife controlled by fcrn is a major parameter to be considered for the applicability of therapeutic antibodies , engineering phsensitivity into the interaction of antibodies with their targets may also increase the clinical potential of these molecules . increasing the affinity to the antigen in the plasma ( ph 7.4 ) while simultaneously decreasing the interactions at acidic ph potentially reduces antigenmediated clearance in the lysosome and therefore allows for administration of therapeutic antibodies at lower frequencies and doses . it was demonstrated that prolonged halflife of tocilizumab , a humanized antibody against il6 receptor , and antibodies binding to proprotein convertase subtilisin kexin type 9 can be engineered by subjecting several residues within the cdr loops to histidine scanning . antigen complex dissociates at endosomal ph and the antibody is salvaged from degradation by binding to fcrn which recycles it back to the cell surface 59 , 60 . to apply this concept to igg1fc , the her2binding variant h10036 was used as model fcab and a library was constructed by applying parsimonious mutagenesis to the regions coding for the binding loops of h10036 in order to generate phdependent binding sites . the resulting yeast surface display library was subjected to alternating selections for binding at ph 7.4 and nonbinding at ph 6.0 61 . fcab variants could be selected whose interaction with her2 was phdependent not only in the yeast display format but also when her2positive skbr3 cells were titrated with soluble fcabs . importantly , this effect was not caused by conformational changes , as shown by dsc and md simulations . only one variant contained a single hissubstitution , but all selected mutations were in the close proximity of existing histidines . the application of a surface display method for selections of phdependent binders in order to circumvent the laborintensive histidine scanning approach was also demonstrated in a very recent study by bonvin et al . 62 . here , scfv variants binding to the chemokine cxcl10 and enriched in histidine residues in the cdrh3 were selected de novo from a phage library . based on the selected lead clone , when reformatted into human igg1 , the isolated antibody 1a4 inhibited cxcl10induced chemotaxis with an ic50 of 1.6 nm . in addition , the strong phdependency was evidenced by performing a dose response elisa , where 1a4 exhibited a 167fold lower affinity to cxcl10 at ph 6.0 than at ph 7.4 . of course , not only can igg1fc be engineered to obtain novel functionalities but also to improve existing functions . 63 combined algorithms for computational prediction and high throughput screening methods to selectively optimize the affinity and specificity for fcrs . designed fc variants of the her2binding monoclonal antibody trastuzumab exhibited adcc enhancements over wildtype with the enhancement levels being proportional to the increase in affinity for fciiia . importantly , adcc was observed for the engineered variants even with a cell line whose low surface levels of her2 did not allow for adcc detection after using wildtype trastuzumab . the authors concluded that especially for antibodies that fail in inhibiting proliferation , enhanced engagement of the immune system by fc engineering and thus mediated killing , i.e. by adcc and cdc , could prove to be important . another very promising and constantly growing field in which the engineering of igg1fc plays an important role is the generation of bispecific antibodies ( bsabs ) , which are able to simultaneously target two different antigens while at the same time maintaining important functions of a mab . a number of different bispecific formats are currently in clinical trials or already approved for cancer therapy , with catumaxomab ( fresenius biotech ) , a mouse igg2a and rat igg2b hybrid antibody combining binding to cd3 and epcam that was approved in 2009 , being a prominent example 64 . two other bsabs include rg7221 ( roche , basel , switzerland ) , a clinical phase ii bsab designed to bind angiopoietin 2 and vegfa , and ly3164530 bsab ( eli lilly , indianapolis , in , usa ) , currently being evaluated in clinical phase i and comprising binding sites for her1 and cmet 65 , 66 , 67 , 68 . the technologies proposed for the construction of the latter two molecules use different strategies to solve the light chain association problem . the crossmabch1cl technology from roche ensures correct pairing of the light chains by rearranging the ch1 domain of one heavy chain with the cl domains of the corresponding light chain 69 , while bispecificity of the ly3164530 antibody is partly achieved by creating an orthogonal interface through mutations in v and l domains for the correct assembly of the different fab domains . the second prerequisite for the generation of bispecific antibodies is the enforcement of the correct heavy chain heterodimerization over wrong homodimerization , which requires modification of the fc fragment . the knobintoholes ( kih ) approach mimics a keylocks system by introducing a bulky residue in one ch3 domain that favors binding to a small residue in the other ch3 domain 70 . 71 extended the kih technology by construction of a phage library of ch3 hole mutants which were tested for binding to the t366w knob mutant and were able to select a heterodimer variant with improved thermal stability . to further stabilize and increase the purity of the heterodimeric fc , an artificial disulfide bond was introduced by merchant et al . another approach represents the seedbody technology , which is based on the fact that the ch3 domains of human igg and iga do not dimerize 73 . by using molecular modeling , the authors investigated interdigitating strand segments of igg and iga ch3 domains for the generation of complementary heterodimer contact surfaces . one further technology to enforce correct dimerization includes mutations at the interface of the ch3 domains altering charge polarity of the heavy chain monomers . two negatively charged residues in chain a pair with two positively charged residues that were introduced in chain b ( ddkk variant ) resulting in a high degree of heterodimer purity , but also a decrease in thermal stability of the ch3 domain 66 , 74 . 75 identified mutations in the hinge region of human igg1 and igg2 that produce stabilizing ionic interactions . by combining these changes of the amino acid sequence with an additional mutation at the canonical position 409 in the ch3 domain , however , in this case both homodimers were first produced separately and then purified by affinity chromatography using protein a. formation of heterodimers was induced by mixing both samples at equimolar ratios and incubating them under reducing conditions at 37c for 24 h , resulting in the most stably paired variant eeerrr for higg1 . 76 identified residues in the ch3 interface promoting fc heterodimerization by combining structural considerations with sequence information . several variants were screened for the highest degree of heterodimerization , and an hatf variant was identified , where his and thr are stabilized through a hydrogen bond and ala and phe act as key and lock . described the heterodimer format zw1 providing high thermal stability and 95% purity , with the residual 5% being present as monomeric , but not homodimeric ch2ch3 subunits . by combination of in silico design and experimental screening , variants with high degrees of heterodimerization but low thermal stabilities based on these initial results , modifications of the selected heterodimeric variants were designed toward increasing purity and stability . the leading format zw1 carries four mutations on each ch3 domain located in the ch3ch3 interface and exhibits wildtypelike tm values 77 . in a very recent study , choi et al . 78 combined electrostatic with asymmetric hydrophobic interactions and generated the ewrvt fc heterodimer . by introducing a disulfide bond between the ch3 domains they could further improve purity and thermal stability 79 . all of the abovementioned approaches to the heterodimerization of heavy chains and the correct pairing of light chains aim at the production of fullsize bsabs providing one distinct specificity at each of the two fab fragments . by contrast , application of the modular antibody technology would allow for the combination of these fablocated binding sites with novel , artificial antigenbinding sites in the structural loops of constant domains . for example , the fc of an existing mab could be replaced with an fcab to generate a socalled mab that bivalently binds to one antigen via its fab fragments and mono or bivalently to a second antigen via the fcab portion ( fig . schematic representation of a hypothetical mab2 [ based on pdbid 1hzh ( 122 ) ] and one isolated ch3 domain thereof . secondary structure elements of the antibody are colored in gray with the molecular surface of the cdr loops shown in green . loop areas in the ch3 domains are displayed in red ( ab loop ) , orange ( cd loop ) , and purple ( ef loop ) . the surface approximations of the three loops indicate the putative region for the generation of binding sites . the correctness of the overall fold of igg1fc variants was confirmed in many cases . under some circumstances it was necessary to improve the biophysical properties of fcabs , either in advance by including stabilizing measures in the construction of libraries to make use of the full versatility of the scaffold or by repairing functionalized , yet impaired , fc fragments , which were mainly selected from early generation combinatorial libraries . also , even though the fc fragment is an intrinsically stable protein , the engineering of its properties could further accentuate the advantages over other nonantibodybased protein therapeutics . a detailed systematic study on the effect that the engineering of the cterminal structural loops of the ch3 domain of igg1fc has on the biophysical properties of the fc fragment was published by traxlmayr et al . this motif , in the context of the heptapeptide gcrgdcl , forms a cyclic and rather rigid structure as a consequence of disulfide bond formation by the flanking cysteines , resulting in increased interaction with integrins . single , double , and tripleinsertion variants ( i.e. grafting of gcrgdcl into ab loop , cd loop , ef loop , ab+cd , ab+ef , or cd+ef ) were expressed in pichia pastoris and evaluated for the binding to soluble or cell surfaceexpressed v3 integrin as well as for the effect of the engineering efforts on the overall fold and the structural integrity of the protein . expression levels determined for the variants did not differ significantly from those determined for the wildtype protein , except for the heavily mutated triplevariant , where grafting of the rigid circular motif into each of the cterminal loops apparently resulted in severe misfolding and degradation . aside from wildtypelike expression levels , all other constructs exhibited high purity and homogeneity and eluted as single peaks and at defined elution volumes in sizeexclusion chromatography , suggesting the correct folding of the proteins and the absence of aggregates . also , using electronic circular dichroism spectroscopy , the overall secondary structure content was determined for each variant . no significant changes were observed for ab and cd loop variants , whereas engineering of the ef loop apparently affected the helical content of the protein . this effect was also reflected in the strongly decreased stability of ef loop variants as determined by dsc . in contrast to that , manipulation of ab and cd loop destabilized the protein to a lesser degree . as expected , simultaneous insertion in two loops had a more pronounced effect on protein stability than single insertions . furthermore , the interaction with natural ligands was analyzed by spr spectroscopy and biolayer interferometry : fcrn , protein a , and fcriiiabinding revealed to be wildtypelike , which again confirmed the structural integrity of the recombinant proteins . the importance of biophysical properties of antibody fragments for largescale production and/or therapeutic efficacy has been demonstrated in various studies . 81 described the correction of an antiegp2 scfv fragment which , despite its high affinity , did not enrich at tumor xenografts . by grafting the binding residues of this scfv onto the framework of a more stable fragment and identification and introduction of stabilizing mutations , a functionally improved variant could be generated for which tumor localization was observed . in a different study , antibodies directed against the chemokine ccl17 were selected from a fab phage library designed by shi et al . 82 , many of them raised from the vh169 germline gene family abundant in the human immune repertoire 83 . the authors suggested that the high hydrophobicity of the germline cdrh2 leads to these unfavorable properties . by generating a library with randomized surfaceexposed residues within cdrh1 and cdrh2 to a group of biochemically distinct amino acids , a panel of novel clones could be isolated comprising both high affinity and reduced nonspecific interactions . surprisingly , the overall hydrophobicity of the selected clones was not significantly reduced , but three residues turned out to be critical in terms of undesired protein protein interaction . clones exhibiting a mutation at position i51 to polar or charged residues as well as at position f54 to small polar residues demonstrated higher solubility . furthermore , mutation of p52 suggested a structural change to the loop associated with higher stability . this study reveals the challenge in selecting for high affinity and good biophysical properties and demonstrates the importance of combinatorial library design , which we will discuss later in this review . one further study describes a monoclonal antibody that neutralizes binding of angiopoietin 2 to its receptor in vitro and inhibits tumor growth in vivo 84 . even though the pharmacological activity could be demonstrated , production of the antibody coincided with heterogeneity of the preparations , rapid aggregation , and poor expression yields . exchange of a susceptible surfaceexposed cysteine by all other 19 amino acids yielded a threoninevariant that exhibited reduced proneness to aggregation , improved homogeneity , largely increased expression levels , retained activity and , interestingly , the midpoint of denaturation shifted by 11c , corresponding to a strongly improved thermal stability . the authors stated that the engineering process resulted in the fulfillment of requirements necessary for largescale production in order to provide amounts of material sufficient for clinical trials . considering the conclusions from the abovementioned work , comparable efforts proved to be beneficial for the fc scaffold . tool box that would help the correction of impaired fc fragments was published recently 85 . in this work , the authors implemented a novel method that allows screening for stabilizing mutations in proteins that exhibit an already high thermal stability and t m values of up to 85c . two libraries of igg1fc variants differing in their mutation rates were constructed by errorprone pcr targeting the entire gene . these libraries were then expressed in the yeast surface display format and incubated at 79c in order to denature those variants displayed on yeast that were not stabilized by mutation . variants that were still conformationally intact were stained with fluorescently labeled structurespecific markers , either fcri or antich2 antibody , and thereby tagged for sorting of the displaying yeast cell by facs . as a consequence of heat denaturation of the yeast cells , plasmid dna coding for the stabilized variants had to be isolated , followed by retransformation of s. cerevisiae and construction of novel libraries , now being enriched in variants carrying favorable mutations . a total of four sorting rounds were performed to select for the most stabilized variants in the libraries which were eventually identified by sequencing of the isolated plasmid dna . biophysical characterization of 17 single , double , and triple mutants expressed in p. pastoris revealed that all of the variants exhibited increased thermal stabilities and wildtypelike binding to relevant ligands , i.e. fcrn , fcriiia , and protein a. it was concluded that possible adverse effects of the artificial amino acid composition in the engineered loops might be counteracted by the introduction of the identified stabilizing mutations without negatively affecting the intrinsic functionality of the fc fragment . in addition , this original igg1fc library pool generated by errorprone pcr and the selected libraries after one round of facs were analyzed by highthroughput sequencing 86 . for each amino acid position , the change in the mutation rate during selection was determined , indicating the tolerance to mutation at the respective position . as expected , selection for binding either to fcri or the antich2 antibody resulted in reduced mutation rates . this was more pronounced in the ch3 domain reflecting the thermal denaturation pathway of igg1fc with the reversibility of unfolding of the ch2 domain , as long as the ch3 domain remains natively folded . these data indicate a lower selection pressure for the ch2 domain , as only mutations either located in the binding site of the structurespecific markers or impeding the correct folding of the ch2 domain were eliminated . as both ligands that were used in this study bind to the ch2 domain , the changes in the mutation rates at positions in the ch3 domain were solely dependent on the impact of the respective side chain on foldability and/or stability , enabling the generation of a stability landscape of the ch3 domain . importantly , positions that are evolutionarily conserved among different species were significantly less tolerant to mutation in these in vitro selections , validating the quality of the stability landscape . furthermore , the experimentally derived tolerances to mutation correlated with the changes in the free energy of unfolding determined in silico . the results of this study not only revealed the sequencestability relationship of an entire protein at single residue resolution but also proved to be an important tool for protein engineering , because library randomizations can be focused on mutationtolerant regions of the protein . in addition , comparison of two selection experiments with different ligands ( fcri and an antich2 antibody ) enabled the identification of their epitopes on igg1fc . in a followup project , this directed evolution protocol was applied to improve the biophysical properties of the her2binding fcab h10036 87 , which , even though the interaction with important effector molecules was wildtypelike , exhibited impaired biophysical properties in an initial characterization . in contrast to the method described above , mutagenesis was directed to the engineered loops only in order to minimize the overall changes the fc fragment . an initial experiment revealed that the binding of h10036 to her2 was decreased after heat incubation , leading to the assumption that a correct fold is necessary for molecular recognition and that combination of heat shock and selection for ligand binding could be applied to simultaneously screen for improved thermal stability and retained affinity to the antigen . after heat incubation , the yeast displayedlibrary was either sorted for ( i ) binding to the antigen and to structurally specific ligands or ( ii ) binding to the antigen only . enriched clones were expressed in p. pastoris and hek293 cells and their biophysical properties were analyzed by sec , ecd spectroscopy , and dsc . stabilized variants resulting from the combined staining strategy ( antigen and structurally specific ligand ) exhibited higher thermal stabilities , which led to the assumption that this selection strategy should be favored . in addition , some stabilized fcabs were less prone to aggregation after long term storage , showed more wildtypelike sec elution profiles and the solubility of the fcab exhibiting the highest thermal stability was largely increased when compared to the parental clone h10036 . the general applicability of this method to improve the biophysical properties of suitable proteins was concluded . in addition , the differences in thermal stability of igg1fc and fcabs between the two expression systems , p. pastoris and hek293 , were analyzed . generally , the high mannose glycan structures attached to asn297 of the p. pastorisproduced fc variants destabilizes the interface of the ch2 domains and therefore leads to lower t m values . in a study by schaefer and pluckthun 88 , significant differences between fullsize iggs produced in both expression systems revealed not only different temperatures of unfolding but also indicated differences in terms of aggregation susceptibility . antibodies produced in p. pastoris were less prone to aggregate formation due their mannoserich glycan structure and the nterminal residual eaea extension , remaining from the factor prepro secretion sequence . although the thermal stability of p. pastorisproduced fc variants was lower , the corresponding sec elution profiles were highly comparable with the hekproduced counterparts 87 , as was the stabilityranking of fcabs in both expression systems . this clearly underlined that p. pastorisproduced fc variants can be used to investigate the biophysical properties and binding characteristics of a panel of selected fcabs . a different approach to stabilize igg1fc in order to provide a stable scaffold for the engineering of antigenbinding sites or other novel functionalities is based on the insertion of artificial disulfide bonds based on computational prediction 89 . selected cysteinevariants were expressed in p. pastoris and their biophysical properties were characterized , revealing that the thermal stabilities of two variants bearing novel intradomain disulfide bonds were largely increased while the overall structure remained wildtypelike . moreover , stabilization of the her2binding fcab h10036 could be achieved by the introduction of only one of the disulfide bonds . in a second study , the observation that the cterminus of the ch3dimer closely resembles the cterminus of the ch1cldimer of the fab fragment led to the assumption that the three cterminal amino acids of the ch3 domains could be replaced by those of the cl domain 90 . the resulting variant exhibited a wildtypelike elution profile in sec , leading to the assumption that specific disulfide bonding was accomplished and no incorrect crossbridging occurred . thermal denaturation of the protein occurred at significantly higher temperatures compared to wildtype igg1fc and this effect was observed to be further pronounced in a variant carrying both the stabilizing inter and intradomain disulfides . interestingly , more detailed analysis by dsc revealed a strong stabilizing cooperative effect that the ch3located alterations had on the ch2 domain . the introduction of both the computationally and rationally selected mutants into h10036 increased the thermal stability of the protein to be approximately wildtypelike while antigenbinding was retained . those identified mutations could serve as a valuable tool for stabilization of single proteins or entire libraries . in a similar study , gong et al . 91 described the stabilization of a monomeric human igg1ch2 domain by the introduction of artificial , rationally designed disulfide bonds . for two variants whose expression levels were comparable to the wildtype domain and which were highly soluble , increased thermal and conformational stabilities were determined in heat and chemical denaturation experiments structural changes in this variant as a consequence of the cysteine mutations were analyzed by nmr , once again confirming the correct formation of the novel disulfide bond . nuclear overhauser effect spectra were recorded and showed that the flexibility of both the wildtype ch2 domain and the stabilized variant were rigid in the framework but highly flexible in the loop regions . based on these findings , it was suggested that the ch2 domain as well as its stabilized variant can be applied as scaffolds for engineering antigen binders . in summary , the methods described in this section can be applied in several ways : one possibility is the introduction of thus identified stabilizing mutations in nave libraries in order to prestabilize the scaffold and thereby minimize the risk of selecting an fcab with impaired biophysical properties . the combination of several beneficial mutations exhibiting additive stabilizing effects could not only compensate for destabilization upon mutation of the structural loops but also further improve the characteristics of the resulting binders . moreover , starting from a stabilized protein scaffold has been shown to promote evolvability by tolerating a wider range of mutations 92 . in other words , a library based on a stabilized protein contains a higher fraction of correctly folded and therefore functional protein mutants . a more elaborate way of exploiting stabilizing effects of single or multiple point mutations would be the repairing of existing binders as a reaction to negative effects of loop mutations , as was shown for the her2 binding fcab h10036 . the previous chapters have clearly shown that igg1fc is a very attractive scaffold for the design of novel binding molecules that possess all antibody functions at only onethird of the size of a fullsize igg1 molecule . like many other therapeutic antibodies , antibodybased and nonantibodybased molecules , fcabs are selected from combinatorial libraries that became an alternative to conventional methods , i.e. the hybridoma technology . the selection of proteins with the desired binding properties from these libraries is in many cases accomplished by the application of various display technologies such as phage , ribosome or yeast surface display 93 . therapeutic igg1 molecules are generated by selecting either scfv or fab from combinatorial phage libraries , or fullsize igg from yeast or mammalian display libraries . the three main aspects of such libraries that are known to impact library quality are ( i ) design , ( ii ) the origin of sequence diversity , and ( iii ) the method of library generation , while library quality can be assigned to the library size , diversity , and the developability of the selected molecules , i.e. high affinity and good biophysical properties . maximization of library diversity can be accomplished by increasing the functional size and improving the resulting molecules developability , which for example is achieved by restriction to one stable framework or a limited number of consensus frameworks . the issue of immunogenicity is met by choosing framework and cdr compositions as close to the human germline as possible 93 . the introduction of novel binding sites into noncomplementaritydetermingregion ( cdr ) loops in immunoglobulinlike domains of nonig proteins as well as immunoglobulin constant domains as already demonstrated in the context of fcabs requires more elaborate considerations with respect to library design . while the lack of somatic hypermutation is , as is the case for cdr sequences of scfv or fab fragments selected from combinatorial libraries , met by different affinity maturation strategies , the design of libraries for nave selections is more challenging than in scfv or fab libraries . first of all , there is little or no natural variation in the amino acid sequences of noncdr loops and loop lengths are , in contrast to some cdr loops , mostly conserved . information on typical amino acid compositions that can be drawn from the large pool of existing cdr sequences is not available for alternative scaffolds . and lastly , the knowledge of canonical cdr loop conformations is a design advantage that can not be exploited in noncdr loops as yet . therefore , these favorable properties that are intrinsic to cdr loops have to be systematically investigated for noncdr loops of igderived and alternative binding scaffolds . as the term antibodybased is commonly used to describe formats that exploit the original binding site formed by the cdrs of either both or only one of the variable domains , antigenbinding igg1fc , albeit derived from igg1 , will be classified as an alternative binding scaffold. in this respect , the initial strategies that are pursued in order to provide a high degree of diversity , but also functionality , in libraries of different alternative binding scaffolds , are consistent . in this section , we will focus on these strategies and compare the library design efforts that have been made in the engineering of igg1fc and other formats , especially the fibronectin type iii scaffold , which , due to its immunoglobulinlike fold , is particularly interesting for comparison . as mentioned above , the generation of diversity in alternative binding scaffolds can not rely on the natural variation that is present in antibodies through somatic recombination and hypermutation during bcell development . while in the course of this maturation process stable frameworks supporting diversity in variable domains are selected for , it is highly probable that diversification of one or several amino acid positions in alternative binding scaffolds impairs the overall protein fold to a certain degree . as mentioned above , in the case of fcabs , it was shown that the introduction of an integrinbinding motif into each of the three cterminal loops of igg1ch3 is possible while retaining the binding to generic ligands 80 . however , overall folds of the proteins as well as thermal stabilities were impaired to some degree . the design of the first combinatorial libraries , i.e. the choice of amino acid positions in the cterminal loops to be randomized , was based on the degree of evolutionary conservation and visual evaluation of the crystal structure of igg1fc according to several criteria ( solvent accessibility and structural independence of the respective amino acid side chains ; generation of a coherentbinding surface ) 15 , and the applicability of this igg1fc variant library was proved by isolating fcabs binding to hen eggwhite lysozyme and cd20 . later , using an advanced library , it was shown that randomization of five positions in each the ab loop and the ef loop of igg1ch3 as well as insertion of five additional random amino acids in the ef loop , construction of a yeast surface display library and selection of igg1fc variants binding to her2 yielded wellexpressing and biologically functional , yet slightly destabilized proteins 53 . to circumvent this minor drawback already on the level of nave libraries , two approaches have successfully been followed , which resulted in the construction of superior next generation libraries : first , prior to selections , nave libraries can potentially be cleaned by isolating yeast cells that display igg1fc still binding to conformationally specific ligands ( e.g. protein a or fcri ) after diversification . depending on the applied threshold of residual binding to these ligands , optimized regions of diversification were identified for the generation of libraries of igg1fc in order to minimize detrimental effects on the ch3 framework and increase the number of productive clones in the library 94 . for this purpose , yeast surface display model libraries were constructed with distinct or overlapping regions randomized in the ab , cd , or ef loop of igg1ch3 and subjected to a protocol that involves the incubation at increasing temperatures of yeast suspensions induced for surface display and subsequent flow cytometric recording of the residual binding to conformationally specific ligands . library denaturation curves were derived from the resulting mean fluorescent intensities and used for the determination of temperatures of halfmaximal irreversible denaturation ( t 1/2 ) of entire yeast libraries , yielding a clear hierarchy of the distinct loop regions tolerance to randomization . igg1fc libraries were redesigned based on these findings and are currently evaluated for their potential in the selection of fcabs . an approach to library design similar to the basic strategy pursued for fcabs was published by koide et al . 14 , who identified the tenth type iii unit of human fibronectin ( fn3 ) , an immunoglobulinlike sandwich protein , as a potent binding scaffold . similar to the involvement of the nterminal loops bc , fg , and c'e of igg1ch2 in the binding of the fc receptors 39 , fn3 binds to integrin via the rgd motif in its fg loop . initially , fn3 library design was based on sequence analyses of several fibronectin type iii domains as well as structural evaluation of the loop architectures . selections using a library with five residues randomized in each the bc and the fg loop yielded a fn3 variant binding to ubiquitin with an ic50 of 5 m . however , this variant was less soluble at neutral ph than the wildtype fn3 protein and interacted with the column material in sizeexclusion chromatography . in a followup study , it was suggested though that this negative side effect of mutation could be counteracted by the removal of unfavorable electrostatic interactions on the protein surface 95 . 96 reported selections of fn3 variants binding to tnf. the master library applied in these selections consisted of an equimolar mixture of three sublibraries having either one , two , or all three of the nterminal fn3 loops randomized . interestingly , all but one of the resulting tnfbinding fn3 variants stemmed from the sublibrary having all three loops randomized , indicating the importance of diversity for the isolation of highaffinity binders . again , the stabilities reported for two representative variants were decreased . in a followup study , parker et al . 97 reported the significant loss of stability and solubility of vegfr2binding fn3 variants during affinity maturation , once more suggesting a tradeoff between stability and affinity . the authors counteracted destabilization by structurebased sitedirected mutagenesis , which also included the systematic reversion of randomized positions to their respective wildtype amino acids . also , it was suggested to apply alternative designs of the apparently crucial de loop of fn3 . all of these findings were based on the biophysical characterization of a limited set of fn3 variants , which leads to the assumption that it would be possible to further enhance fn3 library design ( i.e. at which positions the nterminal loops can be randomized ) by applying the flow cytometrybased method developed for libraries of igg1fc to this scaffold as described above , even though it is focused on stability and does not take into account the effects library design will have on affinity 94 . if , on the other hand , results from one further study on the fn3 scaffold by lipovsek et al . 98 are taken into consideration , it can be expected that a higher number of randomized residues will increase the affinity of selected fn3 variants while , as mentioned above , stability and solubility will be impaired . consequently , if information on the importance of distinct regions for the overall fold and stability of the scaffold is made available in a systematic manner , as was done for igg1fc , desired affinities can be approached by manipulating increasing numbers of distinct loop positions while at the same time being aware of the effect this will have on the biophysical properties of the scaffold . besides the application of modular antibody engineering to the cterminal loops of igg1fcch3 , various other studies have described the introduction of novel binding sites to immunoglobulin constant domains : xiao et al . 10 identified hiv1 inhibitors based on isolated igg1ch2 by randomizing the longest nterminal loops in the domain , i.e. bc and fg . an interesting design feature was the addition of a glycine residue at the cterminal end of each loop to provide flexibility and favor the accommodation of amino acid alterations necessary for stability and antigen recognition . however , as the stability of native ch2 is relatively low , the solubilities of three hiv1binding nanoantibodies selected from this library were reported to be poor . to overcome these issues , the isolated ch2 domain was stabilized by introducing an additional disulfide bond and removing seven nterminal residues 91 , 99 , 100 . starting from this scaffold , a library was constructed that comprised randomized bc and de loops and a cdrh3 from the hiv1 gp120binding vh m36 grafted in place of the fg loop 101 . while one of two clones selected from this library interacted noncompetitively with an hiv1 neutralizing epitope and fcrn , the second was not further characterized due to its aggregation proneness , leading to the authors conclusion that further improvements to the library design would be necessary to develop igg1ch2 as a scaffold for the development of novel therapeutics . length variation of cdr loops is another important factor in the natural generation of diversity . among the six cdr loops , h3 is the most diverse , both in terms of sequence and length . in a study on the clustering of antibody cdr loop confirmations , north et al . 102 assigned between two and eight different loop lengths to l1 , l2 , l3 , h1 , and h2 , and 20 different lengths to h3 , ranging from 5 to 26 residues . this length variability is introduced by imprecise joining during the combinatorial rearrangement of vh , dh , and jh genes in the course of bcell maturation 103 and is considered to be a main contributor to the recognition of diverse antigens , as h3 , given by its location in the center of the antigenbinding site , potentially controls the relative positions of vh and vl and affects the flexibility and cavity size of the paratope 104 . consequently , in order to mimic this crucial aspect of the development of antigen specificity by the immune system , loop length variation in the antigenbinding sites of alternative scaffolds is an important factor in the generation of specific , highaffinity interactions . in the process of development of the fcab scaffold , several steps have been made toward a loop elongation strategy that would allow for the selection of variants binding to diverse antigens while at the same time the intrinsic stability can be retained to a satisfactory degree . as mentioned above , the initial design for variant libraries of igg1fc included the insertion of five additional residues at the nterminal part of the ef loop , with this loop elongation aiding in the selection of an fcab binding to her2 with a k d value of 8.6 nm 53 . however , mutation and insertion negatively affected the biophysical properties of this fcab 87 . therefore , one further aspect of the detailed analysis of the cterminal loops of igg1ch3 was the systematic insertion of five additional random residues at different loop positions according to a sliding window 94 . t 1/2 values were determined for the resulting yeast surface display libraries as described above and used for the comparison of the tolerance of different loop positions to insertion . the results from this study , as well as the identification of sites of natural insertion from phylogenetic analysis of igg1ch3 from different species , were also considered for the design of novel variant libraries of igg1fc . as mentioned above , furthermore , findings from a study that dealt with the identification of stabilizing point mutations in igg1ch3 by using a directed evolution approach were combined with rational considerations 85 , 105 . in order to generate stabilizing stem regions that would allow for loop elongation the central part of this loop is constituted by an arginine residue forming a salt bridge with a glutamic acid in the cd loop , and a tryptophan residue that has been shown to be crucial for protein stability by contributing to the packing of the hydrophobic core . at the cterminus of this rw motif , a glutamine residue was replaced by a stabilizing leucin residue . at the nterminus of the adjacent fstrand , a serine between a phenylalanine also contributing to hydrophobic packing and a cysteine forming the intradomain disulfide bond was replaced by a stabilizing threonine . yeast surface display libraries including or not including these stabilizing stem regions and carrying increasing numbers of additional residues in between them were constructed , and their stabilities were evaluated by using the yeast surface displaybased method described above 94 , showing that , indeed , a largely increased tolerance to loop elongation was achieved by this stabilization approach , with the potential of such libraries for the selection of fcabs binding to diverse antigens being yet to be looked into . while the work on the design of libraries of igg1fc to date has focused on the question of how enhanced diversification , both in terms of site or regionspecific randomization and loop elongation , affects the overall fold and the biophysical properties of the scaffold , the tradeoff between this focus and its effect on fcab affinity is still under investigation . however , this has been addressed for other alternative formats , including the abovementioned immunoglobulinlike fn3 scaffold , which is why the results of the underlying studies should be of interest in this context and a link can be made to ongoing and future projects dealing with igg1fc . 106 performed basic experiments on the potential for elongation of all the loops in the fn3 domain , thereby providing some first information on the tolerance to insertion of alanines , which , of course , does not reveal the effect of full randomization . 107 , who diversified all three nterminal loops of fn3 both in length and composition . four different lengths were chosen for each loop based on sequence analysis of fn3 from different species , and nnb degenerate codons were used to incorporate all 20 amino acids . the output of this nave selection was diversified by loop shuffling and errorprone pcr and sorted twice , followed by another four rounds of this procedure , yielding fn3 variants of single digit picomolar affinity and high sequence diversity , having accumulated a considerable number of beneficial framework mutations . interestingly , further mutational studies on the de loop of one particular highaffinity fn3 variant revealed that this loop can be either engineered to improve affinity or stability to a considerable degree . these results underline once more that library design for scaffolds based on immunoglobulin and immunoglobulinlike domains must undergo adjustments based both on the systematic evaluation of nave libraries and selection outputs in order to efficiently approach an optimum balance of stability and affinity of relevant variant proteins . the degree of cdr sequence diversification in combinatorial libraries of antibodybased alternative scaffolds , i.e. the usage of the amino acid repertoire , follows various different strategies . while nave libraries provide natural diversity by combination of functional vgene segments isolated from the lymphoid tissues of nonimmunized donors [ e.g. cat 1.0 and cat 2.0 libraries of cambridge antibody technology 108 , 109 ] , synthetic libraries such as the hucals ( morphosys ) offer any desired amino acid compositions in the cdrs 110 , 111 . in general , it was observed that , despite the hypervariability of cdr sequences , there is a bias of functional cdrs to certain amino acid types , most of all tyrosine , glycine , and serine 112 . showed that while scfv variants binding to some antigens at nanomolar affinities were selected from phage display libraries providing only a binary amino acid repertoire ( i.e. tyrosine and serine ) , selections of binders from the same libraries to other antigens yielded affinities only in the micromolar range 113 , 114 , 115 . modifications of these libraries included an increased chemical diversity in cdrh3 and the consideration of nonparatope residues potentially important for cdr conformation 116 . as mentioned above , morphosys hucal fab libraries are fully synthetic , and they were developed over the course of several years 110 , 111 . the latest version , named hucal platinum , offers , among other features , length variation in cdrh2 and cdrh3 , and lengthdependent amino acid frequencies as observed in the analysis of rearranged sequences , which was realized by using a large set of different trinucleotide mixtures . in principle , a similar approach is potentially valid for the construction of variant libraries of igg1fc . naturally , while the alignment of thousands of vh and vl sequences was used to generate information on the amino acid distributions in cdr loops , it can not be estimated how , for example , binary codes or natural distributions in cdrs would influence the efficient isolation of welldevelopable fcabs binding to diverse antigens at high affinities . investigated the effect of full or restricted diversity in fn3 , which , again , can be a valuable source of information for the engineering of igg1fc due to its immunoglobulinlike fold 117 , 118 . in these studies , the sequencefunction landscape of the fn3 scaffold was approached by comparing various amino acid compositions in the nterminal loops , leading to important conclusions : first , it was shown that maximal amino acid diversity is more beneficial for the selection of antigenbinding fn3 variants than a binary tyrosine / serine code as described above . and second , wildtype conservation at positions potentially important for structural integrity , as well as amino acid distribution biases toward the natural occurrence in cdrs made clear that both strategies were valuable for an efficient selection of binding fn3 variants . consequently , while the identification of positions in igg1fcch3 at which conservation of wildtype amino acids improves the biophysical properties of selected variants has been accomplished 86 , 94 , the application of tailored amino acid distributions as described above is a promising approach to be investigated in the future . over the past 30 years , therapeutic monoclonal antibodies and antibodybased alternative formats have been successfully developed , first by using the hybridoma technology and later by selection from combinatorial libraries . in this review , we introduced the potential of igg1fc as a promising scaffold for the generation of alternative protein therapeutics . by applying the modular antibody engineering technology , novel binding sites for theoretically any desired antigen can be introduced in the cterminal loops of the ch3 domains to create fcabs , antigenbinding fcs . in this way , the fc is engineered to unite all important functions normally conveyed by fullsize iggs , i.e. ( i ) the mediation of effector functions through binding to fcrs ; ( ii ) contribution to a long halflife in serum through binding to fcrn , and ( iii ) ( novel ) binding to an antigen . fs102 , a her2binding fcab that has recently entered the clinic , is believed to accelerate aggregation and internalization of the antigen / fcab complexes as a consequence of the distinct fcab structure , with pharmacokinetics not being impaired by the sequence changes in the ch3 domain . in some cases , as has been described for other alternative scaffolds , the engineering process might negatively affect the biophysical properties of igg1fc . the current article summarizes a set of methods , mostly based on directed evolution and yeast surface display , which provide a we also reviewed the various approaches to modifying iggfc for the production of bispecific antibodies and described the highly promising concept of constructing mabs , monoclonal antibodies with one specificity in the two antigenbinding sites of the fabs and one additional specificity at the cterminus of the fc , which again can be accomplished by modular antibody engineering . loop position and loop regionspecific information has been obtained that will aid in the construction of libraries of high quality , and studies dealing with the modification of the architecture of the putative fcab binding sites by loop elongation have been performed . many approaches that have proved successful in the context of other alternative scaffolds , especially those targeting tailored amino acid distributions , can be used as models for the future investigation of libraries of igg1fc , which will ultimately lead to a further accentuation of the intrinsically favorable properties of fcabs .

summarythe crystallizable fragment ( fc ) of the immunoglobulin class g ( igg ) is a very attractive scaffold for the design of novel therapeutics due to its quality of uniting all essential antibody functions . this article reviews the functionalization of this homodimeric glycoprotein by diversification of structural loops of ch3 domains for the design of fcabs , i.e. antigenbinding fc proteins . it reports the design of libraries for the selection of nanomolar binders with wildtypelike in vivo halflife and correlation of fc receptor binding and adcc . the in vitro and preclinical biological activity of selected fcabs is compared with that of clinically approved antibodies . recently , the great potential of the scaffold for the development of therapeutics for clinical use has been shown when the her2binding fcab fs102 entered clinical phase i. furthermore , methods for the engineering of biophysical properties of fcabs applicable to proteins in general are presented as well as the different approaches in the design of heterodimeric fcbased scaffolds used in the generation of bispecific monoclonal antibodies . finally , this work critically analyzes and compares the various efforts in the design of highly diverse and functional libraries that have been made in the engineering of igg1fc and structurally similar scaffolds .

extracorporeal membrane oxygenation ( ecmo ) is a form of cardiopulmonary bypass for patients with pulmonary or circulatory failure unresponsive to conventional treatment . most patients are heavily sedated to prevent accidental decannulation or impeded ecmo flow due to movement or suboptimal cannula position . however , prolonged and high cumulative doses of opioids and benzodiazepines have been associated with tolerance , physical dependency , and consequently withdrawal syndrome in neonates and children [ 15 ] . sedation guidelines for pediatric icu patients have been developed but are in part hampered by the lack of high - quality evidence , and exclude neonates and ecmo patients [ 6 , 7 ] . strategies to decrease cumulative doses and duration of continuous infusions with the intent to reduce consequent adverse events include daily interruption or even complete withholding of continuous sedation [ 8 , 9 ] . the latter strategies were both shown to significantly reduce total cumulative doses of sedative drugs without an increase in complications . more importantly , ventilator - free days , length of icu stay , and occurrence of posttraumatic stress syndrome were also significantly reduced [ 1012 ] . two meeting reports on daily interruption in children presented a reduction of midazolam dose in the intervention group ; both studies lacked power to show an effect on mechanical ventilation or icu stay [ 13 , 14 ] . to our knowledge the aim of our study is therefore to evaluate safety and feasibility of initial interruption of analgesia and sedatives in neonates following cannulation for ecmo . the institutional medical ethics review board approved the study , and informed consent was obtained from the parents or legal representatives . all neonates < 7 days old admitted for ecmo in 1 year were eligible for enrolment . criteria for ecmo treatment were : gestational age > 34 weeks , birth weight > 2.0 kg , mechanical ventilation < 7 days , alveolar arterial oxygen difference > 600 mmhg , and oxygenation index > 25 for more than 6 h. all received standardized anesthesia during cannulation , consisting of fentanyl 5 mcg / kg bolus injection , morphine 50 mcg / kg / u , and midazolam 200 mcg / kg / u continuous infusion during cannulation . on icu admission , severity of illness was assessed using the score for neonatal acute physiology version ii ( snap ii ) and the score for neonatal acute physiology , perinatal extension , version ii ( snappe ii ) . pain and sedation were routinely assessed by the attending nurse using validated pain ( visual analog scale , vas ) and sedation ( comfort - b ) scores [ 15 , 16 ] . morphine and midazolam infusions were discontinued 3060 min after cannulation and resumed on the guidance of regularly determined cs and vas scores . when comfort - b score was 17 or higher , continuous midazolam 100 mcg / kg / h was started after a loading dose of 200 mcg / kg . / kg / u was started after a loading dose of 100 mcg / kg when vas score was 4 or higher , or when sedation was ineffective with midazolam ( > 300 mcg / kg / u ) , or at the discretion of the attending medical team . primary : duration of sedation interruptionsecondary : need for rescue medication and number of complications ( extubations , decannulation , impairment of ecmo flow by 50% ) duration of sedation interruption need for rescue medication and number of complications ( extubations , decannulation , impairment of ecmo flow by 50% ) all values are presented as median ( iqr ) unless otherwise indicated . the institutional medical ethics review board approved the study , and informed consent was obtained from the parents or legal representatives . all neonates < 7 days old admitted for ecmo in 1 year were eligible for enrolment . criteria for ecmo treatment were : gestational age > 34 weeks , birth weight > 2.0 kg , mechanical ventilation < 7 days , alveolar arterial oxygen difference > 600 mmhg , and oxygenation index > 25 for more than 6 h. all received standardized anesthesia during cannulation , consisting of fentanyl 5 mcg / kg bolus injection , morphine 50 mcg / kg / u , and midazolam 200 mcg / kg / u continuous infusion during cannulation . on icu admission , severity of illness was assessed using the score for neonatal acute physiology version ii ( snap ii ) and the score for neonatal acute physiology , perinatal extension , version ii ( snappe ii ) . pain and sedation were routinely assessed by the attending nurse using validated pain ( visual analog scale , vas ) and sedation ( comfort - b ) scores [ 15 , 16 ] . morphine and midazolam infusions were discontinued 3060 min after cannulation and resumed on the guidance of regularly determined cs and vas scores . when comfort - b score was 17 or higher , continuous midazolam 100 mcg / kg / h was started after a loading dose of 200 mcg / kg . morphine 10 mcg / kg / u was started after a loading dose of 100 mcg / kg when vas score was 4 or higher , or when sedation was ineffective with midazolam ( > 300 mcg / kg / u ) , or at the discretion of the attending medical team . primary : duration of sedation interruptionsecondary : need for rescue medication and number of complications ( extubations , decannulation , impairment of ecmo flow by 50% ) duration of sedation interruption need for rescue medication and number of complications ( extubations , decannulation , impairment of ecmo flow by 50% ) primary : duration of sedation interruptionsecondary : need for rescue medication and number of complications ( extubations , decannulation , impairment of ecmo flow by 50% ) duration of sedation interruption need for rescue medication and number of complications ( extubations , decannulation , impairment of ecmo flow by 50% ) twenty - one met the inclusion criterion , but one of them died within 24 h after cannulation . median postnatal age ( range ) was 0.79 ( 0.175.8 ) days ( table 1 ) . all patients received midazolam median ( iqr ) 110 mcg / kg / u ( 100200 mcg / kg / u ) and morphine 10.9 mcg / kg / u ( 1020 mcg / kg / u ) before cannulation . all patients received inotropic support and antibiotics.table 1clinical characteristicspatients ( n)20female / male ( n)10/10mortality ( % ) 25cdh7mas10pneumonia1sepsis1pulmonary valve atresia1 median ( iqr)(range)snap ii16 ( 1623)(2635)snappe ii33 ( 1634)(1654)oxygenation index prior to ecmo38(2154)aado2 prior to ecmo ( mmhg)599(522624)age ( days)0.79 ( 0.293.4)(0.176.8)length of ecmo ( h)123 ( 88218)(53462)gestational age ( weeks)40 1/7 ( 38 1/741 4/7)(35/5/742 3/7)birth weight ( kg)3.1 ( 2.83.6)(2.34.0)morphine dose pre - ecmo ( mcg / kg / u)10.9 ( 1020)(8.833)midazolam dose pre - ecmo ( mcg / kg / u)110 ( 100200)(50220)data given are number of patients or median values ( iqr ) ( range)cdh congenital diaphragmatic hernia , mas meconium aspiration syndrome , aado2 arterial alveolar oxygen difference clinical characteristics data given are number of patients or median values ( iqr ) ( range ) cdh congenital diaphragmatic hernia , mas meconium aspiration syndrome , aado2 arterial alveolar oxygen difference midazolam was discontinued in all 20 patients ; morphine in 18 . median interruption time for both drugs combined was 10.3 h ( iqr 5.024.1 h ) . median interruption time for midazolam was 16.5 h ( iqr 6.629.6 ) ; median interruption time for morphine was 11.2 h ( iqr 6.739.4 h ) ( fig . 1 ) . interruption times were shorter for patients with higher cumulative doses of midazolam or morphine ( r = 0.54 , p = 0.013 and r = 0.58 , p = 0.008 , respectively).fig . each dot represents one patient individual interruption times of midazolam , morphine , and of both sedatives . each dot represents one patient interruption times for patients with meconium aspiration syndrome were shorter than for patients with other diagnoses ; the difference did not reach statistical significance [ 6.8 h ( 3.215.2 h ) versus 16.0 h ( 8.735.1 h ) , p = 0.07 ] . duration of interruption did not differ between patients with and without concomitant phenobarbital use , male and female patients , or survivors and nonsurvivors . there was no significant correlation between snap ii or snappe ii score and interruption time . no accidental decannulations or extubations during sedation interruption were observed , neither agitation resulting in impairment of ecmo flow nor accidental bleeding . three patients ( 15% ) received fentanyl during the interruption period , one for perceived discomfort and two for procedural analgesia . both cs and vas scores were low during sedation interruption ( table 2 ) . in seven patients ( 35% ) midazolam or morphine was restarted on the guidance of comfort - b score > 17 . in the other 13 patients either no cs was recorded at the moment of restart of medication ( n = 7 ) or midazolam or morphine was started despite comfort - b or vas score below the cutoff point ( n = 6 ) . reasons for start of medication were : perceived discomfort manifesting as unexplained cardiovascular or respiratory instability , or suspected discomfort in anticipation of a medical procedure.table 2interruption duration , plasma levels , cs , and vas at restart of medicationmedianiqrrangeinterruption duration ( h)10:255:0024:100:0057:30median cs during cessation of medication8.589715vas10205cs at restart of medication ( n = 13)1711181021 interruption duration , plasma levels , cs , and vas at restart of medication twenty - one met the inclusion criterion , but one of them died within 24 h after cannulation . median postnatal age ( range ) was 0.79 ( 0.175.8 ) days ( table 1 ) . all patients received midazolam median ( iqr ) 110 mcg / kg / u ( 100200 mcg / kg / u ) and morphine 10.9 mcg / kg / u ( 1020 mcg / kg / u ) before cannulation . all patients received inotropic support and antibiotics.table 1clinical characteristicspatients ( n)20female / male ( n)10/10mortality ( % ) 25cdh7mas10pneumonia1sepsis1pulmonary valve atresia1 median ( iqr)(range)snap ii16 ( 1623)(2635)snappe ii33 ( 1634)(1654)oxygenation index prior to ecmo38(2154)aado2 prior to ecmo ( mmhg)599(522624)age ( days)0.79 ( 0.293.4)(0.176.8)length of ecmo ( h)123 ( 88218)(53462)gestational age ( weeks)40 1/7 ( 38 1/741 4/7)(35/5/742 3/7)birth weight ( kg)3.1 ( 2.83.6)(2.34.0)morphine dose pre - ecmo ( mcg / kg / u)10.9 ( 1020)(8.833)midazolam dose pre - ecmo ( mcg / kg / u)110 ( 100200)(50220)data given are number of patients or median values ( iqr ) ( range)cdh congenital diaphragmatic hernia , mas meconium aspiration syndrome , aado2 arterial alveolar oxygen difference clinical characteristics data given are number of patients or median values ( iqr ) ( range ) cdh congenital diaphragmatic hernia , mas meconium aspiration syndrome , aado2 arterial alveolar oxygen difference median interruption time for both drugs combined was 10.3 h ( iqr 5.024.1 h ) . median interruption time for midazolam was 16.5 h ( iqr 6.629.6 ) ; median interruption time for morphine was 11.2 h ( iqr 6.739.4 h ) ( fig . 1 ) . interruption times were shorter for patients with higher cumulative doses of midazolam or morphine ( r = 0.54 , p = 0.013 and r = 0.58 , p = 0.008 , respectively).fig . each dot represents one patient individual interruption times of midazolam , morphine , and of both sedatives . each dot represents one patient interruption times for patients with meconium aspiration syndrome were shorter than for patients with other diagnoses ; the difference did not reach statistical significance [ 6.8 h ( 3.215.2 h ) versus 16.0 h ( 8.735.1 h ) , p = 0.07 ] . duration of interruption did not differ between patients with and without concomitant phenobarbital use , male and female patients , or survivors and nonsurvivors . there was no significant correlation between snap ii or snappe ii score and interruption time . no accidental decannulations or extubations during sedation interruption were observed , neither agitation resulting in impairment of ecmo flow nor accidental bleeding . three patients ( 15% ) received fentanyl during the interruption period , one for perceived discomfort and two for procedural analgesia . both cs and vas scores were low during sedation interruption ( table 2 ) . in seven patients ( 35% ) midazolam or morphine was restarted on the guidance of comfort - b score > 17 . in the other 13 patients either no cs was recorded at the moment of restart of medication ( n = 7 ) or midazolam or morphine was started despite comfort - b or vas score below the cutoff point ( n = 6 ) . reasons for start of medication were : perceived discomfort manifesting as unexplained cardiovascular or respiratory instability , or suspected discomfort in anticipation of a medical procedure.table 2interruption duration , plasma levels , cs , and vas at restart of medicationmedianiqrrangeinterruption duration ( h)10:255:0024:100:0057:30median cs during cessation of medication8.589715vas10205cs at restart of medication ( n = 13)1711181021 interruption duration , plasma levels , cs , and vas at restart of medication to our knowledge this is the first study that shows that prolonged interruption of sedatives and analgesics is feasible in neonates on ecmo . interruption of morphine or midazolam did not cause any major complications . on average , patients remained adequately sedated for 10 h after cessation of medication . this is much longer than reported in adult patients not on ecmo . in the present study median comfort - b scores during the study period were low overall : 8.5 ( iqr8 - 9 ) , indicating oversedation . in combination with predominantly low comfort - b and vas scores at time of restart of sedatives , this goes to show that , if anything , sedation was reintroduced early rather than late . in line with adult studies , interruption of medication seems more effective in preventing oversedation than does protocolized sedation alone . potentially altered disposition or effect of the drugs given , due to age , pre - existing disease , cannulation or ecmo treatment , could play a role in the longer interruption duration in our patients compared with adults . as all were younger than 7 days , effect of age on interruption duration could not be studied . pharmacokinetic data of midazolam in these patients show increased volume of distribution and clearance on ecmo . this suggests that the observed interruption times are not related to increased plasma levels on ecmo . we did find a shorter interruption duration in patients with high cumulative doses of morphine and midazolam prior to ecmo treatment , which could imply increased tolerance to both drugs . as a limitation of the study , there was a high percentage of protocol violation . in 60% of cases morphine was started prior or simultaneously with midazolam ; in 10% morphine was never discontinued . in all but one patient vas scores morphine was mostly used as a sedative , either as first choice or as an addition to midazolam even when midazolam dose was below 300 mcg / kg / u . the attending physician was allowed to deviate from protocol based on clinical assessment of the patient . in many neonatal icus morphine is the sedative of choice in ventilated ( pre-)term infants , therefore attending physicians may opt for morphine more easily than for midazolam . furthermore , procedures perceived as painful may have elicited the choice for morphine as a prophylactic analgesic . due to these protocol violations it is impossible to discriminate between the sedative effects of midazolam and morphine in this study . a second limitation lies in either missing or low comfort - b scores at restart of medication . in two patients medication patients nurses indicated that the patient was uncomfortable or more awake than deemed necessary , despite low comfort - b scores . showed that interpretation of cs scores between 11 and 22 is difficult in children on the icu and may necessitate an additional score . finally , doctors and nurses fear of accidental decannulation or ecmo system failures may precipitate earlier restart of sedatives . our findings suggest that the actual interruption duration could have been longer if protocol compliance had been better . . reported 100% adequate sedation with midazolam and morphine in a study cohort of 20 neonates on ecmo ; unfortunately , dose adjustments were not reported . our findings are in line with previous studies showing that , even if patients are oversedated and sedation protocols dictate to lower doses of sedative drug , these dose adjustments are not always made . interruption of sedatives and analgesics is feasible and safe in neonates on ecmo without increased risk of complications .

purposein most extracorporeal membrane oxygenation ( ecmo ) centers patients are heavily sedated to prevent accidental decannulation and bleeding complications . in ventilated adults not on ecmo , daily sedation interruption protocols improve short- and long - term outcome . this study aims to evaluate safety and feasibility of sedation interruption following cannulation in neonates on ecmo.methodsprospective observational study in 20 neonates ( 0.175.8 days of age ) admitted for ecmo treatment . midazolam ( n = 20 ) and morphine ( n = 18 ) infusions were discontinued within 30 min after cannulation . pain and sedation were regularly assessed using comfort - b and visual analog scale ( vas ) scores . midazolam and/or morphine were restarted and titrated according to protocolized treatment algorithms.resultsmedian ( interquartile range , iqr ) time without any sedatives was 10.3 h ( 5.024.1 h ) . median interruption duration for midazolam was 16.5 h ( 6.629.6 h ) , and for morphine was 11.2 h ( 6.739.4 h ) . during this period no accidental extubations , decannulations or bleeding complications occurred.conclusionsthis is the first study to show that interruption of sedatives and analgesics following cannulation in neonates on ecmo is safe and feasible . interruption times are 23 times longer than reported for adult icu patients not on ecmo . further trials are needed to substantiate these findings and evaluate short- and long - term outcomes .

ca19 - 9 is a monosialoganglioside , which is associated with various types of mucinous tumors in the gastrointestinal tract , such as in the pancreas and biliary tract [ 13 ] . serum ca19 - 9 plays an important role in the diagnosis and prognostication of colorectal , pancreatic , and biliary tract cancers [ 46 ] . in the gastrointestinal tract and ovaries , there have been a number of studies suggesting that serum ca19 - 9 level might be a useful marker in diagnosis of benign dermoid cyst . in those studies , large tumor size , bilateral tumor involvement , and tumor torsion were correlated with serum ca19 - 9 elevation . however , there have been limited reports of ca19 - 9 as a diagnostic marker in ovarian mucinous tumors . although many gynecologic oncologists are using serum ca19 - 9 level as a preoperative marker in the investigation of women with an ovarian mass , evidence is still insufficient . in addition , differentiation of malignant tumors from benign tumors will be more challenging if the role of ca125 as a screening tool is controversial in ovarian malignancy . serum ca125 is frequently elevated in benign conditions , including pregnancy , endometriosis , and pelvic inflammatory disease , as well as in malignant disorders . moreover , a number of studies suggest that ca125 is not elevated in most primary ovarian mucinous neoplasms [ 1013 ] . therefore , we investigated the clinical characteristics correlated with serum ca19 - 9 elevation and evaluated the role of serum ca19 - 9 in differentiating benign from borderline or malignant mucinous tumors in the ovaries . from 2001 to 2011 in hallym medical university hospital , a total of 149 women with pathologically - confirmed primary ovarian mucinous tumors were preoperatively checked for serum ca19 - 9 and ca125 levels . of those , all the patients with malignant mucinous tumors were in stage 1 or 2 . among 122 women with pathologically - confirmed benign mucinous cystadenomas in the ovaries , the control group was established by 1:2 matching for age to complement the small sample size of borderline or malignant tumors compared to benign tumors . patients with benign disease in the gastrointestinal tract , such as in the pancreas and gall bladder , and patients with other co - existing malignant tumors , were excluded from the study group . patient characteristics ( age at operation , parity , and menopause ) , ultrasonographic ( us ) findings of the lesion ( the largest diameter and site of the lesion ) , preoperative level of serum tumor markers ( ca125 and ca19 - 9 ) , and existence of torsion were retrieved from medical records and pathology reports . the serum level of ca 19 - 9 and ca 125 were determined by radioimmunoassay by using the modular analytics e 170 module ( roche laboratory systems , mannheim , germany ) . the cut - off values for ca19 - 9 and ca 125 are 37 u / ml and 35 u / ml , respectively . statistical analyses were performed using spss for windows ( version 18.0 , spss inc . ) . the hazard ratio ( hr ) and 95% confidence intervals ( ci ) were calculated . for all statistical tests , p value less than 0.05 serum ca19 - 9 was elevated in the ovaries in 16.7% , 56.3% , and 45.5% of benign , borderline , and malignant mucinous tumors , respectively ( table 1 ) . in contrast , serum ca125 was elevated in only 27.3% of cases with malignant mucinous tumors in the ovaries . although the mean value of serum ca19 - 9 was not significantly different among histological subtypes ( p=0.774 ) , serum ca19 - 9 was more frequently elevated in borderline or malignant mucinous tumors than in benign tumors ( 57.9% vs. 16.7% , p=0.001 ) . clinical characteristics in association with serum ca19 - 9 elevation in women with primary ovarian mucinous tumors are described in table 2 . specifically , the largest diameter of tumor ( 15 cm in us finding ) , serum ca125 elevation , and tumor pathology ( borderline or malignant ) were correlated with elevated serum ca19 - 9 levels . however , torsion , bilateral involvement of tumor , and other patient characteristics , including parity and menopause , were not correlated with serum ca19 - 9 elevation . multivariate analysis revealed that tumor pathology ( borderline or malignant ) was the only independent factor for serum ca19 - 9 elevation in primary ovarian mucinous tumors ( odds ratio [ or ] 3.842 , 95% ci 1.27711.558 , p=0.017 ) ( table 3 ) . interestingly , subgroup analysis in women with normal serum ca 125 level revealed that serum ca19 - 9 elevation was significantly correlated with borderline or malignant tumors than benign ( 12.8% vs. 43.8% , p=0.014 ) ( table 4 ) . odds ratio for serum ca19 - 9 elevation was 6.3 ( 95% ci 1.43819.648 ) . in other words , negative predictive value and positive predictive value of ca19 - 9 was 87.2% and 43.8% , respectively , for cancer discrimination in patients with normal ca125 . ca19 - 9 is a sialylated lewis a antigen , which is associated with mucins in gastrointestinal adenocarcinomas and also is frequently expressed in mucinous tumors in the ovaries . although ca19 - 9 is recognized as a useful diagnostic marker in various types of mucinous tumors in the gastrointestinal tract ( e.g. , in the pancreas and biliary tree ) , there have been limited reports of ca19 - 9 as a diagnostic marker in ovarian mucinous tumors . primary mucinous tumors , which account for approximately 1215% of all ovarian tumors , can be subdivided into 2 distinct histogenetic types : the much more common intestinal ( or non - specific ) type and the less common mllerian ( or endocervical ) type . therefore , ca125 , which is secreted by mainly mllerian origin tissue , can not be a major tumor marker in mucinous tumors of the ovaries . pathologically , primary ovarian mucinous tumors are classified as benign , borderline ( mucinous tumor of low malignant potential ) , or malignant tumors . although 75% of primary mucinous tumors are benign , the other 10% and 15% are comprised of borderline and malignant tumors , respectively . according to a recent model for ovarian carcinogenesis , ovarian neoplasms can be divided into type i and type ii , and each should be considered as a different disease . type i tumors , including low - grade serous , mucinous , endometrioid , clear cell , and transitional cell carcinomas , are often confined to the ovary at the time of diagnosis , with a stable genome and without tp53 mutations . in contrast , type ii tumors , including high - grade serous carcinomas , undifferentiated carcinomas , and carcinosarcomas , are more aggressive and genetically highly unstable [ 19,2123 ] . actually , the behavior of mucinous ovarian carcinoma is different from that of serous ovarian carcinoma . despite a relatively good prognosis in early - stage disease , mucinous ovarian cancers are frequently associated with poorer response to platinum / taxane chemotherapies , and poorer survival , compared to serous ovarian cancers [ 2426 ] . in addition , mucinous borderline ovarian tumors , which are generally characterized as having low malignant potential without obvious stromal invasion , may present with peritoneal implants , lymph node metastases , and recurrence after the resection . however , in contrast to serous tumors , differential diagnosis of benign from borderline or malignant tumors is more challenging in mucinous tumors because of their typical large size and the great variation in the degree of differentiation of individual tumors . although magnetic resonance imaging ( mri ) has recently been suggested as a useful diagnostic tool for mucinous borderline or malignant tumors , considering its cost - effectiveness , the role of mri is still questionable [ 3033 ] . moreover , serum ca 125 level , which is a typical tumor marker in serous - type ovarian cancer , is less frequently elevated in mucinous tumors than in non - mucinous tumors . therefore , verification of ca19 - 9 as an effective diagnostic marker is important . in our results , serum ca19 - 9 was frequently elevated in primary ovarian mucinous tumors . moreover , borderline and malignant mucinous tumors , but not benign mucinous tumors , were significantly associated with serum ca19 - 9 elevation . it might be natural that serum ca19 - 9 , which is a sialylated lewis a antigen associated with mucins , is frequently elevated in primary mucinous ovarian tumors . the principal mechanism of the elevation of ca19 - 9 in ovarian cysts is well - documented in a number of studies of mature cystic teratomas . for instance , ito et al . demonstrated the presence of ca19 - 9 in the bronchial mucosa and glands of ovarian mature cystic teratoma by immunohistochemical staining . they also revealed the secretion of ca19 - 9 into the cystic cavity of the lesion . considering to those findings , the leakage of ca19 - 9 from the cystic cavity into the blood stream might be a main mechanism of serum ca19 - 9 elevation . we can predict that probable conditions of leakage into the blood stream , such as a larger size tumor , bilateral involvement of the tumor , and tumor torsion , may be correlated with serum ca19 - 9 elevation . several studies have described the clinical characteristics correlated with serum ca19 - 9 elevation in women with primary ovarian mature cystic teratomas . reported that ca19 - 9 elevation was correlated with larger tumor size and higher rate of ovarian torsion in ovarian mature cystic teratomas . demonstrated significant correlation between serum ca19 - 9 levels and larger tumor size , although they failed to show a positive relationship between bilateral tumor involvement and serum ca19 - 9 levels . likewise , cho et al . reported that serum ca19 - 9 elevation was associated with larger tumor size and presence of a fat component in ovarian mature cystic teratomas . moreover , they suggested that simultaneous elevation of serum ca125 and ca19 - 9 was associated with a higher cancer risk ( p<0.001 ; or : 23.7 ; 95% ci : 8.86363.576 ) than single elevation of serum ca 19 - 9 . in our results , clinical characteristics associated with serum ca19 - 9 were not the bilateral tumor involvement or existence of torsion , but rather larger tumor size , serum ca125 elevation , and tumor pathology ( borderline or malignant ) . in agreement with results of prior studies , we found that the elevation of serum ca19 - 9 in ovarian mucinous tumors was significantly correlated with larger tumor size , with leakage as a likely mechanism . but more importantly , we should focus on the fact that tumor pathology ( borderline or malignant ) was the only independent risk factor for serum ca19 - 9 elevation in primary ovarian mucinous tumors ( or 3.842 , 95% ci 1.27711.558 , p=0.017 ) . subgroup analysis in women with normal serum ca 125 level showed that cancer risk ( borderline ) in women with serum ca19 - 9 elevation is 6.3 times higher than in those with normal serum ca19 - 9 level ( 95% ci 1.43819.648 , p=0.014 ) , which is comparable to results of cho et al . . as previously mentioned , serum ca19 - 9 is a well - recognized tumor marker in diagnosis and in predicting prognosis of various types of mucinous tumors in the gastrointestinal tract . there is little published evidence of the potential of ca19 - 9 as a preoperative diagnostic tool in ovarian cancer . , which failed to show a significant correlation between serum ca19 - 9 elevation and histologic subtype of primary ovarian mucinous tumors ( benign 27% vs. borderline 38% vs. malignant 40% , p=0.32 ) . although they found a weak but statistically significant correlation between tumor size and serum ca19 - 9 level ( spearman s rank correlation coefficient=0.17 , p=0.04 ) , they concluded that serum ca19 - 9 can not be used to predict histologic subtype of mucinous tumors . serum ca19 - 9 was elevated more frequently in borderline and malignant mucinous tumors , and multivariate analysis revealed that tumor pathology was the only independent correlating factor for serum ca19 - 9 elevation , regardless of tumor size and serum ca125 elevation . particularly , subgroup analysis in women with normal serum ca 125 level showed that cancer risk ( borderline ) in women with serum ca19 - 9 elevation is 6.3 times higher than in those without elevated levels of ca19 - 9 . serum ca19 - 9 , which is frequently elevated in primary ovarian mucinous tumors , can be a useful marker in predicting malignancy , particularly when serum ca125 level is not elevated . this is the first study suggesting a possible role of serum ca19 - 9 in diagnosis of borderline or malignant ovarian tumors , despite several weaknesses , including retrospective design and a small number of subjects . to clarify the diagnostic role of serum ca19 - 9 in discrimination of borderline and malignant tumors from benign mucinous ovarian tumors

backgroundthis study was designed to investigate the clinical characteristics correlated with serum ca19 - 9 elevation in primary mucinous ovarian tumors and to evaluate the role of serum ca19 - 9 in predicting borderline or malignant tumors.material/methodswe retrospectively identified 27 women with pathologically - confirmed primary ovarian mucinous neoplasms ( 16 borderline and 11 malignant ) , who had been preoperatively checked for serum ca19 - 9 and ca125 levels . the control group was established by 1:2 matching for age among all women with pathologically - confirmed benign mucinous tumors over the same time period . the associations of the serum ca19 - 9 elevation and clinical characteristics , including tumor pathology , were evaluated.resultsserum ca19 - 9 was more frequently elevated in borderline or malignant than benign tumors ( 57.9% vs. 16.7% , p=0.001 ) , although the mean value of serum ca19 - 9 was not significantly different among histological subtypes . ca19 - 9 elevation was correlated with large tumor size ( largest diameter 15 cm ; p=0.028 ) , serum ca125 elevation ( p=0.006 ) , and tumor pathology ( borderline or malignant tumors ; p=0.001 ) . other clinical characteristics , including parity , menopause , bilateral tumor involvement , and torsion were not correlated with ca19 - 9 elevation . multivariate analysis revealed that tumor pathology was the only independent factor for ca19 - 9 elevation in primary ovarian mucinous tumors ( odds ratio 3.842 , 95% ci 1.27711.558 , p=0.017 ) . interestingly , subgroup analysis in women with normal serum ca 125 level revealed that ca19 - 9 was significantly correlated with borderline and malignant tumors but not with benign tumors ( odds ratio 6.3 , 95% ci 1.43819.648 , p=0.014).conclusionsserum ca19 - 9 can be a useful complementary marker in differentiating benign from borderline or malignant mucinous tumors in the ovaries , particularly when serum ca125 level is not elevated .

long time ago , before any clinical study , it was believed that most suicides occur in the fall and winter , when there is less light , which in humans leads to mood swings ( 1 , 2 ) . the human body is very sensitive to changes in temperature , humidity , wind , air pressure , insolation , precipitation , positive or negative air ionization , particularly when these factors increase or decrease ( 3 ) . with the increasing number of publications and increasingly rigorous studies , it became clear that the period of spring and early summer are periods for the most frequent occurrence of suicide ( 4 , 5 ) . from the cooperation between meteorologists and doctors meteropathy is defined as a group of symptoms and reactions that are manifested when there is a change of one or more meteorological factors ( 3 ) . usually there is a case of middle - aged women , the elderly and chronically ill , or in total of every third inhabitant of our planet ( 5,6 ) . weather conditions affect human mood , and many people believe that they are happier when the days are longer with sunny intervals , then when the days are shorter , darker and rainy ( 5 ) . forward , and has been particularly linked with affective disorders and tragic consequences in the suicides ( 5 , 6 ) . the term climate is considered to be a set of meteorological phenomena and factors in a given period of time which constitute the state of the atmosphere over some part of the earth s surface ( 7 ) . contemporary definitions define climate as a dynamic system in which participate affect each other the atmosphere , oceans , lithosphere , ice and snow cover and biosphere including human impact ( 7 , 8) . based on the collected data and their values the climate is divided into several so - called climate zones and our country is divided into three zones : north temperate continental , central part with the continental and south with mediterranean climate ( 8) . some weather parameters in a certain way alter the functions of the human organism and are considered as stressful time . strong ionized wind known as the fohn and so called warm fronts are the two most common climatic stress factors ( 8 , 9 ) . determine the total number of patients admitted to psychiatric clinic during the period 2010/2011.determine the most common psychiatric disorders in the examined period.determine whether there is an increased incidence of some psychiatric disorders in certain seasons during the 2010/2011.determine whether specific weather parameters affect the increased incidence of some psychiatric disorders . determine whether there is an increased incidence of some psychiatric disorders in certain seasons during the 2010/2011 . this study was conducted in the period from january 1st 2010 to december 31st 2011 at the psychiatric clinic , clinical center of sarajevo university and includes respondents selected randomly . on a total of 2355 respondents , aged from 5 to 89 years there was 669 ( 58% ) male respondents was , and during 2011647 or 54% . female respondents in 2010 was 486 ( 42% ) , and in 2011553 ( 46% ) . the idea was grouping of patients into groups based on diagnoses that are commonly present in this period , and processing of data on subjects relevant to the study itself . the survey instrument that was used is structured psychiatric interview and the diagnosis made according to icd-10 classification system . conducted is a clinical study which includes a retrospective - prospective study , based on observation and analysis of the variables present , the processing of diagnostic entities , and the same grouping . also performed is the comparison the incidence of certain psychiatric disorders in certain months of the year in order to find possible correlation between the occurrence of certain diseases and seasons , and the correlation of certain weather parameters ( temperature , humidity , barometric pressure , precipitation ) and increased admission rates of patients at psychiatric clinic . the study used data from the federal hydrometeorological institute in sarajevo on the values of climatic parameters for 2010 and 2011 , relevant to the research and related to the climatological analysis of the situation in these years . statistical analysis of data obtained during the study was performed using stigmastat 3.5 and microsoft office excel 2007 . the data are , after the statistical analysis presented in tables and charts , and included the number of patients in certain diagnosis and reporting to clinic in certain seasons and months of the year . statistical significance between the groups was tested by chi - square test and kolmogorov - smirnov test , depending on the data type . during processing data of the respondents ( n-2355 ) who were admitted to clinic during the period from 2010 and 2011 , set aside the fact that the majority of hospitalized were under the diagnosis of schizophrenia , anxiety disorders , reaction to severe stress , mood disorders , bipolar disorder , depression and behavioral disorders due to use of psychoactive substances . we also discussed the frequency of suicide in the same period . from the table 1 it is evident that with the diagnosis f10-f19 most respondents was admitted during the falloff 42% , then the summer24% , 22% during the spring and 12% during winter . with the diagnosis f20-f29 most patients was admitted in the spring27% , then in the summer and fall with 25% and 23% during the winter . with diagnosis f30-f39 most patients were admitted in the spring 28% , then 27% during the winter , fall 25% and 20% during the summer . with diagnosis f40-f48 the most patients were admitted in the winter 29% , then fall 28% , 23% during the spring and 20% during summer . in case of suicide attempts 50% of respondents chi - square test revealed statistically significant differences in the prevalence of certain diagnostic groups according to the seasons of 2010 at the confidence level of 99% or p<0.01 . from table 2 is obvious that most patients with diagnoses f10-f19 were admitted in the spring30% . with diagnosis f20-f29 chi - square test revealed statistically significant differences in the prevalence of certain diagnostic groups according to the seasons of 2011 at the confidence level of 99% or p<0.01 . table 3 shows the weather parameters , whose influence was studied in the course of study with their values for all months in 2010 as well as an increase or decrease the number of patients admitted during the month in which significant changes were observed . so it is determined the increase in diagnoses f10-f19 in august , october , december and decline in march . the increase in diagnoses f20-f29 in the months of january and may and decrease in november . for diagnosis table 4 shows the weather parameters , whose influence was studied in the course of this study and their values for all months in 2011 as well as an increase or decrease in the number patients admitted during the months in which significant changes were observed . it was found the increase in the number of patients with diagnoses f10-f19 in june and decrease in july . the increase in diagnoses f20-f29 was recorded in september and november and decrease was recorded in december . for diagnosis most of them in march 4 , 2 in april and june , and one attempt in january , february , may , august , october , november and december . statistical analysis by spearman rank correlation coefficient shows that in the case of diagnostic group f10-f19 there is a weak statistically significant correlation with temperature , precipitation and humidity , which indicates that the increase of these parameters leads to the increased number of admissions of patients with these disorders . in case of diagnostic group f20-f20 strong statistically significant correlation was found by months ( more hospitalizations in the second half of the year ) , and the temperature which indicates that increase in temperature leads to more frequent hospitalization of people with this diagnosis . for the diagnostic group f30-f39 demonstrated is strong statistically significant correlation only to the temperature , or that the increase in temperature affects the number of hospitalizations with this diagnosis . likewise , for the diagnostic group f40-f48 was found a strong correlation with the months of the year which indicates a greater number of hospitalizations in the second half of the year ( july december ) . suicide attempts shows no statistically significant correlation with any one of the monitored parameters , which can certainly be attributed to the small number of patients in the observed period , which hinders accurate analysis . as seen from the above results , this study conducted at the psychiatric clinic , clinical center of sarajevo university included a total of 2355 respondents , of whom 1039 were women and 1316 men . during this study data were taken from the federal hydrometeorological institute bjelave in sarajevo with the values of climatic parameters for 2010 and 2011 year that were relevant to the survey and also take the same information about the climatological analysis of the situation in that year . patients are processed and sorted into groups according to the diagnoses under which they were admitted to the clinic . followed were four diagnostic entities that have the highest percentage during these years . by analyzing and processing the collected data showed that the frequency of admission at the clinic during the two years were patients with the diagnoses f40-f48neurotic and somatoform disorders caused by stress , which include phobic anxiety disorder , obsessive compulsive disorder , dissociative disorders , somatoform disorders and reactions to severe stress . the total number of patients with diagnoses f40-f48 , which were admitted during the 2010 was 385 and during the 2011353 patients . the temperature values were then lower than the average , precipitation were higher than the average , with normal humidity and the air pressure with slightly lower than normal values . the temperature was higher than average while precipitation , humidity , and air pressure was normal . the temperature was higher , precipitation , humidity and atmospheric pressure was within normal values . during the 2011 the majority of patients were admitted in january or 45 . the temperature was higher than average while precipitations , humidity , and atmospheric pressure was lowered . in the month of march air temperature was higher and the amount of precipitations , with normal pressure and humidity . the smallest number of respondents was admitted in july19 , when the air temperature was lower than average and precipitation with normal pressure and humidity . from the obtained data we can say that the information on certain weather parameters were the same for 2010 and 2011 when it comes to increase the number of patients admitted , but only for two months , other months where there has been an increase in patients admitted there was no changes in weather parameters , and it can be concluded that there is a specific , constant form which could explain why these diagnoses occur just in certain months or circumstances of some weather parameters . thus , the group under common diagnosis codes f40-f48 ( neurotic and somatoform disorders caused by stress ) , during the 2010 the majority of patients were admitted during the winter 29% , fall 28% , 23% during spring and summer with 20% . during the 2011 the majority of patients were admitted during the winter 32% , 26% fall , spring 24% and summer 18% . the authors come to a conclusion similar to ours that these disorders occur independently of climatic factors ( 2 ) . in second place were diagnosis f20-f29 ( schizophrenia , schizophrenia like disorders and mad states ) . in both years the number of respondents is the same338 . during the 2010 the most respondents 27% were admitted in spring , summer and autumn alike with 25% and 23% during the winter . temperatures were above average for that month and for the whole year , with increased rainfall , and humidity and pressure values within the limits of normal . in november the temperature was higher than the average for that month , and the values of pressure , rainfall and humidity were within normal . it was reported that the temperature during this period was higher than average and precipitation , humidity and pressure were within normal values . we can therefore conclude that the months in which increase was recorded in daily temperatures were those months in which were admitted to psychiatric clinic patients with multiple diagnoses f20-f29 in both years and that their number decreased with the months with lower temperature . these results coincide with the results of relevant literature that during the summer months there is an increased number of hospitalized patients suffering from schizophrenia ( 6 ) . also , the authors have reached research results , as in our study that the summer season is with the highest schizophrenia prevalence ( 10 , 11 ) . in third place were diagnosis f30-f39-mood disorders , which include episodes of mania , bipolar disorders , depression , recurrent depressive disorder , constant mood disorders and other mood disorders . during the 2010 , 266 respondents were admitted , and during the 2011 , 268 . during the 2010 temperatures were below average , precipitations increased , and the values of humidity and atmospheric pressure within the limits of normal . in temperatures then were higher than average as well as precipitation , and the values of relative humidity and atmospheric pressure were normal . during the 2011 the most patients were admitted in march31 and november 30 . the temperature in these months was above the average value as well as the amount of rainfall , and the values of humidity and atmospheric pressure were within normal . the least number of patients were admitted in july11 , when the temperature was normal for the month , rainfall decreased and the values of humidity and atmospheric pressure normal . from this we can conclude that the month of july was the month where it was registered both the lowest rate in patients admitted at the psychiatric clinic , and this is the month with a relatively nice weather and higher temperatures as the data show . months in which there was an increase of the admissions are january , march , may and november , months where the mean monthly temperatures was lower than the month of july , no matter what the value of these months were above average , and this could be taken as possible explanation for the obtained data . thus , during most of 2010 patients were admitted in the spring or 28% , then during the winter with 27% , with 25% fall and 20% during summer when it comes to mood disorders . during the 2011 the most admitted patients or 28% was during the winter , autumn and spring , with 26% and 20% during the summer . the study of a mood disorders shows the existence of one of the two peaks which appear in spring and autumn as well as appearing semi - cyclic and cyclic periods of the same diagnostic group of respondents who belong to the same diagnostic groups ( 9 , 12 ) . admission rates for subjects suffering from mood disorders depends on climatic factors and us higher in spring and autumn ( 9 , 12 , 13 , 14 ) . at the fourth place in this study were diagnoses f10-f19 ( mental and behavioral disorders caused by the use of psychoactive substances ) . during the 2010 at the clinic 59 patients were admitted , and 53 during the 2011 . during the 2010 the majority of patients were admitted in the fall of 42% , then 24% in the summer , spring 22% and winter 12% . in 2010 the highest admission rate was recorded in the fall , but the fall of that year by the data of the hydrometeorological institute was warmer than average and this can be considered as a possible reason . during the 2011 the majority of patients with this diagnosis was admitted in the the spring ( june ) 30% , then 29% during the winter , autumn 26% and summer 15% . many authors agree that high - lighted part of spring as the top of the hot season increases the number of patients admitted with this diagnosis ( 8,9,10 ) . also , these data coincide with our data for 2011 where most of the respondents were admitted in the spring . respondents were also analyzed , in addition to sex and most diagnoses according to age and were found that most respondents are aged between 51 and 60 years with 35% , and least in the age of 15 - 18 years with 2% . as a separate entity was analyzed a group of patients who attempted suicide , because there is some evidence to argue that suicide attempts occur at certain times of the year ( 4 , 5 ) . during the 2010 there were 2 attempted suicides , one in march and another in july . in march the temperature was lower than average , with increasing amounts of precipitation for the month , increasing humidity and low air pressure . in july the temperature was normal , with increased precipitation , while humidity and air pressure are normal . we could draw the conclusion that an increase in rainfall in both months could present information that might indicate a connection with attempted suicide , although the sample is extremely small that we could make quality conclusions . as for the 2011 , there were significantly more suicide attempts in relation to the 2010r . whether it was because of the weather , difficult social situation , or some other problem to which the patients were more exposed is unknown . a total of 15 patients attempted suicide , the highest number in the march 4 , april 2 , in january , february , may , august , october , november and december 1 , and none in june and september . most suicide attempts were registered or 40% in winter , spring 33% , 20% during fall and summer with 7% . when we look at the values of weather parameters for the month of march when it there was most suicide attempts it can be seen that the value of air temperature was higher than average as well as precipitation with a slightly lower percentage of humidity and normal atmospheric pressure . in april when the two patients attempted suicide temperature was normal with normal precipitation , normal values of humidity and air pressure . in july and september , the month when no one has attempted suicide temperature was normal with very little rainfall and humidity , with normal air pressure , and we could talk about a possible correlation between increased rainfall and increased number of suicides , if we could be able to exclude other possible factors that could lead to attempting suicide . by analyzing the data , we conclude that in 2010 one male respondent attempted suicide in the spring , which coincides with data from relevant studies , and one female during the winter period which does not coincide with data from relevant studies ( 4,5 ) . similar results reached the authors of the research on suicide in correlation with the seasons ( 4,5,15 ) . during the 2011 the more men attempted suicide in the spring of 27% , which again coincides with the relevant data , and women during the winter 26% and 20% fall , which again as for a period of 2010 does not coincide with the relevant literature ( 4 , 5 , 11 , 14 , 15 ) . number of attempted suicides in this period is negligibly small to be able based on this number draw a conclusion and compare it with other studies . when we talk about a possible deviation of some results from those studies in the literature should be taken into account that no one has taken the relevant studies conducted in bosnia and herzegovina or of this part of the european continent , where the different climatic conditions and where people are exposed to different climatic factors and elements . it should also be taken into consideration whether the respondents were due to other reasons were admitted to the clinic , or whether the worsening of their underlying disease was caused by some specific condition or situation , and that weather in the period of health worsening they were in open or indoors , and whether they were generally exposed to the weather , because there are in fact in some studies done in psychiatric asylums where patients part of the day spent outdoors . as for research directly related to suicide attempts , the sample is small to be able to make some precise conclusions , and we need to continue research in this field . statistical analysis confirmed the hypothesis that the rate of admissions with the most common psychiatric illnesses during the 2010 and 2011 is in correlation with the climatic elements and weather conditions and tends to increase with climate change in certain parameters , and that the admission rate of patients with the most common psychiatric illnesses during the 2010 and 2011 increase in certain seasons . specifically , as can be seen from table 5 statistical analysis spearman rank correlation coefficient indicates that the climate and climatic factors have a statistically significant effect on the rate of patients admitted to treatment in all diagnostic groups except for f10-f19 . for this diagnostic group , there is a weak statistically significant correlation with temperature , precipitation and humidity , which indicates that the increase of these parameters leads to the increasing number of patients admitted with these disorders . also suicide attempts shows no statistically significant correlation with any one of the monitored parameters , which can certainly be attributed to the small number of patients in the observed period , which hinders accurate analysis . one explanation is that the correlation in this study , which explains higher frequency of meteropathy today s is modern lifestyle , which is further away from nature . scientists believe that life is mainly carried out in sealed , air - conditioned spaces often reduces the ability of our body s natural adaptation to different environmental conditions . the human body is accustomed to closed spaces , which are often overheated in winter and cooled in summer so that self - regulation mechanisms are no longer able to optimally respond to sudden weather changes ( 3 ) . statistical analysis by spearman correlation coefficient indicates that the climate and climatic factors have a statistically significant effect on the rate of patients admitted for the treatment in all diagnostic groups except for f10-f19 . for this diagnostic group , there is a weak statistically significant correlation with temperature , precipitation and humidity , which indicates that the increase of these parameters leads to the increasing number of patients admitted with these disorders . also suicide attempts shows no statistically significant correlation with any one of the monitored parameters , which can certainly be attributed to the small number of patients in the observed period , which hinders accurate analysis . comparing the results we obtained by analyzing the data of conducted study with other literature studies we obtained partial matching results . the results of these studies induce the need for future research , especially the correlation of suicide attempts and climatic factors ( this sample is small to be able to make some important conclusions ) .

introduction : climate and its impact on human health and mental illness have been in the focus of the research since years in the field.aim:the aim of the research is to study the admissions rate to the psychiatric clinic in correlation to seasons and climate.material and method : the research was conducted in a psychiatric clinic of the clinical center in sarajevo . randomly selected subjects ( aged 5 - 89 years , 1316 males and 1039 females ) n=2355 , were interviewed by the structural clinical interview ( scid ) which generated dsm - iv . in this retrospective - prospective , clinicalepidemiological study subjects were divided into groups according to type of disorders . correlation between the impact of seasons and the rate of admissions to a psychiatric clinic was analyzed . certain data were taken from federal hydrometeorological institute in sarajevo of the climatic situation for period of the study.results and conclusions : of the total number of subjects who were admitted to the clinic in the period of 2010/2011 the most common diagnoses were f10-f19 , f20-f29 , f30-f39 , f40-f48 , and the suicide attempts as the separate entity . it was found correlation between certain seasons and the effects of the certain weather parameters at an increased admission rate of subjects with the certain diseases .

candida species are the most important opportunistic fungal pathogens of humans responsible for superficial and systemic infections ( 1 ) . among these species , candida albicans is responsible for the majority of infections , but other species are becoming increasingly common ( 1 ) . because of its predominance , c. albicans has been the focus of genomic and molecular studies over the last 20 years , becoming a model organism for other pathogenic candida species and fungal pathogens . the c. albicans genome was made publicly available by the stanford genome technology center at the end of the 1990s and different assemblies and annotations have been released since ( 24 ) . this has been accompanied by the implementation of two main genomic databases : candidadb ( 5 ) and the candida genome database ( 6,7 ) . as infections due to non - albicans candida in hospitals genome sequencing projects for these species , as well as related non - pathogenic yeast species , have been completed or are nearing completion ( 4,912 ) . the availability of numerous related genomes paves the way for comparative genomic approaches that have already contributed to our understanding of the evolutionary processes that underlie speciation in the sachharomycotina subphylum ( 10,1315 ) . applied to closely - related pathogenic and non - pathogenic yeast species , comparative genomics should provide insights in virulence processes . to date , most yeast genomes are available at different databases and there is no resource that enables online comparative analysis . the current aim of the candidadb database is to provide such a comparative resource for species of the ctg clade of the subphylum saccharomycotina that is characterized by the translation of the cug codon into serine instead of leucine . the ctg clade includes c. albicans and several of the most important human pathogenic fungi ( 1618 ) . candidadb provides genome sequences of four pathogenic [ c. albicans , candida tropicalis , candida ( clavispora ) lusitaniae , candida ( pichia ) guillermondii ] and three non - pathogenic ( lodderomyces elongisporus , debaryomyces hansenii , pichia stipitis ) species belonging to the ctg clade ( table 1 ) . it has been enriched with illustrations of structural features and functional domains and tools for sequence comparisons and analysis . moreover , new tools for comparative genomics have been implemented in order to take advantage of the integration of multiple genomes in a unique database . importantly , pre - calculated comparisons provide rapid access to comparative analysis at the protein and genomic scale . table 1.characteristics of the nine genomes available in the current release of candidadbspeciesstrainnumber of proteinsnumber of chromosomes and/or supercontigsstatus and release datesequencing center / database repositorydatabase linkscandida albicanssc531460988draft assembly 13 september 2006cgdhttp://www.candidagenome.org / candida albicanswo1615916draft assembly 15 march 2006broad institutehttp://www.broad.mit.edu / annotation / genome / candida_albicans / candida guilliermondiiatcc626059209draft assembly 15 march 2006broad institutehttp://www.broad.mit.edu / annotation / genome / candida_guilliermondii / candida tropicalismya-3404625823draft assembly 12 june 2006broad institutehttp://www.broad.mit.edu / annotation / genome / candida_lusitaniae / debaryomyces hanseniicbs76763187complete 3 july 2004gnolevureshttp://cbi.labri.fr / genolevures 2007jgihttp://genome.jgi - psf.org / picst3/picst3.home.htmllodderomyces elongisporusnrll yb-4239580227draft assembly 12 june 2006broad institutehttp://www.broad.mit.edu / annotation / genome / lodderomyces_elongisporus / saccharomyces cerevisiaes288c585816complete 27 march 2007sgdhttp://www.yeastgenome.org / total954 170124 characteristics of the nine genomes available in the current release of candidadb eight publicly available genome sequences of seven closely related species belonging to the ctg clade are included in the new release of candidadb : the genomes of c. albicans strains sc5314 ( 2 ) and wo1 ( 20 ) ; three genomes of other pathogenic species , c. tropicalis strain mya-3404 ( 21 ) , c. lusitaniae strain atcc42720 ( 22 ) and c. guilliermondii strain atcc6260 ( 23 ) ; and the genomes of three non - pathogenic species , l. elongisporus strain nrll yb-4239 ( 24 ) , an ascososporogenous species , d. hansenii strain cbs767 ( 10 ) , a halotolerant yeast found in fish and salted dairy products that have a role in agro - food processes and pichia stipitis strain cbs6054 ( 12 ) , a xylose fermenting yeast . the new release of candidadb also includes the s. cerevisiae strain s288c genome ( 19 ) in order to take advantage of the high level of annotation provided for this species that is not part of the ctg clade but is part of the saccharomycotina subphylum ( 17 ) . these genome sequences and associated annotations were obtained from the sources indicated in table 1 that summarizes the general information for the nine genomes available in the current version of candidadb . the new version of candidadb uses assembly 20 of the genome sequence of c. albicans strain sc5314 genome available at the candida genome database ( cgd ) ( 4,7 ) . while previous releases of candidadb used annotations contributed by the galar fungail consortium ( 5 ) , candidadb now uses sequences , descriptions , accession numbers and annotations available at cgd which is the reference depository site for c. albicans . the genomes of p. stipitis , d. hansenii and s. cerevisiae available through candidadb are considered completed and have been published ( 10,12,19 ) , while the other genomes are draft assemblies , close to completion and with a low number of contigs . candidadb aims to follow the usual accession number for open reading frames ( orfs ) provided by the institutions which performed the sequences , for better clarity , inter - database relations and faster update procedures . genolist is an integrated environment for multiple genomes based on a relational database run through a web user interface that provides comparative genomic and proteomic tools in complement to the gene descriptions . genolist has been originally developed as a multigenome database for comparative analysis of bacterial genomes ( 25 ) and has been adapted to eukaryotes in order to manage the candidadb database . when connecting to candidadb , users are prompted to register and provide a login and password . although this is optional and no tracking of the registered users is performed , it allows users to specify parameters for candidadb usage ( see subsequently ) and maintain these parameters upon return to the database . upon registered or unregistered login , users have access to a web interface that is composed of a main window allowing different forms of queries and analysis at the gene , genome and multi - genome scale genes can be accessed through a gene specific window providing reports , a dynamic map of the genomic environment , pre - computed data of comparative proteomic analysis and tools for sequence analysis and downloads as described subsequently . an important component of candidadb is the possibility for users to select those genomes that they wish to query from the list of all available genomes . users can define a favourite genome , a query list of genomes and a comparative list of genomes . through these selections , candidadb can be made a database focused on a favourite organism and provide comparative data for genomes of the comparative list only . several comparative and query lists can be specified and remain accessible to registered users upon return to the database . the migration of candidadb to the genolist multi - genome environment combined with the integration of nine genomes expands the possibilities for genome and proteome analysis and allows access to comparative genomics . search options are identical to those available in the previous version of candidadb : the left panel of the main window allows the search by gene names and synonyms , accession numbers , text and location in the set of genomes defined by the user ( favourite organism , query or comparative lists ) or in all genomes present in candidadb . blast search ( 26 ) and pattern search tools are also accessible from the left panel as well as two new tools for comparative genomic analysis , findtarget and difftool . findtarget ( 27 ) allows the user to identify genes from a given genome ( query genome , the user - defined favourite organism ) that , based on tuneable criteria ( percentage of identity , e - value , etc . ) , are specifically present in a set of genomes ( reference genomes , by default the user - defined query list ) and , optionally , absent in another set of genomes ( exclusion genomes , by default the user - defined comparative list ) . the algorithm makes use of pre - computed blastp best hits obtained upon systematic comparisons of all protein versus all proteins available in candidadb . difftool ( 28 ) allows the identification of protein families whose components are shared by a set of organisms ( reference genomes ) as compared to another set of organisms ( exclusion genomes ) . protein families have been pre - computed in candidadb using data of systematic blastp comparisons of every protein versus all proteins . several family sets are available according to the criteria used in the clustering procedure ( e.g. proteins that share at least 40 , 50 or 60% sequence similarity over 80% of the protein length ) . results are provided in the main window as a list of annotated protein families , each linked to the list of included proteins and a clustalw multiple alignment ( 29 ) . results of the different searches are displayed in the main window as gene lists , each gene being linked to a specific page that provides description , annotation and a graphical view of the genomic environment of the gene ( figure 1 ) . pre - computed results from comparative analysis for protein families ( difftool ) and best hits ( findtarget ) and a regularly updated blastp comparison to the non - redundant protein databank ( 30 ) are systematically available ( figure 1 ) . clustalw pairwise or multiple alignments with best hits found in the genomes of the comparative list are provided . additional protein features are displayed graphically showing signal peptide and membrane - spanning domains predicted using the phobius software ( 31 ) and pfam domains ( 32 ) ( figure 1 ) . direct links to relevant databases are listed in the cross - references panel ( figure 1 ) . tuneable , not pre - defined , search tools ( blast , difftool , findtarget ) and sequence retrieval tools are accessible in the analysis and sequence tabs of this gene window , respectively . figure 1.snapshot of a gene window for the c. albicans opt1 gene . the gene window displays annotation data , a dynamic map of the genomic region surrounding the opt1 gene , access to a protein cluster including the opt1 protein , a list of best hits identified in genomes of the comparative list with links to pairwise and multiple clustalw alignments , a list of bi - directional best hits in other genomes available in candidadb , a graphical representation of predicted signal peptide , transmembrane domains and pfam domains , and links to relevant pages in other databases . other tabs in the gene window allow access to dynamic analysis tools and tools for sequence retrieval . the gene window displays annotation data , a dynamic map of the genomic region surrounding the opt1 gene , access to a protein cluster including the opt1 protein , a list of best hits identified in genomes of the comparative list with links to pairwise and multiple clustalw alignments , a list of bi - directional best hits in other genomes available in candidadb , a graphical representation of predicted signal peptide , transmembrane domains and pfam domains , and links to relevant pages in other databases . other tabs in the gene window allow access to dynamic analysis tools and tools for sequence retrieval . the integration in a single database of a large number of genome sequences from related yeast species provides an unprecedented tool for comparative genomics of yeasts . the new version of candidadb aims to provide information complementary to that available at the candida genome database by implementing comparative genomic tools and by providing data on functionally - relevant protein domains which were not directly available yet . access to these data is facilitated by the use of pre - computed multi - genome analysis that are normally cpu - intensive . yet candidadb provides the ability to perform similar queries with user - defined parameters avoiding the limitations of these static results . the user - defined lists of genomes allow the user to limit searches and results to selected organisms , an option that will be increasingly useful when a larger number of genomes becomes available through the database . candidadb is a convenient entry point for the community working on other candida species than c. albicans since any candida genome can be used as the favourite genome . it should be helpful for those who are working with genomes that are still undergoing annotation . in this regard , the comparative tools available in candidadb can be used to refine some of the gene models provided by sequencing centers . they can also be used to focus functional genomic studies that should eventually identify gain or loss of functions that underlie the differences in pathogenicity , virulence and morphogenesis observed between the different species of the ctg clade of saccharomycotina . other genomes of species within the ctg clade , e.g. c. parapsilosis and c. dubliniensis , have been recently sequenced and are undergoing annotation . the same is true for species of the saccharomycotina that do not belong to the ctg clade . our aim is to incorporate these genomes into candidadb as they become publicly available , to update sequences and annotations in a regular manner and to provide new tools for comparative and structural analysis . in particular , the incorporation in candidadb of a synteny visualisation tool will greatly help in the interpretation of the comparative data outputs .

candidadb ( http://genodb.pasteur.fr/candidadb ) was established in 2002 to provide the first genomic database for the human fungal pathogen candida albicans . the availability of an increasing number of fully or partially completed genome sequences of related fungal species has opened the path for comparative genomics and prompted us to migrate candidadb into a multi - genome database . the new version of candidadb houses the latest versions of the genomes of c. albicans strains sc5314 and wo-1 along with six genome sequences from species closely related to c. albicans that all belong to the ctg clade of saccharomycotina candida tropicalis , candida ( clavispora ) lusitaniae , candida ( pichia ) guillermondii , lodderomyces elongisporus , debaryomyces hansenii , pichia stipitis and the reference saccharomyces cerevisiae genome . candidadb includes sequences coding for 54 170 proteins with annotations collected from other databases , enriched with illustrations of structural features and functional domains and data of comparative analyses . in order to take advantage of the integration of multiple genomes in a unique database , new tools using pre - calculated or user - defined comparisons have been implemented that allow rapid access to comparative analysis at the genomic scale .

cancer is a term used for a group of diseases in which abnormal cells divide uncontrollably , having the ability to invade other tissues and spread to other parts of the body through the blood and the lymph systems . it is one of the dominating causes of death worldwide , being responsible for 8.2 million deaths in 2012 , while annual cancer cases are expected to rise from 14 millions in 2012 to 22 millions during the next two decades . there are a number of cancer treatment approaches , with surgery , chemotherapy , and radiotherapy being some of the most common ones . traditional chemotherapy drugs act against all rapidly dividing cells , including the non - cancerous ones , a disadvantage that led to an increased interest in the development of targeted anticancer therapies ( tats ) . tat refers to the systemic administration of drugs or other substances with particular mechanisms that interfere with specific molecules involved in cancer cell growth and survival , and have minimized adverse effects on healthy cells.17 antibody drug conjugates ( adcs ) constitute a class of tat . an adc molecule consists of three components : a cytotoxic drug , also called payload ; a tumor - targeting monoclonal antibody or antibody fragment ; and a molecule that connects the previous two , called linker . its mechanism of action can be described in general terms as the binding of the antibody to its antigen and the subsequent release of the cytotoxin , which results in the death of the cancer cell . the choice of the antibody depends on the target antigen , usually a molecule present in cancer cells at a much higher concentration than in normal cells . therefore , the expected performance from an adc upon its administration to the patient is to remain stable in circulation and deliver the cytotoxic substance selectively to cancer cells , maximizing their exposure to the drug , while minimizing the exposure of healthy cells . some adcs are internalized by the cell upon the binding of the antibody to the target , although other adcs reduce the blood supply of the tumor by targeting endothelial cells within the tumor vasculature . there are three internalization routes : clathrin - mediated endocytosis , caveolae - mediated uptake , and pinocytosis.818 the most common antibody form incorporated in adcs is the full monoclonal antibody , or immunoglobulin ( igg ) . iggs have a long half - life in blood , usually spanning from days to weeks , which enables them to travel in the blood vessels for a time long enough to locate the tumor cells.1922 the second part of the adc , the linker , is required to be stable during the circulation of the adc in the bloodstream in order to avoid the premature release of the drug , as well as able to discharge the drug after the binding of the antibody to its antigen . cleavable linkers include lysosomal protease - sensitive linkers , acid - sensitive linkers , and glutathione - sensitive linkers.2325 regarding the cytotoxic part of the adc , there are two main classes of adc payloads that have been explored , the first one being drugs that disrupt microtubule assembly , such as auristatins and maytansinoids , and the second one being drugs that target dna structure , such as calicheamicins and duocarmycins.8,9,2529 since the hypervariable regions of the antibody are expected to bind to the cancer - specific antigen , they are not advisable as conjugation sites . instead , the conjugation of a linker to an antibody takes place at the more preserved regions of the antibody , at solvent - accessible reactive amino acids.30,31 two amino acids typical for conjugation with drugs are lysines and cysteines , the latter being exposed after the reduction of the interchain disulfide bonds of the antibody . even though the number of drugs linked to an antibody is usually 08 , conjugation can occur at 40 different lysines and at 8 different cysteines per antibody . the numerous possible conjugation sites , in combination with the fact that the drug - to - antibody ratio ( dar ) can be larger than 1 , means that numerous different adcs can be generated from the same antibody , drug , and linker . in addition , controlling the site and stoichiometry of drug conjugation to the antibody is not easy and typically results in heterogeneous mixtures of adcs . heterogeneous adcs do not have well - defined in vivo pharmacokinetic properties , which is a disadvantage in terms of their therapeutic effect and manufacturing process , and they can not be easily optimized . therefore , the production of homogeneous adcs is a necessity and a lot of effort is being made toward that direction . part of that effort is the accomplishment of site - specific conjugation with a number of methods , such as cysteine engineering , glycoengineering , and enzymatic conjugation , as well as use of non - native amino acids such as selenocysteine , acetylphenylalanine , para - acetylphenylalanine , and para - azidophenylalanine.12,19,3237 drug development is a complicated , time - consuming , and expensive process . bioinformatics is a multidisciplinary scientific field that aids this process , giving the opportunity to model biologically active molecules and make estimations about their properties . for example , computational drug design and molecular mechanics methods , although imperfect , aim to predict whether a given molecule will bind to a target and with what binding affinity . the information obtained through those computational methods , even though it is not exact , accelerates the process of drug discovery . however , even though a number of computational tools for drug design exist , the specialized field of adc computational design has been explored to a much smaller degree.3845 the in silico study of biological molecules requires their computational representation , usually in the protein data bank ( pdb ) format . the pdb format provides a standard representation for three - dimensional structures of biological macromolecules , derived experimentally with x - ray diffraction and nmr studies . a pdb file includes information about the primary , secondary , and tertiary structure of the molecule described . the atomic coordinates of the molecule , as well as the bonds between its atoms are some of the most essential data contained . however , additional information can be included , such as crystallographic structure factors , nmr experimental data , sequence database references , and bibliographic citations.46 in this paper , a method of computational construction of adcs using data from established databases is described . the three pdb files of the antibody , the linker , and the drug are processed and merged into a final pdb file of an adc molecule . specifically , the configuration of the linker and the drug molecules is changed so that they are aligned with the antibody , and hydrogen bonding occurs between the successive molecules in the adc triplet . the amino acids of the antibody that were chosen to be conjugated with the linker are lysines in the surface of the antibody . the change in the configuration of the linker and the drug is accomplished via translation and rotation . the data used are antibodies from the rcsb protein data bank and anticancer drugs from the open national cancer institute database , as well as the molecule c15n , which represents a non - cleavable linker , all as pdb files . chimera is developed by the resource for biocomputing , visualization , and informatics at the university of california , san francisco ( supported by nigms p41-gm103311).41 in this section , the process of the computational conjugation of the antibody , the linker , and the drug is described in more detail . as previously explained , the goal of the program developed is to produce the pdb file of an adc molecule , given the pdb files of an antibody , a linker , and a drug . the drug and the linker are reconfigured via rotation and translation in order to be brought in positions appropriate for the hydrogen bonding to occur between the linker and the drug , as well as between the linker and a surface lysine of the antibody . the change in the configuration of the antibody , the linker , and the drug was executed computationally by changing their atomic coordinates . first , the drug was rotated and translated in relation to the linker , while the linker remained stable . drug conjugate was rotated and translated in relation to the selected surface lysine of the antibody , while the antibody remained stable . similarly , the two files were merged to produce the final pdb file of the antibody drug conjugate . in order for the reconfiguration of the molecules to be correct , the changes in their atomic coordinates had to preserve the initial lines and distances between the atoms , which was accomplished with the use of an affine transformation . an affine transformation is any transformation that preserves collinearity , which means that all points placed on a line before the transformation still lie on a line after the transformation . it also conserves the ratios of distances , which means that the midpoint of a line segment remains the midpoint after the application of the transformation.47,48 according to the homogeneous transformation matrix defined in ref . 49 , the change in the position of an atom can be described with the following equations , r00=a*cos(rz)*cos(ry ) r01=a*(cos(rz)*sin(ry)*sin(rx)sin(rz)*cos(rx ) ) r02=a*(cos(rz)*sin(ry)*cos(rx)+sin(rx)*sin(rx ) ) r03=tx r10=a*(sin(rz)*cos(ry ) ) r11=a*(sin(rz)*sin(ry)*sin(rx)+cos(rz)*cos(rx ) ) r12=a*(sin(rz)*sin(ry)*cos(rx)cos(rz)*sin(rx ) ) r13=ty r20=(1)*a*sin(ry ) r21=a*cos(ry)*sin(rx ) r22=a*cos(ry)*cos(rx ) r23=tz x=r00*(x)+r01*(y)+r02*(z)+r03 y=r10*(x)+r11*(y)+r12*(z)+r13 z=r20*(x)+r21*(y)+r22*(z)+r23 where x , y , z are the initial coordinates of an atom , x , y , z are the new coordinates of the atom , a is the scaling factor , set at the value of 1 since in this project scaling was not necessary , rx , ry , rz are the rotation angles of the atom around the x , y , z axis , respectively , and tx , ty , tz are the distances according to which the atom will be translated in the x , y , z direction , respectively . in order to rotate a molecule in relation to another molecule the axis of the linker was defined as the line connecting its two most distant non - hydrogen atoms , in order to be representative of the shape of the molecule . for that purpose , the distance between every pair of heavy atoms of the linker was calculated , and the pair with the largest distance was chosen . these two atoms also participated in the connections of the linker with the drug and the antibody , as will be explained in the following paragraph . the axis of the drug was defined as the line connecting the hydrogen atom of the drug that took part in the hydrogen bond with the linker and the electronegative atom of the drug covalently bonded to it . drug conjugate was defined as the line connecting the two most distant non - hydrogen atoms of the linker drug conjugate , similarly to the axis of the linker . finally , the axis of the lysine was defined as the line connecting the alpha carbon of the lysine and the nitrogen atom of its side chain , since this line is directed toward the exterior of the antibody , which is the desired direction for the linker similarly , in order to translate a molecule in relation to another molecule , a distance between them had to be defined . the distance between the drug and the linker was defined as the distance between the hydrogen atom of the drug that participates in the hydrogen bond with the linker and the linker atom that participates in the hydrogen bond with the drug , which was selected to be one of the two most distant atoms of the linker . the distance between the linker drug conjugate and the antibody is defined as the distance between the linker atom that participates in the hydrogen bond with the antibody , which was selected to be one of the two most distant atoms of the linker drug conjugate , the one that belongs to the linker , and a hydrogen atom covalently bonded to the nitrogen of the lysine side chain . as a molecule ( ie , the drug or the linker drug conjugate ) rotates in relation to a stable molecule ( ie , the linker or the antibody , respectively ) , or equivalently as the values of the variables rx , ry , rz change , the angle between its axis and the axis of the stable molecule is calculated . the values of rx , ry , rz for which this angle becomes minimal are selected , and finally the molecule is rotated according to those angles . similarly , as a molecule ( ie , the drug or the linker drug conjugate ) is translated in relation to a stable molecule ( ie , the linker or the antibody , respectively ) , or equivalently as the values of the variables tx , ty , tz change , the distance between those two molecules is calculated as described in the previous paragraph . the values of tx , ty , tz for which that distance becomes minimal are chosen , and the molecule is translated according to those values . according to the steiner saenger definition of the hydrogen bond , a hydrogen bond is any cohesive interaction x ha where h carries a positive and a a negative ( partial or full ) charge and the charge on x is more negative than on h. the molecule c15n , which represents a common non - cleavable linker , can form hydrogen bonds with a drug as well as a lysine amino acid of an antibody . in particular , every hydrogen atom of the drug that is connected to a heavy atom more electronegative than hydrogen can form a hydrogen bond with a heavy atom of the linker , such as carbon . similarly , the nitrogen atom of the lysine side chain and the hydrogen atom covalently bonded to it can form a hydrogen bond with a carbon atom of the linker . after a molecule has been rotated and translated in relation to the stable molecule , the hydrogen bond is simulated computationally by deleting the hydrogen atom of the hydrogen donor from the pdb file , before the two files are merged into one pdb file.50 the final adc molecule obtains a realistic conformation , as ensured by a final minimization step using the molecular dynamics package gromacs , and specifically the gromos bonding library.51 in this section , the process of the computational conjugation of the antibody , the linker , and the drug is described in more detail . as previously explained , the goal of the program developed is to produce the pdb file of an adc molecule , given the pdb files of an antibody , a linker , and a drug . the drug and the linker are reconfigured via rotation and translation in order to be brought in positions appropriate for the hydrogen bonding to occur between the linker and the drug , as well as between the linker and a surface lysine of the antibody . the change in the configuration of the antibody , the linker , and the drug was executed computationally by changing their atomic coordinates . first , the drug was rotated and translated in relation to the linker , while the linker remained stable . drug conjugate was rotated and translated in relation to the selected surface lysine of the antibody , while the antibody remained stable . similarly , the two files were merged to produce the final pdb file of the antibody drug conjugate . in order for the reconfiguration of the molecules to be correct , the changes in their atomic coordinates had to preserve the initial lines and distances between the atoms , which was accomplished with the use of an affine transformation . an affine transformation is any transformation that preserves collinearity , which means that all points placed on a line before the transformation still lie on a line after the transformation . it also conserves the ratios of distances , which means that the midpoint of a line segment remains the midpoint after the application of the transformation.47,48 according to the homogeneous transformation matrix defined in ref . 49 , the change in the position of an atom can be described with the following equations , r00=a*cos(rz)*cos(ry ) r01=a*(cos(rz)*sin(ry)*sin(rx)sin(rz)*cos(rx ) ) r02=a*(cos(rz)*sin(ry)*cos(rx)+sin(rx)*sin(rx ) ) r03=tx r10=a*(sin(rz)*cos(ry ) ) r11=a*(sin(rz)*sin(ry)*sin(rx)+cos(rz)*cos(rx ) ) r12=a*(sin(rz)*sin(ry)*cos(rx)cos(rz)*sin(rx ) ) r13=ty r20=(1)*a*sin(ry ) r21=a*cos(ry)*sin(rx ) r22=a*cos(ry)*cos(rx ) r23=tz x=r00*(x)+r01*(y)+r02*(z)+r03 y=r10*(x)+r11*(y)+r12*(z)+r13 z=r20*(x)+r21*(y)+r22*(z)+r23 where x , y , z are the initial coordinates of an atom , x , y , z are the new coordinates of the atom , a is the scaling factor , set at the value of 1 since in this project scaling was not necessary , rx , ry , rz are the rotation angles of the atom around the x , y , z axis , respectively , and tx , ty , tz are the distances according to which the atom will be translated in the x , y , z direction , respectively . in order to rotate a molecule in relation to another molecule the axis of the linker was defined as the line connecting its two most distant non - hydrogen atoms , in order to be representative of the shape of the molecule . for that purpose , the distance between every pair of heavy atoms of the linker was calculated , and the pair with the largest distance was chosen . these two atoms also participated in the connections of the linker with the drug and the antibody , as will be explained in the following paragraph . the axis of the drug was defined as the line connecting the hydrogen atom of the drug that took part in the hydrogen bond with the linker and the electronegative atom of the drug covalently bonded to it . drug conjugate was defined as the line connecting the two most distant non - hydrogen atoms of the linker drug conjugate , similarly to the axis of the linker . finally , the axis of the lysine was defined as the line connecting the alpha carbon of the lysine and the nitrogen atom of its side chain , since this line is directed toward the exterior of the antibody , which is the desired direction for the linker similarly , in order to translate a molecule in relation to another molecule , a distance between them had to be defined . the distance between the drug and the linker was defined as the distance between the hydrogen atom of the drug that participates in the hydrogen bond with the linker and the linker atom that participates in the hydrogen bond with the drug , which was selected to be one of the two most distant atoms of the linker . the distance between the linker drug conjugate and the antibody is defined as the distance between the linker atom that participates in the hydrogen bond with the antibody , which was selected to be one of the two most distant atoms of the linker drug conjugate , the one that belongs to the linker , and a hydrogen atom covalently bonded to the nitrogen of the lysine side chain . as a molecule ( ie , the drug or the linker drug conjugate ) rotates in relation to a stable molecule ( ie , the linker or the antibody , respectively ) , or equivalently as the values of the variables rx , ry , rz change , the angle between its axis and the axis of the stable molecule is calculated . the values of rx , ry , rz for which this angle becomes minimal are selected , and finally the molecule is rotated according to those angles . similarly , as a molecule ( ie , the drug or the linker drug conjugate ) is translated in relation to a stable molecule ( ie , the linker or the antibody , respectively ) , or equivalently as the values of the variables tx , ty , tz change , the distance between those two molecules is calculated as described in the previous paragraph . the values of tx , ty , tz for which that distance becomes minimal are chosen , and the molecule is translated according to those values . according to the steiner saenger definition of the hydrogen bond , a hydrogen bond is any cohesive interaction x ha where h carries a positive and a a negative ( partial or full ) charge and the charge on x is more negative than on h. the molecule c15n , which represents a common non - cleavable linker , can form hydrogen bonds with a drug as well as a lysine amino acid of an antibody . in particular , every hydrogen atom of the drug that is connected to a heavy atom more electronegative than hydrogen can form a hydrogen bond with a heavy atom of the linker , such as carbon . similarly , the nitrogen atom of the lysine side chain and the hydrogen atom covalently bonded to it can form a hydrogen bond with a carbon atom of the linker . after a molecule has been rotated and translated in relation to the stable molecule , the hydrogen bond is simulated computationally by deleting the hydrogen atom of the hydrogen donor from the pdb file , before the two files are merged into one pdb file.50 the final adc molecule obtains a realistic conformation , as ensured by a final minimization step using the molecular dynamics package gromacs , and specifically the gromos bonding library.51 the application of the process described in the methods section resulted in the generation of a number of adc pdb files . since the antibody and the drug , as well as the conjugation sites of the antibody and the drug , can vary , the number of different combinations of initial molecules generating distinct adcs is quite large . here , four different adcs are demonstrated as results of this process . the two conjugates depicted in figure 2 contain the antibody with pdb i d 4gag . in the left conjugate , the linker has formed a hydrogen bond with the surface lysine with residue sequence number 147 , located at the antibody chain with i d l , while the drug with sequence number 600 ( nci_600.pdb ) has formed a hydrogen bond with the linker . in the right conjugate , the linker has been connected with a hydrogen bond to the surface lysine with residue sequence number 115 , located at the antibody chain with i d h , while the drug with sequence number 450 ( nci_450.pdb ) has formed a hydrogen bond with the linker . the conjugation areas of these two adcs are depicted in figure 3 , from a different angle and a smaller distance . in figure 4 , two different adcs are illustrated , both containing the antibody with pdb i d 4gaj . in the left conjugate , the linker has formed a hydrogen bond with the surface lysine with residue sequence number 75 , located at the antibody chain with i d h , while the drug with sequence number 700 ( nci_700.pdb ) has formed a hydrogen bond with the linker . in the right conjugate , the linker has been connected to the surface lysine with residue sequence number 209 , located at the chain with i d h , with a hydrogen bond . also , the drug with sequence number 14 ( nci_14.pdb ) has formed a hydrogen bond with the linker . the conjugation areas of these two adcs are depicted in figure 5 , from a different angle and a smaller distance ( figs . in this paper , a process of computational construction of adcs has been described , choosing surface lysines as the antibody conjugation sites . for this purpose , drug pdb files from the open national cancer institute database , antibody pdb files from the rcsb protein data bank , and the pdb file of the non - cleavable linker molecule c15n were used . between the linker and the drug , as well as between the antibody lysine and the linker the method described in this paper represents one of the many ways a drug can be conjugated with an antibody . parameters such as the amino acid participating in the conjugation , the dar , the type of linker and drug used , as well as the chemical bonds formed between the components of the conjugate can vary . besides lysine , other natural or synthetic amino acids such as cysteine , selenocysteine , or acetylphenylalanine can be connected with a linker drug conjugate . in addition , other non - cleavable or cleavable linkers can be used , while maytansinoids , auristatins , calicheamicins , and duocarmycins can be used as cytotoxic substances . an example of a different conjugation technique is the formation of a covalent bond between an amino acid and a reactive functional group pendent to the linker drug conjugate through amide bonds is also possible , using an n - hydroxysuccinimide ( nhs ) ester appended to the linker surface lysines of the antibody can be modified to introduce a reactive group such as maleimide , and then conjugated to a linker drug that contains an appropriate reactive handle such as thiol , a method applied in the commercial adc kadcyla . regarding cysteine conjugation , the controlled reduction of existing disulfide bonds in an antibody liberates cysteine residues , which can react with a maleimide attached to the linker drug , a method used in the commercial adc adcetris . however , the conjugation processes described above are rather random and produce heterogeneous mixtures of conjugates with variable dars . in addition , the site of conjugation could be different for each adc species containing even only one drug . heterogeneity in overall charge can impact negatively the solubility , stability , and pharmacokinetic properties of the produced adc.5255 the need for the development of homogeneous adcs led to an increasing interest in site - specific conjugation , through which the number of conjugated drugs and the site of conjugation can be controlled . site - specific conjugation has been achieved with a number of methods , such as cysteine engineering , amino acid insertion , enzymatic conjugation , and glycoengineering . thiomab drug conjugates ( tdcs ) are a class of engineered antibodies in which cysteines have been introduced into the amino acid sequence by single point mutations . the ideal sites for mutation are identified with phage display techniques , while the engineered antibody is reduced and reoxidized to present the thiols of the mutated cysteines for conjugation . conjugation using the engineered cysteine site leaves the antigen - binding regions unaffected and is quite homogeneous , with greater than 92% of the engineered antibody ( thiomab ) conjugates containing two drugs . another approach is the replacement of interchain cysteines with serines in order to reduce the number of potential conjugation sites . site - specific conjugation has also been accomplished by inserting non - native amino acids into the antibody , such as selenocysteine , acetylphenylalanine , para - acetylphenylalanine , and para - azidophenylalanine , which can provide orthogonal conjugation chemistries that otherwise are not available from functional groups present in the 20 canonical amino acids . for example , site - specific adcs have been produced using anti-5t4 and anti - her2 antibodies , with oxime bond formation between ketones on the side chain of the incorporated non - native amino acid and hydroxylamine - functionalized monomethyl auristatin d with either protease - cleavable or non - cleavable linkers . in particular , glycotransferase has been used to attach a chemically active sugar functional group to a glycosylation site on an antibody , which serves as a conjugation site . transglutaminase , on the other hand , has been used to form a bond between an amine group on the linker drug and an engineered glutamine residue on the antibody . chemoenzymatic approaches have been explored with the aim to generate bioorthogonal reactive groups for selective conjugation . for example , the formylglycine - generating enzyme ( fge ) has been utilized to recognize a cxpxr sequence and convert a cysteine to formylglycine , in order to generate antibodies with aldehyde tags . finally , site - specific conjugation has also been achieved by conjugating drugs at the glycosylation site of antibodies , without changing their amino acid sequence or cell culture condition . in particular , the native glycans on an asparagine residue ( asn297 ) of antibodies have been enzymatically remodeled in vitro using galactosyl and sialyltransferases in order to introduce terminal sialic acids . these sialic acids were subjected to periodate oxidation , resulting in aldehyde groups that were used to conjugate cytotoxic agents with oxime ligation . the adcs produced with site - specific conjugation proved to have improved pharmacokinetic and therapeutic properties in comparison with the randomly generated adcs . therefore , a future step regarding adc - related computational operations can be the simulation of site - specific conjugation methods as those mentioned above.25,36,37,52,5660 another aspect that could be examined is the evaluation of the computationally produced adcs , perhaps taking into account the existing analytical technologies that assess the physicochemical properties of real adcs . properties of real adcs , such as the dar , drug distribution , aggregation , and fragmentation , are evaluated with a variety of techniques . for instance , uv / vis spectroscopic analysis and hydrophobic interaction chromatography ( hic ) are two methods used to measure the dar , while technologies such as mass spectroscopic analysis and chromatographic analysis are used to evaluate drug distribution . therefore , computational techniques could be developed in order to perform the equivalent analytical evaluations on computational adcs , in order to further aid the design and manufacturing processes of real adcs.10,61 in addition , computational techniques that make estimations about the pharmacokinetic and therapeutic properties of a given adc would be beneficial to the process of adc design , since an adc could not only be constructed , but also evaluated in silico , obtaining valuable information in relatively little time and cost prior to in vitro development . in conclusion , adcs have emerged as a promising anticancer targeted therapy that aims to treat cancer by selectively attacking cancer cells while leaving normal cells unaffected for the most part . in comparison to conventional chemotherapy , this targeted mechanism of action has fewer side effects and enables the use of more potent drugs . the fact that adcs are formed from three molecules instead of one makes their design and manufacturing even more complex than the already complicated discovery process of standalone drugs . however , it also results in an increased number of possible combinations of antibody conformation , linker , drug , and conjugation method . therefore , the scientific field of adcs provides vast research opportunities , not only in biology but also in bioinformatics , since specialized computational methods could benefit considerably the evolution of tat . in this paper , a process of computational construction of adcs has been described , choosing surface lysines as the antibody conjugation sites . for this purpose , drug pdb files from the open national cancer institute database , antibody pdb files from the rcsb protein data bank , and the pdb file of the non - cleavable linker molecule c15n were used . between the linker and the drug , as well as between the antibody lysine and the linker the method described in this paper represents one of the many ways a drug can be conjugated with an antibody . parameters such as the amino acid participating in the conjugation , the dar , the type of linker and drug used , as well as the chemical bonds formed between the components of the conjugate can vary . besides lysine , other natural or synthetic amino acids such as cysteine , selenocysteine , or acetylphenylalanine can be connected with a linker drug conjugate . in addition , other non - cleavable or cleavable linkers can be used , while maytansinoids , auristatins , calicheamicins , and duocarmycins can be used as cytotoxic substances . an example of a different conjugation technique is the formation of a covalent bond between an amino acid and a reactive functional group pendent to the linker drug conjugate through amide bonds is also possible , using an n - hydroxysuccinimide ( nhs ) ester appended to the linker surface lysines of the antibody can be modified to introduce a reactive group such as maleimide , and then conjugated to a linker drug that contains an appropriate reactive handle such as thiol , a method applied in the commercial adc kadcyla . regarding cysteine conjugation , the controlled reduction of existing disulfide bonds in an antibody liberates cysteine residues , which can react with a maleimide attached to the linker drug , a method used in the commercial adc adcetris . however , the conjugation processes described above are rather random and produce heterogeneous mixtures of conjugates with variable dars . in addition , the site of conjugation could be different for each adc species containing even only one drug . heterogeneity in overall charge can impact negatively the solubility , stability , and pharmacokinetic properties of the produced adc.5255 the need for the development of homogeneous adcs led to an increasing interest in site - specific conjugation , through which the number of conjugated drugs and the site of conjugation can be controlled . site - specific conjugation has been achieved with a number of methods , such as cysteine engineering , amino acid insertion , enzymatic conjugation , and glycoengineering . thiomab drug conjugates ( tdcs ) are a class of engineered antibodies in which cysteines have been introduced into the amino acid sequence by single point mutations . the ideal sites for mutation are identified with phage display techniques , while the engineered antibody is reduced and reoxidized to present the thiols of the mutated cysteines for conjugation . conjugation using the engineered cysteine site leaves the antigen - binding regions unaffected and is quite homogeneous , with greater than 92% of the engineered antibody ( thiomab ) conjugates containing two drugs . another approach is the replacement of interchain cysteines with serines in order to reduce the number of potential conjugation sites . site - specific conjugation has also been accomplished by inserting non - native amino acids into the antibody , such as selenocysteine , acetylphenylalanine , para - acetylphenylalanine , and para - azidophenylalanine , which can provide orthogonal conjugation chemistries that otherwise are not available from functional groups present in the 20 canonical amino acids . for example , site - specific adcs have been produced using anti-5t4 and anti - her2 antibodies , with oxime bond formation between ketones on the side chain of the incorporated non - native amino acid and hydroxylamine - functionalized monomethyl auristatin d with either protease - cleavable or non - cleavable linkers . in particular , glycotransferase has been used to attach a chemically active sugar functional group to a glycosylation site on an antibody , which serves as a conjugation site . transglutaminase , on the other hand , has been used to form a bond between an amine group on the linker drug and an engineered glutamine residue on the antibody . chemoenzymatic approaches have been explored with the aim to generate bioorthogonal reactive groups for selective conjugation . for example , the formylglycine - generating enzyme ( fge ) has been utilized to recognize a cxpxr sequence and convert a cysteine to formylglycine , in order to generate antibodies with aldehyde tags . finally , site - specific conjugation has also been achieved by conjugating drugs at the glycosylation site of antibodies , without changing their amino acid sequence or cell culture condition . in particular , the native glycans on an asparagine residue ( asn297 ) of antibodies have been enzymatically remodeled in vitro using galactosyl and sialyltransferases in order to introduce terminal sialic acids . these sialic acids were subjected to periodate oxidation , resulting in aldehyde groups that were used to conjugate cytotoxic agents with oxime ligation . the adcs produced with site - specific conjugation proved to have improved pharmacokinetic and therapeutic properties in comparison with the randomly generated adcs . therefore , a future step regarding adc - related computational operations can be the simulation of site - specific conjugation methods as those mentioned above.25,36,37,52,5660 another aspect that could be examined is the evaluation of the computationally produced adcs , perhaps taking into account the existing analytical technologies that assess the physicochemical properties of real adcs . properties of real adcs , such as the dar , drug distribution , aggregation , and fragmentation , are evaluated with a variety of techniques . for instance , uv / vis spectroscopic analysis and hydrophobic interaction chromatography ( hic ) are two methods used to measure the dar , while technologies such as mass spectroscopic analysis and chromatographic analysis are used to evaluate drug distribution . therefore , computational techniques could be developed in order to perform the equivalent analytical evaluations on computational adcs , in order to further aid the design and manufacturing processes of real adcs.10,61 in addition , computational techniques that make estimations about the pharmacokinetic and therapeutic properties of a given adc would be beneficial to the process of adc design , since an adc could not only be constructed , but also evaluated in silico , obtaining valuable information in relatively little time and cost prior to in vitro development . in conclusion , adcs have emerged as a promising anticancer targeted therapy that aims to treat cancer by selectively attacking cancer cells while leaving normal cells unaffected for the most part . in comparison to conventional chemotherapy , this targeted mechanism of action has fewer side effects and enables the use of more potent drugs . the fact that adcs are formed from three molecules instead of one makes their design and manufacturing even more complex than the already complicated discovery process of standalone drugs . however , it also results in an increased number of possible combinations of antibody conformation , linker , drug , and conjugation method . therefore , the scientific field of adcs provides vast research opportunities , not only in biology but also in bioinformatics , since specialized computational methods could benefit considerably the evolution of tat .

antibody drug conjugates ( adcs ) constitute a category of anticancer targeted therapy that has gathered great interest during the last few years because of their potential to kill cancer cells while causing significantly fewer side effects than traditional chemotherapy . in this paper , a process of computational construction of adcs is described , using the surface lysines of an antibody and a non - covalent linker molecule , as well as a cytotoxic substance , as files in protein data bank format . also , aspects related to the function , properties , and development of adcs are discussed .

due to the occurrence of the industrialization and urbanization without environmental care , toxic elements such as lead ( pb ) , cadmium ( cd ) , and arsenic ( as ) , coming mainly from mining , industrial processes , pesticides , chemical fertilizers , and atmospheric deposition , have become a major source of environmental contamination . toxic elements are considered highly hazardous to human health and they may cause acute or chronic poisoning . chronic exposure to lead has been associated with the induction of pathological changes and damage in organs and central nervous system , leading to lower intelligence quotient in children . cadmium is highly toxic to the kidneys and this metallic element is considered as carcinogenic . besides , cadmium may cause bone mineralization , osteoporosis being a critical effect resulting from this element exposure . arsenic is also considered as carcinogenic , and the majority of its chronic exposure reports are focused on skin problems like pigmentation and keratosis [ 1 , 2 ] . because of the high soil mobility and availability of the total arsenic , cadmium , and lead derived from the human activities and natural sources , there is a general concern about their phytotoxicity and risks to organisms , as they are rapidly able to spread out at different levels in the food chain . it has been shown that plants growing in soils contaminated with toxic elements are not capable of preventing their uptake and accumulation in the plant tissue , but are capable of restricting them only . thus , the foods contaminated with metals have turned out to be serious problem due to the potential bioaccumulation in biosystems through contaminated water and soil . this circumstance is associated with the fact that some toxic elements are slowly eliminated from the human body , and they tend to accumulate in different tissues such as liver , muscles , and bones , threatening the human health . rice ( oryza sativa l. ) is one of the most consumed cereals in the world , and it is part of the staple diet of the world population ; and it is considered as the most important source of nutrients for billions of people around the world . rice provides 20.0% of energy and 15.0% of the daily requirement of protein for adults . brazil is the largest non - asian rice producer in the world , and the average consumption of this cereal per person is nearly 25.0 kgyear [ 1 , 5 ] . according to the brazilian ministry of agriculture - livestock and food supply , brazil imported 372,567 tons of rice and exported 961,473 tons of the cereal in 2015 . high concentrations of toxic elements are found in rice when compared to other plants grown under the normal conditions . many toxic elements ' accumulation in rice is associated with the plant characteristics and its cultivation , as it is usually grown in flooded or very humid areas , which optimize the transfer of such elements from the soil to the plant . only fish and seafood may carry higher concentrations of arsenic than rice ; however , while arsenic in rice occurs mainly as inorganic arsenic species , which are very toxic , arsenic in fish and seafood occurs primarily as organic species , which are less toxic [ 8 , 9 ] . in this context , the scope of this study was to investigate a suitable method for rice sample preparation , as well as to validate a method for monitoring the concentration of total arsenic , cadmium , and lead , in rice using inductively coupled plasma mass spectrometry ( icp - ms ) . the proposed method was applied for analyzing different rice types ( polished , brown , and parboiled ) coming from various brazilian regions in order to investigate whether they are in accordance with the national legislation , aiming at public health promotion . high purity deionized water ( resistivity 18.2 m cm ) from a millipore water purification system ( bedford , ny , usa ) was used throughout this study . lead ( pb ) , cadmium ( cd ) , arsenic ( as ) , germanium ( ge ) , indium ( in ) , and rhenium ( re ) at 1000 g ml standard solutions , produced according to the iso guide 34 , were acquired from inorganic ventures ( christiansburg , va , usa ) . all of the employed reagents were of analytical grade . suprapur hno3 ( 65.0% ) and h2o2 ( 30.0% ) used in the digestion procedures were acquired from merck ( darmstadt , hesse , germany ) . instrumental daily performance solution was purchased from perkinelmer ( shelton , ct , usa ) . certified reference material irmm 804 rice flour was acquired from the joint research centre institute for reference materials and measurements ( geel , antwerp , belgium ) . external calibration was performed using a five - point analytical curve , prepared by diluting the individual arsenic , cadmium , and lead standards with 5.0% ( v / v ) hno3 . analytical curve concentrations ranged from 1.0 to 40 , 1.2 to 24 , and 1.0 to 20 g l for arsenic , cadmium , and lead , respectively . a multielement ( germanium for arsenic , indium for cadmium , and rhenium for lead ) internal standard solution with 5 g l of each element in 0.2% ( v / v ) hno3 solution was prepared by serial dilution of 1000 g ml monoelement stock solutions . internal standard solution was added in - line to the analyzed solutions through a mixing tee , used to blend in the internal standards with the samples after the peristaltic pumping and before the nebulizer . all of the measurements were conducted using an icp - ms ( elan drc ii , perkinelmer ) instrument , equipped with a glass meinhard ( golden , co , usa ) nebulizer and a cyclonic glass spray chamber . a standard 2.0 mm i d quartz injector and pt sampler ( 1.10 mm orifice diameter ) and skimmer ( 0.9 mm orifice diameter ) cones were used . standard , blank , and sample solutions were delivered using a s10 ( perkinelmer ) autosampler . l of mg , in , u , ce , and ba ( perkinelmer ) . according to the instrument manufacturer , the following parameters were evaluated during the daily performance analysis : sensitivity ( mg , in , and u ) , doubly charges ( ba ) , and oxides ( ce ) formation . sample preparation procedure is a critical point for the success of the analysis , being considered an important source of error in analytical method development . in the present study different sample preparation procedures were investigated in order to check their suitability for rice decomposition aiming at determining the total arsenic , cadmium , and lead concentrations by means of icp - ms . a rice package ( 1 kg ) of a given brand randomly selected was acquired in a market located in so paulo city , sp , brazil . at first , the samples were weighed using an analytical balance ( shimadzu , kyoto , japan ) and then grinded in an ika analytical mill ( staufen , baden - wrttemberg , germany ) , except when performing the procedure carried out in the muffle furnace , where the entire grain was ashed . for investigating the analytes recovery for the various sample preparation procedures , the samples were spiked using arsenic , cadmium , and lead aqueous solutions . for each sample preparation procedure , three independent replicates of the sample were analyzed , and the respective procedural blanks were considered in the final results . samples were fortified in order to get final concentrations ranging from 8.0 to 30.0 g l ( within the calibration curves concentration range ) for all the analyzed elements in the final sample solutions . laboratory standard procedure for food samples mineralization was performed using a fornitec ( so paulo , sp , brazil ) muffle furnace . in a porcelain capsule , 2.0 g of the sample was weighted and 2 ml of 60.0% mg(no3)2 was added . the samples were initially ignited in a bunsen burner , and then they were taken into a muffle furnace with a heating ramp of 150c until reaching 420c , maintaining this temperature for 4 h. after cooling , 1 ml of hno3 was added and allowed to dryness on a heating plate . samples returned to the muffle furnace at 420c until reaching the complete destruction of the organic matter . samples were spiked in order to obtain a final concentration of 9.6 g l for arsenic , cadmium , and lead in 50 ml of at 5% ( v / v ) hno3 . for the metallic block , 1 g of the sample was weighted in a polytetrafluorethylene ( ptfe ) flask . hno3 ( 1 ml ) and h2o2 ( 2 ml ) were used as reagents , and an overnight predigestion step was performed . digestion was performed in a marconi ( piracicaba , sp , brazil ) metallic block at 100c for 5 hours . samples were spiked in order to get a final concentration of 16.0 , 9.6 , and 8.0 g l of arsenic , cadmium , and lead , respectively , in 25 ml of deionized water . for digesting on the hot plate , 0.5 g of the sample was weighted in an erlenmeyer flask and 1 ml of hno3 and 2 ml of h2o2 were added . the mixture was left overnight and then heated on a hot plate ( marconi ) at 130c for 2 h. samples were spiked in order to get a final concentration of 8.0 g l of the elements in the sample solution ( volume completed to 25 ml by adding deionized water ) . for the digestion assisted by microwave radiation , the method published by batista and coworkers was performed with some modifications . in the present study , 0.5 g of rice sample was weighted and transferred to the ptfe flask specific for the microwave oven used ( ethos one from milestone , sorisole , bergamo , italy ) . two ml of hno3 , 2 ml of h2o2 , and 4 ml of h2o were added to the sample in the flask after an overnight predigestion step . the following program was run : 1000 w at 100c ( 5 min . samples were spiked in order to reach a final concentration of 30.0 , 10.0 , and 10.0 g l of arsenic , cadmium , and lead , respectively , in the final sample solution ( volume completed to 25 ml by adding deionized water ) . for the method validation , the sample solution obtained from digestion in microwave oven was selected due to the lesser time consumption involved and the lower blank values . the analytical method validation was performed by considering the limit of detection ( lod ) , limit of quantification ( loq ) , linearity , precision ( repeatability ) , and relative bias . lods and loqs were established as three and ten times , respectively , the standard deviation of six rice samples independently digested considered as having approximately 1 g l of arsenic and concentration of cadmium and lead < loq in the final sample solution . the final values of both parameters were calculated taking into account the samples dilution factor and the weight . linearity was established by preparing the calibration curves of all of the target elements by employing an unweighted least - squares linear regression . relative bias and repeatability of the method were evaluated by analyzing seven replicates of the certified reference material irmm 804 rice flour , for determining arsenic , cadmium , and lead . relative bias was obtained as the percentage difference between obtained and certified values , while the repeatability was calculated as relative standard deviation ( rsd% ) . to evaluate the analytical method performance for determining the arsenic , cadmium , and lead in different rice types samples consumed by the brazilian population , 37 rice samples from different brands and lots were collected from various states of the country ( cear , esprito santo , gois , paraba , rio grande do sul , rondnia , and so paulo ) . samples were collected by the health surveillance system from 2013 to 2015 and sent to the inorganic contaminants laboratory - adolfo lutz institute . they consisted of 27 polished rice samples , two parboiled rice samples , and eight brown rice samples . expanded uncertainty estimation ( uc ) for the obtained results was calculated according to the criteria described in eurachem / citac . for this evaluation , the following parameters were considered : analytical curve uncertainty associated with the linear least - square fitting procedure ; volumetric flasks calibration and temperature effect on the volumetric measurement ; and analytical balance calibration . expanded uncertainty was determined by multiplying the coverage factor ( k ) and the combined uncertainty ( uc ) : uc = k uc , considering the coverage factor k = 2 , for a confidence level of 95.45% . the well - known polyatomic interference caused by arcl was considered in the total arsenic determination by using arithmetic correction . according to t - test ( p = 0.005 , n = 4 ) similar result was found by cai and coworkers for citrus leaves standard reference materials digested with hno3 and h2o2 , reagents also used in the present study . this result can be explained by the fact that only 2% of the total chlorine contents in rice plants are present in the edible part . table 2 shows the analytes recovery in the spiked samples submitted to the different preparation procedures for determining total arsenic , cadmium , and lead in rice . recoveries varied from 81.0 to 115.0% , indicating that results for all elements determined in the sample submitted to different preparation procedures were within the percentages recommended by fda , which comprise the range between 80.0 and 120.0% . this finding highlights the possibility of using all of the sample preparation procedures employed in the present study , including arsenic determination whose volatility is well known . soylak and coworkers also compared various sample preparation procedures for determination of trace elements in turkey spices . recoveries ranged from 95.0 to 97.0% for muffle oven , 99.0 to 95.0% for hot plate , and 98.0 to 103.0% for microwave oven ; and these results are comparable to those found in the present investigation . the results found in the present study are in agreement with the data reported by wei et al . , where acid digestion assisted by microwave radiation was carried out , reaching recoveries of 97.0 , 106.0 , and 103.0% for total arsenic , cadmium , and lead , respectively . nowadays , researches on sample preparation procedures have advanced , leaning more and more to the microwave technology , becoming difficult to find present - day publications using other procedures . the advantages of microwave technology are undeniable , but the use of less resourceful instruments may eventually be appropriate , providing good results for the analytes under study . the overall performance of the proposed method for total arsenic , cadmium , and lead determination in rice is summarized in tables 3 and 4 . lods and loqs results were considered acceptable as the values were below the limits established by the brazilian legislation for arsenic , lead , and cadmium for rice and its derivatives : 0.30 mg kg , 0.20 mg kg , and 0.40 mg kg , respectively . the linearity of the calibration curve was evaluated by investigating the correlation coefficient ( r ) of the calibration curves . the r values were higher than 0.998 for all of the analytes , as shown in table 3 , and the regression analyses showed that the linear correlation between concentration and signal intensity was significant ( p < 0.05 ) . relative bias ( table 4 ) was assessed through the difference between the mean value of obtained results and the certified values . for all elements , the rsd ( repeatability ) was in compliance with the european commission decision 2002 , and it did not exceed 10.0% . therefore , as expected , the use of microwave oven for rice acid digestion was appropriate for determining the total arsenic , cadmium , and lead concentrations in rice using icp - ms . the above was method applied for quantifying the concentration of total arsenic , cadmium , and lead in 37 rice samples ( polished , parboiled , and brown rice ) . results are summarized in table 5 . according to table 5 , of 37 analyzed samples , 35 showed total arsenic concentration higher than the loq , ranging from 0.061 to 0.660 mg kg . in two polished rice samples , the average total arsenic concentration in parboiled rice was lower than that found in other rice types ( 0.071 mg kg ) , followed by polished rice ( 0.130 mg kg ) and brown rice , which had the highest arsenic concentration ( 0.224 mg kg ) . in one brown rice sample , collected in the state of so paulo , the total arsenic concentration was 0.660 mg kg . this value was higher than that established by the brazilian legislation and the codex alimentarius , which is 0.30 mg kg . total arsenic concentrations were in agreement with the maximum level established for total arsenic in raw rice . total arsenic mean concentrations found in the present study were in agreement with those cited in the literature ; and the respective authors pointed out the evident occurrence of the highest arsenic concentrations in brown rice . this occurs owing to the fact that rice plants concentrate this element in the outer layer of the grain , in the region corresponding to the pericarp . a great amount of arsenic is removed during the rice polishing [ 21 , 5052 ] . besides , variation in the arsenic concentration may occur due to different cultivars , geography , environment , water quality , and growth conditions [ 21 , 24 , 25 , 29 , 30 , 37 , 51 , 5356 ] . the results obtained in the present work are comparable to others in investigations performed in brazil , as shown in table 6 . usually , the data from several studies presented the same tendency , the total arsenic concentration being higher in brown rice , followed by polished and parboiled rice . the results found in this study on the total arsenic contents were also in agreement with those previously reported for rice analyzed in other countries ( table 7 ) . the exception is for arsenic concentration found in rice cultivated in bangladesh , one of the countries that have been mostly vulnerable to arsenic exposure , causing a serious public health problem [ 33 , 34 , 53 ] . in the 1970s , the plumbing pipes contaminated by arsenic were installed in the country , and it caused the contamination of the water consumed by the population . in consequence , it originated the contamination water used for rice irrigation . with respect to cadmium , only one polished rice sample had cadmium concentration above the loq ( 0.042 0.008 mg kg ) . in the other rice samples , cadmium concentration was below the lod in 17 samples , while in 19 samples it was below the loq . in none of the analyzed samples , cadmium concentrations exceeded the maximum value of 0.40 mg kg allowed by the brazilian legislation and the codex alimentarius . thus , referring to cadmium contamination , the polished , parboiled , and brown rice samples were considered as satisfactory for consumption . cadmium concentration found in the analyzed samples were similar to those reported in other studies carried out by brazilian investigators , as outlined in table 6 . in all of the investigations , the cadmium levels were lower than those recommended by the brazilian legislation . the same is observed when the data on rice from other countries are compared ( table 7 ) . however , higher cadmium concentrations in rice have been reported , which can be attributed to the soil contaminated by metals in mining and industrial areas [ 31 , 56 , 58 , 59 ] . as for lead , in 14 polished rice and one parboiled rice samples lead concentration was below the lod , and 11 polished rice and four brown rice samples had lead concentrations below the loq . in one parboiled rice ( 0.127 mg kg ) , two polished rice ( 0.0870.115 mg kg ) , and four brown rice ( 0.0650.124 mg kg ) samples , the lead concentrations were above loq , with mean values of 0.101 mg kg for polished rice and 0.104 mg kg for brown rice . in all of the analyzed samples , the results indicated that the lead concentrations were lower than the maximum value allowed , which is 0.20 mg kg , according to the brazilian legislation and european community . thus , regarding to lead , the brazilian rice evaluated in this study was shown to be suitable for consumption . the lead concentrations found in brazilian rice ( table 6 ) and other countries ( table 7 ) were comparable , not exceeding the maximum value established by the brazilian legislation . higher lead contents found in some investigations might indicate the soil contamination by fertilizers , industrial , and/or mining activities [ 31 , 56 , 59 ] . regarding the sample preparation , all of the procedures ( ashing in muffle furnace , acid digestion under heating on metallic block or hot plate , and acid digestion assisted by microwave radiation ) led to good results ( recoveries ranging from 80.0 to 120.0% ) . this information is important for laboratories that execute rice analyses , as the sample preparation may be cheaper . the parameters obtained for validation have demonstrated that the method fits for its purpose , which is to quantify the total arsenic , cadmium , and lead in complying with the brazilian legislation limits . regarding the parboiled , polished , and brown rice samples analyzed , the concentrations of total arsenic , cadmium , and lead were lower than the established limits according to the brazilian legislation , codex alimentarius , and european community , except for total arsenic in one sample . the other analyzed rice samples were considered satisfactory for human consumption regarding the investigated elements . the data obtained indicated that only the consumption of brown rice can represent risk to brazilian population . therefore , it is necessary to establish programs to focus attention on this type of rice aiming at promoting the public health , since rice might be an important route for human exposure to toxic elements , particularly in populations following diets based on this cereal , as is the case of the brazilian population .

this study is aimed at investigating a suitable method for rice sample preparation as well as validating and applying the method for monitoring the concentration of total arsenic , cadmium , and lead in rice by using inductively coupled plasma mass spectrometry ( icp - ms ) . various rice sample preparation procedures were evaluated . the analytical method was validated by measuring several parameters including limit of detection ( lod ) , limit of quantification ( loq ) , linearity , relative bias , and repeatability . regarding the sample preparation , recoveries of spiked samples were within the acceptable range from 89.3 to 98.2% for muffle furnace , 94.2 to 103.3% for heating block , 81.0 to 115.0% for hot plate , and 92.8 to 108.2% for microwave . validation parameters showed that the method fits for its purpose , being the total arsenic , cadmium , and lead within the brazilian legislation limits . the method was applied for analyzing 37 rice samples ( including polished , brown , and parboiled ) , consumed by the brazilian population . the total arsenic , cadmium , and lead contents were lower than the established legislative values , except for total arsenic in one brown rice sample . this study indicated the need to establish monitoring programs for emphasizing the study on this type of cereal , aiming at promoting the public health .

cicatricial or scarring alopecia is defined as permanent loss of hair follicles , and its hallmarks are the loss of follicular ostia in clinical examination and destruction of hair follicle in histological examination . it is divided into primary and secondary types . in primary cicatricial alopecia ( pca ) , the hair follicle itself is the target for inflammation and destruction , whereas in the secondary type , pathological changes begin from non - follicular dermis . histopathology of scalp is necessary in distinguishing scarring alopecia from the non - scarring type . also , based on histopathological patterns , pca is divided into lymphocytic , neutrophilic , mixed , and nonspecific types . this classification is important because different treatment strategies may be used depending on the histological type of pca . although there is no hope for regrowth of destructed hair , there is a chance that the progression of the disease could be stopped through early and correct diagnosis . the predominant histological type was lymphocytic in some studies and neutrophilic in some other studies . the present study aimed to examine the epidemiological features of pca cases in a university hospital in iran . all cases of histopathological pca diagnosed over a period of ten years in the skin ward and pathology department of a university hospital in iran were included in our study . age , sex , type of job ( indoor or outdoor ) , and clinical findings were determined from hospital records of the patients . histological examination was performed on 4-mm skin specimens sectioned horizontally and vertically and stained with hematoxylin and eosin . histological types of pca were determined according to pathology reports . based on the classification provided in 2001 by the north american hair research society , discoid lupus erythematous ( dle ) , lichen planopilaris ( lpp ) and its variants , and pseudopelade of brocq ( ppb ) were regarded as lymphocytic pca . folliculitis decalvans ( fd ) and dissecting cellulitis / folliculitis ( dcf ) were regarded as neutrophilic pca . folliculitis keloidalis ( as a subclass of mixed pca ) and nonspecific pca were collectively considered other types . the data were described using descriptive statistics ( frequency , mean , and standard deviation ) . the relationship between different variables was analyzed using the chi - squared test and t - test on spss 16 ( ibm corporation , armonk , ny , usa , 2008 ) . a total of 97 cases , 35 ( 36.1% ) men and 62 ( 63.9% ) women , were included in this study . the patients age ranged from 10 to 70 years , with an average age of 37 ( sd=12.7 ) . as table 1 shows , most patients ( 32% ) were in the 40 to 49 age group , and no relationship was found between age group and histological type ( p=0.97 ) . it can be seen from table 1 that most cases ( 84.5% ) were of the lymphocytic type . also , in the neutrophilic group , there were nine cases of fd and only one case of dcf . furthermore , of the cases under the other heading , four were nonspecific pca , and one was of the folliculitis keloidalis type . the female / male ( f / m ) ratio was 1.7:1 for total cases . this ratio was 1.9:1 for the lymphocytic category , 1:1.5 for the neutrophilic group , and 4:1 for the other category . no relationship was observed between sex and type of job on the one hand and histological type of alopecia on the other ( p - values were 0.48 and 0.94 , respectively ) . itching , scalp tenderness , and ulceration were common clinical problems , but no relationship was seen between these problems and histological diagnosis ( p - values were 0.45 , 0.72 , and 0.07 , respectively ) . there is a paucity of data on the epidemiology of pca . table 2 gives a summary of the results obtained in the present study and a few other similar studies . a wide range of patient age was seen in the present research , but the disease was more common among the middle - aged individuals . another finding was that pca affected women about 1.7 times more than it affected men . an almost double dominance has also been reported for female patients in some other studies . in contrast , a study in iran showed that pca affected male patients more commonly . this inconsistency can be attributed to the fact that a high percentage of pca cases in this reference were of the neutrophilic type . indeed , past research has shown that neutrophilic pca is more common in middle - aged men , but lymphocytic pca is more frequently seen among middle - aged women . another point to make is that the highest f / m ratio in our study concerned the ppb type . similar f / m ratios have also been reported in some other studies . in our study , no relationship was seen between the type of job and histological types of pca . however , a study in iraq found that most male patients had outdoor jobs , and the author ascribed their alopecia to the possible effect of some environmental factors such as exposure to sunlight . indeed , sun exposure has been shown to play a role in developing some types of pca such as dle and lpp . as reported in another study , itching , scalp tenderness , and ulceration were commonly seen in our patients , but no relationship was found between these clinical problems and histological types of pca . in this study , dle turned out to be the most common histological type , a finding which is in agreement with some other studies . however , there are studies which reported fd and ppb as the most common type . another observation in the present study was that the ratio of lymphocytic pca to neutrophilic / other types of pca was 5.5:1 . this ratio was 7.4:1 , 8.5 : 1 , 0.78:1 , and 1.86:1 in other studies . this inconsistency is probably multifactorial , with a possible factor being the process whereby patients are selected for biopsy . for example , it is less common to perform biopsy for fd and dcf if the distinctive clinical and dermatoscopic features are present . in our study and also in some other studies , neutrophilic type of pca makes up a small percentage of pca . non - specific pca constituted a low percentage of histological types unlike in the study done by whiting . this difference may be due to the fact that patients refer to a dermatologist at a low rate when the disease subsides or because the clinician tends to choose not to do biopsy at this stage . our knowledge of pca etiology is low , but different etiological factors such as infectious agents , drug reaction , or sun exposure may have a role in developing pca . frequency of etiological factors in different populations maybe another contributor to different percentages reported for different histological types . a limitation of this study is that it only included those pca cases for which biopsy had been performed . this decision was made due to the retrospective nature of the present study , which investigated the hospital evidence amassed over a ten - year - long period . it might as well be noted that the studies cited in this work have similarly dealt with the biopsied cases only . before we bring this paper to an end , it is advisable to give a brief account of the treatment options available for pca . delayed or incorrect diagnosis of the diseases affecting hair follicles leads to permanent follicular loss . classification of pca into lymphocytic , neutrophilic , and mixed categories has the advantage that , although each specific histological type of pca requires a special treatment option , there are general rules for the treatment of the pca cases within each of the three main categories . more specifically , the general treatment for the lymphocytic cases of pca is to reduce inflammation by means of immunosuppression or through the use of immune system modulating agents . on the other hand , the main treatment decision for the neutrophilic cases of pca is to eliminate microbes through the use of antimicrobial agents . and immunosuppression is usually performed via some oral medications such as oral corticosteroids and cyclosporine or through the use of local drugs such as intraleisional triamcinolone acetonide or the betamethasone dipropionate topical cream . as for the neutrophilic cases of pca , the recommended treatment is the culture of hair follicle pustule or the administration of antibiotics according to the antibiotic sensitivity report . for this purpose , antibiotic agents such as cloxacillin , clindamycin , rifampicin , tetracycline , and dapson could be used individually or in combination with an anti - inflammatory drug such as colchicine . this study reviewed significant cases of histologically confirmed pca obtained over a period of ten years . the ratio of lymphocytic alopecia to neutrophilic / mixed alopecia or other types was 5.5:1 . pca was found to be more common among middle - aged individuals , and it had a tendency to affect middle - aged women in the case of the lymphocytic type . also , the neutrophilic type was more common among middle - aged men . itching , scalp tenderness , and ulceration were common in our patients . no relationship was observed between clinical findings , type of job ( indoor or outdoor ) , and histological types .

cicatricial alopecia can produce major psychosocial disturbance . this study aimed to evaluate epidemiological features of primary cicatricial alopecia ( pca ) . epidemiological and histological types of scarring alopecia were determined . the chi - squared test and t - test were performed to examine the relationship between different variables using spss 16 . a total of 97 cases , 35 ( 36.1% ) men and 62 ( 63.9% ) women , with an average age of 37 ( sd=12.7 ) , were included in this study . the female / male ( f / m ) ratio was 1.7:1 for total cases , 1.92:1 for the lymphocytic type , and 1:1.5 for the neutrophilic type . no relationship was found between type of job ( indoor or outdoor ) , clinical findings and histological types . discoid lupus erythematous ( dle ) was the most common histological type ( 63.9% ) . pca was found to mainly affect middle - aged individuals . the high percentage of dle in the present study is in agreement with some similar studies .

a 65-year - old woman presented to the emergency department with severe ocular pain in the right eye ; the patient gave a history of trauma sustained from a door handle three hours back . on examination , her visual acuity in the right eye was hand motion ( hm ) , upper and lower lids behind the luxated globe , iop 54 mmhg , corneal edema , deep quite anterior chamber and hazy view to the retina [ fig 1 ] . the case was diagnosed as retro bulbar hemorrhage by the emergency resident on call , in which urgent brain and orbit computed tomography ( ct ) scan revealed only globe luxation with retracted swollen eyelids and no evidence of intracranial or intraorbital hemorrhages or orbital wall fractures [ fig 2 ] , while b scan revealed no evidence of optic nerve avulsion . right eye with visual acuity of hm intraorbital hemorrhages or orbital wall fractures topical benoxiate drops were administered to the right eye and a trial to reposition the globe with the help of a cotton tip applicator was unsuccessful . desmarres lid retractors was used in which we inserted the curved tip of the retractor between the upper lid and the globe and by pulling the retractor up and superior the globe retracted back to its place [ fig 3 ] . the patient felt immediately relieve of pain and reduction of iop to 21 mmhg without anti - glaucoma medications and associated with improvement of corneal clarity [ fig 4 ] . desmarres lid retractors applied to upper lid patient eye after treatment during follow up ptosis was observed in the right eye for the first three weeks , however , this improved gradually and got resolved 6 weeks after the trauma . in the last visit , after 6 months of trauma , the patient presented with visual acuity of 20/60 and iop of 16 mmhg . complications associated with spontaneous globe luxation may include exposure keratitis , corneal abrasion , blurred vision , pain , blepharospasm , and anxiety . door handles ocular injuries rarely occurs in adults but has been reported to cause significant ocular and periocular injuries among young children . brain and orbital ct scans are required to exclude intracranial bleeding , optic chiasmal injury and bone fractures . the luxated globe should be managed as an emergency because most cases end with no light perception vision . a procedure has been described to reduce a luxated globe by patient relaxation and reclining to allow the orbiculais oculi muscle to relax and make globe manipulation easier then rolling back the lids out around the front part of the globe using a finger of cotton swab while gently pushing the globe back into place . in our case we tried a similar approach unsuccessfully and therefore introduced a desmarres lid retractor as a good option to reposit the globe . three cases of unilateral neurogenic blepharoptosis secondary to trauma with complete recovery within the first 3 months which simulates part of our patient presentation has been reported . although globe luxation is a devastating consequence to a blunt trauma to the globe , in some instances patients can end up with a favorable outcome with good vision . in our patient early intervention with globe repositioning led to prevention of a well known complication of optic disc damage and can be a key factor to regain good vision . this can be achieved by different maneuvers depending on the location settings and patient cooperation .

luxation of the eye globe is a rare occasion but it carries a risk of threat to permanent vision loss especially when associated with very high intraocular pressure . appropriate intervention should be undertaken instantly . predisposing factors include ; eyes as in shallow orbital sockets , floppy eyelid syndrome , and exophthalmos . prompt reduction results in restoration of full anatomical and visual recovery in otherwise healthy eyes . we report a case of globe luxation following trauma by door handle in a 65-year - old female , who recovered completely after reposition of the globe using desmarres lid retractors .

tumefactive multiple sclerosis ( tms ) is an inflammatory demyelinating disease of the central nervous system , and has recently been described as a subtype of multiple sclerosis ( ms ) that is characterized by the appearance of solitary or multiple space - occupying lesions associated with ring enhancement and perifocal edema on magnetic resonance images ( mri ) . this disease is an extremely rare variant of ms , occurring in 1/1000 cases of ms or 3 cases per million per year . these lesions pose considerable diagnostic uncertainty , in part due to the atypical neurologic symptoms that can be observed as a consequence of the size , location , and the potential associated mass effect and edema . a 34-year - old lady was transferred to the intensive care unit ( icu ) due to developing quadriplegia and decreased level of consciousness in the postanesthesia care unit . she had received general anesthesia for an exploratory laparotomy procedure because of right upper quadrant abdominal pain 6 h before referral . the laparotomy had yielded to the sole finding of fatty liver with no evidence of cholecystitis or other surgical complications . during the operation , the patient was stable and the procedure was uneventful ; however , in the recovery room it was noticed that the patient had developed quadriplegia , decreased level of consciousness , and aphasia . the patient had a past history of diabetes mellitus and hypothyroidism and she arrived in icu with a glasgow coma scale of 8/15 and muscle power of 1/5 in all extremities . the deep tendon reflexes were 1/2 in upper extremities and 0/2 in lower limbs . due to neurological findings , brain mri was performed which revealed a focus of high signal intensity in left cerebellar peduncle extending to the left side of medulla oblongata on t2 and fluid - attenuated inversion - recovery ( flair ) images showing expansion and peripheral enhancement after contrast injection [ figure 1 ] . a hypersignal lesion in t2 and flair images were also noted in the right temporal lobe , involving both gray and white matter , which was hyposignal in t1 [ figure 2 ] . brain magnetic resonance images ( a - c ) showing a focus of high signal intensity in left cerebellar peduncle extending to the left side of medulla oblongata on t2 and fluid - attenuated inversion - recovery images showing expansion and peripheral enhancement after contrast injection images ( a - c ) revealing a lesion in right temporal lobe , involving both gray and white matter , which is hyposignal in t1 , and hypersignal in t2 , and fluid - attenuated inversion - recovery images primary differential diagnosis included glioblastoma , rhombencephalitis , and tms , so immediate complementary workups including blood samples , cerebrospinal fluid examinations , and rheumatologic serology tests were sent which were all within normal limits . hence , based on all the findings , an impression of tms was made , and the patient was started on methylprednisolone pulse therapy with the dosage of 500 mg intravenously every 12 h for 3 days . she showed dramatic response with improvement in muscle power , deep tendon reflexes , level of consciousness , and the ability to speak fluently after 4 days . tumefactive multiple sclerosis is a very rare form of ms with the predominantly female distribution . it can present with various symptoms , such as slowed mentation , memory lapses , limb weakness , confusion , gaze preference , visual changes , dizziness , and ataxia . ms plaques on mri typically appear as multiple , well - demarcated , homogenous , small ovoid lesions , lacking mass effect , and often oriented perpendicular to the long axis of the lateral ventricles . in tms , however , radiological findings totally differ including a solitary large lesion , size > 2 cm , associated mass effect , perilesional edema , and/or the presence of ring enhancement . the clinical and imaging characteristics of these demyelinating lesions may mimic primary and secondary brain tumors , brain abscess , tuberculoma , and other inflammatory disorders , e.g. , sarcoidosis , primary sjogren 's syndrome , and thus confound the diagnosis . the occurrence of tumor - like demyelination is reportedly rare being estimated at 12/1000 cases of ms . limited numbers of previous case reports on tms are available ; however , this is the first reported patient with the initial presentation of postoperation quadriplegia and aphasia evoked after the general anesthesias a manifestation of tms . among the largest cohort of biopsy - proven tms cases analyzed to date , common presenting symptoms in decreasing frequency included : motor , cognitive , cerebellar , and brainstem dysfunction . in addition , atypical symptoms included headache , seizures , aphasia , cortical sensory loss or psychosis . the tumefactive episode represented the initial event in 61% of cases ; however , 29% of patients had a prior history of relapsing neurologic symptoms , and 5% carried an established diagnosis of ms . acute onset of the disease , presence of ring enhancement , and dramatic response to pulse therapy helped establish the diagnosis in our patient .

post - operative quadriplegia is a rarely encountered complication and not previously reported as the initial presentation of tumefactive multiple sclerosis . we present an unusual case of a patient with such manifestation and atypical lesions on brain magnetic resonance imaging . the patient was treated with methyl prednisolone pulse therapy and showed a dramatic response . uncommon neurologic diseases can have very unusual presentations , which should be taken into consideration when encountered with such patients . considering this fact will help physicians in better decision - making and proper treatment planning .

major depressive disorder ( mdd ) is a common mental disorder that is associated with deficits in cognitive function.1 it ranks fourth as the leading cause of overall disease burden worldwide and is the predominant reason of lost disability - adjusted life - years among developed countries.2 mdd can lead to a reduction in the quality of life and overall health , and enhanced economic costs . moreover , it is also associated with a higher risk of suicide.3,4 there are many antidepressants available for the treatment of mdd ; however , only ~50% of patients respond to these drugs and ~30% achieve remission.57 moreover , antidepressant treatment could result in several adverse events , such as weight changes , sexual dysfunction , and insomnia , which can influence patients compliance with therapy.810 vortioxetine is a novel antidepressant that has been approved for the treatment of mdd.11,12 in october 2013 , the us food and drug administration ( fda ) approved vortioxetine for the treatment of mdd.13 the mechanism of action of vortioxetine lies in its multimodal activity . it combines two pharmacologic modes of action : direct modulation of serotonin ( 5-ht ) receptor activity and inhibition of the 5-ht transporter . in vitro studies demonstrate that vortioxetine is a 5-ht3 , 5-ht7 , and 5-ht1d receptor antagonist ; a 5-ht1b receptor partial agonist ; a 5-ht1a receptor agonist ; and an inhibitor of the 5-ht transporter.14,15 the precise contribution of the individual targets to the observed pharmacodynamic profile remains unclear . however , preclinical trials indicate that the targets interact in a complex fashion , which result in modulation of neurotransmission in several systems , including serotonin , norepinephrine , dopamine , histamine , and acetylcholine systems , within the rat forebrain.14,15 the current recommend dosage of vortioxetine for the treatment of mdd is 520 mg / day,15 and 10 mg / day is recommended as the starting dose . however , a dose of 5 mg / day vortioxetine is recommended for patients who do not tolerate this high dose of 10 mg . several multicenter , large - scale trials have evaluated the treatment effects of 10 mg vortioxetine in the treatment of mdd ; however , these trials have shown inconsistent results . thus , we conducted a meta - analysis of randomized controlled trials ( rcts ) to assess the efficacy and safety of 10 mg vortioxetine in the treatment of patients with mdd . a comprehensive search was conducted to identify relevant studies published in pubmed , embase , and web of science databases before october 22 , 2015 . the search terms were ( depressive disorder , major[mesh terms ] or ( depressive[all fields ] and disorder[all fields ] and major[all fields ] ) or major depressive disorder[all fields ] or ( major[all fields ] and depressive[all fields ] and disorder[all fields ] ) or major depressive disorder[all fields ] or depressive disorder[mesh terms ] or ( depressive[all fields ] and disorder[all fields ] ) or depressive disorder[all fields ] or ( major[all fields ] and depressive[all fields ] and disorder[all fields ] ) ) and ( vortioxetine[supplementary concept ] or vortioxetine[all fields ] ) . furthermore , we also identified relevant studies through a review of clinicaltrials.gov in case of missing unpublished studies . the reference lists of included studies and recent reviews were also manually searched until no additional potential studies could be found . all clinical trials that assessed the efficacy and safety of vortioxetine / lu aa21004 in the treatment of mdd were considered eligible for the analysis . the following study inclusion criteria were applied : 1 ) population : patients were diagnosed with mdd according to the diagnostic and statistical manual of mental disorders 4th ed , 2 ) intervention : vortioxetine / lu aa21004 10 mg / day , 3 ) comparison : placebo alone , 4 ) outcomes : response rate ; remission rate ; absolute changes in the montgomery asberg depression rating scale ( madrs ) , hamilton rating scale for depression ( 24-items ) ( ham - d24 ) , clinical global impression - severity ( cgi - s ) , and clinical global impression - improvement ( cgi - i ) scores ; and the incidence of treatment - emergent adverse events , and 5 ) study design : rct . madrs response rate was defined as 50% decrease in madrs total score from baseline , and madrs remission rate was defined as a madrs total score 10 . data extraction and quality assessment were conducted by two independent investigators ( guangjian li and dihui ma ) using a standardized data extraction form . the information extracted included : first author , year of publication , regimen , study design , number of patients in the study and control group , medical dose , duration of therapy , baseline depression rating scores and posttreatment mean change scores from baseline , incidence of treatment - related adverse events in the study and control group , response rate , and remission rate . for the trials that compared different doses of vortioxetine to placebo , we only included the data comparing the 10 mg / day dose to the placebo dose . the jadad scale consists of three items describing randomization ( 02 points ) , masking ( 02 points ) , and dropouts and withdrawals ( 01 points ) in the report of an rct.16 the quality scale ranges from 0 to 5 points , and a higher score indicates higher quality . any study with a score 3 is considered to be of high quality.17 this meta - analysis was conducted using stata version 12.0 ( statacorp lp , college station , tx , usa ) . dichotomous variables , such as response rate , remission rate , and incidence of adverse events , were expressed as risk ratio ( rr ) with 95% confidence intervals ( 95% cis ) . continuous variables , including the change in madrs and ham - d24 scores from baseline , were expressed as weighted mean differences ( wmds ) with 95% cis . before the data were pooled , we first tested the heterogeneity among the studies using the cochrane q chi - square test and i statistics , in which p - value < 0.10 or i>50% were considered as heterogeneity.18 a random - effects model ( dersimonian laird method)19 or a fixed - effects model ( mantel haenszel method)20 was used to pool the estimates according to the presence or absence of heterogeneity . whenever heterogeneity was found , subgroup analysis and sensitivity analysis were performed to explore the potential sources . because the number of included studies in each analysis was less than ten , publication bias was not assessed . a comprehensive search was conducted to identify relevant studies published in pubmed , embase , and web of science databases before october 22 , 2015 . the search terms were ( depressive disorder , major[mesh terms ] or ( depressive[all fields ] and disorder[all fields ] and major[all fields ] ) or major depressive disorder[all fields ] or ( major[all fields ] and depressive[all fields ] and disorder[all fields ] ) or major depressive disorder[all fields ] or depressive disorder[mesh terms ] or ( depressive[all fields ] and disorder[all fields ] ) or depressive disorder[all fields ] or ( major[all fields ] and depressive[all fields ] and disorder[all fields ] ) ) and ( vortioxetine[supplementary concept ] or vortioxetine[all fields ] ) . furthermore , we also identified relevant studies through a review of clinicaltrials.gov in case of missing unpublished studies . the reference lists of included studies and recent reviews were also manually searched until no additional potential studies could be found . all clinical trials that assessed the efficacy and safety of vortioxetine / lu aa21004 in the treatment of mdd were considered eligible for the analysis . the following study inclusion criteria were applied : 1 ) population : patients were diagnosed with mdd according to the diagnostic and statistical manual of mental disorders 4th ed , 2 ) intervention : vortioxetine / lu aa21004 10 mg / day , 3 ) comparison : placebo alone , 4 ) outcomes : response rate ; remission rate ; absolute changes in the montgomery asberg depression rating scale ( madrs ) , hamilton rating scale for depression ( 24-items ) ( ham - d24 ) , clinical global impression - severity ( cgi - s ) , and clinical global impression - improvement ( cgi - i ) scores ; and the incidence of treatment - emergent adverse events , and 5 ) study design : rct . madrs response rate was defined as 50% decrease in madrs total score from baseline , and madrs remission rate was defined as a madrs total score 10 . data extraction and quality assessment were conducted by two independent investigators ( guangjian li and dihui ma ) using a standardized data extraction form . the information extracted included : first author , year of publication , regimen , study design , number of patients in the study and control group , medical dose , duration of therapy , baseline depression rating scores and posttreatment mean change scores from baseline , incidence of treatment - related adverse events in the study and control group , response rate , and remission rate . for the trials that compared different doses of vortioxetine to placebo , we only included the data comparing the 10 mg / day dose to the placebo dose . the jadad scale consists of three items describing randomization ( 02 points ) , masking ( 02 points ) , and dropouts and withdrawals ( 01 points ) in the report of an rct.16 the quality scale ranges from 0 to 5 points , and a higher score indicates higher quality . this meta - analysis was conducted using stata version 12.0 ( statacorp lp , college station , tx , usa ) . dichotomous variables , such as response rate , remission rate , and incidence of adverse events , were expressed as risk ratio ( rr ) with 95% confidence intervals ( 95% cis ) . continuous variables , including the change in madrs and ham - d24 scores from baseline , were expressed as weighted mean differences ( wmds ) with 95% cis . before the data were pooled , we first tested the heterogeneity among the studies using the cochrane q chi - square test and i statistics , in which p - value < 0.10 or i>50% were considered as heterogeneity.18 a random - effects model ( dersimonian laird method)19 or a fixed - effects model ( mantel haenszel method)20 was used to pool the estimates according to the presence or absence of heterogeneity . whenever heterogeneity was found , subgroup analysis and sensitivity analysis were performed to explore the potential sources . because the number of included studies in each analysis was less than ten , publication bias was not assessed . the initial search yielded 328 relevant records , of which 322 were excluded because of duplicate records and various reasons ( case reports , reviews , letters , non - rcts , or unrelated with our topics ) . eventually , six rcts with a total of 1,801 patients met the inclusion criteria and were included in this meta - analysis ( figure 1).2126 we obtained the full texts of the six papers through various means . the main characteristics of the six rcts included in this meta - analysis are presented in table 1 . the sample size of these trials ranged from 205 to 391 . of the studies included , two were conducted in us , three outside us , and one in us and non - us sites . all the trials were placebo - controlled , and two trials also included active comparator arm ( one trial included duloxetine and the other one included venlafaxine ) . these trials also studied the effect of other doses of vortioxetine , including 2.5 , 5 , 15 , and 20 mg . in accordance with the purpose of this meta - analysis all the trials evaluated the effect of vortioxetine at 8 weeks except one,25 in which the effect assessment was conducted at 6 weeks . all the included studies had a jadad score greater than 3 ( range from 4 to 5 ) . all six rcts reported the data on response rate.2126 the aggregated results of these studies suggest that patients treated with 10 mg vortioxetine had a higher response rate than those treated with placebo ( rr = 1.50 ; 95% ci : 1.32 , 1.70 ; p<0.001 ) ( figure 2 ) . all trials reported the data on remission rate.2126 the aggregated results of these studies suggest that vortioxetine 10 mg was associated with a higher remission rate than placebo ( rr = 1.54 ; 95% ci : 1.29 , 1.83 ; p<0.001 ) ( figure 2 ) . all six rcts reported changes from baseline in the madrs score.2126 the aggregated results of these studies suggest that vortioxetine 10 mg significantly reduced the madrs score ( wmd = 3.27 ; 95% ci : 4.88 , 1.66 ; p<0.001 ) ( figure 3 ) . exclusion of the trial that assessed the effect of vortioxetine at 6 weeks25 resulted in similar combined estimates ( wmd = 2.79 ; 95% ci : 4.51 , 1.06 ; p=0.002 ) , yet the heterogeneity did not disappear ( i=99.8% , p<0.001 ) . exclusion of the trial conducted by mahableshwarkar et al24 did not change the pooled estimates substantially ( wmd = 3.77 ; 95% ci : 5.24 , 2.29 ; p<0.001 ) , and the heterogeneity was still present ( i=99.7% , p<0.001 ) . further exclusion of any single study did not resolve the heterogeneity and the overall combined wmd , which ranged from 3.62 ( 95% ci : 5.43 , 1.82 ) to 2.79 ( 95% ci : 4.51 , 1.06 ) . the pooled results showed that vortioxetine 10 mg significantly reduced the madrs score in both the us ( wmd = 1.49 ; 95% ci : 2.88 , 0.11 ; p=0.034 ) and non - us ( wmd = 3.98 ; 95% ci : 6.49 , 1.47 ; p=0.002 ) regions ; patients outside the us seemed to have a greater decrease in the madrs score than those in the us ( 3.98 vs 1.49 ) . three rcts reported changes from baseline in ham - d24 and cgi - s scores,21,25,26 and six rcts reported changes from baseline in cgi - i score.2126 the aggregated results of these studies suggest that vortioxetine 10 mg was associated with a greater reduction in ham - d24 score ( wmd = 3.94 ; 95% ci : 6.33 , 1.56 ; p=0.001 ) , little decrease in cgi - s score ( wmd = 0.56 ; 95% ci : 1.06 , 0.06 ; p=0.028 ) , and slight reduction in cgi - i score ( wmd = 0.32 , 95% ci : 0.55 , 0.08 ; p=0.010 ) ( figure 4 ) . the sensitivity analysis showed that the pooled estimates were not significantly influenced when we excluded any single trial , but the heterogeneity was still present ( data not shown ) . all the trials reported data on adverse events.2126 the aggregated results of these studies suggest that the incidence of treatment - emergent adverse events was slightly higher in the 10 mg vortioxetine group than that in the placebo group ( rr = 1.11 ; 95% ci : 1.03 , 1.20 ; p=0.005 ) . the most common adverse events were nausea , headache , dizziness , diarrhea , and dry mouth . pooled results showed that , compared to placebo , 10 mg vortioxetine was associated with a higher incidence of nausea ( rr = 3.44 ; 95% ci : 2.63 , 4.48 ; p<0.001 ) , vomiting ( rr = 2.78 ; 95% ci : 1.32 , 5.85 ; p=0.007 ) , constipation ( rr = 2.03 ; 95% ci : 1.15 , 3.58 ; p=0.015 ) , and hyperhidrosis ( rr = 4.44 ; 95% ci : 1.29 , 15.26 ; p=0.018 ) . for seven other adverse events , there were no significant differences between the vortioxetine and placebo groups . the initial search yielded 328 relevant records , of which 322 were excluded because of duplicate records and various reasons ( case reports , reviews , letters , non - rcts , or unrelated with our topics ) . eventually , six rcts with a total of 1,801 patients met the inclusion criteria and were included in this meta - analysis ( figure 1).2126 we obtained the full texts of the six papers through various means . the main characteristics of the six rcts included in this meta - analysis are presented in table 1 . the sample size of these trials ranged from 205 to 391 . of the studies included , two were conducted in us , three outside us , and one in us and non - us sites . all the trials were placebo - controlled , and two trials also included active comparator arm ( one trial included duloxetine and the other one included venlafaxine ) . these trials also studied the effect of other doses of vortioxetine , including 2.5 , 5 , 15 , and 20 mg . in accordance with the purpose of this meta - analysis all the trials evaluated the effect of vortioxetine at 8 weeks except one,25 in which the effect assessment was conducted at 6 weeks . all the included studies had a jadad score greater than 3 ( range from 4 to 5 ) . all six rcts reported the data on response rate.2126 the aggregated results of these studies suggest that patients treated with 10 mg vortioxetine had a higher response rate than those treated with placebo ( rr = 1.50 ; 95% ci : 1.32 , 1.70 ; p<0.001 ) ( figure 2 ) . all trials reported the data on remission rate.2126 the aggregated results of these studies suggest that vortioxetine 10 mg was associated with a higher remission rate than placebo ( rr = 1.54 ; 95% ci : 1.29 , 1.83 ; p<0.001 ) ( figure 2 ) . all six rcts reported changes from baseline in the madrs score.2126 the aggregated results of these studies suggest that vortioxetine 10 mg significantly reduced the madrs score ( wmd = 3.27 ; 95% ci : 4.88 , 1.66 ; p<0.001 ) ( figure 3 ) . exclusion of the trial that assessed the effect of vortioxetine at 6 weeks25 resulted in similar combined estimates ( wmd = 2.79 ; 95% ci : 4.51 , 1.06 ; p=0.002 ) , yet the heterogeneity did not disappear ( i=99.8% , p<0.001 ) . exclusion of the trial conducted by mahableshwarkar et al24 did not change the pooled estimates substantially ( wmd = 3.77 ; 95% ci : 5.24 , 2.29 ; p<0.001 ) , and the heterogeneity was still present ( i=99.7% , p<0.001 ) . further exclusion of any single study did not resolve the heterogeneity and the overall combined wmd , which ranged from 3.62 ( 95% ci : 5.43 , 1.82 ) to 2.79 ( 95% ci : 4.51 , 1.06 ) . the pooled results showed that vortioxetine 10 mg significantly reduced the madrs score in both the us ( wmd = 1.49 ; 95% ci : 2.88 , 0.11 ; p=0.034 ) and non - us ( wmd = 3.98 ; 95% ci : 6.49 , 1.47 ; p=0.002 ) regions ; patients outside the us seemed to have a greater decrease in the madrs score than those in the us ( 3.98 vs 1.49 ) . three rcts reported changes from baseline in ham - d24 and cgi - s scores,21,25,26 and six rcts reported changes from baseline in cgi - i score.2126 the aggregated results of these studies suggest that vortioxetine 10 mg was associated with a greater reduction in ham - d24 score ( wmd = 3.94 ; 95% ci : 6.33 , 1.56 ; p=0.001 ) , little decrease in cgi - s score ( wmd = 0.56 ; 95% ci : 1.06 , 0.06 ; p=0.028 ) , and slight reduction in cgi - i score ( wmd = 0.32 , 95% ci : 0.55 , 0.08 ; p=0.010 ) ( figure 4 ) . the sensitivity analysis showed that the pooled estimates were not significantly influenced when we excluded any single trial , but the heterogeneity was still present ( data not shown ) . all the trials reported data on adverse events.2126 the aggregated results of these studies suggest that the incidence of treatment - emergent adverse events was slightly higher in the 10 mg vortioxetine group than that in the placebo group ( rr = 1.11 ; 95% ci : 1.03 , 1.20 ; p=0.005 ) . the most common adverse events were nausea , headache , dizziness , diarrhea , and dry mouth . pooled results showed that , compared to placebo , 10 mg vortioxetine was associated with a higher incidence of nausea ( rr = 3.44 ; 95% ci : 2.63 , 4.48 ; p<0.001 ) , vomiting ( rr = 2.78 ; 95% ci : 1.32 , 5.85 ; p=0.007 ) , constipation ( rr = 2.03 ; 95% ci : 1.15 , 3.58 ; p=0.015 ) , and hyperhidrosis ( rr = 4.44 ; 95% ci : 1.29 , 15.26 ; p=0.018 ) . for seven other adverse events , there were no significant differences between the vortioxetine and placebo groups . the present study was a meta - analysis with the objective of assessing the efficacy and safety of 10 mg vortioxetine in the treatment of patients with mdd . our study demonstrated that , compared to placebo , the treatment with 10 mg vortioxetine was associated with a higher response rate and remission rate in patients with mdd . furthermore , vortioxetine 10 mg also produced significant effects on the changes from baseline in the madrs , ham - d24 , cgi - i , and cgi - s scores . a higher incidence of treatment - emergent adverse events was observed in the 10 mg vortioxetine group than that in the placebo group . these findings indicated that 10 mg vortioxetine seemed to be more effective and well tolerated than placebo in the treatment of patients with mdd . in this meta - analysis , we found that 10 mg vortioxetine significantly improved the response rate and remission rate in the treatment of patients with mdd . these positive results were observed in all the included studies , in which the response rate and remission rate ranged from 33.8% to 68% and 21.4% to 49% , respectively . the highest response rate and remission rate were observed in the study conducted by alvarez et al,25 in which 205 patients from 49 psychiatric settings in eleven countries were enrolled , and 92% of them were caucasian . at week 6 , 68% ( 68 out of 100 ) of patients in the vortioxetine 10 mg group and 42.9% ( 45 out of 105 ) of patients in the placebo group achieved a madrs response ( 50% decrease in madrs total score)25 and the corresponding value of remission rate was 49% ( 49 out of 100 ) and 25.7% ( 27 out of 105 ) , respectively . another rct assessing the efficacy and safety of 10 mg vortioxetine , however , demonstrated a relatively lower rate of response and remission , in which 312 participants at 37 sites in the us were enrolled , and 72.4% of them were white.23 the madrs response at 8 weeks was achieved in 33.8% and 28.4% of patients in the vortioxetine 10 mg and placebo groups , respectively . the madrs remission rate for the two groups was 21.4% and 14.2% , respectively.23 despite that both the two trials observed a significant difference in response rate and remission rate between the vortioxetine 10 mg and placebo groups , the magnitude of response rate in the former trial ( 68% ) was almost two times greater than that in the latter trial ( 33.8% ) . one possible explanation for this was the difference in race , since the proportion of white patients in the former trial ( 92% ) was larger than that in the latter one ( 72.4% ) . regarding the changes from baseline in the madrs score , our study indicated that there was a significant reduction in the madrs score for the vortioxetine 10 mg group compared with placebo . however , high heterogeneity was found among the trials reporting data on madrs score . despite sensitivity analysis was performed to explore the potential sources of heterogeneity , no significant factors that may introduce the heterogeneity were found . according to the published studies , several factors may contribute to the huge heterogeneity among the included studies.27,28 the inclusion criteria were an important factor for the heterogeneity among the studies . of these included studies , the inclusion criteria for the madrs total score varied among them . four of the six trials included patients with a madrs total score 26 , and the remaining two enrolled patients with a score 30 . the differences in the inclusion criteria of madrs total score may result in heterogeneous patients , and thus may influence the subsequent outcomes of changes in the madrs score . furthermore , some other factors among the included studies were different , including age , region , and race . among the six trials , three were conducted outside us ( including europe , asia , and africa ) , two in us , and one in us and non - us sites . different regions have different races and social environments , which would result in heterogeneity . in terms of safety , the incidence of treatment - emergent adverse events was higher in the 10 mg vortioxetine group than that in the placebo group . the most common adverse events of vortioxetine included nausea , dizziness , headache , dry mouth , and diarrhea . the pooled results showed that vortioxetine induced a higher incidence of nausea when compared with placebo , but the incidences of other common adverse events between the two groups were not significantly different . some other adverse events of vortioxetine were reported in these studies , including vomiting , constipation , hyperhidrosis , fatigue , insomnia , and nasopharyngitis . of them , the incidences of vomiting , constipation , and hyperhidrosis were higher in the vortioxetine group than those in the placebo group . treatment.27,28 it not only adversely impacts the quality of life of antidepressant users , but also reduces the patients compliance with treatment.28 in this meta - analysis , only two trials reported the available data on sexual dysfunction ; thus , we could not investigate whether vortioxetine has adverse effects on sexual dysfunction in the treatment of patients with mdd . future research could focus on this issue . in this meta - analysis , we assessed the efficacy and safety of 10 mg vortioxetine in the treatment of mdd , and most of the findings were consistent with a recent published meta - analysis that evaluated the effects of 5 mg vortioxetine.29 in that study , the authors included five rcts , and found that the treatment response of 5 mg / day vortioxetine was greater than that of placebo group and the incidence of nausea was higher in the 5 mg / day vortioxetine group than that in the control group.29 however , 5 mg / day vortioxetine did not have a significant antidepressant effect on remission rate for patients with mdd . notably , huge heterogeneity among the five rcts was also observed when performing the meta - analysis . thus , the authors conducted a sensitivity analysis ; however , only the pooled remission rate was significantly influenced when one trial was excluded . there are some potential limitations in this meta - analysis that should be taken into account when interpreting our results . first , our study was conducted on only six rcts , and most of them had relatively small sample size . although the six rcts were well conducted and of high quality ( jadad score > 3 ) , caution should be exercised when applying the pooled results into clinical practice since small trials are more likely to overestimate the treatment effect as compared to larger trials . third , due to limited data , we did not evaluate the effects and safety of vortioxetine on subgroup population , such as the older patients and white vs non - white patients . fourth , it should be noted that all the trials were funded by a pharmaceutical company ( takeda ) , and their results may have been influenced by the inherent conflict of interest and possible bias . the present meta - analysis indicated that 10 mg vortioxetine significantly increased the response rate and remission rate , and also decreased the madrs , ham - d24 , cgi - s , and cgi - i scores . moreover , 10 mg vortioxetine produced an acceptable and tolerable risk of nausea . therefore , vortioxetine 10 mg is more effective than placebo for the treatment of mdd . however , considering that this study was conducted on a small number of rcts , further large - scale , well - performed trials are needed to verify our findings .

backgroundvortioxetine is an investigational multimodal antidepressant . we conducted this meta - analysis to assess the efficacy and safety of 10 mg vortioxetine in the treatment of major depressive disorder ( mdd).methodsrandomized controlled trials ( rcts ) published in pubmed , web of science , embase , and clinicaltrials.gov were systematically reviewed to assess the treatment effects and safety profiles of patients with mdd who were treated with 10 mg vortioxetine . the outcome measures included response rate , remission rate , changes from baseline in montgomery asberg depression rating scale ( madrs ) , hamilton rating scale for depression ( 24-items ) ( ham - d24 ) , clinical global impression - severity ( cgi - s ) , and clinical global impression - improvement ( cgi - i ) scores . results were expressed with risk ratio or weighted mean difference with 95% confidence intervals . pooled results were calculated using a fixed - effects model or a random - effects model according to the heterogeneity among included trials.resultssix rcts with a total of 1,801 patients met the inclusion criteria and were included in this meta - analysis . the 10 mg vortioxetine dose significantly increased the response rate and remission rate in the treatment of mdd compared with placebo . moreover , there was a statistically significant reduction from baseline in the madrs , ham - d24 , cgi - s , and cgi - i scores with 10 mg vortioxetine vs placebo . the incidence of treatment - emergent adverse events such as nausea , vomiting , constipation , and hyperhidrosis was higher in the 10 mg vortioxetine group than in the placebo group.conclusionvortioxetine 10 mg can significantly increase the response rate and remission rate , and reduce the madrs , ham - d24 , cgi - s , and cgi - i scores in patients with mdd with an acceptable risk of treatment - emergent adverse events . further well - conducted , large - scale trials are needed to validate these findings .

as an autoimmune disease that attacks the central nervous system ( cns ) , multiple sclerosis ( ms ) leads to multifocal neural demyelination and axonal injuries . due to the lack of effective treatment , most patients survive with various disabilities that severely impair the quality of life . currently , the most important animal model of ms is experimental allergic encephalomyelitis ( eae ) , which is induced by immunizing sensitive animals using specific antigens and is manifested with cns white matter demyelination [ 24 ] . specifically , mog 3555-immunized c57bl/6 mice had eae similar to clinical ms , making it an ideal animal model [ 57 ] . immune dysfunctions in eae include the breakdown of myelin sheath by autoantibodies , the activation of auto - reactive t cells , and related cytokine expression modulation [ 79 ] . toll - like receptors ( tlrs ) play a critical role in both innate immunity and acquired immunity . recent studies show that toll - interleukin-1 receptor ( tir)-domain containing adaptor protein - inducing interferon beta ( trif ) is an important molecule in tlrs - induced signal transducing pathway . further studies about the trif - related pathway have established its role in immune response and pathogenesis , in addition to novel drug targets against certain allergic disease . the role of trif in either human ms or eae animal models , however , still needs to be further elucidated . this study therefore aimed to investigate the effect of trif in eae using specific small - interference rna ( sirna ) and related neurological methods . the animal study protocol was pre - approved by the animal experiments ethics committee of the heilongjiang hospital . after anesthesia , the spleen was removed , ground , filtered , and rinsed by hank s solution . the collected spleen cell suspension after the complete lysis of erythrocytes , the mixture was re - centrifuged at 2000 rpm for 3 min to discard erythrocyte debris . after washing by hank s solution , lymphocytes were re - suspended in rpmi-1640 medium ( yubo biotech , china ) with 10% fetal bovine serum ( fbs ) . cells were cultured using dmem culture medium ( yubo biotech , shanghai , china ) containing 5 mm d - glucose at 37c with 5% co2 . the experimentation with animals was governed by the regulations of experimental animals of heilongjiang hospital authority and was approved by the animal ethics committee of heilongjiang hospital . one day before the transfection , cultured lymphocytes were inoculated into petri dishes without antibiotics . cells with 30% confluence were transfected with sirna of icos or non - specific ( ns ) controlled sirna ( santa cruz , usa ) using lipofectamine 2000 ( invitrogen , usa ) according to the manual s instructions . in brief , diluted liposome solutions ( 1:50 ) were mixed with equal volumes of sirna ( 0.2 mm ) , followed by 20-min incubation at room temperature . the mixture was then added into the cultured dish , which was filled with 5 ml serum - free dmem culture medium . cells ( 510 ) in all groups were collected and extracted for total rna using the trizol kit ( invitrogen , usa ) following the manual s instructions . trif - specific primers were designed by primer 5.0 software with the following sequences : trif - f , 5-cuc cac gac uca aua ta-3 ; icos - r , 5-ttc atg ugc uaa cgc ag-3 ; -actin - f , 5-ggt gtg atg gtg ggt atg ggt-3 ; -actin - r , 5-ctg ggt cat ctt ttc acg gt-3. quantitative rt - pcr was carried out using sybr pcr kit ( invitrogen , usa ) following the manual s instructions with the following condition : pre - denature for 5 min at 94c ; 30 cycles of amplification , each containing 1-min denature at 94c , 1-min annealing at 60c , and 3-min elongation at 72c ; ending with 5-min elongation at 72c . . relative expression level of mrna was calculated using 2 method based on the standard curve . we purchased 20 female c57bl/6 mice ( age between 6~8 weeks , body weight=16~20 g ) from the animal center of our university . at the first day , 100 l mog 35 - 55 emulsion ( containing 100 g mog35 - 55 purchased from sheldon biotech , canada ; 500 l complete freund s adjuvant and 500 g inactivated mycobacteria ) was subcutaneously injected into bilateral inguinal regions . on the same day and 48 h after the immunization , we used the following standard of neurology to evaluate the condition of eae : grade i , partial drooping of the tail ; grade ii , complete drooping of the tail ; grade iii , complete drooping of the tail and slow movement ; grade iv , partial paralysis of hind limbs ; grade v , complete paralysis of hind limbs ; grade vi , agonal status . after the generation of the eae model , 100 l of trif - specific sirna or non - specific ( ns ) sirna was injected into the tail vein of animals . the neurological behavior was evaluated 24 h after the injection . lymphocytes were extracted as described previously and were cultured in dmem ( with 10% fbs and 5 mm d - glucose ) at 37c with 5% co2 . after 48-h incubation , supernatants from culture medium was quantified for il-2 and ifn- levels using elisa kit ( bd corp . spss 17.0 software was used to process all collected data , which are presented as mean standard deviation ( sd ) . one - way analysis of variance ( anova ) was applied for multiple group comparisons . the animal study protocol was pre - approved by the animal experiments ethics committee of the heilongjiang hospital . after anesthesia , the spleen was removed , ground , filtered , and rinsed by hank s solution . the collected spleen cell suspension after the complete lysis of erythrocytes , the mixture was re - centrifuged at 2000 rpm for 3 min to discard erythrocyte debris . after washing by hank s solution , lymphocytes were re - suspended in rpmi-1640 medium ( yubo biotech , china ) with 10% fetal bovine serum ( fbs ) . cells were cultured using dmem culture medium ( yubo biotech , shanghai , china ) containing 5 mm d - glucose at 37c with 5% co2 . the experimentation with animals was governed by the regulations of experimental animals of heilongjiang hospital authority and was approved by the animal ethics committee of heilongjiang hospital . one day before the transfection , cultured lymphocytes were inoculated into petri dishes without antibiotics . cells with 30% confluence were transfected with sirna of icos or non - specific ( ns ) controlled sirna ( santa cruz , usa ) using lipofectamine 2000 ( invitrogen , usa ) according to the manual s instructions . in brief , diluted liposome solutions ( 1:50 ) were mixed with equal volumes of sirna ( 0.2 mm ) , followed by 20-min incubation at room temperature . the mixture was then added into the cultured dish , which was filled with 5 ml serum - free dmem culture medium . cells ( 510 ) in all groups were collected and extracted for total rna using the trizol kit ( invitrogen , usa ) following the manual s instructions . trif - specific primers were designed by primer 5.0 software with the following sequences : trif - f , 5-cuc cac gac uca aua ta-3 ; icos - r , 5-ttc atg ugc uaa cgc ag-3 ; -actin - f , 5-ggt gtg atg gtg ggt atg ggt-3 ; -actin - r , 5-ctg ggt cat ctt ttc acg gt-3. quantitative rt - pcr was carried out using sybr pcr kit ( invitrogen , usa ) following the manual s instructions with the following condition : pre - denature for 5 min at 94c ; 30 cycles of amplification , each containing 1-min denature at 94c , 1-min annealing at 60c , and 3-min elongation at 72c ; ending with 5-min elongation at 72c . . relative expression level of mrna was calculated using 2 method based on the standard curve . we purchased 20 female c57bl/6 mice ( age between 6~8 weeks , body weight=16~20 g ) from the animal center of our university . at the first day , 100 l mog 35 - 55 emulsion ( containing 100 g mog35 - 55 purchased from sheldon biotech , canada ; 500 l complete freund s adjuvant and 500 g inactivated mycobacteria ) was subcutaneously injected into bilateral inguinal regions . on the same day and 48 h after the immunization , 400 ng pertussis toxin ( we used the following standard of neurology to evaluate the condition of eae : grade i , partial drooping of the tail ; grade ii , complete drooping of the tail ; grade iii , complete drooping of the tail and slow movement ; grade iv , partial paralysis of hind limbs ; grade v , complete paralysis of hind limbs ; grade vi , agonal status . after the generation of the eae model , 100 l of trif - specific sirna or non - specific ( ns ) sirna was injected into the tail vein of animals . lymphocytes were extracted as described previously and were cultured in dmem ( with 10% fbs and 5 mm d - glucose ) at 37c with 5% co2 . after 48-h incubation , supernatants from culture medium was quantified for il-2 and ifn- levels using elisa kit ( bd corp . spss 17.0 software was used to process all collected data , which are presented as mean standard deviation ( sd ) . one - way analysis of variance ( anova ) was applied for multiple group comparisons . as suggested by rt - pcr assay , sirna can effectively suppress the expression of trif in lymphocytes in vitro ( figure 1 , p<0.05 ) . eae is mainly manifested with slow movement , mental fatigue , decreased appetite , and body weight loss . in our study , eae mice began to show limb weakness , unstable movement , and further paralysis at 15 days after the immunization . the application of sirna alleviated the disease condition when compared to the model or sirna control group , as the treated mice had more days until disease onset , shorter durations of eae , and lower scores for neurological dysfunction ( table 1 , p<0.05 ) . elisa showed that after 1 week of disease onset , serum il-2 and inf- levels were significantly decreased in sirna - treated animals compared to sirna controls ( figure 2 , p<0.05 ) . as suggested by rt - pcr assay , sirna can effectively suppress the expression of trif in lymphocytes in vitro ( figure 1 , p<0.05 ) . eae is mainly manifested with slow movement , mental fatigue , decreased appetite , and body weight loss . in our study , eae mice began to show limb weakness , unstable movement , and further paralysis at 15 days after the immunization . the application of sirna alleviated the disease condition when compared to the model or sirna control group , as the treated mice had more days until disease onset , shorter durations of eae , and lower scores for neurological dysfunction ( table 1 , p<0.05 ) . elisa showed that after 1 week of disease onset , serum il-2 and inf- levels were significantly decreased in sirna - treated animals compared to sirna controls ( figure 2 , p<0.05 ) . both ms and eae have immune dysfunctions , including the production of autoantibody and activation of autoreactive t cells , both of which can damage the myelin sheath . various reactive t cells have been identified from both cerebrospinal fluid ( csf ) and peripheral blood in ms patients . the exact pathogenesis mechanism of ms is not clear , but it is very possible that the breakdown of body immune balance and related autoimmune reaction causes this disease [ 1315 ] . trif plays a critical role in immune response because the activation of transmembrane protein receptors tlr3 and tlr4 transduce their signals via the trif - inducing pathway , making trif a crucial target molecule for downstream signal transduction [ 1618 ] . downstream targets of trif include trif family - associated nf-b activator binding kinase 1 ( tbk1 ) and i-b kinase ( ikk ) . the signal subsequently transfers to the nucleus by phosphorylation to induce the gene expression of type i interferon . recent studies have revealed the importance of the trif - signaling pathway in the immune response against microbial infections . recent in vitro and in vivo studies have identified the participation of trif - inducing signal pathways in the production of multiple inflammatory factors , making it an important research focus . related studies showed that the lps - inducing tlr4/trif pathway works in a cascade pathway to facilitate the secretion of il-18 , which can up - regulate tnf- and cause liver damage . a previous study on ms using the eae model reported that polyinosinic - polycytidylic acid , a double - stranded rna analog , induced endogenous ifn - beta to suppress eae via tlr3 signaling pathway . evidence was also presented that r(+)win55,212 - 2 strongly induced ifn - beta expression in ms patient peripheral blood mononuclear cells and enhanced the therapeutic efficacy of murine ms model eae . it has been suggested that type i ifn suppresses eae development via constraining il-17 and induction of il-27 , indicating a protective role of trif against eae . we designed sirna to target the trif gene and for the first time utilized it in eae animal models . interestingly , our results were in contrast to previous data and showed that the decreased mrna level of trif in vitro and in vivo significantly favors neurological functions in sirna - treated animals compared to controls . unlike gene knockout technique , which alters dna sequence , rna silencing reduces the expression of specific genes and in turn mounts a variety of responses for regulation of life activities , the mechanism of which may be distinct from that in the gene knockout model . here , we showed that rnai - mediated trif knockdown improved the neurological outcomes of eae animals and their neurological functions . as the development of ms is modulated by multiple factors , the present study revealed that the down - regulation of il-2 and ifn- ; in serum of eae animals with trif sirna treatment correlated with the alleviation of neurological dysfunctions . it has been reported that the expression of il-2 in cns was decreased during the recovery period of eae , but was elevated during the induction and acute phases of the disease . other scholars have generated eae models using il-2 gene knockout mice and found that only one - quarter of transgenic mice had eae onset , in contrast to nearly 100% incidence in wild - type littermates . further studies also elucidated the involvement of il-2 in chronic renal failure after transplantation as other trif - inducing inflammatory factors , including il-6 and il-10 , facilitate the progression of the disease [ 27 , 28 ] . clinical signs of eae were also significantly lower in mice lacking irf3 , with impaired proliferation of th17 cells . other studies found that the substances released after tissue injury can work as endogenous ligands to activate relevant tlrs to exert a role in tissue recovery via tlr / trif - inducing cytokine release . our study further demonstrated the potentiation of serum il-2 and ifn- secretion by trif using sirna intervention in eae animals . trif sirna can extend the incubation period of eae , shorten its progressive period , and alleviate the neurological dysfunction , thereby protecting against eae , possibly via its suppression of cytokine il-2 and ifn- secretion .

backgroundmultiple sclerosis ( ms ) is an autoimmune disease causing multifocal demyelination and axonal injuries in the central nervous system ( cns ) . toll - interleukin-1 receptor ( tir)-domain containing adaptor protein - inducing interferon beta ( trif ) is an important adaptor protein for toll - like receptors ( tlrs ) and can modulate the immune response via regulating cytokine secretion . this study investigated the potential function of trif in ms mice via small interference rna ( sirna).material / methodsisolated mouse lymphocytes were processed using trif sirna , followed by rt - pcr assay to quantify trif expression level . an experimental allergic encephalomyelitis ( eae ) model was prepared in c57bl/6 mice immunized with mog 3555 . trif sirna or controlled sirna were intravenously applied to evaluate the neurological function of animals . serum levels of ifn- and il-2 were observed.resultsspecific sirna effectively decreased the trif expression in mouse dendritic cells and this sirna improved the eae severity and neurological scores . further assays showed that both ifn- and il-2 levels in the sirna treatment group were significantly lower than in controls.conclusionsthe expression of trif can be down - regulated by sirna , thereby alleviating the severity of eae via its inhibition of interleukin and cytokine release . this may provide new insights for future treatment of ms .

electron spin resonance ( esr ) or electron paramagnetic resonance ( epr ) is now widely used to analyze free radical species in living body and materials . it can be potentially used for estimating postmortem duration in the cause of death . pashinian and proshut , who suggested the potential of using esr in forensic medicine , attempted to determine the time of the occurrence of mechanical trauma by measuring the esr signals of bone marrow . several studies have analyzed blood by esr , because blood contains iron - containing proteins such as hemoglobin . mil ' et al . reported that the esr signal intensity of blood of patients exposed to radiation at the chernobyl nuclear accident is higher than that of healthy people . they reported that the intensity of esr signals from methemoglobin , nonheme irons , and organic radicals in dried human blood increase with time . . showed that ( 1 ) esr signals from bloodstains are effective in estimating the age of human and ( 2 ) esr signals regularly change over time within the period of 432 days . in these esr studies , measurements were performed at low temperature ( 140k ) for detecting the esr signal of protein - bonded ions . as described above , esr is now widely used to analyze living body and material in forensic medicine , and it can be potentially used to estimate the age of human from bloodstains . in those cases , esr measurements were performed at room temperature unless otherwise mentioned . however , with the exception of blood , few studies have examined the postmortem changes in esr signals found in organs and tissues . in this study , we investigated the origins of esr signals in postmortem tissues and the time courses of changes in the signals . esr spin trapping and probing is a method that has recently attracted attention and is used to analyze the free radicals of tissues . esr spin trapping method is performed by a conventional x - band esr analysis system [ 8 , 9 ] , which detects individual radical types as spin adducts and identify and quantify reactive oxygen species ( ros ) types based on the signal patterns . esr spin probing method has recently been applied to three - dimensional esr imaging for living body [ 1014 ] , but the method has to analyze relatively weak signals from living body [ 15 , 16 ] . ascorbic acid ( asa ) is a superior scavenger ; it reacts with hydroxyl radicals strongly , the rate of reaction is 7.0 101.1 10 ms , and ascorbyl radical ( asa * ) is generated after the reaction . the detection of esr signals of asa * is straightforword , because the spin trap adduct signal of asa * is simple . previous study of asa * spin adduct signal was limited to tissues having strong oxidative stresses or asa administration mouse having a high asa * level . a doublet peak spectrum was found to obtain following asa injection in mouse , and the signals were confirmed in different ways due to asa * . it was reported that ( 1 ) tissue constantly suffers from the oxidation of asa and iron proteins and ( 2 ) the oxidation reaction could proceed by the reaction of asa by these recycle fenton reactions . dmpo-(5,5-dimethtyl-1-pyrroline n - oxide ) asa * was detected in oxidative stress mouse skin induced by x - ray irradiation . a method to detect dmpo - asa * signal with a high sensitivity from a brain was reported recently by masumizu et al . . since esr signals of the tissues are extremely weak , the detection of signals has been difficult by conventional methods due to water - induced dielectric loss ( widl ) . however , the detection of dmpo - asa * from a normal organ without oxidation stress was also difficult . to minimize widl in biotissues , we attempted to detect tissue free radicals by modifying esr cuvettes and using dmpo . as normal tissue samples , brain , hart , lung , liver , kidney , pancreas , muscle , skin , and whole blood of mice were used . from these tissues , various esr spin adduct signals including dmpo - asa * , dmpo - superoxide anion radical ( ooh ) , and dmpo - hydrogen radical ( h ) signal were detected . the postmortem changes in asa spin adduct and other signals were monitored up to 205 days . possible application of asa * adduct signal as a natural oxidation stress indicator was also investigated through these experiments . in accordance with the methods of masumizu et al . , multiple standard free radicals were generated by following the radical generation system , and the g - value and hfcc of each spin adduct were obtained by esr - spin trapping method . a spin trapping agent ( 1050 l ) and a reaction liquid of the following free radical generation system ( 1050 l ) were placed on a high purity quartz cuvette , which was covered with a cover glass ( 0.15 mm in thickness ) , and spin adduct signals were measured by an esr . cover glass was bonded to the cuvette with the surface tension of spin trapping agent . spin trapping agents used in this study were dmpo ( 100 w / w% , liquid ) , 5-(dipropoxy phosphoryl)-5-methyl-1-pyrroline n - oxide ( dppmpo ) ( 50500 mm , dimethyl sulfoxide solution ) . the signal ratio was obtained for each measurement using the signal of mno , an internal standard substance , as a standard . superoxide dismutase ( sod ) solution ( 30 l ) ( 0.1 phosphate buffer / saline , ph 7.8 , 200 u / ml ) was added to it , and an appeared peak is assigned to dmpo - ooh ( superoxide radical ) or dppmpo - ooh . hydroxyl radicals were generated from the reaction of 10 mmol / l feso4 and 20 mmol / l h2o2 ( fenton reaction ) . hydroxyl radical were confirmed by adding 30 l asa solution ( 0.1 mol / l asa ) , and tan appeared peak is assigned to dmpo - oh ( hydroxyl radical ) or dppmpo - oh . asa * was generated by reacting hemoglobin ( 0.1 w / w% ) and asa ( 1 asa * was also generated by adding 10 l l - ascorbic acid solution ( 10 mmol / l ) to the 10 l hydroxyl radical generation system described above . hydrogen radical was generated by hematoporphyrin ( 1 w / w% ) with uv irradiation at 365 nm ( the intensity : 5 mw / cm ) ( ushio optical modulex , sx - ui 500mqq)(ushio , tokyo , japan ) . hydrogen radical is also generated by electrolyzing 0.01 w / w% nacl solution with ti-8000 ( nihon trim , osaka , japan ) . for confirming the generation of hydrogen radicals , dbnbs was added to the hydrogen radical solution and the color of the solution was observed to be orange ( p2002 - 350420a ) . the g - value of free radical signal obtained and identifyied and the signal was identified by the calculation of both frequency and magnet field of the esr signal . for correcting internal cavity for quantitative analysis , manganese oxide ( mno ) the relative intensity of radicals was calculated by comparison with the 3rd mno signal intensity . the g - value and the distance ( mt ) between the peaks for hfcc were measured by software coming with esr device . the measurements of g - value and hfcc were calculated by analysis software ( a - system vl.40 isaj , fa - manager vl.20 , jes , tokyo , japan ) accompanying with esr spectrometer . numerical value was measured more than three times , and the numerical maximum dispersion range is shown in number . electron spin resonance ( esr ) spectrometer ( jeol , jes - fa200 spectrometer , tokyo ) . esr spectrometry conditions used to estimate each radical with spin - trapping reagent were as follows : microwave frequency : 9414.499 5.000 mhz , microwave power : 4.00 mw , field center : 335.32 0.5 mt , sweep width : 5.00 mt , modulation frequency : 100.00 khz , modulation width + / : 0.1 mt , sweep time : 0.55 min , amplitude : 1.5002.500 , and time constant : 0.030.5 s , at room temperature . esr universal cavity ( jeol , es - ucx2 : te011 mode cavity ) with an x - band microwave unit ( 8.7509.650 ghz ) . esr standard marker : manganese oxide ( mno ) powder ( jeol datum , mo7-fb-4 ) aqueous sample cell ( jeol , es - lc12 ) , sample volume : 20100 l . a tissue - type quartz cell ( labotec , tokyo ) with home - made cover glass ( size : 40 5 0.5 mm in thickness ) . for postmortem change experiments , male ddy mice ( nihon slc , shizuoka , japan ) weighing 20.125.7 g ( 6 to 8 weeks old ) were used . the animals were housed at a room temperature of 20.225.3c under a 12-h light - dark cycle ( lights on at 7:00 a.m. ) . all of the following procedures were conducted in accordance with the guiding principles for the care and use of laboratory animals promulgated by the japanese pharmacological society and with the guidelines for animal care in our laboratories , as approved by the tokyo women 's medical university committee on animal care and use . the tissues were immediately removed and placed on an ice - cold plate after being rinsed with ice - cold buffer ( 0.1 mol / l phosphate buffer / saline , ph 7.8 ) . the tissues were sliced into 0.20.3 mm in thickness using a microtome ( kn3150465 ) ( kenis , osaka , japan ) . dmpo ( 1050 l ) was added to the tissue samples ( 1050 mg ) or the blood ( 1050 l ) immediately after being weighed , and at precisely five minutes after remove , esr signals were measured . to identify obtained peaks , the signals measured were analyzed by specialized analysis software , installed in the esr device , for determining the g - value and hfcc calculated from the distance between peaks . after the adduct signals of superoxide were confirmed , the decaying of the peak was monitored by adding sod solution to cuvettes containing samples . their tissues were collected , and their esr spin adduct signals were detected by the procedures described above . for observing postmortem change of esr signal , the sliced tissues were stored at 4c and for 3125 , 163 , 205 days after being sealed with polyvinylidene chloride film to prevent water evaporation for creating fixed decomposition conditions . the sliced mouse tissues were esr - analyzed on the 3 , 15 , 30 , 60 , 125 , 163 , and 205 days postmortem by the procedures described above . the chemicals used in the present study were 5,5-dimethyl-1-pyrroline - n - oxide ( dmpo ) ( labotec , tokyo , japan ) , 5-(dipropoxy phosphoryl)-5-methyl-1-pyrroline n - oxide ( dppmpo ) , ( dojin chemicals , kumamoto , japan ) , xanthine oxidase ( mp biomedicals , ohio , usa ) , hypoxanthine ( wako pure chemical industries , osaka , japan ) , methanol , ( usp grade ) , dimethyl sulfoxide , sequencing ( dmso ) ( pierce biotechnology , ill , usa ) , hydrogen peroxide ( wako pure chemical , ) ferrous sulfate , ( usp grade ) , superoxide dismutase , from bovine erythrocytes ( cu / zn type ) ( wako pure chemical ) , l(+)- ascorbic acid ( wako pure chemical ) , and 3,5-dibromo-4-nitrosobenzenesulfonic acid sodium salt ( mp biomedicals , inc . , ohio , usa ) . standard esr signals were recorded on the esr computer system , the position and height of peaks were recorded together with the height of the internal standard . g - value and hfcc were calculated automatically after measurements with esr computer software . the esr signals of samples were identified by determining the g - value and hfcc of measurable peaks and compared with the peak values of standard radicals . one - way anova followed by dunnett 's multiple comparison test was used for evaluating the significance of difference . a p less than < .05 was considered significant . in the analysis of an esr signal of postmortem change , regression line , correlation coefficient ( r1 ) , contribution rate ( r2 ) , and the significant difference calibration were calculated by a method of pearson . a correlation coefficient ( r1 ) 0.7 and a contribution rate 0.5 were considered significant . signals a , b , c , and d shown in figure 1 were originated from dmpo - ooh ( superoxide adduct signal ) , dmpo - asa * ( asa radical adduct signal ) , dmpo - h ( hydrogen radical adduct signal ) , and dmpo - oh ( hydroxyl radical adduct signal ) , respectively . the hfcc of dmpo - ooh , dmpo - asa * , and dmpo - h was in agreement to three digits after decimal point within the max range of 0.0009 , and this value was almost the same as the previous study . with regard to dmpo - ooh , when peaks decayed , adjacent peaks were merged , making it difficult to distinguish their g - values , because ah values ( 0.132 ) was quite small . therefore , the g - values of combined adjacent peaks were determined by the standard peaks in advance , and the g - values and the distance between the combined peaks were used for identification . the following g - values were determined from the standard waveform and used to identify the peaks detected in the organs when peaks decayed in tissue . for example , in figure 1(a ) , ( i ) was the center point g - value between the g - value of the highest point of peak ( i ) and the g - value of the lowest point of peak ( ii ) ( 2.0173 ) . ( ii ) was the center point the g - value between the g - value of the highest point of peak ( iii ) and the g - value of the lowest point of peak ( vi ) ( 2.0096 ) . further tests for identification showed that the peak of dmpo - oh was decayed with the addition of asa solution , while the peak of dmpo - ooh was decayed with the addition of sod solution . the existence of hydrogen radicals was confirmed by observing orange color in the ddtmk - added hydrogen - radical solution . these results confirmed that the peaks of the spin adducts artificially generated were adequate as standard peaks . the g - value and hfcc of dmpo - asa * signal were 2.0045 and 0.187 , respectively . the tissue samples were the brain , hart , lung , liver , kidney , pancreas , muscle , and skin of ddy mice . these results showed that dmpo - asa * , dmpo - ooh , and dmpo - h were detectable and identifiable in the mouse tissue . figure 2 shows esr signals of dmpo adduct of normal mice from brain , lung , muscle from femoral , skin from ear , heart , liver , kidney , and pancreas . the marks ( , , and ) were added to the peak that accords with the g - value of standard signal in figures 1 and 2 . figure 1 shows the spectrum of dmpo standard adduct signals of various free radicals that were artificially generated . postmortem changes in dmpo - asa and dmpo - ooh signals were observed at 4 c in various tissues of the mouse . figure 3(a ) shows the change of signal from brain ; figure 4(a ) , lung ; figure 5(a ) , heart ; figure 6(a ) , liver . the brain was measured up to 125 days before tissue destruction , the lungs and the liver were able to be measured up to 163 days , and the heart , a strong tissue , was measured up to 205 days . the signal peaks of the spin adducts identified were monitored at the 125 , 163 , and 205th day after postmortem . the increase of signal intensity ratio was observed from 0 to 3 days posthumously but no significant difference . the decrease rate was found to be straight on the logarithmical scale of postmortem period . the regression analysis of the signal intensity ratio and the postmortem period was performed for each tissue . the results of regression analysis of brain were shown in figure 3(b ) ; lung , figure 4(b ) ; heart , figure 5(b ) ; liver , figure 6(b ) . furthermore , correlation coefficient ( r1 ) , the square of r1 ( r2 ) , and the probability of error ( p ) were also calculated . the linearity of dmpo - asa * was found to be better than that of dmpo - ooh from the former 's higher correlation coefficient . the linearity of dmpo - asa * in the liver tissue ( y = 40.7x + 113.8 , x = log(day ) , r1 = 0.779 , ( p < .001 ) ) and brain ( y = 45.3x + 110.1 , x = log(day ) , r1 = 0.739 , p < the significant amount of asa is found in the body and is one of redox molecules first consumed by oxidative stress . asa is particularly an essential factor in eliminating ros ( reactive oxygen species ) in which hydroxyl radicals are the most highly toxic . the lifetime of asa * is extremely short , being measured in microseconds , which makes them extremely difficult to be detected . to date , research has been carried out via an esr spin drum ( trapping ) method . however , x - band electromagnetic waves , which are emitted from whole tissues using the spin trapping method , are attenuated due to the body moisture of wiel . therefore , detecting the signals with this conventional method is difficult and is limited to be applied to a tissue such as brain emitting comparatively strong signals . in this experiment , a high purity quart cuvette was improved ( modified ) , and by a new spin trap agent , dmpo , with a high permeability to brain tissues , the detection sensitivity of signal of asa * in brain tissues was improved successfully by modifying the method described as follows . the permeability of x - band waves was improved by a thin tissue sample that was half of that used . widl was also minimized by drastically reducing the overall fluid volume ( including a large quantity of moisture ) added to esr cavity for each organ from 150 l to 2050 l . the attenuation in electromagnetic waves caused by cover glass was also reduced by making cover glass thinner ( 0.15 m ) . the ratio of the spin trap solution and the mass of each tissue slice was changed to 1.2 : 1 to improve its sensitivity . while the masumizu method used grease on the edge of the cover glass to fix specimen , the weight of cover glass in our method was very light and its surface tension was sufficient to attach sample tissue without grease , ignoring the spectral and chemical changes induced by the grease itself . the new procedure was able to measure esr signal from sample with high sensitivity . it is demonstrated that a substantial improvement in the sensitivity of detecting dmpo - asa * and dmpo - ooh signals occurred and that the obvious peaks of dmpo - asa * and dmpo - ooh were detected with esr even without oxidative stress . in a condition without oxidative stress , dmpo - ooh signals were high in heart , liver , and kidney among postmortem tissues while dmpo - asa * signals were detected especially high in the brain and lungs samples . in the previous study , only the traces of asa * adducts were detected in tissue with a low asa concentration and it was difficult to measure them except brain . however , this study was able to show the spin adduct signals of asa * even in tissue with a low asa concentration without adding oxidative stress . in other words , asa * adducts can now be detected in almost all tissue including brain , lung , heart , liver , kidney , pancreas , muscle , and skin . these results indicate that oxidative stress can be easily detected in almost all tissue as long as dmpo - asa * adducts are used as indicators for oxidative stress . asa * adducts are observed , when asa reacts with hydroxyl radicals or ros such as superoxide and also when asa removes an electron in the regeneration process of tocopheryl radicals . on that time , these asa * react with spin trap agents resulting in dmpo - asa*. reacting especially with hydroxyl radicals , asa is known as a hydroxyl radical scavenger in the body . it is highly possible that the spin adducts of asa * are the byproducts of these radical reactions . the peaks of dmpo - asa * were composed of twin peaks of the same height , with g - values of 2.0057 and 2.0045 and a hfcc of 0.187 mt . the signals of dmpo - asa * agree well with those values reported by masumizu et al . , that is , the g - value and hfcc ( ah ) of a doublet were 2.0048 and 0.187 mt . regarding the hydrogen radical , the g - values and those of its nine characteristic peaks were measured ( figures 1 and 2 ) . although all nine peaks were unable to be observed always , the g - values of peaks observed in tissue were able to be measured and compared with the standard peaks . in mouse tissue in this study , dmpo detected an asa radicals adduct signal , superoxide adduct signal , and several other adduct signals with the same g - values as a hydrogen radicals adduct signal . esr signals from sample tissue were identified as dmpo - ooh , dmpo - asa * , and dmpo - h by comparing their hfcc with the reference values . regarding dmpo - oh , a peak of equal g - values was detected only at trace level from tissue . although the peak height of spin adducts in the spectrum varies depending on the concentration of spin trap agents , by thin - sliced tissue and the conditioning of spelling q - dip , dmpo - asa * clearly showed better sensitivity than dmpo - ooh or dmpo - h which are detected at the same time . since the signal of dmpo - asa * was stable in comparison with dmpo - ooh or dmpo - h , dmpo - asa * might be more useful in detecting intracellular oxidative stress than dmpo - ooh or dmpo - h . as one disadvantage , dmpo - ooh is overlapped by background signals , especially in heart and other muscles , thus making it difficult to distinguish . conversely , dmpo - asa * can yield clear signals , although the g - value overlaps that of dmpo - ooh . therefore , dmpo is considered a useful spin trap agent , especially for detecting intracellular asa*. the signals of dmpo - asa * was detected in mouse brain and lung more clearly than another tissue in this esr measurement . the signals of dmpo - ooh were detected in mouse heart and liver more clearly than other tissues . intracellular asa concentration in tissues ( brain , lung , liver , kidney , and pancreas ) is higher than extracellular asa concentration ( like in blood ) , because superoxide was speculated to have an extracellular source . in regards to asa * , for dmpo - asa * , the detection peaks for both of these were , in order from the highest to the lowest , brain > lung > liver > kidney > heart > muscle . brain and lungs tissues have an antioxidation stress system , because both tissues are able to receive oxidation stress easily [ 2427 ] . as for the high detection levels of asa * in brain and lung , the concentration of asa in organ is brain > lung > liver > kidney > heart > muscle . therefore , there is a possibility that the peak heights of dppmpo asa reflect asa concentration within respective tissue . the signal intensity ratio of dmpo - ooh was high in heart and liver tissues . the heights of respective peaks of dmpo - ooh at 0 days postmortem were , except blood , in order , heart ( 50% ) and liver ( 50% ) > brain ( 45% ) and lungs ( 45% ) ; this appeared to have matched the ranking of respective iron concentrations within each organ . the peak heights of dmpo - ooh were found to be dependent on the iron concentrations of hemoglobin being the main representative among components within each tissue . it is the experimentally found results . in a previous study , regarding iron concentrations in each organ , the blood was reported to have the highest concentrations ; for a mouse of age 100 days , iron concentrations in heart , liver , kidney , and brain were 298 , 254 , 245 , and 89 ng fe / mg dry wt , respectively . in an organism , 70% fe exists in blood hemoglobin , while 20% to 25% exists in water - soluble ferritin and insoluble hemosiderin in the liver , spleen , bone marrow , and so forth . in blood serum , numerous reports describe multiple generation systems producing superoxide from blood . for example , a system generating superoxide is activated by phagocytes . especially , the present study was able to continue to detect superoxide and asa radical adduct signals in heart over 200 days postmortem ( figure 5 ) . further , at around 200 days , heart tissue color was found to change from black to a yellowish brown , and as an organ dries and hardens , the most of cells in the organ are presumed to die . nevertheless , even from such tissue , the trace amounts of superoxide continued to be detected . the linearity of dmpo - asa * was found to be better than that of dmpo - ooh from the correlation coefficients . the linearity of dmpo - asa * liver ( y = 40.7x + 113.8 , x = log(day ) , r1 = 0.779 ) was found to be the best ( figure 6 ) , because it was thought that ( 1 ) the liver asa level at death time was comparatively high and ( 2 ) the configuration of liver tissue was stable posthumously . as a possible system for generating superoxide over a long postmortem duration , the best candidate hemoglobin contains four hemes ; when heme iron is fe(ii ) , it reversibly binds with oxygen . hemoglobin with oxygen ( oxyhemoglobin ) oxidizes postmortem and becomes methemoglobin containing fe(iii ) . at the reaction step , electrons are released and superoxide and h2o2 are generated ( haber - weiss reaction ) : ( 1)fe(ii)+o2fe(iii)+(o2) it is a well - known fact that hydrogen peroxide is produced from the reaction of superoxide dismutase and superoxide . it has recently become clear that fe(ii ) generates hydrogen peroxide ( h2o2 ) [ 32 , 33 ] due to the reaction of superoxide and h(hydrogen ion ) and further , that due to the reaction of ( 3 ) , a hydroxyl radical is produced : ( 2)fe(ii ) + ( o2) + 2h+fe(iii)+h2o2 the iron in these reactions may be dissolved or surface bound as these reactions can occur in solution or on pyrite surface . the hydrogen peroxide is generated with reaction ( 2 ) due to the fenton reaction with fe(ii ) and produces a hydroxyl radical : ( 3)fe(ii)+h2o2o3h + oh + fe(iii ) it is thought that the large amounts of generated superoxide cause further hemoglobin oxidation and that they promote further the production of methemoglobin . ito et al . , reported that iron oxidation reaction proceeds in iron protein and asa . furthermore , asa reduces iron as the following reaction of iron - proteins and asa ; this reaction would be recycled . possible reactions proceed in the following sequence : ( 4)fe(ii ) protein+o2 fe(iii ) protein+(o2 ) ( 5)fe(ii ) protein+(o2)+2h+fe(iii ) protein+h2o2 ( 6)fe(ii ) protein + h2o2o3h+oh+fe(iii ) protein + oh+fe(iii ) ( 7)fe(iii ) protein+ asafe(ii ) protein+asa iron - protein recycling reaction with asa suggested that the reactions would potentially continue for long time . hochstein and collaborators [ 36 , 37 ] reported that the oxidation of myoglobin into ferrylmyoglobin ( mbiv ) is a critical event in tissue damage associated with cardiac ischaemic reperfusion states . also , superoxide extricates free fe from fe - binding proteins such as ferritin , thereby assisting in the oxidation of fe . further , in this study , dmpo - ooh originating from the blood was confirmed to be suppressed ( inhibited ) by the addition of citric acid , an iron chelator . in the postmortem observations in our experiments , over a long term , dmpo - ooh from tissue samples was detected , because the superoxide generation system became the main source for generating superoxide in tissue during postmortem . the linear decrease of superoxide indicated the reduction of superoxide generation in the oxidation process of fe(ii ) to fe(iii ) . however , in the tissue , numerous other o2 generation sources were observed in addition to iron oxidation . for example , in several days postmortem , phagocytes in blood such as neutrophils , eosinophils , monocytes , and macrophages , and so forth , were thought to produce superoxide by nadph and nadph oxidase reactions from the stimuli of bacterial proliferation , protein degeneration , and and so forth . from esr signal of liver , the peak where the g - values of dmpo - ooh , dmpo - asa * , and dmpo - h were recognized . in the liver , mitochondria in hepatocytes are active occurred , and superoxide is produced by drug metabolism [ 40 , 41 ] . superoxide apparently appears more in the liver , which is an organ most easily exposed to superoxide , because of the extremely high level of superoxide dismutase ( sod ) activity reported in the liver . the main sources of superoxide in the liver are reportedly microsome p450 ( p450iie1 ) and nadh during the metabolism of substances like alcohol . in a previous study , it was reported that the majority of superoxides originating from tissue are metabolic byproducts from mitochondria , respiration , and microsomes . in the brain , superoxide is reportedly produced , when the nervous system is directly exposed to hemoglobin , which releases a large amount of iron . in nerve cells , the generation of superoxide in the brain gives neuronal death , which is considered as a cause of damage to the nerve cells , as manifested in diseases including multiple sclerosis , the deterioration of cognitive function with aging , dementia , amyotrophic lateral sclerosis ( als ) , and alzheimer 's and parkinson 's diseases . the results of our experiments showed a tendency for increasing the peak height of dmpo - ooh , a spin adduct for superoxide , from immediately to several days after death . dmpo - ooh occurring from the superoxide production system of hepatocytes as mentioned above is also considered as the part of this increase . all mean values on three days after death were slightly above the line of the superoxide decay curve ; it may be the indication of other superoxide sources than fe . however , the marginal differences in these values imply that the postmortem occurrence of superoxide still remains a major source for generating superoxide three days after death regardless of the origin of control . for several days postmortem , cells in tissue samples remain alive and the tissues are under ischemic condition . the increase of dmpo - ooh during these postmortem days is speculated to be due to the occurrence of superoxide caused by reaction with ischemia from hypoxic condition . in this study , the sensitivity of detecting dmpo adduct signals in the tissue was improved using an x - band esr and the spin trap method . for reducing the decay caused by widl of x - band , sample cuvette in esr instrument was also modified and dmpo was examined as a new spin trap agent . by these improvements , spin adduct signals were detected from brain , lungs , heart , liver , kidneys , pancreas , muscles , and skin tissues and the signals were confirmed to be the genuine adduct signals of superoxide and asa * from their g - values and hfcc - values of standard signal . in the postmortem follow up , dmpo - ooh , dmpo - asa * , and dmpo - h were detected not only in the fresh tissue but also in the tissue of a mouse that had been stored more than 200 days after death in 4c . dmpo - asa * in liver was found to linearly decrease to logarithm of postmortem . it was related linearly to the logarithm of duration and not linearly to postmortem duration . therefore , dmpo - asa * signals were found to be a useful indicator estimating postmortem duration and oxidative damages in various tissue .

electron spin resonance ( esr ) method is a simple method for detecting various free radicals simultaneously and directly . however , esr spin trap method is unsuited to analyze weak esr signals in organs because of water - induced dielectric loss ( widl ) . to minimize widl occurring in biotissues and to improve detection sensitivity to free radicals in tissues , esr cuvette was modified and used with 5,5-dimethtyl-1-pyrroline n - oxide ( dmpo ) . the tissue samples were mouse brain , hart , lung , liver , kidney , pancreas , muscle , skin , and whole blood , where various esr spin adduct signals including dmpo - ascorbyl radical ( asa ) , dmpo - superoxide anion radical ( ooh ) , and dmpo - hydrogen radical ( h ) signal were detected . postmortem changes in dmpo - asa and dmpo - ooh were observed in various tissues of mouse . the signal peak of spin adduct was monitored until the 205th day postmortem . dmpo - asa in liver ( y = 113.840.7 log ( day ) , r1 = 0.779 , r2 = 0.6 , p < .001 ) was found to linearly decrease with the logarithm of postmortem duration days . therefore , dmpo - asa signal may be suitable for detecting an oxidation stress tracer from tissue in comparison with other spin adduct signal on esr spin trap method .

we performed a retrospective study of individuals with domestically acquired c. jejuni infection in order to assess factors associated with related hospitalisations in sweden between november 2011 and october 2012 . a total of 8,585 notifications of cases with laboratory - confirmed campylobacter infection were received at the public health agency of sweden during the study period , and 3,434 from those were classified as having been acquired in sweden . clinical microbiological laboratories in sweden were asked to submit all isolates obtained from domestically acquired campylobacter cases to the national veterinary institute ( sva ) in uppsala for mlst typing during the study period ; a total of 1,914 samples were received from 25 laboratories . from these samples , 1,139 were selected for typing by stratified random sampling to generate an equal sampling fraction through the year and the region . a total of 1,139 c. jejuni stool isolates obtained from domestically acquired cases between november 2011 and october 2012 were included in our study . these isolates had already been typed at the sva according to the previously published mlst protocol ( 7 ) . data collected included swedish personal identification number , age , sex , and name of the laboratory where primary diagnostic testing was performed as well as the date of sampling and mlst type . the personal identification numbers from all 1,139 c. jejuni cases were used to match the microbiological data to the registry of hospitalisation from the swedish board of health and welfare . clinical data obtained included all hospitalisation events for these patients from january 2011 to december 2012 , including admission and discharge dates , primary diagnosis , and other diagnosis encoded with the icd-10 system . hospitalisation events occurring within 2 weeks from the c. jejuni isolation were considered potentially related to the campylobacter infection ; these diagnostic codes were checked individually and if unlikely to be related to campylobacter infection ( i.e. road traffic accident or burns ) , hospitalisation was considered as non - related . in addition , patients without matching hospitalisation records or hospitalisation outside the window period were considered not having been hospitalised due to campylobacter infection . campylobacter infection was defined as domestic if the individual had not travelled abroad in the 2-week period before the laboratory diagnosis . co - morbidity was defined as having a chronic underlying health condition , including chronic heart , lung , kidney , and liver disease , or being immunocompromised ( any form of neoplasm or acquired immunodeficiency ) based on provided icd-10 codes . typed isolates were excluded from this study if it was not possible to match the sample identifier to a record from registry of hospitalisations from the swedish board of health and welfare . the factors associated with two separate outcome measures , hospitalisation ( yes / no ) and length of hospitalisation ( in days ) , were investigated . the factors included c. jejuni st , county of residence , age , sex , and co - morbidity . variables which were present in less than 33 cases ( i.e. detection frequency < 3% ) were omitted from the analysis ; p - values under 0.05 were considered statistically significant.hospitalisation . univariable analyses to investigate associations between the risk factors and hospitalisation were performed using the 22 chi - square test . risk ratios ( rrs ) with 95% confidence intervals [ ci ] were calculated . to adjust the rrs for potential confounders such as age , sex , and co - morbidity , a multivariable analysis using a logistic regression model was performed . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test.length of hospitalisation . univariable analysis to assess the association between the risk factors and length of hospitalisation ( i.e. time to discharge ) was performed using a cox proportional hazard model . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test.estimation of hospitalisation linked to campylobacter infections in sweden . based on the reported numbers of campylobacter infections and the hospitalisation rate obtained in this study , we have estimated the total number of hospitalisations linked to domestic campylobacter infections in sweden during the 1-year study period . univariable analyses to investigate associations between the risk factors and hospitalisation were performed using the 22 chi - square test . to adjust the rrs for potential confounders such as age , sex , and co - morbidity , a multivariable analysis using a logistic regression model was performed . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test . univariable analysis to assess the association between the risk factors and length of hospitalisation ( i.e. time to discharge ) was performed using a cox proportional hazard model . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test . estimation of hospitalisation linked to campylobacter infections in sweden . based on the reported numbers of campylobacter infections and the hospitalisation rate obtained in this study , we have estimated the total number of hospitalisations linked to domestic campylobacter infections in sweden during the 1-year study period . the confidentiality of study subjects was protected via anonymisation of the data at the sva . we performed a retrospective study of individuals with domestically acquired c. jejuni infection in order to assess factors associated with related hospitalisations in sweden between november 2011 and october 2012 . a total of 8,585 notifications of cases with laboratory - confirmed campylobacter infection were received at the public health agency of sweden during the study period , and 3,434 from those were classified as having been acquired in sweden . clinical microbiological laboratories in sweden were asked to submit all isolates obtained from domestically acquired campylobacter cases to the national veterinary institute ( sva ) in uppsala for mlst typing during the study period ; a total of 1,914 samples were received from 25 laboratories . from these samples , 1,139 were selected for typing by stratified random sampling to generate an equal sampling fraction through the year and the region . a total of 1,139 c. jejuni stool isolates obtained from domestically acquired cases between november 2011 and october 2012 were included in our study . these isolates had already been typed at the sva according to the previously published mlst protocol ( 7 ) . data collected included swedish personal identification number , age , sex , and name of the laboratory where primary diagnostic testing was performed as well as the date of sampling and mlst type . the personal identification numbers from all 1,139 c. jejuni cases were used to match the microbiological data to the registry of hospitalisation from the swedish board of health and welfare . clinical data obtained included all hospitalisation events for these patients from january 2011 to december 2012 , including admission and discharge dates , primary diagnosis , and other diagnosis encoded with the icd-10 system . hospitalisation events occurring within 2 weeks from the c. jejuni isolation were considered potentially related to the campylobacter infection ; these diagnostic codes were checked individually and if unlikely to be related to campylobacter infection ( i.e. road traffic accident or burns ) , hospitalisation was considered as non - related . in addition , patients without matching hospitalisation records or hospitalisation outside the window period were considered not having been hospitalised due to campylobacter infection . campylobacter infection was defined as domestic if the individual had not travelled abroad in the 2-week period before the laboratory diagnosis . co - morbidity was defined as having a chronic underlying health condition , including chronic heart , lung , kidney , and liver disease , or being immunocompromised ( any form of neoplasm or acquired immunodeficiency ) based on provided icd-10 codes . typed isolates were excluded from this study if it was not possible to match the sample identifier to a record from registry of hospitalisations from the swedish board of health and welfare . the factors associated with two separate outcome measures , hospitalisation ( yes / no ) and length of hospitalisation ( in days ) , were investigated . the factors included c. jejuni st , county of residence , age , sex , and co - morbidity . variables which were present in less than 33 cases ( i.e. detection frequency < 3% ) were omitted from the analysis ; p - values under 0.05 were considered statistically significant.hospitalisation . univariable analyses to investigate associations between the risk factors and hospitalisation were performed using the 22 chi - square test . risk ratios ( rrs ) with 95% confidence intervals [ ci ] were calculated . to adjust the rrs for potential confounders such as age , sex , and co - morbidity , a multivariable analysis using a logistic regression model was performed . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test.length of hospitalisation . univariable analysis to assess the association between the risk factors and length of hospitalisation ( i.e. time to discharge ) was performed using a cox proportional hazard model . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test.estimation of hospitalisation linked to campylobacter infections in sweden . based on the reported numbers of campylobacter infections and the hospitalisation rate obtained in this study , we have estimated the total number of hospitalisations linked to domestic campylobacter infections in sweden during the 1-year study period . univariable analyses to investigate associations between the risk factors and hospitalisation were performed using the 22 chi - square test . risk ratios ( rrs ) with 95% confidence intervals [ ci ] were calculated . to adjust the rrs for potential confounders such as age , sex , and co - morbidity , a multivariable analysis using a logistic regression model was performed . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test . univariable analysis to assess the association between the risk factors and length of hospitalisation ( i.e. time to discharge ) was performed using a cox proportional hazard model . risk factors with p<0.20 in the univariable analysis were included in a multivariable model built through stepwise forward selection using the likelihood ratio test . estimation of hospitalisation linked to campylobacter infections in sweden . based on the reported numbers of campylobacter infections and the hospitalisation rate obtained in this study , we have estimated the total number of hospitalisations linked to domestic campylobacter infections in sweden during the 1-year study period . the confidentiality of study subjects was protected via anonymisation of the data at the sva . a total of 1,139 c. jejuni isolates were included in this study , but 64 of these were excluded as it was not possible to match their sample identifiers to the data from the swedish board of health and welfare . the remaining 1,075 c. jejuni isolates consisted of 119 distinct c. jejuni sts and 26 ccs . the most frequent sts identified and included in statistical analyses were st-21 ( 139 isolates ; 12.9% [ belonging to the cc-21 ] ) , st-50 ( 116 ; 10.8% [ cc-21 ] ) , st-19 ( 104 ; 9.7% [ cc-21 ] ) , st-45 ( 105 ; 9.8% [ cc-45 ] ) , st-677 ( 90 ; 8.4% [ cc-677 ] ) , st-48 ( 88 ; 8.2% [ cc-48 ] ) , and st-257 ( 41 ; 3.8% [ cc-257 ] ) ; all the remaining sts were identified in less than 33 cases and were clustered into their own group named other ( 392 isolates ; 36.5% ) ( table 1 ) . although sts were further grouped into ccs , analyses have been performed based on sts as genetic diversity is less within sts than within the ccs ( and results based on the cc were in line with the results based on sts ; data not shown ) . overall , 76 sts were represented by only one or two isolates in the collection . samples were obtained from all 21 swedish counties ; those counties which had less than 33 campylobacter cases in total ( i.e. frequency < 3% regardless of st ) were further clustered into their own group named the sample was geographically and temporally representative of all domestic cases reported in sweden during the study period ( data not shown ) . the frequency of detection and hospital admission , length of hospital admission and mean age of individuals infected with c. jejuni mlst sequence types ( st ) in sweden , between november 2011 and october 2012 sequence types which were identified in les s than 33 isolates have been combined into this a total of 289 individuals with c. jejuni infection were hospitalised ( 26.9% ; table 1 ) : the smallest proportion of hospitalisation was noted for those infected with c. jejuni st-19 ( 19.4% ) and highest for those infected with st-257 ( 40% ) . most individuals ( 98% ; 292/298 ) were hospitalised within 7 days ( from 2 days before to 5 days after ) from microbiological diagnosis of c. jejuni ; the remaining six were hospitalised either 4 days ( three individuals ) or 5 days ( three individuals ) before the diagnosis . most individuals hospitalised with c. jejuni infection were admitted either with the diagnosis of enteritis or colitis ( n=265 ) or with symptoms of diarrhoea and abdominal pain ( n=6 ) , and the reason for admission was not given for five individuals . however , campylobacter - specific icd-10 diagnostic code was used for 148 hospitalised individuals ( a405 ; 51% ) . a total of seven individuals with colitis were known to have either ulcerative colitis ( n=4 ) , diverticular disease ( n=1 ) , or crohn 's disease ( n=2 ) . isolates from gastroenteritis were represented in all sts , whereas most isolates obtained from individuals with inflammatory bowel disease were found in st-45 ( 4/6 ) , gbs in st-22 ( 1/1 ) , and sepsis in st-677 ( 1/1 ) . mean age of individuals infected with c. jejuni was 42.5 years , whereas individuals hospitalised with c. jejuni infections were generally older with a mean age of 50 years ( table 1 ) . the individuals infected and hospitalised with c. jejuni st-677 were the oldest ( mean age of 50.5 and 57.9 years , respectively ) . furthermore , individuals infected with c. jejuni st-21 ( 37.3 years ) and individuals hospitalised with c. jejuni st-50 ( mean age of 42.7 years ) were the youngest . infection with c. jejuni st-257 ( rr : 1.57 ; 95% ci : 1.082.30 ) , an age of 60 years or older ( rr : 2.13 ; 95% ci : 1.762.57 ) , and underlying co - morbidity ( rr : 4.49 ; 95% ci : 2.916.92 ) were factors significantly associated with hospitalisation among patients who had c. jejuni infection in sweden based on univariable analysis ( table 2 ) . most of the cases with reported co - morbidities , including being immunocompromised and those with chronic underlying conditions admitted to hospital , also had a laboratory - confirmed c. jejuni infection ( 83% ; 80/97 ) , whereas a smaller proportion of individuals without these co - morbidities were hospitalised with c. jejuni infection ( 22% ; 209/978 ) . furthermore , age under 20 years ( rr : 0.69 ; 95% ci : 0.500.95 ) or between 40 and 60 years ( rr : 0.69 ; 95% ci : 0.550.87 ) as well as being diagnosed in halland and skne counties ( rr : 0.45 ; 95% ci : 0.210.97 and rr : 0.67 ; 95% ci : 0.460.97 , respectively ) were identified as statistically significant protective factors for hospitalisation coinciding with c. jejuni infection . no significant differences in proportion of individuals with co - morbidities or in age distribution of individuals were observed between counties . potential covariates and their association with hospitalisation evaluated in univariable analysis using a 22 chi - square test in laboratory - confirmed domestic cases of c. jejuni in sweden , november 2011october 2012 variables with more than two categories ( st , county , and age group ) were dichotomised by category , using all the remaining observations were as the reference group ( e.g. st-21 vs all other sts ) . results for variables shown to be statistically significantly associated with hospitalisation ( p>0.05 ) are shown in bold face . nd = not determined for variables with prevalence < 3% . after correction for potential confounders , co - morbidity ( or : 13.89 ; 95% ci : 7.8824.46 ) , an age of 60 years or older ( or : 1.98 ; 95% ci : 1.223.25 ) , and c. jejuni st-257 ( or : 2.35 ; 95% ci : 1.154.81 ) were found to be independently associated with hospitalisation ( table 3 ) . in addition , vstra gtaland ( or : 0.59 ; 95% ci : 0.360.96 ) , halland ( or : 0.30 ; 95% ci : 0.210.97 ) , and skne ( or : 0.43 ; 95% ci : 0.460.97 ) counties were identified as statistically significant protecting factors for hospitalisation with c. jejuni infection in multivariable analysis . result of multivariable logistic regression analysis of variables associated with hospitalisation of laboratory - confirmed domestic cases of c. jejuni in sweden , november 2011october 2012 the results for variables shown to be statistically significantly associated with hospitalisation ( p>0.05 ) are shown in bold face . none of the factors investigated were significantly associated with duration of hospitalisation based on univariable analysis ( table 4 ) or multivariable analysis ( data not shown ) . duration of hospitalisation was not statistically different between cases infected with st-677 or any other c. jejuni sts . it varied from 2.51 days ( st-50 ) to 4.21 days ( st-48 ) , with the mean hospital stay of 3.20 days . duration of hospitalisation was not statistically significant between different age groups , but those older than 60 years were hospitalised longer than those under 60 years of age ( 4.07 days vs. 2.53 days [ < 20 years ] , 2.14 days [ 2039 years ] , and 3.12 days [ 4059 years ] ) . furthermore , those infected with c. jejuni who had underlying co - morbidities were also hospitalised for longer than those without ( 4.16 days vs. 2.84 days ) . variables investigated for their association with length of hospitalisation evaluated in univariable analysis using cox regression in laboratory - confirmed domestic cases of c. jejuni in sweden , november 2011october 2012 as the mean length of hospitalisation was 3.2 days , and 289 individuals with domestically acquired c. jejuni infections were hospitalised , it can be calculated that a total of 925 hospital bed days were used ( 95% ci : 879971 ) . as only a proportion of domestic c. jejuni infections were included in our study ( 1,075 from 3,434 ) , the true numbers would be bigger ( estimated around 2,954 bed days ) . furthermore , one case of gbs among our study population would translate into three cases among all hospitalised individuals due to domestic c. jejuni infections in sweden during the study period . infection with c. jejuni st-257 ( rr : 1.57 ; 95% ci : 1.082.30 ) , an age of 60 years or older ( rr : 2.13 ; 95% ci : 1.762.57 ) , and underlying co - morbidity ( rr : 4.49 ; 95% ci : 2.916.92 ) were factors significantly associated with hospitalisation among patients who had c. jejuni infection in sweden based on univariable analysis ( table 2 ) . most of the cases with reported co - morbidities , including being immunocompromised and those with chronic underlying conditions admitted to hospital , also had a laboratory - confirmed c. jejuni infection ( 83% ; 80/97 ) , whereas a smaller proportion of individuals without these co - morbidities were hospitalised with c. jejuni infection ( 22% ; 209/978 ) . furthermore , age under 20 years ( rr : 0.69 ; 95% ci : 0.500.95 ) or between 40 and 60 years ( rr : 0.69 ; 95% ci : 0.550.87 ) as well as being diagnosed in halland and skne counties ( rr : 0.45 ; 95% ci : 0.210.97 and rr : 0.67 ; 95% ci : 0.460.97 , respectively ) were identified as statistically significant protective factors for hospitalisation coinciding with c. jejuni infection . no significant differences in proportion of individuals with co - morbidities or in age distribution of individuals were observed between counties . potential covariates and their association with hospitalisation evaluated in univariable analysis using a 22 chi - square test in laboratory - confirmed domestic cases of c. jejuni in sweden , november 2011october 2012 variables with more than two categories ( st , county , and age group ) were dichotomised by category , using all the remaining observations were as the reference group ( e.g. st-21 vs all other sts ) . results for variables shown to be statistically significantly associated with hospitalisation ( p>0.05 ) are shown in bold face . nd = not determined for variables with prevalence < 3% . after correction for potential confounders , co - morbidity ( or : 13.89 ; 95% ci : 7.8824.46 ) , an age of 60 years or older ( or : 1.98 ; 95% ci : 1.223.25 ) , and c. jejuni st-257 ( or : 2.35 ; 95% ci : 1.154.81 ) in addition , vstra gtaland ( or : 0.59 ; 95% ci : 0.360.96 ) , halland ( or : 0.30 ; 95% ci : 0.210.97 ) , and skne ( or : 0.43 ; 95% ci : 0.460.97 ) counties were identified as statistically significant protecting factors for hospitalisation with c. jejuni infection in multivariable analysis . result of multivariable logistic regression analysis of variables associated with hospitalisation of laboratory - confirmed domestic cases of c. jejuni in sweden , november 2011october 2012 the results for variables shown to be statistically significantly associated with hospitalisation ( p>0.05 ) are shown in bold face . none of the factors investigated were significantly associated with duration of hospitalisation based on univariable analysis ( table 4 ) or multivariable analysis ( data not shown ) . duration of hospitalisation was not statistically different between cases infected with st-677 or any other c. jejuni sts . it varied from 2.51 days ( st-50 ) to 4.21 days ( st-48 ) , with the mean hospital stay of 3.20 days . duration of hospitalisation was not statistically significant between different age groups , but those older than 60 years were hospitalised longer than those under 60 years of age ( 4.07 days vs. 2.53 days [ < 20 years ] , 2.14 days [ 2039 years ] , and 3.12 days [ 4059 years ] ) . furthermore , those infected with c. jejuni who had underlying co - morbidities were also hospitalised for longer than those without ( 4.16 days vs. 2.84 days ) . variables investigated for their association with length of hospitalisation evaluated in univariable analysis using cox regression in laboratory - confirmed domestic cases of c. jejuni in sweden , november 2011october 2012 as the mean length of hospitalisation was 3.2 days , and 289 individuals with domestically acquired c. jejuni infections were hospitalised , it can be calculated that a total of 925 hospital bed days were used ( 95% ci : 879971 ) . as only a proportion of domestic c. jejuni infections were included in our study ( 1,075 from 3,434 ) , the true numbers would be bigger ( estimated around 2,954 bed days ) . furthermore , one case of gbs among our study population would translate into three cases among all hospitalised individuals due to domestic c. jejuni infections in sweden during the study period . this is the first study to determine the risk factors associated with the hospitalisation and the length of hospitalisation of individuals with domestically acquired c. jejuni infections in sweden . our study included 1,075 c. jejuni infected individuals , representing approximately 30% of all reported domestic c. jejuni cases in sweden during the 1-year study period . a high diversity of mlsts among human c. jejuni isolates with a total of 119 distinct sts were observed , from which the seven frequent sts ( st-21 , st-50 , st-19 , st-45 , st-677 , st-48 , and st-257 ) covered 64% of all isolates in accordance with previously published studies from the united kingdom , finland , denmark , and canada ( 914 , 24 , 26 ) . these sts were recently shown to have been responsible for a large proportion of domestic c. jejuni infections in sweden already in 2000 , and have also been isolated from swedish broilers ( 23 ) . it has been suggested that the poultry is likely the most important source of domestic c. jejuni infections ( 19 ) . although campylobacter infections are usually considered mild and self - limiting , they can also lead to more severe infections requiring hospitalisation ( 35 , 31 ) . up to 26.9% of individuals included in this study were admitted to hospital with the domestically acquired c. jejuni infection . we have matched the data on campylobacter infections obtained from the public health agency of sweden and from the registry of hospitalisations from the swedish board of health and welfare . based on our data , only 50% of hospitalisations were registered with campylobacter - specific icd-10 coding ( a04.5 ) , and the remaining were registered with non - specific gastroenteritis and colitis coding . the numbers on the hospitalisations related to campylobacter infections are likely underestimated in studies where only specific icd-10 codes are used without matching ( 3134 ) . only 5% of reported campylobacter cases were hospitalised according to the review of three national databases over a 4-year period in canada ( 32 ) , whereas an annual hospitalisation rate of 12.3% was obtained in a danish registry - based study ( 33 ) and 10% in us surveillance study ( 34 ) . as all the studies have used different methods to obtain the hospitalisation estimates , we can not state if the hospitalisation rates are truly increasing , if they are higher since a smaller proportion of milder infections have been sampled , or simply more accurately estimated than recorded previously . the correlation between co - morbidities and hospitalisation due to domestic c. jejuni infection is not surprising , given that most co - morbidities result in decreased immune function and thus more likely will lead to symptomatic c. jejuni enterocolitis . co - morbidity category also included all known immunocompromised individuals ( i.e. those with known malignancy ) . furthermore , individuals with co - morbidities are more likely to seek health care with gastrointestinal symptoms and are more likely to be tested for campylobacter than those without co - morbidities . there was also a trend towards more severe infections among the individuals with co - morbidities ; they were hospitalised for longer than those without ( 4.16 days vs. 2.84 days ) . although these differences were not statistically significant , they suggest more severe infections in those with co - morbidities . in a previous study , a high hospitalisation rate of 47.6% was described in patients with ulcerative colitis ( 35 ) . however , the main focus of the arora study ( 35 ) was to determine the risk factors for c. jejuni infection and not to investigate the risk factors associated with hospital admissions due to campylobacter infections . furthermore , previous studies have shown that those aged over 60 years are three times more likely to be hospitalised with campylobacter infection than younger individuals ( 34 ) , and that age > 60 years can be a risk factor for a longer hospital stay ( 28 ) . it is most likely that the older individuals have more diagnosed co - morbidities than the younger ones ; the factor not considered in those studies . we clearly demonstrate that co - morbidity is the most significant risk factor for hospitalisation while having c. jejuni infection , not old age . indeed , over 60% of all those hospitalised were younger than 60 years of age . it is not fully understood why the hospitalisation rates were lower in the southwestern parts of sweden ( vstra gtaland , halland , and skne counties ) than elsewhere . none of the swedish microbiology laboratories were using molecular methods for campylobacter detection during the study period . a potential explanation could be differences in study population , such as overrepresentation of the elderly or those with co - morbidities , but no significant differences were observed between counties . the lower hospitalisation rates in these counties could also reflect differences between counties in primary health care policies with regard to testing patients with gastrointestinal illness for campylobacter , where counties with a more liberal testing policy would be identified as protective in this literature due to the relatively larger number of cases detected , and not hospitalised . the finding could also be due to differences in hospitalisation policy ( i.e. stricter criteria for hospital admissions ) . only one study has previously investigated the association between c. jejuni sts and hospitalisation ; based on that it was expected that c. jejuni st-677 would be associated with more frequent hospitalisations and also with increased length of hospitalisation than other campylobacter types ( 13 ) . this hypothesis was also supported with more recent evidence demonstrating that c. jejuni st-677 is specifically associated with invasive infections ( i.e. campylobacteremia ) ( 27 ) . in our study , the association between c. jejuni st-677 and the increased hospitalisations or a longer hospital stay could not be demonstrated . however , it should be noted that the feodoroff study investigated blood culture isolates of c. jejuni collected over a 10-year study period , whereas the number of invasive c. jejuni infections during our 1-year study period would have been minimal ( 36 ) . interestingly , individuals infected with another less common c. jejuni type , st-257 , were shown to be at increased risk of hospital admissions in our study . although st-257 was recently isolated from domestic dogs in sweden ( 37 ) , only 4% of dogs were positive for c. jejuni and thus the importance of dogs as a source of human infections needs to be clarified further . in addition , st-50 was linked to the highest number of campylobacter related hospitalisations in sweden ( 37/289 ) . both of these types , st-257 and st-50 , although the pathogenesis of c. jejuni remains poorly understood , some c. jejuni types have been associated with severe infections . in our study , one individual was diagnosed with gbs and c. jejuni st-22 infection , whereas another individual with systemic invasive infection had c. jejuni st-677 , consistent with the previous literature ( 7 , 26 , 27 ) . furthermore , we identified another c. jejuni type , st-257 , as a risk factor significantly associated with hospitalisation . this st has not been linked to a specific disease outcome and thus the reason(s ) for the observed increased rate of hospitalisation is not currently known . however , c. jejuni st-257 was shown to be the most virulent type measured as larval survival in the insect galleria mellonella model ( 38 ) . it is likely that the genetic differences between c. jejuni types will determine their pathogenicity , as previously demonstrated by combining the data from whole - genome sequencing and phenotypical characterisation of c. jejuni st-677 ( 27 , 39 ) . although most campylobacter infections are self - limiting and do not require treatment , antibiotics are often given to immunocompromised individuals ( 25 ) , and thus it is important to consider possibility of resistance . in that context , it is important to note that a previous study from slovakia demonstrated equally high frequency of antibiotic resistance among isolates obtained from humans , animals , and food . these included universal persistence of ciprofloxacin - resistance among c. jejuni st-50 isolates ( 40 ) ; the second most common c. jejuni type in sweden . high levels of ciprofloxacin resistance were also previously identified not only among c. jejuni st-50 isolates but also among st-257 isolates in belgium ( 41 ) . however , much lower levels of ciprofloxacin - resistance was observed among these types in the united kingdom ( 10 ) . data on antibiotic resistance in human campylobacter isolates is not routinely collected in sweden , but a high level of ciprofloxacin resistance for untyped human campylobacter isolates was reported in 20022011 ( 49% ; ( 42 ) ) . for these reasons , further systematic monitoring of antimicrobial resistance in sweden for human campylobacter should also be considered . the clinical data obtained in this study were based on the diagnostic codes used and reported . as they have been assigned by individual doctors , they might differ according to the doctor and hospital practice . in addition , since only the diagnostic codes were used , we do lack other information on disease severity ( i.e. data on itu admission , need for iv fluids , antibiotic treatment , and resistance ) . it should also be noted that only individuals who have been diagnosed with certain disease entities will have been given the diagnostic codes ( i.e. young individuals with newly diagnosed neoplasm might still be under ongoing investigations and thus definite diagnosis may not have been reported as yet ) . however , these limitations are likely to result in underestimation of associations and can not be minimised within this study design . in addition , only campylobacter cases who sought medical care could be included in this study ( prerequisite for sampling ) and thus milder infections that did not require medical attention were not included in this study . this may result in an under- or over - estimation of the effect of genotype on hospitalisation since cases of mild illness may not be uniformly distributed among genotypes of c. jejuni , as well as overestimation of the population proportion of hospitalised cases . we have demonstrated that over a quarter of all individuals diagnosed with domestic c. jejuni infection are hospitalised in sweden , and that those infected with st-50 or st-257 are slightly more likely to be subject to hospital care than those infected with other sts . although over 50% of all hospitalised individuals were less than 60 years of age and did not have any co - morbidities and were not known to be immunocompromised in this study , the biggest risk factors for hospitalisation identified included co - morbidities and old age . we have shown that individuals with co - morbidities are at a 14-time higher risk of becoming hospitalised with a domestic c. jejuni infection than those without . as these co - morbidities are often seen in older people , the burden of domestic c. jejuni infections is likely to increase even further in the future , considering the ageing population trend . targeted public health messages including strict advice on kitchen hygiene and safe drinking water sources for those with co - morbidities as well as further investigations on antimicrobial resistance in campylobacter in humans in sweden the clinical data obtained in this study were based on the diagnostic codes used and reported . as they have been assigned by individual doctors , they might differ according to the doctor and hospital practice . in addition , since only the diagnostic codes were used , we do lack other information on disease severity ( i.e. data on itu admission , need for iv fluids , antibiotic treatment , and resistance ) . it should also be noted that only individuals who have been diagnosed with certain disease entities will have been given the diagnostic codes ( i.e. young individuals with newly diagnosed neoplasm might still be under ongoing investigations and thus definite diagnosis may not have been reported as yet ) . however , these limitations are likely to result in underestimation of associations and can not be minimised within this study design . in addition , only campylobacter cases who sought medical care could be included in this study ( prerequisite for sampling ) and thus milder infections that did not require medical attention were not included in this study . this may result in an under- or over - estimation of the effect of genotype on hospitalisation since cases of mild illness may not be uniformly distributed among genotypes of c. jejuni , as well as overestimation of the population proportion of hospitalised cases . we have demonstrated that over a quarter of all individuals diagnosed with domestic c. jejuni infection are hospitalised in sweden , and that those infected with st-50 or st-257 are slightly more likely to be subject to hospital care than those infected with other sts . although over 50% of all hospitalised individuals were less than 60 years of age and did not have any co - morbidities and were not known to be immunocompromised in this study , the biggest risk factors for hospitalisation identified included co - morbidities and old age . we have shown that individuals with co - morbidities are at a 14-time higher risk of becoming hospitalised with a domestic c. jejuni infection than those without . as these co - morbidities are often seen in older people , the burden of domestic c. jejuni infections is likely to increase even further in the future , considering the ageing population trend . targeted public health messages including strict advice on kitchen hygiene and safe drinking water sources for those with co - morbidities as well as further investigations on antimicrobial resistance in campylobacter in humans in sweden the authors have not received any funding or benefits from industry or elsewhere to conduct this study .

backgroundcampylobacter jejuni is among the most frequent causes of bacterial gastroenteritis in europe . over 8,000 c. jejuni multilocus sequence typing sequence types ( sts ) have been described ; st-21 and st-45 have been identified as the most frequent types in all human studies so far . in contrast to other sts , st-22 has been associated with the guillain barr syndrome and st-677 was recently linked to severe systemic infections in finland . we investigated risk factors associated with hospitalisation in individuals with c. jejuni infections acquired in sweden.methodsa total of 1,075 individuals with domestically acquired c. jejuni infection diagnosed between november 2011 and october 2012 in sweden were included in this retrospective cohort study . typing data for the isolates as well as clinical data including hospitalisation dates and diagnosis codes for individuals with c. jejuni infection were obtained . factors associated with hospitalisation and length of hospitalisation were investigated by multivariable analysis.resultsa total of 289 individuals were hospitalised due to c. jejuni infection ( 26.8% ) ; those with co - morbidities were over 14 times more likely to become hospitalised than those without ( odds ratio [ or ] : 14.39 , 95% confidence interval [ ci ] : 6.8430.26 ) . those with underlying co - morbidities were also hospitalised longer than those without ( 4.22 days vs. 2.86 days ) , although this was not statistically significant . c. jejuni st-257 ( or : 2.38 ; ci : 1.085.23 ) , but not st-22 or st-677 , was significantly associated with hospitalisation.conclusionst-677 was not associated with increased hospitalisation or a longer hospital stay in our study whilst st-257 was . however , individuals with c. jejuni infections were generally more frequently hospitalised than previously demonstrated ; this requires further consideration including possible targeted interventions .

vulvar and vaginal atrophy ( vva ) is a chronic , progressive medical condition that is associated with physiological changes of the vagina and symptoms such as dyspareunia and vaginal dryness . women can now expect to spend more than one - third of their lives in a postmenopausal state due to an increased life expectancy . therefore , the proper diagnosis and treatment of vva have become increasingly important in the care of postmenopausal women . multiple studies have demonstrated the negative impact of vva on quality of life and sexual function in postmenopausal women . revive , a survey of 3046 menopausal women , found that vva significantly interferes with overall healthy sexual functioning . a separate study , the menopause epidemiology study , evaluated 1480 postmenopausal women ; respondents reporting sexual dysfunction were 3.84 times more likely to have vva . the closer survey found that vva - related painful sex negatively affected relationships for both male and female partners , and a survey of 363 sexually active women found that more frequent dyspareunia was associated with less frequent sexual intercourse . currently available treatment options for postmenopausal vva include over - the - counter products ( e.g. vaginal lubricants and moisturizers ) , systemic hormonal therapies ( when treatment of other menopausal symptoms is needed ) , vaginal estrogen therapies ( intravaginal tablets , rings , and creams ) , and ospemifene ( for dyspareunia ) . oral and local estrogen therapies have been reported to improve sexual functioning in some studies but not in others . one hypothesis is that the increase in sex hormone binding globulin ( shbg ) levels after oral estrogen therapies results in a decreased bioavailability of testosterone , which may impact the assessment of sexual function . various assessment tools have been used to measure factors associated with female sexual dysfunction ( fsd ) . the female sexual function index ( fsfi ) was developed as a brief , easy - to - administer , self - report tool for assessing key dimensions or domains of sexual function and quality of life ( arousal , desire , orgasm , lubrication , satisfaction , and pain ) in various populations of women . the fsfi questionnaire has been used in postmenopausal women , although it has not been specifically validated in a vva population . other assessment tools were developed prior to the revision of sexual disorder classifications but do not address some aspects of the current definitions . for example , to increase clinical relevance , the fsfi domains of desire and arousal were separated to allow factors such as lubrication or subjective arousal / desire to be measured as separate , nuanced responses to sexual stimulation . ospemifene is an oral , non - estrogen , tissue selective estrogen agonist / antagonist approved in the united states for the treatment of moderate to severe dyspareunia associated with vva due to menopause . a phase-3 , randomized , double - blind clinical trial assessed the efficacy , safety , and tolerability of ospemifene in the treatment of postmenopausal vva . here , we report data on the effect of ospemifene on sexual function as evaluated by the fsfi and data on changes in serum hormones , which were pre - specified , secondary efficacy endpoints of this study . this study was a phase-3 , multicenter , randomized , double - blind , parallel - group trial comparing ospemifene 60 mg / day administered for 12 weeks with placebo in postmenopausal women with vva who were stratified by a self - reported most bothersome symptom ( mbs ) of either dyspareunia or vaginal dryness . the co - primary endpoints of the trial have been previously reported . among the secondary efficacy endpoints were change from baseline in total score ( at weeks 4 and 12 ) , change from baseline in the domains of the fsfi ( at weeks 4 and 12 ) , and change from baseline in serum sex hormones ( at week 12 ) . study participants completed the fsfi questionnaire at baseline , week 4 , and week 12 ( or last observation carried forward , locf ) . the questionnaire consisted of 19 questions , each rated on a scale ranging from 0 to 5 or 1 to 5 , with 0 indicating no sexual activity in the past month ( table 1 ) . scores for each of the six domains were calculated in the standard fashion by adding individual domain question scores and multiplying by the domain factor ( i.e. 0.6 for desire , 0.3 for arousal and lubrication , and 0.4 for orgasm , satisfaction , and pain ) . the total fsfi score is the sum of the scores for the six individual domains . of a total possible score of 36 , 26.55 or less no cut - off score for fsd has been described specifically in a vva population with dyspareunia or dryness . a domain score of zero indicates that no sexual activity was reported during the past month . from : rosen r , et al . available at http://www.fsfi-questionnaire.com/ fasting serum samples were collected at screening and week 12 or final visit . specimens were prepared at the sites ( clot time of 1530 min and centrifugation at 3000 rpm to separate serum ) and were shipped on dry ice on the day of collection to a central laboratory ( mayo clinic , rochester , mn , usa ) . serum levels of the following analytes were measured : estradiol , follicle stimulating hormone ( fsh ) , luteinizing hormone ( lh ) , shbg , and total and free testosterone . analysis of fsh , lh , and shbg was conducted using chemiluminescent immunoassays ; analysis of estradiol and testosterone was conducted using liquid chromatography mass spectrometry . analyses of fsfi data were conducted for the intent - to - treat ( itt ) population ( all randomized subjects who had received one dose of the study medication ) and for the dyspareunia and dryness strata . a post hoc analysis also evaluated the change from baseline to weeks 4 and 12 in fsfi total and domain scores for the subgroups of hysterectomized and non - hysterectomized women for the combined strata among the itt population . separate analysis of covariance ( ancova ) models were used for the by - stratum and combined strata analyses for change in fsfi total score and domain scores to weeks 4 and 12 . for analysis of each separate stratum , an ancova model was used ( i.e. with treatment and center as fixed effects in the model and the baseline value used as the covariate ) . for combined data , the ancova included stratum , rather than center , as a fixed effect in the model . an additional analysis , including treatment by stratum interaction , was also performed to test for the generalizability of results across the strata . this study was a phase-3 , multicenter , randomized , double - blind , parallel - group trial comparing ospemifene 60 mg / day administered for 12 weeks with placebo in postmenopausal women with vva who were stratified by a self - reported most bothersome symptom ( mbs ) of either dyspareunia or vaginal dryness . the co - primary endpoints of the trial have been previously reported . among the secondary efficacy endpoints were change from baseline in total score ( at weeks 4 and 12 ) , change from baseline in the domains of the fsfi ( at weeks 4 and 12 ) , and change from baseline in serum sex hormones ( at week 12 ) . study participants completed the fsfi questionnaire at baseline , week 4 , and week 12 ( or last observation carried forward , locf ) . the questionnaire consisted of 19 questions , each rated on a scale ranging from 0 to 5 or 1 to 5 , with 0 indicating no sexual activity in the past month ( table 1 ) . scores for each of the six domains were calculated in the standard fashion by adding individual domain question scores and multiplying by the domain factor ( i.e. 0.6 for desire , 0.3 for arousal and lubrication , and 0.4 for orgasm , satisfaction , and pain ) . the total fsfi score is the sum of the scores for the six individual domains . of a total possible score of 36 , 26.55 or less no cut - off score for fsd has been described specifically in a vva population with dyspareunia or dryness . a domain score of zero indicates that no sexual activity was reported during the past month . from : rosen r , specimens were prepared at the sites ( clot time of 1530 min and centrifugation at 3000 rpm to separate serum ) and were shipped on dry ice on the day of collection to a central laboratory ( mayo clinic , rochester , mn , usa ) . serum levels of the following analytes were measured : estradiol , follicle stimulating hormone ( fsh ) , luteinizing hormone ( lh ) , shbg , and total and free testosterone . analysis of fsh , lh , and shbg was conducted using chemiluminescent immunoassays ; analysis of estradiol and testosterone was conducted using liquid chromatography mass spectrometry . analyses of fsfi data were conducted for the intent - to - treat ( itt ) population ( all randomized subjects who had received one dose of the study medication ) and for the dyspareunia and dryness strata . a post hoc analysis also evaluated the change from baseline to weeks 4 and 12 in fsfi total and domain scores for the subgroups of hysterectomized and non - hysterectomized women for the combined strata among the itt population . separate analysis of covariance ( ancova ) models were used for the by - stratum and combined strata analyses for change in fsfi total score and domain scores to weeks 4 and 12 . for analysis of each separate stratum , an ancova model was used ( i.e. with treatment and center as fixed effects in the model and the baseline value used as the covariate ) . for combined data , the ancova included stratum , rather than center , as a fixed effect in the model . an additional analysis , including treatment by stratum interaction , was also performed to test for the generalizability of results across the strata . a total of 919 women were randomized ; 463 participants received ospemifene 60 mg / day and 456 received placebo . approximately two - thirds of participants ( n = 605 ) reported dyspareunia as the mbs ; 303 of these women were treated with ospemifene and 302 received placebo . approximately one - third of participants ( n = 314 ) reported dryness as the mbs ; 160 of these women were treated with ospemifene and 154 received placebo . overall , the mean ( standard deviation ) age of participants was 58.6 ( 6.47 ) years , the majority of participants were white , and approximately half of the participants ( 53.1% ) had an intact uterus . demographic and baseline characteristics were balanced between treatment groups , both in the itt population ( table 2 ) and in each of the two strata . demographic and baseline characteristics of the intent - to - treat ( itt ) population . the itt population included all randomized participants who received one dose of study medication . data are given as mean standard deviation or n ( % ) fsfi , female sexual function index of the 919 randomized participants , 819 women ( 89.1% ) completed the study . the percentage of women who discontinued from the study was 10.2% for the ospemifene group and 11.6% for the placebo group ; adverse events were the most common reason for discontinuation ( 5.4% vs. 3.1% , respectively ) . the dispositions of participants were similar in both strata compared with the overall population . as reported previously , this study met the co - primary efficacy endpoints of changes from baseline to week 12 in the percentage of superficial cells and parabasal cells , vaginal ph , and the severity of dyspareunia as the mbs . in the itt population , women who received oral ospemifene 60 mg / day had a significantly greater improvement in the fsfi total score compared with women who received placebo ( figure 1 ) . this improvement was evident at week 4 ( p < 0.001 ) and continued to increase in magnitude up to week 12 ( locf ; p < 0.001 ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) total score in the intent - to - treat ( itt ) population . , p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and stratum were fixed effects . the itt population included all randomized participants who received one dose of study medication . ancova , analysis of covariance ; ls , least squares in the dyspareunia stratum , significant improvements in fsfi total score were observed in women treated with ospemifene compared with placebo at weeks 4 ( p < 0.001 ) and 12 ( locf ; p < 0.0001 ; figure 2 ) . in the vaginal dryness stratum , improvements in fsfi total score were numerically greater in women treated with ospemifene compared with placebo at weeks 4 and 12 ( locf ) ; however , the difference did not reach statistical significance ( data not shown ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) total score in the dyspareunia stratum . , p < 0.001 compared with placebo ; , p < 0.0001 compared with placebo . p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and center were fixed effects . ancova , analysis of covariance ; ls , least squares total scores for the fsfi were also evaluated in a subgroup analysis of women with or without an intact uterus . in the subgroup with an intact uterus , those treated with ospemifene 60 mg / day showed significantly greater improvements than those randomized to placebo at both weeks 4 ( p = 0.0022 ) and 12 ( locf ; p < 0.0001 ) . in the subgroup without an intact uterus , the difference between ospemifene and placebo was significant at week 12 ( locf ; p = 0.0133 ; data not shown ) . in the itt population , greater improvements were observed in all six fsfi domains in women treated with ospemifene 60 mg / day compared with placebo ( figure 3 ) . at week 4 , statistically significant improvements were noted for the fsfi domains of desire , arousal , and pain ( all p < 0.05 ) and lubrication ( p < 0.001 ) . the domain improvements noted in women treated with ospemifene continued to increase in magnitude and reached statistical significance in all domains compared with placebo by week 12 ( locf ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) domain scores in the intent - to - treat ( itt ) population . , p < 0.05 compared with placebo ; , p < 0.001 compared with placebo . p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and stratum were fixed effects . ancova , analysis of covariance ; ls , least squares ; w4 , week 4 ; w12 , week 12 in the dyspareunia stratum , the same pattern of treatment effect was observed , with statistically significant improvements in all domains at week 12 ( figure 4 ; p < 0.05 , p < 0.001 , or p < 0.0001 ) . in the dryness stratum , improvements in fsfi domain scores at weeks 4 and 12 were numerically greater in women in the ospemifene group than in the placebo group ; however , statistical significance was not achieved ( data not shown ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) domain scores in the dyspareunia stratum . , p < 0.05 compared with placebo ; , p < 0.001 compared with placebo ; , p < 0.0001 compared with placebo . p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and center were fixed effects . ancova , analysis of covariance ; ls , least squares ; w4 , week 4 ; w12 , week 12 in participants with a history of hysterectomy , improvements at week 4 were significant in the domains of lubrication ( p = 0.0148 ) and pain ( p = 0.0151 ) ; for women with an intact uterus , improvements were significant in four domains ( desire ( p = 0.0174 ) , lubrication ( p = 0.0002 ) , orgasm ( p = 0.0118 ) , and pain ( p = 0.020 ) ) . improvements were sustained from week 4 to week 12 ( locf ) for both women with an intact uterus and those without . these improvements were significant at week 12 ( locf ) in the subpopulation of hysterectomized women for the three domains of desire ( p = 0.0188 ) , lubrication ( p = 0.0023 ) , and pain ( p = 0.0413 ) , and significant for all domains at week 12 ( locf ; p < 0.05 ) in the subpopulation of non - hysterectomized women . for the women in the ospemifene group , both mean fsh and lh levels decreased slightly from baseline to week 12 while remaining well within the normal range for postmenopausal women . the mean shbg level increased , but remained within the normal range at week 12 ( 20130 nmol / l ) . one ospemifene participant in the dryness stratum and 25 participants ( 24 ospemifene , one placebo ) in the dyspareunia stratum shifted from normal shbg levels at baseline to higher than normal levels at week 12 . total testosterone levels increased slightly in women in the ospemifene group ; however , mean free testosterone levels remained unchanged ( figure 5 ) . mean standard deviation serum hormone concentrations at baseline and week 12 in the intent - to - treat population . bl , baseline ; fsh , follicle stimulating hormone ; lh , luteinizing hormone ; shbg , sex hormone binding globulin ; w12 , week 12 a total of 919 women were randomized ; 463 participants received ospemifene 60 mg / day and 456 received placebo . approximately two - thirds of participants ( n = 605 ) reported dyspareunia as the mbs ; 303 of these women were treated with ospemifene and 302 received placebo . approximately one - third of participants ( n = 314 ) reported dryness as the mbs ; 160 of these women were treated with ospemifene and 154 received placebo . overall , the mean ( standard deviation ) age of participants was 58.6 ( 6.47 ) years , the majority of participants were white , and approximately half of the participants ( 53.1% ) had an intact uterus . demographic and baseline characteristics were balanced between treatment groups , both in the itt population ( table 2 ) and in each of the two strata . demographic and baseline characteristics of the intent - to - treat ( itt ) population . the itt population included all randomized participants who received one dose of study medication . data are given as mean standard deviation or n ( % ) fsfi , female sexual function index of the 919 randomized participants , 819 women ( 89.1% ) completed the study . the percentage of women who discontinued from the study was 10.2% for the ospemifene group and 11.6% for the placebo group ; adverse events were the most common reason for discontinuation ( 5.4% vs. 3.1% , respectively ) . as reported previously , this study met the co - primary efficacy endpoints of changes from baseline to week 12 in the percentage of superficial cells and parabasal cells , vaginal ph , and the severity of dyspareunia as the mbs . in the itt population , women who received oral ospemifene 60 mg / day had a significantly greater improvement in the fsfi total score compared with women who received placebo ( figure 1 ) . this improvement was evident at week 4 ( p < 0.001 ) and continued to increase in magnitude up to week 12 ( locf ; p < 0.001 ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) total score in the intent - to - treat ( itt ) population . , p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and stratum were fixed effects . the itt population included all randomized participants who received one dose of study medication . ancova , analysis of covariance ; ls , least squares in the dyspareunia stratum , significant improvements in fsfi total score were observed in women treated with ospemifene compared with placebo at weeks 4 ( p < 0.001 ) and 12 ( locf ; p < 0.0001 ; figure 2 ) . in the vaginal dryness stratum , improvements in fsfi total score were numerically greater in women treated with ospemifene compared with placebo at weeks 4 and 12 ( locf ) ; however , the difference did not reach statistical significance ( data not shown ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) total score in the dyspareunia stratum . , p < 0.001 compared with placebo ; , p < 0.0001 compared with placebo . p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and center were fixed effects . ancova , analysis of covariance ; ls , least squares total scores for the fsfi were also evaluated in a subgroup analysis of women with or without an intact uterus . in the subgroup with an intact uterus , those treated with ospemifene 60 mg / day showed significantly greater improvements than those randomized to placebo at both weeks 4 ( p = 0.0022 ) and 12 ( locf ; p < 0.0001 ) . in the subgroup without an intact uterus , the difference between ospemifene and placebo was significant at week 12 ( locf ; p = 0.0133 ; data not shown ) . in the itt population , greater improvements were observed in all six fsfi domains in women treated with ospemifene 60 mg / day compared with placebo ( figure 3 ) . at week 4 , statistically significant improvements were noted for the fsfi domains of desire , arousal , and pain ( all p < 0.05 ) and lubrication ( p < 0.001 ) . the domain improvements noted in women treated with ospemifene continued to increase in magnitude and reached statistical significance in all domains compared with placebo by week 12 ( locf ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) domain scores in the intent - to - treat ( itt ) population . , p < 0.05 compared with placebo ; , p < 0.001 compared with placebo . p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and stratum were fixed effects . ancova , analysis of covariance ; ls , least squares ; w4 , week 4 ; w12 , week 12 in the dyspareunia stratum , the same pattern of treatment effect was observed , with statistically significant improvements in all domains at week 12 ( figure 4 ; p < 0.05 , p < 0.001 , or p < 0.0001 ) . in the dryness stratum , improvements in fsfi domain scores at weeks 4 and 12 were numerically greater in women in the ospemifene group than in the placebo group ; however , statistical significance was not achieved ( data not shown ) . change from baseline to weeks 4 and 12 ( last observation caried forward ) in the female sexual function index ( fsfi ) domain scores in the dyspareunia stratum . , p < 0.05 compared with placebo ; , p < 0.001 compared with placebo ; , p < 0.0001 compared with placebo . p values were computed using ancova where change from baseline was the response variable , baseline assessment was the covariate , and treatment and center were fixed effects . ancova , analysis of covariance ; ls , least squares ; w4 , week 4 ; w12 , week 12 in participants with a history of hysterectomy , improvements at week 4 were significant in the domains of lubrication ( p = 0.0148 ) and pain ( p = 0.0151 ) ; for women with an intact uterus , improvements were significant in four domains ( desire ( p = 0.0174 ) , lubrication ( p = 0.0002 ) , orgasm ( p = 0.0118 ) , and pain ( p = 0.020 ) ) . improvements were sustained from week 4 to week 12 ( locf ) for both women with an intact uterus and those without . these improvements were significant at week 12 ( locf ) in the subpopulation of hysterectomized women for the three domains of desire ( p = 0.0188 ) , lubrication ( p = 0.0023 ) , and pain ( p = 0.0413 ) , and significant for all domains at week 12 ( locf ; p < 0.05 ) in the subpopulation of non - hysterectomized women . for the women in the ospemifene group , both mean fsh and lh levels decreased slightly from baseline to week 12 while remaining well within the normal range for postmenopausal women . the mean shbg level increased , but remained within the normal range at week 12 ( 20130 nmol / l ) . one ospemifene participant in the dryness stratum and 25 participants ( 24 ospemifene , one placebo ) in the dyspareunia stratum shifted from normal shbg levels at baseline to higher than normal levels at week 12 . total testosterone levels increased slightly in women in the ospemifene group ; however , mean free testosterone levels remained unchanged ( figure 5 ) . mean standard deviation serum hormone concentrations at baseline and week 12 in the intent - to - treat population . bl , baseline ; fsh , follicle stimulating hormone ; lh , luteinizing hormone ; shbg , sex hormone binding globulin ; w12 , week 12 it is estimated that up to approximately 4050% of postmenopausal women experience symptoms of vva . these symptoms are directly related to the physiological changes of the vaginal epithelium ( e.g. thinning , narrowing , reduced elasticity , and increased vaginal ph ) due to a decrease in circulating estrogen levels after menopause . an epidemiologic study in sexually active postmenopausal women examined the relationship between vva ( defined as pain , itching , and dryness associated with sexual activity ) and sexual dysfunction ( desire , arousal , and orgasm ) using the arizona sexual experience questionnaire . the prevalences of sexual dysfunction ( 55% ) and vva ( 57% ) were similar and there was substantial overlap of the two conditions ( 40% of the study participants had both conditions ) . the authors of that study concluded that the pain associated with vva may preclude women from desiring , initiating , or responding to sexual activity . nonetheless , 52% of menopausal women aged 5079 years in the women 's health initiative observational study reported that they had been sexually active with a partner in the past year , and most published literature suggests that approximately 1030% of women over 70 years of age still engage in sexual intercourse . therefore , one may hypothesize that therapies aimed at improving vva symptoms may help maintain life - long sexuality and potentially improve sexual function . a recent cochrane review found that estrogen alone or in combination with progestogens ( ept ) was associated with a small to moderate improvement in sexual function , and the review reported data on selective estrogen receptor modulators and sexual function to be limited and inconclusive . some studies with ept have also failed to detect corresponding improvements in sexual satisfaction , even when vva was improved . importantly , since the women 's health initiative , substantial numbers of women have declined to initiate or continue estrogen - based therapies and are seeking alternatives . ospemifene , an oral non - estrogen drug with tissue - selective estrogen agonist / antagonist effects , exerts an agonistic effect on vaginal epithelial tissue . previously published results of this phase-3 trial demonstrated that ospemifene 60 mg / day was effective in improving physiological vaginal changes ( maturation index and ph ) and , for participants with an mbs of dyspareunia , significantly reduced the severity of dyspareunia . this trial also evaluated the effect of ospemifene on fsfi scores , a pre - specified secondary efficacy endpoint , as reported in the current article . treatment with ospemifene led to significantly greater improvements , compared with placebo , in total fsfi composite score and individual fsfi domain scores for the itt population . in general , improvements were observed as early as week 4 and continued to increase in magnitude up to week 12 . although underpowered , exploratory subgroup analyses were carried out to evaluate dyspareunia and dryness strata , in hysterectomized as well as non - hysterectomized participants . however , women in the vaginal dryness stratum had numerical improvements in fsfi scores that did not reach statistical significance . both subgroups of women , with or without an intact uterus , had significant improvements in fsfi scores with ospemifene treatment . serum levels of some hormones ( e.g. testosterone and dehydroepiandrosterone ) are known to affect fsfi scores . in the current study , clinically non - relevant increases in mean total testosterone and moderate increases in mean shbg were observed in women receiving ospemifene ; mean estradiol and free testosterone levels were unchanged , whereas mean fsh and lh levels had a clinically non - relevant decrease with ospemifene treatment . these data suggest that the significant improvements in fsfi scores noted in women treated with ospemifene were unlikely to be attributed to changes in serum sex hormone levels , but rather appear to be due to the positive effects of ospemifene on the physiology of the vaginal epithelium ( maturation index and vaginal ph ) and the vva symptom of dyspareunia . it is important to note that treatment with ospemifene resulted in improvement not only in pain and lubrication , but also in the scores in all six fsfi domains . since a systemic non - steroidal ligand such as ospemifene might have selective genomic or non - genomic effects on genital , extragenital , and central nervous system tissues , other potential central and peripheral mechanisms for the improved sexual response and function demonstrated here deserve further study . first , although the fsfi is a widely used tool that has been documented in more than 700 publications and validated in the postmenopausal population , it has not been validated specifically in a vva population such as the one analyzed here . second , the change in fsfi score was pre - specified as a secondary efficacy endpoint for this phase-3 trial but was not a primary outcome . third , the subgroup analyses presented here were underpowered and were performed solely for hypothesis generation . fourth , the fsfi data are based on patient self - reported diaries with the known potential inconsistencies of diary data . additionally , the evaluation of serum hormones could have potentially been imprecise due to the inexact timing of sample collection . in a phase-3 randomized , double - blind , placebo - controlled , 12-week clinical trial , oral ospemifene 60 mg / day demonstrated significant improvements in the co - primary endpoints of physiological vaginal changes in postmenopausal women with vva due to menopause and reduced severity of dyspareunia . treatment with ospemifene also significantly improved the total fsfi score and fsfi domain scores in the itt population and in the dyspareunia stratum . conflict of interest gdc : consultant for : shionogi inc . ; sak : consultant for : apricus , emotional brain , palatin , novo nordisk , shionogi inc . , sprout , pfizer , sst , and teva ; djp : consultant for : shionogi inc . , research grants : quatrx , endoceutics , trimel , amneal , sun , pfizer , bayer , palatin , actavis . noven , pfizer , teva , therapeuticsmd ; rcr : research support : shionogi inc . , consultant for : palatin , apricus , sprout ; sg : former employee of : shionogi inc . assistance with manuscript development was provided by complete publication solutions , llc , with financial support from shionogi inc .

backgroundospemifene is a non - estrogen , tissue selective estrogen receptor agonist / antagonist , or selective estrogen receptor modulator , recently approved for the treatment of dyspareunia , a symptom of vulvar and vaginal atrophy ( vva ) , due to menopause . postmenopausal dyspareunia is often associated with female sexual dysfunction ( fsd ) . in this report , we present data that demonstrate the effect of ospemifene 60 mg / day on fsd assessed by the female sexual function index ( fsfi ) , a widely used tool with six domains ( arousal , desire , orgasm , lubrication , satisfaction , and pain).methodsa phase-3 , randomized , double - blind , 12-week trial ( n = 919 ) compared the efficacy and safety of oral ospemifene 60 mg / day vs. placebo in postmenopausal women with vva in two strata based on self - reported , most bothersome symptom of either dyspareunia or dryness . primary data were published previously . we report herein pre - specified secondary efficacy endpoints analyses , including changes from baseline to weeks 4 and 12 for fsfi total and domain scores as well as serum hormone levels.resultsospemifene 60 mg / day demonstrated a significantly greater fsfi total score improvement vs. placebo at week 4 ( p < 0.001 ) . improvement in fsfi scores continued to week 12 ( p < 0.001 ) . at week 4 , the fsfi domains of sexual pain , arousal , and desire were significantly improved with ospemifene vs. placebo ; at week 12 , improvements in all domains were significant ( p < 0.05 ) . changes in serum hormones were minor and uncorrelated with changes in sexual functioning.conclusionin a large , randomized , double - blind , placebo - controlled trial , ospemifene 60 mg / day significantly improved fsd in women with vva . consistent effects across fsfi domains were observed .

adiponectin is a circulating hormone that is produced exclusively by adipocytes1 and has both anti - inflammatory and anti - atherogenic properties.2 endothelial dysfunction due to reduced nitric oxide ( no ) bioavailability is an essential early event in the development , propagation , and clinical expression of atherosclerosis and its complications.3 oxidized - ldl ( ox - ldl ) has a prominent role in the pathogenesis of atherosclerosis,4 and the elevation of ox - ldl levels in atherosclerotic plaques is an important event in the development of atherosclerosis.5 moreover , elevated ox - ldl contributes to plaque instability and vulnerability.6 adiponectin may protect the endothelium against the detrimental effects of ox - ldl.7 low adiponectin levels are associated with high circulating ox - ldl in patients with type 2 diabetes mellitus and coronary artery disease.8 adiponectin hampers proatherogenic events , such as nuclear factor b signaling , foam cell formation , and vascular smooth cell migration.9,10 it also promotes no production by endothelial cells11 and suppresses the proliferation of human aortic smooth muscle cells.12 decreased levels of adiponectin act as an independent risk factor for coronary artery disease.13 in patients with stable chest pain , low adiponectin levels may contribute to coronary plaque vulnerability and may play a role in the pathophysiology of acute coronary syndrome.14 also , low plasma adiponectin in patients with stable coronary artery disease is associated with the presence of thin - cap fibroatheroma , which is a criterion for plaque vulnerability.15 previous studies have demonstrated that low adiponectin levels are an independent predictor of the extent of coronary artery disease and coronary lesion complexity , as determined by coronary angiography.16 - 18 despite the aforementioned relationships between adiponectin levels and coronary artery disease , the existence of differences in adiponectin levels between stable and unstable coronary artery disease patients is controversial . in one study of 608 patients with stable angina and 378 patients with unstable angina , conducted by stefan et al,19 in contrast , another study found that the plasma levels of adiponectin were significantly lower in patients with unstable angina pectoris relative both to patients with stable angina pectoris and to the control group.20 in addition , in other acute settings ( such as acute coronary syndrome and myocardial infarction ) , plasma adiponectin levels are lower relative to stable coronary artery disease patients.17,21 the relationships between plasma adiponectin levels and the inflammatory and non - inflammatory markers ox - ldl and no in patients with stable and unstable coronary artery disease relative to normal subjects have not yet been assessed . furthermore , the differences in adiponectin levels between stable and unstable coronary artery disease patients require further evaluation . therefore , in the present study , we sought to assess whether plasma adiponectin levels differ among patients with stable angina , unstable angina , and control subjects , and whether these differences correlate with inflammatory and clinical risk factors , such as ox - ldl and no . between 22 november 2009 and 22 may 2010 , 150 patients receiving coronary angiograghy following chest pain , clinical manifestations or suspected changes on electrocardiography were selected for inclusion in this study at isfahan cardiovascular research center in iran . these subjects included 50 stable angina patients , 50 unstable angina patients , and 50 control subjects . the patient 's angiograms were assessed by two experienced cardiologists who were unaware of the disease status of each subject . the position and extent of stenosis for 15 main coronary segments were determined according to the method of miller et al.22 coronary artery disease was defined as 50% stenosis in at least one main coronary segment . in the majority of the normal subjects , coronary artery obstructions were less than 10% , but a minority of them ( 15 subjects ) presented stenosis of less than 25% in at least one main coronary artery segment . in addition , the control subjects did not have any history or clinical symptoms of cardiovascular disease . among the patients with significant stenosis , 80 patients ( 85% ) had 50 to 75% stenosis in at least one main coronary artery segment , and 20 patients ( 20% ) had 76 to 85% stenosis in one main coronary artery segment . furthermore , 85 patients ( 85% ) had single vessel stenosis , 10 patients ( 10% ) had double vessel stenosis and 5 patients ( 5% ) had triple vessel stenosis . all of the patients were evaluated both prospectively at enrollment and retrospectively by review of their clinical history . the unstable angina patients had random and unpredictable angina at rest or sleep along with transient st - segment shifts and normal creatine kinase mb levels , whereas the stable angina patients had chest pain during physical exertion that was relieved by rest and presented a constant pattern or frequency of chest pain . patients with myocardial infarction diagnosed on the basis of st - segment elevation on their electrocardiogram and high levels of creatine kinase mb , lactate dehydrogenase and troponin t were not included in the study . information about conventional clinical risk factors , such as smoking , diabetes mellitus , family history of coronary artery disease , hypertension , medication and other necessary data , were obtained through a standardized questionnaire after admission . patients with a recent ( within 6 months ) myocardial infarction , cardiovascular event , surgery ( within 3 months ) , cancer , infection or inflammatory disease were not included in the study . any patient that underwent any other diagnostic or therapeutic treatment or who experienced a cardiovascular event that might have interfered with the study within one week after the angiography was excluded . before enrollment , written informed consent was obtained from all of the subjects and approval of the study was provided by the ethics committee of isfahan university medical sciences and isfahan cardiovascular research center ( icrc , a who collaborating center ) . one week after the angiography , a 12-hour fasting venous blood sample was collected from each patient into a vacutainer edta - tube ( bd vacutainer , brocken bow , ne usa ) , centrifuged and stored at -70c until analyses were performed . plasma adiponectin levels were determined with an enzyme - linked immunosorbent ( elisa ) assay kit ( cat . ox - ldl was measured with an elisa kit ( immundiagnostik ag , bensheim , germany ) . total nitric oxide ( no ) was determined by spectrophotometry using a total no assay kit ( assay designs , inc . plasma levels of hscrp were measured with a highly sensitive latex - enhanced immunoturbidometric assay ( randox laboratory ltd , belfast , united kingdom ) . plasma total lipoprotein profiles ( total cholesterol , triglycerides , ldl - cholesterol , and hdl - cholesterol ) were determined using enzymatic test kits ( pars azmun co. , karaj , iran ) . all of the statistical analyses were performed using spss statistical software version 16.0 ( spss inc . , the sample size was determined by a power analysis based on preliminary results that were obtained in our research center . with a type i error of < 0.05 ( 2-tailed ) , power ( 1- ) of 0.80 , an expected difference in adiponectin concentration between patients and normal subjects of about 1.4 g / ml and a standard deviation of about 2.5 g / ml , a minimum of 49 subjects in each group would be adequate to detect a difference in the plasma adiponectin concentration . before the statistical analysis , the variables were examined for normal distribution and approved by the shapiro - wilk test . the comparison of means for continuous variables among the groups was performed using the unpaired student 's t - test or one - way analysis of variance ( anova ) with post hoc comparison using the bonferoni test , and the chi - square test was applied to the dichotomous variables . correlations between the plasma concentration of adiponectin and other normally distributed variables were assessed by pearson 's coefficient of correlation ( r ) . multiple logistic regression analysis was performed to determine the relationship between adiponectin levels and the presence of stable angina or unstable angina . the data are expressed either as mean standard deviation or as counts and percentages . a p - value < 0.05 was considered to be statistically significant . between 22 november 2009 and 22 may 2010 , 150 patients receiving coronary angiograghy following chest pain , clinical manifestations or suspected changes on electrocardiography were selected for inclusion in this study at isfahan cardiovascular research center in iran . these subjects included 50 stable angina patients , 50 unstable angina patients , and 50 control subjects . the patient 's angiograms were assessed by two experienced cardiologists who were unaware of the disease status of each subject . the position and extent of stenosis for 15 main coronary segments were determined according to the method of miller et al.22 coronary artery disease was defined as 50% stenosis in at least one main coronary segment . in the majority of the normal subjects , coronary artery obstructions were less than 10% , but a minority of them ( 15 subjects ) presented stenosis of less than 25% in at least one main coronary artery segment . in addition , the control subjects did not have any history or clinical symptoms of cardiovascular disease . among the patients with significant stenosis , 80 patients ( 85% ) had 50 to 75% stenosis in at least one main coronary artery segment , and 20 patients ( 20% ) had 76 to 85% stenosis in one main coronary artery segment . furthermore , 85 patients ( 85% ) had single vessel stenosis , 10 patients ( 10% ) had double vessel stenosis and 5 patients ( 5% ) had triple vessel stenosis . all of the patients were evaluated both prospectively at enrollment and retrospectively by review of their clinical history . the unstable angina patients had random and unpredictable angina at rest or sleep along with transient st - segment shifts and normal creatine kinase mb levels , whereas the stable angina patients had chest pain during physical exertion that was relieved by rest and presented a constant pattern or frequency of chest pain . patients with myocardial infarction diagnosed on the basis of st - segment elevation on their electrocardiogram and high levels of creatine kinase mb , lactate dehydrogenase and troponin t were not included in the study . information about conventional clinical risk factors , such as smoking , diabetes mellitus , family history of coronary artery disease , hypertension , medication and other necessary data , were obtained through a standardized questionnaire after admission . patients with a recent ( within 6 months ) myocardial infarction , cardiovascular event , surgery ( within 3 months ) , cancer , infection or inflammatory disease were not included in the study . any patient that underwent any other diagnostic or therapeutic treatment or who experienced a cardiovascular event that might have interfered with the study within one week after the angiography was excluded . before enrollment , written informed consent was obtained from all of the subjects and approval of the study was provided by the ethics committee of isfahan university medical sciences and isfahan cardiovascular research center ( icrc , a who collaborating center ) . one week after the angiography , a 12-hour fasting venous blood sample was collected from each patient into a vacutainer edta - tube ( bd vacutainer , brocken bow , ne usa ) , centrifuged and stored at -70c until analyses were performed . plasma adiponectin levels were determined with an enzyme - linked immunosorbent ( elisa ) assay kit ( cat . ox - ldl was measured with an elisa kit ( immundiagnostik ag , bensheim , germany ) . total nitric oxide ( no ) was determined by spectrophotometry using a total no assay kit ( assay designs , inc . plasma levels of hscrp were measured with a highly sensitive latex - enhanced immunoturbidometric assay ( randox laboratory ltd , belfast , united kingdom ) . plasma total lipoprotein profiles ( total cholesterol , triglycerides , ldl - cholesterol , and hdl - cholesterol ) were determined using enzymatic test kits ( pars azmun co. , karaj , iran ) . all of the statistical analyses were performed using spss statistical software version 16.0 ( spss inc . , the sample size was determined by a power analysis based on preliminary results that were obtained in our research center . with a type i error of < 0.05 ( 2-tailed ) , power ( 1- ) of 0.80 , an expected difference in adiponectin concentration between patients and normal subjects of about 1.4 g / ml and a standard deviation of about 2.5 g / ml , a minimum of 49 subjects in each group would be adequate to detect a difference in the plasma adiponectin concentration . before the statistical analysis , the variables were examined for normal distribution and approved by the shapiro - wilk test . the comparison of means for continuous variables among the groups was performed using the unpaired student 's t - test or one - way analysis of variance ( anova ) with post hoc comparison using the bonferoni test , and the chi - square test was applied to the dichotomous variables . correlations between the plasma concentration of adiponectin and other normally distributed variables were assessed by pearson 's coefficient of correlation ( r ) . multiple logistic regression analysis was performed to determine the relationship between adiponectin levels and the presence of stable angina or unstable angina . the data are expressed either as mean standard deviation or as counts and percentages . a p - value < 0.05 was considered to be statistically significant . the inflammatory markers hscrp and ox - ldl were significantly higher in the angina patients relative to the control subjects , and they were higher in the unstable angina patients relative to the stable angina patients . the lipid profiles varied among the three groups , although these differences failed to reach significance , with the exception of ldl - cholesterol , which was significantly higher in the unstable angina patients than in the control subjects ( p = 0.009 ) . as shown in figure 1 , the plasma adiponectin levels were significantly lower in the unstable angina patients ( 4.901.3 g / ml ) than in the stable angina patients ( 6.341.0 g / ml ) or in the control subjects ( 9.251.8 g / ml ) , and they were lower in the stable angina patients than in the control subjects ( p<0.001 ; table 1 ) . there was a significant inverse relationship between adiponectin and ox - ldl levels in the unstable angina patients ( r = -0.447 , p = 0.001 ) , stable angina patients ( r = -0.379 , p = 0.007 ) , and control subjects ( r = -0.406 , p = 0.003 ) ( figure 2 ) . in all of the patients , plasma adiponectin levels p = 0.01 ) than in the unstable angina patients ( r = 0.448 , p = 0.01 ) or in the stable angina patients ( r = 0.405 , p = 0.01 ) . furthermore , total no levels were significantly higher in the control subjects than in the angina patients , and they were higher in the stable angina patients than in the unstable angina patients ( figure 3 ) . the angina patients exhibited a trend toward higher levels of cholesterol , triglycerides , ldl - cholesterol , hscrp and a lower level of hdl - cholesterol compared with the control subjects , but with the exception of hscrp levels , these differences were not statistically significant ( table 1 ) . we also assessed the association between plasma adiponectin levels and conventional cardiovascular risk factors among the subjects . as shown , no significant correlation was found between age , total cholesterol or hdl - cholesterol and adiponectin level . we did not find a significant difference in plasma adiponectin levels between patients with and without drug therapy . the stable and unstable angina patients did not differ with respect to the extent of coronary artery stenosis or the number of affected arteries . among all of the subjects , plasma adiponectin levels were higher in women than in men ( 7.02.0 g / ml vs. 6.72.4 g / ml , p = 0.034 ) . to look for an independent association of plasma adiponectin level with the presence of stable versus unstable angina , a multiple logistic regression analysis was performed adjusting for age , gender and other clinical risk factors . as shown in table 3 , a low plasma adiponectin level was an independent predictor for both stable and unstable angina ( or = 0.51 , p = 0.023 ; or = 0.59 , p = 0.001 , respectively ) . other predictors for the presence of stable and unstable angina , respectively , were age ( or = 1.26 , p = 0.022 ; or = 1.43 , p = 0.042 ) , hscrp ( or = 1.62 , p = 0.033 ; or = 1.37 , p = 0.003 ) , ox - ldl ( or = 1.78 , p = 0.014 ; or = 2.01 , p = 0.038 ) , total no ( or = 0.61 , p = 0.008 ; or = 0.76 , p = 0.012 , negative predictor ) , statins ( or = 0.64 , p = 0.050 , negative predictor for stable angina only ) , and family history of coronary artery disease ( or = 2.02 , p = 0.023 ; or = 2.17 , p = 0.047 ) . to the best of our knowledge , the association between plasma adiponectin level and the cardiovascular risk markers ox - ldl and total no has not yet been evaluated in stable and unstable angina patients . the findings of the study demonstrate that plasma adiponectin levels are closely associated with the inflammatory markers ox - ldl and total no in stable and unstable angina patients and that these relationships persist after adjustment for conventional cardiovascular risk factors . also , this study revealed that plasma adiponectin levels are lower in patients with stable and unstable angina relative to control subjects , and this disparity can be used to identify patients . decreased levels of circulating adiponectin have been reported in patients with angiographically documented coronary artery disease.13,20 our finding that adiponectin was significantly lower in the stable and unstable angina patients relative to the control subjects is in line with the findings of nakamura et al.20 in another study conducted by stefan et al , no significant difference in adiponectin levels was found between the stable and unstable angina patients.19 however , a recent study demonstrated that plasma adiponectin levels in patients with acute coronary syndrome are significantly lower than in those with stable coronary artery disease and that low adiponectin levels are correlated with the presence of complex coronary lesions.17 low adiponectin concentrations in unstable coronary artery disease patients may contribute to coronary plaque vulnerability and thus may play a role in the pathophysiology of acute coronary syndrome.14 therefore , coronary plaque instability in the acute setting may account for the lower adiponectin levels in our unstable angina patients relative to the stable angina patients . despite these findings , further studies are required to address the difference in adiponectin levels between stable and unstable angina patients . ox - ldl and no play roles in all stages of coronary artery disease.24,25 decreased adiponectin levels are an indicator of increased oxidative state in the arterial wall and are associated with high ox - ldl levels in patients with type 2 diabetes mellitus and coronary artery disease.8 in our study , plasma adiponectin was found to be inversely correlated with ox - ldl . this correlation was strongest in the unstable angina patients , weaker in the stable angina patients and weakest in the control subjects , in accordance with the above study . ox - ldl is a key factor in plaque instability.6 given the protective effects of adiponectin against plaque vulnerability , the mutual relationship between adiponectin and ox - ldl may become lost during coronary artery disease , especially in the unstable angina patients . endothelial dysfunction is a primary event in the pathogenesis of coronary artery disease.3 adiponectin directly promotes the production of no by the endothelium.26 hypoadiponectinemia is associated with endothelial dysfunction in the peripheral arteries.27 in our study , adiponectin levels exhibited a positive correlation with the total no level . a beneficial effect of total no elevation in patients with symptomatic coronary artery disease has been reported.28,29 our finding of significantly lower total no levels along with elevated levels of the oxidative markers ox - ldl and hscrp in the angina patients demonstrates that adiponectin may act through antioxidative and anti - inflammatory mechanisms . we found inverse associations between adiponectin levels and other conventional cardiovascular risk markers that were in accordance with the results of other studies.30 - 33 in a multiple logistic regression analysis that adjusted for other cardiovascular risk factors , a low plasma adiponectin level was an independent negative predictor of the presence of stable or unstable angina in the present study , which is in accordance with the findings of pilz et al.19 the correlation between adiponectin and the risk of coronary heart disease is controversial . although some studies have reported an inverse relationship between adiponectin level and the risk of coronary artery disease,13,16,19,34 others failed to find a significant relationship.35,36 differences in the underlying conditions of the study populations may be the cause of the controversy . altogether , the negative correlations between adiponectin and well - known cardiovascular risk factors in the above literature and in our study highlight the anti - atherogenic effects of elevated adiponectin levels . however , further studies are required to determine the precise nature of this relationship . hypoadiponectinemia is an early sign of a complex cardiovascular risk factor leading to the development and progression of atherosclerosis . however , the exact genomic and environmental interactions contributing to hypoadiponectinemia are not fully understood.37 single nucleotide polymorphisms ( snps ) in the adiponectin gene have been associated with the early onset of coronary artery disease and low adiponectin levels.37,38 moreover , adipose tissue dysfunction and visceral adiposity have been identified as significant predictors of adiponectin levels.39 there is no definite conclusion regarding the effects of insulin on adiponectin production.40 on the one hand , some in vitro studies have indicated that insulin decreases adiponectin production,41 but in the clinical setting , long - term insulin therapy has failed to increase adiponectin levels.42 on the other hand , in type b insulin resistance , high levels of insulin are accompanied by high levels of adiponectin.43 oxidative stress44 and proinflammatory cytokines45 suppress adiponectin expression , whereas a mediterranean diet and exercise increase plasma adiponectin levels.46,47 in our study , body mass index ( bmi ) and diabetes mellitus , two important cardiovascular risk factors , were negatively associated with plasma adiponectin levels , thereby indirectly corroborating the causal relationships that may exist between adiposity , insulin resistance and hypoadiponectinemia.39,41 other cardiovascular risk factors , such as hypertension , smoking , family history of coronary disease hdl - cholesterol , triglycerides , and cholesterol , were also inversely associated with plasma adiponectin level , whereas female sex and statin therapy were positively associated with the plasma adiponectin level . according to these findings and to the above literature , the conventional cardiovascular risk factors may affect adiponectin levels , and there may be mutual relationships between adiponectin and the cardiovascular risk factors in the pathogenesis of atherosclerosis . although our results follow a normal distribution , larger samples are frequently used in clinical investigations . the findings of this study indicate that plasma adiponectin levels are lower in stable and unstable angina patients than in control subjects . these lower adiponectin levels may facilitate the stratification and identification of stable and unstable angina patients . the correlations found between adiponectin level and both no and ox - ldl further corroborate the antiatherogenic effects of adiponectin in cardiovascular patients , and the in vivo mechanisms of atherosclerotic progression that are elucidated by these correlations may be useful for disease assessment .

introduction : adiponectin is a circulating hormone that is produced exclusively by adipocytes and has anti - inflammatory and anti - atherogenic properties . the hypothesis that there are differences in adiponectin levels between stable and unstable coronary - artery disease patients remains controversial . furthermore , the potential relationships between the plasma adiponectin level and the inflammatory and non - inflammatory markers ( oxidized low density lipoprotein and nitric oxide ) in patients with stable and unstable coronary - artery disease relative to normal subjects have not been assessed.objectives:to assess whether plasma adiponectin levels differ among patients with stable and unstable coronary - artery disease and among control subjects , and to correlate plasma adiponectin level with inflammatory and clinical risk factors ( such as oxidized - ldl and nitric oxide ) in these patients.methods:this study included 50 control subjects , 50 stable angina patients and 50 unstable angina patients with angiographically documented coronary - artery disease . plasma adiponectin and oxidized - ldl levels were determined using an enzyme immunoassay . plasma nitric oxide , high sensitivity c - reactive protein and lipid profile levels were also measured.results:plasma adiponectin levels were lower in the unstable angina patients ( 4.91.30 g / ml ) than in the stable angina patients ( 6.341.0 g / ml ) or in the controls ( 9.251.8 g / ml ) ; these levels were also significantly lower in stable angina patients versus controls ( p<0.001 ) . plasma adiponectin levels were negatively correlated with oxidized - ldl , high sensitivity c - reactive protein , lipid profile and other clinical risk factors but positively correlated with nitric oxide.conclusion:plasma adiponectin levels were found to be lower in both stable and unstable angina patients relative to control subjects , and the correlation between plasma adiponectin and cardiovascular markers is weakened in these patients .

among the most important protozoan parasitic species causing diseases in humans , five had their genomes recently sequenced . three of them are pathogenic members of the order kinetoplastida , family trypanosomatidae , that cause sleeping sickness ( caused by pathogenic subspecies of trypanosoma brucei ) , chagas disease ( t. cruzi ) or leishmaniasis ( leishmania major ) representing the major human diseases caused by kinetoplastids ( 13 ) . the fourth pathogenic species in question is plasmodium falciparum , a member of the phylum apicomplexa and the causative agent of the most important human malaria ( 4 ) . the last is entamoeba histolytica , member of the subphylum sarcodina , the causative agent of amebiasis that infects approximately 50 million people over the globe , mainly on neotropical developing countries ( 5 ) . the availability of pathogenic protozoan genome sequences allows for comparative analyses to be performed in a systematic and straightforward way , towards a better understanding of biological , genetic and evolutionary aspects . also , such analyses allow the identification of genes related to pathogenesis and/or species - specific genes , useful for diagnostic markers as well as genes involved in crucial metabolic pathways that may lead to drug or vaccine development . identification of homolog genes , particularly orthologs , became an important task to transfer annotation from experimentally or better characterized genes , allowing annotation and re - annotation of genes and genomes . considering the existing genomic data from important human protozoan parasites as well as ongoing sequencing efforts of several other relevant pathogenic species such as p. vivax , toxoplasma gondii , cryptosporidium parvum , t. rangeli , l. braziliensis and l. chagasi [ gold ( 6 ) ] , protozoadb is being developed to initially host genomics and post - genomics data from p. falciparum , e. histolytica , t. brucei , t. cruzi and l. major ( 5-protozoa ) , with added - value obtained from similarity- and phylogeny - based analyses performed as part of the system pipeline , but considering the adding / linking of more pathogenic species database in a near future . all 5-protozoa nucleotide entries available at genbank ( release 160 ) , refseq ( release 24 ) and est ( release 160 ) divisions were downloaded from ncbi ( table 1 ) and loaded into protozoadb using the genomics unified schema ( gus : http://www.gusdb.org ) system , version 3.5 , for postgres ( http://www.postgres.org ) . table 1.number of nucleotide sequences from each parasitic protozoan species retrieved from the genbank , refseq and est databasesspeciesgenbankrefseqestp . number of nucleotide sequences from each parasitic protozoan species retrieved from the genbank , refseq and est databases database search executed in july 2007 . redundancy of sequence proteins was treated in the following way : ( i ) the cd - hit ( 7 ) software was ran on all proteins of each five species , providing information on proteins with 100% identity , and ( ii ) redundancy mapped to already existing gus tables , then users will be able to query and retrieve non - redundant datasets . external database ids ( from tcruzidb and plasmodb ) mappings were incorporated into gus , so that users can query and retrieve protozoadb data using genbank , tcruzidb or plasmodb ids . visitors can also click on any of the mapped external database ids to be re - directed to plasmodb , tcruzidb , genedb or superfamily databases , then look on extra annotations . similarity analyses were performed using all the proteins coded by the genbank and refseq entries listed in table 1 , consisting of blastp against the uniref90 database ( release 11 ) of the uniprot consortium ( http://www.pir.uniprot.org/database/nref.shtml ) . further similarity analyses using the conserved domain database ( 9 ) and interpro ( 10 ) are being progressively added to the database . protozoadb is designed to offer a variety of query - based search tools that allow the user to perform an easy search of genes among the 5-protozoan genomes through ( i ) keyword , ( ii ) gene i d , ( iii ) product , ( iv ) protein motifs or ( v ) sequence type ( coding sequences , mrna , rrna , trna , snrna , snorna , transcript primary , precursor rna and untranslated sequences ) searches . also , the web user interface allows to view protozoan sequences separately or to compare them with each other . individual chromosomes can be visualized using gbrowse ( http://www.gmod.org/wiki/index.php/gbrowse ) that has been integrated to protozoadb . additionally , when a query is executed , information related to sequences features and dna , as well as translated and protein sequences may be obtained . when a gene ( e.g. tubulin ) is searched , the user can retrieve tubulin entries originally available from genbank or refseq , with their corresponding tags or keyword annotation , and also associated papers published in pubmed . tubulin adding more keywords to describe function and/or localization , and track further ( re- ) annotation of that particular tubulin entry through the addition of sequence or gene rss ( really simple syndication ) to their preferred rss reader ( or even using igoogle or netvibes ) ( figure 1 ) . ( a ) searching e. histolytica subset , ( b ) choosing u20322 entry , ( c ) details of u20322 entry that can be tracked with rss , google or netvibes and ( d ) cds of u20322 entry and associated abstracts published in pubmed ( a ) searching e. histolytica subset , ( b ) choosing u20322 entry , ( c ) details of u20322 entry that can be tracked with rss , google or netvibes and ( d ) cds of u20322 entry and associated abstracts published in pubmed . protozoadb also contains a collection of ests from different life cycle stages of the distinct species , allowing the user to perform queries on genes related to metacyclogenesis and/or to compare genes expressed in different parasite species or stages . due to their particular biological and medical importance , a collection of ests from epimastigote , promastigote and amastigote forms of t. cruzi and l. major is available . moreover , ests from gametocytes , schizont and asexual stages of p. falciparum are also available for comparison . an extensive documentation is being incorporated progressively , then users can benefit from the howto ( user manual ) , faq ( frequently asked questions ) , gus - postgres - wiki ( details on the installation , configuration and debugging of gus for postgres ) and protozoadb roadmap ( features to be added ) in the left - side menu of the main page . phylo was designed and incorporated into gus 3.5 , extending it in order to store data from phylogenetic experiments , e.g. molecular phylogeny using distance and maximum likelihood , and profile - based phylogeny , as described by theobald and wuttke 2005 ( 11 ) . currently , users can perform queries in the phylogenetic trees constructed for the enzymes coded by mobile genetic elements and for the 18s rdna ( figure 2 ) . at this stage , only trees obtained by the neighbor - joining and distances methods are being stored in the system . the ultimate goal is to have all the 5-protozoan homologous genes identified , to support inferences and to store the phylogeny of all orthologous and paralogous genes , as well as conserved domains to allow other studies such as horizontal gene transfer . ( a ) searching mobile genetics elements ( mge ) phylogenetic trees , ( b ) mge genes trees , ( c ) ribonuclease h available data , ( d ) trypanosomatid taxons and ( e ) phylogenetic tree of ribonuclease h. features of the protozoadb phylo search tool . ( a ) searching mobile genetics elements ( mge ) phylogenetic trees , ( b ) mge genes trees , ( c ) ribonuclease h available data , ( d ) trypanosomatid taxons and ( e ) phylogenetic tree of ribonuclease h. all 5-protozoa nucleotide entries available at genbank ( release 160 ) , refseq ( release 24 ) and est ( release 160 ) divisions were downloaded from ncbi ( table 1 ) and loaded into protozoadb using the genomics unified schema ( gus : http://www.gusdb.org ) system , version 3.5 , for postgres ( http://www.postgres.org ) . table 1.number of nucleotide sequences from each parasitic protozoan species retrieved from the genbank , refseq and est databasesspeciesgenbankrefseqestp . number of nucleotide sequences from each parasitic protozoan species retrieved from the genbank , refseq and est databases database search executed in july 2007 . redundancy of sequence proteins was treated in the following way : ( i ) the cd - hit ( 7 ) software was ran on all proteins of each five species , providing information on proteins with 100% identity , and ( ii ) redundancy mapped to already existing gus tables , then users will be able to query and retrieve non - redundant datasets . external database ids ( from tcruzidb and plasmodb ) mappings were incorporated into gus , so that users can query and retrieve protozoadb data using genbank , tcruzidb or plasmodb ids . visitors can also click on any of the mapped external database ids to be re - directed to plasmodb , tcruzidb , genedb or superfamily databases , then look on extra annotations . similarity analyses were performed using all the proteins coded by the genbank and refseq entries listed in table 1 , consisting of blastp against the uniref90 database ( release 11 ) of the uniprot consortium ( http://www.pir.uniprot.org/database/nref.shtml ) . further similarity analyses using the conserved domain database ( 9 ) and interpro ( 10 ) are being progressively added to the database . protozoadb is designed to offer a variety of query - based search tools that allow the user to perform an easy search of genes among the 5-protozoan genomes through ( i ) keyword , ( ii ) gene i d , ( iii ) product , ( iv ) protein motifs or ( v ) sequence type ( coding sequences , mrna , rrna , trna , snrna , snorna , transcript primary , precursor rna and untranslated sequences ) searches . also , the web user interface allows to view protozoan sequences separately or to compare them with each other . individual chromosomes can be visualized using gbrowse ( http://www.gmod.org/wiki/index.php/gbrowse ) that has been integrated to protozoadb . additionally , when a query is executed , information related to sequences features and dna , as well as translated and protein sequences may be obtained . when a gene ( e.g. tubulin ) is searched , the user can retrieve tubulin adding more keywords to describe function and/or localization , and track further ( re- ) annotation of that particular tubulin entry through the addition of sequence or gene rss ( really simple syndication ) to their preferred rss reader ( or even using igoogle or netvibes ) ( figure 1 ) . ( a ) searching e. histolytica subset , ( b ) choosing u20322 entry , ( c ) details of u20322 entry that can be tracked with rss , google or netvibes and ( d ) cds of u20322 entry and associated abstracts published in pubmed ( a ) searching e. histolytica subset , ( b ) choosing u20322 entry , ( c ) details of u20322 entry that can be tracked with rss , google or netvibes and ( d ) cds of u20322 entry and associated abstracts published in pubmed . protozoadb also contains a collection of ests from different life cycle stages of the distinct species , allowing the user to perform queries on genes related to metacyclogenesis and/or to compare genes expressed in different parasite species or stages . due to their particular biological and medical importance , a collection of ests from epimastigote , promastigote and amastigote forms of t. cruzi and l. major is available . moreover , ests from gametocytes , schizont and asexual stages of p. falciparum are also available for comparison . an extensive documentation is being incorporated progressively , then users can benefit from the howto ( user manual ) , faq ( frequently asked questions ) , gus - postgres - wiki ( details on the installation , configuration and debugging of gus for postgres ) and protozoadb roadmap ( features to be added ) in the left - side menu of the main page . with respect to protozoadb schema , a complete new subschema named phylo was designed and incorporated into gus 3.5 , extending it in order to store data from phylogenetic experiments , e.g. molecular phylogeny using distance and maximum likelihood , and profile - based phylogeny , as described by theobald and wuttke 2005 ( 11 ) . currently , users can perform queries in the phylogenetic trees constructed for the enzymes coded by mobile genetic elements and for the 18s rdna ( figure 2 ) . at this stage , only trees obtained by the neighbor - joining and distances methods are being stored in the system . the ultimate goal is to have all the 5-protozoan homologous genes identified , to support inferences and to store the phylogeny of all orthologous and paralogous genes , as well as conserved domains to allow other studies such as horizontal gene transfer . ( a ) searching mobile genetics elements ( mge ) phylogenetic trees , ( b ) mge genes trees , ( c ) ribonuclease h available data , ( d ) trypanosomatid taxons and ( e ) phylogenetic tree of ribonuclease h. features of the protozoadb phylo search tool . ( a ) searching mobile genetics elements ( mge ) phylogenetic trees , ( b ) mge genes trees , ( c ) ribonuclease h available data , ( d ) trypanosomatid taxons and ( e ) phylogenetic tree of ribonuclease h. protozoadb system is publicly available at http://www.biowebdb.org/protozoadb and offers modern web interfaces , based on concepts inspired by what has been called the web2.0 ( http://en.wikipedia.org/wiki/web_2 ) and rest - based web services ( http://en.wikipedia.org/wiki/representational_state_transfer ) . those design principles can enhance e - scientists experiment perception , by improving the web applications look - and - feel , facilitating collaboration and sharing of resources , and , most of all , facilitating services interoperability . protozoadb offers more flexibility than traditional ( perl ) scripts while being more flexible and efficient than web services technology . yet , it remains compatible with web services protocols as well as with scripts , turning the system extremely customizable . we currently use the developed rest - based web services as content providers for quick dynamic responses to user actions through the system interface , as well as to enable content and functionality sharing between protozoadb and third - party websites . in general , protozoadb interoperates in three distinct categories : ( i ) use of third - party web services for dynamic integration of information : an example of the use of lightweight services is provided through a protozoadb user interface , where we merge information obtained from protozoadb and ncbi 's entrez programming utilities ( e - utils : http://www.ncbi.nlm.nih.gov/entrez/query/static/eutils_help.html ) . in this specific example , we search pubmed dynamically , providing links to literature whenever an article cites sequences stored in protozoadb ; ( ii ) provision of web services for third - party reuse : a collection of services are offered to facilitate data retrieval in protozoadb , intended to be used by automated third - party pipelines ( workflows ) or external user interfaces interested in interoperating with protozoadb ; ( ii ) tools for direct community involvement : protozoadb interface encourages users involvement by offering them the option of entering their amendments or full annotations to any sequence in the form of tagsa concept successfully used in content - sharing websites such as flickr ( http://flickr.com/tour/ ) and delicious ( http://del.icio.us/ ) , and more recently , ncbi entrez with the introduction of generifs ( gene reference into function : http://www.ncbi.nlm.nih.gov/projects/generif/ ) . additionally , an rss feed option is available for user subscription , allowing him / her to receive notification of any updates on a given sequence of interest . rss feeds are widely supported by current web technology , such as e - mail clients ( e.g. mozilla thunderbird ) , browsers ( e.g. mozilla firefox ) , igoogle ( google customized homepage ) and netvibes ( http://www.netvibes.com ) . the general architecture of protozoadb system is basically composed by three main modules : web services , query system and database - loading plugins ( gus plugins ) ( figure 3 ) . the rest - based web services constitute its main layer , through where all the services are provided and by which protozoadb data can be accessed worldwide . a web page containing a javascript component provides a way for a dynamic user - friendly interaction with the protozoadb services . other application clients such as third - party pipelines can also directly connect to these services and reuse protozoadb data . alternatively , protozoadb provides automatic database update notifications through rss feeds to the users , reinforcing the community - based research aspect of the system . it aims to process genomic data originated from external data sources ( e.g. genbank , obo , etc . ) and to feed such data into the protozoadb ( gus - based extended schema ) . gus plugins are open - source perl programs and are bundled with the gus distribution kit . being open source , gus facilitates distinct projects to write and share personalized plugins , enhancing research projects / teams collaboration through its the protozoadb architecture allows data storage in a central repository that locally integrates processed core genomic data , but a loosely coupled integration with external sources is envisioned and preliminarily supported . we believe that in the near future , other initiatives will also adopt content sharing via web services , allowing a more flexible and dynamic integration with protozoadb and thus offering a user - friendly and powerful database . figure 3.general overview of the protozoadb architecture . general overview of the protozoadb architecture . in addition to web services access , the protozoadb database is available through a user interface , where a series of pre - defined database queries is offered to the users in order to ease the analysis task . finally , the eutils ( entrez programming utilities ) module , provided by ncbi , which does not currently integrate the protozoadb architecture , was included in figure 3 to illustrate the system ability to provide services composition with third - party database sites . our plans include : ( i ) design and incorporation of another new subschema into gus 3.5 for protein structure experiments , including druggability inferences ; ( ii ) link / interactions with tcruzidb ( 12 ) , apidb ( 13 ) , genedb ( http://www.genedb.org ) and tdrtargets ( http://www.tdrtargets.org ) databases ; ( iii ) inclusion of sequences from more protozoan species whose genome / transcriptome / proteome data generation are currently under way ; ( iv ) the addition of post - genomics data from microarrays , proteomics and 3d structures experiments ; ( v ) at least a yearly release cycle for protozoadb and ( vi ) the inclusion of a non - restrictive creative commons license . in step with the emergence of the semantic web , an envisioned third generation of the web , our database was partially mapped to a set of ontologies . providing accessibility to our repository through semantic web - based technologies , we offer web access to formal relationships that can be explored both by humans and machines , towards a relationship web ( 14 ) .

protozoadb ( http://www.biowebdb.org/protozoadb ) is being developed to initially host both genomics and post - genomics data from plasmodium falciparum , entamoeba histolytica , trypanosoma brucei , t. cruzi and leishmania major , but will hopefully host other protozoan species as more genomes are sequenced . it is based on the genomics unified schema and offers a modern web - based interface for user - friendly data visualization and exploration . this database is not intended to duplicate other similar efforts such as genedb , plasmodb , tcruzidb or even tdrtargets , but to be complementary by providing further analyses with emphasis on distant similarities ( hmm - based ) and phylogeny - based annotations including orthology analysis . protozoadb will be progressively linked to the above - mentioned databases , focusing in performing a multi - source dynamic combination of information through advanced interoperable web tools such as web services . also , to provide web services will allow third - party software to retrieve and use data from protozoadb in automated pipelines ( workflows ) or other interoperable web technologies , promoting better information reuse and integration . we also expect protozoadb to catalyze the development of local and regional bioinformatics capabilities ( research and training ) , and therefore promote / enhance scientific advancement in developing countries .

a cure for type 1 diabetes mellitus depends on replenishing functional insulin - producing cells . however , the limited supply of pancreatic islets from cadaver donors and the need for life - long immune suppression makes pancreas or pancreatic islet allotransplantation impractical for the vast majority of patients . this hurdle has led to a search for new alternate sources of insulin - producing cells or tissues [ 13 ] . a challenging approach to generating surrogate -cells for cell replacement therapy in diabetes liver and pancreatic cells share a common developmental origin , making liver cells good candidates for manipulation into -like cells . for example , cells with properties virtually identical to those of hepatic oval cells can also emerge in the pancreas , especially after the ablation of acinar cells . upon transplantation , these pancreas - derived oval cells can differentiate into functional hepatocytes and bile ducts . the reciprocal conversion of rodent [ 813 ] and human [ 1418 ] liver cells into pancreatic endocrine cells by transdifferentiation or direct cellular reprogramming has also been described . liver cells have been induced to differentiate into insulin - producing cells by ectopic expression of pancreatic transcription factors , the best studied of which is pdx-1 , a key regulator of pancreatic development and insulin expression in adult pancreatic beta cells [ 8 , 10 , 14 , 1619 ] . however , whether transcription factor - induced reprogramming primarily occurs in stem - like pluripotent cells or rather adult cells can directly give rise to committed cells of alternate lineages is questionable and presently analyzed . adult liver contains several populations of cells , including hepatocytes , cholangiocytes , endothelial stellate cells , and bone marrow- ( bm- ) derived cells [ 2022 ] . activation of the pancreatic lineage in mice in vivo has been reported to occur in several areas of the intact organ [ 8 , 11 , 23 , 24 ] . pdx-1-induced insulin production in mouse livers in vivo appears to occur mainly in the parenchyma of the liver around the central veins [ 8 , 11 , 25 ] . on the other hand , neurod1 and betacellulin - induced insulin production occurs mainly in cells close to the hepatic capsule . ngn-3 and betacellulin induce the transdetermination of parenchymal hepatocytes and hepatic progenitor cells and possibly endoderm - derived oval cells in periportal areas of the liver . the aim of the present study was to characterize the human - derived liver cells capable of giving rise to insulin - producing cells and determine whether they originate from mature or hepatic progenitor cells . the definite characteristics of hepatic progenitor cells which populate the adult human organ is controversial ; however , there is a wide agreement that all these populations express the epithelial marker , epcam [ 2729 ] . we generated in vitro primary cultures of liver cells derived from different human donors that already demonstrated a capacity to reprogram along the endocrine pancreatic and -cell - like lineages by ectopic expression of pancreatic transcription factors [ 1416 , 30 ] . the origin of the induced insulin - positive cells in proliferating cultures of adult human liver cells is not clear , because the original liver cell morphology is altered and the cells undergo massive dedifferentiation , which is further augmented by ectopic pdx-1 expression and the reprogramming process itself . here , we characterize the cells in the adherent , proliferating cultures derived from adult human liver and demonstrate their mesenchymal - like characteristics . using a genetic cell lineage tracing for albumin , we demonstrate that the cells coexpress both mesenchymal and adult hepatic markers , but none of the cells express epcam . the mesenchymal - like cells that originate from cells expressing albumin give rise to insulin expression upon ectopic pdx-1 expression . adult human liver tissues were obtained from 3 different liver transplantation surgeries from 410-years - old children and 8 individuals over forty years old . liver tissues were used with approval from the committee on clinical investigations ( institutional review board ) . isolation of human liver cells was performed as previously described [ 16 , 31 ] . briefly , the cells were digested by 0.03% collagenase type i ( worthington biochemical corp . , nj ) and cultured in dulbecco 's minimal essential medium ( 1 gr / l glucose ) supplemented with 10% fcs , 100 u / ml penicillin , 100 g / ml streptomycin and 250 ng / ml amphotericin b ( biological industries , israel ) . the medium was changed daily during the first three days in order to remove nonadherent cells . the cells were kept at 37c in a humidified atmosphere of 5% co2 and 95% air . the ptrip albumin promoter ( 410 ) nlscre deltau3 ( alb - cre ) vector was generated by removing with bamhi and xhoi of the enhanced green fluorescent protein ( egfp ) coding region from the ptrip alb egfp deltau3 vector , which contains a fragment of the rat albumin promoter from 423 to 23 relative to the transcription start site . the reading frame a gateway cassette ( gateway conversion kit ; invitrogen ) was next ligated to the blunt - ended vector according to the manufacturer 's instructions , generating a ptrip alb rfa - gateway deltau3 destination vector . the nlscre fragment was amplified by pcr from a plasmid provided by guilan vodjdani ( hospital de la pitie , salpetriere , paris ) using the forward primer 5 caccagatctatgcccaagaaga . agagg-3 and the reverse primer 5-ctcgagctaatcgccatcttc-3 , and the resulting pcr product was cloned into the pentr / d / topo plasmid ( invitrogen ) to generate an nls - cre entry clone . both destination vector and entry clone were used for in vitro recombination using the lr clonase ii system ( invitrogen ) according to the manufacturer 's instructions . lentiviruses infection was performed 24 hours after plating ; liver cells were washed with pbs and infected with a 1 : 1 mixture of the two viruses at multiplicity of infection ( moi ) 3 : 1 in growth media containing 8 ng / ml polybrene overnight . the medium was then replaced with culture medium , and the cells were refed twice a week and split 1 : 3 once a week . the percentiles of egfp and dsred2 positive cells were analyzed using a beckman coulter fc500 flow cytometer or facs calibur , using the cellquest program . adenoviral infection of ad - cmv - pdx-1 ( 1000 moi ) was preformed as previously reported [ 14 , 16 , 30 ] . all animals were maintained and animal experiments were carried out under the supervision and guidelines of the sheba medical center institutional animal welfare committee ( 177/2002 ) . cells at passage 4 , were harvested , washed twice with sterile pbs , counted , and resuspended in matrigel ( bd biosciences ) . six - week - old female athymic nude mice were injected subcutaneously in both flanks with human liver cells at density of 1 10 viable cells/100 l as previously described . liver - derived cells were harvested and washed with flow cytometry buffer consisting of 1% bsa and 0.1% sodium azide ( sigma , st . louis , mo , usa ) in phosphate buffered saline ( invitogen , carlsbad , calif , usa ) . for the cell surface antigen detection , approximately 10 cells labeled with conjugated monoclonal antibodies . intracellular staining was preformed using intracellular staining flow assay kit ( imgenex , san diego , calif , usa ) following manufacturer 's instruction . control samples included unstained cells , isotype antibody stained cells , and single fluorochrome - stained cells . the cells were analyzed using a beckman coulter fc500 flow cytometer or facs calibur , using the cellquest program . three weeks after lentiviruses infection the labeled liver - derived cells were sorted using a fluorescence - activated cell sorter ( facs ) ( aria cell sorter ; becton dickinson , san jose , calif , usa ) with a fluorescein isothiocyanate filter ( 530/30 nm ) for egfp and a pe - texas red filter ( 610/20 nm ) for dsred2 . following manufacturer 's instructions ( human mesenchymal stem cell functional identification kit , r&d systems , minneapolis , minn , usa ) , human liver - derived cells at passage 4 were plated on cover slips at 2,000 cells / cm in 6-well tissue culture - treated plates in the presence of the adipogenic or osteogenic supplements provided by the company . after 14 days in culture , the adipogenic culture formed adipogenic - like vacuoles . the plates were fixed with 4% paraformaldehyde for 20 minutes and stained with oil red o ( sigma ) . the osteogenic differentiation cultures were incubated for 21 days and fixed and stained with 1% alizarin red solution ph 4.1 ( sigma ) . slides were imaged under a leica dmlb microscope using the leica application suite version 2.7.1 r1 software . total rna was isolated , cdna was prepared and amplified as described previously [ 8 , 16 ] . quantitative real - time rt - pcr was performed using abi steponeplus ( applied biosystems , calif , usa ) as described previously [ 14 , 16 , 30 ] . human liver cells treated were plated on glass cover slides in six - well culture plates . forty - eight hours later , the cells were fixed and stained as described previously . statistical analyses were performed using two - sample students t - test assuming unequal variances . adult human liver cells can be propagated in vitro for roughly 20 passages ; after an initial 2-week lag , the cells proliferate at a constant rate ( figure 1(a ) ) [ 1417 ] . in addition to proliferation , a gradual and partial decrease in mature hepatic characteristics is observed . a comparison of the gene expression profiles of primary cultures of adult human liver cells ( passages 24 ) , and the original intact tissues revealed changes in the repertoire of expressed genes ( figures 1(b ) and 1(c ) ) . human liver - derived cells in culture undergo dedifferentiation , manifested as decreased expression of numerous adult hepatic markers and increased expression of immature and endodermal markers ( figure 1(b ) ) . previously , it was reported that hepatic dedifferentiation and downregulation of mature hepatic markers occurs rapidly , within 24 hours in culture . our data support that as the reduction was detected at any time point analyzed ( p025 in culture ) . despite the massive downregulation of adult hepatic markers , 88 6% of the liver cells in culture maintains albumin expression and production , as demonstrated by flow cytometry and immunofluorescence ( figures 2(a ) and 2(b ) ) . approximately 60% of the cells in culture were positive for another adult hepatic marker -anti - trypsin ( aat ) inhibitor ( figure 2(a ) ) though at lower levels than in the intact organ . twenty percent of liver cells in culture express the hepatic fetal marker alpha - fetoprotein ( afp ) , but none express the hepatic progenitor marker epcam or duct cell markers ca199 or ck19 [ 28 , 36 , 37 ] . taken together , these results suggest that the proliferating cells in culture may not represent populations of hepatic stem cells . liver cells in culture expressed lower levels of the epithelial marker e - cad and higher levels of n - cad compared to intact liver tissues ( figures 1(c ) and 2(a ) ) . such a switch in cadherin expression usually characterizes an epithelial to mesenchymal transition ( emt ) process , which also occurs to pancreatic islet cells in culture . in addition to the switch in cadherin expression levels , expression of the transcription factors snail and slug was activated , which further strengthens the notion that proliferating human liver cells in culture may undergo an emt process ( figure 1(c ) ) . to further uncover the nature and properties of liver - derived cells in in vitro culture cellular characterization of the cells in increasing passages indicated that most liver - derived cells in culture express several mesenchymal stem cell ( msc ) markers , including cd105 , cd90 , cd73 , and cd29 ( figures 2(a ) and 2(c ) ) . double immunostaining demonstrated the colocalization of hepatic and msc markers within the same cells ( figure 2(d ) ) . hematopoietic marker expression was not detected in the human liver - derived cultures ( figure 2(a ) ) . these data suggest that liver - derived cells in culture coexpress hepatic and general msc markers but may not represent a known hepatic progenitor population , as neither ck-19 nor epcam expression is detected [ 28 , 36 , 37 ] . the msc markers present on most liver - derived cells in culture motivated us to analyze whether the cells also exhibit cellular plasticity . human liver cells at passage 4 were cultured for 21 days under defined differentiation conditions known to activate osteocytes and adipocytes among bm - derived mscs ( figures 2(e ) , 2(f ) , 2(g ) , and 2(h ) ) . indeed , human liver cells cultured in adipogenic differentiation medium exhibited lipid - containing droplets visualized by oil red staining ( figure 2(e ) ) . cells cultured in osteogenic differentiation media developed calcium deposits visualized by alizarin red staining , which is characteristic of osteogenic differentiation ( figure 2(g ) ) . these data indicate that the liver - derived cells that propagate in vitro acquire developmental plasticity , which may allow them to differentiate along alternate developmental fates in response to applied growth and differentiation conditions . the developmental plasticity these cells exhibited may provide a partial explanation of their capacity to acquire a -cell phenotype in response to ectopic pancreatic transcription factor expression . the epithelial - mesenchymal transition in liver has been suggested to be related to invasiveness and metastatic potential in mouse and human cancers [ 39 , 40 ] . moreover , bm - derived mesenchymal stem cells have been demonstrated to exhibit tumorigenic capacity upon in vivo implantation [ 4143 ] . therefore , we analyzed whether the implantation of adult human liver - derived cells potentially generates tumors in vivo upon transplantation in immune - deficient mice . adult human liver - derived cells at passage 4 were injected subcutaneously into both flanks of nude mice ( 1 10 cells per injection , 5 mice per group , 2 transplantations per mouse ) and tumor growth monitored weekly . transplantation of tumor - derived cells , such as mda - mb 231 or panc-1 cells , resulted in large tumor formation 36 weeks after implantation , but none of the mice implanted with liver - derived cells developed visible tumors over 4 months . these data suggest that despite the cellular plasticity manifested earlier , dedifferentiated human liver cells have mesenchymal characteristics but may not carry a risk of uncontrolled cell proliferation or tumor formation . the adult human - derived liver cells characterized above were reported in the past to undergo cellular reprogramming and generate insulin - producing cells upon ectopic expression of the pancreatic transcription factor pdx-1 [ 14 , 16 , 17 , 30 ] . however , because only a fraction of pdx-1 expressing cells become insulin positive [ 14 , 16 ] , we sought to analyze whether the insulin - producing cells are generated from cells that originally express albumin or a yet unidentified side population of stem - like cells that may be enriched in the hepatic - derived primary cultures . because pdx-1 turns off the hepatic repertoire of gene expression , we irreversibly tagged albumin expression prior to pdx-1 treatment . human liver cells at passages 13 were coinfected by a dual lentivirus system modified from russ et al . . this lentivirus system included the cmv - loxp - dsred2-loxp - egfp ( r / g ) reporter and an additional lentiviral vector carrying the expression of cre recombinase under the control of the albumin promoter ( alb - cre , figure 3(a ) ) . r / g treatment resulted in dsred2 , but not egfp , expression in 84.1 3.1% of cells . the albumin promoter activates the expression of cre recombinase only in albumin - positive cells . dsred2 , allowing the constitutive expression of egfp under the same cmv promoter ( figure 3 ) . the dual lentivirus system exhibited a high level of specificity ; no egfp - positive cells were detected in non - liver cells , such as pancreatic tc1 cells ( figures 3(e ) , 3(f ) , and 3(g ) ) , and cre recombinase expression colocalized with albumin ( figures 3(h ) , 3(i ) , 3(j ) , and 3(k ) ) . because most adult human liver cells express albumin ( 88 6% , figure 2(a ) ) , we expected that the majority of cells infected by both lentiviruses would have activated cre recombinase and become egfp - positive . the efficiency of infection with a single lentivirus was 85% , and double infection resulted in 72% egfp - positive cells , using cmv - cre as control . adult human liver cells infected with the two - lentivirus system ( r / g and alb - cre ) resulted in 69.4 7.6% egfp - positive cells within ten days of infection , with few cells expressing both egfp and dsred2 protein ( figure 3(d ) ) . colabeling with egfp and dsred2 likely reflects the activity of the albumin promoter and the relatively long half - life of the dsred2 protein ( t1/2 = 4.5 days ) , such that the dsred2 protein can be detected even 1 - 2 weeks after the dsred2 gene is no longer expressed . only 9.3 5.4% of the cells remained irreversibly positive for dsred2 . these cells , in part , represent an incapability to activate albumin expression ( about 2%-3% ) and/or cells infected only with the reporter vector cmv - loxp - dsred2-loxp - egfp but not by the alb- cre lentivirus vector . egfp - labeled liver cells were separated from dsred2-positive cells by facs - sorter and cultured separately for several passages ( figures 4(a ) , 4(b ) , 4(c ) , 4(e ) , and 4(f ) ) . two weeks after sorting ( 3 passages ) , less than 3% of dsred2-positive cells were detected among the egfp - positive population , the vast majority of which were colabeled by egfp ( data not shown ) , suggesting a highly purified culture of albumin - positive , egfp - labeled cells . in addition to increased expression of the albumin gene in egfp - positive cells ( figure 4(g ) ) , additional adult hepatic markers , such as adh1b , glul , and the transcription factor cebp , were expressed to higher levels compared to the dsred2-positive cells ( figure 4(g ) ) . however , the expression level of the hepatic genes in egfp - positive cells was lower than that of cells at passage 24 ( figure 1(b ) ) , further suggesting an ongoing dedifferentiation process which occurs in culture with time . the expression of immature or progenitor markers , such as afp and ck19 , was similarly detected in both groups ( data not shown ) . in contrary , the dsred2-positive cells were enriched for sma , desmin , and gfap expression compared to the egfp - positive cells ( figure 4(h ) ) . sma , desmin , and gfap are typically considered to be hepatic stellate cell markers . although stellate cells are considered mesenchymal cells , they do not usually express the mesenchymal marker cd90 . the fact that dsred2 cells also expressed sma , desmin , and gfap but low levels of cd90 ( figure 4(i ) ) suggests that indeed , the dsred2 population of cells may include the hepatic stellate cell population . flow cytometry and immunofluorescence confirmed that each of the isolated egfp - positive cells expressed albumin , cd105 , and cd90 at higher levels than dsred2-positive cells ( figures 4(j ) and 4(k ) and data not shown ) . next , we sought to analyze which of the two liver cell populations preferentially support pdx-1-induced reprogramming , manifested as induced insulin production . egfp - positive cells and dsred2-positive cells were separately treated with ad - pdx-1 and supplemented with soluble factors as previously described . ectopic pdx-1 expression resulted in a significant decrease in albumin gene expression ( data not shown ) . however , ectopic pdx-1 expression did not affect the expression of cd105 and cd90 in the separate cultures ( data not shown ) . ectopic pdx-1 expression in egfp positive cells activated the expression of pancreatic hormones gene expression ( ins , gcg , and sst ; figure 5(a ) ) , the expression of genes involved in -cell glucose sensing ( glut-2 , gk ) , and prohormone processing ( pc2 ) ( figure 5(b ) ) . only the expression of somatostatin pdx-1 treatment resulted in insulin production , which mainly colocalized with egfp ; 17.6 3.5% of egfp - positive cells coexpressed insulin ( figures 5(c)5(h ) ) . in contrast , only 3.35 2.1% of dsred2-positive cells was also positive for insulin in response to a similar reprogramming protocol ( data not shown ) . because about 28% of the dsred2-positive cells could have been positive for albumin but not egfp , the actual percentage of insulin - positive cells generated in albumin - negative human liver cells is even lower than 3.35 2.1% . taken together , these data suggest that albumin - positive cells represent the vast majority of liver cells that undergo reprogramming along the pancreatic lineage . using a genetic lineage - tracing approach , we demonstrate for the first time that the insulin - producing cells induced by ectopic expression of the pancreatic transcription factor pdx-1 in human liver cells mainly originate from albumin - positive cells . the proliferating adherent human liver cells express both adult liver and mesenchymal cell markers and possess a considerable level of developmental plasticity ( figures 1 and 2 ) . most liver - derived cells in the primary culture express mesenchymal characteristics ( figure 2 ) . the origin of these hepatic msc - like cells is not clear ; they could represent liver cells that underwent emt , or the cells may represent a preexisting population of stem - like cells with self - replication capacity , which normally serve as hepatic progenitor cells . the precise combination of markers that characterize human hepatic progenitor cells is controversial ; thus , it is complicated to completely rule out the possibility that our culture conditions promoted the amplification of pre - existing human hepatic stem - like cells . however , the comprehensive characterization of the primary culture of the human liver - derived cells seems to favor the option that insulin - producing cells are generated in dedifferentiated liver cells that underwent an emt process , meaning that such cells , most likely , do not exist in the intact organ . this conclusion is based on several lines of evidence . first , 88% of the cells in culture are not only positive for albumin , but the albumin - positive cells also express higher levels of other adult hepatic markers , which is not expected to occur in pluripotent stem - like cells . second , epcam is agreed upon as being a hepatic progenitor marker and is not expressed in our human - derived cells . third , the only cells in the intact adult liver with mesenchymal characteristics are stellate cells . however , stellate cell marker expression was low in general and occurred mainly in the albumin - negative population , which had lower reprogramming efficiency ( figure 4(h ) ) . taken together , these data may suggest that the cells populating the majority of human liver - derived primary culture are not residents of the intact organ that underwent preferential proliferation . on the other hand , our human liver - derived primary culture exhibits several emt characteristics , including specific mesenchymal marker expression ( figures 1 and 2 ) , decreased e - cad associated with increased n - cad expression ( figure 1(b ) ) , and the activation of snail and slug expression , the zinc finger transcription factors known to control the emt process ( figure 1(c ) ) [ 40 , 46 ] . epithelial to mesenchymal transition is a common process that epithelial cells undergo upon in vitro culture [ 4749 ] . in vivo , emt plays a key role in morphogenic changes during embryonic development , wound healing / tissue regeneration , and neoplasia [ 25 , 26 , 30 ] . several groups have demonstrated that the process is associated with the downregulation of epithelial gene expression and activation of mesenchymal gene expression [ 4749 ] . emt induction in vitro has been suggested in cultured thyroid cells and adult human islets upon entrance into the cell cycle . more recently , direct evidence of emt in cultured adult primary -cells was demonstrated using genetic lineage tracing . the capacity of adult parenchymal liver cells to give rise to insulin - producing cells is further strengthened by in vivo studies . direct administration of pdx-1 in mice in vivo suggests that the insulin - producing cells are primarily generated in parenchymal cells close to the central veins [ 8 , 11 , 25 ] . hepatic pericentral cells are suggested adult , terminally differentiated , while adult hepatic stem cells mainly reside in periportal areas of the liver and in the canals of hering . while these observations need to be directly analyzed by a lineage tracing approach , they suggest that the reprogramming process does not primarily take place in bona fide adult hepatic stem cells . despite the uniform morphology of the human liver - derived cells in vitro , the cells seem to maintain different phenotypes with regard to albumin and the expression of other adult hepatic markers , which may correlate with distinct reprogramming capacity . using irreversible lineage tracing for albumin promoter activity , we present supporting evidence that insulin - positive cells induced by ectopic pdx-1 expression are preferentially generated in cells that are originally albumin - positive ( figure 5 ) . isolated human hepatic progenitor cells that carry the capacity to differentiate along multiple hepatic lineages , including mesenchymal cells the colocalization of albumin expression with mesenchymal markers suggests that the reprogramming process of liver to pancreas does not occur in such cells but in hepatic dedifferentiated cells , which undergone an emt process . because we also detected a small number of insulin - positive cells among the dsred2-positive cells , we can not rule out the possibility that nonalbumin - positive cells present in our culture underwent reprogramming and contributed to the insulin - producing cell population but with lower reprogramming efficiency . the fact that the special mesenchymal cells coexpressing albumin do not induce tumors in immune - deficient rodents conveys a substantial safety advantage over using other progenitor cells in tissue engineering approaches [ 52 , 53 ] . by contrast , other mesenchymal cells derived from bone marrow have been documented in numerous studies to carry a tumorigenic potential under similar conditions [ 4143 ] . the data generated in this study provide a better understanding of the nature of primary human liver cell culture , which is capable of undergoing pancreatic transcription factor - induced reprogramming . further dissection of subpopulations of cells within the liver - derived , albumin - positive mesenchymal cells will allow us to identify the specific characteristics of liver cells , which are predisposed to reprogramming to allow a substantial increase in the efficiency of the reprogramming process along the pancreatic lineage . the present study suggests that the insulin - producing cells induced by ectopic expression of the pancreatic transcription factor pdx-1 in human liver cells mainly originate from albumin - positive cells . the proliferating adult human liver cells in culture acquire mesenchymal characteristics and a high level of cellular plasticity . however , while most liver cells in culture possess mesenchymal - like characteristics , insulin production is induced in albumin positive cells , which are enriched for adult hepatic markers expression . identification and the characterization of cells prone to reprogramming along the -cell lineage is expected to increase the reprogramming efficiency . it may allow developing controlled and reproducible reprogramming process , by overcoming the pronounced heterogeneity of cells in the primary cultures . reprogramming liver to pancreas offers the access to an abundant source of self - tissue . the approach obviates the shortage in tissue availability from cadaveric donors and the need for antirejection treatment , allowing the diabetic patient to be the donor of his own therapeutic tissue .

activation of the pancreatic lineage in the liver has been suggested as a potential autologous cell replacement therapy for diabetic patients . transcription factors - induced liver - to - pancreas reprogramming has been demonstrated in numerous species both in vivo and in vitro . however , human - derived liver cells capable of acquiring the alternate pancreatic repertoire have never been characterized . it is yet unknown whether hepatic - like stem cells or rather adult liver cells give rise to insulin - producing cells . using an in vitro experimental system , we demonstrate that proliferating adherent human liver cells acquire mesenchymal - like characteristics and a considerable level of cellular plasticity . however , using a lineage - tracing approach , we demonstrate that insulin - producing cells are primarily generated in cells enriched for adult hepatic markers that coexpress both albumin and mesenchymal markers . taken together , our data suggest that adult human hepatic tissue retains a substantial level of developmental plasticity , which could be exploited in regenerative medicine approaches .

strategies for tissue regeneration must consider an assortment of factors that influence the proper reformation of functional tissue including inflammation [ 15 ] . components of the inflammatory pathway can shape the means in which proper wound healing is attained or negatively effect overall tissue remodeling [ 2 , 6 , 7 ] . specifically , cellular constituents of the innate immune system are typically the first to arrive at areas of tissue injury in an effort to provide the foundation for subsequent tissue regeneration [ 811 ] . however , in situations where adverse pathology or reaction to a foreign body plays a pivotal role in wound healing outcomes , alternative strategies must be employed to temper overzealous or dysfunctional innate inflammatory immune responses . two major factors that can affect the role of inflammation during tissue regenerative processes are the scaffold composition and choice of cells used for scaffold seeding . studies employing synthetic and biological scaffolds for tissue regeneration have been hampered by a myriad of obstacles , including scaffolds that were non - compliant or possessed limited structural integrity and lacked a means to mediate inflammation while simultaneously promoting tissue regeneration [ 1214 ] . poc [ poly ( 1,8-octanediol - co - citrate ) ] is an elastomeric scaffold that has demonstrated the ability to mimic mechanical properties of the bladder while providing an amenable surface for cell growth [ 1517 ] . mscs have been shown to modulate acute inflammatory responses and ameliorate injury in vivo , while cd34 hspcs robustly induce angiogenesis and provide support for peripheral nerve regeneration [ 15 , 18 , 19 ] . within the framework of this study , we have attempted to determine whether human bone marrow ( bm ) mscs and cd34 hspcs combined with poc could influence the innate inflammatory response and promote bladder tissue regeneration in a rodent model of bladder augmentation . poc [ poly ( 1,8-octanediol - co - citrate ) ] was synthesized and cell seeded as previously described . the cystectomized defect was augmented with 1 ) unseeded poc ( upoc ) ; 2 ) poc / cd34 hspcs ; 3 ) poc / mscs ; or 4 ) poc / mscs + cd34 hspcs . animal studies were approved by the institutional animal care and use committee at the stanley mann research center , chicago . cd68 ( macrophage marker ) , mpo ( myeloperoxidase ; neutrophil marker ) , il-1 , tnf , il-10 , and il-13 were used for if . antibodies were obtained from abcam or santa cruz biotechnology and used as described [ 15 , 16 ] . tissue samples were also quantified for respective marker / cytokine expression as previously described [ 15 , 16 ] . poc [ poly ( 1,8-octanediol - co - citrate ) ] was synthesized and cell seeded as previously described . the cystectomized defect was augmented with 1 ) unseeded poc ( upoc ) ; 2 ) poc / cd34 hspcs ; 3 ) poc / mscs ; or 4 ) poc / mscs + cd34 hspcs . animal studies were approved by the institutional animal care and use committee at the stanley mann research center , chicago . cd68 ( macrophage marker ) , mpo ( myeloperoxidase ; neutrophil marker ) , il-1 , tnf , il-10 , and il-13 were used for if . antibodies were obtained from abcam or santa cruz biotechnology and used as described [ 15 , 16 ] . tissue samples were also quantified for respective marker / cytokine expression as previously described [ 15 , 16 ] . differences between groups were determined using anova , with the tukey kramer method for multiple comparisons ( sas 9.4 ) . if staining subjectively demonstrated elevated levels of cd68 and mpo cells within upoc or poc / cd34 hspc grafts at 4 and 10 week time - points ( figure 1a , columns i and ii , respectively ) compared to other graft conditions . poc / msc and poc / msc + cd34 hspc grafts demonstrated a marked decrease in both cd68 and mpo cells within regenerated tissues at both time - points ( figure 1a , columns iii and iv , respectively ) . ( a ) cd68 macrophage ( green ) expression was highly abundant in upoc and poc / cd34 hspcs grafts . the infiltrating macrophage population encompassed the entirety of the graft and was also evident at contact points where the suture traversed native bladder tissue into the poc . similarly , mpo neutrophils ( red ) were also found to be in greater numbers in the aforementioned treatment groups . in contrast , poc / msc and poc / msc - cd34 hspc grafts displayed considerably lesser levels of both cd68 macrophage and mpo neutrophils at both 4 and 10 weeks post - surgery . ( b ) quantification of cd68 ( left bars ) and mpo ( right bars ) if staining at 4 weeks ( left panel ) and 10 weeks ( right panel ) . at 4 and 10 weeks post - augmentation , cd68 cells comprised 35.4 2.2% and 29.8 1.9% of the regenerated tissue from unseeded grafts , with mpo levels ( cd68 and cd68 ) of 8.5 1.0% and 10.5 1.2% . poc / msc grafts , with or without cd34 hspcs , resulted in a significant decrease in the macrophage infiltrate ( 4 and 10 weeks ) and in the neutrophil population ( 10 weeks ) ( 4w : poc / msc 18.1 2.9% cd68 , 5.7 1.5% mpo and poc / msc + cd34 hspc 17.3 1.2% cd68 , 4.3 1.3% mpo + ; 10w poc / msc 13.2 0.7% cd68 , 5.8 0.3% mpo and poc / msc cd34 hspcs 13.0 2.3% cd68 , 4.6 1.2% mpo ) . poc / cd34 hspcs grafts showed a delayed effect , with reduced macrophage and neutrophil populations observed at 10 weeks ( 4w : 33.8 0.6% cd68 , 10.4 1.0% mpo ; 10w : 19.3 2.1% cd68 , 5.3 0.1% mpo ) . significance shown for comparison of cell - seeded groups to upoc ; * p < 0.05 , * * p < 0.01 , * * * p 0.001 , * * * * p < 0.0001 . levels of anti - inflammatory cytokines il-10 and il-13 were most prominent in poc / msc and poc / msc + cd34 hspc grafts at the 4 week time - point and gradually decreased at 10 weeks post - surgery ( figure 2a , rows 3 and 4 , respectively ) . poc / cd34 hspcs and upoc grafts exhibited significantly lower levels of il-10 and il-13 production at both time - points as quantified in figure 2b . ( a ) the cytokines il-10 and il-13 are known to possess anti - inflammatory properties and facilitate tissue regeneration throughout the remodeling phases of inflammation . at 4 weeks post - augmentation , both il-10 ( green ) and il-13 ( green ) expression is low in upoc and poc / cd34 hspc grafts . this trend continued as seen at the 10 week time - point where the levels of expression decrease even further . antithetical results are observed with poc / msc and poc / msc + cd34 hspc grafts . there is an approximate 4-fold increase in il-10 and il-13 cytokine expression at 4 weeks post - augmentation compared to the upoc control . although the levels of the anti - inflammatory cytokines decreased at the 10 week time - point , there were still significant levels of expression of both cytokines , again approximately 4-fold greater than upoc control grafts . ( b ) quantification of anti - inflammatory cytokine expression , shown as percentage of cells staining positive for il-10 ( left bars ) and il-13 ( right bars ) at 4 weeks ( left panel ) and 10 weeks ( right panel ) . il-10 and il-13 expression levels indicated a strongly anti - inflammatory profile for poc / mscs or poc / msc + cd34 hspcs . notably , at 4 weeks the presence of mscs increased mean expression of il-10 and il-13 from < 20% of the cell population in the unseeded group to > 70% in msc - seeded groups ( 4w : upoc 16.3 0.8% il-10 and 12.8 4.1% il-13 vs. poc / msc 74.6 5.1% il-10 and 77.0 1.5% il-13 , poc / msc + cd34 hspcs 81.7 5.2% il-10 and 80.1 5.3% il-13 ; 10w : upoc 9.9 0.3% il-10 and 10.7 1.3% il-13 vs. poc / msc 16.0 1.6% 42.0 1.4% il-10 and 37.6 1.2% il-13 , poc / msc + cd34 hspcs 47.6 1.8% il-10 and 47.7 1.6% il-13 ) . significant effects were not observed for poc / cd34 hspcs grafts ( 4w : 23.3 2.9% il-10 and 18.6 2.6% il-13 ; 10w : 15.4 3.2% il-10 and 12.6 1.8% il-13 ) . significance shown for comparison of cell - seeded groups to upoc ; * p < 0.05 , * * p < 0.01 , * * * p 0.001 , * * * * p < 0.0001 . pro - inflammatory cytokines il-1 and tnf exhibited their highest levels of expression at the 4 week time - point in poc / cd34 hspcs and upoc grafts ( figure 3a , columns i , ii and rows 1 , 2 ) exhibited a modest decline in expression of each cytokine in upoc grafts , while a greater decline was seen in the poc / cd34 hspcs grafts at 10 weeks post - surgery . if data were verified as described in figure 3b . ( a ) detrimental to proper tissue regeneration is the presence of confounding pro - inflammatory cytokines including il-1 and tnf. il-1 ( red ) and tnf ( red ) levels were highly abundant in cd34 hspc and upoc grafts at the 4 week time - point . tnf levels remained elevated 10 weeks post - surgery while il-1 decreased only moderately in the unseeded samples . il-1 and tnf levels in poc / msc and poc / msc + cd34 hspc grafts were approximately half the value found in poc / cd34 hspc and upoc grafts at the 4 week time - point . there was a general decrease in pro - inflammatory cytokine expression at the 10 week time - point for all samples ; however , tnf expression was relatively elevated with the poc / cd34 hspc seeded construct . ( b ) quantification of pro - inflammatory cytokine expression , shown as percentage of cells staining positive for tnf ( left bars ) and il-1 ( right bars ) at 4 weeks ( left panel ) and 10 weeks ( right panel ) . the cytokine expression profile for upoc graft tissue was predominantly pro - inflammatory , with mean percentages of 41.5 2.2% tnf and 33.3 1.2% il-1 at 4 weeks and 34.3 3.1% tnf and 27.0 2.3% il-1 at 10 weeks . significant reduction in both tnf and il-1 expression was observed for grafts seeded with mscs or mscs / cd34 hspcs ( 4w : poc / msc 20.5 0.8% tnf and 13.9 0.9% il-1 , poc / msc + cd34 hspcs 22.5 1.3% tnf and 14.2 3.7% il-1 ; 10w : poc / msc 16.0 1.6% tnf and 7.0 1.2% il-1 , poc / msc + cd34 hspcs 14.4 2.2% tnf and 11.5 1.1% il-1 ) ; grafts seeded only with cd34 hspcs did not show this effect ( 4w : 39.2 2.6% tnf and 30.5 1.3% il-1 ; 10w : 26.6 1.5% tnf and 17.8 4.6% il-1 ) . significance shown for comparison of cell - seeded groups to upoc ; * p < 0.05 , * * p < 0.01 , * * * p 0.001 , * * * * p < 0.0001 . granulomas ( cd68 macrophages clustering ) in regenerating bladder tissue were highly abundant in upoc and poc / cd34 hspc grafts while lesser numbers of granulomas were present in poc / msc and poc / msc + cd34 hspc grafts ( figure 4a ) , which remained fairly constant throughout both time - points . ( a ) the accumulation of cd68 macrophage clusters ( green ) was most prominent in 4- and 10-week upoc and poc / cd34 hspc grafts . the numbers of granulomas was greatly reduced in poc / msc and poc / msc + cd34 hspc grafts ( figure 4a , columns iii and iv ) and both time - points . scale bar , 200 m . ( b ) frequency of granulomas in bladder tissue decreased with the addition of mscs , but not cd34 hspcs , to grafts . at 4 weeks , the mean number of granulomas for msc - seeded groups was < 2 ; by 10 weeks further reduction resulted in instances of no detectable granulomas ( poc / msc range 0 - 2 ; poc / msc + cd34 hspcs range 0 - 1 ) . the interplay between inflammation - based response mechanisms to tissue insult and endogenous regeneration programs are pivotal for proper tissue reformation [ 5 , 20 , 21 ] . aberrant expression of inflammatory pathway components can lead to suboptimal tissue regeneration , which is reflected in poor architectural remodeling and ineffective organ function . since the initial response to tissue injury is typically a cascade of innate immune events that include macrophage and granulocyte localization , it is essential to modulate , but not abolish , the catabolic effects of pro - inflammatory cytokines in this setting [ 15 , 16 , 22 ] . the application of bm mscs and the differentiated progeny of cd34 hspcs to attenuate highly reactive innate immune inflammation responses is potentially a feasible option for bladder regeneration . mscs known to possess potent anti - inflammatory properties and the ability to alter macrophage phenotype [ 2224 ] were not only able to modulate aspects of macrophage and neutrophil migration , but were also able to influence pro- and anti - inflammatory cytokine secretion in vivo . specifically , msc / poc grafts decreased the presence of macrophage and neutrophils 2- and 1.5-fold , respectively , compared to upoc grafts at 4 weeks post - augmentation ( figure 1 ) . this correlated to a substantial up - regulation in anti - inflammatory cytokine secretion of il-10 and il-13 ( figure 2 ) , which was 4-fold greater than control samples combined with a significant reduction of pro - inflammatory cytokines tnf and il- ( figure 3 ) . decreased levels of tnf and il- expression mediated by a reduction in macrophage activity or by agonist supplementation have been shown to be conducive to tissue repair and regeneration in a number of settings including nerve regeneration [ 2528 ] . although poc / msc + cd34 hspc grafts did not appear to greatly alter the levels of macrophage and neutrophil tissue content and cytokine expression compared to poc / msc grafts , it had a profound effect on other aspects of bladder tissue regeneration . we have previously demonstrated that poc / msc + cd34 hspc grafts greatly increased bladder muscle growth and promoted peripheral nerve regeneration and tissue vascularization when compared to upoc or poc / msc grafts at the 4 week time - point . as tnf maintains a pleiotropic role with regards to angiogenesis , markedly reduced levels of tnf did not appear to effect levels of angiogenesis in our model [ 15 , 29 , 30 ] . compensatory attributes provided by the cd34 hspcs may have accounted for the robust angiogenic response . the data presented here supports data derived from a previous study by pokrywczynska and colleagues , which also demonstrated the pro - regenerative and anti - inflammatory power of bone marrow cells . within the context of that study , it was observed that there was an increased expression of anti - inflammatory cytokines along with corresponding matrix metalloproteinases ( mmps ) that provided the impetus for rigorous bladder detrusor muscle regeneration in an in vivo model of bladder augmentation . the onset of granuloma formation is initiated with the localized accumulation of inflammatory mononuclear cells including macrophages . granulomas can eventually transition to fibrosis and compromise bladder elasticity and function with the potential to negatively impact the upper urinary tract . in the presence of poc / msc grafts , augmented bladders had a diminished capacity to form granulomas ( figure 4b ) in part due to a reduction in macrophage numbers . thus , an augmentation scheme utilizing poc / mscs and poc / cd34 hspcs can help alleviate the formation of granulomas and promote healthy bladder tissue regeneration . this study provided a limited but poignant examination of the anatomical and histological features in which inflammatory factors that may affect bladder tissue regeneration in the presence of mscs and cd34 hspcs . as only specific aspects of the innate immune system were studied , other arms of the immune system must also be scrutinized to delineate the roles between inflammation and regeneration . compared to controls , poc / mscs ( cd34 hspcs ) decreased numbers of macrophages and neutrophils along with levels of pro - inflammatory cytokines while promoting anti - inflammatory cytokine expression during regeneration with a concomitant reduction in the number of tissue granulomas . however , the addition of cd34 hspcs to the grafts was necessary for multifaceted bladder regeneration . the partial modulation of inflammation likely produced an environment advantageous to overall bladder tissue regeneration .

introductioninflammatory responses following tissue injury are essential for proper tissue regeneration . however , dysfunctional or repetitive inflammatory tissue assaults can lead to poor tissue regeneration and ultimate tissue failure via fibrosis . previous attempts at urinary bladder tissue regeneration utilizing polymeric and biologic scaffolding materials tended to elicit these responses leading to poor tissue regeneration . recent advances in bladder regeneration utilizing bone marrow derived mesenchymal stem cells ( mscs ) and cd34 + hematopoietic stem / progenitor cells ( hspcs ) with biocompatible citric acid based scaffolds have provided an environment that not only promotes the growth of architecturally germane and physiologically functional tissue , but also modulates aspects of the innate immune response.material and methodswithin this study mscs , cd34 + hspcs , or msc / cd34 + hspc seeded poc [ poly ( 1,8-octanediol - co - citrate ) ] scaffolds were utilized in an established rodent bladder augmentation model to evaluate inflammation as it pertains to bladder tissue regeneration.resultsquantified data from post - augmentation regenerated tissue samples at the 4 week time - point demonstrated that poc / msc and poc / msc + cd34 + hspc grafts markedly reduced the presence of pro - inflammatory cd68 + macrophages and mpo+ neutrophils compared to unseeded poc or poc / cd34 + hspc - only seeded grafts . pro - inflammatory cytokines tnf and il-1b were also significantly down - regulated with a concomitant increase in the anti - inflammatory cytokines il-10 and il-13 in the aforementioned poc / msc and poc / msc + cd34 + hspc composites . furthermore , this led to fewer instances of bladder tissue granuloma formation combined with greater muscle content and tissue angiogenic events as previous data has demonstrated.conclusionsdata indicates that poc / msc and poc / msc + cd34 + hspc grafts attenuate the innate inflammatory response and promote bladder tissue regeneration .

a variety of paraneoplastic syndromes , the majority of neurological complications , are occurring in timely association with neuroblastoma . opsoclonus - myoclonus syndrome ( oms ) , and cerebellar ataxia are the most common paraneoplastic syndromes considered to be paraneoplastic neurologic disorders ( pnds ) ( 1 ) . however , clinical presentations of paraneoplastic syndromes may be multiple . early diagnosis of these syndromes maximizes likelihood of the treatment of the tumor along with the absence of the neurologic manifestations . within the last 5 years 9 of them presented exclusively with paraneoplastic syndromes involving various organs or systems , some of which were recognized as rare paraneoplastic syndromes . in order to make more accurate diagnosis , we reviewed the clinical data and the literature on this syndrome . between april 2007 and april 2012 , 68 children were diagnosed with neuroblastoma or ganglioneuroblastoma in our institution , 9 of which presented exclusively with paraneoplastic syndromes and had not received chemotherapy before diagnosis . after collecting the patients clinical records and having reviewed the literature on pediatric neuroblastoma cases that coincided with paraneoplastic syndrome , further understanding of the phenomena was reached . at the time of diagnosis , among 68 pediatric patients with neuroblastoma or ganglioneuroblastoma , 4 ( 5.9% ) patients suffered from neurological complications at diagnosis , 2 ( 2.9% ) patients had digestive tract disorders , 2 ( 2.9% ) patients had immune diseases , and 1 ( 1.5% ) suffered hematological disorder ( without bone marrow involvement ) . neurological complications were the most common ones , which were followed by digestive and immune diseases . six patients experienced misdiagnosis and received treatments including gammaglobulin and/or prednisone / dexamethasone . after chemotherapy and operation , 5 patients achieved complete remission and all 4 patients with pnds achieved partial response after a median time of 4 months on paraneoplastic syndrome . all patients achieved complete remission of paraneoplastic syndrome before completion of chemotherapy . among the 9 patients , one ( 11.1% ) patient died during treatment . the median follow up duration for these patients was 2.08 0.929 ( 95% ci , 1.95 - 3.12 ) years . the two years event free survival was 77.8% , the two years overall survival was 88.9% . abbreviations : chemo , chemotherapy ; f , female ; g , gammaglobulin ; inss , international neuroblastoma staging system ; m , male ; p / d , prednisone / dexamethasone ; radio , radiotherapy ; time , time from onset of paraneoplstic syndrome to diagnosis of neuroblastoma . paraneoplastic syndrome is defined as a dysfunction of organ systems caused by the remote humoral effects of a tumor and not by local effects or metastases ( 2 ) . oms has been observed in up to 4% of patients with neuroblastoma ( 1 ) . until now , various clinical cohort studies have shown different rates of neurological paraneoplastic syndromes . one such study claims that it could reach up to 40% ( 3 ) , while it was reported 68% by chu et al . ( 4 ) . in our study , the rate of neurological complications was 5.9% . apart from oms , pediatric patients with neuroblastoma have presented with other paraneoplastic neurologic disorders , which include lambert - eaton myasthenic syndrome ( 5 ) , encephalomyelitis ( 6 ) , cerebellar ataxia ( 7 ) , and hypothalamic syndrome ( 1 ) . among the 9 patients who presented with paraneoplastic syndromes in our study , 4 ( 5.9% ) had neurological complications , the typical paraneoplastic syndrome was cerebellar ataxia , besides that , myalgia , motor dysfunction of lower extremities and monoplegia of the lower extremity were also seen . why are paraneoplastic syndromes coinciding with neuroblastoma directly affecting the neurologic system ? a variety of autoantibodies have been reported , particularly anti - hu antibody , in neuroblastoma patients with paraneoplastic syndromes . histochemically , it has been identified that the anti - hu antibody reacts with nuclei of neurons throughout the central nervous system ( 8) . oms was first recognized as a possible remote effect of neuroblastoma by solomon and chutorian in 1968 ( 9 ) . since then , other neurological signs and syndromes , such as seizures , choreoathetosis , and peripheral neuropathies , have also been described as remote effects of neuroblastoma ( 10 , 11 ) . in our cases , the presence of serum and cerebrospinal fluid ( csf ) anti - hu antibody was associated with complications including cerebellar ataxia , monoplegia of the lower extremity , constipation , and diarrhea . even though , the initial presentation , in patient 2 was motor dysfunction of lower extremities . the spinal magnetic resonance imaging removed the possibility of spinal nerves compression by tumor mass . based on fathallah opinion , pnds are subdivided into three categories : 1 ) those whose pathogenesis is understood , 2 ) those that are linked to the tumor by biologic data but whose pathogenesis is not yet elucidated , and 3 ) those that could not be linked to the malignancy by biologic data ( 12 ) . depending on specific damage of anti - hu antibody to neural system and characteristics of sympathetic innervation , the presenting features of neuroblastoma may be various . honnorat et al . has reported a child with neuroblastoma who had localized myoclonus , progressive hemiplegia and high titers of anti - hu antibodies in the serum and cerebrospinal fluid ( 13 ) , indicating that due to the widespread presence of the sympathetic nervous tissue in various body organs and apparatuses , the presenting features of neuroblastoma may be variable . there is evidence that this symptom is related to vasoactive intestinal polypeptide ( vip ) production in tumor cells stimulating intestinal aberrant secretions ( 2 ) . . however , constipation in association with a ganglioneurobalstoma is rare . in our study , patient 5 presented with chronic constipation which had lasted for about 6 months . in general investigation , firstly described a patient presenting with intestinal pseudoobstruction as a paraneoplastic syndrome of ganglioneurobalstoma ( 14 ) . thus , in clinical experiences , although rare , diarrhea and constipation may initially present together in cases of neuroblastoma or ganglioneuroblastoma , easily missing the diagnosis of tumor . interestingly , we observed that patients with ganglioneuroblastoma were mostly presenting with digestive system diseases . to our knowledge , there was no report of paraneoplastic syndrome presenting with erythema , kawasaki disease and immune thrombocytopenic purpura , associated with immune disorders . even though immune injury is known as the major etiology for paraneoplastic syndromes , there are no established procedures to identify it in patients with neuroblastoma prior to tumor diagnosis . paraneoplastic syndromes will relieve after receiving immune therapy or chemotherapy , or be cured following surgical and/or chemotherapy interventions . currently , the exact mechanisms of immune - mediated dysfunction and endocrine tumor effect with paraneoplastic syndromes in patients are unknown . it is postulated that autoimmune disorders are the major reason , but the precise pathophyiology is unclear . neuroblastoma may present with a range of nonspecific neurologic symptoms in addition to the well - known oms and cerebellar ataxia . in our series , we identified 9 out of 68 patients different kinds of paraneoplastic syndromes prior to the diagnosis of neuroblastoma . to date , however , there is no identifiable common denominator among the various paraneoplastic syndromes of neuroblastoma . but in any case , the presence of unexplained neurologic manifestations and other common clinical presentations such as erythema , constipation , diarrhea , especially immune disorders in an otherwise healthy child should raise the suspicion of a possible paraneoplastic syndrome because of the presence of an undiagnosed tumor .

background : clinical presentations of paraneoplastic syndromes in neuroblastoma may multiply . review of the clinical data and the literature on this syndrome may help in the diagnosis of neuroblastoma.objectives:in order to make more accurate diagnosis , we reviewed the clinical data and the literature on this syndrome.patients and methods : between april 2007 and april 2012 , 68 children were diagnosed with neuroblastoma or ganglioneuroblastoma in our institution , 9 of which presented exclusively with paraneoplastic syndromes and were not treated with chemotherapy prior to diagnosis . after the diagnosis , all patients received chemotherapy and operation on nb97 protocol.results:among 68 pediatric patients with neuroblastoma or ganglioneuroblastoma , 4 ( 5.9% ) patients suffered from neurological complications at diagnosis , 2 ( 2.9% ) patients had digestive tract disorders , 2 ( 2.9% ) patients had immune diseases , and 1 ( 1.5% ) suffered from hematological disorder ( without bone marrow involvement ) . all paraneoplastic syndrome patients achieved complete remission on paraneoplastic syndrome before completion of chemotherapy.conclusions:neuroblastoma may present with a range of non - specific neurologic symptoms in addition to the well - known opsoclonus - myoclonus syndrome and cerebellar ataxia . in any case , the presence of unexplained neurologic manifestations and other common clinical presentations such as rash , constipation , diarrhea , and especially immune disorders in an otherwise healthy child had raised the possibility of paraneoplastic syndrome due to the presence of an undiagnosed tumor .

because this research was a part of a public health response , our study did not require formal ethical approval from a medical ethics committee . we communicated with the airline and bus operators to collect passenger information and undertook personal interviews in related communities . a hotline was set up , and the case - patient s travel information was published in the media . we also reviewed video footage from closed circuit television in hotels and restaurants visited by the case - patient , enabling us to identify contacts and measure duration and distance of exposures . information about bus passengers was limited ; consequently , with help from police departments , we analyzed video footage recorded by public surveillance cameras at bus stations and surrounding communities and traced the whereabouts of related passengers . we identified 110 contacts in mainland china : 87 ( 79% ) were from mainland china , 11 ( 10% ) from south korea , 2 ( 2% ) from hong kong , 6 ( 5% ) from taiwan , 3 ( 3% ) from canada , and 1 ( 1% ) from japan . of the 110 contacts , 27 were air travel contacts ( passengers onboard the same flight with the case - patient ) ; 24 were land travel contacts ( stewards and passengers taking the same buses with the case - patient ) ; and 59 were community contacts ( persons who had face - to - face contact with the case - patient or who had direct contact with his belongings in hotels , restaurants , and a meeting room ) ( table 1 ) . the hotline resulted in 16 ( 59% ) air travel contacts and 12 ( 50% ) land travel contacts . reviewing video helped trace 9 ( 38% ) land travel contacts and 25 ( 42% ) community contacts ( table 2 ) . we located all community , air travel , and land travel contacts within 3 days , 6 days , and 8 days , respectively ( figure ) . * close contacts include 2 from taiwan and 2 from south korea that returned to their countries before they were identified . numbers and percentages for contacts and close contacts exclude 4 contacts who left mainland china before they were identified . timeline for imported case of middle east respiratory syndrome ( mers ) coronavirus infection and contact tracing investigation , china , 2015 . the case - patient was identified on may 27 , 2015 , and quarantined beginning in the early morning of may 28 , the day contact tracing began . laboratory testing , which began on may 28 , confirmed mers on may 29 , the date of the start of the hotline . who , world health organization . among 44 contacts whom we classified as close contacts , 6 were air travel contacts who had been seated <3 rows from the case - patient on the flight ; 24 were land travel contacts ; and 14 were community contacts who had prolonged ( > 15 minutes ) face - to - face ( < 2 m ) contact with the case - patient or direct contact with his belongings . of the 44 close contacts , 40 were staying in mainland china and were quarantined in designated facilities for 14 days after their last exposure to the case - patient . the remaining 4 close contacts , 2 from taiwan and 2 from south korea , had returned to their countries before they were traced . of 66 common contacts , 49 were quarantined in designated facilities , and 17 conducted self - monitoring at home ( an alternative for common contacts ) for 14 days after their last exposure to the case - patient . public health officials visited them daily . during follow - up , fever developed in 1 contact and 2 others had sore throat . throat swab samples from 106 contacts and serum samples from 53 were obtained on the first and last days of follow - up . an additional set of specimens was collected from the 3 symptomatic contacts immediately after onset of symptoms . all specimens were tested by real - time reverse transcription pcr , as previously described ( 4 ) . no specimens tested positive for mers - cov , and follow - up for contacts ended on june 10 , 2015 . from the date of his isolation ( may 28 ) until the date of his discharge ( june 26 ) , the case - patient received direct medical care and examination from 73 healthcare workers ( hcws ) . these hcws were not considered contacts in our investigation because they all used personal protective equipment , as recommended by the world health organization ( 5 ) . the hospital conducted follow - up with all 73 hcws until 14 days after their last interaction with the case - patient . throat swab and serum samples were obtained from all hcws on day 10 after the case - patient s admission and on day 14 after his discharge . all specimens tested negative for mers - cov by real - time reverse transcription pcr . we traced 110 contacts of a patient with an imported case of mers - cov infection in china . follow - up and laboratory testing indicated that no virus transmission occurred among contacts . because of the timely notification from south korea and the world health organization regarding the mers - cov outbreak ( 4 ) , our hospital was able to prepare in advance for admission of the case - patient . our findings indicate that human - to - human transmission of mers - cov is still limited ( 68 ) . to minimize risk of local spreading , china health authorities decided to identify and trace all contacts of the initial case - patient and enforce mandatory monitoring . first , the mers outbreak in south korea , from where the case - patient traveled , was ongoing , and superspreading was observed there ( 9,10 ) . second , the patient was symptomatic and potentially infectious during his travel and stay in china . previous clusters have been detected in hospitals and households ( 1113 ) , and mers - cov transmission might occur in enclosed settings . moreover , because knowledge about mers is still limited , cases could have been easily missed initially . publicizing information and hotlines can facilitate contact tracing and risk communication and helped us identify > 50% of the case - patient s travel contacts . however , we also had to rule out large numbers of false hotline calls that resulted from inaccurate recall and excessive worry . review of video footage is another active solution for identifying contacts , especially for anonymous contacts . in our investigation , we directly located some bus passengers who resided near the station by reviewing footage from surveillance cameras . other bus passengers left the station by private cars , which were captured by cameras . also , no identity information for bus passengers was available , and privacy issues were concerns . furthermore , lack of knowledge about mers made some contacts less willing to comply with mandatory monitoring . nevertheless , we traced and monitored all contacts eventually . we suggest combining multiple approaches and data sources beyond ordinary investigation to trace contacts of persons with imported cases of mers .

confirmation of an imported case of infection with middle east respiratory syndrome coronavirus in china triggered intensive contact tracing and mandatory monitoring . using a hotline and surveillance video footage was effective for tracing all 110 identified contacts . contact monitoring detected no secondary transmission of infection in china .

transmembrane beta - barrel ( tmb ) proteins form a beta - barrel as a single beta - sheet joined at its edges . the sheet is all - next - neighbor(1 ) , meaning all paired strands are adjacent in sequence . the architecture can be described as the repeating pattern , where up means towards the extracellular side : n - term , [ up - strand , outer loop , down - strand , periplasmic hairpin]n , c - term . proftmb , originally published in ( 2 ) provides a prediction of residues in these four states ( example figure 1 ) . it exploits statistical features of tmbs including enrichment of beta- and gamma - hairpins in the periplasm , lengths of outer loops , hydrophobic belt , and follows several design ideas from other hidden markov model ( hmm)-based tmb predictors ( 3,4 ) . atypical gram - positive bacteria called mycolata , which have thicker mycolic acid containing outer membranes . users submit one or more fasta - formatted protein sequences . for each sequence , proftmb builds a psi - blast profile and runs the prediction , attempting to find the best fit of the protein to its tmb - based architecture , indicated as a z - value . results are always returned on a webpage , and take 4 min per 500-residue protein . in the case of more than one sequence , an email of the results url is sent . if the query protein receives z - value 4.0 , proftmb provides a four - state ( upward - strand , downward - strand , outer loop , periplasmic loop ) per - residue prediction . graphical output consists of color - coded four state posterior probability plots and amino acid sequence ( figure 1 ) . amino acid color indicates the final prediction , and usually corresponds to the state with maximum posterior probability , but with corrections based on context shown with lighter - weight font [ described in decoding section of the supplementary data of ( 2 ) ] . while we did not quantify confidence levels for per - residue prediction , higher z - values tend to have fewer corrected residues and greater contrast in state posterior probabilities . in the example shown ( figure 1 ) , ompa from escherichia coli [ pdb : 1g90 ( 5 ) chain a ] this result is expected , given proftmb was trained on very similar sequences . in most predictions on real tmbs , also , most strand and loop states have the best state close to probability 1 . in the second example shown ( figure 2 ) , heme acquisition system protein a from serratia marcescens , of the gammaproteobacteria class ( gram - negative ) illustrates a false positive prediction . in fact , the structure [ pdb : 1b2v ( 6 ) ] consists of a seven - stranded beta - sheet against four -helices . notice that predicted strands four , five and six have poor contrast in posterior probability , indicating a poor fit to the proftmb model . finally , proteins shorter than 140 or longer than 1392 residues receive z - value 10 000 ( data not shown ) . the lower length of 140 is a conservative estimate of the smallest possible tmb , while the upper bound reflects the limit of our test set for z - value calibration . occasionally , proftmb will assign z - value less than four to a known tmb . unfortunately , in such a case , the fact that it is a tmb ca n't be used to help produce a reliable per - residue prediction since proftmb derives the prediction from sequence alone . this occurred in about 15% of the cases in our test set ( see performance evaluation in methods tab on website ) . in our original paper ( 2 ) we used psi - blast profiles run with options h 1 ( e - value cutoff for inclusion in next pass ) and j 2 ( number of iterations ) , and did not explore the effect of different profiles on proftmb accuracy , either for whole protein or per - residue prediction . since then , we have run 8-fold jackknife tests ( leave one out , seven in ) on the original swiss - prot sequence versions of eight pdb structures ( settmbfull : 1a0s_p , 1af6_a , 1bt9_a , 1fep_a , 1prn , 1qd5_a , 1qj9_a , 1qjp_a ) . we built sets of psi - blast profiles with 30 different combinations of settings h { 1 , 0.1 , 0.01 , 0.001 , 0.0001 , 0.00001 } and j { 2 , 3 , 4 , 5 , 6 } and used each set in a separate jackknifed test . the original q2 accuracy , with settings h 1 j 2 was 86.0% , while the best settings , h 0.0001 j 2 achieved 87.3% q2 accuracy . as a result , we changed the defaults to h 0.0001 j 2 we have not estimated the effects of psi - blast settings on whole - protein prediction yet . currently , z - value and resulting estimated accuracy and coverage are calibrated from our original sequence - unique set called setroc , containing a representative set of proteins from swiss - prot . as sequence databases are updated , we will periodically re - calibrate z - values . a cluster plot and resulting accuracy versus coverage curve can be found in the predictions on 78 gram - negative proteomes are available in the download section , updated since original publication as follows . first , length - adjusted bits score was replaced by z - value , which gives slightly improved discrimination on our test set ( unpublished data ) . second , per - residue predictions were re - run using updated psi - blast profiles , with option h 0.0001 rather than h 1 . third , the model architecture now explicitly includes begin and end states , representing the beginning and end of the amino acid sequence . the proftmb software is a general profile - hmm allowing specification of model architecture , encoding and decoding . the training data , consisting of eight tmb sequences with hand - annotated per - residue labeling based on their 3d structures , is available as well . interested users may download and compile the c++ source code and use proftmb with the original training data or modify it . we make it available in the spirit of reproducibility , and encourage interested readers to contact the authors for more detailed advice . true positive output example . proftmb prediction for ompa from e.coli [ pdb : 1g90 ( 5 ) chain a ] , a true tmb . note that predicted strands have high contrast between state probabilities for a majority of their length . heme acquisition system protein a ( hasa ) from serratia marcescens [ pdb : 1b2v ( 6 ) ] , a secreted hemophore with architecture beta - alpha - beta ( 6)-alpha ( 2 ) according to scop ( 7 ) . predicted strands four , five and six show poor contrast in state probabilities and

proftmb predicts transmembrane beta - barrel ( tmb ) proteins in gram - negative bacteria . for each query protein , proftmb provides both a z - value indicating that the protein actually contains a membrane barrel , and a four - state per - residue labeling of upward- and downward - facing strands , periplasmic hairpins and extracellular loops . while most users submit individual proteins known to contain tmbs , some groups submit entire proteomes to screen for potential tmbs . response time is about 4 min for a 500-residue protein . proftmb is a profile - based hidden markov model ( hmm ) with an architecture mirroring the structure of tmbs . the per - residue accuracy on the 8-fold cross - validated testing set is 86% while whole - protein discrimination accuracy was 70 at 60% coverage . the proftmb web server includes all source code , training data and whole - proteome predictions from 78 gram - negative bacterial genomes and is available freely and without registration at .

asthma is the most common chronic illness of childhood and its prevalence is increasing , causing much concern for identification of risk factors such as air pollution . we previously conducted a study showing a relationship between asthma visits in all persons < 65 years of age to emergency departments ( eds ) and air pollution in seattle , washington . in that study the most frequent zip codes of the visits were in the inner city . the seattle - king county department of public health ( seattle , wa ) subsequently published a report which showed that the hospitalization rate for children in the inner city was over 600/100,000 , whereas it was < 100/100,000 for children living in the suburbs . therefore , we conducted the present study to evaluate whether asthma visits to hospital emergency departments in the inner city of seattle were associated with outdoor air pollution levels . ed visits to six hospitals for asthma and daily air pollution data were obtained for 15 months during 1995 and 1996 . the association between air pollution and childhood ed visits for asthma from the inner city area with high asthma hospitalization rates were compared with those from lower hospital utilization areas . daily ed counts were regressed against fine particulate matter ( pm ) , carbon monoxide ( co ) , sulfur dioxide , and nitrogen dioxide using a semiparametric poisson regression model . significant associations were found between ed visits for asthma in children and fine pm and co. a change of 11 microg / m3 in fine pm was associated with a relative rate of 1.15 [ 95% confidence interval ( ci ) , 1.08 - 1.23 ] . there was no stronger association between ed visits for asthma and air pollution in the higher hospital utilization area than in the lower utilization area . these findings were seen when estimated pm2.5 concentrations were below the newly adopted annual national ambient air quality standard of 15 microg / m3.imagesfigure 1figure 2

anti - glomerular basement membrane ( anti - gbm ) disease is a rare autoimmune disorder characterized by circulating auto - antibodies against epitopes in the 3-chain of type iv collagen present in the glomerular and/or pulmonary basement membranes . the renal biopsy shows crescentic glomerulonephritis ( crgn ) > 50% glomeruli with crescents ) in more than 80% of patients . however , crgn due to anti - gbm disease accountis for only 10 - 20% of patients , as compared to the other causes namely immune - complex - mediated and pauci - immune crgn . pulmonary renal syndrome ( goodpasture syndrome ) is more common in young patients with anti - gbm disease . despite the availability of potent immunosuppressive agents , less than one - third patients of anti - gbm disease we report our experience of anti - gbm crgn over 9 years from a tertiary care center in north india . renal biopsies diagnosed as anti - gbm crgn at the department of pathology , sanjay gandhi postgraduate institute of medical sciences , lucknow over a period of 9 years ( january 2004 to december 2012 ) were included in this study . only patients with renal biopsies for both light microscopy and for immunofluorescence were included . diagnosis of anti - gbm crgn required > 50% crescents , linear igg deposition along gbm on immunofluorescence and elevated serum anti - gbm antibody titers . the study was approved by the institutional ethics committee . clinical presentation and investigations at the time of biopsy including hematology , biochemistry , urine examination , serum complement levels , and serology for autoantibodies were noted . clinical records were reviewed to determine the serum creatinine and proteinuria at follow - up . biopsies were performed under ultrasound guidance by a spring loaded biopsy gun using 18 g needle under local anesthesia . , serial sections of 3 m thickness were obtained from renal biopsy received in 10% buffered formalin . all biopsies were stained with hematoxylin and eosin , periodic acid schiff , periodic silver methenamine , and masson 's trichrome . biopsies were evaluated for the percentage of glomeruli showing glomerular sclerosis , increased mesangial cellularity , endocapillary proliferation , neutrophilic exudation , fibrinoid necrosis , and crescent formation . tubular atrophy , interstitial inflammation , and interstitial fibrosis were graded semi - quantitatively as 0 - 3 + based on the percentage of cortical involvement ( 0 none ; 1 + < 25% ; 2 + 25 - 50% ; 3 + biopsy was transported in normal saline for immunofluorescence , and immediately processed by immersing in isopentane and snap freezing in liquid nitrogen . all biopsies were stained with fluorescein isothiocyanate conjugated antibodies for igg , igm , iga , c3 , and c1q ( dako , denmark ) at 1:60 dilution , mounted in buffered glycerol and viewed under nikon eclipse 80i immunofluorescence microscope . the location , pattern , and intensity ( on a scale of 04 + ) of positive immunostaining was recorded survival analysis was performed using kaplan - meier curves and differences in renal survival were tested using the log - rank test . survival analysis was performed using kaplan - meier curves and differences in renal survival were tested using the log - rank test . over a period of 9 years ( january 2004 to december 2012 ) , 215 biopsies were diagnosed as crgn , of which 11 were diagnosed as anti - gbm nephritis ( 5.1% ) . clinical and biochemical data in patient of anti - gbm crescentic glomerulonephritis ( n=11 ) most patients were in the third to fifth decade with no sex predilection ( m : f 5:6 ) . the most common renal presenting symptom was oliguria ( n = 10 ; 83.3% ) and extrarenal symptom was cough ( n = 2 ; 16.6% ) . all patients presented as a rapidly progressive renal failure with a high serum creatinine and were dialysis - dependent at the time of presentation . only one patient had nephrotic proteinuria . in rest , the proteinuria was subnephrotic with 24 hr urinary protein ranging from 0.12 to 1.9 gmg / day . antineutrophil cytoplasmic antibody ( anca ) screening done in all patients was positive in two patients ( 18% ) with raised anti - myeloperoxidase ( mpo ) titers . the renal biopsies in anti - gbm nephritis had an average of 13 glomeruli ( range 619 ) . crescents were found in 53 - 100% of unsclerosed glomeruli ( 76% 19% ) . the crescents were predominantly fibrocellular ( 65% 32% ) followed by cellular ( 30% ) and fibrous ( 5% ) crescents [ figure 1 ] . glomerular basement membrane crescentic glomerulonephritis showing a cellular crescent obliterating the bowman space with compression of the glomerular tuft and presence of fibrinoid material in the crescent ( b arrow ) ; immunofluorescence for igg shows linear staining along glomerular capillary wall ( d ) . ( a ) h and e ; ( b ) mason trichrome ; ( c ) periodic acid silver methenamine ; ( d ) fluorescein isothiocyanate conjugated anti immunoglobulin g , 200 mesangial and endocapillary proliferation was seen in an average of 25% ( range 2335% ) and 41.6% ( range 3549% ) glomeruli , respectively . fibrinoid necrosis involving the glomerular capillary tuft was noted in 6 ( 54.5% ) renal biopsies . rupture of bowman 's capsule was seen in 7 ( 63.6% ) renal biopsies , however , periglomerular granulomatous inflammation was uncommon , found in only one renal biopsy . tubular atrophy was seen in all biopsies , being mild in nine biopsies ( 82% ) . on immunofluorescence , all renal biopsies showed linear strong ( 34 + ) igg deposition along the gbm [ figure 1d ] . the treatment protocol followed for patients of crgn in all patients was intravenous methylprednisolone 750 mg followed by oral prednisolone 0.5 mg / kg for 4 weeks and oral cyclophosphamide ( 1.5 mg / kg ) . follow - up was available in four patients for 30270 days ( mean sd 99.5 114.5 days ; median 49 days ) . two patients ( 82% ) remained dialysis dependent on follow - up while two died due to septicemia and uremia after a period of 9 months and 10.2 months , respectively . the renal biopsies in anti - gbm nephritis had an average of 13 glomeruli ( range 619 ) . crescents were found in 53 - 100% of unsclerosed glomeruli ( 76% 19% ) . the crescents were predominantly fibrocellular ( 65% 32% ) followed by cellular ( 30% ) and fibrous ( 5% ) crescents [ figure 1 ] . glomerular basement membrane crescentic glomerulonephritis showing a cellular crescent obliterating the bowman space with compression of the glomerular tuft and presence of fibrinoid material in the crescent ( b arrow ) ; immunofluorescence for igg shows linear staining along glomerular capillary wall ( d ) . ( a ) h and e ; ( b ) mason trichrome ; ( c ) periodic acid silver methenamine ; ( d ) fluorescein isothiocyanate conjugated anti immunoglobulin g , 200 mesangial and endocapillary proliferation was seen in an average of 25% ( range 2335% ) and 41.6% ( range 3549% ) glomeruli , respectively . fibrinoid necrosis involving the glomerular capillary tuft was noted in 6 ( 54.5% ) renal biopsies . rupture of bowman 's capsule was seen in 7 ( 63.6% ) renal biopsies , however , periglomerular granulomatous inflammation was uncommon , found in only one renal biopsy . tubular atrophy was seen in all biopsies , being mild in nine biopsies ( 82% ) . on immunofluorescence , all renal biopsies showed linear strong ( 34 + ) igg deposition along the gbm [ figure 1d ] . the treatment protocol followed for patients of crgn in all patients was intravenous methylprednisolone 750 mg followed by oral prednisolone 0.5 mg / kg for 4 weeks and oral cyclophosphamide ( 1.5 mg / kg ) . follow - up was available in four patients for 30270 days ( mean sd 99.5 114.5 days ; median 49 days ) . two patients ( 82% ) remained dialysis dependent on follow - up while two died due to septicemia and uremia after a period of 9 months and 10.2 months , respectively . this study included 11 patients of anti - gbm nephritis evaluated at a single center over a period of 9 years . studies from the north america and western europe have shown that anti - gbm disease accounts for 1015% of crgn . a study from north - east india including 34 patients of crgn over a period of 3.5 years reported an incidence of 14.7% . however , another study from north india found no case of anti - gbm nephritis over a 2 years study of 46 patients of crgn . we found a prevalence of 5% for anti - gbm nephritis among 215 patients diagnosed as crgn on renal biopsy . reports from china have reported bimodal peaks of onset for anti - gbm nephritis , one in the second to third and other in the sixth to seventh decade . an earlier study from china of 172 patients of crgn over a 16 years period reported an earlier age of onset ( mean sd 27.8 7.6 years ) for anti - gbm nephritis ( n = 15 ) . in one of the largest series , jennette et al . reported the mean age of onset for anti - gbm nephritis in the third to sixth decade ( mean sd 52 21 years ) . we also found the similar age of onset with most patients ( 90% ) presenting in the fourth decade ( mean sd 48 15.7 years ) . found 22.6% elderly patients ( 65 years or older ) in 221 consecutive chinese patients with anti - gbm disease diagnosed in a 10 years period . less pulmonary involvement has been reported in elderly patients with anti - gbm disease who have a milder disease as compared to young patients . studies have reported 40 - 80% incidence of renal insufficiency in anti - gbm disease . in patients with rapidly progressive glomerulonephritis , jennette et al . found raised serum creatinine at a presentation in most patients of anti - gbm nephritis ( mean 9.7 7.2 mg / dl ) . all our patients had renal insufficiency as the study included patients of anti - gbm disease with crgn . co - existence of anti - gbm and anca has been reported in one - third to one - fourth patients of anti - gbm disease . alchi et al . , found that dual - positive patients of anti - gbm nephritis were almost 20 years older than those with anti - gbm positivity alone . both of our patients were also elderly , both being in the in the geriatric age group ( > 60 years ) . double positivity for anca and anti - gbm antibodies in anti - gbm disease is not associated with renal prognosis , it has been reported to be associated with increased incidence of extrarenal symptoms in crgn . however , none of our patients with double positivity had extrarenal involvement . on immunofluorescence , igg is the most common immunoglobulin and c3 , the most common complement with linear deposits along gbm . tang et al . had reported igg in 77.5% of patients and c3 in ( 21.1% ) cases of anti - gbm nephritis . the renal prognosis in anti - gbm disease is usually poor with only less than one - third patients having maintained kidney function after 6 months of follow - up . our study and earlier reports from india suggest that these patients are diagnosed late resulting in a poor renal outcome . the poor response to therapy may be attributed to the presence of rapidly progressive glomerulonephritis in all our patients who were dialysis - dependent at the time of presentation . alchi et al . reported oligo - anuria and percentage of glomerular crescents as the strongest predictor associated with poor renal outcome in anti - gbm disease . other studies have shown that patients of anti - gbm disease presenting with rapidly progressive glomerulonephritis and high serum creatinine at presentation have a poor renal outcome . similar results have been reported in a large study from australia and new zealand ( anzdata registry ) . in this study , between 1963 and 2010 , 449 patients ( 0.8% ) with anti - gbm disease on renal replacement therapy for end - stage renal disease were identified . only 13 patients recovered renal function ; however , ten subsequently experienced renal death after a median period of 1.05 years . despite aggressive immunosuppression , the response in anti - gbm disease is seen only when the disease is detected at an early stage , making a high degree of awareness necessary to find these rare cases . our findings show that anti - gbm nephritis usually presents as a renal - limited disease . it is associated with a poor renal outcome as most patients present with advanced renal failure . early diagnosis before the development of advanced disease may help in improving the outcome of these patients . newer modalities of treatment need to be developed for this aggressive disease with a poor renal survival .

anti - glomerular basement membrane ( anti - gbm ) disease is an autoimmune disease that most commonly presents as rapidly progressive glomerulonephritis with or without pulmonary involvement . it is characterized by the presence of antibodies directed to antigenic targets within glomerular and alveolar basement membranes . this study was performed to evaluate the clinicopathological features and outcome in anti - gbm crescentic glomerulonephritis ( crgn ) at a tertiary care center in north india over a period of 9 years ( january 2004 to december 2012 ) . a diagnosis of anti - gbm crgn was made in the presence of > 50% crescents , linear deposits of igg along gbm , and raised serum anti - gbm antibody titer . of 215 cases of crgn diagnosed during this period , 11 had anti - gbm crgn . anti - gbm crgn was found at all ages but was most common in the third to fifth decade with no gender predilection ( mean age 48 + /- 15 years , 1367 years ) . patients presented with a mean serum creatinine of 10.2 + /- 5.3 mg / dl and sub - nephrotic proteinuria . pulmonary involvement was present in two patients . myeloperoxidase - antineutrophil cytoplasmic antibody was positive in two ( 2/11 ) elderly patients . follow - up was available in four patients for a range of 30 - 270 ( mean 99.5 114.5 ) days , two remained dialysis dependent while two died due to uremia and sepsis . our findings show that anti - gbm disease is a rare cause of crgn in india , accounting for only 5% of patients . it usually presents as a renal - limited disease and is associated with a poor renal outcome .

nerve cell survival depends on the balance between the formation and degradation of cellular proteins and damaged organelles . the ubiquitin - proteasome system and autophagy pathway are the two major mechanisms for maintaining this balance . the ubiquitin - proteasome system is an important route for the degradation of short - lived proteins whereas autophagy is responsible for the degradation of long - lived proteins and damaged organelles ( pan et al . , 2008 ) . the activation of autophagy has been observed in many diseases such as cardiovascular disease ( martinet et al . , 2007 ) , cerebral hemorrhage ( hu et al . , 2011 ) , pancreatic cancer ( grasso et al . , 2012 ) and neurodegenerative disease such as alzheimer 's disease and parkinson 's disease ( shacka et al . , 2008 ) . there are three types of autophagy : macroautophagy , microautophagy , and chaperone - mediated autophagy ( rubinsztein et al . , 2005 ; macroautophagy occurs through autophagosomes , double - membrane - bound vesicles that fuse with lysosomes which subsequently degrade proteins . microautophagy is the engulfment of cytoplasmic cargo directly by the lysosomal membrane through the processes of invagination , protrusion , and separation . chaperone - mediated autophagy transports unfolded proteins via lysosomal chaperonin heat - shock constitutive protein 70 ( hsc70 ) and lysosomal membrane-2a ( lamp-2a ) , a lysosomal membrane receptor ( periyasamy - thandavan et al . , 2009 ) . two major therapeutic strategies are currently being used to treat cerebral ischemia ( gabryel et al . , 2012 ) . however , these drugs have a narrow therapeutic window of 3 hours , and could lead to hemorrhagic complications . but , most neuroprotective agents show poor efficacy or severe toxicity / side effects and thus new therapeutic agents for the treatment of ischemic stroke need to be developed . recent studies show that macroautophagy is activated in cerebral ischemia and indicate that autophagic induction might serve as a new therapeutic target for stroke ( wen et al . , 2008 the relationship between autophagy and cerebral ischemia is unclear ; one report suggests activation of autophagy protects neurons from death ( carloni et al . , 2008 ) , whereas another indicates it has a more destructive role ( koike et al . , 2008 ) . in this review , we introduce macroautophagy ( herein referred to as autophagy ) , and focus on its potential role and possible signaling pathways in cerebral ischemia . autophagy plays an important physiological role in the process of cellular growth and differentiation ( gabryel et al . , 2012 ) and is extremely important in maintaining cellular homeostasis which requires the continual turnover of nonfunctional proteins and organelles . the process of autophagy consists of several sequential steps ( klionsky and ohsumi , 1999 ; mizushima , 2007 ; he and klionsky , 2009 ) : ( 1 ) sequestration . a unique membrane , called an isolation membrane , sequesters cytoplasmic constituents including organelles to form an autophagosome . ( 2 ) transportation . both the inner membrane and the materials contained within the autophagosome are degraded by lysosomal hydrolases . autophagy depends on the interaction of different complexes that are composed of several different autophagy - related ( atg ) proteins . the complexes include ( 1 ) two ubiquitin - like conjugation systems , atg12-atg5 and atg8/lc3-pe ( microtubule - associated protein 1a/1b - light chain 3 -phosphatidylethanolamine ) conjugate systems ( klionsky and emr , 2000 ; suzuki et al . , 2005 ; periyasamy - thandavan et al . , 2009 ) ; ( 2 ) a phosphatidylinositol 3-kinase ( pi3k ) complex ; ( 3 ) the atg1/unc-51-like kinase ( ulk ) complexes ; ( 4 ) matg9 ; and ( 5 ) the atg2-atg18 complexes ( longatti and tooze , 2009 ; chen and klionsky , 2011 ; mizushima et al . , 2011 ) . stroke is the third most common cause of death worldwide and the major cause of adult neurological disability . it can be caused by a number of different disorders and results in temporary or permanent disruption of blood supply to the brain . approximately 80% of stroke cases are due to primary cerebral ischemia resulting in infarction , whilst 20% are attributed to cerebral hemorrhage ( markus , 2012 ) . when blood flow to the brain is interrupted , cells undergo a series of molecular events which include excitotoxicity , mitochondrial dysfunction , acidotoxicity , ionic imbalance , oxidative stress and inflammation . these molecular events can lead to cell death and irreversible tissue injury ( ouyang and giffard , 2012 ) . there is no doubt that neurons have a vital role in the nervous system and so it is particularly important to protect them from insult and death in cerebral ischemia . there are two morphological types of cell death following cerebral ischemia , necrosis and apoptosis ( puyal and clarke , 2009 ) . morphological characteristics of necrosis include vacuolation of the cytoplasm , breakdown of the plasma membrane and an induction of inflammation around the dying cell by release of cellular contents and proinflammatory molecules ( edinger and thompson , 2004 ) . apoptosis is also termed type i programmed cell death ( type i pcd ) ( shintani and klionsky , 2004 ) and is characterized by nuclear condensation and fragmentation , cleavage of chromosomal dna into internucleosomal fragments and the formation of apoptotic bodies , which are removed by phagocytosis without the breakdown of the plasma membrane ( edinger and thompson , 2004 ) . recently , studies have identified that aside from necrosis and apoptosis , a third type of cell death that occurs during ischemic stroke , autophagy ( adhami et al . , 2006 ; rami et al . , 2008 ) which can also be termed type ii pcd ( ouyang et al . , 2012 ) . the correlation between apoptosis , autophagy and necrosis and their pathologic processes in ischemic stroke is not clear . some studies have shown that neurons at the core of ischemia tend to undergo necrosis , while neurons in the penumbra ( surrounding region ) are subjected to apoptosis ( sabri et al . , 2013 ) . however , some in vivo experiments indicate that both apoptosis and autophagy are activated in the ischemic penumbra ( pamenter et al . , 2012 ) . terminal deoxynucleotidyl transferase - mediated dutp - biotin in situ nick end labeling ( tunel ) and propidium iodide ( pi ) are used as markers of apoptosis and necrosis , respectively ( unal cevik and dalkara , 2003 ) . according to a study by balduini et al . ( 2012 ) , autophagy - positive neurons that were also tunel - positive were mainly found in superficial layers of the cerebral cortex 24 hours after hypoxia - ischemia , with only scattered necrotic cells observed in the same area . they also reported that after ischemia , necrotic cells ( pi - positive ) were mainly detected in the hippocampus and the deep layers of the cerebral cortex , and most cells in the superficial layers of the cortex were pi - positive ( necrotic ) at later time points ( 4872 hours after hypoxia - ischemia ) . when 3-methyladenine ( 3-ma ) and wortmannin , two type iii pi3k inhibitors ) , were used to inhibit autophagy in a model of neonatal hypoxia - ischemia , activation of the autophagic pathway was significantly reduced and there was a switch from apoptosis to necrosis in cell death . in contrast , it could be observed that necrotic cell death and brain injury were reduced when rapamycin , the inhibitor of the mammalian target of rapamycin ( mtor ) , was administered to increase autophagy ( balduini et al . , 2009 ) . for example , bcl2l11 ( also known as bim ) , a bh3-only protein , is considered a novel molecular link between autophagy and apoptosis . bcl2l11 recruits beclin-1 , the homologue of yeast atg6 , to microtubules by bridging beclin-1 and dynein light chain 1 ( dynll1 , also known as lc8 ) , and it can inhibit autophagy and promote apoptosis ( luo and rubinsztein , 2013 ) . in summary , the crosstalk among the three types of cell death , especially between autophagy and apoptosis , is very complex and not understood . autophagy is the process by which a membrane engulfs organelles and cytosolic macromolecules to form an autophagosome , with the engulfed materials being delivered to the lysosome for degradation ( yoshimori , 2007 ) . autophagy was not observed in the brain of mice that had been deprived of food for 48 hours and it is thought that brain nutrients could be compensated from other organs under conditions of starvation ( mizushima et al . , 2004 ) . second , localization of autophagosomes and lysosomes is different ; autophagosomes are located throughout the cytoplasm but lysosomes are mainly located in the juxtanuclear cytoplasm of the cell body in the neuron . to form autolysosomes , autophagosomes which are formed in dendrites and synaptic terminal regions need be transported to lysosomes in the cell body . this means that when dendrites or axons are damaged , autophagosomes that have formed in dendrites and synaptic terminal regions can not fuse with lysosomes to degrade sequestrated material ( komatsu et al . , 2007 ) . basal autophagy is considered a housekeeping process in neurons ( mizushima and komatsu , 2011 ) , whereas induced autophagy may be a promising neuroprotective strategy in neurodegenerative diseases . induction of autophagy may serve to rid neurons of aberrant protein aggregates a common hallmark of neurodegenerative diseases . many studies have suggested that either the absence of autophagy or inadequate autophagy may be an underlying cause of neurodegenerative diseases ( puyal et al . , 2012 ) . although currently there is no unified theory as to the role autophagy plays in cerebral ischemia , based on studies over past few years , the following five viewpoints ischemia have emerged . ( 2010 ) suggested that in neonatal hypoxia - ischemia , autophagy may be part of an integrated pro - survival signaling complex that includes pi3k - akt - mtor . when either autophagy or pi3k - akt - mtor pathways were interrupted , cells underwent necrotic cell death . ( 2012 ) reported that neuronal survival was promoted during cerebral ischemia when autophagy was induced by nicotinamide phosphoribosyltransferase ( nampt , also known as visfatin ) , which is the rate - limiting enzyme in mammalian nad biosynthesis and regulates the tsc2-mtor - s6k1 signaling pathway . these studies suggest that autophagy may be a potential target for post - ischemic neuronal protection . mice deficient in atg7 , the gene essential for autophagy induction , showed nearly complete protection from both hypoxia - ischemia - induced caspase-3 activation and neuronal death , indicating autophagy is essential in triggering neuronal death after hypoxia - ischemia injury ( koike et al . , 2008 ) . wen et al . ( 2008 ) confirmed autophagy was activated in a permanent middle cerebral artery occlusion ( mcao ) model . in their paper , the infarct volume , brain edema and motor deficits could be significantly reduced by administration of 3-ma ( an autophagy inhibitor ) . the neuroprotective effects of 3-ma were associated with an inhibition of ischemia - induced upregulation of lc3-ii , a marker of active autophagosomes and autophagolysosomes . moreover , it was observed that the inhibition of autophagy , either by direct inhibitor 3-ma or by indirect inhibitor 2me2 ( an inhibitor of hypoxia inducible factor-1 ; hif-1 ) might prevent pyramidal neuron death after ischemia in the study of xin et al . ( 3 ) the degree of autophagy determines the fate of cells in cerebral ischemia . kang and avery ( 2008 ) proposed that levels of autophagy were critical for the survival or death of cells : physiological levels of autophagy promote survival , whereas insufficient or excessive levels of autophagy promote death . this hypothesis was confirmed in an oxygen and glucose deprivation model that observed dual roles of the autophagy inhibitor 3-ma in different stages of re - oxygenation ( shi et al . , 2012 ) . twenty - four hours prior to reperfusion , 3-ma triggered a high rate of neuronal death . it is possible that prolonged oxygen and glucose deprivation / reperfusion triggers excessive autophagy , switching its role from protection to deterioration . ( 4 ) after cerebral ischemia , the time at which autophagy is induced determines its role . autophagy could play a protective role in ischemic preconditioning but have a different effect once ischemia / reperfusion has occurred ( ravikumar et al . , 2010 ) . infarct volume , brain edema and motor deficits induced by permanent focal ischemia were significantly reduced after ischemic preconditioning treatment . 3-ma suppressed neuroprotection induced by ischemic preconditioning , while rapamycin reduced infarct volume , brain edema and motor deficits induced by permanent focal ischemia ( sheng et al . ( 2011 ) in which 3-ma administrated through intracerebroventricular injection before hyperbaric oxygen preconditioning , attenuated the neuroprotection of hyperbaric oxygen preconditioning against cerebral ischemia . in contrast , pretreatment with rapamycin mimicked the neuroprotective effect of hyperbaric oxygen preconditioning ( yan et al . , 2011 ) . ( 2008 , 2010 ) also showed that when 3-ma and rapamycin were injected 20 minutes before hypoxia - ischemia , 3-ma inhibited autophagy , significantly reduced beclin-1 expression and caused neuronal death , while rapamycin increased autophagy and decreased brain injury . in addition , 3-ma administrated by intracerebroventricular injections strongly reduced the lesion volume ( by 46% ) even when given 4 hours after the beginning of the ischemia ( puyal et al . , 2009 ) . ( 2012 ) found that rapamycin applied at the onset of reperfusion might attenuate the neuroprotective effects of ischemic postconditioning . conversely , 3-ma administered before reperfusion significantly reduced infarct size and abolished the increase of brain water content after ischemia . targeting autophagy either pre- or post - treatment has different results and this may reflect the different effects of autophagy at early and late stages ( he et al . , 2012 ) . the time of intervention could be related to the degree of autophagy at different stages of ischemia and further studies are necessary to confirm this . a common feature of many neurodegenerative diseases is the accumulation of an abnormally large number of autophagic vacuoles ( autophagosomes and autolysosomes ) or the frequent appearance of irregularly shaped autophagic vacuoles . enhanced autophagosome formation seems to be reflected by increased density of autophagic vacuoles , but these increased autophagic vacuoles may also imply impaired autolysosomal degradation ( komatsu et al . , 2007 ) . ( 2008 ) also observed a dramatic up - regulation of beclin-1 and lc3 in rats after cerebral ischemia . recently , however , it has been hypothesized that the increase in proteins may reflect a failure in lysosomal function leading to an accumulation of autophagosomes , or an improvement in the activity of autophagy ( xu et al . , 2012 ) . 2010 ) found that accumulation of lc3-ii was observed in sham - operated rats after treatment with lysosomal inhibitor - chloriquine , but the further change of lc3-ii levels in post - ischemic brain tissues was not observed . the results indicated that accumulation of autophagy - associated protein following ischemia could be the result of failure of the autophagy pathway . puyal and clarke ( 2009 ) demonstrated that lysosomal activity detected by lamp-1 and cathepsin d was increased in neurons with punctate lc3 expression in neonatal focal cerebral ischemia model . the deficiency of acid phosphatase activity in the lysosome could lead to the increase of autophagosomes and autolysosomes . further studies are required to verify whether the activity of autophagy is enhanced in cerebral ischemia . mammalian target of rapamycin ( mtor ) is a 289 kda serine / threonine protein kinase that regulates transcription , cytoskeleton organization , cell growth and cell survival . by binding to different co - factors , mtor can form two distinct protein complexes , mtorc1 ( mtor complex 1 ) and mtorc2 ( mtor complex 2 ) ( jung et al . , 2010 ) . the classification of mtorc1 and mtorc2 are based on their components and sensitivity to rapamycin . recent studies suggest that the pi3k / akt / mtor pathway could regulate acute nervous system injury in cerebral hypoxia - ischemia ( chong et al . , 2012 ) . class i pi3k plays an important role in the pi3k - akt - mtor pathway . pi3k phosphorylates and activates akt which in turn phosphorylates and inactivates tuberous sclerosis complex ( tsc ) 1/2 . inactivated tsc1/2 increases the activation of rheb which is part of the ras family gtp - binding protein , and mtor is subsequently activated . beclin-1 , a component of the class iii pi3k , is essential for the initial steps of autophagy and could also induce autophagy via the interaction with other components of the class iii pi3k pathway in cerebral ischemia ( xingyong et al . , 2013 ) . peroxisome proliferator - activated receptor- ( ppar- ) , a member of nuclear hormone receptor superfamily , is a ligand - activated transcription factor . ppar- activation antagonizes beclin-1-mediated autophagy via upregulation of bcl-2/bcl - xl which interact with beclin-1 in cerebral ischemia / reperfusion ( xu et al . , 2013 ) . amp - activated protein kinase ( ampk ) is a serine / threonine protein kinase and consists of three subunits : a catalytic -subunit and regulatory and -subunits . the most studied is the catalytic -subunit which contains a threonine phosphorylation site that when phosphorylated , activates ampk .. amp which binds to sites located on the -subunit can enhance the phosphorylation of ampk by lkb1 , and ampk activation could subsequently inhibit the activity of mtor to induce autophagy ( poels et al . , 2009 ; li and mccullough , 2010 ) . nuclear factor kappa b ( nf-b ) is a transcription factor that regulates expression of multiple genes ( chen et al . , 2011 ) . recent experiments have demonstrated that the knockout of p50 ( nf-b1 ) enhanced autophagy by repression of mtor in cerebral ischemic mice ( li et al . , 2013 ) . nf-b - dependent p53 signal transduction pathway is also associated with autophagy and apoptosis in the rat hippocampus after cerebral ischemia / reperfusion insult ( cui et al . , 2013 ) . mitogen - activated protein kinases ( mapks ) include extracellular signal - related kinase ( erk ) , jun nh2 terminal kinase ( jnk ) and p38 ( lien et al . , 2013 ) . mapk is one upstream regulator of mtorc1 and autophagy could also be induced via mapk - mtor signaling pathway in cerebral ischemia / reperfusion ( wang et al . , 2013 ) . hypoxia - inducible factor 1 ( hif-1 ) is a key transcriptional factor that is activated in response to hypoxia during cerebral ischemia ( althaus et al . , 2006 ) . hif-1 is composed of a constitutively expressed hif-1 subunit and an inducibly expressed hif-1 subunit . since ubiquitination is inhibited under hypoxic conditions , hif-1 can accumulate and dimerize with hif-1. this dimer activates transcription of a number of downstream hypoxia - responsive genes , including vascular endothelial growth factor ( vegf ) , erythropoietin ( epo ) , glucose transporter 1 , and glycolytic enzymes ( xin et al . , 2011 ) . bcl-2 and adenovirus e1b 19 kda interacting proteins 3 ( bnip3 ) with a single bcl-2 homology 3 ( bh3 ) domain is a subfamily of bcl-2 family proteins and also serves as an important target gene of hif-1 ( cho et al . , 2012 ) . bnip3 can compete with beclin-1 for binding to bcl-2 and beclin-1 is released to trigger autophagy ( he and klionsky , 2009 ; glick et al . , 2010 ) . bnip3 also binds and inhibits rheb , an upstream activator of mtor , so it could activate autophagy by inhibiting mtor activity . however , these models still require additional genetic testing in vivo ( zhang and ney , 2011 ) . the induced p53 stabilization by up - regulation of hif-1 also plays an important role in post - ischemic autophagy activation ( xin et al . , 2011 ) . autophagic cell death is activated in the nervous system in response to oxidative stress ( kubota et al . , 2010 ) . oxidative stress can occur in cerebral ischemia and could increase reactive oxygen species such as superoxide , hydroxyl radical and hydrogen peroxide . recent studies have reported that selenium provides neuroprotection through preserving mitochondrial function , decreasing reactive oxygen species production and reducing autophagy ( mehta et al . , 2012 ) . autophagy can also be induced under conditions of excitotoxicity which can also occur in cerebral ischemia ( puyal et al . , 2012 ) . although excitotoxic glutamate blocks autophagic flux , it could also induce autophagy in hippocampal neurons ( kulbe et al . , 2014 ) . sustained elevations of ca in the mitochondrial matrix are a major feature of the intracellular cascade of lethal events during cerebral ischemia . recently , it was reported that endoplasmic reticulum stress is one of the effects of excitotoxicity ( ouyang and giffard , 2012 ) . when endoplasmic reticula were exposed to toxic levels of excitatory neurotransmitters , ca was released via the activation of both ryanodine receptors and ip3r , leading to mitochondrial ca overload and activation of apoptosis . during endoplasmic reticulum stress , the signaling pathways mentioned above and their relationship to cerebral ischemia and auto phagy are shown in figure 1 . the figure shows the many different signaling pathways involved in the activation of autophagy during cerebral ischemia . when activated , akt and nf-b activate mtor to inhibit autophagy in cerebral ischemia . however , the activation of ampk could inhibit the activity of mtor and induce autophagy . excitotoxicity could induce autophagy by er stress and block autophagic flux by glutamate in cerebral ischemia . autophagy could also be induced through ros and inhibited through ppar-. ppar- : peroxisome proliferator - activated receptor- ; amp : adenosine 5-monophosphate ; pi3k : phosphatidylinositol 3-ki - nase ; ros : reactive oxygen species ; hif-1 : hypoxia inducible factor 1 ; bcl-2 : b cell lymphoma / leukmia-2 ; bcl - xl : b - cell lymphoma - extra large ; ampk : amp - activated protein kinase ; ampk : amp - activated protein kinase ; akt / pkb : protein kinase b ; nf-b : nuclear factor kappa b ; er : endoplasmic reticulum ; bnip3 : bcl-2 and adenovirus e1b 19 kda interacting proteins 3 ; mtor : mammalian target of rapamycin . although autophagy has no unified role in cerebral ischemia , increasing evidence supports the notion that autophagy is a double - edged sword . we believe that the degree of autophagy is critical to its role ( neuroprotective or deteriorative ) in ischemic stroke . physiological levels of autophagy are favorable to neuronal survival , but excessive or inadequate levels could be harmful and cause injury . the mechanisms of autophagy underlying cerebral ischemia and whether autophagy activity is really enhanced in cerebral ischemia should be further investigated . it is also important to study the time point at which autophagy inhibitors and activators should be administered . ( 2010 ) have used green fluorescent protein ( gfp)-fused lc3 transgenic mice to detect autophagy in vivo and this could be helpful in monitoring autophagic processes in live stroke patients as well as clarifying the detailed roles of autophagy in the ischemic brain . the idea that the time point of autophagy induction determines the fate of neurons during cerebral ischemia provides a new treatment strategy for ischemic stroke patients .

evidence suggests that autophagy may be a new therapeutic target for stroke , but whether activation of autophagy increases or decreases the rate of neuronal death is still under debate . this review summarizes the potential role and possible signaling pathway of autophagy in neuronal survival after cerebral ischemia and proposes that autophagy has dual effects .

a 59-year - old man presented with a 12-h history of sudden onset of right upper quadrant and epigastric pain . the pain was then felt localized to the right iliac fossa and was constant , made worse with movement . his last bowel movement which was 1 day previously had been normal with no bleeding per rectum noted , and no lower urinary tract symptoms . his medical comorbidities include type 2 diabetes and hypertension and his regular medications included metformin , simvastatin , ramipril , ezetimibe and lercanidipine . on physical examination , he was pyrexial at 38.4c , tachycardic with a pulse rate of 120 beats per minute , tachypnoeic at a respiratory rate of 20 per minute and a blood pressure of 130/70 mmhg . clinically , he appeared flushed and in pain . his abdomen was not distended but tender and guarding in the right upper and lower quadrants . white blood cell count 21.1 10/l and c - reactive protein 22 mg / l . no air under the diaphragm . a computerized tomography of abdomen and pelvis with contrast ( fig . c ) showed an inflamed meckel 's diverticulum with some high density material , presumed to be enteroliths within it . the adjacent portion of the ileum was also mildly inflamed , with some fatty infiltration of the wall and surrounding inflammatory stranding in the mesenteric fat . the appendix appeared normal as well as normal appearances of the rest of the small and large bowel , gallbladder , pancreas , kidneys , spleen and adrenals . figure 2:ct abdomen and pelvis ( a ) transverse ; ( b ) frontal ( coronal ) ; and ( c ) sagittal view . ct abdomen and pelvis ( a ) transverse ; ( b ) frontal ( coronal ) ; and ( c ) sagittal view . intraoperatively , an inflamed , swollen and thickened meckel 's diverticulum was found , but not perforated or gangrenous ( fig . 3 ) . the nearby small bowel was slightly inflamed , but the terminal ileum felt normal . anti - mesenteric border of small bowel was closed transversely using 3/0 pds interrupted seromuscular in two layers . a thorough washout with warm saline was performed and the abdominal incision was closed by a mass closure technique using loop pds 1/0 with staples to skin . figure 3:intraoperative findings : broad based meckel 's diverticulum with oedematous adjacent small bowel ( ileum ) . intraoperative findings : broad based meckel 's diverticulum with oedematous adjacent small bowel ( ileum ) . the histology showed diverticulum with profuse chronic active inflammatory exudate involving all layers of the wall and accompanied by areas of necrosis . the adjacent small bowel shows prominent submucosal oedema with moderately severe chronic inflammatory exudate ( fig . 4 ) . figure 4:histology : small bowel histology showing margin of resection with prominent submucosa oedema and mild inflammation . histology : small bowel histology showing margin of resection with prominent submucosa oedema and mild inflammation . intraoperatively , an inflamed , swollen and thickened meckel 's diverticulum was found , but not perforated or gangrenous ( fig . 3 ) . the nearby small bowel was slightly inflamed , but the terminal ileum felt normal . anti - mesenteric border of small bowel was closed transversely using 3/0 pds interrupted seromuscular in two layers . a thorough washout with warm saline was performed and the abdominal incision was closed by a mass closure technique using loop pds 1/0 with staples to skin . figure 3:intraoperative findings : broad based meckel 's diverticulum with oedematous adjacent small bowel ( ileum ) . intraoperative findings : broad based meckel 's diverticulum with oedematous adjacent small bowel ( ileum ) . the histology showed diverticulum with profuse chronic active inflammatory exudate involving all layers of the wall and accompanied by areas of necrosis . the adjacent small bowel shows prominent submucosal oedema with moderately severe chronic inflammatory exudate ( fig . 4 ) . figure 4:histology : small bowel histology showing margin of resection with prominent submucosa oedema and mild inflammation . histology : small bowel histology showing margin of resection with prominent submucosa oedema and mild inflammation . meckel 's diverticulitis is one of the recognized complications of the condition and is clinically indistinguishable from appendicitis , except that the pain and tenderness typically localized at the periumbilical region . it is generally recommended that asymptomatic meckel 's to be resected in children during laparotomy [ 2 , 3 ] given an increased lifelong risk for complications . the argument was that the likelihood of meckel 's diverticulum becoming symptomatic in an adult is 2% or less and that postoperative morbidity secondary to intestinal obstruction and infection from prophylactic resection confers no potential benefit in prevention of disease . many surgeons advocate that incidentally found normal - appearing meckel 's diverticulum should not be resected unless if there is a palpable abnormality ( suggestive of the presence of ectopic mucosa ) , a long diverticulum ( > 4 cm ) and a narrow neck or base of diverticulum ( < 2 cm wide ) . elective prophylactic resection of asymptomatic meckel 's diverticulum identified on imaging is not recommended for both children and adult . on the other hand , treatment for a symptomatic ( bleeding , inflamed ) meckel 's diverticulum should be prompt and referred for surgical intervention in all patients ( children and adults ) to relieve symptoms . the standard surgical approach is to perform a segmental ( wedge or v - shaped diverticulectomy ) resection of the narrow - based diverticulum or to perform a limited small bowel resection followed by primary end - to - end anastomosis if an inflamed or ulcerated diverticulum is encountered . although gastrointestinal bleeding from a meckel 's diverticulum is a rare complication , when encountered , a segmental small bowel resection followed by end - to - end ileoileostomy rather than simple diverticulectomy is preferred . transverse closure of the ileum with hand - sewn technique or using linear stapler across the base of the diverticulum is the ideal method to minimize the risk of subsequent stenosis . the long - term outcomes with laparoscopy approaches ( including laparoscopic diverticulectomy and laparoscopic - assisted transumbilical meckel 's diverticulectomy ) are still lacking . however , many studies have reported that the laparoscopic management of the complicated meckel 's diverticulum is safe , cost effective and efficient , fewer complications and shorter recovery period compared with conventional laparotomy [ 7 , 8 ] . the learning point of this clinical vignette is that meckel 's diverticulitis is often clinically indistinguishable from appendicitis especially in adult patients . computed tomography ( ct ) has become an invaluable tool for the evaluation of abdominal pain . ct scanning is useful in demonstrating acutely inflamed diverticula , typically identified as a blind pouch off the distal small intestine and associated with bowel wall thickening and in detecting the presence of enterocolic and enterovesical fistulas . open or laparoscopic diverticulectomy in managing complicated meckel 's diverticulum is safe although the latter approach depends on local technical expertise and facilities .

meckel 's diverticulum is the most common congenital abnormality of the small intestine that results from incomplete closure of the vitelline ( omphalo - mesenteric ) duct . this true diverticulum , ~2 ft from the ileocecal valve commonly found on the anti - mesenteric border of the ileum , is benign and majority asymptomatic . diagnosis challenges arise when it became inflamed or presented in following ways , for example , haemorrhage ( caused by ectopic pepsin and hydrochloric acid secreting gastric mucosa ) , intestinal obstruction ( secondary to intussusception or volvulus ) or the presence of diverticulum in the hernia sac ( littre 's hernia ) . we report a case of a 59-year - old male who was admitted under the surgical service at blackpool victoria hospital with suspected appendicitis that turned out to be a meckel 's diverticulitis , a rare presentation of an acute abdomen . we discuss the issues involved in his investigation and management as well as perform a literature review comparing different surgical approaches .

irrational use of medicines is a global problem , and the cost implication is enormous . the use of medicines is said to be rational when patients receive medications appropriate to their clinical needs , in doses that meet their own individual requirements , over an adequate period of time , and at the lowest cost to them and their community . irrational prescription of medicines exist in various forms , for example , polypharmacy , inappropriate use of antimicrobials / injections , and failure to prescribe in accordance with clinical guidelines among others . the subject of irrational prescription is of utmost importance regarding pharmacotherapy in the elderly since they use more medicines than the younger population and are at a high risk for developing adverse drug events . nigeria is not left out of the current demographic transition characterized by increase in the elderly population and this further justifies the need for this study . although the population of nigeria is currently a relatively young one , the united nations estimated that the proportion of elderly nigerians will increase from 2.7% in 2010 to 3.8% by 2050 when nigeria by estimate will be the third most populous nation on the earth . the country 's elderly population , however , appears to be increasing faster than estimated , as the elderly account for 3.2% of the 2006 population census . the world health organization / international network of rational use of drugs ( who / inrud ) drug use indicators have proven to be a useful tool in assessing rational use of medicines in various hospital settings . although these indicators were developed for outpatient use of medicines , they have also been found useful in the study of inpatient use of medicines . these indicators have revealed various levels of irrational use of medicines in nigerian outpatient clinics . the use of these indicators to assess inpatient drug has been rather sparse though periods of hospitalization are times of increased used of medicines . the absence of standard values for who / inrud drug use indicators for inpatients prescription is another limiting factor for the use of these indicators for inpatient prescriptions assessment . using the who / inrud drug use indicators , we studied the prescriptions of medicines for elderly patients on various days of admission with a view to profiling the use of medicines in the elderly and detecting areas of irrational prescription . while this study is on the prescription patterns based on the who / inrud drug use indicators for elderly patients , further studies aimed at developing standard values that will serve as yardsticks to assess the who / inrud drug use indicators for elderly inpatients are being suggested this was a prospective study of prescriptions of medicines on hospital days 1 , 3 , 5 , 7 , 14 , and 28 for patients aged 65 years and above admitted in the medical wards of nnamdi azikiwe university teaching hospital ( nauth ) , nnewi , from january 2009 to december 2009 . nauth is the largest tertiary hospital and referral center in anambra state , southeast nigeria . the 350-bed hospital has two medical wards ( a male ward and a female ward ) , with 36 beds each . patients requiring care from all clinical subspecialties in internal medicine are admitted to these wards through the emergency department or from the medical outpatient clinics . on admission , prescription of medicines on hospital days 1 , 3 , 5 , 7 , 14 , and 28 was entered into a case report form and each day 's prescription was considered a drug encounter . according to the who document how to investigate drug use in health facilities , surveys describing current treatment practices should have at least 600 drug encounters with a greater number , if possible . according to the same document , studies that involve comparisons of health facilities or prescribers should have more than 30 drug encounters but preferably 100 drug encounters per facility or prescriber to give the total 600 or more drug encounters . the hospital days ( 1 , 3 , 5 , 7 , 14 , and 28 ) were chosen because of the dynamics in drug prescriptions occurring during these periods of hospital admissions , especially the 1 week of admission . drugs are prescribed for patients admitted through the emergency room on hospital day 1 by both the attending emergency room doctor and the medical officers on call in the medicine department . during hospital days 37 , there are varying levels of specialist review of the patients , most investigations results will be available , diagnosis will be established , and a definitive treatment will be commenced for most patients . most patients with acute illness are treated within this 1 week of admission while those patients staying longer than the 1 week are not spared from further changes in their drug prescriptions . all patients aged 65 years and above admitted in the medical wards of the nauth , nnewi , during the study period were included in the study if they gave informed consent or consent was obtained from caregivers / relatives for patients who had impaired level of consciousness . patients already on admission prior to the time of commencement of the study were excluded from the study . the information obtained was used to characterize the prescribing patterns by determining the following who / inrud prescribing indicators : the average number of medicines prescribed per encounter , percentage of medicines prescribed by generic name , percentage of encounters with an antibiotic prescribed , percentage of encounters with an injection prescribed , and percentage of medicines prescribed from essential medicines list or formulary . metronidazole was included as an antibiotic in this present study contrary to the recommendation of the who because for most part it was used as an antibiotic against anaerobic organisms rather than as an antiamebic agent . antituberculous drugs were not included as antibiotics as recommended by the who protocol for studying drug use patterns in health facilities . the nigerian essential drug list ( edl ) , 4 revision 2003 , published by the federal ministry of health in collaboration with the who , was used for analysis because it was the extant edition at the time of the study . the anatomical therapeutic chemical ( atc ) classification this system classifies drugs into 14 main anatomical groups , each divided into therapeutic subgroups that are further subdivided according to chemical group and the particular chemical substance . patients primary diagnosis was characterized using the who - recommended international classification of diseases and health related problems 10 revision , 2007 . ethical approval for the study was obtained from the ethical committee of the nauth , nnewi . data were analyzed using the statistical package for the social sciences ( spss version 15.0 for windows xp , chicago , il , usa ) . analysis of variance was used to compare the who core indicators on various days of encounter with the level of significance at p < 0.05 . they were aged between 65 and 92 years with a mean age of 72.41 6.6 . two hundred and twenty - one ( 64.1% ) were males while 124 ( 35.9% ) were females . a total of 1513 drug encounters were assessed as follows : 345 patient encounters on hospital day 1 , 336 on day 3 , 312 on day 5 , 283 on day 7 , 175 on day 14 , and 62 on hospital day 28 . the average values of the prescribing indicators for the total duration of stay were assessed as shown in table 1 . the percentage of medicines prescribed by generic name was 73% while the percentage of medicines prescribed from the national edl was 81% . an antibiotic was prescribed in 59.9% of the encounters , and the percentage of encounters with an injection prescribed was 60% . the number of antibiotics prescribed to be taken daily for encounters with two or more antibiotics prescribed were 2 , 3 , and 4 antibiotics in 27.6% , 3.1% , and 0.13% , respectively . the number of injections prescribed for encounters with two or more injections prescribed to be administered daily were 2 , 3 , 4 , and 5 or more injections in 14.8% , 10.9% , 5.6% , and 2.0% encounters , respectively . the injections prescribed on hospital day 28 were insulin for 37.1% ( n = 23/62 ) of the patients , ceftriaxone for 11.3% ( n = 7/62 ) , genticin for 6.5% ( n = 4/62 ) , and metronidazole for 4.8% ( n = 3/62 ) . other injections prescribed were artemether , pentazocine , diclofenac , and enoxaparin for 1.6% ( n = 1/62 ) each [ table 1 ] . the world health organization / international network of rational use of drugs core drug use indicators values table 2 shows the prescribing indicators for the various days on admission surveyed . the average number of medicines per encounter ranged from 6.1 2.5 on hospital day 1 to 7.8 2.3 on hospital day 28 . there was a gradual increase in the average number of medicines per encounter as the admission days increased and this difference was statistically significant ( f = 14.016 ; p = 0.000 ) . the percentage of encounters with an antibiotic prescribed increased from 50.4% on day 1 to 65.4% on day 7 but decreased to 62.9% on day 28 . there was a decrease in the percentage of encounters with an injection prescribed from 72.8% on day 1 to 50.1% on day 28 . the percentage of medicines prescribed by generics ranged from 76.7% on day 1 to 72.9% on day 28 , while the percentage of medicines prescribed from the edl ranged from 84.3% on day 1 to 82.2% on day 28 . the variations in the various who core indicators were statistically significant [ table 2 ] . comparison of the world health organization drug use indicators values on various hospital days the major classes of medicines prescribed were vitamins , 82.9% ( n = 286 ) , antibiotics for systemic use , 72.8% ( n = 251 ) , and analgesics , 60% ( n = 207 ) [ table 3 ] . others were intravenous fluid for 56.2% ( n = 194 ) , diuretics for 54.8% ( n = 189 ) , and renin - angiotensin - related drugs for 52.2% ( n = 180 ) . antithrombotics and antimalarials were prescribed for 48.1% ( n = 163 ) and 45.2% of the patients ( n = 156 ) , respectively . the various classes of antibiotics prescribed were quinolones for 55.4% ( n = 191 ) , followed by cephalosporins for 40% ( n = 138 ) , and metronidazole for 39.7% of the patients ( n = 137 ) . penicillins were prescribed for 10.1% ( n = 35 ) of the patients while the other classes of antibiotics were prescribed for < 10% of the patients each [ tables 3 and 4 ] . the major classes of drugs prescribed classified according to the anatomical therapeutic and chemical classification distribution of the various classes of antibiotics prescribed the prominent diagnostic categories that were the primary diagnosis accounting for the elderly admissions are shown in table 5 . the diseases of the circulatory system accounted for 40.6% ( n = 140 ) , endocrine and metabolic diseases in 18.3% ( n = 63 ) , and certain infectious and parasitic diseases in 15.1% ( n = 52 ) of the patients [ table 5 ] . percentage distribution of the primary diagnosis classified using the international classification of diseases 10 revision the overall average number of medicines per encounter on the various days on admission was high in our study . the average number of medicines per encounter is an index of the degree of polypharmacy . although the precise minimum number of medication used to define polypharmacy is variable , it generally ranges from 5 to 10 . however , in certain clinical conditions where patients present with multimorbidities , the rational use of multiple medications can be justified . in our study , the overall average number of medicines per encounter on the various hospital days was 6.6 2.4 but significantly increased from 6.1 2.5 on hospital day 1 to 7.8 2.3 on hospital day 28 . the number of medicines per encounter in our study was less than the 8 0.2 drugs per encounter reported among elderly patients admitted in an indian tertiary health - care facility . direct comparison of research results is not as useful as using standard values in the assessment and judgment of the quality of prescriptions . standard values are developed for specific regions because of differences in clinical case mix between different regions and when available such standard values act as yardsticks for measurements of drug use indicators in those regions . standard values for the drug use indicators have been developed for outpatient prescriptions in developing countries but not for inpatients . the differences in morbidity mix between outpatients and inpatients will limit direct application of these values for inpatients . in developing countries , 1.61.8 number of medicines per encounter is the who standard value for the average number of drugs per encounter for outpatients prescriptions . currently , there are no standard values for inpatient prescription assessments . in the elderly with multiple chronic diseases , many medicines may be used as found among diabetic and heart failure patients . however , it is always safe to remember that the use of many medicines is an independent risk factor for adverse drug events irrespective of the age . irrational prescription was also noted in the percentage of encounter with an antibiotic prescribed in our study . in our study , the average percentage of encounters with an antibiotic prescribed was 59.9% but ranged from 50.4% on hospital day 1 to 65.4% on hospital day 7 . although < 70% to 88.2% reported in other drug use studies among elderly inpatients , it appears to represent an overprescription of antibiotics . it is also of interest that two or more antibiotics were prescribed to be taken daily in about 31% ( 466/1513 ) of drug encounters in this present study . appropriate antibiotic prescription is the first step for optimum antibiotic use and determination of their rational use may be obtained by a more in - depth audit . rational combination of antibiotics to provide a broad antibacterial coverage is justifiable in certain clinical settings , but whether the combination for each individual case in this present study is justified was not determined . rational use of antibiotics has the potential to reduce the development of resistant microorganisms and also reduce cost of management . previous workers and the who have noted that antibiotics are commonly prescribed without sound justification . the pattern of antibiotic prescriptions in this present study also showed a tendency toward prescribing newer and more expensive antimicrobial agents such as cephalosporins and quinolones . a similar finding was reported from nepal , and the possible reasons for such antibiotic prescription patterns include unbridled advertisement , promotion and sale of antibiotics by drug sale representatives . assumption by attending physicians that older classes of antibiotics would have been used at referral centers may also be contributory . in previous nigerian studies , penicillins , cotrimoxazole , gentamicin , and tetracycline were the most frequently prescribed antibiotics in private health institutions and secondary health centers . quinolones were the most frequently prescribed class of antibiotics in this present study followed by the third - generation cephalosporins and metronidazole . the percentage of encounters with an injection prescribed found in our study also indicated irrational drug prescriptions . the percentage of encounter with injection prescribed was 72.8% on hospital day 1 , this however decreased to 50.0% by hospital day 28 . the average percentage value of encounters with an injection prescribed on the various hospital days was 60% in our study and it is comparable to 60% and 62% reported in ghana and eastern nepal , respectively , but < 86.4% reported for elderly inpatients in india . administration of drugs through the parenteral route entails additional expenditure , efforts , and hazards . parenteral drugs are converted to oral routes when the severity of the illness reduces and patients can tolerate orally , except for drugs administered only through parenteral routes . the average percentage value of encounters of 50.0% on day 28 may suggest that nearly half of the patients staying up to 4 weeks on admission were either in a poor state of health and could not tolerate orally or were on medicines administered through parenteral routes only . for instance , in this study , the proportion of patients on insulin was 37.1% . besides these reasons , the overprescription of injections might be the possible explanation . in almost three quarters ( 73% ) of cases in our study , prescriptions were in generic names while in more than three quarter ( 80% ) , medicines prescribed were listed in the edl . although these are below the 100% value recommended for both indicators by the who , there is still a latitude for improvement . using generic names reduces confusion relating to drug names particularly in the elderly . in a study of 204 elderly patients undergoing a multidisciplinary home medicines review , sorensen et al . reported that one in ten patients was actually using multiple brands or types of the same drug . vitamins were the most frequently prescribed class of drugs . while the prescription of vitamins are justifiable to improve the healing process , especially when dietary patterns are inadequate in the elderly , tendency toward misuse abound . analgesics which are among the most frequently used medicines for the elderly were prescribed for 60% of the patients in this present study . vitamins and analgesics , though relatively safe , are the most commonly inappropriately or irrationally used drugs in many countries . intravenous fluids were prescribed for 56.2% of the patients in this present study in the course of hospital admission . this agrees with other studies on elderly where intravenous fluids were prescribed in 34.8% and 61% of elderly inpatients admitted in western and eastern nepal , respectively . cardiovascular drugs were widely prescribed for the patients and this follows the high frequency of cardiovascular diseases among the patients . among the cardiovascular drugs , diuretics ( 54.8% ) and renin - angiotensin - related drugs ( 52.2% ) were the most frequently prescribed classes of medicines . the high prescription of use of agents acting on the renin - angiotensin system is in keeping with their current recommendations in older hypertensive patients and their indication in heart failure and as renoprotective agents in diabetic patients . this study outlines the profile of the use of medicines among the elderly in a nigerian teaching hospital . it suggests some degree of irrational prescribing by physicians attending to this population of patients as evident by the average number of medicine per encounter and the percentages of encounters with an antibiotic or injection prescribed in the study . we suggest further studies to developed standard values for the who / inrud indicators based on the recently published national treatment guidelines for common elderly diseases which will serve as yardsticks for the assessment of elderly inpatients prescriptions using who / inrud core indicators .

objectives : to assess the medications prescribed for elderly inpatients on specific days during hospital admission with a view to detecting areas of irrational prescription.methods:it was a prospective study of all patients aged 65 years and above admitted to the medical wards of a nigerian tertiary hospital over a 12-month period . the world health organization / international network of rational use of drugs ( who / inrud ) drug use indicators were used to assess drug prescriptions on various days of admission.results:a total of 1513 patient encounters involving 345 patients aged between 65 and 92 years were assessed on hospital days 1 , 3 , 5 , 7 , 14 , and 28 . the average number of medicines per encounter ranged from 6.1 2.5 on hospital day 1 to 7.8 2.4 on hospital day 28 . this difference was statistically significant ( f = 14.42 ; p < 0.05 ) . the percentage of encounters with an antibiotic prescribed ranged from 50.4% on hospital day 1 to 62.9% on hospital day 28 while the percentage of encounters with an injection prescribed decreased from 72.8% on hospital day 1 to 50.0% on day 28.conclusions:this study suggests some degree of irrational prescribing as evident by the high average number of medicine per encounter and the high percentages of encounters with an antibiotic or injection prescribed . however , there is a need to develop standard values for the who / inrud indicators based on the recently published national treatment guidelines for common elderly diseases which will serve as yardsticks to assess elderly inpatients prescriptions using who / inrud core indicators in future studies .

heme oxygenase-1 ( ho-1 ) has been defined as a cellular hercules because of its potent and pleiotropic biological activities . , in 1972 , published the first report describing the enzymatic degradation of heme , the interest in this enzyme has grown exponentially and to our knowledge , today there are almost 4000 publications on this topic . the induction of ho-1 , mainly considered a generalized response to oxidative stress , results in an increased formation of carbon monoxide ( co ) and bilirubin while redox - active iron is rapidly and safely sequestered by the simultaneous coinduction of ferritin . amazingly , bilirubin , thought to be always a useless and possibly a toxic molecule , has revealed to be an excellent lipophilic antioxidant , far more effective than reduced glutathione . co , a well - known deadly gas molecule , when released in trace amounts , appears to be cytoprotective because of its cyclic - gmp - mediated modulation of vascular tone and neurotransmission . thus , it is not surprising that ho-1 has been shown to prevent or improve pathological states associated with cardiomyopathy , chronic limb ischemia , hypertension , endotoxemia , organ transplantation , chronic infections , pulmonary diseases , diabetes , and autoimmune diseases [ 68 ] . in all of these cases , the initial etiological cause is perpetuated by a chronic oxidative stress that tends to accelerate the progression of the disease . orthodox medicine has several valid drugs that , rather than curing the disease , aim to stabilize it . a supplemental administration of antioxidants is harmless , but it is of little help because the main problem is the intracellular unbalance between an excessive production of reactive oxygen species ( ros ) , peroxidation products , and proinflammatory cytokines in front of the reduced efficiency of the antioxidant system . during the last decade , our biological and clinical work [ 1014 ] has shown that a judiciously performed ozone therapy in still responsive patients is able to correct this abnormal situation by upregulating antioxidant enzymes such as sod , gsh - peroxidases , reductases and transferases , and glucose-6-phosphate dehydrogenase . this result , firstly demonstrated for sod in 1996 , is due to the repetition of small and acute oxidative stresses induced by precise doses of well - calibrated ozone against the potent antioxidant capacity of human blood . this process , now universally present from bacteria to fungi , plants , and mammals , has been defined as an adaptation to acute oxidative stresses or oxidative preconditioning [ 1012 , 15 , 16 ] . moreover , this apparently paradoxical biological effect has been postulated [ 1012 ] to be supported by the simultaneous induction of ho-1 because this enzyme is induced by hydrogen peroxide ( h2o2 ) , ultraviolet radiation , ros , and by heme . during the few minutes of ozonation of human blood ex vivo ; ozone dissolves in the plasmatic water and generates messengers such as h2o2 and lipid oxidation products ( lops ) which , after the prompt reinfusion of the ozonated blood in the donor , are responsible of the several biological effects , of which an important one is the upregulation of the antioxidant system intuitively explained as a defensive reaction . owing to the fact that ozone therapy , besides behaving as a calculated acute oxidative stress , favors the release of a small amount of hemoglobin , it appears reasonable to envisage the subsequent induction of ho-1 in the donor patient . on this basis , we have performed the following preliminary study to ascertain whether potential ho-1 inducers can stimulate the synthesis of this enzyme in human endothelial cells . sodium nitrite ( nano2 ) , h2o2 ( 30% solution ) , l - arginine , and the no synthase inhibitor ng - nitro - l - arginine methyl ester ( l - name ) were purchased from sigma chemical and aldrich chemical ( mo , usa ) . hemin was dissolved in 10% ammonium hydroxide in 0.15 m nacl to prepare a stock solution of 100 mg / ml and then further diluted 1 : 40 with sterile 0.15 m nacl ( 2.5 g/1 l ) . ozone was generated from medical - grade oxygen ( o2 ) using electrical corona arc discharge , by the o3 generator ( model ozonosan pm100k , hansler . gmbh , iffezheim , germany ) , which allows the gas flow rate and o3 concentration to be controlled in real time by photometric determination , as recommended by the standardisation committee of the international o3 association . the ozone flow rate was kept constant at 3 l / min in all experiments . polypropylene syringes ( ozone - resistant ) were used throughout the reaction procedure to ensure containment of o3 and consistency in concentrations . blood samples were taken from one of us in the morning by using calciparin ( 20 u / ml blood ) as an anticoagulant . each blood sample of 20.0 ml , contained in a 50 ml syringe , was immediately treated with the gas mixture composed of a volume of 20.0 ml of a gas mixture composed of o2(96% ) and o3(4% ) , at the ozone concentrations indicated in table 1 . the gas withdrawn in a 20 ml syringe was introduced into the 50 ml syringe containing the blood sample via a multidirectional stopcock . we have previously determined that a rapid rotation of the syringe along its longitudinal axis ( about 80 cycles / min ) for one minute achieved a complete mixing of the liquid - gas phases with minimal foaming and that , within this period of time , ozone reacts completely with substrates , implying that blood samples receiving ozone react with the ozone dose totally . the po2 reached a value of about 400 mm hg , while the blood pco2 and ph values did not change . in order to obtain reproducible results , it needs to be emphasized that o3 is a very reactive gas meaning that an extremely rapid and precise handling is required . the final gas pressure remained at normal atmospheric pressure . control sample received only oxygen . immediately after either the oxygenated or the ozonated samples were centrifuged at 3500 g for 7 minutes , the separated plasma was promptly distributed in cell culture dishes . primary human endothelial cells ( huvecs ) were obtained from the neonatal umbilical cord vein as previously described . endothelial cell growth medium ( egm ) with the appropriate supplements and other necessary media were obtained from clonetics ( san diego , calif , usa ) . for tissue culture procedures , in terms of initiation , subculturing and maintenance , we followed the indications given by cambrex inc . cells were grown in a humidified incubator at 37c ( 95% room air , 5% co2 , ph 7.3 ) within 34 days after growth to confluence . when nitrite measurements were performed , cells were transferred to 24 well ( 2 cm ) tissue culture plates and were used at the same cell density and passage number . hydrogen peroxide ( h2o2 ) was measured in plasma before and after addition of oxygen - ozone by the enzymatic method described by green and hill . protein thiol groups ( ptg ) were measured in plasma according to hu using procedure 1 with 5,5-dithiobis ( 2-nitrobenzoic acid , dtnb ) dissolved in absolute methanol . the thiobarbituric acid ( tba ) assay was carried out in plasma as described by buege and aust . values are expressed as m of tba reactive substances ( tbars ) relative to a malondialdehyde standard . production of nitrite concentrations was measured in culture medium supernatants after the addition of predetermined inducers , by using the griess reagent as previously described [ 18 , 22 ] . nitrite concentration ( m ) was determined by comparison with a standard curve made from a solution of nano2 . confluent huvecs in 75 cm flasks were incubated for 18 hours in egm ( alone for the control group ) or in the presence of several ho-1 inducers as follows : h2o2 ( from 20 to 200 m ) , porcine hematin ( 2.5 mg / ml saline ) ho-1 activity assay . the enzymatic activity was measured by bilirubin generation as described by motterlini et al . with minimal modifications . huvecs were grown to confluence in 10 cm tissue culture dishes and then were incubated for 18 hours in egm ( final volume 10 ml , control group ) or in the presence of the mentioned inducers . after treatment , cells were washed twice with phosphate - buffered saline , scraped with a rubber policeman , and pelleted at 2500 g for 10 minutes . the cell pellet was suspended in mgcl2 ( 2 mm ) phosphate ( 100 mm ) buffer ( ph 7.4 ) , frozen at 80c , thawed three times to break up the cell membrane , and finally sonicated in ice before centrifugation at 18 000 g for 10 minutes at 4c . the final supernatant was added to the reaction mixture ( 400 l ) containing 3 mg protein of rat liver cytosol prepared from 105 000 g supernatant fraction as a source of biliverdin reductase , 20 mol / l hemin , 2 mmol / l glucose 6-phosphate , 0.2 units glucose 6-phosphate dehydrogenase , and 0.8 mmol / l -nadph . the reaction was conducted for 1 hour at 37c in the dark and terminated by the addition of 1 ml chloroform . the extracted bilirubin was calculated by the difference in absorption between 464 and 530 nm using a quartz cuvette ( extinction coefficient , 40 mm cm for bilirubin ) . ho-1 activity was expressed as picomoles of bilirubin formed per milligram of endothelial cell protein per hour . equal amounts of proteins , which were determined using a kit from pierce ( rockford , ill , usa ) , were resolved by sds - polyacrylamide gel electrophoresis , transferred to pvdf filters and subjected to immunoblot using specific antibodies against ho-1 ( stressgen biotechnologies , canada ) , hsp-70 ( bd biosciences , san jose , ca , usa ) , and -actin ( cell signaling technology , beverly , ma , usa ) . membranes were incubated with an appropriate peroxidase - conjugated secondary antibody , and the antigen - antibody complexes were visualized using an immuno - star hrp kit ( bio - rad laboratories , hercules , ca , usa ) . nonsaturated - immunoreactive bands were detected with a ccd camera gel documentation system ( chemidoc xrs , bio - rad laboratories , ca , usa ) and then quantitated with quantity one software ( bio - rad laboratories ) . -actin was used in the same gel to normalize the amounts of total protein present in the samples . owing to a cell contamination , the average values of only two sets of data are presented in table 1 . results , although in good agreement , do not allow a statistical analysis . on the other hand , figure 1 has been statistically evaluated and values are expressed as means and standard deviation . figure 1 shows the modification of the levels of ptg , tbars , and h2o2 in relation to the different ozone concentrations . in previous experiments , we have also measured the total antioxidant status of human plasma that transitorily decreases to no less than 60% when the ozone concentration is at 80 g / ml per ml of blood . ptg show a progressive decrease in relation to the ozone dose and the lowest value ( 53% ) was determined at an ozone concentration of 160 g / ml per ml of blood . peroxidation levels were measured as tbars increased with the ozone dose and their values ensure the ozonation efficiency . table 1 shows the results as achieved by evaluating both no and the ho-1 activity . after 18-hour incubation , no was measured in the culture supernatants while the supernatants obtained from the cell layers after undergoing the enzyme extraction were incubated for one hour for measuring the generation of bilirubin . h2o2 induces both no and ho-1 , indirectly measured by the production of bilirubin . as it has been previously observed ( 23 , 25 ) , there is a good relationship between no and ho-1 : addition of l - arginine ( 20 m ) enhances the production of no and of ho-1 , while the no - synthase inhibitor l - name ( 20 mm ) strongly depresses the release of the messenger and of the enzyme . without l - arginine , a concentration of 40 g / ml is more effective than the higher concentration of 80 g / ml . the same trend has been observed with the use of ozonated human plasma similarly inhibited in the presence of l - name . both h2o2 and ozonated human plasma induce an increased production of no and bilirubin in a dose - dependent fashion up to noncytotoxic doses . this trend has been confirmed in analyzing , by western blot , some of the samples ; and in figure 2 , we can note that a medium - level plasma ozonation ( 40 g / ml ) is the most effective in inducing both ho-1 and hsp-70 . interestingly , either the low or the high doses are less effective . 4-hydroxynonenal was inhibitory probably because it was cytotoxic at the concentration of 10 m . since maines ' extensive review on the heme oxygenase system , its antioxidant and cytoprotective activities have been amply demonstrated in a variety of pathological conditions [ 2634 ] . it is well recognized that ho-1 is induced during oxidative stress due to superoxide , hydroxyl radicals , hypoclorous acid , singlet oxygen , and peroxyl radicals . have clarified that no and no - releasing compounds modulate the activity of ho-1 . all of these contributions have been important in explaining why some drugs are able to produce anti - inflammatory and antiproliferative effects most likely due to ho-1 . for a long time , we have been involved in clarifying the biological and therapeutic effects of ozone therapy , that in the classical form , consists in exposing for a few minutes a volume ( 100225 ml ) of human blood to a mixture of oxygen - ozone where the latter gas is only 24% . however , its extremely high reactivity causes an acute oxidative stress that activates a number of biochemical pathways [ 1015 ] without any deleterious action on ho-1 blood cells , because the ozone dose is perfectly calibrated against the potent antioxidant capacity of plasma and erythrocytes . while we have shown already the induction of antioxidant enzymes , it remains to demonstrate the production of ho-1 . ozone dissolves in the water of plasma and instantaneously reacts with unsaturated fatty acids and antioxidants and in doing so , disappears but generates h2o2 , a variety of alkenals , and a trace of hemoglobin from no more than 0,7% of the erythrocyte mass . the evaluation of the ozonated plasma has shown the consistency of the ozonation process , particularly in the therapeutic range of 0.42 mol / ml ( 20 g / ml ozone per ml of plasma ) up to 1.68 mol/ ml ( 80 g / ml ozone ) . in table 1 , we compared the production of no and ho-1 , assessed as bilirubin , because it has been previously ascertained a consequential effect [ 23 , 25 ] . we have confirmed this relationship except for the highest ozone dose ( 1.68 mol / ml ) and when the inhibitor of no synthase was present . moreover , the optimal induction of ho-1 depends very much from the dose ; in fact , h2o2 at concentrations of 100 and 200 g / ml ( data not shown ) and 4-hydroxynonenal at a concentration of 10 m have inhibited the induction because they are most likely cytotoxic . it remains unclear why in this experiment heme inhibited the induction of both hsp-70 and ho-1 . nonetheless , it appears evident , as we have observed also for the induction of antioxidant enzymes , that the optimal induction of ho-1 and hsp-70 , at least in vitro , is achieved by using the medium ozone therapeutic dose ( 0.84 mol / ml or 40 g / ml gas per ml of blood ) . the biochemical data are consistent with the western blot analysis and show that both ho-1 and hsp-70 may play important protective functions in adaptive responses to oxidative stress [ 35 , 36 ] . in addition , the adaptation to oxidative stress induced by o3 treatment has been also shown in animal studies by zamora et al . and by ajamieh et al . [ 37 , 38 ] . this result agrees well with the clinical data because the best therapeutic results have been obtained by starting with low dose up to medium dose . a final useful comment is that the induction of ho-1 surprisingly has been obtained by administering simvastatin , rosuvastatin , aspirin , and curcumin , suggesting the protective activity of this enzyme with other drugs .

heme oxygenase - i ( ho-1 ) has emerged as one of the most protective enzymes and its pleiotropic activities have been demonstrated in a variety of human pathologies . unpublished observations have shown that ho-1 is induced after the infusion of ozonated blood into the respective donors , and many other experimental observations have demonstrated the efficacy of oxidizing agents . it appeared worthwhile to evaluate whether we could better define the activity of potential inducers such as hydrogen peroxide and ozonated human plasma . human vascular endothelial cells at confluence were challenged with different concentrations of these inducers and the simultaneous production of nitric oxide ( no ) ; and ho-1 was measured by either measuring nitrite , or bilirubin formation , or / and the immune reactivity of the protein by western blot using a rabbit antihuman ho-1 and hsp-70 . the results show that production of both no and ho-1 is fairly dose dependent but is particularly elevated using human plasma after transient exposure to a medium ozone concentration . at this concentration , there is also induction of hsp-70 . the results clarify another positive effect achievable by the use of ozone therapy .

when reaching to grasp an object , we have an exquisite ability to precisely shape our hand according to the object 's three - dimensional structure . such skilled hand movements require the brain to perform a complex transformation of the object 's visual properties into a grasp - specific motor command acting on the hand muscles . several lines of evidence implicate a cortical grasping circuit in this visuomotor transformation , including the anterior intraparietal area ( aip ) , ventral premotor cortex ( pmv ) and primary motor cortex ( m1 ) ( davare et al . , 2011 , , 1995 , murata et al . , 2000 , nelissen and vanduffel , 2011 ) . typically , when the object geometry requires either a precision grip ( pg ) or whole hand grasp ( whg ) , the excitability of cortical muscle representations increases in a grasp - specific fashion . this was first unveiled by probing excitability changes during grasping preparation and execution in intracortical circuits ( late i - wave pathways ) within m1 ( cattaneo et al . , 2005 ) , which probably reflected cortico cortical interactions between pmv and m1 ( davare et al . , 2008 , selective activation of the motor system is not only critical for performing actions , but can also be detected when the individual passively looks at an action being performed by another . indeed , action observation modulates motor evoked potentials ( meps ) , elicited by transcranial magnetic stimulation ( tms ) of m1 , in muscles that human observers recruit during the actual performance of the same action ( alaerts et al . , 2010a , fadiga et al . , 1995 , mccabe et al . , 2015 , urgesi et al . , 2006 ) , a phenomenon known as motor resonance . this resonance has been proposed to result from the human mirror system , supposed to include homologues of areas f5 and aip , housing mirror neurons in monkeys ( gallese et al . , 1996 , maeda et al . , 2015 , since no direct recording has so far been obtained from these regions in humans for technical reasons ( mukamel , ekstrom , kaplan , iacoboni , & fried , 2010 ) , the similarity between motor resonance and excitability changes in m1 during action preparation and execution have been cited as evidence in favour of the existence of mirror neurons in humans ( fadiga et al . , 1995 ) . while a number of reports have suggested similar changes in m1 excitability during both action observation and execution ( cattaneo et al . , 2009 , fadiga et al . , 2005 , senot et al . , 2011 ) , to date , only muscle - specific resonance has been reported ( catmur et al . , 2007 , cavallo et al . , 2012 , mccabe et al . , 2015 , strafella and paus , 2000 , urgesi et al . , 2006 ) . since motor resonance supposedly depends on premotor inputs to m1 , an additional condition to be met by motor resonance is to reflect the properties of these inputs . it has been shown that static images of an action , because they may imply motion , increase m1 excitability ( urgesi et al . , , recently a study showed that the human homologues of f5 subsectors respond more to action videos than static images , even those taken close to the moment of contact ( ferri et al . , 2015 ) . hence , one can predict that motor resonance should not only be grasp - specific but this pattern should be clearer for action videos rather than static frames taken from the video . finally , the latter study ( ferri et al . , 2015 ) has also shown that different parts of pmv [ i.e. , putative human area f5a ( phf5a ) , phf5p and phf5c ] react differentially to action videos depending on the visibility of the actor being observed . that is , phf5c was active when the actor was fully visible to the observer but not when only the hand was visible , leaving the other subsectors of pmv to transmit visuomotor information about the latter ( hand only ) condition . hence , by manipulating visibility of the observer , we can effectively activate or deactivate the output of phf5c in order to test how phf5c contributes to motor resonance . therefore , we manipulated four factors ( 3 visual and 1 muscle ) in the first tms experiment : muscle [ first dorsal interosseous ( fdi ) and abductor digiti minimi ( adm ) ] and grasp ( precision grip and whole hand grasp ) to document the grasp specificity , type of visual stimulus ( video vs static image ) and view ( with whole actor visible vs hand alone ) . we hypothesised that , similar to action execution , fdi meps would show greater modulation during observation of precision grip compared to adm and adm meps would show greater modulation during observation of whole hand grasp compared to precision grip . in addition we expected that if inputs to m1 from phf5c affect motor resonance , greater changes would be seen when observing an actor performing grasping actions compared with observation of the hand alone . alternatively , if observation of the hand alone results in significant changes in motor resonance , inputs from other sub - regions of pmv might be more important . observing a whole person in an image of equal size to that of the hand alone images and videos would invariably result in the hand being smaller in the whole person visual stimuli , thus the relative size of the hand is an uncontrolled variable that could contribute to results in the above experiment . we therefore carried out a second experiment investigating whether hand size was important in grasp - specific motor resonance . thirty - two healthy subjects participated in the present study ( mean age : 26.5 5.0 years ; 19 females ) . twenty subjects participated in experiment 1 and 15 subjects participated in experiment 2 , 3 subjects participated in both experiments . experiment 1 and 2 were performed several weeks apart , therefore reducing any possible carry - over effects in the latter 3 subjects . all subjects were right - handed ( self - reported via screening questionnaire ) , with normal , or corrected to normal vision and gave informed consent . potential risks of adverse reactions to tms were evaluated by the tms adult safety screen questionnaire ( keel , smith , & wassermann , 2001 ) . participants were seated comfortably in a chair in a darkened room in front of a 17-inch computer ( 1280 1024 pixels ; 60 hz ) screen located at a distance of 54 cm . subjects ' right hand rested comfortably on a pillow in front of them in a prone position and their left hand rested on a computer keyboard . the visual stimuli consisted of videos clips and images of a right hand ( and forearm ) and the full view of a person grasping objects with the right hand . the stimuli were presented from a lateral left - sided viewpoint , whereby the inner , radial side of the hand , arm and body were visible to the observer . this view was used in order to provide the observer with the most complete view of the body and the object , including kinematics of the hand and arm , during the grasping cycle . the disembodied hand stimuli were derived from the whole body stimuli by zooming in on the hand and arm . one video cycle lasted 4.5 sec ( frame rate 20/sec ) , the static images were presented for the same amount of time ( 4.5 sec ) . presented images and videos were subtended to a visual angle of approximately 10 by 10. during observation of the stimuli the visual angle of the hand during grasping in the hand alone , the whole person , and the small hand alone ( see experiment 2 below ) conditions was 2.76 , 1.06 and 1.06 , respectively . digital conversion and timing of the tms pulses were performed with a micro 1401mk2 unit ( cambridge electronic design , cambridge , uk ) controlled by a custom written matlab script . electromyographical ( emg ) recordings were made from the first dorsal interosseous ( fdi ) and abductor digiti minimi ( adm ) of the right hand with surface electrodes ( ag agcl , 10 mm diameter ) . the emg signal was amplified 1000 , high - pass filtered at 3 hz , sampled at 5 khz and stored for off - line analysis ( ced 1401 with spike and signal software , cambridge electronic design , cambridge , uk ) . eye position was recorded via an infrared camera ( thomas recordings , giessen , germany ) , separate x and y axis signals were sampled at 5 khz and stored for off - line analysis . single - pulse tms was applied using a magstim 200 stimulator ( magstim , whitland , uk ) connected to a standard 9 cm figure - of - eight coil . the coil was applied tangentially to the scalp with the handle pointing backwards and laterally with a 45 angle to the midline . the coil was systematically moved over the scalp until the optimal hotspot for evoking responses in both fdi and adm muscles was found . at the beginning of each experiment , the resting motor threshold ( rmt ) , defined as the minimum intensity that induced motor evoked potentials ( meps ) of 50 v in 5 out of 10 responses ( rossini et al . , 2015 , rothwell et al . , 1999 ) , was determined for the fdi muscle ( rmt : 41.7 7.3% ) . the stimulus intensity was set to obtain motor - evoked potentials ( meps ) at rest of an approximate amplitude of 1 mv , on average , from the fdi muscle ( 117.9 7.6% of rmt ) . the first experiment aimed to determine whether observing the whole person or the hand alone performing a grasp differentially modulated meps recorded in muscles related to the task being observed . here , subjects sat at rest while they observed a series of videos and static images of a disembodied hand alone grasping a peanut ( precision grip ) , whole person grasping an apple ( whole hand grasp ) and whole person grasping a peanut ( precision grip ; fig . a baseline of meps without visual stimuli was taken prior to each observation block ( 15 meps for fdi and adm ; fig . the start of each observation block consisted of a red fixation dot that appeared in the centre of a black screen for 2s ( fig . six visual conditions were presented in a 2 2 2 factorial design : 2 grasps ( precision grip vs whole hand grasp ) 2 observation views ( hand only vs whole person ) 2 visual stimuli type ( videos vs static images ) . the videos and images were randomised ; tms pulses were given with each visual presentation ( 5 meps per condition ; 40 per block ; fig . after each image or video an inter - trial - interval ( iti ) was presented , this consisted of a black screen with the red fixation dot ( fig . the final block was followed by a final baseline without visual stimuli ( 15 meps ; fig . thus , in total an experiment consisted of 75 meps without visual stimuli ( 15 5 blocks ; fig . 1b ) , 20 mep per observation condition ( 20 8 observation conditions : 160 meps in total for each muscle ) and 60 iti meps ( 15 4 blocks ; fig . whilst attending to the presented visual stimuli , subjects were asked to continue to fixate the red dot , which was present throughout the presentation of visual stimuli . experiment 2 was performed to determine whether the size of the hand being observed was the contributing factor to the changes in motor resonance seen in experiment 1 . in this experiment , the procedure was the same except that subjects observed a series of videos and static images of a disembodied hand alone grasping an apple ( whole hand grasp ) , a 1 ) , a small disembodied hand alone grasping an apple ( whole hand grasp ) and a small disembodied hand alone grasping a peanut ( precision grip ; fig . therefore , six visual conditions were presented in a 2 2 2 factorial design : 2 grasps ( precision grip vs whole hand grasp ) 2 observation views ( hand alone vs small hand alone ) 2 visual stimuli type ( videos vs static images ) . in total , an experiment consisted of 75 meps without visual stimuli , 20 mep per observation condition ( 160 in total for each muscle ) and 60 iti meps . tms was triggered at first contact of the hand with the object ( i.e. , the apple or peanut ; fig . therefore , tms was triggered at 2.5 sec from the start of the presentation for whole hand grasp and at 3 sec for precision grip . during the static image presentation , tms was triggered at an averaged time of the 2 object contact times ( 2.75 sec ) after the image was first presented . each visual stimulus was preceded by an iti , which consisted of the red fixation dot on a black screen ( fig . if tms was triggered during the iti the duration of these trials was 7 sec , where tms was delivered at 1.5 sec from the beginning of the iti . trials with itis in which tms was not given lasted 4.5 sec . to maintain the subjects ' attention during the presentation , the fixation dot would dim ( i.e. , change from bright red to dark red ) randomly in 13% of the trials . dimming occurred at a random time between 3.4 and 4.3 sec after the start of the visual stimuli . subjects were instructed to press a key on a keyboard with their left hand when they observed dimming of the fixation dot and to relax immediately after the key press . dimming trials were never followed by tms pulses . additionally , in half of the subjects for experiment 1 , eye position was monitored to ensure subjects were fixating the red dot and to ensure visual stimuli were located on the right visual hemifield . the peak - to - peak amplitude of each individual mep was measured during the baseline without visual stimuli and each condition during the observation blocks . meps were excluded from analysis if they were preceded by a background mean rectified emg activity greater than the resting baseline mean + 2sd [ expt . 1 : 1.88 1.10% ( mean standard deviation ) of trials ; expt . 2 : .74 .73% of trials ] . in addition , in order to ensure meps included in the analysis were recorded during full alertness we excluded meps that were less than 50 v [ expt . 1 : 1.01 1.71% of trials ; expt . 2 : 1.87 2.21% of trials ( catmur , mars , rushworth , & heyes , 2011 ) ] . we also excluded meps that we considered to be extreme outliers , therefore meps greater than the mean + 3sd were excluded [ expt . 1 : 1.70 1.73% of trials ; expt . 2 : 3.79 1.27% of trials ( alaerts et al . , 2010a , alaerts et al . , 2010b ) ] . blocks were removed if subjects made 3 or more errors on the attentional tasks ( i.e. , they failed to make a key press on a dimming trial ) . for experiment 1 , a repeated - measures 4 factor anova ( combining the 3 stimulus factors and the muscle factor ) was performed to determine the effect of view ( hand alone vs whole person ) , visual stimuli ( videos vs static images ) , grasp ( precision grip vs whole hand grasp ) and muscle ( fdi vs adm ) on normalised mep amplitude . bonferroni - corrected t - tests were used for post - hoc analysis of significant interactions where appropriate . for experiment 2 , a repeated - measures 4 factor anova was performed to determine the effect of hand size ( hand vs small hand ) , visual stimuli ( videos vs static images ) , grasp ( precision grip vs whole hand grasp ) and muscle ( fdi vs adm ) on normalised mep amplitude . bonferroni - corrected t - tests were used for post - hoc analysis of significant interactions where appropriate . for both experiments , 2-factor repeated - measures anovas were also performed to test the effect of grasp ( precision grip vs whole hand grasp ) and muscle ( fdi vs adm ) on mep amplitude for different conditions . the paired t - test statistic was used to analyse the mep amplitude during rest and iti baselines and fdi and adm mep amplitude across grasp ( precision grip vs whole hand grasp ) . corticospinal output was investigated via single pulse tms over the m1 hand representation at rest during the observation of static images and videos of different grasping actions . 2 shows the group mean baseline mep amplitudes in the fdi and adm without visual stimuli prior to and during each action observation block ( iti ) . note how meps recorded during the iti were larger across all blocks than meps recorded while subjects were resting and not attending to any visual stimulus . indeed , the averaged iti baseline mep was significantly larger than without visual stimuli in both the fdi [ iti : 1.50 .11 mv ( mean standard error ) , rest : 1.18 .07 mv ; t(19 ) = 3.83 , p = .001 ] and adm muscles [ iti : .68 .06 mv , rest : .54 .04 mv ; t(19 ) = 3.23 , p = .004 ] . importantly , this suggests a general and non - specific task arousal effect on corticospinal excitability . consequently , to reveal the net action observation effect on mep amplitude , we normalised the amplitude of meps recorded during the observation conditions to those recorded during the iti ( fig . we also normalised the amplitude of these meps to those recorded without visual stimuli ( fig . 3c , d ) . a four - factor repeated - measures anova was used to test whether the observation conditions of view , visual stimuli , grasp type and muscle differentially affected mep size . the results of the main anova and the partial eta squared for each statistic are presented in table 1 . the anova yielded two significant 3-way interactions , these are described in the following section . 3 shows the normalised fdi and adm meps during observation of videos ( fig . 3a , b , top ) and to the baseline without visual stimuli taken before each observation block ( fig . overall , both fdi and adm mep amplitudes during action observation were decreased compared with iti mep amplitude ( below 1 , p < .022 ; fig . conversely , when compared with the baseline without visual stimuli , mep amplitude was larger during observation trials , showing an overall facilitation of the mep ( above 1 , p < .022 ; fig . note that grasp muscle - specific effects were only present during observation of videos . specifically , the main anova revealed a significant triple interaction between visual stimuli , grasp and muscle [ iti normalised : f(1,19 ) = 9.69 , p = .006 , fig . 3a , b ; without visual stimuli normalised : f(1,19 ) = 8.64 , p = .008 , fig . post - hoc analysis revealed that this interaction was driven by fdi meps being significantly larger during observation of precision grip videos compared to images ( iti : p = .004 ; without visual stimuli : p = .042 ) and videos of precision grip compared to whole hand grasp ( iti : p = .010 without visual stimuli : p = .040 ) . in addition , fdi meps were larger than adm meps when observing precision grip videos ( iti : p = .005 ; without visual stimuli : p = .038 ) . in order to specifically test grasp muscle interactions we performed further repeated - measures anovas , they revealed a significant double interaction between grasp and muscle during observation of videos [ iti normalised : f(1,19 ) = 10.48 , p = .004 , fig . 3a ; without visual stimuli normalised : f(1,19 ) = 8.80 , p = .008 , fig . f(1,19 ) = 3.02 , p = .099 ; fig . 3b ; without visual stimuli normalised : f(1,19 ) = 3.21 , p = .089 , fig . thus , the observation of videos of actions rather than static images is critical for grasp / muscle - specific changes in mep size . 4 shows fdi and adm meps ( normalised to iti ) during observation of only the hand or the whole person during precision grip and whole hand grasp . note that only during observation of the hand alone were grasp muscle - specific effects present . during whole actor observation , while fdi meps were similar across conditions , adm meps showed a reversed pattern effect . the main anova revealed a significant triple interaction between view , grasp and muscle [ iti normalised : f(1,19 ) = 5.41 , p = .031 , fig . post - hoc analysis revealed that this interaction was driven by a trend for fdi meps to be significantly larger when observing the hand perform precision grip compared to a whole hand grasp ( p = .062 ) , whilst fdi meps were also significantly larger than adm meps during observation of the hand perform precision grips ( p = .047 ) . importantly , the observation of the hand alone [ f(1,19 ) = 4.94 , p = .039 ; fig . 4a ] , but not the person [ f(1,19 ) = .40 , p = .534 ; fig . these results show that observation of the hand alone was important in revealing grasp / muscle - specific changes in mep size , changes that were absent when the whole person was observed . to specifically address the question of whether view ( person vs hand alone ) is important for grasp specific changes in motor resonance during the observation of video actions we performed a 2 factor ( grasp , muscle ) repeated - measures anovas on the video condition separately . 5 shows normalised ( iti ) fdi and adm meps during observation of only the hand or the whole person during precision grip and whole hand grasp videos . note that there was a crossed pattern of effect when observing the hand alone , whereby fdi meps were larger during precision grip compared with during whole hand grasp , while adm meps were larger during whole hand grasp compared with precision grip . indeed , when the person and hand conditions were separated a significant grasp muscle interaction was found for observation of the hand alone [ f(1,19 ) = 20.96 , p 5a ] , but not the whole person [ f(1,19 ) = 2.23 , p = .151 ; fig . 5b ] . in line with the main anova post - hoc test , the grasp muscle interaction during observation of the hand is driven mainly by fdi meps , as fdi meps were significantly different across grasp [ t(19 ) = 2.25 , p = .036 ] , whereas adm meps were not [ t(23 ) = 1.58 , p = .131 ] . overall , these findings show that the observation of hand alone videos mediates differential changes in corticospinal excitability of muscles that are specific to the type of grasping being observed . in the light of these findings , we were aware that the size of the hand in the whole person visual stimuli was less than half that of the hand in the hand alone visual stimuli ( visual angle : 1.06 vs 2.76 , respectively ) . since observing the kinematics of the grasp is important for motor resonance , it could be hypothesised that a lack of grasp - specific motor resonance seen for the whole person visual stimuli was due to the small size of the hand being observed ( i.e. , poor visibility of the hand ) . therefore , we tested whether hand size was a confounding variable in our results for experiment 1 . here , the whole person videos and images were replaced by videos and images of the hand alone with the same visual angle ( 1.06 ) , these were compared to the previous hand alone visual stimuli ( visual angle : 2.76 ) . a four - factor repeated - measures anova was used to test whether the conditions of hand size , visual stimuli , grasp type and muscle differentially affected mep size . the results of the main anova and the partial eta squared for each statistic are presented in table 2 . the anova yielded a trend for a significant grasp muscle interaction [ f(1,14 ) = 4.43 , p = .054 ] . a significant visual stimuli muscle interaction [ f(1,14 ) = 4.93 , p = .043 ] , where post - hoc analysis reveals that fdi meps were larger during observation of the standard hand compared to the small hand ( p = .042 ) . finally , a significant triple interaction between visual stimuli , grasp and muscle [ f(1,14 ) = 6.82 , p = .021 ] on mep size . post - hoc analysis revealed that this interaction was driven by fdi meps being significantly larger when observing the standard hand perform precision grip compared to the small hand ( p = .028 ) and during observation of the standard hand performing a precision grip fdi meps were significantly larger than adm meps ( p = .048 ) . there was a trend for fdi meps during observation of the standard hand to be larger when the actor performed a precision grip compared to a whole hand grasp , but this did not quite reach significance ( p = .075 ) . these results reinforce the findings from experiment 1 and show again that observing videos of the grasps is crucial for grasp - muscle specific motor resonance . importantly , we did not find a significant interaction between hand size , grasp and muscle [ f(1,14 ) = .01 , p = .970 ] , suggesting that hand size is unlikely to contribute to grasp - specific motor resonance . we investigated this further by analysing the effect of observing the standard size hand and small hand during precision grip and whole hand grasp on mep size in the videos alone . 6 shows the normalised ( iti ) fdi and adm meps during observation of the standard and small hand alone during precision grip and whole hand grasp videos . note that there is a crossed pattern effect for both the standard hand and the small hand . indeed , a significant interaction was found between grasp and muscle for the standard hand [ f(1,14 ) = 6.76 , p = .021 ; fig . 6a ] and the small hand condition [ f(1,14 ) = 4.81 , p = .046 ; fig . overall , this data reveals that grasp - muscle specific modulation of the corticospinal output when observing different grasping actions is not dependent on the size of the hand being observed . this is the first study to report that changes in m1 corticospinal excitability underlying grasp - specific motor resonance can be affected by the visibility of the observed grasp . fdi and adm muscle responses were differentially modulated depending on the type of dynamic grasp being observed ( i.e. , precision grip vs whole hand grasp ) when subjects viewed the hand only , but not the person . thus , grasp - specificity of mep amplitude was sensitive to the kinematic information available in the videos , since the visibility of the actor altered the interaction pattern of motor resonance . our control experiment further reveals that this effect was unlikely to be due to the size of the hand being observed . interestingly , we show that this grasp - specific motor resonance is modulated by dynamic aspects of actions since videos , but not static images , led to a distinct interaction grasp muscle interaction . a fourth important finding is that a large part of the motor resonance effects are not task - specific . specifically , we have found that baseline meps recorded within the observation block ( iti ) were significantly larger than those recorded during periods without visual stimuli . using the iti baseline to normalise meps recorded during action observation revealed that grasp - specific modulation of corticospinal excitability occurred in the inhibition rather than in the facilitation domain . this is an important finding as it seems action observation mimics mechanisms of surround inhibition seen during actual action preparation and execution ( kassavetis et al . , 2014 , sohn and hallett , 2004 ) , hence further strengthening the link between neural processes underlying action observation and execution . grasp - specific muscle activation has been found when an individual executes a grasping movement ( cattaneo et al . , 2005 , for example , this can be seen when subjects are presented with two different objects , a pen or a disc , which they have to lift with a precision grip or whole hand grasp , respectively . execution of precision grip requires more activity in the fdi muscle than for the whole - hand grasp . conversely , there is more adm muscle activity for a whole hand grasp than a precision grip ( cattaneo et al . , 2005 , davare et al . , 2009 , this pattern is expected because fdi is a prime mover in precision grip , whereas the adm abducts the little finger during the opening of the hand for whole - hand grasp . the present study shows that observing a hand ( alone ) performing a precision grip or whole hand grasp has a similar differential effect on corticospinal excitability . this may suggest a common neural mechanism underlying both action execution and action observation . in line with this , studies have shown that changes in corticospinal excitability during observation of specific hand movements are similar to changes in emg patterns during execution of the same movement ( alaerts et al . , 2010a , fadiga et al . , 1995 , mccabe et al . , 2015 , urgesi et al . , 2006 ) . previous action observation studies have shown changes in corticospinal excitability in muscles specific to the task being observed ( catmur et al . , 2007 , cavallo et al . , 2012 , mccabe et al . , 2015 , strafella and paus , 2000 ) . specifically , sartori , bucchioni , and castiello ( 2012 ) showed that fdi meps were larger whilst subjects observed a precision grip compared to whole hand grasp and adm meps were larger during observation of whole hand grasp compared to precision grip . since the authors analysed the muscles independently it is unknown if these effects were powerful enough to produce a significant grasp - muscle interaction . it could be argued that motor resonance during action observation is similar to motor imagery , as corticospinal excitability also increases during mental rehearsal of an action ( fadiga et al . , 1999 ) . indeed , clark , tremblay , and ste - marie ( 2004 ) showed that hand muscle meps were equally increased during observation and imagery of a simple hand action . however , action observation ( sartori et al . , 2012 ) , grasp execution and preparation all show grasp specificity , whereas motor imagery does not ( cattaneo et al . , 2005 ) and therefore may not use the same neural network as action observation . interestingly , in our study , although the observer watching the whole person videos could see which of the two grasps was being performed , this did not result in any significant grasp - specificity of meps . the results confirm our prediction that stimuli driving f5c or other regions of pmv influence motor resonance differently . area f5c responds only to the observation of an acting person but other regions of pmv respond to both observation of a hand alone and the whole person ( ferri et al . , thus , when we probed cse during observation of hand alone movements , it seems likely that salient effects on m1 cse came mainly from f5a and other regions of pmv . however , when probing cse during observation of whole person movements , signals from both f5c and other regions of pmv interacted within m1 and biassed cse in a way that abolished grasp - specific effects . it is important to highlight that cse represents the endpoint measure of a complex circuit which is sensitive to inputs from pmv and other areas . it is probable that these inputs directly influence discharge in corticospinal neurons , since , at least in the monkey , these neurons can show mirror - like properties ( vigneswaran , philipp , lemon , & kraskov , 2013 ) . in this respect , the resonance during static image presentation may result from the effects of canonical neurons present in f5 . it must be noted that it is possible these results could be due other confounding variables . for instance , it is possible that the abolition of the grasp muscle interaction is due to predominance in attending to the moving body , head and eyes . since seeing a face looking at an object can cause rapid spontaneous shifts in spatial attention towards the same object ( langton , o'donnell , riby , & ballantyne , 2006 ) , attention or even overt gaze shifting between the body and the object could diminish these interactions . however , in the current experiment subjects were instructed to maintain their gaze on the red dot in the centre of the screen whilst observing the actions and attention to the fixation dot was maintained by the dimming task . additionally , the size of the images and videos were as such that the observer could attend to the whole person without attention or gaze shifts , therefore it is less likely that attention or gaze shifts influenced our results . it could be argued that the findings from experiment 1 , rather than demonstrating specific inputs from pmv , could be a result of the visibility of the grasp since the hand is larger in the hand alone visual stimuli . thus , if the system is unable to match grasp action observation with execution then motor resonance may be reduced . however , previous evidence shows that hand size does not prevent subject 's grasp perception , indeed psychophysical discrimination experiments show subjects can distinguish types of grasp within this range ( orban & platonov , 2015 ) . to further these results experiment 2 now shows that grasp - specific motor resonance is present irrespective of the size of the hand being observed . we note that the pattern of the effect is similar when comparing the whole person videos with the small hand videos . nonetheless , this does not negate the fact that the greater variability within the whole person videos ( possibly due to a noisier output from all pmv subsectors ) lead to a non - significant grasp - muscle interaction . thus , the lack of grasp - specific motor resonance whilst observing a whole person is less likely to be due to the relative size of hand . overall motor resonance was less evident in the adm muscle than in fdi in subjects observing the hand alone and whole person ( expt . notably , the adm motor resonance was similar when observing the whole person and small hand alone , although less variable in the latter condition . this might be because the ulnar side of the hand was obscured in the lateral views of the grasps that were presented , particularly in those views in which the hand was smaller . this could suggest that even though action observation relies on similar mechanisms to action execution , continuous online inputs about kinematics are important to mediate motor resonance . indeed , evidence from monkey studies shows that neuronal responses evoked by performed actions are dependent on the viewpoint of the observing monkey ( caggiano , fogassi , rizzolatti , thier , & casile , 2009 ) . in humans , studies have demonstrated that the view of the hand when observing actions can be important in motor resonance ( alaerts , heremans , swinnen , & wenderoth , 2009 ; maeda et al . , 2002 , ( 2012 ) revealed stronger motor resonance in the adm than fdi in which subjects viewed grasps from a frontal view . while the fdi action is more clearly visible than the adm action in the lateral view as in the current experiment , the opposite is true for the frontal view . as in previous imaging studies ( ferri et al . , 2015 , gazzola et al . , 2007 , jastorff et al . , 2010 ) , it is important to differentiate motor resonance effects following observation of videos from those following observation of static pictures . the motor resonance we found during viewing of dynamic actions was clearly decreased when observing static pictures . similarly , revealed greater motor resonance during precision grip action observation compared with its static image counterpart . however , loporto , mcallister , edwards , wright , and holmes ( 2012 ) presented only a single action pinching a big ball in lateral view and hence were unable to document the absence of muscle these differential motor resonance and mr activation patterns of action videos and static frames are consistent with a recent psychophysical study ( orban & platonov , 2015 ) indicating that discrimination thresholds are much lower for action videos than static frames . a final point is that grasp - specific motor resonance does not modulate cse in the facilitation domain , but rather in the inhibition domain . this is evident when we subtract the general effect of task arousal to reveal the net action observation effect which is suppressed compared with baseline . in addition , a similar mechanism has been found during action execution , called surround inhibition , in which muscles that are not involved in the movement will be suppressed ( kassavetis et al . neurons within f5 have demonstrated a complete suppression of discharge during action observation ( kraskov , dancause , quallo , shepherd , & lemon , 2009 ) . but more importantly , vigneswaran et al . ( 2013 ) later found that some corticospinal mirror neurons identified within m1 could also be suppressed during action observation . this effect could be part of the same mechanism as the one described above , i.e. , suppression of unwanted muscle activity during observation , which may be the rule rather than the exception . in conclusion , we show grasp - specific modulation of corticospinal excitability when the observer views a video of a hand performing an action , which is abolished when the actor is fully visible or when viewing static images taken from the videos . although we can not completely exclude other effects on cse that might be produced by viewing videos of the complete actor , the most likely explanation of our results is that such stimuli , driving f5c ( ferri et al . this result underlines the importance of the kinematics of the observed action and indicates significant suppressive rather than facilitatory effects . we would also like to emphasise the importance of baseline choice when analysing tms data . for instance , it would be misleading to use terms such motor facilitation when referring to action observation motor resonance , as this can entirely depend on the baseline used .

motor resonance is the modulation of m1 corticospinal excitability induced by observation of others ' actions . recent brain imaging studies have revealed that viewing videos of grasping actions led to a differential activation of the ventral premotor cortex depending on whether the entire person is viewed versus only their disembodied hand . here we used transcranial magnetic stimulation ( tms ) to examine motor evoked potentials ( meps ) in the first dorsal interosseous ( fdi ) and abductor digiti minimi ( adm ) during observation of videos or static images in which a whole person or merely the hand was seen reaching and grasping a peanut ( precision grip ) or an apple ( whole hand grasp ) . participants were presented with six visual conditions in which visual stimuli ( video vs static image ) , view ( whole person vs hand ) and grasp ( precision grip vs whole hand grasp ) were varied in a 2 2 2 factorial design . observing videos , but not static images , of a hand grasping different objects resulted in a grasp - specific interaction , such that fdi and adm meps were differentially modulated depending on the type of grasp being observed ( precision grip vs whole hand grasp ) . this interaction was present when observing the hand acting , but not when observing the whole person acting . additional experiments revealed that these results were unlikely to be due to the relative size of the hand being observed . our results suggest that observation of videos rather than static images is critical for motor resonance . importantly , observing the whole person performing the action abolished the grasp - specific effect , which could be due to a variety of pmv inputs converging on m1 .

experimental infection - female balb / c mice aged six - eight weeks , provided by the centre for laboratory animal breeding of the oswaldo cruz foundation ( fiocruz ) ( rio de janeiro , rj , brazil ) , were intraperitoneally inoculated with 1 10 p. yoelii 17xl - prbc in 0.2 ml of phosphate - buffered saline ( pbs ) . at the earlier ( day 4 ) and later ( day 7 ) stages of anaemia , blood from each animal was collected in heparinised tubes and rbcs and plasma were separated by centrifugation ( 350 g , 10 min ) for the evaluation of apoptosis and the plasmatic levels of cytokines , no and anti - rbc antibodies . blood samples from non - infected age - matched mice were also obtained and used as controls . ethics - all animal experimentation protocols were approved by the fiocruz animal ethical committee . determination of parasitaemia - parasitaemia was determined by counting the number of prbcs among 1,000 rbcs in thin blood smears stained using romanowski 's method ( pantico rpido , laborclin , pi - nhais , pr , brazil ) . determination of anaemia - anaemia was evaluated by counting the number of rbcs per mm of blood . a 2-l aliquot of whole blood was suspended in 0.5 ml of heparinised pbs and diluted 1:10 in the same buffer . apoptosis assay - apoptotic nrbcs were identified ex vivo through the detection of phosphatidylserine exposure at the cell surface using syto 16 and annexin v - pe double staining , as previously described ( totino et al . briefly , rbcs isolated from heparinised blood were washed twice with pbs ( 350 g , 10 min ) and subsequently incubated at 37c for 40 min at a density of 1 10 cells/400 l in pbs containing 100 nm syto 16 ( invitrogen , carlsbad , ca , usa ) . after incubation , the staining buffer was discarded and the rbcs were stained with 5 l of annexin v ( bd pharmingen , san diego , ca , usa ) for 15 min at room temperature ( rt ) in 100 l of annexin - binding buffer ( bd pharmingen , san diego , ca , usa ) containing 100 nm syto 16 . finally , the cells were diluted five times in annexin - binding buffer containing syto 16 and analysed using a facscalibur flow cytometer ( becton dickinson , san jose , ca , usa ) . measurement of no - no production was estimated by measuring total nitrite in the plasma using the griess method ( schmidt et al . briefly , 40 l of each plasma sample was incubated overnight at 37c in a 96-well plate with equal volumes of a cocktail containing 500 l of nicotinamide adenine dinucleotide phosphate nadph ( 5 mg / ml ) ( sigma , st . louis , mo , usa ) , 1,000 l of potassium phosphate buffer ( 0.5 m kh2po4 , ph 7.5 ) , 50 l of nitrate reductase ( sigma , st . louis , mo , usa ) ( 20 u / ml in potassium phosphate buffer ) and 950 l of deionised milli - q water . after incubation , the samples were centrifuged at 400 g for 5 min and transferred to a new plate . subsequently , 80 l of griess reagent [ 1:1 mixture of 0.1% n-(1-naphthyl)ethylenediamine in deionised water and 1% sulphanilamide in 5% phosphoric acid ] was added . the absorbance was measured using a spectrophotometer ( spectra max , molecular devices , sunnyvale , ca , usa ) at 540 nm and the results were expressed as the concentration ( m ) of nitrite . measurement of cytokines - the plasmatic levels of the cytokines tumour necrosis factor ( tnf ) , interferon ( ifn)- , interleukin ( il)-5 , il-4 and il-2 were determined using the bd cytometric bead array mouse th1/th2 cytokine kit ( bd biosciences , san jose , ca , usa ) , according to the manufacturer 's instructions . briefly , a 25-l plasma sample was incubated for 2 h at rt with 25 l of cytokine capture beads and 25 l of pe detection reagent . after incubation , the samples were washed once with wash buffer by centrifugation ( 200 g , 5 min ) . the supernatants were discarded and the pelleted beads were resuspended in 300 l of wash buffer for analysis on a facscalibur flow cytometer ( becton dickinson , san jose , ca , usa ) . the plasmatic concentration of each cytokine in pg / ml was determined based on standard curves for the recombinant cytokines provided in the kit . detection of anti - rbc antibodies - anti - rbc antibodies in the plasma were detected by flow cytometry using normal rbcs obtained from a non - infected control mouse . briefly , plasma samples were diluted five times in pbs containing 1% bovine serum albumin ( bsa ) and 0.125% rbcs and incubated for 1 h at rt . after washing three times with pbs-1% bsa , the rbcs were incubated for 1 h at rt with anti - mouse polyvalent immunoglobulins ( g , a and m ) conjugated to fluorescein isothiocyanate ( fitc ) ( sigma , st . finally , the rbcs were washed three times with pbs and resuspended in the same buffer . bound antibodies were detected using a facscalibur flow cytometer ( becton dickinson , san jose , ca , usa ) . statistical analysis - statistical analyses were performed using graphpad prism 5.0 software ( san diego , ca , usa ) . differences between groups were determined by the nonparametric mann - whitney u test or the kruskal - wallis test with dunn 's post - test . to determine correlations between apoptosis and other variables , the nonparametric spearman 's rank correlation test was applied . to study the relationship between nrbc apoptosis and anaemia , we infected balb / c mice with a lethal strain of rodent malaria parasite ( p. yoelii 17xl ) . we then evaluated the levels of apoptotic nrbcs and the number of peripheral rbcs during the early ( day 4 ) and late ( day 7 ) stages of anaemia , using non - infected mice as a control . as previously reported by our group , p. yoelii 17xl infection led to a significant increase in the levels of nrbc apoptosis at the late stage ( fig . 1a ) and this increase was followed by a significant decline in the number of rbcs ( fig . however , a significant correlation between apoptosis and rbc count was not observed ( fig . 2 ) . fig . 1 : profile of non - parasitised red blood cell ( rbc ) apoptosis ( a ) , anaemia ( b ) , parasitaemia ( c ) , interferon ( ifn)- ( d ) , tumour necrosis factor ( tnf ) ( e ) , anti - rbc antibodies ( f ) and nitric oxide ( no ) ( g ) in plasmodium yoelii 17xl infection . balb / c mice ( n = 7 - 12 ) were infected with p. yoelii 17xl and , then , at days 4 ( early ) and 7 ( late ) post - infection evaluations were parallely performed . data are results from three separate experiments and are presented as mean standard error of the means . * : p < 0.05 ; * * : p < 0.01 ; * * * : p < 0.001 . fig . 2:correlation of non - parasitised red blood cell ( nrbc ) apoptosis and anaemia in plasmodium yoelii 17xl infection . balb / c mice ( n = 12 ) were infected with p. yoelii 17xl and , then , both the levels of apoptotic nrbc and the number of rbc / mm 3 of blood were measured during the late stage of infection ( day 7 ) . to gain insight into the involvement of parasites and the immune response in nrbc apoptosis , we also evaluated parasitaemia and the plasmatic levels of cytokines ( tnf , ifn- , il-5 , il-4 and il-2 ) , no and anti - rbc antibodies during the early and late stages of anaemia . as expected , parasitaemia significantly increased at the late stage compared with the early stage ( fig . levels of the proinflammatory cytokines ifn- and tnf also increased during infection ( fig . 1d , e ) , whereas il-5 , il-4 and il-2 were not significantly detected in the plasma of either control or infected mice ( data not shown ) . ifn- levels increased at both the early and the late stages , with no significant difference between these two phases of infection ( fig . inversely , the tnf concentration and the levels of anti - rbc antibodies only significantly increased during the late stage ( fig . in contrast to what was observed for parasitaemia , proinflammatory cytokines and anti - rbc antibodies , no significant change in no concentration was observed on day 4 or day 7 ( p > 0.5 ) ( fig . , tnf levels and anti - rbc antibodies were increased during the late stage of infection , we attempted to correlate these factors with nrbc apoptosis ( fig . 3 ) . whereas the antibodies and tnf were not correlated with apoptosis ( fig . 3a , c ) , parasitaemia was positively associated with this process ( fig . 3 : correlation of non - parasitised red blood cell ( nrbc ) apoptosis with anti - rbc antibodies ( a ) , parasitaemia ( b ) and tumour necrosis factor ( tnf ) ( c ) in plasmodium yoelii 17xl infection . balb / c mice ( n = 12 ) were infected with p. yoelii 17xl and analysed at late stage of infection ( day 7 ) . augmented levels of erythrocytic apoptosis have been reported in different anaemia - associated clinical disorders , suggesting that apoptosis is involved in this haematological complication ( lang & qadri 2012 ) . in malaria , the relationship between erythrocytic apoptosis and anaemia has not yet been explored . we therefore investigated whether nrbc apoptosis detected in experimental malaria could be associated with the number of peripheral rbcs , parasitaemia or plasmatic levels of no , cytokines and anti - rbc antibodies . our present data confirm our previous results concerning increased levels of apoptotic nrbcs during the late stage of p. yoelii 17xl infection in balb / c mice and also suggest that the degree of anaemia is not related to the extent of apoptosis . we also observed that nrbc apoptosis was associated with parasite load , but not with the components of the immune response that were assessed herein . it is known that parasite - derived factors can participate in the physiopathology of many parasitic infections , including the induction of host cell apoptosis ( bienvenu et al . , several studies have demonstrated that parasitic antigens can stimulate the apoptosis of brain endothelial and neuroglia cells , cardiomyocytes and erythroblasts in vitro ( wennicke et al . 2009 ) . in our study , a high parasite load correlated with increased levels of nrbc apoptosis . this finding , together with the previous identification of nrbcs as target cells for the incorporation of plasmodial molecules ( layez et al . 2005 , omodeo - sale et al . 2008 ) , suggested that malarial antigens could also have apoptogenic effects on nrbcs . in fact , it has previously been shown that nrbcs undergo erythrocytic apoptosis in p. falciparum culture in vitro ( koka et al . 2010 ) , similar to rbcs following treatment with bacterial toxins and schistosoma mansoni antigens in vitro ( lang et al . thus , in addition to the pathogenic effects of hyperparasitaemia mediated through the lysis and cytoadherence of prbcs ( lamikanra et al . 2007 ) , parasite load could induce nrbc apoptosis through a massive adsorption of parasitic antigens on nrbc membranes . in addition to parasitaemia , the basal levels of no during p. yoelii 17xl infection could also contribute to parasite - induced apoptosis . no is a biological mediator with several roles and this mediator 's reduced bioavailability in malaria has been associated with disease severity ( sobolewski et al . 2011 ) . in visceral leishmaniasis , the depletion of no promotes rbc apoptosis and the administration of no to infected animals can prevent this apoptosis ( chowdhury et al . therefore , it is possible that the limited availability of no described herein could potentiate the induction of nrbc apoptosis mediated by parasites because no is a potent regulator of rbc survival and an inhibitor of erythrocytic apoptosis ( nicolay et al . 2010 ) . parasites and no can influence rbc apoptotic processes , but the same does not appear to be true for cytokines . although proinflammatory cytokines have been implicated in apoptosis of nucleated cells ( roeske - nielsen et al . 2010 ) , their pro - apoptotic effects were not observed when fresh or prbcs were maintained in the presence of tnf and/or il-1 ( pattanapanyasat et al . our results are also in accordance with the possible refractoriness of rbcs to cytokine - induced apoptosis ( neote et al . 1994 , daniels 2007 ) because ifn- levels were elevated at stages of infection that were related ( late stage ) and not related ( early stage ) to nrbc apoptosis . moreover , the augmented levels of tnf at the late stage tended to be negatively correlated with the percentage of apoptotic rbcs . our data also suggest that anti - rbc antibodies , which levels are increased at the late stage of infection , do not participate in nrbc apoptosis induced by p. yoelii 17xl parasites . the ability of antibodies to stimulate erythrocytic apoptosis has been demonstrated using antibodies targeted against certain antigens expressed on the rbc surface ; this antibody - antigen interaction likely mimics the receptor - ligand interaction that occurs during apoptotic induction ( head et al . thus , it is possible that the lack of an association between anti - rbc antibodies and apoptosis is due to the ability of the antibodies to recognise rbc surface antigens that are unrelated to apoptosis . the purification of anti - rbc antibodies coupled to apoptotic nrbcs could help to clarify this possibility . regarding the putative role of erythrocytic apoptosis in anaemia associated with different clinical disorders , we hypothesised that nrbc apoptosis could be involved in the anaemia observed during the late stage of p. yoelii 17xl infection ( totino et al . although the percentage of nrbc apoptosis increased at the later stage of infection , this increase was not associated with a reduced number of peripheral rbcs in the present study . however , we can not rule out the pathogenic effect of nrbc apoptosis in human malaria , in which , in contrast to p. yoelii malaria , anaemia can occur in the presence of low parasitaemia levels ( casals - pascual & roberts 2006 , bouyou - akotet et al . we conclude that further studies on malaria models in which acute anaemia develops during a low parasite burden , such as semi - immune mice ( evans et al . 2006 ) and new world monkeys ( carvalho et al . 2003 ) , could improve our understanding of the role of nrbc apoptosis in malarial anaemia .

recently , while studying erythrocytic apoptosis during plasmodium yoelii infection , we observed an increase in the levels of non - parasitised red blood cell ( nrbc ) apoptosis , which could be related to malarial anaemia . therefore , in the present study , we attempted to investigate whether nrbc apoptosis is associated with the peripheral rbc count , parasite load or immune response . to this end , balb / c mice were infected with p. yoelii 17xl and nrbc apoptosis , number of peripheral rbcs , parasitaemia and plasmatic levels of cytokines , nitric oxide and anti - rbc antibodies were evaluated at the early and late stages of anaemia . the apoptosis of nrbcs increased at the late stage and was associated with parasitaemia , but not with the intensity of the immune response . the increased percentage of nrbc apoptosis that was observed when anaemia was accentuated was not related to a reduction in peripheral rbcs . we conclude that nrbc apoptosis in p. yoelii malaria appears to be induced in response to a high parasite load . further studies on malaria models in which acute anaemia develops during low parasitaemia are needed to identify the potential pathogenic role of nrbc apoptosis .