article
stringlengths
0
328k
abstract
stringlengths
261
2.35k
this is a unique case of acquired tm , which was diagnosed after 8 years of insult due to lack of awareness of this clinical entity a 50-year - old female presented with a history of fever , abdominal pain and loose stools for the duration of 1-week . she was known to have type 2 diabetes mellitus , hypertension and hypothyroidism since many years , on regular medicines . she had surgical site infection with involvement of trachea 1-week after surgery . on detailed enquiry , it was found that she had on and off dry cough since last 8 years , which was treated symptomatically with cough suppressants and antibiotics many times . but , symptoms used to recur each time . physical examination revealed a moderately built woman , weight of 62 kg , afebrile , blood pressure of 80/50 mmhg , pulse rate of 110/min , spo2 of 94 % on room air . she did not have pallor , icterus , cyanosis , clubbing , pedal oedema or lymphadenopathy . the investigations showed : total count : 15,500 ( 400010,000 cells / cm)haemoglobin : 11.2 ( 1316 mg / dl)platelets : 231,000 ( 150,000400,000 cells/l)c - reactive protein : 31.3 ( 05 mg / l)serum creatinine : 1.9 ( 0.61.3 mg / dl)sodium : 133 ( 136145 mmol / l ) , potassium : 3.0 ( 3.55.1 mmol / l)aspartate aminotransferase : 663 ( 038 u / l ) , alanine transaminase : 317 ( 041 u / l)sensitive thyroid - stimulating hormone : 0.69 ( 0.274.2 u / ml)chest radiograph : normalhigh - resolution computed tomography ( hrct ) of the thorax with dynamic tracheal imaging : normal tracheal appearance seen during inspiration [ figure 1 ] . a typical crescentric tracheal appearance with > 50% narrowing of lumen s / o tm seen during expiration [ figure 2 ] . total count : 15,500 ( 400010,000 cells / cm ) haemoglobin : 11.2 ( 1316 mg / dl ) platelets : 231,000 ( 150,000400,000 cells/l ) c - reactive protein : 31.3 ( 05 mg / l ) serum creatinine : 1.9 ( 0.61.3 mg / dl ) sodium : 133 ( 136145 mmol / l ) , potassium : 3.0 ( 3.55.1 mmol / l ) aspartate aminotransferase : 663 ( 038 u / l ) , alanine transaminase : 317 ( 041 u / l ) sensitive thyroid - stimulating hormone : 0.69 ( 0.274.2 u / ml ) chest radiograph : normal high - resolution computed tomography ( hrct ) of the thorax with dynamic tracheal imaging : normal tracheal appearance seen during inspiration [ figure 1 ] . a typical crescentric tracheal appearance with > 50% narrowing of lumen s / o tm seen during expiration [ figure 2 ] . normal tracheal appearance during inspiration a typical crescentric narrowing of trachea during expiration on initial clinical evaluation , the diagnosis of acute gastroenteritis with sepsis , prerenal acute kidney injury and upper respiratory infection was considered . the diagnosis of sepsis was confirmed by elevated inflammatory markers and growth of escherichia coli in blood culture . the diagnosis of tm was made after hrct thorax with dynamic tracheal imaging and in consultation with the respiratory physician . she ideally needed bronchoscopy , followed by tracheoplasty or stenting , but due to her morbid condition , conservative treatment with cough suppressant was chosen . tm refers to loss of tracheal rigidity and resulting susceptibility to collapse . it may be diffuse or localized to a tracheal segment . the affected portion may be intrathoracic , in which airway obstruction is accentuated during expiration . less common is extra thoracic obstruction , in which airway obstruction is most marked during inspiration . tracheobronchomalacia is the term used to describe the condition when the mainstem bronchi are involved . the congenital form , described more extensively in children , is related to a variety of congenital disorders e.g. mucopolychondritis . the disorder may persist into adult life and is referred to as idiopathic giant trachea , tracheomegaly , or the mounier - kuhn syndrome . bronchiectasis and recurrent respiratory infections are common . although atrophy of the longitudinal elastic fibres and muscularis layer has been described , the aetiology of these changes is unclear . acquired or secondary tm in adults is most common in men who are over 40 years of age . risk factors include recurrent intubation , prolonged intubation and concurrent high - dose steroid therapy . tm may be caused by conditions that are associated with chronic pressure on the tracheal wall ( benign mediastinal goitre , malignancy , abscess or cyst ) , inflammation of the cartilaginous support or mucosa or interference with tracheal blood flow , exposure to mustard gas and gastroesophageal reflux disease . traumatic injury to the central airways or surgical interventions may also lead to tm . in our case , the most likely aetiology is damage to cartilaginous wall of trachea by chronic inflammation . causes of acquired tracheomalacia tm should be suspected in patients with a history of chronic cough , sputum production and dyspnoea , not responding to symptomatic treatment . the diagnosis is done by direct bronchoscopic visualization to confirm significant narrowing of the tracheal lumen during regular , forced expiration . assessment of the central airways using end - expiratory , dynamic , three - dimensional computed tomography images is useful . the diagnosis is made when the diameters of the trachea or right or left mainstem bronchi exceed the upper limits of normal by three or more standard deviations . it can also be defined as mild , if the lumen narrows to 50% of its initial size during expiration , moderate if it narrows to 25% of its initial size and severe if the anterior and posterior walls touch . initial treatment of symptomatic patients includes optimization of underlying conditions like chronic obstructive pulmonary disease , tracheal stenosis or associated infections . a functional assessment is performed ( e.g. , pulmonary function tests , 6-min walk test ) in symptomatic patients to establish a baseline . it provides immediate improvement , but often migrates , which may manifest as a new cough .
tracheomalacia ( tm ) refers to loss of tracheal rigidity and resulting susceptibility to collapse . it is usually an incidental finding during investigations of other illness . the main symptoms are dyspnoea , cough , sputum production and hemoptysis . most cases are considered as respiratory infection and are treated symptomatically . acquired tm results from damage to trachea due to various conditions such as inflammation , chronic pressure , or medical / surgical procedures . the diagnosis is done by end - expiratory dynamic tracheal imaging , which demonstrates typical crescentric narrowing of trachea and reduced antero - posterior diameter < 50% of normal . management include conservative measures like cough suppressants or surgical measures like tracheoplasty , stenting or surgical repair . we are reporting a case of chronic cough , which was subsequently diagnosed as tm .
lymphadenectomy in gynecological cancer is intensively discussed with respect to prognostic , predictive , and therapeutic aspects [ 15 ] . the prognostic and predictive approach aims primarily on detection of node metastases without inducing additional relevant morbidity . thus , the sentinel node concept and different types of not well defined staging lymphadenectomies were developed . the therapeutic approach aims on removal of all nodes of certain lymph basins and the intercalated nodes at risk , implying cure in case of involvement . however , for potential surgical cure of a patient with lymph node involvement the nodes of risk have to be defined and removed completely . there is evidence that tumor spread is bound to permissive ontogenetic compartments for a long time . this has first been demonstrated in rectal cancer resulting in modification of surgical treatment by total mesorectal excision ( tme ) and later in cervical cancer resulting in total mesometrial resection ( tmmr ) [ 9 , 10 ] . the same tumor permissive or inhibitory compartment mechanisms related to embryologically derived compartments seem to be true for lymph basins as demonstrated by hckel for lymphatic spread in cervical cancer . in his monocentric prospective study overall and five - year relapse free survival was 96% and 94% , respectively , for 305 patients stages ib to iib ( 71 node positive ) following tmmr and therapeutic lymphadenectomy without any adjuvant irradiation . it seems to be mandatory to remove the lymph node regions at risk completely , which can be defined by the pattern of lymph node metastasis and recurrent disease , respectively , in correlation to embryological development of anatomical regions . robotic surgery enables us to develop and dissect structures with extremely increased accuracy , thus allowing to prepare and free the compartments completely of lymphatic tissue without injuring adjacent compartments by respecting the filmy septa at the compartment borders . due to the excellent 3d / hd visualization surgical technique may be described step by step and may precisely be reproduced and documented in each patient . developed for open surgery of uterine cancer , to a robotically assisted approach , which will be described in the following step by step . the first author learned the surgical technique of tmmr and tlne participating in leipzig school of surgery in 2006 . all radical hysterectomies were consequently performed using the nerve - sparing technique of tmmr and tlne , if adequate . in 2010 , robotically assisted laparoscopic surgery was implemented using a da vinci surgical system ( intuitive surgical inc . , sunnyvale , ca , usa ) . the principles of surgical steps were systematically translated to the robotic surgery and optimized to guarantee the same radicalness compared to open surgery but maintain the advantages of an endoscopic approach . the different steps were discussed with hckel by video sequences . finally , hckel participated in the surgery in essen and confirmed equality of the robotic approach with respect to his operation defined by open surgery . the resulting technique of rtlne will be described in detail for the firsttime in international literature . the technique with respect to cervicalcancer has been already described in german only , but without reporting anyclinical data . trocars are positioned 2325 cm above the symphysis ( camera ) , two lateral robotic trocars about 5 cm10 cm above the upper anterior iliac spine , one additional robotic trocar on the left between camera trocar and left lateral trocar , one assistant trocar of 10 mm diameter on the right side between camera trocar and right lateral trocar . the space in between the trocar incisions was at least 10 cm to ensure adequate mobility . as a first proof of feasibility , 35 patients were treated by rtmmr or rpmmr and rtlne with cervical cancer figo ib - iia or endometrial cancer figo i - iii . robotic surgery in analogy to the procedure described by hckel [ 3 , 6 ] . thus , the clearance of defined lymph basins and the intercalated nodes downstream to the mllerian compartment were defined to be a superior quality parameter compared to the number of removed lymph nodes . these include for cervical cancer : mesometrial nodes ( mm ) , paravisceral nodes ( internal iliac nodes including gluteal and rectal nodes , pv ) , external iliac nodes ( ei ) , common iliac nodes ( ci ) , and presacral / subaortic nodes ( ps ) on both sides . in endometrial cancer , there will be no involvement of gluteal and rectal nodes but of periaortic nodes including inframesenteric ( i m ) and supramesenteric / infrarenal ( sm / ir ) nodes , since primary lymph basins are reached via ovarian vessels directly . perioperative morbidity and early postoperative morbidity were analyzed . we noted whether there was the need of perioperative blood transfusions and the length of hospitalization . analysis of clinical and histopathological data was performed using and spss17.0 for macintosh ( spss , chicago , il , usa ) . we conducted a descriptive analysis only , considering the limited number of patients and the explorative character of this study . the principle of ontogenetically derived surgical compartmental resection may be defined for each organ system . in the following , we will focus on lymphatic basins and the intercalated nodes of the uterus . as outlined by hckel et al . , the lymphatic downstream compartments of the uterine cervix may be divided in the local system , corresponding to intercalated nodes in the vascular mesometrium ( mm ) and in the regional system corresponding to the paravisceral ( pv ) and external iliac ( ei ) basins as primary and the common iliac ( ci ) and presacral ( ps ) basins as secondary basins . tertiary and quaternary basins of the cervix are located along the aorta and caval vein inframesenterically ( i m ) and supramesenterically / infrarenally ( sm ) ( figures 1(a)1(c ) ) . whereas in cervical cancer skip metastases in tertiary and quaternary basins are extremely uncommon , they occur in endometrial cancer due to the different lymph drainage ( figure 1(c ) ) . whereas cervical lymph drainage runs downstream along the vascular and fibrofatty mesometria , drainage of uterine corpus involves vascular mesometrium and ovarian vessels . this implicates that in endometrial cancer tertiary and quaternary basins have also to be regarded as primary basins in contrast to cervical cancer . following this concept obturatorii , gluteales superiores et inferiores , pudendales , rectales , praesacrales and subaortici corresponding to the primary and secondary basin . in case of proven node metastases in the primary or secondary basin , the inframesenteric periaortic and pericaval nodes ought to be removed ; in case of their involvement , the infrarenal periaortic and pericaval nodes in addition . in case of high risk endometrial cancer without cervical involvement no metastases may be present in the deep gluteal , pudendal , and rectal nodes . however , all other nodes of level 14 have to be removed due to the risk of involvement . the following steps will illustrate the surgical anatomy and operative technique of robotically assisted therapeutic pelvic and periaortic lymphadenectomy ( rtlne ) . inspection of the anatomy , exposition of preaortic / precaval region , and incision of peritoneum lateral to the right common iliac artery ( figure 1(d ) ) . development of the retroperitoneum from the inframesenterial periaortic region to the branching of internal and external iliac vessels and presacrally down to s2 . the left common iliac artery can be followed dorsally of the sigmoid mesentery into the sigmoid tunnel ( figure 2(a ) ) . separation of the retroperitoneal lymph basins from the mesenteries of the rectosigmoid ( figure 2(a ) ) , ascendant colon ( figure 2(b ) ) , and the hypogastric superior plexus ( figures 3(a ) and 3(b ) ) should define the ventral and lateral borders of common iliac and subaortic / presacral lymph basins . preparation of the infundibulopelvic ligaments , ureters , genitofemoral nerves , and psoas muscles on both sides to define the dorsal borders laterally as shown on the left ( figure 4 ) and on the right ( figure 5 ) . mobilization of the lymphatic tissue en bloc starting from laterally , right to medially dissecting vessel anastomoses to the infundibulopelvic ligament and the vena cava , less frequently the aorta ; cranially starting from the level of aortic branching , caudally to the iliac branching , usually located at the level of crossing of the ureter . dissection of the lymphatic basin and separation from the medial border of the common iliac vessels down to the branching of the internal iliac artery into its anterior and posterior branches , medially down to s2 . mobilization from caudally to cranially by exposing the promontory , the median sacral artery , and the back bone ( figures 6(a)6(c ) ) . laterally and dorsally of the common iliac vessels , mobilization of obturator nerve , and lumbosacral trunk removing all lymphatic tissue ( figure 7 ) . the preparation of the branches of the internal vessels may be performed down to the left uterine artery due to the excellent access via the sigmoid tunnel . now the mobilized tissue of the secondary compartment ( level ii ) may be resected and preserved in an endobag or left en bloc . exposition of the right external iliac region and again preparing the genitofemoral nerve and the psoas muscle laterally ( figure 8) down to the a. and v. circumflexa ilium profunda and the level of the femoral channel . opening the paravisceral basin from lateral by dissecting the nodal tissue from the obturator fascia down to the arcus tendineus pushing the iliac vessels medially . dissecting the lymphatic tissue at the level of the femoral channel preserving the vasa circumflexa ilium profunda and the inferior epigastric vessels medially ( ei ) ( figures 9 , 10 , and 11 ) . identification of the umbilical artery ( medial umbilical ligament ) and preparation from the anterior abdominal wall to its origin from the internal iliac artery . development of the paravisceral space from medially by medialization of the vesical mesenteric septum and dissection down to the endopelvic fascia ( figure 12 ) . removal of the medial nodes located in front of the femoral channel and exposition of the pecten ossis pubis ( figure 11 ) . by preparing down along the obturator muscle the obturator nerve / vessel bundle can be identified , freed completely from lymph tissue and preserved . now the lateral and medial part of paravisceral basin can be joined and totally be cleaned down to the pubococcygeal and iliococcygeal muscles and up to the internal iliac vessels ( pv , caudally ) ( figure 13 ) . step 9 . in case of removal of the lymphatic tissue along the branches of iliac vessels in cervical cancer first the prespinal tissue will be removed exposing the pudendal artery reentering the pelvis via the minor ischiadic foramen ( figure 14 ) . glutea superior , inferior , iliolumbalis , rectalis media and pudenda interna , and the corresponding veins will be freed of lymphatic tissue , completely . concomitantly the lumbosacral trunc , the roots of s1s4 of sacral plexus , the ischiadic , and pudendal nerve are presented and preserved ( ( figures 15 , 16(a ) , and 16(b ) ) shown on the left ) ( pv , cranially ) . following preparation of the branches of the anterior internal iliac artery ( figure 17 ) the mesometrial nodes are usually removed concomitantly with resection of vascular mesometrium by tmmr in cervical or pmmr in endometrial cancer ( figure 18 ) . finally , the connection to the left common iliac region has to be established to guarantee complete node dissection also posterior to the sigmoid colon ( figure 19 ) . thus , the therapeutic pelvic lymphadenectomy is completed . in case of indication for periaortic lymphadenectomy two different situations have to be addressed : primary tumor involves uterine corpus and/or adnexa or the cervix only . in the first situation lymph drainage follows the vascular mesometrium and the infundibulopelvic ligament ; therefore primary lymph basins are pelvic and periaortic , simultaneously , and therefore have to be removed entirely . in the second situation periaortic lymph basins are of third or forth order and may be maintained in case of histologically proven negative pelvic nodes . in case of tumor involvement of the uterine corpus or the adnexa in addition to the vascular mesometrium also the network for vascular and lymphatic anastomoses between uterus and adnexa has to be removed , best covered by the peritoneal leaves of the broad ligament ( pmmr ) . the vascular and lymphatic drainage system along the ovarian vessels has to be removed in analogy to the vascular mesometrium up to its connection to the periaortic and pericaval lymph basins . whereas the vascular anastomoses to the mesenteric vessel system ( ascendant and descendant colon ) are dissected the connections to the periaortic lymph basins are preserved and removed together en bloc . on the other hand , if tumor is located in uterine corpus , exclusively , the deep gluteal , pudendal , and rectal nodes may be preserved , since usually there will be no upstream drainage in such situation except for clinically suspicious nodes . on the other hand , if it is located in uterine cervix only , periaortic lymphadenectomy has only to be performed in case of positive pelvic nodes , and resection of the ovarian vessel system is not mandatory . in case of cervical cancer inframesenteric periaortic lymphadenectomy may be performed following elevation of the superior hypogastric plexus , the inferior mesenteric artery , and the sigmoid colon ventrally , thus continuing lymphadenectomy from common iliac vessels ( figures 20 and 21 ) . it has to be ascertained to remove the interaortocaval nodes and the chains dorsally of vena cava and aorta ( figures 22 and 23 ) . the infundibulopelvic ligaments have to be resected first ; aorta , vena cava , the right ureter , and the right infundibulopelvic ligament ( figure 24(a ) ) are identified . mobilization of the right colic mesentery allows to identify vessel anastomoses to the ovarian vessel system and can be divided ( figure 24(b ) ) . following the ovarian vein the lateral border of the ovarian lymphovascular drainage bundle can be followed until the right angle between vena cava and right renal vein is reached . the duodenum usually is loosely attached to the preaortic region and has to be mobilized ( figure 25 ) . the right ovarian vein is isolated at the level of caval vein and dissected ( figure 26(a ) ) . now the lymphatic channels may be dissected cranially along the right renal vein and dorsally to the right paracaval region to expose the back bone . the lymphatic paraaortic system may now be pulled to the left , and the interaortocaval region will be exposed . the vertebral vessels will be freed from lymphatic tissue , and the vena cava now is cleaned at 360 degrees . care has to be taken to remove the dorsolateral lymph node chain running draining from deep right pelvis , which is not directly connected ventral chain . the right ovarian artery will be exposed , coagulated and divided ( figure 26(b ) ) . the left renal vein will now be identified at its caval angle and followed to lateral , and again the lymph channels will be dissected along the left renal vein until the left ovarian vein can be identified . now moving downward using the ovarian vein as lateral border and the aorta as medial border for mobilization and resection of left periaortic lymphatic basin left ovarian artery will be identified approximately at the level of right ovarian artery , coagulated , and cut ( figure 26(d ) ) . the left periaortic lymphatic tissue together with the left infundibulopelvic ligament can be separated from the inferior mesenteric system ( figure 27 ) and the superior hypogastric plexus . to do this the mesenteric vessels are elevated ventrally together with the nerve bundles , and the lymphatic tissue is mobilized and pushed through the paraaortic tunnel posterior to the mesenteric artery caudally ( figure 28 ) . doing this , attention has to be paid to preserve the nerve fibers of the inferior mesenteric plexus and the aortic plexus which can be separated from the lymphatic tissue ( figure 29 ) . the right part , especially the right sided crossing nerve fibers of the aortic plexus , however , for our experience can not entirely be preserved in case of therapeutic periaortic lymphadenectomy . the left infundibulopelvic ligament and periaortic lymph tissue are mobilized inframesenterically using the left aortic wall , the back bone , the sympathetic chain , and the left ureter as border , medially , dorsally , and laterally . ( figure 30 ) . if resection of the ovarian vessel drainage system is not necessary in case of cervical cancer the procedure can be performed identically following dissection of connecting vessels to the periaortic drainage system and lateralization of the ovarian vessels . during the preparation care should be taken to mobilize the entire lymphatic basins of interest and concomitantly preserve the autonomic nerve fibers and the ureteral supplying vessels as thoroughly as possible . this compartment defined lymphadenectomy in therapeutic intention is combined by compartment defined local surgery , for example , tmmr ( total mesometrial resection ) or fmmr ( fertility - preserving mesometrial resection ) for cervical cancer , pmmr ( peritoneal mesometrial resection ) for endometrial cancer or salpingo - oophorectomy with resection of ovarian vascular / lymphatic vessel system in early ovarian cancer . in total , 35 patients were operated with the diagnosis of endometrial ( n = 16 ) or cervical ( n = 19 ) cancer . all patients received a total mesometrial ( cervical cancer ) or a peritoneal mesometrial ( endometrial cancer ) resection of the uterus and therapeutic pelvic lymphadenectomy ( cervical cancer ) or therapeutic pelvic and periaortic lymphadenectomy ( endometrial cancer ) . the majority of endometrial as well as cervical cancer patients were diagnosed with figo i. no transition to open surgery was necessary due to complications or technical problems . we noted complication rates of 13% for endometrial cancer and 21% for cervical cancer . in the group of endometrial cancer patients , one patient had a superficial vein thrombosis , and one had a phase of transitional postoperative aphasia which resolved completely . in the group of cervical cancer patients , there were two reoperations due to formation of an intra - abdominal lymphocele / abscess and one due to postoperative bleeding . endometrial cancer patients with tumor stage figo iii and/or positive lymph nodes were treated with six cycles of adjuvant platinum based chemotherapy . patients with cervical cancer and positive lymph nodes received an adjuvant platinum based chemotherapy with or without irradiation . median followup was 20(22 ) month ( table 2 ) , and up to now 1 patient with cervical cancer and 2 patients with endometrial cancer developed recurrent disease . the patient with recurrence of cervical cancer presented with stage of pt2b , pn1 , and g2 and had rupture of the anterior cervical fascia during surgery with exposure of tumor to the surgical field . she refused radiation therapy and developed trocar site recurrence after 9 months , treated by radiation therapy and surgical excision , respectively . the first patient with endometrial cancer recurrence was a 26-year - old woman with massive overweight ( bmi 57 kg / m ) . the initial tumor stage was pt1a , n0 ( 0/29 ) , and g3 , and the histopathology revealed an endometrioid tumor type . she did not receive adjuvant treatment and presented one year after initial diagnosis with liver metastases ; there was no evidence of relapse in the pelvis . the second patient with recurrence of endometrial cancer had initially a tumor stage of pt3b , pn1 ( 24/46 ) , and g2 ( endometrioid histopathology ) . the tumor was completely resected , and the patient received an adjuvant chemotherapy with carboplatinum auc 5 and paclitaxel 175 mg / m d1 , q3w over six cycles . after 11 months , she presented with local pelvic recurrence and liver metastases and was treated with palliative chemotherapy . no patient , up to now , neither in cervical nor in endometrial cancer developed isolated locoregional recurrence . detailed data on patient characteristics and oncological outcome are depicted in tables 1 and 2 . we were able to show that the principle of compartment based surgery in uterine cancers , which is applied in the techniques of modified radical hysterectomies as tmmr and pmmr , can be translated with respect to the removal of the accordant lymphatic basins , to minimal invasive , robotically assisted procedures . the method appears to be feasible and safe , especially if we consider that the presented data were collected during the very first learning curve of the authors . although the followup time of our patients is limited , we are confident that the oncological outcome will be comparable to open surgery . due to the excellent visibility , the high precision , and control of preparation , the technical radicalness of lymph node dissection can be controlled individually and documented continuously for each single region allowing complete removal of tissue at least comparable to open surgery if not even better . in our experience first , compartment based surgery oncologically appears to exert excellent locoregional control combined with a lower complication rate especially regarding the autonomous nerve plexus . second , the translation to a minimal invasive method by robot assistance adds the advantages of minimal invasive surgery , regarding blood loss , mobilization , length of hospitalization , and short - term complications [ 14 , 15 ] . however , exposure of tumor to the surgical field has strictly to be avoided , as it is in classical laparoscopic surgery . in conclusion , we suggest that the minimal invasive approach of compartment based oncologic surgery for uterine cancers by robotic assistance is feasible , safe , and beneficial for patients . to evaluate whether the excellent monocentric data with excellent locoregional tumor control and low morbidity of hckel in cervical cancer [ 3 , 9 , 10 ] holds true in a multicenter approach independent of open or laparoscopic access , a multicenter observational study has been initiated , which will start recruitment in 2013 . however , for surgical studies it is crucial to define exactly the surgical procedure to be done . for therapeutic lymphadenectomy the technique described in this publication will be the reference basis , as it could be for other trials referring to therapeutic lymphadenectomy . in addition , operative procedure of tmmr and tlne is exactly defined by surgical videos of open and robotically assisted tmmr and therapeutic lymphadenectomy preceded by education at leipzig school of radical pelvic surgery and followed by onsite visit to control for the technique . in future , from our point of view , this kind of preparation and auditing of surgical studies could contribute to comparability between different sites , which is not only mandatory in scientific studies but may also beneficial in education and clinical practice . 3 d vision , hd quality , magnification of structures , and thus , excellent quality of surgical videos derived from robotic surgery will revolutionize our prospects for education , scientific research , and quality control .
objective . to define compartment based therapeutic pelvic and periaortic lymphadenectomy in cervical and endometrial cancer . compartment based oncologic surgery appears to be favorable for patients in terms of radicality as well as complication rates , and the same appears to be true for robotic surgery . we describe a method of robotically assisted compartment based lymphadenectomy step by step in uterine cancer and demonstrate feasibility data from 35 patients . methods . patients with the diagnosis of endometrial ( n = 16 ) or cervical ( n = 19 ) cancer were included . patients were treated by rtmmr ( robotic total mesometrial resection ) or rpmmr ( robotic peritoneal mesometrial resection ) and pelvic or pelvic / periaortic rtlne ( robotic therapeutic lymphadenectomy ) with cervical cancer figo ib - iia or endometrial cancer figo i - iii . results . no transition to open surgery was necessary . complication rates were 13% for endometrial cancer and 21% for cervical cancer . within follow - up time median ( 22/20 ) month we noted 1 recurrence of cervical cancer and 2 endometrial cancer recurrences . conclusions . we conclude that compartment based rtlne is a feasible and safe technique for the treatment of uterine cancers and is favorable in aspects of radicality and complication rates . it should be analyzed in multicenter studies with extended followup on the basis of the described technique .
hand , foot , and mouth disease ( hfmd ) , a common febrile illness in children , is usually caused by human enteroviruses . enterovirus 71 ( ev71 ) and coxsackievirus a16 ( ca16 ) are two major causative agents of hfmd . ev71 and ca16 infections manifesting as lesions on the skin and oral mucosa are clinically similar , but ev71 infection is more frequently associated with serious neurological diseases such as aseptic meningitis , encephalitis , and acute flaccid paralysis and fatalities [ 14 ] while the ca16-associated hfmd has a milder outcome . more than 500,000 hfmd cases caused by ev71 were reported nationwide , including 176 fatal cases in china since march 2008 . elucidating the cellular events following ev71 infection will facilitate the development of strategies to prevent and treat this virus . however , the molecular mechanisms of the host response to ev71 infection are not completely understood . micrornas ( mirnas ) have emerged as key regulators in many biological processes , from development to defense , at almost all organismal levels through mrna degradation or translational repression of their targets [ 7 , 8 ] . not only the mirna encoded by viral genomes but host encoded mirnas have been found participating in host - virus interactions . for example , liver - specifc mir-122 is an indispensable factor in supporting hepatitis c virus ( hcv ) replication , whereas , mir-125b and mir-223 directly target human immunodeficiency virus-1 ( hiv-1 ) mrna , thereby attenuating viral gene expression in resting cd4 t cells . it has been showed that epstein - barr virus ( ebv ) encodes five mirnas in its large dna genome . these mirnas can potentially regulate several genes encoding proteins involved in apoptosis , cell proliferation , signal transduction , transcription regulation , and immune response . in contrast , the global changes , mirnas expression during ev71 infection have not yet to be extensively elucidated . to determine which cellular micrornas play a role in the host response to enterovirus infection , in this study , we performed a comprehensive mirna profling in ev71-infected hep2 cells through deep sequencing . human epidermoid carcinoma ( hep2 ) cells were grown in rpmi 1640 medium ( invitrogen ) supplemented with 10% fetal calf serum ( fcs ) . when the hep2 cells were grown to 70% confluence in 25 cm flasks , they were infected with ev71 at a multiplicity of infection ( m.o.i . ) of 0.03 50% tissue culture infectious doses ( tcid50 ) and maintained after infection at 37c in rpmi 1640 medium with 2% fcs . hep2 cells were infected with ev71 as described above . at 6 h , 24 h , 48 h , 72 h , and 96 h post infection , total rna or mirna was extracted from cells using the mirvana kit according to the manufacturer 's protocol ( ambion ) . the quality and the concentration of the rna samples were monitored by gel electrophoresis and absorbance at a260/280 ratio . the mirna sequencing library construction followed standard procedure of solid small rna expression kit ( applied biosystem ) . different barcodes were introduced to two samples in the polymerase chain reaction of library construction , and all the samples were sequenced in a single sequencing run . solid data were first analyzed by solid system small rna analysis pipeline tool ( rna2map ) . the mirbase sequences ( sanger ) of human being were downloaded from mirbase ( http://www.mirbase.org/).the number of bases to use when generating initial seeds locations was 18 with a tolerance of 3 mismatches . after extension step , at potential conserved target genes of differentially expressed mirnas were firstly predicted by targetscan ( http://www.targetscan.org/ ) [ 1214 ] . target genes of some mirnas , such as mir-1972 , mir-1974 , mir-1975 , mir-1979 , and mir-764 , could not be predicted in targetscan database , we further predicted those mirnas targets using diana - microt v3.0 [ 15 , 16 ] . in brief , each differentially expressed mirna was submitted to targetscan individually and all of its targets predicted in targetscan or microt v3.0 were used for the following gene ontology ( go ) analysis ( http://www.babelomics.bioinfo.cipf.es/ ) . functional category enrichment based on the go terms was evaluated on the targets of these differentially expressed mirnas . to confirm the expression of mirnas by deep sequencing approach , stem - loop quantitative rt - pcr ( qrt - pcr ) was performed . in brief , cdna was synthesized from total rna by using amv reverse transcriptase ( takara ) . the 20 l reactions were incubated for 15 min at 16c , 30 min at 42c and 5 min at 85c , and then held at 4c . subsequently , real - time quantification was performed using an applied biosystems 7500 sequence detection system ( applied biosystems ) . the 20 l pcr reactions included 1 l rt - pcr product , 10 l premix ex taq ( takara ) , and 1 l sybr green ( invitrogen ) . the reactions were incubated in a 96-well optical plate at 95c for 10 min , followed by 40 cycles of 95c for 15 s and 60c for 1 min . after reaction , the threshold cycle value ( ct ) data were determined using default threshold settings , and the mean ct was determined from the duplicate pcrs . the expression levels of mirnas were measured in terms of ct and normalized to u6 using 2 . we firstly used the z test to determine the statistical significance of the differences between the two libraries . this approach is to look at the number of copies of a specifc mirna per cell as a fraction or proportion of the total number of mirna molecules in that cell . the same proportion of specifc tags should be present in the mirna library of all sequenced tags . in this test a false discovery rate mirnas were considered significantly altered only when they fulflled three criteria : ( 1 ) mean fold change > 2 or < 0.5 , ( 2 ) having at least 10 copies by solid sequencing , and ( 3 ) z score>1.96 or < 1.96 . cytopathic effect ( cpe ) was first observed at 24 h post infection and progressed to moderate and severe cpe at 72 and 96 h , respectively . mirna extracted from cells after 72 h infection was used for solid deep sequencing . a total of 411,419 and 479,414 filtered high quality reads were obtained from infected and control cells by deep sequencing , respectively . after filtrating reads contaminated by rrna , trna , snrna , and snorna , 35,272 and 78,143 reads were obtained from infected and non - infected cells , respectively . out of these reads , 11,188 of these high quality reads were exact matches while other 68,041 reads were loose matches to known human mirnas ( table 1 ) . loose matches were defined by sequence reads that aligned with human mirna consensus sequence with 14 mismatches . these may represent sequencing errors ( when occurring in low copy numbers ) , mutations , and/or rna editing events . the size distribution of sequence reads showed that the majority of mirnas was 1825 for both libraries ( > 90% ) , with 22 nt small rna being the most abundant ( figure 1 ) , which is within the typical size range of human mirnas . after reads were compared with an mirbase database ( release 14.0 ) , 569 mirnas were detected in ev71-infected cells while 540 mirnas were detected in non - infected control cells . on the basis of differentially expressed mirna , we found 64 that mirnas were differentially expressed between infected and non - infected cells . more mirnas ( 42 out of 64 mirnas ) were upregulated than down - regulated during ev71 infection in hep2 cells ( tables 2 and 3 ) . quantitative rt - pcr assays were used to confirm the expression pattern of differentially expressed mirnas in hep2 cells . there was general consistency between quantitative rt - pcr assay and deep sequence analysis in four mirnas ( mir-1246 , mir-1237 , mir-30a , and mir-222 ) in terms of directions of regulation and significance . specifically , there was a 1.92-fold upregulation ( 7.35-fold in deep sequencing analysis ) in mir-1246 , 1.58-fold upregulation ( 2.58-fold in deep sequencing analysis ) in mir-1237 , ( p < .05 ) , 2.45-fold down - regulation ( 2.94-fold in deep sequencing analysis ) in mir-30a , and 1.42-fold down - regulation ( 2.02-fold in deep sequencing analysis ) in mir-222 . targets were predicted for all identified differentially expressed mirna families . in total 5765 unique target genes were predicted for 64 of the differentially expressed mirnas ( see table s1 in supplementray material available online at doi:115/2010/425939 ) . on the basis of the biological functions described by fatigo program ( http://www.babelomics.bioinfo.cipf.es/ ) the majority of targets fall into the category of metabolic process , regulation of biological process , and cell communication indicating intense biological change in hep2 cells after ev71 infection . several other groups contain genes regulating death ( 255 target genes including 239 apoptosis - related target genes ) , neurological process ( 211 target genes ) , and immune response ( 120 target genes ) . hundreds of altered transcripts in response to ev71 infection were found in two transcriptomic studies [ 20 , 21 ] . to determine whether mirnas might be modulators of mrnas that were differentially expressed , we investigated whether those differentially expressed mrnas are enriched for predicted targets and interrogated their inversely correlated targets for functional associations . to our surprise , targets for differentially expressed mirnas or mirna families in the present study account for 12.1% ( 19 out of 157 ) of the differentially expressed mrnas in one study whereas they account for 22.4% ( 13 out of 58 ) of the transcripts that were significantly altered in another study ( tables 4 and 5 ) . many technologies have been developed for mirna profiling , including real - time quantitative rt - pcr , northern blotting [ 23 , 24 ] , and microarray analyses based on either direct hybridization or hybridization coupled with enzymatic extension [ 25 , 26 ] . , first two methods were not high - throughput while microarray method needs large amounts of starting materials . recent progress in high - throughput sequencing technologies allows deep sequencing of large libraries of short rnas [ 2730 ] . the longest reads are obtained by the 454 technology , which currently gives reads of about 400 base pairs ( bp ) . however , this technology yields much less reads than other techniques ( about 400 000 per sample ) . the solexa ( illumina ) and solid platform ( applied biosystems ) generates shorter reads ( up to 35 bp ) but yields 13 million reads per sample [ 28 , 29 ] . the other high - throughput technique , such as massively parallel sequencing ( mpss ) , gives more reads than solexa but the reads are even shorter , only 17 bp . in the present study , we used solid platform to explore differential mirna profling of hep2 cells response to ev71 infection . we obtained about 0.4 million reads in both samples , well below the capacity of solid . even now , we found that there was general consistency between quantitative rt - pcr assay and deep sequence analysis . so , solid deep sequencing successfully revealed mirna profling in ev71-infected and control hep2 cells . based on a comprehensive examination of mirna expression from ev71-infected and non - infected control hep2 cells , we identified 64 mirnas that were differentially expressed , with most of them ( 65.6% ) upregulated in ev71-infected cells . the altered patterns of cellular mirnas we observed for ev71-infected cells are similar in some respects to changes seen for cells infected with hepatitis c virus ( hcv ) but contrast with those with epstein - barr virus ( ebv ) and human cytomegalovirus ( hcmv ) in which more mirnas were dow - regulated in response to virus infection . most of the mirnas affected by ev71 are different from those affected by hcv , ebv , and hcmv . though their functions during virus infection have not been explored , their predicted target genes have been identified to be involved in virus entry , replication and propagation . for example , reticulon 3 ( rtn3 ) , one predicted target gene of mir-636 , can bind the 2c protein of enterovirus 71 and is required for viral replication , . poliovirus receptor - related 1 ( herpesvirus entry mediator c ) ( pvrl1 , also known as nectin-1 ) , another target gene of mir-636 , can serve as receptor for herpes simplex virus and pseudorabies virus entry . abhydrolase domain containing 2 ( abhd2 ) , one predicted target gene of mir-584 , is essential for hepatitis b virus propagation . thus , it will be important to investigate the mechanisms of regulation of mirna levels during virus infection , which could be at the stages of transcription , maturation , and/or degradation . the host response to viral infection represents complex orchestration of divergent pathways deigned to eliminate the virus and protect the host . as seen from gene ontology analysis , the top 3 gene ontology terms related to metabolic process which indicated ev71 infection have enormous effect on hep2 cells metabolism . intriguingly , neurological process , apoptosis , and immune response related go terms in biological process were also enriched from the predicted targets . considering the fact that ev71 can cause lethal encephalitis or myocarditis , both apoptosis and immune response contribute to ev71 pathogenesis . myocarditis , for example , represents an intricate interplay between virus and patient responses , in which both direct viral injury and immunopathologic damage caused by innocent - bystander phenomena affect the disease course . further study of the functions of those underlying mirnas related to neurological process , apoptosis , and immune response will help to elucidate the molecular mechanisms of ev71 pathogenesis . we did not assess the roles in infection of mirnas whose expression were altered after infection . as micrornas predominately function as repressors of target gene expression , we indeed found numbers of targets in an another transcriptomic research whose expression was inversely correlated with the expression of dysregulated mirnas in the present study . although all assays were executed when cells demonstrated similar cpe , the virus may interact with mirna regulatory pathways differently in different cell types in which human neural sf268 cells and rhabdomyosarcoma cells were used in those studies , respectively . even then , these findings suggest that expression modification of host mirnas during ev71 infection could be related to a number of cellular physiological processes that eventually control the cell fate . in summary , in this study , we identified the mirnas involved in the host response to ev71 infection using deep sequencing technology . once the role of these mirnas in the regulation of host - ev71 interaction has been determined , it will improve the protection and treatment strategies in enterovirus infection .
role of microrna ( mirna ) has been highlighted in pathogen - host interactions recently . to identify cellular mirnas involved in the host response to enterovirus 71 ( ev71 ) infection , we performed a comprehensive mirna profiling in ev71-infected hep2 cells through deep sequencing . 64 mirnas were found whose expression levels changed for more than 2-fold in response to ev71 infection . gene ontology analysis revealed that many of these mrnas play roles in neurological process , immune response , and cell death pathways , which are known to be associated with the extreme virulence of ev71 . to our knowledge , this is the first study on host mirnas expression alteration response to ev71 infection . our findings supported the hypothesis that certain mirnas might be essential in the host - pathogen interactions .
malignant melanoma has a unique position in the surgical and oncological fields as it is responsible for 79% of mortalities despite representing less than 5% of cutaneous malignancies . the considerable variation in recurrence and survival rates among melanoma patients has motivated many researchers to look at different variables and risk factors that could predict prognosis . revolutionised the management of malignant melanomas in early 1990s by developing the sentinel lymph node biopsy ( slnb ) technique , an important landmark in the management of clinical stage i and ii cutaneous melanoma . as a result this trial has shown that the presence of metastases in the sentinel node was the most important prognostic factor and has recommended completion lymph node dissection for patients with a positive slnb . there are several histopathological features that predict recurrence and survival , including the breslow 's thickness , the presence of ulceration , and the mitotic rate . age , sex , presence of lymphovascular invasion and sln status are other recognised risk factors . the impact of the anatomical location of the primary melanoma on prognosis has been a matter of controversy , but some studies have suggested that truncal and head and neck melanomas have a worse prognosis compared to other sites [ 68 ] . recent reports have shown that head and neck melanomas tend to present with macrometastases compared with truncal melanomas which are associated with micrometastases . furthermore , melanomas on the upper limb tend to be thinner compared to other sites , with longer survival rates but without an identifiable reason . axillary and inguinal lymph node dissections are performed when lymph basin is involved and are associated with significant morbidities including infection , wound dehiscence , bleeding , deep vein thrombosis , and most importantly lymphedema . a better understanding of the preoperative risk factors could help predict which patients are more susceptible to postoperative complications . furthermore , the development of complications in itself may have an impact on the recurrence and survival rates of patients . up to date , there is little data on the complication rates comparing different dissection techniques . the only large trail that investigated the impact of morbidity following lymphadenectomies found strong association between lymphedema with groin dissection ( 26.6% ) than that with axillary dissection ( 9% ) . several trials including the mslt compared the complications rates between different techniques in the similar lymph node groups . for example , in patients undergoing slnb , comparisons were made between ( 1 ) wider margins with slnb , ( 2 ) wider excision margins alone or ( 3 ) completion lymph nodes dissection [ 12 , 13 ] . in addition , a comparison between immediate and delayed lymph node dissection has also been reported . to our knowledge , no studies to date have examined the risk factors for complications or the role of complications , as being a predictor of melanoma recurrence . this is particularly important considering that the gold slandered treatment is very invasive and associated with high risk of complications and morbidity . thus , the primary objective of this study was to identify preoperative risk factors for postoperative complications . a secondary end point was to investigate the postoperative complications following alnd or ilnd as a possible predictor for melanoma recurrence . the presented data is of a single surgeon in a tertiary melanoma referral centre where we receive referrals from all hospitals in the southern provinces in ireland . a total of 317 patients underwent either an inguinal or axillary slnb as a staging procedure in cork university hospital for stage i / ii malignant melanoma ( breslow > 1 mm ) in this time period . all patients who subsequently went on to either an axillary or inguinal lymph node dissection due to a positive sln and who had no evidence of systemic metastases were included . the analysed data included patient - related variables such as gender , age at diagnosis , and primary melanoma site . the histology of the primary lesion was reviewed for melanoma type , clark 's level , breslow thickness , presence of ulceration , lymphovascular invasion , and mitotic index . the lymph node dissection samples were examined for the total number of nodes and the number of positive nodes . data from patients who developed disease recurrence was examined to determine the site of locoregional recurrence as well as the duration from the time of original diagnosis to recurrence . finally , postoperative complications , distant metastases and patient overall survival were recorded . alnd involved level i and level ii clearance . a level iii clearance , with preservation of pectoralis minor , was performed if suspicious intraoperative nodes were found . an infrainguinal lymph node dissection was performed as standard , unless there was evidence of suprainguinal lymph node involvement . the sentinel lymph node samples were sent for routine histopathological examination with hematoxylin and eosin ( h&e ) staining . negative nodes were further processed with specific immunohistochemical stains for protein s100 and melanoma - related antigen hmb45 . patients with positive nodes by either h&e staining or on immunohistochemistry were scheduled for immediate lymph node dissection . descriptive statistics such as rates and percentages were used for categorical data while mean standard deviations ( sd ) were used for continuous data . the categorical variables were tested using test , fisher 's exact test , or the wilcoxon rank - sum test . standard logistic regression analysis was used to calculate the relative risk as odds ratios ( or with 95% confidence intervals ( ci ) . twenty patients were excluded either because of missing data with regard to their primary histology or because of follow - up loss . these patients were divided into the ilnd group ( 60.6% ; n = 63 ) and the alnd group ( 39.4% ; n = 41 ) . the average age profile of patients in the ilnd was older compared to the alnd group ( 57.4 16.70 versus 50 16.06 years ; p = 0.03 ) . males were found to have a higher incidence of upper limb melanomas requiring alnd whereas females had a higher incidence of lower limb melanomas requiring ilnd ( p = 0.08 ) . in our population group lower limb melanomas were noted to have a higher breslow thickness ( 5.03 4.49 ) compared with melanomas of the upper limb ( 3.8 3.06 ; p = 0.11 ) . however , the alnd group had a higher rate of immunohistochemistry detected metastatic deposits ( p = 0.01 ) . patients who underwent ilnd had a higher mortality rate ( 68.3% versus 48.8% ; p = 0.05 ) compared to the alnd group . this is most likely a reflection of the higher recurrence rate in the ilnd group as seen in table 2 ( ilnd ( 84.1% ) versus alnd ( 63.4% ) ; p = 0.02 ) . it was noted that the ilnd group had relatively more complications compared to the alnd group ( 39.7% versus 34.1% resp . we found that male patients were more likely to develop complications after alnd compared to females in both univariate and multivariate analysis ( p = 0.03 , 95% ci 0.030.96 ) . with regard to patients in the ilnd group , patients with a clark 's level of 4 or more carried a higher risk of developing complications postoperatively ( p = 0.05 , 95% ci 0.9615.16 ) ( table 4 ) . despite the relative high complication rates in both groups , the impact on the development of local or distal metastases was not significant however , most patients who did develop complications after ilnd had a recurrence of their melanoma ( n = 19/25 , 75% ) . similarly , 10 out of 14 patients ( 71.4% ) who developed complications after alnd had melanoma recurrence ( table 5 ) . lymph node dissections carry significant morbidity with high rates of both acute and chronic complications . these complications negatively impact on the overall function and quality of life of these patients and also pose a significant financial burden to the health system . surgery , in itself , has been implicated as a potential promoting factor in the propagation of malignant lesions [ 14 , 15 ] and may also suppress cell - mediated immunity . taking this into account , both surgery and the complications of surgery can synergistically combine to facilitate the establishment of new metastases and the progression of preexisting micrometastases . for these reasons , we hypothesise that high complication rates following lymph node dissection might have an effect on metastases and could be used as a prognostic indicator for recurrence . the anatomical location of the primary lesion has been reported as an independent predictor of a positive sln and disease - free survival . however , this role is limited when compared to other well - established variables . our results show an increased incidence of upper limb and truncal melanomas in male patients whereas females had an increased incidence of lower limb melanomas . with regards to breslow thickness , it was observed that patients with upper limb melanomas had thinner tumours and a better overall survival . these findings are in accordance with previous reports [ 9 , 10 ] . the anatomical distribution and its relation to gender could be explained by different sun exposure patterns between genders . in addition , upper limb lesions are more likely to be noticed at an earlier stage , and thus treatment can be initiated sooner . a significant amount of heterogeneity was observed in our data among patients with nodal basin metastases . according to the mslt , node - positive patients who underwent an immediate lymphadenectomy had a longer disease - free survival with a lower risk of recurrence [ 18 , 19 ] . the long - term survival was also observed to be extended when a lymphadenectomy was performed for micrometastases compared to being performed in the setting of clinically detectable nodal disease . unfortunately , we reported a high mortality rate in our patients with no clinically detected nodes who went on to have an immediate lymphadenectomy . this is most likely explained by the disease stage at presentation ; 49% of our patients had a breslow thickness of > 3.5 mm , which is the upper limit in most trials as it has been associated with a poor outcome . nonetheless , we included this category of patients in our study as it is a real - time reflection of our overall practice and to avoid any selection bias . it has been reported that morbidity is higher in patients undergoing inguinal lymphadenectomy compared to those undergoing axillary or cervical lymph node dissection . however , in the literature , there is no difference in the complication rates between alnd and ilnd which correlated with the findings in this study ( 39.7% in ilnd versus 34.1% in alnd , p = 0.57 ) . the literature was reviewed with particular emphasis on differences between the dissection groups . in the ilnd group a trend for developing lymphedema was noted in the deep dissection group . despite the higher rate of regional recurrence after superficial dissections compared to deep dissections the published rate of complications following groin dissection is quite variable . using wound infection rates as an example , our 9.5% infection rate is midway in the published figures which range from 5 to15% . similarly , our lymphedema rate of 22.2% is comparable to the published range of 2140% [ 25 , 26 ] . variations in surgical technique of alnd have a minimal effect on the development of complications . for example , dissections either above or below the axillary vein do not increase the complication rate with an incidence of long term lymphedema between 112% [ 12 , 27 ] . we report an incidence of 14.6% for both lymphedema and seroma formation in our study . it is worthwhile mentioning that due to the high incidence of seroma formation after axillary surgery , some authors consider it as a consequence of the surgery other than a direct complication . our results did not show a statistical significant correlation between the development of postoperative complications and the risk of recurrence of melanoma . it is important to remember that this data applies to a cohort of patients with relatively very thick melanomas which inheritably carries a higher recurrence rate . however , it is not yet known if this data applies to patients with thinner melanomas . in conclusion , male patients tend to have more complications after axillary clearance compared to females . in the ilnd group , a clark 's level of 4 or more is a predictor for the development of complications . finally this study shows that patients who developed complications had a higher incidence of melanoma recurrence ; however , this did not reach significance and hence may not represent a true association .
background . although postoperative complications are common after lymph node dissection , its association with disease recurrence has not yet been fully investigated . methods . a retrospective review of a prospectively maintained database was conducted , looking at all malignant melanoma patients with sentinel nodes positive disease requiring axillary or inguinal dissection between 2002 and 2011 . results . a total of 124 patients required nodal clearance from 317 patients with stage i / ii malignant melanoma who had undergone sentinel lymph node biopsy . of these , 104 patients met the inclusion criteria and were divided into inguinal lymph node dissections ( ilnd ; n = 63 ) or axillary lymph node dissections ( alnd ; n = 41 ) . immunohistochemical deposits had higher detection rate in alnd ( p = 0.01 ) . the ilnd patients had a higher recurrence rate ( 84.1% versus 63.4% ; p = 0.02 ) and mortality ( 68.3% versus 48.8% ; p = 0.05 ) without a significant difference in complications . in patients whom complications developed , 75% of the ilnd group and 71.4% of the alnd group had disease recurrence , but without reaching a statistical value as an independent predictor of melanoma recurrence . conclusion . complications are common following ilnd and alnd ; however there is no significant difference in complications rates between the groups with some associations with recurrence without reaching a significant difference .
food allergies such as tree nut allergies are potentially fatal group of immune - mediated disorders . recent studies demonstrate that both the prevalence and severity of food allergies are escalating for reasons that are not well understood at present [ 1 , 2 ] . tree nut allergies , along with peanut allergy , are the leading causes of food - induced systemic anaphylaxis in usa and european countries . furthermore , once individuals are sensitized , there is a very low potential for outgrowing tree nut allergies [ 4 , 5 ] . consequently , they are considered not only serious but also persistent health problems for rest of the life of sensitized subjects [ 4 , 5 ] . the specific identity of t- and b - cell subsets that expand during the early stages of establishment of life - threatening nut allergies is largely unknown at present . notably , most of the current knowledge about early expansion and establishment of immune memory cells comes from studies of infectious diseases [ 612 ] . knowledge about identity of such immune cells is urgently needed for potential therapeutic targeting in nut allergies . we have previously reported an adjuvant - free mouse model of tree nut allergy using hazelnut as a model tree nut . this model employs a protocol combining transdermal sensitization followed by oral allergen challenge to elicit systemic anaphylaxis [ 1315 ] . furthermore , hazelnut allergy , once established , remains persistent even when the allergen is withdrawn for at least eight months in this model ; and persistence of clinical sensitivity is associated with robust memory t - cell and memory b - cell responses . since this model does not use an external adjuvant , it offers a unique opportunity to determine the phenotype of t- and b - cell subsets that expand during the early stage establishment of nut allergy . here we report the identification of the phenotype of t- and b - cell subsets that expand in the central and peripheral lymphoid organs during the establishment of nut allergy in this mouse . hazelnut protein extract ( greer labs , lenoir , nc , usa ) : protein content of these three protein extracts was measured by lowry 's method . normal saline was prepared in our lab ( 0.85% w / v nacl solution ) : streptavidin alkaline phosphatase ( jackson immunoresearch , west grove , pa , usa ) . the following fluorochrome - conjugated monoclonal antibodies were purchased from bd biosciences ( san diego , ca , usa ) : cd3e ( clone 145 - 2c11)-percp - cy5.5 , cd4(clone gk1.5)-apc - h7 , cd8alpha(clone 53 - 6.7)-fitc , cd80(16 - 10a1)-fitc , and cd73(ty/23)-pe , while cd44(im7)-pe , cd62l(mel-14)-apc , and b220(ra3 - 6b2)-alexafluor700 were purchased from ebiosciences ( san diego , ca , usa ) . all mice were purchased from jackson laboratories ( bar harbor , me , usa ) . transdermal sensitization followed by oral allergen challenge protocols was performed using the method described previously [ 17 , 18 ] . sensitization was determined by measuring hazelnut - specific ige antibody levels in the plasma using an elisa - based method as described . systemic anaphylaxis upon oral allergen challenge was quantified by rectal thermometry before and at 30 minutes after oral challenge using a digital temperature probe ( thermalert th-5 , physitemp ; nj , usa ; instrument specifications : resolution : 0.1c ; accuracy 0.1c 1 digit ; operating range : 2545c ) . animals were euthanized 1 hr after oral challenge and used for tissue collection . following euthanasia after 1 hour after oral challenge and collection of hypothermia data , bone marrow , spleen , and mesenteric lymph nodes cells were blocked with antimouse cd16/32 ( 2.4g2 prepared in house ) on ice for 10 minutes . subsequently , cells were stained with either a memory t - cell master mix ( cd3 , cd4 , cd8 , cd44 , and cd62l ) or memory b - cell master mix ( b220 , cd80 , cd73 , cd44 , and cd62l ) of monoclonal antibody - fluorochrome conjugates . each monoclonal antibody - fluorochrome conjugate was used at concentrations recommended by the manufacturer or previous antibody titration . cells were incubated with the master mix for 30 minutes on ice in the dark , washed twice with facs buffer , and run on a bd facs canto ii flow cytometer . postacquisition flow cytometry analysis was performed using flowjo software ( tree star , inc . , live cells were gated based on forward scatter and side scatter for both t- and b - lymphocyte samples . t cells were gated as cd3 + on a histogram , cd4 + or cd8 + based on a dot plot , and subsequently a quadrant was drawn to separate cd44 and cd62l+ for each t - cell subset . central memory cd4 and cd8 t cells were defined as cd44/cd62l [ 9 , 19 ] . for b - cell analysis , histogram of b220 was drawn out of live cells , and a quadrant gate was used to distinguish cd62l+ and cd80 + cells . increased expression of cd80 , cd62l and cd73 is indicative of memory b - cell phenotype , and expression of cd73 may indicate isotype switched b cells [ 20 , 21 ] . anova and student 's unpaired tests with welch correction were used to evaluate significance using a software program ( graphpad software , san diego , ca , usa ) . groups of mice were rendered hazelnut allergic using the transdermal sensitization followed by oral elicitation of systemic anaphylaxis to hazelnut that we have described before . the induction of hazelnut - specific ige antibody response upon transdermal exposure is shown ( figure 1(a ) ) . systemic anaphylaxis to oral allergen challenge was confirmed by hypothermia responses ( figure 1(b ) ) . the gating strategy we used , the phenotype of expanding t- and b - cell subsets , in the central and peripheral lymphoid organs is shown in figures 2(a ) and 2(b ) . we examined the subsets of cd4 cells for nave versus memory phenotype using high cd62l expression as a marker of nave cells and low cd62l expression as a marker of memory phenotype . as evident , there was consistent expansion of cd4 + cd62l t cells in bone marrow and spleen ( figures 3(a)3(c ) ) . although there was a similar trend in the mln , it was not statistically significant . we also examined the subsets of cd4 cells for nave versus memory phenotype using high cd44 expression as a marker of memory cells and low cd44 expression as a marker of naive phenotype . as evident , there was a modest increase in the number of cd4 + cd44 + t cells in bone marrow and spleen , but this was not statistically significant ( table 1 ) . then we examined the b cells for nave versus memory phenotype using antibodies to cd80 and cd62l as markers . as evident , there was a modest increase in the proportion of cd80 + b cells in the bm , spleen , and mln . a similar trend was noticed for cd62l b cells in bm and spleen but not in mln ( table 2 ) . we surprisingly found a significant reduction in cd73 expressing cells among b cells with both cd80 + cd62l+ and cd80 + cd62l phenotypes in the mesenteric lymph nodes but in bone marrow or the spleen ( figures 4(a)4(c ) ) . this study was undertaken to identify the phenotype of t- and b - cell subsets that expand during the early stages of establishment of hazelnut allergy in an adjuvant - free mouse model that we have described and characterized before [ 1315 , 22 ] . we studied the immune cell expansion in the bone marrow as a central lymphoid organ , spleen as a systemic peripheral lymphoid organ , and the mesenteric lymph node as representative draining lymphoid organ of the gut . there are three novel and important findings from this study : ( i ) we report a significant expansion of cd4 + cd62l t cells in both the bm and the periphery ; ( ii ) an increase in cd80 + and cd62l b cells in bm and the periphery ; ( iii ) a significant downregulation of cd73 expression on a subset of b cells particularly in the mln . we have previously reported that hazelnut allergy once established in model remains persistent for up to 8 months despite withdrawing allergen exposure . however , the specific phenotype of immune subsets that expand at early stages of the disease establishment in the allergic mice was unknown . as a first necessary step towards the long - term goal of identifying the phenotype of persistent t- and b - cell subsets in this model , here we characterized the phenotype of immune cells that expand early on in this model . we are not aware of previous studies examining this in hazelnut allergy or other models of nut food allergy . it has long been held that memory b cells that expand during immune responses during the early stages reside in the bm and memory t cells reside in the lymph nodes [ 2325 ] . however , recent studies clearly demonstrate that nearly 80% of antigen - specific memory t cells reside in the bm in mice upon infection . our data demonstrate for the first time that hazelnut causes significant expansion of cd4 + cd62l t cells in bm as well as in the periphery . in addition there was a modest elevation of such b cells in bm or the spleen that was not statistically significant . one previous study examined memory t - cell phenotype in a mouse model of airways allergy / asthma . they reported expansion of cd62l memory t cells in the lungs of mice with chronic asthma . it is noteworthy that our data using an adjuvant - free mouse model also demonstrates that cd4 + cd62l t cells are induced in both the spleen and bone marrow in response to hazelnut exposure . clearly , more studies are needed to test whether they are long - lasting memory cells and to determine whether long - term persistence of hazelnut allergy in this model is associated with long - lived such subsets in bone marrow or spleen or both . the surface marker , cd73 , is a glycosyl - phosphatidylinositol- ( gpi-)anchored signaling molecule expressed on both t and b cells [ 20 , 27 ] . other studies have identified cd73 as an important marker of b - cell memory subsets . because of this significance , we examined cd73 and found that a significant proportion of cd80 + b cells downregulates cd73 expression in allergic mice . this suggests that this unusual subset of cells might represent a subset of quiescent b cells that we hypothesize as a potential subset of memory b cells . based on previous reports in the literature , one can use cd62l as a marker to distinguish nave versus memory t cells and cd80 , cd62l , and cd73 as markers of memory b cell subset phenotype . we , however , acknowledge the fact that memory cells are known to be and expected to be heterogeneous , and choosing only a few selected markers is a limitation of our study . also cell analyses were done in mice after they were orally challenged with the allergen to induce shock . therefore , shock - induced redistribution of cells ( if at all occurred in this short time of 1 hour , which is very unlikely ) also possibly contributed to the observations in this study . these data demonstrate for the first time that during the early stages of establishment of hazelnut allergy there is ( i ) expansion of cd4 + cd62l t cell subset in both the bm and the periphery , ( ii ) expansion of cd80 + and cd62l b - cell subset in bm and the periphery , and ( iii ) a significant downregulation of cd73 on a subset of b cells particularly in mln .
nut allergies are potentially fatal and rarely outgrown for reasons that are not well understood . phenotype of t- and b - cell subsets that expand during the early stages of nut allergy is largely unknown . here we studied this problem using a novel mouse model of nut allergy . mice were rendered hazelnut allergic by a transdermal sensitization / oral elicitation protocol . using flow cytometry , the t- and b - cell phenotype in the bone marrow ( bm ) , spleen , and the mesenteric lymph node ( mln ) of allergic and control mice was analyzed . nut allergic mice exhibited an expansion of cd4 + cd62l t cells in bm and spleen ; a similar trend was noted in the mln . there was expansion of cd80 + b cells in bm and spleen and mln and cd62l cells in bm and spleen . interestingly , among cd80 + b cells , significant proportion was cd73 particularly in the mln . these data demonstrate that during the early establishment of hazelnut allergy there is ( i ) expansion of cd4+cd62l t - cell subsets in both the bm and the periphery , ( ii ) expansion of cd80 + and cd62l b - cell subsets in bm and the periphery , and ( iii ) a significant downregulation of cd73 on a subset of b cells in mln .
vascular graft salvage is successfully manageable with a muscle flap , following wound debridement and targeted antimicrobial therapy , in 7884% of groin infections [ 13 ] . in this context , four types of flaps have been described , including transposition of the sartorius muscle [ 4 , 5 ] , the gracilis muscle [ 5 , 6 ] , the rectus abdominis and rectus femoris muscle . in complicated cases these flaps may , however , not be feasible because of previous use or a compromised vascular supply as their pedicle is distally from the groin . we report a case in which the external oblique muscle was used to salvage an infected vascular graft . an 81-year - old woman , who had been given an aortobifemoral dacron prosthesis in 2007 for occlusive aortoiliac disease , was seen at our clinic with a persisting medial malleolar wound in september 2014 . thrombosis of the left iliac part of the aorta - bifemoral graft explained the insufficient healing . an unsuccessful attempt to recanalize the graft percutaneously required a reconstruction with a femoro - femoral crossover bypass in october 2014 . she was readmitted after blood loss had occurred from her right groin , 6 weeks after the crossover operation . because of the risk of exsanguination due to anastomotic rupture , an emergency exploration was performed and showed incorporation of the largest part of the graft with surrounding tissue . an infected hematoma in contact with the graft was found at the anterior side of her right quadriceps muscle . the sartorius muscle was proximally released and the proximal part of the graft was covered . subcutaneous tissue was closed with a running absorbable suture ( polysorb 3 - 0 , covidien , mansfield , usa ) and the skin was left open ( fig . vacuum - assisted closure ( vac ) ( kci medical , san antonio , usa ) therapy was started immediately postoperatively . bacterial culture confirmed infection with aerobic- and anaerobic bacteria ( proteus vulgaris , citrobacter koseri and bacteroides fragilis ) . in line with the sensitivity of these microorganisms , treatment was started with piperacilline / tazobactam . duplex ultrasound examination 1 week later showed a patent bypass and computed tomography 10 days thereafter did not show any fluid surrounding the graft . white blood cell count remained normal , and c - reactive protein ( crp ) dropped from 111 mg / l to 52 mg / l after 2 months . the hematoma did not seem macroscopically infected ; it was drained through the previous incision and through a new incision laterally , thus diverting the infection away from the graft . anticoagulation for atrial fibrillation was temporarily interrupted , but the wound did not heal well and crp rose to 224 a third exploration was performed 3 days later and again the remainder of a hematoma was removed . a part of the graft was not covered by the sartorius muscle . in a second attempt to cover the graft , the external oblique muscle was released medially from the linea alba and rotated laterally and caudally , into the groin ( fig . 2 ) . figure 2:drawings before ( a ) and after ( b ) reconstruction with sartorius- and oblique external flap . drawings before ( a ) and after ( b ) reconstruction with sartorius- and oblique external flap . granulating tissue showed better vascularization 3 days thereafter , and again crp dropped to 42 mg / l ( fig . bacterial cultures showed the presence of enterococcus faecalis bacteria and antibiotics were changed to amoxicillin with clavulanic acid , combined with ciprofloxacin and was continued for 6 weeks . figure 3:appearance of the wound after removal of negative pressure , 4 days after the oblique external flap . appearance of the wound after removal of negative pressure , 4 days after the oblique external flap . the patient was discharged home 6 days postoperatively and vac - therapy was continued for 2 months , partially at home . figure 4:approximately half a year post oblique flap ; the wound is fully healed without a fistula . approximately half a year post oblique flap ; the wound is fully healed without a fistula . this report indicates that in complicated cases coverage of an infected vascular graft in the groin with the external oblique muscle flap can help preserve the graft and assist in wound closure . the external oblique muscle is a type v muscle with both dominant and multiple segmental vascular pedicles . the dominant pedicles are one or two branches of either the deep circumflex iliac artery ( 94.7% ) or the iliolumbar artery ( 5.3% ) . the use of the external oblique muscle has predominantly been described for chest wall reconstruction . advantages that the external oblique muscle flap offers are its simple release and its lateral vascularization , facilitating rotation . even though it is a very thin muscle , it seems to have the ability to grow in an infected environment to form a large bulky protection of the synthetic bypasses . the vascularization of the external oblique muscle and the non - smoking status of the patient contributed to the favorable outcome . because of the extension of the external oblique muscle cranially , further mobilization is possible , thus enabling coverage of larger areas in the infected groin . one other advantage may be derived from its cranial position and its blood supply ; the viability of the flap does not depend on the vascularization through a ( infected ) bypass graft , as is the case in sartorius- , rectus femoris- and gracilis flaps . also , its blood supply is not dependent on the epigastric artery , essential for rectus femoris flaps . this epigastric / mammary artery is often used in coronary artery bypass surgery ( cabg ) in patients with peripheral artery disease . to the best of our knowledge , external oblique muscle coverage of a vascular graft has not been described previously and is a feasible , effective , technically simple and safe procedure . it is an attractive option in complicated cases , in which previous muscle transpositions were unsuccessful . it can cover large vascular grafts in the groin , particular in patients with poor vascularization distally and in post - cabg patients . a larger series including functional long - term outcomes are required to confirm the above . none of the authors has a financial interest in any of the products , devices or drugs mentioned in this manuscript .
abstractabdominal muscles , such as the oblique- and transverse muscles , find their blood supply from multiple segmental pedicles from the iliac artery . besides its superior vascularization , its release is simple , leaving two abdominal muscles for securing abdominal wall strength . the release of the muscle and coverage of the graft requires partial muscle mobilization and is a minor reconstruction , but extension of the mobilization cranially enables coverage of larger defects . we present a case of an infected vascular graft in the groin successfully preserved through coverage with an external oblique muscle flap .
this randomized controlled study was conducted in a tertiary care teaching institute of rajasthan after taking approval from the institutional ethics committee . data were collected in the approved pro forma after taking written consent of the patient . all the sputum - positive tubercular patients aged between 18 and 65 years of either sex without history of any osteoarthritic condition and intake of any other hyperuricemic drugs were included in the study in whom standard four - drug att was given . patients having hepatic dysfunction , history of renal calculi , pregnant , and lactating females were excluded from this study . serum uric acid level was monitored at 0 , 2 , 4 , 6 , and 8 week of att . patients whose uric acid level was found to be increased at 2 week were finally recruited in the study . ninety patients who developed hyperuricemia due to att were divided randomly into three groups ( group a , group b , and group c ) of thirty patients each . group a was treated with febuxostat and group b with allopurinol at a daily dose of 40 and 300 mg , respectively . mean serum uric acid levels were calculated at all the weeks in all the groups , and serum uric acid levels were compared by applying student 's t - test and anova . a total of ninety patients were recruited in this study who developed hyperuricemia after 2 weeks of starting att , of which sixty patients were male and thirty patients were female . the mean age of the patients was 41.5 years ( ranging from 18 to 65 years ) . mean serum uric acid levels were calculated , and it was found that serum uric acid levels increased sharply at 2 week in all the groups a , b , and c as shown in table 1 . mean uric acid levels at various weeks in all the groups mean serum uric acid level decreased from 10.698 mg / dl ( at 2 week ) to 7.846 mg / dl ( at 8 week ) in group a and from 11.34 mg / dl ( at 2 week ) to 7.280 mg / dl ( at 8 week ) in group b. the mean levels decreased significantly at 4 , 6 , and 8 weeks when compared with mean values at 2 week . however , when values at 8 week were compared with baseline ( at 0 week ) values , the difference was still significant which suggests that drugs were able to decrease serum uric acid level but could not attain the baseline level . it was observed that at 8 week , 63.33% of patients were having serum uric acid level > 6 mg / dl and 53.33% of patients were having > 6.76 mg / dl in group a , and in group b , 70% of patients were having serum uric acid level > 6.0 mg / dl and 53.33% of patients were having > 6.8 mg / dl at 8 week . the mean serum uric acid levels at all the weeks , i.e. 0 , 2 , 4 , 6 , and 8 week were compared by applying student 's t - test between group a and b , group a and c , and group b and c and were found to be nonsignificant at all the weeks . when the anova was performed for all the weeks within the three groups , comparison of serum uric acid level during weeks in various groups one patient responded well to febuxostat but developed hypersensitivity ( developed itching after starting the drug which subsided after stopping it ) to it and was switched to allopurinol but did not respond to allopurinol . one patient who was treated with febuxostat , uric acid lowered only slightly but responded well to allopurinol . serum uric acid level increased in spite of taking febuxostat in one patient but responded to allopurinol . one patient developed hypersensitivity to allopurinol ( developed itching and rashes after taking the drug which subsided after stopping it ) . in one patient , allopurinol was not able to reduce serum uric acid level to a great extent and hence switched over to febuxostat and responded well . one patient responded well to febuxostat whose serum uric acid level increased in spite of taking allopurinol . expenditure of the patient on including either of the two drugs was compared , and the difference was calculated . 2.33/tablet , and it has to be taken thrice daily , i.e. cost / day was found to be rs . 7.70/tablet , and it has to be taken once daily , i.e. the cost / day was found to be rs . difference between the two drugs was found to be 71 paise / day or rs . tb was virtually wiped out with the help of antibiotics which were developed in 1950s , but the disease resurfaced in potent new and dangerous forms such as multidrug - resistant tb and extensive drug - resistant tb . pza is an important constituent of att but at times forcing its withdrawal due to hyperuricemia . in this study , an attempt was made to continue att without withdrawing pza with the help of adding drugs which decrease synthesis of uric acid by inhibiting xanthine oxidase enzyme . a number of previous studies including three randomized controlled trials have been conducted to compare the two drugs in patients of gout and hyperuricemia , and results were in favor of febuxostat . results of our study suggested that it was possible to continue pza in the patients with the help of these drugs . both drugs were found to be equally efficacious in lowering the serum uric acid levels possibly the reason for same efficacy might be the same mechanism of action of inhibiting the synthesis of uric acid by inhibiting xanthine oxidase . according to singal et al . study , febuxostat is a great addition to the armamentarium for gout management particularly in patients in whom allopurinol has failed because of either lack of efficacy or due to adverse events because of intolerance to allopurinol . moreover , a committee of the british national institute for health and clinical excellence concluded that although febuxostat is found to be more effective than fixed - dose ( 300 mg ) allopurinol , it had not been found to be clinically more efficacious or cost - effective than allopurinol . numbers of adverse events encountered across both the treatment groups were same with both the drugs . allopurinol is known to cause severe hypersensitivity reactions , but after reviewing literatures , it was discovered that such reactions are usually seen after long - term administration of the drug . the phase iii trials and long - term follow - up also showed the incidence of adverse events with febuxostat to be similar with that of allopurinol . the reasons for no or little response with febuxostat could be explained on the basis of that the dose was not increased further . no response with either of the two drugs can also be explained because of variation in response due to individual variation in metabolizing the drugs . favorable point for using febuxostat could be that it requires only once - daily administration resulting in better patient compliance . moreover , overall incidence of adverse effects is also few with febuxostat according to previous studies as compare to allopurinol . as stated earlier that a committee of the british national institute for health and clinical excellence also concluded that it had not been shown to be clinically more efficacious or cost effective than allopurinol and recommended febuxostat for people who are intolerant of allopurinol . this study concludes that both allopurinol and febuxostat were equally efficacious in lowering pza induced raised serum uric acid level in tubercular patients , and it was possible to continue att without withdrawing pza in patients who developed hyperuricemia due to it . similar studies are required in future because ethambutol , constituent of att , also known to increase serum uric acid levels in about 50% of patients was not considered in the present study . other factors such as genetic predisposition and genetic polymorphism could also affect , and alter serum uric acid levels have not been taken into consideration in our study .
objectives : to compare the efficacy and safety of febuxostat and allopurinol in pyrazinamide ( pza)-induced hyperuricemia in patients taking antitubercular therapy ( att).methods : this randomized controlled study was conducted at a tertiary care teaching institute of rajasthan in all the sputum - positive tubercular patients aged between 18 and 65 years of either sex . serum uric acid level was monitored at 0th , 2nd , 4th , 6th , and 8th week of att . patients whose uric acid level was found to be increased at 2nd week were finally recruited in the study . ninety patients who developed hyperuricemia due to att were divided randomly into three groups ( group a - febuxostat , group b - allopurinol , and group c - control ) of thirty patients each . mean serum uric acid levels were calculated at all the weeks in all the groups , and serum uric acid levels were compared by applying student 's t - test and anova.results:mean serum uric acid level decreased from 10.698 mg / dl ( at 2nd week ) to 7.846 mg / dl ( at 8th week ) in group a and from 11.34 mg / dl ( at 2nd week ) to 7.280 mg / dl ( at 8th week ) in group b. numbers of adverse events encountered across both the treatment groups were same with both the drugs.conclusion:allopurinol and febuxostat were equally efficacious in lowering pza induced raised serum uric acid level in tubercular patients , and it was possible to continue att without withdrawing pza .
anesthesia - controlled time ( act ) and turnover time are 2 of the most important factors that regulate operation room ( or ) efficiency . extubation time is of special interests to surgeons and anesthesiologists because it could be affected by different anesthetic agents or techniques . prolonged extubation time would cause slowing of work flow , having or members staying idly waiting for extubation , and the surgeon have to wait longer for next operation . , choosing appropriate anesthetic agents or techniques to avoid prolonged extubation is essential for anesthesiologists in order to improve the efficiency of or . dexter and epstein recommended that recording extubation time and monitoring the incidence of prolonged extubation is very important especially at facilities that have at least 8 hours of cases and turnovers . the act between total intravenous anesthesia ( tiva ) with propofol and desflurane ( des ) anesthesia was investigated , nevertheless , the results are controversial . the majority of these studies comparing the effects of different anesthesia regimens on or efficiency have tended to focus on ambulatory or short - time surgery . as our best knowledge , we found no comparisons in different anesthetic techniques for the improvement of act in open major upper abdominal surgery under general anesthesia ( ga ) . moreover , different propofol delivery techniques such as target - controlled infusion ( tci ) and syringe pump infusion were used in these studies and may lead to different results . the aim of our present study was to determine whether the use of tiva with tci system is more effective than des anesthesia in reducing act in patients undergoing open major upper abdominal surgery . this retrospective study was approved by the ethics committee ( tsghirb no : 100 - 05 - 168 ) of tri - service general hospital , taipei , taiwan ( chairperson , professor pauling chu ) on august 29th , 2011 . irb allows waiving the requirement for obtaining informed consent , and patient records were anonymized and deidentified prior to analysis . the information was retrieved from the medical records and the electronic database of tri - service general hospital ( tsgh ; taipei , taiwan , republic of china ) . we enrolled 343 patients ( american society of anesthesiology class i iii ) who received elective open major upper abdominal surgery under tiva with tci or des anesthesia from january 2010 to december 2011 . exclusion criteria include : body mass index ( bmi ) > 35 kg / m , liver resection , emergent surgeries , patient 's age younger than 18 years , combined tiva with inhalation anesthesia or epidural anesthesia , other inhalation anesthesia besides des , patients were sent to the intensive care unit , or incomplete data . regular monitoring , such as noninvasive blood pressure , arterial line , electrocardiography ( lead ii ) , pulse oximetry , and end - tidal carbon dioxide ( etco2 ) pressure , was applied in each patient . the patients were then intubated and maintained with propofol or des and the analgesic fentanyl . in our common practice , we take patients to the postanesthetic care unit ( pacu ) after extubation and did not extubate in pacu . in the tiva group , ( 2 g / kg ) and 2% lidocaine ( 1.5 mg / kg ) . continuous infusion of propofol ( fresfol 1% ) was delivered subsequently using schneider kinetic model of tci ( fresenius orchestra primea ; fresenius kabi ag , bad homburg , germany ) with the effect - site concentration ( ce ) of 4.0 g / ml . rocuronium ( 0.6 mg/ kg ) was administered when patients lost consciousness , followed by tracheal intubation . anesthesia was maintained using tci with propofol ce 3 to 4 g / ml and an oxygen flow of 0.3 l / min . repetitive bolus injections of cisatracurium and fentanyl were prescribed as required throughout the procedure . in the des group , fentanyl ( 2 g / kg ) , 2% lidocaine ( 1.5 mg / kg ) , and propofol ( 1.52 mg / kg ) . when patients lost consciousness , 0.6 mg / kg of rocuronium was administered , followed by endotracheal intubation . anesthesia was maintained using 8% to 12% des ( inhaled concentration ) in an oxygen flow of 300 ml / min under a closed system without nitrous oxide . maintenance of the ce for the tci with propofol and des concentration was adjusted at the range of 0.2 g / ml and 0.5% , respectively , according to the hemodynamics . if 2 increments or decrements were unsuccessful , the range of ce for tci propofol and des was increased to 0.5 g / ml or 2% , respectively . the etco2 pressure was maintained at 35 to 45 mm hg by adjusting the ventilation rate and maximum airway pressure . once neuromuscular function returns , cisatracurium ( 2 mg , i.v . ) was administered as required . ce of propofol or des concentration was tapered to 2.0 g / ml or 5% respectively at the beginning of skin closure . at the last 5 stitches of surgery , propofol or des was discontinued , but the oxygen flow was kept 300 ml / min . at the end of the skin closure , the lungs were ventilated with 100% oxygen at a fresh gas flow of 6 l / min . reversal of neuromuscular function was achieved by administrating neostigmine ( 0.030.04 mg / kg ) with glycopyrrolate ( 0.0060.008 mg / kg ) once spontaneous breathing returned to prevent residual paralysis . when the patient regained consciousness by name with spontaneous and smooth respiration , the endotracheal tube was removed and the patient was sent to the pacu for further care . an extubation time ( from the end of skin closure until extubation ) equal or longer than 15 minutes is considered prolonged extubation . data are presented as the mean and standard deviation , number of patients , or percentage . multivariable logistic regression analyses were performed to assess the association between variables contributed to prolonged extubation . after excluded from the electrical record , another 56 patients were excluded from the analysis . of those excluded , 20 patients received combined inhalation anesthesia with propofol and 15 patients received sevoflurane anesthesia , and 21 patients had bmi > 35 kg / m ( fig . 1 ) . the flow diagram . des = desflurane anesthesia , tiva = total intravenous anesthesia . our study included 343 patients , of which 184 received des and 159 received tiva anesthesia . the amount of opioids and nondepolarizing muscle relaxants ( ndmrs ) were significant higher in tiva group than in des group while reversal agents showed no significant difference between groups ( table 3 ) . the emergence was faster for tiva group than des group ( 8.5 3.8 vs 9.4 3.7 minutes ; p = 0.04 ) . the waiting for anesthesia time , surgical time , anesthesia time , exit from or after extubation , total or time , pacu time , and the incidence of prolonged extubation were no difference between groups ( table 4 ) . the amount of opioid , ndmrs , and reversal agents during surgical periods between des and tiva group . or time measurement between des and tiva group . the result of multivariable logistic regressions comparing prolonged extubation time between several variants in all patients is shown in table 5 . age , gender , bmi , group , and anesthesia time were factors that contribute to extubation time . the results showed that patients with older age , male , higher bmi , des anesthesia , and lengthy anesthesia time have slower emergence . multivariable linear regression analyses of variables associated with extubation time in all patients ( n = 343 ) . the major findings in this retrospective study show that propofol - based tiva by tci reduced the extubation time relative to des anesthesia . although statistically significant differences were found , 0.9 minutes reduction in extubation time in tiva group suggested less clinical or economical effect on the act component of or efficiency . in addition , we found that the factors of prolonged extubation are age , gender , bmi , des group , and anesthesia time in patients undergoing open major upper abdominal surgery . the 1st finding was consistent with several previous studies showing that ga using tci system with propofol could achieve faster extubation than using des in different surgeries . in our previous large case number retrospective studies , we showed that propofol - based tiva by tci reduced the extubation time were1.8 and 5.4 minutes relative to des in patients undergoing ophthalmic surgery and lengthy lumbar spine surgery . because the awakening time can be predicted by tci system . however , 4 studies compared des anesthesia with propofol - based tiva and failed to show any significant clinical difference in extubation in laparoscopic cholecystectomy , otological surgery , ear , nose , and throat surgery . the reason might be due to the des maintenance flow rate of oxygen was different : 1 to 4 l / min versus 300 ml / min in our study . using close circuit anesthesia in the des group would also prolong the neuromuscular blockade and delay the extubation time . in another study , dolk et al had reported that there were shorter extubation time for des anesthesia compared with propofol delivered by tci in knee surgery . the difference may cause by using nitrous oxide as an adjuvant to anesthetics , which reduce the requirement of des during the maintenance period and facilitate early emergence . another study conducted by the same group demonstrated that the mean time from end of surgery to exit or is at least 12.6 minutes longer in cases with prolonged extubation and that the percentage of cases for which the extubation was prolonged among anesthesia for intraperitoneal procedures in upper abdomen was 15.1% 0.6% . in our present study , the percentage of prolonged extubation in des group is 9.8% , while the percentage of prolonged extubation in tiva group was 9.4% ( table 4 ) . there was no significant difference in the incidence of prolonged extubation between tiva and des groups , which might be due to the similar bmi , gender , surgical time , and anesthesia time . there were studies that investigated the confounding risk factors of prolonged extubation which included prone position , prolonged surgical time , significant blood loss , and larger volume of crystalloid and colloid infusion . our previous study reported that des anesthesia , lengthy anesthesia time , higher bmi , and shorter surgical time contribute to slower emergence in gynecologic laparoscopic surgery . in addition , chan et al demonstrated that the confounding factors that predicted awaken under tci with propofol are age , gender , and times of surgery and anesthesia ( total consumption dose of propofol and fentanyl ) in assortments of surgeries . in this study , old age , male gender , higher bmi , and lengthy anesthesia time resulting in prolonged extubation , which was consistent with our previous studies . nevertheless , we showed that surgical time did not contribute to prolonged extubation , it might be due to the prolonged duration of neuromuscular relaxants resulting from the close circuit anesthesia . previous studies also implied that longer - than - average anesthesia times strongly influence the academic anesthesiology departments by increasing the staffing costs and decreasing hourly productivity . there is evidence that propofol may accumulate and redistributed from the fatty tissue and muscle to the plasma , which leads to delay recovery by using syringe pump with continuous infusion in adult . however , tci could maintain the steady concentration of propofol instead of flow rate and predicit awake time . therefore , the effect of accumulation and redistribution of propofol on extubation should be less than syringe pump with continuous infusion of propofol . the inhaled des is redistributed in the fatty tissue and muscle and delayed emergence once the lengthy anesthesia time . therefore , monitoring anesthetic depth such as bispecrtal index ( bis ) to keep the hypnotic level within the recommended range improves anesthetic delivery and postoperative recovery from relatively deep anesthesia . in addition , we suggested prescribed bis for patients were elder , higher bmi , and lengthy anesthesia time . the amount of opioid and ndmrs in des group was significantly lower than in tiva group during surgical periods . it is reasonable because volatile anesthetics may increase the potency of ndmrs and demonstrate synergy effects with opioids . therefore , we believed the final neuromuscular blockade status and amount of reversal agents given were matched between groups . our previous studies showing that ga using tci system with propofol could achieve faster extubation than using des anesthesia in different surgeries . different anesthetic manipulations before emergence in various types of surgical procedures might explain the differences in findings . for example , in breast and gynecologic surgery , propofol was adjusted to a ce of 2.0 g / ml and the vapor of des was changed to 5.0% in the beginning of wound closure . after gauze coverage , propofol and des were discontinued and lungs were ventilated with 100% oxygen at a gas flow of 6 l / min . in ophthalmic surgery , des or propofol was discontinued after the surgery , and the lungs were ventilated with 100% oxygen at a fresh gas flow of 6 l / min . in spine surgery , we discontinued des or propofol at the end of the operation or at the last 3 stitches of surgery . after turning the patients to supine position , the lungs were ventilated with 100% oxygen at a fresh gas flow of 6 l / min . in addition , we used closed - circuit anesthesia in the des patients , which would prolong neuromuscular blockade and contribute to delay emergence . the first was our study is a retrospective study . considering comparability and standardization of study groups , although the choice of anesthetic management was not randomly allocated but rather by the availability of the tci devices , the results showed no difference in the characteristics of the patients between 2 groups . the study , performed under clinical conditions and provided large sample size , reflects more precisely the clinical relevant benefit . second , we excluded liver resection due to liver dysfunction resulting in major impacts on the pharmacokinetics and pharmacodynamics of anesthetics and the recovery from tiva and inhalation anesthesia is delayed in hepatectomy patients . third , we did not compare the effect of body temperature on extubation time , because hypothermia may delay awakening . however , in our cases , we used the patient warming system including fluid warming kit and convective air warming system to keep their core temperature 35 c perioperatively . fourth , we excluded patients with bmi > 35 kg / m , because obesity may lead to prolonged extubation and it is the limitation in schnider model of tci machine . fifth , we did not include patients receiving whipple operation and blood loss > 1500 ml because larger volume of fluid infusion may be the risk factor for delayed extubation . but the depth of anesthesia was monitored by the experienced anesthesiologist , and our percentage of prolonged extubation was 9.6% less than overall 15.4% reported by a previous study . although anesthesia has the capacity to reduce operating room efficiency , a well - planned anesthesia technique like propofol - based tiva or des does not impede efficiency even after lengthy invasive surgery and even in an academic teaching hospital setting . therefore , other factors ( adequate preoperative patient workup , hospital transport , preparation in the preanesthesia unit , surgical time , patient comorbidities , etc . ) need to be considered .
abstractreducing anesthesia - controlled time ( act ) may improve operation room ( or ) efficiency result from different anesthetic techniques . however , the information about the difference in act between desflurane ( des ) anesthesia and propofol - based total intravenous anesthesia ( tiva ) techniques for open major upper abdominal surgery under general anesthesia ( ga ) is not available in the literature.this retrospective study uses our hospital database to analyze the act of open major upper abdominal surgery without liver resection after either desflurane / fentanyl - based anesthesia or tiva via target - controlled infusion with fentanyl / propofol from january 2010 to december 2011 . the various time intervals including waiting for anesthesia time , anesthesia time , surgical time , extubation time , exit from or after extubation , total or time , and postanesthetic care unit ( pacu ) stay time and percentage of prolonged extubation ( 15 minutes ) were compared between these 2 anesthetic techniques.we included data from 343 patients , with 159 patients receiving tiva and 184 patients receiving des . the only significant difference is extubation time , tiva was faster than the des group ( 8.5 3.8 vs 9.4 3.7 minutes ; p = 0.04 ) . the factors contributed to prolonged extubation were age , gender , body mass index , des anesthesia , and anesthesia time.in our hospital , propofol - based tiva by target - controlled infusion provides faster emergence compared with des anesthesia ; however , it did not improve or efficiency in open major abdominal surgery . older , male gender , higher body mass index , des anesthesia , and lengthy anesthesia time were factors that contribute to extubation time .
since the first reports of secondary hemophagocytic syndrome in hiv patients , much light has been shed to the triggering of hemophagocytic syndrome by the hiv virus . the most common pattern is seen in the setting of severe immunodeficiency , where hiv has been implicated in secondary hs , either alone , or in concert with a large variety of opportunistic infections and malignancies . however , many cases of shs have also been described in the primary infection setting , during seroconversion . a third pattern of shs has emerged in the era of [ highly active antiretroviral therapy ( haart ) ] , where very sparse reports connect hemophagocytic syndrome with the onset of haart , through [ immune reconstitution inflammatory syndrome ( iris ) ] . in the literature , there are only four reports of iris - related shs , most of them with fatal outcome . a 40-year old male patient presented to the emergency department of our hospital complaining of malaise , fatigue , night sweats and fever during the last month . the patient had been tested positive for hiv 7 years ago and had been followed on a regular basis in our infectious diseases unit , until two years ago , when he had insistently denied initiation of haart and was lost to follow up . on admission , clinical examination was remarkable for a mild splenomegaly and a small focus of kaposi sarcoma in the ankle . apart from moderate normocytic anemia and elevated esr , other blood tests and biochemistry panel were normal ( table 1 ) . his cd4 cell count was 17 cells / ul and hiv viral load 105,000 copies / ml . blood cultures for common bacteria and mycobacteria were negative . pcr amplification for cmv genome was undetectable , while for ebv genome 3.410 copies / ml were detected . leishmania infantum was positive in the bone marrow and the serum . however , giemsa stain of the bone marrow was negative for the parasite and antibodies against k39 antigen in the serum were also negative . in view of the above findings , haart with abacavir , lamivudine and dolutegravir was initiated in the 6 hospital day ( day 0 from that point ) and the patient was subsequently treated with liposomal amphotericin , while continuing the diagnostic workup . whole body ct scan performed early in the course of the fever had revealed mild lymphadenopathy in the mesenteric region , as well as mild splenomegaly . a pet-18-fdg scan had then been performed , which had raised suspicion of lymphoma in the above lymph nodes . in the meantime , there was a transient amelioration of the patient s fever spikes and transfusion needs and laparoscopic biopsy of the lymph nodes was postponed . on day 23 from the initiation of haart and after 5 days of apyrexia , fever reappeared . a complete workup with hematology and biochemistry panel , as well as blood cultures , was again unremarkable except for the moderate anemia and the elevated infection markers . cd4 cell count was 39 cells / ul and hiv viral load 51.7 copies / ml . a new ct scan was then performed , which revealed generalized lymphadenopathy , more distinct in the mesenteric area , together with an increase in the spleen size at about 22 cm maximum diameter , as compared to the previous ct scan . in view of the above findings , iris syndrome was suspected and nsaids were administered . while laparascopic biopsy was on schedule , on day 35 , there was an abrupt deterioration of the patient s clinical picture with high fevers , together with profound anemia and thrombopenia . pcr amplification for cmv , hhv-8 and parvob19 genomes were negative , while pcr amplification for ebv was 1.110 . by that time , there was a remarkable increase of the ferritin level at 6500 mg / dl , which raised the suspicion of hemophagocytic syndrome . bone marrow aspiration was reperformed , and all three samples ( the last one , but also the two previous drawn during this hospitalization ) were reviewed separately by two different hematologists under this perspective . in all three samples of bone marrow , neither hemophagocytes , nor any evidence of malignancy could be detected . based on hlh-2004 diagnostic guidelines , the patient had fever , splenomegaly , hemoglogin < 9 g / dl , platelets < 10010/l , fasting triglycerides > 265 mg / dl , fibrinogen < 1.5 g / l and ferritin > 500 microgram / l and thus fulfilled 5 out of 8 criteria for hemophagocytic syndrome . nor nk - cell activity nor soluble cd25 could be measured . when hscore was applied , our patient had a score of 222 points , which is translated to a 96% probability of experiencing reactive hemophagocytic syndrome . taking into account the rapid decline of the hemoglobulin and the platelets , salvage treatment with 24 mg dexamethasone divided in 3 doses , together with a 5-day schedule of gamma globulin of 400 mg / kg of body weight was initiated . fever vanished in the first 48 hours and all cell lineages gradually recovered within 72 hours . the patient had fully recovered and on day 50 he was discharged home with a tapering dose of methylprednisone , pending biopsy results . lymph node biopsy revealed a solid - type primary effusion lymphoma , together with infiltration of the lymph node with kaposi sarcoma . the patient is currently afebrile , on haart and methylprednisone , in good clinical status , on hematology consultation . rather than a distinct disease , hemophagocytic syndrome is increasingly recognized as a clinical syndrome with two main characteristics : the dysregulation of nk and t cells and the cytokine storm resulting in the hyperactivation of macrophages an increasing number of inherited or acquired defects in nk and cytotoxic lymphocytes has been implicated in the pathogenesis of hemophagocytic syndrome . several gene mutations and a number of immune deficiency syndromes have been involved in the familial form . moreover , even more subtle genetic polymorphisms could be involved , under certain conditions , in the secondary form . despite the diversity of the initial defect , all patients with hemophagocytic syndrome share a common final pathway : defective apoptosis and decreased cytotoxicity of nk and t cells , accumulation of the above cells and activation of the cascade , prolonged antigen presentation to cd8 t lymphocytes , subsequent cd8 excessive activation , impaired downregulation and containment of immune response , excessive activation of t cells , increased cytokine release and proliferation of macrophages , resulting in erythrocyte , white cell and platelet phagocytosis within the reticuloendothelial system . hiv alone has been implicated in hemophagocytosis , either in the primary infection setting , or in advanced disease . the hypercytokinaemia state , which is well recognized in the hiv setting , enhanced by malignancy , opportunistic infections , or even the initiation of art , together with virus - related defects in nk - cells and t - cells cytotoxicity , provide the necessary background for a second trigger to fuel the cascade . this double - hit theory could explain the increased incidence of hemophagocytosis in hiv patients . indeed , in an autopsy study of 56 aids patients , histopathological evidence of hemophagocytosis was reported in 20% . a long list of opportunistic infections or malignancies seems to superimpose to hiv virus resulting in secondary hs . apart from ebv , which is directly implicated in the pathogenesis of both familial and secondary form , hhv-8 , and cmv have also been implicated in the pathogenesis of hemophagocytosis . in the case of hhv-8 , this is probably due to the encoding of a functionally active il-6 like viral protein , which enhances the hemophagocytosis cascade . nevertheless , in hhv-8 related hemophagocytosis , a high replication status of the virus has been documented in the patients peripheral blood . such hhv-8 viremia was not evident in our case , not even a low - grade one . moreover , cmv plasma levels were also negative and ebv levels decreased during the episode of hemophagocytosis . whether these negative pcr results reflect the low sensitivity of the method used , or are however , this is not conflicting with the final diagnosis of our patient , since high- grade hhv-8 viremia carries an increased risk for the development of kaposi and almost always accompanies the exacerbations of multicentric castleman disease , but , on the other hand , pcr positivity for hhv-8 is not a prerequisite for the above entities and its use for diagnostic reasons is currently discouraged . lymphohyperplastic diseases , have also been implicated in the pathogenesis of secondary hemophagocytosis in hiv patients . indeed , in the haart era , lymphomas account for the majority of reactive hemophagocytosis in the largest series published , probably due to the increased survival and the decrease of opportunistic infections . our patient was finally diagnosed with an hiv - related solid - type primary effusion lymphoma . while this could represent a potential triggering factor , two facts argue against this hypothesis : despite lymphoma , our patient was clinically stable till the initiation of haart . moreover , there were signs of complete remission in the biopsy specimen , which probably reflects the beneficial effect of haart . the correlation of haart with hemophagocytosis has been proposed in four case reports in the last decade . a review of these reports draws a few important hints : three of the five patients reported , were finally diagnosed with an underlying lymphohyperplastic disease . when reported in the paper , a very low cd4 count was present prior to the initiation of haart . even though we ignore the possible significance of these findings , our patient shared both these features . the onset of haart results in a reduction in hiv viral load and an increase in cd4 cell count . this immune restoration rarely results in a paradoxical inflammatory response to subclinical infectious or noninfectious diseases termed inflammatory reconstitution immune syndrome . iris represents a disproportionate inflammatory response to various antigens , resulting in a cytokine storm . in clinical terms , iris is a diagnosis of exclusion , closely related to the initiation of haart , with clinical manifestations those of the underlying entity . such unmasking of the underlying disease could trigger the hemophagocytosis cascade , which would otherwise remain silent . our patient had a transient amelioration of his symptoms , till one month after the beginning of haart , where fever gradually reappeared . he also manifested an impressive decrease in his viral load , which is compatible with iris syndrome . it is worth mentioning that at the time iris was suspected , the patient did not fulfill criteria for hemophagocytosis . in a review of the five cases of iris - related hemophagocytosis reported , this could probably reflect not only the difficulty in diagnosis , but also the complexity of treatment in haart related cases . immunomodulatory interventions have also been proposed , in an attempt to reverse the cytokine cascade . high doses of corticosteroids seem to have a role in the treatment of secondary hemophagocytosis , even though there are sparse data in the hiv positive population therapeutic immunomodulatory agents , particularly infliximab has been proposed in an attempt to attenuate the cytokine storm . even more recently , the use of tocilizumab , a humanized monoclonal antibody against il-6 receptor , has emerged as an appealing agent in cases of refractory hemophagocytic syndrome , in patients with autoimmune disorders and a clinical trial for its use in the pediatric population is currently ongoing . in the same context , splenectomy has also been proposed in a few case reports , where disease bulk was confined to the spleen . intravenous immunoglobulin has also been proposed in the treatment of hemophagocytic syndrome though , to our knowledge , only in the hiv negative setting . in one study of 17 patients with shs , reactive hemophagocytic syndrome in the hiv setting carries a dismal prognosis , and this was especially true in the pre - art era . in the few case reports in the literature , where iris is related to hemophagocytic syndrome , the outcome was rather unfavorable in most of the cases . the favorable outcome of our patient , could , thus , either represent a milder form of the syndrome , a more favorable underlying malignancy , or be the result of a successful treatment approach . indeed , hemophagocytic syndrome and iris syndrome seem to share common pathogenetic mechanisms and probably reflect different magnitude of the hyperinflammation process . under this prespective , the favorable outcome of our patient could be attributed to the milder form of iris - related hs , versus other forms of hemophagocytic syndrome . however , as mentioned above , this syndrome was lethal in most of the cases reported in the literature . when our patient is compared to these cases , three more parameters could be implied : the impact of the underlying malignancy , the continuation of art despite iris syndrome and the treatment with ivig . indeed , the continuation of haart is increasingly proposed in iris syndrome in the literature . even though , in our case , iris resulted in a dreadful complication , such an approach had multiple advantages . taking into account the complete remission of the underlying lymphoma , longer follow up is necessary to estimate the durability of this result . on the other hand , what is even more promising , is , to our opinion , the effect of ivig in the reversal of hemophagocytosis and cytokine cascade . this is the first report of ivig administration in haart - related hemophagocytosis if not in hiv - related hemophagocytosis . such an approach , even in the context of one case report , merits special attention , given the poor prognosis of hemophagocytosis in this patients population . iris - related hemophagocytic syndrome is a rare but existing entity , with only four reports in the literature , most of them with fatal outcome . this is also the case in our patient , where haart continuation and the combination of ivig and dexamethasone proved life - saving . our experience could hint possible therapeutic insights to the treatment of this dreadful entity , even though its rarity deters us from drawing safer conclusions .
although the connection of [ secondary hemophagocytic syndrome ( shs ) ] with hiv has been well documented , optimal treatment regimen is not well established . this is due not only to the rarity of the syndrome , but also to the heterogeneity of the involved population . most cases are related to opportunistic infections or malignancies in advanced stage , but many cases are also related to seroconversion , in the primary infection setting . moreover , in the [ antiretroviral treatment ( art ) ] era , rare cases of art - related shs have been reported . in these , often fatal cases , an [ immune reconstitution inflammatory syndrome ( iris ) ] process is involved , posing a serious challenge to the treating physician . we hereby report a case of successful treatment of an hiv patient with primary effusion lymphoma who experienced shs shortly after art onset . our patient , treated with high dose dexamethasone and gamma globulin , achieved complete remission . this case might hint possible therapeutic insights in the treatment of iris - related shs .
fish has been and will continue to be one of the major sources of animal protein for humans . it will likely become more important as the population heads towards 8 billion in about 20 years as food production ( e.g. , growing of crops , breeding of domestic animals ) has and will continue to compete with other human activities ( e.g. , transportation , housing , industry ) for the limited usable / inhabitable land . besides being a more affordable animal protein many species of marine fishes have beneficial health components which include the polyunsaturated fatty acids ( e.g. , omega 3 ) . however , the capture - fishery is either stagnant or has been in decline as natural fish stocks in many parts of the world have been reduced significantly because of over and/or indiscriminate fishing and/or the destruction of spawning grounds . many undesirable discharges ( e.g. , organophosphates , heavy metals ) into the aquatic environments , especially from industries , are known to reduce fish survival and reproduction . in some areas fish are no longer suitable for human consumption because of the high levels of accumulated pollutants , and no new fishing grounds have been discovered . according to the food and agriculture organization , aquaculture continues to be the fastest food producing sector with about a 10% annual increase intensive culture of freshwater and marine fishes in cages is well developed in many countries , especially in those that have large numbers of rivers and lakes and/or long coastlines ( e.g. , china , chile , norway ) . however , disease outbreaks become more frequent as intensive fish culture tends to facilitate the transmission of parasites between fish in cages and the acquisition of pathogens from feral fishes that are attracted to the uneaten food in cages . the piscine immune system is well developed , and in many ways it is similar to that in mammals ( e.g. , ) which include a comparable set of immunocompetent cells . in general , the adaptive immune response is slower to develop in fish than in mammals , and this is in part due to its lower body temperature . however , the innate immunity in fish is as well developed and is as responsive as that in mammals . the present discussion is in two parts ; the first part ( section 2 ) is a brief review on cryptobia and the pathobiology in cryptobiosis information which are relevant to the discussion on the development of strategies against the pathogen and disease ( section 3 ) . cryptobiais a parasitic flagellate that has worldwide distribution , and a few species are known to cause disease in marine and freshwater fishes . this extracellular parasite is elongated and is a little larger than a fish red blood cell . the parasite has an anterior flagellum and a recurrent flagellum that attaches to the body and exit as a free flagellum at the posterior end . salmonid cryptobiosis is caused by the haemoflagellate cryptobia ( trypanoplasma ) salmositica ( figure 1 ) . , along the west coast of north america , and outbreaks of cryptobiosis with high fish mortalities have occurred in both freshwater hatcheries and in sea cage cultures . the parasite multiplies by binary fission , and the parasitaemia peaks at about 4 - 5 weeks after infection ( e.g. , [ 79 ] ) . the severity of the disease ( e.g. , the anaemia ) is directly related to the parasitaemia and clinical signs include exophthalmia ( figure 2 ) , general oedema , abdominal distension with ascites , a microcytic and hypochromic anaemia , positive antiglobulin reaction ( or positive coombs ' test ) of red cells ( figure 3 ) , and anorexia [ 7 , 10 , 11 ] . anorexia is a double - edged sword it is beneficial to the host in that it reduces the severity of the disease by lowering plasma proteins and subsequently the parasitaemia but it is also detrimental to the fish in that it contributes to the immunodepression [ 11 , 12 ] . during acute disease in addition , plasma thyroxine ( t3 and t4 ) , protein , and glucose are reduced along with depletion of liver glycogen . the metabolism and swimming performance of infected rainbow trout are also significantly reduced , and the bioenergetic cost of the disease in juvenile fish is considerable . these are contributing factors to the retarded growth as there are significant reductions in food consumption , dry weight and energy gained , energy concentration , and gross conversion efficiency . however , the attenuated vaccine strain ( section 3.3.1 ) has no detectable bioenergetic cost to juvenile fish . the cysteine protease consisting of four polypeptide bands ( 49 , 60 , 66 , and 97 kda ) is a metabolic enzyme while the metalloprotease ( 200 kda ) is a histolytic enzyme . consequently , it is an important contributing factor to the anaemia which is a very consistent clinical sign of the disease . also , the purified metalloprotease readily degrades types i , iv , and v collagens ( figure 5 ) and laminin . it is secreted by the parasite in fish and in culture , and it contributes significantly to the development of the disease and histopathogical lesions in infected fish . briefly , metalloprotease activities can be neutralized by either a monoclonal antibody ( section 3.1 ) or a natural antiprotease ( section 3.2.2 ) or the antibody against the dna vaccine ( section 3.3.2 ) ; this neutralization essentially disarms the pathogen so that the host immune system can more readily control the infection . a murine igg1 monoclonal antibody ( mab-001 ; figure 6 ) has been produced against the 200 kda glycoprotein ( cs - gp200 ) . it significantly lowers the parasitaemias in fish and this is similar to the effects of the inoculation of antisera from fish that had recovered from cryptobiosis . also , mab-001 has prophylactic effects in fish ; however , it does not fix complement but agglutinates live parasite . in vitro exposure of the parasite to mab-001 reduces its survival and infectivity when inoculated back into fish . the monoclonal antibody also inhibits parasite multiplication and its aerobic respiration , and it completely neutralizes the activity of the metalloprotease . the cs - gp200 epitope consists of carbohydrate determinants and conformational polypeptide with internal disulphide bonds . the epitope has its asparagine - bound n - glycosidically linked hybrid - type carbohydrate chain with the minimum length of a chitobiose core unit . it has a phosphatidylinositol residue which anchors the conformational polypeptide ( with disulphide bonds ) to the surface of the pathogen . the molecule is extensively posttranslationally modified , has high mannose components , and appears as a doublet in the pathogenic strain and as a single band in the attenuated vaccine strain . in the present discussion the first is absence of disease in an infected fish ( pathogen - tolerant fish ) and the second is resistance to infection by a fish ( pathogen - resistant fish ) . some laboratory / hatchery raised brook charr , salvelinus fontinalis , can not be infected with c. salmositica , and this is innate resistance to infection . resistance to cryptobia infection is inherited by progeny and it is controlled by a single dominant mendelian locus . cryptobia - susceptible brook charr are homozygous recessive while the cryptobia - resistant fish are either homozygous or heterozygous dominant for the locus . consequently , we can now breed resistant fish by initially testing the freshly collected plasma from the brood fish for cryptobiacidal effects . briefly , under in vitro conditions fresh plasma from cryptobia - resistant charr lyse the parasite via the alternative pathway of complement activation . there is no detectable difference in the immune responses of both cryptobia - tolerant ( section 3.2.2 ) and cryptobia - resistant charr to other antigenic stimulations including a commercial vaccine . not much is known about this type of resistance and its inheritance by progeny ; consequently , further studies on innate resistance to infections in other animals would be most rewarding because it can be a good strategy against some pathogens . parasitaemias in some infected brook charr are just as high as those in oncorhynchus spp . cryptobia - tolerant brook charr are resistance to disease because the metalloprotease secreted by c. salmositica is neutralized by the 2 macroglobulin ( a natural antiprotease ) in the blood . the amount of 2 macroglobulin is higher in brook charr than in rainbow trout prior to infection and it remains high ( about 40% ) even at peak parasitaemia while that in trout drops to about 12% [ 21 , 33 ] . parasitaemias in both infected rainbow trout and brook charr peak at about 46 weeks after infection and as antibodies are produced the parasitaemias decline ; however , the parasitaemia fluctuates in rainbow trout while that in infected cryptobia - tolerant charr rapidly declines after peak parasitaemia . neutralization of the metalloprotease by 2 macroglobulin was demonstrated under both in vivo and in vitro conditions [ 18 , 21 , 33 ] . since cryptobia - tolerant charr do not suffer from clinical disease , the immune system readily controls the infection and the fish recover much more rapidly than trout from the infection . an obviously option to control cryptobiosis in salmon is to consider producing transgenic cryptobia - tolerant salmonids . it is expected that the transgenic salmon will maintain high levels of 2 macroglobulin in their blood , essentially to neutralize the metalloprotease secreted by the pathogen the additional 2 macroglobulin will eliminate or at least reduce the severity of the disease . since the disease is absent or less severe , the fish immune system can more effectively control the infection . this proposal is a novel approach to the management of an infectious disease in animals and it perhaps needs further discussions . an obvious downside with this approach is that it may increase the pool of reservoir animals ( with infections but no disease ) in the population but one very obvious advantage is that no further human interventions ( e.g. , vaccination , chemotherapy ) are required once the transgenic animal is produced . adaptive immunity has also been exploited to protect the susceptible oncorhynchus spp . from cryptobiosis . two distinctly different experimental vaccines ( a live attenuated vaccine and a metalloprotease - dna vaccine ) have been developed . fish inoculated with the live attenuated cryptobia vaccine are protected from infection when challenged with the parasite . however , the metalloprotease - dna vaccine does not prevent an infection in vaccinated fish but antibodies produced in the vaccinated fish neutralize the disease - causing factor secreted by the pathogen . although the dna - vaccinated fish is infected , it does not suffer from cryptobiosis , and it essentially turns the pathogenic cryptobia into a nonpathogenic flagellate as in the case of the cryptobia - tolerant brook charr ( section 3.2.2 ) . c. salmositica was attenuated by prolonged in vitro culture and the attenuated parasite is maintained in tissue culture medium and it has remained avirulent since 1990 . it produces a low infection in rainbow trout , does not cause disease , circulates in the blood for at least 6 months , and is protective when the fish is challenged with the pathogen . it is adapted to in vitro culture and hence multiplies much more readily than the pathogenic strain in tissue culture medium [ 35 , 36 ] . a single injection of the strain protects 100% of vaccinated fish and consequently it is used routinely as an experimental vaccine to study the development and mechanism of protective immunity in salmonids and the pathobiology of the disease . the vaccine has no detectable bioenergetic cost to juvenile rainbow trout , and it protects various species of juvenile and adult salmonids from the pathogen ( e.g. , [ 8 , 9 , 3741 ] ) . rainbow trout vaccinated in fresh water and transferred to sea water are also protected on parasite challenge . vaccinated fish are partially protected if they are challenged at 2 weeks postvaccination ( wpv ) while all vaccinated fish are protected ( e.g. , no drop in packed cell volume and virtually no detectable infection after parasite challenge ) at 4 wpv . protection is via the production of complement fixing antibodies and under in vitro conditions activated macrophages from head kidneys of vaccinated fish show antibody - independent and antibody - dependent cytotoxicities . also , in the presence of antiserum macrophages are very efficient in engulfing living parasites ( figure 7 ) . the complement fixing antibody titres ( e.g. , ) and cell - mediated response ( e.g. , ) in vaccinated fish rise significantly soon after parasite challenge ( classical secondary responses ) , and the responses in vaccinated and challenged fish are similar to those in nave fish at 6 weeks after infection . humoral and cell - mediated immunity are important components of the protection against c. salmositica in both vaccinated and recovered fish ( e.g. , [ 8 , 9 , 40 , 43 ] ) . as indicated earlier ( sections 3.1 and 3.2.2 ) the disease causing metalloprotease ( 200 kda glycoprotein ) can be neutralized . this is accomplished either by the 2 macroglobulin ( a natural antiprotease ) in cryptobia - tolerant brook charr [ 18 , 21 , 33 ] where the parasitaemia does not fluctuate and the fish recovers rapidly or by an antibody ( mab-001 ) produced against the 200 kda glycoprotein . the monoclonal antibody ( mab-001 ) agglutinates the parasite and reduces its survival and infectivity . neutralization of the metalloprotease by antibodies in vaccinated fish is the basis of our current dna vaccine . briefly , the metalloprotease and cysteine protease genes of c. salmositica were sequenced [ 45 , 46 ] and inserted into plasmid vectors ( pegfp - n ) to produce a metalloprotease - plasmid vaccine and a cysteine - plasmid vaccine . rainbow trout and atlantic salmon , salmo salar , injected intramuscularly with the metalloprotease - plasmid vaccine consistently had lower packed cell volume ( as metalloprotease was secreted into the blood ) than controls ( fish inoculated either with plasmid alone or with cysteine - plasmid vaccine ) at 24 wpv . however , the packed cell volume in metalloprotease - vaccinated fish returned to normal by 5 wpv this was because the metalloprotease was neutralized as antibodies were produced . agglutinating antibodies against c. salmositica were detected 57 wpv in the blood ( and not before 5 wpv ) in metalloprotease - vaccinated fish , but not in fish injected with either the cysteine - plasmid or plasmid alone injected fish . fish were challenged with the pathogen at 7 wpv and the metalloprotease - vaccinated fish had lower parasitaemia , delayed peak parasitaemia , and faster recovery than control infected fish . in a recent review on the use of dna vaccines in aquatic organisms many protozoa that are of medical and economic importance ( e.g. , trypanosoma spp . some of these pathogens also modify their surface coats to evade the host immune response ( e.g. , antigenic variations as in the glossina - transmitted mammalian trypanosomes in africa ) ; consequently vaccines based on surface membrane epitopes are not effective . however , an enzyme - based vaccine may be worth serious considerations as enzymes are quite conserve . also , an enzyme - based vaccine will most likely protect against all isolates of the pathogen including those from different geographical locations which may have different surface membrane antigens . enzymes are generally quite conserve and this is true even among different pathogens ; for example , sequences of pcr - derived fragments of the metalloprotease gene of c. salmositica are similar to those in other kinetoplastids , such as leishmania chagasi , l. donovani , trypanosoma cruzi , and t. brucei . major surface protease ( msp ) also known as gp63 or leishmanolysin is a highly abundant zinc metalloprotease present on the cell surface of leishmania spp . the ncbi - conserved domain search shows that the alignment for the metalloprotease of c. salmositica has 78.3% similarity with peptidase_m8 , leishmanolysin domain . chemotherapy is essentially differential toxicity ; that is , the drug is more toxic to the target organism than it is to the host . severity of the side effects of chemotherapy is dependent partly on tissue damage and adverse reactions by the host to the drug . however , the drug can be directed more specifically to the pathogen if it is conjugated to an antibody specific for the target organism . immunochemotherapy will obviously increase costs and is generally not meant for routine use ; it may however be a useful tool under certain circumstances as it reduces the drug dosage and its side effects . for example , it can be used to treat infected brood fish as about 50% of brood fish annually die from cryptobiosis in some hatcheries on the west coast of north america . it is expected the side effects and accumulation of drug residues in host tissues will be reduced in immunochemotherapy , and this may also lower the risk of the development of drug - resistance by the pathogen . reduction in drug residue in host tissues is also an important consideration if the fish are for human consumption . in tropical africa isometamidium chloride ( samorin ) is widely used against trypanosomiasis in domestic animals , and it is also used as a prophylactic drug against bovine trypanosomiasis . in fish , samorin ( 1.0 mg / kg weight ) reaches peak level in the blood 2 - 3 weeks after intramuscular injection . the drug is therapeutic against c. salmositica in rainbow trout during pre- and post - clinical phases of the disease . however , it is not effective during acute disease partly as we believe that the drug modifies surface epitopes of the parasite so that they are not lysed by complement fixing antibodies . the drug is more effective in infected atlantic salmon , and at a higher dose ( 2.5 mg / kg ) the infection is eliminated in about 30% of adult fish and significantly reduces the parasitaemias in remaining fish . also all infected juvenile chinook salmon , oncorhynchus tshawytscha , treated with isometamidium chloride ( 1.0 mg / kg ) survived the disease while 100% of untreated infected fish died with massive parasitaemias . the drug also has prophylactic value , and it does not seem to affect fish growth , food consumption , blood complement levels , or haematocrit values in fish . samorin accumulates rapidly in the kinetoplast of the parasite , causes condensation of its kinetoplast dna , forms vacuoles , and swells the mitochondrial cristae ( figure 8) . although the parasite normally undergoes aerobic respiration , it also has glycolytic enzymes sequestered in microbodies called glycosomes . the in vitro oxygen consumption and carbon dioxide production decrease significantly after drug exposure with very significant increases in secretion of glycolytic products ( lactate and pyruvate ) as the parasite switches from aerobic respiration to glycolysis after its mitochondrion is damaged by the drug . also , in vitro exposure to sublethal levels of the drug reduces infectivity of the parasite to fish and changes the surface glycoprotein antibody - receptor sites of the parasite . this alteration of surface epitopes explains the protection of some parasites from lysis by complement fixing antibodies when rainbow trout with acute infections were treated with the drug . ardelli and woo conjugated isometamidium chloride to polyclonal antibodies ( from recovered fish ) and the monoclonal antibody ( mab-001 , section 3.1 ) . the conjugated drug is on the entire parasite while the unconjugated drug accumulates only in the kinetoplast ( figure 9 ) . before drug conjugation polyclonal antibodies - conjugated drug ( paic ) lyses most of the parasite and it no longer agglutinates the parasite . in contrast , the mab-00-conjugated drug does not lyse c. salmositica but agglutinates it . after in vitro exposure to paic the infectivity of the parasite and subsequent parasitaemias in inoculated fish fish survival ( table 1 ) was much higher in juvenile chinook salmon infected with parasites exposed to the polyclonal antibodies - conjugated drug ( paic ) than to drug alone ( drug ) or to polyclonal antibodies alone ( antibody ) or to drug plus polyclonal antibody ( pai ) . also , preliminary studies indicate the drug - antibody conjugate to be effective when injected into infected fish . the results are encouraging and further studies are needed , for example , to determine dosages needed , refinement of the approach ( e.g. , stage of infection , species of salmonids ) . our concerted efforts to better understand the biology of cryptobia and the mechanism of the disease have allowed us to develop more rational strategies against the pathogen and disease . we have been relatively successful in exploiting the piscine immune system to protect salmonids against c. salmositica and cryptobiosis . this is an ongoing and evolving research program and there is obviously a great deal of work that needs to be conducted . however , i hope our research will be of interest and perhaps be useful to colleagues who are also developing control measures against similar pathogenic organisms . the research has been both challenging and fascinating , and i would like to think the best is yet to come .
salmonid cryptobiosis is caused by the haemoflagellate , cryptobia salmositica . clinical signs of the disease in salmon ( oncorhynchus spp . ) include exophthalmia , general oedema , abdominal distension with ascites , anaemia , and anorexia . the disease - causing factor is a metalloprotease and the monoclonal antibody ( mab-001 ) against it is therapeutic . mab-001 does not fix complement but agglutinates the parasite . some brook charr , salvelinus fontinalis can not be infected ( cryptobia - resistant ) ; this resistance is controlled by a dominant mendelian locus and is inherited . in cryptobia - resistant charr the pathogen is lysed via the alternative pathway of complement activation . however , some charr can be infected and they have high parasitaemias with no disease ( cryptobia - tolerant ) . in infected cryptobia - tolerant charr the metalloprotease is neutralized by a natural antiprotease , 2 macroglobulin . two vaccines have been developed . a single dose of the attenuated vaccine protects 100% of salmonids ( juveniles and adults ) for at least 24 months . complement fixing antibody production and cell - mediated response in vaccinated fish rise significantly after challenge . fish injected with the dna vaccine initially have slight anaemias but they recover and have agglutinating antibodies . on challenge , dna - vaccinated fish have lower parasitaemias , delayed peak parasitaemias and faster recoveries . isometamidium chloride is therapeutic against the pathogen and its effectiveness is increased after conjugation to antibodies .
it is more than three decades since percutaneous coronary intervention ( pci ) was first used to treat coronary lesions . the treatment of the stenotic lesions of the saphenous vein grafts ( svgs ) still poses a challenge to cardiovascular medicine . nearly half of all svgs tend to become occluded and 40% of the rest become severely diseased within a decade after coronary artery bypass graft surgery ( cabg).1 , 2 the fact that repeat cabg is associated with high morbidity and mortality has rendered pci the preferred method for revascularizing patients with a history of cabg.3 , 4 the search , however , still continues for newer devices and modalities for lesions in grafted vessels.512 there is a lesser tendency on the part of interventionists to attempt pci on grafted vessels rather than on native coronary vessels ; however , the ever - increasing number of patients who survive longer after cabg is leaving them with fewer choices . although cabg and pci can complement each other,13 there is a paucity of data on the comparison between the outcome of pci on grafted vessels and that on native coronary arteries . the present study draws upon the tehran heart center registry - interventional cardiology ( thcr - ic ) and laboratory registry , which contain data on demographics , clinical and laboratory findings , in - hospital outcome , and mid - term follow - up in outpatient and/or inpatient settings and seeks to compare the short - and mid - term outcomes of intervention on the svg and those on native coronary arteries in patients requiring revascularization after cabg . our study population , consisting of 226 consecutive patients with a history of previous cabg undergoing pci between 2003 and 2007 , was drawn from the interventional registry carried out at tehran heart center ( thcr - ic ) . the investigation was approved by the institutional review board , overseeing the participation of human subjects in research at tehran university of medical sciences . the inclusion criteria were a previous history of cabg before pci with either balloon angioplasty alone or stenting with bare metal stents ( bms ) or drug - eluting stents ( des ) . patients who had an acute myocardial infarction ( mi ) 72 hours prior to pci or those who underwent pci on both native vessels and svgs were excluded . the selection of the vessel for pci was left to the discretion of the operators . sixty - three patients ( with 82 lesions ) underwent percutaneous revascularization on their svg lesions and 163 patients ( with 212 lesions ) had the procedure done on their native vessels . the operators selected the strategy based on a combination of patient symptoms , results of noninvasive testing , territory of ischemia , results of diagnostic angiographies , and complexity or feasibility of the procedure . the pci procedures and stent applications were performed via standard techniques using the femoral approach . distal embolic protection devices were employed in 26.9% of the patients whose target vessel for pci was a grafted vein . all the patients received aspirin ( 325 mg ) and a 300600 mg loading dose of clopidogrel before the index procedure , intravenous unfractionated heparin ( 70 100 iu / kg ) during the procedure , which was terminated with the procedure , and aspirin ( 325 mg ) for a minimum of one month , which was subsequently tapered to 80 mg for lifelong use . additionally , copidogrel was prescribed for at least one month after bms implantation and several months after des implantation . follow - up information was obtained by direct clinical visits of the patients at the first , sixth , and ninth post - procedural months or from the referring physicians and telephone interviews . the rate of loss to follow - up was about 5% , which was included in the analysis . target vessel revascularization ( tvr ) was defined as all pcis done on the same vessel or cabg . target lesion revascularization ( tlr ) was defined as ischemia - driven repeat revascularization of the target lesion only by pci.st-elevation mi was defined as the presence of new pathological q waves in the electrocardiogram and a rise in ckmb 3 of the normal limit . a non - st elevation mi was defined as just creatine kinase - mb enzyme elevation 3 of the normal value . major adverse cardiac events ( mace ) were defined as cardiac death , non - fatalmi ( st - elevation or non- st elevation ) , and tvr or tlr . the mace rates were compared between the native vessel and svg groups in patients with a history of cabg with respect to both in - hospital period and nine - month follow - up period . the groups were compared using the student t - test or mann - whitney u for the continuous variables and the 2 test for the dichotomous variables . all the statistical analyses were carried out via statistical package for social sciences version 15 ( spss inc . , the study population was comprised of 226 patients with a mean age of 59.52 9.38 years . the clinical and angiographic characteristics of the patients are listed in table 1 , which shows that the two groups of patients were similar in most of the baseline characteristics . for 17 ( 26.9% ) of the svg patients , the no - reflow phenomenon occurred in 9 ( 14.2% ) patients in the svg group . there was no significant difference between the frequency of use and non - use of the distal protection device amongst the patients with no - reflow : 3 ( 17.6% ) vs. 6 ( 13.0% ) respectively , p value = 0.692 ) . more patients in the svg group had prior mi than did those in the native vessel group : 31 ( 49.2% ) vs. 42 ( 25.8% ) , p value = 0.001 . the svg patients also had longer cabg to pci intervals , larger reference vessel as well as stent diameters than did the other patients ( 8.94 4.83 vs. 5.67 4.11 , p value < 0.001 , 3.58 0.64 vs. 3.05 0.42 , p value < 0.001 and 3.46 0.54 vs. 3.07 0.41 , respectively , p value < 0.001 ) ( table 1 ) . however , mace , both in hospital and mid - term , had no significant difference between the two groups ( figure 1 & 2 ) . in the svg group , 3 patients had non - st elevation mi ( nstemi ) compared to 2 cases of nstemis in the native vessel group patients ( 4.8% vs. 1.8% , p value = 0.134 ) . of the 163 patients in the native vessel group , 17 ( 10.4% ) were treated with balloon angioplasty and the rest with stenting ( des , n = 75 ; bms , n = 68 ; and mixed , n = 3 ) . after nine months , the incidence of mace in the patients with native vessel intervention was 4.9% compared with 4.8% in the svg group ( p value = 0.999 ) , ( figure 2 ) . the main finding of this report is that pci for the treatment of svg lesions appears safe , feasible , and effective when compared to pci on native coronary vessels in patients with history of previous cabg . it is expected that more than 50% of svgs will develop stenosis within 10 years of surgery.14 in the present study , we observed that the interval between cabg and pci on svgs was 8.94 4.83 years , which was significantly longer than that between cabg and pci on native coronary arteries ( 5.67 4.11 years ) . we would argue that a lesser tendency on the part of interventionists to challenge grafted vessels could be the reason for this difference . distal embolic protection devices have been shown to be beneficial in the prevention of this complication.15 these devices were used in 26.9% of our svg group patients ( 17 of 63 patients ) , which is close to a reported 22% in the us hospitals.16 recent advances in technology have decreased the rate of early mace , including both st and non - st elevation mi , to less than 3%.17 , 18 in our study , 2 ( 0.88% ) of the study patients had in - hospital nstemi : the two cases were found in the svg group ( 3.17% ) versus none in - hospital nstemi cases identified in the native vessel group ( p value = 0.077 ) . the occurrence of mi after pci lowers survival and worsens prognosis . in the present study , however , the limited number of cases precludes an in - depth discussion on these end - points . because of higher morbidity and mortality associated with repeat cabg , percutaneous intervention is a preferred option for svg lesions.19 early reports of using pci to treat svg lesions did not show good results20 and the incidence of restenosis was relatively high.21 , 22 in contrast , of our 63 patients , only 3 ( 4.8% ) patients ( p value = 0.999 ) had mace during the nine - month follow - up period , which may have been due to improvements in the techniques , skills of the operators , and qualities of the devices utilized such as stents , balloons , and wires . some authors recommend that native artery lesions be targeted first , whenever possible , because of their lower restenosis rate . in this study , some researchers have investigated the rate of late occlusion in svg lesions following pci based on the type of the stent23 and the pattern of restenosis in comparison with the same rate after pci on native coronary arteries;24 this issue is not dealt with in the present study . the data used in this study were derived from a single - center registry ; therefore , the study is bound to have some limitations . the small sample size precludes an analysis on the basis of different methods of angioplasty and different types of stents . furthermore , the follow - up duration of our study population is relatively short ; longer follow - up durations may yield different conclusions . another limitation is the absence of routine angiographic follow - up , which means that not all vessel and stent restenoses were detected . it seems that in patients with coronary artery disease , pci and cabg , far from being rivals , are indeed complementary treatment modalities . percutaneous revascularization in svg lesions appears feasible and safe with a good procedural , in hospital and midterm outcome compared with pci for native vessels in patients with history of cabg . improvements in the proficiency of interventionists and efficacy of devices are expected to usher in more favorable outcomes for intervention on grafted vessels .
backgroundthe optimal target for revascularization in patients with history of coronary artery bypass graft surgery ( cabg ) is unclear . this study was designed to compare the outcome of percutaneous coronary intervention ( pci ) on saphenous vein grafts ( svg ) and that on native vessels in patients with previous cabg in terms of major adverse cardiac events ( mace).methodsthe study drew upon data on consecutive patients hospitalized for pci and mace rate during a nine - month follow - up period . the patients were divided according to the target vessel for pci into two groups : svg and native vessel.resultsbetween 2003 and 2007 , 226 patients underwent pci 6.57 4.55 years after cabg . their mean age was 59.529.38 years , and 176 ( 77.9% ) were male . pci was performed on the svg in 63 ( 27.9% ) patients and on the native coronary artery in the rest . during a nine - month follow - up period , 9 ( 4% ) patients suffered mace ; the prevalence of mace was not significantly different between the svg group ( 4.8% ) and the native vessel group ( 4.9% ) , ( p value = 0.999).conclusionpci on grafted and native vessels did not affect mace in patients undergoing pci after cabg .
sepsis is one of the most common infectious conditions during the neonatal period , and it is still a significant cause of morbidity and mortality , despite the outstanding development of neonatology in recent years . described as systemic inflammatory response ( sirs ) associated with a suspected or proven infection , the sepsis is an infectious disease of varied etiology , which determines degrees of inflammatory and metabolic responses [ 2 , 3 ] . tumor necrosis factor ( tnf ) , interleukin-1 ( il-1 ) , interleukin-6 ( il-6 ) , and interleukin-8 ( il-8 ) are proinflammatory cytokines , whereas interleukin-10 ( il-10 ) and transforming growth factor - beta ( tgf- ) are known as anti - inflammatory cytokines , both produced rapidly in the setting of neonatal sepsis . in the past years , several authors have supported the use of cytokines in the diagnosis of both early and late sepsis . previous results from our study , in which cytokines were measured in the plasma and in the umbilical cord blood at birth , support the idea that increased levels of either proinflammatory cytokines ( tnf- ) or anti - inflammatory cytokines ( il-10 ) in neonates at birth change throughout the infectious process and there is also a positive and significant correlation between the levels of these cytokines . in the present review , we will cover the actual role of cytokines in the pathogenesis of neonatal sepsis and its value as a diagnostic criterion . neonatal sepsis is a systemic infection that occurs in newborns up to 28 days of age and it is a major cause of morbidity and mortality in newborns . according to world health organization , in 2010 , 3.7 million newborns died before reaching 28 days of age in the united states , and 37% were due to infectious causes . as proposed by the international pediatric sepsis consensus conference in 2002 , specific definitions for pediatric sirs and sepsis present important differences related to clinical signs and laboratory biomarkers specific to adults . the major differences between adults and children are that the diagnosis of pediatric sirs requires lower values for heart rate , leukocyte count , and systolic blood pressure and upper values for heart rate , respiration rate , or leukocyte count . in sepsis , to confirm the diagnosis , it is necessary the presence of bacterial infection suspected or confirmed by culture or other methods . taken together , some clinical findings can also help the diagnosis process such as : petechiae and purpura ( in the setting of hemodynamic instability ) ; fever , cough , and hypoxemia ( in the setting of leukocytosis and pulmonary infiltrates ) . in adults , sepsis is defined as a complex clinical syndrome of severe systemic inflammatory response syndrome ( sirs ) with multiple physiological and immunological abnormalities , which is usually associated with bacterial or fungal infections [ 2 , 810 ] . sepsis pathogenesis is associated with hemodynamic changes , disturbances of microcirculation and cellular changes that cause imbalance between blood flow and metabolic tissue requirements , leading to multiple - organ dysfunctions , which is responsible for the severe and often fatal form of the disease . neonatal sepsis and sepsis in adults are very different conditions , with implications for the epidemiology and pathophysiology and even in clinical management . in addition , differences between neonates and adults directly impact the involvement of cytokines during development of sepsis and the use of assessment of these mediators in clinical routine [ 1214 ] . although our focus here is neonatal sepsis , as far as possible we compare results of studies involving adults from those obtained from studies involving neonates . sepsis development can be initiated through recognition of one or more components of invading organism , including structural elements such as gram - negative endotoxins or secreted exotoxins that stimulate the local and systemic release of endogenous inflammatory mediators . among the inflammatory mediators are cytokines such as tnf- , ifn- , il-1 , il-6 , and il-8 , which act favoring the migration and activation of immune cells [ 15 , 16 ] . stimulation of polymorphonuclear leukocytes , histiocytes , platelets , and endothelial cells leads to the production of biologically active mediators , including platelet activating factor ( paf ) , arachidonic acid metabolites , histamine , bradykinin , complement proteins , vasoactive peptides , and oxide nitric ( no ) . the production and release of these proinflammatory mediators can induce a systemic inflammatory response characteristic of the initial phase of sepsis [ 17 , 18 ] . for a long time , it was believed that sepsis was caused by an exacerbated inflammatory response generated from innate immune response triggered by bacterial infections . however , researchers eventually described the presence and importance of compensatory anti - inflammatory response syndrome , cars , which often occurs after hyperinflammatory phase , especially in patients who develop severe sepsis . in neonates , severe sepsis is characterized by the persistence and prevalence of proinflammatory mediators up to the third day after diagnosis , whereas these groups of cytokines are prevalent in sepsis , with good clinical evolution , just on the day of diagnosis . the study of inflammatory mediators and cytokines as biomarkers of neonatal sepsis are really important for syndrome diagnosis . recent research has pointed to the role of damage - associated molecular patterns ( damps ) , which are intracellular proteins released in response to cell injury , such as high mobility group box protein 1 ( hmgb-1 ) . damps act as endogenous danger signals to activate and amplify the function of receptors such as receptor for advanced glycation end products ( rage ) , hence perpetuating the inflammatory response . this may be particularly important for neonatal sepsis , because the maternal - fetal barrier is compromised by the inflammatory response , leading to translocation of damps into the fetus . the study of proinflammatory cytokines il-6 , tnf- , il-1 , and il-8 and anti - inflammatory cytokines il-10 and tgf- as reliable biomarkers of neonatal infection has been shown to be potentially useful for early sepsis diagnosis and to predict the severity of disease at early stages of the infection [ 2326 ] . cytokines are relatively small molecules with short serum half - life ( from minutes to a few hours ) and play a central role in immune response in neonates with sepsis . during sepsis , cytokine levels may be observed in picograms per milliliter of plasma or in nanograms or even micrograms per milliliter . in the 1990s , sepsis was believed to be associated with an exacerbated release of mainly proinflammatory cytokines , such as tumor necrosis factor ( tnf- ) , interleukin ( il-1 , il-6 , and il-12 ) , interferon- ( ifn- ) , and macrophage migration inhibitory factor ( mif ) . the expression however , recent research on the pathophysiologic mechanisms underlying sepsis indicates that the profound proinflammatory response is counteracted by certain anti - inflammatory cytokines , including il-10 , transforming growth factor ( tgf- ) , and il-4 , which attempt to restore immunological balance [ 18 , 29 , 30 ] . il-6 is a cytokine that shows early response to infection , preceding the increase in c - reactive protein and followed by tnf- release . it is synthesized by mononuclear phagocytes , endothelial cells , fibroblasts , and the decidua , chorion , amnion , and trophoblast cells soon after stimulation by microbial products [ 31 , 32 ] . il-6 acts as a signal in the activation of t cells , and it induces the secretion of antibodies by b cells and the differentiation of cytotoxic t cells . it stimulates the release of other cytokines , particularly tnf- and il-1. il-6 is an early marker in the diagnosis of neonatal sepsis , increasing several hours before the increase in c - reactive protein . the sensitivity of these tests together can reach values close to 100% , hence the importance of these markers . it is capable of interfering with the production of c - reactive protein , so it can be detected earlier than c - reactive protein during bacterial infection . the c - reactive protein has both anti - inflammatory and proinflammatory effects during infection , since it mediates the elimination of pathogens , despite also inhibiting the interaction between endothelial cells and leukocytes . as the secretion starts 46 hours after stimulation and it peaks at 36 hours after infection , it is often used in the diagnosis of infection . biomarker to have a very short half - life , approximately 100 minutes in patients with meningococcal infection ; additionally , the circulating levels decrease or return to basal levels 24 hours after appropriate treatment in late - onset neonatal sepsis . several studies have reported sensitivity for detection of il-6 in 75 to 90% of circulating serum in the first 24 hours of infection , with a marked reduction in the diagnostic effectiveness 48 hours after the onset of symptoms and suspected sepsis [ 23 , 25 , 37 , 38 ] . moreover , il-6 has been correlated with maternal chorioamnionitis and used in the initial diagnosis of early neonatal sepsis when detected at high levels in umbilical cord blood . similar results were found by our research group when analyzing liver of perinatal deaths diagnosed with fetal inflammatory response syndrome ( firs ) using immunoperoxidase method ; we observed that il-6 and c - reactive protein were overexpressed . when detected in the umbilical cord blood of newborns at term and without risk factors , il-6 does not have significant clinical utility in differentiating infected and healthy newborns . on the other hand , in newborns with premature rupture of membranes , il-6 showed high sensitivity and specificity in predicting funisitis and positive cord blood culture . the difference in il-6 levels in cord blood and blood of the newborn infant at birth is due to the kinetics of il-6 . therefore , sample collection time is an important factor for the detection of high levels of il-6 in neonates . release of tnf- may occur approximately 30 minutes after lps injection , and the circulating levels reach their peak in approximately one and a half hour , with an estimated half - life of about 70 minutes [ 30 , 32 ] . tumor necrosis factor ( tnf- ) is the prime mediator of septic shock in neonates and widespread tissue injury , and it regulates the secretion of il-1 [ 37 , 38 ] . high levels of tnf- appear to be related to the severity of the disease , although some studies in adults do not confirm this relationship [ 44 , 45 ] . the peak plasma concentration of tnf- is reached after an hour of experimental endotoxemia , with near - zero levels for three hours . there are evidences that tnf- is found free in plasma concomitant with the appearance of signs and symptoms of bacterial infection . systemic release of tnf- can cause vasodilation and increased vascular permeability leading to systemic edema , with decreased blood volume and hypoproteinemia that can progress to shock . there was stimulus for leukocyte and platelet adhesion , with clots formation in small vessels and consumption of coagulation proteins that may lead to disseminated intravascular coagulation . this condition may also progress to multiple - organ failure and death in early - onset neonatal [ 47 , 48 ] . in addition , tnf- and il-1 were identified as crucial cytokines to development of fever and , therefore , belong to a group of pyrogenic cytokines [ 30 , 49 ] . tnf- induces increased adherence of neutrophils and integrins to endothelial tissues and upregulates the endothelial expression of procoagulant proteins . moreover , together with il-1 , tnf- was one of the first mediators identified in inflammatory sites . synergically , tnf- and il-1 amplify the inflammatory signals by activating macrophages to produce proinflammatory cytokines such as il-6 and il-8 , as well as lipid mediators and reactive oxygen species leading to sepsis - induced organ dysfunction . tnf- acts through two receptors , tnfr1 ( tnf receptor-1 ) and tnfr2 ( tnf receptor-2 ) , resulting in immune cell activation and release of several immunoregulatory mediators . the role of tnf- as a marker for the prediction of early - onset neonatal sepsis has been suggested . additionally , when used in combination with il-6 , tnf- may achieve up to 98.5% sensitivity . on the other hand , santana and colleagues demonstrated that tnf- was not significantly different between sick and healthy neonates . discrepancy between the studies could be due to the fact that the kinetics of tnf- production is not fully understood in early life . furthermore , due to the short half - life of tnf- and its interaction with soluble receptor , the detection becomes difficult . thus , tnf- as a reliable biomarker for sepsis is compromised . in contrast , some studies , especially by pickler and colleagues , reported that high levels of tnf- , il-6 , and il-1 are often associated with profiles of sepsis in neonates . these authors also confirmed the low sensitivity and specificity of tnf- to differentiate sepsis in infected newborns . experimental studies have shown that the injection of tnf causes a syndrome which is indistinguishable from septic shock . it was observed that the infusion of recombinant tnf- in humans results in sirs [ 5557 ] . it is believed that because this role in the inflammatory process results in severe clinical conditions of sepsis , tnf- may have a direct correlation with the severity of sepsis and the mortality rate during the development of sepsis in newborns at risk for infections . il-1 is a proinflammatory cytokine released by timely activated macrophages similar to those of tnf-. it signals through two distinct receptors , called il-1 receptor type i ( il-1r1 ) and il-1r2 , and has many effects on immune cells [ 30 , 59 ] . in the inflammatory response cascade , namely , il-1 can be produced by the central nervous system , particularly in the hypothalamus , and also can be induced by infectious agents ( bacterial endotoxins , viruses , fungi , and parasite antigens ) and c5a complement , usually in one hour , reaching peak levels in 510 hours [ 61 , 62 ] . during sepsis , il-1 seems to induce fever , coagulation , and hematopoiesis , promoting the extravasation of inflammatory cells . therefore , it has been noticed that il-1 is significantly increased in most patients with sepsis , and it has been associated with the severity of sepsis [ 63 , 64 ] . moreover , persistently elevated levels of this cytokine have been correlated with the development of multiple - organ failure and with a worse prognosis in adults [ 45 , 64 ] . interleukin-1 has been described as a marker of neonatal sepsis , although its diagnostic efficacy is lower than that of il-6 and tnf- . the diagnostic value of il-6 , tnf- , and il-1 is limited by the time of blood sample collection , which should be as early as possible if neonatal sepsis is suspected , since these cytokines have very short half - life [ 46 , 65 ] . therefore , analysis of a panel of cytokines , and not only the isolated measurement of a single cytokine , is required in order to characterize the inflammatory response in sepsis . il-8 belongs to the class of proinflammatory chemokines and it is produced by the placental cells , fetal monocytes / macrophages , and cells . il-8 is a chemokine which follows a course of time similar to that of il-6 . this characteristic limits , to a great extent , the role of il-6 and il-8 as clinically useful biomarkers for all stages of sepsis , although they may be useful early in the disease prior to treatment in neonates . recently , the association of high levels of il-8 in the presence of retinopathy was determined in seventy - four very low birth weight preterm infants with clinical criteria of early infection whose cytokines were obtained during the first three days of life . the cut - off points for il-6 > 357 pg / ml , il-8 > 216 pg / ml , and tnf- > 245 pg / ml were significantly associated with the development of retinopathy . placental cells , fetal monocytes / macrophages , and endothelial cells are able to produce il-8 after infectious process originated in the uterus . il-8 levels increase about 90 minutes after infection and peak at about 120 minutes in septic neonates , whereas its circulating concentration decreases significantly 48 hours after birth , likewise the kinetics of il-6 . only preterm infants less than 32 weeks of gestation may have increased levels of il-8 due to gestational age . data by dembinski and colleagues showed that il-8 levels were undetectable in the umbilical cord blood of healthy newborns . in the past years , il-8 has been extensively investigated as a predictive biomarker of early - onset neonatal sepsis that is corroborated by dllner and colleagues , who observed increased il-8 levels in the umbilical cord blood of infected preterm neonates . the disadvantage of il-8 measurement in comparison with il-6 levels is the limit of detection . the il-6 serum detection limit is > 0.7 pg / ml , whereas the serum detection limit of il-8 is > 10 pg / ml . anti - inflammatory cytokines , such as il-10 and tgf- , are important inflammatory mediators , since they play a major role in preventing excess proinflammatory response during sepsis . il-10 is produced by different types of immune system cells such as monocytes , macrophages , t and b lymphocytes , and nk cells . this cytokine suppresses the production of proinflammatory mediators including tnf- , il-1 , il-6 , ifn- , and gm - csf in cells of the immune system . high levels of il-10 have been correlated with poor prognosis of sepsis in adults , shown to be a useful predictor of severity in septic shock and death [ 76 , 77 ] . however , it was shown that the appropriate response of il-10 may have a protective effect on sirs and that high il-6/il-10 ratio was found in patients with a worse prognosis . similarly , a high il-10/tnf ratio has also been associated with severe late - onset neonatal sepsis [ 26 , 75 ] . in an experimental model , it was shown that the administration of recombinant murine il-10 protects from lethal endotoxemia , even when il-10 was injected 30 minutes after lps administration . in contrast , the immunoneutralization of il-10 led to increased levels of tnf and il-6 in circulating mice , and it also reversed the ability of il-10 to protect mice from lethal endotoxin . despite these clear protective effects of il-10 in lps - induced diseases , il-10 actions are not always beneficial . the effects of il-10 appear to depend on the time of administration in case of neutralizations . furthermore , the authors reported that il-10-deficient mice showed an earlier onset of lethality after experimental sepsis induced by cecal ligation and puncture as compared with wild type mice . tgf- , as well as il-10 , is a member of the growth factor family and it is an important anti - inflammatory cytokine . tgf- was shown to play a role in tissue repair and fibrosis , as well as in sepsis - induced immunosuppression . in vitro , tgf- suppresses the release of proinflammatory mediators such as il-1 and tnf- from monocytes and macrophages . tgf- also inhibits t - lymphocyte functions , such as il-2 , and the secretion of t cell proliferation , as well as promoting the development of t regulatory cells . studies involving evaluation of in vitro assays , experimental models of sepsis , and human clinical evaluations support the anti - inflammatory actions of tgf-. these experiments have shown that treatment with tgf- blocked endotoxin - induced hypotension , probably inhibiting the hypotensive effects of no and improved survival in a rat model of salmonella endotoxin - induced septic shock [ 72 , 88 ] . another study reported that adult patients at the onset of sepsis presented high levels of tgf- even though these levels were not correlated with severity or prognosis of disease . recent data have demonstrated that tgf- reverses the depression of cardiac myocyte contraction , which is induced by cytokines such as tnf- and il-1 and by the serum of patients with septic shock . hence , it is suggested that tgf- may have cardioprotective effects in sepsis - induced cardiac injury . recently , il-7 , which is a hematopoietic growth factor , has been reported to have antiapoptotic roles , essential for lymphocyte survival and growth [ 91 , 92 ] . in addition to its antiapoptotic properties , it induces proliferation of cd4 and cd8 t cells . one of the characteristic features of sepsis is the profound loss of t cells in various lymphoid organs . during experimental sepsis , il-7 decreases cell apoptosis through the expression of antiapoptotic bcl-2 gene [ 94 , 95 ] . another study showed that septic mice treated with recombinant il-7 ( rhil-7 ) increase the local and systemic production of neutrophils and il-17 , thus recruiting more neutrophils to the site of infection . nevertheless , further studies are necessary to understand the real role of il-7 in the pathogenesis of neonatal sepsis . another cytokine which has been studied and seems to be really involved in the pathogenesis of sepsis is il-22 . in a small group of hospitals within a single health center it is believed that il-22 that is produced during sepsis may contribute to host defense and to stabilizing mucosal barrier functions under systemic infection conditions . however , the adverse effects of il-22 are also described in a model of polymicrobial peritonitis , in which the levels of il-22 and its receptor in the spleen and kidney were very high . the biological activity of il-22 is modulated by its antagonist , il-22 pb . treatment of mice with il-22 pb before sepsis led to increased accumulation of neutrophils and mononuclear phagocytes , as well as a reduction in bacterial burden at the site of infection . thus , the beneficial effects of il-22 are mediated by promoting tissue protection , whereas ill effects are connected with exacerbated inflammation . this dual role of il-22 implies that it participates in the pathophysiology of experimental sepsis . il-33 can induce t helper cells , mast cells , eosinophils , and basophils to produce th2 cytokines . il-33 mediates its biological effects through interaction with its receptors and with associated proteins abundantly expressed on the surface of th2 cells and mast cells . il-33 also functions as a chemotactic mediator for th2 cells [ 100 , 101 ] . in mast cells , il-33 triggers the production and release of proinflammatory cytokines , promotes maturation , and induces degranulation . furthermore , il-33 amplifies the polarization of alternatively activated macrophages and it enhances tlr4-mediated cytokine production by macrophages . st2 exists in different splice variants , which results in a cell membrane - bound form and in a soluble form . the soluble form , sst2 , is generated by alternative splicing and does not induce signaling , thus acting as a receptor for il-33 . high levels of sst2 have been associated with the pathogenesis of sepsis , so sst2 may be a potential marker of poor prognosis [ 95 , 105 ] . il-33 has beneficial effects in experimental sepsis , enhancing the accumulation of neutrophils through the upregulation of cxcr2 via grk2-dependent pathways at the site of infection and reducing the inflammatory response in systemic sites . however , it has not yet been determined whether the administration of il-33 actually represents a therapeutic strategy . the proinflammatory cytokine il-17a is mainly produced by th17 cells and is involved in the mediation of proinflammatory responses , hence triggering the production of many other cytokines such as il-1 , il-6 , and tnf- . it has recently been shown that increased il-17a levels have adverse effects during experimental sepsis in clp - induced sepsis models . whereas the blocking of il-17a was associated with reduced levels of bacteremia , proinflammatory cytokines and an increased survival rates of animals . it causes an increased production of il-4 itself and of other anti - inflammatory cytokines , suppressing the secretion of monocyte - derived proinflammatory cytokines . experimental studies have shown that il-4 increases the survival rates of mice exposed to lethal lps doses . similarly , in humans , mrna expression of il-4 was associated with survival of patients with severe sepsis . nonetheless , il-4 plasma levels of septic patients on the day of hospital admission were not different between the patients who survived and those who did not survive sepsis . it was recently suggested that polymorphisms in the il-4 gene promoters may affect the balance of th1 and th2 response and , consequently , predispose trauma patients to develop sepsis . although there are several studies suggesting that il-4 plays an important role in the pathogenesis of sepsis , its real role in the course of the disease remains unknown . procalcitonin ( pct ) is the hormone calcitonin , which is normally produced by the c cells of the thyroid gland , leading to massive release of pct into the bloodstream depending on the severity of sepsis . assicot and colleagues were the first to describe pct as a potential biomarker of sepsis and infection . the authors showed a more favorable pct kinetic profile than the profile of c - reactive protein and cytokines . pct circulating levels decrease within about 24 hours , when the infection is sufficiently treated . decreasing pct levels are , thus , associated with improved survival , whereas increased or persistently increasing pct levels are predictive of an unfavorable outcome [ 113 , 114 ] . discrimination between infectious and noninfectious conditions for pct and decreasing pct levels in properly treated patients raised the hypothesis that pct levels can help in determining the antimicrobial therapy . pct serum concentrations may be increased in medullary thyroid carcinoma in the absence of bacterial infections and in conditions such as severe trauma , surgery , or postcardiac arrest , heat shock , stress birth , and various types of immunotherapies and some autoimmune diseases . however , as any other biomarker , pct levels must be evaluated within the clinical context of the patient . understanding the neonatal sepsis pathogenesis still remains a challenge , given its complexity and the inherent immunological characteristics of the newborn . cytokines seem to be one of the major mediators involved in the outcome of this entity . the imbalance between proinflammatory and anti - inflammatory cytokines appears to be related to both the severity and prognosis of neonatal sepsis . therefore , the use of cytokines as biomarkers of neonatal sepsis seems plausible and necessary , since the early diagnosis of neonatal sepsis directly influences the therapy and prognosis .
neonatal sepsis is a major cause of morbidity and mortality and its signs and symptoms are nonspecific , which makes the diagnosis difficult . the routinely used laboratory tests are not effective methods of analysis , as they are extremely nonspecific and often cause inappropriate use of antibiotics . sepsis is the result of an infection associated with a systemic inflammatory response with production and release of a wide range of inflammatory mediators . cytokines are potent inflammatory mediators and their serum levels are increased during infections , so changes from other inflammatory effector molecules may occur . although proinflammatory and anti - inflammatory cytokines have been identified as probable markers of neonatal infection , in order to characterize the inflammatory response during sepsis , it is necessary to analyze a panel of cytokines and not only the measurement of individual cytokines . measurements of inflammatory mediators bring new options for diagnosing and following up neonatal sepsis , thus enabling early treatment and , as a result , increased neonatal survival . by taking into account the magnitude of neonatal sepsis , the aim of this review is to address the role of cytokines in the pathogenesis of neonatal sepsis and its value as a diagnostic criterion .
an estimate of 240 million people have been chronically infected with hepatitis b virus ( hbv ) worldwide . chronic liver injury and ongoing inflammation in chronic hepatitis b ( chb ) can lead to cirrhosis . in east asia , the respective 5-year cumulative incidences of cirrhosis in hepatitis b e antigen ( hbeag ) negative and hbeag positive patients were 13% and 8% , respectively . a cirrhotic liver initially maintains normal liver functions ( compensatory stage ) , but 15% of patients may progress into a decompensated stage in 5-year while 3.7% will develop hepatocellular carcinoma ( hcc ) . studies that investigated risk factors for the advancement of chb to cirrhosis found that prognosis or histological progression is strongly related to hbeag positivity , serum hbv dna , and alanine aminotransferase ( alt ) levels . further analyses showed that elevated hbv dna level is a single risk factor for deteriorating liver functions in hbv - related cirrhosis and is strongly related to the advancement of cirrhosis from a compensatory to a decompensated stage and hcc . patients within compensated stage often remain asymptomatic for many years , allowing a normal quality of life . nucleos(t)ide analogs ( nas ) have been proven to be effective at inhibiting hbv replication . cirrhosis patients who received entecavir treatment had a significantly lower liver - related death rate than the placebo group . entecavir therapy resulted in more frequent improvement in histology , virological response and biochemical normalization in both hbeag positive and negative patients compared to lamivudine ( lam ) . although patients with the partial virological response at 3 month could continue entecavir therapy , the 3 month ( 12 weeks ) posttreatment is an important time point for antiviral therapy in both surrogate marker and treatment practice . it is at this time point that primary nonresponders to nas therapy will be identified based on hbv dna level . thus , hbv dna at the 3 month of treatment reflects if hbv replication is effectively inhibited . one log10 iu / ml or greater reduction of hbv dna level from the baseline at the 3 month could indicate such a response . in addition , the lower the hbv dna level , the higher the probability of spontaneous seroclearance of hbeag . studies suggested that early hbv dna decrease is an important prognostic marker . a negative hbv dna or a fall of 3 log10 from baseline at the 3 month projects a 96% probability of negative hbv dna at week 96 posttreatment . virological and biochemical , or other factors that contributed to virological response at the 3 month of treatment , have not been investigated . in the present study , we aimed to evaluate the efficacy of entecavir therapy by monitoring virological response at the end of the 3 month of treatment and try to figure out whether baseline factors could help predict it in a cohort of hbv compensated cirrhosis patients and to determine the cut - off value of a predicting parameter . the data were extracted from the database of a prospective study into which hbv - induced cirrhosis patients were enrolled for antiviral therapy either by entecavir or lam plus adefovir dipivoxil ( adv ) in eight centers located in the mainland of china . the prospective study began in march 2012 , and recruitment of subjects is still ongoing . the study was conducted in accordance with the ethics principles of the declaration of helsinki and it was approved by the institutional ethics committee . selection of nas was made jointly by patients and their attending physicians , in view of medical insurance coverage , in accordance with the guideline of prevention and treatment for chb of china . individuals were all nucleos(t)ide - nave before recruitment and started therapy at a dose of entecavir at 0.5 mg / d or lam 100 mg plus adv 10 mg / d . eligible participating patients met the following criteria : ( 1 ) patient ages were between 18 and 70 years old with written informed consent ( including 18 and 70 at the time of recruitment ) . ( 2 ) chb - induced cirrhosis was clinically diagnosed by : ( 1 ) liver biopsy , ( 2 ) endoscopy of esophageal or gastric varices , excluding noncirrhotic portal hypertension , ( 3 ) two of the following ( when biopsy and endoscopy were not performed ) ( a ) ultrasonographic evidence or computed tomography / magnetic resonance imaging result that indicated imaging changes in liver morphology , which included nodules in the hepatic parenchyma , serrated change on the liver surface or spleen pachydiameter > 4.0 cm or > 5 costal region , ( b ) blood platelet ( plt ) < 100 10/l with no other explanation , ( c ) albumin ( alb ) < 35 g / l , inr > 1.3 , or che < 5.0 ku / l , ( d ) liver stiffness measurement ( lsm ) value > 12.4 kpa . ( 3 ) hbv dna levels were more than 1000 u / ml ( 5 10 copies / ml ) for hbeag - positive patients or 100 iu / ml ( 500 copies / ml ) for hbeag - negative patients . exclusion criteria included : ( 1 ) decompensated cirrhosis : patients with ascites , hepatic encephalopathy , gastrointestinal bleeding , and other complications of cirrhosis ( such as spontaneous bacterial peritonitis ) ; ( 2 ) allergy to nas ( such as entecavir , adv , lam ) ; ( 3 ) reported liver disease : alcoholic liver disease , autoimmune liver disease , heretic liver disease , drug - induced liver disease , nonalcoholic fatty liver disease , and other chronic liver diseases ; ( 4 ) laboratory tests demonstrating that alpha - fetoprotein was > 100 ng / ml or cr > 1.5 upper limit of normal ( uln ) ; ( 5 ) patients with any malignant tumor ; ( 6 ) any complication of severe heart , lung , kidney , brain , blood diseases or other important organs diseases ; ( 7 ) complicated to severe mental illness ( such as depression , mania , epilepsy , schizophrenia ) ; ( 8) pregnant and lactating women . the selection flow of this study is shown in figure 1 . in this cohort , 563 recruited individuals were diagnosed with hbv compensated cirrhosis and had been treated by entecavir continuously . in 563 patients , 188 had been followed for more than 9 months . among them , 112 had a consecutive record of every 3 months before hbv dna first became undetected ( follow - up varied at every 3 or 6 month after hbv dna was undetectable ) . in addition , 3 patients with baseline alt > 10 uln were excluded because of the possibility of extrahepatic lithiasis . thus , the total number of patients included in the study was 91 , all of whom were treated with entecavir hbv dna at undetectable levels was defined by hbv dna 500 copies / ml ( 100 iu / ml ) . statistics with recorded clinical and laboratory data of this study were analyzed using the statistical program for social sciences ( spss 20.0 for mac ; spss inc . , data were presented as follows : ( i ) n ( % ) ( ii ) mean standard deviation ( sd ) ( iii ) median ( range ) . categorical variables were compared by chi - square testing or fisher 's exact testing as appropriate . continuous variables were compared by the two - sided student 's t - test or nonparametric test as appropriate . the data were extracted from the database of a prospective study into which hbv - induced cirrhosis patients were enrolled for antiviral therapy either by entecavir or lam plus adefovir dipivoxil ( adv ) in eight centers located in the mainland of china . the prospective study began in march 2012 , and recruitment of subjects is still ongoing . the study was conducted in accordance with the ethics principles of the declaration of helsinki and it was approved by the institutional ethics committee . selection of nas was made jointly by patients and their attending physicians , in view of medical insurance coverage , in accordance with the guideline of prevention and treatment for chb of china . individuals were all nucleos(t)ide - nave before recruitment and started therapy at a dose of entecavir at 0.5 mg / d or lam 100 mg plus adv 10 mg / d . eligible participating patients met the following criteria : ( 1 ) patient ages were between 18 and 70 years old with written informed consent ( including 18 and 70 at the time of recruitment ) . ( 2 ) chb - induced cirrhosis was clinically diagnosed by : ( 1 ) liver biopsy , ( 2 ) endoscopy of esophageal or gastric varices , excluding noncirrhotic portal hypertension , ( 3 ) two of the following ( when biopsy and endoscopy were not performed ) ( a ) ultrasonographic evidence or computed tomography / magnetic resonance imaging result that indicated imaging changes in liver morphology , which included nodules in the hepatic parenchyma , serrated change on the liver surface or spleen pachydiameter > 4.0 cm or > 5 costal region , ( b ) blood platelet ( plt ) < 100 10/l with no other explanation , ( c ) albumin ( alb ) < 35 g / l , inr > 1.3 , or che < 5.0 ku / l , ( d ) liver stiffness measurement ( lsm ) value > 12.4 kpa . ( 3 ) hbv dna levels were more than 1000 u / ml ( 5 10 copies / ml ) for hbeag - positive patients or 100 iu / ml ( 500 copies / ml ) for hbeag - negative patients . exclusion criteria included : ( 1 ) decompensated cirrhosis : patients with ascites , hepatic encephalopathy , gastrointestinal bleeding , and other complications of cirrhosis ( such as spontaneous bacterial peritonitis ) ; ( 2 ) allergy to nas ( such as entecavir , adv , lam ) ; ( 3 ) reported liver disease : alcoholic liver disease , autoimmune liver disease , heretic liver disease , drug - induced liver disease , nonalcoholic fatty liver disease , and other chronic liver diseases ; ( 4 ) laboratory tests demonstrating that alpha - fetoprotein was > 100 ng / ml or cr > 1.5 upper limit of normal ( uln ) ; ( 5 ) patients with any malignant tumor ; ( 6 ) any complication of severe heart , lung , kidney , brain , blood diseases or other important organs diseases ; ( 7 ) complicated to severe mental illness ( such as depression , mania , epilepsy , schizophrenia ) ; ( 8) pregnant and lactating women . the selection flow of this study is shown in figure 1 . in this cohort , 563 recruited individuals were diagnosed with hbv compensated cirrhosis and had been treated by entecavir continuously . in 563 patients , 188 had been followed for more than 9 months . among them , 112 had a consecutive record of every 3 months before hbv dna first became undetected ( follow - up varied at every 3 or 6 month after hbv dna was undetectable ) . in addition , 3 patients with baseline alt > 10 uln were excluded because of the possibility of extrahepatic lithiasis . thus , the total number of patients included in the study was 91 , all of whom were treated with entecavir hbv dna at undetectable levels was defined by hbv dna 500 copies / ml ( 100 iu / ml ) . statistics with recorded clinical and laboratory data of this study were analyzed using the statistical program for social sciences ( spss 20.0 for mac ; spss inc . , chicago , il , usa ) . data were presented as follows : ( i ) n ( % ) ( ii ) mean standard deviation ( sd ) ( iii ) median ( range ) . categorical variables were compared by chi - square testing or fisher 's exact testing as appropriate . continuous variables were compared by the two - sided student 's t - test or nonparametric test as appropriate . there were 91 intention - to - treat patients included who were followed for a median 12 ( 924 ) months . the majority of patients were 4060 years old with a male preponderance . among the 91 patients , 54.7% were hbeag negative , and most of them achieved virological response in the first 3 months . fifty - two patients had a plt level < 100 10/l , 36 of them had hbv dna undetectable at the 3 month . among 25 cases with alb < 35 g / l , 18 experienced early virological response . among the 64 participants who took lsm with fibroscan , 12 out of 15 lsm < 12.5 kpa individuals experienced early virological response . among 71 with t - bil < 34 mol / l individuals , 51 of them had hbv dna undetectable during the first 3 months [ table 1 ] . main baseline characteristics of the study data are expressed as n ( % ) , meansd or median ( range ) , as appropriate . * no available data for five patients . hbv : hepatitis b viral ; hbeag : hepatitis b e antigen ; alt : alanine aminotransferase ; plt : blood platelet ; t - bil : total bilirubin ; alb : albumin ; pt : prothrombin time ; lsm : liver stiffness measurement ; sd : standard deviation . baseline factors that may be related to an early undetectable hbv dna were analyzed by logistic regression [ table 2 ] . univariate and multivariate logistic regression analysis for the risk of third month hbv dna response * statistically significant . or : odds ratio ; ci : confidence interval ; hbv : hepatitis b viral ; hbeag : hepatitis b e antigen ; alt : alanine aminotransferase ; plt : blood platelet ; t - bil : total bilirubin ; alb : albumin ; pt : prothrombin time . baseline hbv dna level was strongly related to virological response at the 3 month ( p < 0.001 , odds ratio [ or ] : 2.13 , 95% ci : 1.443.15 ) . sixty - four patients ( 70.3% ) had hbv dna undetected at the 3 month ; 3 of them experienced virological breakthrough . the remaining 27 patients ( 29.7% ) had detectable hbv dna after the 3 month ; 2 of the 31 patients experienced virological breakthrough after the virological response . the mean sd of hbv dna was lower in early response patients than in late responders . the alt baseline value was also associated with early virological response ( p = 0.023 , or : 1.01 , 95% ci : 1.001.01 ) . there were 33 individuals ( 86.8% ) with normal alt , who had hbv dna undetected at the 3 month while 58.5% in patients with abnormal alt . in addition , 62.9% of the patients in the early virological response group were hbeag negative while 59.0% patients who were hbeag positive had hbv dna undetectable within 3 months ( p = 0.016 , or : 0.30 , 95% ci : 0.110.80 ) . age , gender , alcohol consumption , lsm , plt , t - bil , alb , and pt between patients with hbv dna undetected at the 3 month and after first 3 months were comparable ( p > 0.05 ) . baseline alt and hbv dna level and hbeag negativity were further tested by multiple logistic regression . hbv dna level was the only significant factor that could predict early response ( p < 0.001 , or : 1.98 , 95% ci : 1.332.94 ) . we then stratified patients into six groups using the baseline hbv dna levels [ figure 2 ] . we found that patients with elevated hbv dna at baseline had a higher probability to remain hbv dna positive at the 3 month ( p < 0.001 ) . median of hepatitis b virus ( hbv ) dna ( log10 ) of different baseline log hbv dna strata . median hbv dna values among patients with baseline serum hbv dna levels at < 7 , 7.07.9 and 8.0 log10 strata were 0.0 , 2.9 , and 3.3 log10 , respectively , at the 3 month . the higher baseline hbv dna and the higher median hbv dna remained at the 3 month . approximately , 68.2% of all the participants with hbv dna > 7.0 log10 , had detectable hbv dna at the 3 month , which was significantly higher than 22.2% ( 5.06.9 log10 group ) and 12.1% ( < 5.0 log10 group ) ( p < 0.01 ) . a 38.1% hbv dna detectable rate in > 7.0 log10 group at month 6 was also significantly higher than 3.6% in < 5.0 log10 group ( p = 0.003 ) and 6.5% in 5.06.9 log10 group there were no significant differences at the 9 and 12 months . according to the receiver operating characteristic ( roc ) curve analysis in this study , the baseline hbv dna area under the curve for predicting the 3 month virological response was 77.6% ( 95% ci : 66.788.5% ) [ figure 3 ] . a baseline hbv dna level at 5.8 log10 showed a best cut - off value with a sensitivity of 85.2% and specificity of 64.1% for predicting the virological response at the 3 month . receiver operating characteristic analysis for 3 month prediction of hepatitis b virus ( hbv ) dna response from baseline . finally , we calibrated the accuracy of the cut - off value of predicting the 3 month hbv dna virological response [ figure 4 ] . median hbv dna in groups with baseline hbv dna < 5.8 and 5.8 log10 were at a respective 0.0 log10 and 2.4 log10 at the 3 month . about 8.9% of the 45 patients with lower baseline hbv dna had detectable hbv dna at the 3 month , compared to 50.0% in 46 patients with higher baseline hbv dna ( p < 0.001 ) . at the 6 month , 2.6% had sustained detectable hbv dna in the low baseline hbv dna group , whereas the level was 23.8% in high baseline hbv dna patients ( p = 0.008 ) . median of hepatitis b virus ( hbv ) dna ( log10 ) by sort of best cut - off value . there were 91 intention - to - treat patients included who were followed for a median 12 ( 924 ) months . the majority of patients were 4060 years old with a male preponderance . among the 91 patients , 54.7% were hbeag negative , and most of them achieved virological response in the first 3 months . fifty - two patients had a plt level < 100 10/l , 36 of them had hbv dna undetectable at the 3 month . among 25 cases with alb < 35 g / l , 18 experienced early virological response . among the 64 participants who took lsm with fibroscan , 12 out of 15 lsm < 12.5 kpa individuals experienced early virological response . among 71 with t - bil < 34 mol / l individuals , 51 of them had hbv dna undetectable during the first 3 months [ table 1 ] . main baseline characteristics of the study data are expressed as n ( % ) , meansd or median ( range ) , as appropriate . * no available data for five patients . hbv : hepatitis b viral ; hbeag : hepatitis b e antigen ; alt : alanine aminotransferase ; plt : blood platelet ; t - bil : total bilirubin ; alb : albumin ; pt : prothrombin time ; lsm : liver stiffness measurement ; sd : standard deviation . baseline factors that may be related to an early undetectable hbv dna were analyzed by logistic regression [ table 2 ] . univariate and multivariate logistic regression analysis for the risk of third month hbv dna response * statistically significant . or : odds ratio ; ci : confidence interval ; hbv : hepatitis b viral ; hbeag : hepatitis b e antigen ; alt : alanine aminotransferase ; plt : blood platelet ; t - bil : total bilirubin ; alb : albumin ; pt : prothrombin time . baseline hbv dna level was strongly related to virological response at the 3 month ( p < 0.001 , odds ratio [ or ] : 2.13 , 95% ci : 1.443.15 ) . sixty - four patients ( 70.3% ) had hbv dna undetected at the 3 month ; 3 of them experienced virological breakthrough . the remaining 27 patients ( 29.7% ) had detectable hbv dna after the 3 month ; 2 of the 31 patients experienced virological breakthrough after the virological response . the mean sd of hbv dna was lower in early response patients than in late responders . the alt baseline value was also associated with early virological response ( p = 0.023 , or : 1.01 , 95% ci : 1.001.01 ) . there were 33 individuals ( 86.8% ) with normal alt , who had hbv dna undetected at the 3 month while 58.5% in patients with abnormal alt . in addition , 62.9% of the patients in the early virological response group were hbeag negative while 59.0% patients who were hbeag positive had hbv dna undetectable within 3 months ( p = 0.016 , or : 0.30 , 95% ci : 0.110.80 ) . age , gender , alcohol consumption , lsm , plt , t - bil , alb , and pt between patients with hbv dna undetected at the 3 month and after first 3 months were comparable ( p > 0.05 ) . baseline alt and hbv dna level and hbeag negativity were further tested by multiple logistic regression . hbv dna level was the only significant factor that could predict early response ( p < 0.001 , or : 1.98 , 95% ci : 1.332.94 ) . we then stratified patients into six groups using the baseline hbv dna levels [ figure 2 ] . we found that patients with elevated hbv dna at baseline had a higher probability to remain hbv dna positive at the 3 month ( p < 0.001 ) . median of hepatitis b virus ( hbv ) dna ( log10 ) of different baseline log hbv dna strata . median hbv dna values among patients with baseline serum hbv dna levels at < 7 , 7.07.9 and 8.0 log10 strata were 0.0 , 2.9 , and 3.3 log10 , respectively , at the 3 month . the higher baseline hbv dna and the higher median hbv dna remained at the 3 month . approximately , 68.2% of all the participants with hbv dna > 7.0 log10 , had detectable hbv dna at the 3 month , which was significantly higher than 22.2% ( 5.06.9 log10 group ) and 12.1% ( < 5.0 log10 group ) ( p < 0.01 ) . a 38.1% hbv dna detectable rate in > 7.0 log10 group at month 6 was also significantly higher than 3.6% in < 5.0 log10 group ( p = 0.003 ) and 6.5% in 5.06.9 log10 group there were no significant differences at the 9 and 12 months . according to the receiver operating characteristic ( roc ) curve analysis in this study , the baseline hbv dna area under the curve for predicting the 3 month virological response was 77.6% ( 95% ci : 66.788.5% ) [ figure 3 ] . a baseline hbv dna level at 5.8 log10 showed a best cut - off value with a sensitivity of 85.2% and specificity of 64.1% for predicting the virological response at the 3 month . receiver operating characteristic analysis for 3 month prediction of hepatitis b virus ( hbv ) dna response from baseline . demonstrate the baseline hbv dna load predicting 3 month virologic response . finally , we calibrated the accuracy of the cut - off value of predicting the 3 month hbv dna virological response [ figure 4 ] . median hbv dna in groups with baseline hbv dna < 5.8 and 5.8 log10 were at a respective 0.0 log10 and 2.4 log10 at the 3 month . about 8.9% of the 45 patients with lower baseline hbv dna had detectable hbv dna at the 3 month , compared to 50.0% in 46 patients with higher baseline hbv dna ( p < 0.001 ) . at the 6 month , 2.6% had sustained detectable hbv dna in the low baseline hbv dna group , whereas the level was 23.8% in high baseline hbv dna patients ( p = 0.008 ) . median of hepatitis b virus ( hbv ) dna ( log10 ) by sort of best cut - off value . in this study , we investigated the relationship between several baseline parameters and virological response to etv therapy by the 3 month among patients with hbv induced cirrhosis . there were two notable features in this prospective study : ( 1 ) our cohort is exclusively composed of hbv - related cirrhosis patients who were at a compensatory stage , treatment naive and were selected under strict recruiting and exclusion criteria . ( 2 ) we report that the baseline hbv dna level was the most important factor related to full virologic response at the 3 month , and we identified a cut - off value of baseline hbv dna level for predicting antiviral response . to our knowledge , our study is the first one to establish this cut - off value for prediction . our univariate analysis found that patients with lower hbv dna or negative hbeag at baseline tended to have a higher probability to achieve a full virologic response at the 3 month . our results are in line with previous studies . however , multiple regression analysis only confirmed the baseline hbv dna level as a sole factor related to the virological response . this highlights the importance of the baseline hbv dna level in achieving early full virological response , reflecting the fact that a shorter treatment course is sufficient to decrease hbv dna to undetectable levels . we also evaluated the best cut - off value that can be used to predict the virological response at the 3 month . we found that a < 5.8 log10 baseline hbv dna cut - off represented significantly higher likelihood to achieve virological response at the 3 month . this can be explained by the fact that the median hbv dna level is lower in hbv - related cirrhosis patients than chb patients . there was no significant difference in the hbv dna undetectable rate between groups that either had more or fewer hbv dna copies than 5.8 log10 at baseline after 6 months . in this study , we also investigated the relationship between baseline alt value and the 3 month full virological response . patients with alt 1 unl had a higher probability of achieving a full virological response within the first three months than patients with alt > 1 unl in this cohort . once a chronic hbv - induced patient experienced hbeag seroconversion , as did more than half of our cohort , serum hbv dna level was significantly reduced . the patients who were hbeag negative , accompanied by a reduction in hbv dna and normal alt , were referred to as inactive carriers . our results showed that patients with normal alt had lower hbv dna at baseline and a lower baseline hbv dna level was favored for achieving an early full virological response in our cohort as discussed above . it appears that our results indicating that a baseline normal alt is a favorable factor for early loss of detectable hbv dna contradicted the previous reports , which showed an elevated alt . for instance , a value > 5 unl at baseline was more likely to have hbeag seroconversion and better virological response in treated chb patients . however , the real difference is due to the varied cohorts . chb patients can be variable and may be at two different phases : one phase having high hbv dna but accompanied only by slightly elevated alt , and the other phase having a medium hbv dna level accompanied by significantly elevated alt . it takes a shorter time course to promote a change to undetectable from the medium hbv dna than from a high hbv dna level . the principle was the same : a relatively lower baseline hbv dna promoted an earlier virological response . the relationship between lsm and hbv dna kinetics in chinese hbv - induced compensated cirrhosis remains to be established . our study showed that patients with different lsm baseline levels showed no significant difference in early virological response . our data showed that the baseline hbv dna level was the most effective factor related to an early full virological response to etv therapy . the lower the hbv dna at baseline , the earlier the virological response was in our cohort . one limitation of our study was although the enrolled patients were clear clinical diagnosed by strict criteria and every routine 3-month follow - up , the total cases were still limited and relatively short follow - up , as it was launched in march 2012 and patient recruitment is currently ongoing . in addition , our strict criteria of recruiting and exclusion of patients may impede the extrapolation of results to a broader range of hbv induced cirrhosis patients , especially to those who had combined autoimmune liver disease , severe kidney or cardiovascular diseases , and human immunodeficiency virus infection .
background : cirrhosis is a common complication of chronic hepatitis b. it remains unclear if viral and biochemical parameters at baseline affect virological response to entecavir and therefore warrant investigation . in the present study , we aimed to evaluate the efficacy of entecavir therapy by monitoring virological response at the end of the 3rd month of treatment and try to figure out whether baseline factors could help predict it in a cohort of hepatitis b virus ( hbv ) compensated cirrhosis patients and to determine the cut - off value of a predicting parameter.methods:a total of 91 nucleos(t)ide - nave patients with hbv induced cirrhosis ( compensatory stage ) were enrolled in a prospective cohort . hbv dna and alanine aminotransferase ( alt ) were tested at baseline and monitored every 36 months after starting therapy.results:of all 91 patients , the median follow - up time was 12 ( 924 ) months . overall , 64 patients ( 70.3% ) achieved virological response in the 3rd month . univariate analysis showed that the 3rd month virological response can be predicted by baseline hbv dna levels ( p < 0.001 , odds ratio [ or ] : 2.13 , 95% confidence interval [ ci ] : 1.443.15 ) , alt value ( p = 0.023 , or : 1.01 , 95% ci : 1.001.01 ) and hepatitis b e antigen ( hbeag ) negativity ( p = 0.016 , or : 0.30 , 95% ci : 0.110.80 ) . multiple regression analysis showed baseline hbv dna level was the only parameter related to full virological response . higher baseline hbv dna strata indicated a higher probability that hbv dna remains detectable at the 3rd month ( p = 0.001 ) . area under receiver operating characteristic curve for determining the 3rd month virological response by baseline hbv dna was 77.6% ( 95% ci : 66.785.2% ) , with a best cut - off value of 5.8 log10.conclusions:baseline hbv dna , hbeag negativity , and alt were independent factors contributing to virological response at the 3rd month . further , multiple regression showed that hbv dna level was the only parameter predicting full virological response as early as the 3rd month , in this cirrhosis cohort .
during the past 50 years , caring for the critically ill has become an increasingly complex task . new insights into pathophysiology , expensive therapeutic agents , and the proliferation of new technologies for physiologic monitoring contribute to making care of the critically ill patient a nuanced and demanding effort . thus , the need for an intensivist , trained in the management of critically ill patients , in the icu has become more evident . in fact , management by intensivists has become a quality indicator for many icus , especially high - intensity icus . numerous small , prospective cohort studies have demonstrated the beneficial effect of intensivists on outcomes in the critically ill [ 3 - 5 ] . consequently , some clinicians have advanced the argument that a night - time intensivist is an essential ingredient for safe , high - quality care for critically ill patients [ 6 - 8 ] . in response , many institutions have hired full - time intensivists for both day and night coverage in the icu . although the belief has also generated debate in the literature , no robust studies that supported either position had been published until recently . now two studies have been conducted that make a compelling argument for redirecting funding of night - time intensivists to areas of greater need in health care . significant messages for the field are conveyed in the article by wallace and colleagues , a retrospective cohort trial evaluating the presence of night - time intensivists in low- and high - intensity units . in high - intensity icus , consults or management by critical care physicians are mandated for all admitted patients ; in low - intensity icus , consultations by critical care physicians are not mandated . in this large database that involved 49 icus and more than 65,000 patients , high - intensity daytime staffing was not associated with decreased mortality , and no benefit of night - time intensivists could be found in high - intensity icus . this suggests that in icus where care is managed by intensivists during the day , a night shift by intensivists does not seem to improve care further . during the night the second study , a randomized controlled trial published by kerlin and colleagues , evaluated the effect of night - time intensivists on length of stay , mortality , and other outcomes . the message from this study is much clearer : this was a negative trial . in this methodologically rigorous trial , there was no difference in outcomes between the intensivist and control group , which consisted of in - house resident coverage at night with availability by telephone of fellows and intensivists . it is important to recognize that this randomized trial was conducted in a single - center , large academic , high - intensity university icu in the us , with a full complement of house staff and critical care trainees and can not be generalized to smaller , non - teaching , or low - intensity environments . therefore , both studies are consistent - addition of night - time intensivists to a high - intensity icu does not make a difference in mortality or length of stay . when critically ill patients are managed by intensivists during the day , there is no added benefit to patient outcomes with the presence of an intensivist on - site at night . in both studies , intensivists and/or fellows were on - call and available at night for management to maintain the consistency of care plans developed during daytime hours . although the article by wallace and colleagues suggests that in low - intensity environments outcomes are improved when care is directed by intensivists at night , the widespread drive to add night - time intensivist coverage based on an assumption of better outcomes may have been premature . according to these articles , there is no evidence to support this assertion . in both of the recent articles , the authors suggest that other , unmeasured outcomes - such as better end - of - life care , improved compliance with quality measures , and better educational opportunities for house staff and nursing staff - may be improved with the presence of night - time intensivists . in part , this is supported by two recent articles by reinick and colleagues and almeida and colleagues . however , we have to question whether this is an attempt to keep alive the belief that night - time intensivists do make a difference , and we must question whether the expense is justified by these potential outcomes . these two robust studies clearly suggest that night - time intensivists do not improve mortality in icus managed by intensivists during the day . perhaps it is time to stop trying to prove that a single intensivist in the unit at night has an effect on mortality . the value of a single intensivist may be more subtle , but just as important : as the leader of a team they create a safer environment that is more patient / family - centric , and that is more consistent with best practices . that value foretells considerable implications for many icus globally . given the reality of spiraling costs in health care , this might be one area in which cost savings can be realized without sacrificing the quality of care our patients receive . it is time we embraced the results of these trials as reflecting the need for daytime intensivists - who apply the appropriate standard of care in order to maintain high - quality care - and to redirect the resources proposed for night - time intensivists elsewhere .
during the past 50 years , caring for the critically ill has become increasingly complex and the need for an intensivist has become more evident . management by intensivists has become a quality indicator for many icus . numerous small studies have demonstrated the beneficial effect of intensivists on outcomes in the critically ill , and some clinicians have advanced the argument that a night - time intensivist is essential for the care of critically ill patients . in response , many institutions have hired full - time intensivists for both day and night coverage in the icu . two recent studies have been conducted that make a compelling argument for redirecting funding of night - time intensivists to areas of greater need in health care . in a retrospective analysis of a large database that involved more than 65,000 patients , no benefit of night - time intensivists could be found in icus where care is managed by intensivists during the day . only in icus where management by intensivists is not mandated could a beneficial impact on mortality be found . the second study , a randomized controlled trial , evaluated the effect of night - time intensivists on length of stay , mortality , and other outcomes and was a negative trial . in this methodologically rigorous trial , there was no difference in outcomes between the intensivist and control group , which consisted of in - house resident coverage at night with availability by telephone of fellows and intensivists . these two robust studies clearly suggest that night - time intensivists do not improve mortality in icus managed by intensivists during the day . though possibly beneficial in low - intensity environments , the widespread drive to add night - time intensivist coverage may have been premature .
psoriasis affects 23% of the european populations , and less commonly other populations of other countries , i.e. far east and china.1 , 2 to date , there is no doubt that psoriasis is an immune - mediated disorder as reflected by t cell hyperactivity and the production of multiple proinflammatory cytokines , such as tumour necrosis factor alpha ( tnf- ) and interleukin ( il)-2 , il-12 , il-17 , il-22 or il-23.3 , 4 , 5 nevertheless , all available treatment options remain largely unspecific , and many patients do not achieve the desired outcome.6 , 7 topical agents including corticosteroids , vitamin d analogous , tazarotene , coal tar , and dithranol are predominantly used for mild disease , and systemic agents including photochemotherapy , methotrexate , ciclosporin , retinoids fumarates , and biological agents are used for severe disease.8 , 9 none of these treatment options has fully met the needs of affected patients.6 , 7 the question whether a combination therapy of biologic and systemic agents may improve treatment outcome is yet unclear.6 , 7 thus , there is a need for alternative and well - tolerable treatment for psoriasis . in fact , many affected patients are using or seeking new therapeutic options , including complementary and alternative medicine.10 , 11 , 12 in this observational case series study , we documented the effectiveness and tolerability of durrderma in adult patients with active moderate to severe psoriasis vulgaris . the active ingredients of durrderma are black cumin as the main component , and olive oil , tea tree oil , cocoa butter , vitamin a and vitamin b12 as further components . a total of 12 unselected out - patients with moderate ( n = 6 ) to severe ( n = 6 ) psoriasis as diagnosed by a dermatologist or experienced general practitioner and characterized by a psoriasis area and severity index ( pasi ) score of 10 ( table 1 ) were treated with durrderma . patients had to had a disease endurance of > 3 months and at least one conventional previous treatment approach . treatment duration was scheduled for 12 weeks and tubes of 200 g and boxes with 500 g were handed out as anticipated for proper use during the planned 12-week treatment period . patients were asked to apply the cream twice daily and hereby to cover all skin lesions with a thin layer of cream . the preparation relates to compositions comprising black cumin oil ( > 10% ) , olive oil ( > 10% ) , tea tree oil ( < 0,09% ) , cocoa butter ( < 4% ) , vitamin a ( < 0,05% ) and vitamin b12 ( < 0,05% ) . the essential oil components of black cumin oil are thymoquinones which have been shown to have anti - oxidative , anti - inflammatory , anti proliferative , anti - allergic and anti - bacterial activities , as well as immunomodulatory and immunotherapeutic characteristics . it has been shown to have anti - oxidative , anti - inflammatory and anti - microbial activities . cocoa butter is extracted from cocoa beans and contains various anti - oxidants that are related to catechines and epicatechines , as well as others that are related to procyanidines and polyphenols . vitamin a has anti - oxidative activity and is one of the cells physiological anti - oxidants . vitamin b12 is a water - soluble vitamin with a key role in the normal functioning of the brain and nervous system , as well as for the formation of blood . it affects inter alia dna synthesis and regulation , fatty acid synthesis and energy production . all patients were evaluated for 12 weeks and assessments of disease activity with calculation of pasi took place at baseline and at the time points of 2,4 , 8 and 12 weeks after initialization of treatment by the treating physician . in addition , all patients completed a patient 's questionnaire assessing satisfaction with treatment and side effects . there was no selection of patients by age , gender , localization and severity of disease , or previous treatments . patients were aged from 18 to 86 years and had a confirmed diagnosis of psoriasis for longer than 3 months . the majority of patients had received previous standard topical and/or a systemic therapy but were treatment - resistant . only two patients had no previous standard treatment ( table 1 , nos . 6 and 8) . initially , the vast majority of patients ( n = 10 ) showed a mild to moderate increase of local inflammation with increased reddening of the affected skin area ( table 2 ) for a short period of time . however , during continuous observation and under sustained treatment a gradual and pronounced clinical improvement became obvious in almost all cases within a few weeks . a pasi reduction of > 75% was observed in 10 of the 12 treated patients , in 3 patients already before the 12-week assessment , in the other 7 patients after 12 weeks of treatment ( table 2 ) . the remaining two patients showed a pasi reduction of 50% , at week 4 and 8 . one of the non - responder patients ( no.12 ) had autoimmune thrombocytopenia which required continuous treatment with nplate ( thrombopoietin receptor agonist ) . one of the well responding patients had a treatment course of topical tea tree oil ( also an ingredient of durrderma ) before starting the durrderma application . this patient reported that the previous use of tea tree oil alone was ineffective but resulted in an exacerbation of the disease and discontinuation of this treatment after two weeks . a mild exacerbation of the skin inflammation was a common initial response ( 24 days after treatment initialization ) with a subsequent consistent improvement of the disease state thereafter . some of the patients complained about the fatty characteristic of the preparation and the related pollution of clothes . this case series study was initiated to determine by a first documentation the effectiveness and tolerability of durrderma , a traditional herbal preparation in a new specific combination formula , in patients with manifest and treatment - resistant psoriasis . independent of previous treatment and severity of disease , 10 of the 12 treated patients with the new herbal preparation were well responding and 2 patients moderately responding . most intringuingly , psoriasis signs not only improved but completely disappeared following treatment in 4 patients and nearly disappeared in further 6 of the patients ( fig . 1 ) . thus , a clinical meaningful effect of the preparation might be possible and should be tested and evaluated by means of a randomized controlled clinical trial . as treatment options in severe psoriasis are limited and the safety profile , so far , seems good , further research is warranted . however , based on the fact that psoriasis is an immune - mediated disease,3 , 4 , 5 and that oxidative stress is playing a key role in this process,13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 it seems likely that anti - oxidative products , such several food constituents,21 , 22 may have a positive effect on psoriasis . the durrderma composition contains different natural and herbal products which have potential anti - oxidative and/or anti - inflammatory effects . black cumin oil is obtained from the seeds of nigella sativa and contains thymoquinones , which have been shown to have anti - oxidative , anti - inflammatory , anti proliferative , anti - allergic and anti - bacterial activities , as well as immunomodulatory and immunotherapeutic characteristics.23 , 24 , 25 , 26 , 27 similarly , olive oil contains a high concentration of polyphenols which have by large similar effects as thymoquinones from nigella sativa.28 , 29 , 30 tea tree oil is obtained from leaves of melalenca alternifolia which has anit - oxidative , anti - inflammatory , anti - bacterial , anti - viral , and anti - fungal acivities.31 , 32 , 33 cocoa butter is extracted from cocoa beans which also contain various antioxidants , i.e. catechines , epicatechines , procyanidines , and polyphenols . thus , durrderma may provide a therapeutic effect that is not based on an isolated substance , but rather on a synergistic combination of various prophylactic , therapeutic , anti - inflammatory , immunological and anti - microbial activities . 4 ) , previous to the application of the preparation in this case observation , used tea tree oil which , however , led to continous worsening of his psoriasis . in addition , there is empirical observation that many such affected patients appear to have used olive oil without effect . however , some topical drugs , such as coal tar and anthralin have been described also to cause a flare - up ( koebner phenomenon ) in patients with active psoriasis.36 , 37 we do not know if the initial ( mild ) aggravation is a precondition for the retarded and lasting treatment effect . of note , patients need to be informed about this treatment kinetic to ensure compliance . however , on the background of current existing preclinical and botanical research data of the components of the preparation , no specific safety concerns are expected . in conclusion , the observations in this case series study point to a promising and clinically relevant beneficial effect of the durrderma preparation in patients with skin psoriasis .
the objective of this study was to assess the effectiveness of a specific composition of a traditional herbal preparation ( durrderma ) in adult patients with moderate to severe skin psoriasis . the preparation is a newly developed topical combination containing plant - based extracts traditionally used in skin disease as black cumin , olive oil , tea tree oil , cocoa butter completed by vitamin a and vitamin b12 . we documented the effectiveness of the preparation in a first case series . a total of 12 patients ( 8 males and 4 females , 2186 y ) with manifest and treatment - resistant psoriasis were included and treated for 12 weeks . all patients were assigned to twice - daily treatment with the durrderma preparation . treatment success as determined by the psoriasis area and severity index ( pasi ) score , the body surface area , and the dermatology life index was achieved ( pasi reduction of > 75% ) in 10 of the 12 treated patients ( 83% ) . the remaining two patients showed a pasi reduction of 50% . in 5 of the patients pasi reduction was achieved < 12 weeks ( between week 311 ) . the beneficial effect in responder patients might be explained by a synergistic anti - oxidative and anti inflammatory activity of all components present in durrderma . we conclude that the new preparation using a traditional approach seems to be a promising complementary treatment for psoriasis .
this results in less trauma and pain , faster recovery , and a better cosmetic outcome for the patients . natural orifice transluminal endoscopic surgery ( notes ) involves the introduction of instruments through a natural orifice into the peritoneal cavity to perform diagnostic and therapeutic surgical interventions . although many reports have demonstrated the technical feasibility of per os , transgastric and transcolonic approaches to certain procedures , current endoscopes and instruments are too flexible and insufficient to allow wide usage of this technology for procedures . the combination of conventional rigid laparoscope and instruments with the natural orifice technique , such as transvaginal , may allow less - invasive procedures and favorable outcomes . the technique of vaginal hysterectomy has become more commonly used , and in many countries it is the operation of choice for benign uterine disease requiring surgery . the establishment and closure of transvaginal access to the abdominal cavity have become conventional techniques in this procedure , which also provide a theoretical basis and technical support for transvaginal notes procedures . the vagina is the most widely used approach to notes because it is easy to clean and disinfect and , more importantly , because it provides safe access to the peritoneal cavity and the incision can easily be closed manually . in dedicated collaboration with gynecologists and surgeons , we successfully performed transvaginal appendectomy using conventional rigid laparoscope and instruments , using the vaginal opening , at the time of vaginal hysterectomy . ten patients underwent transvaginal laparoscopic appendectomy at the time of vaginal hysterectomy at shengjing hospital of china medical university between november 2010 and november 2012 . the mean patient age was 46.7 years ( range , 27 to 63 years ) . the indications for hysterectomy were abnormal uterine bleeding ( 1 case ) , symptomatic leiomyomata ( 7 cases ) , and endometrial hyperplasia ( 2 cases , 1 of them combined with symptomatic leiomyomata ) . the diagnoses of chronic appendicitis were made when the patient had 1 or more attacks of acute appendicitis and a fecalith was present on computed tomography scan or no filling of the appendix on barium enema . the exclusion criteria included a history of multiple prior open abdominal operations , body mass index ( bmi ) > 35 kg / m ( because morbid obesity may affect the exposure of the appendix by the transvaginal route , unlike transvaginal hysterectomy alone ) , and extremes of age ( < 18 yr . or > 65 yr . ) . all patients gave written informed consent for surgery , institutional review board approval was obtained for the study , and patient confidentiality was maintained at all times . all patients underwent routine preoperative mechanical and chemical bowel preparation and received a single dose of prophylactic intravenous antibiotics immediately prior to the start of the procedure . under general endotracheal anesthesia ( 7 patients ) or epidural anesthesia ( 3 patients ) , all subjects were placed in the lithotomy position . vaginal hysterectomy was performed in the usual fashion ; once the uterus was removed , attention was turned to the appendix . three trocars were placed through the opening of the vagina in the fashion of a reverse triangle ( figure 1 ) . before the above procedure , sparse sutures on the opening end of vagina were taken to maintain the trocars place and pneumoperitoneum . a 30 rigid laparoscope ( stryker endoscopy , u.s.a . ) was used throughout the procedures . using 5-mm conventional ultrasonic ace ( ethicon , u.s.a . ) , the mesoappendix was coagulated and cut , mobilizing the appendix to its base ( figure 2 ) . closure of the appendicular base was performed with hem - o - lock clips ( weck closure systems , u.s.a . ) . the appendix was then removed via the colpotomy without the use of an endoscopic bag ( figure 4 ) . after hemostasis was confirmed , the vaginal cuff was sutured manually in the routine fashion for vaginal hysterectomy . t-shaped tube as vault drainage was placed through the opening of vagina ( removed at 48 hours after surgery ) . during the laparoscopic procedures with pneumoperitoneum , it is not easy to keep the vaginal incision tightly sealed , and a gas leak or the use of suction can significantly affect operative field visibility and instrument maneuverability . we used 2 towel forceps to form a parallel double - line suspension at the right lower quadrant , around mcburney s point , as we described previously , which is able to provide better exposure in the pelvis to facilitate gasless surgery the first suspension device makes room for surgery , while the second expands the space so that instruments can be manipulated with greater ease . using 5-mm conventional ultrasonic ace ( ethicon , u.s.a . ) , the mesoappendix was coagulated and cut , mobilizing the appendix to its base ( figure 2 ) . closure of the appendicular base was performed with hem - o - lock clips ( weck closure systems , u.s.a . ) . the appendix was then removed via the colpotomy without the use of an endoscopic bag ( figure 4 ) . after hemostasis was confirmed , the vaginal cuff was sutured manually in the routine fashion for vaginal hysterectomy . a t-shaped tube as vault drainage was placed through the opening of vagina ( removed at 48 hours after surgery ) . during the laparoscopic procedures with pneumoperitoneum , it is not easy to keep the vaginal incision tightly sealed , and a gas leak or the use of suction can significantly affect operative field visibility and instrument maneuverability . we used 2 towel forceps to form a parallel double - line suspension at the right lower quadrant , around mcburney s point , as we described previously , which is able to provide better exposure in the pelvis to facilitate gasless surgery the first suspension device makes room for surgery , while the second expands the space so that instruments can be manipulated with greater ease . all intended surgical procedures were carried out successfully and additional transabdominal ports were not required . the appendectomy procedure time was measured from the establishment of the operating space to the complete closure of the vaginal cuff . the average operating time was 27.2 min ( range , 21 to 34 min ) , and the estimated blood loss was minimal . postoperative analgesia was considered routine for the vaginal hysterectomy procedure ; additional medication requirements were not noted . all patients were started on a clear liquid diet on postoperative day 1 and advanced to a low - residue diet without difficulty within 48 hours . the mean postoperative hospital stay was 2.7 days , with 4 patients discharged home on the second postoperative day , 5 on the third day , and 1 on the fourth day . pathological examination of all appendectomy specimens revealed fibrosis in the appendiceal wall , partial to complete obstruction of the lumen , evidence of old mucosal ulceration and scarring , or infiltration of the wall of the appendix with chronic inflammatory cells . minor outpatient postoperative complications were as follows : 1 urinary tract infection successfully treated with oral antibiotics , and 1 vaginal cuff granulation tissue repair 3 months after surgery . the patients were advised to abstain from sexual activity for 2 weeks postoperatively , and all sexually active patients reported a return to normal sexual activity 2 weeks later . notes represents a new field that is drawing the attention of surgeons and endoscopists alike , which comprises several new endoscopic and surgical entryways into the abdominal cavity . transvaginal surgery , traditionally limited to gynecologists for the purpose of performing hysterectomies , is now being used for abdominal operations such as appendectomy , cholecystectomy , nephrectomy , hernia repair , adrenalectomy , and sleeve gastrectomy . one of the advantages of notes is the ability to provide female patients with a superior cosmetic alternative to the traditional laparoscopic techniques . nonetheless , this new frontier of surgical approaches has been received critically from the surgical community . the vaginal hysterectomy route appears to have little effect on postoperative sexual function , but overall pain scores are improved with the vaginal approach , over abdominal hysterectomy . the establishment and closure of transvaginal access to the abdominal cavity have become conventional techniques in gynecology , which provide a theoretical basis and technical support for transvaginal notes . effective closure of natural tract - wall incisions and prevention of intra - abdominal infections are 2 key factors affecting the development of the notes technique . manual closure of a vaginal incision is much easier and safer than closing wounds of the stomach and colorectal walls . the transvaginal approach does not have the serious potential risk of causing intestinal fistula , unlike the transgastric and trans - colorectal approaches . in addition , with adequate preoperative vaginal preparation , the risk of abdominal infection can be effectively reduced so as to establish a safe and reliable notes pathway . based on our previous animal notes experiments and a large number of umbilical laparoscopic surgeries , we decided to perform transvaginal laparoscopic appendectomy . because the target organ ( the appendix ) is close to the operation pathway ( the vagina ) , and appendectomy is a relatively simple procedure , we tried this procedure in our initial series . from our results , transvaginal laparoscopic appendectomy using rigid instruments proved to be feasible , safe , and cost - effective . the major drawback to this technique is the frequent collision of laparoscopic instruments , both extra- and intracorporeally , ascribed to the lack of triangulation necessitated by the narrow instrument - insertion space and the limited operating area . in addition , when surgical instruments are almost coaxial with the light source , a strong sense of space misappropriation is generated and it becomes even more difficult when multiple instruments are simultaneously needed for a collaborative operation . vaginal opening gas leak is another important problem that seriously affects transvaginal laparoscopic procedure performed under conventional pneumoperitoneum . it is difficult to ensure that the vaginal incision is as absolutely airtight as an abdominal incision , and a surgical gas leak or the use of extensive suction will influence the operative view and instrument maneuverability ; waiting for resufflation will prolong surgery . we used an abdominal lifting device so that the procedure could be performed under gasless conditions , and thus avoided this problem . it also has other advantages , such as avoiding the complications of carbon dioxide pneumoperitoneum ( e.g. , subcutaneous or mediastinal emphysema ) , hypercapnia , air embolism , cardiopulmonary dysfunction , and hemodynamic changes . under gasless surgery , our technique employs 2 towel forceps to form a parallel double - line suspension to provide better exposure in the pelvis , which is more simple , convenient , time - saving , and cost - effective . transvaginal laparoscopic appendectomy is in the exploratory stage of clinical application , and is far from achieving the same popularity as conventional laparoscopic surgery . for their procedure , rigid instruments were used and the procedure was performed with 2 transvaginal and 1 transumbilical access points , with the specimen retrieved transvaginally . roberts et al . reported that pure transvaginal appendectomy was a safe and well - tolerated procedure , with significantly less pain and faster recovery compared to traditional laparoscopic appendectomy . recently , some authors also reported the utilization of the vaginal opening at the time of laparoscopic - assisted vaginal hysterectomy or total laparoscopic hysterectomy as a natural orifice for appendectomy and achieved acceptable outcomes . although the transvaginal approach is the preferred surgical route , controversy still exists as to the ethical aspects . the results of some questionnaire surveys have shown that the acceptance of transvaginal notes is still low in the public . the presence of severe adhesions , obesity , or the need for a complex operation are still technical bottlenecks for pure notes , as is the lack of appropriate surgical instruments . development of special access devices and instruments will remove some of the present limitations of notes surgery so that it may be applied to a wider variety of surgical fields . we have applied laparoscopy to transvaginal appendectomy for the first time , and gained the desired results . based on this initial series , transvaginal laparoscopic appendectomy , following vaginal hysterectomy , seems to be a safe and effective modification of established techniques , with acceptable outcomes .
backgroundnatural orifice transluminal endoscopic surgery ( notes ) involves the introduction of instruments through a natural orifice into the peritoneal cavity to perform surgical interventions . the vagina is the most widely used approach to notes . we report the utilization of the vaginal opening at the time of vaginal hysterectomy as a natural orifice for laparoscopic appendectomy.material/methodswe reviewed cases of 10 patients with chronic appendicitis who underwent transvaginal laparoscopic appendectomy simultaneously with vaginal hysterectomy . a laparoscopic approach was established after removal of the uterus , and the appendix was removed transvaginally . among the 10 cases , 5 were conducted under gasless laparoscopy by using a simple abdominal wall - lifting instrument.resultsall procedures were performed successfully without intraoperative or major postoperative complications . the appendectomy portion of the procedure took approximately 21 minutes to 34 minutes . all patients were discharged less than 4 days after surgery , without external scars.conclusionstransvaginal appendectomy with rigid laparoscopic instruments following vaginal hysterectomy appears to be a feasible and safe modification of established techniques , with acceptable outcomes .
tearing of the small bowel mesentery and rupture of small bowel or colon are common gastrointestinal injury patterns associated with seat belt related trauma resulting from rapid deceleration forces . such injuries occasionally result in delayed presentation with manifestations including small bowel obstruction through a mesenteric tear and an enterocutaneous fistula involving the sigmoid colon . rare cases including appendiceal transection in a child secondary to a lap belt have also been documented . the seatbelt sign, the presence of bruising on the abdominal wall along the site of the belt increases the likelihood of intra - abdominal injury . closed rupture of the rectus abdominis muscle secondary to seatbelt trauma has been described in the past associated with intestinal rupture at 90 cm from the ligament of treitz . rupture of rectus abdominis with associated rupture of the ipsilateral renal artery has also been described in the literature . seatbelt injury can also result in complete rupture of abdominal wall musculature with resultant subcutaneous herniation of small bowel . obese patients present their own challenges , often presenting with differing injury patterns . however , stipulated cushion effect may result in a lower severity of abdominal injuries in obese individuals . we present a case of closed rupture of the rectus abdominis muscle in association with small bowel and mesenteric injury in an obese middle - aged female secondary to seatbelt trauma . a 45 year old female , bmi 38 , was a front - seat passenger restrained with a seat belt in a car involved in a high velocity ( > 60 mph ) front end collision road traffic accident . the air bag deployed during the accident but did not result in any injuries , facial or otherwise . however , there was significant intrusion into the passenger compartment and our patient was initially trapped inside . following prolonged extrication she presented to our accident and emergency department tachycardic ( hr 110/min ) with borderline hypotension ( 95110 mmhg systolic ) which both responded to fluid resuscitation . abdominal examination revealed a soft abdomen , diffusely tender , with bruising to flanks and in the distribution of the seatbelt , from left hypochondrium to right inguinal region . the ct scan of thorax , abdomen and pelvis findings were that of discontinuity of the rectus abdominis muscle with protrusion of large and small bowel through the defect ( fig . fluid was noted within the fat adjacent to the loops of ascending and descending colon in both flanks . further free fluid was also noted tracking down the right flank , adjacent to the spleen and in the pelvis . the ct scan also suggested traumatic aortic dissection ; however , this was not symptomatic and was managed conservatively and monitored with subsequent ct scanning . several skeletal injuries were sustained including several undisplaced rib fractures without underlying lung contusion , closed fracture dislocation of the left ankle in addition to closed fractures of the left distal radius and left distal fibula . an initial damage - limitation laparotomy was performed which confirmed rupture of the rectus abdominis muscles and devascularisation of the skin under the areas of seat - belt related bruising . a single section of small bowel beyond the mesenteric avulsion was resected en - bloc with the right colon up to the proximal transverse colon . the ends were stapled off leaving 90 cm small bowel from duodeno - jejunal flexure , 20 cm of isolated transverse colon and distal colon from sigmoid downwards to rectum . a temporary abdominal closure was applied using a bag of saline as a bogota bag stitched to fascia of the anterior abdominal wall covered by abdominal gauze sandwiched between 2 layers of transparent adhesive dressing with low pressure suction onto the gauze via 2 small bore vacuum drains maintained at low pressure using drainage bottles connected to wall suction . the remaining healthy 90 cm of small bowel was anastomosed to 20 cm of transverse colon . this anastomosis was required to allow the bowel to reach the abdominal wall as a stoma as the small bowel alone would not reach through the thick adipose tissue . the remaining colon , measuring 4050 cm in length , was defunctioned from the recto - sigmoid junction . the rectus abdominis was opposed and the abdominal musculature re - enforced with permacol , a porcine dermal collagen implant . the biological mesh provided tensile strength required for re - enforcement of the closure . post - operative complications included intra - abdominal collections requiring re - laparotomy , and further collections requiring radiological drainage . total parenteral nutrition ( tpn ) , was given , both in hospital and at home , to manage her short bowel syndrome and an enterocutaneous fistula from the site of her ileo - colic anastomosis . following spontaneous closure of the fistula , the tpn was withdrawn and she is now maintaining her nutrition with a normal diet and has returned to work . she has declined reversal of her colostomy as concerns over resulting stool frequency might not be compatible with her occupation as a teacher . our case describes how closed rupture of the rectus abdominis muscle can be associated with multiple intra - abdominal injuries to small and large bowel . transection of the rectus muscles secondary to trauma has been previously documented in association with rupture of small bowel . in our case abdominal examination findings were hard to interpret due to the patient 's body habitus but bruising in the distribution of the seatbelt was apparent . however , even in a slim abdomen closed rupture of the rectus muscles would not have been readily suspected due to rarity of the condition . imaging should be reviewed in conjunction with a patient 's clinical condition , proceeding to laparotomy where necessary . rare injuries such as closed rupture of rectus abdominis should be considered . in our case . on subsequent radiology review , limited traumatic dissection of her aorta was also noticed although was asymptomatic . transection of the rectus resulting from seatbelt injury highlights considerable amount of force transferred to the extra - abdominal compartment . this should raise suspicion of injury to intra - abdominal structures . whilst ct scan did not indicate any overt visceral injury , multiple skeletal fractures whilst seatbelts have been responsible for a decreasing mortality and decreased severity of injuries from road traffic accidents , seatbelt related injury patterns arise from the transfer of kinetic energy to the abdominal wall and internal visceral organs , both intra and retro - peritoneal . as per manufacturer 's safety guidelines , seatbelts should be tight with no slack . in the uk it is illegal for drivers and passengers to not wear a seatbelt . the presence of rupture of rectus abdominis muscle secondary to seatbelt injury should raise the suspicion of intra - abdominal injury . in these cases there should be a low threshold for laparotomy to explore the possibility of occult injury . written informed consent was obtained from the patient for publication of this case report and case series and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .
introductionclosed rupture of rectus abdominis following seatbelt related trauma is rare.presentation of casewe present the case of a 45 year old female who presented with closed rupture of the rectus abdominis in conjunction with damage to small bowel mesentery and infarction of small and large bowel following a high velocity road traffic accident . multiple intestinal resections were required resulting in short bowel syndrome and abdominal wall reconstruction with a porcine collagen mesh . post - operative complications included intra - abdominal sepsis and an enterocutaneous fistula.discussionthe presence of rupture of rectus abdominis muscle secondary to seatbelt injury should raise the suspicion of intra - abdominal injury.conclusionour case highlights the need for suspicion , investigation and subsequent surgical management of intra - abdominal injury following identification of this rare consequence of seatbelt trauma .
erlotinib is a selective epidermal growth factor receptor inhibitor ( egfri ) utilized in the treatment of solid tumors . cutaneous side effects , including changes in hair texture and alopecia , have been reported . in this case report , we observed a new finding of loose anagen hairs and pili torti in two patients treated with erlotinib . her hair progressively became curlier , brittle , and dull and the overall hair volume decreased . the second patient who was a 60-year - old female with metastatic adenocarcinoma of the lung had been on erlotinib for over a year when she noticed increased hair loss . examination of both revealed a band of nonscarring alopecia along the entire hair margin [ figure 1a and b ] associated with diffuse thinning and eyelash trichomegaly in the second patient . trichoscopy showed irregularly shaped shafts and bending at different angles , numerous black dots and broken hairs and no inflammation [ figure 2a ] . high magnification revealed anagen hairs devoid of sheaths and multiple twisting of flattened shafts through 180 at irregular intervals [ figure 2c and d ] . scalp biopsies , performed in the first patient , revealed normal telogen count of 10% . anagen follicles showed irregular thinning of the outer root sheath ( ors ) and a serrated vitreous layer . several follicles showed features of hair breakage with pigmented casts , increased number of apoptotic cells in the ors , and disintegrated inner root sheath ( irs ) . diagnosis of hair breakage associated with pili torti and loose anchoring of anagen hairs induced by erlotinib was made . topical steroids and minoxidil 5% were empirically prescribed to the second patient , with significant improvement after 3 months [ figure 1c ] . pronounced nonscarring alopecia along the entire hair margin in ( a ) patient one and ( b ) patient two ; ( c ) patient two after 3-month therapy trichoscopic and histopathologic findings in patients treated with erlotinib . trichoscopy shows ( a ) black dots , twisting of hair shafts , and broken hairs at different lengths ( 20 ) ; ( b ) features resembling black rectangular granular structures ( 20 ) ; ( c ) high magnification of a flattened hair shaft reveals multiple twisting ( 250 ) ; ( d ) the pull test results in numerous anagen hairs devoid of sheaths ( 250 ) ; ( e ) scalp biopsy from the alopecic area shows two hair follicles corresponding to the broken hairs on trichoscopy as their hair shafts are replaced by pigmented casts in the hair canal and are surrounded by abnormal , disintegrated inner root sheath , and irregularly thinned outer root sheath . note the absence of sebaceous glands ( h and e , vertical sections , 4 ) ; ( f ) two anagen follicles at the level of subcutaneous fat reveal corrugated and thicker pink vitreous layer ( h and e , horizontal sections , 10 ) reported egfri - induced hair changes include curlier and brittle hair on scalp and extremities , trichomegaly or curling of the eyelashes and eyebrows , and facial hypertrichosis as well as inflammatory and noninflammatory alopecia . in mice harboring a disruption of the epidermal growth factor receptor - allele , hair follicles fail to enter catagen and remain in an aberrant anagen state and display thinning or loss of the irs and ors . irregular atrophy of the distal ors , as observed in our biopsies , has been described as arrow sign . irs abnormalities might be responsible for the loose anchoring of anagen hairs in our patients , as also reported in loose anagen hair syndrome ( lahs ) . another possible similarity to lahs were dermoscopic features resembling black rectangular granular structures , which have been recently associated with this syndrome . hair texture modification and fragility , including pili torti , have also been linked to anomalies in the irs . the absence of sebaceous glands detected is in accordance with previously published data reporting marked disruption of sebaceous gland growth in egfri - treated patients . it is possible that the elastic bands used to fasten the wigs led to increased friction over the scalp rim explaining the pronounced marginal alopecia . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
erlotinib is a selective epidermal growth factor receptor inhibitor utilized in the treatment of solid tumors . cutaneous side effects , including changes in hair texture and alopecia , have been described . in this case report , we describe two patients with a new finding of loose anagen hairs and pili torti leading to nonscarring marginal and diffuse alopecia and discuss potential mechanisms underlying erlotinib - induced hair changes .
the main structures that are known to process pain are the primary and secondary somatosensory , insula , anterior cingulated , and prefrontal cortices , as well as the thalamus ( 1 ) . additional structures that play a smaller role are the basal ganglia , cerebellum , amygdala , hippocampus , and areas within the parietal and temporal cortices ( 1 ) . these complex brain structures integrate nociceptive input with contextual information and memory to provide cognitive mediation of pain affect ( 1 ) . additionally , opioid dependence is related to pathologic learning and memory ( 2 ) . we examined the case of a patient who experienced excruciating pain caused by bone metastasis of breast cancer and who became pain - free , experienced amnesia , and recovered from opioid dependence after cardiopulmonary resuscitation ( cpr ) . there are few reports concerning the interrelationship between pain , memory , and drug dependence ; hence , we are reporting a case of amnesia and pain relief with a literature review . a 48-yr - old woman who was diagnosed with breast cancer 5 yr ago was transferred to our pain clinic for pain management on april 21 , 2010 . the patient experienced excruciating pain in her back and in her right lower chest area ( fig . her visual analog scale ( vas ) score was 9 - 10/10 , and she had received morphine ( 300 mg / day , intravenous administration ) . we performed a single epidural block as a trial for predicting its effect before a planned continuous epidural block using an epidural port . a 22-gauge tuohy needle was inserted blindly into the lumbar epidural space at the l1 - 2 level . we used the loss - of - resistance ( lor ) technique to detect the proper epidural space . after observing no leakage of cerebrospinal fluid ( csf ) and blood , we slowly injected 0.4% mepivacaine hydrochloride ( 8 ml ) , without a test dose of the drug . approximately 1 min later , the patient had a sudden seizure of generalized tonic - clonic type for 30 s , and then lost consciousness and demonstrated difficulty breathing . immediately , artificial respiration was performed on her . at that time , her blood pressure ( bp ) level was 100/80 mmhg , and her heart rate ( hr ) was 60 beats / min . the patient was intubated with an endotracheal tube , mechanically ventilated , and her condition was monitored closely . her vital signs were as follows : bp , 110/50 mmhg ; hr , 120 beats / min ; body temperature , 36.5 ; respiratory rate , 20/min ; spo2 , maintained at 100% . a neurologic assessment by a neurologist did not reveal any neurological abnormalities other than unconsciousness . 2 ) twice , but neither scan showed any abnormalities except metastatic lesions in the meninges and bones . 3 ) showed a partial seizure lesion and severe , diffuse cerebral dysfunction in the right temporal lobe area . she made eye contact with the medical team , grasped her hand , and responded to the doctor 's requests . after 17 days , she could have simple conversations with her husband , and started communicating fluently after 22 days . although no neurologic sequelae remained , she could not remember her 3 yr of autobiographic memory prior to the incident , and the severe pain of which she had complained had almost disappeared ( vas 1/10 ) . she again experienced extreme pain ( vas 7 - 8/10 ) , but did not feel any pain in her back or right lower chest where she had experienced pain before . although many studies have been performed to demonstrate this complicated phenomenon , it is still poorly understood . in the present case , the patient did not show any neurological complications except memory loss . memory loss can be classified according to many criteria ; this patient demonstrated retrograde amnesia , particularly remote and episodic amnesia . this generalized and long - lasting episodic memory loss is almost always related to bilateral injury of the limbic network in the thalamus or the hippocampo - entorhinal complex ( 4 ) . most cases of amnesia are not caused by injury of the memory storage area , but usually by dysfunction of the limbic network , which composes pieces of stored memories from many different parts of brain into coherent events . the most common causes are alzheimer 's disease ; traumatic injury ; vascular infarction ; infection ; and metabolic insults including hypoxia , hypoglycemia , and prolonged seizures ( 5 ) . among these various causes , we assume that the causes of amnesia in the present case are hypoxic brain injury and prolonged seizure after respiratory and cardiac arrest . many cognitive impairments and memory losses occur by hypoxic brain injury after cardiac arrest , but the precise mechanism of this phenomenon is not yet clearly proven ( 6 ) . ( 7 ) reported that hypoxic brain injury in an animal model of birth asphyxia produced significant functional deficits in the hippocampus , and caused a reduction of long - term potentiation ( ltp ) , paired pulse facilitation ( prf ) , and post - tetanic potentiation ( ptp ) . this occurred in the absence of gross cellular damage . in a positron emission tomographic study of 2 post - ischemic - hypoxic amnesia patients , there was destruction of the inhibitory pathways to the thalamus and basal ganglia ( 8) . hence , we believe that a short arrest duration , as in our case , may be sufficient to cause memory loss . epilepsy , especially initiated from the temporal lobe , which is related to memory , can cause memory loss . transient epileptic amnesia , accelerating long - term forgetting , and remote memory loss commonly occur after epilepsy ( 10 ) . although our patient did not have any history of epilepsy , a temporary seizure occurred after the epidural block . in addition , eeg showed a partial seizure of the temporal lobe area ; hence , we presume that seizure is another possible cause of amnesia . in an animal model of hypoxia - induced seizures ( hs ) , seizure had an effect on the synaptic plasticity , especially diminish silent synapses and ltp in hippocampus ( 11 ) . in this case , both memory and severe pain disappeared without any neurologic sequelae . we do not know the exact reason of this phenomenon , but are assuming that the pain may be gone due to loss of memory which plays important role in chronic pain . recent studies reveal an interrelationship between chronic pain and the functional , anatomical , and chemical reorganization of the brain . memories of nociceptive stimuli can lead to persistent pain coding in the brain , and these are associated with central mechanisms , and cortical reorganization in the brain ( 12 - 14 ) . both the intensity and chronicity of pain accentuate the development of pain memory ( 14 ) . the amygdala is activated during pain , and it plays a role as a " defensive behavioral mechanism " that controls the transmission of the nociceptive experience to the brain ; this has relevance to the memory storage of past pain experiences and their context . moreover the hippocampus does not appear to have a direct role in the formation of pain or fear avoidance , but is associated with learning pain - related behavior ( 15 , 16 ) . recent neuroimaging studies have demonstrated that the anterior cingulate cortex ( acc ) is closely related to the affective features of pain , such as unpleasantness , and has a multimodal integrative , rather than a specific , nociceptive role ( 15 , 17 ) . there is also an association between pain and the posterior cingulate cortex ( pcc ) ( 18 ) . nielsen et al . ( 13 ) have performed a meta - analysis of the segregation between memory and pain components . they find that the distribution of memory and pain brain activations in the pcc is quite similar . abuse of drugs for a long time cause changes in the brain , and induce memory formation ( 19 ) . neural plasticity is induced by chronic substance consumption , and this is related to drug - induced ltp and synaptic changes in the mesolimbic system . this changes are also implicated in memory formation ( 2 , 19 , 20 ) . opioid dependence , learning , and memory also share the same complex circuits involving the hippocampus , cerebral cortex , ventral and dorsal striatum , and amygdala ( 19 ) . in the present case choi et al . ( 3 ) report 2 patients who experienced pain reduction and improvement of opioid dependence after sudden memory loss . their 2 patients experienced sudden memory loss due to status epilepticus and minor brain injury , respectively . one of their reported patients could recall his episodic autobiographical memory , and he began to feel pain again . in conclusion , we report a case of pain relief and recovery from opioid dependence associated with memory loss . in this case , we do not clearly know the cause of memory loss , pain relief , and the disappearance of opioid dependence . we also do not know why the patient 's most painful memory , of all possible memories , was affected . however , we assume that memory loss plays a major role in the modulation of both pain and opioid use . moreover , understanding this complex mechanism in the brain can help treat intractable pain and addiction , which will allow us to help patients forget their chronic pain in the future .
the mechanism of chronic pain is very complicated . memory , pain , and opioid dependence appear to share common mechanism , including synaptic plasticity , and anatomical structures . a 48-yr - old woman with severe pain caused by bone metastasis of breast cancer received epidural block . after local anesthetics were injected , she had a seizure and then went into cardiac arrest . following cardiopulmonary resuscitation , her cardiac rhythm returned to normal , but her memory had disappeared . also , her excruciating pain and opioid dependence had disappeared . this complication , although uncommon , gives us a lot to think about a role of memory for chronic pain and opioid dependence .
in 1947 , owren described a female patient with a hemorrhagic disorder due to previously unrecognized coagulation factor , and coined the term parahemophilia . owren called this new coagulation factor discovery , factor v. the factor v deficiency shows usually autosomal recessive trait inheritance . the hereditary factor v deficiency is very rare , and probably fewer than 500 patient s affected worldwide have been reported since its discovery in 1943 . heterozygotes are usually asymptomatic and intermediate or normal plasma factor v levels . only homozygotes patients have hemophilia - like hemorrhages and markedly decreased plasma factor v levels . hemorrhagic manifestations of the factor v deficiency were ecchymosis , epistaxis and bleeding of oral cavity . spontaneous intracranial bleeding was uncommon and occurred in approximately 6 to 10 percent of factor v deficiency of patients . most bleeding episodes in patients with factor v deficiency could be treated with sufficient fresh frozen plasma to raise the plasma factor v level to 30% . a patient , 53-year - old male , visited the emergency room of our university hospital on july 22 1995 for sudden onset of drowsy mental status . on admission , the blood pressure was 140/90mmhg , the pulse rate was 72/min , body temperature was 36.8c and respiration rate was 20/min . he had had no diabetes mellitus , no hypertension , no hemorrhagic diathesis in past histories . in neurologic examinations , he had a deep drowsy mental status , disconnected orientation , sensory dysphasia but intact cranial nerve system , motor and sensory systems . brain ct showed intracranial hemorrhage in left thalamus and intraventricular hemorrhage in occipital horn of left lateral ventricle(fig . laboratory results as follows : cbc and esr were normal . bleeding time was normal ( 3 min ) . both prothrombin time ( pt 18.0 sec , inr 2.2 , normal range < 1.14 inr ) and activated partial thromboplastin time ( aptt 49.0 sec , normal range < 35 sec ) , were markedly prolonged . the levels of the coagulation studies on the patient revealed significant decrease of factor v ( below 1% ; normal range 60140% ) . after fresh frozen plasma was replaced , factor v recovered to 15% , prothrombin time recovered to 15.0 sec ( inr 1.5 ) and activated partial thromboplastin time recoverd to 40.0 sec . all their laboratory data were normal except for mild decrease of the concentration of factor v of his son ( 45% ; normal range 60140% ) . two weeks later , follow - up brain mri showed decreasing size of intracranial hemorrhage and stablized subacute hematoma ( fig . he completely recovered after three weeks from admission day and has been followed at the out - patient clinic . in 1944 , owren described a patient who had a bleeding diathesis attributable to the lack of single blood clotting factor , namely factor v or labile factor . parahemophilia , to emphasize the clinical similarity to hemophilia . at that time , only four coagulation factors were considered : fibrinogen , calcium , prothrombin , thrombokinase . after owren reported parahemophilia , it was soon found that labile factor and factor v were one and same factor . at present , characteristic features of coagulation factor v established molecular weight : < 700kd , plasma concentration : 7g / ml , biologic half time : 1215 hour . factor v synthesis has been demonstrated in the hepatoma cell line hepg2 and human megakaryocyte and bovine aortic endothelial cells . the liver , as the source of plasma factor v , consisted of whole organ perfusion experiments showing factor v production by the liver . biosynthesis of factor v that are structurally , functionally and immunologically indistinguishable from plasma factor v has been demonstrated in a human hepatocellular carcinoma cell line , hepg2 , suggesting that the hepatocyte is the site of synthesis within the liver . tracy pb et al . found that platelets synthesized factor v. they reported that normal range of factor v concentration was from 4 to 14g / ml of plasma , while washed platelets indicated that 0.63 to 1.93g / ml of factor v was present per 2.5108 platelets . when corrected to individual hematocrits and platelets count , the data indicated that platelets contributed approximately 18% to 25% factor v of whole blood . bleeding diathesis and the concentration of plasma factor v in patients with factor v deficiency was not as well related as plasma factor v level . in contrast , the other coagulation factors that function as enzymatically active serine protease activators , factor viii and factor v , are cofactors in the coagulation cascade . activated factor v is a cofactor in the conversion of prothrombin to thrombin by factor xa in an action that are phospholipid and calcium dependent . the activator complex formed by factor xa , activated factor v , phospholipid and calcium was called the prothrombinase complex . factor v was converted to factor va by thrombin generating a heavy chain and light chain , and these two chains were held together by calcium ions . a connection , originally located between the heavy and light chains , is liberated during the active reaction . activation of factor v by thrombin is achieved through a series of proteolytic cleavages . as a result of these cleavages , single chain precursor factor v consisted of a 115-kd heavy chain and 73-kd light chain . activated factor v was inactivated by activated protein c in a surface dependent reaction that requires calcium ions and nonenzymatic cofactor and protein s. factor v deficiency was diagnosed by specific factor v assay . since factor v acts as a cofactor in both intrinsic and extrinsic coagulation pathways , screening tests typically revealed prolongation of prothrombin time and partial thromboplastin time and normal thrombin time . factor v deficiency was usually considered to be inherited in autosomal recessive manner , although some authors considered it to be partially dominant . only homozygous patients had hemophilia - like hemorrhage or thrombotic manifestations , while heterozygotes were usually asymptomatic and intermediate or normal plasma factor v levels . because his parents had died early , our patient had not typical autosomal recessive inheritance trait . the factor v of his son was mild decreased ; it was probably subclinical deficiency . epistaxis , an almost uniform problem , could be easily controlled with nasal packing and transfusion of fresh frozen plasma . in the female , menorrhagia , which was a serious cause of death with the first menstrual period , had been reported in factor v deficiency . excessive bleeding occurred following dental extractions , trauma and surgery , but it is milder and much better controlled than the bleeding associated with hemophilia a. hematuria , gastrointestinal bleeding or hemarthrosis occurred in approximately 15 to 20 percent . spontaneous intracranial hemorrhage occurred in approximately 6 to 10 percent of factor v deficiency patients . a patient with factor v deficiency with intracranial hemorrhage although factor v deficiency is a milder disorder than hemophilia a , patients with factor v deficiency may sometimes require replacement therapy . treatment is usually with fresh frozen plasma , since no commercial concentrates of factor v are available . the level of factor v activity in the patients plasma is usually < 5% of that in normal plasma . most bleeding episodes in patients with factor v deficiency can be treated with sufficient fresh frozen plasma to raise the plasma factor v level to 30% .
factor v deficiency is a relatively uncommon disorder , inherited as an autosomal recessive trait that manifests clinically only in individuals who inherit the defective gene from both parents . the hemorrhage of nasal and oral cavity and ecchymosis are common but intracranial hemorrhage is very rare.we experienced a 53 year old male patient with intracranial hemorrhage due to factor v deficiency . the laboratory tests showed prolongation of aptt and pt , normal bleeding time and normal thrombin time . the levels of the coagulation profiles on the patient revealed a significant decrease of factor v , below 1% of normal range(60140% ) . other coagulation factors were normal . he was treated with fresh frozen plasma and completely recovered 3 weeks after treatment .
synovial chondromatosis ( sc ) is a rare monoarticular pathological entity of unknown origin diagnosed on pathological confirmation characterised by synovial proliferation and metaplasia , resulting in multiple intra - articular cartilaginous loose bodies in the synovium of joint producing mechanical symptoms . the disease process involves calcification or ossification of cartilaginous nodules in the joint and extrude to the loose bodies in the joint space or extra - articular extension into soft tissue1234 ) . compression on bone and nerves is caused by calcified or ossified bodies and can cause bone erosion or pain on movement or even at rest5691112 ) . including this current description , there are fifteen cases of spinal sc reported in medical literature 1517 ) ( table 1 ) . thirty - one - year - old male patient presented with history of low backache with left lower limb pain , difficulty in micturition since 8 months and difficulty in walking due to tightness of lower limbs since 2 months . left lower limb pain intensity recorded on a visual analogue scale was of seven points . neurological examination revealed , muscle strength of grade ii in left lower limb and grade iii in right lower limb according to british medical research council grading . patient had grade 3 spasticity ( modified ashworth scale ) , exaggerated deep tendon reflexes in left lower limb with normal sensory component and extensor plantar reflexes in both lower limbs . magnetic resonance imaging ( mri ) of spine revealed an extradural lesion at d10-d11 arising from left facet joint , lesion was hypo to isointense on t1 and t2 mri sequence with conus compression ; on gadolinium injection minimum peripheral enhancement was seen ( fig . patient was planned for elective surgery and underwent dorsal hemilaminectomy of d10 , d11 , and d12 with removal of facet joints at involved level followed by total excision of firm to hard tumour . histopathology revealed fragments of bone , disc and cartilage with a lesion composed of chondriod nodules having chondrocytes in clusters . chondrocytes showed hyperchromatic nuclei and binucleation with one fragment of tissue showing vascularised lining resembling synovium . 2 ) . at follow - up of 3 weeks , patient was pain free , reduction of spasticity to grade 1 with restoration of normal daily activities and better bladder control was present . sc is a benign metaplastic pathological entity rather than a neoplastic one , in which nodules are formed from aggregates of chondrocytes in the synovium which is the cause for patient 's mechanical symptoms17 ) . sc of the spine is an extremely rare disease which has been reported only in series of case reports . among those cases , primary sc represents a benign idiopathic neoplastic disease process and secondary sc is associated with joint abnormalities like arthritic or mechanical conditions that can lead to intra - articular chondral bodies10 ) . the median age at the time of presentation of vertebral sc is 39 years ( range , 21 to 60 years ) , and the male to female ratio is approximately 1:1 . pain was the most common presenting symptom in 9 patients and other symptoms included a growing mass , weakness and paraesthesia15 ) . definitive preoperative diagnosis of sc is exceedingly difficult and challenging due to the nondescript clinical presentation and vague characteristic profile of imaging14918 ) . clustered chondrocytes show varying nuclear polymorphism , binucleate cells , increased mitotic activity , and prominent cellularity are seen microscopically716 ) . thus preoperatively it is diagnosis of exclusion and definitive confirmative diagnosis is often made postoperatively after analysing microscopic features . characteristic typically calcified or osseous bodies are seen on plain radiography , however calcification may not be seen in 5% to 30% of cases because of the lack of matrix mineralization , those had appeared as water - dense foci . mri reveals nodules are seen using an intermediate to isointense signal on t1 sequences , high signal intensities on t2 sequences and enhancement after gadolinium administration1913 ) . due to malignant transformation risk with recurrence of approximately 6% to 17% , inferred from extra - vertebral sc , recommended treatment is surgery which includes removal of the loose body or mass and the complete synovectomy of the affected joints which is highly effective in alleviating the symptoms . although the recurrence rate is very low in vertebral sc , it is thought that recurrence is secondary to incomplete removal of synovial lining and no agreed treatment guideline is available . arthrodesis has been reported to be a successful as a salvage treatment option for recurrent sc and in case instability is suspected78131416 ) . to summarize it is a benign uncommon pathology entity without any definitive preoperative diagnostic features . surgery is the definitive treatment and confirmation by histology which should be considered as gold standard .
synovial chondromatosis is an uncommon benign condition of metaplastic and focal formation of cartilage in the intimal layer of synovial membrane of joints with extremely low risk of malignant potential . disease process is typically monoarticular predominantly involving large joints and spinal involvement being a very rare event . we report 31-year - old male patient who presented with history of low backache , left lower limb pain , difficulty in micturition since 8 months and difficulty in walking since 2 months .magnetic resonance imaging of spine revealed d10 - 11 extradural lesion arising from left facet joint . lesion was excised completely by posterior approach with resolution of symptoms . literature reveals fourteen cases of spinal variant of synovial chondromatosis which has been published and this report represents the fifteenth case .
type 2 diabetes mellitus ( t2 dm ) is one of the most common chronic diseases in the worldwide , the incidence of which tends to grow steadily . it is associated with a high risk of cardiovascular disease ( cvd ) which is the leading cause of death in patients with type 2 diabetes mellitus . obesity , insulin resistance , and diabetes have identified a proinflammatory state associated with increased adiposity . epicardial adipose tissue ( eat ) is a visceral fat depot of the heart located along the large coronary arteries and on the surface of the ventricles and apex . several studies have shown that eat is not only an anatomic depot of fat but also may serve as a local source of proinflammatory cytokines related to coronary artery disease ( cad ) . therefore , eat thickness has been considered to be a possible cardiovascular risk indicator [ 6 , 7 ] . transthoracic echocardiography ( tte ) , magnetic resonance imaging ( mri ) , and multislice computed tomography ( msct ) scanning have been conventional methods for quantifying eat . assessment of eat by tte could be a simple and practical tool for cardiovascular risk stratification in clinical practice . carotid intima - media thickness ( cimt ) is a simple and inexpensive tool to assess the cumulative effect of atherosclerotic risk factors and is an independent predictor of future cardiovascular ( cv ) risk . the ultrasound - based measurement of cimt has become a standard for assessing arteriosclerosis and is recommended by the american heart association for the noninvasive assessment of cardiovascular risk [ 10 , 11 ] . previous studies have reported that increased eat is associated with cad , metabolic syndrome ( mets ) and obesity [ 1216 ] . in the present study , we evaluated type 2 diabetic patients to investigate epicardial fat thickness by tte and investigate its relationship with cimt . in this observational , cross - sectional study , 139 type 2 diabetic patients , having this diagnosis for at least 1 year , were consecutively included in the study . the study protocol was approved by our local ethics committee , and all patients gave their written informed consent to participate in the study . exclusion criteria of the study were subjects with known ischemic heart disease , cerebrovascular disease , peripheral vascular disease , congestive heart failure , valvular heart disease , and chronic kidney disease . medical history was obtained and physical examination was performed in all patients and controls . blood pressure was measured three times5 min apart in a sitting position , on the right arm , and the mean value was calculated . weight and height of the patients were measured without heavy outer garments and shoes , after a 12 h fasting period . body - mass index ( bmi ) was calculated as body weight divided by the square of the height . waist circumference was measured at the level of midway between the lower rib margin and iliac crest after removal of the clothes . blood samples were withdrawn by venipuncture from all subjects following 12 h of fasting . fasting blood glucose , serum creatinine , total cholesterol , high - density lipoprotein cholesterol ( hdl ) , low - density lipoprotein cholesterol ( ldl ) , and triglyceride levels were recorded . each patient underwent a complete transthoracic echocardiography using the american society of echocardiography guidelines of measurement . echocardiogram was performed using a vivid 7 ( general electronic , wauke - sha , wisconsin , usa ) with a 2.53.5 mhz transducer , placed on the iii iv left intercostal space along the parasternal line , with patients being supine in left lateral decubitus and the head of the bed kept at 30. all examinations were performed by an experienced cardiologist , blind to the patient 's clinical information . epicardial fat was identified as the space or layer anterior to the right ventricle with decreased echoreflectivity compared with the myocardium and pericardium . epicardial fat thickness ( eft ) was measured in end diastole on the free wall of the right ventricle from the parasternal long- and short - axis views , as previously described [ 19 , 20 ] . the maximum values at any site were measured , and the average value was considered . imaging constraints were used to ensure that the epicardial fat thickness was not measured obliquely . parasternal long- and short - axis views allow the most accurate measurement of eat on the right ventricle , with optimal cursor beam orientation in each view . carotid arteries were evaluated using a logiq 7 ( general electronic , wauke - sha , wisconsin , usa ) with a 7.5 mhz transducer . all examinations were performed by an experienced radiologist , blind to the patient 's clinical information . measurements involved a primary transverse and longitudinal scanning of the common carotid artery , bifurcation , and internal carotid . the cimt was measured on the far wall at 1 cm from bifurcation of the common carotid artery as the distance between the lumen - intima interface and the media - adventitia interface . at least three measurements were performed on both sides , and the average measurement was taken as the cimt . categorical variables were expressed as number and proportions , while continuous variables were expressed as mean standard deviation . chi - square ( ) test was used to compare groups regarding categorical variables . continuous variables were compared with student t - test ( while comparing parametric variables between diabetic patients and controls ) or mann - whitney u test ( while comparing nonparametric variables between diabetic patients and controls ) . correlation analysis was performed using pearson or spearman tests . receiver operating characteristic ( roc ) curve analysis was performed to determine cutoff high risk value of eft when patients are divided into two groups according to cimt ( < or 0.9 mm ) . there were 139 patients ( mean age 54.3 9.2 and 49.6% male ) in the t2 dm group and 40 patients ( mean age 52.1 7.3 and 50% male ) in the control group . the demographic findings and laboratory values of the study groups are presented on table 1 . the mean duration of disease in patients with t2 dm was 6.5 3.9 years . the age , frequencies of sex distribution , hypertension , hyperlipidaemia , smoking , family history of the cad , and waist circumference were similar between patients with t2 dm and the controls . bmi was higher in the control group compared with the value of the type 2 diabetic patients ( 29.1 4.2 versus 27.6 3.1 , p = 0.03 , resp . ) . patients with t2 dm had significantly increased eft and cimt than those of the controls ( 6.0 1.5 mm versus 4.42 1.0 mm , p < 0.001 and 0.76 0.17 mm versus 0.57 0.14 mm , p < 0.001 , resp . ) . when laboratory findings were compared , type 2 diabetic patients had significantly higher fasting blood glucose , creatinine , c - reactive protein levels , and hba1c , but total cholesterol , ldl , hdl and triglyceride levels did not differ between the two groups . the variables correlated with eft in the type 2 diabetic patients were cimt ( r = 0.479 , p < 0.001 ) ( figure 1 ) , waist circumference ( r = 0.371 , p < 0.001 ) , bmi ( r = 0.315 , p < 0.001 ) , age ( r = 0.260 , p = 0.002 ) , duration of dm ( r = 0.258 , p = 0.003 ) ( figure 2 ) , and hba1c ( r = 0.200 , p = 0.032 ) ( table 2 ) , and those in the controls were ; cimt ( r = 0.690 , p < 0.001 ) , waist circumference ( r = 0.420 , p = 0.02 ) , and age ( r = 0.365 , p = 0.02 ) . when we performed subgroup analysis in the patients with t2 dm according to sex , eft was correlated with cimt ( r = 0.481 , p < 0.001 ) , waist circumference ( r = 0.429 , p < 0.001 ) , age ( 0.348 , p = 0.003 ) , bmi ( r = 0.391 , p < 0.001 ) , duration of dm ( r = 0.293 , p = 0.014 ) , and weight ( r = 0.285 , p = 0.018 ) in female patients and cimt ( r = 0.481 , p < 0.001 ) and waist circumference ( r = 0.263 , p < 0.03 ) in male patients . after multivariate stepwise linear regression analysis , cimt ( = 3.52 , t = 3.72 , p < 0.001 ) and waist circumference ( = 0.36 , t = 2.26 , p = 0.03 ) were found to be independent relevant factors of eft in patients with t2 dm ( table 3 ) . the patients with t2 dm are divided into two groups according to the values of cimt ( < or 0.9 mm ) , which is an indicator level of subclinical organ damage as proposed by esc hypertension guideline , to determine cutoff high risk value of eft in patients t2 dm by receiver operating characteristic ( roc ) curve analysis . in the roc curve analysis , the area under the curve ( auc , figure 3 ) was found statistically significant ( auc = 0.797 , 95% ci : 0.7090.884 , p < 0.001 ) . as an optimal cutoff point , high risk eft value of 6.3 mm was determined with a 72.5% sensitivity and 71.7% specificity . the major findings of the present study were first , patients with t2 dm had increased eft and cimt compared with age- and sex - matched controls . second , eft was correlated with cimt , waist circumference , bmi , age , duration of dm , and hba1c in patients with t2 dm . finally , eft of 6.3 mm was determined as a high risk value for subclinical atherosclerosis with a 72.5% sensitivity and 71.7% specificity in roc curve analysis . epicardial , mesenteric , and omental fats share the same origin from the splanchnopleuric mesoderm . it has been shown that eat produces inflammatory mediators such as interleukin ( il)-6 , il-1b , tumor necrosis factor ( tnf)-a , and monocyte chemotactic protein ( mcp-1 ) in patients with significant coronary artery disease and expresses mrnas of adiponectin , resistin , leptin , il-6 , tnf - a , and cd-45 . several studies have shown that eat can play a role in the development and aggravation of cad [ 8 , 2224 ] . in addition , eft has been shown to be related to mets , abdominal visceral adiposity , subclinical atherosclerosis , nonalcoholic fatty liver disease , type 1 dm , impaired fasting glucose , and hypertension [ 19 , 20 , 2529 ] . to our knowledge , as a main difference when compared to previously published data in patients with mets , this is the first study in the literature focusing on the relationship between eft and cimt in patients with t2 dm . it is also important that a positive linear and significant relationship between eft and duration of diabetes mellitus was found in our study . according to these results , eft may be used as a marker of subclinical atherosclerosis and disease progression in patients with t2 dm . recently , in a study performed by kim et al . , increased eat thickness assessed by cardiovascular magnetic resonance ( cmr ) was an independent risk factor for significant coronary artery stenosis in asymptomatic type 2 diabetes . there were 100 patients and no control group in that trial . in another study reported in a series of 49 type 2 diabetic patients by wang et al . , eat volume assessed by cardiac multislice computed tomography was shown to be increased and was associated with unfavourable components of mets and coronary atherosclerosis . in our study , similar to these trials , we found that eft was increased in patients with t2 dm . in contrast to these trials , we evaluated eft by tte in a larger population with a control group and sought relation between eft and cimt , which is increasingly used as a surrogate marker for atherosclerosis . although epicardial fat is readily visualized on high - speed ct and mri , widespread use of these methods for its assessment is not practical . echocardiographic eft measurement in the current practice appears to be feasible , as well as reliable due to good reproducibility which has been shown both in previous studies [ 19 , 20 , 32 ] and in this study . in our study , patients with t2 dm had lower bmi . however , eft and cimt were higher in the diabetic patients compared to the controls . additionally , bmi correlated with eft in female diabetic patients , but it did not correlate with eft in male diabetic patients and did not find independent predictor for eft . waist circumference not only was correlated with eft but also was independent predictor for eft in patients with t2 dm and also in both sex . similarly , we also found that waist circumference was more reliable parameter than bmi to predict eft in this study . iacobellis et al . have reported that threshold values of high risk eft to predict mets are median values of 9.5 mm ( 85% sensitivity and 63% specificity ) and 7.5 mm ( 82% sensitivity and 62% specificity ) in white men and women , respectively . in another study performed by natale et al . in a large population of hypertensives , patients with eft > 7 mm showed a significantly increase in cimt ( 0.84 0.2 mm ) . in a large study performed on patients presenting for cardiovascular preventive care , nelson et al . have reported that eat thickness 5.0 mm may identify an individual with a higher likelihood of having detectable carotid atherosclerosis . in our study , we found that eft of 6.3 mm was determined as a high risk value for subclinical atherosclerosis with a 72.5% sensitivity and 71.7% specificity . different race and patient population in those studies may have created these different threshold values of eft . even if different threshold values of eft have been found in all these studies , increased eft seems to be related to atherosclerotic process . this is a case control study , and prospective studies are necessary to show relation between eft with cimt and waist circumference . all data were based on a single measurement and may not reflect the association of eft and cimt regarding changes with time . in order to establish eft as a high risk criteria of atherosclerosis in type 2 diabetic patients , further studies are necessary on larger series . in conclusion , we found that eft measure by tte was increased in patients with t2 dm . our study also demonstrated that eft was strongly correlated with waist circumference and cimt as being independent of sex . these results from our study population may suggest that the echocardiographic assessment of eft is the reliable marker of atherosclerosis and increased cv risk in patients with t2 dm . further studies are needed to confirm these findings .
aims . the aim of this study was to investigate the relationship of echocardiographic epicardial fat thickness ( eft ) with carotid intima - media thickness ( cimt ) , in patients with type 2 diabetes mellitus ( t2 dm ) . methods and results . a total of 139 patients with t2 dm ( mean age 54.3 9.2 and 49.6% male ) and 40 age and sex - matched control subjects were evaluated . echocardiographic eft and ultrasonographic cimt were measured in all subjects . patients with t2 dm had significantly increased eft and cimt than those of the controls ( 6.0 1.5 mm versus 4.42 1.0 mm , p < 0.001 and 0.76 0.17 mm versus 0.57 0.14 mm , p < 0.001 , resp . ) . eft was correlated with cimt , waist circumference , bmi , age , duration of t2 dm , hba1c in the type 2 diabetic patients . linear regression analysis showed that cimt ( = 3.52 , t = 3.72 , p < 0.001 ) and waist circumference ( = 0.36 , t = 2.26 , p = 0.03 ) were found to be independent predictors of eft . a cutoff high risk eft value of 6.3 mm showed a sensitivity and specificity of 72.5% and 71.7% , respectively , for the prediction of subclinical atherosclerosis . conclusion . we found that echocardiographic eft was significantly higher in patients with t2 dm . our study also showed that eft was strongly correlated with waist circumference and cimt as being independent of sex .
thermophilic campylobacter spp . strains are some of the most frequent etiological agents of bacterial gastroenteritis in humans in many developed countries . c jejuni , c coli , c lari , and c upsaliensis are considered to be thermophilic because of their ability to grow at 42c . most detection methods are designed for the human pathogens c jejuni and c coli , and the majority of the studies deal with c jejuni , a common commensal of the gastrointestinal tracts of wild and farm animals that is ubiquitous in the natural environment ( kwan et al . , 2008 ) . thermophilic campylobacter can cause severe post - infection neuropathies , including guillan - barr syndrome and miller fisher syndrome ( rapp et al . , campylobacteriosis is a commonly reported zoonosis in the european union ( eu ) since 2005 and the number of reported confirmed cases of human campylobacteriosis in the eu in 2014 was 236,851 , which registered an increase of 22,067 cases compared with 2013 . the eu notification rate was 71.0 per 100,000 population in 2014 , which showed an increase by 9.6% compared with 2013 ( 64.8 per 100,000 population ) ( efsa , 2015 ) . in temperate climates , a seasonal trend was observed in the incidence of human campylobacteriosis cases , with peaks reported in spring and autumn in some countries , or in summer in other countries ( stanley et al . , 1998 ) . dairy cattle faecal shedding ( stanley and jones , 2003 ) , suggesting that cattle may play a role in the seasonal peak of human infection ( kwan et al . , 2008 ) . the significance of cattle as reservoir of human campylobacteriosis is related to food products contamination ( meat and milk ) , to environmental and water contamination , and to a direct transmission to humans . several studies have identified poultry meat as the main food vehicle associated with sporadic cases of campylobacteriosis , but there is also strong evidence that raw milk consumption represents a risk factor for campylobacteriosis . raw cow s milk has been reported to be a vehicle of human campylobacteriosis in outbreaks both in the united states and europe ( claeys et al . , 2013 ; , 2013;taylor et al.,2013 ; efsa , 2015 ) . in the united states the expert consultation on the global view of campylobacteriosis reported that raw unpasteurised milk is the most common food vehicle for campylobacteriosis outbreaks , whereas the relative contribution of raw milk accounts for only a small fraction of sporadic cases ( who , 2013 ) . the european union summary report on zoonoses , zoonotic agents and food - borne outbreaks in 2012 reports that milk was the second most frequently identified food vehicle in the strong - evidence campylobacter outbreaks , 20.0% of which implicated milk , indicating a well - documented risk of campylobacteriosis ( efsa , 2015 ) . in italy , the results of diagnostic activities performed in different surveys and official control data showed that the prevalence of c jejuni in raw milk samples collected by self - service vending machines varies from 0 to 1.5% ( giacometti et al . in addition , two outbreaks of c jejuni linked to the consumption of raw milk have been reported in italy , one in veneto region and the other in marche region ( amato et al . , 2007 ) . the objective of this study was to assess if a seasonal trend in thermophilic campylobacter spp . contamination of raw milk exists and to evaluate a possible link with the increase of human campylobacteriosis cases in summer months . data were collected from official microbiological records monitoring raw milk samples from self - service vending machines in lombardy region . all samples were analysed at the institute for experimental veterinary medicine of lombardy and emilia - romagna , brescia , following the iso 10272 - 1:2006 method ( iso , 2006 ) . test procedures are accredited according to the international organization for standardization 17025:2005 ( iso , 2005 ) by accredia , the italian accreditation body . in this study a total of 1629 raw milk samples analysed during 2012 - 2014 was considered ; statistical analysis was performed using spss software ( spss statistics ver . chicago , il , usa ) by test comparing the prevalence of thermophilic campylobacter contamination during warmer months ( april - september ) vs cooler months ( october - march ) . results showed a mean prevalence of 1.6% of samples positive for thermophilic campylobacter spp . with a range of 0.0 - 3.1% in different months during the three years considered . most of the samples were analysed by the official veterinary services in the periods between may and november . one month ( january ) showed a noticeable lower number of samples tested by official authorities and in one month ( august ) no sample was performed . the statistical analysis showed a significant difference ( p<0.01 ) of the prevalence of samples positive for thermophilic campylobacter spp . between warmer and cooler months ( 2.3 vs 0.6% ) . a total of 1629 milk samples collected during 2012 - 2014 in lombardy region were analysed for the presence of thermophilic campylobacter spp . ; twenty - six out of 1629 examined ( 1.6% ) resulted positive . is in agreement with previous studies performed in italy on raw milk sold for direct consumption , which ranged between 0 and 2.2% in different regions ( giacometti et al . , 2012 , 2013 ) . the observed prevalence is also in agreement with other investigations performed in different countries ( desmasures et al . , 1997 ; dontorou et al . , 2003 ; meyer - broseta et al . , 2003 ; oliver et al . , 2005 , 2009 ; most of the samples were analysed by official veterinary services in warmer months ; this is in agreement with the principle that sampling should be planned according to the microbiological risk and should follow the regulatory guidelines of the italian ministry of health ( 2007 ) on raw milk . regional rules specify that every year at least two samplings must be performed for each farm authorised to sell raw milk and that at least one sampling must be performed during summer . in the 3-year - period of this study , a mean of 230 farms was authorised to sell raw milk ; the total number of samples tested ( 1629 ) shows that the mean value of milk samples collected from each farm was 2.3/year . a seasonal trend in thermophilic campylobacter spp . contamination of raw milk samples was observed in this study , with higher prevalence in warmer months ( april - september ) , corresponding to the higher prevalence rates of faecal shedding observed in cattle ( grove - white et al . , 2010 ) even in italy ( merialdi et al . , 2015 ) and in humans ( stampi et al . , 1992 ) . different reasons for seasonal increase of human campylobacteriosis were proposed , including increase shedding of animal reservoirs and higher levels of the food chain contamination , changes in human behaviour and the abundance of invertebrate vectors . however , the driver of this trend is still unknown ( spencer et al . , 2012 ) . despite the most important risk factors for campylobacteriosis are recognised to be handling and consumption of poultry meat and cross - contamination of uncooked products , there is now a growing evidence , based on molecular typing of isolates , that non - poultry sources of human infection has been underestimated . epidemiological data suggest that the vehicles of common sources outbreaks are different from sporadic infections ( stanley and jones , 2003 ) : in fact the most frequent food vehicle reported in campylobacteriosis outbreaks is represented by raw unpasteurised milk , whereas for sporadic cases poultry represents the main risk factor ( taylor et al . , 2013 ) . also , a rural - urban association of strains was demonstrated , with the majority of children infections caused by cattle strains in rural areas and by poultry strains in urban areas . cattle products , the environment contamination , and direct contact between cattle and humans are well - recognised sources of infection of pathogenic agents ( ellis - iversen et al . , 2009 ) . the transmission pathways of thermophilic campylobacter spp . , and in particular c jejuni , from dairy cows to humans may include direct contact with dairy animals , consumption of untreated water contaminated with animal effluents and consumption of contaminated milk ( gilpin et al . high rates of campylobacteriosis have been reported in high - density dairying areas ( gilpin et al . , 2013 ) and in particular rural residence was identified as a recognised risk factor for children ( bessel et al . , 2010 ) . recently , in italy , multi locus sequence typing of c. jejuni isolates showed a correspondence between milk and cattle isolates and five of the most frequently detected clinical human ccs isolates ( cc-21 , cc-45 , cc-48 , cc-61 , cc206 ) in europe , emphasising the role of cattle as a major source of food contamination and human infection ( bianchini et al . , 2014 ) . common sources of campylobacteriosis outbreaks are rare but show a marked seasonality trend and in particular contaminated water , milk or cattle represent the most commonly implicated vehicle or risk factor ( stanley et al . , 1998 ; kwan et al . , 2008 ) 2013 ) attributed the significant higher number of campylobacteriosis cases in summer months to an increase of food - related cases . the evidence of a seasonal trend in thermophilic campylobacter spp . contamination of raw milk sold for direct consumption with an increase of the prevalence in warmer months may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis . bacteriological surveillance of raw milk samples may help to understand the role of campylobacter spp . in foodborne and/or zoonotic infections transmitted to humans .
in temperate climates , a seasonal trend was observed in the incidence of human campylobacteriosis cases , with peaks reported in spring and autumn in some countries , or in summer in others ; a similar trend was observed in campylobacter spp . dairy cattle faecal shedding , suggesting that cattle may play a role in the seasonal peak of human infection . the objectives of this study were to assess if a seasonal trend in thermophilic campylobacter spp . contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months . the results showed a mean prevalence of 1.6% of milk samples positive for thermophilic campylobacter spp . with a wide range ( 0.0 - 3.1% ) in different months during the three years considered . the statistical analysis showed a significant difference ( p<0.01 ) of the prevalence of positive samples for thermophilic campylobacter spp . between warmer and cooler months ( 2.3 vs 0.6% ) . the evidence of a seasonal trend in thermophilic campylobacter spp . contamination of raw milk sold for direct consumption , with an increase of the prevalence in warmer months , may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis .
pseudoprogression , that is , initial tumor growth followed by subsequent tumor regression , has been well described for immunomodulation therapy in melanoma patients . nivolumab , an anti - pd-1 monoclonal antibody , was recently approved for nonsmall cell lung cancer ( nsclc ) as a second - line therapy . we present a patient with squamous nsclc , suffering from multiple bone and subcutaneous metastases . a subcutaneous lesion in her upper back grew substantially after the first cycle of nivolumab , and later regressed , with marked improvement in all cancer sites . nivolumab , an antiprogrammed death 1 ( pd-1 ) monoclonal antibody , was recently approved as second - line therapy for nonsmall cell lung cancer ( nsclc ) . pd-1 related therapies are an emerging field in cancer and currently , there are 3 approved therapies from this family ( pd-1 blockade ; nivolumab , pembrolizumab ; programmed death ligand 1 [ pdl-1 ] blockade ; atezolizumab ) . pdl-1 is a ligand released by the tumor which inhibits the lymphocytes in the microenvironment . by blocking the pd-1 receptor ( on the lymphocyte ) or by scavenging the pdl-1 , the immune system is enhanced and lymphocytes may interfere with the tumor tissue development . this process may cause local inflammation and physical growth . once the immune system overcomes the tumor this pseudoprogression may lead to misinterpretation of the patient 's status and wrong clinical decisions . we present here a case of pseudoprogression followed by dramatic regression of a subcutaneous metastatic lesion in a patient with squamous nsclc treated with nivolumab . pseudoprogression has been reported in 6.7% to 12% of patients with malignant melanoma treated by immunotherapy , while the manifestation of this phenomenon in lung cancer is still uncertain . a 68-year - old female smoker with a history of pulmonary embolism and diabetes mellitus was diagnosed with stage iiib ( t4n2m0 ) squamous nsclc . she was treated by definitive chemoradiotherapy with cisplatin and vinorelbine until september 2014 . in october 2014 , positron emission tomography computed tomography ( pet - ct ) scan demonstrated a good response in the primary lesion ; however , new metastases in the right adrenal gland and right femur developed and were irradiated in november 2014 . a month later the disease progressed with development of multiple bone and subcutaneous metastases . at that point she received one cycle of carboplatin and gemcitabine followed by severe pancytopenia , and treatment was switched to nivolumab 3 mg / kg q14 days in january 2015 . one week after the first cycle of nivolumab , a subcutaneous lesion in her upper back grew substantially , accompanied by severe pain and significant inflammatory reaction ( fig . after the second cycle of treatment marked symptomatic improvement was observed , including improvement in general appearance and dyspnea and reduction of the bone pain . the subcutaneous lesions started to regress too , with complete resolution by the 12th week as well as improvement in all bone lesions ( figs . 1 and 2 ) . ( a ) pet - ct demonstrating a subcutaneous metastatic lesion , 2 months after starting nivolumab treatment ( 03/2015 ) . ( b ) pet - ct demonstrating complete resolution of the lesion 5 months after starting nivolumab treatment ( 06/2015 ) . specifically , initial tumor growth followed by subsequent tumor regression ( pseudoprogression ) has been reported in metastatic melanoma . the underlying mechanism for the phenomenon is either continued tumor growth until a sufficient immune response occurs , or a transient immune - cell infiltrate . immune - related response criteria have been developed in order to address unconventional response patterns observed with immunotherapy . their use has revealed an additional 10% of favorable responses and survival in ipilimumab - treated melanoma patients . immune - related responses were also reported in melanoma patients treated with nivolumab , a fully human igg4 pd-1 immune check - point inhibitor . nivolumab received food and drug administration ( fda ) approval for second - line treatment of squamous nsclc based on superior survival rate over docetaxel in the checkmate 017 trial . the rate of pseudoprogression patterns in immunotherapy - treated lung cancer patients is still unclear . we describe a case of pseudoprogression of subcutaneous metastasis in a patient with lung squamous cell carcinoma treated with nivolumab .
abstractrationale : pseudoprogression , that is , initial tumor growth followed by subsequent tumor regression , has been well described for immunomodulation therapy in melanoma patients . this phenomenon is not well defined in lung cancer . nivolumab , an anti - pd-1 monoclonal antibody , was recently approved for nonsmall cell lung cancer ( nsclc ) as a second - line therapy.patient concerns and diagnosis : we present a patient with squamous nsclc , suffering from multiple bone and subcutaneous metastases.interventions:the patient was treated with nivolumab.outcomes:a subcutaneous lesion in her upper back grew substantially after the first cycle of nivolumab , and later regressed , with marked improvement in all cancer sites.lessons:such pseudoprogression may serve to predict subsequent clinical response .
primary human aortic endothelial cells ( haecs ) ( from cambrex ) and conditionally immortalized haecs ( generated by dr . anita samuga , albert einstein college of medicine ) were maintained in ebm-2 medium ( from lonza ) with all the supplements . immortalized haecs were grown at 33c , but experiments and treatment were performed at the nonpermissive temperature of 37c . mn(iii)tetrakis(4-benzoic acid)porphyrin chloride ( mntbap ) was obtained from calbiochem ( san diego , ca ) . ucp1 , sod2 , and glo1 cdnas ( obtained from open biosystems ) were cloned into the shuttle vector pad5cmvk - npa , and adenoviral vectors and empty control virus were prepared by the gene transfer vector core at the university of iowa . extracellular hmgb1 level was analyzed by an hmgb1 elisa detection kit ( # apo-54n-043 from apotech ) according to the manufacturer 's instructions . sirna for the nuclear factor ( nf)-b p65 subunit , activated protein-1 ( ap-1 ) ( c - jun ) , and scrambled oligonucleotide as control ( sc-37007 ) were obtained from santa cruz biotech . the antibodies for rage ( sc-74473 ) , s100a8 ( sc-20174 for human , and sc-8113 for mouse ) , hmgb1 ( sc-56698 ) , and 3-nitrotyrosine ( sc-32731 ) were obtained from santa cruz biotech . methylglyoxal - modified protein was measured by western blotting using a monoclonal antibody to the major intracellular methylglyoxal - derived epitope , n - acetyl - n ( 5-hydro-5-methyl)-4-imidazolone . mol / l cm - h2dcfda ( invitrogen ) for 45 min at 37c , and the intracellular formation of ros was measured at excitation / emission wavelengths of 485/530 nm using a wallac 1420 fluorescent plate reader . total rna from cells was extracted using the rneasy mini kit or rneasy micro kit ( qiagen ) , and the rna was reverse - transcribed with the superscript iii first strand synthesis system ( invitrogen ) . real - time quantitative pcr ( qpcr ) was run on a lightcycler roche 480 with lightcycler 480 sybr green i master kit ( roche ) . pcr was performed by denaturing at 95c for 7 min , followed by 45 cycles of denaturation at 95c , annealing at 60c , and extension at 72c for 10 s , respectively . proteins were separated on 10% sds - page gels , blotted with the indicated primary antibodies , and then simultaneously incubated with the differentially labeled species - specific secondary antibodies , anti - rabbit irdye 800cw ( green ) , and anti - mouse ( or goat ) alexa680 ( red ) . membranes were scanned and quantitated with the odyssey infrared imaging system ( li - cor , lincoln , ne ) . glo1 activity was measured by using a spectrophotometric method that monitors the increase in absorbance at 240 nm due to the formation of s - d - lactoylglutathione ( 240 = 3.37 mmol treated cells were harvested , protein lysates prepared , and protein concentration measured by the coomassie protein assay kit ( thermo fisher scientific ) using bsa as a standard . the reaction buffer ( 7.9 mmol / l methylglyoxal , 1 mmol / l freshly prepared glutathione , and 16 mmol / l mgso4 in 200 mmol / l imidazole buffer , ph 7.0 ) was incubated for at least 2 min to ensure the equilibration of hemimercaptal , the actual substrate of glo1 . the hemimercaptal is formed nonenzymatically and its concentration was calculated to be 0.7 mmol / l using keq = 3.1 mmol / l . the reaction was initiated by the addition of a rate - limiting volume of protein lysates ( 1030 g ) to 3.0 ml of reaction mixture . one unit of glo1 activity is defined as the amount of enzyme catalyzing formation of 1 mol of s - d - lactoylglutathione per minute . treated cells were washed and cross - linked using 1% formaldehyde for 20 min . after stopping cross - linking by addition of 0.1 mol / l glycine , cell lysates were sonicated and centrifuged . a total of 500 g protein was precleared by bsa / salmon sperm dna and a slurry of protein a agarose beads . immunoprecipitations were performed using the indicated antibodies or preimmune rabbit igg in the presence of bsa / salmon sperm dna and a 50% slurry of protein a agarose beads . input and immunoprecipitates were washed and eluted and then incubated for 2 h at 42c in the presence of proteinase k followed by 6 h at 65c to reverse the formaldehyde cross - linking . the related fragments on promoters of rage ( 720 to 561 ) , s100a8 ( 1,290 to 1,132 ) , s100a12 ( 163 to 4 ) , and hmgb1 ( 200 to 54 ) were amplified by real - time pcr ( qpcr ) . diabetes was induced in c57/blk6 mice by consecutive injection of 50 mg / kg streptozotocin ( stz ) ( 0.05 mol / l sodium citrate , ph 5.5 ) for 5 days after an 8-h fast . after 4 weeks of diabetes , one group of stz mice was treated with 10 mg / kg mntbap intraperitoneally for 7 days , whereas control mice received only vehicle . mice were killed by cervical dislocation , and the aorta was dissected and snap - frozen in oct compound . then , 10-m sections were cut by microtome and mounted on pen ( polyethylene naphthalate ) membrane slides ( 2.0 m , leica ) . aortic endothelial cells or smooth muscle cells all in vivo procedures were approved by the institutional animal care and use committee of the albert einstein college of medicine . blood glucose values were 158 19 mg / dl for ctl , 391 21 mg / dl for stz diabetic , and 376 26 mg / dl for mntbap - treated stz mice . body weights were 29.7 + 1.7 g ( ctl ) , 26.7 + 1.8 g ( stz ) , and 27.1 + 1.4 g ( mntbap - treated stz mice ) . data distribution was analyzed , and statistical differences for different treatments were evaluated by anova and the tukey - kramer test using spss 15 software . treated cells seeded in a 96-well plate were incubated with 10 mol / l cm - h2dcfda ( invitrogen ) for 45 min at 37c , and the intracellular formation of ros was measured at excitation / emission wavelengths of 485/530 nm using a wallac 1420 fluorescent plate reader . total rna from cells was extracted using the rneasy mini kit or rneasy micro kit ( qiagen ) , and the rna was reverse - transcribed with the superscript iii first strand synthesis system ( invitrogen ) . real - time quantitative pcr ( qpcr ) was run on a lightcycler roche 480 with lightcycler 480 sybr green i master kit ( roche ) . pcr was performed by denaturing at 95c for 7 min , followed by 45 cycles of denaturation at 95c , annealing at 60c , and extension at 72c for 10 s , respectively . proteins were separated on 10% sds - page gels , blotted with the indicated primary antibodies , and then simultaneously incubated with the differentially labeled species - specific secondary antibodies , anti - rabbit irdye 800cw ( green ) , and anti - mouse ( or goat ) alexa680 ( red ) . membranes were scanned and quantitated with the odyssey infrared imaging system ( li - cor , lincoln , ne ) . glo1 activity was measured by using a spectrophotometric method that monitors the increase in absorbance at 240 nm due to the formation of s - d - lactoylglutathione ( 240 = 3.37 mmol treated cells were harvested , protein lysates prepared , and protein concentration measured by the coomassie protein assay kit ( thermo fisher scientific ) using bsa as a standard . the reaction buffer ( 7.9 mmol / l methylglyoxal , 1 mmol / l freshly prepared glutathione , and 16 mmol / l mgso4 in 200 mmol / l imidazole buffer , ph 7.0 ) was incubated for at least 2 min to ensure the equilibration of hemimercaptal , the actual substrate of glo1 . the hemimercaptal is formed nonenzymatically and its concentration was calculated to be 0.7 mmol / l using keq = 3.1 mmol / l . the reaction was initiated by the addition of a rate - limiting volume of protein lysates ( 1030 g ) to 3.0 ml of reaction mixture . one unit of glo1 activity is defined as the amount of enzyme catalyzing formation of 1 mol of s - d - lactoylglutathione per minute . treated cells were washed and cross - linked using 1% formaldehyde for 20 min . after stopping cross - linking by addition of 0.1 mol / l glycine , cell lysates were sonicated and centrifuged . a total of 500 g protein was precleared by bsa / salmon sperm dna and a slurry of protein a agarose beads . immunoprecipitations were performed using the indicated antibodies or preimmune rabbit igg in the presence of bsa / salmon sperm dna and a 50% slurry of protein a agarose beads . input and immunoprecipitates were washed and eluted and then incubated for 2 h at 42c in the presence of proteinase k followed by 6 h at 65c to reverse the formaldehyde cross - linking . the related fragments on promoters of rage ( 720 to 561 ) , s100a8 ( 1,290 to 1,132 ) , s100a12 ( 163 to 4 ) , and hmgb1 ( 200 to 54 ) were amplified by real - time pcr ( qpcr ) . diabetes was induced in c57/blk6 mice by consecutive injection of 50 mg / kg streptozotocin ( stz ) ( 0.05 mol / l sodium citrate , ph 5.5 ) for 5 days after an 8-h fast . after 4 weeks of diabetes , one group of stz mice was treated with 10 mg / kg mntbap intraperitoneally for 7 days , whereas control mice received only vehicle . mice were killed by cervical dislocation , and the aorta was dissected and snap - frozen in oct compound . then , 10-m sections were cut by microtome and mounted on pen ( polyethylene naphthalate ) membrane slides ( 2.0 m , leica ) . aortic endothelial cells or smooth muscle cells all in vivo procedures were approved by the institutional animal care and use committee of the albert einstein college of medicine . blood glucose values were 158 19 mg / dl for ctl , 391 21 mg / dl for stz diabetic , and 376 26 mg / dl for mntbap - treated stz mice . body weights were 29.7 + 1.7 g ( ctl ) , 26.7 + 1.8 g ( stz ) , and 27.1 + 1.4 g ( mntbap - treated stz mice ) . data distribution was analyzed , and statistical differences for different treatments were evaluated by anova and the tukey - kramer test using spss 15 software . in cultured haecs , mrna levels of rage , s100a8 , and s100a12 calgranulins and hmgb1 were increased by high glucose by 2.3- , 2.1- , 3.4- , and 1.7-fold , respectively ( fig . each of these high glucose - induced increases was prevented by overexpression of either uncoupling protein-1 ( ucp1 ) or manganese superoxide dismutase ( sod2 ) , both of which prevent hyperglycemia - induced superoxide production by the mitochondrial electron transport chain ( 13,14 ) . increased gene expression of rage , s100a8 , s100a12 , and hmgb1 was also prevented by overexpression of the -oxoaldehyde degradating enzyme glyoxalase 1 ( glo1 ) . the major physiological substrate for glo1 , methylglyoxal , is a highly reactive dicarbonyl that accumulates in endothelial cells and in several other cell types exposed to hyperglycemia , as a consequence of increased mitochondrial superoxide production . overexpression of ucp1 , sod2 , and glo1 in cells subjected to 5 mmol / l glucose decreased ros levels by 40% ( data not shown ) . a : primary haecs were infected with ucp1 , sod2 , glo1 , or empty control adenovirus ( ctl ) . after incubation with either low glucose ( lg ) ( 5 mmol / l ) or high glucose ( hg ) ( 30 mmol / l ) for 5 days , mrna levels were determined by real - time pcr ( n = 3 ) . b : intracellular protein levels of rage , s100a8 , and hmgb1 were determined by western blotting ( n = 4 ) . protein sizes were evaluated by standard protein markers , and their sizes were as follows : rage ( 46 kda ) , s100a8 ( 11 kda ) , and hmgb1 ( 25 kda ) . c : levels of secreted hmgb1 were determined in culture medium by enzyme - linked immunosorbent assay ( elisa ) ( n = 5 ) . values are shown as means + sd , * p < 0.05 vs. lg / ctl group . ( a high - quality color digital representation of this figure is available in the online issue . ) protein expression of rage , s100a8 , and intracellular hmgb1 paralleled mrna levels ( fig . high glucose increased levels 1.7- , 1.9- , and 1.5-fold , respectively . because hmgb1 is released into the extracellular milieu under stressed conditions ( 17 ) , extracellular hmbg1 protein was also measured in the medium ( fig . this increase was totally normalized by overexpression of either ucp1 , or sod2 , or glo1 . high glucose increased ros twofold , and this was prevented by overexpression of either ucp1 , sod2 , or glo1 ( fig . similarly , high glucose increased levels of methylglyoxal - modified intracellular protein , and this was also prevented by overexpression of either ucp1 , sod2 , or glo1 ( fig . endogenous glo1 activity and protein levels were unchanged after incubation in high glucose for 24 h ( fig . 2f . however , after 5 days , hyperglycemia - induced ros reduced endogenous glo1 activity ( fig . 2 g ) and protein levels ( fig . overexpression of ucp1 , sod2 , and glo1 prevents hyperglycemia - induced ros generation and methylglyoxal formation . primary haecs were infected with ucp1 , sod2 , glo1 , or empty control adenovirus ( ctl ) . after incubation with either low glucose ( lg ) ( 5 mmol / l ) or high glucose ( hg ) ( 30 mmol / l ) for 1 or 5 days , the cells were used for analysis . a : ros formation on day 5 . ( a high - quality color digital representation of this figure is available in the online issue . ) to confirm that hyperglycemia - induced increases in intracellular methylglyoxal were sufficient to increase expression of rage and rage ligands , glo1 was knocked down 80% by shrna in cells exposed to normal glucose ( fig . 3a and b ) . when glo1 was knocked down , mrna levels for rage , s100a8 , s100a12 , and hmgb1 were increased by 2.3- , 1.9- , 2.4- and 1.7-fold , respectively , levels equivalent to those induced by high glucose ( fig . 3a ) . in cells incubated in high glucose , glo1 sirna further increased expression of rage and rage ligands . similarly , rage , s100a8 , and hmgb1 protein levels increased 2.1- , 1.8- , and 1.6-fold , respectively , when glo1 was knocked down in cells exposed to normal glucose ( fig . 3b ) , levels equivalent to those induced by high glucose . in cells incubated in high glucose , glo1 knockdown also increased intracellular levels of methylglyoxal - modified protein to that caused by high glucose incubation ( fig . glo1 knockdown duplicates the effect of hyperglycemia on expression of rage , s100 calgranulins , and hmgb1 . conditionally immortalized haecs were infected with either shglo1 or nontargeting control ( ctl ) lentivirus and then incubated in either low glucose ( lg ) or high glucose ( hg ) for 5 days . a : mrna levels were determined by real - time pcr ( n = 3 ) . protein sizes were evaluated and confirmed by standard protein markers , and their sizes were as follows : rage ( 46 kda ) , s100a8 ( 11 kda ) , and hmgb1 ( 25 kda ) . c : intracellular methylglyoxal - modified proteins were quantitated by western blotting ( n = 4 ) . d : representative blots for c. values are shown as means + sd . * p < 0.05 vs. ctl group . ( a high - quality color digital representation of this figure is available in the online issue . ) we next asked how ros - induced increases in methylgloxal - modified protein caused increased expression of rage and its endogenous ligands . induction of rage expression by ages and ligands such as tumor necrosis factor ( tnf)- requires binding of the transcription factor nfb ( p65/p50 ) to canonical binding sites in the rage promoter , while induction by other ligands requires binding of the transcription factor sp1 ( 18,19 ) . because hyperglycemia - induced ros cause increased expression of p65 ( 20 ) , the effect of p65 knockdown by sirna on rage expression was determined . knockdown of nfb p65 ( 80% ) prevented increased rage expression by high glucose ( fig . glo1 knockdown increases p65 expression in the absence of hyperglycemia , and glo1 overexpression prevents high glucose - induced p65 expression ( 20 ) . therefore , the effect of glo1 overexpression on nfb p65 binding to the rage promoter was determined using chromatin immunoprecipitation ( chip ) . as shown in fig . 4b , high glucose increased binding of this transcription factor to the rage promoter , and glo1 overexpression prevented this . a search of the s100a8 , s100a12 calgranulin , and hmgb1 promoters for common putative transcription factor binding sites showed that binding sites for the redox - sensitive transcription factor ap-1 were common to all three promoters . therefore , the effect of ap-1 ( c - jun ) knockdown by sirna on rage expression was determined . knockdown of ap-1 prevented increased s100a8 , a100a12 calgranulin , and hmgb1 expression by high glucose ( fig . the effect of glo1 overexpression on ap-1 binding to the promoters of s100a8 , s100a12 , and hmgb1 are shown in fig . high glucose increased binding of this transcription factor to the three rage ligand promoters , and glo1 overexpression prevented this increase . hyperglycemia - induced methylglyoxal increases binding of nfb to the rage promoter and binding of ap-1 to the s100a8 , s10012 , and hmgb1 promoters . a : conditionally immortalized haecs were treated with low glucose ( lg ) , high glucose ( hg ) , or hg after transfection with either scrambled oligonucleotides ( lg and hg ) or sirna for p65 ( hg / sip65 ) for 5 days , and the rage mrna level was determined by qpcr ( n = 3 ) . b : primary haecs were treated with lg , hg , or hg after infections with either nontarget control or glo1 adenovirus ( hg / glo1 ) for 5 days . chromatin immunoprecipitation was performed using the p65 antibody , and the rage promoter was amplified by qpcr ( n = 4 ) . c : conditionally immortalized haecs were treated with lg , hg , or hg after transfection with either scrambled oligonucleotides or sirna for ap-1 ( c - jun ) ( hg / siap-1 ) for 5 days , and mrna levels of s100a8 , s10012 , and hmgb1 were determined by qpcr ( n = 3 ) . d : primary haecs were treated with lg , hg , or hg after infections with either nontarget control or glo1 adenovirus ( hg / glo1 ) for 5 days . chromatin immunoprecipitation was performed using c - jun antibody , and the s100a8 , 100a12 , and hmgb1 promoters were amplified by qpcr ( n = 4 ) . values are shown as means + sd . * p < 0.05 vs. lg group . ( a high - quality color digital representation of this figure is available in the online issue . ) finally , expression of rage , s100a8 , and hmgb1 was evaluated in aortic endothelial cells isolated by laser capture microdissection from nondiabetic mice , stz diabetic mice , and stz diabetic mice treated with the superoxide dismutase mimetic mntbap ( fig . s100a12 was not measured , since the s100a12 gene is not expressed in rodents ( 21 ) . to confirm that laser capture microdissection had successfully isolated endothelial cells , mrna levels of vwf , an endothelial cell specific marker ; -actin , a smooth muscle cell marker ; and actin , a control gene , were measured ( fig . vwf mrna was greatly enriched in endothelial cells compared with smcs , whereas smcs were greatly enriched in -actin compared with endothelial cells . treatment of diabetic mice with mntbap normalizes increased expression of rage , s100 calgranulins , and hmgb1 . a : aortic endothelial cells ( aec ) or smooth muscle cells ( smc ) were isolated from either wild - type ( wt ) mice , stz - induced diabetic mice ( stz ) , or stz - diabetic mice treated with mntbap ( stz / mntbap ) , using laser capture microdissection . mrna levels for vwf ( a ) and -actin ( b ) were determined by qpcr ( n = 3 , * p < 0.05 vs. aec group ) . c : 3-nitrotyrosine content of aortic cells from the above mice was determined by western blot ( n = 4 , * p < 0.05 vs. ctl group ) . d : representative blots for c. e : methylglyoxal - modified protein content of aortic cells from the above mice was determined by western blot ( n = 4 , * p < 0.05 vs. ctl group ) . f : representative blots for e. g : aortic endothelial cells were used for analysis of gene expression by qpcr ( n = 3 , * p < 0.05 vs. wt group ) . ( a high - quality color digital representation of this figure is available in the online issue . ) diabetes increased intracellular ros , as determined by 3-nitrotyrosine levels , and mntbap treatment normalized this ( fig . intracellular levels of methylglyoxal - modified protein were similarly increased by diabetes and normalized by mntbap treatment ( fig . 5f . diabetes increased rage mrna levels by 1.8-fold , s100a8 calgranulin mrna levels by 1.7-fold , and hmgb1 mrna levels by 2.4-fold ( fig . treatment of diabetic mice with the superoxide dismutase mimetic compound mntbap normalized diabetic endothelial cell rage , s100a8 , and hmgb1 mrna levels . in the present study , we show that hyperglycemia - induced ros production by the mitochondrial electron transport chain increases expression of rage and three high - affinity endogenous rage ligands s100a8 calgranulin , s100a12 calgranulin , and hmgb1that exhibit proinflammatory effects in vitro at concentrations found at sites of inflammation in vivo ( 9 ) . this effect is mediated by ros - induced production of methylglyoxal , the major -oxoaldehyde substrate of the enzyme glyoxalase 1 . this increases binding of nfb to the rage promoter and of ap-1 to the s100a8 , s100a12 , and hmgb1 promoters . diabetes also increased expression of rage , s100a8 , and hmgb1 in aortic endothelial cells in vivo , and treatment of diabetic mice with the superoxide dismutase mimetic mntbap normalized each of these increases . much evidence supports a unified mechanism of hyperglycemia - induced cellular damage , in which intracellular hyperglycemia develops in target cells of diabetic complications , causing increased mitochondrial production of ros . the ros cause strand breaks in nuclear dna , which activate the enzyme poly(adp - ribose ) polymerase ( parp ) . this decreased gapdh activity activates the polyol pathway , increases intracellular age formation , activates pkc isoforms , increases nfb p65 transcription and activity , and activates hexosamine pathway flux ( 13,14,20 ) . the data presented in the current study demonstrate that increased expression of rage and of its proinflammatory endogenous ligands are also a consequence of hyperglycemia - induced ros and thus constitute another element of this unifying mechanism . rage was originally identified by its ability to bind advanced glycation end products . however , there is currently disagreement about the importance of age - modified proteins as agonists of rage in vivo , because proteins modified by ages to the extent necessary to bind rage are unlikely to exist in physiological systems in vivo ( 2224 ) . in contrast , s100/calgranulin proteins and high mobility group-1 protein are present at sites of inflammation in vivo at concentrations that activate rage ( 9,15 ) . while modification of the corepressor msin3a by the glo1 substrate methylglyoxal has been shown to mediate hyperglycemia - induced transcription of angiopoietin-2 ( 25 ) , the specific methylglyoxal - modified protein(s ) responsible for hyperglycemia - induced transcription of rage and its ligands s100a8 calgranulin , s100a12 calgranulin , and hmgb1 remain to be determined . regardless of the specific proteins modified , however , the data presented here suggest that pharmacologic agents capable of reducing methylglyoxal concentration in cells susceptible to diabetic complications ( 14 ) may have a beneficial effect on the damaging consequences of nonphysiologic rage activation ( 3 ) .
objectiverage interacts with the endogenous ligands s100 calgranulins and high mobility group box 1 ( hmgb1 ) to induce inflammation . since hyperglycemia - induced reactive oxygen species ( ros ) activate many pathways of diabetic tissue damage , the effect of these ros on rage and rage ligand expression was evaluated.research design and methodsexpression of rage , s100a8 , s100a12 , and hmgb1 was evaluated in human aortic endothelial cells ( haecs ) incubated in normal glucose , high glucose , and high glucose after overexpression of either uncoupling protein 1 ( ucp1 ) , superoxide dismutase 2 ( sod2 ) , or glyoxalase 1 ( glo1 ) . expression was also evaluated in normal glucose after knockdown of glo1 . expression was next evaluated in high glucose after knockdown of nuclear factor ( nf)-b p65 ( rage ) and after knockdown of activated protein-1 ( ap-1 ) ( s100a8 , s100a12 , and hmgb1 ) , and chromatin immunoprecipitation ( chip ) was performed glo1 overexpression for nfb p65 ( rage promoter ) and ap-1 ( s100a8 , s100a12 , and hmgb1 promoters ) . finally , endothelial cells from nondiabetic mice , stz diabetic mice , and stz diabetic mice treated with the superoxide dismutase mimetic mn(iii)tetrakis(4-benzoic acid)porphyrin chloride ( mntbap ) were evaluated.resultshigh glucose increased rage , s100a8 , s100a12 , and hmgb1 expression , which was normalized by overexpression of ucp1 , sod2 , or glo1 . glo1 knockdown mimicked the effect of high glucose , and in high glucose , overexpression of glo1 normalized increased binding of nfb p65 and ap-1 . diabetes increased rage , s100a8 , and hmgb1 expression , and mntbap treatment normalized this.conclusionsthese results show that hyperglycemia - induced ros production increases expression of rage and rage ligands . this effect is mediated by ros - induced methylglyoxal , the major substrate of glyoxalase 1 .
although shock is defined in terms of a critically low blood pressure , a more generally accepted and physiology - based definition of shock is : the inability of the circulation to sustain the cellular respiration needed to maintain normal organ function . although intensivists are aware of the physiology - based mechanisms of shock , they have to rely on surrogate global upstream ( e.g. , blood pressure ) and/or downstream ( e.g. , svo2 ) hemodynamic variables to diagnose inadequate organ perfusion and guide therapy . attempts to integrate regional indicators such as intestinal co2 , lactate and indocyanine green ( icg ) clearance , which have all been associated with prognosis , have had limited success . apart from these general limitations , it becomes clear that in distributive shock shunting in the microcirculation is an intrinsic complexity . although theoretically the concept of shunting has been well known for many decades , new technologies have elucidated the role of microcirculatory weak units. in a model of ischemia reperfusion , a speckled pattern of nadh fluorescence and po2 emerged after re - oxygenation , indicating an inhomogeneous distribution of cells more vulnerable to ischemic insults than others . provided upstream oxygen delivery is adequate , shunted parts of the microcirculation remain hypoxic in the presence of well - maintained venous po2 , explaining the persistence of elevated lactate and regional pco2 levels not sensed by the downstream variables such as svo2 . the net systemic result is an inability to increase tissue oxygen uptake , despite efforts to ( supra)normalize oxygen delivery , but whether this reflects a true extraction deficit as result of a preceded cellular metabolic shutdown or a potentially correctable state of inhomogeneous hypo perfusion remains to be established . because of the introduction of direct in vivo observation of the microcirculation , heterogeneity of blood flow has now become a key feature of distributive shock . it has not only been reported within the microcirculation , but also between different organs , within different regions of one organ , in response to therapeutic interventions and in a time - dependent way [ 4 , 9 ] , all challenging the simplicity of systemic hemodynamic monitoring under such conditions . at first evaluation , these observations seem to add more data to the already dazzling complexity of treatment modalities in the critically ill . however , these new insights have established two main findings : ( 1 ) the independent perfusion behavior of the microcirculation in relation to classically measured systemic hemodynamic variables , albeit within certain absolute limits of minimal perfusion pressure , and ( 2 ) persistence of microcirculatory alterations are associated with morbidity and mortality under various conditions , irrespective of correction of systemic hemodynamics [ 10 , 11 ] . the issue to be resolved is whether correction of microcirculatory distributive alterations will improve organ function and morbidity . in order to explore this exiting concept , it is not sufficient to simply find novel therapeutic approaches that specifically aim to reopen the microcirculation directly . we also have to be prepared to ( re)evaluate our current strategies at the bedside in the light of its potential effects from the perspective of the microcirculation and relate it to organ function and outcome . administration of vasoactive compounds and fluid therapy are the cornerstone of hemodynamic management of critically ill patients . in this paper we will review reported effects of vasoactive substances on microcirculatory perfusion and tissue oxygenation in shock . these compounds have been advocated to improve systemic perfusion pressure and oxygen delivery , with subsequent improvement of tissue perfusion and oxygen uptake . but since shock is a syndrome rather than a well - defined pathophysiologic entity , disease itself as well as treatment might contribute to the clinical picture . an appreciation of basic physiology with respect to manipulating vascular tone and its effect on the microcirculation is followed by a systematic review of the literature . we will focus our review on recent clinical research that includes microcirculatory effects of three classes of vasoactive substances : vasopressors , inotropes and vasodilators , and follow the suggested classification of shock etiology . preclinical studies will only be discussed in so far as they pertain to the clinical studies . article titles containing shock or sepsis or septic or organ failure or critically ill in combination with vasopressor or vasoactive or inotrope or inotropic or vasodilator or several specific vasoactive drugs [ e.g. , ( nor)adrenaline/(nor)epinephrine , vasopressin , dopamine , dobutamine , nitroglycerin ] were selected . the search was restricted to clinical studies in the english language , published over the last 15 years , where indicators of microcirculatory or regional perfusion were specifically mentioned , or in case the effect was evaluated with aid of specific microcirculatory or regional techniques [ e.g. , tonometry / capnography , icg , orthogonal polarization spectral ( ops)/side - stream dark field ( sdf ) imaging , spectrophotometry ( table 1)].table 1summary of techniques for the quantification of ( microvascular ) organ perfusion and oxygenationtechniqueprincipledata expressed asarea of interestremarkstonometryballoon content ( saline : tonometry , air : capnography ) equilibrates with mucosal cellular fluid / gas . content is quantified with classical bloodgas technology ( ph , pco2 , hco3)intestinal ph or difference between intestinal and arterial ( pco2 g - a)mucosal capillary blood flowdetects mucosal dysoxia ( imbalance between oxygen demand and supply ) as a result of inadequate microvascular perfusion . hypoxic hypoxia is not detected , serosal perfusion can influence measurements.indocyanine green clearancedye dilution method . the flow is related to the quantity of the injected indicator dye divided by the area under the curve of the downstream dye concentration , according to the stewart - hamilton equationl / minhepatosplanchnic vascular compartmentindocyanine green clearance is dependent on overall hepatosplanchnic blood flow and hepatic cellular clearance function ( altered in liver failure)laser - doppler flowmetryshift in frequency between emitted and received signal related to ( red ) blood cell velocity ( doppler principle ) ; flow = velocity probe catchment aream / s ( velocity ) or l / min ( flow)catchment volume incorporates arteriolar , capillary and venular blood flowspectrophotometrylight with a specific wavelength is emitted by a spectrometer . given a specific distance , the solute concentration or color between the spectrometer and the receiving photometer determines the ( change in ) received light intensity , according to beer s lawoptical density units from which hemoglobin saturation ( % ) is calculatedcatchment area incorporates capillary and venular hemoglobin saturationhemoglobin saturation may be normal or elevated under conditions of microvascular heterogeneity in capillary blood flow due to shuntingorthogonal polarization spectral imagingdirect in vivo video microscopy . absorbance of green light ( 540 nm ) by hemoglobin projects red blood cells as black dots . polarization prevents scattering of lightsemi - quantitative : microvascular blood flow index ( convective transport ) and perfused capillary density ( diffusion distance ) quantative : functional capillary density ( software analysis needed)images less than 1 mm discriminates between capillaries and venulesvisualization of vessels depends on presence of red blood cells . enables to visualize distributive changes in blood flow between individual capillariessidestream dark field imagingdirect in vivo video microscopy . absorbance of green light ( 540 nm ) by hemoglobin projects red blood cells as black dots . ring of stroboscopic light emitting diodes around the camera prevents scattering of lightsemi - quantitative : microvascular blood flow index ( convective transport ) and perfused capillary density ( diffusion distance ) . quantative : functional capillary density ( software analysis needed)images less than 1 mm discriminates between capillaries and venulesvisualization of vessels depends on presence of red blood cells . enables to visualize distributive changes in blood flow between individual capillaries summary of techniques for the quantification of ( microvascular ) organ perfusion and oxygenation microcirculatory perfusion pressure is the net result of precapillary inflow pressure minus venular outflow pressure . most of the pressure drop occurs upstream in small arterioles ( resistance vessels ) as the principal site of active diameter changes to achieve regulation of blood flow . mean capillary pressure is therefore much closer to venous pressure than to arterial pressure , which is relevant for the maintenance of tissue fluid balance . under normal conditions sympathic vasoconstriction this signal is forwarded upstream electrophysiologically via endothelial cells connected by gap junctions proximal to arterioles causing upstream dilatation . it is proposed that the sensor for detecting changes in ambient po2 is located downstream and acts by release of nitric oxide ( no ) in the venules . in this respect additional exogenous precapillary and postcapillary vasoconstriction by means of a vasopressive drug results in a reduced net perfusion pressure over the microcirculation , despite increment of systemic blood pressure ( fig . 1 ) . at the same time shunting may disrupt the normal venular signaling process for vasodilatation to prevent local hypoxia . indeed , in ischemia / reperfusion local hypoxia persists in microcirculatory weak units after restoration of oxygen delivery in a speckled pattern that appears to be determined at the capillary level , but not at the arteriolar level .fig . 1left panel arteriolar vasodilation increases the opening pressure of the microcirculation as result of a decrease in pressure drop prior to the microvascular compartment . right panel combined arteriolar and venular increment of vascular tone reduces the net driving pressure over the microvascular compartment ( from by permission ) left panel arteriolar vasodilation increases the opening pressure of the microcirculation as result of a decrease in pressure drop prior to the microvascular compartment . right panel combined arteriolar and venular increment of vascular tone reduces the net driving pressure over the microvascular compartment ( from by permission ) apart from interference in the complex regulation of tissue perfusion , vasoactive drugs may also influence the homeostasis of tissue oxygenation . tissue oxygenation is not only dependent on convective properties of red blood cells ( flow ) , but is also determined by diffusion . given the gas - specific characteristics , oxygen diffusion is related to the pressure gradient and inversely related to the distance between the capillary and the cell ( fig . 2 ) . closing capillaries in order to maintain perfusion pressure increases diffusion distance and vice versa . under resting conditions capillaries constantly perform changes in caliber in order to serve both purposes .fig . 2convective transport of oxygen through the capillaries depends on red blood cell velocity , capillary hematocrit and oxygen saturation . oxygen transport from the capillary to the cell via diffusion is inversely related to the diffusion distance ( d1 and d2 ) according to fick s law convective transport of oxygen through the capillaries depends on red blood cell velocity , capillary hematocrit and oxygen saturation . oxygen transport from the capillary to the cell via diffusion is inversely related to the diffusion distance ( d1 and d2 ) according to fick s law a third factor that influences microcirculatory oxygen delivery is capillary hematocrit . mechanical interaction between red blood cells and vessel walls induces the formation of a plasma layer adjacent to the wall and increases hematocrit in the center . since blood flow - velocity distribution has a parabolic shape , from zero next to the wall to a maximum at the center , the average red cell velocity is higher than overall blood velocity . as a consequence , red cell transit time this results in dynamic lowering of the capillary hematocrit in comparison to the entering and discharge hematocrit , and is known as the fahraeus effect . additional to this effect , capillary hematocrit is also determined by a phenomenon , originally described by krogh as plasma skimming . at the diverging branches of the capillary network , distribution of red cells hematocrit ranged from 6.8% during vasoconstriction to 38% under vasodilatation , with profound implications on capillary oxygen transport . from the perspective of microcirculation , the dilemma of the use of vasopressors to enhance organ perfusion and oxygenation can not be better expressed than in the original observations by krogh : this plasma skimming is usually very pronounced when adrenaline is applied in small drops to muscle arteries of which all branches , even the smallest , react and show a contraction , which in a short time may become complete . the portion of the muscle supplied by the contracting artery becomes blanched and the capillaries often disappear completely from view , while application of adrenaline to capillaries and venules alone shows that these vessels do not react visibly to the substance .fig . 3under experimental conditions with a systemic hematocrit ( ha ) of 50% , capillary hematocrit ( hcap ) ranges from 6.8% under vasoconstriction to 38% under vasodilation . ( from by permission ) under experimental conditions with a systemic hematocrit ( ha ) of 50% , capillary hematocrit ( hcap ) ranges from 6.8% under vasoconstriction to 38% under vasodilation . ( from by permission ) despite abundant experimental data , little is known about human in vivo alterations of vasomotor tone during shock . direct in vivo observations of the microcirculation in animal endotoxemia demonstrated loss of arterial vasomotion . interestingly , not all vessels were affected at once , but areas with stagnant blood flow were observed next to areas with brisk flow . in humans , this was inhibited by glucocorticoids , but not mitigated by no synthase- or cyclo - oxygenase inhibitors , suggesting other mediators than no or prostanoids contribute to the overall vascular response to endotoxin . systemic lps injection in healthy volunteers blunted the vascular baroreflex response against nitroprusside - induced hypotension and caused complete uncoupling of the cardiac baroreflex from prevailing blood pressure . at present , no direct observations of the microcirculation , other than in tongue or skin , are available from human endotoxemia models . norepinephrine ( and -adrenergic , table 2 ) is the most commonly advocated vasopressive drug in septic shock to maintain mean arterial pressure ( map ) at a minimum level of 65 mmhg . although suggested , improvement of outcome as a result of the use of ne has never been established . recent studies , which included direct in vivo observation of the microcirculation with sidestream dark field ( sdf ) imaging , have established that in human sepsis further increment of map above 65 mmhg by means of ne does not improve sublingual microcirculatory perfusion , intestinal pco2 concentrations or arterial lactate levels [ 25 , 26 ] . this confirmed previous reports in which stepwise increases of map with cumulating ne doses did not change arterial lactate levels , skin capillary blood flow , arterial - to - gastric pco2 gradient ( pco2 g - a ) , systemic oxygen uptake or renal function [ 27 , 28 ] . however , substantial inter - individual differences were observed , related to baseline values of microvascular blood flow . furthermore , these effects may be time and situation dependent , and equal changes in map may have different drug - related effects on organ perfusion . for renal function an optimal map of 75 mmhg in sepsis has been suggested , but direct in vivo observations of the renal microcirculation has not been performed . these studies underline the concept that under conditions of a minimal systemic perfusion pressure , an additional rise in arterial pressure does not automatically improve microcirculatory perfusion in distributive shock , in accordance with physiological theory . clearly , despite important efforts to compare mortality , systemic and regional perfusion and cardiovascular side effects between ( combinations with ) ne and other vasopressors , these studies do not elucidate its individual effects on the microcirculation or establish a critical minimum map with respect to microcirculatory organ perfusion [ 3235 ] . an observed relation between both hypotension and mortality , as well as vasopressor load and mortality , may be related to the event itself , but may also be a marker for severity of illness [ 36 , 37].table 2adrenergic vasopressors ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]vasopressorsettingtechnique(s)effectsremarks[11 , 25]norepinephrineseptic shock , n = 20 , n = 20sdf - imaging , tonometry , laser - dopplerno change in sublingual microvascular blood flow , lactate or pco2 g - astepwise increase map from 65 to 85 mmhg , individual effect baseline - dependentnorepinephrineseptic shock , n = 10laser - doppler , tonometryno difference in skin capillary blood flow , pco2 g - a , lactate or urine outputstepwise increase map from 65 to 85 mmhgnorepinephrineseptic shock , n = 28creatinine clearanceno difference in lactate , urine output or creatinine clearancecomparison between map 65 and 85 mmhgnorepinephrineseptic shock , n = 11doppler ultrasonography , creatinine clearancedecrease in renal resistive index , increase in urine output , no change in creatinine clearanceeffect between map 65 and 75 , no further change at 85 mmhgepinephrineseptic shock , n = 8tonometry , hepatic vein lactate , icg clearancedecrease in mucosal ph and splanchnic blood flow , increase in hepatic vein lactatecross - over , in addition to norepinephrine plus dobutaminephenylephrineseptic shock , n = 32tonometry , icg clearanceno change in splancnic blood flow , pco2 g - a , lactate , urine output or creatinine clearanceincrement map from 65 to 75 mmhg , comparison between norepinephrine and phenylephrinephenylephrineseptic shock , n = 15tonometry , icg clearancedecrease in splanchnic blood flow , pco2 g - a , lactate or creatinine clearanceswitching from norepinephrine to phenylephrine under steady state map at 70 mmhgphenylephrinecardiopulmonary bypass , n = 15sdf - imaging , laser - doppler flowmetry , spectrophotometrydecrease in sublingual capillary blood flow together with an increase in microcirculatory hemoglobin oxygen saturation and overall sublingual blood flow , suggesting shuntincrement map from 47 to 68 mmhg under steady state cardiac outputdopamine ( high dose)septic shock , n = 20tonometrydecrease in gastric mucosal phincrement map from 60 to 75 mmhg , under norepinephrine intestinal ph decreasedsdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , icg indocyanine green adrenergic vasopressors ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , icg indocyanine green in cardiogenic shock , inotropic agents , but not vasopressors , are advocated [ 38 , 39 ] . intra - aortic balloon counter pulsation instantly improved sublingual microcirculatory blood flow in cardiogenic shock , but additional ne dosage was inversely correlated with microcirculatory blood flow . epinephrine ( and -adrenergic , table 2 ) in the treatment of septic shock has been subject to controversy . hyperlactatemia during use of epinephrine in sepsis treatment may be caused by tissue hypoxia , but may also be explained by direct metabolic effects [ 32 , 41 ] . human data about direct effects of epinephrine on microcirculatory perfusion in sepsis are not available , but only in comparison to ne . in a crossover design , in comparison to ne plus dobutamine , epinephrine was associated with lower intestinal ph ( phi ) and higher hepatic venous lactate levels under equal systemic hemodynamic conditions , but again interpretation of these data with respect to splanchnic perfusion is complicated by the intrinsic effect of epinephrine to cause hyperlactatemia and systemic acidosis [ 41 , 43 ] . phenylephrine ( -adrenergic , table 2 ) has been used to increase map in human sepsis from 65 to 75 mmhg over a 12-h period . gastric - to - arterial pco2 difference , indocyanine clearance , arterial lactate levels and urine output / creatinine clearance were found to be unaltered over time and in comparison to ne , indicating that intestinal microcirculatory organ perfusion neither improved nor deteriorated as a result of a phenylephrine - induced rise in map . however , switching from ne to phenylephrine in patients with septic shock while maintaining map at 70 mmhg at steady - state systemic hemodynamic variables revealed a rise in pco2 g - a and a decrease in icg clearance and urine output / creatinine clearance . these indicators of impaired splanchnic and renal perfusion during phenylephrine infusion disappeared after switch - back to ne again . in cardiopulmonary bypass ( cpb)-induced hypotension , phenylephrine was used to increase map from 47 to 68 mmhg . during hypotension , sdf - measured microcirculatory blood flow of sublingual capillaries was unchanged in comparison to pre - cpb hypotension , but after correction with phenylephrine microcirculatory blood flow was significantly reduced . at the same time , global tissue blood flow ( laser doppler ) and spectophotometric microvascular hemoglobin oxygen saturation ( hbio2 ) of the tongue increased , underlining the distributive changes that take place as a result of phenylephrine administration , not sensed in the absence of direct observation of the microcirculation . interestingly , in an animal model of cpb - induced hypotension , administration of phenylephrine also reduced tissue perfusion to all visceral organs despite correction of map from 40 to 65 mmhg . however , correction of hypotension by increasing pump flow improved perfusion of the pancreas , colon and kidneys . vasopressin ( table 3 ) depletion is believed to play a causative role in sepsis - induced vasodilatory shock . in a mixed population with catecholamine - resistant vasodilatory shock , additional low - dose arginine vasopressin ( avp ) was associated with an increment of pco2 g - a over time , but lower than ne alone . direct in vivo observation of the sublingual microcirculation with ops imaging in a patient with non - septic distributive shock revealed marked microcirculatory alterations , which did not change after avp injection . in a randomized controlled open - label trial in patients with septic shock , additional use of avp disclosed no changes in pco2 g - a and a higher creatinine clearance in comparison to ne alone . this was in contrast to other reports of patients with septic shock ; both additional continuous infusion of low dose avp as well as replacement of ne by high dose avp resulted in a significant increase of pco2 g - a [ 51 , 52 ] . equally conflicting data in animal studies are suggested to be related to volume status and cardiac performance . avp administration in sepsis has been associated with ischemic skin and tongue lesions in up to 30% , although in a recent trial the reported incidence was considerably lower and not different from norepinephrine .table 3vasopressin and analogues ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]vasopressorsettingtechnique(s)effectsremarksavpvasodilatory shock , n = 48tonometryincrease in pco2 g - a and bilirubin concentrations over timeadditional to 0.5 mcg / kg / min norepinephrine , map 70 mmhg ; increase in pco2 g - a lower in comparison to norepinephrine aloneavpvasodilatory shock , n = 1ops - imagingno difference in capillary perfusionbaseline capillary perfusion markedly impairedavpvasodilatory shock , n = 23tonometryno change in pco2 g - a over time and in comparison to norepinephrine , no change in lactate , increase in creatinine clearancein comparison to norepinephrine lower sofa score , despite higher bilirubin[51 , 52]avpseptic shock , n = 11 , n = 12tonometryincrease in pco2 g - ain addition to norepinephrine or replacement of norepinephrine respectivelyavpvasodilatory shock , post cardiac surgery , n = 8tonometry , laser - doppler flowmetrydecrease in jejuna mucosal blood flow , increase in pco2 g - ano change in map , decrease in cardiac outputavpvasodilatory shock , post cardiac surgery , n = 8renal vein thermodilution , cr - edtadecrease in renal blood flow , increase in glomerular filtration rate , impairment of renal oxygen supply / demand relationshipno change in mapterlipressinseptic shock , n = 1ops - imagingcomplete shutdown sublingual microcirculatory blood flow , increase in urine outputrise in map from 58 to 105 mmhg[62 , 63]terlipressinseptic shock , n = 17 , n = 15tonometry , laser - doppler flowmetryincrease of urine output and creatinine clearance , rise in bilirubin , no significant change in pco2 g - aavp argenine vasopressin , ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , edta ethylenediaminetetraacetic acid vasopressin and analogues ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) avp argenine vasopressin , ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , edta ethylenediaminetetraacetic acid in post - cpb cardiac surgery patients with high output failure , replacement of ne by avp during steady - state map at 75 mmhg resulted in augmentation of pco2 g - a and diminished laser doppler - measured jejunal mucosal perfusion , but this was in conjunction with a significantly lower cardiac index . in hemodynamically stable post - cpb patients , incremental doses of avp were associated with a decline in renal blood flow and impairment of the renal oxygen demand / supply relationship , in the absence of changes in map . terlipressin ( table 3 ) not only acts as a long - lasting prodrug for avp with a high v1a receptor affinity , but is also a fast - acting vasopressor peptide per se that evokes coronary vasoconstriction with reduction in cardiac output . the dilemma of its use in septic shock is outlined in a case report in which a bolus of terlipressin produced significantly higher map and urine output while tapering ne doses , but was also associated with a complete shutdown of sublingual microcirculatory perfusion and progressive acidosis . more human data of direct effects of terlipressin on microcirculatory perfusion are not available , but only in comparison to other ( combinations of ) vasopressors . in septic shock after volume resuscitation , there was no difference between a bolus terlipressin or ne with respect to lactate levels and creatinine clearance . additional terlipressin to ne in septic shock was accompanied by a rise in bilirubin and aminotransferases , but not in pco2 g - a . as with avp , with respect to splanchnic perfusion in relation to terlipressin , it is of note that it has become an established treatment modality in hepatorenal syndrome and gastrointestinal bleeding in liver cirrhosis . this condition is characterized by a marked vasoconstrictive state in the liver in combination with systemic vasoplegia . as opposed to septic shock , its potent ability to reduce splanchnic blood flow has become beneficial under these conditions , either to increase risk of bleeding or to redirect flow to the kidney . dobutamine ( predominantly 2-adrenergic , table 4 ) has both inotropic and mild vasodilatory effects . in an open - label setting addition of dobutamine in septic patients was associated with improved ops - measured sublingual microcirculatory perfusion over time , irrespective of changes in systemic hemodynamic variables . interestingly , topical application of acetylcholine further improved microcirculatory perfusion , challenging the widespread concept of an irresponsive endothelium in sepsis - induced hypotension . in a crossover setting , dobutamine attenuated intramucosal acidosis during sepsis , whereas dopamine did not change pco2 g - a under equal effects in systemic hemodynamics . addition of dobutamine to ne in septic patients revealed a lower pco2 g - a , but no change in icg plasma clearance [ 68 , 69 ] ; this could either be due to a direct effect on the microcirculation or a result of an increase in cardiac output . whether an increase in general splanchnic perfusion indeed is followed by improved organ function is still a matter of debate .table 4inotropic agents ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]inotropesettingtechnique(s)effectsremarksdobutamineseptic shock , n = 22ops - imagingincrease in sublingual capillary perfusion over timemicrocirculatory effects irrespective of systemic hemodynamics[6769]dobutamineseptic shock , n = 10 , n = 14 , n = 12tonometry , laser - doppler flowmetry , icg clearancedecrease in pco2 g - a , increase in gastric mucosal perfusion , no change in overall hepatosplachnic perfusionsubstantial rise in cardiac output[72 , 73]dopamine ( low dose)septic shock , n = 11 , n = 16tonometry , icg clearanceno change in intestinal ph despite increase in overall splanchnic blood floweffect on splanchnic blood flow baseline - dependentdopexamineseptic shock , n = 15tonometry , spectrophotometryincrease in microvascular hemoglobin saturation , no change in intestinal phthese combined observations suggest distributive failuredopexamineseptic shock , n = 22laser - doppler flowmetryincrease in gastric mucosal blood flowin addition to norepinephrine and in comparison to epinephrine[79 , 80]dopexaminecardiac surgery , n = 19 , n = 14tonometry , icg clearanceincrease in splanchnic blood flow and oxygen consumption , no change in intestinal phsignificant rise in cardiac outputlevosimendanseptic shock , n = 28tonometry , laser - doppler flowmetrydecrease in pco2 g - a and lactate , increase in gastric mucosal perfusion and urine outputin comparison to dobutaminelevosimendanabdominal aneurysm repair , n = 20tonometry , icg clearanceoverall splanchnic blood flow remained unaltered , pco2 g - a decreasedin comparison to placebo during aortic clamping , significantly higher cardiac outputops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green inotropic agents ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green dopamine ( 2-adrenergic and dopaminergic , table 4 ; in high - dose also -adrenergic , table 2 ) was used in sepsis for many years in low concentrations for its potential beneficial effects on renal function as a result of afferent renal vessel dilatation . however , results of multiple studies have made such an effect of clinical relevance very unlikely . low - dose dopamine in addition to ne did not alter phi despite increased overall splanchnic oxygen consumption [ 72 , 73 ] . high - dose dopamine decreased phi despite a rise in cardiac output , whereas ne increased phi at the same map . dopexamine ( predominantly dopaminergic , also 2-adrenergic , table 4 ) initially was introduced as an inotropic agent with specific pro splanchnic perfusion abilities . however , though dopexamine infusion was associated with a partial correction of spectrophotometric gastric hbio2 , pco2g - a remained unaltered . this might be compatible with persistence of microcirculatory weak units in combination with shunting , not sensed by spectrophotometry due to incorporation of arteriolar and venular hemoglobin . dopexamine , in addition to volume loading and dobutamine , increased icg - derived splanchnic blood flow , but with a concomitant decrease in phi . apart from this heterogeneity in blood flow between regional circulation and microcirculation , experimental data also suggested regional heterogeneity in blood flow between the gastric and colon region during the use of dopexamine in sepsis . in postoperative cardiac surgery no difference in pco2 g - a between low - dose dopexamine and placebo could be detected . in another study phi did not rise despite an increment in icg - measured splanchnic blood flow and cardiac output . apart from thermogenetic effects of dopexamine , this might also be explained by a distributive effect . to date , in postoperative non - cardiac surgery , the use of dopexamine remains a matter of debate [ 81 , 82 ] . levosimendan ( calcium sensitizer , table 4 ) improves cardiac contractility and has slight vasodilatory effects . in patients with sepsis - induced myocardial depression levosimendan in addition to ne plus dobutamine was superior to an incremental dose of dobutamine , with respect to pco2g - a , laser doppler - measured gastric mucosal perfusion , arterial lactate levels and creatinine clearance , either as a direct effect or as result of improved cardiac output . after abdominal aortic aneurysm surgery pco2 g - a was lower in the levosimendan group in comparison to placebo , but despite a higher cardiac output this was not a result of better regional splanchnic perfusion . in an experimental setting attenuation of sepsis - induced cellular hypoxia was observed , but simultaneous sdf - imaging failed to detect changes in microvascular blood flow . nitroglycerin ( ntg , table 5 ) as well as other organic nitrates undergo intracellular metabolism in order to produce nitric oxide ( no)-mediated vasodilatation . despite the fact that overwhelming no production is believed to play an important role in sepsis - induced hypotension , it has also been suggested as therapeutic strategy to overcome heterogeneity in microcirculatory blood flow [ 5 , 87 ] . this dilemma is illustrated by the fact that unselective blocking of no - synthase indeed was associated with a substantial increase in blood pressure , but also with a higher mortality [ 88 , 89 ] . the general idea that increasing map results in a higher net microcirculatory perfusion pressure is not in line with physiological theory of the microcirculation as a low - pressure vascular compartment . for example , in the brain of healthy volunteers ( with intact autoregulation ) , ne was unable to increase estimated cerebral perfusion pressure despite a rise in map , whereas glyceryl trinitrate increased estimated cerebral perfusion pressure as a result of a lower zero flow pressure , even at a lower map .table 5vasodilators ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]inotropesettingtechnique(s)effectsremarksnitroglycerinseptic shock , n = 8ops - imaginginstantaneous increase in sublingual microcirculatory blood flow after a 0.5 mg iv bolusopen label , after fulfilment of static pressure resuscitation endpointnitroglycerinseptic shock , n = 70sdf - imagingno difference in sublingual microcirculatory blood flow after 24 hplacebo controlled double - blind , after fulfilment of dynamic resuscitation endpoints.nitroglycerincardiogenic shock , n = 20sdf - imagingincrease in sublingual perfused capillary densityeffect ceased after stop medicationketanserincardiac surgery , n = 6sdf - imagingno change in sublingual perfused capillary density and microvascular blood flowmap dropped from 86 to 68 mmhgprostacyclinseptic shock , n = 16tonometryincrease in gastric mucosal phintravenous prostacyclinprostacyclinseptic shock , n = 16tonometry , icg clearancedecrease in pco2 g - a , no change in overall splanchnic perfusionpatients with septic shock and pulmonary hypertension , aerosolized prostacyclin ; effects in comparison to baseline and inhaled nitric oxydeops orthogonal polarization spectral , sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green , map mean arterial pressure vasodilators ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) ops orthogonal polarization spectral , sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green , map mean arterial pressure in an uncontrolled setting , ntg was administered to septic patients who fulfilled static systemic hemodynamic resuscitation endpoints . despite fulfilment of these endpoints sublingual microcirculatory flow remained severely impaired . after a single bolus of ntg , instant improvement of microcirculatory blood flow was observed , indicating an no - mediated endothelial ability for vasodilatation , which based on the analogy of topical acetylcholine challenged the general idea of endothelial hyporesponsiveness in sepsis - induced hypotension . however , in a double - blind placebo - controlled setting , after fulfillment of dynamic systemic hemodynamic resuscitation endpoints , sublingual microcrocirculatory perfusion improved significantly over time , but no effect of ntg in comparison to placebo could be demonstrated . in the uncontrolled setting , baseline values for microvascular blood flow in large vessels was considerably lower in comparison to the controlled setting , suggesting marked differences in systemic volume status . in cardiogenic shock , impairment of sublingual microcirculation has also been observed and associated with morbidity and mortality . application of low - dose ntg in addition to standard care for cardiogenic shock was associated with a rise in sublingual perfused capillary density . this was not accompanied by a change in cardiac output or map and disappeared after cessation of ntg administration . interestingly , non - pulsatile systemic circulatory flow support by means of a percutaneous left ventricular assist device after acute myocardial infarction was also reflected in a better sublingual microcirculatory flow score . in the specific setting of gastric tube reconstruction , topical application of ntg improved laser doppler blood in the fundus without changes in local hbio2 . however , no effect was observed during intravenous ntg in the same setting , suggesting potential interference with bioactivation . ketanserin ( serotonin 5-ht2 antagonist and weak 1-adrenergic blocker , table 5 ) has been used in the treatment of hypertension with a reported beneficial effect on microhemodynamics and hemorheology due vasodilatation and inhibition of platelet aggregation . administration of ketanserin in hypertensive post - cpb cardiac surgery patients effectively lowered map , while sublingual capillary blood flow was preserved . prostacyclin ( cyclic adenosine monophosphate activator , table 5 ) was initially propagated as a drug for improvement of oxygen extraction deficits , suspected to cause tissue dysoxia . since then it has been studied extensively , especially in experimental settings , for its potential beneficial effect on organ perfusion , as it plays a crucial role in the physiological endothelial vasodilatory response to ischemia / reperfusion . administration of intravenous prostacyclin after conventional resuscitation was associated with higher phi and indicative for outcome . similar effects on phi were reported during aerosolized prostacyclin despite unaltered icg clearance in patients with pulmonary hypertension . during cpb , infusion of prostacyclin blunted jejunal vasomotion , resulting in a reduced ability to maintain laser doppler - measured jejunal perfusion constant under variation of blood pressure ( autoregulation ) . on the other hand , jejunal perfusion increased significantly in parallel to a drop in map , but unfortunately pco2 g - a was not measured to establish the overall effect on jejunal microcirculatory perfusion . microcirculatory perfusion pressure is the net result of precapillary inflow pressure minus venular outflow pressure . most of the pressure drop occurs upstream in small arterioles ( resistance vessels ) as the principal site of active diameter changes to achieve regulation of blood flow . mean capillary pressure is therefore much closer to venous pressure than to arterial pressure , which is relevant for the maintenance of tissue fluid balance . under normal conditions sympathic vasoconstriction this signal is forwarded upstream electrophysiologically via endothelial cells connected by gap junctions proximal to arterioles causing upstream dilatation . it is proposed that the sensor for detecting changes in ambient po2 is located downstream and acts by release of nitric oxide ( no ) in the venules . in this respect additional exogenous precapillary and postcapillary vasoconstriction by means of a vasopressive drug results in a reduced net perfusion pressure over the microcirculation , despite increment of systemic blood pressure ( fig . 1 ) . at the same time shunting may disrupt the normal venular signaling process for vasodilatation to prevent local hypoxia . indeed , in ischemia / reperfusion local hypoxia persists in microcirculatory weak units after restoration of oxygen delivery in a speckled pattern that appears to be determined at the capillary level , but not at the arteriolar level .fig . 1left panel arteriolar vasodilation increases the opening pressure of the microcirculation as result of a decrease in pressure drop prior to the microvascular compartment . right panel combined arteriolar and venular increment of vascular tone reduces the net driving pressure over the microvascular compartment ( from by permission ) left panel arteriolar vasodilation increases the opening pressure of the microcirculation as result of a decrease in pressure drop prior to the microvascular compartment . right panel combined arteriolar and venular increment of vascular tone reduces the net driving pressure over the microvascular compartment ( from by permission ) apart from interference in the complex regulation of tissue perfusion , vasoactive drugs may also influence the homeostasis of tissue oxygenation . tissue oxygenation is not only dependent on convective properties of red blood cells ( flow ) , but is also determined by diffusion . given the gas - specific characteristics , oxygen diffusion is related to the pressure gradient and inversely related to the distance between the capillary and the cell ( fig . 2 ) . closing capillaries in order to maintain perfusion pressure increases diffusion distance and vice versa . under resting conditions capillaries constantly perform changes in caliber in order to serve both purposes .fig . 2convective transport of oxygen through the capillaries depends on red blood cell velocity , capillary hematocrit and oxygen saturation . oxygen transport from the capillary to the cell via diffusion is inversely related to the diffusion distance ( d1 and d2 ) according to fick s law convective transport of oxygen through the capillaries depends on red blood cell velocity , capillary hematocrit and oxygen saturation . oxygen transport from the capillary to the cell via diffusion is inversely related to the diffusion distance ( d1 and d2 ) according to fick s law a third factor that influences microcirculatory oxygen delivery is capillary hematocrit . mechanical interaction between red blood cells and vessel walls induces the formation of a plasma layer adjacent to the wall and increases hematocrit in the center . since blood flow - velocity distribution has a parabolic shape , from zero next to the wall to a maximum at the center , the average red cell velocity is higher than overall blood velocity . as a consequence , red cell transit time this results in dynamic lowering of the capillary hematocrit in comparison to the entering and discharge hematocrit , and is known as the fahraeus effect . additional to this effect , capillary hematocrit is also determined by a phenomenon , originally described by krogh as plasma skimming . at the diverging branches of the capillary network , distribution of red cells hematocrit ranged from 6.8% during vasoconstriction to 38% under vasodilatation , with profound implications on capillary oxygen transport . from the perspective of microcirculation , the dilemma of the use of vasopressors to enhance organ perfusion and oxygenation can not be better expressed than in the original observations by krogh : this plasma skimming is usually very pronounced when adrenaline is applied in small drops to muscle arteries of which all branches , even the smallest , react and show a contraction , which in a short time may become complete . the portion of the muscle supplied by the contracting artery becomes blanched and the capillaries often disappear completely from view , while application of adrenaline to capillaries and venules alone shows that these vessels do not react visibly to the substance .fig . 3under experimental conditions with a systemic hematocrit ( ha ) of 50% , capillary hematocrit ( hcap ) ranges from 6.8% under vasoconstriction to 38% under vasodilation . ( from by permission ) under experimental conditions with a systemic hematocrit ( ha ) of 50% , capillary hematocrit ( hcap ) ranges from 6.8% under vasoconstriction to 38% under vasodilation . ( from by permission ) despite abundant experimental data , little is known about human in vivo alterations of vasomotor tone during shock . direct in vivo observations of the microcirculation in animal endotoxemia demonstrated loss of arterial vasomotion . interestingly , not all vessels were affected at once , but areas with stagnant blood flow were observed next to areas with brisk flow . in humans , this was inhibited by glucocorticoids , but not mitigated by no synthase- or cyclo - oxygenase inhibitors , suggesting other mediators than no or prostanoids contribute to the overall vascular response to endotoxin . systemic lps injection in healthy volunteers blunted the vascular baroreflex response against nitroprusside - induced hypotension and caused complete uncoupling of the cardiac baroreflex from prevailing blood pressure . at present , no direct observations of the microcirculation , other than in tongue or skin , are available from human endotoxemia models . norepinephrine ( and -adrenergic , table 2 ) is the most commonly advocated vasopressive drug in septic shock to maintain mean arterial pressure ( map ) at a minimum level of 65 mmhg . although suggested , improvement of outcome as a result of the use of ne has never been established . recent studies , which included direct in vivo observation of the microcirculation with sidestream dark field ( sdf ) imaging , have established that in human sepsis further increment of map above 65 mmhg by means of ne does not improve sublingual microcirculatory perfusion , intestinal pco2 concentrations or arterial lactate levels [ 25 , 26 ] . this confirmed previous reports in which stepwise increases of map with cumulating ne doses did not change arterial lactate levels , skin capillary blood flow , arterial - to - gastric pco2 gradient ( pco2 g - a ) , systemic oxygen uptake or renal function [ 27 , 28 ] . however , substantial inter - individual differences were observed , related to baseline values of microvascular blood flow . furthermore , these effects may be time and situation dependent , and equal changes in map may have different drug - related effects on organ perfusion . for renal function an optimal map of 75 mmhg in sepsis has been suggested , but direct in vivo observations of the renal microcirculation has not been performed . these studies underline the concept that under conditions of a minimal systemic perfusion pressure , an additional rise in arterial pressure does not automatically improve microcirculatory perfusion in distributive shock , in accordance with physiological theory . clearly , despite important efforts to compare mortality , systemic and regional perfusion and cardiovascular side effects between ( combinations with ) ne and other vasopressors , these studies do not elucidate its individual effects on the microcirculation or establish a critical minimum map with respect to microcirculatory organ perfusion [ 3235 ] . an observed relation between both hypotension and mortality , as well as vasopressor load and mortality , may be related to the event itself , but may also be a marker for severity of illness [ 36 , 37].table 2adrenergic vasopressors ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]vasopressorsettingtechnique(s)effectsremarks[11 , 25]norepinephrineseptic shock , n = 20 , n = 20sdf - imaging , tonometry , laser - dopplerno change in sublingual microvascular blood flow , lactate or pco2 g - astepwise increase map from 65 to 85 mmhg , individual effect baseline - dependentnorepinephrineseptic shock , n = 10laser - doppler , tonometryno difference in skin capillary blood flow , pco2 g - a , lactate or urine outputstepwise increase map from 65 to 85 mmhgnorepinephrineseptic shock , n = 28creatinine clearanceno difference in lactate , urine output or creatinine clearancecomparison between map 65 and 85 mmhgnorepinephrineseptic shock , n = 11doppler ultrasonography , creatinine clearancedecrease in renal resistive index , increase in urine output , no change in creatinine clearanceeffect between map 65 and 75 , no further change at 85 mmhgepinephrineseptic shock , n = 8tonometry , hepatic vein lactate , icg clearancedecrease in mucosal ph and splanchnic blood flow , increase in hepatic vein lactatecross - over , in addition to norepinephrine plus dobutaminephenylephrineseptic shock , n = 32tonometry , icg clearanceno change in splancnic blood flow , pco2 g - a , lactate , urine output or creatinine clearanceincrement map from 65 to 75 mmhg , comparison between norepinephrine and phenylephrinephenylephrineseptic shock , n = 15tonometry , icg clearancedecrease in splanchnic blood flow , pco2 g - a , lactate or creatinine clearanceswitching from norepinephrine to phenylephrine under steady state map at 70 mmhgphenylephrinecardiopulmonary bypass , n = 15sdf - imaging , laser - doppler flowmetry , spectrophotometrydecrease in sublingual capillary blood flow together with an increase in microcirculatory hemoglobin oxygen saturation and overall sublingual blood flow , suggesting shuntincrement map from 47 to 68 mmhg under steady state cardiac outputdopamine ( high dose)septic shock , n = 20tonometrydecrease in gastric mucosal phincrement map from 60 to 75 mmhg , under norepinephrine intestinal ph decreasedsdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , icg indocyanine green adrenergic vasopressors ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , icg indocyanine green in cardiogenic shock , inotropic agents , but not vasopressors , are advocated [ 38 , 39 ] . intra - aortic balloon counter pulsation instantly improved sublingual microcirculatory blood flow in cardiogenic shock , but additional ne dosage was inversely correlated with microcirculatory blood flow . epinephrine ( and -adrenergic , table 2 ) in the treatment of septic shock has been subject to controversy . hyperlactatemia during use of epinephrine in sepsis treatment may be caused by tissue hypoxia , but may also be explained by direct metabolic effects [ 32 , 41 ] . human data about direct effects of epinephrine on microcirculatory perfusion in sepsis are not available , but only in comparison to ne . in a crossover design , in comparison to ne plus dobutamine , epinephrine was associated with lower intestinal ph ( phi ) and higher hepatic venous lactate levels under equal systemic hemodynamic conditions , but again interpretation of these data with respect to splanchnic perfusion is complicated by the intrinsic effect of epinephrine to cause hyperlactatemia and systemic acidosis [ 41 , 43 ] . phenylephrine ( -adrenergic , table 2 ) has been used to increase map in human sepsis from 65 to 75 mmhg over a 12-h period . gastric - to - arterial pco2 difference , indocyanine clearance , arterial lactate levels and urine output / creatinine clearance were found to be unaltered over time and in comparison to ne , indicating that intestinal microcirculatory organ perfusion neither improved nor deteriorated as a result of a phenylephrine - induced rise in map . however , switching from ne to phenylephrine in patients with septic shock while maintaining map at 70 mmhg at steady - state systemic hemodynamic variables revealed a rise in pco2 g - a and a decrease in icg clearance and urine output / creatinine clearance . these indicators of impaired splanchnic and renal perfusion during phenylephrine infusion disappeared after switch - back to ne again . in cardiopulmonary bypass ( cpb)-induced hypotension , phenylephrine was used to increase map from 47 to 68 mmhg . during hypotension , sdf - measured microcirculatory blood flow of sublingual capillaries was unchanged in comparison to pre - cpb hypotension , but after correction with phenylephrine microcirculatory blood flow was significantly reduced . at the same time , global tissue blood flow ( laser doppler ) and spectophotometric microvascular hemoglobin oxygen saturation ( hbio2 ) of the tongue increased , underlining the distributive changes that take place as a result of phenylephrine administration , not sensed in the absence of direct observation of the microcirculation . interestingly , in an animal model of cpb - induced hypotension , administration of phenylephrine also reduced tissue perfusion to all visceral organs despite correction of map from 40 to 65 mmhg . however , correction of hypotension by increasing pump flow improved perfusion of the pancreas , colon and kidneys . vasopressin ( table 3 ) depletion is believed to play a causative role in sepsis - induced vasodilatory shock . in a mixed population with catecholamine - resistant vasodilatory shock , additional low - dose arginine vasopressin ( avp ) was associated with an increment of pco2 g - a over time , but lower than ne alone . direct in vivo observation of the sublingual microcirculation with ops imaging in a patient with non - septic distributive shock revealed marked microcirculatory alterations , which did not change after avp injection . in a randomized controlled open - label trial in patients with septic shock , additional use of avp disclosed no changes in pco2 g - a and a higher creatinine clearance in comparison to ne alone . this was in contrast to other reports of patients with septic shock ; both additional continuous infusion of low dose avp as well as replacement of ne by high dose avp resulted in a significant increase of pco2 g - a [ 51 , 52 ] . equally conflicting data in animal studies are suggested to be related to volume status and cardiac performance . avp administration in sepsis has been associated with ischemic skin and tongue lesions in up to 30% , although in a recent trial the reported incidence was considerably lower and not different from norepinephrine .table 3vasopressin and analogues ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]vasopressorsettingtechnique(s)effectsremarksavpvasodilatory shock , n = 48tonometryincrease in pco2 g - a and bilirubin concentrations over timeadditional to 0.5 mcg / kg / min norepinephrine , map 70 mmhg ; increase in pco2 g - a lower in comparison to norepinephrine aloneavpvasodilatory shock , n = 1ops - imagingno difference in capillary perfusionbaseline capillary perfusion markedly impairedavpvasodilatory shock , n = 23tonometryno change in pco2 g - a over time and in comparison to norepinephrine , no change in lactate , increase in creatinine clearancein comparison to norepinephrine lower sofa score , despite higher bilirubin[51 , 52]avpseptic shock , n = 11 , n = 12tonometryincrease in pco2 g - ain addition to norepinephrine or replacement of norepinephrine respectivelyavpvasodilatory shock , post cardiac surgery , n = 8tonometry , laser - doppler flowmetrydecrease in jejuna mucosal blood flow , increase in pco2 g - ano change in map , decrease in cardiac outputavpvasodilatory shock , post cardiac surgery , n = 8renal vein thermodilution , cr - edtadecrease in renal blood flow , increase in glomerular filtration rate , impairment of renal oxygen supply / demand relationshipno change in mapterlipressinseptic shock , n = 1ops - imagingcomplete shutdown sublingual microcirculatory blood flow , increase in urine outputrise in map from 58 to 105 mmhg[62 , 63]terlipressinseptic shock , n = 17 , n = 15tonometry , laser - doppler flowmetryincrease of urine output and creatinine clearance , rise in bilirubin , no significant change in pco2 g - aavp argenine vasopressin , ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , edta ethylenediaminetetraacetic acid vasopressin and analogues ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) avp argenine vasopressin , ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , edta ethylenediaminetetraacetic acid in post - cpb cardiac surgery patients with high output failure , replacement of ne by avp during steady - state map at 75 mmhg resulted in augmentation of pco2 g - a and diminished laser doppler - measured jejunal mucosal perfusion , but this was in conjunction with a significantly lower cardiac index . in hemodynamically stable post - cpb patients , incremental doses of avp were associated with a decline in renal blood flow and impairment of the renal oxygen demand / supply relationship , in the absence of changes in map . terlipressin ( table 3 ) not only acts as a long - lasting prodrug for avp with a high v1a receptor affinity , but is also a fast - acting vasopressor peptide per se that evokes coronary vasoconstriction with reduction in cardiac output . the dilemma of its use in septic shock is outlined in a case report in which a bolus of terlipressin produced significantly higher map and urine output while tapering ne doses , but was also associated with a complete shutdown of sublingual microcirculatory perfusion and progressive acidosis . more human data of direct effects of terlipressin on microcirculatory perfusion are not available , but only in comparison to other ( combinations of ) vasopressors . in septic shock after volume resuscitation , there was no difference between a bolus terlipressin or ne with respect to lactate levels and creatinine clearance . additional terlipressin to ne in septic shock was accompanied by a rise in bilirubin and aminotransferases , but not in pco2 g - a . with respect to splanchnic perfusion in relation to terlipressin , it is of note that it has become an established treatment modality in hepatorenal syndrome and gastrointestinal bleeding in liver cirrhosis . this condition is characterized by a marked vasoconstrictive state in the liver in combination with systemic vasoplegia . as opposed to septic shock , its potent ability to reduce splanchnic blood flow has become beneficial under these conditions , either to increase risk of bleeding or to redirect flow to the kidney . dobutamine ( predominantly 2-adrenergic , table 4 ) has both inotropic and mild vasodilatory effects . in an open - label setting addition of dobutamine in septic patients was associated with improved ops - measured sublingual microcirculatory perfusion over time , irrespective of changes in systemic hemodynamic variables . interestingly , topical application of acetylcholine further improved microcirculatory perfusion , challenging the widespread concept of an irresponsive endothelium in sepsis - induced hypotension . in a crossover setting , dobutamine attenuated intramucosal acidosis during sepsis , whereas dopamine did not change pco2 g - a under equal effects in systemic hemodynamics . addition of dobutamine to ne in septic patients revealed a lower pco2 g - a , but no change in icg plasma clearance [ 68 , 69 ] ; this could either be due to a direct effect on the microcirculation or a result of an increase in cardiac output . whether an increase in general splanchnic perfusion indeed is followed by improved organ function is still a matter of debate .table 4inotropic agents ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]inotropesettingtechnique(s)effectsremarksdobutamineseptic shock , n = 22ops - imagingincrease in sublingual capillary perfusion over timemicrocirculatory effects irrespective of systemic hemodynamics[6769]dobutamineseptic shock , n = 10 , n = 14 , n = 12tonometry , laser - doppler flowmetry , icg clearancedecrease in pco2 g - a , increase in gastric mucosal perfusion , no change in overall hepatosplachnic perfusionsubstantial rise in cardiac output[72 , 73]dopamine ( low dose)septic shock , n = 11 , n = 16tonometry , icg clearanceno change in intestinal ph despite increase in overall splanchnic blood floweffect on splanchnic blood flow baseline - dependentdopexamineseptic shock , n = 15tonometry , spectrophotometryincrease in microvascular hemoglobin saturation , no change in intestinal phthese combined observations suggest distributive failuredopexamineseptic shock , n = 22laser - doppler flowmetryincrease in gastric mucosal blood flowin addition to norepinephrine and in comparison to epinephrine[79 , 80]dopexaminecardiac surgery , n = 19 , n = 14tonometry , icg clearanceincrease in splanchnic blood flow and oxygen consumption , no change in intestinal phsignificant rise in cardiac outputlevosimendanseptic shock , n = 28tonometry , laser - doppler flowmetrydecrease in pco2 g - a and lactate , increase in gastric mucosal perfusion and urine outputin comparison to dobutaminelevosimendanabdominal aneurysm repair , n = 20tonometry , icg clearanceoverall splanchnic blood flow remained unaltered , pco2 g - a decreasedin comparison to placebo during aortic clamping , significantly higher cardiac outputops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green inotropic agents ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green dopamine ( 2-adrenergic and dopaminergic , table 4 ; in high - dose also -adrenergic , table 2 ) was used in sepsis for many years in low concentrations for its potential beneficial effects on renal function as a result of afferent renal vessel dilatation . however , results of multiple studies have made such an effect of clinical relevance very unlikely . low - dose dopamine in addition to ne did not alter phi despite increased overall splanchnic oxygen consumption [ 72 , 73 ] . high - dose dopamine decreased phi despite a rise in cardiac output , whereas ne increased phi at the same map . dopexamine ( predominantly dopaminergic , also 2-adrenergic , table 4 ) initially was introduced as an inotropic agent with specific pro splanchnic perfusion abilities . however , though dopexamine infusion was associated with a partial correction of spectrophotometric gastric hbio2 , pco2g - a remained unaltered . this might be compatible with persistence of microcirculatory weak units in combination with shunting , not sensed by spectrophotometry due to incorporation of arteriolar and venular hemoglobin . dopexamine , in addition to volume loading and dobutamine , increased icg - derived splanchnic blood flow , but with a concomitant decrease in phi . apart from this heterogeneity in blood flow between regional circulation and microcirculation , experimental data also suggested regional heterogeneity in blood flow between the gastric and colon region during the use of dopexamine in sepsis . in postoperative cardiac surgery no difference in pco2 g - a between low - dose dopexamine and placebo could be detected . in another study phi did not rise despite an increment in icg - measured splanchnic blood flow and cardiac output . apart from thermogenetic effects of dopexamine , this might also be explained by a distributive effect . to date , in postoperative non - cardiac surgery , the use of dopexamine remains a matter of debate [ 81 , 82 ] . levosimendan ( calcium sensitizer , table 4 ) improves cardiac contractility and has slight vasodilatory effects . in patients with sepsis - induced myocardial depression levosimendan in addition to ne plus dobutamine was superior to an incremental dose of dobutamine , with respect to pco2g - a , laser doppler - measured gastric mucosal perfusion , arterial lactate levels and creatinine clearance , either as a direct effect or as result of improved cardiac output . after abdominal aortic aneurysm surgery pco2 g - a was lower in the levosimendan group in comparison to placebo , but despite a higher cardiac output this was not a result of better regional splanchnic perfusion . in an experimental setting attenuation of sepsis - induced cellular hypoxia was observed , but simultaneous sdf - imaging failed to detect changes in microvascular blood flow . nitroglycerin ( ntg , table 5 ) as well as other organic nitrates undergo intracellular metabolism in order to produce nitric oxide ( no)-mediated vasodilatation . despite the fact that overwhelming no production is believed to play an important role in sepsis - induced hypotension , it has also been suggested as therapeutic strategy to overcome heterogeneity in microcirculatory blood flow [ 5 , 87 ] . this dilemma is illustrated by the fact that unselective blocking of no - synthase indeed was associated with a substantial increase in blood pressure , but also with a higher mortality [ 88 , 89 ] . the general idea that increasing map results in a higher net microcirculatory perfusion pressure is not in line with physiological theory of the microcirculation as a low - pressure vascular compartment . for example , in the brain of healthy volunteers ( with intact autoregulation ) , ne was unable to increase estimated cerebral perfusion pressure despite a rise in map , whereas glyceryl trinitrate increased estimated cerebral perfusion pressure as a result of a lower zero flow pressure , even at a lower map .table 5vasodilators ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]inotropesettingtechnique(s)effectsremarksnitroglycerinseptic shock , n = 8ops - imaginginstantaneous increase in sublingual microcirculatory blood flow after a 0.5 mg iv bolusopen label , after fulfilment of static pressure resuscitation endpointnitroglycerinseptic shock , n = 70sdf - imagingno difference in sublingual microcirculatory blood flow after 24 hplacebo controlled double - blind , after fulfilment of dynamic resuscitation endpoints.nitroglycerincardiogenic shock , n = 20sdf - imagingincrease in sublingual perfused capillary densityeffect ceased after stop medicationketanserincardiac surgery , n = 6sdf - imagingno change in sublingual perfused capillary density and microvascular blood flowmap dropped from 86 to 68 mmhgprostacyclinseptic shock , n = 16tonometryincrease in gastric mucosal phintravenous prostacyclinprostacyclinseptic shock , n = 16tonometry , icg clearancedecrease in pco2 g - a , no change in overall splanchnic perfusionpatients with septic shock and pulmonary hypertension , aerosolized prostacyclin ; effects in comparison to baseline and inhaled nitric oxydeops orthogonal polarization spectral , sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green , map mean arterial pressure vasodilators ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) ops orthogonal polarization spectral , sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green , map mean arterial pressure in an uncontrolled setting , ntg was administered to septic patients who fulfilled static systemic hemodynamic resuscitation endpoints . despite fulfilment of these endpoints sublingual microcirculatory flow remained severely impaired . after a single bolus of ntg , instant improvement of microcirculatory blood flow was observed , indicating an no - mediated endothelial ability for vasodilatation , which based on the analogy of topical acetylcholine challenged the general idea of endothelial hyporesponsiveness in sepsis - induced hypotension . however , in a double - blind placebo - controlled setting , after fulfillment of dynamic systemic hemodynamic resuscitation endpoints , sublingual microcrocirculatory perfusion improved significantly over time , but no effect of ntg in comparison to placebo could be demonstrated . in the uncontrolled setting , baseline values for microvascular blood flow in large vessels was considerably lower in comparison to the controlled setting , suggesting marked differences in systemic volume status . in cardiogenic shock , impairment of sublingual microcirculation has also been observed and associated with morbidity and mortality . application of low - dose ntg in addition to standard care for cardiogenic shock was associated with a rise in sublingual perfused capillary density . this was not accompanied by a change in cardiac output or map and disappeared after cessation of ntg administration . interestingly , non - pulsatile systemic circulatory flow support by means of a percutaneous left ventricular assist device after acute myocardial infarction was also reflected in a better sublingual microcirculatory flow score . in the specific setting of gastric tube reconstruction , topical application of ntg improved laser doppler blood in the fundus without changes in local hbio2 . however , no effect was observed during intravenous ntg in the same setting , suggesting potential interference with bioactivation . ketanserin ( serotonin 5-ht2 antagonist and weak 1-adrenergic blocker , table 5 ) has been used in the treatment of hypertension with a reported beneficial effect on microhemodynamics and hemorheology due vasodilatation and inhibition of platelet aggregation . administration of ketanserin in hypertensive post - cpb cardiac surgery patients effectively lowered map , while sublingual capillary blood flow was preserved . prostacyclin ( cyclic adenosine monophosphate activator , table 5 ) was initially propagated as a drug for improvement of oxygen extraction deficits , suspected to cause tissue dysoxia . since then it has been studied extensively , especially in experimental settings , for its potential beneficial effect on organ perfusion , as it plays a crucial role in the physiological endothelial vasodilatory response to ischemia / reperfusion . administration of intravenous prostacyclin after conventional resuscitation was associated with higher phi and indicative for outcome . similar effects on phi were reported during aerosolized prostacyclin despite unaltered icg clearance in patients with pulmonary hypertension . during cpb , infusion of prostacyclin blunted jejunal vasomotion , resulting in a reduced ability to maintain laser doppler - measured jejunal perfusion constant under variation of blood pressure ( autoregulation ) . on the other hand , jejunal perfusion increased significantly in parallel to a drop in map , but unfortunately pco2 g - a was not measured to establish the overall effect on jejunal microcirculatory perfusion . norepinephrine ( and -adrenergic , table 2 ) is the most commonly advocated vasopressive drug in septic shock to maintain mean arterial pressure ( map ) at a minimum level of 65 mmhg . although suggested , improvement of outcome as a result of the use of ne has never been established . recent studies , which included direct in vivo observation of the microcirculation with sidestream dark field ( sdf ) imaging , have established that in human sepsis further increment of map above 65 mmhg by means of ne does not improve sublingual microcirculatory perfusion , intestinal pco2 concentrations or arterial lactate levels [ 25 , 26 ] . this confirmed previous reports in which stepwise increases of map with cumulating ne doses did not change arterial lactate levels , skin capillary blood flow , arterial - to - gastric pco2 gradient ( pco2 g - a ) , systemic oxygen uptake or renal function [ 27 , 28 ] . however , substantial inter - individual differences were observed , related to baseline values of microvascular blood flow . furthermore , these effects may be time and situation dependent , and equal changes in map may have different drug - related effects on organ perfusion . for renal function an optimal map of 75 mmhg in sepsis has been suggested , but direct in vivo observations of the renal microcirculation has not been performed . these studies underline the concept that under conditions of a minimal systemic perfusion pressure , an additional rise in arterial pressure does not automatically improve microcirculatory perfusion in distributive shock , in accordance with physiological theory . clearly , despite important efforts to compare mortality , systemic and regional perfusion and cardiovascular side effects between ( combinations with ) ne and other vasopressors , these studies do not elucidate its individual effects on the microcirculation or establish a critical minimum map with respect to microcirculatory organ perfusion [ 3235 ] . an observed relation between both hypotension and mortality , as well as vasopressor load and mortality , may be related to the event itself , but may also be a marker for severity of illness [ 36 , 37].table 2adrenergic vasopressors ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]vasopressorsettingtechnique(s)effectsremarks[11 , 25]norepinephrineseptic shock , n = 20 , n = 20sdf - imaging , tonometry , laser - dopplerno change in sublingual microvascular blood flow , lactate or pco2 g - astepwise increase map from 65 to 85 mmhg , individual effect baseline - dependentnorepinephrineseptic shock , n = 10laser - doppler , tonometryno difference in skin capillary blood flow , pco2 g - a , lactate or urine outputstepwise increase map from 65 to 85 mmhgnorepinephrineseptic shock , n = 28creatinine clearanceno difference in lactate , urine output or creatinine clearancecomparison between map 65 and 85 mmhgnorepinephrineseptic shock , n = 11doppler ultrasonography , creatinine clearancedecrease in renal resistive index , increase in urine output , no change in creatinine clearanceeffect between map 65 and 75 , no further change at 85 mmhgepinephrineseptic shock , n = 8tonometry , hepatic vein lactate , icg clearancedecrease in mucosal ph and splanchnic blood flow , increase in hepatic vein lactatecross - over , in addition to norepinephrine plus dobutaminephenylephrineseptic shock , n = 32tonometry , icg clearanceno change in splancnic blood flow , pco2 g - a , lactate , urine output or creatinine clearanceincrement map from 65 to 75 mmhg , comparison between norepinephrine and phenylephrinephenylephrineseptic shock , n = 15tonometry , icg clearancedecrease in splanchnic blood flow , pco2 g - a , lactate or creatinine clearanceswitching from norepinephrine to phenylephrine under steady state map at 70 mmhgphenylephrinecardiopulmonary bypass , n = 15sdf - imaging , laser - doppler flowmetry , spectrophotometrydecrease in sublingual capillary blood flow together with an increase in microcirculatory hemoglobin oxygen saturation and overall sublingual blood flow , suggesting shuntincrement map from 47 to 68 mmhg under steady state cardiac outputdopamine ( high dose)septic shock , n = 20tonometrydecrease in gastric mucosal phincrement map from 60 to 75 mmhg , under norepinephrine intestinal ph decreasedsdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , icg indocyanine green adrenergic vasopressors ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , icg indocyanine green in cardiogenic shock , inotropic agents , but not vasopressors , are advocated [ 38 , 39 ] . intra - aortic balloon counter pulsation instantly improved sublingual microcirculatory blood flow in cardiogenic shock , but additional ne dosage was inversely correlated with microcirculatory blood flow . epinephrine ( and -adrenergic , table 2 ) in the treatment of septic shock has been subject to controversy . hyperlactatemia during use of epinephrine in sepsis treatment may be caused by tissue hypoxia , but may also be explained by direct metabolic effects [ 32 , 41 ] . human data about direct effects of epinephrine on microcirculatory perfusion in sepsis are not available , but only in comparison to ne . in a crossover design , in comparison to ne plus dobutamine , epinephrine was associated with lower intestinal ph ( phi ) and higher hepatic venous lactate levels under equal systemic hemodynamic conditions , but again interpretation of these data with respect to splanchnic perfusion is complicated by the intrinsic effect of epinephrine to cause hyperlactatemia and systemic acidosis [ 41 , 43 ] . phenylephrine ( -adrenergic , table 2 ) has been used to increase map in human sepsis from 65 to 75 mmhg over a 12-h period . gastric - to - arterial pco2 difference , indocyanine clearance , arterial lactate levels and urine output / creatinine clearance were found to be unaltered over time and in comparison to ne , indicating that intestinal microcirculatory organ perfusion neither improved nor deteriorated as a result of a phenylephrine - induced rise in map . however , switching from ne to phenylephrine in patients with septic shock while maintaining map at 70 mmhg at steady - state systemic hemodynamic variables revealed a rise in pco2 g - a and a decrease in icg clearance and urine output / creatinine clearance . these indicators of impaired splanchnic and renal perfusion during phenylephrine infusion disappeared after switch - back to ne again . in cardiopulmonary bypass ( cpb)-induced hypotension , phenylephrine was used to increase map from 47 to 68 mmhg . during hypotension , sdf - measured microcirculatory blood flow of sublingual capillaries was unchanged in comparison to pre - cpb hypotension , but after correction with phenylephrine microcirculatory blood flow was significantly reduced . at the same time , global tissue blood flow ( laser doppler ) and spectophotometric microvascular hemoglobin oxygen saturation ( hbio2 ) of the tongue increased , underlining the distributive changes that take place as a result of phenylephrine administration , not sensed in the absence of direct observation of the microcirculation . interestingly , in an animal model of cpb - induced hypotension , administration of phenylephrine also reduced tissue perfusion to all visceral organs despite correction of map from 40 to 65 mmhg . however , correction of hypotension by increasing pump flow improved perfusion of the pancreas , colon and kidneys . vasopressin ( table 3 ) depletion is believed to play a causative role in sepsis - induced vasodilatory shock . in a mixed population with catecholamine - resistant vasodilatory shock , additional low - dose arginine vasopressin ( avp ) was associated with an increment of pco2 g - a over time , but lower than ne alone . direct in vivo observation of the sublingual microcirculation with ops imaging in a patient with non - septic distributive shock revealed marked microcirculatory alterations , which did not change after avp injection . in a randomized controlled open - label trial in patients with septic shock , additional use of avp disclosed no changes in pco2 g - a and a higher creatinine clearance in comparison to ne alone . this was in contrast to other reports of patients with septic shock ; both additional continuous infusion of low dose avp as well as replacement of ne by high dose avp resulted in a significant increase of pco2 g - a [ 51 , 52 ] . equally conflicting data in animal studies are suggested to be related to volume status and cardiac performance . avp administration in sepsis has been associated with ischemic skin and tongue lesions in up to 30% , although in a recent trial the reported incidence was considerably lower and not different from norepinephrine .table 3vasopressin and analogues ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]vasopressorsettingtechnique(s)effectsremarksavpvasodilatory shock , n = 48tonometryincrease in pco2 g - a and bilirubin concentrations over timeadditional to 0.5 mcg / kg / min norepinephrine , map 70 mmhg ; increase in pco2 g - a lower in comparison to norepinephrine aloneavpvasodilatory shock , n = 1ops - imagingno difference in capillary perfusionbaseline capillary perfusion markedly impairedavpvasodilatory shock , n = 23tonometryno change in pco2 g - a over time and in comparison to norepinephrine , no change in lactate , increase in creatinine clearancein comparison to norepinephrine lower sofa score , despite higher bilirubin[51 , 52]avpseptic shock , n = 11 , n = 12tonometryincrease in pco2 g - ain addition to norepinephrine or replacement of norepinephrine respectivelyavpvasodilatory shock , post cardiac surgery , n = 8tonometry , laser - doppler flowmetrydecrease in jejuna mucosal blood flow , increase in pco2 g - ano change in map , decrease in cardiac outputavpvasodilatory shock , post cardiac surgery , n = 8renal vein thermodilution , cr - edtadecrease in renal blood flow , increase in glomerular filtration rate , impairment of renal oxygen supply / demand relationshipno change in mapterlipressinseptic shock , n = 1ops - imagingcomplete shutdown sublingual microcirculatory blood flow , increase in urine outputrise in map from 58 to 105 mmhg[62 , 63]terlipressinseptic shock , n = 17 , n = 15tonometry , laser - doppler flowmetryincrease of urine output and creatinine clearance , rise in bilirubin , no significant change in pco2 g - aavp argenine vasopressin , ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , edta ethylenediaminetetraacetic acid vasopressin and analogues ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) avp argenine vasopressin , ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , map mean arterial pressure , edta ethylenediaminetetraacetic acid in post - cpb cardiac surgery patients with high output failure , replacement of ne by avp during steady - state map at 75 mmhg resulted in augmentation of pco2 g - a and diminished laser doppler - measured jejunal mucosal perfusion , but this was in conjunction with a significantly lower cardiac index . in hemodynamically stable post - cpb patients , incremental doses of avp were associated with a decline in renal blood flow and impairment of the renal oxygen demand / supply relationship , in the absence of changes in map . terlipressin ( table 3 ) not only acts as a long - lasting prodrug for avp with a high v1a receptor affinity , but is also a fast - acting vasopressor peptide per se that evokes coronary vasoconstriction with reduction in cardiac output . the dilemma of its use in septic shock is outlined in a case report in which a bolus of terlipressin produced significantly higher map and urine output while tapering ne doses , but was also associated with a complete shutdown of sublingual microcirculatory perfusion and progressive acidosis . more human data of direct effects of terlipressin on microcirculatory perfusion are not available , but only in comparison to other ( combinations of ) vasopressors . in septic shock after volume resuscitation , there was no difference between a bolus terlipressin or ne with respect to lactate levels and creatinine clearance . additional terlipressin to ne in septic shock was accompanied by a rise in bilirubin and aminotransferases , but not in pco2 g - a . with respect to splanchnic perfusion in relation to terlipressin , it is of note that it has become an established treatment modality in hepatorenal syndrome and gastrointestinal bleeding in liver cirrhosis . this condition is characterized by a marked vasoconstrictive state in the liver in combination with systemic vasoplegia . as opposed to septic shock , its potent ability to reduce splanchnic blood flow has become beneficial under these conditions , either to increase risk of bleeding or to redirect flow to the kidney . dobutamine ( predominantly 2-adrenergic , table 4 ) has both inotropic and mild vasodilatory effects . in an open - label setting addition of dobutamine in septic patients was associated with improved ops - measured sublingual microcirculatory perfusion over time , irrespective of changes in systemic hemodynamic variables . interestingly , topical application of acetylcholine further improved microcirculatory perfusion , challenging the widespread concept of an irresponsive endothelium in sepsis - induced hypotension . in a crossover setting , dobutamine attenuated intramucosal acidosis during sepsis , whereas dopamine did not change pco2 g - a under equal effects in systemic hemodynamics . addition of dobutamine to ne in septic patients revealed a lower pco2 g - a , but no change in icg plasma clearance [ 68 , 69 ] ; this could either be due to a direct effect on the microcirculation or a result of an increase in cardiac output . whether an increase in general splanchnic perfusion indeed is followed by improved organ function is still a matter of debate .table 4inotropic agents ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]inotropesettingtechnique(s)effectsremarksdobutamineseptic shock , n = 22ops - imagingincrease in sublingual capillary perfusion over timemicrocirculatory effects irrespective of systemic hemodynamics[6769]dobutamineseptic shock , n = 10 , n = 14 , n = 12tonometry , laser - doppler flowmetry , icg clearancedecrease in pco2 g - a , increase in gastric mucosal perfusion , no change in overall hepatosplachnic perfusionsubstantial rise in cardiac output[72 , 73]dopamine ( low dose)septic shock , n = 11 , n = 16tonometry , icg clearanceno change in intestinal ph despite increase in overall splanchnic blood floweffect on splanchnic blood flow baseline - dependentdopexamineseptic shock , n = 15tonometry , spectrophotometryincrease in microvascular hemoglobin saturation , no change in intestinal phthese combined observations suggest distributive failuredopexamineseptic shock , n = 22laser - doppler flowmetryincrease in gastric mucosal blood flowin addition to norepinephrine and in comparison to epinephrine[79 , 80]dopexaminecardiac surgery , n = 19 , n = 14tonometry , icg clearanceincrease in splanchnic blood flow and oxygen consumption , no change in intestinal phsignificant rise in cardiac outputlevosimendanseptic shock , n = 28tonometry , laser - doppler flowmetrydecrease in pco2 g - a and lactate , increase in gastric mucosal perfusion and urine outputin comparison to dobutaminelevosimendanabdominal aneurysm repair , n = 20tonometry , icg clearanceoverall splanchnic blood flow remained unaltered , pco2 g - a decreasedin comparison to placebo during aortic clamping , significantly higher cardiac outputops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green inotropic agents ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) ops orthogonal polarization spectral , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green dopamine ( 2-adrenergic and dopaminergic , table 4 ; in high - dose also -adrenergic , table 2 ) was used in sepsis for many years in low concentrations for its potential beneficial effects on renal function as a result of afferent renal vessel dilatation . however , results of multiple studies have made such an effect of clinical relevance very unlikely . low - dose dopamine in addition to ne did not alter phi despite increased overall splanchnic oxygen consumption [ 72 , 73 ] . high - dose dopamine decreased phi despite a rise in cardiac output , whereas ne increased phi at the same map . dopexamine ( predominantly dopaminergic , also 2-adrenergic , table 4 ) initially was introduced as an inotropic agent with specific pro splanchnic perfusion abilities . however , though dopexamine infusion was associated with a partial correction of spectrophotometric gastric hbio2 , pco2g - a remained unaltered . this might be compatible with persistence of microcirculatory weak units in combination with shunting , not sensed by spectrophotometry due to incorporation of arteriolar and venular hemoglobin . dopexamine , in addition to volume loading and dobutamine , increased icg - derived splanchnic blood flow , but with a concomitant decrease in phi . apart from this heterogeneity in blood flow between regional circulation and microcirculation , experimental data also suggested regional heterogeneity in blood flow between the gastric and colon region during the use of dopexamine in sepsis . in postoperative cardiac surgery no difference in pco2 g - a between low - dose dopexamine and placebo could be detected . in another study phi did not rise despite an increment in icg - measured splanchnic blood flow and cardiac output . apart from thermogenetic effects of dopexamine , this might also be explained by a distributive effect . to date , in postoperative non - cardiac surgery , the use of dopexamine remains a matter of debate [ 81 , 82 ] . levosimendan ( calcium sensitizer , table 4 ) improves cardiac contractility and has slight vasodilatory effects . in patients with sepsis - induced myocardial depression levosimendan in addition to ne plus dobutamine was superior to an incremental dose of dobutamine , with respect to pco2g - a , laser doppler - measured gastric mucosal perfusion , arterial lactate levels and creatinine clearance , either as a direct effect or as result of improved cardiac output . after abdominal aortic aneurysm surgery pco2 g - a was lower in the levosimendan group in comparison to placebo , but despite a higher cardiac output this was not a result of better regional splanchnic perfusion . in an experimental setting attenuation of sepsis - induced cellular hypoxia was observed , but simultaneous sdf - imaging failed to detect changes in microvascular blood flow . nitroglycerin ( ntg , table 5 ) as well as other organic nitrates undergo intracellular metabolism in order to produce nitric oxide ( no)-mediated vasodilatation . despite the fact that overwhelming no production is believed to play an important role in sepsis - induced hypotension , it has also been suggested as therapeutic strategy to overcome heterogeneity in microcirculatory blood flow [ 5 , 87 ] . this dilemma is illustrated by the fact that unselective blocking of no - synthase indeed was associated with a substantial increase in blood pressure , but also with a higher mortality [ 88 , 89 ] . the general idea that increasing map results in a higher net microcirculatory perfusion pressure is not in line with physiological theory of the microcirculation as a low - pressure vascular compartment . for example , in the brain of healthy volunteers ( with intact autoregulation ) , ne was unable to increase estimated cerebral perfusion pressure despite a rise in map , whereas glyceryl trinitrate increased estimated cerebral perfusion pressure as a result of a lower zero flow pressure , even at a lower map .table 5vasodilators ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function)study [ ref]inotropesettingtechnique(s)effectsremarksnitroglycerinseptic shock , n = 8ops - imaginginstantaneous increase in sublingual microcirculatory blood flow after a 0.5 mg iv bolusopen label , after fulfilment of static pressure resuscitation endpointnitroglycerinseptic shock , n = 70sdf - imagingno difference in sublingual microcirculatory blood flow after 24 hplacebo controlled double - blind , after fulfilment of dynamic resuscitation endpoints.nitroglycerincardiogenic shock , n = 20sdf - imagingincrease in sublingual perfused capillary densityeffect ceased after stop medicationketanserincardiac surgery , n = 6sdf - imagingno change in sublingual perfused capillary density and microvascular blood flowmap dropped from 86 to 68 mmhgprostacyclinseptic shock , n = 16tonometryincrease in gastric mucosal phintravenous prostacyclinprostacyclinseptic shock , n = 16tonometry , icg clearancedecrease in pco2 g - a , no change in overall splanchnic perfusionpatients with septic shock and pulmonary hypertension , aerosolized prostacyclin ; effects in comparison to baseline and inhaled nitric oxydeops orthogonal polarization spectral , sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green , map mean arterial pressure vasodilators ( summary of effects in human studies on microvascular perfusion , oxygenation and organ function ) ops orthogonal polarization spectral , sdf sidestream dark field , pco2 g - a arterial - to - gastric pco2 gradient , icg indocyanine green , map mean arterial pressure in an uncontrolled setting , ntg was administered to septic patients who fulfilled static systemic hemodynamic resuscitation endpoints . despite fulfilment of these endpoints after a single bolus of ntg , instant improvement of microcirculatory blood flow was observed , indicating an no - mediated endothelial ability for vasodilatation , which based on the analogy of topical acetylcholine challenged the general idea of endothelial hyporesponsiveness in sepsis - induced hypotension . however , in a double - blind placebo - controlled setting , after fulfillment of dynamic systemic hemodynamic resuscitation endpoints , sublingual microcrocirculatory perfusion improved significantly over time , but no effect of ntg in comparison to placebo could be demonstrated . in the uncontrolled setting , baseline values for microvascular blood flow in large vessels was considerably lower in comparison to the controlled setting , suggesting marked differences in systemic volume status . in cardiogenic shock , impairment of sublingual microcirculation has also been observed and associated with morbidity and mortality . application of low - dose ntg in addition to standard care for cardiogenic shock was associated with a rise in sublingual perfused capillary density . this was not accompanied by a change in cardiac output or map and disappeared after cessation of ntg administration . interestingly , non - pulsatile systemic circulatory flow support by means of a percutaneous left ventricular assist device after acute myocardial infarction was also reflected in a better sublingual microcirculatory flow score . in the specific setting of gastric tube reconstruction , topical application of ntg improved laser doppler blood in the fundus without changes in local hbio2 . however , no effect was observed during intravenous ntg in the same setting , suggesting potential interference with bioactivation . ketanserin ( serotonin 5-ht2 antagonist and weak 1-adrenergic blocker , table 5 ) has been used in the treatment of hypertension with a reported beneficial effect on microhemodynamics and hemorheology due vasodilatation and inhibition of platelet aggregation . administration of ketanserin in hypertensive post - cpb cardiac surgery patients effectively lowered map , while sublingual capillary blood flow was preserved . prostacyclin ( cyclic adenosine monophosphate activator , table 5 ) was initially propagated as a drug for improvement of oxygen extraction deficits , suspected to cause tissue dysoxia . since then it has been studied extensively , especially in experimental settings , for its potential beneficial effect on organ perfusion , as it plays a crucial role in the physiological endothelial vasodilatory response to ischemia / reperfusion . administration of intravenous prostacyclin after conventional resuscitation was associated with higher phi and indicative for outcome . similar effects on phi were reported during aerosolized prostacyclin despite unaltered icg clearance in patients with pulmonary hypertension . during cpb , infusion of prostacyclin blunted jejunal vasomotion , resulting in a reduced ability to maintain laser doppler - measured jejunal perfusion constant under variation of blood pressure ( autoregulation ) . on the other hand , jejunal perfusion increased significantly in parallel to a drop in map , but unfortunately pco2 g - a was not measured to establish the overall effect on jejunal microcirculatory perfusion . regardless of practical limitations , there is a growing perception that shock should be defined at the level of the microcirculation . previous clinical research was limited to surrogate markers of organ microcirculatory blood perfusion such as tonometry , laser doppler flowmetry and icg clearance . recent developments have brought direct in vivo observation of the microcirculation in critically ill patients within reach , albeit limited to accessible organs . to date there are no data available in support of the idea that increasing map is beneficial from the perspective of microcirculatory perfusion and/or oxygenation , and such an idea is not in line with the physiological theory of the microcirculation as a low - pressure vascular compartment . in septic shock several reports have demonstrated an absence of effect on microcirculatory perfusion above a map of 65 mmhg , but a lower threshold has not been established . microcirculatory weak units is yet to be elucidated . in cardiogenic shock neither vasopressors nor inotropic agents have been proven beneficial in terms of organ perfusion , but increasing systemic flow by means of several assist devices are now associated with better microcirculatory flow .
purposethe clinical use of vasoactive drugs is not only intended to improve systemic hemodynamic variables , but ultimately to attenuate derangements in organ perfusion and oxygenation during shock . this review aims ( 1 ) to discuss basic physiology with respect to manipulating vascular tone and its effect on the microcirculation , and ( 2 ) to provide an overview of available clinical data on the relation between vasoactive drugs and organ perfusion , with specific attention paid to recent developments that have enabled direct in vivo observation of the microcirculation and concepts that have originated from it.methodsa medline search was conducted for clinical articles in the english language over the last 15 years pertainig to shock , sepsis , organ failure , or critically ill patients in combination with vasoactive drugs and specific variables of organ perfusion / oxygenation ( e.g. , tonometry , indocyanine clearance , laser doppler , and sidestream dark field imaging).resultseighty original papers evaluating the specific relationship between organ perfusion / oxygenation and the use of vasoactive drugs were identified and are discussed in light of physiological theory of vasomotor tone.conclusionssolid clinical data in support of the idea that increasing blood pressure in shock improves microcirculatory perfusion / oxygenation seem to be lacking , and such a concept might not be in line with physiological theory of microcirculation as a low - pressure vascular compartment . in septic shock no beneficial effect on microcirculatory perfusion above a mean arterial pressure of 65 mmhg has been reported , but a wide range in inter - individual effect seems to exist . whether improvement of microcirculatory perfusion is associated with better patient outcome remains to be elucidated .
opioid derivatives , particularly -opioid receptor agonists such as morphine , are the most effective and widely prescribed therapy for treatment of moderate - to - severe pain ( 1 , 2 ) . however , when opioids are repeatedly used for pain relief , the analgesic effects of these agents are accompanied by unwanted side effects such as physical dependence and hence , must be administered in escalating doses due to rapid development of tolerance to their analgesic actions ( 3 - 5 ) . over the past decades orexin - a and b , a well - known pair of hypothalamic peptides , are identified as regulators of feeding behaviors and sleep - wake cycle ( 6 , 7 ) . orexins act at least on two subtypes of g - protein coupled receptors known as orexin receptor-1 and 2 . orexin projections and receptors expression found in multiple brain regions are involved in pain modulation such as ventral tegmental area ( vta ) , nucleus accumbens , hippocampus , hypothalamic , dorsal and medial raphe , locus coeruleus ( lc ) , periaqueductal gray ( pag ) , and reticular formation ( 9 , 10 ) . previous behavioral researches have shown analgesic effects of orexin - a ( 11 - 17 ) . these studies have indicated that the efficacy of orexin - a as an analgesic agent is similar to that of morphine in 50 c hot - plate test ( 13 ) . in addition , evidences emphasize that orexin receptor-1 is involved in responsiveness to both pain and stressful stimuli ; therefore , it may have a key role in stress - induced anti - nocecption ( sia ) ( 18 , 19 ) . orexin mechanisms of anti - nociception have not yet been clarified , but as orexin receptor-1 is expressed in both brain and spinal cord , it is proposed that both mechanisms contribute to the anti - nociceptive in both brain and spinal cord , it is proposed that both mechanisms contribute to the anti - nociceptive effects of orexins ( 13 , 20 , 21 ) . recently , it has been has shown that microinjection of orexin - a into the periaqueductal gray ( pag ) produces analgesic effect ( 12 ) . tolerance , as a result of mal - plasticity in the nervous system mechanisms , appears with a decrease in responsiveness and increase in demand for drug ( 22 ) . repeated administration of some analgesic drugs causes tolerance to anti - nociceptive effect of these substances ( 23 ) , as a clinically undesirable outcome . therefore , our attention was attracted by the question that whether repeated administration of orexin - a would induce tolerance to anti - nociceptive effect of this peptide . in all experiments , adult male sprague - dawley rats ( 200 - 250 g ) purchased from razi institute , karaj , iran were used . animals were housed in an environment with 12 hr/12hr light / dark cycle at room temperature ( 222 c ) . all research and animal care procedures were done according to the international guidelines on the use of laboratory animals . animals were anaesthetized with a mixture of ketamine and xylazine ( 100 mg / kg and 10 mg / kg , respectively ; ip injection ) and placed in a stereotaxic apparatus ( stoelting , usa ) . to perform direct icv administrations of chemicals , the dura was exposed with drilling the skull at an appropriate and previously labeled site just above the lateral ventricle ( lv , coordination : ap , -0.9 mm ; l , -1.8 mm ; v , -3.8 mm all from the bregma ) according to the rat brain atlas ( 22 ) . following removal of the dura , a 23-gauge , stainless steel guide cannula was implanted just 2 mm above the right side of the lv . the cannula was anchored in the skull on two stainless steel screws using dental cement . a 30-gauge needle ( protruded 2 mm beyond the guide cannula to reach the right lv and connected through a polyethylene tube to a 10 l hamilton syringe ) mounted on a stereotactic micromanipulator , was used to inject chemicals . a volume of 5 l of orexin - a ( 25 , 100 , and 200 pmol ) in sterile 0.9% saline ( ph 7.4 ) was microinjected icv ( at a rate of 2 l / min ) to determine the optimum dose for analgesic effects . a hot - plate apparatus ( analgesia meter iitc , life science , usa ) was used to measure the time latencies to pain . animals were placed in an acrylic box ( 22.5 22.5 cm in diameter ) on the heated surface , and the . the response latency of all animals was measured one day before the beginning of drug microinjections to provide baseline response for each group . temperature of hot - plate apparatus was set and held at 52 1 c for all experiments ( 23 ) . animals were microinjected icv with orexin - a or saline and subjected to the hot - plate test after 5 , 15 , 30 , and 60 min . the dose of orexin - a was selected based on the data from the dose - response experiments . animals were divided into two experimental groups ( n = 8 in each group ) . in group 1 , orexin - a was given unilaterally ( icv ) for six days ( twice per day with 12 hr intervals ) . in group 2 , saline was given ( icv ) as orexin - a . to prevent associative learning during the hot - plate test , the analgesic effects of the chemicals were evaluated on days 1 , 4 , and 7 using hot - plate test at 5 , 15 , 30 , and 60 min following morning administrations . the microinjection procedure might cause a learning process which results in progressive shortening of the jumping reaction or licking behavior in hot - plate test . by this , we tried to prevent association learning that might happen between microinjection of drug and affect jumping reaction or licking behavior in hot - plate test . in both groups , the body weight was measured every two days , from the day of baseline test until the end of the experiments . at the end of the experiments , all animals received 5 l of pontamine sky blue ( 0.2% ) rats were initially perfused intracardially with 100 - 150 ml of pbs solution and later with equal volume of 4% formalin solution . whose diffusion and microinjection site were confirmed in the lv ( 19 ) , were included . in all experiments after testing the data for their normal distribution ( kolmogorov - smirnov ) , they were analyzed using repeated - measures anova or one - way anova ( by dunnett s test ) for comparison between groups . animals were anaesthetized with a mixture of ketamine and xylazine ( 100 mg / kg and 10 mg / kg , respectively ; ip injection ) and placed in a stereotaxic apparatus ( stoelting , usa ) . to perform direct icv administrations of chemicals , the dura was exposed with drilling the skull at an appropriate and previously labeled site just above the lateral ventricle ( lv , coordination : ap , -0.9 mm ; l , -1.8 mm ; v , -3.8 mm all from the bregma ) according to the rat brain atlas ( 22 ) . following removal of the dura , a 23-gauge , stainless steel guide cannula was implanted just 2 mm above the right side of the lv . the cannula was anchored in the skull on two stainless steel screws using dental cement . a 30-gauge needle ( protruded 2 mm beyond the guide cannula to reach the right lv and connected through a polyethylene tube to a 10 l hamilton syringe ) mounted on a stereotactic micromanipulator , was used to inject chemicals . a volume of 5 l of orexin - a ( 25 , 100 , and 200 pmol ) in sterile 0.9% saline ( ph 7.4 ) was microinjected icv ( at a rate of 2 l / min ) to determine the optimum dose for analgesic effects . a hot - plate apparatus ( analgesia meter iitc , life science , usa ) was used to measure the time latencies to pain . animals were placed in an acrylic box ( 22.5 22.5 cm in diameter ) on the heated surface , and the . the response latency of all animals was measured one day before the beginning of drug microinjections to provide baseline response for each group . temperature of hot - plate apparatus was set and held at 52 1 c for all experiments ( 23 ) . animals were microinjected icv with orexin - a or saline and subjected to the hot - plate test after 5 , 15 , 30 , and 60 min . the dose of orexin - a was selected based on the data from the dose - response experiments . animals were divided into two experimental groups ( n = 8 in each group ) . in group 1 , orexin - a was given unilaterally ( icv ) for six days ( twice per day with 12 hr intervals ) . to prevent associative learning during the hot - plate test , the analgesic effects of the chemicals were evaluated on days 1 , 4 , and 7 using hot - plate test at 5 , 15 , 30 , and 60 min following morning administrations . the microinjection procedure might cause a learning process which results in progressive shortening of the jumping reaction or licking behavior in hot - plate test . by this , we tried to prevent association learning that might happen between microinjection of drug and affect jumping reaction or licking behavior in hot - plate test . in both groups , the body weight was measured every two days , from the day of baseline test until the end of the experiments . at the end of the experiments , all animals received 5 l of pontamine sky blue ( 0.2% ) icv through the cannula and were later anaesthetized with ketamine overdose . rats were initially perfused intracardially with 100 - 150 ml of pbs solution and later with equal volume of 4% formalin solution . whose diffusion and microinjection site were confirmed in the lv ( 19 ) , were included . in all experiments , data were expressed as mean sem . after testing the data for their normal distribution ( kolmogorov - smirnov ) , they were analyzed using repeated - measures anova or one - way anova ( by dunnett s test ) for comparison between groups . the three doses of orexin - a ( 25 , 100 , and 200 pmol ) selected for dose - response test showed anti - nociceptive effect in hot - plate test , 5 , 15 , and 30 min after microinjection . as seen in figure 1 , the lowest dose of orexin - a ( 25 pmol ) produced anti - nociception for 30 min ( p<0.05 ) . in addition , microinjection of the two other doses of orexin - a ( 100 and 200 pmol ) showed even more marked analgesic effect whereas the difference was statistically insignificant ( p>0.05 ) . however , it seems that the highest dose of orexin - a ( 200 pmol ) produced a longer anti - nociception , 60 min after microinjection ( figure 1 ) . dose - response test . curves showing the antinociceptive effect produced by three different concentrations ( 25 , 100 and 200 pmol ) of orexin - a when microinjected into the lv . antinociceptive responses were measured at 5 , 15 , 30 , and 60 min after microinjection . * p<0.05 ; * * p<0.001 and * * * p<0.01 in comparison with vehicle group according to figure 2 , the hot - plate latencies increased significantly on the first day , 5 , 15 , and 30 min after microinjection of orexin - a ( 100 pmol ) compared to the baseline and saline - microinjected animals ( p<0.05 for 5 and 30 min and p<0.01 for 15 min ) . according to the experiment , maximum anti - nociception occurred 15 min after the administration of orexin - a indicating a potent analgesic effect for orexin - a . however , 60 min after orexin - a microinjections , the latency of responses was similar to baseline and control groups . furthermore , when orexin - a was administrated on the following days ( twice per day ) and the latency of responses were measured on days 4 and 7 , analgesic effect significantly decreased toward the baseline and saline groups ( p>0.05 ) ( figure 2 ) indicating the occurrence of tolerance following chronic orexin - a . as seen in this figure , saline microinjection on continuous days had no effects on latency of responses on different days of hot - plate test . orexin - a ( 100 pmol ) microinjections into the lv showed a potent analgesic effect on day 2 when measured with hot plate at 5 , 15 , and 30 min but not 60 min ( p<0.05 ) after its administration however , the repeated application of orexin - a on following days demonstrated a significant decline in its analgesic effect when measured on days 4 and 7 by hot plate . p<0.05 and * * p<0.001 in comparison with vehicle group as demonstrated in figure 3 , a significant difference in body weight was observed between the control group and animals that were treated with orexin - a in a chronic manner ( p<0.01 ) . body weight was controlled daily along the experiments and the differences in body weight were measured between the day of baseline test and the day of final microinjection . while saline - microinjected animals showed an increase in their body weights ( 3.252.69 g ) , orexin - a - administrated animals showed weight loss ( 9.92.29 g ) . body weight showed an increase in saline - administrated animals whereas the orexin - a - microinjected animals revealed a significant decrease in body weight ( p<0.05 ) . body weight measurement was followed daily during the experiments ; however , only the difference between the day of baseline test and the last day of microinjection is shown here . * the three doses of orexin - a ( 25 , 100 , and 200 pmol ) selected for dose - response test showed anti - nociceptive effect in hot - plate test , 5 , 15 , and 30 min after microinjection . as seen in figure 1 , the lowest dose of orexin - a ( 25 pmol ) produced anti - nociception for 30 min ( p<0.05 ) . in addition , microinjection of the two other doses of orexin - a ( 100 and 200 pmol ) showed even more marked analgesic effect whereas the difference was statistically insignificant ( p>0.05 ) . however , it seems that the highest dose of orexin - a ( 200 pmol ) produced a longer anti - nociception , 60 min after microinjection ( figure 1 ) . dose - response test . curves showing the antinociceptive effect produced by three different concentrations ( 25 , 100 and 200 pmol ) of orexin - a when microinjected into the lv . antinociceptive responses were measured at 5 , 15 , 30 , and 60 min after microinjection . * p<0.05 ; * * p<0.001 and * * * p<0.01 in comparison with vehicle group according to figure 2 , the hot - plate latencies increased significantly on the first day , 5 , 15 , and 30 min after microinjection of orexin - a ( 100 pmol ) compared to the baseline and saline - microinjected animals ( p<0.05 for 5 and 30 min and p<0.01 for 15 min ) . according to the experiment , maximum anti - nociception occurred 15 min after the administration of orexin - a indicating a potent analgesic effect for orexin - a . however , 60 min after orexin - a microinjections , the latency of responses was similar to baseline and control groups . furthermore , when orexin - a was administrated on the following days ( twice per day ) and the latency of responses were measured on days 4 and 7 , analgesic effect significantly decreased toward the baseline and saline groups ( p>0.05 ) ( figure 2 ) indicating the occurrence of tolerance following chronic orexin - a . as seen in this figure , saline microinjection on continuous days had no effects on latency of responses on different days of hot - plate test . orexin - a ( 100 pmol ) microinjections into the lv showed a potent analgesic effect on day 2 when measured with hot plate at 5 , 15 , and 30 min but not 60 min ( p<0.05 ) after its administration however , the repeated application of orexin - a on following days demonstrated a significant decline in its analgesic effect when measured on days 4 and 7 by hot plate . as demonstrated in figure 3 , a significant difference in body weight was observed between the control group and animals that were treated with orexin - a in a chronic manner ( p<0.01 ) . body weight was controlled daily along the experiments and the differences in body weight were measured between the day of baseline test and the day of final microinjection . while saline - microinjected animals showed an increase in their body weights ( 3.252.69 g ) , orexin - a - administrated animals showed weight loss ( 9.92.29 g ) . body weight showed an increase in saline - administrated animals whereas the orexin - a - microinjected animals revealed a significant decrease in body weight ( p<0.05 ) . body weight measurement was followed daily during the experiments ; however , only the difference between the day of baseline test and the last day of microinjection is shown here . * * p<0.001 in comparison with vehicle group in the current research , for the first time , we provide evidence that chronic administration of orexin - a into the lateral ventricle produced tolerance to the anti - nociceptive effect of this peptide . several studies have shown anti - nociceptive effects of orexins in various animal models of pain ( 12 , 14 , 21 , 24 , 25 ) . herein , our results also confirmed the analgesic activity of orexin - a . anti - nociceptive effect of orexin - a , but not orexin - b , has been described to be as pronounced as morphine ( 13 ) . however , a clinically unfavorable problem with the chronic administration of opioids is development of tolerance to their analgesic actions ( 22 ) . gene expression studies have shown that orexin receptors are widely distributed in both brain and spinal cord ( 20 ) . central administration of orexin - a agonist into the brain and spinal cord have revealed significant pain relief in various animal models of pain ( 12 , 16 , 20 ) . this effect seems to be opioid - independent and mainly mediated through ox1 receptors ( 21 , 25 ) . however , in all of these reports , orexin was given in an acute manner and thus , it is unclear whether chronic administrations of these peptides show similar effect . to find an appropriate dose of orexin - a with anti - nociceptive effect following icv microinjection , a dose - response test was designed . our results showed that maximum analgesic action appears following administration of 200 pmol orexin ; however , as the same effect was almost produced by 100 pmol of orexin , this amount was selected as the optimum dose for other experiments . some studies have investigated systemic anti - nociceptive effect of orexin - a in different animal models of pain ( summarized table in chiou et al . , 2010 ) ( 26 ) and most of them used orexin - a at doses from 0.1 nmol to 1 nmol for icv ( 5 l ) or intrathecal ( it , 10 l ) injection . moreover , a similar amount of orexin - a ( 0.5 nmol ) was microinjected ( icv ) for examining the effects of this agent on food intake and body weight ( 27 ) . it has been reported that icv microinjection of orexin - a ( 0.5nmol / h for 7 days ) has no effect on body weight despite an increase in daytime food intake ( 28 ) . we observed a significant weight loss in animals treated with orexin - a for 7 days as compared to saline group . in our study , animals weight was measured daily as they were under microinjection of orexin or saline twice a day . the microinjection protocol used by yamanaka et al ( 28 ) was different from that we used in this study which may explain the discrepancies in results between these two studies . as revealed by our data , repeated administration of orexin - a not only prevented weight increase , but also produced weight loss . novak and levine ( 27 ) have reported the occurrence of weight loss following chronic orexin - a microinjection into the paraventricular nucleus ( pvn ) . although , they applied orexin - a into a paraventricular nucleus at a different dose , their results are similar to ours . it has been reported that orexins increase the food intake ( 27 ) and also affect the spontaneous physical activity and wakefulness ; therefore , a weight loss due to negative energy balance may be expected ( 29 ) . although , repeated administration of orexin - a produced a significant decrease in anti - nociceptive response , pharmacological tolerance was observed . in addition , changes in arousal , cardiovascular activation , hyperlocomotion and alteration of homeostasis following chronic administration of orexin - a might occur and become confounding factors for the hot - plate response , although we disregarded them but these factors should be considered in future studies . it has been suggested that the opioid tolerance mainly occurs through adaptation at the level of opioid receptor itself . other studies , however , have demonstrated additional adaptation mechanisms appearing downstream from the opioids receptor and involving the activation of nmda receptors , translocation and activation of protein kinases , uncoupling of opioids receptors from g proteins and adenylate cyclases , supersensitivity of the adenylyl cyclase system , and downregulation and internalization of opioids receptors ( 1 , 2 , 5 , 30 ) gintzler and chakrabarti described a shift from gi inhibitory to the g stimulatory in opioids tolerance ( 3 ) . previous investigations have shown that the orexin-1 receptors mainly couple to the gq/11 subclass of heterotrimeric g proteins whereas the orexin-1 receptors pair with gq/11 , gi / o , and gs ( 31 ) . also , it has been reported that the protein kinases such as pkc , pka , and camkii mediate the effects of orexins in cells ( 32 , 33 ) . according to the previous studies , the cellular signal transduction mechanisms of orexins and opioids have many similarities . therefore , same cellular mechanisms might be responsible for appearance of tolerance to analgesic action of orexin following chronic use ; however , further in - depth studies are needed to investigate the cellular mechanisms . in all previous investigations on the analgesic action of orexins , a single injection of these peptides was applied which led to occurrence of a potent analgesic effect that was comparable with morphine , but this is assumed to be independent of endogenous opioidergic system ( 14 , 21 , 25 ) . however , as the orexin central action is mediated via pag and the descending pain control system , it could be speculated that the opioidergic system might be involved in both analgesic action and tolerance produced by orexins injection . prior to the current study , there is no available report in the literature regarding the chronic administration of these peptides and their analgesic effect . considering this potent effect of orexin , these peptides might further support the development of orexin-1 agonists for pain treatment in clinical settings . it is noteworthy that discovery of analgesic agents with zero to little tolerance following chronic administration is of vital importance . herein , we centrally administered orexin - a for 7 continuous days and interestingly a reduction in its effectiveness after the 4 day of microinjection was observed . further investigations are needed to find the mechanism(s ) of this tolerance produced by the repeated injection of orexin - a and if such phenomenon occurs for the other effects of orexins then , the next important question will be whether the development of tolerance could be avoidable .
objective(s):reduction of pharmacological effectiveness or tolerance appears following repeated administration of many analgesic drugs . we investigated tolerance to anti - nociceptive effects of orexin - a , an endogenous potent analgesic peptide using the hot - plate test.materials and methods : orexin - a was microinjected icv ( intracerebroventricular ) with an interval of 12 hr for 7 continuous days and its anti - nociceptive responses were measured on days 1 , 4 and 7 using the hot - plate test following the first day of administration . orexin - a was used at a dose of 100 pmol to induce analgesic effects.results:icv administration of orexin - a produced an effective anti - nociception on the first day of experiment as measured by hot - plate 5 , 15 , and 30 min after the injection , in comparison with both baselines ( hot - plate test one day before the beginning of orexin - a administration and control , saline - administrated group ) . however , repeated administration of orexin - a on the following days revealed a significant reduction in this analgesic effect during day 4 to day 7 . however , to rule out any associative tolerance resulting from learning related to experimental procedures and/or environmental cues , a single injection of orexin - a was administrated to animals of control group ( which were receiving saline during 7 days of experiments ) and the analgesic effect was observed.conclusion:these results , for the first time , indicated the appearance of tolerance to anti - nociceptive effects of orexin - a , following repeated administrations of this agent .
colo - articular fistulas involving the hip joint are rare entities associated with significant morbidity . they have previously been reported in the literature in patients with inflammatory bowel disease ( ibd ) , in addition , solitary case reports have described their formation following total hip arthroplasty [ 4 , 5 ] . to our knowledge we report the first case where a colo - articular fistula has developed between healthy sigmoid colon and the hip joint in a patient with a history of intravenous drug use ( ivdu ) and previous girdlestone procedure . a 44-year - old caucasian male presented to the emergency department with a 3-day history of increasing abdominal pain , melaena , coffee ground vomit and left hip pain with difficulty in walking . the patient was a known ivdu , with a history of hepatitis c. he previously underwent multiple incision and drainage procedures for left groin abscesses and on one occasion required an emergency fasciectomy for suspected necrotizing fasciitis . the patient subsequently developed chronic osteomyelitis in the left proximal femur with avascular necrosis of the femoral head . whilst under the care of a specialist bone infection unit he underwent a left girdlestone resection arthroplasty 1 year prior to this presentation . on admission , examination of the left hip revealed indurated tender skin to the upper outer thigh without discharging sinus . blood investigations showed elevated inflammatory markers ( crp 213 mg / l and wcc 13.5 10/l ) . he was commenced on intravenous antibiotic therapy ( pipperacillin and tazobactam ) for sepsis and proton pump inhibitors for a presumed upper gastro - intestinal bleed and admitted under the care of the physicians . the patient 's condition deteriorated and complained of increasing left sided lower abdominal and hip pain . despite vigorous administration of intravenous fluids , serial lactate levels demonstrated a rapid increase . a computed tomography ( ct ) scan of the abdomen and pelvis demonstrated a moderate collection involving the musculature surrounding the left hip with gas within the soft tissue , extending to the left ischiorectal fossa and left obturator internus muscle , suggesting a communication between the bowel and hip joint there were no features of ibd , dd or bowel carcinoma ( fig . 1 ) . figure 1:(a ) coronal slice from a ct scan of the abdomen and pelvis showing the left hip gridlestone with the presence of air in the joint space . ( b and c ) axial images demonstrating air in the lower rectum with involvement of the left ischial fossa and passage along the obturator canal to the left hip joint . ( a ) coronal slice from a ct scan of the abdomen and pelvis showing the left hip gridlestone with the presence of air in the joint space . ( b and c ) axial images demonstrating air in the lower rectum with involvement of the left ischial fossa and passage along the obturator canal to the left hip joint . following review by the orthopaedic team on opening the hip capsule , copious amount of faeculant fluid was found inside the joint . a colorectal surgeon was called to theatre and identified a fistula between the hip joint and the bowel through the obturator foramen , from which faeculent fluid could be expressed . the hip joint was washed thoroughly , packed and a negative pressure wound dressing was applied . fluid cultures taken intra - operatively grew escherichia coli and streptococcus anginosus . following discussion with the microbiologist , this revealed areas of gas and an abscess in the upper thigh with extensive oedema and collections surrounding the rectum but due to significant movement artefact a fistula could not be visualized . forty - eight hours post - operatively , a diagnosis of fournier 's gangrene was made and the patient was taken back to theatre for debridement of the perineal region . the hip joint had further washouts and the wound was treated with a negative pressure dressing . subsequent ogd demonstrated oesophagitis , with two small duodenal ulcers that were not actively bleeding . following surgery , the patient reported significant improvement in his left hip pain over the course of 10 days . he demonstrated a good range of hip movement and was able to weight bear and mobilize pain free . colo - articular fistulas involving the hip joint are predominantly rare sequale of underlying inflammatory or malignant gastro - intestinal disease . fistula formation in crohn 's disease and dd are recognized complications , and communication with the hip joint has been documented with associated psoas abscess formation . these conditions can also produce thigh abscess and other significant soft tissue infections from colo - cutaneous fistula . colo - articular fistulas have also been reported following surgery and radiotherapy for primary bowel carcinoma and post - total hip arthroplasty , where the components have migrated [ 4 , 5 ] . his current ct and mri images did not reveal any evidence of any underlying disease process . the patient did have a history of chronic infection in the left hip , as a result of his ivdu . he had experienced multiple soft tissue groin abscesses and presented with acute - on - chronic soft tissue infection to the proximal thigh and perineum . the subsequent diagnosis was fournier 's gangrene ; it is likely that his infection started from an extra - abdominal source becoming intra - peritoneal . the presence of gas within the hip , gram - negative anaerobes in the aspirate and marked improvement of symptoms following defunctioning loop colostomy are in keeping with an appropriately managed fistula . although rare , this case serves to raise awareness amongst orthopaedic surgeons about the possibility of colo - articular fistulas in patients with soft tissue infections . the case also highlights the importance of a multi - disciplinary team approach to obtain a good outcome . early involvement of the colorectal surgeons is essential to manage the fistula output and combined surgery with the orthopaedic team ensures that aggressive debridement of infected tissues is undertaken to control the infection . in addition , microbiologist input must be sought to ensure that the correct antibiotic regime is commenced promptly .
colo - articular fistulas are rare complications that are usually associated with inflammatory , infective or malignant bowel disease . we report the case of a 44-year - old male who was found to have a colo - articular fistula intra - operatively during the washout of a septic hip joint . the patient had no pre - existing bowel disease , but was an intravenous drug user , who had previously undergone a girdlestone procedure for osteomyelitis of the proximal femur . the patient was managed through a multi - disciplinary team approach with subsequent debridement and formation of a transverse loop colostomy to control the faeculent fistulous discharge .
1 . an autoimmune mechanism has been implicated in the pathogenesis of vitiligo in most cases . 2 . histamine mediates some actions through various interleukin pathways and elevated levels of serum soluble il-2 receptor , il6 , and il- 8 has been reported in vitiligo patients . vitiligo is an acquired , idiopathic disorder of the skin characterized clinically by circumscribed depigmented macules and histologically by the absence of identifiable melanocytes . functional melanocytes disappear from the involved skin by a mechanism(s ) that has not been identified . the main mechanism of melanocyte destruction in vitiligo is thought to be due to an autoimmune lymphocytic attack on melanocytes . there are several hypotheses concerning the pathogenesis of vitiligo . of the many hypotheses suggested by various investigators from time to time the following three have received general acceptance : ( 1 ) autoimmune hypothesis : suggests that depigmentation is due to formation of autoantibodies directed against body 's own melanin or some other part of melanocyte . this may arise as a primary aberration of the immune surveillance , or the primary event could be an injury to the melanocyte with release of antigenic substance(s ) and subsequent autoimmunization . autoimmune etiology is favored by its association with known autoimmune diseases such as addison 's disease , hashimoto 's thyrioditis , pernicious anemia , and the fact that patients with vitiligo have increased organ - specific autoantibodies including antibodies to adrenal cytoplasm , thyroglobulin , gastric parietal cells , and pancreatic islet cells . antibodies directed against melanocyte cell surface antigens are often demonstrated in the sera of vitiligo patients . also antibodies against tyrosinase ( 2 ) self - destruction hypothesis : suggests that in the process of synthesis of melanin within the melanocytes some toxic metabolic intermediates form . defects in , or absence of , of this inherent mechanism results in accumulation of toxic melanin precursors causing melanocyte dysfunction or death . ( 3 ) neuro - chemical hypothesis : suggests that release of a neuro - humoral or chemical factor destroys the melanocyte or inhibits melanin formation giving rise to depigmentation . nature of this toxic mediator remains speculative . for a long time neurotransmitters from peripheral nerve - endings ( acetylcholine and catecholamines ) also dysfunction of sympathetic nerves in vitiliginous skin has been reported showing abnormalities in catecholamines and related enzymes ( catechol - o - methyl transferase and monoamine oxidase ) . the neural hypothesis is based in the first place on the presence of segmental vitiligo . it has now been realized that all the various clinical types of vitiligo can not be explained by a single hypothesis . koga has shown that there are two distinct types of vitiligo , each having a different pathogenesis . according to his view , the pathogenesis of dermatomally distributed vitiligo involves some disturbance in some sympathetic nerves of the affected area , which influences the melanocyte causing their functional inhibition or destruction . in contrast , nondermatomal vitiligo has a different pathogenesis in which primary disturbance lies in the melanocyte itself , where an autoimmune mechanism is suspect . this clinical distinction of segmental vitiligo and nonsegmental vitiligo done by koga has not been challenged until recently . the vitiligo european task force ( vetf ) in its consensus paper has followed this classification of koga . the vetf concluded that there was no significant evidence that the various sub - types of nonsegmental vitiligo were clearly distinct . only recently it has been reported that in certain vitiligo patients , a characteristic segmental involvement become associated usually in a second - step with bilateral vitiligo patches and the term mixed vitiligo has been proposed by mulekar et al . the sequence of early segmental vitiligo leading to late onset nonsegmental vitiligo as found in the study of ezzedine et al . , may reflect the role of a cutaneous gene defect causing segmental vitiligo and later triggering a generalized immune response against cutaneous melanocytes driven by another immune - related gene defect . the idea that histamine might act as a toxic mediator in the pathogenesis of vitiligo arose from the observation that a good number of vitiligo patients attending the pigment clinic gave a history of significant pruritus over vitiligo patches . more significantly , many patients gave a history of spread of vitiligo lesions just preceded by itching in the new areas . such patients differed from the general pool of vitiligo patients in that they presented with hypo - pigmented patches scattered diffusely and were of short duration . many of them gave history of sudden onset of such lesions with itching while several of them associated their lesions with photosensitivity and complained of flare - up of lesions after administration of melanizing agents . histamine is particularly relevant in this context since histamine , which is also liberated along with other chemicals when cells are damaged , is one of the chemical mediators of itch . moreover , there is evidence that in frog both histamine and histamine releaser produce skin color blanching and melanophor contraction . also a significant number of vitiligo patients gave a history of atopy along with pruritus . the term atopy , or as presently used , atopic allergy implies a familial tendency to manifest alone or in combination such conditions as asthma , allergic rhinitis , and urticaria . asthma is associated with increased ige levels and high levels of ige are found in patients with atopic dermatitis . it has now been reported that histamine promotes the differentiation of dendritic cells toward a th2 profile . it is known that several hormones regulate melanogenesis through the action of ubiquitous cyclic adenosine monophosphate ( amp ) . based on the above facts and observations , it was hypothesized that histamine might act as a toxic mediator in the pathogenesis of a particular type of vitiligo . the present study is a retrospective analysis of data of a select group of patients attending the pigment clinic of the department of dermatology , sskm hospital and ipgme and r , kolkata between february 1 , 1975 and june 30 , 1985 . all new vitiligo patients attending the pigment clinic were closely scrutinized by carefully taken histories and thorough clinical examination . only those patients satisfying one or more of the following criteria were selected for the study : ( 1 ) presence of pruritus in the lesions ; ( 2 ) faintly defined hypopigmented guttate type lesions that are distributed in a diffuse manner and are of recent origin ; ( 3 ) a positive history of atopy in the patient or in the family ; and ( 4 ) association of halo nevus , koebner 's phenomenon , or photosensitivity . in the period under review , important clinical data of the patients are summarized in table 1 . from a small lesion of recent origin in a suitable area a thin slice of skin was taken with the help of a punch under local anesthesia . the tissue obtained by punch biopsy was subjected to conventional sectioning through the stages of fixation , dehydration , clearing , impregnation and embedding . sections from each tissue are stained by haemtoxylin eosin stain and by toluidine blue stain ( for mast cells ) . before giving any treatment to the patients , five ( 5 ) ml of blood was dissolved in 10 ml of 10% trichloroacetic acid solution in a test - tube , and after vigorous shaking ; the mixture was kept in a refrigerator . estimation of blood histamine level was done by bio - assay method ( h.o . schild , 1942 ) using a strip of terminal guinea pig ileum in an organ bath . dose - related contraction in the presence of atropine ( to exclude acetylcholine activity ) followed by inhibition of this activity by antihistamine mepyramine maleate confirms the presence of histamine . this method reliably detects concentrations in the range of 1 - 2.5 ng / ml . all new vitiligo patients attending the pigment clinic were closely scrutinized by carefully taken histories and thorough clinical examination . only those patients satisfying one or more of the following criteria were selected for the study : ( 1 ) presence of pruritus in the lesions ; ( 2 ) faintly defined hypopigmented guttate type lesions that are distributed in a diffuse manner and are of recent origin ; ( 3 ) a positive history of atopy in the patient or in the family ; and ( 4 ) association of halo nevus , koebner 's phenomenon , or photosensitivity . from a small lesion of recent origin in a suitable area a thin slice of skin was taken with the help of a punch under local anesthesia . the tissue obtained by punch biopsy was subjected to conventional sectioning through the stages of fixation , dehydration , clearing , impregnation and embedding . sections from each tissue are stained by haemtoxylin eosin stain and by toluidine blue stain ( for mast cells ) . before giving any treatment to the patients , blood samples were taken for estimation of histamine levels in the blood . five ( 5 ) ml of blood was dissolved in 10 ml of 10% trichloroacetic acid solution in a test - tube , and after vigorous shaking ; the mixture was kept in a refrigerator . estimation of blood histamine level was done by bio - assay method ( h.o . schild , 1942 ) using a strip of terminal guinea pig ileum in an organ bath . dose - related contraction in the presence of atropine ( to exclude acetylcholine activity ) followed by inhibition of this activity by antihistamine mepyramine maleate confirms the presence of histamine . this method reliably detects concentrations in the range of 1 - 2.5 ng / ml . of the 50 patients studied , pruritus was a significant finding in 28 patients and atopy in 12 patients . regarding distribution of lesions , the histology of lesions of recent origin revealed flattening of epidermis , homogenization ( a ground glass appearance ) of collagen in the upper dermis and mild increase of vascularity with slight perivascular infiltrate and edema . melanocytes are decreased in number with scanty or absent pigment granules . except three cases , infiltrate ( which is chiefly lymphocytic ) was patchy , scanty , and perivascular . in three specimens the infiltrates are slightly heavy in the border of the active lesions and in one the infiltrate invaded the epidermis . no degeneration of nerve fibrils seen and the sweat glands and other appendages are normal . the blood histamine values of vitiligo patients were significantly increased in comparison with values of matched controls ( normal human volunteers ) as shown by the overall mean values in [ table 2 ] . blood histamine levels ( ng / ml ) in vitiligo patients versus normal patients when the blood histamine values of the vitiligo patients were further analyzed forming groups in terms of presence of or absence of pruritus , and length of duration , it was found that the blood histamine values were higher in all cases except those of long duration where the values are significantly lower than the general trend ( p < 0.05 ) blood histaminase levels were also determined ( expressed in provisional units / ml ) and were found to be significantly high in vitiligo patients compared with normal group [ table 4 ] . high plasma histaminase values along with high blood histamine levels indicate even higher value of histamine in vitiligo than what has been found in the patients . significantly higher values of histamine in short duration cases is shown in a histogram [ figure 1 ] . blood histamine levels ( ng / ml ) in vitiligo patients plasma histamine levels ( pu / ml ) in vitiligo patients versus normal patients histamine value histogram of the 50 patients studied , pruritus was a significant finding in 28 patients and atopy in 12 patients . regarding distribution of lesions , the histology of lesions of recent origin revealed flattening of epidermis , homogenization ( a ground glass appearance ) of collagen in the upper dermis and mild increase of vascularity with slight perivascular infiltrate and edema . melanocytes are decreased in number with scanty or absent pigment granules . except three cases , infiltrate ( which is chiefly lymphocytic ) was patchy , scanty , and perivascular . in three specimens the infiltrates are slightly heavy in the border of the active lesions and in one the infiltrate invaded the epidermis . no degeneration of nerve fibrils seen and the sweat glands and other appendages are normal . the blood histamine values of vitiligo patients were significantly increased in comparison with values of matched controls ( normal human volunteers ) as shown by the overall mean values in [ table 2 ] . blood histamine levels ( ng / ml ) in vitiligo patients versus normal patients when the blood histamine values of the vitiligo patients were further analyzed forming groups in terms of presence of or absence of pruritus , and length of duration , it was found that the blood histamine values were higher in all cases except those of long duration where the values are significantly lower than the general trend ( p < 0.05 ) . blood histaminase levels were also determined ( expressed in provisional units / ml ) and were found to be significantly high in vitiligo patients compared with normal group [ table 4 ] . high plasma histaminase values along with high blood histamine levels indicate even higher value of histamine in vitiligo than what has been found in the patients . significantly higher values of histamine in short duration cases is shown in a histogram [ figure 1 ] . blood histamine levels ( ng / ml ) in vitiligo patients plasma histamine levels ( pu / ml ) in vitiligo patients versus normal patients histamine value histogram multiple theories have been proposed , including genetic , autoimmune , neural , and biochemical mechanisms . reviews addressing the etiology of vitiligo , viewed in totality suggest that vitiligo is probably a heterogeneous disease encompassing multiple etiologies . this study , performed in earlier times when modern immunological techniques were not available , showed that a considerable number of patients presented with pruritus and atopy and it seems reasonable that histamine might be acting as a toxic mediator in these cases . histopathological study revealed slight perivascular infiltrate and moderately increased vascularity with some vasodilation and significantly increased number of mast cells . this flattening of the epidermis and vacuolization of some epithelial cells reflect an involvement of histamine since it has now been reported that histamine acts as an inhibitor of human keratinocytes and suppressor of epidermopoiesis in humans and animals . blood histamine values of vitiligo patients are significantly higher than the values found in normal persons ( p < 0.05 ) . also blood histaminase levels were determined and were found to be significantly elevated in vitiligo cases of short duration compared with normal control group . high plasma histaminases along with high blood histamine indicate even higher value of histamine in vitiligo . these observations support the hypothesis that histamine has a role in the pathogenesis of a particular type of vitiligo , characterized by faint white patches , pruritus , occasional intolerance to melanizing agents , and an association of atopy . histamine might also be operative in the pathogenesis of other types of vitiligo but the present study has been restricted to a group of patients having vitiligo of a particular type specified . now it has been established that histamine regulates t - cell and b - cell function by differential expressions of h1 and h2 receptors . histamine enhances th1 responses by triggering the h1 receptor , whereas both th1 and th2 responses are negatively regulated by h2 receptor via the activation of different intracellular signaling pathways . these findings indicate an important regulatory mechanism in the control of immune functions through release of histamine . this theory is based on increased number of immune phenomena and immunological disorders seen in vitiligo patients . an increased frequency of hypothyroidism ( e.g. , hashimoto thyroiditis , graves disease ) , diabetes mellitus , and alopecia areata are commonly seen in vitiligo patients . several investigators have also addressed the role of peripheral blood and lesional cytokine expression in the pathogenesis of vitiligo . elevated levels of serum soluble il-2 receptor , il-6 , and il-8 and elevated lesional tissue levels of il-2 have been reported in vitiligo patients . histamine , through the h2 receptor , reduces the production of il-1 , il-6 , and tnf- from endotoxin - stimulated monocytes . thus , it has now been clear that histamine mediates some actions through various interleukin pathways and thus this finding can be taken to correlate with this study , which was performed much earlier , showing role of histamine in the pathogenesis of vitiligo of a particular kind . from our findings of high blood histamine level as well as high blood histaminases level in cases of a particular type of vitiligo of short duration and characterized by faint hypopigmented patches with significant itching , we hypothesize that histamine has a definite role in the pathogenesis of vitiligo . this study , which was performed much earlier , highlighted that some allergic phenomena were operative in the pathogenesis of vitiligo as evidenced by high levels of blood histamine and histaminases . the idea raised by this study that some allergic phenomena were suspect in the causation of vitiligo has been corroborated by subsequent workers showing autoimmune nature of the disease . blood histamine as well as histaminases levels are found to be significantly high in a particular group of vitiligo patients . this points to autoimmune basis of etiology of vitiligo and indicate possible benefit to vitiligo patients with antihistamine therapy along with standard treatment regimen for vitiligo .
background : the precise cause of vitiligo is still unclear . multiple theories have been proposed , including genetic , autoimmune , neural , and biochemical mechanisms . an immune mediated pathogenesis is indeed the most popular theory . the autoimmune hypothesis considers the role of toxic mediator that might cause an injury to the melanocytes with the release of an antigenic substance and subsequent autoimmunization.aims:this study performed over a period of 10 years ( february 1975 to june 1985 ) aims at exploring the role that histamine might play in the pathogenesis of vitiligo.materials and methods : fifty patients with a particular type of vitiligo characterized by faint white patches occurring with significant pruritus and a history of atopy were selected and blood histamine levels were determined by bio - assay method.results:blood histamine values of patients with vitiligo of short duration and with pruritus were significantly increased in comparison with values of matched controls.conclusion:histamine appears to play a significant role in the pathogenesis of a particular type of vitiligo characterized by faint hypopigmented patches with significant itching .
acute pancreatitis ( ap ) is a pathology with acute inflammatory manifestations , and constitutes around 3% of all inpatient cases of abdominal pain ( 1 ) . all prevalence and incidence values of ap are based on hospital records and their accuracy is influenced by data collection methods , etiological and diagnostic approaches and social - demographic factors . descriptive incidence ranges from 5 , 4/100,000 per year in england ( 3 , 4 ) , to 15/100,000 per year in germany ( 5 ) , to 79.8 80 /100 000 per year in the u.s ( 6 , 7 , 8) . in countries where ap data are available was 9.4/100,000 from 1968 to 1980 , but it has been found a steep growth in 31 , 8/100,000 between 1985 - 1995 ( 5 , 9 ) . a similar increase is observed in other countries as well , such as england , denmark , sweden , finland , germany and the netherlands . recent studies show that the incidence of ap has increased during the last years ( 10 ) . the increase of incidence in northern european countries like finland and the netherlands is related to the increase of excessive alcohol consumption ( 11 ) , but on the other hand it might be linked with better discernibility due to better and faster diagnostic methods . distribution of ap etiology consists of 48% gallstones - related , 21% alcohol - related , 18% idiopathic and 57% other etiologies . this disparity is due to higher excessive alcohol consumption prevalence among males and because the distribution of gallstones - related ap is similar in males and females ( 5 , 6 ) . mortality rates of ap are , on average 1.3/100,000 ( 3 , 9 , 10 ) ; 55%65% of patients develop mild ap , 20%30% necrosis of the pancreas and 25% severe ap with complications ( 13 , 14 ) . there is a lack of data and publications regarding ap and incidence rates . in our daily practice , it has been found that the hospital admissions with the diagnosis of ap have increased . our study is intended to describe the epidemiological situation of ap among albanians patients , as well as to obtain data on incidence rates , etiology and severity of the disease . this is a retrospective study based on clinical records and patient admissions during an 8 year period 2005 - 2012 in the uhc mother theresa in tirana . mother theresa is a tertiary health care institution and serves as a reference for acute pancreatitis , as all cases are referred to this center from all corners of albania . patients with ap are admitted at the gastroenterology service , surgery service and intensive care unit depending on their situation at the moment of hospital admission . data collected included age , gender , symptoms , alcohol and drug consumption , coexisting diseases and pathologies . nearly all the patient had an ultrasonography on admission and during hospitalization , ct scans and/or magnetic resonance image ( mri ) when possible . ap was diagnosed if there were persistent clinical data for ap ( abdominal pain , nausea and vomiting ) , and elevated serum amylases levels 3 times over the normal values ( reference values of amylase lower than 110 iu / i ) . in those cases where amylasemia levels were not elevated , the diagnosis was based on clinical examination and imaging findings on ultrasonography and ct scan . ap diagnosis was determined only if at least two of the below listed criteria were present : acute pain or sensitivity in the epigastric regionelevation of amylase level 3 times over the normal values in blood or in the ascitic fluid ( if ascites present)imaging data of the pancreatic gland that suggest appatients with recurrent ap and chronic ap were not included in the study . acute pain or sensitivity in the epigastric region elevation of amylase level 3 times over the normal values in blood or in the ascitic fluid ( if ascites present ) imaging data of the pancreatic gland that suggest ap patients with recurrent ap and chronic ap were not included in the study . classification of acute pancreatitis was determined by : ( 1 ) etiology ( gallstones , alcohol , hyper - triglyceridemia , hypercalcemia , traumatic , autoimmune , viral etc . ) and by ( 2 ) severity ( mild to moderate and severe ap ) based on atlanta classification and ranson criteria . statistical package for social sciences , version 15.0 , chicago , illinois ( spss ) was used for analysis of the collected data . out of 1428 patients included in the beginning of the study based on their files , only 964 patients fulfilled the inclusion criteria of the ap during the years 2005 - 2012 . the total average age was 54.50 years 16.93 , range 2 - 104 years old . among 964 patients , 377 or 39.1% were females and 587 or 60.9% males . figure 1 shows the incidence of ap during the years 2005 - 2012 as well as the incidence of ap in females and males during these years . there is a steady increase in incidence rates of ap from 2005 to 2007 . incidence rates increase after 2008 and lower in 2010 with slight fluctuations . from 2010 to 2012 according to gender , incidence among males is generally stable , but among females there is a tendency of growth from 2010 to 2012 , almost doubled . incidence of acute pancreatitis between 2005 and 2012 , by sex ( per 100,000 ) incidence rates of ap in albania range from 3 , 6 5 , 64 new cases per 100,000 inhabitants , per year . incidence of ap is calculated based on data from our study and population data from the national institute of statistics of albania ( instat , census 2011 ) ( 16 ) . the distribution of ap cases by residence was 782 cases or 81.1% were residents of urban areas and 182 cases or 18.9% of rural areas . according to instat , the resident population in urban areas was 53.5 per cent , while 46.5 per cent of the population was living in rural areas . based on the risk factors , we have classified patients with ap as biliary , alcoholic , hypertriglyceridemic and other etiology , including viral , trauma , autoimmune and idiopathic causes . distribution of ap by risk factors and gender . out of 964 cases with ap , 382 ( 39.6% ) of them reported alcohol consumption , which was greater compared with other etiological risk factors . in 362 patients ( 37.6% ) we identified gallstones as a risk factor , hypertriglyceridemia in 19 patients ( 2.0% ) and other etiologic factors in 201 patients ( 20.8% ) . in males , alcoholic etiology is the most common cause of ap ( 382 out of 587 male patients or 65.07% had alcoholic ap ) , and the gallstones are more frequent in females ( 308 or 81.69% out of 377 female patients ) . our results show that females develop more biliary pancreatitis , while men develop alcoholic pancreatitis and this is statistically significant ( kendall s tau - b r = 0.473 , p < 0,001 ) . in albania , males are distinctively more heavy drinkers compared to females , and this difference is expressed in the table 1 ; actually we have no females identified to be alcohol consumer . mean age of patients with biliary etiology was 62 14 , while the mean age of patients with alcoholic etiology was 51 14 ( p < 0 , 05 ) . mean age of female patients with biliary etiology was 59 17 , while the mean age of male patients with biliary etiology was 62 13 . males with alcoholic pancreatitis have younger age than females with biliary etiology who develop pancreatitis at an older age . during the study period , 690 cases ( 71.57% ) have been classified with mild or moderate ap . 274 patients ( 28.42% ) have been determined to have a severe manifestation of the disease , table 2 . the incidence of ap ranges from 10 to 80 new cases/100,000 inhabitants worldwide , but in most european studies , it has a much narrower range from 20 to 30 new cases/100,000/year ( 18 ) , higher than the results of our study . although several european studies have shown a significant increase in the incidence over the last 20 years , our study showed a slight increasing trend over an eight year period ( 19 , 20 , and 21 ) . our study has also shown a pattern in the incidence of ap with regards to the etiology . the incidence of alcohol ap seems to be almost steady , with slight fluctuations over the years . on the other hand , , the general impression is that we see more alcoholic than biliary pancreatitis , but our data do not support our impression . most of the studies have demonstrated that specific etiologic factors dominate within a certain region of the country . for example , a higher proportion of cases with alcoholic ap were found in the grampian and highland region of scotland ( 22 ) . the different distribution of afore mentioned etiologies is not entirely clear but can be explained by the difference in alcohol consumption and the incidence of gallstone ap between north and south europe . continental europe has a particularly high incidence of alcoholic pancreatitis , not only because of high alcohol consumption per capita , but also due to the fact that alcoholic beverages in this climate contain a high percentage of alcohol , and as such may have a stronger toxic effect on the pancreas ( 25 ) . a reasonable explanation of this epidemiologic situation might be that the incidence of alcoholic ap is steady because but most of our alcoholic ap cases have developed severe ap , and mild to moderate cases are not recovering at the hospital , as the symptoms of the disease are mild . according to the albanian demographic and health survey of 2008 - 09 , 16 . 3% of men aged 15 - 49 are heavy drinkers and a sharp increase is observed among the group age of 35 - 49 from 19.5 in 24 . this might be because of the better diagnosis and discernibility of the gallstones and improved diagnosis of the biliary tree during the last years . during the last years it has been demonstrated that increased prevalence of gallstones and gallbladder disease in the obese patients is accompanied with an increasing incidence of acute pancreatitis in those patients , and this might be another reason ( 23 ) and data from adhs show an increasing prevalence of overweight and obesity during the last two decades ( 17 ) . the frequency of alcohol and biliary etiology varies between sexes , but without significant ( p>0.05 ) and as we would expect , significantly more women than man had biliary ap , and more man than women suffered considerably from alcohol - induced ap . men develop alcoholic ap at a younger age 51 14 years , while females develop biliary pancreatitis at an older age 59 17 years , and this is statistically significant ( p<0.05 ) in our analysis , there were 19 patients ( 2% ) with hypertriglyceridemia as the etiologic cause of ap . according to the literature , it is assumed that hypertriglyceridemia is the cause of ap in 4% of cases , and we are relatively close to this figure ( 19 , 24 ) . we have identified a virus as the etiological factor for ap , one of them was a two year old baby boy . these data are in agreement with other epidemiological studies , especially with the results published in our neighboring countries , italy , greece and croatia , even that the incidence rates are lower ( 25 ) . the incidence of acute pancreatitis in albania varies from 3.6 to 5.64 new cases per 100,000 inhabitants , which is lower than the incidence of pancreatitis in the region , but with an increasing trend . the majority of cases have an alcoholic etiology ( 39.6% ) and the young age of male patients .
background : acute pancreatitis ( ap ) is an inflammatory pathology with large regional variations in incidence and etiologyaim : the aim of the study was to provide a description of the epidemiologic situation of ap in albanian population , regarding incidence , etiology and severity of the diseasemethods : we have studied all the files of all patients with acute pancreatitis admitted at the uhc mother theresa during an eight year period ( 2005 - 2012).the results : we had 964 admissions with the diagnosis acute pancreatitis , making an incidence of 5.64 per 100 000 inhabitants per year . mean age of patients was 54.5 16.93 years old . among risk factors , alcohol consumption was found in 382 patients ( 39.6% ) , gallstone in 362 patients ( 37.6% ) , and others in 220 patients ( 22.8%).conclusion : the incidence of acute pancreatitis in albania ranges from 3.6 5.64 new cases per 100 000 inhabitants per year , with an increasing trend during the last years . the incidence of ap among females almost doubles during 2005 - 2012 . alcohol consumption is the predominating etiologic factor among young males .
erosive pustular dermatitis of the scalp ( epds ) typically affects elderly people and is clinically characterized by pustules , erosions , and crusts , which heal with scarring alopecia . videodermoscopy ( vd ) of the scalp ( trichoscopy ) is a noninvasive tool used for the diagnosis and follow - up of different types of hair loss that , to the best of our knowledge , has never been assessed in the diagnosis of epds . to evaluate the trichoscopy features of epds , we carried out a retrospective analysis of vd images obtained in the scalp of ten patients who affected by histopathologically confirmed epds , seen over a period of 7 years at the outpatients consultation of hair diseases of dermatology of the university of bologna . the trichoscopy results obtained from the patients with epds were compared with those obtained from a series of thirty patients who affected by other type of scarring alopecia involving the scalp and clinically presenting with erosions , crusts , pustules , and atrophy . the most specific vd feature was thus represented by evident hair bulb in the scarring scalp , observed in all patients . epds , a rare chronic disorder of unknown etiology , was first described in 1979 by pye et al . epds typically affects elderly people and is clinically characterized by pustules , erosions , and crusts , which heal with scarring alopecia . usually , the diagnosis is pathologically confirmed . scalp pathology excludes other scarring diseases and reveals nonspecific features : massive fibrosis of the dermis with considerable reduction of the hair follicle density and absence of sebaceous glands with a neutrophilic infiltrate present around the hair follicles at the isthmus level . trichoscopy is a new diagnostic tool that permit diagnosing of different types of hair disorders and it has proved very useful in the management of epds , never seen before . we conducted a retrospective study of vd images obttained in the scalp of ten patient ( mean age 50.3 years , range from 8 to 95 ) with a pathological diagnosis of epds made at the outpatient consultation of hair diseases of the university of bologna seen over a period of 7 years . all medical records of patients with a diagnosis of epds made between january 2007 and january 2015 were reviewed . all patients were monitored by global photography and videodermatoscopy ( foto finder dermatoscope , touchscreen software , bad bimbach , germany ) . the clinical examination revealed in all cases areas of scarring alopecia with skin atrophy . the hair was sparse or absent and sometimes irregularly twisted and broken a few millimeters above emergency . the skin of the scalp was severely thin with eroded areas and in eight patients , it showed blood and seropurulent crusts [ figure 1a ] while in two patients , it was diffusely covered by oily scales . clinical ( a ) and videodermoscopy ( b ) of erosive pustular dermatitis of the scalp with evident hair bulb ( 20 ) trichoscopy was performed with high magnifications ( 2070 ) and in incident light , without the use of immersion oil ( dry vd ) . the following vd features were observed : ( a ) atrophic and thin scalp in 8/10 patients ; ( b ) lack of follicular ostia in 7/10 patients ; ( c ) evident superficial blood vessels in 5/10 patients ; ( d ) evident hair bulbs in all cases [ figure 1b ] . the most specific vd feature was thus represented by evident hair bulb in the scarring scalp , observed in all patients ( 100% ) . the presence of atrophic and thin scalp was observed in 8/10 of cases ; lack of follicular ostia was observed in 7/10 of patients while evident superficial blood vessels were observed in half of the patients . the trichoscopy results obtained from the patients with epds were compared with those obtained from a series of thirty patients , taken from our databases , affected by other type of scarring alopecia involving the scalp and clinically presenting with erosions , crusts , pustules , and atrophy . in folliculitis decalvans ( ten patients ) , vd showed the presence of tufted hair , perifollicular pustules , crusting , yellowish tubular scaling , and thin scalp without follicular ostia with twisted and elongated blood capillary loops [ figure 2a ] . in lichen planopilaris ( ten patients ) , vd showed the presence of peripilar casts , thin scalp without follicular ostia with enlarged and concentrically oriented blood vessels [ figure 2b ] . in discoid lupus erythematosus ( ten patients ) , vd showed keratotic plugs , red dots , and atrophic skin without follicular ostia with enlarged arborizing vessels [ figure 2c ] . ( c ) discoid lupus erythematosus ( 20 ) vd is an important diagnostic tool for hair diseases and should be utilized in all patients as it provides important information and may allow diagnosis , avoiding a biopsy . in our series of patients with epds , the clinical features were not always diagnostic , and other scalp disorders producing atrophy and scarring had to be excluded . trichoscopy might be useful in the diagnosis of epds as it shows atrophic and thin scalp , lack of follicular ostia , evident superficial blood vessels , and more specifically , visible hair follicle bulbs . the presence of evident hair bulb in epds has never been reported in the literature and seems unique and diagnostic of this disease . in conclusion , the finding of scarring alopecia with skin thinning and evident hair follicle bulbs is highly suggestive for epds and may avoid a biopsy . this is particularly interesting in epds as it typically affects elderly patients , where performing a biopsy is difficult due to comorbidities and drug intake .
erosive pustular dermatitis of the scalp ( epds ) typically affects elderly people with scarring alopecia . videodermoscopy ( vd ) of the scalp has never been assessed in the diagnosis of epds . to evaluate the trichoscopy features of epds , we carried out a retrospective analysis of vd images obtained in the scalp of ten patients who affected by epds and were compared with those obtained from a series of thirty patients who affected by other type of scarring alopecia . the most specific vd feature was thus represented by evident hair bulb in the scarring scalp , observed in all patients .
osteoarthritis ( oa ) is a systemic condition that may affect single or multiple joints . oa involves degenerative changes in articular cartilage , remodelling of subchondral bone , and limited synovial inflammation . osteoarthritic changes in articular cartilage are associated with progressive proteolytic degradation of the extracellular matrix ( ecm ) , which is composed mainly of type ii collagen and aggrecan . their destruction leads to eventual cartilage loss that is accompanied by phenotypic hypertrophy - related changes in chondrocytes , such as the production of type x collagen ( a marker of hypertrophy ) and upregulation of collagenase mmp-13 , events similar to those seen in the foetal growth plate [ 13 ] . it is generally accepted that net collagen loss in the ecm in oa articular cartilage results from net collagen degradation , which outweighs any increase in collagen synthesis . protein synthesis is a process that consumes substantial energy and , thus , requires sufficient amounts of atp . cellular atp concentrations are controlled by adenosine monophosphate - activated protein kinase ( ampk ) , the expression of which is regulated by the amp / atp ratio [ 5 , 6 ] . in addition , protein synthesis requires amino acids , which are produced by transamination of intermediates of the glycolytic pathway , the pentose phosphate pathway , or the krebs cycle ( citric acid , tricarboxylic acid , tca cycle ) . recently , mitochondrial dysfunction , accompanied by a decrease in ampk expression in oa chondrocytes and in healthy articular chondrocytes in the presence of interleukin- ( il- ) 1 or tumor necrosis factor ( tnf) , has been reported [ 8 , 9 ] . moreover , ampk activators can reverse chondrocyte procatabolic responses . limitations in the required amino acids may , therefore , reduce oa chondrocytes capacity of producing sufficient amounts of collagen even under conditions of high atp availability . ampk expression [ 10 , 11 ] and type ii collagen synthesis [ 12 , 13 ] are increased in healthy chondrocytes under hypoxic conditions . low oxygen tension stimulates hypoxia - inducible factor ( hif ) expression in normal and oa chondrocytes in vitro that accompanies increased expression of ecm - related genes and causes decreased expression of degradation markers and chondrocyte hypertrophy . hif1 induction under normoxic conditions by the hypoxia - mimicking agent and iron chelator o - phenanthroline also reduces mmp-13 and mmp-3 expression but has limited ability to improve matrix synthesis during chondrogenic differentiation in human osteoarthritic articular chondrocytes [ 15 , 16 ] : this might be associated with concomitant inhibition of mitochondrial respiration . in contrast , another iron chelator deferoxamine ( dfo ) is capable of stabilizing hif1 expression while simultaneously improving dental pulp cell repair activity and accelerating wound healing in diabetic rats . the effects of dfo are associated with the upregulation of glycolysis in cancer cells under normoxic conditions [ 20 , 21 ] , and the preservation of respiratory chain cytochrome - c - oxidase subunit concentrations , which might enhance aerobic respiration during hypoxia [ 22 , 23 ] . based on these observations , we hypothesized that dfo treatment of human oa articular cartilage explants might decrease collagen cleavage activity and generation of proinflammatory cytokines and recover an often - altered chondrocyte phenotype by changing the cellular energy balance in favour of improving of mitochondrial function and restoring an anabolic matrix phenotype . in this study , we test this hypothesis in cultured oa cartilage while also examining and comparing whole - body ampk expression by peripheral blood mononuclear cells ( pbmcs ) in oa versus normal patients . the study protocol was approved by the mcgill university and the nasonova research institute of rheumatology ( protocol number 5 , february 17 , 2011 ) committees on the ethics of human research , and informed consent was obtained from all subjects prior to performing the study . human femoral condylar cartilage samples were obtained via total knee arthroplasty from 44 oa patients ( 21 men , mean age 66.2 11.2 years , range 5379 years ; 23 women , mean age 64.4 12.4 years , range 4690 years ) : 7 patients were used for dfo dose - response studies ; 15 patients , to study the inhibition of collagenase cleavage activity caused by dfo ; and 7 patients , to study the effects of dfo on gene expression . knee articular cartilages from another 15 oa patients from whom peripheral blood was also obtained were used to examine ampk gene expression . condylar cartilages from 2 oa patients were used for dfo toxicity studies . as articular cartilage was obtained after joint replacement surgery , the amount of tissue was limited and scarcely sufficient for one assay procedure . therefore , different assays required the use of different patients . all end - stage oa arthroplasty patients had radiological k&l grades of iii or iv , experienced severe pain , and had walking problems ( lameness ) . all of the patients studied fulfilled the oa criteria of the american college of rheumatology . human articular cartilage from 12 healthy individuals ( 10 men , mean age 36.0 7.7 years , range 2545 years ; 2 women , mean age 35.0 2.1 years , range 3437 years ) was obtained less than 12 h postmortem at autopsy from the femoral condylar surfaces of the knee that articulate with the patella . no patient had received chemotherapy , was diagnosed with diabetes , or exhibited lower limb vascular insufficiency . we also examined pbmcs from 15 end - stage oa patients , aged 49 to 71 years ( mean age 56.6 8.9 years ) undergoing knee joint arthroplasty . for the control group , peripheral blood was also obtained from 16 healthy subjects ( average age 58.6 8.3 years , range 4274 years ) who were free of any serious diseases . all oa cartilage samples exhibited macroscopic articular surface differences compared with normal cartilages . to generate sufficient cartilage to perform each patient analysis , all the available articular cartilage from each patient , regardless of the degree of degeneration ( mankin grades 412 ) , was used as we have previously described . for mankin grading of oa articular cartilage the specimens were removed as full - depth ( to subchondral bone ) slices cut from three different pieces from the same knee . articular cartilage specimens with normal cartilage ( as revealed by mankin grade of 1 ) from donors were removed at autopsy as full - depth ( to subchondral bone ) slices cut from the femoral condyle surface that articulates with patella : from medial ( 2 pieces ) and lateral ( 2 pieces ) condyles and from the patella - femoral groove ( 3 pieces ) as shown on supplementary figure ( see supplementary material available online at http://dx.doi.org/10.1155/2016/6432867 ) . the oa articular cartilage was washed three times with high glucose dulbecco 's modified eagle 's medium a ( dmem ; gibco brl , life technologies , grand island , ny , usa ) containing 20 mm hepes buffer ( ph 7.4 ) ( gibco brl ) , 45 mm nahco3 , 100 units / ml penicillin , 100 g / ml streptomycin , and 150 g / ml gentamycin sulfate . full - depth cartilage slices of approximately 20 mm 20 mm were cut vertical to the articular surface and then into cubes . five to seven cubes were randomly obtained and wet weights of approximately 50 mg were distributed into each culture well ( 48-well costar 3548 plate ; corning inc . prior to dfo addition , samples were maintained for 48 h at 37c in 1 ml per well of medium a in 95% air and 5% co2 . final concentrations of 150 m dfo ( sigma ) were freshly added to medium a from day 0 at each medium change every 4 days . cartilage ( triplicate cultures for each analytical point ) was cultured for a total of 16 days and analyzed at day 16 for type ii collagen cleavage by collagenases . the conditioned media were collected every 4 days at each medium change from days 4 to 16 and stored at 20c until analyzed . for gene expression analysis , , after the media change at day 0 , dfo was added in concentrations from 150 m to the oa articular cartilage explants and cultured for 4 days . after the media change , the cartilage was biolabeled by adding 25 ci / ml of tritiated proline or 10 m / ml of tritiated thymidine ( amersham , oakville , ontario , canada ) . the cartilage was then washed 3 times for 1 h each in phosphate buffered saline ( pbs ) to remove any free label . the cartilage was digested overnight with 1 ml proteinase k ( sigma ) at 1 mg / ml in 50 mm tris hcl , ph 7.6 . the digest was mixed with a scintillation fluid ( ready value ; beckman instruments , irvine , ca , usa ) and analyzed with a packard ca 1900 scintillation counter ( meriden , ct , usa ) . oa cartilage explants from day 16 of culture were digested and extracted with -chymotrypsin to solubilize the denatured collagen , including the carboxyterminal neoepitope col2 - 3/4c short ( c1 , 2c ) epitope generated by the cleavage of type ii collagen by collagenase : extracts and media were assayed as described previously by elisa . total cleavage neoepitope in the cartilages and media was calculated using a summation of the data from each medium change and cartilage analysis . the results are expressed as pmoles of the epitope / mg wet weight of cartilage , which is based on a molecular weight of the standard peptide epitope of 608 g / mol . peripheral blood ( 10 ml ) was collected in vacutainer tubes containing ethylenediaminetetraacetic acid ( edta ) ( bdh , england ) . blood samples were taken in a standardized manner in the morning ( between 07:00 am and 09:00 am ) . pbmcs were collected , washed twice in phosphate buffered saline ( pbs ) , and frozen at 70c prior to protein extraction . number kho0651 ) were determined in isolated pbmcs lysates by elisa ( invitrogen , camarillo , ca , usa ) according to the manufacturer 's instructions . lysates were prepared using a cell extraction buffer containing 10 mm tris , ph 7.4 , 100 mm nacl , 1 mm edta , 1 mm egta , 1 mm naf , 20 mm na4p2o7 , 20 mm na3vo4 , 1% triton x-100 , 10% glycerol , 0.1% sds , and 0.5% deoxycholate ( invitrogen , camarillo , ca , usa ) supplemented with protease inhibitor cocktail ( sigma - aldrich , inc . , st . louis , usa ) and 1 mm pmsf ( sigma - aldrich , inc . , st . total dna content in pbmc lysates was measured spectrophotometrically using genequant ( amersham biosciences , united states ) . total rna was isolated from fresh knee articular cartilage and pbmcs using trizol reagent according to the manufacturer 's recommendations ( invitrogen , carlsbad , ca , usa ) . the rt - reaction was performed using a reverta kit containing m - mlv reverse transcriptase , random hexanucleotide primers , and total rna according to the manufacturer 's recommendations ( interlabservice , moscow , russia ) . premade primers and probes for taqman assay ( applied biosystems , foster city , ca , usa ) of human genes were mmp1 ( hs00233958_m1 ) ; mmp-13 ( hs00233992_m1 ) ; cts ( hs00166156_m1 ) ; col10a1 ( hs00166657_m1 ) ; glut1 ( hs00197884_m1 ) ; pgk1 ( hs99999906_m1 ) ; pkm2 ( hs00987255_m1 ) ; idh3 g ( hs00188065_m1 ) ; sdh ( hs01042482_m1 ) ; ogdh ( hs01081865 ) ; mdh2 ( hs00938918_m1 ) ; ampk ( hs01562315_m1 ) ; tnf ( hs00174128_m1 ) ; il-1 ( hs00174097_m1 ) ; col2a1 ( hs00264051_m1 ) ; and hif1 ( hs00936368_m1 ) . quantification of gene expression levels of mrna was conducted using a 7500 real - time pcr system ( applied biosystems , foster city , ca , usa ) . 1 l of rt product was subjected to real - time pcr in a 15 l total reaction mixture containing 7.5 l taqman universal pcr master mix ( applied biosystems , foster city , ca , usa ) , 900 nm sense and antisense primers , and 50 nm probe . after a single step of 50c for 2 min and initial activation at 95c for 10 min , reaction mixtures were subjected to 40 amplification cycles ( 15 s at 95c for denaturation and 1 min of annealing and extension at 60c ) . using a sequence detection system , the threshold cycle ( ct ) after the pcr , dissociation curves were generated with one peak that indicated the specificity of the amplification . a threshold cycle ( ct value ) was obtained from each amplification curve using sds v 1.3 software provided by the manufacturer ( applied biosystems , foster city , ca , usa ) . relative mrna expression was determined using the ddct method , as detailed by the manufacturer guidelines ( applied biosystems , foster city , ca , usa ) . a dct value was calculated by subtracting the ct value for the housekeeping gene -actin from the ct value for each sample . a ddct value was then calculated by subtracting the dct value of the control ( unstimulated cartilage ) from the dct value of each treatment . fold changes compared with the control were determined by raising 2 to the ddct power ( 2 ) . three no template controls were consistently negative for each reaction . to avoid variation in efficiency between the experiments , all the samples of the same cartilage were simultaneously subjected to rt , and the cdna samples were simultaneously amplified using real - time pcr . cartilage obtained from each patient was cultured with or without dfo in triplicate for 48 h. isolated rna was assayed by rt - pcr in duplicate . for the statistical comparison between the ra patient groups before and after treatment , the wilcoxon matched pairs test was applied . previously , dfo was used with chondrocytes in a variety of concentrations ranging from 10 nm to 500 m . therefore , we initially tested 1 to 50 m dfo concentrations for toxicity , examining the effects of the drug on cellular dna and protein synthesis . figure 1 shows examples of these analyses performed on samples from 62-year - old and 81-year - old female oa patients . repeat studies of other patients revealed essentially the same results ; that is , dfo concentrations within this range were not toxic to articular cartilage chondrocytes in explant culture . our analyses of the effect of dfo dose on collagen cleavage revealed that although in one patient , a 5 m dfo downregulated collagenase activity as measured by the c1,2c method , inhibition of activity was observed with 10 m dfo and higher in other patients ( figures 2(a)2(f ) ) and at 10 m dose in a larger cohort of 15 other patients ( figure 2(g ) ) in which a mean inhibition of 43.3% ( range 27.6 to 61.5% ) was noted . for gene expression studies , we examined cartilage explants from 67- , 44- , 63- , 72- , 50- , 57- , and 54-year - old patients , which exhibited significant inhibition of collagenase cleavage ( 55.4 , 60.2 , 54.0 , 45.4 , 43.7 , 48.6 , and 50.4% , resp . ) . mankin grading of the examined oa cartilages has revealed values of 8.6 , 10 , 9,6 , 10,3 , 9 , 7.3 , and 7 , respectively . compared with the controls , when cultured in the presence of 10 m dfo , the oa explants from all 7 patients exhibited reduced expression of mmp-1 ( figures 3(a)3(g ) , table 1 ) . the expression of the collagenase mmp-13 was downregulated in 6 of the 6 patients examined ; the gene related to chondrocyte hypertrophy , col10a1 , in 7 of 7 subjects ; and protease cathepsin k expression was reduced in 3 of 6 patients . in all patients examined , the gene expressions of the proinflammatory cytokines il-1 and tnf were downregulated by dfo . in contrast , expression of col2a1 ( 5 of 7 ) and hif1 ( 6 of 7 ) was upregulated in the same oa explants , although one patient exhibited decreased hif1 and col2a1 gene expression ( figures 3(a)3(g ) , table 1 ) and another patient exhibited no change in col2a1 expression . dfo had no effect on the expression of the glucose transporter glut1 in 3 of 7 patients ( figures 4(a)4(g ) , table 1 ) . pyruvate kinase ( pkm2 ) , an atp - producing gene involved in glycolysis , was downregulated in 2 of 7 patients , was upregulated in 3 patients , and showed no changes in other subjects ( 2 of 7 ) . another glycolysis gene associated with atp generation , phosphoglycerate kinase 1 ( pgk1 ) , was upregulated in 4 of 7 oa patients and downregulated in 3 of 7 cases in the presence of dfo . regarding the genes involved in atp generation in the tca cycle , dfo upregulated malate dehydrogenase ( mdh2 ) gene expression in 7 of 7 oa patients and succinate dehydrogenase ( sdh ) gene expression in all of the same patients . isocitrate dehydrogenase ( idh3 g ) ( 5 of 6 ) and 2-oxo - glutarate dehydrogenase ( ogdh ) ( 6 of 7 ) were increased in most patients in response to dfo treatment ( figures 4(a)4(g ) , table 1 ) . we also observed upregulation of ampk gene expression in 6 of 7 patients ( figures 4(a)4(g ) ) . the mean and sd values for these gene expression analyses are shown in figures 3(h ) and 4(h ) where the interrelationships of these dfo effects can be more clearly observed . overall , dfo significantly reduced the expression of collagenases mmp-1 , mmp-13 , cytokines il-1 and tnf , and col10a1 , while stimulating succinate dehydrogenase , 2-oxo - glutarate dehydrogenase , malate dehydrogenase , ampk , col2a1 , and hif1. gene expression of isocitrate dehydrogenase was also upregulated , but not significantly ( p = 0.09 ) ( figure 4(h ) ) . a comparison of the expression of ampk in oa articular cartilages ( n = 15 ) with that in healthy subjects ( n = 12 ) revealed significant downregulation from oa patients ( figure 5 ) . in contrast , pbmcs of the same 15 oa patients exhibited a significant upregulation of ampk gene expression compared to age- and gender - matched healthy controls ( n = 16 ) . moreover , gene expression results for pbmcs were confirmed by examination of ampk protein , which again revealed significantly higher ampk protein concentrations in oa patients ( n = 15 ) compared to healthy subjects ( n = 16 ) . it has been shown previously that downregulation of collagen cleavage in oa articular cartilage is associated with inhibition of inflammation , mmp expression , chondrocyte hypertrophy , and activation of ampk [ 8 , 25 , 30 ] . even in vivo , collagen cleavage in experimental oa can be reduced by inhibition of either mmp activity or chondrocyte hypertrophy [ 31 , 32 ] favouring matrix repair . other studies have reported that expression of ecm - related genes could be stimulated in a hypoxic environment via improved mitochondrial energy balance [ 1214 ] . therefore , we were interested in determining whether inhibition of collagen cleavage is related to increases in gene expression associated with collagen repair in an oa cartilage explant model and how this effect relates to energy metabolism . towards this end , we studied the effects of dfo , which upregulates hif1 and glycolysis , improving aerobic respiration and tissue repair [ 1823 ] . we conducted our studies under normoxic conditions because previous studies have shown that dfo is capable of upregulating hif1 expression under conditions of normal oxygen tension [ 20 , 21 ] . besides , at low oxygen concentrations these effects might be due to a hypoxic response . at the same time , the observation that intracellular pampk concentrations are equal at 20% and 5% o2 in porcine articular chondrocytes is important , as we wished to examine ampk gene expression . furthermore , we used a high glucose dmem to provide glucose saturation to maintain high glycolytic activity , as oa chondrocytes have been shown to acquire atp primarily via glycolysis . using this model , we show that dfo is capable of inhibiting excessive collagen cleavage in cultured human oa articular cartilage explants . this inhibition is accompanied by downregulation of collagenases mmp-1 and mmp-13 ; the cytokines il-1 and tnf ; and col10a1 , a marker of chondrocyte hypertrophy . at the same time , we also observed significant increases in hif1 and type ii collagen ( col2a1 ) gene expression accompanied by upregulation of ampk and tca - related genes . the products of tca - related genes may provide precursors for amino acid synthesis in the same oa articular cartilage explants . this may be important given that oa articular cartilage exhibits a significant inhibition of autophagy , a process involving the degradation and recycling of dysfunctional organelles and cellular breakdown products with the release of the resulting macromolecules back into the cytosol [ 3537 ] . an increase in idh3 g in response to dfo is also important , as oxidative decarboxylation of isocitrate produces 2-oxoglutarate , a proline precursor , posttranslational hydroxylation of which is required for collagen synthesis . therefore , the observed increases in ampk gene expression in 6 of 7 patients may be associated with elevated energy expenditure for protein synthesis , as evidenced by col2a1 upregulation . upregulation of ampk expression may be pivotal for articular cartilage anabolic functions and restoration of a prehypertrophic chondrocyte phenotype as ampk upregulation associated with oa articular cartilage repair was previously reported . although inhibition of collagen cleavage by dfo was associated with anticatabolic and anti - inflammatory effects in all of the oa patients studied , alterations in the expression of other genes varied . the general trend was observed in two patients aged 67 years old and 44 years old . in 72-year - old , 57-year - old , and 54-year - old patients , an increase in col2a1 expression was associated with upregulation of hif1 and its target genes glut1 and pgk1 . the latter genes are involved in glycolysis , which could also provide the amino acids required for protein synthesis via the pentose phosphate cycle , as observed in some types of cancer . in contrast , in a 63-year - old patient , hif1 upregulation was accompanied by no change in col2a1 expression that resembled the chondrocyte response to o - phenanthroline treatment [ 15 , 16 ] . this result may be associated with a shortage in proline precursors due to the disturbance in idh3 g expression , which was not detected in explants obtained from this patient . finally , in a 50-year - old oa patient , downregulation of col2a1 , hif1 , and idh3 g gene expression in response to dfo was associated with no change in ampk expression , although tca - related sdh and mdh2 genes were upregulated . variability of patient responses to treatment tested in articular cartilage explants was also observed by us previously and might be due to differences in oa pathology [ 27 , 40 ] . however , the assessment of mean values in a group of patients might help to understand the general trend of the drug action . if upregulation of ampk , hif1 , and tca - related gene expression is pivotal for promotion of collagen repair , then this is a testable hypothesis in future studies . although inflammation is believed to drive collagen cleavage in oa articular cartilage , we observed that il-1 and tnf downregulation was not always accompanied by decrease in expression of all the proteases in different patients . for example , in earlier oa studies of human articular cartilages , we observed differences between patients in the activities of different collagenases based on differential responses to a selective collagenase inhibitor . in addition , previously we noted that joint destruction activity is more difficult to inhibit than inflammation . interpretation of these observations is complicated by the presence of chondrocytes of an altered phenotype , reflected in part by the proliferative changes characterized by the cell clusters seen in degraded articular cartilage , particularly in advanced oa , and by chondrocyte hypertrophy characterized by expression of col10a1 . furthermore , these clusters can also contain mesenchymal stem cells , again with distinct metabolomes [ 4345 ] . but since it is possible to reverse this hypertrophic phenotype of chondrocytes in association with inhibition of collagen degradation , as we have shown here , there is arguably potential to explore the shift of the phenotype to one where matrix anabolism is emphasized over matrix catabolism . unfortunately , we do not have access to obtain sufficient numbers of specimens to conduct studies on dfo effects on normal human articular cartilage . these studies should be definitely conducted in future . as we studied cartilage specimens from oa patients , what we are interested in is whether dfo can regulate molecular events that have previously been shown to be a feature of oa pathology . additional studies involving degrading articular cartilages from patients with other pathologies are required to examine this possibility . different types of behavior for ampk in the peripheral blood and articular cartilage in oa patients compared to healthy controls are not a unique phenomenon as previously a similar type of behavior was observed in case of autophagy - related ulk1 gene expression in the end - stage oa patients . interestingly , both genes are associated with mtor ( mechanistic target of rapamycin ) regulation : ampk is an mtor inhibitor while an increase in autophagy is associated with mtor inhibition upon cell growth cessation . mtor is a key regulator of cell growth and proliferation , which integrates contributions from amino acids , growth factors , and molecules involved in energy status of the cell and is upregulated in both the articular cartilage and the peripheral blood of the end - stage oa patients . therefore , our observations suggest that oa articular cartilage maintained normal regulatory behavior while in the pbmcs this regulation might be disturbed as mtor , ampk , and ulk1 gene expressions are all upregulated compared to healthy subjects . our observation that reduced ampk gene expression in oa articular cartilage is accompanied by its high expression in pbmcs in the same oa patients compared to healthy subjects suggests that whole - body energy availability and that in articular cartilage can differ in oa patients . this might induce an energy appeal reaction , a process that involves the redirection of energy - rich fuels from energy sources , such as articular cartilage in oa , as indicated by studies of the activated immune system [ 4 , 50 ] . as catabolic pathways are responsible for energy provision , the excessive cartilage degradation seen in oa might represent an energy - rich compartment for further energy relocation to specific body sites , such as the immune system . in summary , our studies demonstrate that dfo is capable of suppressing excessive collagenase - mediated type ii collagen cleavage in oa cartilage and reversing phenotypic changes . the concomitant upregulation of proanabolic tca - related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end - stage oa chondrocytes . this might normally be prevented by strong whole - body energy requirements indicated by elevated ampk expression in pbmcs of oa patients . further studies on the involvement of chondrocyte energy metabolic alterations in oa might provide new approaches for better disease control .
this study reports the effects of the iron chelator deferoxamine ( dfo ) on collagen cleavage , inflammation , and chondrocyte hypertrophy in relation to energy metabolism - related gene expression in osteoarthritic ( oa ) articular cartilage . full - depth explants of human oa knee articular cartilage from arthroplasty were cultured with exogenous dfo ( 150 m ) . type ii collagen cleavage and phospho - adenosine monophosphate - activated protein kinase ( pampk ) concentrations were measured using elisas . gene expression studies employed real - time pcr and included ampk analyses in pbmcs . in oa explants collagen cleavage was frequently downregulated by 1050 m dfo . pcr analysis of 7 oa patient cartilages revealed that 10 m dfo suppressed expression of mmp-1 , mmp-13 , il-1 , and tnf and a marker of chondrocyte hypertrophy , col10a1 . no changes were observed in the expression of glycolysis - related genes . in contrast , expressions of genes associated with the mitochondrial krebs cycle ( tca ) , ampk , hif1 , and col2a1 were upregulated . ampk gene expression was reduced in oa cartilage and increased in pbmcs from the same patients compared to healthy controls . our studies demonstrate that dfo is capable of suppressing excessive collagenase - mediated type ii collagen cleavage in oa cartilage and reversing phenotypic changes . the concomitant upregulation of proanabolic tca - related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end - stage oa chondrocytes . this might normally be prevented by high whole - body energy requirements indicated by elevated ampk expression in pbmcs of oa patients .
alveolar bone height is the distance between the cement - enamel junction ( cej ) and the alveolar bone crest ( abc ) , along a line parallel to the long axis of the tooth . this distance indicates whether there is alveolar bone loss ( abl ) and bone alterations due to periodontal disease . although studies showed considerable variation in this distance , from 0 to 3 mm , a 2 mm distance is more often adopted as the norm for patients without periodontal disease . the diagnosis of periodontal diseases requires a careful clinical examination that takes into account the clinical history and associated signs and symptoms . in addition , radiographic examination is a fundamental tool to assess morphological and pathological changes in the periodontium , to assist the diagnosis , treatment planning , and prognosis of periodontal diseases . the most used radiographic methods in the diagnosis of periodontal diseases are panoramic radiography , bitewings and periapical radiography , despite their limitations - subjectivity of interpretation , image overlapping , and reduced sensitivity in detecting marginal bone changes . constant technological development brought into dentistry other important imaging methods , such as digital radiography and cone - beam computed tomography ( cbct ) . digital radiographic methods facilitate clinical practice , given that they eliminate chemical processing , reduce radiation exposure , and the images can be manipulated with the use of software . this possibility of enhancing digital images optimizes diagnosis , unlike the static images of conventional films , which can not be manipulated or enhanced . however , as the geometry of digital images is still in two - dimension , the interpretation of intraoral and panoramic radiography do not benefit greatly from this aspect . cone - beam computed tomography , on the other hand , provides images with excellent quality and accuracy , the structures can be seen in three - dimension at any angle , which allows analysis without distortion , and measurement of bone loss even of the buccal and lingual / palatal faces , a possibility not possible with other types of images . assert that only about 3% of current studies in dentistry examine the applications of cbct in periodontics . the aim of this in vitro study was to evaluate the diagnostic accuracy of conventional periapical radiography taken with film holders rinn and han - shin , digital periapical radiography with complementary metal - oxide semiconductor sensor ( cmos ) , panoramic radiography , and cbct in the measurement of abl . the study was approved by the institutional review board / independent ethics committee of the state university of maring ( protocol 0655142.7.0000.0104 ) . the sample consisted of 70 teeth from 10 macerated human mandibles of the university 's department of morphophysiology sciences , each mandible with varied number of teeth . the control method of measuring abl consisted of determining the linear distance between the cej and the abc on the interproximal surface of the teeth ( the cej - abc distance ) , with the use of a digital calliper accurate to 0.01 mm ( lee tools , rio de janeiro , brazil ) . the experimental methods consisted of measuring abl using conventional periapical radiography with film holders ( rinn xcp and han - shin ) , digital periapical radiography with cmos , panoramic radiography , and cbct [ figure 1 ] . for better standardization were placed in small metal spheres in the cej and another peak of the abc . ( e ) panoramic radiography conventional periapical radiographs were obtained using the paralleling technique with rinn xcp film holder ( dentsply , usa ) at a 40 cm focal length , and bisecting technique with han - shin film holder ( maquira , maring , brazil ) at a 20 cm focal length . particular care was taken in order to minimize discrepancies among radiographs , by standardizing the geometrical projection of the x - rays , the alignment of the images , and contrast and density of the images . the bitewing technique was not performed because abl was extensive in some teeth and could cut in the image . digital periapical radiographs were taken with the film holder provided by kodak rvg 6100 digital radiography system ( carestream health , rochester , ny , usa ) . the digital periapical radiographs was measured using the equipment 's own software ( kodak dental imaging 6.1 , carestream health , rochester , ny , usa ) . panoramic radiographs were obtained with a conventional x - ray machine ( orthoralix 9200 gendex , dentsply , des plainnes , usa ) using kodak t - mat g / ra films ( 15 30 cm , carestream health , new york , usa ) with their metallic cassette and intensifying screen ( kodak lanex medium extraoral imaging screens x - omat ) . using alignment lights , the mid sagittal plane of the mandibles was positioned perpendicularly to the ground and the occlusal plane parallel to the ground . calibration of panoramic radiography , conventional and digital periapical radiography was made using an aluminum step wedge ( 8 steps ) with 1 mm increment and 5 mm thickness . conventional radiographs were processed in an automatic processor ( revell x - tec , londrina , paran , brazil ) . cone - beam computed tomography images were obtained using an i - cat scanner ( hatfield , pa , usa ) . for most favorable detailing of root structures , the study used a 14-bit grey scale , field of view of 6 cm , voxel of 0.125 mm , and 36.2 mas exposure time . all radiographic and tomographic images were taken by the same operator , a specialist in dentomaxillofacial radiology . panoramic radiographs and conventional periapical radiographs were digitized using a scanner and a transparency adaptor ( hp scanjet g4050 , hewlett - packard company , washington , usa ) with optical scanning resolution of up to 4800 dpi . conventional radiographs were scanned at a resolution of 300 dpi and archived in uncompressed tagged - image file format ( tiff ) . the tiff format is the best image format for digitized images , as if it were transformed into digital imaging and communications in medicine ( dicom ) the details will be lost . alveolar bone loss from digitized conventional periapical radiographs and digitized panoramic radiographs was measured using image tool 3.00 software ( university of texas health sciences center , san antonio , texas , usa ) , according to grdal et al . the best image format using for cbct images [ figure 2 ] , abl was measured using the equipment 's own software ( i - cat vision , imaging sciences international , llc , pennsylvania , usa ) . measurements were made parallel to the long axis of the tooth , on the proximal surfaces . means ( in mm ) of different radiographic methods file formats were determined by the image generated by the programs , except the conventional radiographs that had to be scanned format , that tiff considered best for scanned images was used . we chose to use the best file format and better resolution for each image type . all measurements were made by a single radiologist , experienced with the use of the mentioned programs , a specialist in dentomaxillofacial radiology , and were analyzed again with a 1 week interval between them . intra - examiner coefficient was 0.843 , the strength of agreement was very good according altman [ table 1 ] , nevertheless the means of these two measurements were used for statistical analysis for greater reliability . data were subjected to anova and tukey 's test at 5% significance level , using graphpad prism 6.0 ( graphpad software , san diego , ca , usa ) and minitab 15.0 ( minitab inc , state college pa , usa ) . the highest means of vbl were found for the actual measures using the calliper , the control method , and for the cbct images , whereas the lowest ones values were for the images taken with the film holder han - shin [ table 2 and figure 1 ] . mean and sd of abl of different types of radiographic methods ( n=70 ) multiple comparisons of means using tukey 's test revealed that statistical differences [ table 3 ] were between control method and periapical using han - shin film holder ( p < 0.001 ) , but not between control and the other methods . the results of cbct were different from those of panoramic radiographs ( p = 0.0130 ) , periapical with rinn xcp film holder ( p = 0.0066 ) , periapical with han - shin film holder ( p < 0.0001 ) , and digital periapical radiographs ( p = 0.0027 ) . digital periapical differed from periapical with han - shin film holder ( p = 0.0004 ) . radiographic examination , along with clinical examination , is essential in the diagnosis of periodontal diseases , in determining their prognosis , and in assessing treatment outcome . due to its relevance , this study aimed to evaluate the best radiographic method for measuring abl . in this study the results of periapical radiographs using the rinn xcp film holders and han - shin were different from those forsberg and halse and hayashi et al . although these authors concluded that both film holders show comparable accuracy if han - shin is correctly used and set at the right angle for the bisecting technique , they found that the paralleling technique is , in general , more accurate . in this study langlois cde et al . who found that periapical radiographs and panoramic images showed similar accuracy , in the present study panoramic radiographs ( mean 2.664 ) were more accurate to detect abl than periapical using han - shin film holder ( mean 2.224 ) . however , compared with the control results the panoramic images were close , so indicating the panoramic as an initial test for the evaluation of abl . in this respect , cbct showed the most accurate abl measurements , not statistically different from the control method . , vandenberghe et al . , grimard et al . , and mol and balasundaram who compared cbct images with digital radiography in the detection of intrabony defects . the authors used two measurements - from the cej to the bottom of the bone defect ( cej - bd ) , and cej - abc . they found that both cbct and digital radiography had similar means for cej - abc , whereas for cej - bd digital radiography showed a discrepancy of 1 - 2 mm from the actual means , with cbct being more accurate to assess bd . mengel et al . compared different radiographic methods for accuracy and quality of the representation of bds . they found more accuracy for cbct , the images in three plans with no overlapping or distortion . the scholars evaluated cbct and panoramic radiography , quantitatively and qualitatively , and concluded that cbct images were more accurate to evaluate anterior mandibular area . the comparison between cbct with periapical radiographs showed , again , that cbct is more accurate in detecting and locating abl , as de faria vasconcelos et al . also found . in contrast , misch et al . , who used cbct , periapical radiography , periodontal probe , and an electronic calliper as the standard reference , found no difference between cbct and periapical images in the detection of interproximal bds . however , misch et al . also found that cbct , but not periapical radiography , was able to detect buccal and lingual defects . as conventional radiography can not assess the buccal and lingual surfaces , the present study opted to measure the interproximal surfaces , which allows the comparison among different radiographic methods . given the present research , it is clear that for interproximal bds cbct is not necessary given the fact that other techniques provide satisfactory accuracy except conventional periapical radiography using han - shin film holder . within the limitations of this study , compared with the control measurements , only conventional periapical radiography using han - shin film holder showed significant lower differences , whereas the values of cbct were the closest to the control method .
background : to evaluate the diagnostic accuracy of different radiographic methods in the assessment of proximal alveolar bone loss ( abl).materials and methods : abl , the distance between cement - enamel junction and alveolar bone crest , was measured in 70 mandibular human teeth directly on the mandibles ( control ) , using conventional periapical radiography with film holders ( rinn xcp and han - shin ) , digital periapical radiography with complementary metal - oxide semiconductor sensor , conventional panoramic , and cone - beam computed tomography ( cbct ) . three programs were used to measure abl on the images : image tool 3.0 ( university of texas health sciences center , san antonio , texas , usa ) , kodak imaging 6.1 ( kodak dental imaging 6.1 , carestream health , rochester , ny , usa ) , and i - cat vision 1.6.20 . statistical analysis used anova and tukey 's test at 5% significance level.results:the tomographic images showed the highest means , whereas the lowest were found for periapical with han - shin . controls differed from periapical with han - shin ( p < 0.0001 ) . cbct differed from panoramic ( p = 0.0130 ) , periapical with rinn xcp ( p = 0.0066 ) , periapical with han - shin ( p < 0.0001 ) , and digital periapical ( p = 0.0027 ) . conventional periapicals with film holders differed from each other ( p = 0.0007 ) . digital periapical differed from conventional periapical with han - shin ( p = 0.0004).conclusions : conventional periapical with han - shin film holder was the only method that differed from the controls . cbct had the closest means to the controls .
acute oxalate nephropathy ( aon ) in cases of secondary oxalosis is the result of excessive oxalate accumulation because of increased ingestion , increased production , or decreased excretion of oxalate . the kidney is the primary organ for oxalate excretion and increased oxalate load may result in renal insufficiency . increased dietary intake of oxalate is fairly uncommon ; however , there have been case reports in the literature describing excessive intake of star fruit ( averrhoa carambola ) juice and peanut intake leading to oxalate nephropathy . irumban puli ( averrhoa bilimbi ) is a local fruit in south india which has high oxalic acid content . excessive ingestion of fruit juice can lead to increased serum oxalate level which can cause deposition of calcium oxalate crystals in renal tubules and cause acute renal failure ( arf ) . we present a series of cases from five hospitals in the state of kerala who developed arf due to aon after consumption of i. puli juice . a 38-year - old man , who was working abroad and came to india on a vacation , underwent a health check up , which showed normal renal functions and hypercholesterolemia . he consumed a glass of i. puli fruit juice daily for 4 days for control of hypercholesterolemia . after 4 days , the patient developed abdominal discomfort , nausea , and loss of appetite . he presented to our center with the above - mentioned symptoms ; he had normal urine output . on examination , the patient was conscious , oriented , blood pressure 150/90 mmhg ; he had no edema , and his systems were normal . investigations showed severe renal failure with serum creatinine of 6.4 mg / dl , with normal hemogram and liver function tests ; urine analysis showed no albuminuria , and microscopy showed oxalate crystals . the patient underwent two sessions of hemodialysis , following which a left percutaneous kidney biopsy was done . kidney biopsy showed acute tubular necrosis with many polarizable fractured crystals in the tubular lumina ( calcium oxalate crystals ) [ figure 1a and b ] . the oxalate content of the fruit was 25.1 mg per 100 g of the fruit , when analyzed in our lab by spectrophotometry method . his renal functions improved to normal in 6 weeks ( serum creatinine : 0.9 mg / dl ) . ( a ) renal tubules showing features of acute tubular necrosis with fractured crystals in the lumen ( lm : h and e , 40 ) , tubules with necrosis ( bold arrow ) , intratubular fractured crystals ( thin arrow ) ; ( b ) calcium oxalate crystals under polarized light ( arrow ) ; ( c ) urine microscopy showing calcium oxalate crystals ( envelope - shaped ) a 57-year - old man , known to have type 2 diabetes mellitus ( on diet control ) and dyslipidemia ( on statins ) presented to us with a history of anorexia , nausea , and fatigue for 2 weeks after intake of i. puli fruit juice for 5 days ; he was oliguric . he had a normal hemogram , with serum creatinine : 9.3 mg / dl , serum cholesterol : 180 mg / dl . urine analysis showed 1 + protein , and microscopic examination of the urine sample showed plenty of oxalate crystals . he was initiated on hemodialysis and subsequently underwent a left percutaneous kidney biopsy which showed acute tubular necrosis with intra tubular calcium oxalate crystals . eight out of 10 patients had plenty of oxalate crystals in urine ; all the patients had severe renal failure with serum creatinine ranging from 5.5 to 12.3 mg / dl . seven patients required hemodialysis in view of severe renal failure ; the remaining three patients were treated conservatively and renal functions returned to normal . all the patients showed acute tubular necrosis with polarizable tubular crystals consistent with oxalate crystals [ figure 1 ] . the time taken for serum creatinine to reach the normal level ranged from 2 to 6 weeks . a 38-year - old man , who was working abroad and came to india on a vacation , underwent a health check up , which showed normal renal functions and hypercholesterolemia . he consumed a glass of i. puli fruit juice daily for 4 days for control of hypercholesterolemia . after 4 days , the patient developed abdominal discomfort , nausea , and loss of appetite . he presented to our center with the above - mentioned symptoms ; he had normal urine output . on examination , the patient was conscious , oriented , blood pressure 150/90 mmhg ; he had no edema , and his systems were normal . investigations showed severe renal failure with serum creatinine of 6.4 mg / dl , with normal hemogram and liver function tests ; urine analysis showed no albuminuria , and microscopy showed oxalate crystals . the patient underwent two sessions of hemodialysis , following which a left percutaneous kidney biopsy was done . kidney biopsy showed acute tubular necrosis with many polarizable fractured crystals in the tubular lumina ( calcium oxalate crystals ) [ figure 1a and b ] . the oxalate content of the fruit was 25.1 mg per 100 g of the fruit , when analyzed in our lab by spectrophotometry method . his renal functions improved to normal in 6 weeks ( serum creatinine : 0.9 mg / dl ) . ( a ) renal tubules showing features of acute tubular necrosis with fractured crystals in the lumen ( lm : h and e , 40 ) , tubules with necrosis ( bold arrow ) , intratubular fractured crystals ( thin arrow ) ; ( b ) calcium oxalate crystals under polarized light ( arrow ) ; ( c ) urine microscopy showing calcium oxalate crystals ( envelope - shaped ) a 57-year - old man , known to have type 2 diabetes mellitus ( on diet control ) and dyslipidemia ( on statins ) presented to us with a history of anorexia , nausea , and fatigue for 2 weeks after intake of i. puli fruit juice for 5 days ; he was oliguric . he had a normal hemogram , with serum creatinine : 9.3 mg / dl , serum cholesterol : 180 mg / dl . urine analysis showed 1 + protein , and microscopic examination of the urine sample showed plenty of oxalate crystals . he was initiated on hemodialysis and subsequently underwent a left percutaneous kidney biopsy which showed acute tubular necrosis with intra tubular calcium oxalate crystals . eight out of 10 patients had plenty of oxalate crystals in urine ; all the patients had severe renal failure with serum creatinine ranging from 5.5 to 12.3 mg / dl . seven patients required hemodialysis in view of severe renal failure ; the remaining three patients were treated conservatively and renal functions returned to normal . all the patients showed acute tubular necrosis with polarizable tubular crystals consistent with oxalate crystals [ figure 1 ] . the time taken for serum creatinine to reach the normal level ranged from 2 to 6 weeks . arf can occur as a result of acute oxalate nephropathy due to the deposition of calcium oxalate crystals within the renal tubules . primary hyperoxaluria is a group of autosomal recessively inherited enzyme deficiencies that lead to the increased urinary excretion of oxalate . in type 1 primary hyperoxaluria , there is a reduction of alanine glyoxylate aminotransferase activity in the liver , leading to an accumulation of oxalate . type 2 primary hyperoxaluria occurs due to a mutation of glyoxylate reductase / d - glycerate dehydrogenase , leading to the excretion of increased amounts of l - glyceric acid as well as oxalate . secondary hyperoxaluria can occur due to increased dietary intake of oxalate , increased absorption of oxalate from the bowel ( also known as enteric hyperoxaluria ) , and increased production of oxalate . enteric hyperoxaluria results mainly from fat malabsorption , which leads to increased absorption of soluble oxalate from the colon . this reduces the normal calcium oxalate precipitation in the feces , thereby allowing the absorption of soluble oxalate from the gut . enteric hyperoxaluria occurs in orlistat therapy , roux - en - y gastric bypass surgery , celiac disease , and crohn 's disease . increased production of oxalate is mainly due to increased levels of oxalate precursors , more commonly glyoxylate , which is associated with ethylene glycol ingestion , and less commonly ascorbic acid . a. bilimbi ( commonly known as bilimbi , i. puli , chemmeen puli , bimbul ) is a fruit - bearing tree of the genus averrhoa , family oxalidaceae . the fruits are fairly cylindrical with five broad rounded longitudinal lobes , and are produced in clusters [ figure 2 ] . a. bilimbi fruits are very sour , and are used in the production of vinegar , wine , pickles , jams , and jellies and in the preparation of south indian dishes . averrhoa bilimbi tree with fruits a. bilimbi had been advocated for the treatment of hyperlipidemia , hypertension , and diabetes by different communities . in indonesia , the fruit is used to treat hypertension and the decoction of the leaves is used for the management of diabetes . in india , the leaves , flowers , and fruits have been used by some communities to treat hypercholesterolemia , hypertension , and diabetes . in rats the fruit is also used to treat tinea versicolor , beri - beri , cough , mumps , rheumatism , and scurvy . the high levels of oxalic acid found in bilimbi are probably responsible for its extremely low ph ( 0.9 - 1.5 ) . the oxalate content of the fruit was found to be 25.1 mg/100 g of fruit when analyzed in our lab ; this is very high compared to other fruits [ table 2 ] . oxalate content of various fruits various renal and neurological side effects like muscle weakness , intractable hiccups , mental confusion , seizures after ingestion of star fruit ( a. carambola ) have been documented . a. bilimbi , which belongs to the same family , causing acute tubular necrosis due to high oxalate content has not been described before . oxalic acid has a direct toxic effect on the renal tubules and interstitium , facilitates the development of oxalate crystals which are endocytosed by renal epithelial cells and promote a proliferative response . these crystals also stimulate specific genes in renal tubular cells , including the connective tissue growth factor gene leading to interstitial fibrosis . i. puli ( a. bilimbi ) is a traditional ingredient of various south indian dishes , and is also used in various other south east asian countries as a local remedy for various ailments like hypertension , diabetes , and dyslipidemia . when used in high concentrations , the fruit juice can lead to arf due to acute tubular necrosis , owing to its high oxalate content , which results in intratubular oxalate crystal deposition . we conclude that it is not safe to consume high oxalate - containing fruits in large quantities .
irumban puli ( averrhoa bilimbi ) is commonly used as a traditional remedy in the state of kerala . freshly made concentrated juice has a very high oxalic acid content and consumption carries a high risk of developing acute renal failure ( arf ) by deposition of calcium oxalate crystals in renal tubules . acute oxalate nephropathy ( aon ) due to secondary oxalosis after consumption of irumban puli juice is uncommon . aon due to a. bilimbi has not been reported before . we present a series of ten patients from five hospitals in the state of kerala who developed arf after intake of i. puli fruit juice . seven patients needed hemodialysis whereas the other three improved with conservative management .
a 57-year - old male patient presented with a sudden onset of low back pain radiating to the left lower leg after running on a treadmill . magnetic resonance imaging revealed a posterior herniated ruptured disc between the fourth and fifth vertebrae in the lumbar spine . a neurosurgeon evaluated the patient 's condition , which indicated the need for a microdiscectomy of the left l4-l5 intervertebral disc . an emergency operation was decided because the patient complained of severe pain and numbness . inside the operating room , the non - invasive blood pressure ( nibp ) , electrocardiography ( ecg ) and pulse oximeter ( spo2 ) were connected to the patient . general anesthesia was induced with propofol 120 mg and endotracheal intubation was facilitated using rocuronium 60 mg as a muscle relaxant . anesthesia was maintained with desflurane in a 50% n2o and o2 mixture , and rocuronium . the lungs were ventilated mechanically with a semiclosed circuit system to maintain the end - tidal co2 ( etco2 ) at approximately 35 mmhg . intraoperative monitoring included the heart rate , nibp , ecg , spo2 , etco2 , anesthetic gases analysis and the airway pressures . a sudden spurt of blood occurred when the disc was almost completely removed . as the blood continued to gush out , the systolic bp decreased to 50 mmhg , the nibp was not detectable and patient began to have tachycardia ( 156 bpm ) . three 16 g cannulas were quickly secured on the dorsum of the other hand and both external jugular veins . arterial cannulation was achieved with a 20 g cannula on the left radial artery . under the suspicion of a large vessel injury , the laminectomy wound was closed immediately and the patient was turned to the supine position for a laparotomy . at that time , the patient showed an inflating abdomen . a 16 g double lumen central line was placed in the right internal jugular vein and fluids were infused . dopamine and dobutamine infusions were started but they had no effect , so a norepinephrine infusion was also started . the neurosurgeons , anesthesiologists and cardiothoracic surgeons agreed about the necessity of cardiopulmonary bypass ( cpb ) due to the suspicion of severe bleeding from an iatrogenic large vessel injury . a right iliac artery injury was suspected so the left femoral artery and vein were used for cannulation . an arterial cannula was cannulated into the left femoral artery , with a flow of 2,000 ml / m / min , and partial cpb was started . , a wedge - shape rent was found in the right external iliac artery around the l4 - 5 level . during the operation , the intravascular volume was replaced with 9 liters of crystalloid , 0.5 liters of colloid , 18 units of packed red blood cells , 14 units of fresh frozen plasma and 8 units of platelet concentrates . as soon as the external iliac artery injury had been repaired , the hemodynamic parameters of the patient began to improve . after the bleeding was controlled , and the cpb was stopped , and protamine ( 185 mg ) was administrated . postoperatively , the patient was sent intubated and ventilated to the intensive care unit ( icu ) . in the icu , the patient was extubated on the fourth postoperative day . under the appropriate treatment for seven days four weeks later , the patient was discharged from hospital neurologically intact and with a healthy laparotomy wound . the aorta is ventral to the vertebral column , which transverses the diaphragm at the level of the l1 intervertebral space and bifurcates at the level of the l4 intervertebral space into the common iliacs . the inferior vena cava is located to the right of the aorta in these segments , and is divided further into left and right common iliac veins , also at the level of the l4 intervertebral space . the incidence of major vascular injury during lumbar disc operations is 0.01 - 0.05% with an overall mortality of 10 - 65% [ 2 - 4 ] . the broad range of the mortality is associated with the diameter of the injured vessels , size of the tear , speed of diagnosis , laparotomy and control of bleeding . many factors predisposing the patients to vascular injury during lumbar surgery have been reported , including anterior disc rupture , preexisting defects in the anterior annulus fibrosus and anterior longitudinal ligaments , vertebral anomalies , body habitus , patient positioning , use of different techniques , use of a surgical microscope , prior intraabdominal surgery , surgery for recurrent disc herniation , and the surgeon 's experience . major vascular injuries can manifest as acute life - threatening hemorrhage , chronic arteriovenous fistula or pseudoaneurysm formation . acute blood loss can lead to an intractable and progressive decrease in blood pressure due to hypovolemia , wide pulse pressure , tachycardia , a decrease in haematocrit , pallidness , and a decrease in skin temperature . an arteriovenous fistula and aneurysms may often be undetected initially and patients may present with symptoms months or years later . the mortality rate for lacerations , the most common injury among them is on the right common iliac artery , which is located immediately anterior to the l4-l5 lumbar disc space . next in order of frequency is an arteriovenous fistula between the right common iliac artery and left common iliac vein . the most common surgical techniques for repair of these complication include the following techniques : primary suturing , interposition grafting , excision with end - to - end anastomosis , suturing from within the vessel , patch angioplasty , ligation and endovascular embolisation or stent - graft placement . laceration of a major artery or vein will result in life - threatening bleeding complications that should be treated by rapid fluid resuscitation and immediate vascular surgical intervention . the surgical decision and repair of the arterial wall injury in patients presenting with an acute and rapid course of deterioration should be made as early as possible . the mortality rate approaches 100% when surgery is not performed immediately in arterial injuries . during lumbar disc surgery , ureteral and intestinal injuries can also occur but , the diagnosis can be more difficult due to a lack of specific diagnostic signs . generally , cpb with the femoral artery and vein is indicated for an aneurysm of the ascending aorta , or severe atherosclerosis or difficult cannulation in the ascending aorta during cardiac surgery due to the complex surgical technique . in addition , it can be used when difficult airway management is predicted or , like this case , when severe bleeding caused by a major vessel injury occurs . in summary , correct crisis resolution protocols , such as proper massive transfusion algorithms and successful surgical intervention , are quite effective during the critical period . a high index of suspicion , prompt diagnosis and action will result in improved patient salvage .
iatrogenic vascular injury during lumbar disc surgery is a rare but serious complication . this paper reports a patient who sustained an injury to the iliac artery while undergoing intervertebral disc surgery at the lumbar region . he suffered from massive bleeding and shock . an urgent laparatomy was performed under cardiopulmonary bypass , and the vascular injuries were repaired successfully . this case shows that a rapid diagnosis and immediate intervention can result in a favorable outcome .
serine hydroxymethyltransferase ( ec 2.1.2.1 , shmt ) is a pyridoxal - phosphate - binding enzyme that catalyzes the reversible reaction of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate . shmt - catalyzed reactions are important as a primary source of one - carbon units used in folate - dependent metabolism , including purine synthesis . two isoforms of shmt are found in eukaryotic cells : one expressed in the cytoplasm ( shmt - cyt ) and one in mitochondria ( shmt - mit ) . the gene encoding the former is located on human chromosome 17p11.2 and the gene encoding the latter is on human chromosome 12q13.2 . a third member of this small gene family is a processed pseudogene , shmt - ps1 , located on human chromosome 1p32.3-p33 . analyses of known shmt amino acid and nucleotide sequences indicate that eukaryotic shmt - cyt is descended from a prokaryotic glya - like ancestor and that both shmt - mit and shmt - ps1 have been derived from shmt - cyt . pcr - based analyses of evolutionary conservation of the shmt - ps1 nucleotide sequence suggest that the reverse transcription event giving rise to shmt - ps1 occurred after the divergence of the order primates from the rest of the mammalia , thus making this locus a genetic marker unique to the primates . here , this suggestion is verified using two end - point molecular beacon assays . in addition , results presented here further refine the time frame in which the reverse transcription and retrotransposition events occurred . end - point molecular beacon assays ( see materials and methods ) were carried out on 19 primate and 12 non - primate mammalian genomic dnas . the results of those assays confirmed the previous conclusion that shmt - ps1 is not found outside members of the order primates . there was , however , one notable departure from expectation among the primate dna samples . in previous studies , genomic dna from lemur catta had given a 292 base pair ( bp ) shmt - ps1 amplicon from which sequence had been obtained . in the present study , the genomic dna sample from the ruffed lemur , varecia variegata , gave no evidence of the pseudogene with either molecular beacon probe , e8/e9 or e9/e10 ( figure 1 ) . to establish which of these results was reliable , genomic dnas from an additional 17 lemurs covering nine living species were examined by pcr using the c1/b6 primer pair under the amplification conditions given in the materials and methods . in no case did the lemur samples yield the expected shmt - ps1 amplicon , whereas the other primate controls succeeded each time they were used . on the basis of these new data , it now appears that the original l. catta sample did not contain pure lemur genomic dna , and that the shmt - ps1 locus is not present in the prosimians as previously thought . results of molecular beacon end - point assays using the e8/e9 and e9/e10 probes on a representative genomic dna panel . there is no difficulty in distinguishing a positive from a negative result in this assay . note that the ruffed lemur sample ( v. variegata ) is clearly negative for both probes . thermodynamic studies of molecular beacons suggest that conformationally constrained probes display enhanced hybridization specificity as a general feature . the states in which a molecular beacon can exist are a random coil , the closed hairpin / loop structure , and a linearized structure bound to the target pcr product . when two or more competing molecular beacons are present , the enhanced hybridization specificity results in the ability to discriminate between target sequences that differ by as little as a single nucleotide . in the present study , in which molecular beacon probes were used singly as end - point reporters comparative sequences homologous to the e8/e9 and e9/e10 probes ( figure 2 ) from several species are shown in table 1 . as can be seen , the species - specific target sequences differed from the probe sequences by as many as nine bases , with the average difference being 2.5 bases . confidence in the ability of these highly sensitive probes to reliably detect the presence of target sequences that differ from the probe sequence by numerous bases is supported by the observation that the most divergent targets , those belonging to the old world monkey species for the e8/e9 probe , still gave positive , albeit weakened , results . on the other hand , potential targets that were perfect matches or that differed by only one or two bases did not give any positive indications in the lemur and non - primate mammal samples ( figure 1 ) . the positions of the two molecular beacon sequences e8/e9 and e9/e10 are shown in relation to the exon - exon boundaries in shmt - ps1 . aligned sequences homologous to molecular beacons e8/e9 and e9/e10 exon / exon boundaries are indicated with a slash , and nucleotide differences from sequence 1 are in bold . sequence sources are as follows : 1 - 10 , all from ; 11 , genbank l11931 ; 12 , genbank z11846 ; 13 , genbank x80024 . the appearance of a processed pseudogene such as shmt - ps1 is due to the reverse transcription of a processed mrna followed by the random insertion of the derived cdna into the genome via retrotransposition . on the basis of the results presented here , refinement of the point at which those events giving rise to shmt - ps1 occurred must now exclude the prosimians . kay et al . suggest that the divergence of the line leading to the monkeys and apes ( haplorrhini ) from that leading to the prosimians ( strepsirrhini ) occurred around the beginning of the eocene some 55 million years ago . they also note that the divergence of the old world monkeys and apes ( catarrhini ) and the new world monkeys ( platyrrhini ) probably took place before the end of the eocene , or before 34 million years ago . given that shmt - ps1 is found in both new world and old world monkeys , the window in which the reverse transcription event could have taken place is further bracketed within a 12 to 15 million year period between the lower and middle eocene . one species that has not so far been examined that would shed light on this question is , of course , the tarsier . should the tarsier not have shmt - ps1 in its genome , the window would be further constrained to a lower bound corresponding to the origin of the anthropoidea , which is placed somewhat nearer the middle eocene . finally , of interest here is the report of another primate pseudogene , a processed immunoglobulin j chain pseudogene , j , whose origin is via the same process at about the same time . examined several primate species , including old world and new world monkey species , and concluded that this locus , too , arose in the primates some 40 to 50 million years ago . we have recently been able to confirm this conclusion by a pcr study of the same genomic dna panel used in this paper ( e.j.d . and h. trill , unpublished observations ) . is the fact that two retroprocessed pseudogenes were produced in the order primates at nearly the same time unusual ? suggest that retropseudogenes are a common phenomenon in mammalian genomes and estimate that the human genome contains some 23,000 to 33,000 such loci . they also note several common features among the genes giving rise to retropseudogenes : they are widely expressed ; they are highly conserved ; they are usually short ; and they are relatively gc poor . shmt - cyt , the antecedent locus of shmt - ps1 , does , in fact , meet most of these criteria , as does the antecedent locus of j. thus , although shmt - cyt is quite large and neither gene is particularly gc poor , the appearance of these two retroprocessed pseudogenes at about the same time in the evolutionary history of the primates is probably not unusual . both may genomic dna samples used in this study were obtained both commercially and through the generosity of a number of colleagues . dna samples from humans ( homo sapiens ) as well as from chimpanzee ( pan troglodytes ) , orangutan ( pongo pygmaeus ) , tamarin ( leontopithecus rosalia ) , horse ( equus equus ) , cow ( bovis domesticus ) , dog ( canis familiaris ) , cat ( felis domesticus ) , sheep ( ovis aries ) , pig ( sus scrofa ) , rabbit ( oryctolagus cunniculatus ) , rat ( rattus norvegicus ) , hamster ( mesocricetus auratus ) , and the northern short - tailed shrew ( blarina brevicauda ) were obtained by the author . dna samples from gibbon ( hylobates lar ) , macaque species ( macaca mulatta , m. assamensis , m. nemestrina , m. arctoides , and m. fuscata ) , baboon species ( papio hamadryas and p. anubis ) , the african green monkey ( chlorocebus aethiops ) . new world capuchins ( cebus capucinus , c. apella , and c. albifrons ) , squirrel monkey ( saimiri boliviensis ) and spider mokey ( ateles paniscus ) were provided by moses schanfield . dna from the ruffed lemur ( varecia variegata ) was one of a number of lemur dnas provided by edward lewis ( henry doorly zoo , omaha , nebraska ) . dna from the short - tailed opossum ( monodelphis domestica ) was provided by john vandeberg ( southwest foundation for biomedical research , san antonio , texas ) and dna from the blind mole rat superspecies spalax ehrenbergi by eviatar nevo ( university of haifa , israel ) . to date , analyses of shmt - ps1 in primates and other mammals have focused on a region of the pseudogene that flanks a his - lys dimer at positions 256 - 257 . this dimer is the pyridoxal - phosphate - binding site and is thus a critical functional region of the protein . pcr amplifications of this small region of the shmt - ps1 sequence are carried out using the primers shmt - c1 ( 5'-ggcgtggtgccctccccattt-3 ' ) and shmt - b6 ( 5'-tgcagttggccaccacctggt-3 ' ) . usual amplification conditions are 94c for 3 min followed by 30 cycles of 94c for 30 sec ; 62c for 30 sec ; 72c for 45 sec with a final 72c extension for 5 min . pcr amplicons are visualized directly on 1.3% low melting temperature agarose gels ( 1x tbe ) after ethidium bromide staining . the shortest , 281 bp , has been seen in humans , chimpanzees , and gorillas as a result of the 11 bp deletion in those species . the longest , 317 bp , is only seen in c. aethiops , due to the presence of the 25 bp insertion . all other primate species so far examined ( 18 species in all ) display a 292 bp amplicon . in previous work , evidence for the absence of the shmt - ps1 locus in non - primate mammals was taken from a consistent failure to amplify the pseudogene sequence from genomic dnas via pcr using a variety of primers in addition to the c1/b6 primer pair . among these other primer pairs , this assay is taken further by employing the more sensitive and specific method of molecular beacons . molecular beacons contain a sequence - specific probe of up to 25 bases flanked by a self - complementary stem of 5 - 6 bases . on the 5 ' end of the probe is a fluorescent moiety and on the 3 ' end is a dark quencher . in the ground state , the molecule is folded such that the fluorophore and the quencher are in direct contact and the transfer of fluorescent energy from the former to the latter is subsequently emitted as heat rather than as light . thus , in the ground state , molecular beacons are dark . in the presence of a target sequence , the molecular beacon undergoes a conformational change , with the internal probe sequence hybridizing to its target and the fluorophore and quencher becoming separated by a distance sufficient to prevent quenching . in this state , their data show that the 281 - 317 bp shmt - ps1 amplicon generated by the pcr primer pair c1/b6 contains parts of exons 8 and 10 as well as all of exon 9 . shmt - cyt genomic sequences also show that exons 8 and 9 are separated by a 4,500 bp intron and that exons 9 and 10 are separated by a 2,500 bp intron . to eliminate the possibility of false hybridization to shmt - cyt genomic sequences instead of the intronless shmt - ps1 sequence , two molecular beacons were designed to span exon - exon boundaries ( figure 2 ) . following the general design rules set out by kramer and colleagues , the sequences of these two molecular beacons are shmt - e8/e9 : 5'-fam - cccggcacgatcttctacag / gaaaggagggccggg - dabcyl-3 ' and shmt - e9/e10 : 5'-hex - gccgcacaaccacaccattgctg / gggttgctgcggc - dabcyl-3 ' . the self - complementary hairpin sequence in each molecular beacon is in bold and the exon - exon boundaries are indicated by the slashes . finally , the fluorophores fam ( 5-carboxyfluorescein ) and hex ( 5-hexachlorofluorescein ) are paired with the universal fluorescence quencher dabcyl ( 4-(4'-dimethylaminophenylazo)benzoic acid ) . as the analyses carried out in this study were end - point assays having a simple yes / no answer , the pcr amplifications were all performed in the presence of 100 ng genomic dna . in addition to the target dnas , 50 pmol of the pcr primers c1 and b6 , 10 mm each dntp , 2.5 u taq polymerase , and standard taq pcr buffer ( roche ) were used . amplification conditions were 94c for 3 min followed by 40 cycles of 94c for 30 sec , 62c for 30 sec , 72c for 45 sec and a final extension step for 7 min at 72c . following amplification , 250 pmol of molecular beacon probe was added to the reaction , the mixture was heated to 94c for 3 min , and then held at 60c before visualization of the reaction tubes on a uv transilluminator . each set of reactions was photographed on the transilluminator in the same manner as ethidium bromide - stained agarose gels ( figure 1 ) . genomic dna samples used in this study were obtained both commercially and through the generosity of a number of colleagues . dna samples from humans ( homo sapiens ) as well as from chimpanzee ( pan troglodytes ) , orangutan ( pongo pygmaeus ) , tamarin ( leontopithecus rosalia ) , horse ( equus equus ) , cow ( bovis domesticus ) , dog ( canis familiaris ) , cat ( felis domesticus ) , sheep ( ovis aries ) , pig ( sus scrofa ) , rabbit ( oryctolagus cunniculatus ) , rat ( rattus norvegicus ) , hamster ( mesocricetus auratus ) , and the northern short - tailed shrew ( blarina brevicauda ) were obtained by the author . dna samples from gibbon ( hylobates lar ) , macaque species ( macaca mulatta , m. assamensis , m. nemestrina , m. arctoides , and m. fuscata ) , baboon species ( papio hamadryas and p. anubis ) , the african green monkey ( chlorocebus aethiops ) . new world capuchins ( cebus capucinus , c. apella , and c. albifrons ) , squirrel monkey ( saimiri boliviensis ) and spider mokey ( ateles paniscus ) were provided by moses schanfield . dna from the ruffed lemur ( varecia variegata ) was one of a number of lemur dnas provided by edward lewis ( henry doorly zoo , omaha , nebraska ) . dna from the short - tailed opossum ( monodelphis domestica ) was provided by john vandeberg ( southwest foundation for biomedical research , san antonio , texas ) and dna from the blind mole rat superspecies spalax ehrenbergi by eviatar nevo ( university of haifa , israel ) . to date , analyses of shmt - ps1 in primates and other mammals have focused on a region of the pseudogene that flanks a his - lys dimer at positions 256 - 257 . this dimer is the pyridoxal - phosphate - binding site and is thus a critical functional region of the protein . pcr amplifications of this small region of the shmt - ps1 sequence are carried out using the primers shmt - c1 ( 5'-ggcgtggtgccctccccattt-3 ' ) and shmt - b6 ( 5'-tgcagttggccaccacctggt-3 ' ) . usual amplification conditions are 94c for 3 min followed by 30 cycles of 94c for 30 sec ; 62c for 30 sec ; 72c for 45 sec with a final 72c extension for 5 min . pcr amplicons are visualized directly on 1.3% low melting temperature agarose gels ( 1x tbe ) after ethidium bromide staining . the shortest , 281 bp , has been seen in humans , chimpanzees , and gorillas as a result of the 11 bp deletion in those species . the longest , 317 bp , is only seen in c. aethiops , due to the presence of the 25 bp insertion . all other primate species so far examined ( 18 species in all ) display a 292 bp amplicon . in previous work , evidence for the absence of the shmt - ps1 locus in non - primate mammals was taken from a consistent failure to amplify the pseudogene sequence from genomic dnas via pcr using a variety of primers in addition to the c1/b6 primer pair . among these other primer pairs , this assay is taken further by employing the more sensitive and specific method of molecular beacons . molecular beacons contain a sequence - specific probe of up to 25 bases flanked by a self - complementary stem of 5 - 6 bases . on the 5 ' end of the probe is a fluorescent moiety and on the 3 ' end is a dark quencher . in the ground state , the molecule is folded such that the fluorophore and the quencher are in direct contact and the transfer of fluorescent energy from the former to the latter is subsequently emitted as heat rather than as light . thus , in the ground state , molecular beacons are dark . in the presence of a target sequence , the molecular beacon undergoes a conformational change , with the internal probe sequence hybridizing to its target and the fluorophore and quencher becoming separated by a distance sufficient to prevent quenching . in this state , their data show that the 281 - 317 bp shmt - ps1 amplicon generated by the pcr primer pair c1/b6 contains parts of exons 8 and 10 as well as all of exon 9 . shmt - cyt genomic sequences also show that exons 8 and 9 are separated by a 4,500 bp intron and that exons 9 and 10 are separated by a 2,500 bp intron . to eliminate the possibility of false hybridization to shmt - cyt genomic sequences instead of the intronless shmt - ps1 sequence , two molecular beacons were designed to span exon - exon boundaries ( figure 2 ) . following the general design rules set out by kramer and colleagues , the sequences of these two molecular beacons are shmt - e8/e9 : 5'-fam - cccggcacgatcttctacag / gaaaggagggccggg - dabcyl-3 ' and shmt - e9/e10 : 5'-hex - gccgcacaaccacaccattgctg / gggttgctgcggc - dabcyl-3 ' . the self - complementary hairpin sequence in each molecular beacon is in bold and the exon - exon boundaries are indicated by the slashes . finally , the fluorophores fam ( 5-carboxyfluorescein ) and hex ( 5-hexachlorofluorescein ) are paired with the universal fluorescence quencher dabcyl ( 4-(4'-dimethylaminophenylazo)benzoic acid ) . as the analyses carried out in this study were end - point assays having a simple yes / no answer , the pcr amplifications were all performed in the presence of 100 ng genomic dna . in addition to the target dnas , 50 pmol of the pcr primers c1 and b6 , 10 mm each dntp , 2.5 u taq polymerase , and standard taq pcr buffer ( roche ) were used . amplification conditions were 94c for 3 min followed by 40 cycles of 94c for 30 sec , 62c for 30 sec , 72c for 45 sec and a final extension step for 7 min at 72c . following amplification , 250 pmol of molecular beacon probe was added to the reaction , the mixture was heated to 94c for 3 min , and then held at 60c before visualization of the reaction tubes on a uv transilluminator . each set of reactions was photographed on the transilluminator in the same manner as ethidium bromide - stained agarose gels ( figure 1 ) . i thank moses schanfield , edward lewis , john vandeberg and eviatar nevo for their generosity in providing samples of mammalian dnas .
background : the serine hydroxymethyltransferase processed pseudogene shmt - ps1 has been suggested to be unique to the order primates because of the failure to amplify this sequence by pcr from genomic dnas of any non - primate mammal species . here , ' molecular beacon ' probes specific to shmt - ps1 were used in an attempt to verify this suggestion.results:in a search for shmt - ps1-specific sequences using molecular beacons across a range of mammalian species , shmt - ps1 was only found in primates . the molecular beacon assays also showed that shmt - ps1 is present in both old world and new world species but not among prosimians.conclusions:these results suggest that shmt - ps1 originated close to the origin of the anthropoidea , some 40 to 50 million years ago .
oral lichen planus ( olp ) is a chronic , autoimmune mucocutaneous disease , occurring most commonly in the middle aged women . lichen planus may also occur concurrently or independently in the skin and the genital , anal , esophageal , nasal and laryngeal mucosae . andreasen reported that the average age of occurrence in males and females is 40 - 49 years and 50 - 59 years , respectively . clinically the oral lesions have been grouped into reticular , papular , plaque like , atrophic , erosive and bullous forms . olp usually occurs in a bilaterally symmetrical pattern , commonly involving buccal mucosa , gingivae and dorsum of the tongue . the lesions are usually painless , though pain and burning sensation are associated with erosive and atrophic lesions . earlier studies have implicated stress , anxiety , depression as the causes for olp . however , whether stress is the cause or the consequence , was left undetermined . concluded that human leukocyte antigen ( hla ) associated genetic factors play a certain role in the pathogenesis of olp . hedberg and associates reported that epithelium involved by olp was consistently positive for hla - dr . lodi g et al . reported that lichen planus is sometimes associated with infections or auto immune diseases and / or neoplasia , but the association had not been established . certain systemic diseases like diabetes mellitus , hypertension , ulcerative colitis , myasthenia gravis , lupus erythematosus , etc were considered to be associated with olp . a more consistent association was found between chronic liver disease and erosive form of olp . recent studies indicate an association between hepatitis c virus ( hcv ) and olp.[1521 ] hcv is a hepatotrophic ribonucleic acid ( rna ) virus , which possibly alters the antigenecity of the epidermis , causing an interaction with activated t- cells , or acts through a modulation of the quality of host immune response . oral lichenoid reactions caused by drugs and dental restorative materials have been considered as variants of olp . drugs implicated are non steroidal anti inflammatory agents , sulfonyl ureas , beta blockers , oral hypoglycemic agents , dapsone , pencillamine . dental restorative materials like amalgam , composite , acrylic , gold have been reported to cause lichenoid reactions . lichenoid lesions have also been reported in tobacco chewers ; however , the causative role of tobacco in the pathogenesis of olp has not been identified . current literature suggests that olp is caused by cluster of differentiation 8 ( cd-8 ) cell mediated damage to the basal keratinocytes leading to apoptosis . the antigen inciting the cytotoxic t cells could be any of the above mentioned factors including stress , chronic liver disease , hcv virus , dental restorative materials and/or drugs . the main event in the pathogenesis appears to be increased production of cytokines leading to the recruitment of langerhans cells and clonal expansion of cytotoxic cells . langerhans cells produce increased amounts of interferon -alpha ( ifn - ) , which further activates cytotoxic cell mediated apoptosis , via the keratinocyte caspase cascade . interferon - production increases the apoptosis through the up regulation of p53 and matrix metallo proteinase -1 ( mmp-1 ) . non specific mechanisms like mast cell degranulation and mmp -1 activation further aggravate the t cell accumulation , basement membrane disruption by mast cell proteases and keratinocyte apoptosis ( triggered by basement membrane disruption ) . the chronicity of the olp lesions might be partly explained by the fact that the basement membrane disruption triggers keratinocyte apoptosis and apoptotic keratinocytes are unable to repair the breach in basement membrane . therefore , interaction of various factors is probably responsible for the initiation , aggravation and persistence of olp . the current treatment modalities are not only inadequate in treating all patients and preventing recurrences , but also have significant side effects . further clarity on the pathogenesis will aid in modifying therapeutic interventions , thus significantly reducing the morbidity of olp patients .
oral lichen planus ( olp ) is a chronic mucocutaneous disease of uncertain etiopathogenesis . several factors including stress , genetics , systemic diseases , viruses , dental restorative materials and drugs have been implicated as causative agents . the disease seems to be mediated by an antigen specific mechanism , activating cytotoxic t cells , and non specific mechanisms like mast cell degranulation and matrix metalloproteinase activation . further clarity on the pathogenesis will aid in modifying therapeutic interventions , thus significantly reducing the morbidity of olp patients .
a mandibular position that determines occlusal , muscular and articular balance is fundamental to plan and execute oral rehabilitations in compliance with the stomatognathic system1,2,4,5,10 . historically , some debate on what should characterize optimal occlusal relationships has been found in the literature : the centric occlusion ( co ) and centric relation ( cr ) are conceptual positions used by clinicians as such . some researchers affirmed that the cr is an unstrained position where the mandible is in maximum retrusion23 . however , others do not agree , as they consider maximum retrusion a strained position14 . in 1969 , schuyler16 introduced the concept of freedom in centric and supported the theory that cr was rather a biological area of the temporomandibular joint ( tmj ) than a point . the considerations of those authors were assessed by dawson3 ( 1973 ) , gilboe5 ( 1983 ) and okeson , et al.12(1993 ) , who stated that the cr should be the most anterior and superior position of the condyles at the mandibular fossa , with the articular disk interposed between them . bear1 ( 1956 ) , defined cr as a position of physiological rest , and such definition was complemented by weinberg21 ( 1985 ) as follows : .... the clinical cr is functional when the articular spaces are symmetric and both condyles are concentrically positioned in the superior portion of their respective glenoid fossa ... . therefore , several methods have been suggested for this purpose , all of them associated with the specific definitions previously mentioned3,6,8,9,18 . the aim of this study was to assess the reproducibility of two techniques used to determine and record the cr . twenty patients ( 6 male , 14 female ) aged 18 to 35 years were recruited for this study after signing a written informed consent form approved by the ethics in research committee of the dental school of piracicaba ( n 049/2004 ) . inclusion criteria were : presence of 28 teeth , angle s class i malocclusion relationship and absence of signs and symptoms of functional alterations in the stomatognathic system . , rio de janeiro , rj , brazil ) impressions of both arches were taken and poured immediately with type iv stone ( durone ; dentsply ind . and com . superior and inferior stone casts were mounted in a dental articulator ( dentatus ab , hgersten , sweden ) using the maximal intercuspal position ( mip ) . to test the gothic arch tracing technique , autopolymerizing acrylic resin ( clssico artigos odontolgicos ltda . , so paulo , sp , brazil ) occlusal appliances were fabricated on stone casts . thereafter , reference marks were made in the inferior appliances with a bur to positioning stainless steel plates ( figure 1 ) . the intraoral apparatus was transferred to the patient s mouth , which was sat in a dental chair , with the back of the chair forming a 90 angle with the floor and with the patient s head resting in the head support positioned in such a way that the frankfort plane was parallel to the floor . the patient was instructed to execute bordering protrusive , retrusive and bilateral lateral - protrusive movements . therefore , the gysi s gothic arch was recorded in the steel plate , with the vertex of this gothic arch being the more retrusive position achieved by the mandible during the mandibular movements . a # 1012 round diamond ( kg sorensen ind . com . , so paulo , sp , brazil ) was used to perforate 1.4 mm from the vertex of the gothic arch13 . this procedure was repeated during the five observation periods of this study . to obtain the cr through bilateral manipulation technique , the patient was positioned with his / her thorax parallel to the ground while the dentist was sat behind the patient . in this position , the dentist was instructed to place four fingers of each hand on the lower border of the patient s mandible and then lay the thumbs over the mandibular symphysis so they would touch each other . after that , the dentist was instructed to apply firm pressure against the mandible with fingers , pressing downwards and slightly backwards with thumbs until the first interocclusal contact occurred . when this position was achieved , chemically activated acrylic resin ( duralay reliance dental mfg . co. , worth , il , usa ) was inserted between the incisal borders of the anterior teeth , in order to construct a jig that would enable this position to be reproduced in the stone casts mounted in the articulator . all above - described procedures were also repeated for the five re - established evaluation periods . therefore , five acrylic resin jigs were obtained per patient and numbered 1 to 5 . ten records of the cr position were obtained for each patient , 5 of them using the gothic arch tracing technique aided by the intraoral apparatus and the other 5 by bilateral manipulation technique . the registers were taken five times with 1-week intervals between each register , always at the same hour of the day . to assess the obtained condylar positions , a condylar locator13 was adapted to the articulator . a circular piece of white cardboard was adapted to each metallic disc of the condylar locator to register every condylar positions obtained ( figure 2 ) . with the stone casts mounted in mip , a piece of red articulating paper ( arti - fol , articulating film 8 , bausch articulating papers , inc . , nashua , nh , u.s.a . ) was inserted between each metallic pointer of the articulator and the cardboard 1 adapted to each metallic disc of the condylar locator . then , the condylar locator was moved towards the metallic pointers in order to record with red points the bilateral position of the condyles in mip , i.e. point 0 . after , the intraoral apparatus used to obtain the cr by the gothic arch technique was adapted over the respective stone casts and the screws of the condylar elements of the articulator were released to liberate the movement of the superior ramus , which enabled the metal screw of the superior appliance to match the perforation made in the steel plate 1 of the inferior appliance . afterwards , a piece of blue articulating paper ( arti - fol , articulating film 8 , bausch articulating papers , inc . ) was inserted between the pointers and the same circular pieces of cardboard in order to register the condylar positions obtained by the gothic arch technique . still using the same cardboard adapted to the condylar locator , the superior ramus of the articulator was again liberated for adaptation of the acrylic resin jig 1 used for the cr register obtained through the bilateral manipulation . then , a piece of black articulating paper ( arti - fol , articulating film 8 , bausch articulating papers , inc . ) was inserted between the metallic pointers of the articulator and the first cardboards adapted to each metallic disc of the condylar locator to register this third position . by this method , three distinct points were obtained on the first cardboard , each one of them representing its respective condylar position on the sagital plane of both sides on the first day of this study ( figure 3 ) . this procedure was repeated five times for each patient in order to assess the reproducibility of the techniques used to obtain the cr . therefore , five pairs of circular pieces of cardboard were generated with their respective records . the pieces of cardboard with their respective records were analyzed on the measuring microscope ( olympus measuring microscope stm ) , and the distance between the red and the blue points and the distance between the red and the black points were measured on the horizontal plane of all cardboard . a table was drawn with these distances for statistical analysis in order to compare the differences between them and the reproducibility of the techniques under study . to assess the obtained condylar positions , a condylar locator13 was adapted to the articulator . a circular piece of white cardboard was adapted to each metallic disc of the condylar locator to register every condylar positions obtained ( figure 2 ) . with the stone casts mounted in mip , a piece of red articulating paper ( arti - fol , articulating film 8 , bausch articulating papers , inc . , nashua , nh , u.s.a . ) was inserted between each metallic pointer of the articulator and the cardboard 1 adapted to each metallic disc of the condylar locator . then , the condylar locator was moved towards the metallic pointers in order to record with red points the bilateral position of the condyles in mip , i.e. point 0 . after , the intraoral apparatus used to obtain the cr by the gothic arch technique was adapted over the respective stone casts and the screws of the condylar elements of the articulator were released to liberate the movement of the superior ramus , which enabled the metal screw of the superior appliance to match the perforation made in the steel plate 1 of the inferior appliance . afterwards , a piece of blue articulating paper ( arti - fol , articulating film 8 , bausch articulating papers , inc . ) was inserted between the pointers and the same circular pieces of cardboard in order to register the condylar positions obtained by the gothic arch technique . still using the same cardboard adapted to the condylar locator , the superior ramus of the articulator was again liberated for adaptation of the acrylic resin jig 1 used for the cr register obtained through the bilateral manipulation . then , a piece of black articulating paper ( arti - fol , articulating film 8 , bausch articulating papers , inc . ) was inserted between the metallic pointers of the articulator and the first cardboards adapted to each metallic disc of the condylar locator to register this third position . by this method , three distinct points were obtained on the first cardboard , each one of them representing its respective condylar position on the sagital plane of both sides on the first day of this study ( figure 3 ) . this procedure was repeated five times for each patient in order to assess the reproducibility of the techniques used to obtain the cr . therefore , five pairs of circular pieces of cardboard were generated with their respective records . the pieces of cardboard with their respective records were analyzed on the measuring microscope ( olympus measuring microscope stm ) , and the distance between the red and the blue points and the distance between the red and the black points were measured on the horizontal plane of all cardboard . a table was drawn with these distances for statistical analysis in order to compare the differences between them and the reproducibility of the techniques under study . the standard deviation of each technique for every patient was calculated considering , independently , the left and right sides . the averages between the standard deviation for the gothic arch tracing technique ( ga ) and the standard deviation for the bilateral manipulation technique ( bm ) for both left and right sides were calculated ( bilateral manipulation 0,94 and gothic arch tracing 0,27 ) . the averages obtained for each patient were paired and the differences between them were determined . the shapiro - wilk test was applied and the symmetry coefficient and the curtose coefficient were calculated on these differences to test normality ( table 1 ) . ga - gothic arch tracing technique ; bm - bilateral manipulation technique . in face of these results , it was possible to verify that the data were obtained from a normal distributed population , which permitted the application of the student s t - test for paired data ( table 2 ) . student s t - test strongly demonstrated ( p<0.00001 ) that the real average between the standard deviation differences is different then 0 , demonstrating that the gothic arch tracing and the bilateral manipulation techniques presented different variability degrees . since the average of the difference was smaller than 0 , it was possible to verify that the variability average of the bilateral manipulation technique was significantly greater than that of the gothic arch tracing . the concept of cr emerged due to the search for a reproducible mandibular position that would enable the positioning of artificial teeth during the construction of complete dentures . as the most retrusive position of the mandible in relation to the maxilla was a reproducible mandibular position , this became known as cr15 . this concept of a more retrusive mandibular position became questionable because when the mandible is in this position the space between the condyle and the posterior wall of the fossa is eliminated , which causes a compression of the retrodiscal region20 . moyers11 ( 1956 ) verified that the mastication muscles showed a misbalance when the condyles were in a posterior position in the mandibular fossa . gilboe5 ( 1983 ) and weinberg19 ( 1972 ) affirmed that a more posterior location of the condyle is a reproducible but not a physiological position . while considering a more posterior positioning of the condyle in the mandibular fossa as a non - physiological location , several authors3,5,10,12,14 began to advocate an anterior - superior condylar position as a more adequate definition of cr . this technique is performed with the patient positioned in dorsal decubitus which , associated with the natural neuromuscular reaction to the mandibular manipulation method itself , makes an anterior - superior positioning of the condyles in the mandibular fossa as described , very improbable10 . our opinion goes along with authors , such as mcneill10 ( 2000 ) , who affirmed that the condylar position in cr , using bilateral manipulation , depended not only on the manipulation method but also on the condition of the muscular activity . this author considered that the cr is a functional relation observed when there is a homogeneity and symmetry of the articular spaces in both tmjs . it was also observed that , under these conditions , the condyles should be concentrically positioned in the superior portion of their respective mandibular fossa . to position the condyles in the location described by weinberg20 ( 1975 ) as cr , casselli2 ( 2002 ) , ramos , et al.13 ( 2006 ) and williamson , et al.22 ( 2004 ) proposed the use of the gysi s gothic arch technique with the aid of an intraoral apparatus . currently , a consensual definition of cr described in the literature refers to a reproducible physiological position that is independent of occlusal contacts7 . therefore , the most posterior position and the techniques described to obtain it have been abandoned , prevailing the bilateral manipulation ( anterior - superior positioning of the condyles ) and the gothic arch tracing with the aid of an intraoral apparatus ( central position of the condyles ) . in the present study , we evaluated the reproducibility of these two techniques as we consider such factor an important validation tool7 . our results revealed that , for both sides , in the articulator , the condylar positions obtained by the bilateral manipulation technique ( black point ) presented themselves in a more anterior position in relation to point 0 ( mip ) ( figure 3 ) . therefore , the patients condyles were positioned backwards , i.e. , distal to mip , as the articulator condylar position is inverse to the patients condylar position . this patients backwards condylar position would be predicted thanks to the force exerted upon the patients chin . our results agree with the observations of ramos13 ( 2006 ) , who verified the same fact in a sample of patients with the same occlusal features . the bilateral manipulation technique , which would place the condyles in a more anterior and superior position , is conflicting with such results . it has been well established in this study that in the gothic arch tracing technique , the vertex of this arch and the mip are distinct positions and therefore not coincident . these results agree with those of gysi6 ( 1910 ) , who affirmed that this vertex represents the most posterior condylar position . in accordance with this gysi s statement , in this study , the vertex was not used as a reference to obtain the cr because the posterior condylar position is a non - physiological position . when comparing the bilateral manipulation technique to the gothic arch tracing , ramos , et al.13 ( 2003 ) , verified that the latert was the only that enabled the determination of the centric occlusion ( co ) . in that study , the author verified that between the condylar position of deglutition and the position of mastication , there is a space of approximately 1.4 mm on the horizontal plane anterior to the vertex , suggesting that this space is the real cr , which justifies the distance used to perforate the steel plates in our study . the perforation anterior to the gothic arch vertex is also supported by casselli , et al.2 ( 2006 ) , who affirmed that to obtain a maximum retrusive mandibular position , the mandible should be dislocated 1 to 2 mm backwards from the mip . regarding the variability of the studied techniques , the gothic arch tracing yielded the best results , differing significantly from the bilateral manipulation technique . another important fact for reproducibility is time . according to silva , et al.17 ( 1997 ) and casselli , et al.2 ( 2006 ) , the gothic arch allows verifying the muscular function , which is variable determined with the patient awaken . during sleep , for example , the muscles are more relaxed than during the day . in this study , seeking to eliminate such variable , all records , of the five periods , were made exactly at the same hour of the day . the results obtained in this study demonstrate that perhaps the most important is not the acquisition of the cr by any technique as a rehabilitation position , but rather the determination of the co , as a location that allows the physiological dislocation of the condyles backwards , favoring deglutition without any intra - articular compression . therefore , a technique with a smaller variability and greater reproducibility for the determination of cr and consequently co should be used . based on the results of this study , it may be concluded that the studied techniques demonstrated different variability degrees , considering that the gothic arch tracing technique with the aid of an intraoral apparatus proved to have greater reproducibility than bilateral manipulation .
the centric relation is a mandibular position that determines a balance relation among the temporomandibular joints , the chew muscles and the occlusion . this position makes possible to the dentist to plan and to execute oral rehabilitation respecting the physiological principles of the stomatognathic system . the aim of this study was to investigate the reproducibility of centric relation records obtained using two techniques : dawson s bilateral manipulation and gysi s gothic arch tracing . twenty volunteers ( 14 females and 6 males ) with no dental loss , presenting occlusal contacts according to those described in angle s i classification and without signs and symptoms of temporomandibular disorders were selected . all volunteers were submitted five times with a 1-week interval , always in the same schedule , to the dawson s bilateral manipulation and to the gysi s gothic arch tracing with aid of an intraoral apparatus . the average standard error of each technique was calculated ( bilateral manipulation 0.94 and gothic arch tracing 0.27 ) . shapiro - wilk test was applied and the results allowed application of student s t - test ( sampling error of 5% ) . the techniques showed different degrees of variability . the gysi s gothic arch tracing was found to be more accurate than the bilateral manipulation in reproducing the centric relation records .
dissolved organic carbon ( doc ) export from mangrove swamps accounts for 10% of the global terrestrial flux of doc to coastal oceans . given recent reports of high concentrations of mercury ( hg ) in mangrove tissues and mangrove marsh waters , and the known high affinity of hg species for doc in surface waters , there is concern that a large hg flux may accompany the doc flux from mangroves . in other aquatic environments , transport of hg species is intimately linked to the transport of doc because of strong complexation , particularly in tidal wetlands . elevated mercury levels have long been reported in coastal aquatic food webs from areas near the extensive mangrove swamps of southwest florida . in recent years , hg concentrations in some fish and wading birds in the everglades have declined , but concomitant declines have not been observed in florida bay species . these decoupled trends suggest that mitigation efforts may have diminished the terrestrial accumulation of hg but have not similarly benefited coastal food webs , perhaps because the hg source to coastal food webs is different than that of the uplands . methylmercury ( mehg ) , the form of hg that bioaccumulates , has several potential sources in coastal waters : it may be produced in low - oxygen environments in terrestrial systems and then exported to coastal waters ; it may be produced in coastal wetlands such as mangroves and then tidally pumped into surrounding waters ; or it may be produced within estuarine and coastal sediments . although elevated tissue concentrations of hg and mehg are known to occur in mangroves and high concentrations of aqueous hg and mehg have been reported in mangrove - dominated environments , remarkably little is known about the magnitudes of hg and mehg export from mangrove swamps into coastal and estuarine waters . this study sought to characterize the export of doc and hg from the mesohaline estuarine mangrove swamps and fresher interior sawgrass marshes of the shark river estuary ( everglades national park , florida , usa ) to nearshore open coastal waters to test the hypothesis that mangroves can be significant sources of doc , hg , and mehg to coastal waters . estimating mass fluxes of carbon and mercury species in estuarine environments is challenging because of bidirectional flows , rapidly changing concentrations , and the multiple factors that affect tidal interactions with wetlands . we capitalized on the known strong association between doc and hg and applied a recently developed strategy that uses in situ continuous measurements of fluorescent dissolved organic material ( fdom ) as a proxy . we first established the relationship of fdom to doc , total hg and mehg concentrations by measuring fdom in situ while collecting discrete water samples throughout the estuary over a range of salinities and constituent concentrations during both wet and dry seasons . we also measured fdom continuously at a fixed site in the middle of the estuary for approximately two weeks of each season . regression models developed from the estuary - wide data were then applied to convert the seasonal midestuary fdom time series to time series of doc , total hg , and mehg concentrations , which were in turn used to calculate fluxes and yields . the premise of this study was that fluxes past the midestuary site would integrate processes operating over the range of nontidal to tidal domains , thereby providing insight into the production and transport of doc and mercury species . the concentration and flux time series data improve our understanding of processes controlling production and transport of doc , total hg ( thg ) , and mehg from mangrove - dominated areas , assessments previously unattainable in dynamic estuarine systems . the southwest florida coast is a region of mangrove - dominated tidal inlets and rivers . the shark river ( si figure s1 ) is one such river , located entirely within everglades national park . shark river slough drains an area of predominantly freshwater sawgrass marsh in its headwaters , and expansive mangrove swamp characterizes the estuary s lower reaches . tides are semidiurnal with a mean amplitude of approximately 1 m. the everglades experiences two distinct precipitation seasons : a may october rainy season and a november april dry season . regional average annual rainfall is approximately 1.4 m. our midestuary sampling site was near gunboat island ( si figure s1 ) , approximately 10 km inland from the coast and adjacent to a u.s . water depth at the site is 9 m. hg deposition and cycling in the region are strongly coupled to the pattern of precipitation . soil hg concentrations in the lower shark river are relatively high ( 0.15 to 0.30 mg kg ) . during a 2005 reconnaissance study , water samples were collected from a number of southwest florida coastal rivers ( si table s1 ) to identify areas of high hg . for the follow - on flux study , additional samples were collected from the shark river estuary during september 2122 , 2010 ( wet season ) and april 56 , 2011 ( dry season ) ( si figure s1 , si table s2 ) . surface water samples were collected by boat directly into 1 l polycarbonate containers . during the september sampling period , water was also collected at gunboat island from 0.5 m below the air sea interface , at 2 m depth , and at 1 m above the bottom . these samples were collected using a peristaltic pump , a 20 cm length of c - flex tubing , and three teflon tubes ( 1/4 in . samples collected for doc analysis were filtered within 2 h of collection through prerinsed gelman gelcap filters ( nominal cutoff of 0.45 m ) into precleaned , precombusted 1 l or 125 ml amber glass bottles . these samples were refrigerated and express - shipped on ice to the usgs laboratory in boulder , co. samples were analyzed for doc content by wet chemical oxidation and for uv absorbance by diode array spectrophotometry ( see the supporting information for details ) . specific uv absorbance ( suva254 ) was calculated as the uv absorbance at 254 nm divided by the doc concentration . samples collected specifically for total mercury ( thg ) and methylmercury ( mehg ) analyses were drawn directly into acid - washed 1 l pet bottles and then immediately filtered using an all - teflon filtration tower , fired quartz fiber filters ( 0.7 m pore size ) , and teflon sample bottles . all field sampling followed mercury - clean procedures and included the collection of numerous field blanks to monitor for possible contamination . filtered waters were immediately acidified to 1% ( v / v ) with concentrated hcl and were stored at ambient temperature out of direct sunlight . all samples were express - shipped to the usgs mercury research laboratory in madison wi . epa method 1631 and 1630 , respectively , as implemented by the usgs mercury research laboratory ( see the supporting information for details ) . concurrent with collection of each discrete water sample , fluorescent dissolved organic matter ( fdom ) fluorescence and other parameters were measured in situ with an open - faced optical sensor ( wet labs eco ) attached to a water quality sonde ( ysi 6920 ) . for continuous measurements , in situ instruments were deployed at the gunboat island site during september 2030 , 2010 , and april 419 , 2011 . a flow - through fdom fluorometer ( wet labs wetstar ; excitation wavelength 370 nm , emission wavelength 450 nm ) fitted with a pump ( sea - bird electronics 5 t ) and a water quality sonde ( ysi 6920 ) was mounted approximately 1.5 m above the seabed to collect data at 15 min intervals . the fluorometer was purged for one minute , followed by 60 s of data collection . temperature , salinity , dissolved oxygen , ph , and turbidity were also measured during the same 60 s interval . the data were binned by averaging over the last 30 s of each data - collection period . midway through each field deployment , the instruments were briefly removed and cleaned ; the resulting data gaps were filled by interpolation . fluorescence is reported here as quinine sulfate equivalents ( qse ; the concentration of quinine sulfate dehydrate in ppb that results in an equivalent instrument response ) . clean - water offsets , determined prior and subsequent to field deployment , were less than 1% of the measured in situ sample fluorescence values . water discharge data were obtained from the usgs gunboat island stream gage , which was equipped with a side - looking acoustic doppler velocimeter that measured cross - sectional velocities every 15 min . discharge measurements were calibrated using a moving boat equipped with a downward - looking acoustic doppler current profiler , and discharge was calculated according to published methods . concentrations of doc , filtered total mercury ( fthg ) , and filtered methylmercury ( fmehg ) at gunboat island were derived from the continuous in situ fdom measurements . discrete - sample data were used to develop season - specific type i linear regression models to relate doc , fthg , and fmehg concentrations to fdom as described in supporting information section s2 ; no simple relationships were found to relate particle - associated hg concentrations to fdom or other parameters measured continuously in situ . the regression models ( one set applicable where freshwater and midestuary waters mixed and another set applicable where midestuary and saline waters mixed ) were applied to the continuous fdom data to obtain continuous time series estimates of doc , fthg , and fmehg concentrations . the freshwater estuary submodels were applied where fdom > 125 qse ; the estuary seawater submodels , where fdom 125 qse , corresponding to inflection points in salinity , suva254 , fdom , and constituent values ( figure 1 ) . measured dissolved organic carbon ( doc ) and mercury species as a function of salinity ( in practical salinity units , psu ) and dissolved organic matter fluorescence ( fdom ; in quinine sulfate units , qse ) in discrete samples of the shark river estuary , sept . 2122 , 2010 , and april 56 , 2011 : doc ( top row ) , specific uv absorbance at 254 nm ( suva ; second row ) , filter - passing total mercury ( fthg ; third row ) , and filter - passing methylmercury ( fmehg ; bottom row ) . the small gray circles in parts a h show the modeled constituent values at gunboat island for comparison . the large black circles in parts i p indicate fdom < 125 qse , while the large gray circles in these figures indicate fdom 125 qse , corresponding to the two mixing models described in the text . constituent fluxes were calculated for each 15-min interval as the product of the discharge and the estimated constituent concentration . flux is here defined as positive seaward and negative landward ; thus a positive flux represents net export out of the estuary toward the gulf of mexico . yields ( fluxes per unit area ) were estimated by dividing constituent fluxes by the area likely contributing doc and mercury to the midestuary water column . the contributing area in relatively flat tidal systems can not be defined in terms of watershed area , as is typically done for estimates of terrestrial yields . instead , it was estimated for the shark river site as the planar area covered by the water volume of each deployment s tide of maximum exchange . for the tide of greatest ebb flood water - height difference at gunboat island , the volume of the flooding waters was divided by the accompanying change in water height . this initial estimate of area was then refined by adjusting for the effects of soil porosity and water retention . the doc measurement error was 0.2 mg l , for a median error of 1% of the reported values . the laboratory error in fthg measurements was constrained by laboratory protocols to be less than 10% of the measured value . based on the regression models ( si figure s2 ) , the root - mean - square errors of prediction ( rmseps ) for the wet - season models were 2% for the doc model , 11% for fthg , and 5% for fmehg . the dry - season rmseps were 1% for the doc model , 6% for fthg , and 4% for fmehg . cumulative error was estimated as the square root of the sum of the squared error from the component measurements in the flux calculations . , the average errors were estimated to be 12% of the calculated doc flux value , 16% of the calculated fthg value , and 13% of the calculated fmehg value . for the april study period , the average errors were estimated to be 12% of the calculated doc flux value , 14% of the calculated fthg value , and 13% of the calculated fmehg value . the 2005 reconnaissance water sampling of nearshore areas , tidal rivers , and mangrove swamps ( si table s1 ) revealed some of the highest reported levels of mehg for south florida ( > 26 ng l ) , including the everglades . concentrations of fthg and fmehg in samples collected near mangroves were higher than in samples collected from nearby channel waters , suggesting that mangrove areas were contributing large amounts of doc and mercury to estuary and coastal waters . the 20102011 shark river flux study was designed to assess the magnitude of this contribution . water samples and in situ measurements were collected during portions of both the wet and dry seasons to help gauge the range of fluxes that may occur and to provide insights into underlying and perhaps contrasting processes . during the september wet - season sampling period ( figure 2a ) , the gunboat island site experienced much greater precipitation than during the april dry - season period ( figure 2d ) . the midestuary median salinity was 9 psu in september , with a range of over 21 psu ; the median salinity in april was much higher ( 31 psu ) , with a much smaller range ( 9 psu ) . median water height during the september period ( 0.1 ft ) was higher than during april ( 0.7 ft ) . as is discussed below , the salinity gradient , precipitation , and regional water height all have important implications for the estuarine export of doc , thg , and mehg . times series of tidal - stream gage data and modeled constituent concentrations and fluxes in shark river estuary at gunboat island during sept . 2122 , 2010 , and april 56 , 2011 : salinity , water height , and precipitation ( top row ) ; modeled dissolved organic carbon ( doc ) , filtered total mercury ( fthg ) , and filtered methylmercury ( fmehg ) concentrations ( middle row ) , and modeled cumulative doc , fthg , and fmehg fluxes ( bottom row ) . sampling during both seasons encompassed freshwater sawgrass slough , mangrove - dominated coastal swampland , and the higher salinity open coastal waters of ponce de leon bay ( si figure s1 ) . doc concentrations were highest near the most inland , low - salinity sampling sites ; concentrations were lowest offshore in ponce de leon bay ( figure 1a , si table s2 ) . the doc : salinity concentration gradient was steeper during the april dry - season sampling period than during september ( figure 1a , e ) . similar to doc , the highest fdom values during both seasons were from inland fresh waters , while the lowest values were found in outer ponce de leon bay ( si table s2 ) . the down - estuary fdom gradient was steeper in the dry season . during both seasons , fdom and doc concentrations were strongly positively correlated ( figure 1i , m ; r = 0.98 in september ; r = 0.99 in april ) . in contrast , suva254 , a compositional property of doc related to doc aromaticity and source , exhibited maximum values at midrange salinities during both sampling periods ( figure 1b , f ) . fall suva254 values peaked at 5 psu salinity , when the gunboat island median salinity was 9 psu ( figure 2a ) . spring suva254 values peaked at 26 psu , when the median salinity at gunboat island was 31 psu ( figure 2d ) . the spatial distribution of fthg was similar to that of suva254 in both seasons ( figure 1 ) , with both quantities peaking near the region of 5 psu salinity in september ( close to salinities at gunboat island ) and near 20 psu salinity in april ( also close to salinities at gunboat island ) . likewise , september fmehg values peaked near 5 psu salinity , in the mangrove zone , with the lowest concentrations found at offshore salinities ( figure 1d ) . in april , however , the spatial distribution of fmehg more closely resembled that of doc , with the highest concentrations at inland sites and progressively lower values offshore ( figure 1h ) . even so , the april relationship between fdom and fmehg showed an inflection point ( figure 1p ) near 25 psu salinity ( figure 1h ) , indicating a change in doc composition from that previously associated with inland fmehg . interestingly , the spatial distributions of particulate thg ( pthg ) and particulate mehg ( pmehg ) also resembled those of suva254 ( si table s2 ) , suggesting a possible coupling between the particulate and dissolved hg phases . these values for the distribution of mercury between particulate and filtered phases with the majority occurring in the filter - passing fractions are similar to those previously reported for the everglades . the concurrent change in fthg , fmehg , fdom , and suva254 values at the salinities found near gunboat island in both seasons ( figure 1 ) strongly suggests that the primary zone of production of doc , thg , and mehg is geographically fixed within the mangrove portion of the estuary , in the general vicinity of gunboat island . if doc and hg production and hg methylation occurred within a specific salinity zone of the estuary , the peak would shift seasonally away from gunboat island salinities . if the large majority of doc and hg were produced in the fresh waters of the sawgrass slough or in the outer estuary and this was where the majority of hg methylation occurred , there would not have been a midestuary maximum . further evidence that the mangroves supply the majority of doc , hg , and mehg is that midestuary high suva254 values can not be explained by invoking an appreciable contribution of freshwater - derived or outer estuary doc ( figure 1 ) . that the mangrove zone is the primary source of doc and hg supply to the coast is consistent with the findings of romigh et al . , who reported high doc fluxes from shark river mangroves . they also agree with rumbold et al . , who found little hg contribution from uplands and the highest thg and mehg concentrations in the transition zone from sawgrass to mangrove , and with the high thg and mehg concentrations found in our 2005 southwest florida reconnaissance study ( si table s1 ) . one implication of this finding is that , since little of the hg and mehg is derived from the sawgrass portion of the estuary , reducing hg loads to sawgrass marsh areas may have little effect on coastal hg fluxes from mangroves . modeled constituent concentrations in the shark river estuary at gunboat island in september and april generally tracked the water - height variations that marked the flood and ebb of the semidiurnal tides and the longer - period spring the highest modeled doc , fthg , and fmehg concentrations for each time series ( figure 2b , e ) most often occurred just after the lowest water of the ebb tide , near the lowest salinity portion of the tidal cycle . lower concentrations , the result of mixing with coastal waters , were seen coincident with the higher relative salinities that accompanied the flood tides . this difference in concentration between the ebbing and flooding waters drove the majority of flux in shark river estuary . material export from estuaries is driven by both net flow ( the residual water flow after tidal exchange ) and tidal pumping ( net transport resulting from different constituent concentrations in ebbing and flooding waters ) . for the periods measured , net water discharge from the estuary accounted for less than 5% of the estimated constituent flux in september and less than 1% in april . most shark river doc , fthg , and fmehg export was driven by tidal pumping . daily fluxes were always positive ( seaward ) , except for a few periods in the middle of the april deployment ( figure 2c , f ) . for september , estimated daily fluxes from the shark river estuary averaged 9.1 ( 0.6 ) 10 mg d for doc , 1.5 ( 0.2 ) 10 ng d for fthg , and 1.7 ( 0.2 ) 10 ng d for fmehg . in april , the average estimated total daily fluxes were much smaller : 1.5 ( 0.02 ) 10 mg d for doc , 1.7 ( 0.1 ) 10 ng d for fthg , and 1.1 ( 0.04 ) 10 ng d for fmehg . despite finding that all constituents were related to fdom , estimated flux through time was different for each constituent ( figure 2 ) for example , between september 25 and 27 , average daily fluxes were lower than those seen during the first three days of the measurement period to a degree that varied depending on the constituent : approximately 70% lower for doc , 60% lower for fthg , and 35% lower for fmehg ( figure 2c ) . although tidal pumping is the engine that drives shark river doc and hg exports , it appears that flux magnitudes are controlled by hydrologic and geomorphic properties that affect material exchanges between marsh / swamp surfaces and tidal channel waters . tidal exchange volumes were similar during the september and april deployments , but mercury fluxes were significantly larger in the fall than in the spring ( 9 times higher for fthg ; 17 times higher for fmehg ) . water levels were also elevated in september : median water height was 0.6 ft higher and median high water was approximately 0.2 ft higher ( figure 2a , c ) . the greater water heights in fall would have inundated more mangrove - swamp surface area , thus making available more mangrove - derived material for ebb transport to channel waters . the effect of this enhanced supply can be seen in the contrast between the modeled concentration time series in september and april ( figure 2b , e ) . in april , after the tide reversed , a smooth decline in concentration accompanied the incoming flood . in september , however , modeled constituent values did not decline smoothly with the incoming tide . instead , high concentrations often persisted into the subsequent flood stage , likely due to greater inundation during this period of higher water height and slow draining , the result of ebb it appears from these observations that even modest increases in regional sea level due to storms , wind , or rising global sea level have the potential to significantly alter constituent fluxes from mangroves . following the heavy rains of september 27 ( figure 2a ) , for example , estimated total daily fluxes doubled for doc and fthg and increased by 75% for fmehg ( figure 2c ) . note that elevated modeled constituent concentrations ( figure 2b ) did not occur until a full day after the precipitation fell . the heavy rains may have connected a supra - tidal mangrove plain ( normally isolated from the shark river ) to interior intertidal zones , supplying them with doc and hg . the modeled concentrations and fluxes of all constituents remained high ( figure 2c ) . a similar lag effect in flux response to precipitation is seen following the rainfall event of april 4 ( figure 2d , f ) . we sought to compare our flux estimates to previously published values and to assess whether exports from mangroves might represent a significant flux of thg and mehg to coastal waters . to do this , it was necessary to convert our flux values to yields ( fluxes per unit area ) and make a series of assumptions to generate annual values . we first converted the doc , fthg , and fmehg daily fluxes to annual ones by assuming that our deployment periods were representative of their respective seasons ( wet and dry ) . we then converted these to yields by normalizing the fluxes to the area of influence ( see methods ) . this calculation provided an estimated annual doc yield for the shark river estuary of 180 ( 12.6 ) g c m yr . this value is somewhat higher than the estimated annual doc yield reported by romigh et al . ( 56 g c m yr ) for a small mangrove subdrainage in the shark river estuary but is well within the 44381 g c m yr range reported for mangrove swamps worldwide in a review by bouillon et al . the similarity between our results and other published values indicates that our fdom - based methods provided doc yield estimates of a reasonable magnitude . the estimated annual yield for fthg was 28 ( 4.5 ) g m yr : eight times the highest previously reported wetlands value and 20 to 100 times more than is generally reported for wetlands . the estimated yield for fmehg was 3.1 ( 0.4 ) g m yr : 10 to 100 times values previously reported from terrestrial wetlands for fmehg and 5 to 100 times previously published values from terrestrial wetlands for unfiltered mehg . the estimated shark river fmehg yields are more than five times those observed in the st . mary s river , a north florida blackwater river with a high doc concentration and flux . however , the mehg yields found here are similar to those measured in a tule - dominated tidal marsh in san francisco bay ( 2.5 mg m yr ) . our estimates , in combination with other recent studies of tidal wetlands , indicate that tidal flushing of marshes and swamps represents a potentially large and previously unrecognized source of thg and mehg to estuarine and coastal aquatic ecosystems . to assess whether fthg and fmehg exports from mangroves to the coastal ocean might be significant in comparison to other potential sources , we multiplied the shark river yields derived above by the 1400 km of fringing mangrove swamps in southwest florida . this exploratory calculation resulted in estimated annual exports in the range of 250 mt doc , 39 kg fthg , and 4.3 kg fmehg . to include particulate fractions , we increased the mercury fluxes according to the average ratios of particulate to filter - passing hg species found in this ( si table s2 ) and other studies for the everglades . the resulting total ( combined particulate and filtered ) hg exports were thereby found to be approximately 55 kg for thg and 6.5 kg for mehg . we caution that these calculations are wholly heuristic in nature , made only to scale up the magnitudes determined in this study for the purpose of understanding the potential implications of our shark river findings within the context of what is currently known about coastal mercury supply in general . longer time series preferably multiyear time series and studies at multiple locations are needed to adequately constrain fluxes at larger scales . do fluxes of this magnitude represent a significant source to the coastal environment in comparison to other potential sources ? for thg , the primary source to southwest florida coastal waters is currently thought to be atmospheric deposition , with freshwater runoff accounting for only a small fraction . flux from mangroves comparing the potential mangrove flux to estimates of the combined wet and dry deposition of thg to the 5000 km of adjacent coastal waters suggests that mangroves could account for a loading equivalent to approximately 40% of atmospheric thg deposition . . found hg in waters exported from a mangrove marsh to be more reactive with respect to methylation than was hg in ambient estuary water . for mehg , the dominant source to coastal waters in southwest florida is presently thought to be local production in coastal sediments and diffusion into overlying waters ; the amount discharged from uplands and that attributed to wet and dry atmospheric deposition is small . benthic flux magnitudes of mehg from florida coastal sediments have not been reported , but if magnitudes are similar to fluxes observed elsewhere ( 1 pmol m d in chesapeake bay ; 30 pmol m d in san francisco bay ) , then potential mehg loading from mangroves to the 5000 km coastal - ocean area would be the equivalent of 2.5 to 20 times the flux from sediments , more than 80% of the total flux . this assessment , though preliminary in nature , clearly establishes that tidal mangrove systems have the potential to be a significant source of thg and mehg to tropical coastal waters , in addition to their previously demonstrated contributions of doc . our findings , in conjunction with previously published reports from tidal herbaceous wetlands , bolster the suggestion that tidal pumping of doc and hg from tidal wetlands may represent an important source to coastal environments . additional studies are needed to quantify fluxes from mangroves and other tidal systems and to resolve the fate of the material once it enters the nearshore environment . if the large shark river fluxes found in this study are generally representative of tidal mangrove systems , there may be global implications . recently reported particularly high concentrations of hg in tissues and litter fall of mangroves , suggesting that mangroves are particularly efficient at canopy capture of atmospheric hg . high rates of canopy capture in an environment conducive to methylation combined with the high fluxes found here would result in a system particularly efficient at extracting hg from the atmosphere and transporting it to the coastal oceans as mehg , potentially generating large coastal fluxes of mehg wherever mangroves are found . continuous in situ measurements of fdom can serve as a powerful tool for investigating these doc , thg , and mehg mass fluxes in many tidal systems . such measurements are critically needed to improve our understanding of hg cycling , advance predictive models and budgets of carbon and hg in coastal areas , and inform hg total maximum daily load regulation development . further , high - resolution time series of concentrations and fluxes provide valuable insights into the myriad biological , physical , hydrologic , and geomorphic processes affecting tidal exchange insights that should in turn improve estimates of carbon and mercury fluxes into coastal oceans .
the flux of dissolved organic carbon ( doc ) from mangrove swamps accounts for 10% of the global terrestrial flux of doc to coastal oceans . recent findings of high concentrations of mercury ( hg ) and methylmercury ( mehg ) in mangroves , in conjunction with the common co - occurrence of doc and hg species , have raised concerns that mercury fluxes may also be large . we used a novel approach to estimate export of doc , hg , and mehg to coastal waters from a mangrove - dominated estuary in everglades national park ( florida , usa ) . using in situ measurements of fluorescent dissolved organic matter as a proxy for doc , filtered total hg , and filtered mehg , we estimated the doc yield to be 180 ( 12.6 ) g c m2 yr1 , which is in the range of previously reported values . although hg and mehg yields from tidal mangrove swamps have not been previously measured , our estimated yields of hg species ( 28 4.5 g total hg m2 yr1 and 3.1 0.4 g methyl hg m2 yr1 ) were five times greater than is typically reported for terrestrial wetlands . these results indicate that in addition to the well documented contributions of doc , tidally driven export from mangroves represents a significant potential source of hg and mehg to nearby coastal waters .
since superior mesenteric vein thrombosis ( smvt ) is a relatively rare disease and shows no specific symptom , its early diagnosis is reported to be difficult . in this report , we present a patient with acute appendicitis complicated by smvt and portal vein thrombosis ( pvt ) who followed an uneventful course after surgical treatment of the primary disease with a review of the literature . a 45-year - old man whose bmi was 23.2 kg / m visited our outpatient clinic primarily due to fever and abdominal pain . although mild pain was noted in the right lower abdominal region , there was no other symptom including rebound tenderness , and the patient was prescribed drugs and allowed to go home . after 2 days , pain of the right lower abdomen was slightly alleviated , but a fever above 39 c persisted . blood tests showed high values indicating inflammatory reaction , and abdominal ultrasonography and contrast - enhanced ct showed enlargement of the appendix . the body temperature was 39.0 c , the abdomen was flat , pain in the right lower abdominal region was mild , and no rebound tenderness was noted . on the blood tests at the outpatient visit 2 days before , the wbc was 8,300/l , and crp was 7.5 mg / dl , but they were exacerbated to 11,000/l and 34.13 mg / dl , respectively . also , the platelet count was reduced to 75,000/l , and liver dysfunction was suggested by increases in the ast 71 iu / l , alt 58 iu / l , t - bil 2.5 mg / dl , and ldh 303 abdominal contrast - enhanced ct showed increased radiodensity of the enlarged appendix and surrounding adipose tissue ( fig . a , b an enlarged appendix is observed with increased radiodensity in the surrounding adipose tissue . c , d there is no finding suggesting the presence of thrombi in the smv or icv abdominal contrast - enhanced ct on admission . a , b an enlarged appendix is observed with increased radiodensity in the surrounding adipose tissue . c , d there is no finding suggesting the presence of thrombi in the smv or icv after admission , as abdominal findings were unremarkable despite of fever and blood test results . decreases in the platelet count , mild increases in the transaminase levels , and increases in the total bilirubin level were noted . we suspected other diseases , for example , viral infection and blood disease as a cause of inflammation . we initially planned to manage the acute appendicitis conservatively with the possibility of taking into consideration of emergency surgery . tests for viral infections such as cytomegalovirus and eb virus infections were negative , and for fungal infection was negative too . as an empiric treatment , meropenem ( mepm ) was administered at 0.5 g 3/day . the fever , high inflammatory reaction , and liver dysfunction were temporarily alleviated , but the wbc and fever elevated again on the 5th hospital day . abdominal contrast - enhanced ct was performed again , and the result showed no remarkable changes in appendicitis . however , a vine - like low - density area along the ileocolic vein ( icv ) and defects in the lumen of the smv and dendritic low - density area of the portal vein in s5 of the liver were recognized ( fig . 2 ) . we suspected the occurrence of smvt and pvt induced by inflammation extending from protracted appendicitis . . a , b a vine - like low - density area along the icv and defects in the lumen of smv were noted ( white arrows ) . a , c a dendritic low - density area was noted in the portal region in s5 of the liver ( black arrows ) abdominal contrast - enhanced ct on the 5th hospital day . a , b a vine - like low - density area along the icv and defects in the lumen of smv were noted ( white arrows ) . a , c a dendritic low - density area was noted in the portal region in s5 of the liver ( black arrows ) intraoperatively , the appendix adhered to the surrounding tissues but could be detached . the mesoappendix was markedly thickened , and there were findings suggestive of abscess formation in the mesoappendix . no sign of edema , congestion , or necrosis was noted in the large intestine , small intestine , and mesentery . abscesses were noted in the mesoappendix , and fibrinoid necrosis was observed in the vascular wall , particularly the venous wall , in the mesoappendix . no clear thrombus , suppurating thrombus , or biofilm was found in the blood vessels . the postoperative course was uneventful , and improvements were observed in inflammatory reaction , platelet count , transaminase levels , and total bilirubin level . postoperatively , heparin administration was started at 16,000 u / day , and heparin was substituted for warfarin with the resumption of oral nutrition . on the 7th postoperative day , regression and alleviation of smvt and pvt were confirmed by abdominal contrast - enhanced ct . on abdominal contrast - enhanced ct on the 48th postoperative day , no sign of recurrence of smvt or pvt was noted , but the smv was atrophied ( fig . the blood at iii activity , protein c antigen and activity levels , and antinuclear antibody level were measured after surgery . as these parameters were all within the normal range , abnormality of the congealing fibrinogenolysis system was excluded.fig . a , b on the 7th postoperative day , smvt was reduced in size ( white arrows ) , and the images of pvt became unclear ( black arrow ) . c , d on the 48th postoperative day , no sign of recurrence of smvt or pvt was noted abdominal contrast - enhanced ct on the 7th and 48th postoperative days . a , b on the 7th postoperative day , smvt was reduced in size ( white arrows ) , and the images of pvt became unclear ( black arrow ) . c , d on the 48th postoperative day , no sign of recurrence of smvt or pvt was noted smvt is a relatively rare disease first reported by warren et al . in 1935 . the presence of secondary causes has been reported in about 80 % of the cases , and abnormalities of the congealing fibrinogenolysis system ( a decrease in anticoagulant factor , antiphospholipid antibody syndrome ) , portal hypertension , inflammatory diseases of the abdomen , laparotomy , malignant tumor , and trauma have been reported as such secondary causes . if smvt is caused by an inflammatory disease of the abdomen , appendicitis , diverticulitis , cholecystitis , pancreatitis , intra - abdominal infection , and intrapelvic infection are considered . blood cultures are often positive , and escherichia coli , b. fragilis , proteus mirabilis , klebsiella pneumoniae , enterobacter species , etc . , when smvt is caused by appendicitis , as in our patient , the following mechanisms of thrombogenesis are considered possible : ( 1 ) local sepsis due to abscesses in the mesoappendix causes a hypercoagulability state , and thrombi are formed locally . ( 2 ) bacteria infiltrate into the smv , cause angiitis such as portal vein phlebitis , and induce thrombus formation . ( 3 ) bacteria invade into tissues around the veins , cause periphlebitis along the vessels , and as inflammation extends into the vascular lumens , blood clotting is promoted , leading to thrombus formation . in our patient , histopathological examination was performed concerning the mesoappendix alone , and details of smvt or pvt were unclear . however , as no thrombus was noted in the blood vessels of the mesoappendix , as fibrinoid necrosis was observed in the vascular wall , and as abdominal contrast - enhanced ct showed a vine - like low - density area along the icv , the third mechanism is considered the most likely . contrast - enhanced ct is an effective diagnostic examination . filling defect in the lumen of smv caused by thrombus is recognized in 90 % or more of cases . in some cases , the organ blood flow and collaterals smvt is treated conservatively if abdominal symptoms are mild , but surgical treatment is the first choice when intestinal necrosis is strongly suspected . if the progression of thromboembolism is slow , the intestinal blood flow remains relatively intact because of the development of collaterals , and necrosis is avoided . if smvt is caused by inflammation , such as appendicitis as in our patient , thrombi are formed rapidly with exacerbation of inflammation , possibly leading to intestinal edema , congestion , and necrosis . if inflammation can not be controlled sufficiently by conservative treatment , aggressive choice of surgical removal of the primary lesion thrombus formation was observed from the icv to the smv , but physical and imaging examinations suggested that the intestinal blood flow was maintained by the collateral blood flows . however , thrombogenesis extended to the intrahepatic portal system caused by the progression of phlebitis . at the diagnosis of pvt , the control of inflammation by conservative treatment is considered to have become insufficient , and thrombosis was likely to spread further . with a delay of the diagnosis and further progression of pvt , the patient may have developed severe liver dysfunction . intestinal necrosis caused by the progression of smvt and obstruction of collaterals and exacerbation of liver dysfunction caused by the progression of pvt were considered possible , and since a recovery of the platelet count was observed around this time , we decided to perform appendectomy . as a result , the alleviation of inflammatory reaction , liver and coagulation dysfunction were recognized ( fig . circles body temperature ( bt ) , diamonds white blood cells ( wbc ) , squares platelet ( plt ) , triangles c - reactive protein ( crp ) . mepm meropenem , taz / pipc , zosyn ; lvfx levofloxacin , pod post operative day , circles body temperature ( bt ) , diamonds white blood cells ( wbc ) , squares platelet ( plt ) , triangles c - reactive protein ( crp ) . mepm meropenem , taz / pipc , zosyn ; lvfx levofloxacin , pod post operative day , ope operation no clear guidelines have been proposed concerning postoperative anticoagulant therapy [ 7 , 8 ] . some authors report that the recurrence rate of , and mortality rate caused by smvt was lower in patients who underwent postoperative anticoagulant therapy than in those who did not . on the other hand , some authors report that anticoagulant therapy is unnecessary if the primary disease has been controlled adequately even when it is complicated by smvt . in our patient , heparin was administered from immediately after surgery , and the administration of warfarin , with which heparin was substituted , was continued for about half a year . no recurrence of thrombosis was noted even after the discontinuation of warfarin administration . in this case , we took the wrong timing of the operation because we suspected other diseases and smvt and pvt developed caused by appendicitis . from this experience , we consider that smvt or pvt induced by intraperitoneal inflammation such as appendicitis , the primary disease should be aggressively treated by surgery if the control of inflammation by conservative treatment is not effective . in recent years , a concept of interval appendectomy is spreading in appendicitis treatment , and the cases where appendectomy is performed before managed conservatively are increasing . some treatments may not be able to control inflammation enough , like in this case , and develop smvt , pvt . as a cause of liver dysfunction under conservative treatment of appendicitis , one should consider the complication of smvt and pvt as a differential disease . in summary , if acute appendicitis is complicated with liver dysfunction , early diagnosis and sufficient control of inflammation of the primary disease are important while taking into consideration smvt and pvt .
since superior mesenteric vein thrombosis ( smvt ) is a relatively rare disease and shows no specific symptom , its diagnosis tends to be delayed . in this report , we present a patient in whom acute appendicitis was complicated by smvt and portal vein thrombosis ( pvt ) . a definitive diagnosis could be made by abdominal contrast - enhanced ct , and acute appendicitis was surgically treated . anticoagulant therapy was continued for about half a year after surgery . abdominal contrast - enhanced ct after discharge showed no recurrence of smvt or pvt . we consider that acute appendicitis induced smvt or pvt caused by the effect of inflammation . there is the possibility that these conditions lead to intestinal congestion or necrosis and liver dysfunction ; appropriate diagnosis and treatment are necessary .
the need for an improved vaccine against tuberculosis ( tb ) has never been more urgent . one in three people today are infected with mycobacterium tuberculosis , the causative agent of tb , and worldwide approximately three million people die from tb annually . the currently available tb vaccine , bacille calmette - gurin ( bcg ) , has failed to consistently protect against the most contagious form of the disease , adult pulmonary tb , despite its widespread use [ 14 ] . developing a new vaccine , which may serve as a booster or a replacement for bcg , is of critical importance in the fight against worldwide tb - related morbidity and mortality [ 4 , 5 ] . of the various vaccine candidates proposed , fusion subunit vaccines have received considerable attention in the recent literature , especially those composed of antigenic proteins esat-6 , ag85b , and tb10.4 [ 38 ] . it appears that the multiple epitopes that fusion subunit vaccines offer makes them more effective than single - peptide vaccines in interacting with the complexity of the host immune response against tb and the genetic restriction imposed by major histocompatibility complex molecules [ 3 , 9 ] . two fusion subunit vaccines , ag85b - esat-6 and ag85b - tb10.4 , which are the focus of the present study , have been found to induce protective cell - mediated immunity in animal models [ 3 , 6 , 7 , 9 , 10 ] . ag85b - esat-6 is currently in expanded phase i studies in which the vaccine is tested in bcg - vaccinated , latently infected , and individuals from tb endemic regions . as these candidates move forward in or toward clinical trials , it will be critically important to evaluate their protective potential as global vaccines via bioinformatic approaches built upon the comparative genomics of the pathogen population and the immunomics of the host population . comparative genomics of the pathogen population , for instance , allows vaccine candidates that are potentially ineffective due to genetic diversity of the pathogen population to be discredited before they reach the costly stages of clinical trials . in other words , bioinformatic approaches can provide information based on which a rational selection of clinical trial sites can be made . as for subunit vaccines , comparative genomics can help analyze whether antigenic targets are conserved among infectious strains of an organism in order to ensure their protective efficacy across diverse pathogen populations circulating in different geographic region . although previous studies have suggested that m. tuberculosis has a relatively stable genome in comparison with other bacteria [ 11 , 12 ] , recent genomic studies have revealed biologically significant variation among clinical strains . hebert and colleagues , for instance , revealed considerable genetic variation in the ppe18 gene of m. tuberculosis , with important implications for the ability of the mtb72f vaccine candidate to provoke protective immunity against diverse populations of m. tuberculosis . furthermore , the interaction of the genetic variation of the ppe18 component of mtb72f with the allelic variation of human mhc - ii drb1 proteins negatively affects vaccine epitope binding to drb1 proteins . taken in the context of vaccine development , revelations like these are crucial to the survival of vaccine candidates as potential clinical vaccines . a similar comparative genomics study on ag85b - esat-6 and ag85b - tb10.4 subunit vaccines may provide useful information for predicting the protective efficacy of these candidates in the pre- or early stages of their clinical evaluation . little information has been documented on the genetic variation of the genes encoding for esat-6 , ag85b , and tb10.4 proteins . if any of these three genes is highly variable , the protective efficacy of ag85b - esat-6 and ag85b - tb10.4 subunit vaccines might be compromised on the global stage . to further investigate the ability of these two - vaccine candidates in recognizing naturally occurring m. tuberculosis strains , we investigate the genetic diversity of the esxa , esxh , and fbpb genes of m. tuberculosis that encode for the components of the two new subunit vaccines in a sample of 88 m. tuberculosis strains collected from turkey and arkansas , usa . the clinical strains used in the present study are from ark , usa , and turkey . following the work of herbert and colleagues , the isolates were selected to represent different geographical regions , including arkansas and malatya , turkey , to assess the impact of regional genetic variability on the two subunit vaccine candidates . each of the selected isolates represents a different strain of m. tuberculosis with a distinct is6110 restriction fragment polymorphism ( rflp ) pattern with more than five bands or a distinct combination of a common is6110 rflp pattern with five or less bands and a unique spoligo typing pattern ( table 1 ) . the rationale for including isolates from two geographical regions was to discern the potential impact of genetic variation on future vaccination with ag85b - esat-6 and ag85b - tb10.4 in separate populations . our initial intent was to analyze the same set of clinical isolates ( n = 225 ) used by hebert and colleagues in their work on ppe18 and pepa . however , after initial sequencing of a randomly selected subset ( n = 41 ) of the 225 isolates revealed no genetic variation in the esat-6 , tb10.4 , and ag85b genes , we selected only 47 of the remaining 84 isolates that had previously shown variation in the ppe18 gene ( n = 47 ) for the current study . this decision was made with the consideration of cost - effective lab procedure , reasoning that local genetic variations would be indicative of broader genomic variability . the 88 study isolates represent 57 different strains from ark , usa , and 31 distinct strains from turkey . the 88 study isolates shared 49 different spoligotypes that represent 47 different spoligo international types , as determined by using the query tool of the fourth international spoligotyping database ( spoldb4 ) . the present sample represents 80 of 84 strains ( 95.2% ) that showed ppe18 variation in hebert 's study . the three genes under study were amplified using invitrogen platinum taq pcrx polymerase kit ( invitrogen , carlsbad , ca ) with primers published previously . the primers used for esxa , encoding the esat-6 protein were esxa - f ( 5-gcaatccggcggctccaccag-3 ) located 533 bp upstream of the esxa gene and esxa - r ( 5-tcggccgccatgacaacctctc-3 ) located 124 bp downstream from the end of the esxa gene . the primers used for esxh , encoding the tb10.4 protein were esxh - f ( 5-gagagggggaggcgacggcttacc-3 ) located 411 bp upstream of the esxh gene , and esxh - r ( 5-tccccgccccaatggtttcagc-3 ) located 86 bp downstream from the end of the esxh gene . finally , the primers used for fbpb , encoding ag85b protein were fbpb - f2 ( 5-actcggctaactggctggtgc-3 ) located 217 bp upstream of the fbpb gene , and fbpb - r ( 5-cataccgccataccgtttgtgagc-3 ) located 164 bp downstream from the end of the fpbb gene . the inclusion of the regions flanking the esxa , esxh , and fbpb genes allowed further confirmation that the pcr products were specific . the positive control in all the pcr reactions was m. tuberculosis h37rv , and the negative control was pcr - grade water . the 50 l pcr reaction mixture used was composed of 5 l of 10 pcrx amplification buffer , 1.5 l of 50 mm mgso4 , 1 l of 10 mm deoxyribonucleoside triphosphate mixture , 20 pmol of each primer in 1 l , 0.5 l of invitrogen platinum taq polymerase mixture , 4 l of a dna solution containing 50 ng of dna template , and 40 l of pcr - grade water . the thermocycling program used for all genes was one cycle at 94c for 1 minute ; 30 cycles of 94c for 30 seconds , 62c for 30 seconds , and 72c for 2.5 minutes ; and a final cycle of 72c for 10 minutes . the sizes of the pcr products were verified by 1.0% ( wt / vol ) agarose gel electrophoresis in 1 tris - borate - edta buffer . pcr products were sequenced to identify any insertions / deletions or single nucleotide polymorphisms ( snps ) in the esxa , esxh , and fbpb genes in the selected isolates . pcr products were purified using invitrogen purelink pcr purification kit , according to manufacturer instructions ( invitrogen , carlsbad , ca ) . dna sequencing was performed with applied biosystems dna sequencers 3700 and 3730 at the university of michigan sequencing core , using the same primers that were used for the pcr of the three genes . the sequences of esxa , esxh , and fbpb of the study strains were compared to those of m. tuberculosis laboratory reference strain h37rv ( genbank accession number bx842575 ) using the blast and blast2 nucleotide sequence alignment program of the national center for biotechnology information ( http://www.ncbi.nlm.nih.gov/blast ) and the sequencher 4.9 dna sequence assembly software ( demo version ) of gene codes corporation ( www.genecodes.com ) . primary dna transcripts were translated to amino acid sequences using the in silico simulation of molecular biology experiment of the university of basque country ( http://insilico.ehu.es/ ) . among the 88 strains investigated , genetic analysis of esxa and esxh in this study revealed no nucleotide polymorphisms in the genes encoding for esat-6 and tb10.4 proteins . of the 88 strains , 38 ( 43.2% ) belong to principal genetic group 1 , 29 ( 33.0% ) belong to principal genetic group 2 , and 21 ( 23.9% ) belong to principal genetic group 3 . the principle genetic groups were defined by snps in the katg and gyra genes as described previously by sreevatsan and colleagues . unlike the study by herbert et al . , where genetic group 1 strains were found to have the highest frequency of dna polymorphisms in the ppe18 protein , a component of the mtb72f vaccine , strains in all of the three principal genetic groups showed no dna variations in both esxa and esxh . this observation suggests that these gene regions might be conserved among m. tuberculosis strains of different geographic origins and among different genetic groups of the pathogen . in fact , gey van pittius and colleagues have recently posited interspecies conservation of the esat-6 gene region as part of a novel gram - positive secretion system with distant homologues in bacillus subtilis , bacillus anthracis , staphylococcus aureus , and clostridium acetobutylicum . the analysis of fbpb , the gene encoding for ag85b revealed only one synonymous c to a snp , located at position 714 bp of the gene sequence , among 39 ( 44.3% ) of the 88 strains sequenced . double strand sequencing was conducted on the 39 isolates to confirm the existence of this snp . although this snp had no effect on the amino acid sequence of the peptide when translated , it is indicative of an allelic variation in the m. tuberculosis gene pool . of the 39 strains , 15 ( 17.0% ) belong to principal genetic group 1 , 11 ( 12.5% ) belong to principal genetic group 2 , and 13 ( 14.7% ) belong to principal genetic group 3 . furthermore , the snp was not found to be associated with any specific geographic origin of the study strains , suggesting that this particular nucleotide polymorphism is of ancestral origin . these data suggest that m. tuberculosis ag85b antigen is highly conserved in , at least , certain populations of m. tuberculosis clinical strains . tb remains one of the deadliest infectious diseases of our times . despite widespread use of the bcg vaccine , the need for a new vaccine has never been more urgent . in order to gain insight into the efficacy of two new vaccine candidates , two fusion proteins combining ag85b and esat-6 , and ag85b and tb10.4 [ 6 , 9 , 10 ] , respectively , the gene regions encoding for esat-6 , tb10.4 , and ag85b proteins were analyzed for their variability . experiments involving these two candidates have revealed them to be effective in generating protective immunity in animal models [ 6 , 9 , 10 ] . yet , while animal models have played an important role in the development of new tb vaccines so far , they are not always representative of the internal human biological environment . as flynn noted earlier , an important drawback of the murine model is that the pathology of pulmonary tb in mice is quite different from that in humans . specifically , the heterogeneity of granuloma types observed in the human host is not displayed in the mouse lung . similar difficulties arise when using other animal models . in the case of bovine infection , the pathology of tb is quite similar to human host response in granulomatous reactions , but differs with respect to cavitation . non - human primate models also represent the human pathology of tb quite well , but like cattle are limited by economic and infrastructural factors . furthermore , current preclinical studies of new tb vaccines ' protection against m. tuberculosis infection in animal models do not take the population diversity of m. tuberculosis into consideration . however , as hebert and colleagues noted previously , genetic diversity of m. tuberculosis genes can be found among clinical isolates , and such diversity may have important implications for the efficacy of the new vaccines . thus , comparative genomics of the pathogen population stands as an additional useful tool for pre - clinical evaluation of new vaccines , providing information complementary to those from current in vivo and in vitro studies . given the resource - demanding nature of clinical trials , comparative genomics serves as a method for predicting the potential protection of proposed vaccines candidates in the general population . hebert and colleagues ' work revealed that the ppe18 protein , part of the mtb72f subunit vaccine , was quite variable among isolates collected from turkey and arkansas . analyzing the variability of antigens targeted by potential vaccines in a diverse set of isolates at the genomic level may indeed allow researchers to avoid developing a vaccine that is only variably effective like the current bcg . the findings of such study can also inform the rational selection of the study populations , with a consideration of covering the diverse pathogen populations in clinical trials of new vaccines . our observation that esat-6 , tb10.4 , and ag85b proteins were highly conserved in our study sample comprising strains from two geographically distant regions and three different principal genetic groups suggest that it is unlikely that the efficacy of ag85b - esat-6 and ag85b - tb10.4 subunit vaccines will be affected by the genetic diversity of m. tuberculosis population . thus , the protective efficacy of these two novel vaccine candidates may have a wider reach than mtb72b vaccine , which contains a highly variable antigen of m. tuberculosis . however , our findings also indicate the need for further bioinformatics research on the three genes investigated and their specific interaction with the host immune system . while highly conserved genes are indicative of homologous protein antigens , they may also suggest a lack of selective pressure by the host immune system and thus a lack of recognition on behalf of the host 's immune response . previous examples of the inability of animal models to accurately represent the human host environment suggest that the degree to which the human host system interacts with these important peptides remains to be studied . the goal of pre - clinical evaluation of these two vaccines may be furthered by future studies that include a larger sample of isolates from a greater range of geographic origins , making the data even more representative of the diversity of m. tuberculosis worldwide . the finding of this study that esxa , esxh , and fbpb were conserved across 88 clinical strains from arkansas and turkey does not confirm that they are conserved globally . including a larger and more genetically diverse sample of isolates would address the two primary limitations of this study another factor that must be taken into account is the potential impact that host diversity may have on the global coverage of these two new tb vaccines . this study looked at the diversity of pathogen genes coding for vaccine proteins , but even uniformly conserved proteins may fail to induce protective immunity if host diversity impedes their ability to effectively bind effector immune cells . mcnamara and colleagues provide an eloquent , bioinformatic approach to studying the impact that host diversity may have on mtb27f vaccine coverage by analyzing the allelic variation of human class ii mhc drb1 proteins and its impact on proper vaccine epitope binding . a similar study on ag85b - esat-6 and ag85b - tb10.4 may provide insightful information on host diversity and its impact on the coverage of these vaccines . with these future directions in mind , the results of the present study represent an important first step in the pre - clinical bioinformatic assessment of ag85b - esat-6 and ag85b - tb10.4 vaccine candidates , and the impact that genetic diversity among their respective antigenic protein targets has on their potential success as global vaccines . the finding that esxa , esxb , and fbpb genes are highly conserved in two distinct populations suggests that ag85b - esat-6 and ag85b - tb10.4 vaccine candidates may be effective in geographically distinct areas of the world .
the effort to develop a tuberculosis ( tb ) vaccine more effective than the widely used bacille calmette - gurin ( bcg ) has led to the development of two novel fusion protein subunit vaccines : ag85b - esat-6 and ag85b - tb10.4 . studies of these vaccines in animal models have revealed their ability to generate protective immune responses . yet , previous work on tb fusion subunit vaccine candidate , mtb72f , has suggested that genetic diversity among m. tuberculosis strains may compromise vaccine efficacy . in this study , we sequenced the esxa , esxh , and fbpb genes of m. tuberculosis encoding esat-6 , tb10.4 , and ag85b proteins , respectively , in a sample of 88 clinical isolates representing 57 strains from ark , usa , and 31 strains from turkey , to assess the genetic diversity of the two vaccine candidates . we found no dna polymorphism in esxa and esxh genes in the study sample and only one synonymous single nucleotide change ( c to a ) in fbpb gene among 39 ( 44.3% ) of the 88 strains sequenced . these data suggest that it is unlikely that the efficacy of ag85b - esat-6 and ag85b - tb10.4 vaccines will be affected by the genetic diversity of m. tuberculosis population . future studies should include a broader pool of m. tuberculosis strains to validate the current conclusion .
we test individual lots of schneider 's media , fetal bovine serum , and staining reagents . then we aliquot and use the same lot for the entire screen . for any assay , it is best to test several different cell lines to determine which is most amenable to your biological read - out . we typically use the s2-drsc line . grow drosophila cells at 25c in complete schneider 's media . schneider 's media10% heat inactivated fbs1x l - glutamine1x pen / strep antibiotics 10% heat inactivated fbs 1x pen / strep antibiotics drosophila cells are semi - adherent and are passaged without trypsinization every four days by pipetting the cells off the flasks and diluting the cells 1:10 into a fresh flask . plate - to - plate and day - to - day variability are minimized through the use of automated liquid handling for all liquid additions to multi - well plates . spray hood and wellmate with 70% ethanol.remove tubing from packaging and spray with 70% ethanol.insert tubing cassette in dispensing position on the wellmate.prime tubing with 25 ml of 70% ethanol.sterilize tubing in ethanol for 15 minutes , then prime with another 25 ml of ethanol.rinse tubing by priming with 50 ml of sterile pbs . sterilize tubing in ethanol for 15 minutes , then prime with another 25 ml of ethanol . pellet cells so that you have 25% more than needed ( 300xg , 5 min ) . the number of cells seeded per well must be optimized according to assay length . when conducting automated image analysis , a single monolayer with no cell clumping is ideal for image segmentation . resuspend pelleted cells in serum - free schneider 's media at 1.7x10 cells / ml . we perform the screen in 384 well plates pre - aliquoted with a commercially available library of dsrna at a concentration of 250ng / well . several wells of each plate are left empty for controls , which are added manually . we use dsrna against thread ( diap ) as a control for robust rnai . knock down of this anti - apoptotic factor results in dramatic cell death and is a quick visual way to assess the quality of the knock down . lastly , we use a dsrna against the viral reporter , in this case beta - galacosidase , as a positive control to validate that we can inhibit viral infection using our assay read - out . if spotting dsrna into plate at the time of cell seeding , aliquot 1 l dsrna into the corner of the well to allow for easier visualization , then centrifuge dsrna onto bottom of well ( 300xg , 1 min ) before adding cells . add 20 l complete schneider 's media and centrifuge 300xg , 1 min . place plates in humidified tupperware containers lined with water - soaked paper towels . the volume of a 384 well is small ; thus , evaporation can have large effects on the biology , which in turn can lead to artifactual changes in the read - outs of the edge wells . to overcome this there is no need to change the media or open humidified containers during this time . sterilize multi - channel aspirator in quatricide for 15 minutes , then rinse in 70% ethanol . prepare schneider 's media with 2% fbs for infection by diluting complete media 1:5 in serum free media . filter crude virus stock through 0.8 um syringe filter to remove cellular debris or use purified virus . dilute vaccinia virus in 2% serum schneider 's media to obtain multiplicity of infection ( moi ) of 2 . remove pbs from wellmate tubing , and prime with diluted virus until the tubing is free of air bubbles . use sterilized multi - channel aspirator and vacuum manifold to gently remove media from the plates of dsrna - treated drosophila cells . prime with 25 ml of 10% bleach , wait 10 minutes , and prime with another 25 ml 10% bleach . liquid is removed using a multi - channel aspirator and vacuum manifold at each step . remove fix and use wellmate to add 30 l pbst ( pbs + 0.1% triton - x ) . incubate 10 minutes and repeat . operate wellmate as described above , except tubing does not need to be sterilized . to detect vaccinia infection we use a -galactosidase reporter driven by an early / late vaccinia promoter . remove liquid and incubate cells in block ( pbst with 2% bsa ) for 10 minutes . dilute primary antibody in block , remove liquid and add 15 l antibody to each well using a multi - channel repeat pipettor ( matrix ) . spin down plates ( 300xg , 1 min ) , cover with a clear sticker , and incubate at 4c overnight . remove primary antibody , and use the wellmate to wash wells in pbst 3 times , 10 minutes each . dilute fluorescently labeled secondary antibody ( fitc ) and nuclear stain in block , and add 15 l to wells using a multi - channel repeat pipettor . seal plate with clear sticker , cover , and store at 4c up to three weeks . fine - tune the automatic focus function by taking a z stack of images , spaced 1um apart , that span the planes above and below the expected plane of focus . image the entire plate , capturing at least three images per well in both the hoechst channel ( dapi ) and the virus channel ( fitc ) . choose sites from several different regions within one well in order to capture images that represent the well as a whole . use metaxpress software to write a journal to segment the image and use count nuclei modules to calculate the total number of cells positive for nuclear staining ( total cells ) and infection ( fitc ) for each plate . calculate percent infection ( 100*fitc positive / total cells ) and log transform . to identify candidates we use a robust z score based on the median and interquartile range of each plate . this method is insensitive to outliers and nonsymmetric data , and thus provides greater power in identifying even weak or moderate hits 10 . for each plate then the resulting values are divided by 0.74 times the interquartile range ( the difference between the values of the 75 percentile and the 25 percentile ) . the robust z score is a measure of distance in standard deviations from the median of the plate . for example , a robust z - score of 2 indicates the % infection of the well is ~2 standard deviations from the plate median or p<0.05 . wells that have a robust z score for percent infection of > 2 or < -2 in duplicate screens ( p<0.0025 ) without cytotoxicity are considered potential candidates from the primary screen . dsrnas are generated against the genes of interest from another region of the mrna and tested as above . those genes for which two independent dsrnas have the same phenotype can be considered for further study . uninfected wells do not show any staining for vaccinia virus proteins , while a representative infected well contains cells staining positive for vaccinia - expressed beta - galactosidase ( gal ) protein , as measured by immunofluorescence microscopy . automated image analysis software quantifies infection in each image using parameters set by the user . in a representative image , the total number of cell nuclei and the number of cells expressing viral antigen are counted based on size and the intensity of staining above the local background staining . knockdown of thread ( diap ) serves as a positive control for robust rnai depletion of target genes . knockdown of luciferase serves as a negative control for the effect of double - stranded rna treatment on infection . knockdown of gal protein serves as a positive control for a reduction in infection , since the assay uses gal protein levels as a read out of infection . knockdown of cellular factor rab5 results in a decrease in the percentage of infected cells . since rab5 is known to participate in endocytosis , this factor likely contributes to vaccinia virus entry . we test individual lots of schneider 's media , fetal bovine serum , and staining reagents . then we aliquot and use the same lot for the entire screen . for any assay , it is best to test several different cell lines to determine which is most amenable to your biological read - out . we typically use the s2-drsc line . grow drosophila cells at 25c in complete schneider 's media . schneider 's media10% heat inactivated fbs1x l - glutamine1x pen / strep antibiotics 10% heat inactivated fbs 1x pen / strep antibiotics drosophila cells are semi - adherent and are passaged without trypsinization every four days by pipetting the cells off the flasks and diluting the cells 1:10 into a fresh flask . plate - to - plate and day - to - day variability are minimized through the use of automated liquid handling for all liquid additions to multi - well plates . spray hood and wellmate with 70% ethanol.remove tubing from packaging and spray with 70% ethanol.insert tubing cassette in dispensing position on the wellmate.prime tubing with 25 ml of 70% ethanol.sterilize tubing in ethanol for 15 minutes , then prime with another 25 ml of ethanol.rinse tubing by priming with 50 ml of sterile pbs . sterilize tubing in ethanol for 15 minutes , then prime with another 25 ml of ethanol . pellet cells so that you have 25% more than needed ( 300xg , 5 min ) . the number of cells seeded per well must be optimized according to assay length . when conducting automated image analysis , a single monolayer with no cell clumping is ideal for image segmentation . resuspend pelleted cells in serum - free schneider 's media at 1.7x10 cells / ml . we perform the screen in 384 well plates pre - aliquoted with a commercially available library of dsrna at a concentration of 250ng / well . several wells of each plate are left empty for controls , which are added manually . we use dsrna against thread ( diap ) as a control for robust rnai . knock down of this anti - apoptotic factor results in dramatic cell death and is a quick visual way to assess the quality of the knock down . lastly , we use a dsrna against the viral reporter , in this case beta - galacosidase , as a positive control to validate that we can inhibit viral infection using our assay read - out . if spotting dsrna into plate at the time of cell seeding , aliquot 1 l dsrna into the corner of the well to allow for easier visualization , then centrifuge dsrna onto bottom of well ( 300xg , 1 min ) before adding cells . add 20 l complete schneider 's media and centrifuge 300xg , 1 min . place plates in humidified tupperware containers lined with water - soaked paper towels . the volume of a 384 well is small ; thus , evaporation can have large effects on the biology , which in turn can lead to artifactual changes in the read - outs of the edge wells . to overcome this there is no need to change the media or open humidified containers during this time . sterilize multi - channel aspirator in quatricide for 15 minutes , then rinse in 70% ethanol . prepare wellmate as described above . prepare schneider 's media with 2% fbs for infection by diluting complete media 1:5 in serum free media . filter crude virus stock through 0.8 um syringe filter to remove cellular debris or use purified virus . dilute vaccinia virus in 2% serum schneider 's media to obtain multiplicity of infection ( moi ) of 2 . remove pbs from wellmate tubing , and prime with diluted virus until the tubing is free of air bubbles . use sterilized multi - channel aspirator and vacuum manifold to gently remove media from the plates of dsrna - treated drosophila cells . prime with 25 ml of 10% bleach , wait 10 minutes , and prime with another 25 ml 10% bleach . liquid is removed using a multi - channel aspirator and vacuum manifold at each step . remove fix and use wellmate to add 30 l pbst ( pbs + 0.1% triton - x ) . incubate 10 minutes and repeat . operate wellmate as described above , except tubing does not need to be sterilized . to detect vaccinia infection we use a -galactosidase reporter driven by an early / late vaccinia promoter . remove liquid and incubate cells in block ( pbst with 2% bsa ) for 10 minutes . dilute primary antibody in block , remove liquid and add 15 l antibody to each well using a multi - channel repeat pipettor ( matrix ) . spin down plates ( 300xg , 1 min ) , cover with a clear sticker , and incubate at 4c overnight . remove primary antibody , and use the wellmate to wash wells in pbst 3 times , 10 minutes each . dilute fluorescently labeled secondary antibody ( fitc ) and nuclear stain in block , and add 15 l to wells using a multi - channel repeat pipettor . seal plate with clear sticker , cover , and store at 4c up to three weeks . fine - tune the automatic focus function by taking a z stack of images , spaced 1um apart , that span the planes above and below the expected plane of focus . image the entire plate , capturing at least three images per well in both the hoechst channel ( dapi ) and the virus channel ( fitc ) . choose sites from several different regions within one well in order to capture images that represent the well as a whole . use metaxpress software to write a journal to segment the image and use count nuclei modules to calculate the total number of cells positive for nuclear staining ( total cells ) and infection ( fitc ) for each plate . calculate percent infection ( 100*fitc positive / total cells ) and log transform . to identify candidates we use a robust z score based on the median and interquartile range of each plate . this method is insensitive to outliers and nonsymmetric data , and thus provides greater power in identifying even weak or moderate hits 10 . for each plate . then the resulting values are divided by 0.74 times the interquartile range ( the difference between the values of the 75 percentile and the 25 percentile ) . the robust z score is a measure of distance in standard deviations from the median of the plate . for example , a robust z - score of 2 indicates the % infection of the well is ~2 standard deviations from the plate median or p<0.05 . wells that have a robust z score for percent infection of > 2 or < -2 in duplicate screens ( p<0.0025 ) without cytotoxicity are considered potential candidates from the primary screen . dsrnas are generated against the genes of interest from another region of the mrna and tested as above . those genes for which two independent dsrnas have the same phenotype can be considered for further study . figure 1 . uninfected wells do not show any staining for vaccinia virus proteins , while a representative infected well contains cells staining positive for vaccinia - expressed beta - galactosidase ( gal ) protein , as measured by immunofluorescence microscopy . automated image analysis software quantifies infection in each image using parameters set by the user . in a representative image , the total number of cell nuclei and the number of cells expressing viral antigen are counted based on size and the intensity of staining above the local background staining . knockdown of thread ( diap ) serves as a positive control for robust rnai depletion of target genes . knockdown of luciferase serves as a negative control for the effect of double - stranded rna treatment on infection . knockdown of gal protein serves as a positive control for a reduction in infection , since the assay uses gal protein levels as a read out of infection . knockdown of cellular factor rab5 results in a decrease in the percentage of infected cells . since rab5 is known to participate in endocytosis , this factor likely contributes to vaccinia virus entry . genome - wide rnai screening in drosophila provides a robust and efficient method for examining the cellular component of viral infection . a number of mammalian viruses infect drosophila cells , which can be used to identify components of the host intrinsic immune response , and host protein factors required for viral replication that may represent novel therapeutic targets . before performing a screen , the assay must be carefully optimized for cell type , cell number , and infection level , and must be well controlled , including both positive and negative viral and cellular targets . it is important to ensure sufficient separation between positive and negative controls prior to screening to maximize the dynamic range of the assay . once the screen has been performed , candidates can be divided into functional categories to determine which host mechanisms contribute to infection . for mammalian viruses such as vaccinia , the contribution of mammalian homologs by rnai should be determined as part of secondary analysis . taken together , these robust screening methods will allow us to gain insight into complex mechanisms by which viruses interact with their host cells .
viral pathogens represent a significant public health threat ; not only can viruses cause natural epidemics of human disease , but their potential use in bioterrorism is also a concern . a better understanding of the cellular factors that impact infection would facilitate the development of much - needed therapeutics . recent advances in rna interference ( rnai ) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome - wide , cell - based loss - of - function screens . drosophila cells are particularly amenable to genome - scale screens because of the ease and efficiency of rnai in this system 1 . importantly , a wide variety of viruses can infect drosophila cells , including a number of mammalian viruses of medical and agricultural importance 2,3,4 . previous rnai screens in drosophila have identified host factors that are required for various steps in virus infection including entry , translation and rna replication 5 . moreover , many of the cellular factors required for viral replication in drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8 , 9 . therefore , the identification of host factors co - opted during viral infection presents novel targets for antiviral therapeutics . here we present a generalized protocol for a high - throughput rnai screen to identify cellular factors involved in viral infection , using vaccinia virus as an example .
leukocytic infiltration of the cornea is a common and important pathologic process observed in infection , autoimmune diseases , allograft rejection , and surgical and nonsurgical trauma . soluble chemotaxins , such as interleukin-8 ( il-8 ) and monocyte chemotactic peptide ( mcp ) , both appear to be essential to leukocyte recruitment , accumulation , and activation at sites of inflammation . il-8 and mcp are distinct polypeptides that directly mediate leukocyte chemotaxis in vitro and in vivo and may be secreted by tissue - based cells exposed to inflammatory cytokines [ 1 , 2 ] . both il-8 and mcp have been shown to be produced by human corneal tissue in response to inflammatory stimuli [ 3 , 4 ] . since the cornea is normally avascular , identification of chemotaxins that elicit corneal leukocyte infiltration may be pertinent to understanding pathogenetic mechanisms regulating corneal inflammation and immunity . lipopolysaccharide ( lps ) is a component of gram - negative bacteria cell membrane that is known to induce the innate immune response . the importance of corneal leukocytic infiltration in disease has prompted prior investigations of corneal - derived chemotactic factors , including lipopolysaccharide ( lps ) [ 58 ] , but the specific time- and dose - dependent properties of il-8 and mcp in response to lps have not previously been identified . in this study , we evaluated cultured human corneal stromal cells for the production of il-8 and mcp using northern blot analysis to assess gene expression and enzyme - linked immunoabsorbent assays ( elisa ) to measure corneal stromal cell secretion of il-8 and mcp product in response to stimulation by lps . human donor corneal specimens of good quality , but unsuitable for transplantation , were obtained from the michigan eye bank and transplantation center or the illinois eye bank . within 24 hours of death , corneal stromal cells were harvested by trimming all limbal tissue , mechanically removing the epithelium and endothelial cells , and establishing the corneal stromal cells in dulbecco 's modified essential medium containing 15% fetal bovine serum ( fbs ) . fourth to sixth passaged cells were used for all assays . before stimulation with cytokines , the cell cultures were rinsed with fresh , serum - free medium . assayed stromal cells were either left unstimulated or treated with lipopolysaccharide ( lps ; escherichia coli 0111:b4 , sigma chemical co. , st . cultured cells were also exposed to lps at specified concentrations ( 1 , 10 , 100 , 1000 , 10,000 ng / ml ) for 8 hours . after experimental incubations , culture media were collected and stored at 70c until elisa assays for il-8 or mcp were performed and the cell monolayers were extracted for il-8 and mcp mrna analysis . human corneal stromal cell monolayers were solubilized in 25 mm tris containing 4.2 m guanidine isothiocyanate , 9.5% sarkosyl , and 0.1 m -mercaptoethanol . total corneal stromal cell rna was extracted , and northern blots prepared by extracting rna , which was separated by electrophoresis , transferred to nitrocellulose and hybridized with either a p-5-end - labeled 30 nucleotide probe complementary to either nucleotides 262 to 291 of the published cdna sequence for il-8 or to nucleotides 256 to 285 of the published cdna sequence for mcp . equivalent amounts of rna in each northern blot was assessed by monitoring equivalence of 28s and 18s rrna signals . immunoreactive il-8 or mcp was measured in corneal stromal cell supernatants using a modification of a double ligand elisa method . briefly , 96-well microtiter plates were coated with either rabbit anti - il-8 or anti - mcp antibody . sequential incubations with biotinylated rabbit anti - il-8 ( 1 : 2000 ) or anti - mcp then performed and chromogen substrate was added . plates were read in an elisa reader and calibrated using 1/2 log dilution standards of ril-8 or rmcp concentrations ranging from 1 pg to 1000 ng / well . under each condition , the elisa was performed 1 ml of media covering 500,000 cells . this elisa method consistently detected il-8 or mcp concentrations greater than 10 pg / ml in a linear fashion . the various assay conditions were compared using student 's t - test and p - values less than 0.05 were considered to be statistically significant . northern blot analysis was performed to assess mrna expression of il-8 and mcp by human corneal stromal cells in response to varying exposure times ( 2 , 4 , 8 , and 24 hours ) to lps at a concentration of 1000 ng / ml . mrna expression of both il-8 and mcp was demonstrated to be minimal after 2 hours of exposure to lps , but then increased substantially after 4 to 8 hours of exposure to lps ( figure 1 ) . mrna expression of both il-8 and mcp was decreased after 24 hours of lps exposure , with a greater decrease seen in il-8 than mcp expression ( figure 1 ) . elisa was performed to assess the expression of il-8 and mcp by human corneal stromal cells after exposure to lps ( 1000 ng / ml ) for 2 , 4 , 8 , and 24 hours . a low level of constitutive il-8 and mcp was consistently determined on unstimulated control cells . a substantial increase was seen relative to unstimulated control with stimulation of lps as soon as 2 hours after exposure , and at all measured time points ( p < 0.05 ) ( figures 2 and 3 ) . expression of both il-8 and mcp-1 increased progressively with length of time of exposure to lps ( p < 0.05 ) ( figures 2 and 3 ) . to determine the effect of lps concentration on human corneal stromal cell il-8 and mcp expression , cells were incubated for 8 hours with different concentrations of lps ( 1 , 10 , 100 , 1,000 , and 10,000 ng / ml ) . elisa was used to compare the il-8 and mcp expression at the different concentrations of lps . increasing concentrations of lps led to progressive increases in il-8 expression which were statistically significant ( p < 0.05 ) ( figure 4 ) . there was also increased mcp expression with increasing concentrations of lps , but mcp expression reached a plateau at lps concentrations greater than 100 ng / ml ( figure 5 ) . mcp expression was statistically significantly increased from baseline at all concentrations greater than 1 ng / ml ( p < 0.05 ) . circulating leukocytes infiltrate tissue at sites of inflammation by binding to cellular adherence molecules expressed by tissue - based cells and migrating along gradients of specific chemotactic factors . although the precise stimuli initiating inflammation vary , they appear to trigger common pathogenetic cascades leading to leukocyte elicitation and activation . lps is an important mediator of inflammation that has been shown to induce de novo synthesis of specific leukocyte chemotaxins , such as il-8 and mcp , by tissue - based cells . our results show that il-8 and mcp are chemotaxins that are significantly induced in corneal stromal cells by lps stimulation . our findings suggest that lps stimulation of steady - state corneal stromal cell il-8 and mcp mrna is prompt and is subsequently followed by secretion of significant levels of these cytokines human corneal stromal cells . this induction is time dependent , with exposures of 4 to 8 hours inducing the highest increase in mrna expression seen in our assays . there is then a decrease in mrna expression at 24 hours , possibly indicating a saturation effect of this pathway of acute inflammation . this decrease was more marked with il-8 mrna expression than mcp , likely associated with the role of mcp in more chronic inflammation . our results show that both il-8 and mcp protein expression continues to increase over the first 24 hours of exposure to lps . it would be interesting to proceed with a longer - term study to evaluate the time dependency of the protein expression of these chemokines . our study also evaluates the effect of concentration of lps on protein expression of il-8 and mcp by corneal stromal cells . il-8 expression increased dramatically in response to increasing concentrations of lps . on the other hand , mcp expression reached a maximum at an lps concentration of 100 ng / ml , and then seemed to plateau or even show slight decreases in expression at higher concentrations of lps . previous studies have shown that lps from several different bacterial species induces increased il-8 and mcp mrna by quantitative rt - pcr and increased protein expression by elisa . it has also been shown that increased il-8 and mcp mrna and protein expression in corneal fibroblasts is potentiated by lps - binding protein and soluble cd14 . to our knowledge , this is the first study to show the time - course and dose dependence of the induction of il-8 and mcp in human corneal stromal cells after exposure to lps . once secreted , corneal - derived il-8 and mcp may elicit their inflammatory effects by binding specific receptors on neutrophils , lymphocytes , and monocytes , leading to leukocyte accumulation and activation at the site of inflammation [ 3 , 4 ] . the elaboration of il-8 and mcp by tissue - based cells may be an especially important mechanism directing leukocytes to migrate over long distances through tissue in which blood vessels containing circulating leukocytes are absent , such as the normally avascular cornea . the induction of il-8 and mcp is one of many events that occur in response to lps . thus , corneal stromal keratocytes may produce soluble , diffusible chemotaxins , including il-8 and mcp , that may be important in the inflammatory cascade response to lps stimulation .
purpose . to determine time course of effect of lipopolysaccharide ( lps ) on production of interleukin-8 ( il-8 ) and monocyte chemotactic protein ( mcp ) by cultured human corneal stromal cells . methods . human corneal stromal cells were harvested from donor corneal specimens , and fourth to sixth passaged cells were used . cell cultures were stimulated with lps for 2 , 4 , 8 , and 24 hours . northern blot analysis of il-8 and mcp gene expression and elisa for il-8 and mcp secretion were performed . elisa results were analyzed for statistical significance using two - tailed student 's t - test . results . northern blot analysis demonstrated significantly increased il-8 and mcp gene expression after 4 and 8 hours of exposure to lps . elisa for secreted il-8 and mcp demonstrated statistically significant increases ( p < 0.05 ) after corneal stromal cell stimulation with lps . conclusions . this paper suggests that human corneal stromal cells may participate in corneal inflammation by secreting potent leukocyte chemotactic and activating proteins in a time - dependent manner when exposed to lps .
gallen international breast cancer conference ( 2011 ) expert panel adopted a new approach towards classifying patients for therapeutic purposes based on the recognition of intrinsic biological subtypes within the breast cancer spectrum . for practical purposes , these subtypes may be approximated using clinicopathological factors rather than gene expression array criteria , including luminal a ( la ) and luminal b ( lb ) breast tumors , overexpression of human epidermal growth factor receptor 2 ( her2 ) , and triple - negative breast cancer ( tnbc ) . clinicopathological subtypes are becoming increasingly relevant to both the diagnosis of breast cancer patients with different prognoses and their therapies . hormone receptor - positive breast cancer is a factor that is predictive of the response to endocrine therapy , and her2-positive breast cancer is sensitive to targeted therapy with a specific monoclonal antibody . in fact , endocrine therapy has fared better than targeted therapy in developing countries such as china because of economic reasons . a recent study suggested that one year of adjuvant trastuzumab treatment was cost - effective , and the incremental cost for an additional year of life was more than us$7,500 in developed areas such as beijing , shanghai , and guangzhou . however , the economic burden of us$40,000 , which is the standard cost of chemotherapy , was very expensive for most patients in underdeveloped areas . the department of breast surgery was established in april 2005 , and the follow - up system was established in june 2006 . in addition , the number of patients treated per year increased from 40 cases in 2005 to 440 cases in 2011 . unfortunately , the first patients with her2 overexpression were not accepted to receive targeted therapy until may 2010 . the aim of this study was to estimate the death and relapse rates of patients with major subtypes of breast invasive ductal cancer as classified using immunohistochemical assays ; in addition , we investigated beneficial treatment patterns from therapies given over the past several years . between june 2006 and december 2009 , a total of 199 patients with invasive breast cancer were evaluated in the department of breast surgery at the shengjing hospital of china medical university , shenyang , china . all patients were treated with adjuvant systemic therapy ( chemotherapy , radiotherapy , and endocrine therapy ) guided by the national comprehensive cancer network ( nccn ) . the followup was carried out at 3-month intervals during the first two years , at 6-month intervals during the next three years , and at 12-month intervals thereafter . the diagnosis of local recurrence and contralateral breast cancer was supported by biopsy , and distant metastasis was diagnosed by more than two kinds of imaging examinations . the outcome criteria were relapse and death due to disease , time until progression ( disease - free survival , dfs ) , and overall survival ( os ) . in this rather homogeneous and relatively small group of patients , we collected anthropometric data ( age at diagnosis , menopause , family history , and hormonal therapy ) , as well as variables related to the tumor ( size , location , tnm staging , histologic grade , and lymphovascular invasion ) . pathological tumor stage was assessed according to the criteria established by the 6th edition of the american joint committee on cancer ( ajcc ) staging manual . the histological grade of the tumors was classified into grades i iii according to the nottingham combined histological grade . immunohistochemistry ( ihc ) was performed on formalin - fixed , paraffin - embedded samples obtained from the pathology registry . tissue sections ( 5 m ) were deparaffinized in xylene and rehydrated in a graded series of ethanol . slides were treated with methanol containing 0.3% hydrogen peroxide to block any endogenous peroxidase activity . heat - mediated antigen retrieval with the pressure cooker method was used for all stainings except for the epidermal growth factor receptor ( egfr ) , which did not need retrieval . antibodies recognizing the estrogen receptor ( er ) , progesterone receptor pgr , and her2 were used for immunohistochemical studies on serial tissue sections from each case ; egfr and ki67 antibodies were used in luminal a tumors . thus , in total , five markers were assessed , namely , er , pgr , her2 , and egfr , which were used for breast carcinoma subtypes , and ki67 , which was used to divide luminal a tumors into two groups . the primary antibodies used in this study included er ( sp1 , 1 : 200 dilution ; zeta ) , pgr ( sp2 , 1 : 200 dilution ; zeta ) , her2 ( cb11 , 1 : 100 dilution ; invitrogen , carlsbad , ca , usa ) , egfr ( sp9 , 1 : 100 dilution ; invitrogen ) , and ki67 ( k-2 , 1 : 100 dilution ; invitrogen ) . immunostaining was scored in a double - blinded manner by two different pathologists who were blinded to the clinicopathologic characteristics and outcome of each patients . for each antibody , the location of immunoreactivity er and pgr staining was assessed by allred scoring , with positive scores ranging from 2 to 8 . egfr staining was considered positive if any cytoplasmic and/or membrane staining was observed , her+ ( ihc ) was defined as a strong whole membrane staining in > 30% of the tumor cells , and ki67 status was expressed in terms of percentage of positive cells , with a threshold of 14% of positive cells . fluorescence in situ hybridization ( fish ) analysis was performed on ihc+ tumors using the pathvysion her2 dna probe kit ( vysis , downers grove , il , usa ) . her2-positive staining was defined as fish positive , and her2-negative staining was defined as ihc 0 or negative fish results . the clinicopathological subtypes of breast cancer were previously described and were best matched with gene expression patterns . briefly , the subtype definitions are as follows : luminal a ( er+ and/or pgr+ and her2 and/or ki67 < 14% ) , luminal b ( er+ and/or pgr+ and her2 + and/or ki67 14% ) , her2 overexpression ( er , pgr , and her2 + ) , and triple negative ( er , pgr , her2 ) ( table 1 ) . all statistical analyses were carried out using spss software ( version 17.0 for windows ) . the correlation analyses between clinicopathological subtypes and the various biological factors were examined by the x test or anvoa analysis . for survival analysis , overall survival ( os ) and disease - free survival ( dfs ) sixty - six ( 33.2% ) patients were classified as luminal a , 55 ( 27.6% ) were luminal b , 26 ( 13.1% ) were her2-positive , and 52 ( 26.1% ) had triple - negative breast cancer . the distribution of characteristics among the various intrinsic subtypes of breast cancer is listed in table 2 ; there were significant differences in histological grade , chemotherapy time , chemotherapy program , chemotherapy cycle , radiotherapy , and endocrine therapy among the subtype cohorts ( p < 0.05 ) . of the 199 patients involved in this study , 181 ( 91% ) were treated with mastectomy , 18 ( 9% ) were treated with tumorectomy , 94.5% received chemotherapy , 43.7% received radiotherapy , and 57.8% received hormone therapy ( table 2 ) . with a follow - up period from 13 to 66 months , the actuarial os of luminal a , luminal b , her2 overexpression , and triple - negative breast cancer was 100 , 85.5 , 84.6 , and 86.5% , respectively , and there were significant differences among the subtypes ( p = 0.015 ) ( table 3 ) . the median survival time of patients with luminal a , luminal b , her2 overexpression , and triple - negative subtypes of breast cancer was 66 , 60 , 60 , and 66 months , respectively , and there were significant differences among subtypes ( p = 0.033 ) ( table 3 ) . in particular , significant differences were on the overall survival curve ( p = 0.017 ) ( figure 1(a ) ) . the actuarial dfs of luminal a , luminal b , her2 overexpression , and triple - negative subtypes was 100 , 83.6 , 80.8 , and 84.6% , respectively , and there were significant differences among the subtypes ( p = 0.006 ) ( table 3 ) . the median disease - free survival time of luminal a , luminal b , her2 overexpression , and triple - negative subtypes was 66 , 60 , 60 , and 66 months , and there were significant differences among the subtypes ( p = 0.013 ) ( table 3 ) , particularly on the disease - free survival curve ( p = 0.008 ) ( figure 1(b ) ) . twelve kinds of patient 's independent biological factors were used to build a cox proportional hazard model for death and tumor progression ( table 4 ) . there were significant differences in age , menopause status , lymph node metastasis , and her2 overexpression for death ( p < 0.05 ) and exp ( b ) ( expose of the b coefficient ) , namely , 1.01 , 5.28 , 10.01 , and 4.32 , respectively . there were significant differences in age , menopause status , lymph node metastasis , and her2 overexpression for tumor progression ( p < 0.05 ) and exp ( b ) , namely , 1.08 , 4.45 , 6.97 , and 3.88 , respectively . four kinds of independent treatment factors were used to build a cox proportional hazard model for death and tumor progression . there were significant differences only in chemotherapy ( p < 0.05 ) and exp ( b ) , which were 1.63 for death and 1.60 for tumor progression ( table 4 ) . breast cancer remains one of the leading causes of cancer - related death worldwide , with invasive ductal cancer ( idc ) being the most common type . however , the prognosis significantly changed with the introduction of adjuvant therapy , including chemotherapy , radiotherapy , endocrine therapy , and targeted therapy . breast cancer is a heterogeneous group of neoplasms , and the aim of grouping them into clinicopathological subtypes was to predict prognosis and guide treatment . recent studies have shown that patients with luminal a idc have the best prognosis among all subtypes , are sensitive to endocrine therapy , and are insensitive to chemotherapy . in that study , none of the 66 patients with luminal a idc died or experienced tumor progression , the os and dfs were 100% , and the median survival and disease - free survival time were 66 months . gallen consensus considered the endocrine therapy enough for patients with early luminal a breast cancer . triple - negative tumors have two subgroups : basal - like and normal , with the expression of cytokeratin being the main difference between them . previous studies demonstrated that triple - negative breast cancer is associated with young age , high - grade tumors , advanced stage at diagnosis , difference in chemotherapy response compared to other subtypes , and the shortest survival . our data suggest that patients with triple - negative breast cancer do not have the worst prognosis , which related with confounding factors of normal like subgroup . of course , the factors that affected the results of the survival analysis were complex , and the main reason could be confounding factors of normal - like subtypes . survival analysis showed that patients with her2 overexpression had the worst os and dfs , with patients with luminal b tumors ranking second . in fact , it appears that a lack of anti - her2 therapy ( targets therapy of trastuzumab ) was the main reason that patients had a poor prognosis . however , it was unclear why the prognosis of patients with luminal b tumors was worse than those with triple - negative breast cancer . according to the principle of clinicopathological subtypes , luminal b tumors can be divided into two subgroups : ki67 14% and her2 overexpression . we conducted survival analysis based on five subtypes ; namely , luminal a , luminal bk ( ki67 14% ) , luminal bh ( her2 overexpression ) , her2 overexpression , and triple - negative breast cancer ( figures 1(c ) and 1(d ) ) . as figures 1(c ) and 1(d ) show , the os of patients with luminal bh ( her2 overexpression ) was the lowest of all subtypes , and the risk of death was the highest of all subtypes ( p = 0.042 ) . dfs was the lowest of all subtypes , and risk of tumor progression was the highest of all subtypes ( p = 0.018 ) . this result was unexpected , which the prognosis of patients with luminal bh was poorer than those with her2 subtype . it was not enough to interpret the differences between luminal bh and her2 subtypes that no patients with her2 enriched were accepted to targets therapy . two kinds of cox models were established to find the relative risk factor of death and tumor progression , including biological factors and treatment , respectively . table 4 shows that age , menopause status , lymph node metastasis , and her2 overexpression are significant relative risk factors for death and tumor progression . however , there was no significance among the four subtypes in age , menopause status , and lymph node metastasis among the subtypes ( table 2 ) . table 4 showed that chemotherapy was the only significant relative risk factor for death and tumor progression . in fact , there were significant differences among the four subtypes in adjuvant or neoadjuvant therapy , as well as the program and cycle of chemotherapy ( table 2 ) . therefore , we speculated that chemotherapy factors were the main reasons underlying the poorer prognosis of patients with luminal b tumors compared to other subtypes . since the introduction of cmf ( cyclophosphamide + methotrexate + 5-fluorouracil ) chemotherapy in the last century compared with cmf , 5-year relapse free survival ( rfs ) and os were favored anthracycline - containing regimens . based on the breast cancer international research group ( bcirg ) 001 trial , the submitted evidence shows that tac ( docetaxel + doxorubicin + cyclophosphamide ) is associated with superior disease - free and overall survival at 5 years compared to the anthracycline - based regimen fac ( doxorubicin + cyclophosphamide + 5-fluorouracil ) , and the side effects from tac were more serious than those from fac . in our study , the proportion of patients who accepted tac chemotherapy was the least among patients with luminal b tumors compared to that of patients with other breast cancer subtypes ( 5.5% ) ( table 2 ) . upon the review of the selection process about chemotherapy , it was in the main subjective reasons causing lower intensity of chemotherapy that the primary doctors consider that patients with luminal b subtypes were sensitive to endocrine therapy and had the good prognosis like the luminal a subtype . the secondary reason was that the improved prognosis of patients with tnbc related with the chemotherapy protocols included docetaxel ( 61.5% ) ( table 2 ) . in summary , our data confirmed that her2 overexpression is an important indicator of poor prognosis . as a result , furthermore , our data prompted that chemotherapy intensity would be enhanced in patients with positive hormone receptors and positive her2 . these patients did not accept the target therapy because of economic reasons and usually were not accepted in intensive chemotherapy due to doctor 's subjective deviations in china .
background . immunohistochemical markers were often used to classify breast cancer into subtypes . the aim of this study was to estimate death and tumor progression for patients with the major subtypes of breast cancer as classified using immunohistochemical assay and to investigate the patterns of benefit from the therapies over the past years . methods . the study population included primary , operable 199 invasive ductal breast cancer patients , with the median age of 51.1 years old . all patients underwent local and/or systemic treatments . the clinicopathological characteristics and clinical outcomes were retrospectively reviewed . the expression of estrogen receptor , progesterone receptor , human epidermal growth factor receptor 2 , and ki67 was analyzed by immunohistochemistry . all patients were classified into the following categories : luminal a , luminal b , her2 overexpression , and triple - negative subtypes . result . the median follow - up time was 33 months . luminal a tumors had the lowest rate of tumor progression ( 0% , p = 0.006 ) , while luminal b , her2 over - expression , and triple - negative subtypes were associated with an increased risk of tumor progression ( 15.4 , 19.2 , 15.4% ) . clinicopathological subtypes retained independent prognostic significance ( p = 0.008 ) . there were significant differences by cox model analyzed in age , menopause , lymph node metastasis , and her2 for the event of death and tumor progression ( p < 0.05 ) , and there were significant differences only in chemotherapy for the event , respectively ( p < 0.05 ) . conclusion . clinicopathological subtypes of breast cancer could robustly identify the risk of death and tumor progression and were significant in making therapeutic decision . her2 was the important poor indicator . the chemotherapy intensity would be enhanced for patients with luminal b , especially for her2 over - expression subgroup .
recurrent headaches are prevalent in children and adolescents . up to 89% of these individuals identify stress as a trigger . yoga offers a complementary and alternative method for this population who often lacks effective relaxation tools for stress relief . this presentation describes the yoga group offered as part of the integrative headache clinic ( ihc ) at children 's hospital colorado . one of the objectives is to determine the effect of the yoga group for children and adolescents with recurrent headaches on pain and relaxation scores . over the course of 18 months ( january 2011 to june 2012 ) , a retrospective chart review was conducted of 40 children and adolescents with an average age of 15 years , 62.5% of whom were female . during the first hour of clinic , every individual takes part in a 50-minute group yoga session consisting of 10 asanas that promote relaxation and pain relief . before and after yoga group , participants rate their level of pain and relaxation on a scale from 0 to 10 ( with 0 being no pain or relaxation and 10 being maximum pain or relaxation ) . 3.0 ) and after yoga pain score was 3.4 ( /-3.1 ) ( p=.0672 ) , representing a decrease in pain . 2.3 ) and after yoga relaxation score was 7.5 ( /-1.9 ) ( p<.0001 ) , representing a statistically significant increase in relaxation . yoga may offer an adjunct to common pharmaceutical options for headache management for children and adolescents .
focus areas : integrative approaches to care , supporting behavioral change , alleviating painobjective : recurrent headaches are prevalent in children and adolescents . up to 89% of these individuals identify stress as a trigger . yoga offers a complementary and alternative method for this population who often lacks effective relaxation tools for stress relief . this presentation describes the yoga group offered as part of the integrative headache clinic ( ihc ) at children 's hospital colorado . one of the objectives is to determine the effect of the yoga group for children and adolescents with recurrent headaches on pain and relaxation scores.description:over the course of 18 months ( january 2011 to june 2012 ) , a retrospective chart review was conducted of 40 children and adolescents with an average age of 15 years , 62.5% of whom were female . during the first hour of clinic , every individual takes part in a 50-minute group yoga session consisting of 10 asanas that promote relaxation and pain relief . before and after yoga group , participants rate their level of pain and relaxation on a scale from 0 to 10 ( with 0 being no pain or relaxation and 10 being maximum pain or relaxation ) . the average before yoga pain score was 3.7 ( /- 3.0 ) and after yoga pain score was 3.4 ( /-3.1 ) ( p=.0672 ) , representing a decrease in pain . the average before yoga relaxation score was 5.2 ( /- 2.3 ) and after yoga relaxation score was 7.5 ( /-1.9 ) ( p<.0001 ) , representing a statistically significant increase in relaxation.results:group yoga is effective in promoting relaxation in children and adolescents with recurrent headache . yoga may offer an adjunct to common pharmaceutical options for headache management for children and adolescents .
dyshormonogenetic hypothyroidism ( dh ) is a specific form of hypothyroidism caused by genetic defects in proteins involved in multiple steps of thyroid hormone biosynthesis . it is one of the commonest causes of hypothyroidism in children and adolescents along with hashimoto 's thyroiditis ( ht ) and iodine deficiency . dh in children appears to be a genetically determined disorder with milder defects in thyroid hormone biosynthesis leading to the delayed presentation in children and adolescents . severe defects in thyroid hormone production presents itself as congential or neonatal hypothyroidism or cretinism ( a severe form of congenital hypothyroidism [ ch ] ) . thyroid stimulating hormone receptor ( tshr ) , thyroid transcription factor ( ttf)-1 , ttf-2 , pax-8 leads to thyroid dysgenesis with defective iodide organification . most of these genetic mutations appear to be inherited recessively presenting as inborn errors of metabolism . however , literature on the etiopathogenesis and natural history of dh is largely an extrapolation of ch and only few smaller studies specifically addressed dh in older children and adolescents . dh is often self - limiting , or its hypothyroidism has waxing and waning course compared to ch , which is often associated with neurological defects and other syndromic associations . further , the genetic studies in pediatric dh ( noncongenital ) are very sparse from indian subcontinent . in this context , we devised this study to address the genetic basis and the clinical implication of dyshormonogenetic mutations in child and adolescent dh from south india . this study was conducted by collaboration between a teritiary care endocrinology hospital , biochemistry department of a teaching medical institute and genetics lab . the study was conducted over the period of 36 months from august 2012 to july 2015 . written informed consent was obtained from the attendants / guardians of the children included in this study . we ensured that the study complies with international ethical norms according to helsinki declaration - ethical principles for medical research involving human subjects . the diagnosis of dh was based on the exclusion of ht and iodine deficiency with demonstration of normal anti - tpo antibody titer and urinary iodine levels . in goitrous subjects , fine needle aspiration cytology ( fnac ) findings of hypercellularity , colloid , and macrofollicles without lymphocytic pathological , sonographic and scintigraphic findings served us in ruling out other causes of hypothyroidism . detailed clinical history , consanguinity and family history of thyroid disease was documented in a structured proforma . after the diagnosis of hypothyroidism , patients were started on thyroxine replacement at the rate of 4 g / kg / day with three monthly clinical and biochemical ( with serum tsh ) evaluation for titrating the dose of thyroxine to maintain euthyroidism . thyroid scintigraphy was performed before starting on thyroxine replacement or after suspending treatment for 30 days ( if already on thyroxine therapy ) . twenty minutes after an intravenous injection of 10 mci of 99mtc - pertechnetate , the images were obtained on an automated scintillation camera equipped with low - energy high - resolution parallel hole collimator . three milliliters of the early morning venous sample is collected from the included children in a sterile silicon coated glass tube . 50 l , 25 l , 200 l , and 30 l of serum samples were used for tri - iodothyronine ( t3 ) , thyroxine ( t4 ) , tsh , and anti - tpo assay immediately . five milliliters of blood was collected from forearm in an ethylenediaminetetraacetic acid vial for genetic analysis and stored at 20c . dna was extracted from whole blood using genomic dna isolation kit using salting out method according to manufacturer 's instructions . dna quality was checked by uv absorption at 260 and 280 nm by agarose gel electrophoresis for any degradation or rna contamination . dna was quantified by spectrophotometric method with absorbance at 260 nm and 280 nm [ figure 1 ] . qualitative check of dna samples by agarose gel electrophoresis polymerase chain reaction ( pcr ) was used to amplify nis gene , tpo gene , and duox2 gene fragments of isolated dna . cycling conditions were 95c for 5 min ( one cycle ) ; at 95c for 40 s , at 55c for 40 s , at 72c for 60 s ( for 35 cycles ) , and final extension at 72c for 10 min using one pair of primers annealing at regions of interest . we used eight sets of primers depending on number of screened single nucleotide polymorphisms ( snps ) 2 for duox2 ; 2 for tpo and 4 for nis . the quality of pcr products was checked with agarose gel electrophoresis [ figure 2 ] . primer sequences with their size used in this study qualitative analysis of polymerase chain reaction products by agarose gel electrophoresis nucleotide sequences of all amplified pcr products were determined in both orientations by direct sequencing with an applied biosystems 3730xl sequencer ( macrogen , seoul , south korea ) . the results were analyzed using bio - edit ( version 7.1.3 ) , ( ibis biosciences , carlsbad , ca , usa for bio - edit applied biosystems co. for sequence scanner ncbi . nlm ) . two types of mutations were looked for known ( mutations already reported in the database of snps ) and unknown ( mutations never reported before ) . we screened for a total of 142 snps with the frequency distribution of 59 snps in nis gene ; 41 snps in tpo and 42 snps in duox2 genes . known mutations were analyzed with restriction fragment length polymorphism analysis . for unknown or novel mutations , we planned to select hotspots on sequencing and study them . laboratory reference ranges of thyroid serum biomarkers was : serum total t3 = 80180 ng / dlserum total t4 = 4.512.6 g / dlserum tsh = 0.44.2 iu / lserum anti - thyroid peroxidase serum total t3 = 80180 ng / dl serum total t4 = 4.512.6 g / dl serum tsh = 0.44.2 iu / l serum anti - thyroid peroxidase antibody titer = 034 iu / l . the biomarkers were assayed with siemens advia centaur cp auto - analyzer employing electro - chemiluminescent immunoassay . tsh was measured with two site sandwich immunoassay and t3 , t4 , anti - tpo titers were measured by competitive immunoassay . to study the dietary iodine status , all children had urinary iodine within the normal range as per unicef and iccidd guidelines . descriptive analysis was done with student 's t - test for means and chi - square test for categorical variables . for impact of genetic mutations of phenotypic attributes of hypothyroidism univariate and multivariate analysis ( uva and mva ) with logistic regression for qualitative data three milliliters of the early morning venous sample is collected from the included children in a sterile silicon coated glass tube . 50 l , 25 l , 200 l , and 30 l of serum samples were used for tri - iodothyronine ( t3 ) , thyroxine ( t4 ) , tsh , and anti - tpo assay immediately . five milliliters of blood was collected from forearm in an ethylenediaminetetraacetic acid vial for genetic analysis and stored at 20c . dna was extracted from whole blood using genomic dna isolation kit using salting out method according to manufacturer 's instructions . dna quality was checked by uv absorption at 260 and 280 nm by agarose gel electrophoresis for any degradation or rna contamination . dna was quantified by spectrophotometric method with absorbance at 260 nm and 280 nm [ figure 1 ] . qualitative check of dna samples by agarose gel electrophoresis polymerase chain reaction ( pcr ) was used to amplify nis gene , tpo gene , and duox2 gene fragments of isolated dna . cycling conditions were 95c for 5 min ( one cycle ) ; at 95c for 40 s , at 55c for 40 s , at 72c for 60 s ( for 35 cycles ) , and final extension at 72c for 10 min using one pair of primers annealing at regions of interest . we used eight sets of primers depending on number of screened single nucleotide polymorphisms ( snps ) 2 for duox2 ; 2 for tpo and 4 for nis . the quality of pcr products was checked with agarose gel electrophoresis [ figure 2 ] . primer sequences with their size used in this study qualitative analysis of polymerase chain reaction products by agarose gel electrophoresis nucleotide sequences of all amplified pcr products were determined in both orientations by direct sequencing with an applied biosystems 3730xl sequencer ( macrogen , seoul , south korea ) . the results were analyzed using bio - edit ( version 7.1.3 ) , ( ibis biosciences , carlsbad , ca , usa for bio - edit applied biosystems co. for sequence scanner ncbi . two types of mutations were looked for known ( mutations already reported in the database of snps ) and unknown ( mutations never reported before ) . we screened for a total of 142 snps with the frequency distribution of 59 snps in nis gene ; 41 snps in tpo and 42 snps in duox2 genes . known mutations were analyzed with restriction fragment length polymorphism analysis . for unknown or novel mutations , we planned to select hotspots on sequencing and study them . laboratory reference ranges of thyroid serum biomarkers was : serum total t3 = 80180 ng / dlserum total t4 = 4.512.6 g / dlserum tsh = 0.44.2 iu / lserum anti - thyroid peroxidase serum total t3 = 80180 ng / dl serum total t4 = 4.512.6 g / dl serum tsh = 0.44.2 iu / l serum anti - thyroid peroxidase antibody titer = 034 iu / l . the biomarkers were assayed with siemens advia centaur cp auto - analyzer employing electro - chemiluminescent immunoassay . tsh was measured with two site sandwich immunoassay and t3 , t4 , anti - tpo titers were measured by competitive immunoassay . to study the dietary iodine status , all children had urinary iodine within the normal range as per unicef and iccidd guidelines . spss version 18.0 for windows ( spss inc . , il , usa ) was employed . descriptive analysis was done with student 's t - test for means and chi - square test for categorical variables . for impact of genetic mutations of phenotypic attributes of hypothyroidism univariate and multivariate analysis ( uva and mva ) with logistic regression for qualitative data demographic , clinical , and biochemical details of all the 22 children with hypothyroidism due to dh are displayed in table 2 . female : male ratio in our cohort was 8:3 with mean age of 11.27 7.1 years ( 518 ) . iu / l ) . clinically , 17/22 ( 77.3% ) had goitrous dh , and five children had no goiter . grade i and ii diffusely enlarged goiters were found in 5 and 12 children respectively . all the children had eutopic thyroid gland on ultrasonography and normal uptake on 99mtc scintigraphy ruling out low uptake of ht or dysgenesis . mean follow - up of the cohort was 22.5 6 ( 1834 ) months . clinico - investigative profile of the patients table 3 shows comparsion of clinic - investigative parameters between children and adolescents . we used an arbitrary cut - off age limit as 12 years to differentiate children from adolescents . children had increased frequency of subclinical hypothyroidism and positive family history amongst first degree relatives compared to adolescents . mean serum tsh levels were significantly higher in adolescents . however , goiter rates were not significantly different . influence of age on hypothyroidism phenotype we detected 9 nis gene mutations in 8/22 ( 36% ) children in the entire cohort . tables 4 and 5 describe the detailed structure and topography of all the detected mutations . all these mutations were located on introns and none in exonic segments in our cohort . except for bi - allelic , synonymous mutation of nis gene in child number 14 [ figure 3 ] , child number 12 had dual nis mutations one substitutional synonymous and another silent in nature . the coding annotation of this missense mutation was r ( cgg ) w ( tgg ) in child number 22 and l ( ctc ) dna sequencing profile and electrophoregram showing nis polymorphism with representative homozygous mutation dna sequencing profile and electrophoregram showing nis polymorphism with representative heterozygous mutation genotype - phenotypic correlations ( gpcs ) in table 6 show that our mutations significantly expressed goitrous forms , overt hypothyroidism , and positive family history rates in this study . clinical phenotypes of goiter , severity of hypothyroidism and familial clustering were statistically significant in the presence of these mutations . . only presence of goiter in dh reached statistical significance both on uva and mva . all thyroid specific mutations found in our cohort characteristics of detected nis mutations genotype correlation with phenotypic variables thyroid dysmorphogenesis and dyshormonogenesis along with iodine deficiency in endemic areas and ht in late childhood are the most common causes of child hypothyroidism . the classical ch occurs at the rate of 1:30001:4000 , which is mostly sporadic with familial occurrence in 2% . the two broad categories of ch are thyroid dysgenesis consisting of agenesis , hypoplasia or ectopia of thyroid gland and thyroid dyshormonogenetic goiter ( dh ) . genes associated with thyroid dysgenesis are tshr , ttf-1 , pax-8 , ttf-2 , nkx2 - 5 , which are different from those causing dh . ch is often associated with birth defects , up to 7% prevalence of nonthyroidal congenital anamolies and 1.5% of chromosomal anamolies . after excluding other causes of hypothyroidism in our methodology , we included only dh cases in children above 5 years of age ( noncongenital ) . an arbitrary cut - off age of 5 years is chosen to exclude inadverent inclusion of late onset ch occurring up to 4 years . about 1520% of child hypothyroidism is due to dh . even in india , ch due to thyroid dysgenesis followed by dh is the most common cause of hypothyroidism in neonates and young children . thus , late childhood and adolescence forms grey zone , wherein both dh and ht can occur . in addition , sparse data in this age group especially from india triggered us to study dh in them . dh is a heterogenous group of thyroid disorders characterized by varying degrees of hypothyroidism due to defective thyroid hormone synthetic machinery at subcellular level . most of the dh cases are familial with autosomal recessive mode of inheritance . except for pendred 's syndrome ( characterized by sensorineural defect along with hypothyrodism ) , however , we have not come across pendred 's syndrome in our cohort , as it mostly presents in early childhood . dh was synonymously and interchangeably described with wide range of terms such as iodide transport defects ( it d ) , iodide organification defect ( iod ) , ch leading to difficulty in uniform comparision of literature from different geographical regions . ambiguity in diagnosis and exact subtyping of child hypothyroidism due to dh is caused by various bipolar clinical presentations such as syndromic or nonsyndromic ; central or peripheral ; primary or secondary / teritiary ; permanent or transient ; early or late onset ; goitrous or nongoitrous ; overt or subclinical forms . there are no robust nongenetic criteria for dh definition or diagnosis , as there is significant overlap of its clinico - investigative picture with other common causes of child hypothyroidism such as ht , iodine deficiency . though , perchlorate discharge test ( pdt ) is pathognomonic of classical dh ; it was not performed in our study as it was difficult to procure perchlorate and pdt has high false negative rates especially in cases with partial organification defects . thus , diagnosis of dh in our study was based on the exclusion of other causes of hypothyroidism based on serological , biochemical , radiological , pathological , and scintigraphic findings . thyroid uptake and scintigraphy were performed using 99mtc - pertechnetate , and its proven to be more advantageous than i due to better quality , faster procedure , and lower radiation dose especially in children . in addition , thyroid dysgenesis and presence of normal or enlarged eutopic thyroid gland was confirmed by neck ultrasonography . the natural history of dh in older children is usually more unpredictable compared to well - studied ch , as most of the literature on the clinical picture and natural history of child hypothyroidism is extrapolation from data on ch . in addition , dh in children and adolescents appears to be reversible in significant proportion of cases and does not correlate with goiter or onset of hypothyroidism . pathologically , fnac features of hypercellularity , colloid , macrofollicles with no lymphocytic infiltration were found in our goitrous dh cases . testifying to the fact that hypothyroidism in child dh is often reversible , in our study 3 cases ( 13.7% ) ( one in overtly hypothyroid and two in subclinically hypothyroid children ) were euthyroid without thyroxine therapy by the end of follow - up duration of 18 months . probably , longer follow - up could result in more self - limiting cases of dh . studies show that 4050% of child ht cases with subclinical hypothyroidism are self - limiting / reversible requiring no further thyroxine replacement on long - term follow - up . various mutations in nis , tpo , duox2 , tg iyf / dehal1 , and pds genes have been primarily implicated in causation of dh . most of these mutations are nonsyndromic and familial , inherited in autosomal recessive pattern except for an occasional autosomal dominantly inherited duox2 gene - based dh . this genetic insight , firmly established it as an inborn error of metabolism affecting the proteins involved in the cascade of thyroid hormone biosynthesis and its regulating pathways . sodium iodide symporter ( nis ) gene influencing nis protein mediates active transport of iodide into thyroid gland , a vital and rate limiting step in thyroid hormone biosynthesis and functional maturation of thyroid gland . tpo is the key enzyme mediating the conversion of iodide to iodine , a mandatory step for coupling and organification in the production of thyroid hormones . dual oxidase system is the enzymatic machinery regulating the hydrogen peroxide function for tpo catalyzed iodination and coupling . many classifications for dh have been proposed based on these mutations , their clinical expression and gpcs . most of them classify child hypothyroidism in to dysgenesis , dyshormonogenesis , hypothalamic - pituitary , and transitory hypothyroidism based on their candidate genes . dh was also classified based on radioiodine uptake and pdt in to it d , iod , and dh with normal pdt . clinical expression , onset , and severity of hypothyroidism in dh both partial and total iodine organification defects caused by heterozygous and homozygous mutations respectively have been reported with tpo and duox2 mutations . most of the mutations were heterozygous , but clinically hypothyroidism ranged from subclinical to overt ; self - limiting to sustain with normal scintigraphic uptake , suggestive of partial dyshormonogenetic defects . all the mutations found in our study were in intronic regulatory regions of nis gene with known snps . we found no mutations in tpo and duox2 genes in our cohort . except for one case of synonymous , homozygous nis mutation , the nature of these mutations was synonymous , heterozygous variants . a mono - allelic defect with haploinsufficiency usually causes a milder defect in hormone synthesis leading to the delayed onset or subclinical or transient self - limiting hypothyroidism . a more severe defect such as bi - allelic , homozygous , exonic variants could lead to severe , early onset or permanent hypothyroidism as in ch or cretinism very few human studies , especially from developing countries such as india , have reported on the structure and expression of thyroid - specific mutations in dh . though , other studies showed that frequent tpo and nis mutations , and to a lesser extent duox2 predispose to , exclusive nis mutations and undetectable tpo , duox2 mutations in our cohort may be due to geographic and ethnic variations or missed cryptic tpo , duox2 mutations . one of the main objectives of this study was deriving hypothyroid phenotypes based on gpcs , which shows that our mutations had a remarkable impact on the phenotypic traits such as demographic , biochemical , and clinical variables . to analyze multiple phenotypic variables , we used reverse uva and mva with presence or absence of mutations as an outcome , to study the gpc . our study showed that these nis mutations expressed increased frequency of goitrous forms , overt hypothyroidism , and positive family history in hypothyroid children reaching statistical significance . two case control studies from india attempted to risk categorize hypothyroidism based on tpo genetic polymorphisms . though , both the studies categorized their subjects based on the biochemical phenotype of anti - tpo antibody titer and level of serum thyroid hormones , but were performed on adult hypothyroidism with very short follow - up . to the best of our knowledge and literature search , we found no indian study on gpc in hypothyroid children and adolescents for comparing our results . other studies have reported the influence of genotype on the pattern , timing , and natural history of hypothyroidism in dh , but mostly in ch setting . though we had 36% family history of hypothyroidism in first - degree relatives , we are unsure about familial clustering of dh in the absence of their genetic analysis . though all our mutations were in introns , existing literature justifies that synonymous mutations in noncoding regions can be phenotypically expressive by altering the splicing pattern , mrna , trna affinities leading to posttranscriptional and posttranslational modification of downstream proteins . though the exact mechanism is elusive , we speculate that above regulatory phenomena of gene function might be driving our heterozygous , synonymous intronic mutations in to influencing hypothyroid phenotypes . predominance of single allele mutations in our study could be due to undetected cryptic mutations in other regulatory gene segments or the other allele . though many specific point mutations with gpcs have been reported , they may not be applicable to all populations worldwide due to unique genetic , geographic , ethnic and dietary factors . polygenic inheritance also compounds this possibility of specific gene - based diagnosis . finally , novel concept of noninheritable epigenetic and stochastic events in dh is a challenge in future . we need consistent results with comparable nomenclature from multiple centers of different populations and ethnicity to generalize dh patterns . till then , an individualized protocol based on population - specific genetic results in respective geographical area is a practical solution . still , we are far away from gene - specific intervention and decoding exact gpcs . a definitive molecular diagnosis of dh allows genetic counseling of family , differentiating transient from permanent hypothyroidism , predicting response of patients to iodine supplementation or thyroxine supplementation and planning follow - up for asymptomatic carriers . the apparent shortcomings in our study are smaller cohort , lack of control group , and inability to genetically screen the family members . it was not possible to procure an ideal control group for children of this hospital based sample and to get family history of thyroid disease in controls . the obvious strengths of this study are mean clinical follow - up of 22 months ; focused study on hypothyroidism in older children and adolescents ; risk categorization of hypothyroid phenotypes ; gpc ; exclusion of major confounding factors iodine excess or deficiency , ch ; a study first of its kind from india . ( 1 ) nis gene mutations alone appears to be most prevalent mutations in ht amongst south indian children , ethnic and environmental factors may be responsible for this pattern ; ( 2 ) these mutations appears to be significantly influencing phenotypic expressions - such as severity of hypothyroidism , goiter rates and family history ; ( 3 ) larger studies are needed to specifically characterize dyshormonogenetic mutations and their respective hypothyroid phenotypes in children and adolescents .
background : dyshormonogenetic goiter is one of the most common causes of hypothyroidism in children and adolescents in iodine nonendemic areas . the exact genotype - phenotypic correlations ( gpcs ) and risk categorization of hypothyroid phenotypes of dyshormonogenetic mutations are largely speculative . the genetic studies in pediatric dyshormonogenesis are very sparse from indian sub - continent . in this context , we analyzed the implications of tpo , nis , and duox2 gene mutations in hypothyroid children with dyshormonogenetic hypothyroidism ( dh ) from south india.materials and methods : this is interdisciplinary prospective study , we employed eight sets of primers and screened for 142 known single nucleotide polymorphisms in tpo , nis , and duox2 genes . the subjects were children and adolescents with hypothyroidism due to dyshormonogenetic goiter . congenital hypothyroidism , iodine deficiency , and hashimoto 's thyroiditis cases were excluded.results:we detected nine mutations in 8/22 ( 36% ) children . all the mutations were observed in the intronic regions of nis gene and none in tpo or duox2 genes . except for bi - allelic , synonymous polymorphism of tpo gene in child number 14 , all other mutations were heterozygous in nature . gpcs show that our mutations significantly expressed the phenotypic traits such as overt hypothyroidism , goiter , and existence of family history . other phenotypic characters such as sex predilection , the age of onset and transitory nature of hypothyroidism were not significantly affected by these mutations.conclusion:nis gene mutations alone appears to be most prevalent mutations in dh among south indian children and these mutations significantly influenced phenotypic expressions such as severity of hypothyroidism , goiter rates , and familial clustering .
voltage - gated potassium channels of the kv1.3 type are widely expressed in many types of cells , both normal and cancer ( felipe et al . activity of kv1.3 channels plays an important role e.g. in setting the resting membrane potential , cell proliferation , apoptosis and volume regulation ( cahalan and chandy 2009 ; gulbins et al . studies performed on kv1.3 channels expressed in human t lymphocytes showed that blockage of these channels inhibited the cell proliferation in the g1 phase ( cahalan and chandy 2009 ) . specific blockers of kv1.3 channels may be applied in a selective immunosuppression ( cahalan and chandy 2009 ) . several studies demonstrated altered expression of kv1.3 channels in some cancer diseases such as breast , colon , pancreas , smooth muscle , skeletal muscle , lung , kidney and prostate cancer ( bielanska et al . inhibitors of kv1.3 channels may potentially find a clinical application in therapy of some cancer disorders characterized by an over - expression of kv1.3 channels , such as , for example , breast and lung cancer , melanoma or chronic lymphocytic leukaemia ( jang et al . for example , it was shown that inhibition of kv1.3 channels by both specific ( mgtx ) and non - specific ( tea ) inhibitors also inhibited proliferation of breast cancer ( jang et al . 2009 ) and lung cancer cells in vitro and in vivo ( jang et al . the most promising candidates for a potential clinical application may be some small molecule organic compounds , since they combine a high efficiency and specificity of cancer cell elimination with a good bioavailability and a low cytotoxity ( leanza et al . one of these compounds , clofazimine , is widely applied in medicine ( in a treatment of leprosy , for example ) since 1960s ( leanza et al . 2012 , 2013 ) . studies performed during last years in our laboratory showed that both some natural plant - derived compounds that exert antiproliferative and proapoptotic effects on cancer cells , such as an isoflavone genistein , substituted stilbene , resveratrol , and some synthetic methoxy derivatives of a substituted stilbene , piceatannol and of a flavonoid , naringenin , were inhibitors of kv1.3 channels in normal human t lymphocytes ( tl ) ( teisseyre and michalak 2005 , 2006 ; teisseyre et al . importantly , the antiproliferative effect on cancer cells and inhibition of kv1.3 channels occurred at comparable concentrations of the compounds tested ( teisseyre and michalak 2005 , 2006 ; teisseyre et al . it was concluded that the antiproliferative effect of these compounds could be , at least partially , related to the inhibition of kv1.3 channels ( teisseyre and michalak 2005 , 2006 ; teisseyre et al . our previous studies also showed that a plant - derived prenylated flavonoid 8-prenylnaringenin in contrast to its precursor naringenin was an effective inhibitor of kv1.3 channels both in normal human tl and in a human cancer t cell line jurkat ( gsiorowska et al . the estimated value of a half - blocking concentration ( ec50 ) was about 2.5 m . a complete inhibition occurred at the concentrations higher than 10 m . it was shown that 8-prenylnaringenin was the most potent inhibitor of kv1.3 channels from all plant - derived polycyclic compounds tested to date in our laboratory ( gsiorowska et al . the potency of the inhibition could be a consequence of the presence of prenyl group in the molecule of this flavonoid . if this hypothesis was correct it could be expected that other compounds from the groups of prenylated flavonoids and chalcones would also be potent inhibitors of kv1.3 channels . in this study , we tested other prenylated compounds from both groups : a chalcone : xanthohumol and a flavonoid : isoxanthohumol ( fig . 1 near here).fig . 1chemical structures of : xanthohumol ( a ) and isoxanthohumol ( b ) chemical structures of : xanthohumol ( a ) and isoxanthohumol ( b ) xanthohumol ( x ) is a structurally simple prenylated chalcone that occurs in the hop plant humulus lupulus ( 0.11 % on dry weight ) and it is used to add bitterness and flavour to beer , which is the main dietary source of xanthohumol ( stevens and page 2004 ) . isoxanthohumol , structurally related to 8-prenylnaringenin , is a product of an isomerization of xanthohumol during the brewing process and it is the main prenylflavonoid in beer ( stevens et al . both compounds have focused much attention in recent years as cancer chemopreventive agents . obtained results provide evidence that both xanthohumol and isoxanthohumol , applied at micromolar concentrations , exert antiproliferative and cytotoxic effects on human breast cancer cell line mcf-7 , colon cancer cell line ht-29 and ovarian cancer cell line a-2780 ( miranda et al . it was also shown that an incubation of xanthohumol and isoxanthohumol applied at micromolar concentrations with prostate cancer cell lines pc-3 and du145 induced a caspase - independent form of cell death ( delmulle et al . 2008 ) . moreover , both xanthohumol and isoxanthohumol exert antiangiogenic and antiinflammatory effects on human umbilical vein endothelial cells ( huvec ) and human aortic smooth muscle cells ( hasmc ) ( negrao et al . since kv1.3 channels are widely expressed in human leukemic t cell line jurkat ( attali et al . 1992 2009 ) , these cells were used in our study as a model system . obtained results provide evidence that both selected compounds effectively inhibited kv1.3 channels . the human leukemic t cell line , jurkat ( clone e6 - 1 ) , was purchased from american type culture collection ( manassas , va ) . the jurkat cells were grown in rpmi 1640 medium ( sigma - aldrich , st . louis , mo ) containing 10 % heat - inactivated fbs , 10 mm hepes and 2 mm glutamate . cells were grown on culture plates at 37 c in a 5 % co2-humidified incubator . during the experiments , cells were placed in the external solution containing , in mm : 150 nacl , 4.5 kcl , 1 cacl2 , 1 mgcl2 , 10 hepes and ph 7.35 adjusted with naoh , 300 mosm . the pipette solution contained in mm : 150 kcl , 1 cacl2 , 2 mgcl2 , 10 hepes 10 egta , and ph 7.2 was adjusted with koh , 280 mosm . the concentration of free calcium ions in the internal solution was below 100 nm , assuming the dissociation constant for egta at ph 7.2 of 10 m ( grissmer et al . 1993 ) . such a low - calcium concentration was applied to prevent the activation of calcium - activated k channels kca2.2 abundantly expressed in jurkat t cells ( grissmer et al . the chemicals were purchased from the polish chemical company ( poch , gliwice , poland ) , except of hepes and egta that were purchased from sigma . pipettes were pulled from a borosilicate glass ( hilgenberg , germany ) and fire polished before the experiment . the pipette resistance was in the range of 35 m. whole - cell potassium currents in tl were recorded applying the patch - clamp technique ( hamill et al . usa ) , low - pass filtered at 3 khz , digitised using digidata 1440 ( molecular devices corp . , usa ) analogue - to - digital converter with the sampling rate of 10 khz . the influence of selected compounds on the activity of the channels was studied by applying the voltage ramp protocol . voltage ramps depolarising cell membranes from 100 mv up to + 40 mv were applied every 20 s ; the ramp duration was 340 ms and holding potential 90 mv . upon application of the voltage ramp protocol , potassium currents in jurkat t cells were stably recorded for at least 20 min after break - in to the whole - cell configuration . during the off - line analysis , the value of kv1.3 current at the end of a voltage ramp ( + 40 mv ) was calculated . for this purpose , the leak current estimated at + 40 mv was subtracted from the total ramp current recorded at this voltage . the calculated voltage - clamp error , due to an uncompensated access resistance , was 4.0 0.5 mv ( the inhibition of the kv1.3 channels is presented in terms of a relative current recorded upon application of the studied compounds , defined as i / icontr ; where i is the kv1.3 current upon an application of an examined compound at + 40 mv , icontr is the kv1.3 current recorded on the same cell at + 40 mv under control conditions . for calculating the value of a half - blocking concentration ( ec50 ) and the hill s coefficient , the magnitude of the inhibition defined as 1 ( i / icontr ) was taken in consideration . both parameters were calculated applying the hill s equation in a form : y = a + ( b a)/(1 + ( x / c ) ) , where y is magnitude of the channels inhibition , a is the minimal value of the inhibitory effect , b is the maximal value of the inhibitory effect , x is the logarithm of the compound s concentration , c is the logarithm of the ec50 value , d is the hill s coefficient . the human leukemic t cell line , jurkat ( clone e6 - 1 ) , was purchased from american type culture collection ( manassas , va ) . the jurkat cells were grown in rpmi 1640 medium ( sigma - aldrich , st . louis , mo ) containing 10 % heat - inactivated fbs , 10 mm hepes and 2 mm glutamate . cells were grown on culture plates at 37 c in a 5 % co2-humidified incubator . during the experiments , cells were placed in the external solution containing , in mm : 150 nacl , 4.5 kcl , 1 cacl2 , 1 mgcl2 , 10 hepes and ph 7.35 adjusted with naoh , 300 mosm . the pipette solution contained in mm : 150 kcl , 1 cacl2 , 2 mgcl2 , 10 hepes 10 egta , and ph 7.2 was adjusted with koh , 280 mosm . the concentration of free calcium ions in the internal solution was below 100 nm , assuming the dissociation constant for egta at ph 7.2 of 10 m ( grissmer et al . 1993 ) . such a low - calcium concentration was applied to prevent the activation of calcium - activated k channels kca2.2 abundantly expressed in jurkat t cells ( grissmer et al . the chemicals were purchased from the polish chemical company ( poch , gliwice , poland ) , except of hepes and egta that were purchased from sigma . dishes with cells were placed under an inverted olympus imt-2 microscope . solutions containing tested compounds pipettes were pulled from a borosilicate glass ( hilgenberg , germany ) and fire polished before the experiment . the pipette resistance was in the range of 35 m. whole - cell potassium currents in tl were recorded applying the patch - clamp technique ( hamill et al . usa ) , low - pass filtered at 3 khz , digitised using digidata 1440 ( molecular devices corp . , usa ) analogue - to - digital converter with the sampling rate of 10 khz . the influence of selected compounds on the activity of the channels was studied by applying the voltage ramp protocol . voltage ramps depolarising cell membranes from 100 mv up to + 40 mv were applied every 20 s ; the ramp duration was 340 ms and holding potential 90 mv . upon application of the voltage ramp protocol , potassium currents in jurkat t cells were stably recorded for at least 20 min after break - in to the whole - cell configuration . during the off - line analysis , the value of kv1.3 current at the end of a voltage ramp ( + 40 mv ) was calculated . for this purpose , the leak current estimated at + 40 mv was subtracted from the total ramp current recorded at this voltage . the calculated voltage - clamp error , due to an uncompensated access resistance , was 4.0 0.5 mv ( n = 30 ) . the inhibition of the kv1.3 channels is presented in terms of a relative current recorded upon application of the studied compounds , defined as i / icontr ; where i is the kv1.3 current upon an application of an examined compound at + 40 mv , icontr is the kv1.3 current recorded on the same cell at + 40 mv under control conditions . for calculating the value of a half - blocking concentration ( ec50 ) and the hill s coefficient , the magnitude of the inhibition defined as 1 ( i / icontr ) was taken in consideration . both parameters were calculated applying the hill s equation in a form : y = a + ( b a)/(1 + ( x / c ) ) , where y is magnitude of the channels inhibition , a is the minimal value of the inhibitory effect , b is the maximal value of the inhibitory effect , x is the logarithm of the compound s concentration , c is the logarithm of the ec50 value , d is the hill s coefficient . examples of the whole - cell currents recorded in jurkat t cells under control conditions and in the presence of xanthohumol and isoxanthohumol at concentrations of 15 and 10 m , respectively , are presented in fig . 2 ( near here).fig . 2both examined compounds reduced the intensity of the whole - cell potassium currents recorded in jurkat t cells applying the voltage ramp protocol ( shown schematically above the current records ) : ( a ) control conditions , ( b ) application of 15 m of xanthohumol ( left panel ) and 10 m of isoxanthohumol ( right panel ) and ( c ) wash - out of the examined compounds both examined compounds reduced the intensity of the whole - cell potassium currents recorded in jurkat t cells applying the voltage ramp protocol ( shown schematically above the current records ) : ( a ) control conditions , ( b ) application of 15 m of xanthohumol ( left panel ) and 10 m of isoxanthohumol ( right panel ) and ( c ) wash - out of the examined compounds this figure depicts the raw currents ( without leak subtraction ) that were recorded applying the voltage ramp protocol . the evoked currents contained two components : small linear and much bigger non - linear . the linear current was the unspecific leak current ( reversal potential equal to 0 mv ) , whereas the non - linear component was due to activation of kv1.3 channels ( grissmer et al . 1992 ; teisseyre and mozrzymas 2002 ) . apparently , application of xanthohumol and isoxanthohumol significantly reduced the amplitude of kv1.3 current . upon application of xanthohumol at concentrations of 1 , 3 , 5 , 7 , 10 , 15 , 20 and 30 m , the relative currents ( defined in materials and methods section ) were reduced to 0.88 0.028 ( n = 5 ) , 0.57 0.076 ( n = 5 ) , 0.31 0.08 ( n = 5 ) , 0.29 0.017 ( n = 5 ) , 0.21 0.022 ( n = 5 ) , 0.20 0.05 ( n = 5 ) , 0.19 0.03 ( n = 5 ) and 0.14 0.07 ( n = 5 ) , respectively . the decrease of the relative current was statistically significant ( p < 0.05 , student s t test ) in case of all applied concentrations . in the case of isoxanthohumol applied at the same concentrations , the relative currents were reduced to 0.99 0.068 ( n = 5 ) , 0.96 0.077 ( n = 5 ) , 0.75 0.028 ( n = 5 ) , 0.55 0.047 ( n = 5 ) , 0.45 0.059 ( n = 5 ) , 0.36 0.071 ( n = 5 ) , 0.25 0.091 ( n = 5 ) and 0.13 0.046 ( n = 5 ) , respectively . the decrease of the relative current was statistically significant ( p < 0.05 , student s t test ) for concentrations equal or higher than 5 m . the inhibitory effects of xanthohumol and isoxanthohumol on kv1.3 currents in human jurkat t cells were not complete at the highest applied concentration ( 30 m ) . in order to characterize the inhibitory effects of the compounds on kv1.3 currents in more detail , the values of a half - blocking concentration ( ec50 ) and the hill s coefficient were calculated , applying the hill s equation . the estimated ec50 values were about 3.06 and 7.81 m for xanthohumol and isoxanthohumol , respectively . the difference in ec50 values between xanthohumol and isoxanthohumol was significant ( p < 0.05 , student s t test ) . this suggests that xanthohumol is much more potent inhibitor of kv1.3 currents in human jurkat t cells than its isomer isoxanthohumol . the estimated values of the hill s coefficient were 2.43 0.54 and 2.09 0.45 for xanthohumol and isoxanthohumol , respectively . these values were not significantly different from each other ( p > 0.05 , student s t test ) . figure 3 ( near here ) depicts the comparison of a magnitude of the channels inhibition by xanthohumol and isoxanthohumol as a function of a logarithm of concentrations ( in m).fig . 3comparison of a magnitude of the inhibition by xanthohumol ( filled squares ) and isoxanthohumol ( empty squares ) plotted as a function of logarithm of concentrations of both compounds ( in m ) . data points were fitted by the hill s equation comparison of a magnitude of the inhibition by xanthohumol ( filled squares ) and isoxanthohumol ( empty squares ) plotted as a function of logarithm of concentrations of both compounds ( in m ) . data points were fitted by the hill s equation our previous results showed that the inhibitory effect of 8-prenylnaringenin was accompanied by a significant increase in the inactivation rate of kv1.3 currents ( gsiorowska et al . 2012 ) . in order to prove whether the inactivation and activation rate were changed upon an application of xanthohumol and isoxantohumol , another study applying a protocol with depolarizing voltage steps described in detail in our previous article ( gsiorowska et al . in contrast to what had been observed earlier for 8-prenylnaringenin , an application of xanthohumol and isoxanthohumol did not significantly change the inactivation kinetics of the currents ( not shown ) . the activation kinetics remained unchanged upon application of the tested compounds ( not shown ) , similarly to what had been observed earlier for 8-prenylnaringenin ( gsiorowska results of our study provide evidence that both selected compounds from the groups of prenylated chalcones and flavonoids : xanthohumol and isoxanthohumol inhibit the activity of kv1.3 channels in human leukemic jurkat t cells . the inhibitory effects of xanthohumol and isoxanthohumol on kv1.3 channels were significantly different than the effect observed earlier for 8-prenylnaringenin ( gsiorowska et al . first , in contrast to what was observed for 8-prenylnaringenin , the inhibitory effects of xanthohumol and isoxanthohumol were not complete at concentrations higher than 10 m . moreover , the inhibitory effects of these compounds were not accompanied by an increase in the currents inactivation rate . these results suggest that xanthohumol and isoxanthohumol are less potent inhibitors of kv1.3 channels in human jurkat t cells than 8-prenylnarigenin . also the mechanism of the channels inhibition by these compounds is probably different . on the other hand , the inhibitory effects of xanthohumol and isoxanthohumol on kv1.3 channels were much more potent than the effects caused by other natural plant - derived compounds , which exert an antiproliferative effect on cancer cells , such as genistein or resveratrol ( teisseyre and michalak 2005 , 2006 ) . results of our previous studies provide evidence that the ec50 values were more than 10 m for genistein and about 40 m in the case of resveratrol ( teisseyre and michalak 2005 , 2006 ) . these values were significantly higher than the ec50 values estimated in this study for xanthohumol and isoxanthohumol . on the other hand , it must be taken in consideration that studies on the influence of genistein and resveratrol were not performed on jurkat t cells , but on kv1.3 channels in normal human tl ( teisseyre and michalak 2005 , 2006 ) . however , preliminary studies on kv1.3 channels in jurkat t cells demonstrated that the channels were also inhibited by resveratrol , however , the magnitude of the effect was smaller than in the case of the channels in normal human tl ( gsiorowska unpublished results ) . therefore , the observed differences in the inhibition potency of xanthohumol , isoxanthohumol , genistein and resveratrol were not due to application of different model systems . they were probably due to an involvement of different mechanisms of kv1.3 channel inhibition by compounds examined in this study , genistein and resveratrol . our earlier experiments provide evidence that a flavonoid naringenin , a precursor compound for 8-prenylnaringenin , did not inhibit kv1.3 channels in normal human tl when applied at 30 m concentration ( teisseyre et al . studies performed recently on the channels expressed in cancer cells human jurkat t cell line provide evidence that naringenin was not an inhibitor of kv1.3 channels in these cells when applied at concentrations up to 30 m ( gsiorowska unpublished results ) . the same study showed that two synthetic derivatives of naringenin : 4,7-dimethylether and 7-methylether inhibited kv1.3 channels in jurkat t cells in a concentration - dependent manner ( gsiorowska unpublished results ) . the estimated ec50 values for the inhibition were about 13 m and about 16 m for naringenin-4,7-dimethylether and naringenin-7-methylether , respectively ( gsiorowska unpublished results ) . thus , similarly to what was observed in the case of genistein and resveratrol , the ec50 values estimated for both methoxy derivatives of naringenin were significantly higher than those obtained for xanthohumol and isoxanthohumol . altogether , obtained results may indicate that prenylated flavonoids and chalcones , such as 8-prenylnaringenin , xanthohumol and isoxanthohumol , are more potent inhibitors of kv1.3 channels than non - prenylated compounds from both groups . these results may confirm our earlier hypothesis that the presence of a prenyl group in a molecule is a factor that facilitates the inhibition of kv1.3 channels by compounds from the groups of flavonoids and chalcones . in accordance to this hypothesis , recently performed studies with isobavachalcone a prenylated plant - derived chalcone with the chemical structure similar to xanthohumol showed that this compound also inhibited kv1.3 channels in jurkat t cells in the concentration - dependent manner . the relative current was reduced to about 0.34 at the concentration of 15 m ( gsiorowska unpublished results ) . the estimated ec50 value for isobavachalcone was about 5 m ( gsiorowska unpublished results ) . our results showed that the ec50 values for kv1.3 channel inhibition by xanthohumol and isoxanthohumol were markedly different from each other . this may be a consequence of differences both in a chemical structure and in geometry of molecules of these compounds ( fig . 1 ) . interestingly , a very significant difference in the inhibition potency occurred between isoxanthohumol and 8-prenylnaringenin ( gsiorowska et al . 2012 ) , despite a very small difference in a chemical structure replacement of a methoxy group in isoxanthohumol by a hydroxyl group in 8-prenylnaringenin . the inhibition of kv1.3 channels by prenylated chalcones and flavonoids is probably a consequence of specific interactions of these compounds with the channels proteins . it is known that inhibition of kv1.3 channels may also inhibit proliferation of some cell types , including breast , colon and prostate cancer cells ( comes et al . it is also known that xanthohumol and isoxanthohumol inhibit cell proliferation in the case of human breast cancer cell line mcf-7 , human colon cancer cell line ht-29 and ovarian cancer cell line a-2780 when applied in vitro . the ec50 values for the inhibition of proliferation of mcf-7 cells after 4 days of incubation were 3.47 and 4.69 m for xanthohumol and isoxanthohumol , respectively ( miranda et al . 1999 ) . these values are close to the ec50 values for the inhibition of kv1.3 channels in jurkat t cells . it is known that kv1.3 channels are expressed in non - lymphocyte cancer cell lines , such as human breast cancer cell line mcf-7 ( gulbins et al . a possible contribution of the inhibition of kv1.3 channels to antiproliferative effects of xanthohumol and isoxanthohumol might explain the observed phenomenon that mcf-7 cells were more sensitive to the flavonoids than ht-29 cells ( miranda et al . 1999 ) . it remains to be elucidated whether inhibition of kv1.3 channels is involved in antiproliferative effects of the examined compounds in cancer cell lines . the inhibition of kv1.3 channels by xanthohumol and isoxanthohumol might also be involved in proapoptotic activities of these compounds . studies performed in the last years showed that kv1.3 channels are expressed not only in plasma membrane but also in the inner mitochondrial membrane in normal human tl and in jurkat t cells ( gulbins et al . it is known that inhibition of mitochondrial kv1.3 channels in human t cells by a proapoptotic protein bax is the first crucial event in the process of an activation of the mitochondrial pathway of apoptosis ( szabo et al . in other studies , it was shown that inhibition of mitochondrial kv1.3 channels in jurkat t cells by membrane - permeant channel inhibitors , such as clofazimine , psora-4 and pap-1 mimicked the effects of bax and triggered the apoptotic cell death by activation of the mitochondrial pathway ( leanza et al . recently , obtained data showed that kv1.3 channels are expressed in inner mitochondrial membrane also in non - lymphocyte cancer cells , such as human prostate cancer cell line pc-3 or breast cancer cell line mcf-7 ( gulbins et al . it is possible that the examined compounds are able to diffuse across the plasma membrane and reach intracellular compartments , so they may inhibit mitochondrial kv1.3 channels . 2008 showed that an application of xanthohumol and isoxanthohumol at micromolar concentrations induced cell death in human prostate cancer pc-3 and du145 cell lines . however , it was shown that in this case , the cell death occurred in a caspase - independent manner , without typical apoptotic morphological features , probably as a result of autophagy ( delmulle et al . whether mitochondrial kv1.3 channels are as sensitive to the inhibition by the compounds as the channels in the plasma membrane and whether this blocking effect is involved in induction of the mitochondrial pathway of cancer cell apoptosis remains to be elucidated .
using whole - cell patch - clamp technique , we investigated influence of selected compounds from groups of prenylated chalcones and flavonoids : xanthohumol and isoxanthohumol on the activity of kv1.3 channels in human leukemic jurkat t cells . obtained results provide evidence that both examined compounds were inhibitors of kv1.3 channels in these cells . the inhibitory effects occurred in a concentration - dependent manner . the estimated value of the half - blocking concentration ( ec50 ) was about 3 m for xanthohumol and about 7.8 m for isoxanthohumol . the inhibition of kv1.3 channels by examined compounds was not complete . upon an application of the compounds at the maximal concentrations equal to 30 m , the activity of kv1.3 channels was inhibited to about 0.13 of the control value . the inhibitory effect was reversible . the application of xanthohumol and isoxanthohumol did not change the currents activation and inactivation rate . these results may confirm our earlier hypothesis that the presence of a prenyl group in a molecule is a factor that facilitates the inhibition of kv1.3 channels by compounds from the groups of flavonoids and chalcones . the inhibition of kv1.3 channels might be involved in antiproliferative and proapoptotic effects of the compounds observed in cancer cell lines expressing these channels .
the purpose of the infection control is to minimize the risk of transmitting the disease from the patient to dentist , the dentist to the patient , from patient to patient and dental personnel , family , and finally to society . the nature of many dental procedures is so that the specific methods must be taken for preventing transmission of infection among dental personnel and patients . since all infected patients can not identified according to disease history , clinical examination and laboratory tests , all patients should be considered infectious , and avoidance contact with blood and body fluids from all patients should be seriously implemented . orthodontics is the branch of dentistry that compared with other fields has minimal contact with the blood , however , when placing and removal of fixed appliances and forming wires or replacing of chains , ligatures , springs and modules , contact with the saliva of the patient is mandatory . in practice , orthodontists generally focus their attention on the sterilization of pliers , headpieces , and other instruments . orthodontic marking pencils are not usually considered as a possible vector in the chain of infection . these pencils are frequently used to mark on the archwires in the oral cavity when orthodontist decides to place a bend or attach a hook on them . therefore , these markers may contaminate with saliva and transmit pathogens between patients . in this regard however , few reports have been published on the permanent marker ( pm ) pens and pencils . stated that marking pencils can transfer bacteria from contaminated archwires , and they used gas sterilization which is effective in killing bacteria but is also costly and difficult , making it impractical for orthodontic clinics . tadiparthi et al . also demonstrated that marker pens can act as fomites for nosocomial infection . furthermore , it was proved that dry whiteboard markers and pm pens carry a significant risk of transmitting infection among patients , and they suggested using disposable markers for immunocompromised patients to prevent cross infection . thomas et al . concluded that marking pens may transmit pathogens from one patient to others . according to this documentation , the aim of this study was to evaluate and compare the effectiveness of three disinfection and sterilization methods ( autoclave , glutaraldehyde solution , and deconex spray ) on orthodontic markers . three common pathogen - a gram - negative rod ( escherichia coli ) , a gram - positive cocci ( staphylococcus aureus ) , and a fungus ( candida albicans ) were grown to logarithmic phase in trypticase soy broth . one hundred and twenty marking pencils ( white wax marker , dentaurum , germany ) were classified into four different groups including a control group and three test groups ( autoclave , glutaraldehyde 2% , and deconex spray ) , so each group consisted of 30 pencils . initially , suspensions with a concentration of 1.5 10 cfu / ml of organisms were prepared in liquid medium equal to 0.5 mcfarland standard ( remel , thermoscientific , lenexa , ks , usa ) . the optical density was 0.132 at 600 nm wavelength . within each 10 sterile test tubes , the pencils were air dried then the bacteria were washed and harvested by placing these pencils in 4 ml of sterile normal saline and by vigorous agitation . ten microliters of this normal saline were inoculated on culture media and incubated at 37c . after 24 h , the colonies were counted , and the numbers of remaining organisms were calculated per ml . similar to the control group , contamination step was performed and after 5 min , pencils air dried and autoclaved for 15 min at 121c . then pencils were placed in 4 ml of sterile saline and bacteria were washed and gathered by vigorous agitation . similarly , contamination steps were performed and after 5 min , pencils were sprayed by deconex ( borer , switzerland ) and after 15 min pencils were washed in 4 ml of sterile saline and bacteria harvested by vigorous agitation , and the number of remaining bacteria was counted . similar to above steps the test procedure were performed , but the pencils were sprayed by glutaraldehyde 2% ( behsa , iran ) and after 30 min the pencils were washed in 4 ml of sterile saline and bacteria harvested after vigorous agitation . within each 10 sterile test tubes , 4 ml of each microbial suspension poured pencils were immersed in bacterial suspensions . the pencils were air dried then the bacteria were washed and harvested by placing these pencils in 4 ml of sterile normal saline and by vigorous agitation . ten microliters of this normal saline were inoculated on culture media and incubated at 37c . after 24 h , the colonies were counted , and the numbers of remaining organisms were calculated per ml . similar to the control group , contamination step was performed and after 5 min , pencils air dried and autoclaved for 15 min at 121c . then pencils were placed in 4 ml of sterile saline and bacteria were washed and gathered by vigorous agitation . similarly , contamination steps were performed and after 5 min , pencils were sprayed by deconex ( borer , switzerland ) and after 15 min pencils were washed in 4 ml of sterile saline and bacteria harvested by vigorous agitation , and the number of remaining bacteria was counted . similar to above steps the test procedure were performed , but the pencils were sprayed by glutaraldehyde 2% ( behsa , iran ) and after 30 min the pencils were washed in 4 ml of sterile saline and bacteria harvested after vigorous agitation . in this study , three different methods of sterilization / disinfection ( autoclave , deconex solution , glutaraldehyde ) for marking pencils were evaluated . three type of microorganism ( e. coli , s. aureus , c. albicans ) were used in our four groups ( one control and three experimental groups ) . in two groups ( autoclave and glutaraldehyde ) , therefore , these groups were considered complete and fully sufficient . in the control group , the mean population of bacteria and c. albicans which settled after contamination was significantly different . tukey test showed that the mean number of e. coli was significantly greater than c. albicans and s. aureus ( p = 0.01 , p = 0.031 , respectively ) there was no significant difference between the population of s. aureus and c. albicans ( p = 0.1 ) [ table 1 ] . this shows that e. coli could contaminate markers much greater than gram - positive bacteria and fungi . whitney u - test confirmed that the mean number of e. coli which settled on pencils was significantly greater than the mean number of c. albicans and s. aureus ( p = 0.026 , p = 0.003 ) and there was no significant difference between the number of s. aureus and c. albicans ( p = 0.125 ) [ table 2 ] . the number of bacteria in deconex group as it could be seen in table 3 , the numbers of bacteria and c. albicans after treatment with deconex were reduced compared to control group . the comparison of bacteria between deconex and control group as the ideal sterilization / disinfection method should reduce the number of bacteria to zero . in the control group , the comparison of bacteria in control group with zero in deconex group , the numbers of three microorganisms were not significantly greater than zero [ table 5 ] . the comparison of bacteria in deconex group with zero the number of bacteria in each groups in the control group , the mean population of bacteria and c. albicans which settled after contamination was significantly different . tukey test showed that the mean number of e. coli was significantly greater than c. albicans and s. aureus ( p = 0.01 , p = 0.031 , respectively ) there was no significant difference between the population of s. aureus and c. albicans ( p = 0.1 ) [ table 1 ] . this shows that e. coli could contaminate markers much greater than gram - positive bacteria and fungi . whitney u - test confirmed that the mean number of e. coli which settled on pencils was significantly greater than the mean number of c. albicans and s. aureus ( p = 0.026 , p = 0.003 ) and there was no significant difference between the number of s. aureus and c. albicans ( p = 0.125 ) [ table 2 ] . the number of bacteria in deconex group as it could be seen in table 3 , the numbers of bacteria and c. albicans after treatment with deconex were reduced compared to control group . the comparison of bacteria between deconex and control group as the ideal sterilization / disinfection method should reduce the number of bacteria to zero . in the control group , the comparison of bacteria in control group with zero in deconex group , the numbers of three microorganisms were not significantly greater than zero [ table 5 ] . the comparison of bacteria in deconex group with zero the number of bacteria in each groups this study compared the efficacy of three disinfection / sterilization procedures on marking pencils contaminated with e. coli , s. aureus , and c. albicans . the results of the study showed that after disinfection of marking pencil by autoclave and glutaraldehyde solution all the microorganisms were killed while in disinfection with deconex all three microorganisms had a little growth that was not significant . based on the result of our study , evaluated the compliance with infection control procedures among california orthodontists and they concluded that orthodontists still need improvement in all aspects of their infection control procedures . the tip of pencils was wiped with either sterile gauze or gauze treated with iodofive disinfectant . however , the pencils were used in this study were not autoclavable . in our study , glutaraldehyde solution completely destroyed microorganisms , and this disinfectant can be used instead of gas sterilization . evaluated the efficacy of autoclave in the sterilization of surgical marking pencils and they reported that no microorganisms were cultured after using autoclave which was in agreement with the results of our study . they reported that autoclave and co2 laser carried out sterilization completely while glutaraldehyde was not able to sterilize endodontic files completely . in our study , glutaraldehyde showed acceptable disinfection characteristics and this difference could be as a result of different types of bacteria , different solutions , and different subjects who were evaluated . they reported that glutaraldehyde was an acceptable disinfectant agent which it was in agreement with our study . parnia et al . examined the effect of different disinfecting agents on contaminated impression materials . they reported that deconex was an acceptable disinfecting agent which was similar to our study . therefore , this study was performed on contaminated markers to examine which infection control procedures are the best for marking pens and pencils in orthodontic clinics . however , the results do not reflect accurately the extent to which the sterilizing and disinfecting methods are reliable methods to be applied in - clinic . based on our result , autoclave and glutaraldehyde solution were the best methods for disinfection of orthodontic marking pencils . the remained bacterial contamination after disinfecting by deconex solution was no significant , and therefore , this agent could be a proper substitute if the two aforementioned methods were not available .
background : marking pencils which are frequently used in orthodontics may cause microbial contamination . the purpose of this study was to evaluate and compare the effectiveness of three disinfection and sterilization methods ( autoclave , glutaraldehyde solution , and deconex spray ) on orthodontic markers.materials and methods : one hundred and twenty orthodontic markers were divided into four groups each 30 pencils : one control group and three groups for three different disinfection / sterilization methods . to evaluate the effectiveness of these methods , pencils were initially contaminated by common pathogen by immersing the pencils in a suspension containing 1.5 108 cfu / ml organisms . then , the pencils were subjected to corresponding disinfection / sterilization methods , and the number of remaining microorganisms was calculated and compared with control group.results:in the control group , the mean number of escherichia coli was significantly higher than the other two microorganisms ( p = 0.01 , p = 0.031 ) . however , the mean numbers of staphylococcus aureus and candida albicans were not significantly different ( p = 0.1 ) . after sterilization with autoclave and glutaraldehyde , no microbial growth was observed , whereas after disinfection with deconx spray some colonies of microorganisms still could be observed.conclusion:autoclaving and glutaraldehyde solution are the best methods for disinfecting orthodontic markers .
canine adenovirus 2 , parainfluenza , and bordetella bronchiseptica cause respiratory disease in dogs , and each has a modified live intranasal vaccine available . molecular diagnostic assays to amplify specific nucleic acids are available for each of these agents . if positive molecular diagnostic assay results are common after vaccination , the positive predictive value of the diagnostic assays for disease would be decreased . to determine the impact of administration of commercially available modified live topical adenovirus 2 , b. bronchiseptica , and parainfluenza vaccine has on the results of a commercially available pcr panel . puppies were vaccinated with a single dose of modified live topical adenovirus 2 , b. bronchiseptica , and parainfluenza and parenteral dose of adenovirus 2 , canine distemper virus , and parvovirus . nucleic acids of all 3 organisms contained in the topical vaccine were detected from both samples multiple times through 28 days after vaccination with higher numbers of positive samples detected between days 3 and 10 after vaccination . vaccine status should be considered when interpreting respiratory agent pcr results if modified live vaccines have been used . development of quantitative pcr and wildtype sequencing are necessary to improve positive predictive value of these assays by distinguishing vaccinate from natural infection .
backgroundcanine adenovirus 2 , parainfluenza , and bordetella bronchiseptica cause respiratory disease in dogs , and each has a modified live intranasal vaccine available . molecular diagnostic assays to amplify specific nucleic acids are available for each of these agents . if positive molecular diagnostic assay results are common after vaccination , the positive predictive value of the diagnostic assays for disease would be decreased.objectiveto determine the impact of administration of commercially available modified live topical adenovirus 2 , b. bronchiseptica , and parainfluenza vaccine has on the results of a commercially available pcr panel.animalseight puppies from a research breeding facility negative for these pathogens.methodsblinded prospective pilot study . puppies were vaccinated with a single dose of modified live topical adenovirus 2 , b. bronchiseptica , and parainfluenza and parenteral dose of adenovirus 2 , canine distemper virus , and parvovirus . nasal and pharyngeal swabs were collected on multiple days and submitted for pcr assay.resultsnucleic acids of all 3 organisms contained in the topical vaccine were detected from both samples multiple times through 28 days after vaccination with higher numbers of positive samples detected between days 3 and 10 after vaccination.conclusions and clinical importancevaccine status should be considered when interpreting respiratory agent pcr results if modified live vaccines have been used . development of quantitative pcr and wildtype sequencing are necessary to improve positive predictive value of these assays by distinguishing vaccinate from natural infection .
but , the results have often been disappointing . recently , with further advancements in laparoscopic surgery , laparoscopic repair of parastomal hernias have been described with good results . many investigations have been reported that laparoscopic repair of parastomal hernias with the proper technique can be safe , feasible and reliable . furthermore , these kinds of repairs offer all of the well - known advantages of minimally invasive surgery . however , despite many advances in laparoscopic surgery in korea , there does not yet seem to have much experience in the treatment of laparoscopic parastomal hernia . in korea , as far as we know , laparoscopic repair of a parastomal hernia with a modified sugarbaker technique has not yet been performed . herein , we present a case report of a patient suffering from a large parastomal and incisional hernias who underwent laparoscopic parastomal hernia repair with a modified sugarbaker technique . a 79-year - old woman , who had undergone an abdominoperineal resection for an adenocarcinoma ( pt3n0m0 , stage ii ) of the rectum 9 years ago , visited the emergency room with severe abdominal pain and vomiting . 1 ) . she first noticed the parastomal hernia seven years ago . in the past , she sometimes had difficulty with fitting stoma appliances and complained of discomfort due to the severe parastomal hernia . on preoperative abdominopelvic computed tomography ( ct ) , a large parastomal hernia with concomitant incisional hernia was observed with a loss of fascia around her ostomy . although the patient experienced some improvement of symptoms with conservative management early in her hospital stay , the authors determined that a laparoscopic surgery for correction of the parastomal hernia would be necessary for long - term management . intravenous prophylactic antibiotics were given during induction of anesthesia , and the patient was operated under general anesthesia with endotracheal intubation . the stoma was covered with a gauze and the stoma site was covered with a clean ioban drape ( 3 m , st . positioning of the surgeons , trocars and video equipment is shown is given in fig . both surgeon and assistant stood on the side of the patient opposite to the stoma site . the first 12 mm balloon trocar intended for the camera was created with an open hasson technique at the side opposite to the stoma , and a pneumoperitoneum was created with 12 mmhg of intraoperative abdominal pressure . finally , a third 12 mm trocar was placed just above the superior iliac crest ( fig . 3 ) . after complete lysis of adhesion with sharp dissection of the anterior abdominal wall , we measured the hernia defect and inspected concomitant incisional hernia ( fig . the parastomal hernia sac size was measured to be 7 cm 5 cm and the concomitant incisional hernia sac size was 6 cm 5 cm . a size of mesh was fit according to these marking such that it would be large enough to cover all hernia defects by at least 5 cm in all directions . before mesh application , the midline incisional hernia was closed with 1 - 0 vicryl sutures using the endo close trocar site closure device ( covidien , mansfield , ma , usa ) through separate small skin incisions ( fig . 4b ) . we used a 25 cm 20 cm sized parietene composite mesh ( covidien ) which was used as the original without cutting . orientation marks were made on the mesh and on the abdominal wall to allow for proper intraperitoneal orientation of the mesh . the first sutures were placed at the orientation marks before the mesh was inserted into the abdomen . the mesh was subsequently oriented using the orientation marks and the sutures were extracted through separate small skin incisions at the orientation marks with an endo close trocar site closure device . the sutures were tied down to the anterior abdominal fascia , thus creating transabdominal fixation sutures . we placed a transfascial fixation suture laterally in the mesh just above and just underneath the lateralized bowel ( fig . further fixation was performed with a mechanical fixation device - autosuture endoscopic tacker ( endo universal 65 devices , 4.8 mm stapler)-at the margin of the mesh with an interval of about 1 to 2 cm ( fig . 4d ) . total operating time was 340 minutes and there were no complications during the procedure ( fig . ( pod ) # 1 , the patient started tolerating sips of water , and at pod # 3 , a soft diet was started . following a brief ileus , now , 6 months after surgery , the patient has shown no evidence of recurrence ( fig . 6 ) . their rate of incidence varies between 4% and 48% . although most asymptomatic hernias are well tolerated and can be managed conservatively , approximately 30% of hernias require surgical intervention for symptoms that include bowel strangulation , obstruction , bleeding , parastomal pain , poorly fitting appliances , and leakage . the three most common surgical approaches are primary fascial repair , stoma relocation , and repair with mesh . direct primary fascia repair at hernia site had reported recurrence rates of 38% to 100% , additionally , stoma relocation does not remove the risk of parastomal hernia developing at the new stoma site and incisional hernia can still develop at the previous stoma closure site . a repair with mesh has shown improved results over stoma relocation and primary fascial repair . recently , with increasing research and advancement in laparoscopic surgery , a laparoscopic method for repair of parastomal hernias with mesh was described , with good results on short - term follow - up . laparoscopic parastomal hernia repair can be divided into two main groups : keyhole techniques and sugarbaker techniques . but , they all have an intraperitoneal mesh with a central hole to allow the colon or ileum to pass through the mesh to go to the stoma site . sugarbaker techniques have no hole in the mesh , but rather the bowel going to the stoma is lateralized and covered by the mesh [ 6 - 8 ] . in 1980 , sugarbaker first described an open technique for repair of parastomal hernia using an intraperitoneally placed polypropylene mesh . in 1998 , it was reported the first case on laparoscopic parastomal hernia repair with a " sugarbaker technique " and in 1999 , it was reported a case of a laparoscopic repair of a parastomal hernia with " keyhole techniques " by bickel et al . . modified sugarbaker technique was first described by stelzner et al . in 2004 . by laparotomy , an intraperitoneal expanded polytetrafluoroethylene mesh was placed with overlap the edges of the fascia by of at least 5 cm in all directions . in 20 patients , with a mean follow up of 3.5 years , they saw three asymptomatic recurrences . in 2007 , muysoms reported a " laparoscopic modified sugarbaker technique for parastomal hernia " in five patients with good early results , no early recurrences and good functional outcome . in many investigations , it has been reported that laparoscopic repair of parastomal hernia is a safe , feasible and reliable technique offering the well - known advantages of minimally invasive surgery . however , despite many advances in laparoscopic surgery in korea , there does not yet seem to have much experience in the treatment of laparoscopic parastomal hernia . . reported laparoscopic repair of parastomal hernia using keyhole - technique for the first time in korea . for example , safadi reported a recurrence rate of 56% ( 5/9 patients ) within 6 months of the operation . muysoms also reported a disappointing experience and high recurrence rates with the " keyhole technique " . recently , reports have shown that the sugarbaker technique has lower recurrence rates compared to the keyhole technique . muysoms reported that laparoscopic parastomal hernia repair with " keyhole techniques " had an unacceptably high recurrence rate . therefore , he changed to a " laparoscopic sugarbaker technique " with more promising early results . reported that the modified sugarbaker technique may offer patients a significant decrease in the risk of recurrence with no significant increase in postoperative complications compared to other parastomal hernia repair techniques . for incisional hernia , already laparoscopic treatment with the mesh is considered gold standard of treatment . for parastomal hernias , it seems that the global trend is shifting towards using a sugarbaker technique rather than keyhole technique . in conclusion , we found that laparoscopic repair of a parastomal hernia with a modified sugarbaker technique can be a safe and technically feasible . it is a mechanically logical technique combining the advantages of minimally invasive surgery with a favorable intra - abdominal pressure gradient . the viability of this approach , however , depends on longer - term follow - up reports with greater statistical power , and standardization of technical details .
a parastomal hernia is the most common surgical complication following stoma formation . as the field of laparoscopic surgery advances , different laparoscopic approaches to repair of parastomal hernias have been developed . recently , the sugarbaker technique has been reported to have lower recurrence rates compared to keyhole techniques . as far as we know , the sugarbaker technique has not yet been performed in korea . we herein present a case report of perhaps the first laparoscopic parastomal hernia repair with a modified sugarbaker technique to be successfully carried out in korea . a 79-year - old woman , who underwent an abdominoperineal resection for an adenocarcinoma of the rectum 9 years ago , presented with a large parastomal and incisional hernias , and was treated with a laparoscopic repair with a modified sugarbaker technique . six months after surgery , follow - up with the patient has shown no evidence of recurrence .
ewing s sarcoma / primitive neuroectodermal tumors ( ews / pnet ) represent a group of rare malignant tumors , probably arising from migrating embryonic cells of the neural crest and showing variable neuroectodermal differentiation . they are extremely rare in adults , but have been reported on the chest wall and other body parts . a 43-year - old woman para 2 , with no family history of breast cancer presented with a rapidly enlarging mass in the left breast discovered one month previously . physical examination revealed a hard , painless mass , measuring approximately 3 cm in diameter , located at the upper outer quadrant of the left breast . mammography and ultrasonography revealed a superficial well defined oval mass with a soft tissue density and a hypoechoic center . an initial diagnosis of fibroadenoma was suspected and core needle biopsy concluded to a fibrocystic dystrophy . one month later , the patient complaint that the mass progressively grew to the size of 13 cm in diameter with inflammation of the overlying skin and a left axillary lymphadenopathy . ultrasonographic examination revealed a 10 cm mass scattered with multiple fluid areas ( figure 1 ) . histopathological examination showed a relatively well - circumscribed tumor , composed by sheets and lobules of malignant cells within distinct borders , amphophilic or eosinophilic cytoplasm sometimes vacuolated ( figure 2a ) nuclei are atypical either round open or hyperchromatic . the morphological feature advocated the diagnosis of poorly differentiated carcinoma or neuroendocrine carcinoma or lymphoma or ews / pnet . immunohistochemical staining showed that tumor cells were positive for vimentin ( v9 , dako a / s , glostrup , denmark , 1/100 ) , neuroendocrine markers such as neuron specific enolase ( nse ) ( h14 , dako , 1/100 ) , synaptophysin ( sy 38 , dako , 1/20 ) , cd99 ( 12e7 , dako , 1/50 ) and fli-1 ( rb - poly , springbio ltd . , portsmouth , uk , 1/50 ) ( figure 2c , d ) . they were negative for cytokeratin ( ae1/ae3 , novocastra - leica biosystems gmbh , nussloch , germany , 1/50 ) and hormonal receptors ( pgr 636 , 1d5 , dako , 1/40 ) . leucocyte common antigen ( lca ) ( m07001 , dako , 1/100 ) was negative , excluding the diagnosis of lymphoma . cytogenetic study in order to look for a characteristic translocation t ( 11 ; 22 ) was not performed because a genetic platform is not available in our institution . surgical margins were positive , therefore , left modified radical mastectomy with axillary lymph nodes dissection was performed . computed tomographic ( ct ) scan of the chest , abdomen and pelvis ruled out any extra mammary origin of the tumor such as bone , soft tissue or other organs . the patient was given 6 cycles of adjuvant chemotherapy containing cyclophosphamide , adriamycin and vincristine . she has been on regular follow up and after 20 months of surgery remains free of disease . carcinomas are the majority of malignancies involving the breast ; sarcomas represent less than 1% of breast malignancies . ews / pnet of the breast is extremely rare , with several of primary tumors previously reported in the literature . ews and pnet form a single group of bone and soft - tissue tumors [ ewing s sarcoma family of tumors ( eft ) ] with typical undifferentiated ewing s sarcoma at one end of the spectrum and pnet with clear evidence of neural differentiation at the other . this group of tumors is characterized by the presence of the typical translocation t ( 11 ; 22 ) ( q24 ; q12 ) , the ews - fli1 chimere transcript at the molecular biology and the expression of cd99 antigen ( mic2 ) at immunohistochemistry . several studies of adult ews / pnet from the royal marsden , the memorial sloan - kettering and the dana - faber cancer centers have reported a median age of 24 - 27 years . our case revealed the age was slightly older which was at the age of 43 . it has been suggested that , despite common genetic traits , ews / pnet in a relatively advanced age group might arise from different precursor cells or appear at different developmental stages than typical eft of adolescents and young adults . it is also possible that additional genetic changes that are critical for tumor progression or that influence patients prognoses are different between typical eft and those at unusual locations in adults . in relation to breast presentation of ews / pnet , the most common is unilateral palpable mass in the breast , with a median dimension of 5 cm . in the present case tumor s size was initially of 3 cm , than rapidly enlarged to reach 12 cm . majid et al . reported one case of bilateral primary neuroectodermal tumor of the breast . they can vary from a hypoechoic mass with posterior enhancement to a heterogeneous mass with a necrotic area . . described sonographic findings of primary ews / pnet of the breast as a superficial , circumscribed , hypoechoic mass with posterior acoustic enhancement and an apparent hypoechoic tract extending to the skin . these lesions were misdiagnosed as an epidermal inclusion cyst and considered therefore as benign . in the present case , sonographic findings were different , displaying a well defined oval lump with a soft tissue density and a hypoechoic center . ct scan and magnetic resonance imaging ( mri ) features of ews / pnet are also non specific , usually showing a large , non calcified and heterogenous soft tissue mass with cystic or necrotic areas on ct . on mri , signal intensity is similar to muscle on t1-weighted images and heterogeneously high on t2-weighted images , with variable gadolinium enhancement . the histopathological pattern of eft is variable depending on the degree of neuroectodermal differentiation . cells vary from small , round cells with round nuclei , fine chromatin , scant cytoplasm and indistinct cell borders to larger cells with irregular nuclear contours . primary ews / pnet of the breast might be misdiagnosed as a small cell carcinoma , medullary carcinoma , poorly differentiated ductal or lobular carcinoma or ductal carcinoma with neuroendocrine differentiation owing to its morphology and immunohistochemical characteristics . metaplastic carcinoma with neuroectodermal differentiation should be considered , so extensive sampling and immunohistochemical investigation are compulsory to do . immuno - phenotyping is necessary to confirm the diagnosis of ews / pnet , showing positivity of tumoral cells for vimentin , fli-1 and cd99 ( mic-2 ) . it shows a membranous staining and seems playing a crucial role in the diagnosis of ews / pnet . it was initially thought to be highly specific for ews / pnet , but it is now recognized that , although its sensitivity ranges from 84% to 100% in ews / pnet , its specificity is limited . and may also be expressed in metaplastic carcinoma of the breast , neuroendocrine carcinoma , lymphoma and rhabdomyosarcoma . ews / pnet that are only immunoreactive to cd99 , albeit rare , have been reported in the literature . reactivity for vimentin , nse , cd57 and s100 may suggest diagnosis but are not pathognomonic . thus , histological and immunohistochemical examination is contributive to propose the diagnosis of pnet in most cases . however ; genotypic analysis , by dna- and rna - based polymerase chain reaction , southern blotting , and fluorescent in situ hybridization are the only confirmatory tools . owing to these recent improvements in diagnostic ability , we now realize that ews / pnet develops in diverse and previously unexpected locations and we should be able to detect more cases of ews / pnet of the breast , some of which might have been diagnosed previously as small cell carcinomas or carcinomas with neuroendocrine differentiation . ews / pnet is an aggressive tumor with a high incidence of local recurrence and distant metastasis . a combination of multiple treatment modalities , including surgery , chemotherapy and radiation therapy , is indicated for these patients . systemic chemotherapy improves the 5-year survival rate in localized forms of pnet from 10% up to 65% which is primarily due to the elimination of micrometastases . although the optimum combination chemotherapy has not yet been established , a regimen containing vincristine , adriamycin , cyclophosphamide and actinomycin d , was the standard first - line treatment for patients with localized disease . in patients with unresectable or metastatic disease , palliative chemotherapy may be useful . however , it can be combined with surgery , in order to control local disease . ews / pnet are rare tumors developed in the breast , their diagnosis need immunohistochemical and genetic investigations . these ancillary techniques are necessary in order to rule out other types of malignant tumor owing poor prognosis and different way of management .
ewing s sarcoma / primitive neuroectodermal tumors ( ews / pnet ) are rare malignant and aggressive tumors , usually seen in the trunk and lower limbs of children and young adults . they are uncommon in the breast . we report a case of a 43-year - old woman who developed a painless breast mass . an initial core needle biopsy concluded to a fibrocystic dystrophy contrasting with a rapidly growing mass ; thus a large lumpectomy was done . diagnosis of primary pnet of the breast was established , based on both histopathological examination and immunohistochemical findings . surgical margins were positive , therefore , left modified radical mastectomy with axillary lymph nodes dissection was performed . the patient was given 6 cycles of adjuvant chemotherapy containing cyclophosphamide , adriamycin and vincristine . twenty months later , she is in life without recurrence or metastasis . ews / pnet may impose a diagnostic challenge . indeed , mammography and ultrasonography features are non specific . the histopathological pattern is variable depending on the degree of neuroectodermal differentiation . immuno - phenotyping is necessary and genetic study is the only confirmatory tool of diagnosis showing a characteristic cytogenetic anomaly ; t ( 11 ; 22 ) translocation .
increased mortality and morbidity due to antibiotic treatment failure make antimicrobial resistance ( amr ) one of the 21st century 's major global public health challenges . overuse and misuse of antibiotics are considered major reasons for the emergence of resistant bacteria in many low - income countries [ 2 , 3 ] . antibiotic resistance has been documented for enteric bacteria from various water sources and these water sources could facilitate dissemination of resistant bacteria to a wider community of people and animals . this is particularly true for low - income countries like tanzania where water sources are frequently shared between animals and people [ 5 , 6 ] . for example , a report from kenya reported a high prevalence of antibiotic resistance e. coli from water and fish in lake victoria [ ampicillin ( 64% ) , tetracycline ( 76% ) , and cotrimoxazole ( 80% ) ] where untreated water is consumed routinely . tanzanian hospitals have reported a high proportion ( 80%90% ) of clinical e. coli isolates that are resistant to antibiotics such as ampicillin , cotrimoxazole , tetracycline , gentamicin , and amoxicillin / clavulanic acid . these bacteria infect people within a healthcare system where , in most cases , there are no laboratory diagnostics to guide antibiotic treatment [ 810 ] . another study reported a high number of antibiotic resistant e. coli , possessing resistance to cephalosporins , from free - range buffalo , zebra , and wildebeest . these animals were located in mixed grazing areas with potential contact with people and livestock . contaminated water was suspected as the source of resistant bacteria found in these wild animals . contaminated water most likely plays a role in the dissemination of antibiotic resistant bacteria and the probability of transmission likely increases when people and animals use that water . antimicrobial resistance ( amr ) genes are transferred to other bacteria , sometimes at the species level , by horizontal gene transfer ( transduction , transformation , and conjugation ) . plasmid - mediated horizontal transfer of multidrug resistance between different bacteria is a major concern because this contributes to the evolution and emergence of antibiotic resistant bacteria in the environment [ 12 , 13 ] . for the last decade , polymerase chain reaction - based replicon typing ( pbrt ) has been used to identify major plasmid types found in enterobacteriaceae , including incompatibility ( inc ) groups ( hi2 , hi1 , i1- , x , l / m , n , fia , fib , fic , w , y , p , a / c , t , k , and b / o ) [ 14 , 15 ] . plasmids belonging to group incf frequently harbor blactx - m-15 that is often associated with blatem-1 , blaoxa-1 , and aac(6)-ib - cr resistance genes . replicon groups inca / c and l1 are frequently associated with enterobacteriaceae and harbor multiple resistance genes including resistance for extended - spectrum cephalosporins and carbapenems [ 1719 ] . in northern tanzania , surface water such as rivers and ponds is often shared between animals and people on daily basis . consequently , these water sources become polluted with human and animal excreta and might harbor antibiotic resistant enteric bacteria . consumption of water containing these bacteria is likely to increase the risk that antibiotic resistant and pathogenic bacteria will be transmitted . nevertheless , to date , no studies have been conducted in tanzania to determine if drinking water represents a risk factor for transmission of antibiotic resistant bacteria to people and animals . the objective of this study was to characterize the replicon types of plasmids that harbor drug resistant traits , their conjugation efficiencies , and the complement of antibiotic resistance genes for a panel of multidrug resistant e. coli isolates that were obtained from drinking water sources in northern tanzania . each source was visited twice and one sample was collected from each source per visit ( in tanzania , march is the rainy season and august is during dry season ) . sample locations included the kilimanjaro region ( moshi municipal , moshi rural , and hai districts ) , the arusha region ( arusha city , arumeru , longido , and monduli districts ) , and the manyara region ( simanjiro and babati districts ) . a convenience approach was used to select sampling sites with appropriate permission from local authorities . water samples were collected in 500 ml sterile bottles and were transported in cooler boxes with ice packs to the laboratory for processing within 6 h of collection . out of 500 ml , 100 ml water samples were analyzed using a standard membrane filtration technique with minor modifications . following filtration , each filter membrane was placed on a chromogenic selective agar plate ( hicrome e. coli agar , himedia laboratories prt . ltd . , the agar plates were initially incubated at 37c for 4 h , followed by incubation for 1622 h at 44c . plates produced 1200 cfu of which individual colonies were subcultured to ensure purity for further characterization . the identity of e. coli isolates was confirmed using a pcr genotyping test that detects the presence of the uida gene . antibiotic break point assays were used to determine the resistance profile of each e. coli isolate against a panel of important antibiotics . macconkey ( mac ) ( thermo oxoid remel ) agar plates with each antibiotic at their clsi recommended minimum inhibitory concentrations ( table 1 ) were used to perform the break point assays . e. coli strains k-12 ( negative control ; susceptible to all antibiotics tested ) and h4h e. coli ( positive control ; resistant to all antibiotics tested ) were used as reference strains for antibiotic susceptibility testing . a set of 31 e. coli isolates that were susceptible to nalidixic acid and resistant to more than 2 antibiotics tested were chosen for this study . filter - mating experiments were performed to determine the conjugation rates of plasmids with the nalidixic acid susceptible mdr ( wild - type ) e. coli isolates as donors and a plasmid - free recipient strain ( e. coli k-12 , nalidixic acid resistant , nal ) as recipient as described earlier [ 23 , 24 ] with minor modifications . briefly , single colonies of e. coli k-12 and potential donor strains were grown separately overnight in lb medium ( luria - bertani medium ; difco lb broth lennox , sparks , md , usa ) at 37c . equal quantities ( 10 l ) of overnight cultures of donor and recipient strains were added on top of a nitrocellulose ( ~1 cm ) membrane overlaid on lb agar with no antibiotics . after 24 h of incubation at 37c , cells from the membrane were suspended in 500 l of sterile phosphate - buffered saline ( pbs , ph 7.0 ) and spread onto lb agar plates containing 32 g / ml nalidixic acid ( sigma - aldrich ) and another antibiotic to which the donor cells were resistant ( table 2 ) . the conjugation efficiency of plasmid was calculated by dividing the number of transconjugants by the number of donor cells . transconjugants were screened for their donor 's antibiotic resistance phenotypes and presence of tet(a ) , tet(b ) , blatem-1 , blashv , and blactx - m genes [ 25 , 26 ] . ctx - m grouping ( group 1 , group 2 , and group 9 ) was further evaluated for all ctx - m positive isolates . all ctx - m e. coli isolates were positive for ctx - m group 1 and the pcr products were subsequently sequenced by functional bioscience ( madison , wi ) . sequencher ( ver 5.0 ) software was used to process sequence traces , and the final sequences were analyzed with clc genomic workbench 7.0.2 ( clc bio aarhus , denmark ) and compared with the reported sequences from genbank ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . pcr - based replicon typing was used with genomic dna of the transconjugants using the methods described by johnson et al . . briefly , pellets from 1 ml of overnight culture were resuspended with 200 l of nanopure water and placed in a heating block at 100c for 10 min . the lysed suspension supernatant was transferred to a new vial and stored at 80c until ready for testing against 18 different sets of primers that were grouped into three multiplex primer panels . the following pcr conditions were used : 5 min at 94c , 30 cycles of 30 s at 94c , 30 s at 60c , and 90 s at 72c , and a final extension of 5 min at 72c . the amplified pcr products were visualized using 1.5% tris - acetate - edta agarose gel containing 0.2 g / ml ethidium bromide alongside a 1 kb ladder ( gene ruler 1 kb , life technologies ) . thirty - one mdr isolates were selected and used as donors to test if the resistance determinants were transferrable to recipient e. coli isolates by conjugation . of these , antibiotic resistance traits were successfully transferred by 25 isolates with conjugation efficiencies ranging from 10 to 10 ( table 2 ) . penta - resistant phenotype that included resistance to ampicillin , streptomycin , sulfamethoxazole , tetracycline , and trimethoprim . pcr testing of transconjugants showed that tet(a ) was most commonly associated with conjugative plasmids ( 33% ) followed by blatem-1 ( 24% ) , tet(b ) ( 17% ) , blactx - m ( 8% ) , and blashv-1 ( 0% ) . a total of 11 replicon types were detected among the 31 mdr isolates ( table 3 ) . incf replicon types ( incf ia , ib , ic , and iia ) were predominant ( 49% ) and were mainly associated with e. coli isolates that were resistant to ampicillin , streptomycin , sulfonamide , tetracycline , and trimethoprim . replicon types incx , incw , incl / m , incy , inchi1 , inct , and inc k were not detected . replicon types n , h12 , fib , and fia were associated with blactx - m-15 and resistance to ampicillin , ceftazidime , streptomycin , sulfamethoxazole , tetracycline , and trimethoprim . after conjugation , one recipient was positive for four different replicons ( i1 , fib , fia , and k / b ) . plasmid - mediated horizontal transfer of multidrug resistance traits plays a key role in the dissemination of antimicrobial resistance around the world . our study shows that e. coli isolated from tanzanian water sources harbor multiple plasmids belonging to major plasmid replicon types such as incf , a / c , l1 , and n. most of these plasmids were associated with transfer of antibiotic resistance traits via conjugation with rates that varied between 10 and 10 using filter - mating assays . moreover , these plasmids harbor multiple antibiotic resistance genes that are associated with plasmid replicon types such as incf , a / c , n , l1 , h12 , and b / o . studies show that plasmid - mediated horizontal gene transfer occurs within and between e. coli and pseudomonas isolated from sewage and lake water . given the presence of resistant e. coli in biologically contaminated water from tanzania , it is likely that their presence contributes to the long - term persistence of resistance traits in people and animals who share these water resources . among the 11 replicon types found , incf group plasmids were detected more frequently than other tested groups . this is in accordance with previous studies where incf plasmids were found predominantly in e. coli from clinical samples ( rectal samples , gastric aspirate samples , and vaginal sample ) [ 28 , 29 ] and in e. coli from people ( feces and uti patients ) and poultry ( fecal swab ) . incfib was the most frequently detected ( 16% ) replicon type , similar to what has been reported for e. coli isolates collected from fecal samples of healthy people and cattle in nigeria . the overall proportion of incf - positive e. coli was 49% , which is lower than that observed in germany ( 71% ) but higher than that observed in e. coli isolates from fecal samples of healthy people and food animals in switzerland ( 45% ) . narrow host range although they are well adapted to e. coli and are frequently associated with the presence of tet(a ) , blatem-1 , and blactx - m [ 31 , 32 ] . in this study , plasmid type incf was associated with tet(a ) , blatem-1 , and blactx - m-15 . the ctx - m-15 -lactamases are disseminated worldwide and are usually located in the conjugative plasmids . detection of this trait in e. coli isolated from water sources is a public health concern because ctx - m-15 -lactamases are commonly associated with urinary tract infections . another study from a hospital in tanzania found ctx - m-15 in klebsiella pneumoniae that can be associated with neonatal sepsis . in this study , detection of ctx - m-15 in e. coli from water suggests a possible contamination of human , livestock , and wild animal excreta and thus consumption of this untreated water is clearly a potential risk for transmission back to people . the inci1 plasmid type was the second most prevalent replicon type ( 13% ) and these plasmids also harbor multiple resistance genes . e. coli can reportedly maintain inci1 plasmids without antibiotic selection pressure and with little or no apparent fitness cost to the host bacterium . importantly , it is also a conjugative plasmid commonly detected in e. coli recovered from humans and animals with the conjugation efficiencies ranging between 10 and 10 [ 15 , 16 , 28 , 34 ] . the inci1 plasmid carrying blactx - m-15 and blatem-1 has been associated with the recent 2011 outbreak of e. coli o104 in germany . in addition , bacteria carrying lncl1 plasmids were responsible for community and hospital acquired infections [ 38 , 39 ] . inca / c plasmids are typically larger ( ~150 kb ) than others with lower conjugation efficiencies [ 24 , 40 , 41 ] . about 10% of e. coli isolates from our water samples harbored inca / c plasmids and these were associated with resistance to ampicillin , streptomycin , sulfonamide , tetracycline , and trimethoprim . importantly , inca / c plasmids can harbor a large number of antimicrobial resistance genes and the broad - host spectrum coupled with an ability to spread via conjugation transfer within bacteria communities means that they can transfer an arsenal of resistance traits to pathogens of people and animals [ 40 , 42 , 43 ] . isolation of e. coli with inca / c from environmental water samples that are consumed by humans and animals on daily basis is a major public health concern . the replicon typing methods have some pitfalls including the obvious inability to detect unknown replicons . for example , 14 isolates in the current study transferred their resistance phenotypes to the recipients ' cells but no plasmid replicon was detected . detection of these public health important conjugative plasmids and antibiotic resistant traits in tanzanian water suggests the possible pollution of these water sources from human , livestock , and wild animal wastes and also shows the potential of these water sources in the maintenance and transmission of these resistance traits between environment , animals , and people . therefore , appropriate intervention strategies should be identified and implemented to reduce the water pollution .
the aim of this study was to identify the replicon types of plasmids , conjugation efficiencies , and the complement of antibiotic resistance genes for a panel of multidrug resistant e. coli isolates from surface waters in northern tanzania . standard membrane filtration was used to isolate and uida pcr was used to confirm the identity of strains as e. coli . antibiotic susceptibility was determined by breakpoint assay and plasmid conjugation was determined by filter - mating experiments . pcr and sequencing were used to identify resistance genes and pcr - based replicon typing was used to determine plasmid types . filter mating experiments indicated conjugation efficiencies ranged from 101 to 107 . over 80% of the donor cells successfully passed their resistance traits and eleven different replicon types were detected ( inci1 , fic , p , fiia , a / c , fib , fia , h12 , k / b b / o , and n ) . incf plasmids were most commonly detected ( 49% of isolates ) , followed by types inci1 and inca / c . detection of these public health - relevant conjugative plasmids and antibiotic resistant traits in tanzanian water suggests the possible pollution of these water sources from human , livestock , and wild animal wastes and also shows the potential of these water sources in the maintenance and transmission of these resistance traits between environments , animals , and people .
an eighteen year old african american male presented to the emergency room with a 1-week history of sore throat , muscle aches , fever , headache , and photophobia . physical examination revealed a tall , thinly built young man , in mild pain with an oral temperature of 97.5f , blood pressure of 114/69 mmhg , heart rate of 89 beats per minute ( bpm ) and respirations of 18/minute . the examination of the central nervous system revealed neck stiffness ; kernig s and brudzinski s signs were not elicited . hemoglobin was 17.5 g / dl , hematocrit 50.8 g / dl , and white count 20.3 10/l with 89% granulocytosis , and platelet count of 35 10/l . basic metabolic profile was within normal limits , except for a potassium level of 3.2 meq / l , blood urea nitrogen of 44.9 mg / dl , and creatinine of 2.3 mg / dl . the blood culture grew penicillin sensitive group c streptococcus ( gcs ) within 24 hours of incubation . further work - up revealed right cavernous and ophthalmic vein thrombosis on magnetic resonance imaging ( figures 1 and 2 ) . gcs is a rare cause of bacteremia , mostly associated with zoonological infections.18 it can cause a mucopurulent pulmonary disease in horses and mastitis in cattle.2,3 in humans , gcs can be part of the normal oral , skin , and genitourinary flora but , gcs infection can be highly virulent , causing rapid , disseminating disease24 carrying with it a mortality of about 25%.4,5 the dismal prognosis is linked to the severity of illness and the high level of virulence of the organism.2 this group of streptococci can be differentiated from other species by their hemolysis pattern and their ability to ferment sorbitol and trehalose.4 examples of major species include streptococcus equisimilis , s. zooepidemicus , s. equi , s. dysgalactiae , with the most common type isolated from the human throat being s. milleri.14,6,7 unfortunately , one of our limitations was our laboratory was unable to identify the species of gcs . one study , which was based on the throat swabs of 1,016 college patients , showed that gcs was associated with pharyngitis.3 this is significant concerning our patient as he had complained of symptoms of sore throat and had a tonsillar exudate . gcs menigitis , though rare , has a strong association with patients who were in close contact with infected animals or consumed unpasterized milk.1,2,69 huang et al reported 13 cases of gcs meningitis;2 of these cases , five died , four suffered permanent neurological sequelae of some kind , and four recovered without lasting sequelae.2 to the best of our knowledge , ours is the first case of gcs meningitis with cavernous sinus thrombosis . adverse outcomes can still occur despite timely initiation of appropriate antimicrobial treatment.2,4,5 blood cultures taken 24 hours after starting treatment would be negative , as well as cerebrospinal - fluid analysis . this expectionally rapid eradication rate of the pathogen exists in the presence of continued fever spikes and a worsening clinical picture,2 as was the case for our patient . he continued to have symptoms of fever and chills for at least 710 days after starting treatment . a classic presentation of meningitis includes nuchal rigidity , fever , headache , and photophobia . however , without aggressive treatment , patients can rapidly develop more severe signs such as tetraparesis,9 aortic aneurysms , osteomyelitis and lymphadenitis,5 hearing loss , and blindness.2,4,5 a possible complication of meningitis can be the development of a thrombosis in the cavernous sinus . this is a cavity at the base of the brain which drains deoxygenated blood from the brain back to the heart . the cause is usually from a spreading infection in the nose , sinuses , ears , or teeth . cavernous sinus thrombosis symptoms include : decrease or loss of vision , chemosis , exophthalmos , headaches , and paralysis of the cranial nerves that course through the cavernous sinus , features which were observed in our patient . this infection is life - threatening and requires immediate treatment , which usually includes antibiotics and sometimes surgical drainage . when the patient originally entered the hospital he was started on extended coverage antibiotics : ceftriaxone and vancomycin . once the diagnosis was established , and given the history of a pencilin allergy , we decided to begin treatment with chloramphenicol , one gram intravenously , every 6 hours . twelve to 24 hours later , the sensitivity profile showed that the pathogen was susceptible to only penicillin g. at this juncture , it was decided to desensitize the patient to pencillin . he did not suffer any ill effects of the desensitization and his antibiotic regimen was switched to intravenous penicillin g , four million units every 4 hours . due to risk of bleeding , considering patient s low platelet count , the decision was made to not fully anticoagulate our patient , but to manage him with 5000 units of subcutaneous heparin three times daily . some advocate for the use of gentamicin , an aminoglycoside , with penicillin g to create a synergistic effect in severely ill patients or those who are immunocompromised.10 our patient continued this treatment regimen for 6 weeks . during these 6 weeks he developed an empyema , which had to be drained with a chest tube , likely secondary to septic emboli . oculomotor or abducens palsy in patients with meningitis further indicates thrombosis of the cavernous sinus since these nerves pass through the sinus . to our knowledge we have presented the first case of gcs meningitis with cavernous sinus thrombosis .
group c streptococcus ( gcs ) is a rare cause of bacteremia in humans . it is mostly associated with zoonological infections . although gcs can be part of the normal oral , skin , and genitourinary fora , an infection with this pathogen can be highly virulent , causing rapid , disseminating disease . with a mortality of about 25% , the poor prognosis is linked to the severity of illness and the high level of virulence of the organism . only a few cases of gcs meningitis have been reported . we present the first case of gcs meningitis with cavernous sinus thrombosis .
although syphilis seemed to be under control after the advent of antibiotics , recent epidemiological data showed drastically increased incidence in europe and the united states since the late 1990s and 2000s [ 1 , 2 ] . worldwide , there are an estimated 12 million new cases of syphilis every year , over 90% of which occur in developing countries . the hong kong social hygiene service reported around 1,400 new cases of syphilis per year in the 1970s followed by a decline to about 300 new cases per year in the early 1990s . since 1998 , the number gradually increased to over 1,000 new cases of syphilis up till 2010 . a multitude of presenting ocular signs has been described among both human immunodeficiency virus ( hiv)-positive and hiv - negative patients . it may be the initial presentation in the eye , occurring in one or both eyes , without obvious systemic manifestations . the diagnosis of ocular syphilis is challenging because of its protean features and lack of distinguishing characteristics . during a 6-month period in 2010 , 2 patients with widely disparate presenting ocular symptoms and signs were examined at our department and diagnosed with ocular syphilis . we reported the clinical findings and management of these 2 cases which illustrate the importance of a high degree of suspicion , prompt diagnosis and appropriate treatment of ocular syphilis in light of its reemergence in hong kong . a 67-year - old heterosexual man presented with a 1-week history of decreased vision in both eyes . on examination , snellen visual acuity was 6/60 and 6/18 in his right and left eye , respectively . slit - lamp examination was unremarkable with absence of cells in the anterior chamber and anterior vitreous . on dilated fundus examination , both optic discs were hyperemic with exudative retinal detachment in the macula ( fig . there were no retinal exudates , hemorrhages , or signs of vasculitis , and the vitreous was clear . visual acuity was hand movement in his right eye and count fingers at 1 foot in his left eye . intravenous fluorescein angiography showed leakage from the retinal pigment epithelial layer and optic discs bilaterally ( fig . complete blood count and immune markers were unremarkable except for a raised erythrocyte sedimentation rate ( esr ) of 36 mm / h . given the acute onset of vision loss secondary to exudative retinal detachment , the hyperemic optic disc , which showed leakage on fluorescein angiograph , together with an absence of ocular trauma , the provisional diagnosis of harada 's disease ( uveitic phase ) was made . the patient was treated with topical and oral prednisolone 1 mg / kg / day and the visual acuity improved to 6/30 and 6/12 in his right and left eye , respectively . however , 5 weeks into steroid treatment , anterior chamber cells started to appear in his right eye . indirect ophthalmoscopy revealed creamy - yellow retinal infiltrates along the inferotemporal arcade , hemorrhage and associated shallow subretinal exudate in the right eye ( fig . the initial finding of exudative retinal detachment in the macula had resolved but disc hyperemia was still present in both eyes . on fluorescein angiography there was early hyperfluorescence and late leakage associated with the inferotemporal lesion in the right eye ( fig . the diagnosis of acute retinal necrosis was made and the patient was treated with a course of intravenous aciclovir and systemic prednisolone was gradually tapered . one week after therapy was started , the patient complained of a headache and systemic laboratory workup revealed a positive venereal disease research laboratory ( vdrl ) test and subsequent fluorescent treponemal antibody absorption ( fta - abs ) test was reactive . cerebrospinal fluid analysis demonstrated 160 leukocytes per microliter , elevated protein and a positive vdrl test . the patient was treated for neurosyphilis with a 14-day course of intravenous penicillin ( 4 million units every 4 h ) . over the next month , the patient 's visual acuity improved to 6/12 in the right eye and to 6/9 in the left eye . right - eye iridocyclitis , subretinal fluid and infiltrates together with optic disc hyperemia resolved completely . a 30-year - old heterosexual man with good past health presented with a 2-week history of decreased vision in both eyes . he also complained of oral and genital ulcers , and bilateral maculopapular rash in the palms and forearms . he initially presented to a private ophthalmologist , who found bilateral vitritis and made the provisional diagnosis of behet 's disease . oral prednisolone 60 mg daily was given for 4 days prior to referral to our center for further management . snellen visual acuity was 6/12 in the right eye and 6/18 in the left eye . laboratory workup was positive for vdrl and fta - abs tests and showed a raised esr of 102 mm / h . cerebrospinal fluid analysis demonstrated 133 leukocytes per microliter , elevated protein and a positive vdrl test . when the diagnosis of neurosyphilis was conveyed to the patient , he revealed a history of unprotected sexual exposure . the patient received a 14-day course of intravenous penicillin ( 4 million units every 4 h ) and oral steroid was tapered . a 67-year - old heterosexual man presented with a 1-week history of decreased vision in both eyes . on examination , snellen visual acuity was 6/60 and 6/18 in his right and left eye , respectively . slit - lamp examination was unremarkable with absence of cells in the anterior chamber and anterior vitreous . on dilated fundus examination , both optic discs were hyperemic with exudative retinal detachment in the macula ( fig . there were no retinal exudates , hemorrhages , or signs of vasculitis , and the vitreous was clear . visual acuity was hand movement in his right eye and count fingers at 1 foot in his left eye . intravenous fluorescein angiography showed leakage from the retinal pigment epithelial layer and optic discs bilaterally ( fig . complete blood count and immune markers were unremarkable except for a raised erythrocyte sedimentation rate ( esr ) of 36 mm / h . given the acute onset of vision loss secondary to exudative retinal detachment , the hyperemic optic disc , which showed leakage on fluorescein angiograph , together with an absence of ocular trauma , the provisional diagnosis of harada 's disease ( uveitic phase ) was made . the patient was treated with topical and oral prednisolone 1 mg / kg / day and the visual acuity improved to 6/30 and 6/12 in his right and left eye , respectively . however , 5 weeks into steroid treatment , anterior chamber cells started to appear in his right eye . indirect ophthalmoscopy revealed creamy - yellow retinal infiltrates along the inferotemporal arcade , hemorrhage and associated shallow subretinal exudate in the right eye ( fig . the initial finding of exudative retinal detachment in the macula had resolved but disc hyperemia was still present in both eyes . on fluorescein angiography there was early hyperfluorescence and late leakage associated with the inferotemporal lesion in the right eye ( fig . the diagnosis of acute retinal necrosis was made and the patient was treated with a course of intravenous aciclovir and systemic prednisolone was gradually tapered . one week after therapy was started , the patient complained of a headache and systemic laboratory workup revealed a positive venereal disease research laboratory ( vdrl ) test and subsequent fluorescent treponemal antibody absorption ( fta - abs ) test was reactive . cerebrospinal fluid analysis demonstrated 160 leukocytes per microliter , elevated protein and a positive vdrl test . the patient was treated for neurosyphilis with a 14-day course of intravenous penicillin ( 4 million units every 4 h ) . over the next month , the patient 's visual acuity improved to 6/12 in the right eye and to 6/9 in the left eye . right - eye iridocyclitis , subretinal fluid and infiltrates together with optic disc hyperemia resolved completely . a 30-year - old heterosexual man with good past health presented with a 2-week history of decreased vision in both eyes . he also complained of oral and genital ulcers , and bilateral maculopapular rash in the palms and forearms . he initially presented to a private ophthalmologist , who found bilateral vitritis and made the provisional diagnosis of behet 's disease . oral prednisolone 60 mg daily was given for 4 days prior to referral to our center for further management . snellen visual acuity was 6/12 in the right eye and 6/18 in the left eye . laboratory workup was positive for vdrl and fta - abs tests and showed a raised esr of 102 mm / h . cerebrospinal fluid analysis demonstrated 133 leukocytes per microliter , elevated protein and a positive vdrl test . when the diagnosis of neurosyphilis was conveyed to the patient , he revealed a history of unprotected sexual exposure . the patient received a 14-day course of intravenous penicillin ( 4 million units every 4 h ) and oral steroid was tapered . the diagnosis of ocular syphilis is often elusive because of the protean features and lack of distinguishing clinical characteristics . because of its ubiquitous nature the great imitator. in both cases reported , the diagnosis of ocular syphilis was not considered prior to laboratory tests and provisional diagnoses of harada 's disease and behet 's disease were made . in a series of 22 consecutive patients in singapore , was nongranulomatous anterior uveitis ( 81.8% ) , followed by vitritis ( 65.4% ) , papillitis ( 27.5% ) , scleritis / episcleritis ( 22.7% ) , interstitial keratitis ( 22.7% ) , granulomatous uveitis ( 13.7% ) , vasculitis ( 13.7% ) and chorioretinitis ( 13.7% ) . jumper et al . reported a series of 3 cases with exudative retinal detachment but all were presented together with focal retinitis . however , case 1 from our report presented with bilateral exudative retinal detachment without focal retinitis initially . provisional diagnosis of harada 's disease led to the use of corticosteroids which may have caused the subsequent manifestation of focal retinitis 5 weeks after commencement of the steroids . fu et al . described a multicenter series of 8 patients who had superficial creamy - yellow retinal precipitates with syphilitic retinitis regardless of sexual preference or hiv status . in our first case , we also found such superficial retinal precipitates with similar optical coherence tomography ( oct ) appearance ( fig . all of the reported cases had rapid resolution of these precipitates after treatment with penicillin g. it was hypothesized that these were pre - retinal collections of leukocytes , representing an exaggerated ocular response to syphilitic infection as a result of immune reconstitution . this distinctive feature may help differentiate ocular syphilis from other etiologies of retinitis such as herpes and cytomegalovirus infection . nonetheless , the presence of optic neuritis and retinitis are generally considered as neurosyphilis and should be managed accordingly . the united states center for disease control ( cdc ) sexually transmitted diseases treatment guidelines recommended treatment of neurosyphilis with penicillin g ( 18 - 24 million units daily ) for 10 to 14 days . increased leukocyte counts and positive vdrl test in cerebrospinal fluid analysis was highly specific but not sensitive . in addition , the vdrl titer may not be proportional to the level of disease activity , rendering it ineffective for monitoring the effects of treatment . if pleocytosis in the cerebrospinal fluid was observed at presentation , monitoring was suggested at 6-month intervals until the cell count normalized . the use of systemic corticosteroids as an adjunct for posterior uveitis , scleritis and optic neuritis associated with syphilis has been described . in addition , it may prevent the jarisch - herxheimer reaction resulting from a hypersensitivity reaction to treponemal antigens that are released in large numbers as spirochetes are killed . hiv co - infection was found to be common ( 33% ) and the cdc recommended that all patients with neurosyphilis be tested for hiv . syphilis is a rare cause of uveitis , accounting for 1 - 5% of cases reported [ 12 , 13 ] . diagnosing ocular syphilis awareness of the reemergence of syphilis reported in many parts of the world in the past decade as well as a high degree of clinical suspicion can allow ophthalmologists to diagnose and treat the disease early , having a reasonably good visual prognosis following treatment with antibiotics .
during a 6-month period in 2010 , 2 patients with uveitis were examined at our department and diagnosed with ocular syphilis . they initially presented with symptoms and signs resembling harada 's disease and behet 's disease and were therefore treated with systemic steroids with suboptimal responses . when laboratory workup revealed neurosyphilis , they were given a course of intravenous penicillin g , which led to significant clinical and visual improvement . epidemiological data indicates a worldwide reemergence of syphilis and a high degree of suspicion is necessary in view of its multitude of presenting ocular signs without pathognomonic features .
air quality management includes deciding which sources to control and by how much . intake fraction ( if ) summarizes the emission - to - intake relationship for a specific source as the fraction of emissions that are inhaled by an exposed population . intake fraction can be used in cost - benefit and cost - effectiveness analyses , investigations of environmental equity , health risk assessment , and other studies that estimate the exposure consequences of emissions . intake fraction varies spatially and temporally , depending on factors such as the size of the exposed population , proximity between people and emissions , and environmental persistence of a pollutant . reported if values for nonreactive motor vehicle emissions include the following results : 0.10.5 ppm for u.s . rural areas , 321 ppm for u.s . cities of typical size , and 29280 ppm for three global megacities ( los angeles , mexico city , and hong kong ) . an if of 10 ppm ( i.e. , 10 ) means that an exposed population inhales an aggregate increment of 10 grams per tonne emitted . prior investigations of if for urban vehicle emissions have emphasized conditions for north america and europe ; determinants such as meteorology and urban form may differ on other continents . moreover , vehicle use is increasing rapidly in countries such as china and india for which few if estimates exist . here , we use a modeling approach to estimate intraurban if values for distributed ground - level primary pollutant emissions for all worldwide cities with a year 2000 population of 100 000 or more . in aggregate , this set of 3646 cities contains 2.0 billion people ( for year 2000 ) , including 1 billion people in asia . a goal of this study is to elucidate global patterns of intraurban if among countries , regions , and cities of varying sizes . we extend a previously published approach for estimating if , incorporating global data sets of demographic and meteorological parameters as model inputs . our investigation is motivated by trying to better understand the exposure consequences of urban vehicle emissions . the results may be informative for any broadly distributed source of ground - level emissions to outdoor urban air . the intake fraction for atmospheric emissions can be evaluated as1where t1 and t2 are the starting and ending times of emissions , p is the number of people exposed , qi(t ) is the volumetric breathing rate ( m s ) for individual i at time t , ci(t ) is the incremental concentration ( g m ) at time t in individual i s breathing zone that is attributable to the emissions , and e(t ) is the emission rate ( g s ) at time t. the integrals in eq 1 are evaluated numerically , as detailed below . examples include one - compartment eulerian models , gaussian plume models , coarse - grid eulerian models , empirical estimates using tracers of opportunity , and intentional tracer - gas experiments . in this paper , we designate urban areas with a population of at least 100 000 as cities . for the large number of cities considered here , an efficient approach is needed that can provide good estimates with a reasonable level of effort per city . we consider spatially distributed ground - level emissions sources ( e.g. , vehicles ) and use a one - compartment eulerian model . we estimate the intraurban if for each city , i.e. , the if associated with residents inhalation of emissions from their city . compared to alternatives , there are several advantages of the one - compartment eulerian model : ( 1 ) input data are available globally using uniform methods . ( 2 ) studies comparing if estimated using this model have found similar results compared with studies using empirical data or complex air - dispersion models . ( 3 ) because this type of model is widely used , the results reported here can be directly applied as model input parameters . ( 4 ) the one - compartment model is readily scaled in size for each location studied . among the limitations of this approach are that ( 1 ) the model excludes within - urban variability , ( 2 ) we have not evaluated if for secondary pollutants orfor nonconserved species with other than first - order decay , and ( 3 ) as applied here , we only consider intraurban exposures . previous findings suggest that for estimating if for individual cities , this approach is accurate within a factor of 2 or better for primary pollutants . we judge this accuracy to be acceptable given the efficiency of the approach ; global intraurban if values reported here vary by much more than a factor of 2 . the following equation , derived from mass balance , embodies a dynamic one - compartment model for predicting a primary - pollutant concentration increment resulting from emissions:2here , c(t ) is the incremental concentration attributable to the emissions source ( g m ) , which varies with time , t ( s ) , e(t ) is the emission rate from the source under consideration ( g s ) , l and w are the windward and crosswind dimensions , respectively ( m ) , of the model domain , h(t ) is the atmospheric mixing height ( m ) , k is the first - order decay constant ( s ) , and u(t ) is the wind speed averaged over the mixing height ( m s ) . the parameter accounts for dilution of contaminated urban air by clean air aloft during periods of increasing mixing height as follows : = 0 when dh / dt is nonpositive ( h decreasing or constant ) , and = 1 when dh / dt is positive ( h increasing ) . were the first to apply this dynamic model to estimate urban if ; eq 2 extends their approach to incorporate pollutants that undergo first - order decay with rate constant k. base - case if analyses are presented in this paper for conserved , nonreactive emissions ( k = 0 ) . many important vehicle - emitted species such as carbon monoxide ( co ) , benzene , and primary ( i.e. , directly emitted ) constituents of fine particulate matter ( pm2.5 ) , including black carbon particles are reasonably modeled as conserved within urban areas , since k u / l . sensitivity cases are simulated for decaying pollutants with 10 and 100 h half - lives ( k = 1.7 and 0.17 d , respectively ) . example species in these classes are acetaldehyde and toluene ( 10 h half - life ) and methyl tert - butyl ether ( mtbe ; 100 h half - life ) . for the primary pollutants considered here , the if is independent of the time - averaged emissions rate . likewise , the intraurban primary - pollutant if for any source is , by definition , independent of background concentrations imposed by other sources and by regional transport . consequently , city - specific emissions and concentration data are not required as model inputs . in implementation , eq 2 is converted from differential to finite - difference form , and the model simulates a series of time steps . we use short time steps : 7.5 min for a 3 year simulation of each urban area . we assumed a constant annual - average emission rate for all cities in our data set and specified initial and upwind boundary conditions for each city as c = 0 . we tested the numerical integration to ensure it behaves as expected for these conditions : ( 1 ) in simple scenarios with known outcome ( e.g. , step change for one input parameter ) and ( 2 ) by matching inputs and outputs from stevens et al . discretization errors resulting from numerical integration of eq 2 are estimated to be less than 1% . we acquired location - specific and time - resolved mixing heights and wind speeds for the years 20072009 from nasa s modern - era retrospective analysis for research and applications ( merra ) . merra uses the goddard earth observing system ( geos ) atmospheric model to assimilate historical meteorological and climatological observations into a global data set with high spatiotemporal resolution ( 1/2 longitude 2/3 latitude 1 h ; in the middle latitudes , these values correspond to a spatial resolution of 56 74 km ) . each city in our data set was matched to the nearest merra grid point . the median distance between the centroid of each city s urbanized land area and the corresponding merra grid point was 23 km ( 10% trimmed range 1034 km ) . merra data provide the wind speed at a standard 10 m reference height . to obtain the mixing - height - averaged wind speed , we employed a truncated power - law relationship for wind speed versus height ( see the supporting information).we used literature - recommended values for the vertical interpolation of wind speed as default input parameters and considered alternate values in sensitivity analyses ( see the supporting information ) . volumetric breathing rates for populations follow diurnal patterns , owing to variations in the levels of physical activity and in physiological processes ( e.g. , circadian rhythm ) . few data sets are available to characterize the temporal pattern of breathing rate for large urban populations . here , we developed a diurnal profile using time - activity data from a large probability - based sample of the u.s . relative to the time - integrated mean , the diurnal profile varies from 47% lower ( 03:00 to 04:00 h ) to 33% higher ( at 15:00 h ) ( see the supporting information ) . for base - case and sensitivity analyses , the time - integrated mean breathing rate was taken to be 14.5 m person d , consistent with long - term average inhalation rates recommended by the u.s . this metabolically derived value is comparable to those used in other recent if analyses ( range 1314.5 m person d ) , and lower than the upper - bound breathing rate value of 20 mperson d employed in some studies . to test the sensitivity of the results to the inferred time pattern of population breathing , we considered four alternative patterns : constant , a sinusoidal daily cycle ( amplitude 25% of the mean ) , and two previously published profiles for the united states ( figure si.4 , supporting information ) . we estimated intake fractions for the 3646 worldwide urban areas that had at least 100 000 inhabitants in the year 2000 utilizing a data set compiled by angel et al . the total population in this data set ( 2.0 billion ) accounts for 71% of the total year 2000 global urban population and 32% of the global population . the following information is available for each city : population , land area ( a , km , derived from satellite data ) , and location ( latitude and longitude ) . in cases where a contiguous urbanized area spans several administrative units ( e.g. , for conurbations or urban agglomerations ) , this database generally provides a single population and land area estimate for the urban portion of the entire metropolitan region . to our knowledge , this database contains the most consistent and comprehensive global set of urban population and land area data available . we idealize each city as occupying a square - plan urban footprint ( l = w = a ) and consider variations in the aspect ratio , = l / w , as a sensitivity parameter . since concentrations of primary nonreactive or first - order decaying pollutants scale linearly with emissions , intake fractions are independent of emission rates that are constant . however , because breathing rates and meteorology vary systematically , diurnal emission rate patterns can influence the intake fraction . for base - case analyses , we developedan archetypal diurnal emissions profile based on mobile source emission inventories for beijing , china , mexico city , mexico , and new delhi , india ( see the supporting information ) . the sensitivity of the results to the choice of diurnal emissions profile was tested using the following alternatives : ( a ) time - invariant emissions , ( b ) individual diurnal profiles from each of the three above cities , and ( c ) emissions scaled to diurnal vehicle activity data ( vehicle km h ) from the usepa national emissions inventory ( figure si.5 , supporting information ) . weekend differences in the timing of emissions or breathing rates . ) as a complement to the time - dependent numerical solution described above , we illustrate here an approximate analytical solution that aids in conceptual interpretation of the results . substituting the steady - state solution for eq 2 into eq 1 yields the following relationship for the if of a conserved species in a square - plan urban area:3this relationship can be decomposed into three parameter groups that provide insight into the key drivers of if . the first term , qi , is the time - averaged per - capita mean breathing rate ( m s person ) . the second group , linear population density ( lpd = p/a , persons m ) , is a property of a city s urban form that represents the mean population per unit length ( in the windward direction ) of urbanized land . the final parameter group , normalized dilution rate ( dr = ( 1/uh ) ) , characterizes atmospheric dilution ( wind speed times mixing height , m s ) . for each city , we compute dr as the long - term harmonic mean of the product of linearly interpolated hourly values of u and h. the ratio dr / lpd can be intuitively understood as an effective per - capita atmospheric dilution rate available for an urban area . the intraurban intake fraction is proportional to the ratio of the population breathing rate to this per - capita atmospheric dilution rate ( if qi[dr / lpd ] ) . table 1 presents summary metrics of population - weighted and unweighted distributions of if values . among all cities , the population - weighted mean intraurban if for distributed ground - level emissions of conserved pollutants is 39 ppm ( iqr = 1452 ppm ) . population - weighted results are computed by weighting each city s if by its population ( i.e. , equal weight per person ) , whereas unweighted results treat each city as a distinct unit with equal weight . because if is correlated with population , weighted metrics better reflect the distribution of if over the global population of city inhabitants . for the remainder of this paper all reported results reflect the full numerical solution to the if model as outlined in section 2.2 . nonitalicized entries ( left column under each column head ) reflect population - weighted statistics ; italicized entries ( right column under each column head ) are unweighted results . abbreviations : lpd , linear population density ; dr , normalized dilution rate ; am , arithmetic mean ; asd , arithmetic standard deviation ; gm , geometric mean ; gsd , geometric standard deviation ; iqr , interquartile range ; p10 and p90 , 10th and 90th percentiles of distribution . intake fraction varies over almost 3 orders of magnitude among all cities ( full range 0.6260 ppm , 10% trimmed range 7.780 ppm ) . the population - weighted distribution of if conforms well to a log - normal form ( geometric mean ( gm ) 26 ppm , geometric standard deviation ( gsd ) 2.5 , figure si.6 , supporting information ) . respectively 530 , 260 , and 120 million people live in cities with if values greater than 50 , 75 , and 100 ppm . variation in if among cities is predicted well by a parsimonious regression model using the following three - parameter fit:4where units on the parameters are as specified in section 2.4 . this regression can be used with reasonable accuracy to rapidly estimate if for any city in the global data set ( r = 0.99 , root - mean - square prediction error 9% ) . in addition , the reduced - form model provides a framework for understanding how variation in if is governed by urban form and meteorology . globally , lpd is more variable than dr ( interquartile ranges are 57220 persons m for lpd and 370550 m s for dr ) . holding other variables constant , an iqr increase in linear population density results in a 3.8-fold increase in if , while an iqr reduction in normalized dilution rate results in only a 42% increase in if . to illustrate , we divide the city data set into three population - based groupings of nearly equal total population : small cities with between 100 000 and 600 000 inhabitants ( 32% of the total city population ) , medium cities with 600 000 to 3 million inhabitants ( 34% ) , and large cities with > 3 million inhabitants ( 34% ) . population - weighted mean intraurban if values for these three groupings are , respectively , 15 , 35 , and 65 ppm . variation in if by city size is principally attributable to the strong correlation between lpd and urban population . on average , each 1% increase in city population is associated with a 0.57% increase in lpd ( r = 0.62 ) . interestingly , lpd is much more variable among the three different city size groupings than is population density ( mean lpd = 50 , 130 , and 310 persons m , mean density = 110 , 150 , and 120 persons m ) . population - weighted distribution of intraurban intake fraction by city size ( small , medium , large ) and region ( labels on horizontal axis ; see table 2 and the map in figure si.7 ( supporting information ) for definitions of the abbreviations ) . for cities of similar size , if is generally higher in asia ( e.g. , eap , sca , and sea ) and lower in high - income regions ( e.g. , euj and lrd ) . intake fractions differ substantially among geographic regions ( table 2 , figures 1 and 2 ) . following angel et al . , we group the world into nine clusters that reflect varying land - use patterns ( figure si.7 , supporting information ) . among these regions , regions with especially high mean intraurban if values include south and central asia ( sca ; mean 55 ppm ) , southeast asia ( sea ; 48 ppm ) , east asia and the pacific ( eap ; 44 ppm ) , and sub - saharan africa ( ssa ; 43 ppm ) . by contrast , if is comparatively low for land - rich developed countries ( lrd ; 20 ppm ) . comparing asia with north and the asian cities mapped in figure 2have a high mean intraurban if ( 48 ppm ) and a large total population ( 914 million , 45% of all global city inhabitants ) . of all cities with intraurban if 100 ppm ( n = 24 cities ) , 75% ( n = 18 ) are in asia and 50% ( n = 12 ) are in china . total population 2.0 billion people ( 72% of the year 2000 urban population , 32% of the global population ) in 3646 cities . map of intraurban intake fraction for cities in the americas ( upper panel ) and asia ( lower panel ) . stars designate megacities ( population > 10 million , 11 on asia map , 3 on americas map ) . regional patterns of if are independent of city size , such that similar trends in if emerge within each of the small , medium , and large city groupings ( figure 1 ) . as a result , if values for smaller cities in some regions may be greater than those for more populous cities elsewhere . for example , the mean if for small cities in eap ( 22 ppm ) is greater than that for medium cities in lrd ( 15 ppm ) . country - average intraurban if varies by more than a factor of 3 among the 10 countries with the largest urban populations ( table 3 ; table si.9 , supporting information ) . mean intraurban if values in mexico ( 65 ppm ) , indonesia ( 53 ppm ) , india ( 51 ppm ) , and china ( 44 ppm ) are greater than in australia ( 14 ppm ) , the united states ( 21 ppm ) , germany ( 30 ppm ) , and russia ( 32 ppm ) . regional variation in if is attributable to urban form and meteorology ( table 2 ) . for example , the high mean if value in south and central asia ( 41% greater than the global mean ) is attributable to high lpd ( 37% greater than the global mean ) and weaker - than - average dilution ( dr 9% below the global mean ) . similarly , relatively low if in land - rich developed countries ( 47% lower than the global mean ) is explained by low lpd ( 36% lower than the global mean ) and more favorable atmospheric dilution ( dr 11% greater than the global mean ) . the range in lpd among the nine regions is roughly twice as large as the range for dr ( table 2 ) . however , local patterns in wind speed and mixing height give rise to apparent hotspots where meteorology has a more pronounced role influencing if . for example , dr is 3060% lower than the global average in the indo - gangetic plain ( pakistan , northern india , bangladesh ) and in heavily forested equatorial regions ( amazon and congo river basins , parts of indonesia ) . globally , spatial variation in long - term dr depends more on the variation in wind speed than on the variation in mixing height . the air quality challenge of megacities ( population > 10 million ) has received considerable attention.the 20 megacities in this data set account for 15% of the total city population ( 300 million people ) and have a population - weighted mean if of 83 ppm ( iqr = 4894 ppm , range 25260 ppm ) . four megacities have intake fractions that exceed 100 ppm : new delhi , india ; kolkata , india ; dhaka , bangladesh ; and mexico city , mexico ( figure 2 ; table si.8 , supporting information ) . although the overall population density for megacities is nearly the same as the global mean for cities of all sizes ( mean 125 persons ha ) , the lpd in megacities is 2.5 times the global urban average ( 410 [ megacities ] versus 170 [ global average ] , persons m ) owing to megacities large spatial extent ( mean area 2300 km ) . the total intraurban population intake ( e if ) of emissions in megacities may be especially high . for example , consider a hypothetical pollutant emitted on an equal per - capita basis everywhere . for that pollutant , a city s total intraurban intake would scale with the product of population and if . under such conditions , the world s 20 megacities would themselves account for 32% of the global intraurban intake or more than double the 15% of the global city population that they contain . diurnal trends in atmospheric mixing and population breathing rate lead to variability in if as a function of emissions timing . in general , ifis elevated for emissions that occur during periods of weak atmospheric dispersion ( e.g. , nighttime , figure si.8 , supporting information ) . considering all cities , the median if for emissions at night ( 21:00 to 03:00 h ) is 8.5 times greater ( iqr = 5.111 times ) than for emissions during the day ( 09:00 to 15:00 h ) . the strong role of atmospheric mixing in driving nighttime maxima in if is highlighted when considering that our model accounts for higher - than - average population breathing rates during daytime hours . interestingly , diurnal cycles in mixing height are principally responsible for the temporal pattern in a city s short - term dr , in contrast to the observation above that regional variation in long - term dr is primarily attributable to between - city differences in mean wind speed . compared to diurnal variability , monthly differences in if are less pronounced . the median ratio of maximum to minimum month - averaged if among all cities is 2.3 ( iqr = 1.82.9 ) . on average , if values in nontropical cities are 13 times greater ( iqr = 9.115 times ) during winter nights than summer days . interannual variability in meteorology for the 3 years considered in this study ( 20072009 ) has a negligible ( < 1% ) effect on global mean if and also little effect on if values for individual cities ( 10% trimmed range 5% ) . several previous studies have estimated if values of urban vehicle emissions for individual cities , countries , or regions , principally in north america and europe . for large groups of cities with diverse population sizes , prior estimates of population - weighted average if values for vehicle emissions are in the range of 520 ppm , with higher if values reported for individual large cities ( e.g. , mexico city , hong kong , los angeles).the higher population - weighed mean if result obtained here ( 39 ppm ) is substantially attributable to the inclusion for the first time of many cities in africa , asia , and south america , which tend to have higher lpd than urban areas elsewhere ( table 2 ) . our core result a global population - weighted mean intraurban if of 39 ppm is approximately consistent with the estimated archetypal if by humbert et al . ( 49 ppm , breathing - rate - adjusted ) for ground - level emissions . model results for individual cities and countries agree favorably with those of previous studies after adjustment for differences in breathing rate . overall , agreement is stronger for groups of cities ( e.g. , national averages of cities ) than for individual urban areas . for example , our estimate for population - weighted mean intraurban if for the 243 u.s . cities with populations 100 000 ( 21 ppm ) is similar to the estimate of marshall et al . census urban areas ( 17 ppm , breathing - rate - adjusted ) . likewise , our estimate for metropolitan los angeles ( 43 ppm ) is consistent with an empirically derived if estimate for the south coast air basin ( 38 ppm , breathing - rate - adjusted ) . our results for mexico city and hong kong two cities with notoriously complex terrains each differ from prior empirical estimates by 50% , but in opposite directions . for mexico city , our estimate ( 140 ppm ) is 60% larger than that of stevens et al . in contrast , our estimate for hong kong ( 110 ppm ) is 40% lower than the value estimated by luo et al . we obtain more closely comparable if estimates for these two cities ( to within 30% ) after harmonizing demographic input parameters , which can vary substantially among studies of megacities . overall , the results are consistent with an expectation of less than a factor of two uncertainty in if values for individual cities estimated using the single - compartment eulerian model . while beyond the scope of the present study , further empirical validation of urban if results is warranted . for example , emissions and concentration data for opportunistic tracer pollutants have already been used to develop semiempirical if estimates in several worldwide urban areas ; for motor vehicles , example tracer species include co , benzene , and diesel pm2.5.recent improvements in global emissions data sets and satellite remote sensing techniques may permit more extensive use of empirical methods for assessing intake fractions in the future as a complement to the modeling approach employed here . we tested the sensitivity of our results to many assumptions and modeling decisions that were necessary to assess if at a global scale . on the basis of comparison with previous work ( section 3.2 ) , we estimate that the overall uncertainty for the aggregated ( many - city ) if estimates is 30% . base - case analyses evaluate if for nonreactive primary pollutants ( k = 0 ) . for nonconserved pollutants that follow first - order decay ( half - lives 100 and 10 h ) , the mean if is , respectively , only 0.8% and 7.2% lower than for conserved , nonreactive pollutants . the effect of decay was somewhat larger for large cities ( 11% for a 10 h half - life ) owing to the longer residence time of air in cities with a greater length scale . nevertheless , we found similar global patterns of if with respect to region and city size for all three pollutant classes considered . since the half - life for many health - relevant primary pollutants in urban air is larger than 10 h , these findings imply that if values for nonreactive pollutants may be reasonably applied to many toxic emissions to urban outdoor air . however , the if values reported here may not be applicable to pollutants formed via secondary processes . for example , prior research indicates that intraurban if may be 12 orders of magnitude lower for secondary pm2.5 attributable to urban precursor emissions than for primary pm2.5 . in general , the results are relatively insensitive to most of the assumptions that we made in preprocessing meteorological parameters ( section 2.3.1 ; table si.4 , supporting information ) . however , the results for time - averaged if are moderately sensitive to assumptions that relate to transient conditions of poor atmospheric mixing ( e.g. , during nights with low wind speeds ) . for example , the global mean if is 35% lower in a sensitivity scenario under which the urban mixing height is constrained to be at least 100 m at all times . since dispersion is generally weak at nights , alternative scenarios with higher emissions ( e ) or breathing rate ( q ) at night result in higher if values . the mean if varies by 515% under a range of plausible assumptions about the diurnal pattern of e and q ( table si.5 , supporting information ) . refined model inputs for nighttime conditions may improve the accuracy of if estimates in future studies . an important modeling simplification relates to the aspect ratio , , the ratio of an urban area s windward to crosswind dimensions ( section 2.3.3 ) . in the default modeling case , we assume square - plan layout ( = 1 ) , as is not readily estimated for cities in this data set . in general , if is expected to increase for situations where > 1 ( less ventilation per unit land area ) , with the opposite true for the intake fraction for individual cities increased ( decreased ) by 30% for sensitivity cases in which = 2 ( = 0.5 ) . more detailed information on may therefore improve the precision of if estimates for individual cities . the one - compartment model does not account for within - urban variation in exposure concentrations or for the effects of microenvironments . to the extent that exposures disproportionately occur in near - source regions ( e.g. , in vehicles on roads ) , if may be systematically underestimated by the model . conversely , the model may overestimate if when outdoor - attributable indoor exposure concentrations are attenuated from ambient levels , as is the case for pm2.5 encountered in buildings . considering limiting cases ( see the supporting information ) , the effect of microenvironmental exposure modification is estimated to account for < 30% absolute uncertainty , roughly consistent with estimates elsewhere . a further limitation is that the model only assesses intraurban if , the fraction of a city s emissions that are inhaled by that city s own inhabitants . the results exclude additional intake that may occur in other urban or rural areas downwind of the source city and therefore may be considered a lower - bound estimate of total if . limited prior research suggests that intraurban if for ground - level emissions may reasonably approximate the total if in many circumstances . nevertheless , the difference between intraurban and total if may be important in certain cases , such as for emissions in a small urban area that is located upwind and near large urban areas . since inhalation intake is an incomplete indicator of health risk , additional analyses are required to interpret if results more explicitly in terms of health effects . in general , a metric of intake - based toxicity ( ibt ; sample units : mortality per mass intake ) can be combined with if to yield estimates of health effect per unit emission . for example , similar reductions in intake may yield differential health benefits among populations with differing baseline exposure levels , susceptibilities , and underlying disease burdens . given constrained resources for environmental protection , air quality policies may seek to maximize the environmental health benefit achieved per unit cost expended . intake fraction lends insight into one dimension of this calculus : the population intake benefit associated with a given quantity of emissions reduction . in concert with other information routinely used in air quality management and health risk assessment ( e.g. , source strengths , cost - of - control curves , pollutant toxicity data ) , it may be advantageous to prioritize emissions reductions for sources with high if . the global average if for urban vehicle emissions ( 39 ppm ) is substantially greater than previous estimates of if for central electric power stations located in california , u.s . ( 1 ppm ) , or china ( 10 ppm ) , reinforcing the relative importance of vehicle emissions control . comparing among regions , our results suggest that mitigating or avoiding increases in urban vehicle emissions in countries with high if ( e.g. , india , china , and indonesia ) may yield relatively high exposure - reduction benefits per unit of emissions reduction . moreover , as vehicle fleets in these countries tend to be high emitting and rapidly growing , the marginal costs of emissions abatement may be favorable . intake fraction results by season and time of day suggest that emissions control measures for ground - level sources with high emissions at night ( e.g. , trucking ) or during the winter ( e.g. , solid - fuel combustion for heat ) may yield relatively high exposure benefits per unit mitigation .
we model intraurban intake fraction ( if ) values for distributed ground - level emissions in all 3646 global cities with more than 100 000 inhabitants , encompassing a total population of 2.0 billion . for conserved primary pollutants , population - weighted median , mean , and interquartile range if values are 26 , 39 , and 1452 ppm , respectively , where 1 ppm signifies 1 g inhaled / t emitted . the global mean urban if reported here is roughly twice as large as previous estimates for cities in the united states and europe . intake fractions vary among cities owing to differences in population size , population density , and meteorology . sorting by size , population - weighted mean if values are 65 , 35 , and 15 ppm , respectively , for cities with populations larger than 3 , 0.63 , and 0.10.6 million . the 20 worldwide megacities ( each > 10 million people ) have a population - weighted mean if of 83 ppm . mean intraurban if values are greatest in asia and lowest in land - rich high - income regions . country - average if values vary by a factor of 3 among the 10 nations with the largest urban populations .
it is only relatively recently in human history that vitamin d became a required nutrient . our species evolved under circumstances of extensive sun exposure , so in the evolutionary sense vitamin d was not a true vitamin but rather an endogenously photosynthetically produced precursor to the active steroid hormone ( 1,25-dihydroxyvitamin d ) . the geographic expansion of humanity , the modern environment , and medical concerns over the sequela of extensive sun exposure ( e.g. , melanoma ) have created conditions where for much of modern humanity endogenous vitamin d production is likely far below that of our ancestors . the importance of dietary vitamin d , both naturally occurring in foods and via supplements added to foods ( e.g. , fortified milk ) or consumed directly , has increased . vitamin d has biological actions in support of calcium metabolism and immune function , among many others , important for maternal , fetal , and neonatal health [ 1 , 2 ] . poor vitamin d status is a risk factor for poor skeletal development and fractures in newborns . more recently , maternal hypovitaminosis d status has been associated with several pregnancy complications , such as preeclampsia , being small for gestational age , low birth weight , and preterm birth in a number of populations around the world [ 410 ] . fetal and neonatal vitamin d status is largely dependent upon maternal status , and maternal vitamin d deficiency / insufficiency is distressingly prevalent in the united states . as many as 30% of pregnant women in the us may have inadequate vitamin d status . in some populations , especially during the winter months in higher latitudes , the proportion of pregnant women with inadequate vitamin d status may exceed 50% , depending on whose definition of inadequate is used . there is some uncertainty over the extent of the us population that has inadequate vitamin d status due to disagreements between experts as to what constitutes inadequate status . the main storage form of vitamin d in blood is 25-hydroxyvitamin d ( 25-oh - d ) which makes this vitamin d metabolite the best indicator of nutritional status . based on data regarding bone health , the institute of medicine panel concluded that a circulating level above 20 ng / ml of 25-oh - d is sufficient and found no evidence for recommending higher values for any subpopulation , including pregnant women [ 15 , 16 ] . other researchers have questioned this finding , citing both a concern that circulating levels of 25-oh - d at 20 ng / ml have not been shown to be sufficient for bone health for all populations and that other nonskeletal functions of vitamin d potentially important for health , which the iom report discounts based on inadequate evidence , may yet be shown to be important and require higher circulating levels of 25-oh - d [ 17 , 18 ] . the endocrine society defined deficiency as circulating 25-oh - d of less than 20 ng / ml but also defined 2029 ng / ml as insufficiency , with a recommended level of 25-oh - d above 30 ng / ml . the two groups also recommend different levels of vitamin d supplementation , in large part due to the different stable levels of circulating 25-oh - d they are attempting to obtain . low to moderate quality evidence exists for a protective effect of vitamin d supplementation during pregnancy for a number of pregnancy outcomes , including preeclampsia , being small for gestational age , and preterm labor . low circulating 25-oh - d levels ( below 32 ng / ml ) also have been associated with these pregnancy complications , as well as with an increased risk of maternal infectious disease including vaginosis and periodontal disease , both risk factors for preterm birth [ 21 , 22 ] . observational studies have consistently found an association with low maternal vitamin d status and increased risk of neonatal infectious disease and later inflammatory and atopic disease in offspring . in vitro studies have shown that 1,25-dihydroxyvitamin d downregulates gene expression of inflammatory markers and contractile associated proteins in human myometrial cells [ 23 , 24 ] , providing a biologically plausible mechanism for vitamin d action in reducing inflammatory and contractile responses due to infection . screening for vitamin d status is relatively easy and accurate , though there is a nontrivial cost . vitamin d supplementation during pregnancy is generally considered safe , though rigorous studies on high doses of vitamin d supplementation are lacking . results from a recent study indicate that vitamin d supplementation during pregnancy with up to 4,000 iu / day is safe and effective . however , consensus on what constitutes adequate vitamin d status during pregnancy and the most efficacious means to prevent and treat vitamin d deficiency / insufficiency in pregnant women has yet to be reached , leading to differing assessments of this public health issue [ 14 , 19 ] . vitamin d status and supplementation of pregnant women is a good example of where obstetrician - gynecologists must make practice decisions in an environment of some uncertainty regarding the risks and rewards . the purpose of this study was to assess the practice , knowledge , and opinions of practicing obstetrician - gynecologists regarding screening for vitamin d status and vitamin d supplementation of their pregnant patients . an online questionnaire survey was administered to a randomly selected group of 225 of the 1,167 fellows and junior fellows in practice of the american college of obstetricians and gynecologists ( acog ) who belong to the collaborative ambulatory care network ( carn ) . carn fellows have been selected to be demographically representative of practicing fellows of the college as a whole . the acog research department actively maintains the carn member list by targeted recruitment and attrition to minimize demographic differences with acog fellows as a whole . the survey contained questions on physician and patient population demographics , physician opinion regarding health concerns associated with vitamin d deficiency / insufficiency , and practice patterns regarding screening and supplementing pregnant women . cover letters with a description of the survey were mailed to the potential participants in early april 2015 . three days after cover letters were sent , physicians were emailed an online link to the survey . four email reminders were sent to nonresponders at approximately two - week intervals . armonk , ny . we calculated distribution of frequencies for each question in the survey study . pairwise comparisons of categorical variables were analyzed using the chi - square test of association . we used two - sided statistical inferences and a significance level of a p value of 0.05 or less . of the potential 225 study subjects , 101 completed the questionnaire . among nonrespondents , 69 declined to participate with no comment , 43 made no response at all , 7 declined and stated they were not eligible ( did not treat pregnant patients ) , 1 had a technical difficulty with the survey link and was unable to participate , and 4 returned incomplete questionnaires and were excluded . after excluding the ineligible recipients and the recipient with the technical difficulty , the response rate was 46.5% ( 101/217 ) . respondents came from all across the united sates , with practices in 37 states and the district of columbia . there were no differences in responses between physicians in states mostly south of the 35th parallel versus those mostly north of that latitude . the responding physicians estimated the racial / ethnic makeup of their patient population to be , on average , 49.9% non - hispanic white , 18.2% hispanic , 18.0% non - hispanic african american , 5.9% asian / pacific islander , 2.9% native american , and 5.2% multiracial . most respondents rated primary care as very important ( 38.6% ) or important ( 41.6% ) to their practice . less than half ( 45.5% ) had read acog committee opinion 495 ( co 495 ) on vitamin d during pregnancy , and opinion was split evenly among these physicians on whether this committee opinion had changed their practice regarding vitamin d screening and supplementation during pregnancy . a majority responded that vitamin d insufficiency was a problem in their patient population ( 68.3% ) and that most of their patients would benefit from taking a vitamin d supplement ( 66.3% ) . geographic location of the practice and racial / ethnic makeup of the patient population had no effect on these opinions . fortified dairy products were the vitamin d source recommended by most respondents , followed by green leafy vegetables , fatty fish , fortified cereals , and vitamin d supplements and multivitamins . sun exposure was recommended by about two of three respondents ; almost none recommended an artificial uv light source ( table 2 ) . a majority of respondents considered vitamin d supplementation during pregnancy ( 82.1% ) to be safe . respondents were concerned about vitamin d deficiency and osteoporosis ( 91.1% ) and bone fractures ( 88.1% ) , but less concerned about other possible sequelae of vitamin d deficiency such as a weakened immune system ( 32.7% ) , colon cancer ( 27.7% ) , cardiovascular disease ( 23.8% ) , impaired glucose metabolism ( 22.8% ) , vulnerability to preeclampsia ( 22.8% ) , increased risk of small - for - gestational - age infant ( 21.8% ) , vulnerability to preterm labor ( 19.8% ) , breast cancer ( 14.9% ) , hypertension ( 12.9% ) , and infertility ( 10.9% ) . more than half of the respondents indicated that they never ( 32.7% ) or rarely ( 23.8% ) screen their pregnant patients for vitamin d ; about one in four always ( 12.9% ) or often ( 12.9% ) screen . more respondents disagreed ( 41.6% ) than agreed ( 22.8% ) that all pregnant women should be screened for vitamin d deficiency . physicians that reported having read co 495 were more likely to screen their pregnant patients ( 36.9% always or often versus 17.0% that had not read co 495 ; p < 0.001 ) as were physicians that reported that vitamin d insufficiency was a problem in their patient population ( 32.8% always or often versus 9.7% ; p = 0.004 ) . physicians with 27 or more years in practice were more likely to screen their pregnant patients ( 31.3% always or often versus 21.8% ; p = 0.023 ) . a majority of the responding physicians agreed that alcohol abuse ( 79.2% ) and african american race ( 51.5% ) were risk factors for vitamin d insufficiency . patient factors that would increase the likelihood that a physician would screen for vitamin d status included evidence of malabsorption syndrome ( 82.2% ) , gastric bypass surgery ( 79.2% ) , family history of osteoporosis ( 75.8% ) , and evidence of alcohol abuse ( 56.4% ) . obesity ( 34.6% ) and african american race ( 28.8% ) had less of an effect on physician inclination to screen . almost all respondents recommend that pregnant patients be prescribed or counseled to take prenatal vitamins ( 92.1% always and 3.0% often ) . there was a lack of consensus of opinion among respondents regarding whether pregnant women taking prenatal vitamins are at low risk of vitamin d deficiency , with equal proportions agreeing and disagreeing and the modal response being neutral . most respondents were either neutral ( 23.8% ) or disagreed ( 41.6% ) with the following statement : most of my pregnant patients will get enough vitamin d through sun exposure and diet . about half of respondents recommend additional vitamin d supplementation to their pregnant patients ( always = 16.8% , often = 11.9% , and sometimes = 23.8% ) . physicians who considered vitamin d insufficiency a problem among their patients were more likely to think that most of their pregnant patients would benefit from taking vitamin d supplements ( 91.2% versus 16.1% ; p < 0.001 ) . the most common answer for vitamin d supplementation dose given to a pregnant woman with no sign of vitamin d insufficiency was 1,000 iu / day ( 41.6% ) , followed by 400 iu / day ( 22.8% ) and 600 iu / day ( 20.8% ) . a few respondents would recommend 1,200 iu / day ( 5.0% ) , 2,000 iu / day ( 3.0% ) , or 4,000 iu / day ( 2.0% ) for all pregnant women . physicians with 27 or more years in practice were more likely to recommend 1,000 or 1,200 iu / day ( 67.8% versus 38.1% ; p = 0.033 ) . regarding the level of circulating 25-hydroxyvitamin d below which there is concern for vitamin d deficiency , respondents were roughly split between below 20 ng / ml ( 50 nmol / l ) and 32 ng / ml ( 80 nmol / l ) as the level at which they would recommend a higher supplementation dose of vitamin d ( 46.5% versus 40.6% ) . a few respondents ( 5.9% ) indicated enhanced concern at 50 ng / ml ( 125 nmol / l ) . there was no effect of physician or patient population demographics on the distribution of these answers . physicians who indicated that vitamin d insufficiency is a problem in their patient population were more likely to agree or strongly agree that vitamin d supplementation during pregnancy is safe and that all pregnant women should be screened . however , even among this group , only about one of three agreed that all women should be screened ( table 3 ) . these physicians were also more likely to disagree with the following statements : vitamin d supplementation during pregnancy is generally not necessary , they are not concerned about vitamin d deficiency in their pregnant patients , pregnant women taking prenatal vitamins are at low risk for vitamin d deficiency , and most of my pregnant patients will get enough vitamin d through sun exposure and diet ( table 3 ) . the results of this study suggest that practicing obstetrician - gynecologists generally are somewhat concerned about the vitamin d status of their pregnant patients and consider vitamin d supplementation during pregnancy to be safe . the greater the concern is over their patients ' vitamin d status , the more likely the physician is to recommend supplementation . the respondents seemed generally knowledgeable regarding conditions that increase the risk of vitamin d insufficiency , such as malabsorption syndrome , gastric bypass surgery , alcohol abuse , african american race , and obesity . the responding physicians were generally not supportive of screening all pregnant women for vitamin d status ; even among physicians that expressed a concern regarding their patient population , less than half would screen most pregnant patients . there was a lack of consensus regarding the appropriate level of vitamin d supplementation during pregnancy and the value of circulating 25-hydroxyvitamin d , below which there is concern regarding vitamin d insufficiency . the lack of consensus among clinicians mirrors a lack of consensus among researchers and recommendations from authoritative bodies . there is continuing controversy over the appropriate levels of vitamin d supplementation and of the levels of circulating 25-hydroxyvitamin d that represent good health . the result has been conflicting recommendations from the iom [ 14 , 15 ] and the endocrine society , especially concerning vitamin d supplementation and appropriate levels of circulating 25-oh - d during pregnancy ( table 4 ) . in support of the endocrine society recommendations , some researchers point to the likely higher circulating levels of 25-oh - d in our ancestors that relied primarily on photosynthetic production of vitamin d , arguing that our vitamin d metabolism is adapted to high endogenous production [ 17 , 18 ] . for example , circulating levels of 25-oh - d in traditionally living people in tanzania ( mean 44 ng / ml ; range of 2369 ng / ml ) were double the iom suggested 20 ng / ml value for sufficiency . vitamin d metabolism differs during pregnancy , with a substantial increase in the production of the active form ( 1,25-dihydroxyvitamin d ) , likely due in part to placental production , resulting in elevated levels relative to the nonpregnant state [ 2 , 28 ] . there is also a direct association between circulating 25-oh - d and 1,25-oh2-d , which is not the case outside of pregnancy , suggesting both higher substrate ( 25-oh - d ) turnover and a greater effect of 25-oh - d levels on vitamin d actions on physiology and metabolism . the association between 25-oh - d and 1,25-oh2-d appears to plateau above 40 ng / ml of 25-oh - d , leading some researchers to conclude that the endocrine society recommended levels for circulating 25-oh - d are more metabolically appropriate during pregnancy ( e.g. , ) . even researchers skeptical of the causality of vitamin d effects on pregnancy outcomes point to a knowledge deficit that needs addressing , especially in areas such as maternal and neonatal infections ( e.g. , ) . the levels recommended by iom have been called too conservative and driven by a concern regarding health risks of oversupplementation and high circulating levels of 25-oh - d for which there is scant evidence and that appear implausible from an evolutionary perspective . on a cautionary note , the evidence for positive benefits of circulating levels of 25-oh - d and vitamin d supplementation above those from iom can hardly be called definitive . a recent study on a mother - offspring cohort in singapore found no evidence for an effect of vitamin d status on birth outcome , though the authors caution that the population had a low prevalence of vitamin d deficiency / insufficiency and thus they may not have been able to detect small effects . evidence supports some risks at levels of circulating 25-oh - d above 32 ng / ml . for example , in white women , the risk of a small - for - gestational - age baby was the lowest between 24 and 32 ng / ml with a steep rise in risk at lower levels of 25-oh - d but also a more gradual increase in risk at higher values ( there was no association among black women ; ) . other epidemiological studies have found an association of increased risk at higher levels of circulating 25-oh - d for a number of pathologies both in and outside of pregnancy , including all - cause mortality , though , again , causality has not been shown [ 21 , 30 ] . in most cases , the increase in risk at high levels is much less than the increase in risk for levels below 30 ng / ml . finally , the fact that vitamin d levels in our ancient ancestors likely exceeded the iom recommendations does not prove that those higher levels are conducive to better health and wellbeing in the modern environment . the conflict between researchers and experts in vitamin d metabolism during pregnancy appears to be reflected in the clinical practice of obstetrician - gynecologists . about half of the respondents in this study appear to follow the recommendations from iom and half are closer to the recommendations from the endocrine society . because relatively few obstetrician - gynecologists in this study report that they routinely screen their pregnant patients , the difference in practice is primarily in the level of recommended vitamin d supplementation during pregnancy . few reported recommending supplementation levels as high as those suggested by the endocrine society , but half would recommend levels above those of the iom report . the endocrine society considers pregnant and lactating women as high - risk groups for vitamin d insufficiency and recommends universal screening . screening does have a cost , however , and this study indicates that few obstetrician - gynecologists appear to consider universal screening appropriate . the majority of respondents would consider screening for specific patient conditions ( e.g. , gastric bypass surgery ) ; a lesser proportion would consider screening because of obesity or for african american women despite both of these patient characteristics being known risk factors for inadequate vitamin d status . dark skin pigmentation , as opposed to african heritage per se , is a risk factor for poor vitamin d status , especially in higher latitudes where sun intensity decreases outside of the summer months . caution should be exercised in extending the results of this study to us obstetrician - gynecologists in general , due to the small sample size . we are confident that the fact that the study only included carn members was unlikely to affect the results , as this group is actively managed to preserve its demographic similarity to practicing acog fellows as a whole . over the last twenty years , we have found few instances where carn fellows ' opinions differed from those of non - carn fellows when both groups were sent identical surveys . although few screen most of their pregnant patients for vitamin d status , most would recommend vitamin d supplementation even without screening . clinical practices regarding levels of supplementation and levels of maternal circulating 25-oh - d that would indicate increased concern are split , just as is opinion among experts and researchers . ongoing clinical trials may provide the needed guidance , but until more definitive results are achieved clinical practice in the us will likely remain variable across physicians , with uncertain public health consequences .
vitamin d deficiency / insufficiency is prevalent among pregnant women . recommendations for adequate levels of circulating 25-hydroxyvitamin d and appropriate vitamin d supplementation during pregnancy differ between the institute of medicine and the endocrine society . obstetrician - gynecologists must make clinical decisions in this environment of uncertain guidance . an online questionnaire regarding physician practice patterns for screening and supplementing pregnant women was administered to 225 randomly selected practicing obstetrician - gynecologists of whom 101 ( 45% ) completed the questionnaire . a majority indicated that vitamin d insufficiency was a problem in their patient population ( 68.4% ) and that most of their pregnant patients would benefit from vitamin d supplementation ( 66.3% ) . half ( 52.5% ) would recommend vitamin d supplementation during pregnancy to some patients , but only 16.8% to all . only one in four ( 25.8% ) routinely screen their pregnant patients for vitamin d status . physicians who indicated that vitamin d status was a problem in their patient population were more likely to screen routinely ( 32.8% versus 9.7% , p = 0.002 ) and believe their patients would benefit from supplementation ( 91.2% versus 16.1% , p = 0.001 ) . opinion regarding supplementation levels and indicators of adequacy were split between the two competing recommendations , suggesting that clinical practice will likely remain variable across physicians , with uncertain public health consequences .
xanthogranulomatous pyelonephritis ( xgn ) is an uncommon condition characterized by chronic suppurative renal inflammation that leads to progressive parenchymal destruction . in the past , the preoperative diagnosis of xgn was notoriously difficult because of its nonspecific clinical presentation and nonspecific radiographic appearances . the ability to diagnose xgn preoperatively the aim of this study was to review and describe the ct findings in patients diagnosed with xgn from our institution in the past 5 years . eleven patients underwent preoperative ct and 13 studies ( 2 patients had two preoperative scans each ) were available and retrieved from the digital image archive . ten studies were performed on a 16-slice multidetector ( mdct ) machine ( somatom sensation 16 , siemens ag , erlangen , germany ; tube voltage 120 kv , tube current 250 ma , section thickness 3 mm , and reconstruction interval of 1.5 mm ) . two studies were performed on a single - slice helical machine ( philips secura , amsterdam , the netherlands ; tube voltage 130 kv , tube current 30 ma , 95 ma , section thickness 10 mm , reconstruction interval 8 mm , and pitch of 1.5 ) . one study was on a 64-slice mdct machine ( toshiba aquilion , tokyo , japan ; renal colic low dose protocol tube voltage 120 kv , tube current 180 ma , section thickness 5 mm , and reconstruction interval 5 mm ) . nonionic contrast medium ( 1.5 ml / kg ; 300 mg iodine / ml ) was administered via a pump injector ( stellant , medrad , warrendale , pennsylvania , usa ) at a rate of 3 ml / sec with images obtained after a 60-sec delay in the portal venous phase of enhancement . the images were retrospectively reviewed on a workstation ( agfa impax 5.1 , morstel , belgium ) by two consultant uroradiologists ( ar and km ) . the kidneys were assessed for parenchymal inflammation and destruction , enlargement , calyceal dilatation , the presence of an obstructing renal calculus , demonstrable focal fat deposits , and any evidence of extrarenal extension . the renal size was estimated by measuring the maximum renal length on coronal images , and the anteroposterior diameter at the interpolar level of the renal hilum on the axial images . extrarenal extension was defined as the presence of inflammatory changes in the perinephric tissues as evidenced by perinephric fat stranding , pararenal fascial thickening , the presence of related collections / abscesses or inflammation in the retroperitoneum , and adjacent abdominal organs . thirteen ct studies of 11 patients ( 6 females and 5 males ) were analyzed . the mean age of the study population was 61.8 years ( range 3986 years ) . ten patients had diffuse xgn changes on histology , while one patient had focal disease . renal enlargement was demonstrable on ct in all patients as an increase in either the ap dimension or renal length on the affected side [ table 1 ] . six patients ( 55% ) had a renal pelvis or upper ureter calculus causing obstruction . three patients ( 27% ) had focal fat deposits identifiable within the inflamed renal parenchyma . ten patients ( 91% ) had extrarenal extension of the inflammatory changes , with perinephric and pararenal space stranding and associated perirenal fascial thickening . three patients ( 27% ) demonstrated more extensive retroperitoneal inflammation , with abscesses within the ipsilateral psoas muscle and extension of inflammation to the abdominal wall . the etiology of xgn remains unclear , but patients are typically middle aged and diabetic female patients , who commonly present with recurrent urinary tract infections , flank pain , hematuria , and occasionally sepsis and weight loss.[26 ] the main predisposing renal factor appears to be obstruction , and an obstructing renal calculus is present in up to 75% of cases . it is postulated that renal obstruction promotes recurrent renal tract infections that lead to an abnormal immune response that is responsible for the chronic changes and parenchymal destruction that ensues . the nonspecific clinical presentation of patients with xgn was responsible for the difficult preoperative diagnosis of the condition , and as a result , a significant number of cases were diagnosed on histology after radical nephrectomy was performed for presumed renal cancer . an example of this difficulty in diagnosis before the advent of ct was highlighted in a retrospective analysis by malek et al , in which the diagnosis of xgn was correctly made preoperatively in only 1 of 26 patients . histologically , the inflammatory foci typically display a central nidus of active inflammation and debris surrounded by a granulomatous reaction in which foamy macrophages are prominent , the latter containing abundant cytoplasmic lipid that imparts a yellowish color grossly . ( a ) gross nephrectomy specimen showing characteristic lobulated xanthomatous lesions confined to the renal parenchyma ( double arrowhead ) caused by an obstructing staghorn calculus ( white arrowhead ) within the renal pelvis which has caused secondary hydronephrosis the dilated upper pole calyces contain purulent green colored fluid ( single black arrowhead ) . note the wedge - shaped area of cortical inflammation ( arrowhead ) in continuity with a larger nodular area extending into perinephric fat ( double arrowhead ) . ( c ) renal parenchymal granulomatous inflammation with multinucleate giant cells and focal necrosis ( far right ) . the inflammatory infiltrate is rich in histiocytes , some of which have a foamy appearance reflecting high intracellular fat content . ( d ) the inflammatory reaction extends into perinephric fat ( represented by the clear spaces ) and with time will undergo organization and fibrosis . when present , the ct equivalents of the typical pathology findings are quite characteristic , and as a result , ct has considerably improved the ability to diagnose xgn preoperatively . multiple areas of low attenuation are visualized within the kidney , representing dilated renal calyces and pus - filled cavities replacing destroyed renal parenchyma . on contrast - enhanced studies , the walls of the dilated calyces demonstrate enhancement due to the vascularity of the surrounding granulation tissue and compressed normal renal parenchyma [ figures 2 and 3 ] . contrast - enhanced ct shows multiple low attenuation areas ( arrow ) in right kidney surrounded by intensely enhancing walls . ( a ) xgn in an 82-year - old female with known renal stones who presented with obstructive uropathy and hyperkalemia . noncontrast ct image shows right renal enlargement and dilated calyces with an obstructing renal calculus ( black arrow ) . ( b ) dmsa image shows no uptake in right kidney and 100% function in left kidney . calyceal dilatation is commonly due to obstruction from a renal or upper ureteric calculus . in the present case series , an obstructing calculus was present in only six cases ( 55% ) [ figures 3 and 4 ] . recent work by loffroy et al demonstrated hydronephrosis in 90% of cases , with staghorn calculi present in 6 of 13 ( 46% ) cases . ( a ) xgn in a 40-year - old female with chronic pancreatitis , fever , and weight loss . ultrasound image showed an enlarged kidney with focal cystic areas ( stars ) , reported as likely renal abscesses . ( b ) selected axial ct image shows multiple enhancing dilated calyces ( black arrowheads ) and an obstructing renal calculus ( white arrow ) . in the present series , unilateral renal inflammation and enlargement were the most consistent findings demonstrated on ct and were present in all patients . this suggests that comparative estimation of renal size should always be performed in the ct evaluation of every patient with suspected xgn . this can be accurately done on ct as supported by a recent study by kang et al which compared the accuracy of various imaging modalities in estimating renal size . in their study , the authors conclude that the measurement of the renal length on coronal ct sections provides the most accurate estimation of renal size . extrarenal extension was characterized by stranding and inflammatory changes in the perinephric fat and associated thickening of the pararenal fascia [ figure 4 ] . a number of patients had more extensive extrarenal inflammation with abscess formation and variable involvement of the adjacent abdominal organs and retroperitoneum [ figure 5 ] . there are literature reports of extensive extra renal disease that extends posterolaterally to the abdominal wall . in these circumstances , there is perinephric stranding and thickening of the posterior pararenal fascia ( white arrows ) . the pathologically distinguishing feature of xanthomas was infrequently observed , as only three patients ( 29% ) had demonstrable focal fat deposits representing discrete xanthomas . whether it is a useful distinguishing finding is debatable as there are other renal masses that may contain focal fat deposits within them , notably liposarcomas and angiomyolipomas . to the best of our knowledge , there are no previous studies in the literature documenting the incidence of this finding . summary of findings in xgn focal xgn presents a particular diagnostic challenge as focal xgn changes may be misreported as renal cell carcinoma or lymphoma [ figure 6 ] . focal xgn may be indistinguishable from other renal pseudotumors that include focal pyelonephritis and renal abscesses . in these cases , it is interesting to note that in the present series , perinephric stranding and pararenal fascial thickening were demonstrable in the single case of focal xgn . conversely , one patient with histologically diffuse disease had no ct evidence of extrarenal extension . the evolving role of magnetic resonance imaging ( mri ) in characterizing focal renal masses may prove useful in these cases , but mri findings of xgn are nonspecific , and more work is needed to assess the diagnostic utility of this modality . low attenuation lesion ( 23 hu ) in lower pole of left kidney ( black arrow ) note associated inflammation in the posterior perinephric space and thickened pararenal fascia ( white arrows ) . the limitations of this study were that it was a retrospective review of a small sample size . with increasing use of ct in the diagnosis of the condition , larger prospective series the most typical features of xgn on ct are unilateral renal enlargement and extrarenal extension of inflammatory changes . their presence in a patient with constitutional symptoms and urinary tract infection should alert the radiologist to the possibility of this uncommon condition . demonstrable focal fat deposits representing the pathologically distinguishing feature of xanthomas are an infrequent finding on ct .
background : xanthogranulomatous pyelonephritis ( xgn ) is an uncommon condition characterized by chronic suppurative renal inflammation that leads to progressive parenchymal destruction.purpose:to review the computed tomography ( ct ) findings of patients diagnosed with xgn.materials and methods : a retrospective review of ct findings in patients with histologically proven xgn was carried out.results:thirteen ct examinations of 11 patients were analyzed . renal enlargement was demonstrable on the affected side in all patients . nine patients ( 82% ) had multiple dilated calyces and abnormal parenchyma . six patients ( 55% ) had a renal pelvis or upper ureteric calculus causing obstruction . three patients ( 27% ) had focal fat deposits identifiable within the inflamed renal parenchyma . two patients had renal abscesses . ten patients ( 91% ) had extrarenal extension of the inflammatory changes . three patients ( 27% ) demonstrated extensive retroperitoneal inflammation.conclusion:unilateral renal enlargement and inflammation were the most consistent findings of xgn on ct . perinephric inflammation and collections or abscess should also alert the radiologist to the possibility of this diagnosis .
recent advances have illuminated the role of inflammation and underlying cellular and molecular mechanisms in atherogenesis . c - reactive protein ( crp ) , a marker of inflammation , has been recognized as an indicator of atherosclerotic and cardiovascular risk . leptin and adiponectin , secreted by adipose tissue , represent the most abundant adipokines in human serum [ 37 ] . recent studies have implicated leptin as a risk factor for cardiovascular diseases independent of traditional risk factors . adiponectin , on the other hand , may have anti - inflammatory , antiatherogenic , and antidiabetic properties [ 8 , 9 ] . lower serum adiponectin concentrations are reported to be associated with coronary heart disease ( chd ) risk . as to the relationship between these adipocytokines and crp direct association of leptin with crp , and inverse association of adiponectin with crp have been reported [ 1114 ] . adjustment for bmi or other obesity measures was done in these previous studies ; interaction terms between adipocytokines and obesity measure were not reported . interlipid , an ancillary study of the international study of macro / micronutrients and blood pressure ( intermap ) , investigated chd risk factors in four japanese population samples in japan and a japanese - american population sample in hawaii [ 1517 ] . in intermap , dietary surveys were conducted with a highly standardized protocol in 17 random population samples in four countries ( japan , china , uk , and usa ) [ 18 , 19 ] . our data , from japanese in japan and japanese - americans , that is , an ethnically homogenous cohort with a wide range of bmis ( from 17.6 to 47.0 kg / m ) , enable us to address unsolved problems on relationships between leptin , adiponectin , and crp , including interaction terms . interlipid participants of ages 4059 years were from five intermap population samples : four in japan and one in hawaii [ 18 , 19 ] . for the present study , serum leptin and adiponectin concentrations were measured in individuals from two of these samples , one from japan and one from hawaii . the two population samples were ( 1 ) japanese residents in aito town , a rural town in shiga prefecture , central japan ( 129 men and 129 women ) and ( 2 ) third and fourth generation offspring of japanese emigrants living in honolulu , hawaii ( 100 men and 106 women ) . participants in honolulu were asked about the ethnicity of their mother and father ; those included in the study responded 100% japanese to both parents . among those in these two samples , 65 persons ( 34 japanese , 31 japanese - americans ) were excluded because volume of their stored serum specimen was not enough to measure crp , adiponectin , and leptin ; 12 persons ( 9 japanese , 3 japanese - american ) were excluded because their serum crp concentrations were more than 10 mg / l , leaving 215 japanese individuals ( 111 men and 104 women ) and 172 hawaiian japanese americans ( 83 men and 89 women ) . ethics committees of the shiga university of medical science , the pacific health research institute , and northwestern university approved the study protocol . written informed consent participants visited the research centers four times on two pairs of consecutive days on average three weeks apart . trained observers inquired about physical activity , smoking status , previous medical history of cerebrocardiovascular diseases / diabetes , use of medication ( including antihypertensive medication ) , and so forth . bmi was calculated as weight divided by height squared ( kg / m ) . to evaluate physical activity , questions were posed about number of hours per day spent in heavy activity , moderate activity , light activity , watching tv , other sedentary , and no activity ( sleeping ) ; the interviewer ensured that the total time added up to 24 h. a physical activity index score was calculated by multiplying the time spent on different activities by corresponding weighting factors that parallel the increased rate of oxygen consumption associated with increasingly more intense physical activity ; for this , the procedure in the framingham offspring study was followed . for the interlipid study , nonfasting blood was drawn on the second day of the first two - day visit pair . we used data on analytes measured in these blood samples , as well as data from intermap . serum and plasma were obtained by centrifugation within 30 min of blood drawing and immediately refrigerated . within 24 hours samples from the hawaiian and japanese centers were shipped to a central laboratory in japan on dry ice . individual samples from the two centers were randomly allocated for analysis to avoid systematic measurement bias . billerica , ma , usa ) , serum adiponectin by an enzyme - linked immunosorbent assay using the elisa kit ( otsuka pharmaceutical co. , ltd . , tokyo , japan ) , and c - reactive protein ( crp ) by immunoturbidimetric assay , all three at the central laboratory . postprandial stability of leptin and adiponectin has been shown in normal and obese persons , as well as in patients with type ii diabetes mellitus [ 2124 ] . sas version 9.2 for windows ( sas institute , cary , nc ) was used . because the distributions of serum leptin , adiponectin , and crp were positively skewed , logarithmic transformation was used to normalize them . the mantel - haenszel chi - square statistical test for nominal variables and the contrast option for analysis of variance for continuous variables ( including log - leptin and log - adiponectin ) were done to assess whether or not there was a significant trend across quartiles of crp concentration . sex - specific multiple linear regression analysis with adjustment for confounders was used to examine the relationships of log - leptin , log - adiponectin with log - crp . model 1 included site ( hawaii = 1 , japan = 0 ) , age , log - leptin , and log - adiponectin ; model 2 , model 1 covariates + cigarettes / day , physical activity index , systolic blood pressure , hemoglobin a1c , and bmi ; model 3 , model 2 covariates + interaction terms ( log - leptin bmi , log - adiponectin bmi ) ; model 4 , model 2 covariates + interaction terms ( log - leptin site , log - adiponectin site ) ; and model 5 , model 2 + interaction term ( log - leptin bmi , log - adiponectin bmi , log - leptin site , and log - adiponectin site ) . the range of bmi in these two population samples was 17.6 to 47.0 kg / m . characteristics of participants by quartile of serum crp concentration for men are shown in table 1 . mean age , hemoglobin a1c , bmi , and median leptin were significantly greater in the higher crp concentration groups ( ps 0.020 to < 0.001 ) . median adiponectin was significantly lower in the higher crp concentration groups ( p < 0.001 ) . percentage of participants from hawaii , mean cigarettes per day , and systolic blood pressure were not significantly different among the groups . option for analysis of variance ( quad ) ( p = 0.012 ) . characteristics of participants by quartile of serum crp concentration for women are shown in table 2 . percentage of participants from hawaii , mean systolic blood pressure , hemoglobin a1c , bmi , and median leptin were significantly greater in the higher crp concentration groups ( ps 0.024 to < 0.001 ) . mean physical activity index and median adiponectin were significantly lower in the higher crp concentration groups ( p < 0.001 ) . mean age and cigarettes per day were not different among the groups . partial correlation coefficients among log - crp , bmi , log - adiponectin , and log - leptin , adjusted for age and site , for men and women separately , are shown in table 3 . partial correlation coefficients of log - crp , bmi , log - adiponectin , and log - leptin are slightly larger for women than men . for men , in multiple linear regression models adjusted first for site and age , log - leptin was significantly directly related to , and log - adiponectin was significantly inversely related to log - crp ( model 1 , table 4 ) . with addition to model 1 of cigarettes per day , physical activity index , systolic blood pressure , hba1c , and bmi , log - adiponectin was significantly inversely related to log - crp ; relation of log - leptin to log - crp became nonsignificant ( model 2 ) . with further addition to model 2 of interaction terms , log - leptin bmi and log - adiponectin bmi , log - leptin was significantly directly related to log - crp ; relation of log - adiponectin to log - crp became nonsignificant ( model 3 ) . with addition to model 2 of interaction terms , log - leptin site and log - adiponectin site , log - adiponectin was significantly inversely related to log - crp ; relation of log - leptin to log - crp became nonsignificant ( model 4 ) . finally , with addition to model 2 of all interaction terms , log - leptin bmi , log - adiponectin bmi , log - leptin site , and log - adiponectin x site , log - leptin was significantly directly related to log - crp ( p = 0.006 ) ; relation of log - adiponectin to log - crp became nonsignificant ( model 5 ) . cigarettes per day were significantly directly related to log - crp in all models ( p < 0.05 ) , and bmi was significantly directly related to log - crp in models 2 , 4 , and 5 ( p = 0.035 to 0.001 ) . for women , in multiple linear regression models adjusted first for site and age , log - leptin was significantly directly related to and log - adiponectin was significantly inversely related to log - crp ( model 1 , table 5 ) . with addition to model 1 of cigarettes per day , physical activity index , systolic blood pressure , and bmi , relations of log - leptin and log - adiponectin to log - crp became nonsignificant ( model 2 ) . unlike the data for men , nonsignificant relations of log - leptin and log - adiponectin to log - crp did not change with addition of interaction terms ( models 3 , 4 , and 5 ) . the main findings here are that serum leptin related to crp independent of bmi , other possible confounding factors , and their interaction terms in men , but not in women ; adiponectin did not independently relate to crp in men or women . previous studies on sex differences in the relationship of leptin to crp showed that either the relationship was similar in men and women independent of obesity [ 11 , 12 ] or that the independent relationship was seen only in women . this is the first study to show that the association between leptin and crp is more distinct in men than in women . a pioneer work on this matter was performed by shamsuzzaman et al . who studied 100 healthy volunteers and found that the association between leptin and crp was significant after adjustment for age , bmi , and other possible confounders in men and women . ble et al . reported a direct association between leptin and crp independent of sex or bmi . abdullah et al . , on the other hand , found that leptin was associated in women with crp independent of obesity , but not in men . several studies showed the association of adiposity or obesity with crp was stronger in women than men [ 2731 ] . another study showed this association was present in women , but not in men . in the present study , we found partial correlations of log - crp and bmi to be slightly larger in women than in men . it is understandable that the association between leptin and crp was seen only in men in the present study because a strong correlation of log - crp with bmi in women attenuated the association when bmi was included in the model . crp is synthesized by the liver , mostly under the regulation of the proinflammatory cytokines , such as interleukin ( il)-6 , il-1 , and tumor necrosis factor- ( tnf- ) . leptin receptor , in addition , was shown to have signaling capability of il-6-type cytokine receptors . furthermore , a direct crp - stimulatory activation of leptin , independent of il-6 or other proinflammatory cytokines , has been shown . our findings are consistent with those of previous studies in men [ 13 , 14 , 36 ] . however , the association in the present study disappeared with inclusion of interaction terms ( log - leptin bmi , log - adiponectin bmi , log - leptin site , and log - adiponectin site ) . because interaction terms were not considered in previous studies , we can not compare our results with those of others . we hypothesized as to the importance of interaction terms in the setting of adipocytokines that interplay tightly with volume of adipose tissue . the main strengths of the present study are ( 1 ) its population - based samples ; ( 2 ) standardized collection of bp and blood data ; and ( 3 ) use of multiple procedures for quality control . due to the cross - sectional nature of this study , its results must be interpreted cautiously in regard to cause - effect relationships . regrettably , we do not have adiposity data other than bmi , such as fat mass . in conclusion , serum leptin directly related to crp independent of bmi and other confounding factors in men , but not in women .
objective . despite considerable study , the relevance of leptin and adiponectin for atherosclerosis development is still unsettled . we investigated relations of serum leptin and adiponectin to serum c - reactive protein ( crp ) , using the interlipid dataset on japanese emigrants living in hawaii and japanese in japan . design and methods . serum leptin , adiponectin , and crp were measured by standardized methods in men and women of ages 40 to 59 years from two population samples , one japanese - american in hawaii ( 83 men , 89 women ) and the other japanese in central japan ( 111 men , 104 women ) . participants with crp > 10 mg / l were excluded . results . sex - specific multiple linear regression analyses , with log - transformed leptin and adiponectin ( log - leptin , log - adipo ) , site ( hawaii = 1 , japan = 0 ) , sbp , hba1c , smoking ( cigarettes / day ) , and physical activity index score of the framingham offspring study as covariates , showed that log - leptin directly related and log - adipo inversely related to log - crp for both sexes ( ps < 0.05 to < 0.01 ) . addition to the model of bmi and interaction terms ( bmi log - leptin , bmi log - adipo , site log - leptin , site log - adipo ) resulted in disappearance of statistical significance except for direct relation of log - leptin to log - crp in men ( p = 0.006 ) . conclusions . leptin directly related to crp independent of bmi and other confounding factors in men but not in women .
pseudotumor cerebri ( ptc ) is an uncommon cause of headache , presenting especially in active jsle . in this paper , we report a case of missed intractable headache that was eventually diagnosed as ptc and presented as the first manifestation of jsle . a 9-year - old girl with a history of progressive headache for four months , fever , fatigue , myalgia , arthralgia , small - joint arthritis of the hands , and recent diplopia was referred to our clinic . the diagnosis of ptc in the background of jsle was made based on her history , physical examination , positive laboratory findings , and increased intracranial pressure , with normal neuroimaging . it seems that a complete neurologic examination in newly diagnosed sle patients is mandatory , especially in the presence of any neuropsychiatric manifestations , such as headache . headache is a common neuropsychiatric manifestation in juvenile systemic lupus erythematosus ( jsle ) , occurring in approximately 38.3% of jsle patients and 72.5% of neuropsychiatric sle ( npsle ) patients ( 1 ) . pseudotumor cerebri ( ptc ) is an uncommon cause of headache , presenting especially in active jsle ( 2 ) . moreover , there are rare published reports of ptc as the first manifestation of jsle . in this paper , we report a case of missed intractable headache that was eventually diagnosed as ptc and that presented as the first manifestation of jsle . a nine - year - old girl , the third child of non - consanguineous parents , was referred to our clinic with severe headache and diplopia . the headache was localized in the right fronto - occipital region with spread to the neck and shoulders . previous records , symptoms of low - grade fever , fatigue , myalgia , arthralgia , mild headache , and small - joint arthritis of the hands had been present for four months . she had no photosensitivity , malar rash , skin lesions , oral ulcers , hair loss , or weight loss . laboratory tests at that time showed mild cytopenia , with platelet count ( plt ) of 249,000/l . her one - hour erythrocyte sedimentation rate ( esr ) was 20 mm / h and c - reactive protein ( crp ) was negative . there were elevated transaminases , with alanine transaminase ( alt ) of 108 u / ml and aspartate transaminase ( ast ) of 70 u / ml , and normal thyroid function tests , with t4 of 8 g / dl , thyroid stimulating hormone ( tsh ) of 4 miu / l . the results also showed negative antiphospholipid antibodies and venereal disease research laboratory ( vdrl ) testing , positive anti - nuclear antibody ( ana ) , negative anti - double stranded dna ( anti - dsdna ) of 69 u / ml ( positive > 100 ) , decreased complement levels ( c3 , c4 ) , and normal urinalysis . the results were compatible with juvenile - onset sle , but optimal follow - up and treatment had not been performed . after two months , her headache gradually progressed , but showed a good response to aspirin 325 mg 3 - 4 times per day , given by her parents . the neurologic findings included bilateral papilledema , bilateral 6th cranial nerve palsy , normal magnetic resonance imaging ( mri ) and magnetic resonance angiogram ( mra ) , and high cerebrospinal fluid ( csf ) opening pressure ( 55 cm h2o at the first visit , 32 cm h2o at the 7th day , and normal at the 10th day ) . csf analysis was within normal limits , with sugar of 46 mg / dl , protein of 33 mg / dl , lactate dehydrogenase ( ldh ) of 64 u / ml , and zero wbcs or red blood cells ( rbcs ) . her parents and other siblings had no history of disease ; however , her 50-year - old aunt ( mother s sister ) suffered from lupus nephritis and her five - year - old cousin ( daughter of mother s brother ) had been treated for myasthenia gravis three years earlier . in the patient s past medical history , levothyroxine had been prescribed for hypothyroidism since the age of four , with good control . the patient was admitted to our hospital with symptoms of severe headache , diplopia , fatigue , malaise , and new - onset hair loss . physical examination showed that she was alert , with an axillary temperature of 38.3c , weight of 30 kg , height of 137 cm , blood pressure of 95/60 mmhg , and heart rate of 100 beats / min . she had bilateral papilledema , bilateral 6th nerve palsy , mild organomegaly , and small - joint arthritis of the hands . the laboratory data at the time of admission showed mild leukopenia and lymphopenia , without thrombocytopenia ( wbc 4300/l , 42% lymphocytes , hgb 12.7 g / dl , and plt 307,000/l ) . she had positive ana ( 103 u / ml , positive > 42 ) and increased anti - dsdna ( 497 u / ml , positive > 100 ) . biochemical markers of renal function ( blood urea nitrogen and creatinine ) and the urinalysis were within normal limits , without any proteins or rbcs . autoantibodies to ribosomal p proteins ( anti - rib - p ) had borderline values according to the laboratory references . although a high titer of antithyroid peroxidase antibody ( anti - tpoab ) was detected ( 270 iu / ml , positive > 40 ) , thyroid function tests showed good control . according to the patient s history , physical examination findings of arthritis , and positive laboratory findings ( positive ana test , increased anti - dsdna ab , and decreased complement [ c3 , c4 ] levels ) , the patient fulfilled four sle criteria ( three laboratory criteria and one clinical criterion ) ( 3 ) . she was therefore treated for sle with acetazolamide , prednisolone ( 1.5 mg / kg / day ) , and hydroxychloroquine . after six months , the patient was in good condition , without any complaints of headache or diplopia . the causes of headache in sle patients are rarely detectable , but ptc as an infrequent cause should be considered ( 4 ) . ptc was characterized by increased intracranial pressure ( icp ) of > 20 cm h2o , with normal neurologic findings except for 6th nerve palsy and papilledema . the most serious complication of ptc is blindness due to severe papilledema ( 5 ) . there are sporadic reports of concomitant sle and ptc in adults , and more rarely in children ( 6 - 10 ) . moreover , in a few cases , ptc was reported as a first manifestation of sle in children ( 6 - 10 ) . most of these patients had prolonged headache , with the interval between the onset of headache and the diagnosis of sle being approximately two months . the headache usually subsides immediately after treatment with high - dose corticosteroids . on the other hand , delayed diagnosis or treatment ( such as in our patient ) could increase the icp , fulfilling the ptc criteria ( 5 ) . in general it has been reported in approximately 17% of sle patients with intractable headaches ( 2 ) . however , nausea , vomiting , and blurred vision are common in these cases ( 2 , 6 - 10 ) . in a report of sle patients , kim and coworkers ( 2 ) focused on the characteristics of ptc during the course of sle . thrombosis occurs in a hypercoagulable state of antiphospholipid antibody syndrome . in approximately 58% of sle patients with ptc , thromboembolic events and high titers of anti - cardiolipin antibody , these antibodies were negative , and mri and mrv were normal , so a thrombotic event could not be the cause of ptc in this patient . on the other hand , in the active phase of sle , immune complex , direct antibodies , or vasculitis may affect the function of arachnoid villi , disturbing the absorption of csf and causing ptc ( 12 ) . fragoso - loyo et al . reported high levels of some cytokines , chemokines , and inflammatory molecules in the csf of sle patients with intracranial hypertension and intractable nonspecific headache ; however , after approximately six months , when the headaches were resolved , these returned to normal limits ( 13 ) . in addition , anti - rib - p antibodies and lupus nephritis may accompany ptc ( 2 ) . our case had no renal complications , but low titers of serum anti - rib - p antibodies were detected . there are some discrepancies in the literature about the presence of autoantibodies in such cases . reported that anti - rib - p was found in 28.2% of sle patients with neuropsychiatric involvement ( npsle ) , whereas 20% of sle patients without neuropsychiatric involvement also had the same antibody . therefore , anti - rib - p is not a specific test for the diagnosis of npsle ( 14 ) . our patient had no significant amount of anti - rib - p antibody at the time of presentation . however , after a reasonable time , any changes in auto - antibody titers should be followed . corticosteroids are the main treatment for ptc in sle patients , either as intravenous methyl prednisolone pulse therapy or as high - dose oral prednisolone ( 2 , 6 - 10 ) . treatment with prednisolone dramatically improved our patient s ptc after approximately 24 hours . in conclusion , it seems that a complete neurologic examination in newly diagnosed sle patients is mandatory , especially in the presence of any neuropsychiatric manifestations , such as headache .
introductionheadache is a common neuropsychiatric manifestation of juvenile systemic lupus erythematous ( jsle ) . pseudotumor cerebri ( ptc ) is an uncommon cause of headache , presenting especially in active jsle . in this paper , we report a case of missed intractable headache that was eventually diagnosed as ptc and presented as the first manifestation of jsle.case presentationa 9-year - old girl with a history of progressive headache for four months , fever , fatigue , myalgia , arthralgia , small - joint arthritis of the hands , and recent diplopia was referred to our clinic . the diagnosis of ptc in the background of jsle was made based on her history , physical examination , positive laboratory findings , and increased intracranial pressure , with normal neuroimaging . treatment with high - dose prednisolone led to dramatic resolution of the headache.conclusionsit seems that a complete neurologic examination in newly diagnosed sle patients is mandatory , especially in the presence of any neuropsychiatric manifestations , such as headache .
appendicitis is the most common abdominal surgical emergency accounting for up to 17% of all surgical abdomens ( 1 ) . however , despite its prevalence it can be difficult to diagnose and delayed diagnosis is the main cause of both operative mortality and morbidity . the accuracy of diagnosis in men varies between 78 - 92% and in women 58 - 85% , the difference being due to pathology of the female reproductive tract . this diagnostic problem is illustrated by the following case of a 63 year - old woman , with migratory abdominal pain and highlights the need for vigilance in diagnosing appendicitis in all cases of abdominal pain , regardless of the presentation or clinical suspicion . a 63-year - old woman , presented as an emergency with a 2-day history of central abdominal pain and vomiting . her medical history included alcohol excess , complicated by mild korsakoff s syndrome , and surgery consisting of a laparoscopic cholecystectomy and a negative , exploratory laparotomy , for a previous , similar presentation . on examination , she was afebrile with a temperature of 37.2 c. initial observations were blood pressure 124/78mmhg , pulse 86 beats / min , respiratory rate of 18 breaths / min with a saturation of 97% on air . her abdomen was mildly tender in the umbilical and epigastric regions with no evidence of either focal or generalised peritonism . a previous laparotomy and laparoscopy scars were observed and normal bowel sounds were auscultated throughout . haematology revealed a normal white cell count of 9.010 ^ 9/l ( neutrophilia of 7.410 ^ 9/l ) . amylase was 95u / l , crp 8mg / l with hyponatraemia of 125 mmol / l but otherwise normal laboratory values . plain abdominal radiograph showed a non - dilated , gas - filled loop of large bowel in the left upper quadrant , but no free gas within the peritoneal cavity ( fig1 ) . plain abdominal radiograph showing a non - dilated , gas - filled loop of large bowel in the left upper quadrant , but no free gas within the peritoneal cavity the following morning , she underwent helical computed tomography ( ct ) of her abdomen and pelvis . this revealed her caecal pole to be situated in the left upper quadrant , with evidence of fat stranding between the caecum and pancreas(fig 2 ) . the liver , spleen , stomach and pancreas all had normal ct appearances and were in their expected , anatomical locations . other findings were cystic duct clips from a previous cholecsytectomy and intra - hepatic biliary duct dilatation ( max diameter of the cbd 1.2 cm ) . there was also an atrophic left kidney but no evidence of lymphadenopathy , ( some of the images were degraded by artefact from a dhs fixation of the left hip ) , and no evidence of bowel obstruction or appendicolith . ct showing the caecal pole to be situated in the left upper quadrant , with evidence of fat stranding between the caecum and pancreas the patient s clinical condition deteriorated , with increasing abdominal pain , which had now moved to the left upper quadrant . her white cell count was still within normal limits at 8.910 ^ 9/l , although with a neutrophilia of 7.910 ^ 9/l and a crp of 254mg / l . once again her renal and liver function tests were all within normal laboratory ranges , adjusted for age and gender . her hypoxaemia had deteriorated to 10.7kpa on 2l oxygen , with a ph of 7.35 , a corrected bicarbonate of 21.7mmol / l and a base excess of -3.2mmol / l . given her clinical and biochemical deterioration , an emergency laparotomy was arranged that confirmed the presence of a mobile caecal pole , located in the left upper quadrant , lying alongside the splenic flexure . at the base of the caecum was a retrocaecal appendix , surrounded by adherent mesoappendix , with focal inflammation , a haemorrhagic surface and surrounding exudates . there was no evidence of caecal volvulus ( axial torsion type ) or colonic necrosis . appendicectomy and caecopexy were performed and the patient had an uneventful post - operative recovery . she was treated with 3 days of antibiotics and discharged 4 days post - laparotomy . appendicitis is the commonest surgical emergency , presenting with abdominal pain , in which the classical history of central abdominal pain migrating to the right iliac fossa , is taken for granted . irvin et al in 1989 performed an audit of diagnoses made on 1190 cases of acute abdominal pain presenting to their surgical department and noted that second to non - specific abdominal pain which comprised 35% of cases , appendicitis was the second commonest at 17% and intestinal obstruction third at 15% ( 1 ) . left sided appendicitis has been reported in the literature , with the majority of patients suffering from situs inversus or midgut malrotation . one case report noted the incidence of situs inversus to be between 1 in 6000 and 1 in 35000 , and midgut malrotation to be even rarer ( 2 ) . in the absence of either of these abnormalities , there is the possibility of incomplete intestinal rotation , whereby at the end of embryonic intestinal development , the right colonic mesentery is incompletely fixed to the retroperitoneal structures . it is estimated that in the adult population , sufficient caecal mobility exists in 25% of patients for bascule formation ( 3 ) , which was the mechanism of caecal malposition in this case . the classical history of appendicitis is one , which is frequently inconsistent , with patients presenting with a variety of other symptoms that might not point the clinician directly towards the diagnosis of appendicitis . indeed , specific scoring tools for suspected appendicitis , such as the mantrels score are limited in their diagnostic ability , as 30% of their criteria are by definition , not applicable in patients presenting with an appendix that is not located in the right iliac fossa . the criteria state that whilst abdominal rebound tenderness has a sensitivity of 96% for appendicitis , pain shifting to the right lower quadrant only has an 80% sensitivity with a leukocytosis on white blood cell count also being 80% ( 4 ) . other studies have shown neutrophilia and a raised c - reactive protein to be more sensitive at 95% and 97 - 100% respectively . it must be noted however that these criteria alone are no substitute for a thorough clinical history and examination . recently , helical ct scanning has been advocated as an appropriate , first - line investigation for suspected appendicitis , with a sensitivity of 100% , specificity of 97% , positive predictive value of 97% and a negative predictive value of 100% ( 5 ) . given the increase in availability of helical ct scanning and its decrease in cost , increased use as evaluation of the acute abdomen should be considered in atypical or diagnostically challenging cases as a minimum . compared to standard ct scanning , helical ct provides shorter acquisition times , better parenchymal visceral and vascular imaging as well as decreasing the radiation doses involved and quantities of contrast required for accurate imaging ( 6 ) . one of the problems however with ct scanning is attenuation and artefact due to surgical implants for example and care should always be taken to ensure this is considered when contemplating the best imaging modality for the clinical situation . in this case the patient s dynamic hip screw would have caused severe degradation in the images had the area of interest been in the lower abdomen or pelvis . the management of appendicitis is not becoming drastically easier with surgeons still performing a number of unnecessary appendicectomies today despite advances in diagnosis and imaging technologies and until a set of robust criteria for diagnosing acute appendicitis , a low clinical incidence of suspicion should be maintained at all times by surgeons when evaluating acute admissions with abdominal pain . to the authors knowledge , this is the first case in english literature , of a case of left - sided abdominal pain and appendicitis , without either of the above anatomical abnormalities . in conclusion , this case highlights the need for vigilance , in all presentations of abdominal pain , with the inclusion of appendicitis as a differential . although , in cases in which the site of presentation is not the right iliac fossa , the statistical likelihood of the primary pathology being appendicitis is low , it is nonetheless an important differential due to the consequences of a missed diagnosis . where there is no clear clinical picture and the patient is deteriorating , with signs of local or generalised peritonitis , helical ct scanning and a high degree of clinical suspicion play an important role in assisting the surgeon in making the diagnosis and instituting the appropriate treatment .
a 63 year old woman , presenting as an emergency provides an useful example of the difficulties in diagnosing acute appendicitis when faced with an atypical history . this patient underwent plain radiography , computed tomography , repeat biochemical investigations and finally an exploratory laparotomy before the diagnosis of acute appendicitis was made . the case was confounded by a highly mobile caecal pole which brought the inflamed appendix to lie over the pancreas highlighting the need for vigilance in diagnosing acute appendicitis .
during the last decades , a close relation between diet and health have been pointed out by the findings of a large number of epidemiologic investigations . due to these findings , today , foods are no more considered just for their nutritive value , but also for their potential positive effects in preventing and protecting against serious chronic diseases with strong socioeconomic implications in western countries such as neoplastic , cardiovascular , neurodegenerative diseases , cataracts , diabetes , metabolic syndrome , inflammatory process , and aging . as regards cancer , for example , it is estimated that its incidence could be reduced by at least 30% adequately increasing diet vegetables and fruits . the foods producing peculiar beneficial effects on human health are generally defined as functional foods . the usa and ue have no legal definition of a functional food that in these countries is strictly a marketing term , even if ue recognizes for some foods specific health claims . japan is the only country that has an established regulatory framework for functional food marketing , which dates back to the 1980s . some organizations , such as the international food information council ( ific , founded in 1991 ) , have attempted to establish a definition . the ific regards them as foods that provide a health benefit beyond basic nutrition . the institute of medicine 's food and nutrition board ( iom / fnb , founded in 1970 ) defined functional foods as any food or food ingredient that may provide a health benefit beyond the traditional nutrients it contains . after this definition , foods , technological - treated food products , and their active components that can be used to prepare enriched and fortified foods or be assumed separately from foods as supplements may be considered as functional foods . in its latest position paper , the american dietetic association ( ada , founded in 1917 ) defines a functional food as one that provides a beneficial effect on health when consumed as part of a varied diet on a regular basis at effective levels . the organization classified functional foods into four groups : conventional foods , modified foods , medical foods , and foods for special dietary use , and called for more research into their potential health benefits . moreover , most of the researchers consider there is a clear difference between dietary supplements , or nutraceuticals , and functional foods . the former , which include vitamins , minerals , other substances with physiological effects , and botanicals , are taken in a dose form . anyway , other researchers consider that a nutraceutical is any food that giving nutriment helps to maintain health . among chronic diseases whose development can be influenced by the consumption of specific foods , also oral diseases such as caries and gingivitis , that are the most common and diffused infectious diseases in the world , should be counted . a consortium of microorganisms , among which streptococcus mutans and streptococcus sobrinus are considered the most influent , is involved in the development of such pathologies . it is well known that oral pathogens virulence can be strengthened or conversely inhibited by dietary factors . for a long time , the negative role of diet sucrose in inducing caries formation has been recognized . recently , the emergence of pathogen resistance to conventional antibacterial agents and the need to develop new strategies for the control of infectious diseases made active the research about natural compounds able to act as antimicrobial agents . such research led to the findings that compounds , able to act with different mechanisms , against the main infective responsible agents for oral diseases , occur in a lot of vegetable and fungal foods . first , the different kinds of tea in in vitro and in vivo both in animal and humans were studied for their protective action against oral pathologies above all by japanese researchers . tea polyphenols were shown to be able to inhibit caries development reducing s. mutans cell surface hydrophobicity and its capability to produce , starting from sucrose , the insoluble , bioadhesive polymer glucan that allows the dental plaque formation [ 48 ] . then coffee and cocoa were studied . our previous in vitro investigation pointed out since 1994 that coffee beverage possesses a wide spectrum antibacterial activity . such activity was found to be relevant against a number of gram - positive and gram - negative microorganisms including streptococcus mutans and other pathogens such as staphylococcus aureus and escherichia coli [ 911 ] . later , it was found that also white and red wine , and barley coffee possess antimicrobial activity . coffee components able to act against oral pathogens , in the experimental - used model system , were found to be the -dicarbonyl compounds formed during roasting process ( green coffee did not show any antibacterial activity ) . interestingly , -dicarbonyl compound activity resulted to be strongly enhanced in the presence of caffeine that alone showed no activity in the same system . as regards wine , most of the antibacterial activity was due to the presence of the low - molecular organic acids naturally occurring in grape or formed during malolactic fermentation process . these results , indicating a potential positive action of coffee and wine in protecting oral health due to the presence of compounds able to inhibit dangerous microorganism proliferation , prompted us to investigate the same beverages for more specific actions that have the capability to inhibit pathogen adhesion to and to induce pathogen detachment from hydroxyapatite ( ha ) beads in in vitro tests . chlorogenic acid , trigonelline and nicotinic acid , and also high - molecular - mass melanoidin components were identified as antiadhesive compounds in coffee , whereas as regards red wine , a fraction containing anthocyanins and proanthocyanidins showed the highest activity . considering barley coffee , it was found that very high - molecular - mass brown melanoidinic components were able to remarkably inhibit s. mutans adhesion to and induce detachment from ha and to inhibit biofilm production [ 15 , 16 ] . as regards cocoa , a number of papers reported anticariogenic effect of water soluble components and in particular of polyphenols [ 1720 ] . among the most studied foods in this field also propolis had to be cited . recently , a potential use of propolis as a cariostatic agent was reported . the promising findings of research in this field prompted the ue to fund a systematic program of research about the ability of food / beverage constituents to protect against oral infectious diseases , that is , caries and gingivitis . the first basic step in this contest was the selection of the food / beverages to be investigated . due to the number of literature papers reporting polyphenols as antimicrobial and antiadhesive agents also able to interfere with biofilm and glycosyl - transferases production , plant and fungal edible materials so , already studied materials such as green and black tea leaves , mushroom , and cranberry were selected for a systematic investigation as well as raspberry , red chicory , and beer never previously studied in relation to a potential action in protecting oral cavity from infection diseases . the selected food / beverages had to be analysed to state their content of macronutrients , that is , protein , lipid , and total carbohydrates . also free sugars , micronutrients such as inorganic ions that were found to exert any positive or negative influence on oral health , and the total polyphenol content of the selected food / beverages were evaluated . as the selected materials had to be tested in biological assays , useful solutions of their water soluble components had to be prepared ( extracts ) and their microbiological quality to be defined . furthermore , the fractionation of the most active extracts ( red chicory , mushroom , and raspberry ) was performed on the basis of their molecular mass as a first step to isolate the active compound / s . concentrated sulphuric acid ( 97% ) , sodium hydroxide 1 n , petroleum ether 4070c , mixed indicator solution ( methyl red - methylene blue ) were purchased from carlo erba reagents ( milan , italy ) . frozen mushrooms ( shiitake , lentinus edodes ) were purchased from bolem ( gorizia , italy ) and asiago food spa ( veggiano , italy ) . rosso tardivo of treviso red chicory ( cichorium intybus l. , variety silvestre ( bishoff ) typology tardivo ) was purchased from italian consorzio radicchio di treviso ( treviso , italy ) . green and black tea ( camellia sinensis ) dry leaves were purchased from an italian tea importer ( berardi & c. s.n.c . , dark beer ( guinnes draught , 4.2% alcohol ) was purchased from a local supermarket . cranberry juice was acquired as concentrated juice from an italian importer ( natex international trade spa , pioltello , italy ) of ocean spray cranberries inc . aliquots of fresh red chicory ( 500 g ) , of frozen mushroom , and of frozen raspberries ( 400 g ) were homogenized ( for 1 , 2 , and 1 min , resp . ) and centrifuged ( for 10 min at 8000 rpm ) , and the juices , after separation from solid parts , were filtered on paper filter , and then submitted to sterile ultrafiltration , with the exception of raspberry juice . green and black tea infusions were prepared from a suspension containing 30 g of dry leaves in 600 ml of water millipore grade ; after 5 minutes of infusion , the extracts were cooled at 20c , filtered on paper filter , and then subjected to sterile ultrafiltration . concentrated cranberry juice ( 5.6x ) supplied by the importer was simply diluted before the analysis . aliquots ( 325 ml ) of guinnes beer were submitted to elimination of co2 and dealcoholated ( bath temperature : 50c , vacuum : 30 bar for 20 minutes ) . kjeldahl method , the standard method of nitrogen determination , was used following the official method of analysis of aoac international [ 25 , 26 ] . values are means of four independent experiments . the soxhlet method , as described in the official method of analysis of aoac international , was applied . d - glucose , d - fructose , and sucrose contents were determined using an enzymatic assay ( boehringer mannheim , r - biopharm , italia srl , cerro al lambro , italy ) . d - glucose concentration was determined before and after the enzymatic sucrose hydrolysis , while d - fructose was determined subsequent to the determination of d - glucose . the other sugars ( arabinose , galactose , mannose , rhamnose , ribose , xilose , and maltose ) were revealed by thin - layer chromatography following the method of talukder . an icp - oes perkin elmer optima 3300 dv was used for the measurements of metal ions at concentration greater than 5 g / l , and , for more diluted samples , inductively coupled plasma - mass spectrometer ( icp - ms ) measurements were carried out on a perkin elmer mod . linearity range between the intensity and concentration for each metal ion was obtained using standard solutions daily prepared from a 1.00 mg / ml stock solution . lods were calculated as the amount of metal ion that gives a signal that is 3 of the mean blank signal and loq as the amount of metal ion which gives a signal that is 10 above the mean blank signal . fluoride ion concentration was measured by fluoride ise on an orion 520 potentiometer , with the standard additions method . total polyphenol contents were determined with the folin - ciocalteu reagent . in brief , 500 l of folin - ciocalteu reagent was added to 100 l of each extract , mixed , and added with 2000 l of a 15% na2co3 solution and millipore grade water to a 5 ml final volume . after mixing and waiting for 2 h , the mixtures were read spectrophotometrically at 750 nm . the microbiological quality controls were done through qualitative and quantitative analysis to determine the following indicator organisms : total viable count ( psychrophilic / mesophilic / bacteria ) through plate count with tryptone soya agar ( oxoid ltd . , basingstoke , hampshire , uk ) ; yeast and mould plate count with malt extract agar ( oxoid ltd . , basingstoke , hampshire , uk ) and potato dextrose agar ( pda ) ( oxoid ltd . , basingstoke , hampshire , uk ) ; enteric indicator bacteria through plate count : determination of escherichia coli with violet red bile glucose agar ( oxoid ltd . , basingstoke , hampshire , uk ) , salmonella spp with xld medium ( oxoid ltd . , basingstoke , hampshire , uk ) , streptococcus faecalis with slanetz and bartley medium ( oxoid ltd . , basingstoke , hampshire , uk ) , sulfite reducing clostridium spores with sps agar ( oxoid ltd . , basingstoke , hampshire , uk ) ; environmental indicator through plate count : determination of pseudomonas spp with pseudomonas agar base ( oxford ) ( oxoid ltd . , basingstoke , hampshire , uk ) ; antrophic indicator bacteria through plate count : determination of coagulase - positive staphylococci ( staphylococcus aureus ) , determination of coagulase - negative staphylococci ( staphylococcus epidermidis ) with baird parker agar base ( oxoid ltd . , basingstoke , hampshire , uk ) , and egg yolk tellurite emulsion ( oxoid ltd . , basingstoke , hampshire , uk ) ; animal indicator bacteria through plate count : determination of listeria monocytogenes with lysteria selective agar base ( oxford ) ( oxoid ltd . , basingstoke , hampshire , uk ) lysteria selective supplement ( sr 140 e ) ( oxford ) ( oxoid ltd . , basingstoke , hampshire , uk ) . the chicory and mushroom extracts fractionation was performed using vivaflow 200 complete system ( vivascience ) equipped with 5,000 mwco pes membrane . the diafiltrate ( mm < 5,000 da - lmm ) and the retentate ( mm > 5,000 da - hmm ) fractions obtained from each extract aliquot of 250 ml , after restoring the initial volume , were submitted to sterile ultrafiltration , freeze - dried , and tested . raspberry extract was fractionated into low- and high - molecular - mass fractions by dialysis . dialysis was performed using a spectra / por biotech regenerated cellulose membrane ( spectrum europe b.v . , breda , the netherlands ) with a molecular mass cutoff ( mmco ) of 3,500 da . aliquots ( 60 ml ) of raspberry extract were fractionated by dialysis in 5600 ml of millipore grade water for 24 h at 4c . the ph values ( ph 3.20 ) of lmm and hmm fractions , reconstituted to the initial volume ( 60 ml ) , were brought to ph 4.55.0 ( using 1.0 m naoh ) not to interfere with subsequent assays of their biological activities . then the fractions were sterilized using ultrafiltration 0.20 m membrane and freeze - dried . in the selected raw food / beverages ( red chicory , mushroom , raspberry , green and black tea , cranberry juice , and dark beer ) , proteins , lipids , total carbohydrates , and sugars such as glucose , fructose , and sucrose were quantitatively determined , whereas the presence of other monomeric or dimeric sugars were just pointed out . among mineral components , the generally considered as positively influencing oral health ions such as fluoride , zinc , strontium , molybdenum , boron , and lithium and the generally indicated as negatively acting selenium , beryllium , copper , and lead were detected . the total content of polyphenols , compounds often indicated as able to interfere with different steps in caries development process , was also determined in the seven selected raw materials . in table 1 , the content of water , macronutrients , and ash of the selected food / beverages was reported . green and black tea show values higher than 60% , cranberry about 50% , and all the other materials less than 15% . carbohydrates are important as regards caries development when they are fermentable by oral pathogens that , embedded in dental plaque , can continuously produce organic acids ( mainly lactic acid ) able to demineralise the protective tooth - calcified tissues . among fermentable sugars , sucrose is considered as the most cariogenic sugar because the capability of microorganisms to rapidly metabolise sucrose producing both organic acids and extracellular bioadhesive polysaccharides is a relevant oral pathogen virulence trait . as regards sugars , glucose , fructose , and sucrose determination was performed in all the food / beverages applying specific enzymatic methods ( table 2 ) . black tea and beer were found not to contain any of such sugars probably because they are metabolized during fermentation process they undergo . all the other selected materials contain these sugars in very small amount ( less than 1% ) , with the exception of cranberry in which glucose percentage is close to 3% . thin - layer chromatographic analysis showed the presence of other monomeric and dimeric sugars as reported in table 3 . lipid content is very low in all the selected food / beverages with beer showing not to contain lipids at all ( table 1 ) . the richest in protein materials are green and black tea leaves . due to the treatment tea leaves undergo , their moisture content is low ( about 8% ) , determining the increase of the other component percentages ; therefore , tea leaves protein content reaches remarkable values similar to that of animal foods or other dry plant foods such as dry legumes . all the other materials are very low in protein and very high in water content including raspberry , mushroom , and red chicory , although they are solid materials . it is known that fresh vegetables and fruits have a high content of water and a high activity water value so that their shelf life is quite short even if stored at refrigerate temperature because free water is abundant and available for microorganisms proliferation ( table 1 ) . so it is not surprising that red chicory and raspberry presented a marked microbial contamination ( table 4 ) . in particular , red chicory presented the highest contamination values for total microbial counts ( mesophilic , psychrophilic , and yeasts ) and for specific indicators of contamination such as enteric indicator ( escherichia coli 740 cfu / ml ) and environmental indicator ( pseudomonas spp 1000 cfu / ml ) , whereas any food showed important microbial indicators of antrophic or animal contamination such as staphylococcus aureus , salmonella spp , and listeria monocytogenes . considering the elements ( table 5 ) , green and black tea are very rich in fluoride ( f ) ions in comparison with the other food / beverages ( about 40 ppm ) . when dental structure is forming , f ions are able to replace hydroxyl group in ha giving fluoroapatite a very protective material that more than ha resists acid attack that determines enamel demineralisation . protective f action continues even when tooth is formed because this anion promotes enamel remineralisation and inhibits oral pathogen proliferation so helping in preventing caries lesion . it is well known that rich in f tooth - paste daily used acts consistently reducing caries incidence . also as regards zinc ( zn ) and strontium ( sr ) , a positive effect zn cations , as other heavy metal cations , possess antimicrobial activity and , due to this , zn is commonly added in the products prepared for oral care , such as tooth - pastes and mouthwashes . because of its chemical similarity to calcium ( ca ) , sr can replace ca in ha crystals of teeth and bone imparting additional strength to these tissues . it was found that when rats are fed increased amounts of sr , their teeth became thicker and stronger . in a 10-year study , carried out by the united states navy dental service , a very low incidence of caries was registered among naval recruits coming from a small area around rossburg , ohio , where the water contains unusually high concentrations of sr . the results of the epidemiologic investigations were confirmed by administering these levels of strontium in experimental animal studies . boron ( b ) , vanadium ( va ) , and , above all , molybdenum ( mo ) have been associated with reduced caries prevalence , whereas selenium ( se ) and lead ( pb ) appear to have adverse effects . to be submitted to the biological screening tests , the raw selected materials required the sample preparation . whereas dark beer needed simply dealcoholation with restoring the volume and cranberry the dilution of the concentrated juice , the solid foods required the preparation of solutions useful for the biological assays . in this case , the water soluble components were obtained by homogenisation , centrifugation , and filtration of the raw materials as regards red chicory , mushroom , and raspberry ; conversely , considering green and black tea , the leaves were treated as commonly done to prepare the infusion used as a beverage as described in materials and methods . in general , the solutions prepared to be submitted to the biological assays will be defined as extracts . in table 6 , the amounts of raw food needed to obtain 100 ml of extracts , extract ph values , content of sugars , and total polyphenols are reported . the extracts were submitted to the same analysis as the raw foods / beverages and to sterile ultrafiltration that microbiological quality control showed to be efficient . with respect to the raw materials , the extracts do not contain , but in traces , proteins and lipids , and , considering carbohydrates , they contain just the water soluble sugars . with regards raspberry , red chicory , and mushroom , as expected , glucose , fructose , and sucrose resulted to occur in a slightly higher concentration than in the whole raw materials . this is due to the fact that the determination of sugars as well as mineral ions requires the separation of these soluble analytes from the insoluble constituents of the food matrices . the separation had to be carried out in the same way used to obtain the extracts in which the water soluble components are actually determined . on the contrary , when the extraction of such water soluble analytes is carried out by infusion in a large volume of water , the extracts obtained present a very lower concentration of such components in comparison with the raw materials , and this is the case of tea leaves . so it is apparent that the analyte concentrations reported for the raw materials are often the results of calculations carried out on the basis of the analyte amounts actually determined in the extracts ( figure 1 ) . in general , this investigation shows that , among the selected food / beverages , tea beverages are good sources of f , zn , sr , b , copper ( cu ) , and polyphenols . raspberry can supply us with relevant amounts of zn , sr , b , and cu , whereas red chicory contains good concentrations of b. mushroom is very rich in f , zn , sr , b , and cu . all the selected food / beverages are rich in total polyphenols , with green and black tea beverages , cranberry juice , and beer containing the highest concentration of such components . the extracts obtained from each food / beverages were submitted to microbiological assays to determine their activity against oral pathogens and their virulence factors . the results of such tests indicated the best potential against infectious oral diseases for mushroom , red chicory , and raspberry [ 35 , 36 ] . to obtain preliminary indications about the molecular mass of the compounds responsible for the detected activities , raspberry extract was fractionated by dialysis due to its high viscosity and density , differently from chicory and mushroom extracts that were fractionated by ultradiafiltration . the dialysis procedure was carried out using dialysis membrane with a 3,500 da cutoff , which allowed the separation of lmm components ( mono- and disaccharides , organic acids , flavonoids and condensed and hydrolysable tannins with low degree of polymerization , and ion elements ) from polymeric components , such as high degree of polymerization tannins , complex carbohydrates , and proteins . due to the very acidic ph values of dialysis fractions ( lmm fraction ph = 2.71 0.12 and hmm fraction ph = 3.20 0.01 ) , which could interfere with subsequent microbiological assays then , dialysis fractions were sterilized using ultrafiltration and freeze - dried . with regards to red chicory and mushroom , the extract fractionation into lmm and hmm fractions was performed using a 5,000 mwco pes membrane . this procedure resulted in the loss of 50% and 33% diafiltrate components for red chicory and mushroom , respectively , which remained in the retentate ; so the lost of such components had to be restored to obtain a diafiltrate fraction with the lmm components at the same concentration as in the raw extract . conversely , the retentate had to be further treated to eliminate the residue lmm components . the right concentration of the lmm components for chicory in the diafiltrates was achieved submitting to diafiltration procedure a double volume of extract and a volume of extract added of 33% for mushroom . diafiltrate and retentate solutions ( mushroom : lmm ph = 6.15 0.11 , hmm ph = 6.80 0.13 ; red chicory : lmm ph = 5.90 0.09 , hmm ph = 6.55 0.10 ) were sterilized using ultrafiltration 0.20 m membrane and freeze - dried , and stored for microbiological assays . in conclusion , the present investigation allows to know the macronutrient , mineral ions , and polyphenol content of seven food / beverages grown in defined area but exported to various countries around the world . while the macronutrient composition of such food / beverages is generally well known and tabulated as mean values , for most of these materials , very scarce literature data about their content in mineral micronutrient are available . tea leaves resulted to be the raw materials richest in all the elements detected as mineral ions , anyway tea beverages resulted to be the richest just in fluoride ion among the selected food / beverages . the highest content in zinc ion was found in red chicory , raspberry , and mushroom . raspberry is the richest food in strontium and boron , beer in selenium , and raspberry and mushroom in copper . as regards polyphenols , beer , cranberry juice , and , above all , green and black tea are very rich in these components confirming these beverages to be important sources of such healthy components . among the selected food / beverage extracts , raspberry , red chicory , and mushroom extracts , considering , in the whole , the results of microbiological assays , showed the highest potential action against oral pathogens . the fractionation of the water soluble components occurring in these extracts , carried out on the basis of their molecular mass , showed that both the hmm and lmm obtained fractions of each food , present any activity in the microbiological tests indicating that more active compounds occur in these foods with the lmm fractions containing the components presenting the highest potential action against the oral pathogens .
this paper reports the content in macronutrients , free sugars , polyphenols , and inorganic ions , known to exert any positive or negative action on microbial oral disease such as caries and gingivitis , of seven food / beverages ( red chicory , mushroom , raspberry , green and black tea , cranberry juice , dark beer ) . tea leaves resulted the richest material in all the detected ions , anyway tea beverages resulted the richest just in fluoride . the highest content in zinc was in chicory , raspberry and mushroom . raspberry is the richest food in strontium and boron , beer in selenium , raspberry and mushroom in copper . beer , cranberry juice and , especially green and black tea are very rich in polyphenols , confirming these beverages as important sources of such healthy substances . the fractionation , carried out on the basis of the molecular mass ( mm ) , of the water soluble components occurring in raspberry , chicory , and mushroom extracts ( which in microbiological assays revealed the highest potential action against oral pathogens ) , showed that both the high and low mm fractions are active , with the low mm fractions displaying the highest potential action for all the fractionated extracts . our findings show that more compounds that can play a different active role occur in these foods .
ankylosing spondylitis ( as ) is a chronic inflammatory rheumatic disease that affects especially males in the second and third decades of life , with a prevalence of 0.50.9% . the main clinical symptom is inflammatory back pain typically occurring at night and morning stiffness improving after exercise . the pain , stiffness , and limited mobility of the spine can cause severe limitations in daily life activities . the last decade there is an increasing interest in the spinal involvement in as visible on magnetic resonance imaging ( mri ) [ 25 ] . there is a wide range of abnormalities described in the spine of as patients . apart from syndesmophytes and ankylosis of the spine resulting in rigidity , in longstanding as , also focal destructive discovertebral lesions ( andersson lesion ( al ) ) can occur , also known as als [ 6 , 7 ] . in 1996 , rasker et al . recently , we described a review on als , which show disk space narrowing or widening , vertebral bone destruction , a surrounding zone of sclerosis , and local kyphosis at radiographs of the spine ( fig . 1 ) . one of the causes of an al is the local inflammation in the spine in combination with a minor trauma . this lesion can be differentiated from the signs of inflammation at the mri of the spine of active disease in as , as is often observed in patients who are candidates for tumor necrosis factor ( tnf ) blocking treatment . an al might be difficult to detect on clinical symptoms alone because most as patients suffer from back pain . more important is the fact that an al requires a different treatment , for instance immobilization , in contrast with the physical therapy normally prescribed in as patients . 1a lateral radiograph of the lumbar spine shows an andersson lesion with extensive bony destruction of the l1l2 disk with irregular endplates and increased sclerosis of adjacent vertebral bodies ( from van royen et al . with permission ) a lateral radiograph of the lumbar spine shows an andersson lesion with extensive bony destruction of the l1l2 disk with irregular endplates and increased sclerosis of adjacent vertebral bodies ( from van royen et al . with permission ) the aim of this study was to investigate whether in as patients , who are candidates for treatment with anti - tnf , als could be detected . as patients were derived from the outpatient clinics of the vu university medical center ( vumc ) and the jan van breemen institute ( jbi ) in amsterdam . all as patients who fulfilled the modified new york criteria and met the criteria for starting treatment with tnf - blocking agents according to the international asas consensus statement [ 9 , 10 ] were included . following this asas statement , all patients had an active disease as defined by a bath ankylosing spondylitis disease activity index ( basdai ) of 4 ( scale 010 ) , had failed to previous therapy with at least two nonsteroidal anti - inflammatory drugs and sulfasalazine in case of peripheral arthritis , and should be treated with tnf - blocking agents according to an expert . patients were enrolled consecutively , but mainly because of limited availability of the mr scanner , several patients could not be included . furthermore , one patient did not fit into the scanner due to severe kyphosis , and several patients suffered from claustrophobia . at baseline , data that conform to daily clinical practice during treatment with tnf - blocking agents were collected in all patients who gave their written informed consent . standing anteroposterior and lateral full - length plain films and an mri of the whole spine were performed before the start of anti - tnf therapy . mri were obtained at baseline and after 624 months of anti - tnf therapy , using t1-weighted spin - echo sequences ( t1 ) before and after administration of the contrast medium gadolinium diethylenetriamine pentaacetic acid ( gd - dtpa ) , t2-weighted sequences ( t2 ) , and fat - suppression sequences ( short tau inversion recovery ( stir ) ) . in patients included in the jbi , mri of the spine was performed in the amstelland hospital amstelveen with a field strength of 0.5 tesla , starting from the third cervical vertebra ( c3 ) and downwards . in patients included in the vumc , mri of the whole spine pre- and post-(gd ) t1 tse and stir mris were acquired . in the amstelland hospital amstelveen , the conventional radiographs and mri were read by two observers , one orthopedic surgeon ( bvr ) and a radiologist ( rm ) , who were blinded to the status of the subjects . the extent of spinal ankylosis in the total study cohort was estimated by counting extensive syndesmophyte formation or bamboo spine features on conventional radiographs counted by segment . the extent of abnormalities in the discovertebral unit was compared with the same discovertebral unit in different sagittal mr sequences and the other way around . an al was defined as an abnormality in the discovertebral junction that shows on mri diffuse endplate destruction , with associated bone marrow edema and fat replacement or sclerosis . the fracture cleft through the disk space or vertebra itself is depicted as decreased signal on t1 and increased signal on t2 , stir , and t1 imaging after gd - dtpa administration , reflecting reactive edema of the fracture . conventional radiography of the al must show a fracture line , irregular endplates , and increased sclerosis of adjacent vertebral bodies . continuous variables were reported as the mean sd or , if skewed , as the median ( range ) . as patients were derived from the outpatient clinics of the vu university medical center ( vumc ) and the jan van breemen institute ( jbi ) in amsterdam . all as patients who fulfilled the modified new york criteria and met the criteria for starting treatment with tnf - blocking agents according to the international asas consensus statement [ 9 , 10 ] were included . following this asas statement , all patients had an active disease as defined by a bath ankylosing spondylitis disease activity index ( basdai ) of 4 ( scale 010 ) , had failed to previous therapy with at least two nonsteroidal anti - inflammatory drugs and sulfasalazine in case of peripheral arthritis , and should be treated with tnf - blocking agents according to an expert . patients were enrolled consecutively , but mainly because of limited availability of the mr scanner , several patients could not be included . furthermore , one patient did not fit into the scanner due to severe kyphosis , and several patients suffered from claustrophobia . at baseline , data that conform to daily clinical practice during treatment with tnf - blocking agents were collected in all patients who gave their written informed consent . standing anteroposterior and lateral full - length plain films and an mri of the whole spine were performed before the start of anti - tnf therapy . mri were obtained at baseline and after 624 months of anti - tnf therapy , using t1-weighted spin - echo sequences ( t1 ) before and after administration of the contrast medium gadolinium diethylenetriamine pentaacetic acid ( gd - dtpa ) , t2-weighted sequences ( t2 ) , and fat - suppression sequences ( short tau inversion recovery ( stir ) ) . in patients included in the jbi , mri of the spine was performed in the amstelland hospital amstelveen with a field strength of 0.5 tesla , starting from the third cervical vertebra ( c3 ) and downwards . in patients included in the vumc , mri of the whole spine was performed with a field strength of 1.5 tesla . pre- and post-(gd ) t1 tse and stir mris were acquired . in the amstelland hospital amstelveen , the conventional radiographs and mri were read by two observers , one orthopedic surgeon ( bvr ) and a radiologist ( rm ) , who were blinded to the status of the subjects . the extent of spinal ankylosis in the total study cohort was estimated by counting extensive syndesmophyte formation or bamboo spine features on conventional radiographs counted by segment . the extent of abnormalities in the discovertebral unit was compared with the same discovertebral unit in different sagittal mr sequences and the other way around . an al was defined as an abnormality in the discovertebral junction that shows on mri diffuse endplate destruction , with associated bone marrow edema and fat replacement or sclerosis . the fracture cleft through the disk space or vertebra itself is depicted as decreased signal on t1 and increased signal on t2 , stir , and t1 imaging after gd - dtpa administration , reflecting reactive edema of the fracture . conventional radiography of the al must show a fracture line , irregular endplates , and increased sclerosis of adjacent vertebral bodies . continuous variables were reported as the mean sd or , if skewed , as the median ( range ) . in total , 56 as patients were included , 36 in the vumc and 20 in the jbi , and the baseline characteristics of all patients are summarized in table 1 . patients from the two centers . table 1baseline characteristicsmean sdrangenumber56age ( in years)43 10.82273male gender ( % ) 3868disease duration ( in years)11 8.7141symptom duration ( in years)21 11.3149basdai ( 010)6.4 1.44.09.7tragus - to - wall distance ( cm ; normal , < 15 cm)16 6.01144lumbar flexion index ( cm ; normal , > 5 cm)2.5 1.20.35lumbar side flexion ( cm ; normal , > 10 cm)10 4.93.819chest expansion ( cm ; normal , > 5 cm)3.4 1.50.57disease duration : mean time between the diagnosis and baselinesymptom duration : mean time between the first symptoms and baselinebasdai : bath ankylosing spondylitis disease activity index ; mean value , 11 baseline characteristics disease duration : mean time between the diagnosis and baseline symptom duration : mean time between the first symptoms and baseline basdai : bath ankylosing spondylitis disease activity index ; mean value , 11 systematic examination of conventional radiographs of the cervical , thoracic , and lumbar spine did not reveal any lesions that met the definition of al . distinct ankylosis with extensive syndesmophyte formation was seen in 13 of 55 ( 24% ) of the patients determined with conventional radiography of the spine . spinal ankylosis or bridging syndesmophytes over multiple vertebrae were seen at the cervical , thoracic , and lumbar segment in 16% , 6% , and 7% of patients , respectively . conventional radiographs and mris of the whole spine showed no al according to our definition . this abnormality showed bone marrow edema of more than 50% of the vertebral bodies adjacent to the intervertebral disk of t7/t8 and t9/t10 ( fig . t1 after administration of gd - dtpa demonstrated high signal intensity around the disk margins of t7/t8 and t9/t10 . however , no fracture line was visible on conventional radiology . 2a t1-weighted gadolinium diethylenetriamine pentaacetic acid postcontrast image demonstrated high - signal intensity around the disk margins of t7t8 and t9t10 . b t1-weighted image shows low - signal intensity bone marrow edema in the adjacent vertebral endplates of the t7/t8 and t9/t10 disk spaces . c t1-weighted image , obtained 24 months after treatment with anti - tumor necrosis factor agents a t1-weighted gadolinium diethylenetriamine pentaacetic acid postcontrast image demonstrated high - signal intensity around the disk margins of t7t8 and t9t10 . b t1-weighted image shows low - signal intensity bone marrow edema in the adjacent vertebral endplates of the t7/t8 and t9/t10 disk spaces . c t1-weighted image , obtained 24 months after treatment with anti - tumor necrosis factor agents the clinical characteristics of this patient did not differ from the other patients . he was a male , aged 65 years , with a basdai and crp of 5 and 35 mg / l , respectively , indicative of an active disease . he did not report any specific localizing complaints or a preceding ( minor ) trauma . he had suffered from complaints of low back pain for 40 years and was diagnosed with as at the age of 51 . after 24 months treatment with infliximab , t1-weighted images showed a decrease of signs of acute inflammation such as bone marrow edema and maybe even an increase of post - inflammatory fatty bone marrow degeneration around the disk margins . the t1-weighted post - contrast images demonstrated no high signal intensity around the disk margins of t7/t8 and t9/t10 anymore . there were signs of progression of the ankylosis and kyphosis in the thoracic segment after 2 years of follow - up despite anti - tnf treatment . apart from the focus on als , other abnormalities involving the discovertebral unit as described in literature on mri in as were encountered . romanus lesions , which are acute inflammatory lesions at the corners of the endplates of the vertebra , were often detected . these lesions show bone marrow edema in the corners of vertebral endplates and are depicted as hypodense signal areas in t1- and high signal in t2-weighted images . systematic examination of conventional radiographs of the cervical , thoracic , and lumbar spine did not reveal any lesions that met the definition of al . distinct ankylosis with extensive syndesmophyte formation was seen in 13 of 55 ( 24% ) of the patients determined with conventional radiography of the spine . spinal ankylosis or bridging syndesmophytes over multiple vertebrae were seen at the cervical , thoracic , and lumbar segment in 16% , 6% , and 7% of patients , respectively . conventional radiographs and mris of the whole spine showed no al according to our definition . this abnormality showed bone marrow edema of more than 50% of the vertebral bodies adjacent to the intervertebral disk of t7/t8 and t9/t10 ( fig . t1 after administration of gd - dtpa demonstrated high signal intensity around the disk margins of t7/t8 and t9/t10 . however , no fracture line was visible on conventional radiology . 2a t1-weighted gadolinium diethylenetriamine pentaacetic acid postcontrast image demonstrated high - signal intensity around the disk margins of t7t8 and t9t10 . b t1-weighted image shows low - signal intensity bone marrow edema in the adjacent vertebral endplates of the t7/t8 and t9/t10 disk spaces . c t1-weighted image , obtained 24 months after treatment with anti - tumor necrosis factor agents a t1-weighted gadolinium diethylenetriamine pentaacetic acid postcontrast image demonstrated high - signal intensity around the disk margins of t7t8 and t9t10 . b t1-weighted image shows low - signal intensity bone marrow edema in the adjacent vertebral endplates of the t7/t8 and t9/t10 disk spaces . c t1-weighted image , obtained 24 months after treatment with anti - tumor necrosis factor agents the clinical characteristics of this patient did not differ from the other patients . he was a male , aged 65 years , with a basdai and crp of 5 and 35 mg / l , respectively , indicative of an active disease . he did not report any specific localizing complaints or a preceding ( minor ) trauma . he had suffered from complaints of low back pain for 40 years and was diagnosed with as at the age of 51 . after 24 months treatment with infliximab , t1-weighted images showed a decrease of signs of acute inflammation such as bone marrow edema and maybe even an increase of post - inflammatory fatty bone marrow degeneration around the disk margins . the t1-weighted post - contrast images demonstrated no high signal intensity around the disk margins of t7/t8 and t9/t10 anymore . there were signs of progression of the ankylosis and kyphosis in the thoracic segment after 2 years of follow - up despite anti - tnf treatment . apart from the focus on als , other abnormalities involving the discovertebral unit as described in literature on mri in as were encountered . romanus lesions , which are acute inflammatory lesions at the corners of the endplates of the vertebra , were often detected . these lesions show bone marrow edema in the corners of vertebral endplates and are depicted as hypodense signal areas in t1- and high signal in t2-weighted images . in 56 as patients , who fulfilled the criteria for treatment with tnf - blocking agents , only one lesion resembling an al of the thoracic spine was detected with mri , but this lesion lacked a fracture line on the conventional radiograph . the low prevalence of als was unexpected because this group of as patients had a relatively high rate of ankylosis of the spine ( 24% ) and signs of active inflammation . this was in concordance with the moderate impairment of the mobility of the spine in these patients . the mean tragus - to - wall distance was 16 cm ( normal , < 15 cm ) , mean lumbar flexion index was 2.5 cm ( normal , > 5 cm ) , the mean lumbar side flexion was 10 cm ( normal , > 10 cm ) , and the mean chest expansion was 3.4 ( normal , > 5 cm ) . the percentage of als as described in literature in this subset of severe as patients varies between 1% and 28% [ 1521 ] . many studies report that the presence of an al is associated with long standing disease in as and with a rigid , ankylosed spine [ 2224 ] , concluding that an al is a late complication of as . the low prevalence of als in our study was probably caused by the relatively short disease duration , with a mean of 11 years and a mean age of 43 years . this could be due to a selection bias , for mostly young patients with an active disease were referred for treatment with tnf - blocking agents , whereas the efficacy of tnf blockers in older and more severe cases of as with complete ankylosis of the spine was still doubtful at the time of the study . a severe kyphotic deformity and an osteoporotic spine put a patient at risk of development of a stress fracture in the ankylosed spine [ 25 , 26 ] . however , we did not find any features of stress fractures in this susceptible subgroup of patients , probably due to the small group size . another cause of the low prevalence of als in this study might be due to the radiographic techniques used to detect them , although the combination of conventional radiographs of the spine and mri with gadolinium should be sensitive enough . hermann et al . compared mri and conventional radiography of spinal changes in patients with spondyloarthritis . they concluded that the best way to detect syndesmophytes was through radiography ; ankylosis was detected equally well by both radiography and mri , but for all other lesions , mri was the preferred method . a disadvantage of conventional radiographs of the spine is the difficult analysis of the vertebrae of the thoracic segment because of the overimposed lung tissue , while most disorders of the discovertebral junction occur in the lower part of the thoracic and upper parts of the lumbar spine [ 28 , 29 ] . mri is important for early detection of discovertebral lesions and described as a sensitive method to detect als , in particular , after administration of gadolinium . some mris in our study showed features of severe degenerative disk disease ( ddd ) , specifically lumbar - sacral . the mri features of these degenerative abnormalities were sometimes difficult to distinguish from destructive discovertebral lesions as was described by jevtic et al . , who showed that the appearance of an al can resemble modic type iii degenerative lesion . one point to differentiate between al and ddd in as is the fact that an al occurs as a result of inflammation in combination with mechanical stress of the ankylosed spine . another point is that al differs from ddd in the localization , because most al lesions occur at the level of the cervical and thoracolumbar spine , whereas the ddd predominate at the lumbosacral level . the debate about the prevalence of als is hampered by the lack of uniformity in the nomenclature of these lesions . for example , the term al has been employed for severe destructive discovertebral lesions , but also for minor abnormalities such as degenerative changes and local inflammation around in the discovertebral junction , as described in our case [ 7 , 12 ] . to conclude , no als was detected by using conventional radiographs and mri in this study in 56 severe as patients , whereas a higher prevalence was described in literature . the discrepancy might be due to the relatively small group of patient with a short disease duration and young age despite the severe ankylosed spine in our study cohort . despite the absence of als in our study , we would like to increase the awareness of this complication in as . in case of a minor spine trauma , an mri should be combined with the conventional spine radiographs in order to detect this lesion in the stiff and vulnerable spine , which is often osteoporotic as well . the treatment of an al lesion consists of immobilization instead of the routinely advised exercise program or even surgical decompression in case of neurological deficits . in previous studies , there has been no sequential mri study of the spine in patients with as that visualizes the evolution from an early discovertebral lesion , as described in our patient , into a severe destructive discovertebral lesion , by some authors called an al . thus , it remains unclear whether and how often an abnormality in the discovertebral junction develops into an al . more research with a long - term follow - up of discovertebral lesions is necessary to clarify the evolution of these lesions .
the objective of this study is to investigate the prevalence of andersson lesions ( al ) in ankylosing spondylitis ( as ) patients who will start anti - tumor necrosis factor ( tnf ) treatment . radiographs and magnetic resonance imaging ( mri ) of the spine were performed before therapy with anti - tnf . als were defined as discovertebral endplate destructions on mri , associated with bone marrow edema and fat replacement or sclerosis , a decreased signal on t1 , enhancement after contrast administration ( gadolinium diethylenetriamine pentaacetic acid ( gd - dtpa ) ) , and increased signal on t2 and short tau inversion recovery ( stir ) . additionally , conventional radiography showed a fracture line , irregular endplates , and increased sclerosis of adjacent vertebral bodies . fifty - six as patients were included , 68% males , mean age of 43 years , and mean disease duration of 11 years . the mean bath ankylosing spondylitis disease activity index was 6.4 , and 24% of all patients had ankylosis . only one patient showed a discovertebral abnormality with bone marrow edema of more than 50% of the vertebral bodies adjacent to the intervertebral disk of t7/t8 and t9/t10 , a hypodense signal area on t1 , and a high signal on stir . irregular endplates were depicted , and t1 after gd - dtpa demonstrated high signal intensity around the disk margins . however , no fracture line was visible on conventional radiology , and therefore , this case was not considered to be an al . no al was detected in our as patients , who were candidates for anti - tnf treatment . one patient showed a discovertebral abnormality on mri , without a fracture line on conventional radiology . the relative small proportion of patients with a long - established disease might explain this finding for , particularly , an ankylosed spine is prone to develop an al .
normally , the pancreas lacks squamous epithelium . during periods of inflammation such as in pancreatitis and squamous cell carcinoma ( scc ) these cells can be observed . the pancreas neoplasms are classified as endocrine or non - endocrine . based on the location of the tumor , non - endocrine neoplasms can have five different sources : acinar , connective tissue , ductal , mixed cell type , and uncertain origin . it accounts for approximately 0.52% of all malignant pancreatic tumors . because it is an infrequent disorder , a diagnosis of primary pancreatic scc is made only after excluding other neoplastic lesions of the pancreas that contain squamous epithelial components . the main differential diagnoses of primary scc of the pancreas are adenosquamous carcinoma ( asc ) another rare primary tumor of the pancreas and metastatic scc from another primary site . here three months ago , a 56-year - old man with epigastric and right upper quadrant pain was admitted to a hospital . after surgery , not only did the symptoms resolve but also loss of appetite and weight ( 15% ) were added to the clinical signs . initial laboratory evaluation revealed moderate elevations of amylase 215 iu / l ( normal up to 100 iu / l ) along with mild anemia ( hb 11.5 g / dl ) . blood samples taken at the time of admission and clinical parameters were as follows : bun 13 mg / dl ( normal range 820 mg / dl ) ; cr 1.5 mg / dl ( normal range for male 0.61.3 mg / dl ) ; uric acid 3.3 mg / dl ( normal range for male 3.67.7 mg / dl ) ; tg 88 mg / dl ( normal range up to 150 mg / dl ) ; cholesterol 124 mg / dl ( desired < 200 ) ; ca 7 mg / dl ( normal range 8.510.5 mg / dl ) ; ph 3.8 mg / dl ( normal range 2.75 mg / dl ) ; na 133 meq / l ( normal range 135145 meq / l ) ; k 4.2 ( normal range 3.55 meq / l ) ; ast 17 iu / l ( normal < 40 ) ; alt 11 iu / l ( normal < 40 ) ; alp 193 ; ldh 301 iu / l ( normal 225450 iu / l ) ; amylase 88 iu / l ( normal up to 100 iu / l ) ; lipase 66 iu / l ( normal up to 60 iu / l ) ; total protein 6.2 iu / l ( normal 6.68.3 iu / l ) ; albumin 3.9 g / dl ( normal 3.55.2 g / dl ) ; total bilirubin 0.4 mg / dl ( normal 0.32 mg / dl ) ; direct bilirubin 0.2 mg / dl ( normal < 1 mg / dl ) ; wbc 6.1 10/l ; rbc 4.5 10/l ; hgb 11.5 g / dl ( normal 1316 g / dl ) ; hct 33.9% ( normal 3948% ) ; mcv 79.8 fl ( normal 80100 ) ; mch 27.1 pg ( normal 2634.4 ) ; mchc 33.9 g / dl ( normal 31.836.3 g / dl ) ; plt 399 10/l ( normal 150400 10/l ) . the initial diagnosis was unclear and the patient underwent computed tomography ( ct ) of the abdomen for further evaluation ( fig . 1 ) . the ct showed the presence of a hypodense mass at the head and trunk of the pancreas . the mass created a pressure and encasement on the celiac trunk , portal vein , and arteries of the liver and spleen . for further evaluation , endoscopic ultrasound ( eus)-guided fine needle aspiration ( fna ) was performed ( fig . 2 ) . eus showed a mass lesion of 4537 mm ( mixed echoic ) at the trunk of the pancreas invading the splenic vein and artery . pathological finding indicated sheets of malignant cells with round to oval nuclei with thick nuclear membrane . occasional prominent nucleoli and high n / c ratio cytoplasm were eosinophilic granular and moderate to abundant with rather well - defined borders . 4 ) were performed using antihuman antibodies against the following markers : unlike cea , which was negative in tumor cells , ck5/6 and p63 were strongly positive in tumor cells . the definitive diagnosis of pancreatic scc was justified by immunohistochemical and pathological study ; thus , the patient was sent for chemotherapy . the patient received chemotherapy with gemzar and oxaliplatin ( gemox at doses of 1,000 and 100 mg / m ) for 4 cycles . he had no response to treatment and chemotherapy was changed to weekly irinotecan ( 140 mg weekly ) . four months after chemotherapy , clinical signs continued and abdominal ct was done again ( fig . although chemotherapy was done for the patient , the ct image revealed a development in scc of the pancreas . there are different reports for the incidence of scc , ranging from 0.5 to 5% . the histogenesis of pancreatic scc is vague , but there are some hypotheses : ( 1 ) a bipotential primitive cell capable of differentiating into either squamous or glandular carcinoma undergoes malignant change ; ( 2 ) squamous metaplasia of the ductal epithelium undergoes a malignant transformation ; ( 3 ) preexisting adenocarcinoma undergoes squamous change ; or ( 4 ) an atypical squamous cell undergoes a malignant change [ 11 , 12 ] . the prominent feature of pancreatic scc is similar to ductal adenocarcinoma including upper abdominal and back pain , anorexia , weight loss , nausea , fatigue , vomiting , and obstructive jaundice . local lymph node involvement and liver metastases are common with this tumor . at present , a tumor blush in angiography and endoscopic retrograde cholangiopancreatography or enhancement of the tumor on contrast ct can be useful in scc diagnosis [ 15 , 16 , 17 ] . however , eus - fna has been increasingly accepted for the identification of pancreatic malignancies with a high sensitivity and specificity . the disease has a poor prognosis and the survival from the time of diagnosis is similar to that of pancreatic adenocarcinoma . although different therapeutic methods have been used in the handling of pancreatic scc , which include surgical resection , chemotherapeutic regimens , and radiotherapy , none have been proven effective .
pancreatic squamous cell carcinoma ( scc ) is a rare event . here , we present a 56-year - old man with pancreatic scc . imaging methods demonstrated a hypodense mass at the head and trunk of the pancreas . also , some lymphadenopathy has been seen around the pancreas and para - aorta . the mass created pressure and encasement on the celiac trunk , portal vein , and arteries of the liver and spleen . endoscopic ultrasound showed a mass lesion of 4537 mm ( mixed echoic ) at the trunk of the pancreas . histological examination of the endoscopic ultrasound - guided fine needle aspiration specimen confirmed the diagnosis of scc . the disease is highly aggressive , most often locally advanced or metastatic at diagnosis , and poorly responsive to treatment . it also has generally poor survival rates .
diffuse optical tomography ( dot ) is a relatively new discipline and drew increasing interest in recent years [ 2 , 3 ] . if the target - specific fluorescent contrast agent is employed in dot , it can probe molecular event in vivo [ 46 ] , which is very useful to detect disease in its early stage , comprehensively understand disease mechanism , and develop new drugs . for example , it is not harmful to tissue due to its noninvasive and nonionizing characteristics . thus it can be repeatedly even continuously used on patients at the bedside . in addition currently , its two main applications are monitoring cerebral blood volume and oxygenation and screening breast cancer [ 712 ] . for neonates , the deficiencies of cerebral blood flow or oxygen may lead to severe irreversible damages to the brain development . . however , the existing conventional medical imaging modalities are not capable of monitoring the cerebral blood volume and oxygenation continuously without invasion and damage . besides , currently the most commonly used conventional means to detect breast tumor is x - ray . it is not suitable to be used on patients continuously or even frequently due to its radiative nature . in addition , when the tumor can be seen by the x - ray instrumentation , it is generally too late to be treated . the optical tomography is a very powerful complementary tool to the existing conventional imaging techniques in the above mentioned fields . many investigators have contributed considerably to dot technique , and many excellent dot systems for medical purpose have been developed [ 1 , 14 , 15 ] . in this paper , we present a dot imaging system that is based on photomultiplier tube ( pmt ) . in the entire imaging system , only one pmt was employed as the detector and an optical multiplexer was used to alter the detector channels , so that the entire imaging system is relatively compact . compared to the charge - coupled - device- ( ccd- ) based imaging system , it is relatively simple and considerably inexpensive . besides , the proposed imaging instrumentation was designed as a highly automatically system , of which all the components can work harmoniously . in the following discussions , the system principle , including hardware setup and control and data acquisition software , is depicted in detail . the dot imaging systems can be broadly divided into three categories : continue - wave ( cw ) system , time - domain ( td ) instrumentation , and frequency - domain ( fd ) modality . a cw system is represented in detail , in which the source light is sinusoidally modulated at the frequency of 5 khz to facilitate the signal processing , such as elimination of noise . as photons propagate in tissue , they experience scattering as well as absorption . in the near - infrared ( nir ) spectral range , scattering is the dominant interaction . the transport process of photons in tissue can be well described by the radiation transport equation ( rte ) . under certain assumptions , the rte can be approximated by the diffusion equation ( de ) , a partial differential equation [ 3 , 13 , 16 ] , which is more commonly used to model light transport in tissue . the diffusion equation in time - domain and frequency - domain has been derived in detail in earlier literature . in the cw case , the de can be written as ( 1)(d(r)(r))+a(r)(r)=q(r ) , where r is the location in tissue domain , (r ) is the photon density distribution , a(r ) is the absorption coefficient distribution , q(r ) is the source term , d is the diffusion coefficient given by d = 1/[3(a + s ) ] , where s = ( 1 g)s is the reduced scattering coefficient , s is the scattering coefficient , and g is the anisotropic factor . the spatially dependent diffusion coefficient d(r ) and absorption coefficient a(r ) are the two main optical properties that reflect the function of the diseased and healthy tissues , and generally are the objectives to be reconstructed in dot . if the source q(r ) is a collimated incident beam , it can be treated as a point source under the surface at a depth of one mean free length . in this situation , q(r ) = q0 (r rs ) , where rs is the location of the equivalent point source and q0 is the strength of the source term . so the measured quantity on the boundary is expressed as ( 2)()=d()()n , where n is the outward normal at the site on the boundary , and ( ) is the measurement photon flux . in the cw case , along with the boundary condition ( 2 ) , ( 1 ) is the most commonly used forward model for dot and it is also employed in this paper in succeeding discussions . in cw case , the absorption and diffusion coefficients can not be recovered simultaneously [ 19 , 20 ] . when scattering is the dominant interaction , it is absorption coefficient rather than scattering coefficient that often derives the important physiological information . so the spatially dependent absorption coefficient distribution is the main optical property of tissue to be recovered . the light in the nir region of 650 nm900 nm is most commonly used in practical applications . in this spectral range , the principal absorbers , water , lipids , and hemoglobin have their lowest absorption coefficients , and then the penetration depth of the light in tissue is highest . the proposed imaging instrumentation is primarily consisted of optical components , electrical components , control and data acquisition routines , and image reconstruction program . in this section , we present the scheme of the imaging system and its hardware setup . the scheme of the dot system can be illuminated in figure 1 . the signal generator circuit ( 1 ) ( homemade ) generates a sinusoidal signal at the frequency of 5 khz , which is used to modulate the intensity of the source light . the laser source ( 2 ) ( va671 - 200 , viasho , china ) produces the source light at wavelength of 671 nm with maximum power of 200 mw . the output power of the source light can be adjusted to the desired level by adjusting the current of the laser generator . the purpose to modulate the source light is to facilitate the elimination of noise in succeeding signal processing . the sinusoidally intensity - modulated source light is also named as ac light ( similarly , the constant intensity light is named as dc light ) , which is guided into a 1 16 fiber switch ( 3 ) ( sun - fsw 1 16 mm , sun , china ) through a source fiber . the ac light is then switched into one of the 16 launch fibers sequentially . the launch fibers are held in the imaging tube ( 4 ) ( homemade ) , and launch the source light onto the tissue surface at different site sequentially . as illustrated in figure 2 , the imaging tube has five rings of bores . on each ring there are 32 bores , of which 16 bores are used to hold the launch fibers and the other 16 bores are for detector fibers bundles . when the launch fibers and the detector fibers bundles are held on the same ring , they are generally used to image in two dimensions ( 2d ) . when held in different rings , the photons that are launched into the tissue undergo scattering and absorption . some will the others will escape out of the tissue surface after they experience multiplying scattering . the light that transilluminates from tissue is collected by the 16 detector fibers bundles , and then is guided into the optical multiplexer ( 5 ) , which switches the 16 detector fibers bundles sequentially to the output fibers bundle . the optical multiplexer is homemade , and its principle is similar to the fiber switch ( 3 ) . the 16 detector fibers bundles have large inner diameter of 1 mm , so that they can collect photons efficiently . however , they are not suitable to be coupled into the fiber switch , because for fiber switch the inner diameter of the coupled fiber is generally required at the m level , such as 62.5 m , a very widely used standard of fiber diameter . that is the reason why we used an optical multiplexer rather than a fiber switch to alter the detector channels . the principle of the optical multiplexer is illustrated in figure 3 . as illustrated in figure 3 , the optical multiplexer has mainly three parts : the motor ( ii ) , the rotation part ( iii ) , and the fixing part ( iv ) . the rotation part and the fixing part are on - axis and coupled through an axletree . the fixing part has 32 bores and in which 16 bores are used to hold the detector fibers bundles ( v ) . the rotation part has one bore that is used to hold the output fibers bundle ( i ) . driven by the motor , the rotation part can revolve around its axis while the fixing part is fixedly mounted on the platform . when the rotation part rotates to different location , the output fibers bundle will aim at different detector fibers bundles , and then the collected photons can be switched from one of the detector fibers bundles to the output fibers bundle . the inner diameter of the detector fibers bundles is 1 mm and that of the output fibers bundle is 2 mm . so the energy of the light can be guided efficiently into the black box ( 6 ) ( homemade ) , as illustrated in figure 1 . inside the black box there is a photomultiplier tube ( pmt : r928 , hamamatsu , japan ) , which translates the light to electrical signal . after being amplified and preprocessed , the electrical signal is then sampled into a personal computer ( 9 ) by the data acquisition circuit ( 8) ( ni5112 , ni america , tex , usa ) as the raw data to be used to reconstruct the image . the primary duties of the instrumentation control and data acquisition software are to sample the raw data , postprocess the data , and control the hardware ( fiber switch and the motor of the optical multiplexer ) . the control software is developed by c++ computer language and runs under windows xp . the process of control and data acquisition can be described as follows : the personal computer delivers a command to the fiber switch by rs-232 serial interface to alter its channels ( namely source channels ) sequentially , and then the source light is switched into different launch fiber to illuminate different site on the tissue surface . once the source channel is changed , the computer then delivers a commands to the motor control circuit ( 7 ) ( as illustrated in figure 1 ) to drive the motor , and then drive the rotation part of the optical multiplexer revolved to alter the detector channels . thus the 16 detector fibers bundles are switched sequentially into the output fibers bundle , and then the light is guided into the black box to illuminate the pmt . the signal translated by pmt is a modulated signal , which is contaminated by the noise , such as the environmental light and the dark current of the pmt . one method is that the lock - in amplifier is employed , in which the sinusoidal signal produced by the signal generator is employed as the reference signal , and the amplified signal derived from the pmt as the input signal . another method is that the digital filter is employed in the signal postprocessing routine in the computer . when the digital filter is used , as the signal is modulated at the frequency of 5 khz , we employ one digital band - pass filter with the central frequency of 5 khz to eliminate the noise . through the digital filter , a relatively pure sinusoidal signal can be obtained , and by hilbert transform , the amplitude , that is , the envelope of the modulated signal , can be extracted ( the result of the hilbert transform of the sinusoidal signal is shown in figure 6(a ) ) . the arithmetical average of the amplitude is evalued as the raw data to reconstruct the image . repeat above processes until all source channels and all detector channels have a turn . all the processes are implemented harmoniously and automatically through the instrumentation control and data acquisition software . the flow chart of above processes and the corresponding signal format of each stage can be illustrated in figure 5 . the graphic user interface ( gui ) of the data acquisition and signal processing software the data acquisition , signal spectrum analysis , and signal processing windows are shown in figure 6(a ) , in which the parameters of the digital band - pass filter , such as the cutoff frequency and the order of the filter can be set manually according to the result of the signal spectrum analysis . the source - detector pair value display panel is shown in figure 6(b ) , in which the 16 sources and 16 detectors constitute 256 source - detector pairs and they are divided into four pages . the active channel displays the value of current source - detector pair . in this work , a gradient - based optimization inversion method is used for the absorption coefficient inversion with finite element method solving the forward model [ 17 , 22 ] . considering an experimental setting that includes s point excitation light sources located at j ( j = 1 , , s ) , and mj measurement positions j , i ( i = 1 , , mj ) for each source j , the following objective function can be defined : ( 3)e=12j=1si=1mj((j , i)mea(j , i)c)2 , where j , i represents the photon intensity measured at position j , i with the incident excitation source located at j . the subscript c denotes the values calculated by the forward simulation and mea represents the experimental values . in practice , it means that calibration should be performed to eliminate the effect of the inconsistent attenuations of fibers or fibers bundles . in order to avoid the calibration procedure , in this paper , two sets of data the corresponding measurement is ( j , i)bef . the other is acquired after the absorber is immersed into the intralipid and the corresponding measurement is ( j , i)aft . the measurements ( j , i)mea in ( 3 ) and following equations are given by the formula ( j , i)mea = ( j , i)aft/(j , i)bef , which are relative quantities . so the calculated values ( j , i)c are also relative quantities . in our work , first , the gradient of the objective function needs to be calculated as follow : ( 4)e=j=1si=1mj((j , i)mea(j , i)c)((j , i)ca ) . therefore , the gradient vector z can be presented as(5)z=e=jtb , where j is an mtot ntot jacobian matrix , mtot=j=1smj is the total measurement number at the boundary , and ntot is the number of the coefficients to be reconstructed . here then j can be calculated by an adjoint source scheme based on the establishment of pmdf ( photon measurement density function , as defined in ) . with the gradient calculated , the next step is to conduct one - dimension search in order to find the best step length on this gradient direction . then , we refresh the absorption coefficient and recalculate the gradient to form iteration computing until the error reaches the supposed value . to test the proposed imaging system , some experiments were performed , of which one model is illustrated in figure 7 . in the experiment , a glass cup was filled with 1% intralipid , a tissue - like medium . the intralipid is a homogeneous medium , namely , its anisotropic factor g = 0 . a glass tube of india ink was employed as the heterogeneous object , that is , the simulated absorber . the launch fibers and the detector fibers bundles were held in the imaging tube on the same ring , and they were separated uniformly . they were sampled , respectively , before and after the india ink was embedded inside the intralipid . the reconstruction results are illustrated in figure 8 . in figure 8(a ) to figure 8(c ) , the circle inside the domain stands for the true size and position of the absorber . we can see , as the iterations increase , the reconstructed result converges gradually to its true solution . the curve of the objective function ( 3 ) is shown in figure 8(d ) . the other models used to test the imaging system can also derive the desired results . inverse problem is intrinsically ill - posed , which means that the solution to the problem may not exist ( existence ) or is not unique ( uniqueness ) , or does not depend continuously on the data ( stability ) [ 24 , 25 ] . for a practical physics problem , the existence and uniqueness of the solution can be satisfied naturally or be enforced by mathematical measures . if a problem lacks the property of stability , a little of fluctuation of the measured data may lead to the solution deviated significantly from its true solution . to reduce the ill - posedness , regularizations strategies , such as tikhonov regularization and landweber iteration , however it is essentially expected that the noise polluted the measured data is as small as possible , while it is unavoidable . so in the next generation of the imaging instrumentation , some measures would be taken to eliminate to a great extent the effect of noise . for example , cooling system is employed on the pmt to reduce the dark current . to understand the model of the noise is very useful to eliminate its influence by using appropriate algorithm . in the imaging instrumentation there are mainly three kinds of noise : thermal noise , shot noise , and relative intensity noise . usually the shot noise is the principal noise in the imaging system , which mainly rises from the dark current of the photodetector . when the current is significantly large , it is governed by the gaussian distribution . in this case , the statistical method , such as bayesian framework , is suitable for the inverse problem [ 28 , 29 ] . in addition , solving dot is also a highly underdetermined problem , since the number of the measured data is much less than that of the pixels to be reconstructed . in above experiment , the forward problem was solved by the finite element method ( fem ) software and the tissue domain was divided into 1644 elements . however , there are only 16 sources and 16 detectors , namely , 256 known data are available . the number of the known data is much less than that of the elements . the underdetermining nature is one of the main factors that influences the quality of the reconstructed image , especially the spatial resolution . as noted in the literature : a lack of information can not be remedied by any mathematical trickery ! the most important way to improve the quality of the image is to obtain prior information as more as possible , for example , acquire more data , or take advantage of the anatomical imaging or the physiology information in the reconstruction process .
diffuse optical tomography ( dot ) is a rapidly growing discipline in recent years . it plays an important role in many fields , such as detecting breast cancer and monitoring the cerebra oxygenation . in this paper , a relatively simple , inexpensive , and conveniently used dot system is presented in detail , in which only one photomultiplier tube is employed as the detector and an optical multiplexer is used to alter the detector channels . the 32-channel imager is consisted of 16-launch fibers and 16-detector fibers bundles , which works in the near - infrared ( nir ) spectral range under continuous - wave ( cw ) model . the entire imaging system can work highly automatically and harmoniously . experiments based on the proposed imaging system were performed , and the desired results can be obtained . the experimental results suggested that the proposed imaging instrumentation is effective .
loss of functional movement is a common consequence of stroke1 . therefore , the activity level of stroke patients is reduced , which further reduces muscle tone2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29 . the loss of a normal degree of strength is an important factor that limits the functional activity of these patients3 . strengthening exercises , such as walking and stair climbing , stair climbing has been used as an important measure in the evaluation of the active independent and community lives of stroke patients5 . however , when the stair climbing and walking activities of these patients were evaluated , lack of strength , coordination , balance , and physical activity were found to be the most common problems they faced5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28 . for patients to successfully climb stairs , they must strengthen the appropriate muscles to improve the balance ability of the lower extremities6 . another method adopted for improving motor function was that of combining treadmill training with repetitive training ; further , strength training exercises along with aerobic exercise or task - oriented exercises were found to lead to improvements in functional behavior , such as walking or stair climbing7,8,9 . the most common interventions used for the rehabilitation of stroke patients include training on several exercise bikes and treadmills10,11,12,13 . however , when measuring the exercise intensity ( i.e. , the rated perceived exertion ( rpe ) ) , the energy consumption ratio of stationary bike training was found to be lower than that of the stepper exercises and treadmill training . in other words , strength training of the muscles is necessary for carrying out the stair climbing function as well as maintaining the correct gait ; aerobic exercise has also been found to improve a person s stair climbing ability7 . therefore , we proposed a training program featuring a combination of aerobic exercise and strength training involving stepper training for climbing stairs . however , stroke patients find it difficult to perform new exercises , including stepper training . learning efficient movement is an important factor for improving sensory feedback and repetition16 . due to inherent damage to the intrinsic feedback mechanism in stroke patients , visual feedback and extrinsic feedback improve movement performance , thereby increasing the efficacy of rehabilitation interventions17 , 18 . thus , the purpose of this study was to investigate the effect of the stepper exercise with visual feedback on lower extremity strength and functional movement of patients with stroke . patients were divided randomly into the 2 groups to minimize the likelihood of bias . thirty patients with stroke were recruited at the stroke rehabilitation s hospital in seoul . before the experiment began , participants were provided with sufficient explanation about the study . the inclusion criteria were as follows : unilateral stroke that occurred 6 months prior to the study ; the ability to perform 10-m independent gait and independent stair climbing ; no sight impairment ; and mini - mental status examination ( mmse ) score of over 24 points . the exclusion criteria were orthopedic , medical , and/or painful conditions ; aphasia ; cardiovascular disease , and previous participation in a similar experiment . the pre - tests included a 10-m walking test and the climbing of 11 stairs . all participants performed the stepper exercise for 30 minutes , thrice per week for 6 weeks . the participants were divided into the stepper exercise ( se , n = 13 ) or the stepper exercise with visual feedback ( sev , n = 13 ) group . the sev group performed the exercise in front of a full - length mirror and watched their own movements in the mirror ; another mirror was placed behind them so they could view the placement of their foot on the foot pedal . both groups performed the exercise for the same amount of time and at the same intensity . all the participants performed the 30-minute stepper exercise , thrice per week for 6 weeks . the t - test and mann - whitney u test were used to compare the participants characteristics . the paired t - test data were also analyzed using the independent t - test to examine differences in the results between the sev and se groups . while 30 subjects were recruited , only 26 ( sev group , 13 ; se group , 13 ) participated in this study . the demographic and clinical characteristics of the 2 groups did not differ significantly ( table 1table 1.characteristics of study participantsparameterssev ( n=13)se ( n=13)age , years71.9 ( 6.92)69.8 ( 9.76)weight , kg55.4 ( 9.00)56.5 ( 6.00)height , cm156.3 ( 8.44)156.9 ( 9.59)disease duration , months13.8 ( 6.96)11.2 ( 5.35)mmse - k26.8 ( 1.74)25.6 ( 1.94)gendermale3 ( 23%)4 ( 31%)female10 ( 77%)9 ( 69%)case of diseasecerebral infarction8 ( 62%)10 ( 77%)cerebral hemorrhage5 ( 38%)3 ( 23%)attack siteright7 ( 54%)4 ( 31%)left6 ( 46%)9 ( 69%)values are mean ( sd ) , mmse - k : mini - mental state examination korea ; sev : stepper exercise with visual feedback ; se : stepper exercise ) . the data regarding hip joint muscle strength , the 10-m walking test , and stair climbing , both within groups and between groups , are summarized in table 2table 2.comparison of hip joint extensor muscle , knee joint extensor muscle and 10 m walking test and 11stair climbing testparametersvalueschange valuessev ( n=13 ) se ( n=11)sev ( n=13)se ( n=11)prepostprepostpost - prepost - premuscle strength ( kg)hjem na7.58 ( 2.09)9.15 ( 3.09)**8.59 ( 2.22)8.88 ( 2.08)1.57 ( 1.84)*0.29 ( 1.21)a4.32 ( 1.99)6.35 ( 1.99)***5.07 ( 1.94)5.68 ( 2.27)2.03 ( 1.64)*0.60 ( 1.75)kjem na8.08 ( 2.44 ) 10.20 ( 3.18)**8.59 ( 3.43)9.99 ( 2.72 ) * 2.12 ( 2.57)1.40 ( 2.25)a5.01 ( 2.54)6.35 ( 2.44)*495 ( 2.86)6.17 ( 3.15)**1.35 ( 2.10)1.22 ( 0.95)10 m walking test ( m / s)0.46 ( 0.25)0.62 ( 0.24)***0.48 ( 0.28)0.53 ( 0.34)*0.15 ( 0.15)*0.05 ( 0.08)11 stair climbing test ( second)34.39 ( 16.41)25.44 ( 15.15)***37.11 ( 20.29)32.62 ( 19.17)**8.95 ( 8.79)4.49 ( 5.76)values are mean ( sd ) , * p<0.05 , * * p<0.01 , * * * p<0.001 . sev : stepper exercise with visual feedback ; se : stepper exercise ; hjem : hip joint extensor muscle ; kjem : knee joint extensor muscle ; na : non paralyzed - side ; a : affected - side . significant improvements were noted in the non - paralyzed hip joint strength and also for the paralyzed hip joint strength of the sev group ( p < 0.05 ) as well as the 10-m walking and 11-stair climbing tests ( p < 0.05 ) . values are mean ( sd ) , mmse - k : mini - mental state examination korea ; sev : stepper exercise with visual feedback ; se : stepper exercise values are mean ( sd ) , * p<0.05 , * * p<0.01 , * * * p<0.001 . sev : stepper exercise with visual feedback ; se : stepper exercise ; hjem : hip joint extensor muscle ; kjem : knee joint extensor muscle ; na : non paralyzed - side ; a : affected - side the stepper exercise was performed on the p - bar to ensure that the patients were safe , as this method allowed them to support themselves using both hands . the sev group received visual feedback by means of mirrors placed in the front and rear . the front mirror enabled the participants to check the alignment of the trunk when performing the exercise , while the rear mirror allowed them to verify that they were using the stepper pedal correctly7 . the sev group showed significant improvements in the hip joint muscle strength of both the paralyzed and non - paralyzed sides , and the strength of the hip joint extensor muscle showed more improvement in the sev group than the se group . after the stepper training , both groups confirmed the activation of the hip joint extensor muscle13 . however , this study only identified significant improvement in the hip joint extensor muscle in the sev group . treatment using the mirror was the result of extensive research on the recovery of patient upper extremity function and pain19,20,21 . only 2 previous studies have reported the recovery of the exercise capacity of the lower extremity involving exercises with visual feedback , such as the use of a mirror22 . first , the patients were moved to the non - paralyzed side of the mirror to influence the attack side , which compensated for the proprioceptive sensory loss23 . second , watching one s own movement in the mirror stimulates the mirror neuron system24 . the visual - motor neuron , a neuron of the mirror neuron system , is activated when observing motion and motion execution . therefore , the present study aimed to activate the visual feedback using a mirror , where patients could observe their movements in the mirror , thereby increasing the efficacy of the stepper exercise . in particular , the rear mirror s location helps patients visualize their exact steps , thereby inducing the benefit of the hip joint extension movement of the stepper and strengthening the hip joint extensor muscle13 . after the training , there was a significant improvement in the knee joint extensor muscle strength in both the sev and se groups but no significant difference between the groups in this regard . in a previous study on stroke patients that involved a stair climbing exercise , the exertion of the hip joint extensor muscle and muscle strength consumption of both sides of the knee joint extensor muscle , ankle joint , and plantar flexor muscle of the non - paralyzed side were higher than that reported in our study25 . the stepper exercise is similar to stair climbing , leading to strengthening of the knee joint extensor muscle . the stepper exercise with visual feedback was found to be more effective in strengthening the hip joint extensor muscle than the stepper exercise alone . improved muscle strength based upon changes in the functional activity was examined to investigate the walk test and the 11-stair climbing task . to determine the effectiveness of the exercise program , the participants were subjected to the 10-m walk test ; both groups showed a significant increase in the results compared to the pre - test data . however , the improvement was higher in the sev group than in the se group . in another study , the increase in the walking speed of stroke patients was thought to be caused by improved muscle strength ; approximately 75% of the improvement in walking speed was attributed to muscle strength training and an increase in the strength of either the hip joint extensor muscle , the ankle joint planter flexor muscle , or both26 . the significant difference in the walking speed between the sev and se group in the 10-m test is thought to have been caused by improvement in bilateral hip joint extensor muscle strength . to examine the different functional changes , the participants were also subjected to an 11-step stair - climbing test ; both groups showed a significant increase in the test results after the exercise program , but there were no significant differences in the scores between the 2 groups . in a previous study on cardiorespiratory capacity reduction of chronic stroke patients , it was shown that the patients found it extremely difficult to climb stairs25 . another study reported that more specialized training was needed in these patients to improve functional movements , such as climbing stairs27 . in yet another study , stair climbing combined with strength training was found to improve the patients ability to climb stairs7 . however , the stair climbing performance of patients from a previous study was compared the experimental and control group . as a result , the hip joint extensor muscle strength costs were similar . both sides of the knee joint extensor muscle and the non - paralyzed side of the dorsiflexor muscle strength costs were also higher25 . thus , in both groups , a significant improvement was observed in the 11-step stair - climbing test results owing to an improvement in the knee joint extensor muscle and the cardiovascular effects of the stepper exercise , albeit with no significant difference in the scores between the 2 groups . the reason behind this observation could be that the hip joint extensor muscle was not improved to a great extent despite the enhanced visual feedback with the use of the mirror25 .
[ purpose ] this study investigated the effect of stepper exercise with visual feedback on strength , walking , and stair climbing in stroke patients . [ subjects ] twenty - six stroke patients were divided randomly into the stepper exercise with visual feedback group ( n = 13 ) or the stepper exercise group ( n = 13 ) . [ methods ] subjects in the experimental group received feedback through the mirror during exercise , while those in the control group performed the exercise without visual feedback ; both groups exercised for the 30 min thrice per week for 6 weeks . the hip extensor and knee extensor strength , 10-m walking test results , and 11-step stair climbing test results were evaluated before and after the intervention . [ results ] the stepper exercise with visual feedback group showed significantly greater improvement for hip extensor strength and the 10-m walking test . the knee extensor strength and 11-step stair climbing in both groups showed significantly greater improvement after the intervention , but without any significant difference between groups . [ conclusion ] the findings of this study indicate that the stepper exercise with visual feedback can help improve the strength of the hip extensor and the 10-m walking test ; the stepper exercise alone may also improve the knee extensor strength and stair climbing ability .
it is evident that infant s umbilical cord is essential for its survival and growth . in the past , it was not considered as a necessary tissue . however , nowadays , it has attracted lots of attention and its relation to different diseases has been demonstrated . in iranian traditional medicine , caring for newborn s umbilical cord has been frequently recommended and it has been associated with different diseases . herein , iranian traditional medicine resources such as qanun - fil - tibb , exir - e - azam , and tib - e - akbari were studied . in addition , recent developments in classical medicine were reviewed using search engines including google scholar , pubmed , sid , and iranmedex . it has been revealed that there is a direct relation between early cord clamping and oxidative stress , anemia , and low cardiac output . in iranian traditional medicine , it is believed that the umbilical cord length , which should be cut off , is important . furthermore , if the umbilical cord is not squeezed efficiently , its content may enter the bladder , testis , and stomach leading to various diseases . it seems that the remarks by the iranian traditional medicine on caring for newborn s umbilical cord can be useful for the prevention of different diseases .
background : it is evident that infant s umbilical cord is essential for its survival and growth . in the past , it was not considered as a necessary tissue . however , nowadays , it has attracted lots of attention and its relation to different diseases has been demonstrated . in iranian traditional medicine , caring for newborn s umbilical cord has been frequently recommended and it has been associated with different diseases.methods:herein , iranian traditional medicine resources such as qanun - fil - tibb , exir - e - azam , and tib - e - akbari were studied . in addition , recent developments in classical medicine were reviewed using search engines including google scholar , pubmed , sid , and iranmedex.results:it has been revealed that there is a direct relation between early cord clamping and oxidative stress , anemia , and low cardiac output . in iranian traditional medicine , it is believed that the umbilical cord length , which should be cut off , is important . a short cord may lead to bladder contraction and frequent urination . furthermore , if the umbilical cord is not squeezed efficiently , its content may enter the bladder , testis , and stomach leading to various diseases.conclusion:it seems that the remarks by the iranian traditional medicine on caring for newborn s umbilical cord can be useful for the prevention of different diseases .
a 62-year - old woman visited the department of cardiology due to aggravated chest pain with dyspnea , which started a week before her visit . the patient had a history of hypertension ; she was diagnosed 20 years earlier . on her visit , her initial mental status was normal , blood pressure was 130/80 mmhg , pulse was 102 beats / min , body temperature was 36 , and respiratory rate was 20 breaths / min . the initial laboratory results showed a creatinine level of 6.5 mg / dl , a high troponin - i level at 2.34 ng / ml , paco2 29 mmhg , pao2 98 mmhg , base excess -10.1 mmol / l , and oxygen saturation at 96% ; the arterial blood gas analysis showed metabolic acidosis with ph 7.31 . an echocardiogram showed hypokinesia of the inferior wall with a 57% ejection fraction . suspecting coronary artery disease , we performed a coronary angiogram , which presented a stenosis greater than 70% in the proximal left anterior descending artery and a stenosis greater than 70% in the right coronary artery . during the intervention for the left anterior descending artery , a rupture suddenly occurred ( fig . the bleeding was controlled after inserting a 319 mm jostent polytetrafluoroethylene ( ptfe)-covered stent ( abbott vascular , abbott park , il , usa ) ( fig . the acute renal failure was treated with continuous renal replacement therapy . a week after the initial treatments an echocardiogram presented a low ventricular ejection fraction of about 29% with hypokinesia of the apex and interventricular septum . the troponin - i was elevated to 40 ng / ml ; acute myocardial infarction was suspected . in the coronary angiogram , a segment of the left anterior descending artery , where the jostent ptfe - covered stent was placed , was occluded . therefore , a percutaneous balloon angioplasty was performed to reestablish the blood flow and a coronary stent was inserted in the stenotic segment of the right coronary artery . thereafter , the symptoms of heart failure persisted and the patient 's hemodynamic condition rapidly deteriorated during treatment in the intensive care unit for a week . an emergent echocardiogram revealed a large ventricular septal defect at the anterior portion of interventricular septum near the apex ( fig . a follow - up coronary angiogram presented a complete reobstruction of the left anterior descending artery where the jostent ptfe - covered stent was placed ( fig . the patient was transferred to our department and an emergent operation was planned . through a median sternotomy approach , a cannulation of the aorta , a superior and inferior vena cava , and a cardiopulmonary bypass were performed . a ventriculotomy was performed 1 to 2 cm lateral and parallel to the left anterior descending artery under the beating heart . a direct visualization through the ventriculotomy presented a ventricular septal defect located at the anterior portion of the interventricular septum near the apex . pledgeted 3 - 0 prolene , interrupted , and continuous sutures were utilized to cover the septal defect . the body temperature was elevated and the cardio - pulmonary bypass was weaned without any hemodynamic compromise . the intubation was maintained for one day after the operation and the postoperative course was uneventful . a ventricular septal defect is a severe complication of acute myocardial infarction that may appear within 2 weeks after the infarction . due to the high mortality rate , 50% of patients expire within the first week after onset and only 20% survive more than a month . a ventricular septal defect needs to be repaired , especially when emergent in patients with a hemodynamic compromise . as experience with the quality of equipment for percutaneous coronary intervention have increased , success rates have improved and the range of applications has increased . on the other hand , various complications of percutaneous coronary intervention have been reported including coronary artery dissection and occlusion , thrombus formation , perforation , and rupture of the guide - wire with residual fragments in the coronary artery . among the lethal complications of percutaneous coronary intervention , coronary artery perforation causes hemopericardium , cardiac tamponade , and myocardial infarction . incidence of these complications were reported to be 0.1% to 3.0% with a mortality rate of about 10% . recently , percutaneous coronary intervention has been applied to more complicated lesions and to vessels with a smaller caliber . the risk factors that increase coronary artery perforation during a percutaneous coronary intervention include an oversized balloon , usage of stiff guide - wires in treating chronic occlusion , usage of cutting balloons , usage of debulking devices to remove the calcified material , usage of high - pressure inflation stents such as the sirolimus - eluting stents , and inappropriate attempts at intervention in irregularly calcified arteries . once the perforation of the coronary artery occurs , treatments worth considering include heparin antidote protamine injection to return coagulation to normal , using low - pressure balloons to occlude the blood flow , and using a balloon designed to allow blood flow through the balloon . when the methods mentioned above are not available , a covered stent may be useful to reestablish the blood flow . however , if a covered stent insertion fails , there is no other option except an operation . the most common contributor to the high mortality rate ( range , 10% to 15% ) in heart surgery after a percutaneous coronary intervention failure is preoperative hemodynamic instability . thus , percutaneous coronary intervention should be avoided in patients with risk factors for perforation . in 1966 , colombo et al . used covered stents for the first time . they applied a stent covered with an autologous greater saphenous vein in a patient with a perforated coronary artery after percutaneous coronary intervention . however , this method was abandoned due to the difficulty of its application . recently , a stent covered with an expandable ptfe graft with an internal and external stent surface and a diameter of 2.5 to 5 mm was developed . this stent graft , which was originally designed to treat coronary aneurysm , was applied for the first time by ramsdale et al . to treat patients with perforated coronary arteries . a higher risk of stent thrombosis follows after a covered stent is applied because it takes longer to form a complete inner wall of vascular endothelium than with conventional stents . moreover , restenosis occurs more frequently with covered stents than conventional stents . in our case , even though clopidogrel and aspirin were administered after inserting the covered stent , occlusion induced by stent thrombosis occurred twice within a 2 week period . furthermore , in the application of grafts , the risk of occlusion around the bifurcation area still remains . used covered stents in 67 patients that developed postoperative stenosis of a greater saphenous vein graft , patients with complicated arterial lesions , and patients with in - stent restenosis . the rates of restenosis for each were 33.3% , 30.0% , and 38.5% , respectively , at a mean of 159 days after intervention . a few studies about emergent life - saving procedures using a covered stent have proceeded to prevent perforation during a percutaneous coronary intervention , but it is still unsettled . the incidence of complications such as thrombus formation , chronic restenosis , restenosis of the branched artery , and occlusion around the bifurcation have not yet been determined . we believe that the location , diameter , length of arteries , and the amount of blood flow are the factors that affect the incidence of complications . furthermore , the occlusion of arteries branched from a stent - implanted artery leads to acute or chronic stenosis and occlusion of the graft . this , in turn , leads to the poor development of the collateral vessels , thus increasing the risk of myocardial infarction and the associated complications . thus , meticulous care and observation is necessary after the implantation of covered stents in patients with perforated coronary arteries after a percutaneous coronary intervention . in conclusion , as in our case , the emergent implantation of a covered stent for ruptured coronary arteries such as the left main coronary artery or the origins of the left anterior descending artery can be performed during a percutaneous coronary intervention , and a coronary bypass surgery should be considered in order to decrease the risk of complete occlusion , thus providing superior long term patency .
we report a case of a postinfarction ventricular septal defect caused by an acute recurrent occlusion after the implantation of a covered stent , which was performed as a rescue procedure for the ruptured left anterior descending artery during a percutaneous coronary intervention . although the emergent implantation of a covered stent for the ruptured coronary arteries such as the left main coronary artery or the origins of the left anterior descending artery can be performed during a percutaneous coronary intervention , and a coronary bypass surgery should be considered in order to decrease the risk of complete occlusion , thus providing a superior long term patency .
to help address the food quality protection act of 1996 , a physically based probabilistic model has been developed to quantify and analyze dermal and nondietary ingestion exposure and dose to pesticides . the residential stochastic human exposure and dose simulation model for pesticides ( residential - sheds ) simulates the exposures and doses of children contacting residues on surfaces in treated residences and on turf in treated residential yards . the simulations combine sequential time - location - activity information from children 's diaries with microlevel videotaped activity data , probability distributions of measured surface residues and exposure factors , and pharmacokinetic rate constants . model outputs include individual profiles and population statistics for daily dermal loading , mass in the blood compartment , ingested residue via nondietary objects , and mass of eliminated metabolite , as well as contributions from various routes , pathways , and media . to illustrate the capabilities of the model framework , we applied residential - sheds to estimate children 's residential exposure and dose to chlorpyrifos for 12 exposure scenarios : 2 age groups ( 0 - 4 and 5 - 9 years ) ; 2 indoor pesticide application methods ( broadcast and crack and crevice ) ; and 3 postindoor application time periods ( < 1 , 1 - 7 , and 8 - 30 days ) . independent residential turf applications ( liquid or granular ) were included in each of these scenarios . despite the current data limitations and model assumptions , the case study predicts exposure and dose estimates that compare well to measurements in the published literature , and provides insights to the relative importance of exposure scenarios and pathways.imagesfigure 1figure 2figure 3figure 4
one of the major objectives of clinical education is to improve the clinical reasoning abilities of medical students and residents . this ability is a key factor in physicians professional performance and competency.1 diagnostic errors can lead to a substantial portion of preventable medical errors.2 diagnostic errors can be associated with a higher morbidity in affected patients than other types of medical errors such as medication errors , surgical mistakes , or skill deficiencies.38 in particular , malignant or rapidly evolving conditions can cause great harm if undiagnosed , misdiagnosed , or diagnosed in an untimely manner . errors have been classified as cognitive ( data gathering or synthesis , faulty knowledge ) , system - related ( technical failures or organizational problems ) , and no - fault ( unusual presentation or patient - related such as deception or poor cooperation).1,9,10 the majority of diagnostic errors are likely due to cognitive errors in physicians clinical reasoning , specifically bias and failed heuristics.1,11,12 the minimization of cognitive errors has been a major challenge in the diagnostic process . many types of biases have been identified that lead physicians to fail in diagnosis.1223 they include availability bias ( the tendency to weigh the likelihood of things by the ease with which they are recalled ) , representative bias ( the tendency to be guided by prototypical features of disease and miss atypical variants ) , confirmation bias ( the tendency to seek data to confirm , not refute , the hypothesis ) , base rate neglect ( the tendency to ignore the true rate of disease and pursue rare , but more exotic , diagnoses ) , and premature closure ( a processing bias , the tendency to stop considering other possibilities after reaching a diagnosis).1,13,15,2428 clinical reasoning can be classified into two classes of mental processes referred to as the intuitive process ( system 1 ) and analytical process ( system 2 ) . this dual - processing model of thinking and reasoning has been explored extensively in psychology and has been applied to diagnostic reasoning in medicine.2931 the intuitive process occurs through unconscious intuitive matching to a prior example accumulated in memory.32 this process is rapid and contextualized , whereas analytical reasoning is deliberate , systematic , logical , and conceptually applies the more traditional methods of medical decision - making . for any specific clinical situation , we can not prescribe which diagnostic process the clinician should rely on , because one or both processes might be appropriate depending on contextual and other factors . in some situations , a trade - off between speed and accuracy might be important , requiring discretionary use of each process.10 for example , experienced physicians tend to rely more on intuitive reasoning based on pattern recognition , which works rapidly and effectively to cope with common or routine problems , despite the fact that this approach might be more easily affected by biases.10,3338 on the other hand , analytical reasoning can provide a more accurate diagnosis based on logical processes , but may require physicians to use more of their functioning memory , thereby limiting their speed.29 physicians often become anchored in their initial hypothesis , whether it is right or not , search for confirming evidence to support their initial diagnosis , underestimate evidence against it , and therefore fail to adjust their initial impression in light of all available information.13,15 the effects of anchoring by an early incorrect diagnosis may lead to inaccurate judgment , inappropriate decisions , and ultimately unwanted and harmful impact on patients . preliminary diagnostic impressions may be subject to bias and should always be checked against other possibilities . a variety of debiasing strategies in making diagnoses have been introduced such as metacognition , cognitive forcing strategies , reflection , enforcing analytical reasoning , feedback , electronic systems , and checklists.13,14,22,23,29,3949 in this article , we introduce a new , practical , and quick - impact error - reducing strategy . in general , physicians generate an initial diagnosis as a most likely hypothesis through intuitive or analytical processing based on collected history and physical examination in conjunction with their own knowledge and the experience stored in their memory . however , this process might lead to diagnostic error due to cognitive bias with or without faulty knowledge . we propose here that it may be possible to reduce error and improve diagnostic accuracy by automatically and simultaneously recalling a cluster of diagnoses whose clinical manifestation / pictures are very close to the initial diagnosis impression . thus , in their initial diagnostic attempt , physicians do not necessarily need to reach the correct diagnosis . in other words , they can make the initial diagnosis as a so - called pivotal disease and at the same time , deploy the cluster of diseases that are very close to the pivotal disease in clinical manifestation ( symptoms or other findings).50 using this pivot and cluster strategy ( pcs ) , physicians might mitigate diagnostic errors . the pcs enables the recall of the most likely differentials in an en bloc manner automatically and swiftly , according to a cluster ( a set of differential diagnosis ) that is prepared in advance . a key characteristic of the pcs is that it provides a guide for diagnostic reasoning and acts as a cognitive aid that may reduce cognitive error ( figure 1 ) . although we introduce an arbitrary pivot disease in table 1 , every disease has the potential to be a pivot . in addition , any diseases in the cluster in table 1 can serve as another pivot . to make another disease as the new pivot some actual examples in which pcs could have served effectively are described in the following clinical scenarios . an internal medicine resident at an urgent care clinic saw a 32-year - old woman with no significant past medical history , complaining of right lower abdominal pain that came on earlier in the day . this resident actually had seen another woman with appendicitis who had a similar right lower quadrant abdominal pain just 2 days earlier . he again made the diagnosis of appendicitis , but the surgeon who examined her did not agree . although this example might seem extreme , the diagnostic process of this internal medicine resident was confounded by commonly seen biases such as availability bias , representative bias , and confirmation bias , all contributing to misdiagnosis . if the resident had used pcs at that time , he would have considered not only appendicitis , but also the cluster of appendicitis , making it more likely that alternative possibilities would have been considered such as diverticulitis , pelvic inflammatory disease , urinary tract infection , ovarian cyst , or ectopic pregnancy . thus , the pcs pulls in other possibilities on the differential that might not otherwise receive consideration . a 68-year - old man was brought to an emergency department ( ed ) with loss of consciousness . this patient was known to have cirrhosis of the liver due to alcoholism and had multiple prior visits to the ed . a similar presentation with altered level of consciousness had been attributed to hepatic encephalopathy that was treated and the patient was discharged . on this occasion , the emergency physician again attributed the patient s condition to hepatic encephalopathy after minimum examination , and started treatment for hepatic encephalopathy , but the patient s condition did not improve . the patient was admitted and computed tomography of the head was performed , revealing intracranial hemorrhage . the emergency physician s reasoning might have been vulnerable to several biases including the availability heuristic , posterior probability error , premature closure , or anchoring heuristic . however , if he had adopted the pcs for the cluster of hepatic encephalopathy ( altered level of consciousness ) , he would have generated an appropriate differential that would have included hypoglycemia , intracranial hemorrhage , toxidrome , sepsis , and others . clinical scenarios 1 and 2 demonstrate that pcs , as a combination of an intuitive diagnostic process with cognitive forcing strategy , one of the analytical processes , has the potential to improve the patients outcome . cognitive biases are inevitable ; however , we can minimize diagnostic errors due to cognitive bias by using pcs . the strategy effectively serves as a safety net of life - threatening diagnoses if the correct diagnosis is not made initially . the pivot automatically brings in its cluster that includes likely alternate diagnoses that need to be ruled out , especially for premature diagnostic closure , one of the most pervasive of cognitive biases.1 pcs differs from the traditional debiasing strategies in following at least four points : first , pcs is a debiasing strategy that comprises a combination of two mental processes , the intuitive process ( system 1 ) and analytical process ( system 2 ) , in one strategy . that enables physicians to double check their diagnosis by way of two consecutive diagnostic processes . in this way second , pcs urges physicians to focus specifically on the resemblance in clinical manifestation of the disease regardless of each disease entity . third , pcs visualizes one differential diagnosis list as a cluster in the disease map as shown in figures 1 and 2 . this can enable physicians to generate or expand the differential diagnosis list easily , especially when the new pivot is included in the original cluster , because these two clusters are overlapped in some differentials ( figure 2 ) . fourth , the concept of pcs can help learners to grasp the concept of building differential lists with the visual aid of the map . pcs is especially useful where the cognitive workload of the clinician is high or for less clinically experienced interns or residents who are less likely to generate appropriate differential diagnosis lists . for instance , we can offer classes in which medical students can cultivate the skills of pcs in medical schools , or we could offer training sessions for improving their pcs skills as extracurricular training in residency programs . in every session , medical students , interns , and residents are repeatedly required to list a cluster for a specific diagnosis . that training will enable them to list effective differential diagnoses even in a pressing and emergent situation . it is also important for learners to be made aware of the wide variety of cognitive pitfalls in many medical situations . pcs can be developed for settings in which diagnostic error is prevalent : internal medicine , emergency medicine , and family practice . further research could be directed at the cost benefit analysis of using pcs from the perspective of health economics .
diagnostic errors constitute a substantial portion of preventable medical errors . the accumulation of evidence shows that most errors result from one or more cognitive biases and a variety of debiasing strategies have been introduced . in this article , we introduce a new diagnostic strategy , the pivot and cluster strategy ( pcs ) , encompassing both of the two mental processes in making diagnosis referred to as the intuitive process ( system 1 ) and analytical process ( system 2 ) in one strategy . with pcs , physicians can recall a set of most likely differential diagnoses ( system 2 ) of an initial diagnosis made by the physicians intuitive process ( system 1 ) , thereby enabling physicians to double check their diagnosis with two consecutive diagnostic processes . pcs is expected to reduce cognitive errors and enhance their diagnostic accuracy and validity , thereby realizing better patient outcomes and cost- and time - effective health care management .
szacuje si , e w usa rocznie wykonuje si blisko 60 000 implantacji sztucznej zastawki serca . ryzyko dysfunkcji protezy zastawkowej wynosi 0,14% na rok . autorzy pracy przedstawili postpowanie kardiochirurgiczne w przypadku 2 pacjentek z dysfunkcj sztucznej zastawki aortalnej z 71-letnia pacjentka z nadcinieniem ttniczym , stabiln chorob wiecow , cukrzyc typu 2 , przewlek obturacyjn chorob puc ( pochp ) i hipercholesterolemi , po przebytej mastektomii lewostronnej i radioterapii zostaa przyjta do kliniki kardiochirurgii w maju 2011 r. z powodu dysfunkcji sztucznej zastawki aortalnej . przedoperacyjna przezklatkowa echokardiografia wykazaa brak ruchomoci jednego z dyskw sztucznej zastawki ze znacznym ograniczeniem ruchomoci drugiego dysku i wysokim gradientem przezzastawkowym . 87-letnia pacjentka z nadcinieniem ttniczym , pochp , chorob wrzodow w wywiadzie , utrwalonym migotaniem przedsionkw , po udarze niedokrwiennym lewostronnym zostaa przyjta do kliniki kardiochirurgii z powodu dysfunkcji sztucznej zastawki aortalnej . currently , implantation of an aortic prosthesis is one of the most commonly performed cardiac surgery procedures . a thrombus obstructing the prosthetic discs is the most common cause of dysfunction . only in 10% of cases either a thrombus can become fibrinated and resemble pannus , or pannus can stimulate thrombus formation on its surface and , consequently , resemble a thrombus . such clinical situations in which both thrombotic and fibrous components are present are observed in 12% of cases of prosthesis dysfunction . most often , pannus forms on the aortic side , whereas a thrombus develops more frequently on the mitral prosthesis . what is more , thrombus development is mainly associated with sudden aggravation of the clinical condition . regardless of the time between the operation and prosthesis dysfunction , insufficient oral anticoagulation is the most common cause of thrombus formation . none of the symptoms of prosthesis dysfunction , such as deterioration of exertion tolerance , exacerbating dyspnea , syncopes , or lack of the metallic sound of prosthesis closure , allow for differentiation between the two structures pannus and thrombus . the patient was a 71-year - old woman whose medical history included arterial hypertension , stable coronary artery disease , diabetes mellitus type 2 ( oral medications ) , chronic pulmonary obstructive disease ( copd ) , and hypercholesterolemia ; she had previously undergone left - sided mastectomy and radiotherapy ( 1990 ) . she was admitted to the cardiac surgery department in may 2011 due to aortic prosthesis dysfunction . in 2005 , the patient had simultaneously undergone the implantation of an aortic prosthetic valve ( st . jude a21 ) , mitral valve repair using wooler 's method , and coronary artery bypass grafting ( cabg ) of the right coronary artery ( rca ) . on admission , the patient was classified as nyha ( new york heart association ) functional class iv . preoperative transthoracic echocardiography ( tte ) showed an immobile prosthetic disc and a major reduction in mobility of a second . the transvalvular gradient was high ( maximal : 87 mmhg , mean : 44 mmhg ) . based on the tte image , the diagnosis of pannus or thrombus was taken into consideration . a moderate aortic valve insufficiency co - existed with a moderate mitral insufficiency and a secondary mild tricuspid valve insufficiency . the systolic and diastolic thickness of the interventricular septum was , respectively , 1.7 and 1.4 cm . hypokinesis of the postero - inferior cardiac wall within the parabasal and medial segments was revealed . a good ejection fraction ( ef ) echocardiographic presentation and the patient 's clinical condition proved that urgent surgery and prosthesis replacement were required . during the operation , pannus was found . a redo procedure was conducted , and an aortic bioprosthesis ( medtronic hancock ii 21 ) was implanted . the perfusion time was 129 min , and the cross - clamping time was 100 min . cardioprotection was obtained with 1700 ml of a cold , crystalloid , cardioplegic solution , administered antegrade and non - continuously . control postoperative echocardiography showed that the bioprosthesis reimplantation had been successful ( max gradient : 30 mmhg ) . the patient was an 87-year - old woman with arterial hypertension , copd , persistent atrial fibrillation , and a past history of ulcer disease and ischemic stroke ( 2 months earlier ) . she was admitted to the cardiac surgery department in 2011 , due to an aortic prosthesis dysfunction ( st . jude a21 implanted in 2000 ) . ten days before the operation , the patient was admitted to the cardiology department in order to undergo the reimplantation of a stimulating device ( stimulator biotronik actros s - vvi and ventricular electrode biotronik px 60-bp ) implanted in 2002 due to 2/3 degree atrioventricular block ( her medical history included numerous rhythm and conductibility disturbances causing recurrent mas syndrome ) . before the reimplantation of the stimulating device , at an appropriate time , clopidogrel ( taken by the patient since the stroke allergic to acetylsalicylic acid ) and oral anticoagulation were stopped , and low - molecular - weight heparin ( lmwh ) was introduced instead ( enoxaparin ) . on admission , the stimulator was reimplanted without complications . during the patient 's stay at the cardiology department , tte revealed abnormal function of the aortic prosthesis , with a significant transvalvular gradient ( 64 mmhg ) . both examinations confirmed good mobility of the anterior half - disc and an obstruction of the posterior half - disc resulting in significant aortic regurgitation . the blocked disc interfered with the blood outflow , giving the symptoms of valve stenosis . moderate mitral insufficiency with thickened valve leaflets and functional moderate tricuspid insufficiency were also discovered . the left atrium was enlarged to 6.6 x 5.1 cm ( volume 140 ml ) . significant left ventricular hypertrophy was found , but the ef was relatively good ( 54% ) . ultrasonography of the carotid vessels revealed bilateral atherosclerotic changes , but without significant flow disturbances . based on the assessment of the aortic prosthesis , a decision was made to repair it . after the removal of slightly attached thrombotic components , the soft tissue of the pannus became clearly visible . the pannus was removed from the ventricular side of the prosthesis , which resulted in good mobility of the half - discs . total perfusion time was 94 minutes , and aortic cross - clamping time was 59 minutes . cardioprotection was achieved with 1300 ml of a cold , crystalloid , cardioplegic solution , administered antegrade . intraoperative tee was conducted , confirming normal functionality of the prosthesis , while revealing slight aortic insufficiency and a maximal transvalvular gradient of 30 mmhg ( fig . the patient was extubated in the afternoon of the first postoperative day . after the surgery , acute kidney injury was observed ( urea 15 mmol / l and creatinine 225 l / l ) . consequently , on the fourth day after the operation , the patient was discharged from the icu . their results confirmed the success of the removal of the pannus and thrombus from the aortic prosthesis , showing a maximal gradient of 30 mmhg . slightly worse global contractility of the myocardium , especially of the postero - inferior wall , with a decreased ef of 52% , was also observed . image of a mass resembling a slightly attached thrombus and obstructing the artificial aortic valve fluoroscopy image the arrow points to the outline of the structure impairing the mobility of the prosthetic valve disc transesophageal echocardiography intraoperative image of the properly functioning aortic prosthetic valve : visualized open discs ( after removal of the pannus with thrombus ) the patient was a 71-year - old woman whose medical history included arterial hypertension , stable coronary artery disease , diabetes mellitus type 2 ( oral medications ) , chronic pulmonary obstructive disease ( copd ) , and hypercholesterolemia ; she had previously undergone left - sided mastectomy and radiotherapy ( 1990 ) . she was admitted to the cardiac surgery department in may 2011 due to aortic prosthesis dysfunction . in 2005 , the patient had simultaneously undergone the implantation of an aortic prosthetic valve ( st . jude a21 ) , mitral valve repair using wooler 's method , and coronary artery bypass grafting ( cabg ) of the right coronary artery ( rca ) . on admission , the patient was classified as nyha ( new york heart association ) functional class iv . preoperative transthoracic echocardiography ( tte ) showed an immobile prosthetic disc and a major reduction in mobility of a second . the transvalvular gradient was high ( maximal : 87 mmhg , mean : 44 mmhg ) . based on the tte image , the diagnosis of pannus or thrombus was taken into consideration . a moderate aortic valve insufficiency co - existed with a moderate mitral insufficiency and a secondary mild tricuspid valve insufficiency . the systolic and diastolic thickness of the interventricular septum was , respectively , 1.7 and 1.4 cm . hypokinesis of the postero - inferior cardiac wall within the parabasal and medial segments was revealed . a good ejection fraction ( ef ) echocardiographic presentation and the patient 's clinical condition proved that urgent surgery and prosthesis replacement were required . during the operation , pannus was found . a redo procedure was conducted , and an aortic bioprosthesis ( medtronic hancock ii 21 ) was implanted . the perfusion time was 129 min , and the cross - clamping time was 100 min . cardioprotection was obtained with 1700 ml of a cold , crystalloid , cardioplegic solution , administered antegrade and non - continuously . control postoperative echocardiography showed that the bioprosthesis reimplantation had been successful ( max gradient : 30 mmhg ) . the patient was an 87-year - old woman with arterial hypertension , copd , persistent atrial fibrillation , and a past history of ulcer disease and ischemic stroke ( 2 months earlier ) . she was admitted to the cardiac surgery department in 2011 , due to an aortic prosthesis dysfunction ( st . jude a21 implanted in 2000 ) . ten days before the operation , the patient was admitted to the cardiology department in order to undergo the reimplantation of a stimulating device ( stimulator biotronik actros s - vvi and ventricular electrode biotronik px 60-bp ) implanted in 2002 due to 2/3 degree atrioventricular block ( her medical history included numerous rhythm and conductibility disturbances causing recurrent mas syndrome ) . before the reimplantation of the stimulating device , at an appropriate time , clopidogrel ( taken by the patient since the stroke allergic to acetylsalicylic acid ) and oral anticoagulation were stopped , and low - molecular - weight heparin ( lmwh ) was introduced instead ( enoxaparin ) . on admission , the stimulator was reimplanted without complications . during the patient 's stay at the cardiology department , tte revealed abnormal function of the aortic prosthesis , with a significant transvalvular gradient ( 64 mmhg ) . both examinations confirmed good mobility of the anterior half - disc and an obstruction of the posterior half - disc resulting in significant aortic regurgitation . the blocked disc interfered with the blood outflow , giving the symptoms of valve stenosis . moderate mitral insufficiency with thickened valve leaflets and functional moderate tricuspid insufficiency were also discovered . the left atrium was enlarged to 6.6 x 5.1 cm ( volume 140 ml ) . significant left ventricular hypertrophy was found , but the ef was relatively good ( 54% ) . ultrasonography of the carotid vessels revealed bilateral atherosclerotic changes , but without significant flow disturbances . based on the assessment of the aortic prosthesis , a decision was made to repair it . after the removal of slightly attached thrombotic components , the soft tissue of the pannus became clearly visible . the pannus was removed from the ventricular side of the prosthesis , which resulted in good mobility of the half - discs . total perfusion time was 94 minutes , and aortic cross - clamping time was 59 minutes . cardioprotection was achieved with 1300 ml of a cold , crystalloid , cardioplegic solution , administered antegrade . intraoperative tee was conducted , confirming normal functionality of the prosthesis , while revealing slight aortic insufficiency and a maximal transvalvular gradient of 30 mmhg ( fig . consequently , on the fourth day after the operation , the patient was discharged from the icu . their results confirmed the success of the removal of the pannus and thrombus from the aortic prosthesis , showing a maximal gradient of 30 mmhg . slightly worse global contractility of the myocardium , especially of the postero - inferior wall , with a decreased ef of 52% , was also observed . image of a mass resembling a slightly attached thrombus and obstructing the artificial aortic valve fluoroscopy image the arrow points to the outline of the structure impairing the mobility of the prosthetic valve disc transesophageal echocardiography intraoperative image of the properly functioning aortic prosthetic valve : visualized open discs ( after removal of the pannus with thrombus ) pannus is a granulation tissue which develops as part of the healing process . according to teshima et al . , increased levels of tgf-1 in patients with artificial aortic valves stimulate the overgrowth of granulation tissue , giving rise to pannus . pannus is more closely connected with the prosthetic surface , so its removal is related to a greater risk of mechanical valve damage . song et al . also described positive effects of pannus removal after mitral valve ring annuloplasty . however , we have not found any case involving the removal of both pannus and thrombus from an aortic prosthesis . in the case of our first patient , well - formed pannus was closely connected to the prosthesis , completely excluding the possibility of its removal ; reimplantation was the only solution . in the second case , the balloting thrombus and minor soft pannus were easy to remove . considering the patient 's age , the operative risk was high . moreover , redo procedures are always associated with higher risk . on the other hand , some authors have proved that reoperation is not an independent risk factor for operative mortality . the mortality of elective redo procedures is estimated at 1.4% , which is comparable with the mortality associated with primary aortic valve replacement [ 9 , 10 ] . the clinical course of prosthesis dysfunction can sometimes prove to be serious and may include pulmonary edema and cardiogenic shock . in the case of our first patient , however , a thrombus could have been suspected just after the stroke ; it could have resulted from an embolic event , especially as it developed during the cessation of oral anticoagulation and clopidogrel . the presence of both pannus and thrombus could have suggested that the discontinuation of oral anticoagulation resulted in thrombus formation around the previously present pannus despite lmwh treatment ( enoxaparin ) . the recently formed thrombus was susceptible to fragmentation and associated with a high embolic risk . embolic events , inadequate oral anticoagulation , and deterioration of circulatory condition are the primary indications of the presence of a thrombus on a valvular prosthesis . barbetseas et al . evaluated the sensitivity of tee in diagnosing prosthesis dysfunction at 83% . only small structures posed problems , especially if the dysfunction was caused by pannus interfering with the hinges of the prosthesis . in our observation , echocardiography in combination with the patient 's medical history allowed a final diagnosis to be established . in both cases , tte was the first line in the examination process . it gave indirect evidence of a mass blocking the prosthetic valve . during the examination of the first patient the final diagnosis was made considering the time period from the primary operation ( 6 years ) and aortic prosthesis involvement . additionally , tee showed a large mass slightly attached to the prosthesis , whose echogenicity was lower . emphasized the value of multimodal diagnostics in precisely imaging the changes on a prosthesis that manifest poorly . the clinical condition of our patients correlated relatively well with the echocardiographic image . according to some authors , echocardiographic data and clinical criteria are not sufficient to differentiate between pannus and thrombus . the subject literature also underlines the value of spiral tomography and fluoroscopy in diagnosing the cause of prosthesis dysfunction ( pannus or thrombus ) [ 15 , 16 ] . the risk of thrombus development on an aortic prosthesis is estimated at 0.2 - 6% per year per patient . the embolic event rate is reported at 1.8% of patients per year . in such cases , surgery is the preferred treatment of choice . according to some authors , thrombolytic treatment should be chosen in the case of small thrombi , regardless of circulatory failure ( which is also in accordance with the recommendations of the american college of chest physicians ) . however , according to the recommendations for managing left heart thrombi , thrombolysis should be applied : in patients classified as nyha functional class iii or iv with high operative risk and in patients classified as functional nyha class i or ii when the thrombus is immobile or situated in the left atrium . in our second patient , considering the previous stroke and age , thrombolysis would have been associated with a greater risk of complications . emphasis should be put on the early diagnosis of prosthesis dysfunction , which allows for the avoidance of complications and decreases the operative risk.the reported cases confirm the role of echocardiography in diagnosing thrombus and pannus as a cause of prosthesis dysfunction.preoperative diagnostics facilitated the selection of surgical treatment . however , the surgical approach was individualized during surgery.the role of adequate anticoagulation , reducing the risk of thromboembolic complications , must be once again underlined . any change in the type of anticoagulation is especially significant and requires careful monitoring of the patient . emphasis should be put on the early diagnosis of prosthesis dysfunction , which allows for the avoidance of complications and decreases the operative risk . the reported cases confirm the role of echocardiography in diagnosing thrombus and pannus as a cause of prosthesis dysfunction . the role of adequate anticoagulation , reducing the risk of thromboembolic complications , must be once again underlined . any change in the type of anticoagulation is especially significant and requires careful monitoring of the patient .
introductionapproximately 60 000 prosthetic valves are implanted annually in the usa . the risk of prosthesis dysfunction ranges from 0.1% to 4% per year . prosthesis valve dysfunction is usually caused by a thrombus obstructing the prosthetic discs . however , 10% of prosthetic valves are dysfunctional due to pannus formation , and 12% of prostheses are damaged by both fibrinous and thrombotic components . the authors present two patients with dysfunctional aortic prostheses who were referred for cardiac surgery . different surgical solutions were used in the treatment of each case.case study 1the first patient was a 71-year - old woman whose medical history included arterial hypertension , stable coronary artery disease , diabetes mellitus , chronic obstructive pulmonary disease ( copd ) , and hypercholesterolemia ; she had previously undergone left - sided mastectomy and radiotherapy . the patient was admitted to the cardiac surgery department due to aortic prosthesis dysfunction . transthoracic echocardiography revealed complete obstruction of one disc and a severe reduction in the mobility of the second . the mean transvalvular gradient was very high . during the operation , pannus covering the discs surface was found . a biological aortic prosthesis was reimplanted without complications.case study 2the second patient was an 87-year - old woman with arterial hypertension , persistent atrial fibrillation , and copd , whose past medical history included gastric ulcer disease and ischemic stroke . as in the case of the first patient , she was admitted due to valvular prosthesis dysfunction . preoperative transthoracic echocardiography revealed an obstruction of the posterior prosthetic disc and significant aortic regurgitation . transesophageal echocardiography and fluoroscopy confirmed the prosthetic dysfunction . during the operation , a thrombus growing around a minor pannus was found . the thrombus and pannus were removed , and normal functionality of the prosthetic valve was restored.conclusionsprecise and modern diagnostic methods facilitated selection of the treatment method . however , the intraoperative view also seems to be crucial in individualizing the surgical approach .
lumbar spondylolysis , a defect in the pars interarticularis , is a common cause of low back pain in adolescents and young adults . it occurs in 6% of the general population and has been reported more commonly in men . spondylolysis commonly occurs at the fourth and fifth lumbar vertebrae , accounting for more than 95% of total cases of spondylolysis . symptomatic pars lesions appear to be particularly a clinical problem in adolescents , especially adolescent athletes . conservative treatment is commonly considered first in most patients , but those who remain symptomatic may benefit from operative treatment . when the source of back pain is the pars defect itself , direct repair of spondylolysis seems to be most effective and appears to be more logical than posterior spinal fusion in the patients without disc degeneration or spondylolisthesis . multilevel spondylolyses are rare , varying between 1.2% and 5.6% of lumbar spondylolysis cases , and majority involve 2 levels , l4 and l5 . so for , to our knowledge , only 11 cases of 3-level lumbar spondylolyses have been reported in the existing english literature . in this paper , we reported 3 cases of 3-level lumbar spondylolyses in young adults and review the management choices made in these cases . this study obtained the approval of the medical ethics committee of our hospital ( general hospital of armed police force , beijing , china ) . case 1 , a 22-year - old male , presented with low back pain for 2 years . he did not complain of radicular pain , numbness , and concomitant claudication in his lower extremities . he had a history of lumbar injury dropped down from 2 meters high 2 years ago . motor , sensory , and tendon reflex were all normal in his 2 lower limbs . lumbar radiography and computed tomography ( ct ) scan showed left l3 and bilateral l4 and l5 spondylolyses without any slippage . before admission to our hospital , the patient had underwent a 3-month course of conservative treatment with physiotherapy and nonsteroidal anti - inflammatory drugs in a local clinic , but these therapies did not relieve his low back pain . because ct scans have showed terminal - stage findings in the isthmic lysis areas , no abnormality of the posterior arches such as dysplasia and spina bfida was found , surgical indication for left l3 and bilateral l4 and l5 direct isthmic repair via a pedicle screw case 2 , a 22-year - old male , was admitted with low back pain for 14 months . pain was originated from an acute lumbar heavy blow 14 months ago , and increased gradually . one month ago , he felt numbness in his right hip and right lateral thigh . motor , sensory , and tendon reflex were all normal in his 2 lower limbs . radiographs and ct scans showed bilateral l3l5 spondylolyses without any slippage ( figures 1 and 2 ) . after his lumbar injury , he was sent to a local hospital , and was diagnosed with l3l5 bilateral spondylolyses by plain radiography . since then , he has undergone conservative treatment with bracing to protect lumbar spine , physiotherapy , and oral nonsteroidal anti - inflammatory drugs in a local clinic , but these therapies did not relieve his low back pain . after he underwent a 4-month course of conservative treatment , further ct scan showed terminal - stage findings in the l3l5 bilateral isthmic lysis areas . surgical indication for bilateral l3l5 direct isthmic repair via a screw hook technique was recommended . case 3 , a 23-year - old man , was admitted with low back pain for 6 months . in the beginning a month ago , he sprained his waist carelessly , which aggravated his back pain . since then , he has undergone conservative treatment in a local hospital , but conservative treatment did not relieve his back pain motor , sensory , and tendon reflex were all normal in his 2 lower limbs . because mri showed l5/s1 disc degeneration , we needed to identify whether this disc was a pain - generating disc . the result of discography showed l5/s1 disc disruption with pain reproduction , which indicated the l5/s1 disc as the one of the back pain sources . because ct scan had shown terminal - stage findings in the l3l5 bilateral isthmic lysis areas , accordingly , surgical indication for bilateral l3 and l4 direct isthmic repair and l5/s1 interbody fusion was recommended . three cases of 3-level lumbar spondylolyses were diagnosed and subsequently direct isthmic repair in 2 cases and a combined surgery of isthmic repair and interbody fusion in 1 case were recommended for the 3 patients preoperatively based on clinical findings consistent with imaging study . case 1 underwent a surgery of direct isthmic repair in 5 lytic defects . under general anesthesia , conventional posterior midline approach to lumbar spine was used to exposure l3l5 spinous processes , vertebral laminae , and facet joints . first , a 6.0 45 mm pedicle screw was inserted to involved vertebra under fluoroscopic guidance . second , the involved lysis area was curetted , freshened , and grafted with autologous iliac bone . finally , sublaminar hook was placed , and connected through a short rod under compression with corresponding pedicle screw . the total surgical time was 3 hours with 300 ml of blood loss . a lumbar - sacral brace was used for 3 months after surgery . surgical procedure in case 2 was the same as case 1 . the total surgical time was 3 hours with 500 ml of blood loss . postoperatively , the symptoms of low back pain and numbness in right hip and right lateral thigh disappeared . four pedicle screws were placed in l5 and s1 vertebrae bilaterally , then left laminectomy was performed to allow a cage placement ( 10 26 mm ) filled with autogenous local bone derived from laminectomy between the decorticated endplates of l5 and s1 , and finally 2 rods were connected with 4 pedicle screws under compression . the total surgical time was 3.5 hours with 400 ml of blood loss . after surgery , a brace was placed for 3 months , and symptom of low back pain was almost completely disappeared . case 1 has undergone a follow - up of 2 years , and his low back pain was almost completely disappeared . at 6 months after surgery , bone healing was found in all 5 lytic defects . at 8 months after surgery in case 2 , bone healing was found in all 6 lytic defects . during a 1-year follow - up period , he was pain - free . at 2-year follow - up in case 3 , his low back pain had not recurred , and bone fusion was found between l5 and s1 vertebral bodies and in all 4 isthmi of l3 and l4 according to the evaluation of lumbar radiographs and ct scans . the surgery for the 3 patients was successfully performed and their symptoms were obviously relieved and lumbar function was markedly improved . the alleviation of back pain and improvement of lumbar function was assessed by the change in the degree of pain with a self - assessment of pain by an 11-point visual analog scale ( vas , 010 ) pain scale and the oswestry disabiligy index ( odi , version 1.0 , 0100 ) . lumbar spondylolysis is a common disease , in more than 90% of cases located in l5 . a pars defect develops into a chronic nonunion , and becomes bridged by tissue composed of a combination of fibrous , cartilaginous , or osseous material . in this circumstance , the origin of chronic low back pain could be in the scar and connective tissue rich in nociceptive nerve endings that bridges the gap of a pars defect . extra load exerted on the motion segment may cause disc degeneration , which is therefore an accompanying disorder of spondylolysis . the prevalence of progressive disc degeneration in the involved level is markedly increased in the adult spondylolytic patients who often appear low back pain later in life , after an asymptomatic childhood . the pathology of lumbar spondylosis was considered being congenital failure of fusion of 2 ossification centers or a hyperflexion injury at birth , but spondylolysis had never been founded in embryos , fetus and at birth . following wiltse 's proposal in 1957 , the pathology of spondylolysis was shifted to a consensus of fatigue fracture of the pars interarticularis with a strong hereditary basis . for now , 2 factors can explain isthmic lysis , both genetic and mechanical . no specific genetic variation was identified , but it would seem that a genetic predisposition to this pathology may exist . yamada et al reported 3 cases of lumbar spondylolysis in juveniles from the same family . the highest incidence was reported in native residents in greenland up to 54% . from a mechanical point of view , heavy work and repeated injuries seem to favor the appearance of lumbar spondylolysis . a number of studies have described the association of sports activities with spondylolysis , and all of them support the stress fracture theory . traumatic spondylolysis can be diagnosed early with the use of isotope bone scan or single photon emission computed tomography scan . preoperative ct scan is very important to evaluate the degree of sclerosis in the bony margins of the isthmic defect . the obvious osteosclerosis was shown in all the isthmic defect margins in the 3 patients by ct scan , which indicated that direct isthmic repair was necessary . preoperative lumbar mri is imperative to evaluate the state of intervertebral disc . in our case 3 , due to l5/s1 disc degeneration , an additional lumbar discography was used to indicate this disc as a painful disc . this result finally determined the indication for fusion surgery at the l5/s1 segment instead of a direct isthmic repair in l5 . there are many types of direct repair methods , including scott 's wiring , buck 's screwing , louis butterfly plate , and screw hook technique ( pedicle screw and hook rod system ) . from clinical aspects , screw hook technique allows for fixation of the defects in the pars interarticularis with rigid implants and exerts force along the lamina to effectively suppress the defect motion , which is critical for better bone healing . the precondition of direct defect repair is normal signal intensity in the involved disc shown in t2-weighted mri . if not , lumbar fusion should be considered . in the present cases 1 and 2 , the patients were young with normal discs and normal posterior arches , so l3l5 direct isthmic pair was reasonable . in the case 3 , because mri showed both the l3/4 and l4/5 discs normal and the l5/s1 disc degeneration with disruption and pain reproduction in discography , accordingly a combined surgery of bilateral l3 and l4 direct isthmic repair and l5/s1 interbody fusion was performed for the young patient . surgical treatment varies between fusion , direct isthmic repair , and combined management associating 2 procedures at different levels . success of management of multilevel spondylolyses depends on the choice of appropriate treatment for every patient . we reported here 3 cases of 3-level lumbar spondylolyses with good clinical and radiological results . hook technique is a simple and safe procedure for the motion segment with normal disc . although our clinical results are satisfactory , all 3 patients are young and the duration of their follow - up periods has not been long . therefore , further observation of these patients clinical course and radiological results at the segments treated as well as adjacent segments is needed .
abstractthree - level lumbar spondylolyses are extremely rare . so far , only 11 cases were reported in the literature . treatment of multilevel spondylolyses has not been consistent . conservative treatment is commonly considered first in most patients , but those who remain symptomatic may benefit from operative treatment . we report here 3 cases of 3-level lumbar spondylolyses that were treated successfully with direct isthmic repair in 2 cases and a combined surgery of isthmic repair and interbody fusion in 1 case . our clinical results indicated that direct defect repair using the screw hook technique is a simple and safe procedure for the motion segment with normal disc . if the involved disc shows degenerative change , fusion surgery should be consideredsurgical treatment of multilevel spondylolyses varies between fusion , direct isthmic repair , and combined management associating 2 procedures at different levels . the success of management of the 3 patients with 3-level spondylolyses depends on the choice of appropriate treatment for every patient .
the korean public is highly concerned about the risk of occupation cancer as a result of exposure to carcinogens in the workplace . an increase in the incidence of occupational cancer among workers based in industries manufacturing goods such as asbestos textiles , semiconductors , and tires , as well as those working in the refinery / petrochemical sector has raised public concern ( 1,2,3,4 ) . cancer is the most common cause of death in the korean population and because of the costs incurred and the impact it has on the loss of workforce , it is of major concern for employers or policymakers ( 5 ) . occupational cancer is defined as cancer resulting from occupational exposure to carcinogens or an increased risk of cancer incidence during the performance of a specific task ( 6 ) . usually , the evidence indicating if a worker was occupationally exposed to a carcinogen or not is insufficient and the measurement of the past carcinogen exposure level or the cumulative exposure level is very difficult . the general ambiguity regarding past exposure makes the decision for the work - relatedness a controversial subject ( 7 ) . article 34 on the enforcement decree of the industrial accident compensation insurance ( iaci ) act defines the criteria for the recognition of work - related disease . the second is to determine the cumulative exposure level and latent period , which is the period between the first exposure to causative agent and the diagnosis of cancer . occupational lung cancer is covered by 2 acts under korean law . according to the ordinance of the ministry of employment and labor , workers dealing with soil , rocks , or minerals who are exposed to dust that might cause pneumoconiosis and who have confirmed pneumoconiosis by chest radiography ( profusion of 1/0 or greater according to the international labor organization [ ilo ] classification ) can be compensated according to the act on the prevention of pneumoconiosis and protection , etc . the occupational safety and health research institute of the korean occupational safety and health agency and the occupational lung disease institute of the workers ' compensation and welfare service ( comwel ) investigate individual cancer cases to make a scientific decision on the work - relatedness . this process involves thorough occupational history taking , a work environment survey , and a review of epidemiologic literature and medical records . the comwel usually request this epidemiologic investigation for the majority of claims . the criteria determining whether or not an employee is entitled to compensation as a result of occupational cancer are a major issue because the criteria is the only legal standard adapted all processes of compensation for occupational disease from comwel to the administrative court . workers ' compensation and approval rates of individual countries are very closely related to social contexts such as social recognition for the occupational disease , the health insurance system , or the social security system ( 10 ) . owing to the increase in public concern in korea , the opinion that the criteria for occupational cancer should be reviewed and amended on the basis of up - to - date scientific evidence was presented . the aim of this study was to review the history of compensated occupational cancer in korea and to clarify and update the criteria for awarding occupational cancer compensation in korea . this paper will assist clinicians in understanding the issue of occupational cancer for a more informed decision regarding whether compensation should be awarded or not . a review of the published literature was undertaken to determine the strength of the causal association between cancer risks and the workplace environment . literature included data published by the international agency for research on cancer ( iarc ) ( 11,12,13,14,15,16,17,18 ) and related peer - reviewed articles . the occupational cancer lists of international organizations such as the ilo ( 19 ) and the european union ( eu ) and their member countries were also investigated ( 20 ) . an analysis of each individual occupational cancer case awarded compensation in korea between 1992 and 2012 was conducted to decide the validity of including specific causative agents and types of cancer to the criteria list . based on these results , we suggested the list of the carcinogens and its target cancers to include recent amendments of the scope and criteria . the first officially reported case of occupational cancer in korea was a case of mesothelioma at an asbestos thread factory in 1993 . a 56-yr - old non - smoking woman employed at the factory for 18 yr was officially approved by the comwel and was compensated by the iaci ( 21 ) . after the first reported compensation case , between 1992 and 1999 , out of 379 claims for occupational cancer , only 22 cases were confirmed as occupational disease by the occupational safety and health research institute ( table 1 ) ( 22 ) . the 31 lung cancer cases associated with pneumoconiosis reported until 1999 that were compensated according to the pppw act are not included in table 1 , which only included cases to be conduct professional and specific examination for the work - relatedness by occupational physician and occupational hygienist of oshri . however , table 2 included all cases to be decided based on pppw act , the result of special examination for the work - relatedness , or the self process of comwel . from 2000 to 2009 , out of 1933 claims , the comwel approved 253 cases as occupational cancer ( 23 ) . sixty - one of these were compensated according to the pppw act . from january 2010 to october 2012 , out of 544 claims , the comwel approved 266 cases as occupational cancer ( table 2 ) . especially after 2010 , the number of compensated cancers also increased because the social awareness for occupational cancers or carcinogens such as asbestos or benzene improved and the claims from various high risk jobs such as miners , masons , construction workers , painters , welders , and so on , which would be influenced by social issue for the occupational cancer in semiconductor industry or communal claims by metal union . respiratory cancers , especially lung cancer , were the most common cancers compensated for by the iaci . between 2000 and 2009 , occupational cancer types included respiratory ( n=107 ) , lymphohematopoietic ( lhp ) ( n=35 ) , malignant mesothelioma ( n=28 ) , and digestive tract cancer ( n=74 ) ( 23 ) . between january 2010 and october 2012 , occupational cancer types included respiratory ( n=226 ) , lhp ( n=5 ) , malignant mesothelioma ( n=19 ) , and digestive tract cancer ( n=2 ) . cancers originating from digestive tract cancer abruptly decreased after the late 2000s , because hepatocellular carcinoma related to workload or stress in healthy hepatitis b virus carriers were rejected in court , and the specific criteria for recognition of liver disease was amended in 2003 ( 24 ) . between 1999 and 2005 , lung cancer related to asbestos exposure ( 62.3% , 33 out of 53 cases ) and lhp cancer related to benzene ( 84.4% , 43 out of 50 cases ) was the most common cause of occupational cancers ( 5 , 25 , 26 ) . between 2000 and 2009 , construction ( n=15 ) was most common industry among compensated cancers , followed by shipbuilding ( n=11 ) , and other metal product manufacturing ( n=10 ) . the most common occupation among compensated cancers was metal molders , welders , and related trades workers ( n=16 ) , followed by miners , shot firers , stone cutters , and carvers ( n=14 ) ( table 3 ) ( 23 ) . after the early 1990s , the number of claims and compensations has increased , but the origin of cancers awarded compensation is still limited to 2 organs , namely the lung and lhp system . the most probable carcinogens were asbestos ( 45% ) , hexavalent chromium ( 30% ) , and crystalline silica ( 19% ) ( 27 ) . in case of lhp malignancies , the most probable carcinogens were pure benzene ( 27.5% ) , impurity of benzene in a mixture ( 56.9% ) , and ionizing radiation ( 8.0% ) ( 26 ) . with these data in mind , the existing criteria and scope for occupational cancer required amendment with respect to the causative carcinogens and the target cancer type . the prior korean criteria included only 10 agents and were very outdated compared with the ilo occupational disease list or the iarc list of group 1 carcinogens . mesothelioma due to asbestos was included in the occupational disease list in convention 121 in 1980 . on recommendation no . 194 in 2002 , the ilo added 15 carcinogens to the list including asbestos ; benzidine and its salts ; bis - chloromethyl ether ; chromium vi ; coal tars and coal tar pitches ; beta - naphthylamine ; vinyl chloride ; benzene ; toxic nitro and amino derivatives of benzene or its homolog ; ionizing radiation ; tar , pitch , bitumen , mineral oil , anthracene , or related compounds ; coke oven emissions ; nickel ; wood dust ; and other carcinogens . at this time , an association between specific occupational cancers caused by specific carcinogens was not included . in 2010 , arsenic , beryllium , cadmium , erionite , ethylene oxide , and hepatitis b and c viruses were included on the ilo occupational cancer list ( 8) . the iarc reviewed the entire group i carcinogenic agents list between 2006 and 2010 , and 113 agents were included as group i carcinogens . since these agents cover both occupational and environmental exposure , siemiatycki et al . ( 28 ) proposed 28 agents and 12 occupations or industries as definite occupational risk factors and we listed other additional occupational carcinogens updated after the review of iarc . in the european occupational cancer lists including those of austria , belgium , denmark , germany , finland , france , italy , luxemburg , portugal , spain , swiss , and the eu . finland included the fewest agents ( n=17 ) and germany , denmark , and luxemburg included > 40 agents . lung cancer due to chromate , asbestos , or nickel and malignant mesothelioma due to asbestos were included in the list of occupational cancers in all countries . the prior criteria for recognition of occupational cancer according to the enforcement decree of the iaci act included only 11 agents , for example soot , tar , pitch , asphalt , mineral oil , paraffin , vinyl chloride , chrome or its compounds , benzene , asbestos , and hepatitis virus . except for hepatocellular carcinoma due to occupational exposure to hepatitis b or c virus , which was included in the criteria in 2003 , other carcinogens and their target cancers have not ever been amended after since the 1980s ' . table 4 shows the presented agents on the occupational cancer lists of the ilo , and european countries , those suggested by siemiatycki et al . or us based on the iarc list , and the korean criteria of occupational carcinogens before 2013 . originally , cancer caused by soot , tar , pitch , asphalt , mineral oil , or paraffin was incorrectly identified as epithelial cancer , but needed to be amended as skin cancer . in addition , myelodysplastic syndrome is not cancer , but is a hematologic malignancy , and the epidemiologic evidence for larynx cancer caused by chrome exposure was insufficient . vinyl chloride exposure as a cause of human hepatocellular carcinoma had sufficient evidence . in case of ionizing radiation , as a definite cause of cancer was not included in prior criteria , which only included acute radiation injury - related diseases . first , the number of covered agents was smaller than those of the international lists . third , a reconsideration of exposure duration or cumulative exposure level was needed ; however , this was not included in the current amendment because this would require a national consensus across professional review boards considering various situations of exposure in korea . the main points of this amendment were as follows : first , the type and number of carcinogens should match those of international levels , considering the lists of the ilo , eu , and iarc , with the occupational cancer list of the ilo taking first priority . second , the priority order of the list should be decided by the carcinogen exposure possibility in korea . third , the criteria should include matches between specific carcinogens and target cancers , as evidenced by clinical data from the iarc . we , who suggested the list of carcinogens and its target cancers for recent amendment and directly participated in the policy making process of amendments to the scope and criteria , selected 28 agents and 11 industries to extend the criteria of occupational cancer according to the results the previously described review of the occupational cancer list of the ilo , the eu , and the iarc classification , and the exposure possibility in korea to identified risk factors . aflatoxins , 4-aminobiphenyl , arsenics , ultraviolet - emitting tanning devices , benzidine , beryllium , beta - naphthylamine , 1,3-butadiene , cadmium , crystalline silica , diesel engine exhaust , erionite , ethylene oxide , formaldehyde , leather dust , nickel compounds , passive smoking , polyaromatic hydrocarbons ( pahs ) , radon , shale oil , solar radiation , strong inorganic acid , 2,3,7,8-tetrachlorodibenzo - para - dioxin , trichloroethylene , ortho - toluidine , wood dust , anti - cancer drugs or immunosuppressants , and sulfur mustard were included in reviewed list of agents . occupations or industries included the rubber industry , painting magenta production , coal gasification , aluminum production , auramine production , isopropyl alcohol manufacture using strong acids , underground hematite mining , iron and steel founding , coke production , and coal - tar distillation . coal gasification , coke production , and coal - tar distillation were reviewed with respect to pahs . these industries could be matched to causative agents in a korean - based exposure situation . occupational cancer risk of the rubber industry could be explained by exposure to aromatic amines or solvents . the magenta , aluminum , auramine , isopropyl alcohol , or hematite production industries are rare in korea . pahs , crystalline silica , and strong inorganic acid could explain the occupational cancer risks of the iron and steel founding industry . as a result , it was not possible to determine the exposure to passive smoking , solar radiation , ultraviolet - emitting tanning device , and solar radiation between environmental exposure and occupational exposure . in korea , exposure to aflatoxins , sulfur mustard , erionite , shale oil , and 2,3,7,8-tetrachlorodibenzo - para - dioxin is unlikely and was classified as low risk . measuring the exposure level of leather dust , strong inorganic acid mist , pahs , 4-aminobiphenyl , and diesel engine exhaust and trichloroethylene were recently upgraded by the iarc and information concerning exposure measurements , epidemiological evidence , or cases in korea was limited . anti - cancer drugs and immunosuppressant exposure are usually important to patients . in total , 13 agents and 1 occupation among 39 considerable agents and industries were assigned as priority add - ons to the amended scope and criteria specific for korea . we also suggest classifying the system of occupational cancer into an agent- and organ - oriented systems according to the specific criteria for the recognition of occupational diseases according to the enforcement decree of labor standard act ( lsa ) and the enforcement decree of iaci act . therefore , on the basis of the scope of occupational cancers of the lsa , on which all the agents were listed without target cancer , agents were listed with target cancers based on organ oriented system named cancer on the specific criteria of the iaci act . especially , regarding some agents such as benzene , asbestos , or chrome , the considerations related with exposure duration or level persisted unless there were definite evidences . as a result , 14 agents and occupation matched with 12 target cancers were added to the list including x - rays or -rays ; arsenic and its inorganic compounds ; nickel compounds ; cadmium and its compounds ; beryllium and its compounds ; wood dust ; benzidine ; beta - naphthylamine ; crystalline silica ; formaldehyde ; 1,3-butadiene ; radon-222 and its decay ; spray painting ; ethylene oxide . asphalt and paraffin were removed because of the ambiguity of chemical characteristics that could be masked by other agents . the descriptions for some agents were revised to enhance the clarity of the characteristics of the agent ; tar was revised to coal tar , pitch was revised to coal tar pitch , chrome was revised to hexavalent chrome , mineral oil was revised to untreated mineral oil , and hepatitis virus was revised to hepatitis b and c virus . target cancers , especially those related with ionizing radiation , such as cancers of the salivary glands , esophagus , stomach , colon , bone , breast , kidney , thyroid , ovary , nasopharynx , and bladder were incorporated . table 6 presents the scope of occupational cancers according to the enforcement decree of the lsa , july 2013 and the specific criteria for the recognition of occupational diseases according to the enforcement decree of the iaci act , july 2013 . the first officially reported case of occupational cancer in korea was a case of mesothelioma at an asbestos thread factory in 1993 . a 56-yr - old non - smoking woman employed at the factory for 18 yr was officially approved by the comwel and was compensated by the iaci ( 21 ) . after the first reported compensation case , between 1992 and 1999 , out of 379 claims for occupational cancer , only 22 cases were confirmed as occupational disease by the occupational safety and health research institute ( table 1 ) ( 22 ) . the 31 lung cancer cases associated with pneumoconiosis reported until 1999 that were compensated according to the pppw act are not included in table 1 , which only included cases to be conduct professional and specific examination for the work - relatedness by occupational physician and occupational hygienist of oshri . however , table 2 included all cases to be decided based on pppw act , the result of special examination for the work - relatedness , or the self process of comwel . from 2000 to 2009 , out of 1933 claims , the comwel approved 253 cases as occupational cancer ( 23 ) . sixty - one of these were compensated according to the pppw act . from january 2010 to october 2012 , out of 544 claims , the comwel approved 266 cases as occupational cancer ( table 2 ) . especially after 2010 , the number of compensated cancers also increased because the social awareness for occupational cancers or carcinogens such as asbestos or benzene improved and the claims from various high risk jobs such as miners , masons , construction workers , painters , welders , and so on , which would be influenced by social issue for the occupational cancer in semiconductor industry or communal claims by metal union . respiratory cancers , especially lung cancer , were the most common cancers compensated for by the iaci . between 2000 and 2009 , occupational cancer types included respiratory ( n=107 ) , lymphohematopoietic ( lhp ) ( n=35 ) , malignant mesothelioma ( n=28 ) , and digestive tract cancer ( n=74 ) ( 23 ) . between january 2010 and october 2012 , occupational cancer types included respiratory ( n=226 ) , lhp ( n=5 ) , malignant mesothelioma ( n=19 ) , and digestive tract cancer ( n=2 ) . cancers originating from digestive tract cancer abruptly decreased after the late 2000s , because hepatocellular carcinoma related to workload or stress in healthy hepatitis b virus carriers were rejected in court , and the specific criteria for recognition of liver disease was amended in 2003 ( 24 ) . between 1999 and 2005 , lung cancer related to asbestos exposure ( 62.3% , 33 out of 53 cases ) and lhp cancer related to benzene ( 84.4% , 43 out of 50 cases ) was the most common cause of occupational cancers ( 5 , 25 , 26 ) . between 2000 and 2009 , construction ( n=15 ) was most common industry among compensated cancers , followed by shipbuilding ( n=11 ) , and other metal product manufacturing ( n=10 ) . the most common occupation among compensated cancers was metal molders , welders , and related trades workers ( n=16 ) , followed by miners , shot firers , stone cutters , and carvers ( n=14 ) ( table 3 ) ( 23 ) . after the early 1990s , the number of claims and compensations has increased , but the origin of cancers awarded compensation is still limited to 2 organs , namely the lung and lhp system . the most probable carcinogens were asbestos ( 45% ) , hexavalent chromium ( 30% ) , and crystalline silica ( 19% ) ( 27 ) . in case of lhp malignancies , the most probable carcinogens were pure benzene ( 27.5% ) , impurity of benzene in a mixture ( 56.9% ) , and ionizing radiation ( 8.0% ) ( 26 ) . with these data in mind , the existing criteria and scope for occupational cancer required amendment with respect to the causative carcinogens and the target cancer type . the prior korean criteria included only 10 agents and were very outdated compared with the ilo occupational disease list or the iarc list of group 1 carcinogens . mesothelioma due to asbestos was included in the occupational disease list in convention 121 in 1980 . on recommendation no . 194 in 2002 , the ilo added 15 carcinogens to the list including asbestos ; benzidine and its salts ; bis - chloromethyl ether ; chromium vi ; coal tars and coal tar pitches ; beta - naphthylamine ; vinyl chloride ; benzene ; toxic nitro and amino derivatives of benzene or its homolog ; ionizing radiation ; tar , pitch , bitumen , mineral oil , anthracene , or related compounds ; coke oven emissions ; nickel ; wood dust ; and other carcinogens . at this time , an association between specific occupational cancers caused by specific carcinogens was not included . in 2010 , arsenic , beryllium , cadmium , erionite , ethylene oxide , and hepatitis b and c viruses were included on the ilo occupational cancer list ( 8) . the iarc reviewed the entire group i carcinogenic agents list between 2006 and 2010 , and 113 agents were included as group i carcinogens . since these agents cover both occupational and environmental exposure , siemiatycki et al . ( 28 ) proposed 28 agents and 12 occupations or industries as definite occupational risk factors and we listed other additional occupational carcinogens updated after the review of iarc . in the european occupational cancer lists including those of austria , belgium , denmark , germany , finland , france , italy , luxemburg , portugal , spain , swiss , and the eu . finland included the fewest agents ( n=17 ) and germany , denmark , and luxemburg included > 40 agents . lung cancer due to chromate , asbestos , or nickel and malignant mesothelioma due to asbestos were included in the list of occupational cancers in all countries . the prior criteria for recognition of occupational cancer according to the enforcement decree of the iaci act included only 11 agents , for example soot , tar , pitch , asphalt , mineral oil , paraffin , vinyl chloride , chrome or its compounds , benzene , asbestos , and hepatitis virus . except for hepatocellular carcinoma due to occupational exposure to hepatitis b or c virus , which was included in the criteria in 2003 , other carcinogens and their target cancers have not ever been amended after since the 1980s ' . table 4 shows the presented agents on the occupational cancer lists of the ilo , and european countries , those suggested by siemiatycki et al . or us based on the iarc list , and the korean criteria of occupational carcinogens before 2013 . originally , cancer caused by soot , tar , pitch , asphalt , mineral oil , or paraffin was incorrectly identified as epithelial cancer , but needed to be amended as skin cancer . in addition , myelodysplastic syndrome is not cancer , but is a hematologic malignancy , and the epidemiologic evidence for larynx cancer caused by chrome exposure was insufficient . vinyl chloride exposure as a cause of human hepatocellular carcinoma had sufficient evidence . in case of ionizing radiation , as a definite cause of cancer was not included in prior criteria , which only included acute radiation injury - related diseases . first , the number of covered agents was smaller than those of the international lists . third , a reconsideration of exposure duration or cumulative exposure level was needed ; however , this was not included in the current amendment because this would require a national consensus across professional review boards considering various situations of exposure in korea . the main points of this amendment were as follows : first , the type and number of carcinogens should match those of international levels , considering the lists of the ilo , eu , and iarc , with the occupational cancer list of the ilo taking first priority . second , the priority order of the list should be decided by the carcinogen exposure possibility in korea . third , the criteria should include matches between specific carcinogens and target cancers , as evidenced by clinical data from the iarc . we , who suggested the list of carcinogens and its target cancers for recent amendment and directly participated in the policy making process of amendments to the scope and criteria , selected 28 agents and 11 industries to extend the criteria of occupational cancer according to the results the previously described review of the occupational cancer list of the ilo , the eu , and the iarc classification , and the exposure possibility in korea to identified risk factors . aflatoxins , 4-aminobiphenyl , arsenics , ultraviolet - emitting tanning devices , benzidine , beryllium , beta - naphthylamine , 1,3-butadiene , cadmium , crystalline silica , diesel engine exhaust , erionite , ethylene oxide , formaldehyde , leather dust , nickel compounds , passive smoking , polyaromatic hydrocarbons ( pahs ) , radon , shale oil , solar radiation , strong inorganic acid , 2,3,7,8-tetrachlorodibenzo - para - dioxin , trichloroethylene , ortho - toluidine , wood dust , anti - cancer drugs or immunosuppressants , and sulfur mustard were included in reviewed list of agents . occupations or industries included the rubber industry , painting magenta production , coal gasification , aluminum production , auramine production , isopropyl alcohol manufacture using strong acids , underground hematite mining , iron and steel founding , coke production , and coal - tar distillation . coal gasification , coke production , and coal - tar distillation were reviewed with respect to pahs . these industries could be matched to causative agents in a korean - based exposure situation . occupational cancer risk of the rubber industry could be explained by exposure to aromatic amines or solvents . the magenta , aluminum , auramine , isopropyl alcohol , or hematite production industries are rare in korea . pahs , crystalline silica , and strong inorganic acid could explain the occupational cancer risks of the iron and steel founding industry . as a result , it was not possible to determine the exposure to passive smoking , solar radiation , ultraviolet - emitting tanning device , and solar radiation between environmental exposure and occupational exposure . in korea , exposure to aflatoxins , sulfur mustard , erionite , shale oil , and 2,3,7,8-tetrachlorodibenzo - para - dioxin is unlikely and was classified as low risk . measuring the exposure level of leather dust , strong inorganic acid mist , pahs , 4-aminobiphenyl , and ortho - toluidine was very difficult . diesel engine exhaust and trichloroethylene were recently upgraded by the iarc and information concerning exposure measurements , epidemiological evidence , or cases in korea was limited . anti - cancer drugs and immunosuppressant exposure are usually important to patients . in total , 13 agents and 1 occupation among 39 considerable agents and industries were assigned as priority add - ons to the amended scope and criteria specific for korea . we also suggest classifying the system of occupational cancer into an agent- and organ - oriented systems according to the specific criteria for the recognition of occupational diseases according to the enforcement decree of labor standard act ( lsa ) and the enforcement decree of iaci act . therefore , on the basis of the scope of occupational cancers of the lsa , on which all the agents were listed without target cancer , agents were listed with target cancers based on organ oriented system named cancer on the specific criteria of the iaci act . especially , regarding some agents such as benzene , asbestos , or chrome , the considerations related with exposure duration or level persisted unless there were definite evidences . as a result , 14 agents and occupation matched with 12 target cancers were added to the list including x - rays or -rays ; arsenic and its inorganic compounds ; nickel compounds ; cadmium and its compounds ; beryllium and its compounds ; wood dust ; benzidine ; beta - naphthylamine ; crystalline silica ; formaldehyde ; 1,3-butadiene ; radon-222 and its decay ; spray painting ; ethylene oxide . asphalt and paraffin were removed because of the ambiguity of chemical characteristics that could be masked by other agents . the descriptions for some agents were revised to enhance the clarity of the characteristics of the agent ; tar was revised to coal tar , pitch was revised to coal tar pitch , chrome was revised to hexavalent chrome , mineral oil was revised to untreated mineral oil , and hepatitis virus was revised to hepatitis b and c virus . target cancers , especially those related with ionizing radiation , such as cancers of the salivary glands , esophagus , stomach , colon , bone , breast , kidney , thyroid , ovary , nasopharynx , and bladder were incorporated . table 6 presents the scope of occupational cancers according to the enforcement decree of the lsa , july 2013 and the specific criteria for the recognition of occupational diseases according to the enforcement decree of the iaci act , july 2013 . occupational cancer underwent the widest changes in a recent amendment for tables of the enforcement of decree of the lsa and the iaci act . as a result of a review of the published literature including international occupational cancer lists , alongside an analysis of the carcinogen exposure situation in korea , and a review of cases compensated in korea , the carcinogen agents included in legal tables increased from 11 to 23 and the target cancers increased from 9 to 21 . various stakeholders such as representative organizations of employers , workers , insurers , and policymakers participated in this amendment process . as previously stated , it was not possible to further define the work - relatedness between agents and target cancers as a function of exposure level and duration or cumulative exposure . further investigation and discussion between researchers to form a social consensus among various stakeholders will be necessary to resolve criteria for rapid compensation for occupational cancer based on estimates of past exposure level and individual susceptibility . a difference in social security systems between countries is one of the main issues to consider , especially an understanding of the compensation criteria or scope of occupational cancer , because cancer usually develops post - exposure ( 5 ) . the determination of past exposure history or the level of carcinogens in the work environment is very difficult , because of environmental changes over time and the closure of workplaces deemed unfit in the past ( 7 ) . cancer is a chronic disease with a significant financial and health burden at both an individual and national level ( 29 ) . the financial difference between compensation coverage and wage compensation benefit for absenteeism from the workplace between the national health insurance and the iaci system can aggravate the burden of disease for the individual worker , and the outcome of whether a worker is compensated by iaci or not is a major issue for them and their families . the policy makers , professionals , and various stakeholders should carefully consider the fundamental issue in the korean welfare system by introducing sickness absence benefit for workers during the treatment and rehabilitation of occupational cancer . the continuous modification of compensation coverage by the iaci according to new evidence presented in the scientific literature and according to general consensus is essential until sickness absence benefit for workers is introduced by the national health insurance system . a continuous review system of the evidence of causal association is necessary to modify and update the criteria of occupational cancer to formulate guidelines to decide work - relatedness . many countries , such as the uk , germany , france , canada , or japan , operate this kind of regular review system with medical professionals based on legal background , which is not the case in korea . expanding the criteria and scope of occupational cancers is unlikely to lead to an increase in claims for the compensation for occupational cancers , because cancer is a rare disease and the added carcinogens and target cancers in this time have been compensated by decision of professional through out of list system . however , this amendment of the scope and criteria of occupational cancer could increase the public concerns for the compensation for occupational cancer . this situation could improve the very low frequency of claims due to lack of understanding on occupational cancers .
the legal scope and criteria for occupational cancer in korea was out of date . the aim of this study was to review the current criteria for occupational cancer and amend the existent criteria on the basis of recent scientific evidence . the scientific evidence and the legal list of occupational cancer were analyzed to identify the causes of occupational cancer on a global scale . the relationship between compensated occupational cancer cases and carcinogen exposure in korea was examined . the factors associated with specific causes and target cancers were determined to produce additional criteria . five - hundred and nineteen cases of 2,468 were awarded compensation for occupational cancer including lung , malignant mesothelioma , lymphohematopoietic , and liver cancers from january 2000 to october 2012 . between 1996 and 2005 , benzene accounted for 84.4% of cases , and between 1999 and 2005 , asbestos was associated with 62.3% of cases . fourteen novel causative agents and 12 additional target cancers were identified and the final guidelines were amended to include 23 causative agents and 21 target cancers . this amendment of the criteria for occupational cancer represents the widest change in korean history and is expected to improve the understanding of occupational cancer by providing an up - to - date and accurate reference guide.graphical abstract
however , patients with stroke may survive up to 10 or more years because of contemporary medical treatments1 . stroke can affect many aspects of individual functions in gross motor , fine motor , speech , cognition , perception , and limit the outcome performance of the patients . even current medical can increase the life expectancy of patients with stroke , the activities of their daily lives could be limited by the sequels . for instance , hemiparesis , the most common sequela of stroke was reported to affect the vital daily tasks of patients very often2 . useful outcome measures such as the frenchay activities index ( fai ) and the barthel index ( bi ) have been widely used in recent years for patients with stroke to assess their activity in daily living3 . however , using these assessment results for planning interventions has some limitations . for instance , structured questions in these measures often ignore individual differences , and these measures are not patient - centered assessments . furthermore , some functional performance levels can not be examined by these structured assessments , and the results may not be useful for patients . the rehabilitation experts emphasized the benefits of adapting a patient - centered outcome measure for patient assessment5 . the patient - centered outcome measure should be used across multidiscipline , including physiotherapists . the canadian occupational performance measure ( copm ) has a client - centered design and measures outcomes according to three occupational performance areas ( self - care , productivity , and leisure ) , examining self - perceived changes in the occupational performance of patients through a semistructured interview5 . since 1991 , the copm has been translated into more than 20 languages in over 35 countries6 . furthermore , the copm prompts discussion between interviewees and therapists on factors such as different areas of activity , their concerns , and problems to be resolved7 . at the beginning , patients start by identifying their difficulties according to the three occupational performance areas . they subsequently use a 10-point likert - type scale , ranging from not at all crucial ( 1 ) to extremely crucial ( 10 ) , to identify the intensity of certain difficulties . for the top five problems or tasks selected by patients , the interviewer asks them to continue identifying their performance and satisfaction with their performance by using the same 10-point rating scale . accordingly , therapists focus on these main problems or tasks and consider them to be the priority for treatment . in addition , scoring of the performance and satisfaction items can be repeatedly reassessed on follow - up tests . mccoll , paterson , davies , doubt , and law8 reported that previous studies9,10,11 examined the reliability of both the performance and satisfaction domains of the copm , concluding that they both showed an acceptable range of reliability . examining the test retest reliability of the copm for a 2-week interval , pan , chung , and hsinhwei12 and kjeken et al.13 used intraclass correlation coefficients for patients with mental illness and ankylosing spondylitis and obtained coefficients ranging from 0.73 to 0.93 , depending on whether the interview method entailed a personal , telephone , or mail interview . although these studies suggest a satisfactory reliability for the copm , their results may not be generalized to patients with stroke because different types of patients have different concerns . previous studies have reported that the copm was a satisfactory and valid measure of self - reported occupational performance8 , 12 , 14,15,16,17,18 . moreover , the copm showed sensitivity for determining clinically significant improvements after interventions in the total self - rated performance of patients7 , 19 , 20 and could identify unique problems not assessed by other standardized measurement instruments14 , 17 . carswell et al . 6 reviewed 88 articles and conducted a systematic review to determine the effect of the copm . their results indicate that , although the copm has a few limitations , the assessment is valid , reliable , and clinically useful ; it is also acceptable as an outcome measure for clinical use . however , this review did not focus on using the copm for adult patients with stroke . clinicians may want to understand more clearly and evaluate whether the copm is a suitable outcome measure for occupational therapy in patients with stroke . the present study aimed to investigate whether the copm is a suitable instrument for patients with stroke . another aim was to explore using the copm as an outcome measure in clinical settings . we believe that if the physiotherapists well understand the copm , they can have more information and insights to foster a better intervention for their clients with stroke . the first part included an investigation of the reliability and validity of the copm for patients with stroke . the criteria for the correlation coefficients of the test retest reliability were set as excellent ( r0.75 ) , adequate ( 0.4r0.74 ) , and poor ( r<0.40 ) according to the previous report21 . the second part included an exploration of the copm results in randomized controlled trials ( rcts ) of patients with stroke . if one study adopts rct design , the instruments of the study can be seen as feasible . for this review , we searched the medline , cinahl plus with full text , and pubmed databases for articles published before september 2015 . an integrated search function on the ebscohost online database enabled finding medline and cinahl plus with full text articles . in part 1 , we used the following keywords ( terms ) : canadian occupational performance measure , stroke , and reliability or validity and related terms . the study inclusion criteria were as follows : ( 1 ) more than 20% of the participants were stroke patients ; ( 2 ) the copm was included as an assessment ; ( 3 ) the psychometric properties of the copm were investigated ; ( 4 ) the study was published in english ; and ( 5 ) the study was not a review , a letter to the editor , or an editorial . for part 2 , we used the following keywords ( terms ) : canadian occupational performance measure , stroke , and randomized controlled trials and associated terms . the inclusion criteria were as follows : ( 1 ) the study was an rct ; ( 2 ) the participants were diagnosed with stroke ; ( 2 ) the rcts used the copm as an assessment or an outcome measure ; and ( 4 ) the study was published in english . the exclusion criteria were as follows : ( 1 ) the participants were children ( age<18 years ) and ( 2 ) the study was a protocol . in part 1 of the study , which involved a systematic article review , we observed that only a few articles investigated the psychometric properties of the copm for patients with stroke . thus , the first inclusion criteria did not restrict all patients diagnosed with stroke . in part 2 , we excluded children with stroke because the study focused on adult patients with stroke . in part 1 of the study , we shortlisted 20 studies on the basis of the keywords , and three of them met the inclusion criteria ( fig the findings are summarized in table 1table 1.reliability and validity of the copm for patients with strokeauthorspopulationreliabilityvaliditytest retestcontent - related validityconvergent validitydivergent validity / discriminatory validity copm ( performance)copm ( satisfaction)copm ( performance)copm ( satisfaction)copm ( performance)copm ( satisfaction)martini et al . ( 2014)23patients with stroke , 6 ; children with developmental coordination disorder , 8pqrs - g ( r=0.080.44)pqrs - od ( r=0.370.53)pqrs - g ( r=0.130.16)pqrs - od ( r=0.230.29)cup et al . ( 2003)3patients with stroke , 260.89 0.88 bi : r=0.225 fai : r=0.115 sa - sip30 : r=0.102 eq-5d : r=0.143 rankin scale : r=0.209chan and lee ( 1997)24orthopedic patients , 30 ; patients with stroke , 91 . to evaluate whether the occupational performance was good.2 . accuracy and adequacy of the assessment format klein bell adl scale : dressing : r=0.08mobility : r=0.10bathing : r=0.18eating : r=0.20elimination : r=0.04spsq : home management : r=0.18social community problem solving : r=0.02fim : motor : r=0.03 cognitive : r=0.17 klein - bell adl scale : dressing : r=0.15mobility : r=0.18bathing : r=0.32eating : r=0.12elimination : r=0.03spsq : home management : r=0.12social community problem solving : r=0.13fim : motor : r=0.14 cognitive : r=0.16 klein bell adl scale : dressing : r=0.21mobility : r=0.16bathing : r=0.05eating : r=0.03elimination : r=0.33spsq : home management : r=0.31social community problem solving : r=0.39fim : motor : r=0.32cognitive : r=0.20 klein bell adl scale : dressing : r = 0.13mobility : r = 0.14bathing : r = 0.05eating : r = 0.07elimination : r = 0.26spsq : home management : r = 0.22social community problem solving : r = 0.36fim : motor : r = 0.26cognitive : r = 0.14 r : correlation coefficient ; pqrs - od : performance quality rating scale - operational definitions rating system ; pqrs - g : performance quality rating scale - generic rating system ; bi : barthel index ; fai : frenchay activities index ; sa - sip30 : stroke - adapted sickness impact profile-30 ; eq-5d : euroqol five - dimension questionnaire ; spsq : satisfaction with performance scaled questionnaire ; fim : functional independence measure . in part 2 , we included 24 studies on the basis of the keywords , and 10 of them met the inclusion criteria ( fig . the 10 rcts are categorized in table 2table 2.summary of 10 randomized controlled trials using the canadian occupational performance measure ( copm ) in patients with strokeauthors countrypatientsrecruitment interventiontarget domaincopm aspage , hill , and white ( 2013)33usapatients with chronic stroke , 16local stroke support groupsoutpatient rehabilitation clinicse : repetitive task , specific practice with wearing a portable robotic devicec : repetitive task , specific practice with manual regimenupper extremity dysfunctionsecondary outcome measurenilsen , gillen , dirusso , and gordon ( 2012)34usapatients with chronic stroke , 16stroke support groupse : mental training and practice by using either an internal or external perspectivec : relaxation imagery training upper extremity dysfunctionsecondary outcome measurepolatajko , mcewen , ryan , and baum ( 2012)35canadapatients with chronic stroke , 8using the cognitive rehabilitationresearch group databaserehabilitation institutee : cognitive orientation to a daily occupational performance interventionc : standard occupational therapyoccupational performanceprimary outcome measure taylor et al . ( 2012)36new zealandpatients with acute stroke , 38inpatient rehabilitation servicese : using the copm for goal settingc : nonstructured goal settingstructured approach to goal settinggoal settingalmhdawi ( 2011)37usapatients with chronic stroke , 20local medical facilitieslocal community organizationse : occupational therapy , task - oriented approach for first 6 weeks and no treatment for the final 6 weeksc : reverse order of e upper extremity dysfunctionprimary outcome measureshaw et al . ( 2010)32u.k.patients with stroke , 332 ( at least 1 month ) ; 181 , within 1 year ; and 151 , after 1 yearstroke unitsclinicsday hospitalscommunity rehabilitation teamsstroke clubsday centerse : botulinum toxin type a injection(s ) plus upper limb therapyc : upper limb therapy program aloneupper limb spasticitygoal - setting / secondary outcome measurehayner , gibson , and giles ( 2010)38usapatients with chronic stroke , 12local stroke support groups clinicse : constraint - induced movement therapyc : bilateral treatmentupper extremity dysfunctionprimary outcome measuremew ( 2010)39u.k.patients with acute to subacute stroke , 4acute stroke rehabilitation unite : normal movement approachc : functional approachlower limb dressingprimary outcome measuregilmore and spaulding ( 2007)40canadapatients with acute stroke , 10inpatient rehabilitation organizatione : videotape feedback with occupational therapyc : occupational therapydonning socks and shoesprimary outcome measurecorr , phillips , and walker ( 2004)41patients with stroke , 25 ( follow - up , 12 months)the cardiff day servicee : treatment for the first 6 months and no treatment for the final 6 monthsc : reverse order of eoverall performanceprimary outcome measureacute stroke : within 3 monthssubacute stroke : 36 monthschronic stroke : more than 6 monthse : experimental group ; c : control group . process flow of part 1 and the results of the database search r : correlation coefficient ; pqrs - od : performance quality rating scale - operational definitions rating system ; pqrs - g : performance quality rating scale - generic rating system ; bi : barthel index ; fai : frenchay activities index ; sa - sip30 : stroke - adapted sickness impact profile-30 ; eq-5d : euroqol five - dimension questionnaire ; spsq : satisfaction with performance scaled questionnaire ; fim : functional independence measure process flow of part 2 and the results of the database search acute stroke : within 3 months subacute stroke : 36 months chronic stroke : more than 6 months e : experimental group ; c : control group of the studies included in part 1 , only one study explored the reliability of the copm . cup , op reimer , thijssen , and van kuyk - minis3 examined the test retest reliability of the copm for patients with stroke . each participant was interviewed twice by the same therapist after eight days of the first assessment . we identified 115 problems in the first - administered copm , and only 64 ( 56% ) problems were reidentified the second time . no significant differences were observed between the performance and satisfaction scores of the first and second tests . moreover , the test retest reliability was high ( r=0.89 in performance and 0.88 in satisfaction ) . the findings revealed that , although the identified problems may change , the test retest reliability of the same identified problems was good . three studies , which investigated the validity of the copm , met our inclusion criteria for part 1 . martini , rios , polatajko , wolf , and mcewen23 compared the psychometric properties of two scoring systems in the performance quality rating scale ( pqrs ) , namely the pqrs - od and pqrs - g , in examining six patients with stroke and six children with a developmental coordination disorder . the correlation coefficients between the pqrs and copm performance scores were 0.08 to 0.44 on the pqrs - g and 0.37 to 0.53 on the pqrs - od , whereas the correlation coefficients between the pqrs and copm satisfaction scores were 0.13 to 0.16 on the pqrs - g and 0.23 to 0.29 on the pqrs - od . furthermore , cup et al.3 examined the discriminant validity of the copm for patients with stroke . for the individual problems identified in the copm , 25% or less were also identified in the other five standard assessments : the bi , fai , stroke - adapted sickness effect profile-30 ( sa - sip30 ) , euroqol ( eq-5d ) , and rankin scale ( rs ) five - dimension questionnaire . the correlations between the performance scores of the copm and the other five standard assessments were nonsignificant . chan and lee24 assessed the validity of the copm , and three other assessment tools , namely the klein - bell adl ( kb - adl ) scale , satisfaction with performance scale questionnaire ( spsq ) , and functional independence measure ( fim ) , in 39 adults with orthopedic disabilities ( n=30 ) and stroke ( n=9 ) . the results revealed that the copm content and processes presented the occupational performance of the patients . furthermore , the convergent and discriminant validity of the copm and the kb - adl scale were significantly different , although the correlation coefficients in some items were zero or negative . similarly , the copm was not strongly correlated with the spsq or the fim . these results could show that , although the copm efficiently measured occupational performance , it did not assess the same factor in the kb - adl , spsq , or fim . from these three studies , we conclude that the copm is weakly associated with other assessment tools used for assessing patients with stroke . the findings of the 10 rcts , which met our part 2 criteria , are summarized in table 2 . these rcts were published between 2004 and 2014 . from the publication years , we observed the trend that researchers recently intended to select the copm as an outcome measure assessment or goal - setting instrument for patients with stroke : eight rcts were published after 2009 , whereas only two rcts were published before 2009 . all the included rcts were conducted in western or english - speaking countries ( four in the united states , three in the united kingdom , two in canada , and one in new zealand ) . in addition , three rcts enrolled patients with acute or subacute stroke ( < 6 months ) ; five rcts enrolled patients with chronic stroke ( > 6 months ) ; one rct enrolled patients with acute to chronic stroke ; and one rct enrolled patients with stroke at referral and followed them for 12 months . furthermore , the main target domains included upper extremity dysfunction in four rcts , lower limb dressing in two rcts , and various goals ( eg , upper limb spasticity , occupational performance , overall performance ) in one rct . in addition , six rcts used the copm as a primary outcome , two as a secondary outcome , and two as a goal - setting instrument . this review assessed whether the copm is a suitable instrument for patients with stroke . our findings of the psychometric properties and clinical utility of the copm matched our expectations regarding its applicability as a clinical assessment tool . on the basis of previous studies10 , 12 , the copm was considered reliable for different diagnostic populations . however , only3 examined the test retest reliability of the copm for 26 patients with stroke . although they enrolled the same interviewers , the reliability of the copm items remained unclear . therefore , we might require more evidence for supporting the reliability of the copm . further research investigating the problems of patients with stroke is recommended , particularly regarding stroke types and different sequels . regarding the validity of the copm , all three studies ( table 1 ) indicated that the copm was weakly associated with the other outcome measures : the bi , fim , fai , pqrs , rs , kb - adl , spsq , sa - sip30 , and eq-5d . this weak association was attributed to the patient - centered design of the copm : a semistructured interview in which patients self - report their unique problems3 . consequently , the copm explores the special needs of patients , which can not be determined using fixed - item assessment pools . partly explaining this hypothesis25 , indicated that score changes on a self - reported instrument assessing satisfaction with daily living performance was significantly associated with changes in scores on the copm . our findings on rcts revealed that most practitioners generally used other standard assessments in addition to the copm to complete whole perspectives of outcome measure . parker and sykes26 conducted a systematic review and reported that the copm was often effective with other instruments , such as the bi , fim , reintegration to normal living index , and disability of arm , shoulder , hand , and health assessment questionnaire . this result may imply that using standard assessments alone is inefficient for comprehensively understanding a patient s condition . the study showed that the number of rcts using the copm as an outcome measure assessment or goal - setting instrument for patients has progressively increased in recent years , and more than half of the rcts used the copm as a primary outcome measure . this phenomenon can explain why the copm is considered a reliable , valid , and acceptable tool for researchers or clinical practitioners . none of the 10 rcts were conducted in eastern or non - english - speaking countries , possibly because therapists from these countries did not widely use the copm for assessment during the study period or because they published fewer related articles in english . attempting to investigate the use of the copm in eastern countries by assessing taiwan and mainland china as examples , we conducted searches by entering the phrase canadian occupational performance measure in the chinese electronic periodical service database for articles published before november 25 , 2015 . the findings revealed only seven studies ( two from taiwan and five from mainland china ) . moreover , we searched the search terms canadian occupational performance measure and taiwan in pubmed and medline for articles published before november 25 , 2015 ; however , we found only four taiwanese studies . nevertheless , we reviewed the six studies from taiwan and observed that two studies12 , 27 explored the reliability or validity of the copm in taiwanese patients with psychiatric disorders ; the findings revealed that the copm can be reliably used and validated for these patients . three other studies28,29,30 used the copm for assessing goal achievement and quality of life in their patients and compared the results with those of other assessment tools25 reported their experiences of using the copm with participating therapists and patients in a neurorehabilitation unit . the first barrier addressed the passive attitude of patients : if a family member suffers from stroke , the other members extensively support that patient . thus , the patients play patient roles and rely more on their therapist to set goals for them25 . the patients sometimes have low confidence or feel ashamed to make decisions , may over rely on medication , and have high expectations of medical treatments . this passive attitude may discourage clinical therapists from selecting a self - reporting instrument . the second barrier entailed unfamiliarity with the copm : before using the copm , therapists should have sufficient knowledge regarding the copm and personal interview techniques5 . although most therapists generally learn how to use the copm during their studies , they may lose their confidence because of infrequent use . chen , rodger , and polatajko25 reported that taiwanese patients were unfamiliar with the terms performance and satisfaction and sometimes had difficulty identifying their performance problems . in brief , therapists can not use the copm efficiently , which may reduce their motivation to use it . the copm appears to be used for any stage of stroke because the reviewed rcts enrolled patients with chronic , subacute , and acute stroke ( table 2 ) . however , cognition is affected in a high proportion of stroke patients31 , and their cognition level may affect copm use . the advantage of using the copm is that patients with adequate communication skills can accurately identify their occupational performance26 . thus , clinical therapists who treat patients with poor cognition should exercise caution in analyzing copm results . ( 2004 ) reported that the copm is typically considered a useful measurement tool because it demonstrates significant efficiency in enabling patients to set appropriate therapeutic goals and in reflecting and providing effective feedback for patients and therapists . furthermore , the copm enables patients to set goals for themselves and assists the clinical staff in providing more effective rather than ordinary treatments32 . in addition , mccoll et al.8 reported that 75% of their patients considered the copm to be useful for identifying their problems ; all the patients stated that the copm was comprehensible . 32 reported that the goals set by patients themselves may not be achievable or realistic . first , the small number of studies analyzed in our review provided limited evidence . second , the search strategies of the study were limited to searching terms associated with psychometric properties and rcts ; some relevant studies might have been excluded . third , only studies published in english were included ; relevant studies not published in english may have been missed . although the study has some limitations , it still has some contributions to clinical therapists , including physiotherapists . it helps physiotherapists to identify problem in common clinical patient such as neuralgic disease42 , and it also can be an outcome measure for assessing children performance and satisfaction such as cerebral palsy children43 . moreover , the copm is newly used to assess the occupational performance for patients with cardiac disease , because it is necessary to understand their needs for this group of patients44 . in summary , the copm has satisfactory reliability and validity for patients with stroke , enables patients to identify their needs , and provides therapists with directions regarding interventions . the copm also enables therapists to concentrate on patients perceptions and to develop effective intervention strategies . however , the copm has some drawbacks ; for instance , it is not suitable for patients with stroke who exhibit cognitive deficits , and the goals set during a copm interview may not be achievable .
[ purpose ] this study investigated whether the canadian occupational performance measure is a suitable outcome measure for assessing patients with stroke in research and clinical settings . [ subjects and methods ] the study included into two parts : ( 1 ) an investigation of the reliability and validity of the canadian occupational performance measure for patients with stroke and ( 2 ) an exploration of canadian occupational performance measure results in randomized controlled trials of patients with stroke . for this review , the study searched the medline , pubmed , and cinahl plus with full text databases for articles published before september 2015 . [ results ] finally , three eligible articles were collected in part 1 , and ten randomized controlled trials studies were collected in part 2 . the findings of part 1 revealed that the canadian occupational performance measure had efficient test retest reliability , however , the canadian occupational performance measure revealed weak associations with other assessment tools such as barthel index used for patients with stroke . six of the randomized controlled trials studies used the canadian occupational performance measure as a primary outcome and two as a secondary outcome , while the other two as a goal - setting instrument . [ conclusion ] this review indicates that the canadian occupational performance measure is appropriate for clinicians , including physiotherapists , in assessing outcome for patients with stroke . the canadian occupational performance measure can assist patients in identifying their outcome performance and provide therapists with directions on interventions .
chronic multifactorial diseases originate early in life , for many disorders already during pregnancy and adolescence . as bonneux correctly stated , life course can be seen as being started at the moment two future parents meet , the outcome of a complicated social and individual - emotional process . in the prenatal period ( smoking , alcohol , maternal diet , medicine use ) and post - natal period ( circumstances during delivery , breast feeding ) societal factors ( like number of other children , hours of work of both parents ) are important for a successful start of the life course . health being defined by the who as a state of complete physical , mental and social well - being and not merely the absence of disease or infirmity . the concept of subjective well - being refers to people s own evaluations , both affective and cognitive , of their lives . this relates to the perceived quality of life and consists of self - acceptance , positive relations with others , autonomy , environmental mastery , purpose in life , and personal growth . subjective well - being is culturally defined , embedded in values of a society , and varies over the life course constituted by stages of development , including the stage of being - elderly . similarly , stages in the life course are based on culturally interpretations and values that vary between different socio - economic groups and cultural meaning systems in societies . in our approach to healthy ageing this means that society affects individual s healthy ageing , and individual health influences society . for example , an ageing population has consequences for the labor market , the housing market , pensions to be paid , and health care and support to be provided . at the other hand , elderly people have specific needs and demands regarding their housing , ( health ) care and support , but also regarding their daily activities ( voluntary work ; taking care of grandchildren ; leisure activities ) . the same is true for the identification of critical factors at later stages of the life course . selection of friends , changes during adolescence , coping with life events , adequate treatment of chronic diseases and sufficient networks at old age are examples of potential pitfalls for healthy ageing . an example is self - regulation , that is a person s capacity to plan , guide and monitor her / his own behavior . elderly persons with higher proactive self - management capacities report higher levels of life satisfaction , positive affect , and well - being . this is strongly affected by context conditions at different levels , such as life events and life style , the embedding in social networks such as family , peers and friends , and in institutions such as health care facilities.healthy ageing requires physical , mental , and social well - being . these are increasingly affected by the interplay of factors at multiple societal levels : at the macro level , national institutions regulate access to and quality of prevention , care , and pensions , while population dynamics ( e.g. migration ) and demographic processes ( e.g. declining fertility rates ) affect the opportunities and constraints for different institutional solutions.at the meso level , informal communities and social networks as well as formal organizations can provide crucial resources for social and material support , thus constituting essential elements for prevention and mitigation of health related problems . also meso level data from living and working conditions should be included like distances to family and health care service , but also the amount of green in the living environment.at the micro level , individuals do not only differ in their health behavior , physical ( e.g. co - morbidity , genetics ) and mental predispositions ( e.g. self - management ability ) , but also in disease related risk factors accumulating during their life course . these inter - individual differences , in turn , affect the effectiveness of different preventive measures and interventions.a key obstacle to successful ageing is misalignment among and across these different levels . examples for cross - level misalignments are abound : health care routines and structures at meso level are often not equipped to adequately deal with co - morbidity at individual level and changes in age distribution at macro level ; macro - level policies building on social support and care for elderly from within their own social network collide with decreasing size and density of personal networks due to labor migration ; at meso level , programs for integrated care often fail due to inadequate institutional regulations , resulting in inter - organizational coordination problems and perverse incentives for care providers . further research is needed to both find determinants and models of this misalignment , as well as identify factors that predict the misalignment , both at individual and societal level . at the macro level , national institutions regulate access to and quality of prevention , care , and pensions , while population dynamics ( e.g. migration ) and demographic processes ( e.g. declining fertility rates ) affect the opportunities and constraints for different institutional solutions . at the meso level , informal communities and social networks as well as formal organizations can provide crucial resources for social and material support , thus constituting essential elements for prevention and mitigation of health related problems . also meso level data from living and working conditions should be included like distances to family and health care service , but also the amount of green in the living environment . at the micro level , individuals do not only differ in their health behavior , physical ( e.g. co - morbidity , genetics ) and mental predispositions ( e.g. self - management ability ) , but also in disease related risk factors accumulating during their life course . these inter - individual differences , in turn , affect the effectiveness of different preventive measures and interventions . until now , the majority of efforts to investigate the conditions for healthy ageing and devise appropriate interventions neglected this interplay between societal levels and the resulting problems of misalignment . indeed successful ageing research initiatives have a multidisciplinary approach , like the european research area in ageing ( http://era-age.group.shef.ac.uk/ ) and the behavioral and social research program at the national institute on aging ( http://agingcenters.org/ ) . there is no doubt that the multi - state life tablethe main demographic tool of the twenty - first century , according to bonneux proved to be extremely useful for a more fine - grained representation and modeling of life courses . however , as is the case with all statistical methods , multi - stage life tables are a methodological device , the use of which depends entirely on the theoretical objectives that they are supposed to serve . multi - stage life tables can contribute to answer some questions relevant to the subject of healthy aging , but certainly not all of them , and the methodological toolbox relevant for ageing research meanwhile is fortunately much larger than bonneux focus on the multi - stage life table suggests , ranging from a variety of anthropological qualitative data collection techniques over multi - level social network methods to structural equation modeling . life course research is characterized by longitudinal studies , preferably starting before birth , with repeated measurements over time . to investigate the macro and meso societal levels in healthy ageing , socio - cultural and economic factors on group level have to be added to individual longitudinal assessments . classical epidemiological studies are transferred in real life course investigations through longitudinal studies of aging which build on life - course theories and event - history models . ideally studies should cover the entire human life span , but a more feasible approach is including more generations . standard epidemiological data analyses are useful as first step like multivariate regression techniques , including cox proportional hazard analyses , and multi - level models . to fully appreciate the role of different societal levels in healthy ageing , more complex techniques are required like a combination of multi - stage models life table and path analyses . this goes beyond the standard multivariate models and requires the identification of patterns of interpersonal relationships and how these change over the life course . this approach is not limited to psychological or sociological aspects of ageing , as illustrated in a recent paper showing that obesity spreads along social networks . to identify causal determinants and related mechanisms through which they affect healthy aging , potential confounders have to be identified at different levels , ranging from socioeconomic status to number of friends and presence of nearby caregivers . apart from measures at individual level , confounders can be defined at the meso or macro societal levels . to estimate these complicated associations , multilevel approaches to structural equation models are needed . to study the cultural meaning attached to subjective well - being in stages in the lifecourse , qualitative research methods are to be applied . qualitative research methods such as in - depth interviews and focus group discussions provide detailed information on perceptions on health and disease , well - being and happiness , on being elderly . through qualitative research methods , the voices of people themselves are heard . surveys such as the world value survey provide information on values prevalent at societal level . this all needs proper theorizing . by proper theorizing we mean theory that specifies the actor - level micro - foundations and explicates assumptions about how situational opportunities and constraints affect individual level social motives and the resulting individual level outcomes ( e.g. health related behavior ) . in many studies on health and ageing , assumptions about what drives individual decisions are either left implicit or build on a simplified model of human nature , in which individuals are treated as farsighted rational decision makers who make responsible choices about all things that are important to them , including their pensions or health related behavior . research and policy making in this tradition considered ( irrational ) deviations from this model as idiosyncratic and random errors ( noise ) at the individual level which would cancel each other out at the population level yielding an overall rational outcome . in the light of all the evidence collected during the past two decades by a variety of disciplines ranging from behavioral economics to cognitive neurosciences and cognitive anthropology [ 12 , 13 ] , this model of behavior is increasingly difficult to defend . many of these studies convincingly demonstrate that what has been treated as random deviations from rational decision making in fact are systematic and predictable reflections of what has been termed social rationality . the model of social rationality provides a more accurate and realistic micro - foundation of human behavior , in particular with regard to health and well - being . many ingredients of this new model of human nature are meanwhile widely accepted , like human s stronger reaction to losses than to gains of the same amount , our inclination to give into short term rewards even if we know they are detrimental in the long run , or the strong influence of social comparison and relative status . without a proper micro - foundation and the specification of micro - level mechanisms , it will be virtually impossible to assess how macro , meso , and individual level context conditions differentially affect processes and outcomes of aging processes . behavioral micro - foundations are also essential for identifying and mitigating cross - level misalignments . in conclusion , not a pair of twins but a family of disciplines , embedded in theoretical micro - foundations , is needed to investigate the multilevel process of healthy ageing . this family will identify relevant factors to explain and predict healthy ageing at macro , meso , and individual - level .
to study life course trajectories and ageing , scientific expertise is needed beyond epidemiology . more specifically , appropriate models of life course require a theoretical micro - foundation , need to incorporate multi - level context conditions and the interplay between them . it also requires the application of additional social scientific research methods that go beyond the application of statistical methods based on the multi - stage life table . these research theories and methods are available in disciplines like sociology , cultural anthropology , psychology , demography and economics . to effectively study healthy ageing of populations the individual approach of epidemiology has to be extended with the macro - population and socio - cultural approach of ( social ) demography and the institutional and network approaches of sociology .
paragonimiasis , also known as lung fluke disease , is a parasitic disease in humans and other mammals caused by infection with paragonimus spp [ 13 ] . human infection often occurs by ingestion of infectious paragonimus metacercariae in freshwater crab or crayfishes . therefore , the disease is common and limited to areas where the people habitually take raw or undercooked water or food , including such asian countries as china , korea , japan , lao pdr and philippines , some part of latin america and africa[1 , 47 ] . zhejiang province , located on the eastern coast of china , is known to be a paragonimiasis endemic area . the paragonimus metacercariae exist in the small intestine , and pass through the intestinal wall , peritoneal cavity , diaphragm , and pleural cavity , and finally enter the lung parenchyma , where they mature into adults[25 ] . infrequently , the metacercariae migrate to some other tissues , such as the liver , neck , brain and fossa orbitalis , which is named extrapulmonary paragonimiasis[8 , 9 ] . the classic symptoms of pulmonary paragonimiasis include a chronic cough with rusty - brown sputum , hemoptysis , pleurisy , and fever with radiographic findings of patchy density , linear infiltration , nodules , pleural effusion and pulmonary cavities[5 , 10 ] . it was reported to be more prevalent in middle - aged patients , frequently with nodular lesions on chest radiography . however , paragonimiasis has been rarely reported in children and usually misdiagnosed as rheumatopyra , pulmonary tuberculosis , pneumonia , liver abscess , or meningitis[11 , 12 ] . herein , we retrospectively reviewed the pediatric patients with paragonimiasis diagnosed in our hospital to summarize the clinical features and raise awareness of this disease . a total of 58 patients diagnosed with paragonimiasis in our hospital from 2000 to 2009 were enrolled . they were 42 boys and 16 girls aged 2.0 to 15.3 years with a mean age of 6.483.01 years . the diagnoses were based on positive serologic test results for paragonimus - specific antibody , or the detection of characteristic paragonimus eggs in sputum . the medical records were reviewed for information related to the clinical data of the patients , including age , gender , history of ingestion of raw or undercooked freshwater crab or crayfishes , symptoms , duration of symptoms , laboratory tests , chest radiographs , complications and therapy . among the 58 patients , 46 ( 79.3% ) admitted a history of raw water or food ingestion . the first complaint included fever in 17 ( 29.3% ) patients , cough in 16 ( 27.6% ) , chest distress and tachypnea in 4 , abdominal distention in 4 , abdominal pain in 4 , edema in 3 , headache in 3 , mass in 2 , and vomiting , recurrent epistaxis , poor appetite , hepatomegaly and recurrent rash , each in one . two other patients were found occasionally who only presented with eosinophilia without any complaint . during the disease progression , respiratory symptoms were the most common features , found in 43 ( 74.1% ) patients , including cough in 34 ( 58.6% ) , tachypnea in 9 ( 15.5% ) , and chest pain in one . systemic symptoms were found in 41 ( 70.7% ) patients , including fever in 35 ( 60.3% ) , edema in 5 , and fatigue in 3 . abdominal symptoms were noted in 22 ( 37.9% ) patients , including abdominal pain in 13 ( 22.4% ) , vomiting in 10 ( 17.2% ) , abdominal distention in 6 ( 10.3% ) , and diarrhea in 2 . nervous system abnormality was noted in 6 ( 10.3% ) patients , including headache in 5 , convulsion , and facial palsy and hemiplegia each in one . chest distress and rash ( including urticaria in one ) were noted each in 5 patients ( table 1 ) . the clinical characteristics of the 58 patients physical examination revealed pulmonary rale in 15 ( 25.9% ) patients , asymmetrical breath sound in 7 ( 12.1% ) , superficial lymphadenitis in 9 ( 15.5% ) , abdominal distention in 4 , hepatomegaly in 28 ( 48.3% ) , and splenomegaly in 4 ( table 1 ) . mass was noted in 2 patients : one had multiple painless nodes with a diameter of 2 cm in neck , and the other had a painful mass in the right upper abdomen measuring 44 cm . in the 58 patients , wbc ranged from 3.77 to 45.510/l , with one patient lower than 4.010/l and 45 ( 77.6% ) over 1010/l . the percentage of neutrophils ranged from 6.2% to 84.0% , and eosinophils ranged from 0.2% to 71.2% , with 45 ( 77.6% ) over 5% . the number of eosinophils ranged from 14 to 29542/ml , including 46 ( 79.3% ) over 500/ml . elevated esr was noted in 24 of 50 ( 48.0% ) patients with a highest of 89 mm / hr . raised crp was noted in 27 of 54 ( 50.0% ) patients . elevated igg , igm , and iga was noted in 19 ( 79.2% ) , 14 ( 58.3% ) , and 8 ( 33.3% ) , respectively . iu / l to > 400 iu / l ( normal range , < 100 iu / l ) and elevated in 22 ( 91.7% ) , as shown in table 2 . the laboratory data of the patients esr : erytrocyte sedimenation rate ; crp : c - reactive protein ; ig : immunoglobulin ; alt : alanine aminotransferase ; radiography showed pneumonia in 26 ( 44.8% ) patients , including lobar or segmental pneumonia in 20 . it was interesting that transmigrating patchy density in the right lung was noted by chest radiography , and several cysts were noted by ct scan in one patient . meanwhile , pleurisy was found in 28 ( 48.3% ) patients , including pleural effusion or pleural thickening ( fig . 1a - b ) , ascites in 16 ( 27.6% ) , and celiac lymphadenitis in 13 ( 22.4% ) , as shown in table 2 . lactate dehydrogenase ( ldh ) ranged from 737.0 to 4780.0 u / l with a mean of 2147.171565.72 they were muddy and yellow with wbc of 36810/l and 144010/l , polymorphnuclear of 68% and 80% , protein of 33.1 and 41.1g / l . besides hepatomegaly and splenomegaly , calcification in the liver 1c ) , and multiple lamellar low echogenic areas were noted in another ( fig . e. mri shows a long t1 and t2 signal area in the left temporal and apical lobes . f. mri shows slight long t1 and t2 signal area with obscure boundary in the right parietal lobe . stick shape with hyposignal was noted within this area brain abnormality was found in 4 of 10 patients undergoing ct and/or mr . hemorrhage in the left temporal and apical lobe in one patient with facial palsy and hemiplegia was found by mr ( fig . foliated area with slight long t1 and t2 signal and obscure boundary were noted in the right parietal lobe in one patient without nervous symptoms by mr ( fig . lamella area with hypodensity in the right temporal and apical lobes , and slight anfractuosity widening were noted in another 2 patients with nervous features . the pathological study of the neck mass revealed reactive hyperplasia of the lymphnodes ( fig . b ) reactive hyperplasia of lymph node ( he , 100 ) the duration of symptoms before admission to our hospital ranged from 2 days to over 1.5 years with a median of 2 weeks . parasitic disease was considered for 7 of the 58 patients in local hospitals . in the other patients , misdiagnosis made as pneumonia in 25 , oncocytosis in 9 , systemic lupus erythematosus in 4 , sepsis in 4 , rheumatic fever in 2 , tuberculosis in 2 , and liver abscess , purulent meningitis and infectious mononucleosis syndrome each in one . in our hospital , most of these patients were diagnosed with parasitic disease according to the eosinophilia in blood , pericardial fluid , ascetic fluid and/or bone marrow findings . praziquantel was administered at a dose of 20 - 80 mg / kg / d . pericardial paracentesis was performed in 9 patients and constant drainage in 6 because of large pericardial fluid . the duration of hospitalization ranged from 3 to 30 days with a median of 9 days . among the 58 patients , 46 ( 79.3% ) admitted a history of raw water or food ingestion . the first complaint included fever in 17 ( 29.3% ) patients , cough in 16 ( 27.6% ) , chest distress and tachypnea in 4 , abdominal distention in 4 , abdominal pain in 4 , edema in 3 , headache in 3 , mass in 2 , and vomiting , recurrent epistaxis , poor appetite , hepatomegaly and recurrent rash , each in one . two other patients were found occasionally who only presented with eosinophilia without any complaint . during the disease progression , respiratory symptoms were the most common features , found in 43 ( 74.1% ) patients , including cough in 34 ( 58.6% ) , tachypnea in 9 ( 15.5% ) , and chest pain in one . systemic symptoms were found in 41 ( 70.7% ) patients , including fever in 35 ( 60.3% ) , edema in 5 , and fatigue in 3 . abdominal symptoms were noted in 22 ( 37.9% ) patients , including abdominal pain in 13 ( 22.4% ) , vomiting in 10 ( 17.2% ) , abdominal distention in 6 ( 10.3% ) , and diarrhea in 2 . nervous system abnormality was noted in 6 ( 10.3% ) patients , including headache in 5 , convulsion , and facial palsy and hemiplegia each in one . chest distress and rash ( including urticaria in one ) were noted each in 5 patients ( table 1 ) . the clinical characteristics of the 58 patients physical examination revealed pulmonary rale in 15 ( 25.9% ) patients , asymmetrical breath sound in 7 ( 12.1% ) , superficial lymphadenitis in 9 ( 15.5% ) , abdominal distention in 4 , hepatomegaly in 28 ( 48.3% ) , and splenomegaly in 4 ( table 1 ) . mass was noted in 2 patients : one had multiple painless nodes with a diameter of 2 cm in neck , and the other had a painful mass in the right upper abdomen measuring 44 cm . in the 58 patients , wbc ranged from 3.77 to 45.510/l , with one patient lower than 4.010/l and 45 ( 77.6% ) over 1010/l . the percentage of neutrophils ranged from 6.2% to 84.0% , and eosinophils ranged from 0.2% to 71.2% , with 45 ( 77.6% ) over 5% . the number of eosinophils ranged from 14 to 29542/ml , including 46 ( 79.3% ) over 500/ml . elevated esr was noted in 24 of 50 ( 48.0% ) patients with a highest of 89 mm / hr . raised crp was noted in 27 of 54 ( 50.0% ) patients . inccreased alanine aminotransferase elevated igg , igm , and iga was noted in 19 ( 79.2% ) , 14 ( 58.3% ) , and 8 ( 33.3% ) , respectively . iu / l to > 400 iu / l ( normal range , < 100 iu / l ) and elevated in 22 ( 91.7% ) , as shown in table 2 . the laboratory data of the patients esr : erytrocyte sedimenation rate ; crp : c - reactive protein ; ig : immunoglobulin ; alt : alanine aminotransferase ; radiography showed pneumonia in 26 ( 44.8% ) patients , including lobar or segmental pneumonia in 20 . it was interesting that transmigrating patchy density in the right lung was noted by chest radiography , and several cysts were noted by ct scan in one patient . meanwhile , pleurisy was found in 28 ( 48.3% ) patients , including pleural effusion or pleural thickening ( fig . 1a - b ) , ascites in 16 ( 27.6% ) , and celiac lymphadenitis in 13 ( 22.4% ) , as shown in table 2 . lactate dehydrogenase ( ldh ) ranged from 737.0 to 4780.0 u / l with a mean of 2147.171565.72 they were muddy and yellow with wbc of 36810/l and 144010/l , polymorphnuclear of 68% and 80% , protein of 33.1 and 41.1g / l . besides hepatomegaly and splenomegaly , calcification in the liver was found in one patient ( fig . 1c ) , and multiple lamellar low echogenic areas were noted in another ( fig . e. mri shows a long t1 and t2 signal area in the left temporal and apical lobes . f. mri shows slight long t1 and t2 signal area with obscure boundary in the right parietal lobe . stick shape with hyposignal was noted within this area brain abnormality was found in 4 of 10 patients undergoing ct and/or mr . hemorrhage in the left temporal and apical lobe in one patient with facial palsy and hemiplegia was found by mr ( fig . foliated area with slight long t1 and t2 signal and obscure boundary were noted in the right parietal lobe in one patient without nervous symptoms by mr ( fig . lamella area with hypodensity in the right temporal and apical lobes , and slight anfractuosity widening were noted in another 2 patients with nervous features . karyocyte hyperplasia was noted in all the 19 patients who received bone marrow puncture . the percentage of eosinophil granulocytes increased , even up to 55.5% ( fig . the pathological study of the neck mass revealed reactive hyperplasia of the lymphnodes ( fig . the duration of symptoms before admission to our hospital ranged from 2 days to over 1.5 years with a median of 2 weeks . parasitic disease was considered for 7 of the 58 patients in local hospitals . in the other patients , misdiagnosis made as pneumonia in 25 , oncocytosis in 9 , systemic lupus erythematosus in 4 , sepsis in 4 , rheumatic fever in 2 , tuberculosis in 2 , and liver abscess , purulent meningitis and infectious mononucleosis syndrome each in one . in our hospital , most of these patients were diagnosed with parasitic disease according to the eosinophilia in blood , pericardial fluid , ascetic fluid and/or bone marrow findings . praziquantel was administered at a dose of 20 - 80 mg / kg / d . pericardial paracentesis was performed in 9 patients and constant drainage in 6 because of large pericardial fluid . the duration of hospitalization ranged from 3 to 30 days with a median of 9 days . the incidence of paragonimiasis was reported to increase in some areas of china in recent years . similarly , we found that the number of cases presented to our hospital showed an increasing trend . it might be associated with the economic development and medical science advancement , also closely related to the habitual eating of raw or undercooked food . some eating habits are also fashionable in zhejiang province which was transmitted from other areas , such as guoqiao rice noodle from yunnan , chongqi hot pot from chongqing , and it is notable that there were few patients not having history of raw food ingestion . hence , it is necessary to strengthen the awareness of not taking raw water or food . male was predominant in a ratio of 3:1 among the patients in this study , which is higher than in the reports in adults[12 , 14 , 15 ] and may be associated with the fact that boys are more likely to eat raw crabs or crayfish . the clinical features in our patients were variable , predominated by systemic , respiratory , cardiac , and digestive system symptoms and cavity effusion . multiple organ or system lesions were involved in most of our patients , which is similar to reports in adults [ 5 , 8 , 10 , 12 ] . hemoptysis was commonly seen in adult patients[12 , 16 , 17 ] ; however , it is rarely observed in our patients . in addition , our imageology results supported direct lesion in the liver and brain , although hepatomegaly and splenomegaly may also be induced by hydropericardium . it is notable that abnormal brain image was found in patients without any nervous feature , indicating that careful examination for the nervous , digestive and other systems should be conducted in all the patients , even without any associated features . eosinophilia in peripheral blood , pericardial and ascitic fluid , and bone marrow was commonly observed in our patients , as reported by others , too . granulocytosis , another common feature of paragonimiasis , was noted in 77.6% of our patients . besides , it is notable that increased immunoglobulin was also frequently seen in our patients , especially igg and ige , which may be associated with the immunologic sensitization and immunologic response to parasites . although most patients provided a history of raw water drinking or food eating after careful inquisition , only one patient provided a history of raw crab ingestion in advance . this may be associated with the life cycle of paragonimus . because most serious symptoms were caused by the adult worms and their eggs , and the time from infection to oviposition is 2 - 3 months , some pediatric patients may have forgotten the history of raw food ingestion . in this study , 2 asymptotic patients were diagnosed with the clues of eosinophilia found occasionally , and most of our patients were suspected of paragonimiasis after eosinophilia detection . based on the previous studies , at least 293.8 million people are at risk of infection with paragonimus parasites , with 195 million residing in china . moreover , paragonimiasis should be considered in the differential diagnosis in patients with multiple organ or system lesions , especially in those with eosinophilia ; serous cavity effusion ; respiratory , cardiac , digestive , or nervous system abnormality ; and/or mass . the history of raw water or food eating should be carefully inquired and specific antibodies should be detected to confirm the diagnosis . praziquantel at a high dose of 75 mg / kg ( divided into three doses per day ) for 2 days was suggested for these patients . in this study , we noted that some patients were effectively treated with a low dose of praziquantel , even 20 to 50 mg / kg / d . whether it implied that the paragonimiasis can be treated with praziquante at a lower dose in summary , our results suggest that paragonimiasis should be considered in patients with multiple organ or system lesions , especially in those with eosinophilia , serous cavity effusion , respiratory , cardiac , digestive system , nervous system abnormality .
objectiveto analyze the clinical and radiological features of paragonimiasis in children and raise the awareness of this disease.methodsa total of 58 paragonimiasis patients were reviewed . they were 42 boys and 16 girls aged 2.0 to 15.3 years.findingsamong these patients , 20 were diagnosed in the recent 5 years , 46 with a history of raw water or food ingestion . except 2 patients without any complaint , the most common features involved the systemic ( 41 , 70.7% ) and respiratory systems ( 43 , 74.1% ) , followed by abdominal , cardiac and nervous systems , with rash and mass . eosinophilia was noted in 46 ( 79.3% ) patients , granulocytosis in 45 ( 77.6% ) , anemia in 14 ( 24.1% ) , and thrombocytopenia in 3 . imageology showed pneumonia in 26 ( 44.8% ) patients , pleurisy in 28 ( 48.3% ) , hydropericardium in 17 ( 29.3% ) , ascites in 16 ( 27.6% ) , and celiac lymphadenitis in 13 ( 22.4% ) . besides hepatomegaly and splenomegaly , calcification and multiple lamellar low echogenic areas in the liver were noted , each in one patient . abnormal brain imaging was noted in 4 of 10 patients . karyocyte hyperplasia with eosinophilia was noted in all the 19 patients who received bone marrow puncture.conclusionparagonimiasis should be considered in the differential diagnosis of patients with multiple organs or system lesions , especially those with eosinophilia , serous cavity effusion , respiratory , cardiac , digestive system , nervous system abnormality , and/or mass . healthy eating habit is helpful for paragonimiasis prevention .
elucidation of the dynamic changes in secretomes , i.e. , the secreted subset of the proteome , underlies a systems approach to understanding the mechanisms controlling cell cell and cell it is now clear that changes in the cellular microenvironment determine disease progression , and that these include two - way interactions between cancer cells and surrounding stromal cells . several recent studies have employed proteomic techniques to define the secretomes of cancer cells . recent studies have also defined the secretome in breast and colon cancer fibroblasts , but in general the interrogation of stromal cell secretomes by proteomic methods has been limited . changes in secretomes may reflect alterations in secretory protein abundance due to variations in gene expression , rates of exocytosis or presecretory post - translational processing . but in addition , there may also be extensive postsecretory proteolysis that defines the extracellular tumor degradome . in cancer , alterations in extracellular proteolysis through differential secretion of proteases or their inhibitors is important , not least because it underlies disease progression and sensitivity to protease targeted therapies . cancer - associated fibroblasts , of which myofibroblasts are a subset , are important stromal cells that exhibit an altered phenotype in many cancers . myofibroblasts play important roles in defining the tissue microenvironment through secretion of extracellular matrix components , growth factors , proteases and their inhibitors . differences between normal and cancer - associated myofibroblasts ( cams ) have been linked to tumor progression by mechanisms including recruitment from circulating mesenchymal stromal cells , global dna hypomethylation and changes in gene expression profiles . since myofibroblasts stimulate cancer cell invasion , in the present study we sought to define the differences between gastric cams compared with adjacent tissue - derived myofibroblasts ( atms ) with respect to proteolytic processing of their secretomes . the data indicate both upregulation and activation of matrix metalloproteinases ( mmps)-1 , -2 , and -3 are characteristic of the cam secretome . myofibroblasts from gastric cancers ( cams ) and adjacent tissue ( atms ) from two patients have been described previously ( supporting information ) . the work was approved by the ethics committee of the university of szeged , hungary , and subjects provided informed consent . myofibroblasts were cultured in dmem silac media ( pierce , thermo scientific , rockford , il , usa ) for 6 population doublings in the presence of either natural ( light ) or heavy c6-labeled l - arginine ( 0.94 mm ) and c6l - lysine ( 0.46 mm ) ( invitrogen , paisley , renfrew , u.k . ) . media were further supplemented with 10% dialyzed fetal bovine serum ( pierce ) , 2% antibiotic / antimycotic ( sigma - aldrich , poole , u.k . ) and 1% penicillin / streptomycin ( sigma ) . media ( 10 ml , serum - free ) obtained from 1 10 myofibroblasts plated in 10 cm diameter dishes ( 8090% confluency ) were collected after 24 h. samples were concentrated to approximately 0.5 ml using amicon ultra-15 3 kda centrifugal filter devices ( millipore , watford , u.k . ) , precipitated with 20% tca and resuspended in 50 mm hepes , ph 7.4 , 100 mm nacl , 0.8% w / v chaps , 1% v / v protease inhibitor cocktail set iii , edta - free ( calbiochem , merck biosciences , beeston , u.k . ) . equal amounts ( 35 g each ) of light and heavy silac - labeled secretome samples from cams and atms were mixed following determination of protein concentration by the bradford assay ( bio - rad lab , inc . , hemel hempstead , u.k . ) . methionyl - cofradic was performed as described previously ( see supporting information methods ) . samples were reduced and s - alkylated , and following trypsinization ( trypsin : protein 1:100 ) , peptides were fractionated by reversed - phase hplc ( rp - hplc ) using an agilent 1100 hplc system with a zorbax 300sb - c18 column ( 2.1 mm ( internal diameter ) 150 mm , agilent technologies , wokingham , u.k . ) . the resulting hplc fractions were further processed by incubating for 30 min with 0.1% w / v hydrogen peroxide at 30 c . following oxidation of methionines , reaction mixtures were immediately reinjected onto the rp - hplc column for secondary rp - hplc separations under identical conditions . fractions with methionine containing peptides displayed a hydrophilic shift and were collected ( n = 90 ) and analyzed by lc n - terminal cofradic was performed as described previously ( see supporting information methods ) . proteins were reduced and alkylated , and primary - and -amines were blocked by trideutero - acetylation . samples were then trypsinized , and n - terminal peptides were pre - enriched by strong cation exchange chromatography at low ph . following a pyro - glutamate removal step , peptides were separated by rp - hplc as described above . primary fractions were incubated with 2,4,6-trinitrobenzenesulphonic acid ( tnbs ) to modify internal tryptic peptides with free -n - termini . a series of secondary rp - hplc runs was then performed on each individual primary fraction , and n - terminal peptides ( which did not display a hydrophobic shift ) were collected ( n = 36 ) for lc samples prepared for shotgun analysis of the secretomes were processed following the same method as for met - cofradic up to the stage immediately before the first rp - hplc run . at this point ms / ms analysis ( see supporting information methods ) . for neo - n - terminal enrichment , the non - cofradic method employed a scx - only enrichment of n - terminal peptides . samples were prepared as for n - terminal cofradic up to the first rp - hplc run . at this stage 60 fractions of 1 min interval were collected , pooled to give a total of 20 fractions , dried and prepared for lc ms / ms analysis . peptides were analyzed using a ltq orbitrap xl mass spectrometer ( thermo electron , bremen , germany ) as described previously . mascot generic files ( mgf ) were created using the mascot distiller software ( version 2.2.1.0 , matrix science , ltd . , london , u.k . ) . when generating peak lists , grouping of spectra was performed with a maximum intermediate retention time of 30 s and maximum intermediate scan count of 5 . a peak list was only generated when the spectrum contained more than 10 peaks . there was no deisotoping , and the relative signal - to - noise limit for both precursor and fragment ions was set to 2 . the peak lists were then searched with mascot using the mascot daemon interface ( version 2.2.0 , matrix science , ltd . ) against human proteins in the swiss - prot database ( uniprot release 15.0 , containing 20 333 human protein sequences ) . spectra were searched with semiargc / p enzyme settings , allowing no missed cleavages for the n - terminal peptide experiments , and with trypsin / p settings allowing no missed cleavages for the met - cofradic / shotgun experiments . mass tolerance of the precursor ions was set to 10 ppm ( with mascot s c13 option set to 1 ) and of fragment ions to 0.5 da . variable modifications were acetylation of alpha - n - termini and pyroglutamate formation of n - terminal glutamine residues ; fixed modification was oxidation of methionine ( sulfoxide ) . additionally , for n - terminal peptide experiments , trideutero - acetylation of the n - terminus was set as variable peptide modification , and trideutero - acetylation of lysine side chains was included as fixed modification . only peptides that were ranked one and scored above the identity threshold score the fdr was calculated for every search as described previously ( see supporting information methods , table sm3 ) . identified peptides were quantified using the mascot distiller quantitation toolbox ( www.matrixscience.com ) in the precursor mode as described previously . ratios for all peptides of interest were validated by manual inspection of spectra . for processing of all ms data , protein ratios were inferred using the mean of the peptide group ratios for each protein . a peptide group represents all quantifications of a single peptide sequence in an experiment . the distribution of protein ratios as determined by the met - cofradic and shotgun experiments was plotted using rover . this was used to define thresholds to give the 5% of proteins with the largest fold changes in cams relative to atms . all spectra have been stored in the pride database ( http://www.ebi.ac.uk/pride/ , accession numbers 2715727161 ) using pride converter . protein subcellular localizations and functional classifications were manually curated , using the uniprot and hprd online databases . immunocompromised mice ( 6 weeks old , balb / c nu / nu , charles river , wilmington , ma ) with xenogafts of mkn45 cells with or without cams ( supporting information methods ) were used for imaging mmp - activity using mmpsense 750 fast . these experiments were approved by the university of liverpool animal welfare committee and were conducted in compliance with the u.k . myofibroblast cell extracts were prepared in ripa buffer containing protease and phosphatase inhibitors . cell extracts or media were resolved by sds - page and processed for western blotting as previously described . blots were probed with antibodies against mmp-1 ( baf901 , r&d systems , minneapolis , mn , usa ) , mmp-2 ( baf902 , r&d systems ) and mmp-3 ( baf513 , r&d systems ) . membranes were reprobed with anti - gapdh antibody ( biodesign , saco , maine , usa ) for assessing equal loading where appropriate . fluorogenic assays for mmp enzyme activity were performed using selective substrates : dnp - pro - leu - ala - leu - trp - ala - arg - oh ( mmp-1 ; calbiochem , bedfont cross , u.k . ) , dnp - pro - leu - gly - met - trp - ser - arg - oh ( mmp-2/9 ; calbiochem ) , mca - pro - leu - ala - nva - dpa - ala - arg - nh2 ( mmp-2 ; calbiochem ) , dnp - pro - tyr - ala - ty - trp - met - arg - oh ( mmp-3 ; anaspec , fremont , ca , usa ) and 5-fam - arg - pro - lys - pro - val - glu - nva - trp - arg - lys(tq2w)-nh2 ( mmp-3 ; enzo life sciences , exeter , u.k . ) as previously described . briefly , equal volumes of assay buffer and media from 10 myofibroblasts were incubated with 12 m substrate as appropriate . gastric cancer cell ( ags ) migration ( 10 cells per 8 m pore filter insert ) ( bd biosciences , oxford , u.k . ) was studied as previously described . conditioned media were collected as described above and treated with mmp-1 neutralizing antibody ( mab901 , r&d systems ) , or selective mmp-2 ( inhibitor i , calbiochem ) and mmp-3 ( inhibitor iv , calbiochem ) inhibitors as appropriate . results are expressed as mean standard error of the mean ( sem ) , unless otherwise stated . student s t - test or anova ( systat software , inc . , hounslow , london , u.k . ) as appropriate were used to determine statistical significance of results and considered significant at p < 0.05 , unless otherwise stated . when myofibroblasts derived from two gastric cancers and corresponding atms were silac labeled and the secretomes analyzed by lc ms / ms , approximately 350 unique proteins ( 310 and 392 ) were identified in each pair on the basis of one or more peptide unique assignments with validated quantification ( supporting information tables s1 , s2 ) . of these , 42 and 48% were characterized as extracellular proteins on the basis of annotations in the uniprot and hprd databases . one of the paired samples was further analyzed using the cofradic technology that enriches for methionine - containing peptides in an attempt to increase overall proteome coverage by reducing sample complexity . this approach more than doubled the number of unique peptides and proteins identified in the secretome , although a comparable proportion ( 31% ) of the identifications were attributable to extracellular proteins ( figure 1a ; supporting information table s3 ) . the met - cofradic analysis identified the majority ( 72% ) of proteins identified in the initial experiments ( figure 1a ) . in total across the three experiments , 1460 unique proteins were identified , of which 364 were annotated to be extracellular proteins . ( a ) venn diagram showing , left , identification of unique proteins , on the basis of one or more unique peptides with a validated quantification , in media from pairs of cams / atms from two patients , and overlap with met - cofradic identifications in patient 1 based on the same criteria ; right , extracellular proteins in this data set . ( b ) functional classification of extracellular proteins identified by met - cofradic and classical shotgun proteomics , alongside cleaved proteins and total cleavage products in myofibroblast secretomes by n - terminal peptide enrichment ( restricted to identifications with successful quantification ) . extracellular proteins making up the secretome were grouped into 11 functional classifications ( figure 1b ) . there was a broadly similar distribution across these groups in both pairs of cams and atms , with binding proteins and extracellular matrix proteins the two largest groups ( figure 1b ) . when 95% confidence limits were determined and applied to individual experiments , 947 proteins were identified that were above or below these limits ( supporting information figure s1 ; supporting information table s4 ) . interestingly , mmp-1 , mmp-3 , mmp-10 and upa were identified as upregulated in cams in both patients ( supporting information table s4 ) . the largest groups showing differential abundance were binding proteins , e.g. , the insulin - like growth factor binding proteins ( igfbps ) , receptor proteins , e.g. , epidermal growth factor receptor , and proteases , e.g. , mmp-1 ( supporting information table s4 ) . we then extended the analysis to the identification of neo - n - termini generated as a consequence of proteolytic cleavage . thus , silac - labeled media samples were enriched for n - terminal peptides using a strong cation exchange ( scx ) step to remove nonterminal peptides . as part of this procedure , neo - n - terminal peptides had been trideutero - acetylated prior to trypsinisation to facilitate discrimination from other peptides by mass spectrometry , and the results were filtered so that only peptides that were trideutero - acetylated and had a valid mascot identification were used in subsequent analyses . of unique quantified peptides , this process identified peptides starting at residues 1 or 2 of the protein or immediately after removal of the signal sequence , which were excluded from further analysis as they were considered uninformative for present purposes . for each of the remaining peptides , the ratio of relative abundance between the cam and atm samples was manually validated by inspecting the spectra and calculating the area under the peaks of the heavy and light isotopes . one of the paired samples was further analyzed using n - terminal cofradic in addition to the scx enrichment step in an attempt to increase coverage of n - terminal peptides by reducing sample complexity . similar numbers of peptides were identified by n - terminal cofradic and scx - only enrichment , but over 2-fold more of these identifications corresponded to neo - n - termini in the cofradic data set ( supporting information table s5 ) . approximately 50% of all unique proteins identified corresponded to putative secreted proteins ( supporting information table s6 ) . in the functional classification , furthermore , 41 proteins were identified that were not seen in the first set of silac experiments , of which 24 were known extracellular proteins . in the data set as a whole , neo - n - termini corresponding to putative proteolytic cleavage sites were identified in a total of 94 unique proteins , of which collagens alpha1(i ) and alpha-2(i ) and igfbp-5 had the most cleavage sites ( supporting information table s7 ) . in order to refine cancer - related changes , we then sought those proteins for which unique neo - n - termini were identified in cam secretomes relative to their atm counterparts . applying this criterion , we identified 13 proteins that exhibited cam - restricted proteolytic cleavage ( table 1 ) : strikingly , these included cleavages in the propeptide domains of mmp-1 ( interstitial collagenase ) and mmp-3 ( stromelysin-1 ) ( table 1 and supporting information figure s2 ) ; moreover , n - terminal cofradic also identified increased prodomain cleavage in mmp-2 ( 72 kda type iv collagenase ) ( supporting information table s7 ) . functional classification and cleavage sites start and end position number of the n - terminally labeled peptide are relative to unprocessed forms of the protein . to determine the in vivo relevance of myofibroblasts for mmp activity in tumors , we made use of fmt imaging of a mmp fluorescent substrate in a xenograft model consisting of mkn45 gastric cancer cells alone or with human cams . in matched tumors of similar size generated with and without coadministration of cams , the mmpsense substrate revealed significantly increased activity when human cams were present ( figure 2 ) . increased mmp activity in vivo in xenografts containing cams . ( a ) in balb / c nu / nu mice , mmp activity revealed by fmt imaging of mmpsense 750 fast is increased in xenografts of gastric cancer mkn45 cells containing two different cams compared with mkn45 cells alone . ( b ) representative fmt images of mice with xenografts of mkn45 cells alone ( top row ) , mkn45 cells + cam2 ( middle row ) , and mkn45 cells + cam1 ( bottom row ) . the substrate used for in vivo imaging does not distinguish individual mmps , and subsequent studies therefore made use of in vitro techniques to assess the relative contribution of mmps13 in cam media . western blots of mmp-1 revealed increased abundance of a 42 kda form corresponding to the active enzyme in cam compared with atm media ; in contrast , in cell extracts of the two cell types there was similar abundance of the precursor proteins of 57 and 52 kda ( figure 3a ) . for mmp-2 , we identified a precursor form of 72 kd in cells and media of both cams and atms , again in similar abundance in the two cell types . when blots of media were overexposed it was possible to identify a minor band of 63 kda corresponding to the active enzyme in cam but not atm media ( figure 3b ) . finally , for mmp-3 we identified precursor proteins of 59 and 54 kda in cells and media of both cams and atms ; a band of 45 kda corresponding to the active enzyme was found in media , and the abundance was greater in cams compared with atms ( figure 3c ) . western blots show the active forms of mmp-1 , mmp-2 , and mmp-3 in cam media . ( a ) representative western blots of mmp-1 in cam and atm media ( left ) and cell extracts ( right ) . ( b ) representative western blots of mmp-2 in cam and atm media ( left ) and cell extracts ( right ) . ( c ) representative western blots of mmp-3 in cam and atm media at two different exposures ( left , center ) and cell extracts ( right ) . to establish the functional significance of these results , we then studied mmp enzyme activity in cam and atm media . using a fluorogenic substrate for mmp-1 , we found significantly greater activity in cam compared with the corresponding atm media ( figure 4a ) . similarly , substrates selective for mmp-2 , or for mmp-2/mmp-9 ( figure 4a ) , revealed greater activity in cam than atm media , and the same pattern was observed with two different mmp-3 substrates ( figure 4a ) . increased mmp-1 , mmp-2 , and mmp-3 activity in cam media . ( a ) mmp-1 , mmp-2 , and mmp-3 enzyme activities ( using the selective substrates indicated in brackets ) are increased in cam compared with atm media ; left , assays based on trp fluorescence and right on fret . ( b ) cam - cm media stimulates ags cell migration and is inhibited by neutralizing antibody to mmp-1 ( 2.5 g ml ) or inhibitors ( see text ) of mmp-2 ( 6 m ) and mmp-3 ( 3 m ) . there is mmp - stimulation of migration of ags gastric cancer cells in boyden chambers , and this was then used to test the functional significance of the changes in mmp abundance and activity in cam media . conditioned media ( cm ) from both cams and atms stimulated ags cell migration , but the response to the former was significantly greater than to the latter ( cam - cm : 207 11 cells per field ; atm - cm : 145 11 , p < 0.05 ; control media : 15 2 ) . neutralizing antibody to mmp-1 ( 2.5 g ml ) significantly suppressed ags cell migration in response to cam - cm ( figure 4b ) ; similarly , previously characterized selective inhibitors of mmp-2 or mmp-3 at concentrations approximately 3-fold above their reported ki in each case ( 6 and 3 m , respectively ) also inhibited ags cell migration in response to cam - cm , indicating that active mmp-2 and mmp-3 released from myobfibroblasts play a role in cancer cell migration ( figure 4b ) . the tumor microenvironment reflects the secretomes of both cancer and stromal cells including myofibroblasts , fibroblasts , pericytes , endothelial cells , inflammatory and immune cells . crucially , interactions between different secretomes influence cancer cell migration , invasion and metastasis by multiple mechanisms including the activation or inhibition of proteases with consequences for the proteolytic cleavage of ecm proteins , growth factors , cytokines and chemokines . the secretomes of cancer cells have attracted increasing attention in recent years , but little is yet known of stromal cell secretomes . differences in the secretomes of myofibroblasts recovered from gastric cancers and those recovered from adjacent tissue have been reported recently using itraq . we have now used silac and cofradic to determine the extent to which proteolysis influenced myofibroblast secretomes in gastric cancer . our study identified neo - n - termini derived from 94 proteins in cam secretomes including evidence of cleavage of the prodomains of mmp-1 , -2 , and -3 leading to increased extracellular proteolytic activity . the data indicate that a distinguishing feature of cancer myofibroblasts is increased expression and increased activation of these mmps in an autonomous manner in gastric cancer with the potential for promoting cancer progression . the identification of secreted biomarkers by cancer cells has been a focus of interest for several generations and has been stimulated more recently by the development and refinement of proteomic methods and the prospect of rigorously defining the cancer secretome . extracellular proteolysis presents additional challenges in defining the relevant secretomes ; it is important not least because it underlies multiple mechanisms implicated in cancer progression including angiogenesis , tumor cell migration and invasion . a number of proteomic methods have recently been used to identify neo - n - termini generated in complex samples including cofradic and terminal amine isotopic labeling of substrates ( tails ) , which has been applied to the identification of substrates of mmp-2 and mmp-9 in fibroblast secretomes . since silac has previously been used successfully for secretome studies in a range of cell types including stromal cells from other tissues , and since cofradic coupled with silac labeling is considered to offer a rigorous approach to n - terminomics , these methods were selected for the present studies . golgi secretory pathway ; however , as commonly found in secretome studies , there were also proteins likely to be released by other mechanisms including cytoplasmic proteins liberated through cell death , shedding of membrane proteins and release of exosomes . previous studies have identified similar rates of apoptosis in cams and atms suggesting that differential cell death is unlikely to account for differences in the cam and atm secretomes . for proteins released through classical secretory mechanisms , we were able to identify many previously reported in the secretomes of fibroblasts and of the stem cells that may give rise to them , including extracellular matrix proteins , igfbps , mmps and timps . the differences between cam and atm secretomes may reflect alterations in gene expression , post - translational processing , relative rates of secretion and in proteolysis following release . we have now defined the latter though identification of neo - n - termini in cams compared with their corresponding atms . for example , we found multiple neo - n - termini in collagens alpha-2 ( i ) and alpha-1(i ) , and igfbp5 , as well as at limited sites in 91 other proteins . in a small subset of proteins we identified neo - n - termini that were unique to cams , and these included six neo - n - termini in the prodomains of mmp-1 and mmp-3 , suggesting that activation of these mmps might be functionally important in cams . it is well established that mmp activity is increased in tumors and promotes cancer cell migration and invasion ; the present in vivo imaging data indicate that cams contribute to this increased activity in an animal model . it is likely that mmps have multiple roles in different tumor functions accounting for the fact that mmp inhibitors have not yet led to successful anticancer therapies . the present demonstration of increased expression and activation of mmp-1 , mmp-2 and mmp-3 in cam secretomes nevertheless suggests a novel dimension to the role of these enzymes . in vivo there may be activation of myofibroblast mmps by epithelial or cancer - derived proteases , e.g. , mmp-7 . importantly , however , the present data indicate that increased mmp activity in cam media occurs independently of a cancer or epithelial cell stimulus . this is nevertheless relevant to cancer cell function not least because mmp-1 , mmp-2 , and mmp-3 stimulate cancer cell migration and make a substantial contribution to the chemotactic properties of cam conditioned media . the prodomain cleavages of mmp-1 , -2 , and -3 identified here are all on the n - terminal side of the conserved cysteine switch sequence , and we think it is possible that these facilitate activation by exposing the site for autolysis much in the same way that trypsin activates mmps . however , the precise protease(s ) responsible for cam - autonomous prodomain cleavages is presently unclear and should now be investigated . in this context it is worth noting that there was decreased abundance of protease inhibitors , including timps-1 , -2 , and -3 in one patient ( supporting information table s4 ) , which may contribute to increased protease activity . cofradic has provided the most detailed analysis of gastric cancer myofibroblast secretomes to date . it extends previous studies , but in addition , it defines differences in the extracellular degradomes of cams and atms . at least some of the differences between cafs or cams and their normal tissue counterparts are thought to reflect interactions that occur in the presence of cancer cells . the present data indicate that selective mmp - activation occurs in the cam secretome even when these cells are cultured in the absence of cancer cells . this property reflects a cell - autonomous mechanism by which cams might contribute to a cancer - promoting microenvironment . the possibility of targeting anticancer therapies to stromal cells has emerged recently , and the present data indicate how these could be refined to include the stromal degradome .
cancer progression involves changes in extracellular proteolysis , but the contribution of stromal cell secretomes to the cancer degradome remains uncertain . we have now defined the secretome of a specific stromal cell type , the myofibroblast , in gastric cancer and its modification by proteolysis . silac labeling and cofradic isolation of methionine containing peptides allowed us to quantify differences in gastric cancer - derived myofibroblasts compared with myofibroblasts from adjacent tissue , revealing increased abundance of several proteases in cancer myofibroblasts including matrix metalloproteinases ( mmp)-1 and -3 . moreover , n - terminal cofradic analysis identified cancer - restricted proteolytic cleavages , including liberation of the active forms of mmp-1 , -2 , and -3 from their inactive precursors . in vivo imaging confirmed increased mmp activity when gastric cancer cells were xenografted in mice together with gastric cancer myofibroblasts . western blot and enzyme activity assays confirmed increased mmp-1 , -2 , and -3 activity in cancer myofibroblasts , and cancer cell migration assays indicated stimulation by mmp-1 , -2 , and -3 in cancer - associated myofibroblast media . thus , cancer - derived myofibroblasts differ from their normal counterparts by increased production and activation of mmp-1 , -2 , and -3 , and this may contribute to the remodelling of the cancer cell microenvironment .
interleukin-29 ( il-29 ) is the main cytokine among three members of interferon lambda family ( ifn-s ) , also known as type iii ifns , including ifn-1 , ifn-2 , and ifn-3 ( or il-29 , il-28a , and il-28b , resp . ) . the activity of il-29 is determined in part by the distribution and expression of its specific il-28 receptor alpha chain ( il-28ra ) . il-28ra is widely expressed by ranges of cells including epithelial cells , hepatocytes , fibroblasts [ 1 , 2 ] , and immune cells , such as plasmacytoid dcs , macrophages , th17 cells , and nk cells [ 36 ] . the most studied biological role of ifn-s is its antiviral activity , but recent investigation starts to uncover a unique role of ifn-s in and beyond innate antiviral immunity [ 4 , 7 ] . il-29 can induce antiproliferative and antitumor properties [ 8 , 9 ] , inhibit il-13 release in t cells , and stimulate il-6 , il-8 , and il-10 production in macrophages and il-4 and il-13 in mast cells . a recent study showed that il-29 is able to indirectly affect nk cells by regulating il-12 in macrophages . moreover , our recent studies have demonstrated that il-29 levels are higher in peripheral blood mononuclear cells ( pbmcs ) and serum and synovium from rheumatoid arthritis ( ra ) patients when compared to healthy individuals . recombinant il-29 enhances il-6 , il-8 , and matrix - metalloproteinases ( mmps ) production in ra fibroblasts and promotes ra inflammation . il-29 has also been shown to contribute to other immune diseases , such as systemic lupus erythematosus ( sle ) [ 11 , 12 ] , asthma , and psoriasis . however , the role of il-29 in inflammatory diseases remains largely unexplored and whether il-29 is involved in the pathogenesis of osteoarthritis ( oa ) is unclear . oa is one of the most common disorders and has traditionally been classified as a noninflammatory arthritis ; however , increasing evidence shows that synovitis and the immune system are also active players in oa development and progression . for examples , oa synovial fibroblasts ( fls ) contribute to oa pathogenesis by producing inflammatory cytokines such as tumor necrosis factor- ( tnf- ) , il-1 , and chondrolytic mediators such as mmps ; fls - derived il-1 and tnf- induce cartilage degradation . in addition , fls can mediate the innate immune response by responding to both inflammatory cytokines and toll - like receptor ( tlr ) ligands . we have shown that il-29 enhanced ra inflammation and mediated tlr activation in ra fls [ 1 , 2 ] . oa and ra share some similarities in pathogenesis , such as chronic inflammation , synovial hyperplasia , articular destruction , and abnormal immune response . , we examined the potential role of il-29 as a proinflammatory cytokine in oa disease . this study , for the first time , showed that il-29 was higher in blood and synovium from oa patients when compared with healthy controls ( hc ) . recombinant il-29 increased the expression of proinflammatory cytokine in oa fls in vitro and promoted cartilage degradation in coculture of oa fls and cartilage explant ex vivo . finally , our studies revealed that the effect of il-29 on oa fls was likely mediated by nf-b and mapk signaling pathway . our present data support the hypothesis that il-29 may contribute to synovial inflammation and cartilage degradation in oa . recombinant human il-29 and il-1 were purchased from peprotech ( rocky hill , nj , usa ) ; rabbit anti - human il-29/il-28r polyclonal antibody and mouse anti - human cd68 monoclonal antibody were purchased from abcam ( cambridge , ma , usa ) ; mouse anti - human fibroblast growth factor - basic ( fgf-2 ) monoclonal antibody was purchased from millipore ( billerica , ma , usa ) ; pe anti - human il-28r was purchased from biolegend ( san diego , ca , usa ) ; donkey anti - rabbit igg - r and goat anti - rabbit igg / tritc were purchased from santa cruz biotechnology ( santa cruz , ca , usa ) ; dylight488-conjugated affinipure donkey anti - mouse igg , peroxidase - conjugated sheep anti - rabbit secondary antibody , and peroxidase - conjugated sheep anti - mouse secondary antibody were purchased from jackson immunoresearch ( west grove , pa , usa ) ; human il-29 antibody was purchased from r&d systems ( minneapolis , mn , usa ) ; human il-29 enzyme - linked immunosorbent assay ( elisa ) reagent kits were purchased from adlitteram diagnostic laboratories ( san diego , ca , usa ) ; mmp-3 elisa kit was purchased from uscn life science inc . ( wuhan , china ) ; safranin o staining kit was purchased from sciencell research laboratories ( carlsbad , ca , usa ) ; primerscriptrt reagent kit was purchased from takara ( dalian , china ) ; power sybr green pcr master mix was purchased from applied biosystems ( carlsbad , ca , usa ) ; phospho - stat antibody sampler kit , phospho - c - jun n - terminal kinases ( jnk ) , phosphoextracellular signal - regulated kinases ( erk ) , phospho - p38 , phospho - akt , phospho - p65 , phospho - ib , and -actin antibody were purchased from cell signaling technology ( beverly , ma , usa ) ; tissue culture reagents including dulbecco 's modified eagle 's medium ( dmem ) and fetal bovine serum ( fbs ) were purchased from gibco ( carlsbad , ca , usa ) . synovium and cartilage samples were harvested as surgical waste from 10 patients with end - stage symptomatic knee oa at the time of surgery for total knee replacement . blood samples were collected from 30 oa patients and 30 hc . the general characteristics of both patients and controls subjects are summarized in tables 1 and 2 . oa diagnosis was determined by clinician assessment according to the american college of rheumatology ( acr ) criteria . usage of human tissues was approved by the ethical committee of the first affiliated hospital of nanjing medical university , and informed consent was obtained from all patients . blood samples were collected from peripheral veins and were processed within 1 h to provide serum for elisa analysis and pbmc for rna extract . knee synovial tissues ( 5 oa and 3 hc samples ) were used for immunohistology analysis , and the remaining 5 oa synovial samples were prepared for cell culture experiments . synovial tissue was minced and digested with 1% collagenase ii at 37c for 4 h. oa fls were cultured in dmem medium supplemented with 10% fetal bovine serum ( fbs ) , 100 u / ml penicillin , and 100 g / ml streptomycin at 37c in a humidified atmosphere of 5% co2 in air . purity of oa fls was determined by flow cytometry stained with antifibroblast marker ( fgf-2 ) . cells were used for further experiments if > 95% cells were positive for fibroblast marker . il-28r expression on cell surface was measured using flow cytometric analysis . in brief , oa fls ( 1 10 ) were harvested , blocked with 1% bovine serum albumin ( bsa ) for 30 min , and then stained with pe - conjugated il-28r for 25 min at room temperature in the dark . after washing 3 times with pbs , positive cells were determined using a bd facscalibur flow cytometer and cellquest software ( bd biosciences ) . cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assay following our published procedures . briefly , oa fls ( 5 10 ) were incubated in a 96-well , flat - bottomed culture plate in a final volume of 200 l / well culture medium with il-29 ( 1 , 10 , and 100 ng / ml ) for 72 h in a humidified atmosphere ( 37c at 5% co2 ) . next , 20 l of cell proliferation reagent wst-1 was added to each well and incubated for a further 4 hours . after incubation , the absorbance was measured at 450 nm using an elisa plate reader ( biotek , winooski , vt , usa ) . oa fls were stimulated with il-29 ( 1 , 10 , and 100 ng / ml ) in the presence or absence of il-29 blocking antibody ( 1000 , 2000 , and 3000 ng / ml ) for 48 h. after incubation , cells were collected for gene expression analysis by real - time pcr . in another set , oa fls were treated with 100 ng / ml il-29 for 0 min , 20 min , 40 min , and 60 min , respectively . oa cartilages were obtained from knee joint tissue and submerged in a solution with betadine and pbs ( 1 : 3 ) for 10 min and then rinsed with pbs with no any trace of betadine . after freeze - thaw three times at 80c to kill any live cell within the tissue , cartilages were stored at 20c and ready for use . oa fls were cultured in 24-well plate until being 90% confluent and changed to fresh dmem medium . then , the cells were treated with il-29 ( 1 , 10 , and 100 ng / ml ) and il-1 ( 20 ng / ml , positive control ) . thawed cartilage tissues were diced to similar size and placed to each well including oa fls and il-29 . cartilage , oa fls , and il-29 or il-1 were coincubated in dmem medium at 37c in a humidified incubator ( 5% co2/air ) . after 72 h incubation rna was transcribed into cdna in a 20 l mixture containing 1 g of total rna and primescript rt master mix ( takara ) according to the manufacturer 's instructions . quantitative real - time pcr was performed on applied biosystems 7900 ht instrument ( applied biosystems , ca , usa ) following our published procedures . human il-29 and mmp-3 in serum or culture supernatants were measured by elisa according to the manufacturer 's instructions . paraffin - embedded synovial tissues were sectioned , dewaxed , rehydrated , and stained following our published procedures . each slide was evaluated by one of the authors under the microscopy ( nikon , japan ) . tissue sections were scored for staining of the lining on a 0 to 5 scale as reported . for each section , the number of positively stained cells was counted in 20 fields . after sectioning and deparaffin , the slides were stained with the safranin o staining kit to examine the cartilage loss according to the manufacturer 's instructions . in brief , the slides were stained in 0.1% fast green solution for 10 min , rinsed in 1% acetic acid for 15 sec , and stained in 0.1% safranin o staining solution for 30 min . after dehydration in ethanol and clearing in xylene , the slides were mounted and observed under microscope ( nikon , japan ) . scored data were pooled , and the mean sem was calculated . for cells immunofluorescence staining , oa fls were seeded on cover slips and stained following our published procedures . briefly , oa fls were fixed in 4% paraformaldehyde for 10 min and permeabilized with 0.3% triton x-100 in pbs for 5 min . then , the cells were incubated with anti - human il-28r antibody overnight at 4c . after washing , the cells were further incubated with goat anti - rabbit igg / tritc for 1 h in room temperature . finally , the cells were washed and incubated with dapi staining solution for 1 - 2 min and analyzed by fluorescence microscopy ( nikon , japan ) . il-28r was stained in red and nuclei were stained in blue . for tissue double immunofluorescence labeling , sections were incubated with a mixture of primary antibodies ( rabbit anti - il-29 pab , mouse anti - cd68 , or fgf-2 mab ) at 4c overnight . after washing , the slides were further incubated with a mixture of donkey anti - rabbit igg - r and dylight488-conjugated donkey anti - mouse igg for 1 h. finally , the slides were washed and incubated with dapi staining solution for 35 min . images were acquired and processed digitally under the fluorescence microscopy ( olympus , japan ) . the contained positive cells were stained in yellow and nuclei were stained in blue . for western blotting assay , cellular proteins were resolved by 8%10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) and were transferred to polyvinylidene fluoride membranes ( millipore , bedford , ma , usa ) . nonspecific interactions were blocked with 5% skim milk for 2 h and were then probed with phospho - stat 1/2/3/4/5/6 , phospho - akt , phospho - p38 , phospho - erk , phospho - jnk , phospho - p65 , and phospho - ib . the signals were visualized with super signal west dura chemiluminescent detection reagents following the manufacturer 's directions ( thermo fisher scientific inc . , rockford , usa ) , and protein bands were scanned and quantified with the gel - pro analyzer software ( bio - rad , ca , usa ) . the relative quantification of target proteins was calculated by comparison of the bands density levels between samples with image j software . all data were expressed as mean sem and analyzed with graphpad prism 6 software ( graphpad software , la jolla , ca , usa ) . differences between two groups were performed with student 's t - test for parametric data and mann - whitney u test for nonparametric data . a p value of < 0.05 was considered significant . to investigate whether il-29 was involved in the pathogenesis of oa , we first examined the expression of il-29 mrna and its receptor il-28ra in pbmc . real - time pcr analysis revealed that mrna expression of il-29 and il-28ra was significantly higher in oa pbmcs when compared to hc ( p = 0.0012 and 0.0017 , resp . ; figures 1(a ) and 1(b ) ) . in serum , elisa analysis showed that il-29 was significantly higher in oa ( 25.26 3.34 pg / ml ) than in hc ( 5.61 0.71 pg / ml , p < 0.0001 ; figure 1(c ) ) . next , we assessed the expression and localization of il-29 and il-28ra in synovial tissues from 5 oa patients and 3 hc with immunohistochemical analysis . as shown in figure 2 , il-29 and il-28ra are strongly expressed in the lining layer of oa synovial tissues ( figure 2(a ) ) , and semiquantitative analysis indicated that il-29 and il-28ra were significantly increased in oa synovium compared to hc ( p = 0.0045 ) ( figure 2(b ) ) . because macrophages and fls are the major effector cells for inflammation in the infiltrated oa synovium , we next examined whether macrophages and fls can produce il-29 using double immunofluorescence staining . the specific antibodies against cd68 and fgf-2 served as markers for macrophages and fibroblasts , respectively . as shown in figure 2(c ) , il-29-positive cells were stained in red whereas cd68- or fgf-2-positive cells were stained in green , and positive cells for containing il-29 with cd68 or fgf-2 were shown in yellow . as expected , il-29 was strongly expressed in macrophages and fibroblasts in oa synovium , suggesting that these cells might be the important cellular sources of il-29 in oa synovium . immunofluorescence staining showed that il-28ra was expressed in oa fls ( figures 3(a ) and 3(b ) ) , implying that oa fls may be the important target of il-29 . il-29 at 1 , 10 , and 100 ng / ml did not affect the viability of oa fls after 72 h treatment ( figure 3(c ) ) . as shown in figure 4 , il-29 induced a dose - dependent upregulation of il-1 , il-6 , il-8 , and mmp-3 mrna in oa fls following 48 h incubation . furthermore , the action of il-29 on these cytokine expressions in oa fls was abolished by addition of il-29 blocking antibody at the concentration of 2000 and 3000 ng / ml . il-29 can stimulate proinflammatory cytokines expression in oa fls as shown in figure 4 , and chronic inflammation is a major driver of ongoing cartilage damage and joint degeneration in oa pathogenesis . therefore , we chose a coculture model of oa fls with ex vivo cartilage explant to examine the influence of il-29 on cartilage degradation . after 72 h culture , safranin o / fast green staining of the cartilage in the coculture showed that glycosaminoglycan ( gag ) depletion ( mean sem ) was significantly greater in il-29 ( 100 ng / ml ) ( 477.4 22.0 m ) or il-1 ( 20 ng / ml ) ( 717.4 20.9 m ) treated conditions than that in the medium alone ( 154.4 7.1 m ) , indicated by the less intense red staining for safranin o and gag depletion deeper ( figures 5(a ) and 5(b ) ) . in oa , cartilage damage is predominantly mediated by mmps and its specific inhibitors , the tissue inhibitors of metalloproteinases family ( timps ) , most notably by mmp-1 , mmp-3 , mmp-13 , and timp-1 . we examined the ratio of mmp-1 , mmp-2 , mmp-3 , and mmp-13 to timp-1 in the oa fls after 72 h coculture and found that il-29 could significantly upregulate mmp-1/timp-1 , mmp-2/timp-1 , mmp-3/timp-1 , and mmp-13/timp-1 ratio at a dose - dependent manner in oa fls . we also measured mmp-3 levels in supernatant at 72 h incubation in this experiment . consistent with our finding in oa fls monocultures , there were higher levels of mmp-3 in oa fls / cartilage coculture system in response to il-29 at 100 ng / ml when compared to nontreatment control ( figure 5(c ) ) , similar to that stimulated by il-1 ( 20 ng / ml ) . these data imply that il-29 promotes cartilage degradation by stimulating protease production in oa fls . oa fls were stimulated with il-29 and the activation of downstream signal transduction pathways including canonical jak - stat and noncanonical mapk , akt , and nf-b pathways was evaluated ( figure 6 ) . following stimulation of oa fls for 20 min , 40 min , and 60 min with il-29 ( 100 ng / ml ) , phosphorylation of stat 1 ( tyr701 ) and stat 5 ( tyr694 ) ; jnk , erk , and p38 ; and p65 and ib was significantly increased when compared to nontreatment controls . no change in phosphorylation of stats 2 ( tyr690 ) , 3 ( tyr705 ) , and 6 ( tyr641 ) and akt was observed in response to il-29 . phosphorylation of stat 3 ( ser727 ) and stat 4 ( tyr693 ) was not detectable in oa fls . oa has traditionally been classified as a noninflammatory arthritis ; however , the accumulating evidences demonstrate that joint inflammation and synovitis play a critical role in the pathogenesis of oa . our study for the first time showed that il-29 , a novel member of type iii interferon family , ( i ) was upregulated in blood and synovial tissues in patients with oa ; ( ii ) enhanced inflammation of oa fls and promoted cartilage degradation ; and ( iii ) activated mapk and nf-b signaling pathway . in the first case , we demonstrate an essential role of il-29 in inflammation in oa fls . we found that il-29 was abnormally elevated in pbmc , serum , synovial fluid , and synovium in oa patients . within the joint , il-29 and its receptor were located at fls and macrophages , two main cell types in the inflamed synovium responsible for the inflammation and cartilage and bone damage in the joint . abnormal il-29 was also found in ra , sle , gastric cancer , or other diseases . similar to ra , in this study , we did not find a significant correlation between il-29 in serum and oa disease activity ( data not shown ) . the lack of a significant association may be due to the limited sample size and most of the patients having end - stage symptom of knee oa . thus , further prospective studies including a larger sample size and oa patients in early and late disease are needed to determine whether il-29 can serve as a biomarker for systemic inflammation and oa disease activity . we have reported that il-29 contributed to synovial inflammation by stimulating production of proinflammatory cytokines in ra fls . the proinflammatory effects of il-29 have also been shown on pbmc by upregulation of ifn - inducible protein-10 ( ip-10 ) , monokine induced by ifn- ( mig ) , ifn--inducible t cell chemoattractant ( i - tac / cxcl11 ) , and il-8 [ 11 , 18 ] and on t cells by downregulating th2 polarization and cytokine production [ 15 , 19 , 20 ] . soluble inflammatory factors such as cytokines are central to most inflammatory processes , and several cytokines have been implicated in oa pathogenesis including il-6 and il-8 , tnf- , and il-1. indeed , our data showed that il-29 stimulated inflammatory cytokines il-1 , il-6 , and il-8 and production in oa fls , indicating that il-29 may contribute to oa inflammation . recent epidemiological studies on large number of oa patients suggested that an inflammatory synovium / synovitis was linked to increased cartilage damage and pain . fls , the major cellular constituent of the synovial membrane , are the main contributors to the inflammation and cartilage degrading mmp overproduction within the arthritic joint [ 11 , 12 , 22 ] . proinflammatory cytokines derived from fls including il-6 and il-8 , tnf- , and il-1 could increase the production of mmps leading to cartilage damage . our data also showed that mmp-3 mrna was significantly increased in fls upon il-29 treatment ; hence , we further address the interaction between il-29 , inflammation , mmp production , and cartilage degradation . the second novel finding of this study is that il-29 plays a critical role in cartilage degradation in oa . we used a coculture system to establish a direct link between il-29 and cartilage degradation . in this model , fls were cultured with oa cartilage explant to model inflammation - induced mmp production and cartilage degradation . our data showed that il-29 enhanced mmps / timp-1 ratio in oa fls and then resulted in marked increased gag depletion in cartilage . taken together , our data suggest an important role for il-29 in regulating cartilage degradation by driving cytokine and mmp production in oa fls . il-29 is thus capable of modulating one of the most important processes driving tissue degeneration in oa pathogenesis . it has been suggested that il-29 elicits signal transduction via activation of the canonical jak - stat pathway and other alternative pathways including akt and the mitogen - activated protein kinase ( mapk ) in a panel of cells [ 2325 ] . however , the ability of il-29 to trigger the pathways could be cell - type specific or altered in cells . the present study is the first to report the signal transduction pathways in response to il-29 in oa fls . in these cells phosphorylated stats form various homodimers and heterodimers , translocate to the nucleus , and induced il-29-specific biological activities , such as antiviral protection , antiproliferative response , and antitumor activities . and the most prominent biological function of il-29 resides in their ability to induce antiviral state in cells ; thus , the canonical jak - stat signal pathway is the major pathway involved in il-29-induced antiviral action , whereas the effect of il-29 on proinflammatory cytokines production in oa fls may be one key point for studying oa pathogenesis . it is therefore hypothesized that alternative signaling pathways could be more important in oa fls after il-29 stimulation . indeed , il-29 induced strong nf-b and mapk ( p - jnk , p - erk , and p38 ) signal transduction in oa fls . however , whether these pathways are involved in il-29 mediated effects on oa fls has to be investigated in the further study with the inhibitors of these pathways . recent studies suggested that inhibitors of the above two pathways have received more attention in animal model studies and clinical trials in oa patients . collectively , our present data combined with these reports suggested that il-29-mediated inflammation was the pivotal function of il-29 in oa pathogenesis and inhibition of il-29 would be a potential therapeutic target in oa disease . in summary , this study provides the first evidence that il-29 is dysregulated in oa patients and may contribute to synovial inflammation and cartilage degeneration during oa pathogenesis by production of proinflammatory cytokine . further studies of the immunoregulatory effects of il-29 and its underlying molecular mechanism are warranted to understand the pathological role of il-29 in oa disease .
we have recently shown that il-29 was an important proinflammatory cytokine in pathogenesis of rheumatoid arthritis ( ra ) . inflammation also contributes to the pathogenesis of osteoarthritis ( oa ) . the aim of this study was to investigate the effect and mechanism of il-29 on cytokine production and cartilage degradation in oa . the mrna levels of il-29 and its specific receptor il-28ra in peripheral blood mononuclear cells ( pbmcs ) were significantly increased in oa patients when compared to healthy controls ( hc ) . in the serum , il-29 protein levels were higher in oa patients than those in hc . immunohistochemistry revealed that both il-29 and il-28ra were dramatically elevated in oa synovium compared to hc ; synovial fibroblasts ( fls ) and macrophages were the main il-29-producing cells in oa synovium . furthermore , recombinant il-29 augmented the mrna expression of il-1 , il-6 , il-8 , and matrix - metalloproteinase-3 ( mmp-3 ) in oa fls and increased cartilage degradation when ex vivo oa cartilage explant was coincubated with oa fls . finally , in oa fls , il-29 dominantly activated mapk and nuclear factor-b ( nf-b ) , but not jak - stat and akt signaling pathway as examined by western blot . in conclusion , il-29 stimulates inflammation and cartilage degradation by oa fls , indicating that this cytokine is likely involved in the pathogenesis of oa .
visual field assessment is a valuable test in the neuro - ophthalmology clinic for determining presence of visual field deficit , aiding localisation of pathological lesion , and for recording improvement , stabilization , or deterioration of the underlying condition . static perimetry is often undertaken with the humphrey automated perimeter ( humphrey instruments , dublin , ca ) , whilst kinetic perimetry has most commonly been undertaken using the goldmann manual perimeter ( haag streit , switzerland ) . both options , when directly compared , have been shown to reliably detect visual field loss [ 16 ] . central static programmes such as the sita 30 - 2 strategy have been used most with humphrey perimetry in these studies . however , there is less information regarding the use of peripheral static programmes using humphrey perimetry . semiautomated kinetic perimetry ( skp ) has been further developed in recent years , most notably with the octopus 900 perimeter ( haag streit , switzerland ) . assessment of the peripheral visual field in addition to assessment of the central field is often required in the evaluation of patients attending neuro - ophthalmology clinics . however , there is limited information available on the comparison of different peripheral visual field programmes . thus , the purpose of this study was to directly compare skp using the octopus 900 perimeter to a peripheral static programme using the humphrey automated perimeter in a neuro - ophthalmology clinic . a prospective cross - section study was undertaken with local ethical approval and in accordance with the tenets of the declaration of helsinki . participants were not preselected for the study but were identified randomly ; that is , notes were taken consecutively from the list waiting for visual field assessment without prior knowledge of patient ability and cognition . a selection bias existed in that the patients recruited to this study had been booked to an out - patient neuro - ophthalmology clinic for perimetry . thus , there was an assumption that these patients had sufficient ability and cognition to undertake standard automated perimetry . inclusion criteria were adult patients aged 18 years or older attending for visual field assessment , sufficient motor ability to sit at the perimeter unaided , able to press the response button , sufficient cognitive ability to understand and follow instructions for performing the test , willingness to undertake testing on both perimeters on the same day , and able to respond to both i4e and i2e target stimuli on octopus perimetry . the exclusion criteria were patients with visual acuity less than 1.0 logmar , those unable to sit for the duration of perimetry assessment , follow instructions for performing the test , or too ill to complete the full assessment . all patients underwent perimetry following full explanation of the purpose of the test and procedure . the full field 120 ( ff120 ) two zone programme was used as the peripheral static programme on the humphrey perimeter . this programme consists of 120 stimulus locations with a higher density of locations in the nasal than temporal visual field . for the purposes of standardisation and comparison in this study , a screening protocol was used for skp . two stimuli of the same size ( 0.25 mm ) were used but of different intensity ( i4e , 1000 apostilbs and i2e , 100 apostilbs ) . the peripheral visual field boundary and blind spot were assessed using a size i4e target . a minimum of twelve vectors were assessed for the peripheral visual field and eight for the central visual field inclusive of vectors offset from the vertical and horizontal meridia moving centripetally , similar to previously reported testing strategies [ 7 , 8 ] . following assessment , the response points along each vector were joined to form the isopter for i4e and i2e targets , respectively . in addition , 56 static points ( 14 per quadrant ) were assessed within the central 30 degrees of the visual field using the i4e target ( figure 1 ) . movement of the target on the octopus perimeter was set at 5/sec for determination of central and peripheral isopter boundaries and at 3/sec for determination of the blind spot boundary and quantification of boundaries of visual field defects . the study protocol consisted of visual field assessment with both humphrey and octopus perimetry on the same day . the order of testing was randomised as to which of the two assessment types was used first in order to take fatigue effect into consideration . patients were assigned to one perimeter or another according to which perimeter was available for use at the time the patient was called for assessment . reliability was determined automatically by fixation loss and false positive and false negative responses on humphrey perimetry and by manually checking false positive and false negative responses on octopus perimetry . poor reliability was deemed present with fixation losses and false positive and false negative responses of > 25% . visual field results in both groups were assessed for presence or absence of visual field defects . full ( normal ) visual fields by kinetic assessment were defined as visual field results with isopters for i4e and i2e falling within age - matched ranges and no focal defects within the isopter area ( apart from the blind spot in the temporal field ) . visual field loss was defined as isopter boundaries constricted within the age - matched ranges which could be global constriction or a defect type . defect types were classified according to a modified list based on those reported by pineles et al . and the ocular hypertension treatment study ( ohts ) and outlined in table 1 . we added a category of functional visual field loss where the visual field defect followed a tubular or spiral pattern on testing . one author assessed the results of octopus perimetry ( fr ) and the second author assessed the results of humphrey perimetry ( cn ) . each reviewer was masked to patient identifiers and to the classification by the other reviewer . further independent assessment of a sample of visual field results ( n = 36 ) was made by the third author ( mm ) who determined whether the paired humphrey and octopus results were a match or not . a direct comparison was made for octopus and humphrey perimetry results using the statistical package spss version 19 ( ibm spss statistics , usa ) . bland - altman strategy was used to compare the differences between two independent measurements for duration of test versus the average test duration . when analysing the bland - altman results , we expected most of the differences to lie within 1.96 sd if normally distributed . provided the differences within 1.96 sd would not be clinically important , we considered that the two methods can be used interchangeably . we therefore set a clinical cutoff of within 1 minute as a clinically acceptable difference between perimeter test durations . the chi - square test ( ) was used to evaluate correlation between detection of normal and abnormal test results by either perimeter . kappa ( ) evaluation of agreement was used to correct the proportion of agreement between perimeters due to chance when evaluating intraobserver interpretation of visual field results . a value of 1 was defined as perfect agreement , and a value of > 0.7 was deemed a strong agreement . sixty - nine patients attending neuro - ophthalmology clinics underwent dual testing with humphrey ff120 and octopus skp perimetry during the same clinic visit . five patients were subsequently excluded due to octopus perimetry being undertaken using a size iii4e target or i4e target only . sixty - four remaining patients ( 113 eyes ) had diagnoses of posterior visual pathway pathology , anterior visual pathway pathology , functional impairment of visual field , and thirty - one patients had diagnoses that were classed as neurological defects ( postchiasmal ) and 28 patients that were classed as ocular defects ( prechiasmal ) . five patients had normal visual fields or nonspecific visual field defects classed as functional or spurious . there were 29 females and 35 males with a mean age of 48 years ( sd 14 ) . all patients were able to respond to both i4e and i2e target stimuli . on humphrey perimetry the central and peripheral reference decibel level was a mean of 32.6 ( sd 2.4 ) . the mean duration of assessment for skp was 4.54 minutes 0.18 compared to the mean duration for humphrey perimetry of 6.17 0.12 which was significantly different ( p = 0.0001 unpaired t test ) . although the mean duration was higher for humphrey perimetry ( difference between means of 1.63 0.22 ) , bland altman analysis showed proportional change when the differences were compared between the two perimeters ( figure 2 ) . the confidence intervals ranged from 5.25 to 2.01 minutes with differences exceeding our clinical cutoff of within 1 minute . with larger variances , skp showed longer test durations than humphrey perimetry ( 16 eyes ( 15% ) , table 3 ) . 80% of results ( 90 eyes ) were correctly matched for normal or abnormal visual fields using the i4e target versus humphrey ff120 ( table 4 ) , and 73.5% ( 83 eyes ) , correctly matched using the i2e target versus humphrey ff120 ( table 5 ) . mismatch was due to the i4e isopter being classed as normal or showing only a partial defect or different defect to humphrey perimetry . mismatch with the i2e target was due to the isopter being classed as normal , showing a different defect , partial defect , or being more constricted . in three eyes only , the humphrey result was classed as normal while the octopus result was classed as showing a visual field defect . in all other discrepancies , the humphrey result was worse . when comparing the octopus field with combined i4e and i2e isopters ( i.e. , either or both targets detecting a defect ) to the humphrey result , a match for normal or abnormal fields was recorded in 87% ( 98 eyes ) . three eyes ( 2.6% ) had normal humphrey results and abnormal octopus results , while three eyes ( 2.6% ) had normal octopus results and abnormal humphrey results . the features of these match discrepancies are outlined in table 6 . on independent grading of a sample of results , 80% of results ( 28 eyes ) were correctly matched for normal or abnormal visual fields using the i4e target versus humphrey ff120 ( table 7 ) , and 80% ( 28 eyes ) were correctly matched using the i2e target versus humphrey ff120 ( table 8) . when comparing the octopus field with combined i4e and i2e isopters to the humphrey result , a match for normal or abnormal fields was recorded in 83% ( 29 eyes ) . the agreement between matching results by the first two authors versus independent matching by the third author was significant ( p = 0.0001 ) with 30 of 35 results being correctly matched ( = 0.8 ) . of the five results not correctly matched , each had been matched as abnormal for humphrey and octopus perimetry by the first authors but with a mismatch ( humphrey normal and octopus abnormal in four results , humphrey abnormal and octopus normal in two results ) by the third author . for all comparisons , the humphrey result was classed as showing a worse field ( greater size of field defect ) in 38 eyes . conversely , the octopus result was classed as showing a worse field in 20 eyes which was significantly less than humphrey perimetry , p = 0.001 ( test ) . there was no significant difference for humphrey or octopus results being worse in abnormal visual field results due to either ocular or neurological causes ( p = 0.77 and p = 0.964 , respectively , test ) . during humphrey ff120 perimetry there is an initial determination of central and peripheral threshold levels ( calculated in decibel values : db ) at the beginning of the test . this is used to determine the individual 's reference hill of vision and stimuli are subsequently presented at the predetermined test locations at six decibel intensities higher than the expected threshold for each location . a mean reference level of 32.6 db ( sd 2.4 ) was calculated for the humphrey results in this study . thus , stimuli intensities would range from a mean of approximately 26 db . for octopus skp we used the i4e target to determine the peripheral boundary of the visual field and i2e for the central boundary . calibration of the octopus with a background luminance of 31.4 apostilbs and 1000 apostilb maximum stimulus luminance results in a db value of 20 for the i4e target and 30 db for the i2e target . notably , the decibel scale is not standardised across the humphrey and octopus perimeters as the maximum luminance varies between the two perimeters . on comparison of results , a correct match of visual field result was 80% for the i4e target and 73.5% for the i2e target on skp in comparison to the visual field result on humphrey perimetry . furthermore , when both i4e and i2e isopters were compared , in conjunction with each other , to the humphrey result , a correct match was recorded for 87% of results . thus , combined assessment of the peripheral and central field with octopus perimetry led to the more sensitive detection of visual field deficit eight percent of comparisons both showed abnormal visual field results but lacking an accurate match of defect with abnormalities mainly relating to constriction of field versus a defect in different quadrants of the visual field . three eyes ( 2.6% ) had normal humphrey results but corresponding octopus results showed peripheral superior defects ( all in cases of pituitary adenoma ) . in a further three eyes ( 2.6% ) normal octopus results were recorded but humphrey results showed abnormalities . it should be noted that in two results , the humphrey result showed involvement of spurious points or generalised constriction but in which no specific diagnosis of visual field type could be made . thus , these results could represent normal visual fields in which the patient failed to make adequate responses to stimuli from time to time . given these comparisons of mismatch , we did not feel that the octopus missed more defects than humphrey , or vice versa . independent grading of a sample of visual field results provided similar match comparisons , and a strong agreement for matched results by the first two authors in comparison to the third author was found . previous comparative studies have contrasted skp with static perimetry within the central 30 degrees in ocular diseases such as advanced glaucoma , optic neuritis , and optic nerve head drusen , with good comparisons and test - retest reliability . furthermore , improved defection of visual field loss was obtained when both tests were used in conjunction with each other [ 14 , 13 ] . similar comparisons for neuro - ophthalmic cases have been reported with equal reliability in 77% of eyes , and our results are similar to these with skp compared to humphrey ff120 peripheral static perimetry . disadvantages of static perimetry have been reported as inaccurate location of lesion to the anterior visual pathway , failure to detect macular sparing hemianopia , and overestimation of visual field extent . all matched visual field results , the humphrey results were graded as being more extensive than octopus results in 38 eyes , and the octopus results were graded as being more extensive than humphrey results in 20 eyes . the difference of humphrey results being more extensive than octopus results was significant and might reflect the presence of statokinetic dissociation which has been defined as the static defect being larger than the kinetic defect [ 14 , 15 ] . statokinetic dissociation has been reported as occurring as a physiological phenomenon and has been found to increase towards the periphery of the visual field and decrease towards the centre of the visual field . we did not find statokinetic dissociation to be more prevalent in neurological versus ocular causes of visual field loss . a previous comparison of semi - kinetic perimetry versus automated central static threshold perimetry reported a median test duration of 13 minutes for the kinetic option and 11 minutes for the static option . we found the opposite in our study with a mean test duration of 4.54 minutes for skp and 6.17 minutes for humphrey static perimetry . this may reflect the different number of isopters and vectors assessed for octopus perimetry but also the use of a peripheral suprathreshold static programme rather than a central threshold static programme . on further evaluation of the individual test durations versus the average test duration , there was a wide variability , and the humphrey test was not consistently longer than the octopus test . although we used a screening assessment for octopus perimetry to standardise the initial outline of the visual field , we added more vectors to further define visual field defect boundaries ( as described in the methods ) . the skp screening assessment also incorporated static assessment of the visual field similar to previous studies using goldmann perimetry with armaly - drance style strategies [ 7 , 8 ] . thus , the octopus test became more detailed in the presence of more complex visual field defects . this may explain the crossover of test duration evident on bland - altman analysis in which the octopus test duration was longer than the humphrey test duration in 16 eyes ( 15% ) . the humphrey ff120 programme utilised a two zone strategy in which stimuli were recorded as either seen or unseen and would not provide any detailed information with respect to the depth of visual field defect . in these cases , it could be argued that octopus perimetry provides more detailed and informative evaluation of the visual field with better representation of the field defect in terms of its relative or absolute defect severity and which may be more representative of the individuals field defect that was shown by automated perimetry . further evaluation of this aspect in conjunction with patient reported outcome measures for impact of visual field on activities of daily living and quality of life would be useful . although the cases recruited to this study were representative of the types of pathology and visual field defects seen in our neuro - ophthalmology clinics , a larger sample of posterior versus anterior visual pathway defects would have allowed greater comparisons of differences between skp versus static perimetry . our comparison of 28 patients with ocular pathology to 31 patients with neurological pathology did not show any significant differences . a comparison of the ff120 peripheral strategy to a central threshold strategy would be useful to determine if the central threshold static programmes indicate the presence of visual field defects that may impinge more on peripheral than central visual field , such as in cases of pituitary adenoma . this study demonstrates that the combined octopus i4e and i2e targets were more sensitive to detection of visual field loss than either target alone . generally humphrey perimetry test duration was longer than octopus skp although this was not consistent for all tests . when a more detailed evaluation with octopus skp was undertaken , this was at times longer than the humphrey assessment . in the absence of kinetic perimetry options in neuro - ophthalmology clinics , peripheral static suprathreshold programme options such as octopus semi - kinetic perimetry utilising both the i4e and i2e targets provides detailed information of both the defect depth and size and may provide a more representative view of the actual visual field defect , particularly for more moderate to severe visual field defects .
aim . to compare semikinetic perimetry ( skp ) on octopus 900 perimetry to a peripheral static programme with humphrey automated perimetry . methods . prospective cross - section study comparing humphrey full field ( ff ) 120 two zone programme to a screening protocol for skp on octopus perimetry . results were independently graded for presence / absence of field defect plus type and location of defect . results . 64 patients ( 113 eyes ) underwent dual perimetry assessment . mean duration of assessment for skp was 4.54 minutes 0.18 and 6.17 0.12 for ff120 ( p = 0.0001 ) . 80% of results were correctly matched for normal or abnormal visual fields using the i4e target versus ff120 , and 73.5% were correctly matched using the i2e target versus ff120 . when comparing octopus results with combined i4e and i2e isopters to the ff120 result , a match for normal or abnormal fields was recorded in 87% . conclusions . humphrey perimetry test duration was generally longer than octopus skp . in the absence of kinetic perimetry , peripheral static suprathreshold programme options such as ff120 may be useful for detection of visual field defects . however , statokinetic dissociation may occur . octopus skp utilising both i4e and i2e targets provides detailed information of both the defect depth and size and may provide a more representative view of the actual visual field defect .
acquired renal displacements , due to enlargement of adjacent viscera , are less frequent than congenital renal ectopia / malrotation , but have been described . occasionally , these displacements are associated with kidney rotation , more commonly on the right side due to space constraints . here , we report a case of transient right kidney rotation in a patient with a non - ptotic kidney , due to self - limited hepatic congestion and renal enlargement secondary to acute pulmonary thromboembolism . to the best of our knowledge , rapid development and reversibility of acquired kidney rotation secondary to acute pulmonary thromboembolism has not been discussed in the literature . a 43-year - old woman with a prior history of an enterocutaneous fistula , who had required multiple abdominal surgeries , including bowel resections and prior pulmonary embolism , presented to the emergency department with recurrent enterocutaneous fistula and synchronous acute pulmonary embolism . ct scan of the abdomen and pelvis on admission demonstrated rotation and mild inferior displacement of the right kidney , with the long axis of the kidney lying in the horizontal plane [ figure 1a and b ] . this was a new finding compared with multiple prior ct scans available within the last 2 years in which the kidneys were normally oriented parallel to the psoas muscles ct pulmonary angiography performed synchronously for syncope and pulmonary decompensation demonstrated a segmental pulmonary embolism and right heart strain , including reflux of contrast material into the inferior vena cava , interventricular septal bowing , enlarged main pulmonary artery ( 34 mm ) , and right ventricular dilatation ( rv / lv ratio of 1.8 ) [ figure 1c f ] . the most recent ct scan done 45 days prior to this admission is shown in figure 1 g and h. 43-year - old woman presented with recurrent enterocutaneous fistula and synchronous acute pulmonary embolism , and was subsequently noted to have acquired , transient , rotated right kidney . ( a ) axial contrast - enhanced computed tomography ( cect ) scan of the abdomen at presentation ( day 0 ) shows rotation of the enlarged right kidney ( arrow ) around its short axis into the horizontal plane . ( b ) coronal cect scan of the abdomen at day 0 shows hepatomegaly ( double head arrow ) with rotation of the enlarged right kidney ( arrow head ) around its short axis into the horizontal plane . ( c ) axial cect scan of the chest at day 0 shows enlarged main pulmonary artery ( double head arrow ) measuring 34 mm . ( d ) axial cect scan of the chest at day 0 shows segmental embolus ( arrow ) in the anterior branch of the right upper lobe pulmonary artery . ( e ) axial cect scan of the chest at day 0 shows dilated right ventricle ( double head arrow ) with rv / lv ratio of 1.8 . ( f ) axial cect scan of the liver at day 0 shows reflux of the contrast material into the inferior vena cava ( arrow ) and hepatic veins ( arrow head ) . ( g ) axial cect scan of the abdomen 45 days before presentation ( day 45 ) shows normal orientation of the normal - sized right kidney ( arrow ) . ( h ) coronal cect scan of the abdomen at day -45 shows normal orientation of the normal - sized right kidney ( arrow head ) and normal liver ( double head arrow ) size . follow - up imaging done after 10 days demonstrated normalization of the right kidney axis , position , and size , as well as decrease in hepatomegaly [ figure 2a and b ] . calculation of liver and kidney volumes from ct scans done 45 days before presentation , on the day of admission , and 10 days following admission , using the method described by dello et al . repeat ct pulmonary angiogram [ figure 2c and d ] performed 10 days after presentation showed normalization of the thoracic changes including normal size of main pulmonary artery ( 25 mm ) and normal right ventricular size ( rv / lv ratio of 0.86 ) . nephroptosis , which is a condition in which the kidney descends more than two vertebral bodies ( or > 5 cm ) during a position change from supine to upright , was excluded by ultrasound examination of the right kidney which failed to deviate significantly when the patient changed from supine to upright position . 43-year - old woman presented with recurrent enterocutaneous fistula and synchronous acute pulmonary embolism , and was subsequently noted to have acquired , transient , rotated right kidney . ( a ) axial contrast - enhanced computed tomography ( cect ) scan of the abdomen 10 days after presentation ( day 10 ) shows return of the right kidney ( arrow ) to its normal axis . ( b ) axial cect scan of the chest at day 10 shows normal - sized main pulmonary artery ( double head arrow ) measuring 25 mm . ( c ) coronal cect scan of the abdomen at day 10 shows improvement in hepatomegaly ( double head arrow ) with return of the right kidney ( arrow head ) to its normal axis . ( d ) cect scan of the chest at day 10 shows normal - sized right ventricle ( double head arrow ) with rv / lv ratio of 0.86 . 43-year - old woman presented with recurrent enterocutaneous fistula and synchronous acute pulmonary embolism , and was subsequently noted to have acquired , transient , rotated right kidney . liver and kidney volumes were calculated 45 days before presentation ( day 45 ) , at presentation ( day 0 ) , and 10 days after presentation ( day 10 ) . the volume of the liver was approximately 1390 , 2340 , and 1944 cm on days 45 , 0 , and 10 , respectively . the corresponding values for the right kidney were 141 , 168 , and 142 cm , respectively . acquired displacement of the kidney is usually an incidental finding , which may be due to enlarged adjacent organs such as liver , gallbladder , spleen , or adrenal gland . it also occurs in the setting of peritoneal or retroperitoneal masses such as abscesses , hematomas , or neoplasms . this finding is more commonly associated with kidney rotation on the right side than on the left , due to greater space limitations . when caused by hepatomegaly , acquired kidney rotation is usually due to a longstanding process in which the liver enlargement is massive . to the best of our knowledge , rapid development and reversibility of acquired kidney rotation in the absence of nephroptosis has not been discussed in the literature . here , we report a case of transient kidney rotation which occurred over a short period of time secondary to passive hepatic congestion related to an episode of acute pulmonary embolism and resolved promptly within 10 days after the resolution of the right heart strain . hepatic ct volumetry demonstrated a 68% increase in the liver volume at the time of the pulmonary embolism , which may , in part , be due to aggressive hydration after the syncopal episode . however , a few days later , when the right kidney was shown to have returned to its normal anatomical axis and position , the liver volume only decreased by 17% , demonstrating that even small changes in the hepatic size may lead to kidney rotation . a second factor which has been the focus of less attention in the literature is the effect of renal enlargement itself . in the present case , the volume of the kidney increased by 18% at the time of pulmonary thromboembolism and returned to its normal value within 10 days . therefore , it appears that passive congestion and enlargement of the kidney per se can contribute to renal displacement and/or rotation . it has been reported that patients with ptotic , ectopic , or malrotated kidneys may develop vascular or ureteral kinking which can cause a spectrum of renal pathologies including hydronephrosis , pyelitis , renal ischemia , and hypertension . while this did not occur in this patient , the potential exists and it is important for radiologists to be aware of this unusual and interesting entity . we report a case of an acquired , transient , rotated kidney in a patient with acute pulmonary embolism secondary to transient hepatomegaly and passive renal congestion that resulted from right heart strain . to the best of our knowledge , rapid development and reversibility of acquired kidney rotation secondary to acute pulmonary thromboembolism has not been discussed in the literature .
we present a case of an acquired , transient , rotated right kidney in a 43-year - old woman with an enterocutaneous fistula who presented with acute pulmonary embolism . this non - ptotic rotated kidney returned to its normal orientation within 10 days . we postulate that this transient kidney rotation is due to transient hepatomegaly and passive renal congestion secondary to pulmonary embolism . while in this patient there were no untoward sequelae , it has been reported that ureteral obstruction or vascular occlusion can occur in patients with ptotic and malrotated kidneys , and radiologists , therefore , should be aware of this unusual occurrence and the potential complications .
congenital nasolacrimal duct obstruction ( cnldo ) occurs in up to 70% of neonates at delivery . however , only 6%20% of all neonates have symptoms , because the obstruction usually resolves spontaneously before lacrimal secretion begins.1 the main presentation of nasolacrimal obstruction is watering ( epiphora ) and mucopurulent discharge observed from the first month of life . this usually occurs in only one eye , although both eyes may be affected in up to 20% of cases.2 the treatment of cnldo includes observation , topical antibiotics with tear duct massage , and surgical interventions ranging from simple probing to more invasive procedures , such as stent intubation and dacryocystorhinostomy . there is marked controversy regarding the treatment both conservative and surgical of cnldo , mainly due to a literature based on lower levels of evidence such as case reports , expert opinion , and noncontrolled mainly retrospective studies.3,4 higher levels of evidence such as systematic reviews , meta - analyses , and randomized controlled studies are lacking in this clinical area.5 lacrimal system intubation has become a prominent method in the management of refractory cases of cnldo and in those resistant to probing.68 increased experience with the technique and the introduction of various intubation techniques such as monocanalicular intubation ( mci ) have led to choosing intubation as a primary procedure for nasolacrimal duct obstruction in younger children . success rates from 79% to 96% have been reported for intubation as a primary procedure in retrospective case series.6,8 however , the use of these stents requires intubation anesthesia and is associated with a longer operative time and a consecutive higher cost of operation . we conducted a prospective randomized study to assess the use of the new , easily introduced pushed mci in comparison to simple probing for primary management of cnldo . patients were selected from the outpatient ophthalmology clinic of abureesh specialized pediatric hospital , cairo university . the protocol was revised and approved by cairo university ophthalmology ethical committee ; all parents / guardians signed an informed consent before the initiation of the procedure and gave consent to publish their information and images in the study . patients aged <3 years with membranous cnldo and complaining of epiphora with or without discharge with no previous intervention and no associated craniofacial anomalies were included . patients were randomly divided into groups a and b. randomization was done through random allocation sequence ( chit method ) . group a : 30 eyes underwent simple probing of nasolacrimal duct.group b : 30 eyes underwent insertion of masterka tube in addition to initial probing . group b : 30 eyes underwent insertion of masterka tube in addition to initial probing . the function of the lacrimal pathway was evaluated by : history of onset of symptoms , severity of lacrimation , symptoms of repeated infections such as discharge and itching , history of previous medical therapy , or nasolacrimal massage.clinical examination included evaluation of the conjunctival sac and tear film , punctual and medial canthus inspection , and regurge test.modified fluorescein dye disappearance time : a drop of fluorescein is administered on the conjunctiva and the amount of dye present in the conjunctival sac after 5 minutes is recorded . history of onset of symptoms , severity of lacrimation , symptoms of repeated infections such as discharge and itching , history of previous medical therapy , or nasolacrimal massage . clinical examination included evaluation of the conjunctival sac and tear film , punctual and medial canthus inspection , and regurge test . modified fluorescein dye disappearance time : a drop of fluorescein is administered on the conjunctiva and the amount of dye present in the conjunctival sac after 5 minutes is recorded . the history and the modified fluorescein dye disappearance time were considered to be the major end points . under mask anesthesia , probing of the canaliculi and nasolacrimal duct was used to assess the anatomy and functional status of the nasolacrimal pathway , and to exclude cases other than those with membranous obstruction at the level of hasner s valve . a small lacrimal probe was then used initially to probe the lacrimal passage followed by progressively larger probes if possible . after the probe enters the lacrimal sac ( as signaled by the presence of a hard stop ) , it was rotated superiorly , with the body of the probe against the eyebrow . once the probe was rotated to the level of the supraorbital notch at the superior orbital rim , it was guided down the nasolacrimal duct , directed slightly posteriorly and laterally as it is advanced ( figure 2 ) . any significant resistance at this point was not overcome with force ; instead , the probe was withdrawn and the procedure repeated . in the other group , the same procedure was performed then the tube was inserted . the masterka ( fci ophthalmics inc . , pembroke , ma , usa ) pushed monocanalicular silicone intubation set is a pushed lacrimal intubation stent with anchoring plug for punctal fixation ; the metallic guide is located inside the silicone tube , which is available in sizes of 30 mm , 35 mm , and 40 mm . the metallic probe was inserted till the site of obstruction is reached and the punctual position is noted on the probe ( figure 4 ) . the stent was chosen so that it measures ~5 mm longer than the measured distance on the probe ( figure 5 ) . the silicon tube was then inserted ( figure 6 ) till the plug is firmly held in contact with the punctum before removal of the metallic guide ( figure 7 ) . the probe was then withdrawn along the main axis of the lacrimal duct and the tube plug secured in place ( figure 8) . the stent was removed as an office procedure with a forceps instrument by pulling on the collaret . cases with a score of 0 or 1 after 3 months from surgery were considered successful ( table 1 ) . all data were statistically analyzed using microsoft excel software program with analyze it software add - in . percent distribution was used . for other contentious variables ( eg , age ) , frequency distribution , mean , median , comparison between the patient s two groups was made using student s t - test for independent samples for continuous variables and chi - square test for categorical variables . liner regression analysis was used to assess the correlation between continuous variables . for all statistical tests , under mask anesthesia , probing of the canaliculi and nasolacrimal duct was used to assess the anatomy and functional status of the nasolacrimal pathway , and to exclude cases other than those with membranous obstruction at the level of hasner s valve . a small lacrimal probe was then used initially to probe the lacrimal passage followed by progressively larger probes if possible . after the probe enters the lacrimal sac ( as signaled by the presence of a hard stop ) , it was rotated superiorly , with the body of the probe against the eyebrow . once the probe was rotated to the level of the supraorbital notch at the superior orbital rim , it was guided down the nasolacrimal duct , directed slightly posteriorly and laterally as it is advanced ( figure 2 ) . any significant resistance at this point was not overcome with force ; instead , the probe was withdrawn and the procedure repeated . in the other group , the same procedure was performed then the tube was inserted . the masterka ( fci ophthalmics inc . , pembroke , ma , usa ) pushed monocanalicular silicone intubation set is a pushed lacrimal intubation stent with anchoring plug for punctal fixation ; the metallic guide is located inside the silicone tube , which is available in sizes of 30 mm , 35 mm , and 40 mm . the metallic probe was inserted till the site of obstruction is reached and the punctual position is noted on the probe ( figure 4 ) . the stent was chosen so that it measures ~5 mm longer than the measured distance on the probe ( figure 5 ) . the silicon tube was then inserted ( figure 6 ) till the plug is firmly held in contact with the punctum before removal of the metallic guide ( figure 7 ) . the probe was then withdrawn along the main axis of the lacrimal duct and the tube plug secured in place ( figure 8) . the stent was removed as an office procedure with a forceps instrument by pulling on the collaret . cases with a score of 0 or 1 after 3 months from surgery were considered successful ( table 1 ) . all data were statistically analyzed using microsoft excel software program with analyze it software add - in . percent distribution was used . for other contentious variables ( eg , age ) , frequency distribution , mean , median , range , and standard deviation were used . comparison between the patient s two groups was made using student s t - test for independent samples for continuous variables and chi - square test for categorical variables . liner regression analysis was used to assess the correlation between continuous variables . for all statistical tests , group a : 30 eyes of 23 patients , 12 females and eleven males ( average age , 16 months ; range , 734 months ) , underwent simple probing . success was observed in 24 eyes , 80% with an average follow - up of 14 weeks . one patient had epistaxis for 2 days , one patient was found to have upper punctual atresia , and one patient had lower canalicular obstruction . six cases ( 20% ) required further intervention , with 63.3% of cases showing complete resolution of symptoms ( grade 0 ) . group b : 30 eyes of 27 patients , 13 females and 14 males ( average age , 14.85 months ; range , 730 months ) , underwent masterka intubation . success was observed in 25 eyes , 83.3% with an average follow - up of 16 weeks . the tube plug was cut in two patients but the tubes stayed still in place . one patient had corneal ulcer 1 week after surgery , the cause of which was unknown and it healed with proper treatment leaving no complications . six patients had their tubes removed after > 2 months and five cases ( 16.7% ) required further intervention , with 73.3% of cases showing complete resolution of symptoms ( grade 0 ) . however , the difference between the success rates in the two groups was statistically insignificant ( p>0.5 ) . follow - up of cases who underwent probing showed a higher success rate of 86% in the first week compared with 80% at 3 months follow - up with 63.3% of cases showing complete resolution of symptoms ( grade 0 ) , while follow - up showed progressive improvement of symptoms in patients who underwent intubation , the success rate in those during the first week was 83.3% and increased to 86.6% at 2 months . cases that showed complete resolution of symptoms ( grade 0 ) comprised 26.7% in the first week , which then increased to 73.3% by the end of the follow - up ( figure 9 ) . there is comprehensive literature advising treatments for cnldo , opinions have diverged as to the appropriate treatment regarding nature and timing . in our study , we compared the pushed mci by masterka stent as a primary treatment for congenital nasolacrimal obstruction versus simple probing . our study included 60 eyes of 50 patients with cnldo between the ages of 636 months , 30 eyes did primary mci with masterka and 30 eyes did primary probing . the overall success rate in the intubation group was 83.3% , whereas in the probing group it was 80% . however , the difference in the success rates between the two groups was not statistically significant ( p - value of 1 ) . we found success in the probing group in 80% of cases ( 24 cases ) . studies of primary surgical management have found probing to be also successful in 70%97% of cases , with many reports 90%.10 our results are higher than those of the pediatric eye disease investigator group in 2009 in a study that included 955 eyes of 718 children aged 6 months to < 48 months , who underwent initial probing . the success rate was 78% overall and was 78% for children aged 6 months to < 12 months , 79% for children aged 12 months to < 24 months , 79% for children aged 24 months to < 36 months , and 56% for children aged 36 months to < 48 months.11 results are higher than those of the study by casady et al12 that included 127 patients , ranging in age from 1 month to 81 months , with 173 lacrimal systems diagnosed with cnldo that were treated with initial probing showing a success rate of 76.9% . multiple studies have been carried out to assess the role of intubation as a primary treatment for cnldo , to our knowledge none of them was a case - controlled study.5,12 success in the intubation group was achieved in 83.3% of cases ( 25 cases ) . this success is comparable with that of the original designer of the masterka tube , fayet et al,13 in a study that assessed the role of pushed mci using the masterka tube as a primary management of cnldo ; the trial included 110 eyes , and success was achieved in 94 eyes ( 85% ) . eshraghi et al14 in a prospective study assessed the role of pushed mci in children with complex cnldo , they found complete resolution in 26 of 44 eyes ( 59.1% ) . comparing our results with those of other trials that assessed the role of silicon intubation in primary management of cnldo but with a different type of tube showed that our success rate is less than that reported by the pediatric eye disease investigator group in 2008 in a nonrandomized noncomparative trial that included 182 eyes of children between 6 months and 48 months . they found that intubation is successful as a primary management in 90% of cases , in which mci was used in 70% of cases.15 engel et al8 reported in a retrospective case series of 635 patients in whom they found an overall success rate of 96% , which showed a decline to 90% in patients older than 24 months . this difference in success rate could be attributed to the larger number of cases or different types of tubes used . kaufman and guay - bhatia6 showed in a retrospective study on 50 eyes treated with mci with the monoka tube ( 36 as primary treatment ) with an overall success rate of 79% . we have noted that the outcome of the nasolacrimal duct probing at 1 week follow - up was an indication of the final outcome , which was also noted by kashkouli et al.7 probing has commonly been advised as an initial interventional treatment of congenital nasolacrimal duct obstruction ( cndo ) , after conservative treatment failures.3,1619 recently , however , some authors prefer to stent all patients at initial probing , regardless of complexity as it is thought to be associated with a high success and a low complication rate.8 silicon intubation has been recommended by some authors as the primary procedure in patients who are older than 1824 months , because of the presumed reduced success rate of probing with age.4 also , a small proportion of newborns with cnldo have anatomical variations that are unlikely to resolve spontaneously or be relieved by simple probing.10 advocates of primary intubations see that probing may induce minor injuries to the lacrimal duct epithelium , which may lead to cicatricial stricture and prevent the resolution of cndo.1 when probing fails , iatrogenic canalicular obstructions occur in 44% of cases.20 the silicone tube may prevent the formation of granulation - related obstruction around the recent tract.21,22 bleeding could be observed during probing , which might be a sign of trauma further down the system , or a false passage formation.1 it occurs in 20% of cases.1,23 in our study , bleeding from the punctum occurred in 23.3% of probing and 10% of intubation group . another problem is the lower success rate of probing with older children.14,2325 katowitz and welsh24 advocated probing for patients younger than 13 months as they found that probing before 13 months had a cure rate of 97% , which was reduced to 54.7% after 13 months of age . however , some studies have suggested that probing maintains a high success rate without any age - related decline.2,23,25 upon comparing the effect of age of our patients with success in both groups , there was no statistical significance . the amount of failed cases in our study was small for a meaningful statistical assessment of an age effect . to overcome the above problems , we assessed a new type of stenting technique , the masterka , which offers an exciting alternative that can be done with masked ventilation alone . the masterka offers a mci . in this study , we inserted the monocanalicular tube into the superior canaliculus , we observed a single case of corneal abrasion ( 2.8% ) few days after the surgery , the abrasion was central and healed in 3 days without the need of early removal of the tube . fayet et al26 deduced that placing the mci in the superior canaliculus could be a cause of corneal irritation especially if the collaret has a large size . however , engel et al8 recommend placing the tube into the superior canaliculus.8 we had one case of lost tube before the intended time of removal ; premature removal of tube may result in the recurrence of obstruction.8,15,27,28 advantages of the pushed mci include the type of anesthesia used and no retrieval of the tube is required from the nose , thus insertion can be done only with masked airway anesthesia . however , a pulled , monocanalicular ( self - threading ) stent requires general anesthesia and laryngeal protection for retrieval of the stent from the nose . in our study , we were able to insert the tube in selected cases ( three cases ) under sedation only using chloral hydrate as an outpatient procedure without the need for admission to the surgical facility . another advantage is the simplicity of insertion compared with other monocanalicular and bicanalicular tubes ; the use of a pushed intubation method resembles a simple probing technique more than does the pulled intubation . applying the tube into one canaliculus only has an advantage of reducing the risk of iatrogenic trauma to the lacrimal system,29 and the tube is fixated in the punctum without the need of anchoring sutures , there is no risk of cheese wiring of the puncta due to excessive tension as in cases of bicanalicular intubation.28,29 finally , removal of the tube is simple and done under light sedation as an office procedure . one of the main drawbacks of the use of masterka for treatment is that it is only effective for simple mucosal obstructions of the nasolacrimal duct , unlike other types of silicon intubations . complex cases with a stenotic nasolacrimal duct are determined by absence of metallic contact , difficulty during insertion of the tube , and the silicon bunches up around the introducer without passing the stenosis , if this is found then the masterka is not indicated . another problem is that with pushed intubation , removal of the metallic guide by the upper approach will not correct the false passage , whereas with pulled intubation some cases of false passage can be corrected to a certain extent , during retrieval of the stent by the lower nasal approach . this may be reduced by detecting the metallic contact within the nasal fossa to confirm the presence of a ductal opening below the inferior turbinate . the major obstacle for recommended routine use for primary treatment is the cost of the masterka . the tubes currently cost the facility $70 , whereas the probing does not require this extra cost . in addition , intubation requires a visit to remove the tubes , but this is done in the office and does not need a surgical facility . although there was no statistical difference in the success rate of probing and pushed monocanalicular intubation , it is an effective way in the management of nasolacrimal duct obstruction and it requires only mask inhalation anesthesia and it is a good alternative for treatment with low complication rate .
purposeevaluation of efficiency , complications , and advantages of pushed monocanalicular intubation using masterka tube versus simple probing in patients with congenital nasolacrimal duct obstruction ( cnldo).patients and methodsthis is a case - controlled study that included 60 eyes ( of 53 patients ) ; 30 eyes underwent probing and 30 eyes intubation using the masterka tube as a primary treatment for cnldo . the children were aged between 6 months and 36 months at the time of surgery , with no previous nasolacrimal surgical procedure , and had one or more of the following clinical signs of nasolacrimal duct obstruction : epiphora , mucous discharge , and/or increased tear lake.resultswe defined success by absence of epiphora , mucous discharge , or increased tear lake 1 month after tube removal . the overall success rate in the probing group was 80% , while it was 83.3% in the intubation group.conclusionpushed monocanalicular intubation is an effective method for treatment of cnldo ; it requires only mask inhalation anesthesia and could be considered as an appropriate alternative procedure with imperceptible complications .
over the last few years , attention has been focused on the processing of emotion in elderly individuals with a variety of progressive neurological disorders , particularly dementia . although the interest in the emotional aspects of alzheimer 's disease ( ad ) has increased over the last years , the existence of a deficit in the perception or expression of emotional conditions is still widely debated . indeed conflicting evidence has been presented , stemming in part from methodological inadequacies , and in part from lack of consideration of a specific deficit hypothesis . regarding the emotion expression , specifically , it was found that ad and normal controls provided similar subjective ratings when viewing emotion - eliciting images and that these ratings were in the expected directions on valence and arousal dimensions . in addition , participants with ad rated their emotional experiences similarly to control participants but differed in emotion expressivity : they exhibited more negative facial expressions while viewing sad vignettes . about the emotional memory enhancement effect , a body of data indicates a relatively intact enhancement effect for positive pictures , negative stories or film clips [ 58 ] , and a real - life event [ 911 ] ; whereas contrasting results demonstrating a marked impairment in the enhancement effect for positive pictures [ 12 , 13 ] , negative pictures [ 4 , 12 , 13 ] , negative and positive words , negative sentences , and negative and positive neutral words early studies have generally demonstrated impairment of emotional processing abilities [ 15 , 16 ] , whereas more ones have demonstrated a preserved ability to recognize facial emotions [ 1723 ] . when the correlations between ability to recognize emotions and the degree of disease severity and also the type of neuropsychological dysfunction were analyzed , it has been shown that impairment in the emotional processing may be due to cognitive deficits , rather than deficits in emotion processing per se [ 19 , 2426 ] . given that the divergent results regarding the capacity to recognize emotion in complex stimuli are poorly investigated , the goal of the present study was to clarify the discrepancy on literature regarding the ability to perceive and to attribute an emotional rating to stories with different emotional valences and arousal ( a neutral story and an emotionally negative ) . our working hypothesis was that ad patients would have worse emotion processing than control subjects and there would also be a correlation between the performances in the emotional memory test and neuropsychological screening tools . the control group ( cg ) comprised of 10 subjects , and 14 ad patients were matched for age , gender , and years of education . all participants were examined by neurologists and a psychologist and were submitted to standard neuropsychological examinations to assess their cognitive function ( described in later section ) . diagnosis of ad was established according to the nincds - adrda criteria and the dementia severities were determined as 1 or 2 ( 9 and 5 ad patients , respectively ) by the clinical dementia rating ( cdr ) . patients with ad had a history of cognitive decline and memory problems but showed normal consciousness and they lived with their families , requiring no special care . regarding hearing / vision problems , none of the participants showed deficiencies that would impair their tests ' performance and the degree of loss reported by ad patients was matched to those of the control group . patients with other specific causes of dementia such as brain lesions , delirium , and depression were excluded . all ad patients were recruited from the university hospital of braslia ( hub ) , braslia ; each of whom had given informed consent prior to participation in accordance with the ethical guidelines for research with human subjects ( 196/96 cns / ms resolution ) . all subjects were tested with a standard battery of formal neuropsychological tests to evaluate the mental cognitive condition and severity of their cognitive impairment . for this study was used a brazilian version of the mini - mental state examination ( mmse ) , with cutoffs according to education level , to assess the cognitive mental state ( total score ) and the person 's orientation to time and place , recall ability , short - term memory , attention and arithmetic ability , and language comprehension and expression ( subtests scores ) . the clock design ( clox ) was used only in the first part ( patients were asked to draw a clock and put 13:45 h ) verifying executive control and semantic knowledge . verbal fluency test , fas ( oral fluency by letters f , a , and s ) , was used to assess inhibitory control , thought organization , speed of processing , and language . the five - point test was used to evaluate cognitive flexibility and nonverbal fluency . to evaluate episodic memory ( immediate and delayed ) , logical memory i and ii of wechsler memory scale third edition ( wms - iii ) was used . other subtests , such as digit span ( forward and backward ) , were used to assess short - term memory and working memory , along with mental control subtest attention and concentration functions . the similarities subtest of wechsler adults intelligence scale - iii ( wais - iii ) evaluated the subject 's ability to mentally process verbal information , categorizing , and conceptualizing information in the long - term memory store ( abstract reasoning ) . depressive symptoms were measured using the geriatric depression scale ( dgs ) adapted to portuguese . although the ad patients were not formally tested for propositional comprehension , they were able to interact and showed adequate understanding of the instructions during the neuropsychological interview . the instrument used was the emotional memory test ( emt ) which consists of two stories . one was composed of relatively emotionally neutral film clips ( neutral ) , and the other comprised relatively emotionally arousing film clips ( emotional ) . the test relies on the retention of information from an arousing experience that lacks traumatic intensity and involves visual and verbal modalities ( see [ 35 , 36 ] ) . subjects were initially submitted individually to a screening interview and neuropsychological examination . in the first session , each participant watched the test stimuli ( neutral version ) and immediately afterwards was asked to rate the story in a scale of 1 to 4 , with 1 indicating not emotional and 4 highly emotional . five minutes later , the subjects were given an 11-item recall test . the photographs were presented one by one , and in the same order ; meanwhile , the recognition questionnaire was applied to assess subjects ' memory of story line . two weeks later , they did the second part of the research . on this occasion , they watched the emotional version and then were asked to rate the emotional content of the whole story . both emotional rating and recognition questionnaire were also performed with this version of the test . we did not separate the groups into two subgroups due to the fact that all participants watched the neutral story in the first session and the emotional story in the second . in this way , there was no emotional influence that could possibly interfere with their performance . within - groups design ( repeated measure ) we decide not to counterbalance the presentation order of the two versions of the test with the aim of preventing any emotional influence over the neutral story . the kolmogorov - smirnov test was used in order to assess the normal distribution of the dataset . emotional rating scores and total answers for each version of the test were evaluated by a mixed - model anova 2 2 , with version ( emotional and neutral ) as repeated measure within groups and group ( cg or ad ) as between group 's factors . possible differences in cdr 1 and 2 between recognition questionnaire ( neutral and emotional version ) and emotional rating scores were evaluated by an independent samples t - test . stepwise linear regression analyses were performed for each group to determine the best predictors ( from all neuropsychological test results ) of four dependent variables of interest : total score in the recognition questionnaire ( neutral and emotional version ) and emotional rating ( neutral and emotional version ) . significance value was set at p < .05 for all the tests . all statistic analyses were performed using spss version 13.0 for windows ( 2004 ) . ad patients did not differ significantly in age ( t(24 ) p = .466 ) and education ( t(24 ) p = .771 ) . there was no evidence of depression in any subject according to geriatric depression scale , considering a cutoff score of 6 . the cg and ad groups did not differ significantly in gds scores ( t(22 ) = 1.02 , p = .32 ) . the total scores on the neutral version of the questionnaire were cg : 22.6 1.57 ( sd ) , ad : 16.92 4.56 ( sd ) and for the emotional version cg : 22.7 1.16 ( sd ) , ad : 17.78 4.30 ( sd ) . there was a statistically significant effect of group , f(1 , 22 ) = 14.00 , p = .001 , over the total score of the multiple choice recognition questionnaire . f(1 , 22 ) = 1.82 , p = .19 nor group version interaction effect was observed , f(1 , 22 ) = 1,14 , p = .30 . as expected , mean scores of the recognition questionnaire for the neutral version were different between cdr1 ( m = 19.33 , sd = 2.74 ) and cdr2 ( m = 12.6 , sd = 4.04 ) , t(12 ) = 3.74 , p = .003 . mean score of the recognition questionnaire for the emotional version was also different between cdr1 ( m = 19.67 , sd = 3.08 ) and cdr2 ( m = 14.4 , sd = 4.34 ) , t(12 ) = 2.66 , p = .021 . mean emotional ratings for neutral version were cg : 1.80 0.79 ( sd ) , ad : 3.07 0.92 ( sd ) and for the emotional version : cg : 3.2 0.63 ( sd ) , ad : 3.43 0.94(sd ) ( figure 1 ) . emotional rating scores showed a significant effect of group , f(1 , 22 ) = 8.62 , p = .008 . a statistically significant effect of version was observed too , f(1 , 22 ) = 13.38 , p = .001 , as emotional version of the story was rated higher than that of the neutral one . and finally , a significant interaction group version was found , f(1 , 22 ) = 4.71 , p = .04 . post hoc analyses revealed that cg assigned different scores for each version of the test , t(9 ) = 4.58 , p = .001 , while ratings of ad did not differ , t(13 ) = 1.05 , p = .32 . no differences between cdr1 and cdr2 were observed in the emotional rating of any version ( neutral version : cdr1 : m = 2.89 , sd = 0.6 ; cdr2 : m = 3.4 , sd = 1.34 ; t(12 ) = 1.0 , p = .34 . emotional version : cdr1 : m = 3.78 , sd = 0.44 ; cdr2 : m = 2.8 , sd = 1.3 ; t(12 ) = 2.10 , p = .17 ) . clox test result was correlated to the total score in both versions of the emt for the ad group . in addition , wms - r mental control result was included in the model to predict the total score of the neutral version . for the control group , wais - iii similarities test result predicted the total score for the emotional version of the emt . meanwhile , none of the neuropsychological test 's results was a predictor for the total score of the emt 's neutral version for this group . regression analyses for the emotional ratings found that the neutral version rating was correlated to the result found in wais - iii similarities for the control group . for the ad group , mmse and clox results were statistically correlated to the emotional rating of this version of the emt . for the emotional version of the emt , verbal fluency , category ( animals ) , was a predictor of the emotional rating in the control group . finally , verbal fluency , letter ( fas ) , and mmse - recall results were found as predictors of the emotional rating of this version in the ad group . in this study of emotion processing , the results are consistent with our hypothesis that ad patients would have a marked impairment in memory enhancement effect for emt than that for cg subjects . recall scores for both stories were significantly lower in ad patients than those in cg . as expected , ad patients classified at moderate stage of the disease ( cdr 2 ) presented lower scores in the memory recognition questionnaire , in both versions , when compared to mild ad patients ( cdr 1 ) . these results regarding ad patients ' performance in emotion tasks , specially in the memory recognition questionnaire , are different from those reported in recent studies using the same test [ 6 , 7 ] . analysis of each group individually ( cg and ad ) showed that , in cg , there was association with abstract reasoning ( wais - iii similarities subtest ) in the emotional version . for ad patients , significant correlations were found , in both versions , involving specific functions such as auditory language skills , semantic knowledge , and executive functioning ( clox ) for both versions , and with attention and concentration functions too ( wms - r mental control subtest ) to neutral version . hence , it seems that ad patients had to turn to cognitive global functions to complete the task . interestingly , they required more attention and concentration functions to neutral version , suggesting that these materials come to distract them more than arousal contents . on the other hand , given that emt is a test made up of slide presentations of two short stories accompanied by a narrative , the present data support the hypotheses of several cognitive functions being engaged to undertake a complex task . in other words , the adequate global cognitive functioning and conservation of logical reasoning , apart from the mnemonic , linguistic processes ( audio perception of stimuli , comprehension , and verbal understanding ) and executive ones , seems crucial for a good performance in the test . regarding the attribution of emotion to the stories ( neutral and emotional ) , ad subjects were able to recognize and assign appropriate emotion label associated with arousal content : it yielded no significant difference to cg . these results support the notion of preserved emotional content processing in ad patients . despite methodological differences , these findings are in agreement with those from previous investigations [ 5 , 17 , 19 , 20 , 2426 ] which support the idea of unimpaired emotional processing in ad , along with intact emotional expression [ 13 , 37 ] . however , results for the neutral version showed profound differences between the groups , in which cg subjects reported lower scores , as expected whereas ad patients gave similar values to the two versions . comparison between mild and moderate ad patients ( cdr 1 and 2 ) shows no differences regarding emotional attribution to both stories . focusing on the correlations between the attribution of emotion in emt and neuropsychological test 's scores , results suggest that attribution of emotion in its absence ( neutral version ) involved for ad patients cognitive global functions and other specific domains such as semantic memory and executive control ( mmse and clox ) . for cg , there was a significant correlation with abstract verbal reasoning ( wais - iii similarities subtest ) . on the other hand , emotional version involved , for both groups , specifically semantic memory ( cg : category test , animals / min and ad : verbal fluency , fas ) , and additionally there was a significant correlation with other cognitive processes such as working memory , inhibitory control , thought organization , speed of processing , and language particularly for ad group ( mmse recall subtest and verbal fluency , fas ) . therefore , whereas cg seemed to resort to mainly mnemonic processes , ad patients seemed to engage in a wide range of cognitive functions to complete the task , as suggested by the correlations analysis . our data regarding the emotional memory process indicate that ad patients did not benefit from emotional content cues . they maintained the ability to perceive and express emotions for arousal content but they were not as proficient in acknowledging emotions ( or the lack thereof ) for the neutral stimuli . in the context of ad , these difficulties are foreseeable since they are cognitively demanding and ad is , by definition , associated with prominent neurocognitive impairment . thus , difficulties with neutral content may explain the different profile found between the groups . the small sample size is a shortcoming that limits this study , and any conclusion should be interpreted with caution . therefore , further studies , including larger samples of controls and ad subjects , as well as other neuropsychological tests are necessary to assess the influence of neutral and emotional processing in the early stage of ad .
objective . to assess the ability of alzheimer 's disease ( ad ) patients to perceive emotional information and to assign subjective emotional rating scores to audiovisual presentations . materials and methods . 24 subjects ( 14 with ad , matched to controls for age and educational levels ) were studied . after neuropsychological assessment , they watched a neutral story and then a story with emotional content . results . recall scores for both stories were significantly lower in ad ( neutral and emotional : p = .001 ) . cg assigned different emotional scores for each version of the test , p = .001 , while ratings of ad did not differ , p = .32 . linear regression analyses determined the best predictors of emotional rating and recognition memory for each group among neuropsychological tests battery . conclusions . ad patients show changes in emotional processing on declarative memory and a preserved ability to express emotions in face of arousal content . the present findings suggest that these impairments are due to general cognitive decline .
bisphosphonates ( bps ) are a class of synthetic drugs commonly used to treat bone metastasis and various bone diseases that cause osseous fragility ( such as osteoporosis ) . they are able to inhibit bone resorption and prevent loss of bone mass with consequent pathologic fractures , pain , and/or hypercalcemia . they can be divided into two major groups , nitrogen - containing and nonnitrogen - containing bisphosphonates , according to the presence or absence of a nitrogen atom located in the r2 group , with two different mechanisms of action on osteoclasts [ 1 , 2 ] . bisphosphonate - related osteonecrosis of the jaw ( bronj ) is a pathological condition in which there is presence of exposed necrotic bone in the maxillofacial region lasting for more than 8 weeks in a patient who has received bps and has not received radiation therapy to craniofacial region [ 3 , 4 ] . there is also a nonexposed variant of bronj , where no necrotic bone is exposed , but radiographic abnormality with bone pain and swelling is present . recently , osteonecrosis of the jaw ( onj ) caused by chemotherapeutic not belonging to bps drug class agents such as sunitinib ( multikinase inhibitors ) , bevacizumab , and everolimus ( monoclonal antibody that targets vascular endothelial growth factor ) has been reported in patients who never have taken bps . for this reason , it has been proposed recently to rename bronj in antiresorptive agents related osteonecrosis of the jaw ( aronj ) , to include a wider spectrum of drugs that may cause osteonecrosis of the jaw . pathogenesis of bronj is still unclear , but the inhibition of osteoclasts ( which leads to impaired natural remodeling process , that is , a critical event for bone healing ) and inhibition of angiogenesis ( which slows down the healing of bone and soft tissues ) are thought to play a key role . bronj is usually triggered by local traumas like tooth extractions , other minor dentoalveolar surgeries , and dentures [ 4 , 1012 ] . there has been reported spontaneous occurrence too which is commonly caused by underlying odontogenic / periodontal infection . anyway , it must be said that genetic / individual susceptibility is strongly involved in pathogenesis , since bronj does not occur in all patients . diagnosis of bronj is usually performed radiologically ( panoramic radiographs , dental cone beam computed tomography , or spiral computed tomography ) . osteolysis , osteosclerosis , thickening of lamina dura , thickening of periosteum , widening of periodontal space , subperiosteal bone formation or sequestra , fracture , and radiologic evidence of sinusitis are usually seen in bronj lesions . where clinically nonexposed necrotic bone can be seen , further exams such as bone scintigraphy , pet scans , or mri may help in identifying early areas of bone involvement . however , these radiological examinations have very poor specificity and similar findings may be caused in other diseases like odontogenic infections , bone involvement in multiple myeloma , or bone primary tumor / metastasis . the american association of oral and maxillofacial surgeons ( aaoms ) suggested a staging system based on four stages of bronj / aronj [ 5 , 17 ] as follows : stage zero is represented by the nonexposed variant , where other symptoms and signs as pain , sinus tracts , or radiologic markers are present ; first stage includes asymptomatic bone exposure;second and third stage include patients with exposed bone of various extent with other concomitant symptoms and signs which are mainly a result of secondary infection of the necrotic bone . the symptoms may include increased tooth mobility , formation of sinus tracts , suppuration and traumatic ulceration of oral mucosa adjacent to exposed bone , mandibular fracture , or cervical lymphadenopathy . stage zero is represented by the nonexposed variant , where other symptoms and signs as pain , sinus tracts , or radiologic markers are present ; first stage includes asymptomatic bone exposure ; second and third stage include patients with exposed bone of various extent with other concomitant symptoms and signs which are mainly a result of secondary infection of the necrotic bone . the symptoms may include increased tooth mobility , formation of sinus tracts , suppuration and traumatic ulceration of oral mucosa adjacent to exposed bone , mandibular fracture , or cervical lymphadenopathy . the most adequate procedure is far from being standardized and prevention seems to play a pivotal role . physicians who intend to treat aronj usually have their own protocol , which is , usually , based on drug therapy for low stage onjs and surgical therapy ( curettage or en bloc removal ) for advanced stages or resistant cases [ 20 , 21 ] . in our study , we treated 72 patients with bronj with nonsurgical therapy ; in nonresponsive cases , surgical therapy or surgical therapy with platelet rich plasma ( prp ) gel was performed . seventy - two patients affected by bronj observed at the division of maxillofacial & ent surgery , of istituto nazionale tumori , fondazione g. pascale - irccs , naples , italy , from may 2006 to august 2013 were included in this study . their data / tumour history is summarised in table 1 . all patients were treated with bisphosphonates ( alendronate , pamidronate , or zoledronic acid ) and developed osteonecrosis of the jaw . the duration of treatment with bps varied from 4 to 62 months . the extension and the features of the osteonecrosis were evaluated by clinical examination and radiographically with panoramic x - rays scan and ct scan . according to aaoms suggestions , the lesions were classified as stage 0 in five cases , stage 1 in eleven , stage 2 in forty - one , and stage 3 in fifteen . gender , age , primary disease , and administered drug were retrospectively examined and reported in table 1 . all patients with every grade ( 0 , 1 , 2 , or 3 ) of lesions underwent a two - week nonsurgical treatment ( per os 500 mg ciprofloxacin and chlorhexidine 0,20% mouth rinse , twice a day ) ; thus , the status of the lesion(s ) was updated . if the lesion had healed , they underwent a regular follow - up ; if the lesion had improved , they continued therapy for other two weeks ; if the lesion had not improved or worsened , they underwent surgical treatment ( curettage or curettage + excision of necrotic bone ) or surgical treatment with prp ( curettage or curettage + excision of necrotic bone , placement of autologous prp in the residual wound , and closure of the wound ) , continuing the nonsurgical treatment . all the 72 patients thus underwent nonsurgical treatment ; unsuccessful nonsurgical patients were therefore moved to the surgical treatment group , for a total of 15 patients treated with surgery only and 34 patients treated with surgery and prp . autologous platelet gel was prepared at the irccs pascale foundation transfusion medicine ou on the same day of application ; multiple samples of whole blood ( total 60100 ml ) were taken from each patient and collected in 10 ml acd vacutainers ( becton dickinson labware , franklin lakes , nj ) . the amount of blood taken from each patient was based on the size , extension , and depth of the lesion to be treated . blood was then centrifuged at 180 rpm per 10 , in order to separate concentrated erythrocytes from platelet rich plasma ( prp ) . afterward , prp was centrifuged for 10 at 1800 rpm to separate platelet concentrate ( pc ) from platelet poor plasma ( ppp ) . this process yielded 10 ml of pc , at a final concentration of 1000 103/l roughly , for every 60 ml of blood . thrombin , used to activate platelets and accelerate the gelling process , was prepared by adding calcium gluconate to the autologous ppp , at a ratio of 0.2 ml : 1 ml , under a laminar - flow hood ( faster bio48 ) . after 1540 minutes of incubation at 37 , to allow for thrombin formation , the product was centrifuged once again at 1800 g for 1015 minutes . then , 1 ml autologous thrombin - containing supernatant was added to the previously separated prp , together with 0.5 ml ionized ca in a petri dish ( falcon , becton dickinson labware ) , which was shaken until a gelatinous mixture was obtained ( from 2 to 10 minutes ) . with this technique , autologous plt gel can be prepared in the lab in about 90 minutes ; if not used in the same day , it must be aliquoted and stored at 40c before gelling . before administration , each sample was checked for sterility ( culturing for aerobic and anaerobic bacteria and mycetes ) and quality ( platelet concentration in prp ) . different outcomes among groups were analyzed and then their statistical significance was evaluated with chi - square test ( significant when < 0.05 ) and p value ( significant when p < 0.05 ) . of 72 patients , 23 had complete response with nonsurgical treatment only , 15 underwent surgical treatment without prp ( 8 with complete response and 7 with partial response ) , and 34 underwent surgical treatment with prp ( 32 with complete response and 2 with partial response ) , as summarised in table 2 . success rate according to stage at diagnosis is summarized in table 3 ; if stage 0 ( 100% of success ) was not considered , no statistical difference in outcome has been found among the other staging groups . successful therapeutic pathway according to diagnosis stage is summarised in table 4 . for a stage 0 bronj , nonsurgical management success rate decreases in subsequent stages ( stage i : 72% ; stage ii : 20% ; stage iii : 13% ) . when analyzing groups of patients who pursued the two surgical pathways ( with or without prp ) , prp group was found statistically significantly more successful ( p = 0.003 ) than the surgery without prp group . surgery without prp group has shown low success percentage ( 53% ) , much lower than the prp group ( 94% ) . surgery with prp group and surgery without prp group did not show any significant difference in successful outcome among the different stages . clear bone exposure is often complicated by secondary infections of the denuded bone leading to development of osteomyelitis , with abscess or fistula formation and even pathologic fractures may occur . to avoid these events , which have a severe impact on the quality of life of the affected patients , this approach includes antibiotics and antifungals ( systemic or topical ) in addition to disinfectant mouthwashes and appropriate analgesia [ 21 , 2327 ] . some authors recommend that exposed bone should be irrigated with 0.12% chlorhexidine every 72 h for 4 weeks rather than the use of chlorhexidine mouthwash only . it has been suggested that , before systemic antimicrobials are prescribed , wound or pus samples , or both , should be harvested for microscopy and sensitivity testing , including testing for the presence of actinomyces spp penicillin - based ones are commonly and widely used ( phenoxymethylpenicillin , amoxicillin , co - amoxiclav , or clindamycin with or without metronidazole ) [ 4 , 25 , 27 , 28 ] . it must be highlighted that the duration of this treatment is not standardized , and suggestions range from between 7 and 15 days to very much longer treatment [ 2731 ] . it may also be applied as a palliative approach in patients with onj and aggressive cancers with very poor prognosis , for whom more extensive treatment is not indicated . many authors report that nonsurgical management treats local infection and stops the progression of bronj even if it does not lead to the resolution of all mucosal and osseous lesions , because exposed bone in itself is not a problem [ 5 , 28 , 32 ] . in the short term , a conservative approach has many benefits for those who do not have advanced stage disease . anyway relapses and progression of the disease are very common events even in patients who respond well initially [ 33 , 34 ] . surgical approach founds its rationale on the evidence that exposed bone , with its sharp / irregular edges and sequestrum formation , amplifies the risk of increasing inflammation and superinfection and thus should be eliminated . although there is a general consensus on this last topic , it is the extent of surgical intervention that causes the most debate [ 4 , 28 , 35 ] . deciding the necessary quote of bone that must be removed is indeed the most difficult decision of any surgical approach proposed so far . for example , french guidelines highlight that , as bps are administered systemically , actually all margins surrounding bronj lesions are affected and thus should be resected [ 3537 ] . it is a common procedure to perform resections at least until a margin of normally bleeding bone is obtained , as bleeding indicates a metabolic potential for healing . using a wood 's lamp after administration of tetracycline ( 250 mg four times a day for at least 3 days ) or doxycycline ( 100 mg twice daily for 10 days ) has also been suggested to help to delineate radical resection margins [ 38 , 39 ] . histologic examination of tissues should be performed only when there is a justified suspicion of underlying malignancy , because it causes further stress to soft / osseous tissues , which may exacerbate the condition [ 29 , 30 ] . local intervention is a surgical approach which does not involve operating on the basal bone of the mandible or maxilla , therefore removing loose or developing bony sequestra alone , but not all the necrotic zone en bloc , with minimal disturbance of overlying soft tissues and low risk of consequent bone fracture . it avoids the exposure of further bone , and positive outcomes in at least 80% of cases have been reported [ 2325 , 29 , 4043 ] . guidelines from the british dental association ( bda ) and the american society of bone and mineral research ( asbmr ) suggest a conservative surgical approach in case of small segments of necrotic bone which have not caused pathological fractures , removing sharp edges to prevent soft tissue trauma [ 31 , 43 ] . many authors suggest the use of local flaps to expose the necrotic bone , thus aiding removal of the necrotic bone and primary closure of the wound [ 23 , 33 , 40 , 42 , 4446 ] . most authors recommend conservative treatment in most patients and then switching to more aggressive surgical protocol in refractory cases [ 20 , 28 , 36 ] . in radical management , marginal resections ( resection of the alveolus without loss of mandibular continuity ) and segmental resections large sections of jawbones are taken away , aiming at removing all the necrotic bone and resecting bone beyond the alveolus . aaoms recommends using this approach in stage 3 bronj particularly , when lesions are very large or there is a pathological fracture [ 31 , 43 ] . options include immediate or delayed rigid plate fixation or bone graft ; an obturator is recommended for maxillary defects [ 24 , 36 ] . as patients thus undergo major surgical intervention(s ) with this approach , medical indications for surgery must be wisely considered , as bronj patients are often debilitated oncologic individuals [ 22 , 36 ] . prp gel represents a relatively new technique , which seems , thanks to the action of multiple growth factors , to increase tissue vascularization , overtaking one of the major factors on pathogenesis of onjs , the lack of vascularization . in addition , it is autologous and therefore it is a biocompatible and safe product . all studies report excellent results , but , as ours , they are neither case controlled nor randomized [ 22 , 4754 ] . considering what emerges from literature reviewing and our personal experience , we consider it useful to start with any patient at any stage with a two - week nonsurgical approach . even if it has been successful in low percentage in advanced bronj stages , we consider avoiding unnecessary surgical intervention to these patients a priority , avoiding both useless stress and surgical related risks ; furthermore , when nonsurgical approach does not succeed , a two - week delay in performing surgery does not expose patients to major risks . anyway , symptoms referred by patients ( especially pain ) must always be considered in planning treatment . given the necessity of properly suturing wounds when using prp gel to enable its permanence , patients who might have had difficulties in lugging wound flaps were not included in the prp group . possibly for this reason , surgery without prp group has shown low success percentage ( 53% ) , much lower than the prp group ( 94% ) . these data and observation that surgery with prp group and surgery without prp group did not show any significant difference in successful outcome among the different stages highlight the importance of a satisfying closure in the complete healing of bronj wounds . good results showed by prp in improving wound healing give a way to case - control randomized studies that could give definitive evidence of its effectiveness . nowadays , bronj management is still a controversial topic , and there is no definitive standard of care for this disease , with prevention playing a fundamental key role [ 12 , 20 , 55 ] . for advanced stages or cases refractory to nonsurgical approach , surgical resection of the necrotic bone should be performed , possibly granting a proper suture of margins and , according to good reported results , inserting prp in the residual postsurgical wound . in any case , a try of nonsurgical treatment in every patient seems mandatory .
bisphosphonates ( bps ) are a class of synthetic drugs commonly used to treat bone metastasis and various bone diseases that cause osseous fragility ( such as osteoporosis ) . bisphosphonate - related osteonecrosis of the jaw ( bronj ) is a common complication in patients who received bps , especially intravenously . recently , osteonecrosis of the jaw ( onj ) caused by chemotherapeutic not belonging to bps drug class has been reported . for this reason , it has been proposed recently to rename bronj in antiresorptive agents related osteonecrosis of the jaw ( aronj ) , to include a wider spectrum of drugs that may cause osteonecrosis of the jaw . the most debated topic about aronj / bronj is therapy . the most adequate procedure is far from being standardized and prevention seems to play a pivotal role . in our study , we considered 72 patients with bronj with nonsurgical therapy , surgical therapy , and surgical therapy with platelet rich plasma ( prp ) gel to evaluate its therapeutic effect in promoting onj wounds healing . good results showed by prp in improving wound healing give away to case - control randomized studies that could give definitive evidence of its effectiveness .
idiopathic granulomatous lobular mastitis ( iglm ) is an inflammatory disease of the breast with an obscure etiology . it occurs mainly in women of reproductive age , and the lesion mimics carcinoma of the breast both clinically and radiologically we present the case of a 29-year - old female who visited our hospital in kancheepuram , tamil nadu , with a 4 3 cm lump in the upper outer quadrant of her left breast . the clinical and radiological findings were indicative of a malignant lesion ; however , fine - needle aspiration cytology ( fnac ) revealed features of granulomatous mastitis , and the subsequent histology of the excised lump confirmed the diagnosis of iglm . iglm should be considered as one of the differential diagnoses when granulomas are encountered in breast fnac and biopsy . a definitive diagnosis of iglm can be made by identifying its characteristic histomorphology and ruling out other causes for granulomatous inflammation . an exact diagnosis is essential since the treatment for different granulomatous conditions of the breast varies . idiopathic granulomatous lobular mastitis ( iglm ) , which was first reported in 1972 by kessler and walloch , is a rare chronic granulomatous inflammatory lesion of the breast lobules with an unknown etiology ( 1 ) . it is commonly seen in women of reproductive age with a mean age at presentation of 34 years ( 1 ) . clinically these patients present with a painful , unilateral breast lump , but cases with bilateral presentations have also been reported ( 2 ) . some patients also have associated skin changes , lymphadenopathy , nipple discharge , ulcers , and draining sinuses , thus mimicking malignancy . along with a literature review , we present a case of iglm that masqueraded as a breast tumor in a non - lactating young woman.table 1 . summary of iglm cases in literaturestudy groupno of casessex(mean ) ageclinical presentationother findingsgurleyik et al . ( 1)19f34large irregular painful mass in 15 cases , 3 cases had ulcerative skin lesion , 2 had axillary lymphadenopathy.eight patients had history of contraceptive pill usage.altintoprak fet al . ( 2)26f37.5pain , swelling , and inflammation on the affected breast , along with superficial erosion or open fistulae on the breast skinthree patient had history of oral contraceptive use and six had history of smokingreddy km et al . ( 4)case reportf27breast mass , nipple discharge and nipple retractionhistory of breast cancer in the familyergin ab et al . ( 5)case reportf40painful swelling 4.6 1.8 4.6 , erythema , nipple dischargenilakahane et al . ( 6)9f362.4 - 10.0 cm palpable lumps , skin thickening , or axillary lymphadenopathyseven patients were diagnosed within 5 years of their most recent pregnancylai et al . ( 8)case reportf399 6 cm breast lump with localized rednessassociated prolactinemiaour casecase reportf294 3 cm painful mass , firm in consistency with restricted mobilitynil a 29-year - old female presented to our hospital ( shri sathya sai medical college and research institute , kanchipuram , tamil nadu ) with a painful breast lump measuring 4 3 cm in the left upper outer quadrant that had been for the past 6 months . mammography showed a 3.5 3 cm mass with an ill - defined margin that was classified as bi - rads category 3 . because of the clinical suspicion of breast cancer , fine - needle aspiration cytology ( fnac ) was done . the fnac smears showed a few cohesive clusters of ductal epithelial cells along with a focal collection of epithelioid histiocytes , scattered polymorphs , and lymphocytes in the background ( figure 1 ) . cytologically , a diagnosis of granulomatous mastitis was given , and the mass was subsequently surgically excised and sent for histopathological examination . grossly , the mass was well circumscribed , firm to hard with a nodular surface . the cut surface color ranged from gray to tan with focal yellowish areas ( figure 2 ) . microscopy showed granulomatous inflammation centered around the lobules , which were composed of epithelioid histiocytes and langhans giant cells , admixed with neutrophils , lymphocytes , and plasma cells . a clear space rimmed by a thin band of neutrophils was seen at the center of the granulomas ( figures 3 and 4 ) . the sections were stained using a ziehl neelsen method and gomori s methenamine silver ( gms ) and viewed with a polarizing microscope to rule out mycobacterial , fungal , and foreign body etiology , respectively . based on the above findings , the diagnosis of idiopathic granulomatous lobular mastitis was given . the patient was later treated with corticosteroids , and there was good clinical recovery from the disease . though several hypotheses have been suggested , the one that is most widely accepted is damage to the mammary ducts by various factors , including trauma , local irritants , and infections that allow luminal material to leak into the stroma thus evoking a granulomatous inflammation ( 9 ) . the association of iglm with pregnancy , lactation , the use of oral contraceptive pills ( ocp ) , trauma , and autoimmune diseases has been documented . additionally , recent studies have highlighted the involvement of hyperprolactinemia and galactorrhea with iglm ( 10 , 11 ) . there are increased mammary acinar secretions with these conditions , which may lead to distension , rupture of the acini , and extravasation of the luminal contents causing a granulomatous response . ( 12 ) proposed an autoimmune etiology due to the response of iglm to corticosteroids ; however , they were ultimately unable to prove the existence of an autoimmune origin . ( 2 ) evaluated the anti - nuclear antibody ( ana ) and extractable nuclear antigen ( ena ) levels in patients with iglm by indirect immunofluorescence ( iif ) . their results also failed to support an autoimmune basis for iglm . according to akahane et al . ( 6 ) the most common presenting symptoms of iglm are mastalgia and breast mass . they also reported that 58.3% of the cases in their study had diffuse multiple lesions . features like breast lumps , pain , diffuse involvement of the breast , and lymph node enlargement are of concern to clinicians because of high suspicion for inflammatory carcinoma of the breast . ( 9 ) reported that neither mammography nor doppler sonography helps in the diagnosis of ilgm , and it can only be confirmed by histopathology . ilgm is histologically characterized by granulomas that are non - caseating and centered around lobules . a characteristic clear space rimmed by neutrophils is typically seen at the center of the granuloma . this clear space is due to the lipid material from the degenerated cells dissolved during tissue processing ( 13 ) . the final diagnosis is made by identifying ilgm s characteristic histological pattern and excluding other causes of granulomas , such as tuberculosis , sarcoidosis , wegener 's granulomatosis , a fungal infection , or a foreign body ( 4 ) . in kok et al.s ( 14 ) study , only 17% of the iglm patients were diagnosed by fnac alone , while akahane et al . this highlights the limitations of fnac in diagnosing iglm due to the lack of features characteristically seen in histopathology . in our case , the fnac diagnosis was granulomatous mastitis ; however , a final diagnosis of iglm could only be made by histopathology after ruling out other possible causes of granulomas . the definitive treatment of this condition is still unclear although corticosteroids remain the mainstay of treatment in patients with iglm due to their anti - inflammatory action . patients with minimal symptoms are better managed conservatively by close , regular surveillance without surgery ( 7 ) . nevertheless , gurleyik et al . ( 1 ) reported that none of their patients treated with corticosteroids had a complete clinical recovery from the disease . they recommended that local excision of the remaining lesion after steroid therapy would give a better result and decrease the chances of recurrence . unnecessary mastectomies should not be done for this condition as mastectomy is strictly reserved for cases with multiple recurrence and persistent lesions . in cases with multiple recurrence , secondary causes including prolactinemia due to pituitary adenoma or drugs like risperidone should be ruled out ( 8) . a diagnosis of iglm should be made cautiously since erroneously diagnosed cases , if treated with steroids , will aggravate granulomatous disease of an infectious etiology . similarly , cases of iglm , if misdiagnosed as infectious granulomatous conditions , will never respond to antibiotics . iglm should be considered as one of the differential diagnoses when granulomas are encountered in fine - needle breast aspirates , but the final diagnosis should only be made by histopathology with the aid of special techniques and by ruling out other possible causes . iglm should be considered as one of the differential diagnoses when granulomas are encountered in fine - needle breast aspirates , but the final diagnosis should only be made by histopathology with the aid of special techniques and by ruling out other possible causes .
introductionidiopathic granulomatous lobular mastitis ( iglm ) is an inflammatory disease of the breast with an obscure etiology . it occurs mainly in women of reproductive age , and the lesion mimics carcinoma of the breast both clinically and radiologicallycase presentationwe present the case of a 29-year - old female who visited our hospital in kancheepuram , tamil nadu , with a 4 3 cm lump in the upper outer quadrant of her left breast . the clinical and radiological findings were indicative of a malignant lesion ; however , fine - needle aspiration cytology ( fnac ) revealed features of granulomatous mastitis , and the subsequent histology of the excised lump confirmed the diagnosis of iglm.conclusionsiglm should be considered as one of the differential diagnoses when granulomas are encountered in breast fnac and biopsy . a definitive diagnosis of iglm can be made by identifying its characteristic histomorphology and ruling out other causes for granulomatous inflammation . an exact diagnosis is essential since the treatment for different granulomatous conditions of the breast varies .
thyroid hormones ( th ) play an important role in regulating energy balance , metabolism of glucose , and lipids . while th oppose the action of insulin and stimulate the hepatic gluconeogenesis and glycogenolysis they up - regulate the expression of genes such as glucose transporter type-4 ( glut--4 ) and phosphoglycerate kinase , involved in glucose transport and glycolysis , respectively , thus acting synergistically with insulin facilitating glucose disposal and utilization in peripheral tissues.[25 ] the prevalence of thyroid disease in patients with diabetes is significantly higher than that in the general population . homeostatic model assessment ( homa ) is a method for assessing -cell function and insulin resistance ( ir ) from basal ( fasting ) glucose and insulin or c - peptide concentrations . the homeostasis model assessment ( homa ) for ir ( homa - ir ) derives estimates of insulin sensitivity from the mathematical modeling of fasting plasma glucose and insulin concentrations . complex interplay between thyroid function and ir has been implicated in diabetic dyslipidemia . in the light of the existing reports , we decided to evaluate the correlation between ir and altered thyroid state clinically and to assess -cell function and ir by homa - ir . the study was conducted in the care institute of medical sciences , ahmedabad , india . the patients visiting the thyroid clinic were screened and eight patients each suffering from hypothyroidism ( ho ) and hyperthyroidism ( hr ) was enrolled in the study after prior consent ( ethics approval no . the inclusion criteria adopted were : age 1845 years , newly diagnosed and untreated cases for hr or ho . patients suffering from diabetes , having previous history of thyroid disorder other medications that alter thyroid functions and lipid levels led to exclusion from the study . pregnancy and blood samples for the estimation of all the parameters were collected from the patients after an overnight fast . the thyroid stimulating hormone profile ( tsh ) was estimated using ultra - sensitive sandwich chemiluminescence immuno assay and insulin levels were estimated using solid phase radio immuno assay using commercially available kits . the lipid profile and sugar levels were analyzed on micro labs bioanlyaser ( 300 ) using commercially available kits . ir was estimated using homeostasis model assessment ( homa - ir ) from fasting serum glucose and insulin using the oxford homa calculator ( http://www.dtu.ox.ac.uk/homa/index.html ) . patients with high tsh and low tsh were designated to be ho and hr , respectively . keuls multiple comparison test was used to analyze differences in baseline characteristics between the study groups and the control group . the association between the various parameters in different groups was evaluated using pearson 's correlation coefficient . one way anova followed by the newman keuls multiple comparison test was used to analyze differences in baseline characteristics between the study groups and the control group . the association between the various parameters in different groups was evaluated using pearson 's correlation coefficient . tsh levels were high in ho ( 31.5 + 17.51 ) and low in hr ( 0.023 + 0.009 ) groups as compared to the eu group ( 1.9 + 0.19 ) . insulin levels were significantly higher in the hr group ( 29.37 + 8.48 ) as compared to the ho group ( 12.11 + 2.2 ) and the eu group ( 3.711 + 0.22 ) . bmi were significantly high in the ho group ( 24.34 + 1.03 ) and were significantly low in the hr ( 21 + 2.16 ) group as compared to the eu group ( 22.64 + 1.53 ) . homa - ir was higher in the hr group ( 3.45 + 2.51 ) vs. the ho group ( 1.9 + 0.60 ) as well as in both hr and ho groups as compared to controls ( 0.43 + 0.07 ) [ table 1 and figure 1 ] . base line characteristic and biochemical parameters of different study groups effect of altered thyroid state on tsh , insulin homa - ir levels in study patients . values are represented as mean + sem . * eu vs. hr , eu vs. ho , hr vs. ho ( p < 0.05 ) the triglycerides levels were significantly higher in the ho group ( 160.4 + 86.35 ) as compared to the hr group ( 86.13 + 4.64 ) and eu group ( 105.8 + 7.83 ) , whereas the total cholesterol and ldl levels were significantly higher in the ho group ( 178.4 + 27.57 ) vs. the hr group ( 152 + 8.487 ) as well as in both hr and ho groups as compared to the eu group ( 122.6 + 11.77 ) . high density lipoprotein levels ( hdl ) were decreased in both ho and hr groups as compared to eu [ table 1 and figure 2 ] . values are represented as mean + sem . * eu vs. hr , eu vs. ho , hr vs. ho , ho vs. hr ( p < 0.05 ) the pearson 's correlation coefficient for the relationships between serum tsh and homa ir as well as tsh and lipid parameters ho are shown in table 2 . our clinical study showed that tsh levels were positively correlated with insulin and homa ir in patients with ho ( r = 0.62 , p = 0.09 ; r = 0.54 , p = 0.16 , respectively ) . the serum tsh levels significantly positively correlated with total cholesterol ( r = 0.92 , p < 0.005 ) , while positively correlated with ldl and triglycerides levels , and negatively with the hdl level in the ho group ( r = 0.47 , p = 0.22 ; r = 0.05 , p = 0.89 ; r = 0.35 , p = 0.38 , respectively ) . the serum insulin levels were significantly positively correlated with homa - ir ( r = 0.82 , p < 0.05 ) , and positively correlated total cholesterol , ldl , and triglycerides levels while negatively correlated with hdl levels ( r = 0.54 , p = 0.16 ; r = 0.39 , p = 0.33 ; r = 0.01 , p = 0.78 ; r = 0.27 , p = 0.5 , respectively ) . similarly , homa ir was also positively associated with tc , ldl and triglycerides levels while negatively correlated with hdl levels ( r = 0.45 , p = 0.25 ; r = 0.20 , p = 0.62 ; r = 0.12 , p = 0.76 ; r = 0.11 , p = 0.77 ) . correlation between different parameters in hypothyroid patients the pearson 's correlation coefficient for the relationships between serum tsh and homa ir as well as tsh and lipid parameters in hr patients are shown in table 3 . our clinical study showed that tsh levels were negatively correlated with insulin and homa ir in patients with hr ( r = 0.6 , p = 0.1 ; r = 0.5 , p = 0.15 , respectively ) . the serum tsh levels were negatively correlated with total cholesterol , ldl , and triglycerides levels , and significantly positively with the hdl level in hr subjects ( r = 0.4 , p = 0.31 ; r = 0.08 , p = 0.83 ; r = 0.25 , p = 0.54 ; r = 0.72 , p = 0.04 , respectively ) . the serum insulin levels were significantly positively correlated with homa - ir ( r = 0.97 , p < 0.0001 ) , and positively correlated total cholesterol , ldl and triglycerides levels while significantly negatively correlated with hdl levels ( r = 0.07 , p = 0.86 ; r = 0.72 , p = 0.04 ; r = 0.32 , p = 0.45 ; r = 0.86 , p = 0.006 , respectively ) . similarly , homa ir was also positively associated with tc , ldl , and triglycerides levels while significantly negatively correlated with hdl levels ( r = 0.23 , p = 0.56 ; r = 0.06 , p = 0.85 ; r = 0.42 , p = 0.29 ; r = 0.9 , p < 0.005 ) . in this study we have addressed the possible linkage among tsh , ir , and serum concentrations of lipids in both ho and hr population . women are five to eight times more likely to develop ho and eight to 10 times more likely to develop hr . thyroid disease can increase the risk of cardiovascular disease , infertility , and osteoporosis . in recent times our study illustrates the complex interplay between thyroid hormonal status and insulin levels in the pathogenesis of ir . in both , ho and hr insulin levels were found to be higher . cholesterol , tg , are ldl were significantly raised in ho as compared to eu and hr whereas the hdl level was lower . this is in consistence with the well - known association of ho with the lipid profile . the main pathophysiological basis underlying glucose intolerance , dyslipidemia , abdominal obesity , and hypertension has been attributed to ir . in both hyper- as well as hypothyroid groups , there was significant increase in ldl levels . the amount of insulin specifically bound and the number of insulin receptors per cell were inversely correlated with the ldl level . the number of insulin receptors and the amount of insulin bound in the tested subjects with increased ldl were correspondingly low which could further lead to the ir state . considering the insulin and glucose factor in the development of ir glucose metabolism after glucose loading was found to be decreased in both hypo- as well as hyperthyroid groups as compared to the control group . this may be due to either impaired insulin stimulated glucose disposal or decreased insulin - stimulated glucose transport in monocytes due to impaired translocation of glut4 glucose transporters on the plasma membrane as observed in the previous studies in humans . ir is a cardinal feature of type 2 diabetes mellitus and increased risk of dyslipidemia along with relatively frequently found mild thyroid dysfunction . homa of -cell function and ir is a method for assessing -cell function and ir from basal glucose and insulin or c - peptide concentrations . the relationship between glucose and insulin in the basal state reflects the balance between hepatic glucose output and insulin secretion , which is maintained by a feedback loop between the liver and -cells . the use of homa to estimate insulin sensitivity and -cell function helps to compare -cell function and insulin sensitivity in subjects with abnormal glucose tolerance . homa and insulin were found to be positively correlated with tsh in ho and negatively in hr suggesting that even subtle increase or decrease in the thyroid levels can lead to ir . thyroid disorder , including both hypo- and hyper have been associated with ir due to various mechanism such as altered insulin secretion and lipid levels . although hypo- and hyperthyroidism constitute an ir state , more studies need to be done in order to clarify the underlying pathogenic mechanism . thus an altered thyroid state can lead to ir leading to glucose - related disorder such as diabetes dyslipidemia .
objective : to determine the association between altered thyroid hormones and insulin resistance ( ir).materials and methods : eight euthyroid ( eu ) , eight hypothyroid ( ho ) , and eight hyperthyroid ( hr ) patients with no past medical history were studied in this cross - sectional study at the care institute of medical sciences , ahmedabad , india , the fasting blood sample were analyzed for thyroid stimulating hormone ( tsh ) , lipid profile , insulin , and glucose . homeostatic model assessment ( homa ) was calculated for assessing ir.results:homa values were significantly higher in hr and ho groups as compared to the eu group ( p < 0.05 ) . insulin levels were also found to be significantly increased in hr and ho groups as compared to the eu group ( p < 0.05 ) . cholesterol , triglycerides ( tg ) , and low density lipoprotein ( ldl ) were significantly raised in ho as compared to eu and hr groups ( p < 0.05 ) whereas high density lipoprotein levels ( hdl ) were lower . homa and insulin were found to be positively correlated with tsh in ho and negatively in hr.conclusion:thyroid disorder , including both hypo- and hyper have been associated with ir due to various mechanisms such as altered insulin secretion and lipid levels . ir was comparable in patients with both ho and hr . although ho and hr constitute an ir state , more studies need to be done in order to clarify the underlying pathogenic mechanism . thus , an altered thyroid state can lead to ir leading to glucose - related disorder such as diabetes dyslipidemia .
leishmaniasis remains a serious problem in public health , endemic in 88 countries on four continents , but most of the cases occur in underdeveloped or developing countries . visceral leishmaniasis ( vl ) is a progressive infection with fatal outcome in the absence of treatment . approximately 90% of the vl cases registered in the americas occur in brazil and are concentrated in the northeast region . in the new world , lutzomyia longipalpis is the principal vector of leishmania infantum chagasi , the agent of american visceral leishmaniasis . the causes related to development of distinct clinical manifestations in leishmaniasis are multifactorial and reflect the complexity at the vector - pathogen - host interface . protozoan parasites of the genus leishmania are the causative agents of the disease and are transmitted to the mammalian hosts by the bite of female phlebotomine sand flies during blood repast . for blood meal obtainment , sand flies introduce their mouthparts into the skin , tearing tissues , lacerating capillaries , and creating haemorrhagic pools upon which they feed . the presence of sand fly saliva in the blood pool , the environment where the parasite encounters host cells , influences the development and functions of several leukocytes . in recent years , the importance of the interaction between components of sand fly saliva and host immune mechanisms in regulating infectivity and disease progression has become clearer and suggests their consequences to disease outcome in leishmaniasis . the aspects involved in immune response resulting in resistance or susceptibility widely depend on the first attempt of host 's innate response to contain infection that may influence on the predominance of a pattern of future host 's immune adaptive response against leishmania . many studies have been performed to understand the mechanisms leading to protection or exacerbation of the disease however ; relatively few studies have investigated the role of the sand- fly - derived salivary compounds in the innate immunity . in this paper we integrate the influence of sand fly bite with current ideas regarding the role of early steps of host inflammatory response against leishmania . sand fly vectors display a rich source of salivary biological active components to acquire blood from vertebrate hosts , a task not easy due the haemostatic , inflammatory and immune responses resultant from the bite . thus , it is not unexpected that many scientists have progressively investigated several aspects of sand fly saliva , concerning its composition and the range of mammalian response to it . among the new world species of sand fly which are vectors of leishmania , l. longipalpis and its salivary gland content are the best studied . one of the first components related to l. longipalpis salivary gland was maxadilan , the most potent vasodilator peptide known and one of the two phlebotomine salivary proteins more extensively studied . further , it was described that maxadilan is able to modulate the inflammatory response by inhibiting cytokines such as tnf- , by inducing il-6 production , and by stimulating hematopoiesis [ 911 ] . ( 1999 ) reported nine full clones and two partial cdna clones from salivary gland from l. longipalpis . in that work , they reported for the first time a hyaluronidase activity from sand fly saliva , an activity not yet described on phlebotomine sand flies , helping the diffusion of other pharmacological substances through the skin matrix . it was also described an apyrase activity on l. longipalpis saliva which hydrolyses atp and adp to amp , functioning as a potent antiplatelet factor [ 12 , 14 ] . interestingly , a 5-nucleotidase activity is also present in l. longipalpis saliva exert vasodilator and antiplatelet aggregation role by converting amp to adenosine . one of the most abundant protein found in the l. longipalpis saliva is the yellow - related protein [ 12 , 13 , 15 , 16 ] . our group has demonstrated that this family of proteins are the most recognized in sera from children living in an endemic area of visceral leishmaniasis in brazil and by normal volunteers exposed to laboratory - reared l. longipalpis bites . ( 2011 ) described the structure and function of a yellow protein ljm 11 . in this report , the authors described that yellow proteins from l. longipalpis saliva act as binder of proinflammatory biogenic amines such as serotonin , histamine , and catecholamines . one member of the d7 family of proteins ( commonly found in dipterans saliva ) is present in l. longipalpis . however , its role on mosquito 's saliva suggests that it could act as anticoagulant or binding biogenic amines avoiding host inflammatory events [ 12 , 15 ] . herein , we present some of the most studied proteins related to l. longipalpis saliva . ( see [ 6 , 15 , 16 , 20 ] for more details about this topic ) . although many of them have been associated with blood - feeding , their biological functions remain undefined . nevertheless , by modulating the host haemostatic and inflammatory response , this yet unreported sand fly salivary content remains as a research challenge , acting on host immunity to leishmania during transmission and establishment of infection . there are several studies contributing to a better understanding of l. longipalpis saliva effects on host immunity to leishmania infection . a brief exposition of these major contributions in the last 10 years is shown in figure 1 . in mice , salivary products seem to exacerbate the infection with leishmania and may , in fact , be mandatory for establishment of the parasite in vertebrate hosts . it has been shown that components of l. longipalpis or phlebotomus papatasi salivary gland lysates mixed with leishmania major resulted in substantially larger lesions compared to controls [ 21 , 22 ] . our group have shown that repeated exposure of balb / c mice to l. longipalpis bites leads to local inflammatory cell infiltration comprised of neutrophils , macrophages and eosinophils . total igg and igg1 antibodies react predominantly with three major protein bands ( 45 , 44 , and 16 kd ) from insect saliva by western blot . the injection of immune serum previously incubated with salivary gland homogenate induced an early infiltration with neutrophils and macrophages , suggesting the participation of immune complexes in triggering inflammation . we have shown that in endemic areas natural exposures to noninfected sand fly bites can influence the epidemiology of the disease [ 17 , 24 ] . we observed that people who presented antibodies against saliva of l. longipalpis also showed dth anti - leishmania , suggesting that the immune response against saliva of the vector could contribute to the induction of a protective immune response against the parasite . there was a simultaneous appearance of antibodies anti - saliva and an anti - leishmania dth , or a cellular response against the parasite , supporting the idea that eliciting immunity against saliva could benefit the induction of a protective response against the parasite . the anti - sand fly antibodies can serve as epidemiological marker of vector exposure in endemic areas . in fact , we demonstrated that two salivary proteins , called ljm 17 and ljm 11 , were specifically recognized by humans exposed to l. longipalpis , but not lutzomyia intermedia . longipalpis in a panel of 1,077 serum samples and verified that ljm 17 and ljm 11 together in an elisa assay identified the effectiveness of these proteins for the prediction of positivity against salivary gland sonicate ( sgs ) . in experimental model using c57bl/6 mice , immunization with ljm 11 triggered dth response and decrease the diseased burden after l. major infection . we also characterized the immunological patterns following sand fly saliva exposure , using healthy volunteers exposed to laboratory - reared l. longipalpis . we noticed high levels of igg1 , igg4 , and ige antibodies anti - saliva . furthermore , following in vitro stimulation with salivary gland sonicate , there was an increased frequency of cd4(+)cd25(+ ) and cd8(+)cd25(+ ) t cells as well as ifn- and il-10 synthesis . strikingly , 1 year after the first exposure , pbmc from the volunteers displayed recall ifn- responses that correlated with a significant reduction in infection rates using a macrophage - lymphocyte autologous culture . together , these data suggest that human immunization against sand fly saliva is feasible and recall responses are obtained even 1 year after exposure , opening perspectives for vaccination in man . sand fly saliva also seems to exert a direct effect on human antigen presenting cells . l. longipalpis sgs inhibited il-10 and tnf- production but induced il-6 , il-8 , and il-12p40 production by lps - stimulated monocytes and dendritic cells . besides cytokine production , sand fly saliva also interfered with the expression of costimulatory molecules in macrophages ( reduced cd80 and increased hla - dr expression ) and in monocytes ( increased cd80 and hla - dr expression ) . during dendritic cell differentiation induced by cd40l , a slight reduction in cd80 , cd86 , hla - dr , and cd1a expression were also observed . whereas enhancement of leishmania transmission by saliva is probably due to immunomodulatory components of sand fly saliva , an explanation of the anti - leishmania effect resulting from host immunization against salivary antigen is not straightforward . immunity in this system could derive from neutralization of salivary immunomodulators such as the peptide maxadilan from l. longipalpis ( as reviewed in ) . alternatively , immunity could derive from a dth reaction at the site of the bite generated by a cellular response to salivary antigens injected by the fly [ 29 , 30 ] . this particular reaction could turn the lesion and its surroundings into an inhospitable site for the establishment of leishmania infection in the new host , or it could modify the environment priming the initial events of the host immune reaction to leishmania . the disease exacerbative properties of saliva , often resulting from the bioactive property of one or more of its molecules , should not be confounded with antigenic molecules in saliva that induce an adaptive immune response in the host . this acquired immunity can be either protective or exacerbative depending on the nature and dominance of the salivary components of a vector species . exposure to uninfected bites of the sand fly p. papatasi induces a strong delayed - type hypersensitivity response and ifn- production at the bite site that confers protection in mice challenged by l. major - infected flies . by contrast , acquired immunity to l. intermedia saliva results in disease exacerbation not protection . moreover , p. papatasi saliva , despite its overall protective property , contains molecules that alone induce a protective ( ppsp15 ) or exacerbative ( ppsp44 ) immune response in the host [ 32 , 33 ] . it is likely that l. intermedia saliva also contains molecules with similar profiles despite the overall exacerbative effect of total saliva . recently , we developed a model for visceral leishmaniasis ( vl ) in hamsters , using an intradermal inoculation in the ears of 100,000 l. chagasi parasites together with l. longipalpis saliva to mimic natural transmission by sand flies . hamsters developed classical signs of vl rapidly , culminating in a fatal outcome 5 - 6 months postinfection . immunization with 16 dna plasmids coding for salivary proteins of l. longipalpis resulted in the identification of ljm19 , a novel 11-kda protein that protected hamsters against the fatal outcome of vl . ljm19-immunized hamsters maintained a low parasite load that correlated with an overall high ifn-/tgf- ratio and inducible nos expression in the spleen and liver up to 5 months post - infection . importantly , a delayed - type hypersensitivity response with high expression of ifn- was also noted in the skin of ljm19-immunized hamsters 48 h after exposure to uninfected sand fly bites . induction of ifn- at the site of bite could partly explain the protection observed in the viscera of ljm19-immunized hamsters through direct parasite killing and/or priming of anti - leishmania immunity . . showed that ljm19 was also able to protect hamsters against an infection composed by leishmania braziliensis plus saliva of l. intermedia , the vector responsible for the transmission of this parasite in brazil . the immunization also induced a higher ratio of ifn-/tgf- production in the cells from lymph nodes draining the infection site . collin et al . , ( 2009 ) immunized dogs using intradermal injections of dna codifying salivary proteins of l. longipalpis ( ljm17 and ljl 143 ) , followed by injection of recombinant canarypox virus containing the same genes . they also observed a potential protective response against leishmania , showing high concentrations of ifn- in pbmc stimulated with recombinant salivary proteins . importantly , the bite of uninfected sand flies resulted in a strong dth characterized by high amount of ifn- and low levels of tgf- . together , these results point out the possibility to immunize against leishmaniasis using defined proteins of vector 's saliva against leishmania . it is well established that the first steps in leishmaniasis are critical in determining the development of the disease . in order to understand this critical moment , several reports have investigated the early recruitment of cells induced by both l. longipalpis saliva alone or coinoculated with l. chagasi . sand fly saliva is able to induce an inflammatory process in the host by recruiting different cells into the bite site . in fact , it was verified that l. longipalpis salivary gland lysate markedly modifies the inflammatory response to infection with l. braziliensis in balb / c mice . the saliva - associated lesions progressed to extensive accumulations of heavily parasitized epithelioid macrophages , with persistent neutrophilia and eosinophilia . eosinophilia has also been described in dogs intradermally inoculated with l. longipalpis saliva associated with l. chagasi promastigotes . interestingly , this inflammatory response was not observed in animals that received saliva or parasites alone . however , this phenomena is not exclusive to l. longipalpis saliva once eosinophils were described in the inflammatory course at the site of immunization of mice with the salivary recombinant 15-kda protein from p. papatasi , the sand fly species vector of leishmania major . it is well established the abundant presence of eosinophils in both inflammatory site and allergic response . activated eosinophils release lipid mediators as paf , prostaglandins , leukotrienes , and lipoxins , as well as cytokines il-10 and il-8 that , in conjunct , trigger vasodilatation and leukocyte chemotaxis ( reviewed in ) . in the context of sand fly bite , this eosinophilic reaction could favor vector feeding but creates an unfriendly environment for leishmania parasites . host cell infiltration induced by sand fly bite is the most physiologic approach to reinforce the inflammatory role of vector saliva . this event has been explored using p. papatasi , in which saliva - induced dth response observed was associated to a possible fly adaptation to manipulate host immunity for the vector 's own advantage . concerning l. longipalpis saliva , our group investigated the initial vertebrate reactions against sand fly saliva . we demonstrated that repeated exposures of balb / c mice to l. longipalpis bites lead to an intense and diffuse inflammatory infiltrate characterized by neutrophils , eosinophils , and macrophages . this response was observed by histological analysis of the ear dermis from exposed mice as early as 2 hours and was sustained up to 48 hours after challenge with the l. longipalpis salivary sonicate . moreover , the injection of immune serum previously incubated with salivary gland homogenate induced an early infiltration with neutrophils and macrophages , suggesting the participation of immune complexes in triggering inflammation . an elegant and remarkable visual advance obtained by two - photon intravital imaging has recently demonstrated that the neutrophils represent the first cell population which is recruited to phlebotomus duboscqi bite site . although the participation of vector salivary components had not been directly attributed to this inflammatory event by the authors , we could not discharge this possibility considering diverse data showing that saliva from different sand flies species exert chemotaxis . as neutrophils were observed on l. longipalpis bite site the implications of its saliva on this cells will be further discussed in this paper . in addition to in vivo models , cell chemotaxis induced by saliva has also been observed in vitro . this is of particular interest , indicating that l. longipalpis salivary components can act directly as inflammatory mediator . using transwell system , zer et al . ( 2001 ) showed the direct chemotatic effect of saliva on balb / c peritoneal macrophages . in the same work , it was demonstrated that l. longipalpis saliva is able to both increase the percentage of macrophages that became infected with leishmania in balb / c and c3h / hen mice and exacerbate the parasite load in these cells . the authors discuss the possibility that , during natural transmission , saliva could reduce the promastigote exposure to the immune system by attracting host cells to the bite site and by accelerating the uptake of these parasites . exploring a straightforward and consistent model the mouse air pouch to investigate the inflammatory response induced by l. longipalpis , our group has described that l. longipalpis salivary gland sonicate was able to induce not only macrophages , but also neutrophil and eosinophil recruitment after 12 h in balb / c . the increased macrophage recruitment was linked to production of chemokine ccl2/mcp-1 and expression of its receptor ccr2 in the air pouch lining tissue . it was observed that l. longipalpis also synergizes with l. chagasi to recruit more inflammatory cells to the site of inoculation . this is noteworthy because it increases the availability of safe targets , the macrophages , for parasite evasion of the effector immune responses . interestingly , the recruitment profile observed in balb / c was not observed in c57bl/6 mice , indicating that the same salivary components can induce diverse inflammatory effects depending on the host background . however , because of limited number of cells that can be recovered on the air pouch model , some questions concerning early inflammatory events could not be investigated . alternatively , the peritoneal cavity has been employed to this kind of study allowing the collection of high number of immigrating cells [ 44 , 45 ] . in this regard , leukocyte recruitment into peritoneal cavity induced by l. longipalpis saliva has been evaluated in both balb / c and c57bl/6 mouse strains . in this work , significant neutrophil recruitment was observed six hours after administration of saliva , l. major , or saliva plus l. major . however , in balb / c mice , all stimuli were able to induce more neutrophil migration than in c57bl/6 mice . seven days later , it was observed that all stimuli were able to induce higher numbers of eosinophils and mononuclear cells in balb / c when compared with c57bl/6 mice . this study focused on the effect of saliva from l. longipalpis on adaptive immunity , evaluating cd4 + t lymphocyte migration and production of il-10 and ifn- cytokines . neutrophils rapidly accumulate at the inflammatory site ( as reviewed in ) and have been described on the sand fly bite site [ 23 , 40 ] . focusing on inflammatory events triggered by l. longipalpis saliva using the peritoneal model , we could observe a distinct kinetic of neutrophil recruitment to the peritoneal cavity of balb / c and c57bl/6 mice ( figure 2 ) . a late neutrophil influx was observed in balb / c mice ( figure 2(a ) ) , whereas in c57bl/6 mice neutrophils were already evident in the first hours after l. longipalpis saliva inoculation compared to mice injected with endotoxin - free saline ( figure 2(b ) ) . the link between neutrophil recruitment induced by l. longipalpis saliva and other events which initiate and switch off the inflammatory response is an attractive field to be explored . inflammation resolution is regulated by the release of mediators that contribute to an orchestrated sequence of events . for simplicity , they result in predominance of neutrophils in the inflamed area which are later replaced by monocytes that differentiate into macrophages . during the resolution , clearance of apoptotic cells by macrophages drives a response characterized by release of anti - inflammatory mediators . such safe removal of apoptotic cells has been implicated in exacerbation of leishmania infection [ 49 , 50 ] . the influence of l. longipalpis saliva in the time course of inflammation could be observed in cytospin preparations of the peritoneal cells from c57bl/6 mice . neutrophils in contact with or phagocytosed by macrophages were observed at six hours ( figures 2(c ) and 2(d ) ) and leukocyte phagocytosis by macrophages was an early event as well ( figure 2(e ) ) . moreover , apoptotic neutrophils were evident in c57bl/6 mice in the presence of saliva ( figure 2(f ) ) . therefore , components of sand fly saliva are able to both recruit and induce proapoptotic effects on neutrophils . these findings , in the scenario of anti - inflammatory clearance of apoptotic cells , sand fly saliva displays an important role in the macrophage response by triggering the recruitment [ 42 , 51 ] and suppressing the killing of parasites within macrophages [ 41 , 52 ] . in this regard , p. papatasi saliva inhibits the no production in macrophages treated with ifn- and l. longipalpis saliva hampers leishmania antigen presentation to t lymphocytes by macrophages as well as upregulates the il-10 production related with no suppression in macrophages infected with l. amazonensis . moreover , pure adenosine from p. papatasi saliva decreases no production in murine macrophages and maxadilan peptide present in l. longipalpis saliva upregulates il-6 , il-10 , and tgf- cytokine responses of lps - activated macrophages and downregulates il-12 , tnf- , and no associated with l. major killing . despite this , few research reports cover the cellular pathways involved in sand fly saliva modulation of macrophage response . previous study showed that maxadilan acts on pac-1 receptor in lps - activated macrophages and inhibits tnf- production whereas it increases il-6 and pge2 , and the authors suggest the participation of camp activation by maxadilan in this process . although the literature abounds with reports on the effects of sand fly saliva in the immune response and infection , the effect of whole sand fly saliva on macrophages is poorly understood . recently , we showed that l. longipalpis saliva activates lipid body ( lb ) formation in resident macrophages committed with pge2 production by cox-2 enzyme ( figure 3 ) . lipid bodies are intracellular sites related with eicosanoid production , and their formation can be triggered by activation via different intracellular pathways ( as reviewed in ) . in this context , l. longipalpis saliva activated erk-1/2 and pkc phosphorylation and the inhibition of both pathways resulted in blockade of saliva - induced pge2 production by macrophages . pge2 modulates the macrophage response during leishmania infection in macrophages [ 58 , 59 ] and is related with parasite dissemination after infection ; however , the role of saliva in the pge2 released by macrophages during leishmania infection remains to be addressed . further studies will be necessary to clarify the importance of eicosanoids stimulated by sand fly saliva in macrophage clearance of parasites and consequently in parasite transmission after sand fly bite . looking to the neutrophils as a significant host - defense cell player in both innate and adaptive response of immune system , it is surprising that few works have attempted to investigate the consequences of vector 's saliva and neutrophils interaction in the pathogenesis of leishmaniasis . the reasons to encourage this special attention rise from several lines of evidence showing that neutrophils participate in leishmania immunopathogenesis , by uptaking promastigote forms , producing cytokines and inflammatory mediators or interacting with macrophages enhancing infection ( as reviewed in [ 60 , 61 ] ) . neutrophils are considered as an initial target of leishmania infection [ 40 , 62 ] , and they are implicated in the immunopathogenesis of murine leishmaniasis [ 50 , 63 , 64 ] . moreover , significant numbers of neutrophils are present at the inoculation site , lesions , and draining lymph nodes from leishmania - infected mice [ 31 , 63 , 6567 ] . in addition , leishmania parasites undergo a silent entry into macrophages inside phagocytosed neutrophils , thus reinforcing the role of neutrophils on establishment of leishmania infection . leishmania donovani inhibition of traffic into lysosome - derived compartments in short - lived neutrophils was suggested as a key process for the subsequent establishment of long - term parasitism . on the other hand , human neutrophils were capable to kill l. donovani by oxidative mechanisms , and , more recently , it was described the involvement of net 's ( neutrophil extracellular traps ) on l. amazonensis destruction . one elegant approach that reinforced the essential role for neutrophils in leishmaniasis revealed the presence of leishmania - infected neutrophil on the sand fly bite site . however , in that work , although the sustained neutrophil recruitment had been evident only in response to the sand fly bite , the authors did not attribute the neutrophil influx to vector salivary components . surprisingly , besides neutrophil recruitment , there are no previous reports on further effects of sand fly saliva on neutrophil inflammatory response . interestingly , studies performed with tick saliva disclose that the inhibition of neutrophil functions favors the initial survival of spirochetes [ 7375 ] . our group has recently shown the first evidence of direct effect of l. longipalpis salivary components on c57bl/6 mice neutrophils . in summary , we described that saliva from l. longipalpis triggers apoptosis of inflammatory neutrophils obtained from c57bl/6 peritoneal cavity ( figure 3 ) . the proapoptotic effect of saliva was due to caspase activation and fasl expression on neutrophil surface . although salivary glands from blood feeding vectors have a variety of components , it seems that the proapoptosis compound in l. longipalpis saliva is a protein . however , further work is required to elucidate which protein or proteins act in this process . additional helpful information from this study is that preincubation of l. longipalpis saliva with anti - saliva antibodies abrogated neutrophil apoptosis . this allows us to propose that proapoptotic component from l. longipalpis saliva could be target for the host 's antibodies . moreover , neutrophil apoptosis induced by l. longipalpis saliva was also increased in the presence of l. chagasi . this is particularly interesting by reinforcing the synergistic effect of both vector component and parasite on host inflammatory response , as have been observed in cell chemotaxis . this effect was attributed to modulation of neutrophil inflammatory response , as treatment of neutrophils with a pan caspase inhibitor ( z - vad ) and a cox-2 inhibitor ( ns-398 ) abrogated the increased parasite burden observed . finally , we also described a novel inflammatory function of l. longipalpis saliva on neutrophils , stimulating mcp-1 production , able to attract macrophages in vitro . even though chemotatic activity from l. longipalpis saliva has been previously reported , this is the first demonstration that saliva modifies directly the neutrophil inflammatory function , inducing the release of chemotatic factors by these cells . in this paper , we explored the new inflammatory events induced by l. longipalpis in the recruitment and cellular function of leukocytes , as well as the repercussion to l. chagasi infection . the understanding of protective mechanisms regarding the initial steps of host 's response to salivary molecules that can correlate with resistance or susceptibility to leishmania has been poorly explored . identifying new escape mechanisms used by leishmania associated to the pharmacological complexity of the sand fly saliva remains a challenge . in this scenario , phylogenetic implications between vector and leishmania species can result in distinct action under host cells . the insights from the inflammatory scenery approached here , as lipid body induction in macrophages and apoptotic death of neutrophils , need to be investigated during the interaction between saliva from other sand fly and leishmania species . another important point is that these inflammatory effects were detected in salivary gland extract of sand fly vector . however , recombinants proteins from l. longipalpis saliva that presented known immunogenic role should be tested as inducers of these inflammatory events during infection by leishmania sp . the studies discussed here suggest that saliva components can act on virulence factors from parasite surface in the first steps involved the recognition , resistance to oxidative mechanisms , and modulation of inflammatory mediators ' produced by host cells . however , this finding seems to be part of a large puzzle , since they are viewed in isolation , by methodological limitations . recent emerging imaging technologies have opened the possibility to monitor the process of leishmania - host cell interaction in real time from the first moment upon sand fly bite , allowing understanding of molecular and cellular mechanisms in leishmania experimental infection . these advances will enable future integrated studies that may increase understanding of immunopathogenic mechanisms induced by saliva in this intricate and fascinating interaction .
when an haematophagous sand fly vector insect bites a vertebrate host , it introduces its mouthparts into the skin and lacerates blood vessels , forming a hemorrhagic pool which constitutes an intricate environment of cell interactions . in this scenario , the initial performance of host , parasite , and vector authors will heavily influence the course of leishmania infection . recent advances in vector - parasite - host interaction have elucidated co - authors and new roles not yet described . we review here the stimulatory role of lutzomyia longipalpis saliva leading to inflammation and try to connect them in an early context of leishmania infection .
despite the importance of physical activity in maintaining and improving health and quality of life in those individuals over the age of 65 , research suggests that less than 3% of elderly americans comply with the american college of sports medicine 's physical activity recommendations [ 2 , 3 ] . given the correlation between physical activity and increased health , it is of interest to accurately measure physical activity levels within a population . however , the ability to quantify physical activity in individuals can be a problematic task . in addition , because the current recommendations for physical activity include both intensity and duration , there is a compulsory need that measurement tools do the same . criterion methods , such as doubly labeled water and open - circuit spirometry , may not be plausible when examining large populations due to cost and/or an inability to obtain frequency and intensity of physical activity . furthermore , the commonly used self - report instruments are subjective and rely on recall information , which may be limited when applied to an older population . this information can be used to provide estimates of time spent in different levels of physical activity intensities and overall patterns of physical activity . unfortunately , few applications to the elderly population have been made and the raw output data can be difficult to interpret . moreover , accelerometer activity count cut - points used to determine physical activity intensity levels have been established from studies testing young participants [ 69 ] . to date , there are only very few studies that have sought to determine an activity count cut - point for determination of moderate physical activity intensity for elderly adults [ 8 , 10 , 11 ] and only one study has evaluated the relationship between oxygen consumption and activity counts of younger and older adults . furthermore , since investigations have shown that elderly individuals require a greater metabolic cost for walking at the same absolute intensity as young individuals [ 12 , 13 ] , it seems necessary to make such a comparison . lastly , evidence suggests that the standard 3.5 mlkgmin may not represent the resting metabolic rate of the general population [ 14 , 15 ] and that older adults may have a lower resting metabolic rate compared to younger individuals [ 14 , 16 ] . due to those differences at rest and during exercise between younger and older adults , the researchers hypothesized that a lower resting metabolic rate and higher oxygen consumption during exercise with similar accelerometer derived activity counts may result in a lower activity count threshold associated with moderate exercise intensity for older adults . therefore , the first purpose of this investigation was to compare accelerometer derived activity counts and oxygen consumption , measured during treadmill walking , between young and elderly participants . secondly , we sought to determine the relationship between metabolic equivalent ( met ) and accelerometer derived activity counts for each group of participants by using estimated and measured met levels . thirty - two individuals , 16 elderly ( age 66.6 2.9 yrs ) and 16 young ( age 21.3 2.5 yrs ) , recruited from the local community agreed to participate in this study . participants were recruited from flyers posted at recreational facilities ( e.g. , senior centers ) and bulletin boards at various locations ( e.g. , university , grocery stores ) . only participants that were healthy , free of injury within the past six months , and not taking medication ( e.g. , antidepressants , beta - blockers ) or stimulants ( e.g. , caffeine , smoking ) known to influence energy expenditure or exercise capacity were tested . all participants provided written informed consent and approval was obtained by the central washington university human subjects review committee . participants attended a familiarization session prior to testing . during the familiarization session , participants rested for 10 minutes in a seated position while breathing through a mouthpiece and then walked at the various intensities to familiarize them with the walking speeds and grade on the treadmill . at least two days and no more than seven days after the familiarization session , a testing session was scheduled . even though the majority ( 27 out of 32 ) of the tests were performed in the morning ( before 9 a.m. ) , there were some tests that were performed at a later time mainly due to participant availability . participants were instructed to refrain from caffeine and exercise on the day of testing . also , participants were asked to withhold food consumption 3 - 4 hours prior to testing . participants reported to the laboratory and after 10 min of rest to determine compliance with pretest instructions and answer last minute questions ; height was recorded to the nearest centimeter ( med art , st . louis , mo ) and weight was measured to the nearest 0.5 kg ( detecto - medic , brooklyn , ny ) . body density and percent body fat were determined from skinfold measurements ( lange skinfold calipers , cambridge scientific instruments inc . , cambridge , md ) as described by pollack et al . . indirect calorimetry ( true max 2400 , parvo medics inc . , sandy , utah ) was used for the measurement of resting metabolic rate . gas analyzers were calibrated before each test with a gas tank of known concentration ( 16% o2 , 4% co2 ) . respiratory flows were measured with a pneumotachometer calibrated before each test with a syringe of known volume ( 3.0 l ) . participants were then fitted with a mouthpiece that incorporates a two - way breathing valve apparatus ( hans rudolph inc . , initially participants were in a supine position but during pilot testing older participants indicated that they were uncomfortable and therefore all participants remained awake in a seated position for 30 min while expired gases were collected . expired gases were sampled in 30 s intervals and averaged oxygen uptake values ( vo2 ) , both relative ( mlkgmin ) and absolute ( lmin ) , obtained from minutes 15 to 25 were used to calculate an individual 's resting metabolic rate . in addition , heart rate ( polar electro , usa ) was monitored throughout the entire resting period and averaged during minutes 1525 and this value was considered as the individual 's resting heart rate . similar to the procedures of copeland and esliger , the treadmill bout consisted of 6 min stages with 5 min seated rest periods between stages . the four treadmill stages included walking at speeds of 27 , 54 , and 80 mmin ( 1.0 , 2.0 , and 3.0 mph , resp . ) and 0% grade , performed in random order , and a final stage of 94 mmin ( 3.5 mph ) and 2% grade . these intensities were selected to induce light , moderate , and vigorous physical activity . based on pilot testing , the 94 mmin and 2% grade stage was excluded from the random selection because this intensity was too difficult for some individuals to begin with , particularly in the absence of a warm - up and could have resulted in higher oxygen consumption on subsequent stages . all trials were performed on the same quinton q65 treadmill ( quinton instruments company , seattle , wa ) . oxygen consumption during the treadmill bout was calculated by averaging the 30 s sampling rate values obtained in the final 3 min of each treadmill stage completed . in order to determine measured met value per stage , averaged oxygen consumption per stage was divided by the individual 's resting metabolic rate ( measured vo2/measured resting metabolic rate ) and by the standard ( 3.5 mlkgmin ) metabolic rate ( measured vo2/3.5 ) . prior to the treadmill bout , participants were fitted with two actigraph ( pensacola , florida ) accelerometers ( one gt1 m model and one gt3x model ) . the gt1 m ( mass , 27 g ; width , 38 mm ; height , 37 mm ; thickness , 18 mm ) is a newer smaller version of the discontinued actigraph model 7164 . this updated model has demonstrated similar activity counts per minute , when compared with the actigraph 7164 , at treadmill speeds of 54 , 80 , and 107 mmin . unlike the gt1 m model , which senses vertical accelerations , the gt3x detects accelerations along three planes of motion . according to the manufacturer , both activity monitors were initialized before each trial using the same laptop computer and using the actilife low frequency extension . in addition , the activity monitors were marked so that the same units were used for each participant . accelerometers were securely mounted side by side along the anterior - axillary line of the right hip with an adjustable nylon belt . the activity counts recorded by the gt1 m and the vertical axis activity counts from the gt3x were summed using 1 min sampling intervals ( epochs ) and averaged for the final 3 min of each treadmill stage . for the purposes of this investigation , the average activity counts from the gt1 m and gt3x were used in the statistical analysis . body weight , height , and body composition were evaluated for significant differences between groups using a two - tailed independent t - test . likewise , two - tailed independent t - tests were used to determine differences in heart rate and oxygen consumption between groups at rest . a two - way repeated measures ( rm ) analysis of variance ( anova ) with one within factor ( exercise intensity ) and one between factor ( elderly versus young ) was used to evaluate differences between groups in averaged activity counts , oxygen consumption , and met values for each of the intensities . to examine for differences between activity counts derived from the gt1 m and gt3x actigraph models , a linear regression analysis was used to determine the relationship between measured mets and averaged vertical axis activity counts and between estimated mets and averaged vertical axis activity counts for each group ( young and elderly ) . the prediction equation was determined from the entire data set for each group . finally , activity counts corresponding to moderate intensity ( 3 mets ) exercise were calculated from the developed regression equations . data are expressed as means sd , and statistical significance was set at p < 0.05 . thirty - two individuals participated in the investigation ( 16 elderly and 16 young ; table 1 ) . the young and elderly groups were similarly matched for gender ( 9 males and 7 females ; 8 males and 8 females , resp . ) . however , two of the elderly participants were unable to perform at the 94 mmin and 2% grade . in one case , the participant declined to begin the final stage due to fatigue . in the other case , the participant began the final stage but requested to stop because of difficulty maintaining pace . activity counts measured by the gt1 m and gt3x actigraph models are presented in table 2 . there were no differences in activity counts between accelerometers for any of the exercise intensities , although the two - way rm anova revealed significant difference for activity counts among the different intensities ( table 2 ) . at rest , oxygen uptake relative to body mass among the elderly was significantly lower than the young group ( 3.49 0.50 and 3.89 0.28 mlkgmin , resp . ) . there were no differences between groups in relative oxygen uptake ( mlkgmin ) and heart rate at rest ( table 3 ) . however , the two - way rm anova showed a significant interaction between groups and exercise intensities . bonferroni post hoc analysis indicated that oxygen uptake , measured met , and heart rate values were significantly greater for the elderly participants at each of the intensities performed ( table 3 ) . measured met values were significantly greater among the elderly participants for each of the treadmill intensities ( figure 1 ) . a strong correlation ( r = 0.89 ) between averaged activity counts and measured met values existed among the young group ( figure 2(a ) ) . activity counts and estimated met values were also strongly correlated ( r = 0.91 ) for the young group ( figure 2(b ) ) . the relationships between activity counts and measured mets ( figure 3(a ) ) were moderate ( r = 0.72 ) as it was the relationship ( r = 0.76 ) between averaged activity counts and estimated mets ( figure 3(b ) ) for the older participants . based on the linear regression equations accelerometer activity counts of 824 ( 95% ci : 2261719 ) and 2207 ( 95% ci : 17303008 ) countsmin were associated with moderate ( 3 mets ) physical activity intensity for the elderly and young participants , respectively , when using measured resting metabolic rate . using the standard 3.5 mlkgmin , linear regression equations indicated that moderate ( 3 mets ) intensity physical activity was associated with 784 ( 95% ci : 1041859 ) and 2009 ( 95% ci : 12672320 ) countsmin for the elderly and young participants , respectively . the purpose of this investigation was to compare treadmill derived activity counts , oxygen consumption , and met values between young and elderly participants . despite the widespread use of accelerometers for obtaining objective measures of physical activity , few applications to older populations have been made . consequently , this study provides valuable information pertaining to the plausibility of the use of accelerometers within an elderly population . the main finding of the study is that despite no significant differences in accelerometer derived activity counts between older and younger participants at various walking intensities , there were significant differences in relative oxygen consumption and met values at rest and all exercise intensities indicating that moderate intensity physical activity for older adults may be determined at lower accelerometer derived activity counts than younger adults . oxygen uptake values obtained during treadmill exercise from the younger individuals in this study are in agreement with data reported in the literature . reported oxygen uptake values in a group of young adults ( age 23.7 4 ) , who performed treadmill walking exercises at speeds of 54 , 80 , and 94 mmin , respectively . these values closely parallel those measured from the younger participants in our study ( table 3 ) . furthermore , oxygen consumption values associated with walking at the respective speeds in elderly individuals in this study are consistent with findings from previous investigations [ 10 , 13 ] . in this investigation , elderly participants had significantly higher oxygen uptake values than the younger participants during treadmill walking across the range of intensities . similar findings have demonstrated a 12% and 22% increase , among 65- and 80-year - old participants , respectively , in the energy cost of walking at speeds of 80 and 94 mmin , compared with 25-year - olds . energy expenditure per mile walked , among elderly , has been shown to be 21% greater than younger individuals . others have found 31% greater energy cost of walking in older ( age 74 3 ) compared to younger adults ( age 27 3 ) . the average oxygen consumption demonstrated by the elderly participants in this investigation ranged from 14 to 19% greater than the younger participants across the selected speeds . the data in our study support the idea of a greater energy cost in the elderly when compared to a younger cohort for varying walking intensities . nonetheless , the underlying reasons for the increased energy cost among elderly individuals are not fully understood . interestingly , activity counts ( countsmin ) did not differ between groups at any of the treadmill intensities performed . several other studies have reported actigraph activity counts per minute similar to ours for equivalent treadmill walking speeds [ 19 , 2123 ] , although these studies have been specific to younger populations . unfortunately , data concerning actigraph activity counts produced during treadmill walking in older populations is limited . therefore , few comparisons to this study can be made . however , an investigation similar to ours reported mean activity counts of 515 , 1041 , and 2504 countsmin at speeds of 33.5 , 54 , and 80 mmin , respectively , in a group of elderly participants ( age 69.7 3.5 ) . although these values closely resemble ours , the activity counts obtained from our sample of elderly individuals tend to be slightly higher . this difference can be attributed to different models of actigraph accelerometer used to determine activity counts . copeland and esliger used the 7164 model whereas in the present study we used the gt1 m and gt3x models . a study by kozey et al . has shown that activity counts from the gt1 m model are slightly but significantly higher than the 7164 model . research has indicated that the standard 3.5 mlkgmin may not represent the resting metabolic rate of the general population and that resting metabolic rate may be lower in older individuals . since previous studies by copeland and esliger and miller et al . have not measured resting metabolic rate in older adults , this study aimed to determine measured met values for each of the exercise intensities . to our knowledge , this attempt to identify the relationship between measured met values and activity counts for a sample of elderly participants had not previously been performed . in agreement with previous research [ 14 , 16 ] , resting metabolic rate in our group of elderly individuals was significantly less than the younger participants . however , the average resting metabolic rate for the older participants was similar to the standard met value of 3.5 mlkgmin whereas the average resting metabolic rate for the younger adults was significantly higher than the standard met value of 3.5 mlkgmin . the average resting metabolic rates for both older and younger participants in this study are higher than other studies [ 1416 ] . it is possible that the differences between the present study and previous studies are due to different positions during resting periods . while the mean measured met value among the older individuals approached but was not equivalent to 6 mets at a walking speed of 94 mmin 2% grade , five of them obtained values greater than 6 mets . at the intermediate treadmill speeds of 54 and 80 mmin , all of the elderly participants were exercising at or above a moderate intensity . in contrast , the younger participants did not reach a level of moderate physical activity intensity until a treadmill speed of 80 mmin . furthermore , even at the fastest speeds , younger individuals were exercising well below a vigorous intensity . translating accelerometer activity counts to determine intensity of physical activity has proven to be a difficult task and has been questioned by some studies [ 25 , 26 ] . however , based on the data , we were able to determine an activity count threshold that is associated with moderate ( 3 mets ) physical activity for this group of younger and older adults and compare this activity count threshold with current literature . the commonly used actigraph activity count threshold for moderate physical activity intensity ( 1952 countsmin ) , developed by freedson et al . , was derived from exercise tests involving young adults . similarly , actigraph activity count cut - points for moderate physical activity intensity ranging from 1810 to 2260 countsmin have been shown in other studies testing adults aged 2045 . in agreement with previous studies of younger adults , the present study found activity count cut - points for moderate physical activity intensity to be 2207 and 2009 countsmin depending on either measured or standard resting metabolic rate . in contrast to those studies , copeland and esliger and miller et al . have indicated a moderate intensity threshold value of 1041 and 1566 countsmin , respectively , for their group of elderly individuals . in this investigation , the threshold value , equivalent to 3 mets , was 824 countsmin when using measured resting metabolic rate and 784 countsmin when using the standard resting metabolic rate . the activity count threshold associated with moderate intensity activity reported in this study is lower than the ones reported by previous research . copeland and esliger did not attempt to determine cut - points of various intensities . the researchers simply used the activity counts that corresponded to a mean oxygen consumption of 13 mlkgmin . in addition , miller et al . used a different methodology than previous research . participants exercised at various intensities for five minutes and rested between intensities for five or six minutes . it is therefore difficult to compare the activity counts reported in the present study and the one by miller et al . . the results of the present study , along with the results of previous research , may represent the need to establish agreeable metabolic equivalents for respective age groups to effectively determine physical activity intensity level activity count cut - points . these findings are of significant importance because recent epidemiological investigation pertaining to physical activity behaviors among elderly united states citizens reported a substantially low amount of time spent in moderate intensity activity . however , the activity count threshold employed for identifying moderate physical activity in adults aged 1860 was 2020 countsmin . it is possible that previous epidemiological reports may be greatly underestimating the amount of time elderly populations spend performing moderate physical activity . this sample size of younger and older adults is small and therefore the activity count threshold that is associated with moderate ( 3 mets ) physical activity for this group of participants might not be generalizable to all older and younger adults . in addition have shown that accelerometry counts per minute do not change between ages of 18 and 59 . in addition , the activity count thresholds established by freedson et al . were based on similar age group as ours . therefore , the purpose of this study was to examine the differences in oxygen consumption and activity counts between a group of younger individuals ( similar to the one by freedson et al . ) and a group of older individuals above 60 years . the majority of the participants exercised below vigorous intensity ( < 6 mets ) . the intensity of 94 mmin and 2% grade was used to elicit vigorous intensity . it is difficult to elicit vigorous intensity for older adults due to either their lack of fitness , fear , or functional limitations . despite similarity in accelerometer activity counts produced during treadmill walking across a range of treadmill speeds among elderly and young participants , an increased oxygen uptake among elderly participants was evident . therefore , accelerometers appear to be valid in their detection of exercise intensity across age groups . moreover , translating activity counts into categorical levels of physical activity intensity can not be done in the same manner for young and elderly individuals . measurement of resting metabolic rate may offer the most effective way for determining the relationship between activity counts and the intensity level of physical activity performed . further research is necessary in order to better understand the relationship between accelerometer activity counts and physical activity intensity levels for an elderly population .
the purpose of this investigation was to compare accelerometer activity counts and oxygen consumption between young and elderly individuals . sixteen young ( 21.3 2.5 yrs ) and sixteen elderly ( 66.6 2.9 yrs ) participants completed 30 minutes of resting oxygen consumption to determine resting metabolic rate and four 6 min walking intensities ranging from 27 to 94 mmin1 . resting oxygen uptake was significantly lower for the older participants . exercise oxygen consumption was significantly higher for the elderly group . there were no significant differences in activity counts between groups at each of the exercise intensities . when using measured resting metabolic rate , activity counts of 824 and 2207 countsmin1 were associated with moderate ( 3 mets ) physical activity intensity for the older and young participants , respectively . however , using standard resting metabolic rate ( 3.5 mlkg1min1 ) , activity counts of 784 and 2009 countsmin1 were associated with moderate physical activity intensity for the elderly and young participants , respectively . these findings indicate that activity counts are similar across age groups even though the oxygen consumption of exercise is greater among elderly individuals .
for infants and children , urinary tract infections ( utis ) are regarded as one of the most prevalent infections ( 1 ) . utis are prevalent in children , afflicting 3.35.3% of infants who have a fever ( 2 , 3 ) . utis are particularly prevalent in caucasian girls , and they are usually not accompanied by a fever ( 3 ) . the non - particular essence of the symptoms among infants and young children who have a fever produces problems in clinically distinguishing upper utis with renal parenchymal involvement from lower utis with no renal parenchymal involvement ( 24 ) . notwithstanding the fact that upper utis are often referred to as acute pyelonephritis , we chose not to use that term because it is a clinical diagnosis that should not be used for infants or young children . due to its connection with renal scarring , the exact recognition and timely treatment of upper uti are important ( 5 , 6 ) . during the last years of life , one of the most intricate problems of uti is the kidney injury that results in hypertension and , finally , end - stage renal disease ( 7 , 8) . hence , a timely and well - arranged diagnostic test can be useful for the early recognition of renal parenchymal involvement that needs more efficient treatment than lower uti , as well as more careful observation by the patient . technetium tc 99 m dimercaptosuccinic acid ( 99mtc - dmsa ) renal scintigraphy commonly is used to determine the severity of the injury to the kidney and the resulting scarring in patients afflicted by acute pyelonephritis ( 9 ) . dmsa is regarded as the determining factor regarding the diagnosis of renal parenchymal involvement and the evaluation of the severity and advancement of the renal parenchymal damage . some laboratory indicators have been used to predict the extent of injury to the kidney and the extent of scarring . among these indicators , erythrocyte sedimentation rate ( esr ) and leukocyte count are the most frequently used in predicting the results of the dmsa scan ( 1012 ) . patients who have higher leukocyte counts and esr are at greater risk of parenchymal involvement . c - reactive protein ( crp ) is another indicator that commonly is used in qualitative assessments . the progress of renal scarring poses higher risks to the patients who have positive crp rates . none of the indicators mentioned to this point has the necessary precision to predict renal injury . hence , researchers make use of novel indicators that can be of higher diagnostic value to foresee renal injuries ( 1315 ) ; such indicators include the proteins that determine the rate of urinary neutrophil gelatinase associated with lipocalin ( ngal ) . ngal is a novel protein detected in neutrophil granules , and is one of the constituents of the innate immune system ( 1618 ) . this is likewise demonstrated by some other cells , such as renal tubular and epithelial cells , as well as in epithelial cell damage of the liver , kidneys , lungs , and colon ( 19 ) . this indicator makes it possible to obtain a quick and certain detection of urinary tract infection . its sensitivity ranges from 91 to 98% , and the specificity of this method has been reported to be 7695% in various studies . in several studies this biomarker has been assessed as a quick and non - invasive test ( 20 ) . in 2009 , yilmaz et al . conducted research to determine the level of urinary ngal , and they stated that it may be regarded as a novel and valid indicator of uti . they concluded that urinary ngal levels could be used to diagnose uti because its levels in a uti group were conspicuously higher than in the control group . the ngal levels were significantly higher in cortical defects uti than in the control group with no cortical defects ( 22 ) . the aim of this study was to determine the diagnostic accuracy of the urinary ngal test in the detection of renal parenchymal involvement in children with acute pyelonephritis . this descriptive cross - sectional study was done in 2014 on children who had been diagnosed with uti . children between the ages of 2 months and 14 years old who were admitted to koodakan hospital in bandar abbas in hormozgan province , iran , were enrolled in the study . eighty - nine children with fever ( 38.5 c or higher ) and previous uti ( > 10 colony count per ml culture in midstream clean voiding sample and more than 10 colony count in sampling by catheter ) were enrolled in the study . children with anomalies of the urinary system , neurogenic bladder , and who had previous surgery in the urinary tract system were excluded from the study . urine analysis , urine culture , urinary ngal level , crp level , esr , and complete blood count tests were conducted for all of the children in the study . all dmsa scans were performed in a single center under the supervision of a nuclear medicine specialist using a siemens e cam 2009 device . in order to perform imaging , the following grading was used for interpretation of scan results : grade 0 : normal dmsa scan grade i : < 2 renal contour defects grade ii : 2 renal contour defects with areas of normal parenchyma grade iii : diffuse reduction in uptake to measure the ngal concentration in the urine , 15 to 20 ml of each patient s urine were used . the urine samples were kept at 2 to 8 c . the elisa method was used to measure the ngal concentrations in the urine , and the results were reported in ng / ml . a sysmex kx-21n device ( japan ) was used to perform the complete blood count test . software and medcalc software to analyze the data . for the analyses of the data , descriptive statistics were used , including mean , standard deviation , frequency , and percentage . also , the kruskal - wallis test was used to compare urinary ngal concentrations based on the dmsa scan and crp levels . we calculated specificity , sensitivity , positive predictive value ( ppv ) , and negative predictive value ( npv ) for urinary ngal using roc curve analysis . this descriptive cross - sectional study was done in 2014 on children who had been diagnosed with uti . children between the ages of 2 months and 14 years old who were admitted to koodakan hospital in bandar abbas in hormozgan province , iran , were enrolled in the study . eighty - nine children with fever ( 38.5 c or higher ) and previous uti ( > 10 colony count per ml culture in midstream clean voiding sample and more than 10 colony count in sampling by catheter ) were enrolled in the study . children with anomalies of the urinary system , neurogenic bladder , and who had previous surgery in the urinary tract system were excluded from the study . urine analysis , urine culture , urinary ngal level , crp level , esr , and complete blood count tests were conducted for all of the children in the study . all dmsa scans were performed in a single center under the supervision of a nuclear medicine specialist using a siemens e cam 2009 device . in order to perform imaging , the following grading was used for interpretation of scan results : grade 0 : normal dmsa scan grade i : < 2 renal contour defects grade ii : 2 renal contour defects with areas of normal parenchyma grade iii : diffuse reduction in uptake to measure the ngal concentration in the urine , 15 to 20 ml of each patient s urine were used . the elisa method was used to measure the ngal concentrations in the urine , and the results were reported in ng / ml . a sysmex kx-21n device ( japan ) was used to perform the complete blood count test . also , a lendo device ( spain ) was used to measure esr . software and medcalc software to analyze the data . for the analyses of the data , descriptive statistics were used , including mean , standard deviation , frequency , and percentage . also , the kruskal - wallis test was used to compare urinary ngal concentrations based on the dmsa scan and crp levels . we calculated specificity , sensitivity , positive predictive value ( ppv ) , and negative predictive value ( npv ) for urinary ngal using roc curve analysis . twenty - nine of the participants were male ( 32% ) , and 60 were female ( 68% ) . also crp was negative in 31 patients ( 34.8% ) and was trace positive in 3 patients ( 3.4% ) . also 1 + , 2 + , and 3 + crp tests were reported in 17 patients ( 19.1% ) , 18 patients ( 20.2% ) , and 20 patients ( 22.5% ) , respectively . dmsa scan was normal in 46 patients ( 51.7% ) , grade i in 23 patients ( 25.8% ) , and grades ii and iii in 20 patients ( 22.4% ) . the results of the kruskal - wallis test showed that there was a significant difference in the concentrations of ngal in the children s urine samples based on the results of the dmsa scan ( p < 0.001 ) ( table 1 ) . based on results of the kruskal - wallis test , the ngal concentrations in the children s urine samples were significantly higher in the children who had higher crp levels ( p < 0.001 ) ( table 2 ) . the results the analyses of the roc curves were used to determine the accuracy of using the ngal concentration in the children s urine in predicting the dmsa scan figure 1 shows the comparison of the roc curve for the accuracy of ngal in the urine , leukocyte count , and esr in prediction of the dmsa scan in children with pyelonephritis . a cutoff point for ngal concentration in the urine was selected as > 5 mg / l for prediction of positive results in the dmsa scan . for the ngal concentration in the urine , the area under the curve ( auc ) was 0.902 ( 95% ci : 0.8200.955 ) ( p < 0.001 ) . the ngal concentration in the urine had a sensitivity of 67.4% ( 95% ci : 51.580.9 ) and a specificity of 97.83% ( 95% ci : 88.599.9 ) , a ppv of 96.7% ( 95% ci : 82.899.9 ) and an npv of 76.3% ( 95% ci : 63.486.4 ) for prediction of the results of the dmsa scan . the auc was 0.829 ( 95% ci : 0.7350.901 ) for leukocyte count ( p < 0.001 ) . a leukocyte count > 11800 1012/l was selected as the cutoff point for prediction of a positive dmsa scan test with a sensitivity of 76.74% ( 95% ci : 61.488.2 ) and a specificity of 80.43% ( 95% ci : 66.190.6 ) , a ppv of 78.6% ( 95% ci : 63.1289.7 ) , and an npv of 78.7% ( 95% ci : 64.281.0 ) . for esr , the auc was 0.849 ( 95% ci : 0.7580.916 ) ( p < 0.001 ) . a cutoff point of > 32 mm / h was selected for esr for the prediction of a positive dmsa scan with a sensitivity of 76.74% ( 95% ci : 61.488.2 ) , a specificity of 86.96% ( 95% ci : 73.795.1 ) , a ppv of 86.4% ( 95% ci : 69.594.1 ) , and an npv of 80.0% ( 95% ci : 66.390.1 ) ( table 3 ) . twenty - nine of the participants were male ( 32% ) , and 60 were female ( 68% ) . also crp was negative in 31 patients ( 34.8% ) and was trace positive in 3 patients ( 3.4% ) . also 1 + , 2 + , and 3 + crp tests were reported in 17 patients ( 19.1% ) , 18 patients ( 20.2% ) , and 20 patients ( 22.5% ) , respectively . dmsa scan was normal in 46 patients ( 51.7% ) , grade i in 23 patients ( 25.8% ) , and grades ii and iii in 20 patients ( 22.4% ) . the results of the kruskal - wallis test showed that there was a significant difference in the concentrations of ngal in the children s urine samples based on the results of the dmsa scan ( p < 0.001 ) ( table 1 ) . based on results of the kruskal - wallis test , the ngal concentrations in the children s urine samples were significantly higher in the children who had higher crp levels ( p < 0.001 ) ( table 2 ) . the results the analyses of the roc curves were used to determine the accuracy of using the ngal concentration in the children s urine in predicting the dmsa scan figure 1 shows the comparison of the roc curve for the accuracy of ngal in the urine , leukocyte count , and esr in prediction of the dmsa scan in children with pyelonephritis . a cutoff point for ngal concentration in the urine was selected as > 5 mg / l for prediction of positive results in the dmsa scan . for the ngal concentration in the urine , the area under the curve ( auc ) was 0.902 ( 95% ci : 0.8200.955 ) ( p < 0.001 ) . the ngal concentration in the urine had a sensitivity of 67.4% ( 95% ci : 51.580.9 ) and a specificity of 97.83% ( 95% ci : 88.599.9 ) , a ppv of 96.7% ( 95% ci : 82.899.9 ) and an npv of 76.3% ( 95% ci : 63.486.4 ) for prediction of the results of the dmsa scan . the auc was 0.829 ( 95% ci : 0.7350.901 ) for leukocyte count ( p < 0.001 ) . a leukocyte count > 11800 1012/l was selected as the cutoff point for prediction of a positive dmsa scan test with a sensitivity of 76.74% ( 95% ci : 61.488.2 ) and a specificity of 80.43% ( 95% ci : 66.190.6 ) , a ppv of 78.6% ( 95% ci : 63.1289.7 ) , and an npv of 78.7% ( 95% ci : 64.281.0 ) . for esr , the auc was 0.849 ( 95% ci : 0.7580.916 ) ( p < 0.001 ) . a cutoff point of > 32 mm / h was selected for esr for the prediction of a positive dmsa scan with a sensitivity of 76.74% ( 95% ci : 61.488.2 ) , a specificity of 86.96% ( 95% ci : 73.795.1 ) , a ppv of 86.4% ( 95% ci : 69.594.1 ) , and an npv of 80.0% ( 95% ci : 66.390.1 ) ( table 3 ) . especially in asymptomatic infants , the timely recognition of upper utis is a difficult task ( 24 ) . however , differentiating between upper and lower uti is essential because renal parenchymal involvement can produce perpetual renal scarring that can result into chronic renal failure and hypertension ( 56 ) . as a result , recognizing renal parenchymal involvement and treating it in a timely manner are very important . injuries and renal scarring are among the most significant effects of an undiagnosed and untreated uti . thus , it is very important to diagnose and treat this condition as early as possible . the dmsa scan is regarded as a good way of detecting kidney injuries and renal scarring ( 23 ) . during the critical stage of the infection , performing a dmsa scan is of high importance in evaluating renal parenchymal involvement , with an approximate sensitivity of 93% ( 10 ) . nevertheless , there are some factors that restrict the prevalent utilization of dmsa scintigraphy . these factors include the related costs , patients being exposed to radiation , restricted accessibility , and the impossibility of distinguishing between critical renal parenchymal involvement and old scarring without conducting additional dmsa scans in the future . renal scan results have demonstrated that the excretion of ngal in the urine increases after renal damage , and they also may be used for the timely recognition of critical pyelonephritis ( 21 ) . some researchers have demonstrated that the determination of the concentration of ngal in the urine is the most trustworthy , non - invasive way of diagnosing of acute pyelonephritis ( 24 ) . a study conducted by won hee seo demonstrated that the median concentration of ngal in the urine in the uti group with cortical defect was significantly higher than the concentration in the uti group without cortical defect , i.e. , 106.5 vs. 60 ng / ml ) ( 22 ) . our study showed the accuracy of the ngal concentration for predicting renal parenchymal involvement in children with acute pyelonephritis . in our study , a cutoff concentration of 61 ng / ml of ngal in urine was reported for detecting pyelonephritis with a sensitivity of 75% and a specificity of 78.3% . yilmaz reported that the mean urinary ngal level was significantly higher in the group with uti than in the control group , i.e. , 91.02 vs. 14.29 ng / ml , and the cutoff was 20 ng / ml for urinary ngal for diagnosis of uti with a sensitivity of 97% and a specificity of 96% ( 21 ) . in this study , the cutoff point was > 5 mg / l , having the npv of 76.3% , the specificity of 97.83% , the ppv of 96.7% , and the sensitivity of 67.4% . based on our results , leukocyte count and esr based on the results of our study , the ppv is higher in esr and crp than in urinary ngal ; also , the npv for leukocyte count was higher than urinary ngal . in our results , major differences were identified in the urinary ngal concentration among patients based on the crp level . this finding showed that urinary ngal is a more dependable biological marker of higher specificity than leukocyte count and esr . our results indicated that urinary ngal should not be used to predict renal parenchymal involvement due to its high costs and its unavailability to all health clinics and patients . furthermore , making use of other tests , such as leukocyte count and esr , would provide a more accurate prediction . a probable explanation of these results may be that the excretion of urinary ngal occurs with renal parenchymal injury because the severity of glomerular filtration is lessened extensively . the results of the urinary ngal test can be normal in the individuals who are in the earlier phases of renal injury or who have a mild renal injury ( 25 ) . also , we used crp in our research . contrary to some researchers who utilized quantitative crp measures , we used qualitative measures because the qualitative method was available and was the prevalent method in our hospital . it also was demonstrated that crp level is linked to dmsa scan results and that an increase in the crp level is associated with greater risks of an abnormal dmsa scan . hence , as another detection indictor , crp can be used to predict the results of dmsa scans . the results of this research showed that , while urinary ngal is specific enough to be used as a diagnostic marker for the prediction of renal parenchymal involvement , it is not sensitive enough to be used for this purpose . the clinical application of these results is to make better diagnostic strategies for the detection of renal parenchymal involvement in uti in children . we recommend using other common markers , such as esr , leukocyte count , and crp in combination with urinary ngal to predictrenal parenchymal involvement in children with uti . future studies should focus on combinations of these tests for early and accurate detection of renal parenchymal involvement .
introductionurinary tract infections ( utis ) are among the most prevalent infections in children and infants . early and accurate detection of renal parenchymal involvement in uti is necessary for decision making and determining treatment strategies . the aim of this study was to determine the predictive accuracy of urinary neutrophil gelatinase - associated lipocalin ( ngal ) for renal parenchymal involvement in children with acute pyelonephritis.methodsthis descriptive , cross - sectional study was conducted in 2014 on children who had been diagnosed with uti . children who were admitted to koodakan hospital in bandar abbas , hormozgan province , iran , and whose ages ranged from two months to 14 years were enrolled in the study . urine samples were taken to conduct urinary ngal tests , urine cultures , and urinalyses . in addition , some blood samples were collected for the purpose of determining leukocyte count and c - reactive protein ( crp ) and to conduct erythrocyte sedimentation rate ( esr ) tests . all patients underwent a dimercaptosuccinic acid ( dmsa ) scan . spss software was used to analyze the data.resultsamong the participants in the study , 29 were male ( 32% ) , and 60 were female ( 68% ) . the mean age of the children who participated in the study was 2.99 2.94 years . the results of the kruskal - wallis test showed a significant increase in the urinary ngal level , an increase in the crp level , and higher dmsa scan grades ( p < 0.001 ) . the cutoff point amounted to > 5 mg / l , having the negative predictive value ( npv ) of 76.3% , the specificity of 97.83% , the positive predictive value ( ppv ) of 96.7% , and the sensitivity of 67.4%.conclusionurinary ngal is not sensitive enough for the prediction of renal parenchymal involvement , but it is a specific marker .
diabetes mellitus is the most prevalent and independent risk factor for atherosclerosis / cardiovascular diseases ( cvd ) including coronary artery disease ( cad ) . cvd is the leading cause of mortality in type 2 diabetics ( t2 dm ) . several inflammatory markers ( fibrinogen , crp , il-18 , and tnf - alpha ) have been associated with markers of asymptomatic atherosclerosis in type 2 diabetics . mannose - binding lectin ( mbl ) has been suggested to play a role in the pathogenesis of cvd in diabetics [ 3 , 4 ] . mbl , an important member of innate immunity , activating the lectin pathway of complement , is a weak - acute phase reactant and its level increases only two- to threefold temporarily in response to different stress factors . previous studies analyzing the role of mbl in cvd have demonstrated a proatherogenic as well as an antiatherogenic role . low mbl pheno- or genotype has been associated with higher risk of atherosclerosis [ 7 , 8 ] , arterial thrombosis , coronary artery disease [ 10 , 11 ] , bypass graft occlusion , and carotid artery plaques . however , high mbl levels or normal genotypes have also been associated with coronary artery disease and restenosis after carotid endarterectomy . furthermore , in type 2 diabetic population , low mbl genotype is associated with increased risk of cardiovascular events and poorer outcomes of myocardial infarction . whereas high mbl is associated with increased mortality , disease progression , and nephropathy , protective role of high mbl in diabetics has also been suggested . b mode ultrasonography mediated measurement of carotid artery intima - media thickness ( cimt ) permits the study of subclinical carotid atherosclerosis , and patients at high risk for cvd can be identified . studies assessing correlation of mbl pheno- or genotypes with carotid intima - media thickness [ 22 , 23 ] are conflicting . independent of traditional risk factors , a quadratic u - shaped relation between serum mbl and cimt was demonstrated in patients with rheumatoid arthritis . it supported a notion ; both high and low mbl may play a role in cvd . the objective of this study was to investigate hypothetical dual role of serum mbl level in intima - media thickness development among type 2 diabetic patients . after obtaining an institutional ethical clearance and an informed consent from participants , type 2 diabetic patients ( t2 dm ) attending diabetes outpatient clinic at the department of internal medicine , university of debrecen , were recruited for the study . amongst the diabetic patients , patients with severe hypoglycemia , hyperglycemia , diabetic ketoacidosis within three months prior to sample collection , active infections , malignancy , and other comorbid illnesses were excluded . only caucasians aged greater than / equal to 24 and less than / equal to 78 years were included . criteria for hypertension included patients with three consecutive arterial blood pressure values equal to or exceeding 140/90 mmhg or use of antihypertensive medication . hypertensives ( cases and controls ) were included only if they were well treated and did not have hypertensive crisis within three months prior to sample collection . of the subjects who met our inclusion criteria , a total 103 t2 dm patients and 98 controls matched for age an informed consent , detailed history and sociodemographic details , were obtained from all participants . laboratory analysis and measurement of imt the blood samples were taken after overnight fasting of at least 10 hours by qualified staff . fresh serum samples were used to analyze serum glucose , hba1c , and lipid profile using standard methods at the department of laboratory medicine , university of debrecen . high sensitivity c - reactive protein ( crp ) was measured using integra 700 auto analyzer system ( roche , basel , switzerland ) . mbl concentrations were measured by sandwich enzyme - linked immunosorbent assay as described and used previously at our institution . in short , murine monoclonal antibody ( statens serum institut , denmark ) , which preferentially detects functional mbl oligomers , was used . microtiter plates ( flat bottom , high binding capacity , greiner bio - one , mosonmagyarovar , hungary ) were coated with primary antibody ( hyb131 - 01 ) at 10 l/10 ml , that is , 1/1000 dilution in tris - buffered solution ( tbs ) , and were incubated overnight at 4 celsius . sera diluted 5-fold , 25-fold , and 125-fold in dilution buffer and serial twofold dilutions of an mbl serum standard ( bioporto diagnostics a / s ) were added to the wells and incubated at 37 celsius for 90 minutes in a wet chamber . biotin - labeled secondary ( hyb131 - 01b ) antibody at 1.25 l/10 ml ( 1/8000 dilution ) in tbs , 0.05% tween-20 , and 0.25 m edta ( tbs - t - edta ) was incubated at room temperature for 90 minutes in a wet chamber . horseradish peroxidase - conjugated biotin - avidin complex ( vectastain , vector laboratories inc . , burlingame , ca ) and substrate solution containing tetramethylbenzidine dihydrochloride ( tmb , sigma aldrich , schnelldorf , germany ) were used for obtaining color reaction . absorbance was measured at 450 nm using an elisa reader infinity 200 m ( tecan austria gmbh , grdig austria ) . the results were calculated by the magellan software program of the elisa reader , using marquardt curve fitting . philips hd 11 xe ultrasound equipment with a 7.5 mhz linear transducer was used to measure imt ( mm ) . online measurements of imt were performed in the far artery wall of the common carotid arteries , 10 mm proximal to the carotid bulb . all measurements were performed on frozen , enlarged images at end - diastole , and the transducer was in the mediolateral direction . imt was measured on a 1 cm segment . in each of these 1 cm segments , mbl , serum triglyceride ( tg ) , hdl cholesterol , and crp showed a nonnormal distribution ; hence , median and interquartile ranges are used . spearman correlation analysis was used to correlate imt with mbl levels in different groups of patients . furthermore , because both the mbl deficiency and the high mbl are associated with elevated cardiovascular risk , each group ( t2 dm and control ) was subdivided according to serum mbl levels into 4 subgroups : absolute mbl deficiency ( < 100 ng / ml ) , intermediate mbl deficiency ( 100500 ng / ml ) , normal mbl ( 5001000 ng / ml ) , and high mbl levels ( > 1000 ng / ml ) to analyze the possible nonlinear association between mbl and imt . imt in different subgroups were compared using one - way analysis of variance ( anova ) . we used binary logistic regression with dichotomous categorization of cimt for high ( > 0.7 ) and low ( < 0.7 ) imt groups . we also used multiple linear regression analysis to evaluate the multivariate associations between imt ( dependent variable ) and cvd risk factors ( predictors ) . baseline characteristics of diabetics and controls are summarized in table 1 . both groups ( t2 dm and controls ) although the number of patients with hypertension in t2 dm group was significantly higher but all of them were well treated and had normal blood pressure . the median ( lower and upper quartiles ) levels for mbl in t2 dm and controls were 819 ng / ml ( 3211871 ) and 846 ( 2471969 ) , respectively . there was no significant difference between either group ( figure 1 ) . through spearman correlation analysis , mbl was not associated with age , gender , serum glucose , hba1c , hypertension , crp , and total cholesterol in both diabetic and control groups and with duration of diabetes in the t2 dm group . because of dual role of mbl in determination of cvd risk , subgroups of subjects with absolute functional deficiency ( mbl < 100 ng / ml ) , intermediate deficiency ( mbl 100500 ng / ml ) , normal mbl ( 5001000 ng / ml ) , and high mbl level ( > 1000 ng / ml ) within both dm2 and control group were analyzed separately . the percentage of patients among four mbl subgroups did not differ in t2 dm and control group , as seen in figure 2 . the imt values of t2 dm and control patients in mbl subgroups are also depicted in figure 2 . as expected , imt was significantly higher in t2 dm patients ( 0.672 0.148 ) than in controls ( 0.602 0.128 ) ( p = 0.001 ) ( figure 3 ) . amongst the controls meanwhile , in t2 dm , the lowest imt was seen in subgroup with normal mbl level ( 5001000 ng / ml ) while imt continuously increased with both high mbl and absolute mbl deficiency states ( figure 4 ) . this was especially significant in high mbl t2 dm group ( 0.725 0.148 ) versus normal mbl t2 dm group ( 0.601 0.122 ) ( p = 0.002 ) . similarly , in high mbl subgroup , imt in t2 dm patients was higher than in controls ( 0.725 0.148 and 0.58 0.118 , resp . , p < 0.001 ) ( figure 4 ) . in the t2 dm group , among patients with mbl levels above 500 , there was a significant correlation between mbl level and imt ( r = 0.379 , p = 0.001 ) . amongst the diabetics , correlation of imt and cvd risk factors showed strongest association with age ( r = 0.537 ) , followed by mbl ( r = 0.379 ) and with duration of diabetes ( r = 0.292 ) . moreover , apoa showed a negative correlation with imt ( r = 0.325 , p = 0.03 ) . in controls , the male gender ( p = 0.005 ) , age ( 0.024 ) , bmi ( 0.005 ) , waist circumference ( p = 0.011 ) , glucose ( p = 0.009 ) , and hba1c ( p = 0.017 ) binary logistic regression analysis in high imt subgroup ( > 0.7 ) showed a significant contention with apoa ( p = 0.03 ) and near significant values for age ( p = 0.053 ) , triglyceride ( p = 0.053 ) , and cholesterol ( p = 0.056 ) . on the basis of backward stepwise multiple regression analysis in t2 dm group , the main predictors of imt are the age ( p < 0.003 ) , apoa level ( p = 0.023 ) , and the mbl ( p = 0.036 ) , while the total cholesterol level ( p = 0.074 ) and hdl ( p = 0.055 ) showed near significant prediction . other clinical factors ( apob100 , apob100/apoa , triglyceride , and ldl ) were excluded . in control group , in the backward stepwise multiple regression analysis the male gender ( p < 0.0001 ) , the hdl level ( p = 0.098 ) , and apob100/apoa ( p = 0.0001 ) were the predictors , while other clinical parameters ( cholesterol , hba1c , apob100 , tg , glucose , crp , bmi , waist circumference , mbl , ldl , and apoa ) were excluded ( table 2 ) . our results show that imt continuously increased with both high mbl and absolute mbl deficiency states in t2 dm group . this study supports the hypothesis of dual association between mbl levels and imt in type 2 diabetic patients . it shows for the first time that both high mbl levels and absolute mbl deficiency states may contribute to increases in cimt in diabetics , as previously demonstrated , both experimentally and in patients with rheumatoid arthritis . mbl , an acute phase reactant , is synthesized by the hepatocytes . on binding to specific carbohydrate molecules although mbl concentration varies , variations within an individual are very small compared to the interindividual differences in a population . in caucasians , the median concentration is 8001,000 g / l ( ng / ml ) . we used a double monoclonal antibody assay , which is sensitive , and a reproducible method to determine the mbl antigen levels in the sera . it accurately indicates the function estimated by mannan - binding assay or complement activation in the c4b deposition assay . however , due to additional effects of noncoding polymorphisms and some unknown factors , the individual mbl values vary substantially in wild - type homozygotes and mutation heterozygotes , thereby only providing a rough guide to serum mbl concentrations . since serum mbl levels vary markedly even amongst individuals with identical genotypes , measuring mbl concentration in serum is more reliable than genotyping [ 14 , 20 , 28 ] . mbl has diverse functions like modulation of inflammation , recognition of altered self - structures , apoptotic cell clearance [ 29 , 30 ] , and removal of antigen - antibody complexes [ 31 , 32 ] . thus , in a state of mbl deficiency , apoptotic / damaged cells are not sequestered causing lipid accumulation and atherosclerosis . furthermore , variant alleles cause defective complement activation due to decreased oligomerization and dysfunctional association with ligands , thereby causing impaired clearance of large triglyceride rich very low density lipoproteins ( vldl ) [ 34 , 35 ] and promoting atherosclerosis . low mbl may lead to enhanced proinflammatory cytokines , such as il-6 and tnf - alpha which are predictors of cvd . thus , low mbl levels and variant alleles increase infection susceptibility . acute infections in children have been shown to derange lipid levels and increase imt . chronic infection may lead to increased production of serum amyloid a and other acute phase proteins that change the role of hdl from being anti - inflammatory to a proinflammatory state . several studies have shown an association between cvd and various infectious agents including cytomegalovirus , helicobacter pylori , and chlamydia pneumoniae ( c. pneumoniae ) . c. pneumoniae infection provokes severe cad in individuals with variant alleles ( low mbl ) . in heart ischemia reperfusion model , inhibition of lectin pathway significantly decreases infarct size in type 2 diabetic rats , whereas mbl plays a critical role in type 1 diabetic mice . diabetes may cause advanced glycation end products of endothelial surfaces causing increased mbl deposition with subsequent complement activation , tissue injury , and atherosclerosis . hyperglycemia mediates o - glycation of n - acetylglucosamine ( glcnac ) of various proteins including ldl , membrane phospholipids , and apolipoprotein b . mbl strongly binds to these glcnac residues causing increased susceptibility to oxidation and leads to functional alterations in ldl clearance . moreover , glycation causes inactivation of cd59 , a regulatory protein involved in decreasing endothelial susceptibility to membrane attack complex mediated injury . we hypothesize that this dual role of mbl with imt in t2 dm can be explained in view of various functions of mbl . absolute mbl deficiency may promote atherogenesis by enhancing vldl , proinflammatory cytokines , and predisposing to chronic infections which alters functions of hdl . furthermore , combination of high mbl level and hyperglycemia associated with advanced glycation products , fructosamine , altered ldl clearance , and defective cd59 may increase atherosclerosis . in conclusion , the data presented demonstrate for the first time the potential dual role of mbl in pathologic processes leading to atherosclerosis in diabetic patients . mbl deficiency and excess mbl are a risk factor for subclinical carotid artery atherosclerosis in t2 dm . in addition to the potential role of mbl in the atherogenesis it may also be used as a marker of macrovascular disease , as both low and high levels may indicate the susceptibility for atherosclerosis in t2 dm . mbl can be assessed as a member of inherited nontraditional risk factors influencing the development of atherosclerosis significantly in diabetic patients . however , the main limitation of this study is the low number of patients and therefore further studies with larger population size are required to ascertain the exact role of mbl in atherosclerosis .
introduction . mannose - binding lectin ( mbl ) activates complement system and has been suggested to play a role in vascular complications in diabetics . carotid intima - media thickness ( cimt ) detects subclinical atherosclerosis . we evaluated the association of mbl and imt in type 2 diabetic ( t2 dm ) patients . methods . serum mbl levels and cimt were measured in a total of 103 diabetics and in 98 age - matched healthy controls . results . there was no significant difference in mbl level in t2 dm versus controls . as expected , imt was significantly higher in t2 dm patients than in controls ( p = 0.001 ) . in t2 dm , the lowest cimt was seen in patients with normal mbl level ( 5001000 ) while cimt continuously increased with both high mbl and absolute mbl deficiency states . this was especially significant in high mbl versus normal mbl t2 dm patients ( p = 0.002 ) . according to multiple regression analysis the main predictors of imt in t2 dm are age ( p < 0.003 ) , apoa level ( p = 0.023 ) , and the mbl ( p = 0.036 ) . conclusions . our results suggest a dual role of mbl as a risk factor for cimt in t2 dm . mbl may also be used as a marker of macrovascular disease , as both low and high levels indicate the susceptibility for atherosclerosis in t2 dm .
lung cancer is the leading cause of cancer - related death in china , of which 85% are non - small cell lung cancer ( nsclc ) . during the last decades , the treatments for advanced nsclc were confined to platinum - based chemotherapy , with an unsatisfactory response rate of 30% . intensive studies on tumor - related aberrant signaling pathways have led to rapid development in the treatment of lung cancer . medicines targeted at epidermal growth factor receptor ( egfr ) gene mutation or anaplastic lymphoma kinase fusion gene increase the response rate to 6580% , whereas tumor progression is still unavoidable eventually . with a median progression - free survival of about 10 months and a poor overall survival ( os ) , patients with advanced nsclc need new therapeutic targets . fibroblast growth factor receptor 1 ( fgfr1 ) , a transmembrane tyrosine kinase receptor of fibroblast growth factors ( fgfs ) , is encoded by fgfr1 gene ( 8p1112 ) . after combining with fgfs , fgfr ligand - dependent dimerization activates tyrosine kinase domains , resulting in the phosphorylation of intracellular tyrosine residues . phosphorylated tyrosine residues work as docking sites for adaptor proteins , such as grb2 , sos protein , recruiting ras - guanosine diphosphate ( ras - gdp ) , activating mitogen - activated protein kinase , protein kinase c , phosphatidylinositol 3-kinase / akt pathway , and signal transducer and activator of transcription signaling pathways . the overexpression of fgfr1 was found in nsclc and recognized as a novel therapeutic target . although several meta - analyses have been reported , the correlation between the expression status of fgfr1 and clinical pathological features remains controversial [ 810 ] . this study focused on these issues and also studied the promotion of angiogenesis with vegfr2 , which is the main receptor of vegf - a that plays an important role in neoangiogenesis . the expression of vrgfr2 can be detected in a variety of tumor cells , including colorectal cancer , breast cancer , and non - small cell lung cancer . the overexpression of vegfs and vegfr2 is related to tumor invasion and metastasis , mainly because of their effect on angiogenesis . fgf can upregulate the expression of vegf , fgfr , and vegfr in epithelial cells , and vegf can upregulate the expression of fgf . prior studies indicated that neoangiogenesis is essential in developing lung cancer , and microvessel density ( mvd ) is increased even in premalignant lesions and early - stage lung cancer . in this retrospective study , the correlation between fgfr1 and clinical features was explored , including survival analysis and promotion of angiogenesis by fgfr1 and vegfr2 . ninety - two patients pathologically diagnosed with nsclc , who received radical resection ( pneumonectomy + lymph node dissection ) in west china hospital of sichuan university from july 2006 to july 2008 were enrolled in the study . the exclusion criteria were as follows : received neoadjuvant chemotherapy and/or radiotherapy ; received egfr tyrosine kinase inhibitors ; had another kind of carcinoma ; loss to follow - up ; and histopathological specimens unavailable . the study was approved by the hospital ethics committees , and all the patients enrolled gave informed consent . the patients underwent chest computed tomography ( ct ) scan , abdomen ct scan , and brain magnetic resonance imaging , and also bone single - photon emission computed tomography if necessary , during periodic follow - up visit according to the national comprehensive cancer network ( nccn ) guideline . staging was based on the nccn guideline , and histological grading was evaluated according to the world health organization criteria . the clinical features included age , gender , stage , histological type , grade , lymph node status , smoking status , and postoperative adjuvant therapy . the primary endpoint was os , and the secondary endpoint was recurrence - free survival ( rfs ) . formalin - fixed and paraffin - embedded surgical specimens were immunostained according to streptavidin - peroxidase protocol . the paraffin - embedded tissues were sliced up into slices of 4 m . then , after deparaffinization and antigen retrieval , the tissue sections were incubated with fgfr1 antibodies ( monoclonal rabbit anti - human , 1:500 , cell signaling technology co. , ltd , ma , usa ) , vegfr2 antibodies ( polyclonal rabbit anti - human , 1:100 , golden bridge biotechnology co. , ltd . , beijing , china ) , and cd34 antibodies ( monoclonal mouse anti - human , 1:100 , golden bridge biotechnology co. , ltd , beijing , china ) at 37c for 1 h , and then at 4c overnight . the next day the sections were rinsed 3 times with phosphate - buffered saline ( pbs ) before incubating with biotinylated goat anti - rabbit antibodies ( 1:200 , golden bridge biotechnology co. , ltd , beijing , china ) and subsequently with horseradish - labeled streptavidin ( 1:200 , golden bridge biotechnology co. , ltd . , positive controls were provided by reagent companies , and pbs instead of primary antibodies was used as negative control . brownish - black or brown particles displayed in certain places were defined as a specific positive reaction . the weighted score , evaluated in a semi - quantitative way , was calculated by multiplying the quantity score by staining intensity score , representing fgfr1 and vegfr2 expression levels . the quantity scores based on the percentage of stained cells were defined as follows : 0 for < 5% cells stained ; 1 for 525% cells stained ; 2 for 2650% cells stained ; 3 for 5175% cells stained ; and 4 for 76% cells stained . the staining intensity was scored 03 : 0 for no staining ; 1 for pale yellow staining ; 2 for brown staining ; and 3 for brownish - black staining . weighted score 1 , 23 , 46 , or 7 was defined as negative , weak , moderate , or strong , respectively . for statistical analysis , the subgroups were finally dichotomized into high expression ( moderate and strong ) and low expression ( negative and weak ) . the hot spots ( intratumoral areas with a high density of cd34-positive vessels ) were identified under low - power fields , while the cd34-positive vessels in hot spots were quantitated under high - power fields case by case . spss 16.0 software ( spss inc . , il , usa ) was used for statistical analysis . the correlations between the expression of fgfr1and vegfr2 , mvd , and clinicopathological features were tested by chi - square test , t test , and spearman s rank correlation coefficient , respectively . kaplan - meier curve was used to analyze the correlation between the expression of fgfr1 and vegfr2 , mvd , and prognosis . univariate and multivariate analyses were performed by cox regression model . a p value less than 0.05 was considered to be statistically significant ninety - two patients pathologically diagnosed with nsclc , who received radical resection ( pneumonectomy + lymph node dissection ) in west china hospital of sichuan university from july 2006 to july 2008 were enrolled in the study . the exclusion criteria were as follows : received neoadjuvant chemotherapy and/or radiotherapy ; received egfr tyrosine kinase inhibitors ; had another kind of carcinoma ; loss to follow - up ; and histopathological specimens unavailable . the study was approved by the hospital ethics committees , and all the patients enrolled gave informed consent . the patients underwent chest computed tomography ( ct ) scan , abdomen ct scan , and brain magnetic resonance imaging , and also bone single - photon emission computed tomography if necessary , during periodic follow - up visit according to the national comprehensive cancer network ( nccn ) guideline . staging was based on the nccn guideline , and histological grading was evaluated according to the world health organization criteria . the clinical features included age , gender , stage , histological type , grade , lymph node status , smoking status , and postoperative adjuvant therapy . the primary endpoint was os , and the secondary endpoint was recurrence - free survival ( rfs ) . formalin - fixed and paraffin - embedded surgical specimens were immunostained according to streptavidin - peroxidase protocol . then , after deparaffinization and antigen retrieval , the tissue sections were incubated with fgfr1 antibodies ( monoclonal rabbit anti - human , 1:500 , cell signaling technology co. , ltd , ma , usa ) , vegfr2 antibodies ( polyclonal rabbit anti - human , 1:100 , golden bridge biotechnology co. , ltd . , beijing , china ) , and cd34 antibodies ( monoclonal mouse anti - human , 1:100 , golden bridge biotechnology co. , ltd , beijing , china ) at 37c for 1 h , and then at 4c overnight . the next day the sections were rinsed 3 times with phosphate - buffered saline ( pbs ) before incubating with biotinylated goat anti - rabbit antibodies ( 1:200 , golden bridge biotechnology co. , ltd , beijing , china ) and subsequently with horseradish - labeled streptavidin ( 1:200 , golden bridge biotechnology co. , ltd . , positive controls were provided by reagent companies , and pbs instead of primary antibodies was used as negative control . brownish - black or brown particles displayed in certain places were defined as a specific positive reaction . the weighted score , evaluated in a semi - quantitative way , was calculated by multiplying the quantity score by staining intensity score , representing fgfr1 and vegfr2 expression levels . the quantity scores based on the percentage of stained cells were defined as follows : 0 for < 5% cells stained ; 1 for 525% cells stained ; 2 for 2650% cells stained ; 3 for 5175% cells stained ; and 4 for 76% cells stained . the staining intensity was scored 03 : 0 for no staining ; 1 for pale yellow staining ; 2 for brown staining ; and 3 for brownish - black staining . weighted score 1 , 23 , 46 , or 7 was defined as negative , weak , moderate , or strong , respectively . for statistical analysis , the subgroups were finally dichotomized into high expression ( moderate and strong ) and low expression ( negative and weak ) . the hot spots ( intratumoral areas with a high density of cd34-positive vessels ) were identified under low - power fields , while the cd34-positive vessels in hot spots were quantitated under high - power fields case by case . spss 16.0 software ( spss inc . , il , usa ) was used for statistical analysis . the correlations between the expression of fgfr1and vegfr2 , mvd , and clinicopathological features were tested by chi - square test , t test , and spearman s rank correlation coefficient , respectively . kaplan - meier curve was used to analyze the correlation between the expression of fgfr1 and vegfr2 , mvd , and prognosis . univariate and multivariate analyses were performed by cox regression model . a p value less than 0.05 was considered to be statistically significant . a total of 92 patients ( 70 males and 22 females ) with a mean age of 58.5 ( range 3879 ) years were enrolled in the study . classified by histological type , 49 patients had squamous lung cancer , 37 had adenocarcinoma , 4 had adenosquamous carcinoma , and 2 had large - cell lung cancer . histologically , 54 samples were poorly differentiated , 36 moderately differentiated , and 2 well differentiated . according to the nccn guideline of 2013 , 25 patients were at stage i , 16 were at stage ii , 42 were at stage iii , and 9 were at stage iv . moreover , 59 of all the patients were continuously smoking ( defined as never quit or quit for less than 1 year ) , and 33 patients were nonsmokers or quit for more than 1 year . both fgfr1 and vegfr2 were mainly expressed in the cytoplasm ( figure 1a , 1b ) . in terms of fgfr1 expression , 25% ( 23/92 ) were negative , 48.9% ( 45/92 ) were weak , 18.5% ( 17/92 ) were moderate , and 7.6% ( 7/92 ) were strong . notably , the high expression rate of fgfr1 was significantly higher in squamous lung cancer than in adenocarcinoma ( table 1 . the high expression of fgfr1 was not correlated with smoking ( 23.7% vs. 30.3% , p=0.491 ) , while in statistical analysis , we found that the expression rate ( patients that had been tested to be positive , including weak , moderate and strong ) of fgfr1 was significantly higher in smoking patients ( 84.7% vs. 60.6% , p=0.009 ) . moreover , 5.4% ( 5/92 ) of samples were vegfr2 negative , 52.2% ( 48/92 ) were weak , 29.3% ( 27/92 ) were moderate , and 13% ( 12/92 ) were strong . patients with lymph node metastasis ( p=0.022 ) and those with tumor size more than 4 cm ( p=0.001 ) had higher expression of vegfr2 . the high expression of fgfr1 and vegfr2 was not correlated with the patients age , gender , smoking status , differentiation , and stage . microvascular endothelial cells could be stained yellow or brownish by cd34 antibody ( figure 1c ) . the number of stained endothelial cells in a certain area was defined as mvd . in this study , patients with lymph node metastasis ( 37.510.7 vs. 31.010.3 , p=0.004 ) and stages iii iv ( 36.910.7 vs. 31.710.5 , p=0.024 ) presented with a significantly higher mvd in tumor tissues , while no correlation was found between mvd and gender , age , smoking status , histological type , and differentiation . mvd was significantly higher in patients with high expression of vegfr2 than in patients with low expression of vegfr2 ( 40.611.0 vs. 30.18.7 , p<0.001 ) , and a higher mvd was associated with the high expression of fgfr1 as well ( 43.110.1 vs. 31.59.6 , p<0.001 ) . the spearman rank correlation analysis ( table 2 ) demonstrated that , to some extent , the expression intensity of vegfr2 ( r=0.224 , p=0.032 ) and fgfr1 ( r=0.265 , p=0.011 ) was positively correlated with mvd . in addition , the expression levels of fgfr1 and vegfr2 were significantly positively correlated ( r=0.619 , p<0.001 ) . with a total follow - up of 80 months , the patients with the high expression of fgfr1 presented with a significantly shorter os ( 23.5 months vs. 39.8 months , p=0.043 ) and rfs ( 15.0 months vs. 28.0 months , p=0.043 ) than those with the low expression of fgfr1 ( figure 2a , 2b ) . the expression level of vegfr2 showed no significant impact on the survival of patients with nsclc . notably , in squamous lung cancer , the os in patients with the high expression of vegfr2 was 32.5 months , which was shorter than that in patients with the low expression ( 51.0 months , p=0.028 ) ( figure 2e ) . however , no significant difference was observed in the survival of patients with adenocarcinoma between high - expression and low - expression groups of vegfr2 ( p = 0.918 ) ( figure 2f ) . the analysis of the impact of mvd on os and rfs is shown in figure 2c and 2d . the rfs of patients with a high and a low value of mvd was 18.1 and 30.4 months ( p=0.010 ) , respectively , while the os in the low - mvd group was significantly longer than the os in the high - mvd group ( 51.0 months vs. 32.5 months , p=0.013 ) . all clinical and pathological features , including gender , age , smoking status , tumor size , differentiation , histological type , lymph node status , stage , adjuvant therapy , fgfr1 expression , vegfr2 expression , and mvd value , were considered in the cox regression model . the univariate analysis showed that tumor stage ( p<0.001 ) , lymph node metastasis ( p=0.003 ) , high expression of fgfr1 ( p=0.043 ) , and high value of mvd ( p=0.013 ) in tumor tissue suggested shorter os , while only stage ( stage iii : hazard ratio [ hr ] 3.451 , 95% confidence interval [ ci ] : 1.6217.345 , p=0.001 ; stage iv : hr 39.207 , 95% ci : 12.201125.986 , p<0.001 ) and high expression of fgfr1 ( hr 2.194,95% ci : 1.2323.908,p=0.008 ) remained independent risk factors of os in multivariate analysis . adjuvant chemotherapy was the protection factor for os ( hr 0.492 , 95% ci : 0.2510.964 , p=0.039 ) ( table 3 ) . considering that stage is universally thought to be the most important prognostic factor , stratified analysis based on stages was done ( figure 3 ) . the os was not significantly different between low- and high - expression of fgfr1 in stage i , ii , iii and iv , respectively , while when the patients with stage i and ii were all taken into account , the os was significantly longer in those with low fgfr1 expression than high fgfr1 expression ( p=0.044 ) . no significant difference was observed in the survival of patients with low and high fgfr1 expression in stage iii a total of 92 patients ( 70 males and 22 females ) with a mean age of 58.5 ( range 3879 ) years were enrolled in the study . classified by histological type , 49 patients had squamous lung cancer , 37 had adenocarcinoma , 4 had adenosquamous carcinoma , and 2 had large - cell lung cancer . histologically , 54 samples were poorly differentiated , 36 moderately differentiated , and 2 well differentiated . according to the nccn guideline of 2013 , 25 patients were at stage i , 16 were at stage ii , 42 were at stage iii , and 9 were at stage iv . moreover , 59 of all the patients were continuously smoking ( defined as never quit or quit for less than 1 year ) , and 33 patients were nonsmokers or quit for more than 1 year . both fgfr1 and vegfr2 were mainly expressed in the cytoplasm ( figure 1a , 1b ) . in terms of fgfr1 expression , 25% ( 23/92 ) were negative , 48.9% ( 45/92 ) were weak , 18.5% ( 17/92 ) were moderate , and 7.6% ( 7/92 ) were strong . notably , the high expression rate of fgfr1 was significantly higher in squamous lung cancer than in adenocarcinoma ( table 1 . the high expression of fgfr1 was not correlated with smoking ( 23.7% vs. 30.3% , p=0.491 ) , while in statistical analysis , we found that the expression rate ( patients that had been tested to be positive , including weak , moderate and strong ) of fgfr1 was significantly higher in smoking patients ( 84.7% vs. 60.6% , p=0.009 ) . moreover , 5.4% ( 5/92 ) of samples were vegfr2 negative , 52.2% ( 48/92 ) were weak , 29.3% ( 27/92 ) were moderate , and 13% ( 12/92 ) were strong . patients with lymph node metastasis ( p=0.022 ) and those with tumor size more than 4 cm ( p=0.001 ) had higher expression of vegfr2 . the high expression of fgfr1 and vegfr2 was not correlated with the patients age , gender , smoking status , differentiation , and stage . microvascular endothelial cells could be stained yellow or brownish by cd34 antibody ( figure 1c ) . the number of stained endothelial cells in a certain area was defined as mvd . in this study , patients with lymph node metastasis ( 37.510.7 vs. 31.010.3 , p=0.004 ) and stages iii iv ( 36.910.7 vs. 31.710.5 , p=0.024 ) presented with a significantly higher mvd in tumor tissues , while no correlation was found between mvd and gender , age , smoking status , histological type , and differentiation . mvd was significantly higher in patients with high expression of vegfr2 than in patients with low expression of vegfr2 ( 40.611.0 vs. 30.18.7 , p<0.001 ) , and a higher mvd was associated with the high expression of fgfr1 as well ( 43.110.1 vs. 31.59.6 , p<0.001 ) . the spearman rank correlation analysis ( table 2 ) demonstrated that , to some extent , the expression intensity of vegfr2 ( r=0.224 , p=0.032 ) and fgfr1 ( r=0.265 , p=0.011 ) was positively correlated with mvd . in addition , the expression levels of fgfr1 and vegfr2 were significantly positively correlated ( r=0.619 , p<0.001 ) . with a total follow - up of 80 months , the patients with the high expression of fgfr1 presented with a significantly shorter os ( 23.5 months vs. 39.8 months , p=0.043 ) and rfs ( 15.0 months vs. 28.0 months , p=0.043 ) than those with the low expression of fgfr1 ( figure 2a , 2b ) . the expression level of vegfr2 showed no significant impact on the survival of patients with nsclc . notably , in squamous lung cancer , the os in patients with the high expression of vegfr2 was 32.5 months , which was shorter than that in patients with the low expression ( 51.0 months , p=0.028 ) ( figure 2e ) . however , no significant difference was observed in the survival of patients with adenocarcinoma between high - expression and low - expression groups of vegfr2 ( p = 0.918 ) ( figure 2f ) . the analysis of the impact of mvd on os and rfs is shown in figure 2c and 2d . the rfs of patients with a high and a low value of mvd was 18.1 and 30.4 months ( p=0.010 ) , respectively , while the os in the low - mvd group was significantly longer than the os in the high - mvd group ( 51.0 months vs. 32.5 months , p=0.013 ) . all clinical and pathological features , including gender , age , smoking status , tumor size , differentiation , histological type , lymph node status , stage , adjuvant therapy , fgfr1 expression , vegfr2 expression , and mvd value , were considered in the cox regression model . the univariate analysis showed that tumor stage ( p<0.001 ) , lymph node metastasis ( p=0.003 ) , high expression of fgfr1 ( p=0.043 ) , and high value of mvd ( p=0.013 ) in tumor tissue suggested shorter os , while only stage ( stage iii : hazard ratio [ hr ] 3.451 , 95% confidence interval [ ci ] : 1.6217.345 , p=0.001 ; stage iv : hr 39.207 , 95% ci : 12.201125.986 , p<0.001 ) and high expression of fgfr1 ( hr 2.194,95% ci : 1.2323.908,p=0.008 ) remained independent risk factors of os in multivariate analysis . adjuvant chemotherapy was the protection factor for os ( hr 0.492 , 95% ci : 0.2510.964 , p=0.039 ) ( table 3 ) . considering that stage is universally thought to be the most important prognostic factor , stratified analysis based on stages was done ( figure 3 ) . the os was not significantly different between low- and high - expression of fgfr1 in stage i , ii , iii and iv , respectively , while when the patients with stage i and ii were all taken into account , the os was significantly longer in those with low fgfr1 expression than high fgfr1 expression ( p=0.044 ) . no significant difference was observed in the survival of patients with low and high fgfr1 expression in stage iii the malfunction of fgfr signaling pathway , mainly caused by the overexpression and/or mutation of receptor genes , was found in a variety of epithelial tumors [ 2528 ] , such as breast cancer , prostatic cancer , oral carcinoma , and gastric cancer . both in vitro and in vivo experiments showed that the fgfr signal pathway played an important role in growth , survival , and migration of lung cancer cells , which could be blocked by fgfr tyrosine kinase inhibitor . previous studies compared the results between fluorescence in situ hybridization and immunohistochemistry ( ihc ) in detecting the overexpression of fgfr1 , where no significant difference was detected between the 2 methods . in this study , the expression of fgfr1 by ihc , and its correlation with vegfr2 and mvd , was analyzed to evaluate its correlation with clinical features and the impact on prognosis . according to previous reports , gene amplification of fgfr1 was about 1620% in squamous lung cancer and 5% in adenocarcinoma . inconsistently , researches from weiss and schildhaus showed no fgfr1 gene amplification in adenocarcinoma . several common histological types , such as squamous lung cancer , adenocarcinoma , large - cell lung cancer , and adenosquamous carcinoma , were included in this study . the present study showed that 2 patients with large - cell lung cancer and 4 with adenosquamous carcinoma had fgfr1 negative or weak expression . fgfr1 expression was significantly higher in squamous lung cancer than in adenocarcinoma ( 36.7% vs. 16.2% , p=0.036 ) , which was consistent with most previous reports . the similarity between these results implicated no significant ethnic diversity in the fgfr1 status while large - scale researches are still in need . the expression rate of fgfr1 was slightly higher in this study than in previous reports , which might be due to different detection methods . for example , a newly published research using reverse transcription - polymerase chain reaction showed an extremely higher amplification rate of fgfr1 ( 41.5% in squamous lung cancer and 14.3% in nonsquamous lung cancer ) than in any other researches . ihc is a widely used method in detecting the expression of specific proteins , which could test the expression of fgfr1 . zhang s research showed that fgfr1 inhibitor induced tumor stasis or regression in the fgfr1-amplified nsclc model . this study demonstrated that fgfr1 was overexpressed in some nsclcs , especially in squamous lung cancer in the chinese population , suggesting that fgfr1 might be a potential target for targeted therapy and its inhibitor might be applied for the treatment of squamous lung cancer and a small part of adenocarcinoma harboring the high expression of fgfr1 . some studies suggested that smoking was also positively correlated with fgfr1 amplification , while some did not . this study showed some differences , as the high expression of fgfr1 was not correlated with smoking ( 23.7% vs. 30.3% , p=0.491 ) , while the expression rate of fgfr1 was significantly higher in smoking patients ( 84.7% vs. 60.6% , p=0.009 ) . in conclusion , no correlation was found between high expression of fgfr1 and clinical characteristics such as age , gender , stage , grade , smoking status , and lymph node metastasis , suggesting no special predictive potential of these clinical characteristics for fgfr1 status in patients with nsclc . inconsistent pathological types and different egfr - tki treatment status in analysis might explain the differing results . in this study , patients who had taken egfr - tki after relapse were excluded , and multivariate analysis was used to identify the correlation between fgfr1 expression and clinical features . it showed that the high expression of fgfr1 was related to poor prognosis , which was consistent with the findings of weiss s research . however , in weiss s study , clinical pathological characteristics ( e.g. , stage , smoking status , and adjuvant chemotherapy ) were not taken into consideration . the present study , using multivariate analysis ( including gender , age , smoking status , tumor size , degree of differentiation , lymph node metastasis , stage , and adjuvant chemotherapy ) , demonstrated that patients with high expression of fgfr1 had shorter rfs and os , suggesting that the high expression of fgfr1 was the independent prognostic indicator of nsclc . although we found no significant difference in survival between low and high fgfr1 expression in stage i , ii , iii , and iv , when we combined the patients with stage i and ii , the os was significantly longer in those with low fgfr1 expression than high fgfr1 expression ( p=0.044 ) . no significant difference was observed in the survival of patients with low- and high - fgfr1 expression in stage iii iv ( p=0.253 ) , indicating that the prognostic value could be more important in early stage of lung cancer . the small sample size may be why we did not get statistical significance in stage i and ii separately . vegfr2 expression , mainly located in the cytoplasm , was found in most tumor tissues ( 94.6% ) in this study , which was consistent with decaussin s report . the expression of vegfr2 was not influenced by age , gender , smoking status , stage , or grade , but it was significantly higher in patients with lymph node metastasis ( p=0.022 ) and/or tumor size more than 4 cm ( p=0.001 ) . seto s study , involving 60 postsurgery patients with stage i lung cancer , indicated that patients with vegfr2 expression in tumor cells presented with poorer survival , while some other studies showed no correlation between vegfr2 expression and prognosis . a recent meta - analysis found no statistically significant effect of vegfr2 expression on survival , but vegfa / vegfr2 co - expression had an influence on survival ( 40 ) . the differences might be caused by the diversity in stage , histological type , period of follow - up , and sample size between different studies . the present study showed no correlation between the expression statuses of vegfr2 and rfs and os in patients with nsclc after surgery . the subgroup analysis , however , showed that in a subgroup of squamous lung cancer , patients with the high expression of vegfr2 had shorter rfs and os compared with the low - expression group ( p=0.028 ; p=0.033 ) , while this correlation was not found in adenocarcinoma . according to the literature the expression status of vegfr2 might play different roles in the prognosis of different histological types . in the meantime , it reflected indirectly that carcinomas with different histological types present with different biological characteristics , so that personalized treatment should be emphasized during treatment . the proangiogenic effect of vegf and bfgf is mediated through the vegf receptor 2 and fgf receptor 1 , respectively . previous researches also showed crosstalk between them in vitro and in vivo . in this study , mvd , which reflected the number of vessels , was significantly higher in tumors with the high expression of vegfr2 than in tumors with the low expression of vegfr2 . the present study , using human tumor tissues , verified in terms of histopathology that the expression of fgfr1 and vegfr2 was significantly correlated ( r=0.619 ) , and both of them had more or less positive correlation with mvd ( r=0.224 ; r=0.265 ) . although the sample size was small , this study found and verified some important findings in china . the role of fgfr1 in squamous lung cancer and its crosstalk with vegfr2 in tumor development need to be explored further . it is hoped that fgfr1 would serve as one of the treatment targets in nsclc , especially in squamous lung cancer . the high expression of fgfr1 existed in part of nsclc ( including squamous lung cancer and adenocarcinoma ) and was the independent prognostic factor associated with poor prognosis , especially in early stages . the expression of fgfr1 and vegfr2 was positively correlated , and both of them were associated with angiogenesis .
backgroundthis study aimed to explore the correlation between fgfr1 and clinical features , including survival analysis and the promotion of angiogenesis by fibroblast growth factor receptor 1 ( fgfr1 ) and vascular endothelial growth factor receptor 2 ( vegfr2 ) . fgfr1 gene amplification has been found in non - small cell lung cancer ( nsclc ) . however , the prognostic value of fgfr1 and the correlation between fgfr1 and clinical features are still controversial.material/methodsa total of 92 patients with nsclc who underwent r0 resection between july 2006 and july 2008 were enrolled in the study . the expression of fgfr1 , vegfr2 , and cd34 was detected by immunohistochemistry . the correlations between the aforementioned markers and the patients clinical features were analyzed by the chi - square test . the impact factors of prognosis were evaluated by cox regression analyses.resultsthe expression ratios of fgfr1 and vegfr2 were 26.1% and 43.4% , respectively . the intensity of fgfr1 expression was related to vegfr2 and histopathology . to some extent , the average microvessel density ( mvd ) had correlation to the expression of fgfr1 and vgefr2 . the pathological stages iii iv and high expression of fgfr1 were found to be independent prognostic factors.conclusionsthe expression intensity of fgfr1 and vegfr2 was associated with mvd , and the expression of fgfr1 is one of the independent prognostic indicators for nsclc .
male c57bl/6 mice ( 10 weeks old ) received streptozotocin ( stz ) ( sigma - aldrich ; 80 mg / kg / day for 2 days ) intraperitoneally . mildly hyperglycemic mice ( blood glucose levels of 250300 mg / dl ) were given plain water or water containing gaba ( 2 or 6 mg / ml ; sigma - aldrich ) , the gabab - r specific agonist baclofen ( 0.25 mg / ml ; sigma - aldrich ) , or the gabaa - r specific agonist muscimol ( 4.5 mg / ml ; bachem bioscience ) . forty - eight hours later , their pancreatic sections ( 4 m ) were subjected to tunel using a pod cell death detection kit ( boehringer ingelheim ) . after development with diaminobenzidine , the sections were stained with guinea pig anti - insulin ( zymed laboratories ) at 4c overnight and alkaline phosphatase conjugated anti - guinea pig igg ( piece ) and visualized using the valcan fact red chromogen kit 2 ( biocare medical ) . the percentages of insulin -cells or tunel apoptotic islet cells in total islet cells of at least 25 islets from individual mice were calculated in a blinded manner . to study apoptosis in human islets , freshly isolated human islets from the integrated islet distribution program were implanted under the kidney capsule ( 2,000 islets / mouse ) of stz - induced diabetic nod / scid mice . their kidney sections ( 4 m ) were stained by tunel using a click - it tunel alexa fluor 488 ( invitrogen ) and costained with guinea pig anti - insulin . subsequently , the sections were incubated with phycoerythrin ( pe)anti - guinea pig igg and counterstained with dapi . at least 2,500 human islet cells in 10 fields ( original magnification 400 ) from individual grafts were counted . the percentages of insulin -cells or tunel apoptotic -cells in total islet cells within the grafts of individual recipients were determined in a blinded manner . c57bl/6 mice were stz - rendered mildly hyperglycemic and randomly provided with water containing : 1 ) brdu ( 0.8 mg / ml ; sigma - aldrich ) , 2 ) brdu plus gaba ( 2 or 6 mg / ml ) , or 3 ) brdu plus baclofen ( 0.25 mg / ml ) for 14 days . other mice received a 14-day micro - osmotic pump ( alzet ) subcutaneously containing 2 mg muscimol in 100 l of pbs or vehicle alone and water containing brdu . at the end of treatment , their pancreatic sections ( 5 m ) were stained with guinea pig anti - insulin and biotinylated anti - brdu ( abd serotec ) followed by fluorescein isothiocyanate anti - guinea pig igg and pe - streptavidin and counterstaining with 4,6-diamidino-2-phenylindole ( dapi ) . the percentages of brduinsulin -cells in dapi islet cells of 25 islets from individual mice were determined in a blinded manner . mildly hyperglycemic nod / scid mice were implanted with adult human islets ( 2,000 islets / mouse ) under the kidney capsule . the mice were treated for 14 days , as described above . at the end of treatment , the kidney tissue sections ( 5 m ) were subjected to immunofluorescent analysis of brduinsulin human -cells , as described above . in another set of experiments , kidney tissue sections were subjected to immunofluorescent analysis of brduinsulin and ki67insulin human -cells using pe anti - human ki67 ( ebioscience ) . the percentages of brduinsulin or ki67insulin -cells in 2,500 islet cells of 10 fields ( original magnification 400 ) of each islet graft were determined in a blinded manner . data are expressed as the mean sem of individual groups ( n = 49/group ) from two separate experiments . the difference between groups was determined by student t test . a p value of < 0.05 was considered statistically significant . male c57bl/6 mice ( 10 weeks old ) received streptozotocin ( stz ) ( sigma - aldrich ; 80 mg / kg / day for 2 days ) intraperitoneally . mildly hyperglycemic mice ( blood glucose levels of 250300 mg / dl ) were given plain water or water containing gaba ( 2 or 6 mg / ml ; sigma - aldrich ) , the gabab - r specific agonist baclofen ( 0.25 mg / ml ; sigma - aldrich ) , or the gabaa - r specific agonist muscimol ( 4.5 mg / ml ; bachem bioscience ) . forty - eight hours later , their pancreatic sections ( 4 m ) were subjected to tunel using a pod cell death detection kit ( boehringer ingelheim ) . after development with diaminobenzidine , the sections were stained with guinea pig anti - insulin ( zymed laboratories ) at 4c overnight and alkaline phosphatase conjugated anti - guinea pig igg ( piece ) and visualized using the valcan fact red chromogen kit 2 ( biocare medical ) . the percentages of insulin -cells or tunel apoptotic islet cells in total islet cells of at least 25 islets from individual mice were calculated in a blinded manner . to study apoptosis in human islets , freshly isolated human islets from the integrated islet distribution program were implanted under the kidney capsule ( 2,000 islets / mouse ) of stz - induced diabetic nod / scid mice . their kidney sections ( 4 m ) were stained by tunel using a click - it tunel alexa fluor 488 ( invitrogen ) and costained with guinea pig anti - insulin . subsequently , the sections were incubated with phycoerythrin ( pe)anti - guinea pig igg and counterstained with dapi . at least 2,500 human islet cells in 10 fields ( original magnification 400 ) from individual grafts were counted . the percentages of insulin -cells or tunel apoptotic -cells in total islet cells within the grafts of individual recipients were determined in a blinded manner . c57bl/6 mice were stz - rendered mildly hyperglycemic and randomly provided with water containing : 1 ) brdu ( 0.8 mg / ml ; sigma - aldrich ) , 2 ) brdu plus gaba ( 2 or 6 mg / ml ) , or 3 ) brdu plus baclofen ( 0.25 mg / ml ) for 14 days . other mice received a 14-day micro - osmotic pump ( alzet ) subcutaneously containing 2 mg muscimol in 100 l of pbs or vehicle alone and water containing brdu . at the end of treatment , their pancreatic sections ( 5 m ) were stained with guinea pig anti - insulin and biotinylated anti - brdu ( abd serotec ) followed by fluorescein isothiocyanate anti - guinea pig igg and pe - streptavidin and counterstaining with 4,6-diamidino-2-phenylindole ( dapi ) . the percentages of brduinsulin -cells in dapi islet cells of 25 islets from individual mice were determined in a blinded manner . mildly hyperglycemic nod / scid mice were implanted with adult human islets ( 2,000 islets / mouse ) under the kidney capsule . the mice were treated for 14 days , as described above . at the end of treatment , the kidney tissue sections ( 5 m ) were subjected to immunofluorescent analysis of brduinsulin human -cells , as described above . in another set of experiments , kidney tissue sections were subjected to immunofluorescent analysis of brduinsulin and ki67insulin human -cells using pe anti - human ki67 ( ebioscience ) . the percentages of brduinsulin or ki67insulin -cells in 2,500 islet cells of 10 fields ( original magnification 400 ) of each islet graft were determined in a blinded manner . data are expressed as the mean sem of individual groups ( n = 49/group ) from two separate experiments . the difference between groups was determined by student t test . a p value of < 0.05 was considered statistically significant . we treated c57bl/6 mice with stz to induce -cell oxidative stress and mild hyperglycemia and then randomized them into groups that received plain water , water containing gaba ( 2 or 6 mg / ml ) , the gabab - r specific agonist baclofen , or the gabaa - r specific agonist muscimol for 48 h. the percentages of apoptotic islet cells and insulin -cells in individual mice were characterized by tunel and immunohistochemistry assays ( fig . the frequency of apoptotic islet cells in mice treated with gaba at 2 mg / ml was significantly reduced compared with that in control mice ( fig . the percentage of apoptotic islet cells in mice treated with gaba at 6 mg / ml was even lower ( fig . thus , gaba treatment inhibited oxidative stress related -cell apoptosis , and its affects tended to be dose - dependent . similarly , additionally , the percentages of insulin -cells in the mice treated with gaba , baclofen , or muscimol were significantly higher than that in the control mice ( fig . thus , activation of either gabaa - rs or gabab - rs preserved -cells from stz - induced apoptosis . the apoptotic -cells in mouse pancreas and human islet grafts in mice were characterized by immunohistochemistry- or immunofluorescent - based tunel , respectively , followed by anti - insulin staining . data shown are representative images ( original magnification 400 ) of apoptotic -cells in mouse islet ( a ) and human islet graft ( b ; green for tunel , red for anti - insulin ) . the replication of mouse -cells ( c ) and human -cells within islet grafts ( d ) in hyperglycemic mice were characterized by immunofluorescent assays using anti - brdu ( red ) and anti - insulin ( green ) staining . e : representative image of anti - ki67 ( red ) and anti - insulin ( green ) staining cells in a human islet graft . c57bl/6 mice were stz - rendered mildly hyperglycemic and given plain water or water containing gaba , baclofen , or muscimol for 48 h during which period all mice remained hyperglycemic . the percentages of apoptotic islet cells in mice were characterized by tunel and immunohistochemistry with anti - insulin . mildly hyperglycemic nod / scid mice were implanted with 2,000 human islets and treated as described in research design and methods . the percentages of apoptotic islet cells were characterized using alexa fluor 488based tunel , pe anti - insulin , and dapi . data are expressed as the mean sem of the percentages of apoptotic islet cells or insulin -cells in different groups of mice ( n = 48 mice / group ) in two independent experiments . there were no obvious inflammatory infiltrates in pancreatic islets . * p < 0.05 , * * p < 0.01 vs. the control water group , p < 0.05 vs. gaba 6 mg / ml , # p < 0.05 vs. baclofen and muscimol . we next examined the ability of gaba administration to limit -cell apoptosis after human islet implantation . transplanted islets undergo immediate hypoxic stress due to lack of vascularization , and a large percentage of -cell mass is lost due to apoptosis within the first 3 days after implantation ( 1214 ) . hyperglycemic nod / scid mice received human islets under their kidney capsule and plain water or water containing gaba ( 6 mg / ml ) , baclofen , or muscimol . two days later , their kidney sections were stained by tunel and anti - insulin antibodies ( fig in comparison with the control group , there were significantly reduced percentages of apoptotic cells and increased frequencies of insulin -cells in human islets that were implanted into mice that were treated with gaba , baclofen , or muscimol ( fig . 2c and d ) . thus , activation of either gabaa - r or gabab - r limits -cell apoptosis in transplanted human islets . accordingly , the inclusion of gaba in the treatment regimen following clinical human islet transplantation may reduce the number of islets required to achieve insulin independence . to assess whether oral gaba promotes mouse -cell replication in vivo , we stz - rendered c57bl/6 mice mildly hyperglycemic ( 250300 mg / dl ) and provided them with water containing brdu with , or without , gaba ( 2 or 6 mg / ml ) for 14 days . since : 1 ) low levels of -cell replication would be difficult to detect as a change in -cell mass and 2 ) gaba treatment can promote functional recovery of degranulated -cells , leading to an increase in insulin islet cells and an apparent increase in -cell mass , we first assessed -cell replication using anti - insulin and anti - brdu staining ( fig . while brduinsulin -cells accounted for 1% of the islet cells in control mice , newly replicated -cells reached 2.2 and 3.1% of the islets cells in mice that had been treated with 2 and 6 mg / ml of gaba , respectively ( fig . anti - brdu staining can reflect dna repair within damaged -cells , we examined the frequency of brduinsulin cells that had a punctated brdu staining pattern . there was no significant difference in the frequency of punctated brdu islet cells among these groups of mice ( data not shown ) , indicating that dna repair in -cells was similar in all groups . additionally , we observed that the percentages of insulin cells in pancreatic islets significantly increased in both gaba - treated groups , relative to that in the control mice ( fig . 3b ) . thus , oral gaba treatment promoted -cell replication and functional recovery in hyperglycemic mice . c57bl/6 mice were stz - rendered moderately hyperglycemic and given water containing brdu with , or without , the indicated doses of gaba for 14 days . in another set of experiments , hyperglycemic mice were given water containing baclofen and brdu or implanted subcutaneously with a 14-day micropump containing muscimol or vehicle ( pbs ) and fed with water containing brdu for 14 days . the replication of -cells in individual mice was characterized by immunofluorescent assays using anti - brdu and anti - insulin and counterstaining with dapi . data are expressed as the mean sem of the percentages of brdu and/or insulin islet cells in different groups of mice ( n = 49 mice / group ) from two independent experiments . * p < 0.05 , * * p < 0.01 vs. the control water group . to assess whether gabaa - r and/or gabab - r activation mediated gaba s effect on -cell replication , in another set of experiments , we treated hyperglycemic c57bl/6 mice with baclofen or muscimol together with brdu for 14 days . we observed that treatment with either muscimol or baclofen elevated the percentages of brduinsulin -cells in the pancreatic islets by more than twofold , as compared with that in the control group ( fig . thus , activation of either gabaa - rs or gabab - rs promotes mouse -cell replication . we also observed a greater number of insulin cells in pancreatic islets from muscimol- or baclofen - treated mice , relative to that in the control mice ( fig . our data indicate that gaba , through gabaa - rs and gabab - rs , enhanced -cell replication and functional recovery in hyperglycemic mice . we next examined whether oral gaba promotes human -cell replication in mice following islet transplantation . adult human islets were implanted under the kidney capsule of hyperglycemic nod / scid mice . these mice were randomized and provided with water containing brdu with , or without , gaba or baclofen for 14 days . other groups of mice received pbs or pbs plus muscimol via an osmotic mini - pump for 14 days , along with water containing brdu . at the end of treatment , kidneys containing the islet grafts were removed , and the percentages of brduinsulin -cells in total islet cells within the islet grafts of individual recipients were determined by immunofluorescent assays ( fig . we observed that while 0.8% of human islet cells were brduinsulin in the control group , 2% of islet cells were brduinsulin in mice that had been treated with gaba , baclofen , or muscimol ( fig . additionally , we observed that gaba , baclofen , and muscimol treatment significantly increased the percentages of total insulin cells within the islet grafts , as compared with that in the control grafts ( fig . , we again observed that gaba treatment increased the frequency of brduinsulin -cells ( data not shown ) , as well as ki67insulin -cells , compared with the control group ( 0.89 vs. 0.4% ; p < 0.02 ; [ figs . 1e and 4c ] ) . thus , both anti - brdu and anti - ki67 staining demonstrate that gaba treatment enhanced human -cell replication . conceivably , gaba - r promoted -cell replication may reduce exogenous insulin requirements and limit the development of hyperglycemia - related complications in t1d patients . gabaa - r and gabab - r activation promotes human -cell replication in transplanted islets . hyperglycemic nod / scid mice were transplanted with human islets under the kidney capsule and randomly treated as described in the research design and methods . all islets recipients became normoglycemic within 2 days after transplantation and remained so during the observation period . the replication of human -cells in the islet grafts was characterized by immunofluorescent assays using pe anti - brdu and fluorescein isothiocyanate anti - insulin , followed by counterstaining with dapi . b : the percentages of insulin -cells in the grafts . in another set of experiments , the kidney tissue sections ( 5 m ) were subjected to immunofluorescent analysis of brduinsulin and ki67insulin human -cells using pe anti - human ki67 . data are expressed as the mean sem of the percentages of brduinsulin , ki67insulin , or insulin islet cells in different groups of mice ( n = 49 mice / group ) from three separate experiments . significantly higher percentages of brduinsulin or insulin islet cells were observed in the gaba - treated grafts ( data not shown ) . * p < 0.05 , * * p < 0.01 vs. the water group . in summary , we observed that activation of gabaa - r or gabab - r inhibited oxidative stress related -cell apoptosis and preserved pancreatic -cells in hyperglycemic mice . similarly , treatment with either a gabaa - r or gabab - r specific agonist inhibited human islet cell apoptosis in mice following islet transplantation . furthermore , treatment with either a gabaa - r or gabab - r specific agonist promoted mouse and human -cell replication in mice . hence , gaba acts as a growth factor that regulates the survival and replication of islet -cells . gaba can inhibit autoreactive th1 cell responses directly ex vivo ( 1517 ) , increase regulatory t cells ( 2,18 ) , inhibit antigen - presenting cell function ( 2,19 ) , and inhibit inflammation in mouse models of t1d ( 2,16,20 ) , rheumatoid arthritis ( 17 ) , multiple sclerosis ( 19 ) , and type 2 diabetes ( 18 ) . twenty - six weeks of gaba treatment did not significantly alter the numbers or percentages of splenic cd4 , cd8 , t , and b lymphocytes ( 16 ) , nor did long - term gaba treatment desensitize t cells to gaba - mediated inhibition ( 16,17 ) . several studies have suggested that local inflammation helps promote -cell replication ( 21 and references therein ) . accordingly , although inflammation should be very limited in the c57bl/6 and nod / scid mouse models that we have studied , gaba s anti - inflammatory activity may have partially counteracted its pro-cell replication activity . gaba s anti - inflammatory properties , together with its ability to promote -cell replication and functional recovery , suggest that modulation of peripheral gaba - rs may be a promising strategy for preserving and increasing islet -cells . therefore , our findings may provide a basis for the design of new therapies for patients with type i and ii diabetes .
-aminobutyric acid ( gaba ) has been shown to inhibit apoptosis of rodent -cells in vitro . in this study , we show that activation of gabaa receptors ( gabaa - rs ) or gabab - rs significantly inhibits oxidative stress related -cell apoptosis and preserves pancreatic -cells in streptozotocin - rendered hyperglycemic mice . moreover , treatment with gaba , or a gabaa - r or gabab - r specific agonist , inhibited human -cell apoptosis following islet transplantation into nod / scid mice . accordingly , activation of gabaa - rs and/or gabab - rs may be a useful adjunct therapy for human islet transplantation . gaba - r agonists also promoted -cell replication in hyperglycemic mice . while a number of agents can promote rodent -cell replication , most fail to provide similar activities with human -cells . in this study , we show that gaba administration promotes -cell replication and functional recovery in human islets following implantation into nod / scid mice . human -cell replication was induced by both gabaa - r and gabab - r activation . hence , gaba regulates both the survival and replication of human -cells . these actions , together with the anti - inflammatory properties of gaba , suggest that modulation of peripheral gaba - rs may represent a promising new therapeutic strategy for improving -cell survival following human islet transplantation and increasing -cells in patients with diabetes .
sg 20-year - old female complained of irregularly placed upper front tooth and feels uncomfortable to smile . history elicited , revealed no history of orthodontic treatment done before , and she does not remember any extractions done during mixed dentition period , her past medical history was not significant . on extraoral examination [ figure 1a c ] , she had apparently symmetrical face , with a straight profile , competent lips , increased exposure of teeth during smile and an average growth pattern . intraoral finding [ figure 2a e ] revealed the presence of the full complement of permanent teeth except third molars , no carious teeth were present , and she had a good oral hygiene . examination of the arches revealed a v - shaped upper arch and u - shaped lower arch , both asymmetrical ; molars were in class i relation , and class i canine on the left side , with blocked upper right lateral incisor , upper right canine was placed ectopically on the buccal side close to the upper right central incisor , almost in a transposed position . anterior crossbite was present on the right side of the arch , and a midline shift of both the upper lower arches toward the right side by 4 mm . the overjet and overbite of 2 mm . model analysis revealed a space discrepancy of 4 mm in the upper and 3 mm in the lower . she was diagnosed as angles class i malocclusion with ectopic canine , anterior cross bite , upper and lower anterior crowding and an average growth pattern . ( a - c ) pre treatment extra oral ( a - e ) pre treatment intra oral bucally placed canineanterior crossbiteblocked lateral incisorcrowded upper and lower anteriorsmidline shift in upper and lower arches . bucally placed canine blocked lateral incisor crowded upper and lower anteriors midline shift in upper and lower arches . mild arch expansion and mild proclination of the upper and lower anteriors were intended to gain space . , the upper arch was strapped up [ figure 3a c ] , aligning was achieved with 014 niti and followed by 016 niti . we corrected the anterior crossbite in the upper right centrals first , then opened the space for right upper laterals using niti open coil spring . the upper right lateral was bonded with an inverted lateral incisor bracket to reverse the torque . after bringing the laterals into the arch 16 22 niti was used to start leveling the arch , it was followed by 17 25 niti , then to 17 25 ss , then into 19 25 niti . once leveling was achieved , finishing was done using 19 25 ss wire to gain torque . ( a - c ) mid treatment intra oral fixed retention in both upper / lower arches from canine to canine was given . the posttreatment results showed that pleasing smile was achieved [ figure 4a c ] and a good alignment of the canines was achieved in class i relation on both the sides . the upper midline was shifted to the left side by 2 mm , lower midline stayed the same [ figure 5a e ] . ( a - c ) post treatment extra oral ( a - e ) post treatment intra oral bucally placed canineanterior crossbiteblocked lateral incisorcrowded upper and lower anteriorsmidline shift in upper and lower arches . bucally placed canine blocked lateral incisor crowded upper and lower anteriors midline shift in upper and lower arches . mild arch expansion and mild proclination of the upper and lower anteriors were intended to gain space . at first , the upper arch was strapped up [ figure 3a c ] , aligning was achieved with 014 niti and followed by 016 niti . we corrected the anterior crossbite in the upper right centrals first , then opened the space for right upper laterals using niti open coil spring . the upper right lateral was bonded with an inverted lateral incisor bracket to reverse the torque . after bringing the laterals into the arch 16 22 niti was used to start leveling the arch , it was followed by 17 25 niti , then to 17 25 ss , then into 19 25 niti . once leveling was achieved , finishing was done using 19 25 ss wire to gain torque . ( a - c ) mid treatment intra oral fixed retention in both upper / lower arches from canine to canine was given . the posttreatment results showed that pleasing smile was achieved [ figure 4a c ] and a good alignment of the canines was achieved in class i relation on both the sides . the upper midline was shifted to the left side by 2 mm , lower midline stayed the same [ figure 5a e ] . ( a - c ) post treatment extra oral ( a - e ) post treatment intra oral facial displacement of the maxillary canines is mainly attributed to the inadequate space in the arch . patients with palatally displaced canines usually have more arch length available than patients with buccally displaced canines . moss insist on careful examination of ( 1 ) space analysis , ( 2 ) the morphology of the adjacent teeth , ( 3 ) contours of the bone , ( 4 ) mobility of the teeth , ( 5 ) radiographic examination . the buccally displaced canines were also associated with the hyperdivergent growth pattern , and constricted maxillary arch , and crowded upper anteriors . it is very essential to identify the root resorption of the neighboring tooth before treatment . studies by rimes et al . , have shown that resorption of the roots of the laterals is very common in buccally displaced canines . the present diagnostic advancement of cone beam computerized tomography with its three dimensional view enables us to assess the presence of resorption . an early examination and good clinical evaluation with necessary investigations help us predict the correct position of the canines .
the canines being the cornerstone of the arch and smile is one of the teeth , which has the longest eruption passage that gets influenced by local and general etiological factors easily . the initial calcification of the crowns starts at 45 months of age and proceeds toward eruption about 1113 years of age with mesiobuccal crown angulation that gets corrected toward occlusion . it gets displaced buccally or palatally or may sometimes get impacted . early intervention is the best suited to manage canine eruption patterns . once erupted ectopically , they possess a great challenge in repositioning them back into their correct position . this case report discusses an orthodontic treatment planning and execution to correct a buccally placed canine with an anterior crossbite in an adult .
jurkat cells were grown in rpmi-1640 medium supplemented with 10% fcs . before the experiments , cells were washed and resuspended in serum - free medium without glucose containing 2 mm pyruvate . after adaptation to this medium , cells were exposed to 0 or 2.5 m oligomycin for 45 min , and then challenged with sts or an agonist mab ( clone ch-11 ) against cd95 . cultures were stained with a mixture of the membrane permeant dye h-33342 ( 500 ng / ml ) and the membrane impermeant dye sytox ( 500 nm ) ( molecular probes , eugene , or ) . necrotic ( damaged plasma membrane ; noncondensed nuclei ) and apoptotic cells ( intact plasma membrane ; characteristically condensed or fragmented nuclei ) were scored . alternatively , cells were stained with a combination of 0.5 m calcein - am , 1 m ethidium homodimer ( eh-1 ) , and 500 ng / ml h-33342 . stained cells ( immobilized on poly - l - lysine coated cover slips at the bottom of a 35-mm chamber ) were examined with a leica tcs-4d confocal microscope simultaneously for membrane integrity ( calcein retention and eh-1 exclusion ) and morphological changes of the nucleus and the cell ( polarization contrast and h-33342 stain ) . results obtained with both methods were similar . digital images of syto-13/eh-1stained cells were acquired on a leica dm - irb microscope ( 40 lens ) coupled to an imaging system ( imaging corporation , st . the fainter green syto-13 stain was displaced by the red eh-1 stain ( 3 ) . surface phosphatidylserine expression was analyzed by annexin v staining and facs analysis as described ( 13 ) . addition of glucose ( 10 mm ) to cells in the absence of oligomycin resulted in increases of the atp concentration 20% of the initial value ( data not shown ) and did not modify apoptosis . with atp concentrations between 30% and 50% of the resting control level intermediate forms of cell death ( e.g. , partially condensed nuclei in ruptured cells ) , and a slight delay in the kinetics of necrosis were occasionally observed after stimulation with either cd95 or sts . addition of oligomycin decreased the intracellular atp concentration ( as compared with initial control levels : 60% within 10 min , 75% within 20 min , and 90% within 30 min ) irrespective of the presence of other medium supplements or stimuli . conversely , after treatment with glucose , atp rose to 70% within 5 min and reached a new steady state after 15 min . field - inverted gel electrophoresis ( fige ) was performed as described previously ( 3 ) after embedding 5 10 cells into 40-l agarose blocks . conventional agarose gel electrophoresis ( cage ) was performed on 1.0% agarose gels ( 15 ) . alternatively , histone - containing dna fragments were determined quantitatively by elisa ( boehringer mannheim , germany ) ( 16 ) . in this assay western blots were performed using an anti - human lamin b antibody ( clone 101 b7 , oncogene research products , cambridge , ma ) . all lanes of 10% polyacrylamide gels were loaded with 10 g protein , and homogeneous transfer to nitrocellulose membranes was controlled by ponceau red staining . for immunocytochemistry , cells were fixed with 80% meoh . incubation with anti - lamin b antibody ( 101 b7 ) was followed by staining with a secondary bodipy - coupled anti - mouse antibody and 1 g / ml h-33342 . cells were visualized by threechannel confocal microscopy with a 100 uv lens ( polarization , lamin , chromatin ) . jurkat cells were grown in rpmi-1640 medium supplemented with 10% fcs . before the experiments , cells were washed and resuspended in serum - free medium without glucose containing 2 mm pyruvate . after adaptation to this medium , cells were exposed to 0 or 2.5 m oligomycin for 45 min , and then challenged with sts or an agonist mab ( clone ch-11 ) against cd95 . cultures were stained with a mixture of the membrane permeant dye h-33342 ( 500 ng / ml ) and the membrane impermeant dye sytox ( 500 nm ) ( molecular probes , eugene , or ) . necrotic ( damaged plasma membrane ; noncondensed nuclei ) and apoptotic cells ( intact plasma membrane ; characteristically condensed or fragmented nuclei ) were scored . alternatively , cells were stained with a combination of 0.5 m calcein - am , 1 m ethidium homodimer ( eh-1 ) , and 500 ng / ml h-33342 . stained cells ( immobilized on poly - l - lysine coated cover slips at the bottom of a 35-mm chamber ) were examined with a leica tcs-4d confocal microscope simultaneously for membrane integrity ( calcein retention and eh-1 exclusion ) and morphological changes of the nucleus and the cell ( polarization contrast and h-33342 stain ) . digital images of syto-13/eh-1stained cells were acquired on a leica dm - irb microscope ( 40 lens ) coupled to an imaging system ( imaging corporation , st . catherins , canada ) . apoptotic nuclei appeared hyperfluorescent and condensed . in necrotic nuclei , the fainter green syto-13 stain was displaced by the red eh-1 stain ( 3 ) . surface phosphatidylserine expression was analyzed by annexin v staining and facs analysis as described ( 13 ) . addition of glucose ( 10 mm ) to cells in the absence of oligomycin resulted in increases of the atp concentration 20% of the initial value ( data not shown ) and did not modify apoptosis . with atp concentrations between 30% and 50% of the resting control level intermediate forms of cell death ( e.g. , partially condensed nuclei in ruptured cells ) , and a slight delay in the kinetics of necrosis addition of oligomycin decreased the intracellular atp concentration ( as compared with initial control levels : 60% within 10 min , 75% within 20 min , and 90% within 30 min ) irrespective of the presence of other medium supplements or stimuli . conversely , after treatment with glucose , atp rose to 70% within 5 min and reached a new steady state after 15 min . field - inverted gel electrophoresis ( fige ) was performed as described previously ( 3 ) after embedding 5 10 cells into 40-l agarose blocks . conventional agarose gel electrophoresis ( cage ) was performed on 1.0% agarose gels ( 15 ) . alternatively , histone - containing dna fragments were determined quantitatively by elisa ( boehringer mannheim , germany ) ( 16 ) . in this assay western blots were performed using an anti - human lamin b antibody ( clone 101 b7 , oncogene research products , cambridge , ma ) . all lanes of 10% polyacrylamide gels were loaded with 10 g protein , and homogeneous transfer to nitrocellulose membranes was controlled by ponceau red staining . for immunocytochemistry , cells were fixed with 80% meoh . incubation with anti - lamin b antibody ( 101 b7 ) was followed by staining with a secondary bodipy - coupled anti - mouse antibody and 1 g / ml h-33342 . cells were visualized by threechannel confocal microscopy with a 100 uv lens ( polarization , lamin , chromatin ) . initially , we examined the characteristics of cell death caused by the two inducers under conditions of intracellular atp depletion . jurkat cells were maintained in a glucose - free rpmi-1640 medium supplemented with 2 mm pyruvate to allow only mitochondrial atp production . intracellular atp levels were maintained during the first 90 min , but eventually declined after the appearance of the first apoptotic cells ( fig . 1 , a and b ) . when cells were preemptied of atp using oligomycin , a blocker of mitochondrial atp synthesis , death occurred by necrosis ( fig . we asked ourselves whether maintenance of a certain atp level was needed to prevent an early breakdown of the plasma membrane . in this case , the development of apoptosis , which would not necessarily require atp , could have been precluded by a premature demise with apparent necrotic features . however , it became clear that necrosis elicited by either of the two inducers in atp - depleted cells occurred with a similar or rather longer time course than apoptosis . in this case , cell demise had entirely different morphological and biochemical features ( fig . 1 d ) . nuclei of cells pretreated with oligomycin and then exposed to sts/ cd95 had normal size and showed no apoptotic chromatin condensation , while the cell membrane was clearly permeable to fluorescent dyes . the typical apoptotic dna cleavage into 700/300 kbp , 50 kbp , and oligonucleosomal fragments did not occur in jurkat cells preemptied of atp ( fig . exposure of phosphatydylserines on the outer surface of the plasma membrane , a process leading to recognition of apoptotic cells ( 13 ) , did not occur in atp - depleted cells , which later underwent necrosis ( annexin binding cells after 210 min : sts , 85 9% ; oligomycin , 19 4% ; sts + oligomycin , 13 7% ; control , 11 5% ) . this suggests that atp was required for the execution of several distinct processes in the apoptotic program . to estimate the atp concentration sufficient to allow the progression of apoptosis , we clamped the atp concentration of oligomycin - treated cells at different levels by supplementing the medium with glucose ( fig . cells were then treated with the inducers . in sts - treated cells , an atp depletion > 50% ( i.e. , a residual atp concentration < 0.8 nmol mg prot 45 min after the addition of the stimulus , when the apoptotic features were not yet apparent ) was sufficient to change the mode of demise from apoptotic to necrotic . higher atp concentrations instead favored the ordered continuation of the apoptotic program . with cd95 , an atp loss 70% ( i.e. , a residual atp concentration of 0.5 nmol mg prot ) was invariably followed by necrosis ( fig . similar results were obtained in experiments with fructose replenishment . in cells pretreated with oligomycin and then challenged with cd95 , a fructose concentration ( 40 mm ) that limited the atp loss ( i.e. , residual atp above 50% ) changed the mode of cell death from necrosis to apoptosis . addition of similar metabolic substrates , e.g. , glycerol ( 50 mm ) , dihydroxyacetone ( 50 mm ) , or lower fructose concentrations ( 10 mm ) , which were not able to restore intracellular atp levels , did not modify the shape of cell death . thus , it appears that the availability of the atp generated by glycolysis is sufficient to allow the execution of cell death by apoptosis . in the absence of glucose and oligomycin , mitochondrial atp generation stimulated by the addition of pyruvate to determine at which phase of the death program atp was required , we added oligomycin at different times after triggering cell death with sts or cd95 . when atp depletion was inflicted up to 90 min after the challenge with either of the two stimuli , cell death still shifted from apoptosis to necrosis ( fig . , we found that glucose addition to replenish atp in cells treated with either sts or cd95 plus oligomycin directed the death process towards apoptosis up to 2 h after the challenge ( fig . thus , it seemed that atp was required immediately before the characteristic nuclear changes , perhaps to ensure that nuclear collapse , the ordered packaging of chromatin , and dna degradation occur before cell lysis . accordingly , dna fragmentation was strongly reduced in necrotic cells ( i.e. , challenged with sts or cd95 in the presence of oligomycin ) as compared with those undergoing apoptosis , although the total percentage of cell death was approximately the same ( fig . differences in the fate of the nucleus became evident when we examined lamin degradation , a process pivotal for the nuclear collapse that is effected by the activation of certain caspases during apoptosis ( 17 , 18 ) . cleavage of lamin b was significantly reduced under conditions of atp depletion leading to necrosis ( fig . 4 , c and d ) , which suggests that activation of the proteolytic system responsible for lamin cleavage is specific for apoptosis . because activation of caspases is also an integral component of the cd95 signaling system that triggers apoptosis ( 19 , 20 ) we used caspase inhibitors to test whether the same signaling system would be active in necrosis and apoptosis . in this case , caspase inhibitors prevented cd95-induced cell death regardless whether apoptotic or necrotic ( fig 4 , a and b ) , in agreement with other findings that both types of cell death share similar signals and initial mechanisms ( 2123 ) . a cytoplasmic controller ( 24 ) seems to direct downstream events resulting in the typical apoptotic features including proteolysis of nuclear elements and dna degradation . furthermore , according to a series of elegant experiments with reconstituted cell - free systems , an apoptogenic protease ( 25 ) released from mitochondria upon permeability transition ( 26 ) can promote the nuclear changes . in cells , mitochondrial permeability transition can be triggered by a variety of stimuli acting on the mitochondria directly , or by a yet unknown upstream controller ( 25 , 26 ) . thus , either the upstream controller or the execution system(s ) may be modulated by the availability of atp . the latter may be provided by gycolysis or , in tissues with high metabolic demand , primarily by the mitochondria ( 3 , 27 ) . in the model described here , restoration of glycolytic atp generation was sufficient to allow the ordered execution of apoptosis . thus , apoptosis and necrosis would be two extremes of a continuum of possible types of cell demise , whose shape and implications for the neighboring tissue would be decided by the availability of atp , and likely by additional factors in the dying cell and in scavenger cells . this would explain the frequent coexistence of both types of cell death in pathological situations , e.g. , cerebral ischemia ( 28 ) or inflammatory liver failure ( 5 , 6 ) , where individual cell death within the tissue would be decided by the energy supply . cells , in a glucose - free medium supplemented with 2 mm pyruvate , were incubated with solvent ( control ) ( squares ) , 1.2 m sts ( triangles ) , or 100 ng / ml cd95 ( circles ) . pretreatment with 2.5 m oligomycin ( olig ) is shown by the open symbols ; ( a ) intracellular atp concentration was measured at the time indicated and expressed as percentage of untreated controls ( 1.6 nmol / mg protein ; 4.5 nmol/10 cells ) . atp concentrations in cells treated with oligomycin plus sts or cd95 did not differ from those of cells treated with oligomycin alone ( open squares ) ; ( b and c ) the percentage of apoptotic and necrotic cells was determined after staining of cultures with h-33342 plus sytox ; in d , jurkat cell were incubated with 1.2 m sts ( left ) , sts plus oligomycin ( middle ) , or sts plus oligomycin plus 5 mm glucose ( right ) for 4 h , before staining with syto-13 ( green ) and eh-1 ( red ) . data are means sd of triplicate determinations and representative of at least four experiments . jurkat cells were incubated with cd95 or sts in the presence or absence of oligomycin ( olig ) . ( a ) after a 90 min incubation , high molecular weight dna fragmentation was determined by fige ; ( b ) after 3 h , low molecular weight oligonucleosomal fragments were determined by cage . at the selected time points , the two types of dna cleavage had reached the maximum as determined by pilot experiments . changes in the mode of cell death after clamping the intracellular atp concentration at defined levels or at different times . ( a ) jurkat cells in glucose - free medium containing pyruvate ( 2 mm ) were exposed to 2.5 m oligomycin plus the indicated concentrations of glucose . intracellular atp concentrations were determined at the times indicated ; ( b and c ) jurkat cells were preincubated for 45 min in medium containing 2.5 m oligomycin plus the concentration of glucose indicated . sts ( b ) or cd95 ( c ) were then added and the mode of cell death was determined after further 3.5 h ; ( d ) intracellular atp levels were manipulated during incubation of jurkat cells with either sts or cd95 . left , cells were incubated in pyruvate - supplemented medium without glucose and challenged ( at t = 0 ) with 100 ng / ml cd95 or 1.2 m sts . at the times indicated oligomycin was added to deplete atp , and the mode of cell death was determined 4 h after the challenge . right , cells were first depleted of atp by preincubation with oligomycin ( at t = 1 h ) . at t = 0 , sts or cd95 were added . at the times indicated , intracellular atp was replenished by adding 10 mm glucose to the incubation medium . the dashed bold line indicates the cellular atp concentration ( percentage of untreated control cultures in standard pyruvate medium ) , which was reached 15 min after each glucose supplementation . ( a and b ) cells were preincubated for 45 min with oligomycin and/or 75 m zvad - fmk as indicated and then challenged with cd95 . after 4 h , ( a ) the mode of cell death ( closed bars , apoptotic ; open bars , necrotic ) or ( b ) dna fragmentation were determined by dual fluorescent staining or elisa , respectively ; ( c ) cells were incubated with cd95 or sts for 200 min in the presence or absence of 2.5 m oligomycin ( olig ) . the original lamin band and the proteolytic fragment , typically found in apoptotic cells are indicated by arrowheads ; ( d ) lamin disintegration was also studied by immunostaining . lamins were stained with an anti - lamin antibody , whereas nuclei were counterstained with h-33342 . confocal images show that breaks / dissolution of the lamin structure ( middle - left ) as well as chromatin condensation ( middle - right ) did not occur in cells undergoing necrosis ( i.e. , treated with oligomycin ) ( bottom ) .
apoptosis and necrosis are considered conceptually and morphologically distinct forms of cell death . here , we report that demise of human t cells caused by two classic apoptotic triggers ( staurosporin and cd95 stimulation ) changed from apoptosis to necrosis , when cells were preemptied of adenosine triphosphate ( atp ) . nuclear condensation and dna fragmentation did not occur in cells predepleted of atp and treated with either of the two inducers , although the kinetics of cell death were unchanged . selective and graded repletion of the extramitochondrial atp / pool with glucose prevented necrosis and restored the ability of the cells to undergo apoptosis . pulsed atp / depletion / repletion experiments also showed that atp generation either by glycolysis or by mitochondria was required for the active execution of the final phase of apoptosis , which involves nuclear condensation and dna degradation .
research in recent years has placed a particular focus on the study of the glucagon - like peptide 1 ( glp-1 ) intestinal hormone , which is synthesized in response to food stimulus and is involved in glycemic control . dipeptidylpeptidase-4 ( dpp-4 ) was identified as being responsible for the rapid inactivation of glp-1 . based on the study of this hormone , further research led to the development of new therapeutic options for the treatment of type 2 diabetes mellitus ( t2 dm ) . liraglutide is an acylated glp-1 receptor agonist , with a 97% amino acid sequence identity to endogenous human glp-1 ( 737 ) , but is resistant to the hydrolysis of dpp-4 . similar to the glp-1 hormone , liraglutide has multiple roles : restriction of appetite and delay of gastric emptying , weight loss , lowering of blood pressure , inhibition of glucagon secretion , growth of pancreatic -cell function through -cell proliferation , decrease of -cell apoptosis and increase of glucose stimulated insulin secretion . dpp-4 inhibitors ( e.g. sitagliptine , vildagliptine ) prolong the action of the natural glp-1 hormone through the inactivation of dpp-4 enzyme . through the oral administration of dpp-4 inhibitors , and through the lower frequency of side effects , this therapeutic option recommends itself as a progress of diabetology . the patients submitted to the evaluation with liraglutide and dpp-4 inhibitors were selected consecutively over an 11 months period from the heart and diabetes center nrw in bad oeynhausen , germany . the ethics committee of the ruhr university of bochum located at the heart and diabetes center nrw approved this data acquisition . none of the patients have been treated with these substances before ; therapy change was performed during hospital stay following clinical affordance . an informed consent was obtained from the patients who were asked to take part in this data collection and were followed up for 6 months . the new therapy for the treatment of t2 dm consisted of : liraglutide , or sitagliptin , or vildagliptin , respectively which were administered as a therapy associated to other antidiabetic drugs ( metformin , glimepiride , pioglitazone , etc . ) . as these patients were selected consecutively and not based on predetermined criteria this cohort presents a real life patient cohort . the clinical parameters concerning side effects were : nausea , vomiting , heartburns ( pyrosis ) , hiccups ( eructation ) , diarrhea , constipation , headaches , and dizziness . the overall profile of these side effects was based on the questionnaire method which followed three chronological points of reference in time : point 0 the hospitalization period ( the beginning of the therapy ) , point 1 three months after the therapy started , the records had in view the side effects incidence within every single day of the approximately 710 days of the hospitalization . the questionnaires used at point 1 and 2 focused solely on recording the incidence of these adverse reactions within three consecutive days . before monitoring the side effects , records had been made with data regarding the incidence of these reactions in the patients before the hospitalization period . in order to record all data as precisely as possible , the factors taken into consideration were extended to : the history of previous medication , the medication associated to the study therapy , and other factors like environment , temperature , diet etc . which could have influenced the patient s condition . 98 patients ( mean age 57.911.8 years ) were treated with liraglutide and 94 patients ( mean age 62.311.5 years ) received dpp-4 inhibitors ( sitagliptin or vildagliptin ) . for the side effects monitoring , each occurrence of a side effect during the hospitalizing period was counted as negative event. each improvement in relation to the patient s condition before the therapy started was counted as positive event. in the results tables , the incidence of side effects occurrence is presented as follows : each side effect during hospitalization period was counted only once , regardless of its duration . during the hospitalizing period , fewer side effects occurred under the therapy with dpp-4 inhibitors , except for vomiting , pyrosis and headaches ( table i ) . three months after the start of monitoring , the incidence of all side effects was lower as compared to the hospitalizing period , except for pyrosis under liraglutide therapy and nausea , eructation , headaches and dizziness under the use of dpp-4 inhibitors ( table ii ) . six months after the therapy , side effects incidence recorded the lowest rates throughout the monitoring period , both under therapy with liraglutide and dpp-4 inhibitors ( table iii ) . at each of the three chronological points of reference in time , outstanding positive events were recorded for each study group with patients reporting regular bowel disorders before therapy switch to incretins . that observation was especially obvious in patients treated with liraglutide , who had diarrhea ( 16.3% ) , and constipation ( 15.3% ) ( table i ) . throughout the monitoring period of six months , the side effects led to treatment interruption in 4 out of 98 patients treated with liraglutide , and in 6 out of 94 patients under dpp-4 inhibitors . under the therapy with dpp-4 inhibitors , transient states of bloating or fullness were recorded in a small number of patients under both therapies . the incidence of the side effects found are in correlation with the data in the literature , i.e. glp-1 receptor agonists cause more side effects than dpp-4 inhibitors . nevertheless , headache incidence was higher under dpp-4 inhibitors . side effects were generally quickly reversible ; their incidence was declining during the monitoring period . under these therapies , the new therapeutic concept of glp-1 receptor agonists is easily and successfully applied in overweight patients with t2 dm .
the objective of this study was to monitor the side effects of the glp-1 receptor agonist liraglutide in comparison to those of dpp-4 inhibitors ( sitagliptin and vildagliptin ) , in order to determine their safety , tolerability and therapeutic efficiency . the study was carried out in the heart and diabetes center nrw and included overweight patients with type 2 diabetes whose therapeutic regimen was switched to liraglutide or dpp-4 inhibitors . a validated questionnaire method was used to monitor the side effects during the hospitalization period , then again at 3 , and 6 months after the beginning of the therapy.the therapy with liraglutide was associated with more side effects than the one with dpp-4 inhibitors . in general , side effects were declining with time , thus only few patients stopped therapy . the incretin therapy turned out to be a safe and effective therapeutic option for patients with type 2 diabetes mellitus .
adequate debridement of the root canal plays an important role in the success of root canal treatment . mechanical instrumentation of root canals produces a smear layer comprising organic and inorganic substances , such as dentin particles , necrotic debris , microorganisms , and odontoblastic processes . despite the controversies regarding the smear layer [ 3 , 4 ] , the general consensus is that the smear layer adversely affects the root canal seal [ 5 , 6 ] . the effectiveness of citric acid for removal of the smear layer was demonstrated in the 1970s [ 7 , 8 ] . . reported an irrigation solution comprising a mixture of 3% doxycycline , 4.25% citric acid , and 0.5% polysorbate 80 detergent , named mtad . the quantity of smear layer removed by an irrigation solution is related to its ph and the exposure time . traditionally , irrigants are delivered by a large syringe and needle to facilitate their insertion . therefore , several mechanical devices have been developed to improve the penetration and effectiveness of irrigants . some of these irrigation techniques include manual irrigation with needles and cannulas and the use of machine - assisted agitation systems with sonic and ultrasonic energy sources . self - adjusting file ( saf ) was introduced in 2010 and claimed to be successful in difficult - to - clean parts of the root canal with continuous flow of the irrigant . the aim of this study was to evaluate efficacy of mtad and citric acid solutions used with saf system on smear layer . twenty - three freshly extracted single - rooted human teeth with a straight canal , stored in saline solution , were used . radiographs of the teeth were taken in the buccolingual and mesiodistal projections to analyze the shape of the root canals and to detect possible anatomic variations . the coronal parts of the teeth were cut with a high - speed diamond bur to standardize the root lengths and to provide direct access to the root canals . number 15 k files ( dentsply - maillefer , ballaigues , switzerland ) were introduced further into the root canals until their tips were visible at the apical foramen . 5 ml , 5.25% sodium hypochlorite ( naocl ) was used for irrigation between the instruments . a saf file ( redent - nova , israel ) irrigation was performed continuously during the instrumentation using a special irrigation apparatus ( vatea irrigation device , redent - nova , israel ) . the saf file instrumentation with irrigation was performed for a total of 4 minutes in each root canal : group 1 : 10 roots were used . 5.25% naocl was used for 3 minutes ( at a flow rate of 5 ml / min , 15 ml in total ) and then 5 ml mtad was used for 1 minute ; group 2 : 10 roots were used . 5.25% naocl was used for 3 minutes ( at a flow rate of 5 ml / min , 15 ml in total ) and then 5 ml 20% citric acid was used for 1 minute ; group 3 ( control group ) : 3 roots were used . 5.25% naocl solution were used for 4 minutes ( at a flow rate of 5 ml / min , 20 ml in total ) . 5.25% naocl was used for 3 minutes ( at a flow rate of 5 ml / min , 15 ml in total ) and then 5 ml mtad was used for 1 minute ; group 2 : 10 roots were used . 5.25% naocl was used for 3 minutes ( at a flow rate of 5 ml / min , 15 ml in total ) and then 5 ml 20% citric acid was used for 1 minute ; group 3 ( control group ) : 3 roots were used . 5.25% naocl solution were used for 4 minutes ( at a flow rate of 5 ml / min , 20 ml in total ) . finally , all roots were irrigated with 5 ml distilled water , then dried with sterile paper points , and left to dry at a room temperature for 24 hours . all roots were grooved longitudinally on the external surface with a diamond disc in the buccolingual plane , avoiding penetration of the root canals . the specimens were fixed on metal holders and coated with gold and viewed with fei quanta 400f field - emission scanning electron microscope ( fei company , hillsboro , or , usa ) . the smear layer was evaluated from images at 2000x magnification based on the scale of hlsmann et al . : score 1 , no smear layer and all dentinal tubules were open ; score 2 , a small amount of smear layer and some dentinal tubules were open ; score 3 , homogeneous smear layer covering the root canal wall and only a few dentinal tubules were open ; score 4 , complete root canal wall covered by a homogeneous smear layer and no open dentinal tubules ; and score 5 , heavy homogeneous smear layer covering the complete root canal . scores 1 and 2 represent clean canal wall . the kruskal - wallis test was used for statistical evaluation and mann - whitney u test was used for multiple comparisons . the saf , operated with mtad - naocl and citric acid - naocl , resulted in clean canals and most of the specimens revealed scores 1 and 2 ( figures 1 and 2 ) . the cleaning rates of groups 1 and 2 are shown in tables 1 and 2 . control group exhibited heavy smear layer covering the root canal walls ( figure 3 ) . no significant difference was found statistically in the smear layer on the dentine wall among the coronal , middle , and apical thirds in groups 1 , 2 , and 3 based on comparisons within each group ( group 1 , p = 0.378 ; group 2 , p = 0.065 ; group 3 , p = 1.00 ) ( kruskal - wallis test ) . mean scores and statistical equivalence related to the thirds of teeth in the three groups are shown in table 3 . in the coronal third , there was a statistically significant difference among the three groups ( groups 1 - 2 , p = 0.005 ; groups 13 , p = 0.007 ; groups 2 - 3 , p = 0.005 ) . group 3 ( control ) was statistically different from the other groups also in the middle ( groups 13 , p = 0.009 ; groups 2 - 3 , p = 0.007 ) and apical thirds ( groups 13 , p = 0.009 ; groups 2 - 3 , p = 0.009 ) ( mann - whitney u test ) . similar to hand and rotary instrumentation , the saf system produces a smear layer when using naocl alone , but when alternating the application of mtad and 5.25% naocl and 20% citric acid and 5.25% naocl , the canals were rendered virtually free of debris and smear layer , with the most pronounced benefit realized in the apical third of the root canal , as confirmed by the present study . in recent years , numerous researchers [ 1519 ] studied saf system using different evaluation methods and reported successful results as our study in shaping and irrigating root canals . however , as a result of a microbiological and scanning electron microscopy study , paranjpe et al . found out insufficient apical preparation and irrigation when using the saf system . this result could be explained by differences in the sample and the testing methods . in the past , different concentrations of citric acid were used to remove the smear layer [ 21 , 22 ] . di lenarda et al . reported no or negligible difference in smear layer removal with citric acid and edta , the most common chelating agent . in a study of mancini et al . , the efficacy of 42% citric acid , mtad , and 17% edta was tested on removing the smear layer . the irrigation solutions were delivered via a nickel - titanium needle ( stropko niti flexi - tip ; sybronendo , orange , ca ) , which penetrated within 1 to 2 mm of the working length . in direct contradiction with our study , none of these three solutions removed the smear layer in the apical third of the root canal . numerous investigations [ 2528 ] revealed that extended exposure to acids results in excessive demineralization . therefore , 4 min of 20% citric acid application instead of 40% was used with a final flush of saline in the current study . although we used a lower concentration of citric acid ( 20% ) , the smear layer was successfully removed in the majority of our specimens . this success can be attributed to the continuous irrigation and vibration action of the saf system . in the study of metzger et al . , the use of the saf system and irrigation with edta and naocl resulted in smear layer - free canal walls in the apical third of 65% of the specimens . the vatea peristaltic pump used in the saf system delivers a continuous flow of irrigant , which enters the canal through the hollow file . according to the manufacturer , the motion of the file agitates the irrigant to such an extent that it effectively reaches the apical part of the canal with sonic activation . we thought that continuous replacement of irrigant could also explain the excellent cleaning efficiency observed in this study . , mtad irrigation was achieved using a 28-gauge needle placed into the canal space 1 to 1.5 mm short of the working length and a cotton - wrapped barbed broach was placed to the end of the working length and left there for a few minutes . these researchers reported smear - free dentine walls in the apical third of the canals . this success might be due to the direct contact of the fresh solution and replacement of the older solution by the cotton wrapped barbed broach . similarly , direct contact of fresh irrigant with dentine walls might facilitate the saf system irrigation with mtad in our study . as zehnder emphasized , optimal cleaning requires direct contact of the irrigant with the root canal surface . in a study by tay et al . , biopure mtad and edta were applied as a final irrigant , and to increase contact and penetration , a gutta - percha point was used to agitate the solution . the authors reported that the smear layer was successfully removed using this technique , regardless of the irrigant . in the present study , metzger et al . claimed that the saf file has a scrubbing action on the canals , which clearly results in a very clean surface even in the unreachable parts of the canal by activation of the irrigant in the apical third of the canal . in a recent study of melo ribeiro et al . , oval saf was used with continuous naocl irrigation on oval - shaped root canals . these researchers reported that the percentage of remaining debris and uninstrumented canal perimeter was significantly lower in the saf group than in the rotary group . previously , de - deus et al . explained this result by the ability of saf instrument to adapt itself to the cross - section of the canal and the mechanical debridement efficacy of its continuous irrigation system . although there is general agreement regarding the necessity of removing the smear layer , the optimal irrigation solution and removal technique remain under debate.the present findings revealed the effectiveness of the saf system with two different irrigation solutions , suggesting that this methodology may be a useful alternative to conventional methods . in the limitations of this study , it can be concluded that using the saf system and continuous irrigation action with edta and mtad solutions could overcome the difficulty of removing smear layer even in hard - to - reach regions of the root canal .
mechanical instrumentation of root canals produces a smear layer that adversely affects the root canal seal . the aim of this study was to evaluate efficacy of mtad and citric acid solutions used with self - adjusting file ( saf ) system on smear layer . twenty - three single - rooted human teeth were used for the study . canals were instrumented manually up to a number 20 k file size . saf was used to prepare the root canals . the following groups were studied : group 1 : mtad + 5.25% naocl , group 2 : 20% citric acid + 5.25% naocl , and group 3 : control ( 5.25% naocl ) . all roots were split longitudinally and subjected to scanning electron microscopy . the presence of smear layer in the coronal , middle , and apical thirds was evaluated using a five - score evaluation system . kruskal - wallis and mann - whitney u tests were used for statistical analysis . in the coronal third , group 2 exhibited the best results and was statistically different froms the other groups ( p < 0.05 ) . there was not a significant difference among the three thirds of groups according to in - group comparisons ( p > 0.05 ) . the solutions used in group 1 and 2 could effectively remove smear layer in most of the specimens . however , citric acid was more effective than mtad in the three thirds of the canal .
pregnancy is a physiological phenomenon with multidimensional processes including physical , social , physiological , cultural and mental aspects ( 1 ) . the final goal of the parturition team is to provide a safe birth while maintaining the health of the mother and her neonate ( 3 ) . due to advancements in surgical procedures in the past decades , elective cesarean section has increasingly become popular and emerged as an urgent issue for maternity practitioners , hospitals , policy makers , as well as maternity clients ( 2 ) . cesarean section has an important role in reducing the risk of maternal and fetal death due to parturition . but the emerging problem of modern midwifery today is the high rates of cesarean section performed ( 4 ) . cesarean section itself not only causes and enhances obstetric complications , but also it may place more financial burden on families , governments and insurance companies ( 5 ) . accordingly , concerns have been raised about the rising rate of cesarean section around the world . therefore , this study was conducted to clarify factors which could affect women 's preference for cesarean section over vaginal delivery without medical indications in zahedan , iran during 2010 to 2011 . this qualitative study was carried out on 200 pregnant women in the third trimester of pregnancy in zahedan , iran during 2010 to 2011 . the study group included women who attended obstetric offices and imam ali women 's clinic in the city . women with premature parturition , twin pregnancy , small pelvis , diabetes mellitus and high blood pressure were excluded from the study . the participants were subsequently invited to attend group discussions ( 29 sessions ) which were held from january 2010 to august 2011 . as it was not possible to evaluate all the participants in one session , group discussions were repeated to include all . each group discussion lasted for 45 minutes and it was conducted under the supervision of a trained facilitator . the participants discussed topics such as the person(s ) who might make the decision on the type of delivery and events happening before , during and after the delivery . the following questions were proposed by the instructor : at what stage of pregnancy , do you make decision about cesarean section ? what was your perception of delivery type in the first months of pregnancy ? what problem(s ) did you face in your pervious elective cesarean section ? why do you prefer cesarean section when you have not experienced any pain from vaginal delivery ? who else is involved in your decision making ? subsequently , all the details of the group discussions were recorded by a professional note - taker and a tape recorder . later , the data were coded as follows : all ( about 90% to 100% ) , majority ( more than or about 55% ) , half ( about 45% to 55% ) , minority ( about 25% to 45% ) , very limited ( less than 25% ) . nearly half ( 49.5% ) of them had high school diploma or associate degrees and the majority ( 70.5% ) of the women were housewives . a very limited number of participants ( n = 38 ) had previous vaginal deliveries and one - fourth had had previous elective cesarean sections . the responses were coded using content analysis for four major categories as follows : the most distressing factors were psychological reasons , including : fear of pain ( all ) , improper treatment by parturition room personnel ( major ) , vaginal delivery outcomes ( major ) , as well as shame and pungency ( minor).low perceived behavioral control : lack of ability to control parturition pain ( major ) and parturition pain intolerance ( major ) and inability to withstand parturition pain ( major).improper subjective norms : encouragement from family members ( half ) , husband ( minor ) and physician ( minor ) to have elective cesarean section for parturition.wrong attitudes about vaginal delivery : confidence about the baby 's health ( major ) , unawareness about parturition process and anesthesia duration ( major ) , comfort in cesarean section in comparison to vaginal delivery ( major ) and earlier preparation knowledge of exact time of delivery ( very limited ) . the most distressing factors were psychological reasons , including : fear of pain ( all ) , improper treatment by parturition room personnel ( major ) , vaginal delivery outcomes ( major ) , as well as shame and pungency ( minor ) . low perceived behavioral control : lack of ability to control parturition pain ( major ) and parturition pain intolerance ( major ) and inability to withstand parturition pain ( major ) . improper subjective norms : encouragement from family members ( half ) , husband ( minor ) and physician ( minor ) to have elective cesarean section for parturition . wrong attitudes about vaginal delivery : confidence about the baby 's health ( major ) , unawareness about parturition process and anesthesia duration ( major ) , comfort in cesarean section in comparison to vaginal delivery ( major ) and earlier preparation knowledge of exact time of delivery ( very limited ) . a study by karlstrom et al . showed that one - third of cesarean sections were optional . fear and anxiety about child 's health and previous history of elective cesarean section were reported as the main reasons for elective cesarean sections ( 6 ) . saisto also reported that parturition fear has led to 8% to 22% increase in elective cesarean sections in a very limited number of women ( 7 ) . negahban and ansari demonstrated the popularity of elective cesarean section among primiparous women and its relation with fear intensity and parturition type ( 8) . anxiety about pregnancy and natural parturition fear were also observed among primiparous women attending training classes for delivery ( 9 ) . in another study , johanson reported that pregnant mothers preferred elective cesarean section because of its comfort in comparison with vaginal delivery ( 10 ) . the findings of the current study are in line with the results of the abovementioned studies . most developed countries have tried to reduce the rate of cesarean section with effective interventional programs ( 11 ) . for example , in european countries elective cesarean rate has decreased to lower than 15% ( 12 ) . in comparison , in iran , medical care during pregnancy this seems inadequate as the pregnant mothers ignorance about parturition lead to anxiety , related complications and subsequent increase in medical interventions . on the other hand , training physical and neural exercises , correct breathing , concentration exercises and proper birth positioning will help mothers overcome parturition to with least complications . additionally , post - partum depression will be reduced after parturition and desire for breastfeeding will increase . boysdon showed that training classes and mental support could reduce rates of elective cesarean section up to 25% ( 13 ) . sharifi - rad and et al . conducted a study on the effects of husbands education on knowledge and attitude of pregnant women in reducing elective cesarean sections . their showed that elective cesarean section without medical indications was meaningfully fewer in the intervention group than the observation group ( minority vs. half ) ( 14 ) . likewise , another study by malier revealed that training the medical staff and pregnant mothers at health care centers will reduce optional elective cesarean section up to 54% . additionally , safety parturition training reduced optional elective cesarean section up to 24% in another study ( 15 ) . guihard and blondel suggested that different policies should be developed to stop the increasing rate of elective cesarean sections including increasing women 's knowledge about the risks and complications of elective cesarean section , developing parturition room management system at the time of parturition and offering some incentives and encouragement in the national level ( 16 ) . the results of this study suggest that continuous psychological skills training classes and preparatory , sessions for parturition be held for pregnant mothers along with communication skills workshops for the operation room personnel to increase their skills , as well as awareness about the issue . moreover educational movie - clips should be shown and successful mother , with positive view should be invited to such sessions to share their experience . furthermore , sending useful educational materials through post , telephone or internet messages seems to be effective in influencing their husbands and other close relatives of pregnant mothers for reducing elective cesarean sections .
backgrounda qualitative study was carried out on 200 pregnant women attending obstetric offices and imam ali women 's clinic in zahedan , iran during january 2010 to august 2011 . twenty - nine focus group discussions ( fgds ) with 58 participants in each group were formed . the study included women in the third trimester of pregnancy with the intention or decision to undergo elective cesarean section . the women 's views were explored and analyzed in group sessions . subsequently , the responses were divided into four major categories . the majority ( 50% ) of the opinions expressed were psychological in origin , or stemmed from low perceived behavioral control , improper subjective norms , or wrong attitudes about vaginal delivery.methodstwenty-nine focus group discussions ( fgds ) with 5 - 8 participants in each group were formed . the study included women in the third trimester of pregnancy with the intention or decision to undergo elective cesarean section . the women 's views were explored and analyzed in group sessions.resultsthe responses were divided into four major categories . the majority ( 50% ) of the opinions expressed were psychological in origin , or stemmed from low perceived behavioral control , improper subjective norms , or wrong attitudes about vaginal delivery.conclusionit is necessary to hold psychological skills training classes for pregnant women and their husbands to persuade them attend group discussion sessions to increase their control on perceived behavior , highlight their positive attitudes and direct them toward natural vaginal delivery .
protein folding cooperativity is defined by the nature of the finite - size thermodynamic transition exhibited upon folding : two - state transitions show a free - energy barrier between the folded and unfolded ensembles , while downhill folding is barrierless . a microcanonical analysis , where the energy is the natural variable , has proved to be better suited than its canonical counterpart to unambiguously characterize the nature of the transition . replica - exchange molecular dynamics simulations of a high - resolution coarse - grained model allow for the accurate evaluation of the density of states in order to extract precise thermodynamic information and measure its impact on structural features . the method has been applied to three helical peptides : a short helix shows sharp features of a two - state folder , while a longer helix and a three - helix bundle exhibit downhill and two - state transitions , respectively . extending the results of lattice simulations and theoretical models , we have found that it is the interplay between secondary structure and the loss of non - native tertiary contacts that determines the nature of the transition .
pain can develop through sensory afferent nerves originating from the incision and drainage sites , the mediastinal pleura , and the ipsilateral shoulder following the thoracotomy . because there is no analgesic technique that can block various pain afferents at once , ideal analgesia techniques include the administration of intravenous ( iv ) drugs ( opioids , nonsteroidal anti - inflammatory drugs [ nsaids ] , etc . ) , local anesthetic injections to the wound site , and nerve blocks ( nbs ) . thoracic epidural block , paravertebral block , intercostal nerve block ( icnb ) , and intra / extrapleural block are among the nbs that may be utilized . the use of ultrasonography ( us ) in nb has increased the use of novel techniques for nb such as the pectoral nerves ( pecs ) block and transversus abdominis plane ( tap ) block . serratus anterior plane ( sap ) block , which may be a suitable approach for analgesia in thoracic surgery , is one of the new field blocks that provides analgesia at the level of t2-t9 . in this report , we present the case of a patient who underwent posterior thoracotomy , an sap block and catheterization in the same field . the patient received 20 ml of 0.25% bupivacaine , and the visual analog scale ( vas ) scores of the patient were recorded . we will discuss the case of a patient , who required additional analgesics at the seventh postoperative hour and was administered both local anesthetics and iv analgesics through a catheter . a 63-year - old female patient weighing 80 kg with a height of 155 cm underwent wedge resection via thoracotomy for a lung malignancy . we offered the sap block to the patient and explained the procedure in detail . she agreed to undergo the procedure , and following the patient 's provision of informed consent , we described the vas to the patient ( vas ; 0 : no pain , 10 : maximal pain ) . standard monitoring was performed , an iv vascular access was introduced , and an infusion of nacl 0.9% was started . subsequent to the termination of the operation , skin closure , and appropriate field cleansing , linear ultrasound ( usg ) scanning was performed by orienting the probe in the sagittal plane while the patient was positioned in the lateral decubitus position . the fifth rib in the mid - axillary line was detected and the probe directed in a horizontal manner . the serratus anterior , latissimus dorsi , and the intercostal muscles were identified in the fourth and fifth intercostal levels with a linear probe ( 10 - 12 hz ) . a 20 g 100 mm us - visible peripheral nerve block needle was placed under the serratus anterior and intercostal muscles . bupivacaine 20 ml in a concentration of 0.25% was administered under the serratus muscle after a test dose of 1 ml using an in - plane technique ( fig . a dilution ( 0.25% ) of local anesthetic ( la ) was titrated with special monitoring to prevent paralysis of the respiratory muscles and to avoid additional motor blocks . the patient was extubated and transferred to the intensive care unit . during the control posterioanterior ( pa ) chest x - ray performed in the first hour postoperative , 10 ml of contrast material ( iohexol ) was injected through the catheter concomitantly . contrast material was seen to spread on the costae at the lateral thorax starting at the fourth intercostal level and extending to the ninth intercostal level , lateral to the right lung ( fig . the patient was administered 20 ml bupivacaine in a concentration of 0.25% through the catheter for analgesia at the seventh hour postoperative , at which time the patient 's vas score was 4/10 . an nsaid was administered through the iv route since the vas score increased again to 4/10 during the follow - up . subsequent vas scores were around 2/10 , and the patient was transferred to the ward at the 18 hour postoperative . in thoracic surgery , postoperative analgesia is important to prevent respiratory problems and chronic pain . sensory afferent nerves involved at the sites of pain following thoracotomy are carried by intercostal nerves ( t4-t6 ) at the incision site , intercostal nerves ( t7-t8 ) at the sites of thoracic drains , the vagus nerve in the mediastinal pleura , the phrenic nerve ( c3-c5 ) at the central diaphragmatic pleura , and the brachial plexus at the ipsilateral shoulder . this provides a level of analgesia similar to the epidural block and have a lower rate of side effects . analgesia could be provided using a multi - level icnb through the administration of local analgesics through intra / extrapleural catheters . icnb and iv routes could also be used in the management of thoracotomy pain . for thoracotomy pain , a wide space should be blocked and long - term analgesia should be required . in icnb , a limited space is blocked by a single injection . therefore , the use of icnb is limited due to the necessity of multiple injections and the requirement of frequent repeats of these blocks . on the other hand , drugs that are administered solely intravenously are effective in pain control , but higher doses of opioids are needed to relieve the pain that is aggravated with coughing and respiration . the side effects of thoracic epidural injections such as neuraxial hematomas , hypotension , vomiting , and urinary retention are higher in frequency compared to the paravertebral block . nevertheless , the paravertebral block also has complications ( such as total spinal block , pneumothorax , and neural damage ) which are reported in between 2.6% and 5.7% of cases . an intrapleural block , however , has some limitations since the spreading of the drug is uncontrollable and there is a risk of toxicity . for this reason , we used an sap block for pain control with a posterolateral thoracotomy . we consider that its application is easier and sap block might be associated with a lower incidence of complications , as well . in the sap block , a local anesthetic agent is injected under or above the serratus muscle with us guidance and thus the lateral cutaneous branches of the icn are blocked and paresthesia is provided in the dermatomes of t2 and t9 . they injected a mixture of levobupivacaine 0.125% at a dose of 0.4 ml kg-1 and gadolinium ( contrast material ) under us guidance in two separate fields of the serratus anterior muscle , the superficial and deep parts . following the superficial blockage , the duration of the block was 752 min and 502 min in the icn and motor nerves , respectively . the respective values were 386 min and 502 min following the deep injection , respectively . the duration of analgesia was limited to the levels of t2 and t9 . in this present case , we provided paresthesia at the dermatomes of t2 and t10 by injection of bupivacaine . in the pa chest x - ray that was obtained following an injection of 10 ml of contrast material , a spreading type diffusion of the contrast material through the fourth and ninth intercostal areas in the lateral thorax was observed . twenty ml of bupivacaine 0.25% was injected through the catheter at the seventh postoperative hour ( approximately at the 420 minute ) since the vas score of the patient was 4/10 . an nsaid was administered intravenously since the vas scores were around 4/10 at the eighth postoperative hour . paresthesia at the levels t2-t10 and a duration of analgesia of approximately 420 min following the block were compatible with the literature results . the explanation for analgesia being at an inadequate level via the local anesthetic injection after the seventh hour postoperative was attributed to the migration of the catheter that was placed under the serratus muscle and the presence of sensory afferents originating outside the block area . in one of the two case reports presenting cases with sap blocks , they reported that weaning was successful following infusion of a levobupivacaine 0.625% through the catheter . in another case report , kunhabdulla et al . provided pain palliation in a patient with a rib fracture using an injection of 20 mg levobupivacaine ( at a concentration of 0.125% ) followed by an infusion at a concentration of 0.0625% and a dose of 7 - 12 ml / hour . since the patient in their case was obese and had a high likelihood of experiencing complications with thoracic epidural application , and since the icnb required repetitive applications , the authors found it more appropriate to use the sap block . the easier application of the sap block compared to the present methods in the management of thoracotomy pain , that require multimodal analgesia , as well as fewer potential side effects , seem to be the advantages of the sap block . we suggest that controlled studies should be carried out to investigate the effectiveness of the sap block .
thoracotomy is a surgical technique used to reach the thoracic cavity . management of pain due to thoracotomy is important in order to protect the operative respiratory reserves and decrease complications . for thoracotomy pain , blocks ( such as thoracic epidural , paravertebral , etc . ) and pleural catheterization and intravenous drugs ( such as nonsteroidal anti - inflammatory drugs [ nsaids ] , and opioids , etc . , can be used . we performed a serratus anterior plane ( sap ) block followed by catheterization for thoracotomy pain . we used 20 ml 0.25% bupivacaine for analgesia in a patient who underwent wedge resection for a lung malignancy . we provided analgesia for a period of close to seven hours for the patient , whose postoperative vas ( visual analog scale ) scores were recorded . we believe that an sap block is effective and efficient for the management of pain after thoracotomy .
using nanoparticles composed of polymers or assemblies of amphiphilic molecules as drug delivery vehicles have attracted much attention in the recent quest for drug delivery [ 13 ] . among them , many dendrimers have been synthesized with a great degree of control in the synthesis of the designed structure [ 4 , 5 ] . dendrimers exhibit great promise as nanocarriers for efficient drug delivery due to researchers ' ability to control their size ( e.g. , 1 nm to 100 nm ) through the variation of iteration cycles and to implement surface and intramolecular functionalities designed to carry or trap desired drug molecules through covalent , hydrophobic , ionic , or hydrogen - bonding interactions [ 1 , 69 ] . successful examples have been reported , such as the increase in solubility and in vivo compatibility of non - steroidal anti - inflammatory drugs ( nsaids ) using functionalized dendrimer carriers [ 1014 ] . specifically , the combination of indomethacin with poly(amidoamine ) ( pamam ) dendrimers resulted in enhanced in vivo pharmacokinetic performance over indomethacin alone . nanostructures , such as nanomicelles , made by assembly of biocompatible telodendrimers ( e.g. , a linear poly(ethylene glycol)- ( peg- ) block - dendritic oligomers of cholic acid ( ca ) ) in aqueous conditions were also developed recently [ 1621 ] . these nanomicelles are highly flexible , and as such , they exhibit the advantage for in vivo movement . since polymer molecules are the basic unit within micelles , multifunctionalities may be implemented for individual molecules , and size may be tuned ( e.g. , d = 15300 nm ) by varying the conditions of assembly . the amphiphilicity enables the incorporation of hydrophobic drugs such paclitaxel ( ptx ) enclosed inside the micelles , with a load capacity as high as 7.3 mg / ml . the in vitro anticancer activity of ptx loaded peg - ca8 micelles have been performed on human ovarian clear cell carcinoma cells ( es-2 ) and firefly luciferase - expressing ovarian adenocarcinoma cell lines ( skov3-luc - d3 ) . ptx - loaded peg - ca8 micelles exhibited equivalent cytotoxic activity in vitro compared with the clinical formulations of ptx , such as taxol and abraxane . in vivo antitumor efficacy of ptx loaded peg - ca8 micelles have been tested in nude mice bearing human skov3-lue ovarian cancer xenograft , where the results indicated that this vehicle could deliver ptx preferentially to tumor sites via enhanced permeation and retention ( epr ) effect , and thus exhibits superior in vivo anticancer effect overall in animal models , compared to taxol and abraxane [ 16 , 17 ] . to enhance the efficiency of drug delivery , knowledge of the nanocarrier structure and nanocarrier - drug interaction is critical for their design and optimization . in the case of dendrimer systems , the location and the binding of drug molecules to dendrimers are particularly important , as the outcome is directly related to loading capacity and release behavior . while macroscopic information such as solubility [ 1214 ] and spectroscopy are available , little is known at the molecular level . despite the prediction by molecular dynamics simulations [ 2325 ] that drug molecules may attach to both the exterior and interior of dendrimers , the direct evidence from experiments is still lacking due to difficulties in visualizing intramolecular structures of dendrimers . scanning tunneling microscopy ( stm ) , due to its high spatial resolution , offers a promising solution to this challenge . the highest spatial resolution is typically reported for conductive and semiconductive systems , reaching the submolecular level . using metal ion coordination [ 28 , 29 ] , we extended the high - resolution capability of stm to dendrimers in this investigation , resolving individual indomethacin molecules at the dendrimer exterior . in the case of telodendrimer micelles , dynamic light scattering ( dls ) allows the average diameter and distribution to be determined in the solution phase [ 16 , 17 ] . individual micelles may be visualized using cryotransmission electron microscopy ( cryo - tem ) upon freezing of the samples . the use of cryo - tem is complicated , as the micelles are no longer in their natural environment . a much simpler technique , afm offers high spatial resolution and versatility of imaging in various media , including micelle formation media and physiological buffers [ 3133 ] . in this study , we have tested the feasibility and demonstrated the proof - of - concept of using scanning probe microscopy to image ptx - loaded thiol modified telodendrimer micelles , hs - peg - ca8 ( 5k , represents the molecular weight of peg , and 8 indicates the number of ca subunits in the telodendrimer ) , in aqueous media where micelles form . the results are very encouraging : individual micelles are clearly visualized , from which we can extract the size and geometry of micelles in correlation with the conditions of assembly . the difference between native and drug carrying micelles is clearly visible under afm , from which the drug carrying capacity can be estimated . in addition , the knowledge of the geometry and size of individual micelles facilitates our understanding of their efficacy and further optimization . 4th generation hydroxyl - terminated poly(amidoamine ) dendrimers , g4 pamam - oh ( 98% purity , 10% by weight in methanol ) , and 1-(4-chlorobenzoyl)-5-methoxy-2-methyl-3-indoleacetic acid , commonly known as indomethacin ( 99.0% ) , were purchased from sigma - aldrich and used without further purification . 1-adamantanethiol ( ad , 95% purity ) and n - octanethiol ( c8 , 98% purity ) were purchased from sigma - aldrich and used as received . 200 proof ethanol ( 99.99% purity ) was purchased from gold shield chemical co. k2ptcl4 ( min . ultrapure water ( 8 mcm ) was obtained using a millipore milli - q filtration system . ( 98% , air gas co. ) and h2 ( 99.99% , praxair , inc . ) stm tips were made from w wire ( d = 0.010 in , 99.95% , california fine wire co. ) . the boc protecting group was removed via the treatment with 50% of trifluoroacetic acid ( tfa ) in dichloromethane ( dcm ) for 30 min , and then , the majority of solvent was removed by blowing nitrogen . was coupled on the amino groups on the terminal end of telodendrimer using hydroxybenzotriazole ( hobt , 2 equ . ) and diisopropylcarbodiimide ( dic , equ . ) as coupling reagents overnight . the telodendrimer was precipitated and washed by cold ether and was treated with 50% tfa in dcm for 30 min , then the majority of solvent was removed by blowing nitrogen . the telodendrimer solution was filtered and then dialyzed against 4 l water in a dialysis tube with molecular weight cut - off ( mwco ) of 3.5 kda ; reservoir water was refreshed completely four times in 24 h. finally , the telodendrimer was lyophilized . the molecular weight of the telodendrimer was detected by matrix - assisted laser desorption ionization time of flight mass spectrometry ( maldi - tof ms ) and nuclear magnetic resonance ( nmr ) spectrometry . au(111 ) thin films were prepared via thermal evaporation of au onto freshly cleaved mica ( 0001 ) in a high - vacuum evaporator ( denton vacuum , model 502-a ) . the substrate mica was heated via two quartz lamps to 350c under a base pressure of 2 10 torr . the evaporation rate was 0.3 nm / sec and the final thickness of au films was 150 nm . after evaporation , the au was thermally annealed in situ at 375c for 3060 min to increase the size of the au(111 ) terraces . after annealing , the au film was allowed to cool for 5 hr . under vacuum . the gold films described above were used to prepare ultraflat gold films on glass substrates following a method reported previously . briefly , the gold films were annealed in an h2 flame in order to coalesce the gold grains on the mica . then a small droplet of epoxy glue was applied to each of the dry glass substrates ( coverslips ) . the coverslips were then placed on the gold substrate with the glue attached side facing down . after removal from oven , the glass coverslip with gold thin film were peeled off from the mica substrate . the 1-adamantanethiol ( ad ) sams were prepared by immersing the gold films in a 10 mm ethanolic ad solution at room temperature for 24 hours . the ad sam on gold was rinsed first with ethanol , and then with milli q water , before the deposition of the loaded or unloaded micelles . 6 mg of ptx and 20 mg of hs - peg - ca8 were dissolved in 3 ml of chloroform in a 10 ml single neck flask to form a homogeneous solution . the solvent was removed by rotavaporation , and the sample was further dried on high vacuum pump for 30 min . then , 1 ml of phosphate buffered saline ( pbs ) was added into the flask to disperse the solid film via vortex and further sonication for 30 min to yield a homogenous micelle solution . the particle sizes of the micelles before and after ptx loading were measured with dls zetatrac ( microtrac ) to be 16 nm and 23 nm , respectively . the drug loading capacity was measured using high - performance liquid chromatography ( hplc ) calibrated with ptx solutions in dimethyl sulfoxide ( dmso ) with known concentrations . afm measurements of micelles and dendrimers were performed on a mfp3d afm ( asylum research inc . when imaging hs - peg - ca8 and ptx - loaded hs - peg - ca8 micelles in sams , tapping mode was utilized in aqueous solution . the probe is a msnl-10 silicon cantilever ( veeco , camarillo , calif , usa ) with a force constant of k = 0.1 n / m . during afm tapping , the cantilever was modulated by a driving frequency of 68 khz and an amplitude range from 0.30 to 0.71 v , with damping from 30 to 70% . when imaging pamam dendrimers , a silicon cantilever ( ac-240 , olympus ) was used . the probe has a force constant of k = 1.0 n / m as measured by thermal noise method . during tapping mode imaging , the cantilever was modulated by a driving frequency of 74 khz and amplitude of 67.0 nm ( 0.63 v ) , with the damping set to 85% . for displacing adsorbates such as dendrimers or alkanethiolates , tips were placed in contact with the surface with increasing load beyond threshold [ 28 , 29 ] . data display and analysis were conducted using mfp-3d 's software package written on igor pro platform ( wavemetrics ) . the stm has a walker - type scanner ( uhv 300 , rhk technologies , inc . ) and was used under ambient conditions for this investigation . the stm tips were cut w wires which were electrochemically etched at 2.0 v in 3.0 m naoh solutions . all stm images were acquired in constant current mode with typical bias voltages ranging from 0.3 to 0.7 v and tunneling currents from 5 to 25 pa . the piezoelectric scanners were calibrated laterally using a decanethiol sam ( lattice constant = 0.50 nm ) and vertically using a au(111 ) single atomic step ( 0.235 nm ) . a potential application of immobilized ptx - loaded micelles on surfaces is the development of a new type of ptx eluting stent . hs - peg - ca8 telodendrimer is soluble in water and self - assembles into micelles . ptx is loaded into the micelle via a procedure of solvent evaporation followed by the aqueous dispersion of micelles . in order to maintain the integrity of micelles on solid surface , the use of ad is based mainly on two considerations : ( a ) sams provide a buffer to dampen collisions and allow full contact between micelles and gold surfaces and ( b ) ad can be exchanged by alkane thiol functionalities to enable micelles to anchor onto gold surfaces . as illustrated in scheme 1 , micelles are formed instantly via the self - assembly of telodendrimers dissolved in aqueous solution . the micelles have noncharged surfaces , the zeta - potential was measured close to zero . ad sams on gold were soaked in micelle solutions , 0.5 mg / ml , for 20 min . this short exposure resulted in 15.3% surface coverage of micelles on the gold surface . in the case of ptx - loaded micelles , a concentration of 26.4 mg / ml ( weight ratio as 6.4 mg ptx : 20 mg hs - peg - ca8 ) was used and the exposure time was typically 1 hour . after deposition , the samples were rinsed with milli q water and kept in the water solution before afm measurement . upon immobilization , afm imaging is carried out in water media . to attain accurate measurements in 3d without significant deformation , tapping mode is utilized , from which height is extracted from topographic images , and lateral boundaries are well defined from phase images . the afm images in figure 1 indicate that all micelles , ptx - loaded or unloaded , maintain the geometry of elliptical cap geometry . figure 1(a ) is a 300 300 nm afm topography image of ptx - loaded micelles on ultraflat au . the height of a typical ptx - loaded micelle , as shown in cursor 1 , is 4.0 nm , measured from the lowest point in the local surroundings to the apex of the micelle . its lateral boundaries are clearly visible from the afm phase image shown in figure 1(c ) . the lateral dimensions are 28.1 nm and 33.0 nm for short axis and long axis , respectively , as shown in cursors 2 and 3 . among the 49 ptx - loaded micelles measured , the average 3d dimensions ( long axis a , short axis b , and height h ) are 31.8 4.3 nm , 25.6 3.2 nm , and 4.6 0.7 nm , respectively . as a comparison , figure 1(b ) is a 300 300 nm afm topography image of original micelles on ultraflat au . the measured height of the unloaded micelle is 1.9 nm , as shown in cursor 4 . figure 1(d ) is the phase image of unloaded micelle , from which the lateral boundaries are clearly visible . the short and long axis of the unloaded micelle is 17.3 nm and 25.2 nm , respectively , as shown in cursors 5 and 6 . among the 50 unloaded micelles measured , the a , b , and h measure 23.7 2.4 nm , 17.2 2.3 nm , and 1.8 0.2 nm , respectively . the volume , v , of each micelle can be calculated using the simple geometric formula : v = ( 1/6h)(3/4ab + h ) . from figures 1(a ) and 1(c ) , the height of ptx - loaded micelle is 4.0 nm , the lateral dimensions are a = 33.0 nm , b = 28.1 nm , thus v = 1490.1 nm . from figures 1(b ) and 1(d ) , the unloaded micelle , measures a = 25.2 nm , b = 17.3 nm , and h = 1.9 nm , which corresponds to v = 328.9 nm . the average volume of ptx - loaded micelle and unloaded micelle is 1475.8 396.2 nm and 295.1 62.6 nm , respectively . our investigations also reveal that the amounts of ptx uptake affect the volume of micelles . by assuming that the micelle has a spherical shape in water solution , we can estimate the diameter of micelles in solution based on v = 4/3(d/2 ) . here , v is volume and d is the diameter . the volume of a typical ptx - loaded micelle in figure 1(a ) is 1490.1 nm , the corresponding diameter is 14.2 nm . among the 49 ptx - loaded micelles measured , the volume of a typical unloaded micelle in figure 1(b ) is 328.9 nm , the corresponding diameter is 8.6 nm . among the 50 unloaded micelles measured , the diameter of ptx - loaded and unloaded micelle obtained from the dynamic light scatting ( dls ) measurement is 23 8 and 16 4 nm , respectively . one notes that the size of adsorbed micelles as determined from afm experiments is smaller than the corresponding diameter measured from the dls in solution . while dls gives the averaged hydrodynamic radius of the scattering particles , afm provides true 3d measurements of individual micelle . the dimensions extracted from afm measurements more truly reflect the true geometry of the micelles , in addition , it is difficult to reach high accuracy if the particle is very small and nonspherical , for example , < 10 nm , while afm does not have such a limitation . as a bonus , we can estimate the number of ptx molecules based on the volume measurements from afm . the numbers of ptx ( nptx ) and telodendrimers ( ntelo ) are estimated from two equations below , ( a ) assuming that the volume of individual components are conserved , based on connolly solvent - excluded volume using chem3d software , using telodendrimer volume of 13.13 nm , and ptx being 0.754 nm ; ( b ) the mixing follows 7.5 : 2.1 = ptx : telodendrimers . therefore , for a typical ptx loaded micelle in figure 1(a ) , the volume is 1490.1 nm ( 1)nptxntelo=7.52.1 , ( 2)nptx0.754+ntelo13.13=1490.1 . solving ( 2 ) with ( 1 ) , nptx = 336 , while ntelo = 94 . for a typical micelle indicated in figure 1(b ) , there are 25 telodendrimer units . within a typical ptx - loaded micelle as shown in figure 1(a ) , there are 336 ptx molecules and 94 telodendrimers . the increase in overall size upon ptx loading is likely due to the increase in the number of the telodendrimer molecules within individual micelles . the hydrophobicity of ptx may require larger number of amphiphilic telodendrimers to enclose them inside micelles for overall reduced enthalpy . taken collectively , afm provides an alternative and more accurate approach to measure the geometry and size of individual drug delivery vehicles . even for soft systems such as hs - peg - ca8 micelles this versatility of imaging in water media at a designed temperature allows direct comparison before and after loading or uptake of drugs . in addition , the accuracy enables quantification , such as the determination of height , lateral dimension , volume , and number of drugs enclosed . therefore , we encourage researchers to consider the application of afm in determination of the size and geometry of drug - carrying vehicles in the various synthetic and drug - loading steps . to visualize intramolecular structure of pamam dendrimers using stm , two key steps are involved , surface immobilization and introduction of metal ions to enable the transport of stm current . for indomethacin carrying dendrimers , first , g4 pamam - oh dendrimer solutions were made by diluting aliquots of the methanol - based stock solutions to 12.5 m aqueous solutions . second , as illustrated in scheme 2 , k2ptcl4 was then added to achieve a molar ratio of 1 : 120 , dendrimer : pt . the ratios were guided by the number of tertiary amines ( dendrimer branch points ) within individual dendrimers , for example ; g4 has 62 tertiary amines . once mixed , the solution was kept at room temperature for 35 days , allowing sufficient time for pt(ii)-amine coordination within dendrimers . third , indomethacin was weighed and then directly added to reach a final stoichiometry of 1 : 120 dendrimer : indomethacin molar ratio to maximize the potential for interaction between the drug and the dendrimer oh termini and available tertiary amines . final dendrimer is represented by g4 pamam - oh-(pt)n-(indo)m , as represented in scheme 2(c ) . the indomethacin - dendrimer mixture was vortexed for 30 min . and allowed to gestate for an additional 2 - 3 days . for the surface deposition of dendrimers , as shown in scheme 2(d ) , 1 cm pieces of gold films were h2-flamed and allowed 20 min cooling under clean ambient conditions . then , a ~75.0 l drop of g4 pamam - oh-(pt)n-(indo)m dendrimer solution was deposited onto the au(111 ) surface and allowed to contact for 1.25 min . after washing with water and ethanol the surface the surface was then washed again with ethanol and dried under n2 before stm and afm imaging . the formation of c8 sams confines dendrimers laterally , thus maintaining the structural integrity , and prevents lateral movement during scanning . while stm enables high - resolution imaging and accurate determination of the lateral dimension of individual dendrimers , afm allows for the height to be measured precisely [ 28 , 45 , 46 ] . the tip is located at a fraction of a nanometer above the surface ( green tracking line ) . the current between the w - probe and au surface is the feedback signal and very localized , and as such , the lateral dimension of the features ( e.g. , dendrimers ) underneath are clearly defined from topographic images . the height in the stm topograph is influenced by the local structure as well as local density of states ( ldos ) . although the stm height , referred to as apparent height ( happ ) , is a sensitive indicator of surface features , the accuracy is difficult to gauge due to the difficulties in determining the ldos contribution . therefore , afm is frequently utilized for the same sample to determine the height of dendrimers . as illustrated in scheme 3 , the true height of the pamam dendrimers is measured from the au substrate to the apex of the dendrimer . for the cleanness of the au substrate , nanoshaving is exercised to remove adsorbates from the defined area to expose the au as a reference of the origin . our previous studies have correlated the happ and true height with this combined approach [ 28 , 29 ] . , stm imaging reveals that g4 pamam - oh-(pt)n-(indo)m dendrimers are taller than the bare g4 dendrimers . figure 2(a ) is a 20 20 nm stm topograph of g4 pamam - oh-(pt)n-(indo)m dendrimers immobilized on a au(111 ) surface . the stm apparent height , or happ , is obtained by measuring the height from the lowest point in the immediate surrounding matrix to the top of the dendrimer . these cursors indicate that dendrimers loaded with indomethacin adopt an elliptical dome shape similar to the base dendrimers reported previously [ 28 , 29 , 47 , 48 ] . the happ in cursor profiles 1 and 2 is 0.43 and 0.48 nm , respectively . in contrast , the happ of a typical g4 dendrimer , as shown in figure 2(a ) , measures 0.35 nm and 0.33 nm , respectively . the uptake of indomethacin increases the happ by 0.08 nm . among the 102 dendrimers we compared , drug - loaded g4 dendrimers appear 0.09 0.02 nm taller than the dendrimers themselves . the true height is further investigated using afm as described in the previous section . the typical real height ( hreal ) for g4 and indo - g4 complexes are 2.5 0.3 nm and 3.4 0.7 nm , respectively . after measuring the lateral and vertical dimensions , assuming an elliptical cap geometry for all dendrimers , the volume of individual molecules may be calculated using v = ( 1/6hreal)(3/4ab + hreal ) , where a and b are the long and short lateral axes , respectively . in a typical case shown in figure 2 , the lateral dimensions are a = 5.6 nm , b = 4.2 nm for the indomethacin - loaded g4 and the height is 3.4 nm , thus v = 52.3 nm . from figure 2(b ) , the bare g4 dendrimers measure a = 5.7 nm , b = 5.2 nm , and hreal = 2.2 nm , which corresponds to a v = 31.2 nm . among the 102 dendrimers compared , the average lateral dimensions are a = 6.8 1.2 nm and b = 5.6 0.9 nm for indomethacin - loaded g4 and a = 6.2 0.8 nm and b = 5.1 0.7 nm for unloaded g4 . since the lateral deformation of both loaded and unloaded g4 dendrimers are similar , the height , and thus volume , increases observed with the addition of indomethacin suggest that the addition of indomethacin to the exterior of dendrimers increases the overall structural integrity upon surface immobilization . the indomethacin is distinctly recognizable in stm topographs , because they appear taller and usually broader than the oh termini of dendrimers . since figures 3(a ) and 3(b ) display with the same stm apparent height range , the contrast indicates the height and enables a directly comparison . it is clearly seen that the fine features at the surface of g4 pamam - oh-(pt)n-(indo)m dendrimers ( figure 3(a ) ) appear brighter than the unloaded dendrimers which have only oh at the termini ( figure 3(b ) ) . figure 3(a ) is a stm topographic image of a g4 pamam - oh-(pt)n-(indo)m dendrimer surface and the inset is a high - resolution image of a single dendrimer in which the intramolecular features are clearly visible . at first glance , these intramolecular features fall into two types of contrast ; that is , one appears brighter than the other . both previous and present studies of g4-dendrimer reveal the apparent height of oh termini to be below 0.11 nm [ 28 , 29 ] . therefore , we conclude that the bright and tall features identified in figure 3(a ) are new entities , that is , due to attachment by indomethacin . among 20 g4 pamam - oh-(pt)n-(indo)m dendrimers analyzed , indomethacin features have a happ range = 0.120.25 nm with an average happ = 0.16 nm . in contrast , intramolecular feature happ measured on indomethacin - loaded and unloaded metal ion - doped g4 pamam - oh dendrimers ranged 0.030.10 nm , among 40 dendrimers measured previously and in this study . using the threshold of 0.12 nm , we were able to assign intramolecular and indomethacin features in the stm images , therefore , to count how many indomethacin each dendrimer could carry . among all 19 intramolecular protrusions visible in figure 3(a ) , 13 fall under 0.12 nm ( 0.03 to 0.11 nm ) , and 6 are above 0.12 nm ( 0.13 to 0.17 nm ) , thus assignment of 13 termini and 6 indomethacin molecules . figure 3(b ) is an stm topographic image of a base dendrimer molecule , g4 pamam - oh-(pt)n , where intramolecular features , or oh termini , are clearly visible . the number of indomethacin molecules carried by g4 pamam - oh varies from 2 to 14 among the 20 typical dendrimers analyzed in this investigation . this range is consistent with a previous report where each g4 pamam - oh dendrimer molecule could hold 12.5 indomethacin . it is possible that indomethacin may reside in the dendrimer interior void space ; therefore , the observed number of indomethacin per dendrimer most likely represents the minimum uptake . our investigations also reveal that the drug carrying capacity ( load ) increases with the generation , for example , g3 , g4 , and g5 pamam - oh-(pt)n-(indo)m dendrimers carry 57 , 214 , and 219 drugs , respectively . the variations in height and geometry of dendrimer - immobilized indomethacin molecules suggest that drugs are nonspecifically bound to the dendrimer termini and exposed amidoamine moieties . this study demonstrates the significance of using stm and afm in the fundamental studies of new drug - delivery vehicles , telodendrimer micelles and pamam dendrimers . the preliminary results indicate that the exquisitely high - resolution images enable insightful and fundamental information be revealed in the context of molecular level location and load of drug molecules , as well as the stability of drug - carrier complex . the number of drug molecules per carrier can be directly extracted in the case of dendrimers and estimated in the case of telodendrimer micelles . since those studies are at the individual carrier 's level , the results can be directly linked to simulations which shall facilitate the prediction and design of new carriers .
dendrimers and telodendrimer micelles represent two new classes of vehicles for drug delivery that have attracted much attention recently . their structural characterization at the molecular and submolecular level remains a challenge due to the difficulties in reaching high resolution when imaging small particles in their native media . this investigation offers a new approach towards this challenge , using scanning tunneling microscopy ( stm ) and atomic force microscopy ( afm ) . by using new sample preparation protocols , this work demonstrates that ( a ) intramolecular features such as drug molecules and dendrimer termini can be resolved ; and ( b ) telodendrimer micelles can be immobilized on the surface without compromising structural integrity , and as such , high resolution afm imaging may be performed to attain 3d information . this high - resolution structural information should enhance our knowledge of the nanocarrier structure and nanocarrier - drug interaction and , therefore , facilitate design and optimization of the efficiency in drug delivery .
bronchogenic cysts are not uncommon in either children or adults . in children , they comprise approximately 6% of all mediastinal masses . their presentation can range from an asymptomatic incidental finding to sudden respiratory distress . video - assisted thoracoscopy was utilized to remove a bronchogenic cyst that was densely adherent to the adjacent esophagus in a child . the chest tube was removed on postoperative day 1 , and the patient was discharged on postoperative day 2 . an esophagogram obtained 2 weeks after surgery was normal , and the patient 's preoperative symptoms had not returned . bronchogenic cysts should be considered in the differential diagnoses for mediastinal masses at any age . given their benign nature . they may become symptomatic due to esophageal compression as they increase in size or from development of infection . we report the case of a 9-year - old female with a symptomatic bronchogenic cyst , undiagnosed since the age of 2 years , who underwent successful thoracoscopic excision . a 9-year - old girl was first seen at the age of 2 years for cough and fever in the emergency room . a chest x - ray was obtained at that time , which was interpreted as normal . nonetheless , the patient was diagnosed with pneumonia , given a prescription for antibiotics , and released . subsequent to this , she presented several more times each year with similar complaints and with identical posteroanterior ( pa ) chest x - ray findings , resulting in several hospital admissions . her examination revealed no abnormalities , and her laboratory work was within normal limits at the time of her presentation to the pediatric surgery service . repeat chest x - rays were obtained ( figure 1 ) as well as a computed tomography ( ct ) scan of the chest ( figure 2 ) . it revealed a well - circumscribed cyst in the right chest measuring approximately 3x4 cm directly adjacent to the esophagus in the midthoracic region . it was unilocular and homogenous and did not appear to communicate with the esophagus or any neural structures . given these findings , the diagnosis of either an esophageal duplication cyst or bronchogenic cyst was entertained . a thoracoscopic approach was utilized to evaluate and remove the mass ( figure 3 ) . the medial aspect of the cyst was intimately involved with the muscular wall of the esophagus for several centimeters . a harmonic scalpel was used to separate the cyst , which was filled with a white mucoid material , from the esophagus . a small portion of the cyst wall was left in place to avoid perforation of the esophagus . the chest tube drainage was negligible , and it was removed on postoperative day one . she was seen at follow - up 2 weeks after surgery where a normal barium esophagogram ( figure 4 ) was obtained , and her preoperative symptoms were completely resolved . bronchogenic cysts are embryological remnants that are isolated from the normal development of the foregut . on rare occasions they may be found incidentally on a radiographic study or once symptoms are produced as a result of compression or infection . if communication with the airways occurs , an air - fluid level is usually present . histologically , they are lined with ciliated columnar epithelium and can contain cartilage and bronchial glands . accepted treatment is excision because of concern about continued growth and subsequent compression of surrounding structures , the risk of infection , and the unlikely but reported possibility of malignant degeneration . bronchogenic cysts comprise approximately 6% of all mediastinal masses in children , while foregut cysts as a group account for 15% . traditionally , open thoracotomy has been the method by which these cysts have been removed . even with increasingly sophisticated radiographic and percutaneous techniques , an exact diagnosis is often uncertain , and the unequivocal diagnosis must be made surgically . thoracoscopy offers both a minimally invasive diagnostic modality and also a highly successful method of definitive therapy for patients with bronchogenic cysts . although many case reports exist regarding bronchogenic cysts and their minimally invasive treatments , reports of precious few series have been published regarding their thoracoscopic excision . in 1993 , hazelrigg published a series of seven bronchogenic cysts removed thoracoscopically with favorable results . martinod et al reported a series of 20 cases of bronchogenic cysts in adults , of which they successfully removed 13 thoracoscopically . their reasons for conversion were bleeding in 2 cases and dense adhesions to surrounding vital structures in 5 . in 5 cases , thoracoscopy was performed on 22 children , 15 of which were found to have bronchogeni ccysts . of these merry et al reported in their series of 8 foregut duplications 1 recurrence with incomplete excision 1 year after surgery . two other reports of recurrence have been reported , , but so have several reporting successful obliteration of the mucosal lining with good results . reported complications in these articles include the following : bronchial / tracheal laceration ( both repaired endoscopically ) , , recurrence , esophageal injury , pneumothorax , , vascular injury . bronchogenic cysts are not uncommon and , as this case illustrates , can be easily misdiagnosed . subtle findings , as on this patient 's chest x - ray taken at 2 years of age , are overlooked if one fails to consider cystic mediastinal masses in the differential diagnosis . we assert that thoracoscopy is a safe and effective method to deal with bronchogenic cysts and involves considerably less morbidity than thoracotomy does . as experience with thoracoscopy improves , so too will its acceptance as a superior alternative to thoracotomy in most cases of bronchogenic cysts .
background : bronchogenic cysts are not uncommon in either children or adults . in children , they comprise approximately 6% of all mediastinal masses . their presentation can range from an asymptomatic incidental finding to sudden respiratory distress.case report : video - assisted thoracoscopy was utilized to remove a bronchogenic cyst that was densely adherent to the adjacent esophagus in a child . this was accomplished with a harmonic scalpel . the chest tube was removed on postoperative day 1 , and the patient was discharged on postoperative day 2 . an esophagogram obtained 2 weeks after surgery was normal , and the patient 's preoperative symptoms had not returned.conclusions:bronchogenic cysts should be considered in the differential diagnoses for mediastinal masses at any age . given their benign nature , thoracoscopy offers an excellent alternative to open thoracotomy for their removal .
after the great east japan earthquake and tsunami on march 11 , 2011 , the destroyed tokyo electric power company ( tepco ) fukushima no.1 nuclear power plant released radioactive elements with an estimated total activity of 900 pbq ( peta - becquerel ) into the atmosphere . the world health organization estimates that the rates of all solid cancers in male and female infants who were exposed to radiation at the age of one in namie - machi in the fukushima prefecture , a highly contaminated area , would increase by 14% and 24% in 15 years , and that the rates of leukemia would increase by 83% and 57% , respectively . moreover , the world health organization estimates that the rates of thyroid cancer among those males and females would increase 7.4 and 9 times , respectively , and suggests increases in breast cancer as well . due to the vulnerability of the embryo and the fetus , concerns have been raised that even the low dose energy transfer to developing tissue by the frequency magnetic field exposure during ultrasound examinations might entail some health risk . as early as in 1958 , unscear acknowledged that an increase in the frequency of radiation induced dominant mutations associated with visible effects would manifest itself to some unknown extent as an increase in the frequency of malformations and stillbirths . in 10% of the miscarriages , a genetic defect may cause a baby to be stillborn or to die shortly after birth ( perinatal death [ pd ] ) , possibly since a vital organ has not developed properly . unscear emphasizes that increases in stillbirth and changes in the sex ratio are easily observable criteria ( http://www.unscear.org/unscear/en/publications/1958.html ) . lethal mutations in humans may , therefore , be observed in several ways : increase in frequencies of miscarriages , perinatal mortality , stillbirths , reduction in fertility , sterility , and disturbance in the ratio of the sexes at birth . a variety of such detrimental reproductive effects , including early childhood cancers , after occupational , diagnostic , therapeutic , and environmental exposures , have been investigated and reported in the scientific literature : atomic bombing of japanwindscale / sellafield nuclear processing plant fireoccupational exposurediagnostic and therapeutic exposurechernobyl nuclear power plant accidentfukushima nuclear power plant accidentbackground radiationliving near nuclear facilities atomic bombing of japan windscale / sellafield nuclear processing plant fire occupational exposure diagnostic and therapeutic exposure chernobyl nuclear power plant accident fukushima nuclear power plant accident living near nuclear facilities tsuda et al reported that there was an increase in thyroid cancer morbidity after the fukushima no.1 nuclear power plant accident , which suggests an influence of radiation exposure . however , the findings by tsuda et al have been criticized for presumably being artifacts of a screening effect . following the nuclear accident in fukushima and based on data from 2002 to 2013 , increases in the numbers of spontaneous fetal deaths , as well as an increase in the number of infant deaths were reported . however , to date there are no reports of increased pds in japan , even though they have been reported in the case of the chernobyl nuclear accident . based on more comprehensive and more recent data from 2001 to 2014 , we aim to examine whether or not there were increases in perinatal mortality in areas contaminated with radioactive substances in fukushima prefecture following the nuclear accident . the fukushima accident differs from the one at chernobyl since people in japan were additionally affected by the earthquake and the tsunami . therefore , we also examine whether there are associations between the earthquake , the tsunami , radiation , and perinatal mortality overall and in moderately and highly contaminated prefectures . the japanese statistics bureau publishes demographic statistics including the monthly numbers of live births and pds created by the ministry of health , labour , and welfare . six prefectures iwate , miyagi , fukushima , ibaraki , tochigi , and gunma were classed as severely contaminated ; they include wide areas in which the radiation dose in the air was higher than 0.25 sv / h ( micro - sieverts per hour ) , according to a map documenting estimated radiation doses as of december 2011 . chiba , tokyo , and saitama prefectures were designated as moderately contaminated areas that involve only few areas where the radiation dose in the air was higher than 0.25 sv / h . the rest of japan ( 38 prefectures ) excluding severely and moderately contaminated areas was considered not or only slightly affected . figure 1 is a map of japan with the selected prefectures grouped according to the estimated radiation exposure . table 1 lists the live births and the pd cases stratified by year and prefecture group according to the defined contamination levels . note , the smaller moderately exposed area represents approximately twice the population of the much larger highly contaminated area . map of japan with prefectures classed according to wide areas in which the radiation dose in the air was lower or higher than 0.25 sv / h ( micro - sieverts per hour ) as of december 2011 . lb , pd , and pdp in japanese prefectures by contamination level after fukushima . to examine the potential influences of the earthquake and the tsunami as well as the possible effects of radiation contamination , the 6 prefectures designated as severely contaminated were divided into group 1 : iwate ( the number of deaths and missing due to the tsunami as of march 11 , 2016 : n = 5797 ) and miyagi ( n = 10,777 ) , in which the numbers of the dead and missing were high ; and group 2 : fukushima ( n = 1810 ) , ibaraki ( n = 25 ) , tochigi ( n = 4 ) , and gunma ( n = 1 ) , in which the numbers of the dead and the missing were more than 20 times lower compared to the areas heavily hit , see table 2 . monthly perinatal mortalities for those 2 groups were calculated based on the available monthly numbers of births and pds to analyze a possible association between tsunami intensity and pd . the numbers of dead and missing due to the earthquake and the tsunami in 6 highly contaminated prefectures in relation to population size of the prefectures ( https://en.wikipedia.org/wiki/list_of_japanese_prefectures_by_population ) . temporality means that the presumable cause precedes the observed effect in time , and biologic gradient refers to the presence of an exposure response association . consequently , we investigate whether there are changes in perinatal mortality trends after fukushima and whether those changes , if any , are associated with the level of contamination . to this end , we applied linear logistic regression allowing for jumps at certain time lags ( in months ) after the tsunami to model perinatal mortality trends and to test for trend changes possibly associated with contamination . we denote the number of pds by n , the number of total birth by n , and the estimated pd proportion as p = n / n . two central parameters in this context are the odds o = n/(n n ) , and the odds ratio or = o1/o0 = n1/(n1 n1)/(n0/(n0 n0 ) ) , which is the ratio of the odds for 2 populations with o1 and o0 to be compared , for example , in exposed versus nonexposed strata . the dummy variable for the time window from t onward , for example , t = january 2012 , is defined as dt ( t ) = 0 for t < t and dt ( t ) = 1 for t t. the distributional assumption and the parsimonious logistic jump model for a trend in t and a jump in t are : in formula ( 1 ) , t denotes time ( year and month ) , nt the number of pd in t , nt the number of total births in t , and t is the probability of pd in t. if time t is significant in a certain setting it may be considered a confounder as it is associated with the outcome variable perinatal death as well as with the exposure classed before versus after fukushima . note that the assumption of a binomial distribution implies that the variances of the random variables are determined by the binomial parameter . in practice , the estimated sample variances are smaller or larger than theory predicts ( heterogeneity ) for randomness or for unknown reasons , for example , unspecified or unknown covariables . underdispersion may be due to correlated variables , over - fitting , or over - adjustment . therefore , statistical models can be generalized by introducing a heterogeneity parameter , and , to be conservative in this respect , we will allow for this extension in the case of overdispersion but never in the case of underdispersion . 35 involve only minor heterogeneity : deviance/(degree of freedom ) 0.951 , 1.124 , and 0.998 , respectively . in statistical analysis system , software produced by sas institute inc . ( sas ) , for example , correction for oversdispersion may be invoked by the option the basic model in formula ( 1 ) will be complemented by further variables , for example , confounders , including appropriate interactions to estimate or to account for the effects of interesting periods or seasonality , that is , the month - to - month variation , or the immediate or possible late effects of the tsunami . for the japanese monthly pd trend functions , a change - point ( cp ) analysis based on logistic regression and the minimum deviance criterion ( goodness of fit ) the purpose of the cp method is to estimate an optimum point in time , if any exists , when the occurrence of pds after fukushima changes its trend . sas / stat user 's guide , version 9.4 , cary nc : sas institute inc . , 2012 ) . ethical approval for this study was not necessary as only publicly available documents and data are being used . for the monthly pd trend function in the 6 severely contaminated prefectures , a cp analysis based on logistic regression and the minimum deviance criterion ( goodness of fit ) is carried out in fig . the deviance ( 2 ) of a model of type ( 1 ) with parallel trends and a possible downward or upward jump in a given month between january 2008 and december 2014 is plotted against that month in fig . this cp analysis discloses a unique and significant upward jump of the perinatal mortality in january 2012 with minimum deviance among all other months from the beginning of 2008 to the end of 2014 . for comparison the deviance analyses are most informative for approximately balanced time periods before or after the assumed event . therefore , the analysis of the period prior to 2008 is of minor interest in the context of our paper that puts emphasis on the year 2011 of the fukushima accident . the cp analysis in fig . 2 is so to speak a comprehensive sensitivity analysis as it allows for a wide range of potential jump dates and emphasizes the optimum one , which is , here , the optimum time lag of 10 months between the effect and the foregoing event , that is , the fukushima accident followed by an upward jump in perinatal mortality . change - point analysis based on the minimum deviance criterion for the perinatal mortality trend in the 6 severely contaminated prefectures fukushima , gunma , ibaraki , iwate , miyagi , and tochigi ; optimum jump in january 2012 , minimum deviance 156.89 with 165 of freedom : solid curve ; and corresponding analysis for the 3 moderately contaminated prefectures chiba , saitama , and tokyo : broken curve . figure 3 presents monthly perinatal mortality in the 6 severely contaminated prefectures : fukushima , gunma , ibaraki , iwate , miyagi , and tochigi . the annual perinatal mortality proportions are subject to a rather uniform decrease from 2001 to 2014 . perinatal mortality proportions decline with an or per year of 0.960 ; ( 0.952 , 0.968 ) . 2 ) yields the upward jump or 1.156 ; ( 1.061 , 1.259 ) . to concretize this effect , the jump in the perinatal mortality proportion from january 2012 to december 2014 may be translated into 165 ( 66 , 278 ) excess pd cases . adjusting the parsimonious basic model ( 1 ) for seasonality by including independent dummy variables for the months february to december yields practically the same estimates : trend oradjusted = 0.961 ; ( 0.953 , 0.968 ) ; jump oradjusted 1.150 ; ( 1.055 , 1.253 ) . to estimate the presumable immediate effect of the earthquake and the tsunami in the 6 contaminated prefectures in march and april 2011 we include in model ( 1 ) the independent dummies for february to december and the interaction of those dummies for march and april ( for any year ) with the dummy variable for the year 2011 it appears that the perinatal mortality in the 6 contaminated prefectures in march and april 2011 is increased by approximately 20% compared to march and april of the remaining years : or 1.202 ; ( 0.959 , 1.506 ) . this may be anticipated from fig . 3 by inspection of the somewhat elevated perinatal mortality in march 2011 . monthly perinatal mortality in 6 severely contaminated prefectures fukushima , gunma , ibaraki , iwate , miyagi , and tochigi ; jump in january 2012 , jump odds ratio 1.156 ( 1.061 , 1.259 ) . figure 4 presents monthly perinatal mortality in the 3 moderately contaminated prefectures : chiba , saitama , and tokyo . 4 , perinatal mortality proportions decline with an or per year of 0.960 ( 0.954 , 0.966 ) . the estimated jump 10 months after the fukushima accident yields an or of 1.068 ( 1.001 , 1.139 ) . the effect estimate is nearly half the value in the highly contaminated prefectures . combining the data from figs . 3 and 4 yields an overall and more accurate estimate of the presumable total excess pds in japan from january 2012 to december 2014 of 318 cases with 95%-confidence limits of ( 136 , 519 ) . interestingly , the downward trends in perinatal mortality in the contaminated prefectures continue after fukushima , however , at somewhat elevated levels . monthly perinatal mortality in 3 moderately contaminated prefectures chiba , saitama , and tokyo ; jump in january 2012 , jump odds ratio 1.068 ( 1.001 , 1.139 ) . the monthly perinatal mortality in the rest of japan , that is , japan excluding the 6 severely and 3 moderately affected prefectures dealt with above , is shown in fig . the overall trend is again similar to the ones in figs . 3 and 4 . in the unaffected japan , the perinatal mortality declines with an or per year of 0.971 ( 968 , 0.974 ) , and in contrast to the 9 contaminated prefectures , there is no discernible jump 10 months after fukushima : or 0.991 ( 0.958 , 1.024 ) . monthly perinatal mortality in japan excluding the 6 severely and 3 moderately affected prefectures ( see figs . 3 and 4 ) ; insignificant jump in january 2012 , jump odds ratio 0.991 ( 0.958 , 1.024 ) . figures 6 and 7 present the perinatal mortality trends in the 6 severely contaminated prefectures stratified by the impact of the earthquake and the tsunami according to table 2 . in the 4 less tsunami - impacted prefectures fukushima , gunma , ibaraki , and tochigi , the secular downward trend is consistent with the overall trends in the 6 severely and 3 moderately contaminated prefectures with an or of 0.961 ( 0.952 , 0.970 ) . 6 is also consistent with the one based on the 6 severely contaminated prefectures in fig . 3 . in fig . 7 , representing the perinatal mortality in the 2 severely contaminated prefectures strongly impacted by the tsunami , we can see a similar downward trend and jump from january 2012 onward compared to the situation in fig . 7 we observe an uptick of the perinatal mortality already in march and april 2011 that can be attributed to the immediate impact of the earthquake and the tsunami . the or of this peak in the seasonally adjusted trend model is 1.479 ( 1.013 , 2.161 ) and the jump or is 1.132 ( 0.960 , 1.3334 ) , which is consistent with the jumps in january 2012 in figs . 3 and 6 . it is interesting to note that the perinatal mortality decreased after this uptick in march / april 2011 and increased again 10 months after those natural and technical disasters in january 2012 . in conclusion , the tsunami does not confound the association of pd with the presumed radiation exposure . monthly perinatal mortality in the 4 less tsunami - impacted but severely radioactively exposed prefectures fukushima , gunma , ibaraki , and tochigi ; jump in january 2012 , jump odds ratio 1.175 ( 1.062 , 1.301 ) . monthly perinatal mortality in the 2 severely tsunami and fukushima impacted prefectures iwate and myagi ; jump in january 2012 , jump odds ratio 1.151 ( 0.977 , 1.355 ) ; march / april 2011 peak odds ratio 1.709 ( 1.186 , 2.463 ) ; trend model not adjusted for seasonality . we investigated monthly perinatal mortality in japan for the years 2001 to 2014 with emphasis on detrimental pregnancy outcome possibly caused by the earthquake , the tsunami , or the subsequent fukushima nuclear disaster in march 2011 . in the 2 severely contaminated prefectures iwate and miyagi that were also heavily hit by the tsunami , there was a more than 50% increase in perinatal mortality in march and april 2011 , and there was essentially no increase in the remainder of the year 2011 . by contrast , looking at the 4 other severely radioactively affected prefectures ( fukushima , ibaraki , tochigi , and gunma ) , which remained nearly untroubled after the natural disasters , we see essentially no increase in the occurrence of pds in march and april 2011 , and this applies to the rest of that year as well . in addition to the short - term effects in march and april 2011 in all those 6 severely radioactively contaminated prefectures , however , we observed distinct long - term increases in perinatal mortality of approximately 15% from january 2012 onward . furthermore , in the 3 moderately exposed prefectures chiba , saitama , and tokyo there is a long - term relative 6.8% increase in perinatal mortality after january 2012 , and there is apparently no impact on perinatal mortality in japan excluding the severely and moderately affected prefectures , neither by the earthquake and the tsunami nor by the fukushima accident . although the present study is of an ecological type based on highly aggregated data that can not prove causality in principle , it nevertheless provides some evidence of causality according to the well - known bradford - hill criteria : temporality and biologic gradient . this suggests impact primarily on ovum and sperm and less on the embryo or the fetus . moreover , the pd increases show a certain dose response association with the presumable exposure : unaffected as well as moderately and severely impacted prefectures are associated with no , medium , and maximum effects , respectively . the observed optimum overall time - lag of 10 months between the radiological event and the jump in the pd proportion may be explained by the superposition of the periods necessary for the dispersal of the radioactivity ( several weeks ) and the pregnancy length . note that the duration of pregnancies at elevated risk of adverse perinatal outcome may be considerably shorter than the usual 9 months . similar spatiotemporal associations between a nuclear accident and subsequent detrimental reproductive effects have been previously found in europe after chernobyl . a time trend analysis of german perinatal mortality ( 19801993 ) disclosed a 4.8% increase in 1987 , that may be linked to the chernobyl accident in 1986 . higher contaminated parts of germany , bavaria and the former german democratic republic , showed perinatal mortality increases of 8.5% and 8.2% , respectively . significant ecological relative risks in the range of 1.005 to 1.020 per kbq / m . cs ( kilo - becquerel per square meter [ kbq / m ] , cesium [ cs ] ) for stillbirths and congenital malformations in germany and finland as well as relatively increased stillbirth proportions across europe were also seen after chernobyl . a major limitation of this study is the highly aggregated nature of the data considered impeding causal inference in principle . the only potential confounding variables controlled for were time ( secular trend ) , seasonality ( month - to - month variation ) , and the tsunami itself . otherwise , we are not aware of any monthly statistics on a prefecture - by - prefecture basis that reflects possible confounding variables like stresses to pregnant women and any other risk factors for pd that could be linked to the pd occurrence in japan before and after fukushima . ideally , population based data on perinatal risk factors will be generated to complement future investigations . another problem is whether the displacement of the population during the tsunami and the nuclear accident might have confounded our results and conclusions . we are again not aware of any data concerning this issue . however , if young parents have been exposed and put at a higher risk for untoward pregnancy outcome prior to displacement , this could have biased our effect estimates downward , as corresponding pds would have been counted in the unexposed prefectures ( exposure misclassification ) . in view of the detrimental reproductive effects in europe after chernobyl , and acknowledging the observed tentative spatiotemporal ecological dose response association between radiation exposure and perinatal mortality 10 months after fukushima , we conjecture that the increases of pds in the radioactively contaminated prefectures in japan may possibly be due to radioactive releases by the fukushima nuclear power plant accident . it will be interesting to more precisely monitor the future temporal development of the various reproductive outcome measures in japan stratified by radiological exposure to weaken or to corroborate our findings and conclusions . as the japanese government plans to let inhabitants return to areas prospectively exposed to radiation by less than 20 msv / a ( milli - sieverts per year ) , our findings are relevant for the resettlement of people formerly evacuated from the highly contaminated zone , see http://www.pref.fukushima.lg.jp/site/portal-english/rev-plan-3.html . ottawa charter of health promotion emphasizes that political responsibility is needed and that global and environmental factors play an important role in the care for public health . to take political responsibility requires full and continuous access to information , learning opportunities in the various environmental health research disciplines , as well as adequate funding support for ecological , environmental , and medical investigations .
abstractdescriptive observational studies showed upward jumps in secular european perinatal mortality trends after chernobyl . the question arises whether the fukushima nuclear power plant accident entailed similar phenomena in japan . for 47 prefectures representing 15.2 million births from 2001 to 2014 , the japanese government provides monthly statistics on 69,171 cases of perinatal death of the fetus or the newborn after 22 weeks of pregnancy to 7 days after birth . employing change - point methodology for detecting alterations in longitudinal data , we analyzed time trends in perinatal mortality in the japanese prefectures stratified by exposure to estimate and test potential increases in perinatal death proportions after fukushima possibly associated with the earthquake , the tsunami , or the estimated radiation exposure . areas with moderate to high levels of radiation were compared with less exposed and unaffected areas , as were highly contaminated areas hit versus untroubled by the earthquake and the tsunami . ten months after the earthquake and tsunami and the subsequent nuclear accident , perinatal mortality in 6 severely contaminated prefectures jumped up from january 2012 onward : jump odds ratio 1.156 ; 95% confidence interval ( 1.061 , 1.259 ) , p - value 0.0009 . there were slight increases in areas with moderate levels of contamination and no increases in the rest of japan . in severely contaminated areas , the increases of perinatal mortality 10 months after fukushima were essentially independent of the numbers of dead and missing due to the earthquake and the tsunami . perinatal mortality in areas contaminated with radioactive substances started to increase 10 months after the nuclear accident relative to the prevailing and stable secular downward trend . these results are consistent with findings in europe after chernobyl . since observational studies as the one presented here may suggest but can not prove causality because of unknown and uncontrolled factors or confounders , intensified research in various scientific disciplines is urgently needed to better qualify and quantify the association of natural and artificial environmental radiation with detrimental genetic health effects at the population level .