article
stringlengths 0
328k
| abstract
stringlengths 261
2.35k
|
|---|---|
over the past two decades , healthcare reforms in western europe have changed primary care systems , reshaping in particular the organisational role of general practitioners ( gps ) and their clinical and managerial activities . a major thesis shared by many countries
is the promotion of cooperation among gps as well as the improvement of inter - professional collaborative team works as a means to spread knowledge , facilitate accountability and , ultimately , improve patient care with limited resources .
for some years now , also in italy primary care organisational models have been frequently reconsidered in order to enhance accessibility and improve coordination , continuity , and comprehensiveness of care , to increase the capacity for efficient , effective and appropriate care , and to provide opportunities for nursing and other healthcare providers to engage in collaborative practice with gps . nevertheless , these changes have consistently been supply - led rather than demand - led and the idea that the redefinition of primary care models should be primarily consistent with population needs and preferences is strengthening .
traditionally , gps in italy have worked in solo practices without any auxiliary staff or institutional links to other gps . over the past 10 years
, many local health authorities ( lhas ) have tried to reshape the traditional model of primary care by encouraging gps to participate in collaborative arrangements such as group practices in which gps share practice space and other resources .
the main idea behind such initiatives was the improvement of care continuity by reinforcing service coordination and information - sharing among gps in a practice .
however , apart from these expedients , and patient loyalty to their physician , there were no formal mechanisms to guarantee longitudinal and vertical continuity of care .
moreover , associated gps did not appear to perform better in terms of meeting lha pharmaceutical budgets because of the connections formed as a consequence of gp networks .
more recently , italian primary healthcare reform has moved towards a more comprehensive and team - based approach to address population - specific needs and to treat chronic diseases more proactively . in this
professionals from various disciplines ( gps , specialists , out - of - hours doctors , nurses , physiotherapists , psychologists , social workers ) provide a broad range of medical and community services covering diagnostic , curative and palliative care , disease prevention , rehabilitation , home care and patient education and self management interventions . to guarantee longitudinal continuity ,
chronic patient outcomes are measured systematically through structured health tracking instruments and recorded in the patient s medical record , in order to prevent a relapse into poor health condition after improvement .
the caregiving team also promotes the creation of networks for vertical continuity , sharing clinical information with other providers serving the same population ( e.g. hospitals or private practices ) .
as , in the most recent community models , members of collaborative teams share the same centralized building ( primary care centres ) , this setting can also benefit from diagnostic and treatment technologies for early disease detection and rehabilitation that could avoid non - urgent access to accident and emergency department ( a&ed ) and considerably reduce the number of unnecessary referrals to specialists . despite the apparent superiority of team - based community models
, these solutions have shown some important limitations , as highlighted in the present trial as well as in the national and international literature . according to lamarche et al . ,
although on the whole such models ( integrated community models in the author s taxonomy ) achieve the best empirical results in terms of effectiveness , cost reduction , care continuity , quality and equity , they encounter difficulties in preserving the individual relationship between the patient and the professional mostly responsible for their care ( relational continuity ) .
besides , the findings of an empirical study using administrative data showed a considerable variation in medical patterns among some italian primary care providers organised on a team - based model .
thus , while it is possible to recognise both strong and weak points in the various primary care models , it is still difficult to determine which solution is the best , especially in terms of patient preference . to design services that are sensitive
to population needs in a context of limited resources it is therefore important to find out which aspects of primary care models users / patients would most like to see improved , given that they can not have the best level of every characteristic .
this implies a necessary trade - off between the most important attributes of the aforementioned models from the population perspective . at present , although several studies have elicited preferences for various aspects of the primary care sector , there is scant evidence on the importance of different primary care models .
many studies have focussed mainly on family practice , investigating patient predilections [ 810 ] and patient and provider preferences for characteristics connected with a gp appointment mainly access and type of professional consulted .
the value given by the population to continuity of care and regarding the provision of nurse - led versus doctor - led primary health care was also taken into account .
concerning out - of - hours services , preferences for general [ 14 , 15 ] and paediatric out - of - hours primary care services were quantified , as well as the importance of attributes associated to emergency primary care services available during gp hours .
patient relationship in general practice [ 1822 ] . regarding publications investigating provider choices , gps preferences for different job characteristics in general practice
have been elicited [ 2326 ] and community pharmacists priorities for existing and potential new roles in primary care have been examined . recently a swedish study reported population preferences for alternative primary care settings , which , however , considered a specific primary care system , different from the italian one , and did not take into account factors related to respondents experience .
in this study , a discrete choice experiment ( dce ) was used to elicit patient preferences for different primary care models .
dces are a popular stated preference technique in health economics that elicit people s preferences on the basis of their stated preferences in hypothetical scenarios or choice sets . through the use of a dce , the relative importance of the different attributes for a sample of tuscan ( italian ) residents and for respondent subgroups
in the 20082010 regional health plan , the tuscan regional health system ( trhs ) introduced the strategic priority of developing a proactive approach to population - based medicine , experimenting with inter - professional team - based arrangements focussed specifically on chronic patients ( primary care units ) . within this context
, a dce was embedded in the 2009 patient satisfaction and experience survey on primary care services ( sepc ) which was developed by the laboratorio management and sanit of scuola superiore santanna on behalf of tuscany region .
the sepc questionnaire was administered to a sample of tuscan residents over 18 years of age and consisted of four sections .
the first presented questions taken from the sepc survey about respondents experience with primary care services , such as the frequency of gp visits in the last year , the reason for seeing the gp , whether the patient had or had not been listened to carefully by the gp , and whether the gp had given clear explanations about the treatment or not . in the second section ,
the attributes of primary care services selected for the dce experiment were presented , after a short introduction on why the dce was performed . to identify participants that appear unwilling to trade - off the attributes ,
each respondent was invited to rank the attributes in order of importance . in the third section
, participants were asked to make their choices in the context of a consultation for a non - urgent problem , and to express their preference for each choice set presented by selecting one of the unlabelled options a or b , considering that all other characteristics about the consultation were assumed to be equal . this section started with an exhaustive description of each attribute and of its level to clarify their meanings and implications .
the last section consisted of questions on current health status as well as socio - demographic questions , taken from the sepc survey .
although dces in health care have been carried out mainly using self - completed postal questionnaires [ 29 , 33 ] , a computer - aided telephone interview approach was selected as it allowed a wide geographic coverage with higher response rates than postal or internet approaches and it was considered a viable method if used with a small number of choice sets per respondent .
the sample was stratified into the 34 health districts in the region . in each health district , a sample size of approximately 196 subjects was required , assuming that a proportion of 50 % of the adult population have used primary care services in the last 12 months at a 95 % confidence level with a margin of error of 7 % .
assuming a response rate of approximately 40 % , which is in line with previous studies in that area , oversampling was performed to ensure that the minimum sample size was obtained .
the calculated sample size was then multiplied by 34 to obtain the total sample size of 6,970 . however , there is limited guidance on sample size calculations for dces , and there are no practical well - designed rules to guide the analyst .
have suggested that , for dce designs , sample sizes over 100 are able to provide a basis for modelling preference data , and hensher et al . have suggested a rule of thumb of 50 respondents per question to provide adequate variation in the variables of interest .
telephone interviews were conducted in the spring of 2009 by a team of 13 experienced interviewers . to minimise interviewer effects ,
interviewers were initially trained before taking part in the study . through a review of the existing literature and semi - structured interviews to primary care managers and managers of lhas , attributes and levels describing the different primary care scenarios in the choice experiment were identified .
the number of selected attributes regarding waiting times , kind of primary care provider and presence of diagnostic facilities , was limited to the three most important factors that emerged [ 38 , 39 ] , in order to avoid placing a significant cognitive burden on respondents .
plausible levels were assigned to each of the attributes ( table 1 ) , taking into account also the results of previous choice experiments [ 15 , 28].table 1discrete choice experiment ( dce ) attributes , levels and namesattributeslevelnamewaiting time for visit ( wait)0 minwaiting time90 min180 minprimary care provider ( gp)one s own gpown gpa primary care team ( gp + other professionals)primary care teamanother gp in the same practice
another gpdiagnostic facilities ( diag)a lot of diagnostic facilitiesmany diagnostic facilitiessome diagnostic facilitiessome diagnostic facilitiesa few diagnostic facilities
few diagnostic facilities
gp general practitioner
denotes the base category discrete choice experiment ( dce ) attributes , levels and names
gp general practitioner
denotes the base category a full factorial design with 3 ( 27 ) combinations was used . to obtain a more statistically efficient design ,
the exclusion of an opt - out option could be a violation of the underlying welfare measures of the economic experiment , since it makes it impossible to estimate the value of doing nothing , which may be chosen in practice .
nevertheless , this may raise the number of neutral responses , increasing the number of individuals that may choose the opt - out scenario to prevent making difficult choices , even though this would not provide the highest utility .
the feasibility of using an opt - out approach adding a neither option was tested in the pilot study , that revealed that neutral responses were likely to be obtained in this dce ; therefore a forced choice was chosen as appropriate . adding a status quo alternative would have been another option , but it was rejected for two reasons .
first of all , the status quo bias , i.e. the tendency to choose what respondents know best , since respondents were already experienced with primary care services .
secondly , there were possible econometric and interpretation difficulties , due to the fact that the status quo alternative differed among respondents .
a few alternatives to come out of the design may not contain feasible attribute - level combinations ( specifically own gp associated with
many diagnostic facilities ) . since the pilot testing indicated that individuals did not find any of the combinations in the experimental design implausible , constraints between levels were not applied .
a pre - pilot test was performed to a sample of 34 individuals of different ages and from different geographical locations ( health districts ) .
considering that there is little evidence in the literature about the manageable number of choice sets per respondent with telephone surveys and that , above all , the appropriate number of choice sets is context - specific , a blocked design was used to pre - pilot two different sets of questionnaires , including ten and four choice tasks , respectively .
the 27 choice sets were therefore distributed across three blocks of nine and nine blocks of three , respectively , creating an extra column with a number of levels equal to the number of blocks , which is uncorrelated with every attribute of every alternative .
the sequence of questions was randomised and the first choice set was then repeated as the last choice set , to provide a check of response consistency ( discussed further below ) and to allow for a
warm - up question at the beginning of the sequence . as it adds no statistical information , the repeated question was not included in the main data analyses . at the end of the choice experiment ,
respondents were asked if they were taking into consideration other attributes not included in the task when making choices , and to outline them in the affirmative case . on the basis of respondents direct feedback , response rates , item response rates , and rationality tests ,
the pre - piloting indicated that respondents were able to handle a maximum of four choices .
apart from the consultation length mentioned by one respondent , no other attributes different from those included in the dce were considered as relevant by the participants during their decision making process .
some changes were made to the wording of the questions and the instructions , integrating in particular the attributes description with examples in order to place the hypothetical scenarios in a more recognisable and realistic setting .
a further pilot study was undertaken with a new sample of 34 subjects of different age and geographical locations . on the whole
thus , in the final questionnaire , each respondent was assigned randomly to one of the nine blocks and was presented with four discrete choices .
to preserve data set orthogonality , the nine subgroups related to each questionnaire version included an equal number of respondents .
the groups were then tested for homogeneity with regard to geographical location , age and sex .
1.fig . 1example of a choice set example of a choice set the preliminary detection of dominant options
( where all attributes of the first alternative are preferred to all attributes of the second alternative , or vice versa ) was not feasible in this dce for two reasons .
first , the experiment includes a qualitative attribute ( primary care provider ) with levels that do not have a clear ordering and that vary systematically across the alternatives .
second , the sample size of the pilot study was inadequate to make reliable prior assumptions on parameters .
nevertheless , potential imprecision in the estimates should predictably be filtered out , since design techniques that also account for statistical efficiency , excluding most of the choice situations with clearly dominant options , were used , and also because of the large sample size of the study .
choice data were modelled using a random utility maximisation framework . each participants choice between pairs , treated as a single observation , was included in the model as the binary dependent variable ( 1 represents the option being chosen , while 0 not chosen ) .
the independent variables were the differences between the levels of each attribute in each pair of scenarios .
a random effect probit model was used for the estimation , to represent the distribution of the error term that was assumed normal , and also to account for multiple observations from a single respondent .
having also assumed a linear additive utility function , the follow baseline empirical model was specified:1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\vardelta u_{nc } = \beta_{0 } + \beta_{1 } * \vardelta { \text{wait}}_{c } + \beta_{2 } * \vardelta { \text{gp}}_{c } + \beta_{3 } * \vardelta { \text{diag}}_{c } + \pi_{n } + \lambda_{nc}$$\end{document}u indicates the difference in utility between alternatives of a choice set that is observed indirectly .
the subscripts n and c refer to the individual and the number of choice set , respectively .
wait , gp , diag represent the differences in attribute levels within each choice set . in view of the fact that a shorter waiting time and more diagnostic facilities are intuitively preferable , it was expected that the former attribute would be associated with a negative coefficient and the latter with a positive one . for the remaining qualitative attribute , no a priori assumption was made .
0 is the constant term , included to test and control model misspecifications due to unobserved dimensions or unobserved interactions between respondents socio - economic characteristics and dimensions .
1 , 2 , 3 denote the part - worths estimated from the regression analysis .
n is the individual specific error term whereas nc is the random error term . to quantify the correlation between choices ,
the serial correlation was estimated , or corr [ , ] = . effects - coding was used for the attributes primary care provider and diagnostic facilities ( 1 for the base category , 1 for the presence of another category and 0 otherwise ) .
it was also hypothesised that respondents socio - demographic condition and their past experience with the gp would influence preferences for a primary care service .
the segmented model , which included all main and interaction effects , was reduced stepwise to a more parsimonious one , by excluding insignificant interaction effects one at a time on the basis of the likelihood ratio test with a p value > 0.05 .
the estimated marginal utilities were used to quantify the relative importance of the attributes and the marginal rate of substitution ( mrs ) , calculated by dividing the estimated values of the attributes with the value of the waiting time attribute . for each effects - coded variable
the marginal utilities were obtained calculating the difference between the estimated coefficients and the base category coefficient , defined as the negative sum of the coefficients for all other categories of that variable .
furthermore , as previously done in other health care related dces [ 15 , 5760 ] , the part - worth utilities ( s ) and the constant estimated in the eq .
1 were summed to predict the overall utility for all the combinations of attribute levels in the full factorial design .
in addition to the 27 hypothetical scenarios included in the design , three additional forms of care delivery , which are the most representative of the italian primary care service alternatives previously described ( solo general practice ,
group general practice and primary care centre ) , were identified . for a visit to a
, on average , patients have to wait more than 1 h ( 70 min ) to be seen by their own gp exclusively , in a practice with few diagnostic facilities . in a
group general practiceoften a setting with some diagnostic services if patients accept to be seen by an associated gp different from their own physician , they usually have to wait less time ( 40 min ) . a consultation in a
primary care centre normally implies a short waiting time ( 10 min ) , for a visit provided by a primary care team ( the gp and other professionals ) in a practice with many diagnostic services .
the 95 % confidence intervals ( 95 % cis ) for the willingness to wait estimates and predicted utilities were calculated using non - parametric bootstrapping with 2,000 iterations .
all statistical analyses were performed using stata 10 ( statacorp , college station , tx ) .
internal validity was tested by three approaches : ( 1 ) consistency of preferences , ( 2 ) willingness to trade , and ( 3 ) consistency with theoretical predictions.to measure internal consistency , a test of stability was carried out , by which subjects are asked to consider the same discrete - choice comparison both at the beginning and at the end of the questionnaire .
we expected subjects to make the same choice both times the question was offered.the willingness of respondents to trade - off the attributes was tested through the approach used in scott et al . , identifying respondents with dominant preferences ( individuals that always choose according to the best level of a given attribute ) . in relation to the attributes waiting time and diagnostic capabilities
best could be identified , for each attribute was tested whether an individual always chose the option with the best level and ranked the attribute as the most important in a simple ranking of the attributes .
dominant preferences for primary care provider were not calculated since the best level of this qualitative attribute was not known a priori .
the influence of dominant preferences was then assessed by running a regression analysis twice , including and excluding respondents with dominant preferences.theoretical validity was investigated by examining the sign and significance of parameter estimates . to measure internal consistency ,
a test of stability was carried out , by which subjects are asked to consider the same discrete - choice comparison both at the beginning and at the end of the questionnaire .
the willingness of respondents to trade - off the attributes was tested through the approach used in scott et al . , identifying respondents with dominant preferences ( individuals that always choose according to the best level of a given attribute ) . in relation to the attributes waiting time and diagnostic capabilities , where the
best could be identified , for each attribute was tested whether an individual always chose the option with the best level and ranked the attribute as the most important in a simple ranking of the attributes .
dominant preferences for primary care provider were not calculated since the best level of this qualitative attribute was not known a priori .
the influence of dominant preferences was then assessed by running a regression analysis twice , including and excluding respondents with dominant preferences .
in the 20082010 regional health plan , the tuscan regional health system ( trhs ) introduced the strategic priority of developing a proactive approach to population - based medicine , experimenting with inter - professional team - based arrangements focussed specifically on chronic patients ( primary care units ) . within this context
, a dce was embedded in the 2009 patient satisfaction and experience survey on primary care services ( sepc ) which was developed by the laboratorio management and sanit of scuola superiore santanna on behalf of tuscany region .
the sepc questionnaire was administered to a sample of tuscan residents over 18 years of age and consisted of four sections .
the first presented questions taken from the sepc survey about respondents experience with primary care services , such as the frequency of gp visits in the last year , the reason for seeing the gp , whether the patient had or had not been listened to carefully by the gp , and whether the gp had given clear explanations about the treatment or not . in the second section ,
the attributes of primary care services selected for the dce experiment were presented , after a short introduction on why the dce was performed . to identify participants that appear unwilling to trade - off the attributes ,
each respondent was invited to rank the attributes in order of importance . in the third section
, participants were asked to make their choices in the context of a consultation for a non - urgent problem , and to express their preference for each choice set presented by selecting one of the unlabelled options a or b , considering that all other characteristics about the consultation were assumed to be equal . this section started with an exhaustive description of each attribute and of its level to clarify their meanings and implications .
the last section consisted of questions on current health status as well as socio - demographic questions , taken from the sepc survey .
although dces in health care have been carried out mainly using self - completed postal questionnaires [ 29 , 33 ] , a computer - aided telephone interview approach was selected as it allowed a wide geographic coverage with higher response rates than postal or internet approaches and it was considered a viable method if used with a small number of choice sets per respondent .
the sample was stratified into the 34 health districts in the region . in each health district , a sample size of approximately 196 subjects was required , assuming that a proportion of 50 % of the adult population have used primary care services in the last 12 months at a 95 % confidence level with a margin of error of 7 % .
assuming a response rate of approximately 40 % , which is in line with previous studies in that area , oversampling was performed to ensure that the minimum sample size was obtained .
the calculated sample size was then multiplied by 34 to obtain the total sample size of 6,970 . however , there is limited guidance on sample size calculations for dces , and there are no practical well - designed rules to guide the analyst .
have suggested that , for dce designs , sample sizes over 100 are able to provide a basis for modelling preference data , and hensher et al . have suggested a rule of thumb of 50 respondents per question to provide adequate variation in the variables of interest .
telephone interviews were conducted in the spring of 2009 by a team of 13 experienced interviewers . to minimise interviewer effects ,
through a review of the existing literature and semi - structured interviews to primary care managers and managers of lhas , attributes and levels describing the different primary care scenarios in the choice experiment were identified .
the number of selected attributes regarding waiting times , kind of primary care provider and presence of diagnostic facilities , was limited to the three most important factors that emerged [ 38 , 39 ] , in order to avoid placing a significant cognitive burden on respondents .
plausible levels were assigned to each of the attributes ( table 1 ) , taking into account also the results of previous choice experiments [ 15 , 28].table 1discrete choice experiment ( dce ) attributes , levels and namesattributeslevelnamewaiting time for visit ( wait)0 minwaiting time90 min180 minprimary care provider ( gp)one s own gpown gpa primary care team ( gp + other professionals)primary care teamanother gp in the same practice
another gpdiagnostic facilities ( diag)a lot of diagnostic facilitiesmany diagnostic facilitiessome diagnostic facilitiessome diagnostic facilitiesa few diagnostic facilities
few diagnostic facilities
gp general practitioner
denotes the base category discrete choice experiment ( dce ) attributes , levels and names
gp general practitioner
denotes the base category
a full factorial design with 3 ( 27 ) combinations was used . to obtain a more statistically efficient design ,
the exclusion of an opt - out option could be a violation of the underlying welfare measures of the economic experiment , since it makes it impossible to estimate the value of doing nothing , which may be chosen in practice .
nevertheless , this may raise the number of neutral responses , increasing the number of individuals that may choose the opt - out scenario to prevent making difficult choices , even though this would not provide the highest utility .
the feasibility of using an opt - out approach adding a neither option was tested in the pilot study , that revealed that neutral responses were likely to be obtained in this dce ; therefore a forced choice was chosen as appropriate . adding a status quo alternative would have been another option , but it was rejected for two reasons .
first of all , the status quo bias , i.e. the tendency to choose what respondents know best , since respondents were already experienced with primary care services .
secondly , there were possible econometric and interpretation difficulties , due to the fact that the status quo alternative differed among respondents .
a few alternatives to come out of the design may not contain feasible attribute - level combinations ( specifically own gp associated with many diagnostic facilities ) .
since the pilot testing indicated that individuals did not find any of the combinations in the experimental design implausible , constraints between levels were not applied .
a pre - pilot test was performed to a sample of 34 individuals of different ages and from different geographical locations ( health districts ) .
considering that there is little evidence in the literature about the manageable number of choice sets per respondent with telephone surveys and that , above all , the appropriate number of choice sets is context - specific , a blocked design was used to pre - pilot two different sets of questionnaires , including ten and four choice tasks , respectively .
the 27 choice sets were therefore distributed across three blocks of nine and nine blocks of three , respectively , creating an extra column with a number of levels equal to the number of blocks , which is uncorrelated with every attribute of every alternative .
the sequence of questions was randomised and the first choice set was then repeated as the last choice set , to provide a check of response consistency ( discussed further below ) and to allow for a
warm - up question at the beginning of the sequence . as it adds no statistical information , the repeated question was not included in the main data analyses . at the end of the choice experiment ,
respondents were asked if they were taking into consideration other attributes not included in the task when making choices , and to outline them in the affirmative case .
on the basis of respondents direct feedback , response rates , item response rates , and rationality tests , the pre - piloting indicated that respondents were able to handle a maximum of four choices .
apart from the consultation length mentioned by one respondent , no other attributes different from those included in the dce were considered as relevant by the participants during their decision making process .
some changes were made to the wording of the questions and the instructions , integrating in particular the attributes description with examples in order to place the hypothetical scenarios in a more recognisable and realistic setting .
a further pilot study was undertaken with a new sample of 34 subjects of different age and geographical locations . on the whole
thus , in the final questionnaire , each respondent was assigned randomly to one of the nine blocks and was presented with four discrete choices . to preserve data set orthogonality ,
the groups were then tested for homogeneity with regard to geographical location , age and sex .
1.fig . 1example of a choice set example of a choice set the preliminary detection of dominant options
( where all attributes of the first alternative are preferred to all attributes of the second alternative , or vice versa ) was not feasible in this dce for two reasons .
first , the experiment includes a qualitative attribute ( primary care provider ) with levels that do not have a clear ordering and that vary systematically across the alternatives .
second , the sample size of the pilot study was inadequate to make reliable prior assumptions on parameters .
nevertheless , potential imprecision in the estimates should predictably be filtered out , since design techniques that also account for statistical efficiency , excluding most of the choice situations with clearly dominant options , were used , and also because of the large sample size of the study .
choice data were modelled using a random utility maximisation framework . each participants choice between pairs , treated as a single observation , was included in the model as the binary dependent variable ( 1 represents the option being chosen , while 0 not chosen ) .
the independent variables were the differences between the levels of each attribute in each pair of scenarios .
a random effect probit model was used for the estimation , to represent the distribution of the error term that was assumed normal , and also to account for multiple observations from a single respondent .
having also assumed a linear additive utility function , the follow baseline empirical model was specified:1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\vardelta u_{nc } = \beta_{0 } + \beta_{1 } * \vardelta { \text{wait}}_{c } + \beta_{2 } * \vardelta { \text{gp}}_{c } + \beta_{3 } * \vardelta { \text{diag}}_{c } + \pi_{n } + \lambda_{nc}$$\end{document}u indicates the difference in utility between alternatives of a choice set that is observed indirectly .
the subscripts n and c refer to the individual and the number of choice set , respectively .
wait , gp , diag represent the differences in attribute levels within each choice set . in view of the fact that a shorter waiting time and more diagnostic facilities are intuitively preferable
, it was expected that the former attribute would be associated with a negative coefficient and the latter with a positive one . for the remaining qualitative attribute
0 is the constant term , included to test and control model misspecifications due to unobserved dimensions or unobserved interactions between respondents socio - economic characteristics and dimensions .
1 , 2 , 3 denote the part - worths estimated from the regression analysis .
n is the individual specific error term whereas nc is the random error term . to quantify the correlation between choices ,
the serial correlation was estimated , or corr [ , ] = . effects - coding was used for the attributes primary care provider and diagnostic facilities ( 1 for the base category , 1 for the presence of another category and 0 otherwise ) .
it was also hypothesised that respondents socio - demographic condition and their past experience with the gp would influence preferences for a primary care service .
the segmented model , which included all main and interaction effects , was reduced stepwise to a more parsimonious one , by excluding insignificant interaction effects one at a time on the basis of the likelihood ratio test with a p value > 0.05 .
the estimated marginal utilities were used to quantify the relative importance of the attributes and the marginal rate of substitution ( mrs ) , calculated by dividing the estimated values of the attributes with the value of the waiting time attribute . for each effects - coded variable
the marginal utilities were obtained calculating the difference between the estimated coefficients and the base category coefficient , defined as the negative sum of the coefficients for all other categories of that variable .
furthermore , as previously done in other health care related dces [ 15 , 5760 ] , the part - worth utilities ( s ) and the constant estimated in the eq .
1 were summed to predict the overall utility for all the combinations of attribute levels in the full factorial design .
in addition to the 27 hypothetical scenarios included in the design , three additional forms of care delivery , which are the most representative of the italian primary care service alternatives previously described ( solo general practice ,
group general practice and primary care centre ) , were identified . for a visit to a solo general practice , on average , patients have to wait more than 1 h ( 70 min ) to be seen by their own gp exclusively , in a practice with few diagnostic facilities . in a
group general practiceoften a setting with some diagnostic services if patients accept to be seen by an associated gp different from their own physician , they usually have to wait less time ( 40 min ) . a consultation in a
primary care centre normally implies a short waiting time ( 10 min ) , for a visit provided by a primary care team ( the gp and other professionals ) in a practice with many diagnostic services .
the 95 % confidence intervals ( 95 % cis ) for the willingness to wait estimates and predicted utilities were calculated using non - parametric bootstrapping with 2,000 iterations .
all statistical analyses were performed using stata 10 ( statacorp , college station , tx ) .
internal validity was tested by three approaches : ( 1 ) consistency of preferences , ( 2 ) willingness to trade , and ( 3 ) consistency with theoretical predictions.to measure internal consistency , a test of stability was carried out , by which subjects are asked to consider the same discrete - choice comparison both at the beginning and at the end of the questionnaire .
we expected subjects to make the same choice both times the question was offered.the willingness of respondents to trade - off the attributes was tested through the approach used in scott et al . , identifying respondents with dominant preferences ( individuals that always choose according to the best level of a given attribute ) . in relation to the attributes waiting time and diagnostic capabilities
best could be identified , for each attribute was tested whether an individual always chose the option with the best level and ranked the attribute as the most important in a simple ranking of the attributes .
dominant preferences for primary care provider were not calculated since the best level of this qualitative attribute was not known a priori .
the influence of dominant preferences was then assessed by running a regression analysis twice , including and excluding respondents with dominant preferences.theoretical validity was investigated by examining the sign and significance of parameter estimates . to measure internal consistency ,
a test of stability was carried out , by which subjects are asked to consider the same discrete - choice comparison both at the beginning and at the end of the questionnaire .
the willingness of respondents to trade - off the attributes was tested through the approach used in scott et al . , identifying respondents with dominant preferences ( individuals that always choose according to the best level of a given attribute ) . in relation to the attributes waiting time and diagnostic capabilities
best could be identified , for each attribute was tested whether an individual always chose the option with the best level and ranked the attribute as the most important in a simple ranking of the attributes .
dominant preferences for primary care provider were not calculated since the best level of this qualitative attribute was not known a priori .
the influence of dominant preferences was then assessed by running a regression analysis twice , including and excluding respondents with dominant preferences .
of these participants , 3,263 completed the choice tasks , with a response rate of 47 % .
the respondents were distributed equally and without any significant differences in socio - demographic characteristics and past experience with the gp across the nine versions of the questionnaire used .
details on responders characteristics are given in table 2.table 2characteristics of respondentsattributelevelnamefrequency%age group1849 yearsage 184995529.65069 yearsage 50691,38843.0>69 years
age > 6988627.4genderfemalefemale2,50276.8male
male75623.2educationnone / primary leveleduc no1,04732.6secondary leveleduc sec1,83357.1university degree or higher
educ uni32810.2employment statusnot working / retiredempl no1,49046.5working ( high - skilled jobs)empl high3089.6working ( medium / low - skilled jobs ) + students
empl low1,40643.9incomehighinc high1,31342.2mediuminc med1,27941.1low
inc low52016.7living aloneyesalone40212.5no
alone no2,80287.5health statusfair / poorhealth low42013.1excellent / very good / good
health high2,77586.9chronic diseaseyeschron1,25438.9no
chron no1,97161.1frequency of visits to gp clinic in the last yearnever / from 1 to 3 timesfreq low92131.1more than 3 times
freq high2,04368.9reason for seeing the gpgeneral health check / minor illness treatmentreas min50417.3already existing illness checkreas exist66622.8prescriptions / certificates / other
reas other1,74859.9the gp works with other gpsyesassoc83928.8no
assoc no2,07971.2time you waited in the clinic<1 hwait less2,18077.1>1 h
wait more64822.9you have had to put off seeing the gpyes ( waited too much , gp unavailable , clinic closed)putoff2859.8no
putoff no2,63390.2the gp listened to you carefullyyeslisten2,87098.6no
listen no421.4the gp gave you enough time to discussyesentime2,87098.5no
entime no431.5the gp involved you in the decisionsyesinvolv2,83997.7no
involv no682.3the gp gave you clear explanationsyesclear2,87198.7no
clear
no381.3the gp gave you advicesyesadvice1,96567.4no
advice no94932.6you trust in your gpyestrust2,87898.6no
trust no401.4
denotes the base category characteristics of respondents
denotes the base category the age of respondents ranged from 18 to 96 years old with a mean age of 58 years ; 76.8 % were female and 57.1 % had a secondary level of education .
43.9 % were working in medium and low skilled jobs or engaged in a full time education ; 41.1 % had a medium income .
13.1 % were in a fair or poor health status and 38.9 % of them declared a chronic disease .
68.9 % of respondents had visited their gp clinic more than three times in the last year and 77.1 % of them waited < 1 h for a consultation .
the gp was seen mainly in order to get a prescription or certificate ( 59.9 % ) and to check on a pre - existing illness ( 22.8 % ) . during the consultation
, the gp listened carefully to 98.6 % of participants , gave 98.5 % of them enough time to discuss their problem , involved 97.7 % of them in decisions , gave clear explanations to 98.7 % of them and advice on eating or physical activity to 67.4 % of them .
a total of 11 % of respondents failed the stability test , which was considered to be acceptable as the percentage of inconsistent responses usually varies from 1 % to 25 % .
also , 11 % of respondents always chose the scenario with the best level of a given attribute that they ranked as the most important .
the results of regression analyses indicated that the impact on the coefficient size and direction for each attribute was the same regardless of whether dominant preferences were excluded or included within the data analysis .
considering also that random utility models are robust to violations of compensatory decision making , all respondents were thus included in the final analysis .
the serial correlation obtained from running the random effect models was close to zero and not statistically significant , indicating that respondents treated the decision made in each pair - wise comparison as a separate hypothetical situation and not in association with the choice made in each of the remaining pair - wise comparisons .
hence , all models were re - fitted to the data using the standard probit model . to verify whether the linear representation of the continuous variable waiting time was admissible , a univariate smoothed scatter plot was first performed to show potential non - linearities .
in addition , the probit model was re - estimated using dummy variables replacing the continuous variable .
lastly , a likelihood ratio test was used to assess whether the inclusion of a quadratic term would have improved the explanatory power of the model .
as table 3 shows , the main effects probit model has a good fit ( mcfadden pseudo r = 0.25 ) and predicts correctly 76 % of the responses .
all the attributes had a significant impact on respondents decisions.table 3regression results from dce : main effects modelattributecoefficientsemrs ( min)95 % ci ( lower)95 % ci ( upper)constant0.546***0.016waiting time ( min)0.006***0.000own gp0.611***0.015207.1196.5219.5primary care team0.100***0.014127.1118.1135.7many diagnostic facilities0.534***0.015194.9184.9205.7some diagnostic facilities0.176***0.014138.8129.6148.4
n
19,340log likelihood10,086.97likelihood ratio test ( c
, df )
6,636.99 ( 5)***pseudo r
mcfadden
0.248
se standard error , mrs marginal rate of substitution * * * p < 0.001
compared to a only constant model regression results from dce : main effects model
se standard error , mrs marginal rate of substitution
compared to a only constant model other things being equal , participants would be willing to wait up to 207 min for a consultation with their own gp , 195 min longer to be visited in a setting with many diagnostic services and 139 min longer to have some diagnostic facilities in the practice .
therefore , patients preferred to be visited by their own gp and a practice with many diagnostic facilities to a practice with some diagnostic services
. these results are in line with expectations and provide support for the theoretical validity of the model .
compared with the main effects model , the reduced model has a better fit ( pseudo r = 0.28 ) , with the main effects of a similar sign and significant . the results of the model are given in table 4.table 4regression results from dce : segmented modelattributecoefficientseconstant0.5993***0.018waiting time0.0065***0.000own gp0.6165***0.020primary care team0.1636***0.019many diagnostic facilities0.5507***0.019some diagnostic facilities0.2563***0.028waiting time age 18490.0006***0.000waiting time health low0.0003 * 0.000waiting time wait less0.0004**0.000own gp empl no0.0740***0.016own gp chron0.3579***0.018own gp freq low0.0676***0.018own gp advice0.1159***0.017primary care team age 18490.0927***0.023primary care team age 50690.0591**0.019primary care team chron0.2379***0.017primary care team freq low0.0606**0.018primary care team advice0.0919***0.017a lot of diag .
facilities reas min0.0481**0.018some diag . facilities putoff0.0829***0.024
n
16,120log likelihood8,055.42likelihood ratio test ( c
, df )
6,236.23 ( 25)***pseudo r
mcfadden
0.279 * * * p
< 0.001 , * * 0.01 > p 0.001 , * 0.05 p 0.01
compared to a only constant model regression results from dce : segmented model * * * p < 0.001 , * * 0.01 > p 0.001 , * 0.05
p 0.01
compared to a only constant model the marginal utilities indicate that younger respondents ( under 45 years ) and people that waited in the gp practice < 1 h for the last visit would prefer short waiting times . chronic patients and those who are retired or are not working preferred to be visited by their own gp .
this provider had also a higher marginal utility for respondents who , in their last consultation , received advice from the gp on eating or physical activity .
on the other hand , the primary care team was the favourite option for younger respondents who went less frequently to the gp clinic in the last year . concerning
the impact of respondent characteristics on preferences for the diagnostic setting , a visit in a practice with many diagnostic facilities was the preferred option for female respondents and for those that reported a chronic condition .
a setting with some diagnostic services was more likely to be preferred by younger respondents and by people who are retired or are not working .
those who saw a gp in the last year for treatment of a minor illness or for a general health check and those who have had to put off seeing the gp in the last year also preferred to be visited in a practice with some diagnostic facilities . with regards to the choices between the different service configuration , table 5 presents a utility - based ranking for all the configuration hypothesized.table 5predicted utilities for alternative scenarios of care deliveryscenariowaiting timecaregiverdiagnostic facilitiesindirect utility
95 % ci ( lower)95 % ci ( upper)220 minown gpmany3.113.033.19250 minown gpsome2.752.682.83180 minprimary care teammany2.602.522.68primary care centre10 min
primary care teammany
2.54
2.46
2.61
1390 minown gpmany2.542.462.6160 minprimary
care teamsome2.242.172.32790 minown gpsome2.182.112.252690 minprimary care teammany2.031.952.102180 minown gpmany1.961.882.05200 minown gpfew1.871.821.92100 minanother gpmany1.791.741.841290 minprimary care teamsome1.671.591.7516180 minown gpsome1.601.521.699180 minprimary care teammany1.451.361.53140 minanother gpsome1.431.381.48solo gp
70 min
own gpfew1.421.371.4710 minprimary care teamfew1.361.311.40590 minown gpfew1.291.241.351990 minanother gpmany1.221.161.27group gp
40 min
another gpsome1.181.131.2321180 minprimary care teamsome1.091.011.18390 minanother gpsome0.860.800.912390 minprimary care teamfew0.780.730.8311180 minown gpfew0.720.650.784180 minanother gpmany0.640.580.7180 minanother gpfew0.550.550.5524180 minanother gpsome0.280.220.3515180 minprimary care teamfew0.210.140.271790 minanother gpfew0.030.050.0027180 minanother gpfew0.600.660.55
indirect utility = 0.546 + [ 0.006 waiting time ( min ) ] + ( 1.321 own gp ) + ( 0.811 primary care team ) + ( 1.243 many diag .
facilities ) predicted utilities for alternative scenarios of care delivery
indirect utility = 0.546 + [ 0.006 waiting time ( min ) ] + ( 1.321 own gp ) + ( 0.811 primary care team ) + ( 1.243 many diag . facilities ) + ( 0.885 some diag .
facilities ) among the existing care models , the primary care centre would be the most preferred scenario , followed by the solo general practice and the group general practice . despite
own gp being the most preferred respondents caregiver , the actual context in which such physicians have to operate ( solo general practice)with few diagnostic facilities and long waiting times for the visits would not be considered the best service alternative .
with reference to the primary care centre , most of all , its superiority over the
solo general practice derived from a grater diagnostic potential , rather than a shorter waiting time . indeed , assuming that the former service would not maintain a certain diagnostic power , even with no waiting time for the visit ( scenario 1 ) it would have a lower benefit score compared with the utility of the solo general practice . regarding the group general practice , to have a higher benefit score with such service configuration compared with the utility of the
solo general practice , respondents need to be compensated with a 40-min reduction in waiting time ( scenario 14 ) or , assuming no changes in waiting time , with more diagnostic services .
the age of respondents ranged from 18 to 96 years old with a mean age of 58 years ; 76.8 % were female and 57.1 % had a secondary level of education .
43.9 % were working in medium and low skilled jobs or engaged in a full time education ; 41.1 % had a medium income .
13.1 % were in a fair or poor health status and 38.9 % of them declared a chronic disease .
68.9 % of respondents had visited their gp clinic more than three times in the last year and 77.1 % of them waited < 1 h for a consultation .
the gp was seen mainly in order to get a prescription or certificate ( 59.9 % ) and to check on a pre - existing illness ( 22.8 % ) . during the consultation
, the gp listened carefully to 98.6 % of participants , gave 98.5 % of them enough time to discuss their problem , involved 97.7 % of them in decisions , gave clear explanations to 98.7 % of them and advice on eating or physical activity to 67.4 % of them .
a total of 11 % of respondents failed the stability test , which was considered to be acceptable as the percentage of inconsistent responses usually varies from 1 % to 25 % .
also , 11 % of respondents always chose the scenario with the best level of a given attribute that they ranked as the most important .
the results of regression analyses indicated that the impact on the coefficient size and direction for each attribute was the same regardless of whether dominant preferences were excluded or included within the data analysis . considering also that random utility models are robust to violations of compensatory decision making , all respondents
the serial correlation obtained from running the random effect models was close to zero and not statistically significant , indicating that respondents treated the decision made in each pair - wise comparison as a separate hypothetical situation and not in association with the choice made in each of the remaining pair - wise comparisons .
hence , all models were re - fitted to the data using the standard probit model . to verify whether the linear representation of the continuous variable waiting time was admissible , a univariate smoothed scatter plot was first performed to show potential non - linearities .
in addition , the probit model was re - estimated using dummy variables replacing the continuous variable .
lastly , a likelihood ratio test was used to assess whether the inclusion of a quadratic term would have improved the explanatory power of the model .
as table 3 shows , the main effects probit model has a good fit ( mcfadden pseudo r = 0.25 ) and predicts correctly 76 % of the responses .
all the attributes had a significant impact on respondents decisions.table 3regression results from dce : main effects modelattributecoefficientsemrs ( min)95 % ci ( lower)95 % ci ( upper)constant0.546***0.016waiting time ( min)0.006***0.000own gp0.611***0.015207.1196.5219.5primary care team0.100***0.014127.1118.1135.7many diagnostic facilities0.534***0.015194.9184.9205.7some diagnostic facilities0.176***0.014138.8129.6148.4
n
19,340log likelihood10,086.97likelihood ratio test ( c
, df )
6,636.99 ( 5)***pseudo r
mcfadden
0.248
se standard error , mrs marginal rate of substitution * * * p < 0.001
compared to a only constant model regression results from dce : main effects model
se standard error , mrs marginal rate of substitution
compared to a only constant model other things being equal , participants would be willing to wait up to 207 min for a consultation with their own gp , 195 min longer to be visited in a setting with many diagnostic services and 139 min longer to have some diagnostic facilities in the practice .
therefore , patients preferred to be visited by their own gp and a practice with many diagnostic facilities to a practice with some diagnostic services .
these results are in line with expectations and provide support for the theoretical validity of the model .
compared with the main effects model , the reduced model has a better fit ( pseudo r = 0.28 ) , with the main effects of a similar sign and significant . the results of the model are given in table 4.table 4regression results from dce : segmented modelattributecoefficientseconstant0.5993***0.018waiting time0.0065***0.000own gp0.6165***0.020primary care team0.1636***0.019many diagnostic facilities0.5507***0.019some diagnostic facilities0.2563***0.028waiting time age 18490.0006***0.000waiting time health low0.0003 * 0.000waiting time wait less0.0004**0.000own gp empl no0.0740***0.016own gp chron0.3579***0.018own gp freq low0.0676***0.018own gp advice0.1159***0.017primary care team age 18490.0927***0.023primary care team age 50690.0591**0.019primary care team chron0.2379***0.017primary care team freq low0.0606**0.018primary care team advice0.0919***0.017a lot of diag .
facilities putoff0.0829***0.024
n
16,120log likelihood8,055.42likelihood ratio test ( c
, df )
6,236.23 ( 25)***pseudo r
mcfadden
0.279 * * *
p < 0.001 , * * 0.01 > p 0.001 , * 0.05 p 0.01
compared to a only constant model regression results from dce : segmented model * * * p < 0.001 , * * 0.01 > p 0.001 , * 0.05 p 0.01
compared to a only constant model the marginal utilities indicate that younger respondents ( under 45 years ) and people that waited in the gp practice < 1 h for the last visit would prefer short waiting times .
chronic patients and those who are retired or are not working preferred to be visited by their own gp .
this provider had also a higher marginal utility for respondents who , in their last consultation , received advice from the gp on eating or physical activity .
on the other hand , the primary care team was the favourite option for younger respondents who went less frequently to the gp clinic in the last year . concerning the impact of respondent characteristics on preferences for the diagnostic setting , a visit in a practice with many diagnostic facilities was the preferred option for female respondents and for those that reported a chronic condition .
a setting with some diagnostic services was more likely to be preferred by younger respondents and by people who are retired or are not working .
those who saw a gp in the last year for treatment of a minor illness or for a general health check and those who have had to put off seeing the gp in the last year also preferred to be visited in a practice with some diagnostic facilities .
with regards to the choices between the different service configuration , table 5 presents a utility - based ranking for all the configuration hypothesized.table 5predicted utilities for alternative scenarios of care deliveryscenariowaiting timecaregiverdiagnostic facilitiesindirect utility
95 % ci ( lower)95 % ci ( upper)220 minown gpmany3.113.033.19250 minown gpsome2.752.682.83180 minprimary care teammany2.602.522.68primary care centre10 min
primary care teammany
2.54
2.46
2.61
1390 minown gpmany2.542.462.6160 minprimary care teamsome2.242.172.32790 minown gpsome2.182.112.252690 minprimary care teammany2.031.952.102180 minown gpmany1.961.882.05200 minown gpfew1.871.821.92100 minanother gpmany1.791.741.841290 minprimary care teamsome1.671.591.7516180 minown gpsome1.601.521.699180 minprimary care teammany1.451.361.53140 minanother
gpsome1.431.381.48solo gp
70 min
own gpfew1.421.371.4710 minprimary care teamfew1.361.311.40590 minown gpfew1.291.241.351990 minanother gpmany1.221.161.27group gp
40 min
another gpsome1.181.131.2321180 minprimary care teamsome1.091.011.18390 minanother gpsome0.860.800.912390 minprimary care teamfew0.780.730.8311180 minown gpfew0.720.650.784180 minanother gpmany0.640.580.7180 minanother gpfew0.550.550.5524180 minanother gpsome0.280.220.3515180 minprimary care teamfew0.210.140.271790 minanother gpfew0.030.050.0027180 minanother gpfew0.600.660.55
indirect utility = 0.546 + [ 0.006 waiting time ( min ) ] + ( 1.321 own gp ) + ( 0.811 primary care team ) + ( 1.243 many diag . facilities ) + ( 0.885 some diag . facilities ) predicted utilities for alternative scenarios of care delivery
indirect utility = 0.546 + [ 0.006 waiting time ( min ) ] + ( 1.321 own gp ) + ( 0.811 primary care team ) + ( 1.243 many diag .
facilities ) + ( 0.885 some diag . facilities ) among the existing care models , the primary care centre would be the most preferred scenario , followed by the solo general practice and the group general practice . despite
own gp being the most preferred respondents caregiver , the actual context in which such physicians have to operate ( solo general practice)with few diagnostic facilities and long waiting times for the visits would not be considered the best service alternative . with reference to the primary care centre , most of all , its superiority over the solo general practice derived from a grater diagnostic potential , rather than a shorter waiting time . indeed , assuming that the former service would not maintain a certain diagnostic power ,
even with no waiting time for the visit ( scenario 1 ) it would have a lower benefit score compared with the utility of the solo general practice .
group general practice , to have a higher benefit score with such service configuration compared with the utility of the
solo general practice , respondents need to be compensated with a 40-min reduction in waiting time ( scenario 14 ) or , assuming no changes in waiting time , with more diagnostic services .
the results presented in this paper provide useful insights regarding community preferences for different primary care models . to the authors knowledge , this is the first large - scale study in this context that takes into account the impact of the diagnostic facilities .
the willingness to wait values have shown that a consultation with one s own gp is more important than being seen by a primary care team and than a practice with many diagnostic services .
this highlights an important finding given the tendency to limit relational continuity in current health policies . the respondents predilection for their own gp was also highlighted in similar studies [ 8 , 10 , 22 ] .
preferences differed also by respondents characteristics and past experiences , and some of the interaction effects that emerged were similar to those described by previous authors . consistently with the interactions found we can suppose that people who preferred to be visited by their own gp and who did not choose to be visited by a primary care team might be those with high and continuous healthcare needs , probably living in a certain degree of isolation , which makes it difficult to seek new or alternative care providers .
such group could see their own gp as a stable reference point . on the other hand ,
respondents who preferred a consultation with a primary care team regardless of their own gp are young people , with low healthcare needs , that probably have not yet developed a type of dependency on their own gp , and could therefore be more sensitive to service innovations . regarding subgroup preferences for diagnostic technologies , we can presume that people who preferred to have many diagnostic facilities in the practice are probably those with a greater willingness to pay and with high healthcare needs .
on the other hand , individuals who had a preference for some diagnostic technologies and who did not choose a practice with many diagnostic facilities seem to be those with a lower willingness to pay , with minor healthcare needs and without a propensity to wait too long for a diagnostic test .
the results obtained from the predicted utilities of different service configurations would need to be combined with the costs of different combinations of attributes to establish the most cost - effective model of care .
nevertheless , these results have important implications for the demand for new primary care models . considering that the primary care centre would perform better than the solo gp even with some diagnostic services ( for example scenario 6 ) , for a more rapid diffusion of this model
, policymakers and managers , at least in the first phase , may direct care provided by primary care centres towards a younger population with low healthcare needs .
this group , indeed , has demonstrated a strong preference for this specific service configuration .
this strategy , of course , would only partially consolidate team - based community models , because such organisations were particularly designed to tackle the needs of the chronic sick and of elderly people .
however , it could be considered a valid alternative to the inappropriate use of a&ed services ( non urgent access ) .
future policies to improve primary care organisations should be based on a broader framework that takes into account the different needs of population sub - groups , balancing responsiveness with care continuity , equity , and appropriateness . in this context , the present study , following on from previous research , provides evidence on how the tuscan healthcare system is moving toward a pro - active approach in order to provide differentiated services specific to different healthcare needs .
first of all , the relatively small number of attributes used in the study and the exclusion of factors that appeared as relevant in other studies , such as consultation length [ 11 , 24 ] , in order to avoid placing a considerable cognitive burden on respondents , may have led to the omission of other characteristics that may have been captured within the constant term .
there is little discussion on this in the literature , and where a significant constant is identified , the problem tends to be ignored .
while attempts were made to select the attributes in an unbiased way , it is not possible to establish whether other qualitative approaches would generate the same attributes and levels . for a better evaluation of the significance of the attributes found , comparative qualitative approaches identifying attributes and levels for
secondly , even though the response rate achieved was in line with other dces in similar settings [ 14 , 16 , 18 , 19 ] , a comparison with tuscan population data revealed that older respondents and women were overrepresented .
this result may be expected in an in - home interview survey of this type .
a more ample evaluation of sample selection bias was not feasible because age and sex were the only available data on the tuscan population .
the potential for such biases needs to be addressed in future studies , by allocation of more resources at the recruitment phase .
thirdly , potential perceptions of implausible attribute - level combinations could have reduced response efficiency , deteriorating the precision and accuracy of parameter estimates .
although the pilot revealed that individuals did not find the alternatives in the choice tasks unrealistic , identification of this potential bias was not practical given the lack of data on the actual primary care services received by respondents .
future dces should attempt to follow up model estimation with focus groups to address the validity of the results achieved by asking respondents if their preferences are consistent with the findings of the estimated model .
furthermore , collecting information on the respondent s current primary care service would also prevent the adoption of a forced choice design , for instance , using such information for the construction of a status quo alternative in the choice set .
fourthly , the rich set of respondents characteristics , incorporated into the model through the interaction with the attributes , allowed us to show several aspects of preference heterogeneity .
however , some differences in tastes will probably remain random to the extent that it can not be related to observed characteristics .
future analyses should explore the added value of discrete choice models that relax the assumption of taste homogeneity ( e.g. mixed logit and latent class model ) by allowing for random taste variation . | objectivesthe shift toward more innovative and sustainable primary care models in italy leads policy makers and clinicians to face difficult decisions between options that are all regarded as potentially beneficial . in this study ,
patient preferences for different primary care models in the tuscany region of italy were elicited . the relative importance of different attributes to the surveyed respondents
was then examined , as well as the rate at which individuals trade between attributes and the relative value of different service configurations.methodsa discrete choice experiment survey explored the following attributes in a stratified random sample of 6,970 adults : primary care provider , diagnostic facilities and waiting time for the visit.resultsrespondents ( 3,263 ) were likely to prefer a consultation by their own general practitioner ( gp ) and a practice with many diagnostic facilities .
the predicted utilities of different service configurations have shown that a primary care centre with many diagnostic facilities
was preferable to a solo gp model or a group general practice.conclusionsthe study demonstrated how a patient choice model could be used by decision makers for developing successful policies that takes into account different healthcare needs , balancing responsiveness with care continuity , equity and appropriateness . considering that a primary care centre would perform better than a
solo gp , especially for younger respondents and for those with minor healthcare needs , for a more rapid diffusion of this model policymakers and managers could direct the care of primary care centres towards these targeted subgroups , at least in the first phase . |
the current classification of periodontal diseases includes accidental , iatrogenic , and factitious traumatic lesions.1 although the prevalence of traumatic gingival lesions is relatively high , there are limited reports on the diagnosis and management of these injuries
. traumatic lesions , whether chemical , physical , or thermal in nature , are among the most common in the mouth .
sometimes the lesions are termed gingivitis artefacta.24 self - injurious behavior affecting the gingival tissues has minor and major variants.2 gingivitis artefacta minor was recognized as being more common and thought to be provoked by a preexisting locus of irritation .
this form results from rubbing or picking the gingiva using the fingernail , or perhaps from abrasive foods such as crisps.2,3,5 in this form , the habit was claimed to respond readily to simple treatment that removed the underlying source of irritation .
the major form is more severe and widespread and can involve the deeper periodontal tissues.2,6 other areas of the mouth such as the lips and tongue may be involved and extraoral injuries may be found on the scalp , limbs , or face.2 this type of behavior also differed in being more resistant to conventional forms of treatment and was probably associated with an emotional disorder.2,4 self - inflicted oral injuries seem to be much more common in children than in teenagers and adults .
most of the reported cases have involved female patients.7 although the gingiva is the most commonly targeted tissue , no structure in the oral cavity is immune from the effects of this type of behavior .
self - inflicted gingival injuries in children and young individuals can occur as a result of accidental trauma , premeditated infliction , or chronic habits such as fingernail biting , digit sucking , or sucking on objects such as pens , pencils , toothpicks , dental floss , or pacifiers.224 most case reports suggest that the method of producing injury is by picking or
scratching the gingival tissues with fingers or fingernails . the purpose of this case report was to illustrate the destructive nature of the habit and to describe the successful treatment of this case .
a 14-year - old girl was referred by her dentist to the periodontology clinic of the faculty of dentistry , ataturk university , for evaluation and treatment of the gingival recession associated with the mandibular right incisor . upon questioning the patient
, she admitted to have been scratching her gingiva with her fingernail for a long period of time .
the patient further stated that this scratching habit occurred mainly time of exam .
the patient s medical history was non - contributory and she did not take any medications . clinical evaluation revealed gingival recession on the buccal surface extending 3 mm apical to the cemento - enamel junction ( cej ) and a narrow zone of attached gingival measuring approximately 1 mm ( figure 1 ) .
there was loss of papilla height on the mesial aspect of the incisor and moderate gingival overgrowth on the distal aspect .
written informed consent was obtained from the patient s parent after all treatment procedures had been fully explained .
rendering treatment in this case would help the dental problem but total treatment would require discovery and elimination of the intrinsic emotional factors and extrinsic contributing factors .
thus the patient was referred to a psychiatrist for evaluation and treatment . the damage caused by scratching
was pointed out to the patient and she was convinced that she should discontinue this habit . before surgical treatment of the gingival recession , the patient underwent scaling , root planning , crown polishing , oral hygiene instruction , and psychological support .
the goal of surgical periodontal treatment was to restore harmonious appearance of the gingiva by covering the root surface to an equal level of the neighboring teeth and , at the same time ; to increase the zone of attached gingiva .
it was decided to treat this problem with a free gingival graft ( fgg ) .
the area was gently irrigated with sterilized physiological saline solution . before surgery , extraoral antisepsis was performed with 10% povidone - iodine solution .
the defect was treated by approach described by miller.25 a local anesthetic was administered to donor and recipient sites to achieve anesthesia .
following local anesthesia , for preparing a recipient bed for the fgg , a horizontal incision was made at the level of the cej in correspondence to the base of adjacent papilla to the line angles of the neighboring teeth from which vertical incisions were realized to the apical extent of the recipient bed , 3 mm apical to the recession , such delimited tissue was then removed by a partial thickness incision .
the graft of adequate size and of about 1.5 mm thickness was then harvested from the palate in correspondence to the bicuspid area by a partial thickness incision with a no.15 blade ; within 1 min of removal , the graft was then sutured to the recipient bed by two lateral 4 - 0 silk sutures and was then stabilized by a tooth - suspended 4 - 0 silk crossed suture ( figure 2 ) ; an attempt was made to place the coronal margin of the graft in correspondence to the cej . the grafted tissue was then compressed for about 5 min onto the recipient bed .
the patient was prescribed analgesics and instructed to rinse twice daily with 0.12% chlorhexidine rinse for 2 weeks postoperatively and to avoid trauma or pressure at the surgical site .
the dressing and sutures were removed 10 days after surgery , home care instructions were given .
healing was uneventful . at 4 weeks , her plaque control was not good and the gingiva at the surgical site was edematous and reddish ( figure 3 ) .
normal appearance was established at 4 months postoperatively and the amount of attached gingiva was approximately 3 mm .
postoperatively , probing depth at the midbuccal site was less than 1 mm , and the free gingival margin was located less than 0.5 mm apically to the cej ( figure 5 ) .
the patient was followed for approximately 1 year postoperatively and complete tissue healing was achieved .
the patient reported at her postoperative appointment that she had stopped her fingernail scratching habit .
rendering treatment in this case would help the dental problem but total treatment would require discovery and elimination of the intrinsic emotional factors and extrinsic contributing factors .
thus the patient was referred to a psychiatrist for evaluation and treatment . the damage caused by scratching was pointed out to the patient and she was convinced that she should discontinue this habit . before surgical treatment of the gingival recession , the patient underwent scaling , root planning , crown polishing , oral hygiene instruction , and psychological support .
the goal of surgical periodontal treatment was to restore harmonious appearance of the gingiva by covering the root surface to an equal level of the neighboring teeth and , at the same time ; to increase the zone of attached gingiva .
it was decided to treat this problem with a free gingival graft ( fgg ) .
the area was gently irrigated with sterilized physiological saline solution . before surgery , extraoral antisepsis was performed with 10% povidone - iodine solution .
the defect was treated by approach described by miller.25 a local anesthetic was administered to donor and recipient sites to achieve anesthesia .
following local anesthesia , for preparing a recipient bed for the fgg , a horizontal incision was made at the level of the cej in correspondence to the base of adjacent papilla to the line angles of the neighboring teeth from which vertical incisions were realized to the apical extent of the recipient bed , 3 mm apical to the recession , such delimited tissue was then removed by a partial thickness incision .
the graft of adequate size and of about 1.5 mm thickness was then harvested from the palate in correspondence to the bicuspid area by a partial thickness incision with a no.15 blade ; within 1 min of removal , the graft was then sutured to the recipient bed by two lateral 4 - 0 silk sutures and was then stabilized by a tooth - suspended 4 - 0 silk crossed suture ( figure 2 ) ; an attempt was made to place the coronal margin of the graft in correspondence to the cej .
the patient was prescribed analgesics and instructed to rinse twice daily with 0.12% chlorhexidine rinse for 2 weeks postoperatively and to avoid trauma or pressure at the surgical site .
the dressing and sutures were removed 10 days after surgery , home care instructions were given .
healing was uneventful . at 4 weeks , her plaque control was not good and the gingiva at the surgical site was edematous and reddish ( figure 3 ) .
normal appearance was established at 4 months postoperatively and the amount of attached gingiva was approximately 3 mm .
postoperatively , probing depth at the midbuccal site was less than 1 mm , and the free gingival margin was located less than 0.5 mm apically to the cej ( figure 5 ) .
the patient was followed for approximately 1 year postoperatively and complete tissue healing was achieved .
the patient reported at her postoperative appointment that she had stopped her fingernail scratching habit .
self - inflicted oral injuries can be premeditated or accidental or can result from an uncommon habit .
these injuries usually results from a foreign object or a patient s fingernail that habitually causes an erosion of the gingival tissue in a specific area.19 there are varying degrees of self - injurious behavior from simple fingernail biting to extremes in self - mutilation.8,12,15,18,24 in the present case , the mechanical trauma caused by the almost constant self - injurious behavior is considered to have been the primary etiologic factor .
this case serves as another opportunity to emphasize the necessity of a comprehensive history which obtains the more subtle information relative to etiology .
habitual fingernail scratching is a common behavior among children.19 this is probably true but such injuries are not limited to children , diagnosed adolescents and adults.4,7,26 in this case , a teenage patient has a habitual fingernail scratching .
dentists need to be cognizant of the potential ramifications of fingernail scratching including not only physical injury but also gingival recession , potential bacterial contamination ( infection ) , inflammation , attachment loss , bone loss , and even tooth loss .
the case described here demonstrates that scratching is a potential cause of localized gingival recession , attachment loss , edema and ulceration .
the etiology of self - inflicted oral injuries in adolescent and adult includes some emotional disturbance.20,22 in the case presented here , the anxiety and stress of exam are believed to have been the main reason behind the patient s behavior .
management of patients with self - inflicted injuries is usually complicated by their lack of compliance and communication . in cases of self - inflicted injury
sedation , behavior modification and restraints are usually utilized to control the destructive behavior.7,2224 our patient was referred to a psychiatrist for evaluation and she was convinced that she should discontinue this habit . in the case presented here , treatment of the gingival recession was done surgical periodontal treatment .
fggs have been utilized to increase amounts of keratinized tissue and obtain root coverage , considered necessary to improve the marginal adaptation of soft tissue to the root surfaces and to inhibit further apically - directed loss of soft tissues and bone.27 therefore , it was decided to treat this problem with a fgg .
the successful root coverage was obtained % s ranging from 90 to 100% in class 1 and 2 gingival recession,2628 as was demonstrated in this case .
this case report shows that it is possible to treat gingival injury and maintain the periodontal health of a patient with destructive habit .
patient compliance , regular dental follow - ups , and psychologic support may be useful in stabilizing the periodontal condition of these patients .
dentists must be aware that self - inflicted gingival injury , although thought to be uncommon , is quite widespread . | injuries to oral soft - tissues can occur due to accidental , iatrogenic , and factitious traumas .
traumatic lesions , whether chemical , physical , or thermal in nature , are among the most common in the mouth .
a type of physical injury to the gingival tissues is self - inflicted .
sometimes the lesions are termed gingivitis artefacta .
self - inflicted gingival injuries in children and adolescents can occur as a result of accidental trauma , premeditated infliction , or chronic habits such as fingernail biting , digit sucking , or sucking on objects such as pens , pencils or pacifiers .
the purpose of this case report was to illustrate the destructive nature of the habit and to describe the successful treatment of this case .
a 14-year - old girl with moderate pain , gingival bleeding and recession in the anterior mandibulary region was admitted to periodontology clinic . upon questioning ,
the patient readily admitted traumatizing her gingiva with her fingernail .
treatment consisted of oral hygiene instruction , mechanical debridement , psychological support and surgical periodontal treatment .
postoperatively , complete root coverage , gains in clinical attachment levels , and highly significant increases in the width of keratinized gingiva were observed .
this case report shows that it is possible to treat gingival injury and maintain the periodontal health of a patient with destructive habit .
patient compliance , regular dental follow - ups , and psychological support may be useful in stabilizing the periodontal condition of these patients .
dentists must be aware that self - inflicted gingival injury , although thought to be uncommon , is quite widespread . |
one main limitation to the development of a vaccine against plasmodium falciparum is the antigenic diversity related to p. falciparum polymorphism .
merozoite surface protein ( msp)-1 and msp-2 are two proteins causing immune response in humans [ 1 - 4 ] and are prime vaccine candidates . perhaps as part of an immune evasion mechanism , msp-119 and msp-2 dna sequences include variable blocks generating antigenically diverse forms .
the polymorphism at these two loci is mainly assessed by the number of repeats [ 6 - 8 ] , which can be used to distinguish by size the different alleles after pcr amplification .
the phenomenon of clone fluctuation , which consists of kinetic changes in the relative load of each parasite sub - population present in blood , is important to consider when studying p. falciparum diversity .
strain - specific immunity is largely responsible for protective immunity to malaria parasites . in malaria endemic areas , infections due to multiple parasite clones are frequent [ 11,13 - 16 ] , and clone fluctuation may be a logical strategy to slow down the appearance of strain - specific responses .
however , mechanisms other than immune evasion may be involved in peripheral blood genotypes ' fluctuations , including sequestration in the deep vasculature , strain competition , and clearance effect related to either strain - specific immune response or treatment .
allelic diversity and clone fluctuation have rarely been assessed in the same study , although their concomitant existence highly complicates the analysis of p. falciparum polymorphism .
we studied both mechanisms in p. falciparum - infected children from gabon and discuss the implications of our findings .
bakoumba , a village from southeast gabon in the haut - ogoou province , belongs to a meso- to hyper - endemic area for p. falciparum malaria .
the average eir for february and march 2000 , the time of the study , was 0.83 infective bite per man per night , due to anopheles gambiae , anopheles funestus , and anopheles moucheti ( elissa et al . , personal communication ) .
samples were collected during a treatment efficacy study of sulfadoxine - pyrimethamine combination and amodiaquine carried out between january and june 2000 .
patients were followed weekly during four weeks after treatment ( day 0 ) , as well as any other day if the child was unwell . at enrolment , and during the follow - up , finger - prick blood was sampled for thick smears and collection on filter paper .
patients involved in the present study were the 52 children in which treatment failed , and for which multiple parasitised blood samples were available .
ethical clearance was given by the ethics committee of the international centre for medical research of franceville , and informed consent was obtained from parents or guardians .
blood collected on filter - paper was dried and conserved at room temperature until extraction .
dna was prepared by chelex extraction , as described , and stored at -20 c. the oligonucleotides primers were designed from published sequences , as listed in the nucleotide blast database , to amplify block 2 of msp-1 , and block 3 of msp-2 .
the two genes were amplified by nested pcr , each amplification with conserved , or family - specific primer pair , being done separately , as described .
pcr products were electrophoresed on 1.5% agarose gels , and dna visualized by ultraviolet transillumination after ethidium bromide staining .
purified genomic dna from w2 , hb3 and 3d7 laboratory strains were amplified and electrophoresed similarly .
the multiplicity of infection ( moi ) , or number of genotypes per infection , was calculated as the highest number of genotypes at any of the two msp loci .
relations between the moi and age or parasite density were studied using the spearman correlation test .
the prevalence of each family was calculated as the percentage of d0 samples containing allele(s ) of this family .
the distribution of the specific families was estimated at each of the two loci as the percentage of fragments assigned to one family within the overall number of fragments .
the occurrence of specific associations of paired alleles was analysed by the fisher 's exact test .
bakoumba , a village from southeast gabon in the haut - ogoou province , belongs to a meso- to hyper - endemic area for p. falciparum malaria .
the average eir for february and march 2000 , the time of the study , was 0.83 infective bite per man per night , due to anopheles gambiae , anopheles funestus , and anopheles moucheti ( elissa et al . , personal communication ) .
samples were collected during a treatment efficacy study of sulfadoxine - pyrimethamine combination and amodiaquine carried out between january and june 2000 .
patients were followed weekly during four weeks after treatment ( day 0 ) , as well as any other day if the child was unwell . at enrolment , and during the follow - up , finger - prick blood was sampled for thick smears and collection on filter paper .
patients involved in the present study were the 52 children in which treatment failed , and for which multiple parasitised blood samples were available .
ethical clearance was given by the ethics committee of the international centre for medical research of franceville , and informed consent was obtained from parents or guardians .
blood collected on filter - paper was dried and conserved at room temperature until extraction .
dna was prepared by chelex extraction , as described , and stored at -20 c. the oligonucleotides primers were designed from published sequences , as listed in the nucleotide blast database , to amplify block 2 of msp-1 , and block 3 of msp-2 .
the two genes were amplified by nested pcr , each amplification with conserved , or family - specific primer pair , being done separately , as described .
pcr products were electrophoresed on 1.5% agarose gels , and dna visualized by ultraviolet transillumination after ethidium bromide staining .
purified genomic dna from w2 , hb3 and 3d7 laboratory strains were amplified and electrophoresed similarly .
the multiplicity of infection ( moi ) , or number of genotypes per infection , was calculated as the highest number of genotypes at any of the two msp loci .
relations between the moi and age or parasite density were studied using the spearman correlation test .
the prevalence of each family was calculated as the percentage of d0 samples containing allele(s ) of this family .
the distribution of the specific families was estimated at each of the two loci as the percentage of fragments assigned to one family within the overall number of fragments .
the occurrence of specific associations of paired alleles was analysed by the fisher 's exact test .
additional samples were collected from the same subjects , at first reappearance of parasites in blood , 7 to 21 days following treatment . in 10 subjects ,
all genotyped samples were positive for msp-1 and msp-2 pcr . among the 52 d0 samples , at the msp-1 locus , 14 alleles of the k1 family ranged from 135 to 330 bp ; 8 mad20 alleles ranged from 190 to 280 bp ; and 3 of the ro33 family were of 160 , 230 , and 250 bp ( table 2 ) . for the msp-2 locus , 11 fc27 alleles ranged from 300 to 600 bp ; and 8 3d7 alleles ranged from 360 to 590 bp .
forty - seven ( 90.4% ) d0 samples harboured k1 parasites , 33 ( 63.5% ) mad20 parasites , and 19 ( 36.5% ) ro33 parasites . for msp-2 , 34 ( 65.4% )
isolates contained fc27 parasites , and 43 ( 82.7% ) 3d7 parasites . at each locus ,
family distribution was 52.5% , 32.5% , and 15.0% for k1 , mad20 , and ro33 of msp-1 ; and 49.7% and 50.3% for fc27 and 3d7 of msp-2 .
four specific associations of two alleles were over - represented . in the fc27 family , the 500 and 560 bp ( p = 0.004 ) , and the 530 and 600 bp alleles ( p <
was associated positively to the 560 bp allele ( p = 0.01 ) and negatively to the 530 bp allele ( p = 0.01 ) .
sequences of oligonucleotide primers used to amplify merozoite surface protein ( msp)-1 and msp-2 polymorphic regions of plasmodium falciparum isolates from gabon . before treatment ,
the two single clonal infections were composed by parasites belonging to the k1 family of msp-1 , and to the fc27 and 3d7 family of msp-2 , respectively .
moi was not correlated to age ( figure 1 , spearman correlation , p > 0.1 ) , although the number of genotypes of the k1 family increased with age ( spearman correlation , p = 0.04 ) .
mean number of genotypes in merozoite surface protein ( msp)-1 and -2 polymorphic families of plasmodium falciparum collected in the blood of 52 children , 0 to 95 months old , presenting with a malaria attack in gabon , by age .
following treatment , parasites reappeared in the blood of 10 children in which 2 or 3 additional blood samples were obtained .
three types of fluctuating figures of msp-1 and msp-2 molecular patterns were obtained ( figure 2 ) . in type a , one or several initial allele(s ) transiently vanished and recurred thereafter . in type b , new alleles appeared at intermediate and/or final points , although some initial alleles may persist . in type c , alleles observed at intermediate and final points were all present at d0 .
variations in parasite densities were not related to appearance or disappearance of alleles ( spearman test for moi and parasite density , p > 0.1 ) .
the disappearance of alleles , as in type c , could be attributed to treatment efficacy , and can not be considered as parasite fluctuation .
recurrent parasites with identical genotype as initial parasites are likely drug - resistant parasites . among the 5 families of msp-1 and msp-2 genes , a or b fluctuating types were observed in 9 of the 10 children .
the figure of the child n 170 was of type c for all 5 families .
the different clonal fluctuation figures were classified by type a , b , or c. type a : one or several of the initial allele(s ) transiently vanished , and were present again at the final point .
type b : new alleles appeared at intermediate and/or final points , although some of the initial alleles may be still present .
type c : alleles observed at intermediate and final points were all present at d0 .
additional samples were collected from the same subjects , at first reappearance of parasites in blood , 7 to 21 days following treatment . in 10 subjects ,
among the 52 d0 samples , at the msp-1 locus , 14 alleles of the k1 family ranged from 135 to 330 bp ; 8 mad20 alleles ranged from 190 to 280 bp ; and 3 of the ro33 family were of 160 , 230 , and 250 bp ( table 2 ) . for the msp-2 locus , 11 fc27 alleles ranged from 300 to 600 bp ; and 8 3d7 alleles ranged from 360 to 590 bp .
forty - seven ( 90.4% ) d0 samples harboured k1 parasites , 33 ( 63.5% ) mad20 parasites , and 19 ( 36.5% ) ro33 parasites . for msp-2 , 34 ( 65.4% )
isolates contained fc27 parasites , and 43 ( 82.7% ) 3d7 parasites . at each locus ,
family distribution was 52.5% , 32.5% , and 15.0% for k1 , mad20 , and ro33 of msp-1 ; and 49.7% and 50.3% for fc27 and 3d7 of msp-2 .
four specific associations of two alleles were over - represented . in the fc27 family , the 500 and 560 bp ( p = 0.004 ) , and the 530 and 600 bp alleles ( p
< 0.0001 ) were positively associated . in the 3d7 family , the 500 bp allele
was associated positively to the 560 bp allele ( p = 0.01 ) and negatively to the 530 bp allele ( p = 0.01 ) .
sequences of oligonucleotide primers used to amplify merozoite surface protein ( msp)-1 and msp-2 polymorphic regions of plasmodium falciparum isolates from gabon .
the two single clonal infections were composed by parasites belonging to the k1 family of msp-1 , and to the fc27 and 3d7 family of msp-2 , respectively .
moi was not correlated to age ( figure 1 , spearman correlation , p > 0.1 ) , although the number of genotypes of the k1 family increased with age ( spearman correlation , p = 0.04 ) .
mean number of genotypes in merozoite surface protein ( msp)-1 and -2 polymorphic families of plasmodium falciparum collected in the blood of 52 children , 0 to 95 months old , presenting with a malaria attack in gabon , by age .
following treatment , parasites reappeared in the blood of 10 children in which 2 or 3 additional blood samples were obtained .
three types of fluctuating figures of msp-1 and msp-2 molecular patterns were obtained ( figure 2 ) . in type
a , one or several initial allele(s ) transiently vanished and recurred thereafter . in type b
, new alleles appeared at intermediate and/or final points , although some initial alleles may persist . in type c , alleles observed at intermediate and final points were all present at d0 .
variations in parasite densities were not related to appearance or disappearance of alleles ( spearman test for moi and parasite density , p > 0.1 ) .
the disappearance of alleles , as in type c , could be attributed to treatment efficacy , and can not be considered as parasite fluctuation .
recurrent parasites with identical genotype as initial parasites are likely drug - resistant parasites . among the 5 families of msp-1 and msp-2 genes , a or b fluctuating types
the figure of the child n 170 was of type c for all 5 families .
the different clonal fluctuation figures were classified by type a , b , or c. type a : one or several of the initial allele(s ) transiently vanished , and were present again at the final point .
type b : new alleles appeared at intermediate and/or final points , although some of the initial alleles may be still present .
type c : alleles observed at intermediate and final points were all present at d0 .
this work investigated the polymorphism of p. falciparum subpopulations in gabon , by nested - pcr typing .
this method does not allow one to distinguish alleles of identical size , but differing in sequences .
identical field samples were genotyped in different laboratories , and the main difference lied in the number of alleles detected .
our parasite isolates , as most field samples , contained several clones with polymorphic msp-1 and msp-2 sequences at the variable blocks that may differ considerably in size , nucleotide sequence , and repeat copy number . in such conditions
nevertheless , the results should be considered with the method limitations in mind , as variations in sensitivity were seen throughout experiments for weak bands , as well as in the estimation of band 's length .
when the same samples were electrophoresed several times , faint bands were inconsistently visible , demonstrating variations in technique sensitivity , due to unmanageable changes in temperature or moisture content .
estimation of band 's length was liable to disparities between and within gels . given these limitations , it is important to replicate all pcr products migrations .
this study showed high allelic diversity , as 25 and 19 different alleles were respectively present at the msp-1 and msp-2 loci .
however , the ro33 family of msp-1 was poorly polymorphic , with only 3 different alleles detected .
at the msp-2 locus , fc27 and 3d7 alleles were nearly equally distributed , whereas alleles belonging to the k1 family were more frequent at the msp-1 locus .
this situation differs from that of dienga , a village from the same area of gabon ( both villages being 45 km apart ) , where the r033 family was the most frequent at the msp-1 locus in isolates from asymptomatic subjects .
however , a single ro33 allele was detected , confirming the reduced polymorphism of this family . in a more recent study in dienga , ro33 and fc27 alleles
were mainly found during asymptomatic infections , whereas k1 , mad20 , and 3d7 were predominant in isolates from clinical infections .
such a differential distribution according to clinical status was not observed in cameroonian , senegalese , nor kenyan isolates . in senegal and thailand ,
the ro33 family was poorly polymorphic , as opposed to the other msp-1 and msp-2 families .
the msp-2 locus is usually highly polymorphic , and fc27 and 3d7 families are both highly represented .
multiple bands were observed in all but two samples , and the moi was 4.0 , probably as a consequence of the high transmission level .
the very high moi may also be explained by the clinical and immunological status of the patients , although conflicting results are present in the literature .
some studies indicated that moi decreases with age in asymptomatic subjects after 15 years . in our study , age
was not related to the number of genotypes , in agreement with several studies achieved with symptomatic or asymptomatic subjects [ 14 - 16 ] .
ten subjects were studied at multiple points during four weeks . in nine , alleles fluctuated with time .
either alleles transiently disappeared , or additional alleles appeared ( and eventually disappeared ) during the follow up .
we can not rule out that clonal disappearance was the result of treatment activity , and its reappearance due to reinfection by a new anopheles bite .
however , parasite population showed a very rich polymorphism of msp-1 and msp-2 loci composed of at least 22 different alleles , with the most common allele not exceeding 28% of all alleles of a given family .
the concomitant reinfection by several clones similar to those present in the initial infection would be very unlikely .
alleles fluctuations were more likely related to variations of the alleles ratios in peripheral blood , as reported over a several months period in the absence of malaria transmission . in holoendemic areas ,
. concluded that a rapid turnover of parasite populations inoculated by mosquitoes has occurred , whereas farnert et al
several mechanisms may be involved including sequestration in the deep vasculature , strain competition , strain - specific immune response , and/or parasite immune evasion . in our study ,
treatment efficacy is also responsible for the disappearance of sensitive clones , and drug - resistance is liable for recrudescent parasites .
the appearance of new allele(s ) could be attributed to reinfection by new clone(s ) , or to detection of genotype(s ) present earlier at undetectable concentration .
although the method had showed limitations , this study illustrated high polymorphism in southeast gabon with respectively 25 and 19 different alleles at msp-1 and msp-2 loci .
infections were highly complex , malaria attacks being characterized by a mean of four genotypes per infection .
these results illustrate two forms of p. falciparum complexity in a high transmission area : sequence polymorphism and clonal fluctuation .
the three authors participated in the design of the study , the analysis and the interpretation of the results , as well as in preparing the manuscript .
merozoite surface protein ( msp)-1 and msp-2 polymorphism in isolates from 52 gabonese children presenting with a plasmodium falciparum malaria attack , 2000 . *
we are grateful to the children who participated in the study , as well as to their mothers and guardians .
we thank dr m. bakary and j. mayombo for help in patient management , and j. bourgeais , sodepal , for logistical support in bakoumba .
we are also grateful to jacques le bras and remy durand for helpful discussions , and odile mercereau puijalon for critical reading of the manuscript .
this work was supported by the french ministry of research ( vihpal grant ) and by the fondation pour la recherche mdicale . | backgroundplasmodium falciparum antigenic diversity and polymorphism confuses the issue of antimalarial vaccine development .
merozoite surface protein ( msp)-1 and -2 are two highly polymorphic vaccine candidates .
characterisation of their precise polymorphism in endemic regions may facilitate the design of an effective vaccine.methodsisolates obtained in 52 gabonese children presenting with uncomplicated malaria were genotyped by nested - pcr of msp-1 block 2 , and msp-2 block 3 , to analyze both parasite population polymorphism and clone fluctuations.resultstwenty-five and 19 different alleles were respectively obtained for msp-1 and msp-2 loci , the ro33 family of msp-1 being poorly polymorphic .
four cases of non - random distribution of alleles were reported of the fc27 , and/or 3d7 families of msp-2 .
all but two isolates were composed of more than one genotype , and the multiplicity of infection ( moi ) was 4.0 .
neither parasite density nor age was related to moi .
clone fluctuations were studied for ten subjects who were sampled again at reappearance of parasites in blood . disappearance and reappearance of alleles
were observed following treatment , suggesting difficulties in assessing polymorphism and in distinguishing reinfection from recrudescence.conclusionp .
falciparum polymorphism is extensive in southeast gabon , and most of infections are composed of multiple clones .
the fluctuation of clones contributes to parasite diversity . |
type 2 diabetes mellitus ( t2d ) is a global health problem and is predicted to become more prevalent in the coming decades [ 1 , 2 ] .
many currently available antidiabetic drugs improve the impaired insulin secretion or decreased insulin sensitivity seen in t2d .
however , they exhibit a number of limitations such as side effects and high rates of secondary failure and , in the case of novel drugs , rather high treatment costs [ 35 ] .
thus , diabetic patients and healthcare professionals are considering complementary and alternative approaches , including the use of herbal medicine with antidiabetic properties .
traditional herbal medicines have played a major role in the management of diabetes in vietnam and many asian countries for centuries .
gynostemma pentaphyllum makino ( family cucurbitaceae ) is a perennial creeping herb growing wild in the mountain regions of vietnam , china , and some other asian countries .
it has been used widely in southeast asian countries as a herbal medicine and being beneficial for the prevention and treatment of diabetes [ 79 ] .
we have previously presented evidence that gp tea possesses antidiabetic effect , both as a single treatment and as an add - on therapy to sulfonylureas with good safety data in newly diagnosed t2d patients [ 10 , 11 ] .
in addition , the extract of gp has been shown to reduce both hyperglycemia and hyperlipidemia in diabetic zucker fatty rats .
therefore , this study was aimed to evaluate the effect of gp tea on insulin sensitivity by somatostatin - insulin - glucose infusion test ( sigit ) in drug - nave type 2 diabetic patients .
the medication was provided in the form of gp tea at the dose of 6 g / day ( 3 g / packet , twice a day ) .
the whole plants of gynostemma pentaphyllum makino cucurbitaceae were collected from the hoa binh province , in the north of vietnam , and identified by professor pham thanh ky , department of material medica , hanoi college of pharmacy .
the standardized gp tea was produced by a certified herbal manufacturing facility using the method described in document number vn 10907/tl , including two stages .
the first stage was to confirm authenticated gp plants which were compared with the voucher specimen ( hn-0152 ) deposited in the herbarium at the department of material medica , hanoi college of pharmacy .
briefly , the process included extraction of the authenticated gp plants for 2 h in boiling water and a following precipitation of impurities by adding concentrated 70% ethanol .
the 70% ethanol was then removed by distillation at low pressure , and impurities were removed by filtration .
thereafter , the tea was inspected as a semifinished brown powder with typical odour of gp tea .
this powder had a humidity of approximately 6.7% and could be dissolved in water into brown liquid with a sweet - bitter flavour .
the tea contained flavonoids , as shown by a positive cyanidin reaction with base fecl3 ( 5% ) [ 13 , 14 ] , and furthermore about 18% saponins , as indicated by a positive foaming test [ 13 , 14 ] .
thus , the standardization of the gp tea included confirmation of its typical odour , state , and sweet - bitter flavour , approximately 7% in humidity , and positive reaction in the flavonoid ( cyanidin reaction ) and saponin ( foaming ) tests .
the placebo tea was green tea ( camellia sinensis ) , which was supplied at the same dose and was similar to the gp tea in shape and packaging .
after grinding the resulting gp and placebo material into a powder to form soluble particles , the powder was packed in tin foil packets ( 6 5 cm ) by an automatic packing machine .
each packet contained 3 g of powder , and 10 packets were packed in one box to be distributed to the patients .
both gp and placebo tea were easily dissolved in 60 ml water ( room temperature ) and taken 30 minutes prior to breakfast and dinner .
sixteen patients with newly diagnosed t2d were enrolled into the study from february to september 2010 from outpatients at national institute of gerontology and 3 district hospitals in hanoi .
the study protocol was approved by the research ethics board at hanoi medical university , hanoi , vietnam , and the regional ethics committee at the karolinska institutet , stockholm , sweden .
inclusion criteria were ( 1 ) newly diagnosed t2d patients according to who criteria , ( 2 ) age from 40 to 70 years old , ( 3 ) antidiabetic drug nave , ( 4 ) mean ( of two ) fasting plasma glucose ( fpg ) measurements from 7 to 11 mmol / l , and ( 5 ) glycosylated hemoglobin ( hba1c ) from 7 to 9% .
exclusion criteria were ( 1 ) previously pharmacological treatment for diabetes , ( 2 ) chronic complications related to type 2 diabetes , ( 3 ) smoking subjects , and ( 4 ) increased titres of gad and ia-2 antibodies .
the evaluation at baseline included detailed medical history and clinical examination , fasting plasma glucose ( fpg ) and oral glucose tolerance test , ( ogtt ) , hba1c , livers and renal function tests , fasting lipid profile , and plasma insulin level .
the protocol of the study is presented in figure 1 . after screening by the main investigator ,
the selected patients were randomly assigned by another independent allocator by the use of numbered containers into two groups , matched by age , sex , fasting plasma glucose , and hba1c : group a and group b received gp tea and placebo tea , respectively , 6 g daily in divided dose ( twice a day , 30 minutes before breakfast and dinner ) .
after two - week wash - out period of nontea therapy , the patients were switched to another four weeks of 6 g gp tea / day ( group b ) and placebo tea ( group a ) . at the end of both four - week periods of treatment with gp or placebo tea ( week 4 or week 10 ) , all patients underwent a somatostatin - insulin - glucose infusion test .
they were instructed to follow the diet as always recommended for newly diagnosed t2d patients .
they were also instructed to walk 30 minutes a day and at least five days a week during the study .
this was reinforced at each follow - up visit , and subjects were treated on an outpatient basis .
all subjects participated in sigit , performed at 8 am after an 810 h overnight fast with only tap water allowed ad libitum .
the sigit , lasting 150 minutes , was conducted as described earlier [ 1618 ] .
cannula ( exeflon , exelint , los angeles , ca , usa ) was inserted into an antecubital vein for the infusion of all test substances .
a second cannula was inserted into a wrist vein contralaterally to the infusion site for blood sampling .
each subject was given a 150-minute intravenous infusion of somatostatin ( 270 g / h ; somatosan , wasserburger arzneimittelwerk gmbh , wasserburg , germany ) , insulin ( 0.4 mu / kg / min ; actrapid hm , novo nordisk , denmark ) , and glucose ( 6 mg / kg / min ; in a 20% solution ) .
ten ml blood of each patient was added to the mixture to prevent insulin and somatostatin from absorption to glass surface .
plasma glucose and insulin were measured at 0 , 30 , 60 , 90 , 120 , and 150 minutes .
somatostatin was used to suppress endogenous insulin release , thereby allowing for the estimation of sensitivity to exogenously administered insulin by measuring blood glucose value at 90 , 120 , and 150 minutes of the test ( sigit mean ) .
since similar steady - state plasma insulin levels are achieved in all subjects , this test allows us to compare the ability of the recruited subjects to dispose of identical glucose loads under the same insulin stimulus .
therefore , the mean of several plasma glucose concentrations measured during the steady - state period from 90 to 150 minutes is a measure of efficiency of insulin - mediated glucose utilization , that is , insulin sensitivity [ 17 , 18 ] .
blood samples of fasting subjects were taken before , during ( every second week for ten weeks ) , and after the treatment course for measurement of plasma glucose , hba1c , liver transferase ( alt , ast ) , bun , creatinine , lipid profiles , and insulin levels .
analysis of glucose concentration of each sample was done by enzymatic colorimetric test , god - pap in a glucose analyzer ( autolab instrument , boehringer mannheim , germany , wave - length hg 546 nm ) .
hba1c was measured with bio - rad d-10 ( bio - rad strasbourg , schiltigheim , france ) .
the insulin concentration was measured by insulin radioimmunoassay ( ria ) , using our own antibodies , human insulin as a standard , and charcoal addition to separate antibody - bound and free insulin .
oral glucose tolerance tests ( ogtt ) ( 75 g glucose ) were performed at baseline to confirm the diabetic diagnose .
venous blood samples were drawn before 0 , 30 , and 120 minutes after the glucose intake .
body weight , body mass index ( bmi ) , waist and hip circumference , blood pressure , and registered adverse effects were noted in medical records during the visits .
paired t - test was used to analyze data in the same group before and after treatment as well as the steady - state of both sigits .
the independent sample t - test was used for normal distributed variables to compare differences in mean change between the treatment group and the control group ( spss version 16.0 ) .
the baseline characteristics of the patients receiving gp treatment initially did not differ significantly from those starting with placebo and vice versa at week 6 , after two weeks of washout ( table 1 ) .
there were no statistically significant differences between the groups regarding age , gender , systolic and diastolic blood pressure ( sbp and dbp ) , body weight , bmi , waist , hip circumference , fpg , and hba1c .
treatment with gp tea compared to placebo induced no differences in fasting plasma insulin ( fpi ) but resulted in lower fpg ( p < 0.001 ; table 2 ) . following the treatment with gp tea , the fpg decreased to1.9 1.0 mmol / l , while the levels of fpg in the placebo treatment were not changed , 0.2 1.5 mmol / l , p < 0.001 .
the effects were reversed after exchanging treatments ( figure 2 ) , and the glycometabolic improvement was achieved without any major change of circulating insulin levels ( table 2 , figure 2 ) . the mean steady - state plasma insulin levels and plasma glucose responses of the two groups during sigit study
the steady - state plasma insulin ( sspi ) response clearly indicates that similar plasma levels of exogenous insulin were attained as a result of the infusion in all subjects .
in contrast , the mean steady - state plasma glucose ( sspg ) responses were markedly decreased after the gp tea treatment ( p < 0.01 ) , indicating improved insulin sensitivity .
there were no significant differences within or between groups regarding changes in serum triglyceride , total cholesterol , and hdl and ldl cholesterol levels .
similarly , no significant changes in the plasma levels of ast , alt , creatinine , and bun were detected during treatment ( data not shown ) .
neither the gp tea - treated nor placebo - treated groups experienced any acute adverse effect such as gastrointestinal , diarrhea , and hypoglycemic symptoms during the research period , and all patients were compliant with the treatment protocol and completed the study .
the main findings of this study were that gp tea exerted a significant antidiabetic effect and that this was accounted for by enhanced insulin sensitivity .
the placebo group and the gp group did not differ in baseline characteristics and diabetic parameters ( drug - nave t2d , hba1c , and fpg ) .
the gp tea was mainly responsible for the reduction of the glucose levels because all patients received similar diet and exercise therapies , with minor effect on fpg in the control group .
the major antidiabetic role of gp tea was also proven by the reduction of the fpg and the glucose responses to insulin during sigit after gp treatment with reversed effect after switching to placebo treatment , whereas the plasma insulin during sigit did not change after gp tea treatment in our study population .
we assessed insulin sensitivity by sigit , during which the endogenous production of insulin and c - peptide is inhibited by a simultaneous infusion of somatostatin and insulin .
serum glucose levels during the last part of a sigit are used as a measure of the sensitivity to insulin in each individual .
achievement of a continuous suppression of plasma c - peptide levels during sigit guarantees that glucose disappearance is governed by the infused and not by endogenously secreted insulin .
insulin sensitivity measured with sigit is significantly correlated with m values obtained during hyperinsulinemic euglycemic clamp , which is a gold standard in measuring insulin sensitivity [ 20 , 21 ] . in a previous study , endogenous c - peptide concentrations , reflecting insulin secretion during sigit , were almost entirely abolished by somatostatin . in addition , in our previous study we showed that the glycometabolic improvement was achieved without any major change of circulating insulin and c - peptide levels .
thus , our present results are in agreement with our previous findings by gp tea [ 10 , 11 ] and indicate that the decrease in blood glucose levels is explained by the improvement in insulin sensitivity . according to our previous studies in twelve weeks , homa - ir decreased significantly after gp tea treatment .
this observation , combined with the present results , suggests that gp tea provides improved glycemic control via a mechanism that does not involve stimulation of insulin release and thus does not place any additional burden on defective -cells .
an effect by gp tea on insulin sensitivity may be accounted for by suppression of ptp-1b activity by dammarane compounds in the gp tea .
ptp-1b is present in liver and skeletal muscle and has been shown to negatively modulate insulin 's action on hepatic glucose metabolism through tyrosine dephosphorylation of the insulin receptor and/or insulin receptor substrates .
interestingly , a recent experimental study demonstrated that an ethanol extract of gp , produced in vietnam , inhibited protein tyrosine phosphatase 1b activity , which may lead to enhanced insulin sensitivity and thereby improved glucose tolerance . in this study , green tea ( camellia sinensis )
green tea was reported to induce antihyperglycemic effect in mice and streptozotocin - diabetic rats [ 23 , 24 ] , but there is little evidence that it improves glycemic control substantially in human type 2 diabetes [ 24 , 25 ] . in the gp group ,
this finding was in accordance with our previous results [ 10 , 11 ] and was evidence for the biosecurity of using gp tea as an antihyperglycemic treatment .
this notion is supported also by a study in rats where no signs of chronic toxicity were found after 6-month administration of rather high gp extract doses ( up to 0.75 g / kg per day ) . during the study ,
this trial only enrolled a modest number of patients ; larger and longer trials are needed to assess , with higher accuracy , the prevalence of possible adverse effects .
in addition , further research is needed to determine the durability of gp extract 's antidiabetic effect , as well as effects on patient - reported outcomes , morbidity , and mortality .
in conclusion , the results of this placebo - controlled crossover study suggested that the gp tea exerted antidiabetic effect by improving insulin sensitivity . | aims . to evaluate the effect of the traditional vietnamese herb gynostemma pentaphyllum tea on insulin sensitivity in drug - nave type 2 diabetic patients
. methods . patients received gp or placebo tea 6 g daily for four weeks and vice versa with a 2-week wash - out period . at the end of each period ,
a somatostatin - insulin - glucose infusion test ( sigit ) was performed to evaluate the insulin sensitivity .
fasting plasma glucose ( fpg ) , hba1c , and oral glucose tolerance tests and insulin levels were measured before , during , and after the treatment . results .
fpg and steady - state plasma glucose ( sigit mean ) were lower after gp treatment compared to placebo treatment ( p < 0.001 ) .
the levels of fpg in the control group were slightly reduced to 0.2 1.5 versus 1.9 1.0
mmol / l in gp group ( p < 0.001 ) , and the effect on fpg was reversed after exchanging treatments .
the glycometabolic improvements were achieved without any major change of circulating insulin levels .
there were no changes in lipids , body measurements , blood pressure , and no reported hypoglycemias or acute adverse effects regarding kidney and liver parameters .
conclusion .
the results of this study suggested that the gp tea exerted antidiabetic effect by improving insulin sensitivity . |
the avian circadian system is a complex of mutually coupled pacemakers residing in the pineal gland , retinae , and the avian homologs of the suprachiasmatic nucleus ( scn ) , synchronized to environmental light cycles ( ld ) by photoreceptors in the eye , pineal gland , and multiple sites within the brain ( figure 1 ; cassone and menaker , 1984 ) . at the molecular level , genomic and transcriptional analyses
have identified a highly conserved network of clock genes that are orthologous to clock genes identified in insects and mammals ( bailey et al . , 2003 ; karaganis et al . ,
although the biochemical details are not well - known in birds , birds , like other species studied , express positive elements clock and bmal1 , which are transcribed rhythmically , translated in the cytoplasm , where they dimerize and enter the nucleus to activate the transcription of negative elements period 2 ( per2 ) , period 3 ( per3 ) , cryptochrome 1 ( cry1 ) , and cryptochrome 2(cry2 ) , as well as other clock - controlled genes that rhythmically affect downstream processes .
this network has been reviewed extensively elsewhere ( bell - pedersen et al . , 2005 ) .
the pineal gland secretes melatonin during the night , and inhibits the output of the mscn and vscn ( collectively the scn here ) .
the scn in turn inhibits the output of the pineal gland through a multisynaptic pathway via the sympathetic nervous system and norepinephrine ( ne ) . at the systems level , the pineal gland , the ocular retinae and the avian homologs to the suprachiasmatic nuclei form the nexus of biological clock function .
the pineal gland is necessary for rhythmicity in passerine birds ( gaston and menaker , 1968 ; binkley et al . ,
1971 ) , and rhythmic administration of the pineal hormone melatonin entrains circadian rhythms of several avian species ( chabot and menaker , 1992 ; lu and cassone , 1993 ; heigl and gwinner , 1995 ) . in galliforms ( e.g. , chicken and quail ) and columbiforms ( pigeons ) ,
the retinae are also important for circadian organization ( ebihara et al . , 1984 ;
underwood and siopes , 1984 ) since the eyes are major sources of melatonin in these species as well ( menaker , 1997 ) .
thus , the common denominator for the role(s ) played by the pineal gland and the retinae is likely the circadian secretion of melatonin . in birds ,
two sets of structures have been associated with scn function : the medial suprachiasmatic nuclei ( mscn ) and the visual suprachiasmatic nuclei ( vscn ) ( cantwell and cassone , 2006a , b ) but their precise roles show some variation .
these structures are connected via neuronal projections and are contiguous in terms of their cellular populations , especially in the distribution of astrocytes .
the vscn , but not the mscn , contains melatonin receptor binding ( cassone et al . , 1995 ) , and exogenous melatonin inhibits metabolic activity in the vscn , but not in the mscn ( cassone and brooks , 1987 ; lu and cassone , 1993 ; cantwell and cassone , 2003 ) . in japanese quail ,
coturnix coturnix , only the mscn expresses clock gene rhythmicity ( yasuo et al . , 2002 ) , while in the house sparrow , passer domesticus , both structures rhythmically express per2 ( abraham et al . , 2002 ) .
each of these components is integrated dynamically such that overt circadian organization is synchronized to environmental ld and such that internal processes are adaptively orchestrated ( cassone and menaker , 1984 ) .
pineal ( and retinal ) melatonin , synchronized to ld cycles via endogenous photopigments ( figure 1 ; kojima and fukada , 1999 ) , is secreted during the night and inhibits rhythmic metabolism and electrical activity of the vscn . in turn , as the day approaches , oscillators within the pineal gland and retinae wane in their output , disinhibiting scn activity .
oscillators within the mscn and vscn are active during the day , synchronized by ld via rht input to the vscn and possibly extraretinal input to the mscn .
one of the outputs of the vscn at least is the rhythmic regulation of sympathetic activity , releasing norepinephrine ( ne ) within many peripheral targets . among these
pineal melatonin in turn inhibits metabolic activity in the vscn in vivo ( lu and cassone , 1993 ) . in vitro ,
rhythmic melatonin administration synchronizes rhythms of both metabolic activity and the expression of both per2 and per3 ( paulose et al .
birds ' have several extraordinary cognitive abilities , some of which rival those of the most advanced mammalian taxa , particularly among corvid ( e.g. , jays , crows , and ravens ) and psittacine ( parrots ) species .
we focus on three abilities that serve as examples of extraordinary capabilities of birds in which we have a fair understanding of the neural mechanisms and the ecological context .
each of these examples involves seasonal or daily rhythms , suggesting that the circadian clock could be involved . in general ,
the neural substrates for avian cognition can be localized in the telencephalic pallia and are , therefore , in a general sense homologous to those in mammals , where the telencephalic neocortex appears to be the purview of higher order processing ( gntrkn , 2011 ) .
however , the location of specific structures within the telencephalon appears to be homoplastic , or convergent , in that the pallial regions of the telencephalon are differentially organized and reside in different aspects of the telencephalon .
the hippocampal complex ( hc ) , responsible for short - term memory and place , is located in the dorsomedial aspects of the avian telencephalon , while the homologous mammalian hc is embedded within a laminar neocortex .
while in mammals the prefrontal cortex is considered critical for cognitive functions associated with self - directed and task - specific planning , this behavioral capacity is controlled by the avian caudolateral nidopallium ( ncl ) .
differences in the cytoarchitecture of these structures make it unlikely that they share either developmental or immediate phylogenetic ancestors .
yet , they each receive similar inputs from overlapping sensory modalities and are both regulated by extensive dopaminergic afferents arising from the ventral tegmentum during working memory tasks ( bast et al . , 2002 ) .
thus , birds and mammals have independently evolved higher cognitive skills by employing differentially organized forebrains .
there is growing evidence that the biological clock influences the timing of song production and learning .
the song control system of oscine passeriform birds is a specialized network of brain nuclei involved in singing and song learning ( nottebohm et al . , 1976 ; konishi , 1989 ; ball and balthazart , 2010 ) .
song processing occurs in secondary auditory areas in the caudal mesopallium ( cm ) and caudomedial nidopallium ( ncm ) , which interact with the anterior forebrain pathway ( figure 2a ) for song plasticity and learning .
this pathway includes the hvc in the dorsal forebrain , which projects to area x , whose projections form a loop between the dorsolateral thalamus ( dlm ) and the lateral magnocellular nucleus of the anterior nidopallium ( lman ) . then , both hvc and lman project to the robust nucleus of the archipallium ( ra ) , which forms the song motor output pathway ( figure 2b ) .
( a ) the anterior forebrain pathway involves a loop among the hvc , area x ( x ) , the dorsolateral thalamus ( dlm ) , and the lateral magnocellular nucleus of the anterior nidopallium ( lman ) .
( b ) these output through the song motor output pathway in which hvc and lman project to the robust nucleus of the archipallium ( ra ) , which in turn projects to vocal motor pathways controlling the syrinx .
this system enables birds to process a complex species - specific identification of both self and con - specifics as well as other dynamics in birds ' acoustic environments ( competitors , prey , predators , etc . ) .
territories change hands and the available range of mates fluctuates . in order to effectively interpret the acoustic features in song
, the auditory system must structure its representation in such a way that allows for dynamic behavioral goals of the organism .
at the same time , the structure and behavior of song itself must be tuned to reproductively appropriate situations .
some species , such as zebra finches , taeniopygia guttata , and house sparrows , passer domesticus , are close - ended learners , in which song is learned from a tutor during a critical period early in development .
others , such as canaries , serinus serinus , and european starlings , sturnus vulgaris , are open - ended learners , in which new motifs are added to birds ' song over their lifetimes . in both cases , there are two phases of song learning .
the first is the memorization of sensory phase , in which birds listen to a tutor song ; this process is largely mediated by cm and ncm .
the second phase is the sensorimotor phase in which juvenile birds produce plastic song that , after weeks of listening and practice , gradually
an increasing body of evidence points to a central role for sleep in the sensorimotor phase of song learning ( margoliash , 2002 ) .
electrophysiological recordings from ra and hvc during sleep with simultaneous electroencephalographic ( eeg ) recording to ascertain sleep state have shown that ra and hvc neurons fire during sleep , suggesting that cells within these structures replay songs learned during wakefulness ( nick and konishi , 2001 , 2005 ; crandall et al . , 2007 ; shank and margoliash , 2009 ) .
( 2005 ) have found that night - time sleep decreases the power and increases entropy in vocalizations of young zebra finches . as a result ,
morning song is less precise than is afternoon song , as birds ' vocalization becomes more repetitive over the course of the day .
this daily dip in vocal precision diminishes in amplitude as birds ' song crystallizes to adulthood , although it remains throughout birds ' lives .
these authors and others have suggested that playback during sleep prunes aberrant song patterns of plastic song the previous day and that sleep affects the quality of song the following day . in a surprisingly offhand remark
, these authors state that injection of the pineal hormone melatonin into zebra finches during the day induced both a somnolent state for 23 h and the night - induced increase in vocal entropy .
secondly , the song control nuclei hvc , ra , area x , and lman of house sparrows , zebra finches , and starlings , sturnus vulgaris , express high affinity melatonin receptors ( gahr and kosar , 1996 ; whitfield - rucker and cassone , 1996 ; bentley et al .
, 1999 ; jansen et al . , 2005 ) , raising the likelihood that the circadian clock system directly affects birdsong behavior and learning through the circadian secretion of melatonin by the pineal gland . to test this , wang et al .
( 2012 ) pinealectomized adult male zebra finches and measured locomotor activity and vocalizations continuously .
song behavior , however , became arrhythmic several days earlier than did either locomotor activity or calls . when birds were administered melatonin rhythmically , rhythms in all three behaviors were reestablished , but , again , at different rates .
locomotor behavior was entrained to the melatonin regime more rapidly than song behavior which was entrained more rapidly than was call behavior .
the data indicate that the circadian clock in the pineal gland entrains separable circadian oscillators controlling locomotor , song , and call behavior and that these three behaviors are differentially sensitive to melatonin ( figure 3 ) .
the circadian clock influences the song control system through the secretion of melatonin via melatonin receptors in the hvc , lman , area x , and ra .
birds living in temperate zone latitudes generally restrict breeding to the spring and summer , maximizing the likelihood that young will be hatched during times at which food is plentiful ( ball and balthazart , 2010 ; kumar et al . , 2010 ) . as such
, many primary and secondary sexual characteristics in birds undergo dramatic changes in both form and function . in the short days of winter
similarly , both the probability of a male bird to sing in response to a given stimulus as well as the size and complexity of the song control nuclei within its brain vary depending upon the time of year .
birds in the short days of winter possess small hvc , ra , and depending on the species other structures in the system .
when birds are photostimulated as photoperiod increases , the song control nuclei grow in parallel with the growth of the testes , and , as they become photorefractory , these structures regress in both size and complexity ( smith et al . , 1997 ;
as stated above , one neuroendocrine correlate for photoperiod and season that is independent of gonadal function is the circadian secretion on pineal melatonin ( cassone , 1990a , b ; whitfield - rucker and cassone , 1996 ) .
as the photoperiod lengthens from short days of winter to the long days of summer , the secretory pattern of melatonin shortens congruently .
thus , in a long summer day of 16 h of light and 8 h of darkness , the duration of melatonin in the blood of many temperate zone mammals and birds is short , approximately 8 h in length .
conversely , in a short winter day of 8 h of light and 16 h of darkness , the duration of melatonin is quite long . in seasonally breeding mammals , the duration of melatonin regulates the recrudescence and regression of the reproductive axis in appropriate , species - specific fashion .
thus , in short - day breeding ungulates such as sheep , long duration melatonin cycles induce reproductive activity , while in long - day breeding rodents , an identical long duration of melatonin results in gonadal regression . in songbirds ,
pinealectomy and manipulation of melatonin levels and durations have little effect on gonad size or steroid secretion ( gwinner and brandsttter , 2001 ; kumar et al . , 2010 ) .
however , the presence of imel binding in song control structures raises the possibility that seasonal changes in melatonin duration , which are expressed by the avian pineal ( binkley , 1976 ; brandsttter et al . , 2000 ) , may regulate bird song structures . to test this possibility , cassone et al .
( 2008 ) compared the volumes of song control nuclei in house sparrows maintained in constant light ( ll ) that received either a long duration or a short duration of melatonin .
birds that received the short , summer - like duration of melatonin exhibited large , summer - like hvc and ra volumes .
birds that received a long duration , winter - like duration of melatonin exhibited small winter - like hvc and ra .
thus , melatonin not only synchronizes circadian patterns of vocal activity but also influences the seasonal changes in the song control apparatus ( figure 3 ) .
we do not know if the pineal hormone affects the learning of new vocalizations on a seasonal basis , but this would be a very fruitful area of research .
the simplest form of cognition in spatial orientation in birds is the ability to cache resources such as food or nest sites and then to remember their location at some time later .
several groups of birds are particularly adept at caching food , including parids such as chickadees and tits , corvids , and several species of owls .
( clayton et al . , 2003 ) in that corvids , at least , not only express episodic memories of where a particular foodstuff has been stored , but also when it was stored and what type of food was stored .
secondly , these birds are able to plan retrieval of stored food for periods of days to months .
first , food - storing birds such as jays ( corvidae ) and chickadees ( paridae ) have larger hcs , relative to the rest of the brain , than do non - storing birds such as house sparrows ( passeridae ) and domestic pigeons , columba livia ( order columbiformes ) ( krebs et al . , 1989 ) . secondly , as with the song control system of oscine passeriform birds , the hc express adult de novo neurogenesis and food storing birds express greater rates of neurogenesis than do non - storing birds ( hoshooley and sherry , 2007 ) .
lesions in the hc impair the ability of chickadees to locate food caches but have little effect on cognitive performances in other modalities , suggesting the hc is specifically involved in spatial memory ( sherry and vaccarino , 1989 ; hampton and shettleworth , 1996 ) .
there is no direct evidence that either the molecular components of circadian clocks or any neural structure associated with biological clocks influence this form of spatial orientation .
very little or no reported research has been conducted on whether food caching behavior follows daily or circadian patterns .
however , most food caching behavior follows distinct seasonal patterns that are clearly regulated by photoperiod ( sherry and hoshooley , 2010 ) . in most cases ,
caching occurs primarily in fall , when food is predictable and abundant , and retrieved in the winter , when food supplies are reduced and become more unpredictable .
even so , small food - caching birds will retrieve their cache within a few days , but some species may store food for long periods of time .
clark 's nutcrackers , nucifraga columbiana , which live in montane regions of north america , store pine nuts during the autumn when they are abundant , migrate to lower altitudes for the winter , and then retrieve their caches in the spring when they return to breed before vernal growth produces other sources of food ( tomback , 1978 ) .
these birds reproduce this very long - term spatial memory under laboratory conditions ( gould et al . , 2012 ) . as with the song control system described above
, there is some evidence that the hc varies in size depending on the time of year , being larger from late winter and spring than in the fall ( hoshooley and sherry , 2007 ) .
however , the effect is much smaller than it is within the song control system and it is also inconsistent , depending on the year and latitude of the study ( sherry and hoshooley , 2010 ) .
even so , the hc of chickadees express seasonal patterns of neurogenesis , such that neurogenesis occurs predominantly in winter and spring irrespective of whether the hc changes size , suggesting that this process entails neuron replacement rather than growth . to date
, no studies have been done assessing whether any brain or behavior associated with caching is influenced by melatonin , but we predict that this will be the case . as with song
, we also predict the exact form by which the central clock influences caching may vary among species and possibly even populations having different ecologies .
one of the great mysteries of animal behavior surrounds the abilities of birds to migrate over great distances , to identify appropriate breeding , and/or feeding sites at the appropriate time of year and to return to their home consistently and accurately . at the face of it , these behaviors are impressive cognitive feats , and they are embedded in birds ' sense of time at several different levels .
first , migratory birds are genetically imbued with a temporal program that enables them to migrate with a general direction and distance in their first year as nave migrants .
in addition , the birds modify their trajectories and timing as they learn the migratory route , implying a cognitive adaptation ( gwinner , 1996 ) .
secondly , homing pigeons and presumably all birds that use time - compensated navigation employ their internal circadian clock to integrate the progression of the sun 's azimuth to achieve a bearing toward home .
birds can use this ability to learn the location of a desired object or place .
exactly how the circadian clock integrates with each of these mechanisms is not yet known , but several hints are suggestive .
while memory of caches described above can require flight over reasonably large distances for retrieval , as is the case with the nutcrackers , most caching behaviors require only orientation and memory of landmarks in relatively close proximity . in many other situations ,
birds are known to travel great distances during transcontinental migration or homing ( kalmus , 1964 ; gwinner , 2003 ) . in these cases ,
birds are believed to employ a wide array of cognitive forms of compasses and maps to enable them to locate their current position , orient toward the new location or home , and navigate the distance accurately , including odor , magnetic fields , and the sun compass ( wiltschko , 1991 ) .
sun compass or time - compensated navigation was first described in honeybees by von frisch ( cf .
1967 ) in which bees learn to visit a particular food source at a particular time of day and convey that information to the hive via the famous waggle dance . using this information ,
bees navigate to the food source by interpolating the position of the sun 's azimuth with the bees ' internal sense of time .
the fact that an internal sense of time ( zeitgedachnis ) was required for this navigation was demonstrated by shifting the light : dark cycles of the hive by 6 h ( or 90 of the 24 h 360 day ) and showing that bees consistently make a 90 error in orientation .
this capacity has also been demonstrated in several species of birds , including european starlings and domestic pigeons ( kramer , 1959 ; kalmus , 1964 ) .
one question that has arisen from these studies was whether the internal sense of time was one and the same as the biological circadian clock . in an elegant series of studies , hoffmann ( 1960 ) showed that starlings maintained in constant dim light exhibited gradual shifting in orientation with a period equivalent to the period of their free - running rhythms in locomotion .
these data suggested that the orientation clock and the circadian clock shared clock properties , but the studies were conducted before any neurobiological or molecular components of the clock had been identified .
however , bingman and colleagues have asked whether homing pigeons can learn and remember an orientation by employing their sun compass ( bingman and gagliardo , 2006 ) .
pigeons were taught to identify a door in an outdoor octagonal arena that contained seed for food at a particular time of day . then , to determine whether the pigeons were using their sun compass , subject birds were returned to the laboratory where their light cycles were phase delayed 6 h ( 90 ) .
when birds were tested after the shift , those that employed their sun compass to orient to the food cup consistently made a 90 error to the right ( clockwise ! ) .
bingman and colleagues then asked whether this task involved hc place memory by lesioning the hc before the training sessions ( bingman and jones , 1994 ) .
lesion of the left hc interfered with pigeons ' ability to locate the food using the sun compass but had no effect on birds ' ability to use other cues ( gagliardo et al . , 2005 ) . this process could be replicated using an artificial sun in the laboratory ( petruso et al . , 2007 ) and in the field , when birds were released and followed by gps tracking ( gagliardo et al .
thus , pigeons can learn to use their internal biological clock during a cognitive task , but whether it is directly connected to the central clock and how it interacts with structures associated with cognition are unanswered questions .
birds are capable of very complex behavior and possess impressive cognitive skills ( hunt , 1996 , 2002 ; emery et al . , 2007 ;
these behaviors and cognitive skills are modulated by biological clocks on a circadian and circannual bases . yet , in most cases , a direct link of higher order behaviors requiring learning and memory to known structures and gene products associated with biological timing are not known .
the one exception is the presence of melatonin receptors within the avian song control system , and the effects of pinealectomy and melatonin on song behavior .
still , these studies have yet to show an effect of melatonin on the learning of song .
it is true that migratory behavior in nocturnal migrants appears to be influenced by the amplitude of melatonin ( fusani and gwinner , 2006 ) .
in addition , the hc of pigeons also express melatonin receptors , but it is not known whether migratory birds similarly express them ( cassone et al . , 1995 ) .
normally diurnal birds that migrate during the night exhibit lower amplitude rhythms of melatonin during periods of migratory restlessness , zugunruhe , than at other times of year .
this observation has led gwinner and colleagues ( gwinner and brandsttter , 2001 ; gwinner , 2003 ) to suggest that the reduction in the amplitude of melatonin cycles reflect a reduction in the amplitude of the clock itself , enabling birds to eschew sleep during this period of increased activity and to shift time zones rapidly .
it is not clear whether this is a change in sensitivity to the clock 's output , or a change in the cycling of the clock itself .
moreover , there is no indication yet that the pineal or its hormone melatonin influences the what - when - where cognition associated with both food caching and migration or navigation .
because birds express such complex , yet experimentally tractable , cognitive behaviors and because the details of biological clock function in birds are becoming clearer every day , research in the roles the clock plays in cognition and in ways by which birds cognitively employ their clocks will tell us much about the regulation of complex behavior in all animals , even humans .
our review of the linkages between the avian circadian clock and several cognitive tasks that birds are famous for doing strongly suggest that there are direct links between the mechanism of the clock and aspects of the cognitive task .
appropriate timing of behavior could be under strong selection , which might favor one of two outcomes .
first , the central clock could have different , and potentially modulated , effects on different behavioral mechanisms .
some evidence exists for this but more research into this possibility and how it is accomplished would be fruitful .
another potential response to selection on timing is that elements of some cognitive tasks might feedback to influence the clock .
singing by conspecifics or the sight of cachable food ( or even the act of caching ) might alter the periodicity of the central clock .
the evidence for this in birds is very weak , and so our ideas remain hypothetical and based only on the principle that selection will shape mechanisms for time - keeping to produce behaviors when they will have the greatest benefit .
we note that such feedback to the general clock mechanism may be constrained given that the clock regulates multiple tasks that may be on different schedules , it is possible that it will either be relatively inflexible to stimuli arising from one of the many tasks it regulates , or that in some cases there will be multi - channel clocks sets of linked mechanisms that produce generally similar patterns of timing but also have some level of independence due to tight connections with behavioral activities that are on somewhat different schedules .
each of these possibilities generates questions that run the gamut from molecular mechanisms to evolution in the face of constraints .
birds provide an extraordinary opportunity to explore these ideas because the ecological context of their activities can be studied alongside the neural and hormonal mechanisms that influence them .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | avian behavior and physiology are embedded in time at many levels of biological organization . biological clock function in birds is critical for sleep / wake cycles , but may also regulate the acquisition of place memory , learning of song from tutors , social integration , and time - compensated navigation .
this relationship has two major implications .
first , mechanisms of the circadian clock should be linked in some way to the mechanisms of all these behaviors .
how is not yet clear , and evidence that the central clock has effects is piecemeal . second , selection acting on characters that are linked to the circadian clock should influence aspects of the clock mechanism itself .
little evidence exists for this in birds , but there have been few attempts to assess this idea . at its core ,
the avian circadian clock is a multi - oscillator system comprising the pineal gland , the retinae , and the avian homologs of the suprachiasmatic nuclei , whose mutual interactions ensure coordinated physiological functions , which are in turn synchronized to ambient light cycles ( ld ) via encephalic , pineal , and retinal photoreceptors . at the molecular level ,
avian biological clocks comprise a genetic network of positive elements clock and bmal1 whose interactions with the negative elements period 2 ( per2 ) , period 3 ( per3 ) , and the cryptochromes form an oscillatory feedback loop that circumnavigates the 24 h of the day . we assess the possibilities for dual integration of the clock with time - dependent cognitive processes .
closer examination of the molecular , physiological , and behavioral elements of the circadian system would place birds at a very interesting fulcrum in the neurobiology of time in learning , memory , and navigation . |
colorectal cancer ( crc ) is the third most common cancer in the world , with nearly 1.4 million new cases diagnosed in 2012 and with expected growth to an annual incidence of more than 2.4 million cases by 2035 .
moreover , 700 000 deaths are attributed to crc each year worldwide ( ferlay et al . , 2013 ) .
the early detection of advanced neoplasia or crc through appropriate screening is associated with decreased incidence of and mortality from crc ( hewitson et al . , 2008 ; atkin et al . , 2010 ; doubeni et al . , 2013 ; nishihara et al . ,
advanced neoplasia is defined as high - risk lesions that have a high likelihood of becoming cancerous ( lieberman et al . , 2007 ) .
in 2008 , the united states preventive services task force recommended that men and women of average risk begin screening for crc at the age 50 years ( levin et al .
, 2008 ; whitlock et al . , 2008 ) through fecal testing , colonoscopy , or sigmoidoscopy . in 2010 , a large multidisciplinary group supported by the european commission and the who recommended fecal testing and sigmoidoscopy as primary methods of screening in europe ( von karsa et al . , 2013 ) .
fecal testing and sigmoidoscopy are the primary screening modalities in most european countries ( zavoral et al . , 2009 ; riemann , 2011 ) , with some countries ( poland , austria , germany ) favoring colonoscopy for screening average - risk participants . randomized controlled trials have shown that annual or biennial guaiac - based fecal blood testing ( gfobt ) is associated with a 1533% reduction in crc mortality ( mandel et al . , 1993 ; hewitson et al . , 2008 ) .
multiple european and us professional societies have endorsed the use of the fecal immunochemical test ( fit ) to replace gfobt because of fit s improved performance characteristics and potential for higher participant uptake rates ( levin et al . , 2008 ; whitlock et al . , 2008 ) .
gfobt detects only about 1350% of cancers over one round of screening in asymptomatic patients ( lieberman and weiss , 2001 ; imperiale et al . , 2004 ; park et al . , 2010
) , whereas fit detects 79% of cancers over one round of screening ( lee et al . , 2014 )
in addition , adherence to repeated rounds of gfobt testing in real - world screening programs is often low ( partly because of requisite dietary and medication changes ) , raising concerns about its effectiveness as a screening test ( fenton et al . , 2010 ; gellad et al . ,
many fits require only one or two stool samples , and none require dietary or medication restrictions , increasing the ease of use ; several studies have demonstrated a 616% increase in one - time completion of fit by participants , compared with gfobt ( cole et al . , 2003 ; federici et al . , 2005 ; van rossum et al .
the improved accuracy and participant uptake of fit in comparison with gfobt have led several health organizations to adopt fit in centralized screening outreach programs ( denters et al .
, 2009 ; parente et al . , 2009 ; liles et al . , 2012 ; australian government department of health and aging , 2013 ; cole et al . , 2013 ) .
efforts to optimize the use of fit focus on improving diagnostic sensitivity without detrimentally affecting test completion . two studies on fit screening accuracy ( nakama et al . , 1999 ; park et al . , 2010 ) have indicated that increasing the number of fecal samples tested from one to two , or from two to three , increases the sensitivity , albeit with a decrease in specificity .
prior small or nonrandomized studies specifically focusing on gfobt and fit uptake have indicated that uptake for a two - sample test is either similar to or lower than that for a one - sample test ( cole et al . , 2003 ; mysliwiec et al . ,
2008 ) , and that it declines further with an increase from a two - sample to a three - sample test . factors affecting participant uptake are important both for determining population - level test effectiveness and for tailoring screening outreach efforts . the objectives of this study , therefore , were to : ( i ) rigorously evaluate participant uptake of fit testing in a population that received either a one - sample fit kit ( 1-fit ) or a two - sample fit kit ( 2-fit ) and ( ii ) understand how participant uptake of fit screening ( 1-fit vs. 2-fit ) may vary by age , sex , and receipt of prior crc screening .
the protocol for this study was approved by the institutional review board of the study health maintenance organization ( hmo ) .
the study was conducted at kaiser permanente northwest , a nonprofit hmo with about 485 000 members in southwest washington and the portland , oregon , metropolitan area .
the demographic characteristics ( age , sex , race / ethnicity ) of the members are similar to those of the population in the area .
kaiser permanente northwest regional electronic databases provided data on patient membership , demographics , primary - care assignment , and clinical data ( including weight and height , laboratory results , and other healthcare utilization , such as crc screening ) .
these data capture more than 95% of all medical and pharmacy services that members receive , and data are linked through each member s health record number .
we included hmo members aged between 50 and 75 years who were at an average risk for crc and were overdue for screening , and who ( i ) received an automated telephone call ( atc ) as part of a crc screening outreach campaign and ( ii ) requested that an fit kit be sent directly to their home ( through mail ) at the end of the automated call .
the specific details of the automated call , including the definition of average risk , have been described previously ( mosen et al . , 2010 ) .
briefly , the average - risk population includes those who are overdue for screening and do not meet any of the following criteria : ( i ) have risk factors that would indicate need for nonroutine screening ( e.g. presence of inflammatory bowel disease ) , ( ii ) have been diagnosed with adenomatous polyps or crc , ( iii ) have been referred for colonoscopy or sigmoidoscopy in the previous 3 months , ( iv ) have received clopidogrel , warfarin , or other anticoagulant medications in the previous 4 months , which may increase the risk for false - positive results on fit , or ( v ) have a condition that would make screening inappropriate ( e.g. end - stage renal disease , receipt of current hospice care ) .
the brief atcs included information about the benefits of crc screening , encouraged the use of fit as a relatively low - risk method of screening , and allowed patients to request an fit kit by pressing a number on their telephone ( mosen et al . , 2010 ) .
for this study , we used the oc - micro ( polymedco , cortland manor , new york , usa ) , a latex agglutination fit with analytical characteristics similar to the discontinued oc - hemodia . the oc - auto micro 80 instrument processed and quantified the fit results at the manufacturer - recommended concentration cutoff value of 100 ng hemoglobin ( hb)/1 ml of buffer ( 20 ghb / g feces ) for a positive test result .
invitees received illustrated , english - language instructions on sampling feces from one bowel movement by briefly sweeping the tip of a probe several times though the feces , while the feces was suspended on a paper raft ( provided ) that kept the feces clear of toilet water .
after sampling , they were to insert the probe into the collection tube , enter the date of collection on the side of the tube , place the tube in a plastic bag , and insert the bag in a prestamped cardstock envelope that was preaddressed to a central laboratory .
participants also had the option of bringing the completed kit with them to a local laboratory at their own clinic site , although this was not expressly outlined in the instructions .
participants in the 2-fit group had the same instructions , except for an additional line in the instructions advising them to go through the collection process twice and send both kits in one envelope .
a total of 3971 members received an atc and requested an fit between 29 august 2012 and 27 february 2013 .
of these 3971 members , we excluded 850 ; 94% of these members were excluded because they lacked continuous health plan membership in the year before enrollment .
1559 were assigned to the 1-fit group ( receiving one fit kit ) , whereas 1562 were assigned to the 2-fit group ( receiving two fit kits ) .
after randomization , but before mailing , 19 members in the 1-fit group and 20 members in the 2-fit group were excluded because of an incorrect address . an additional member in 2-fit group
was excluded because of being randomized twice ( total excluded=21 ) . of the remaining population
, we mailed fit kits to the homes of 1540 members of the 1-fit group and 1541 members of the 2-fit group .
the primary outcome measure was completion of the fit within 180 days of the index date ( mailing date ) .
fit completion was defined as completion and return of a one - sample test ( 1-fit group ) or both sample tests ( 2-fit group ) .
other explanatory variables included age ( < 60 and > 60 years ) , sex , and prior screening status ( whether the patient had been previously screened by any method ) .
prior screening status was assessed through automated extraction from the electronic medical record ( emr ) of information on any previously completed crc screening test ( colonoscopy , flexible sigmoidoscopy , or fecal testing ) , before randomization .
prior screening was assessed for the following time intervals before the index date : colonoscopy , 10 years ; sigmoidoscopy , 5 years ; and fit , 1 year .
for descriptive purposes , we compared the 1-fit and 2-fit groups in terms of race or ethnicity ( white , non - white , unknown ) , family history of crc , charlson comorbidity index ( cci ; charlson et al . , 1987 ; deyo et al .
, 1992 ; a score of 0 , 1 , 2 + ) , bmi ( kg / m ; < 30 , > 30 , and unknown ) , and a proxy measure for low socioeconomic status ( ses ; yes , no ) . race / ethnicity was available through automated extraction from the emr ( white , non - white , and unknown ) .
we ascertained a family history of crc using two separate methods : we searched for the presence of a diagnosis code as far back as membership existed for international classification of diseases 9th edition , clinical modification code : v16.0 , or for a family history of malignant neoplasm of the gastrointestinal tract .
we also asked the patients to return the survey enclosed with the fit kit(s ) they received , which asked about a family history of crc in any relative .
the cci is a well - established measure for assessing comorbidity ; we extracted all relevant diagnosis codes to inform this index from the emr , drawing on the prior year of inpatient and outpatient visits and from the permanent problem list .
we assessed ses through census block ( demographic data are available through the emr ) .
low ses was defined as either : ( i ) more than 20% of the individual s census block with less than a 12th - grade education , or ( ii ) more than 20% of the individual s census block below the federal family poverty level ( kuntz et al . , 2012 ) .
first , we used -tests to compare the 1-fit and 2-fit groups for variables that had not been considered in the stratified randomization , namely , family history of crc , cci , race / ethnicity , ses , and bmi .
we used cox proportional hazard regression models for the primary analysis of time before return of the fit kit(s ) , in days , during the 6-month follow - up period .
in addition , we examined whether test uptake differed on the basis of age , sex , and prior crc screening by testing interaction terms with group assignment ( 1-fit or 2-fit group ) .
the final cox regression model included : ( i ) fit group [ 1-fit ( reference group ) vs. 2-fit ] , ( ii ) age [ < 60 years ( reference group ) vs. > 60 years ] , ( iii ) sex [ male ( reference group ) vs. female ] , and ( iv ) prior crc screening [ no ( reference group ) vs. yes ] .
the study was conducted at kaiser permanente northwest , a nonprofit hmo with about 485 000 members in southwest washington and the portland , oregon , metropolitan area .
the demographic characteristics ( age , sex , race / ethnicity ) of the members are similar to those of the population in the area .
kaiser permanente northwest regional electronic databases provided data on patient membership , demographics , primary - care assignment , and clinical data ( including weight and height , laboratory results , and other healthcare utilization , such as crc screening ) .
these data capture more than 95% of all medical and pharmacy services that members receive , and data are linked through each member s health record number .
we included hmo members aged between 50 and 75 years who were at an average risk for crc and were overdue for screening , and who ( i ) received an automated telephone call ( atc ) as part of a crc screening outreach campaign and ( ii ) requested that an fit kit be sent directly to their home ( through mail ) at the end of the automated call .
the specific details of the automated call , including the definition of average risk , have been described previously ( mosen et al . , 2010 ) .
briefly , the average - risk population includes those who are overdue for screening and do not meet any of the following criteria : ( i ) have risk factors that would indicate need for nonroutine screening ( e.g. presence of inflammatory bowel disease ) , ( ii ) have been diagnosed with adenomatous polyps or crc , ( iii ) have been referred for colonoscopy or sigmoidoscopy in the previous 3 months , ( iv ) have received clopidogrel , warfarin , or other anticoagulant medications in the previous 4 months , which may increase the risk for false - positive results on fit , or ( v ) have a condition that would make screening inappropriate ( e.g. end - stage renal disease , receipt of current hospice care ) .
the brief atcs included information about the benefits of crc screening , encouraged the use of fit as a relatively low - risk method of screening , and allowed patients to request an fit kit by pressing a number on their telephone ( mosen et al . , 2010 ) .
for this study , we used the oc - micro ( polymedco , cortland manor , new york , usa ) , a latex agglutination fit with analytical characteristics similar to the discontinued oc - hemodia .
the oc - auto micro 80 instrument processed and quantified the fit results at the manufacturer - recommended concentration cutoff value of 100 ng hemoglobin ( hb)/1 ml of buffer ( 20 ghb / g feces ) for a positive test result .
invitees received illustrated , english - language instructions on sampling feces from one bowel movement by briefly sweeping the tip of a probe several times though the feces , while the feces was suspended on a paper raft ( provided ) that kept the feces clear of toilet water . after sampling ,
they were to insert the probe into the collection tube , enter the date of collection on the side of the tube , place the tube in a plastic bag , and insert the bag in a prestamped cardstock envelope that was preaddressed to a central laboratory .
participants also had the option of bringing the completed kit with them to a local laboratory at their own clinic site , although this was not expressly outlined in the instructions .
participants in the 2-fit group had the same instructions , except for an additional line in the instructions advising them to go through the collection process twice and send both kits in one envelope .
a total of 3971 members received an atc and requested an fit between 29 august 2012 and 27 february 2013 .
of these 3971 members , we excluded 850 ; 94% of these members were excluded because they lacked continuous health plan membership in the year before enrollment .
1559 were assigned to the 1-fit group ( receiving one fit kit ) , whereas 1562 were assigned to the 2-fit group ( receiving two fit kits ) .
after randomization , but before mailing , 19 members in the 1-fit group and 20 members in the 2-fit group were excluded because of an incorrect address .
an additional member in 2-fit group was excluded because of being randomized twice ( total excluded=21 ) . of the remaining population
, we mailed fit kits to the homes of 1540 members of the 1-fit group and 1541 members of the 2-fit group .
the primary outcome measure was completion of the fit within 180 days of the index date ( mailing date ) .
fit completion was defined as completion and return of a one - sample test ( 1-fit group ) or both sample tests ( 2-fit group ) .
other explanatory variables included age ( < 60 and > 60 years ) , sex , and prior screening status ( whether the patient had been previously screened by any method ) .
prior screening status was assessed through automated extraction from the electronic medical record ( emr ) of information on any previously completed crc screening test ( colonoscopy , flexible sigmoidoscopy , or fecal testing ) , before randomization .
prior screening was assessed for the following time intervals before the index date : colonoscopy , 10 years ; sigmoidoscopy , 5 years ; and fit , 1 year . for descriptive purposes , we compared the 1-fit and 2-fit groups in terms of race or ethnicity ( white , non - white , unknown ) , family history of crc , charlson comorbidity index ( cci ; charlson et al . , 1987 ; deyo et al . , 1992 ;
a score of 0 , 1 , 2 + ) , bmi ( kg / m ; < 30 , > 30 , and unknown ) , and a proxy measure for low socioeconomic status ( ses ; yes , no ) . race / ethnicity was available through automated extraction from the emr ( white , non - white , and unknown ) .
we ascertained a family history of crc using two separate methods : we searched for the presence of a diagnosis code as far back as membership existed for international classification of diseases 9th edition , clinical modification code : v16.0 , or for a family history of malignant neoplasm of the gastrointestinal tract .
we also asked the patients to return the survey enclosed with the fit kit(s ) they received , which asked about a family history of crc in any relative .
the cci is a well - established measure for assessing comorbidity ; we extracted all relevant diagnosis codes to inform this index from the emr , drawing on the prior year of inpatient and outpatient visits and from the permanent problem list .
we assessed ses through census block ( demographic data are available through the emr ) .
low ses was defined as either : ( i ) more than 20% of the individual s census block with less than a 12th - grade education , or ( ii ) more than 20% of the individual s census block below the federal family poverty level ( kuntz et al . , 2012 ) .
first , we used -tests to compare the 1-fit and 2-fit groups for variables that had not been considered in the stratified randomization , namely , family history of crc , cci , race / ethnicity , ses , and bmi .
we used cox proportional hazard regression models for the primary analysis of time before return of the fit kit(s ) , in days , during the 6-month follow - up period .
in addition , we examined whether test uptake differed on the basis of age , sex , and prior crc screening by testing interaction terms with group assignment ( 1-fit or 2-fit group ) .
the final cox regression model included : ( i ) fit group [ 1-fit ( reference group ) vs. 2-fit ] , ( ii ) age [ < 60 years ( reference group ) vs. > 60 years ] , ( iii ) sex [ male ( reference group ) vs. female ] , and ( iv ) prior crc screening [ no ( reference group ) vs. yes ] .
we found no statistically significant differences between the two groups for any of the baseline characteristics .
about 20% in each group had received some prior crc screening , whereas less than 5% had a family history of crc , as determined by self - report or emr .
indicative of a population with low severity of illness , about 65% of the participants in both groups had a cci score of 0 .
finally , more than 40% of the population in both groups were categorized as obese , and about 20% were of low ses .
baseline population characteristics : 1-fit versus 2-fit six months after fit mailing , 43.3% of the 1-fit group had completed and returned the 1-fit kit compared with 39.6% ( p=0.012 ) of the 2-fit group ( table 2 ) .
figure 2 shows the unadjusted time to completion of the fit kits for both groups , measured in days . in both groups ,
more kits were completed during the first 3045 days after mailing , with more 1-fit kits being completed and returned during the initial period . however , from 46 days until the end of the observation period , the two study group lines remained parallel , suggesting no additional gain with time in patient adherence for the 1-fit group compared with the 2-fit group .
6 months after fit mailing kaplan meier curve : time to completion of the fit .
compared with the 1-fit group , the 2-fit group was found to be less likely to complete the fit on both unadjusted [ hazard ratio ( hr)=0.87 ; 95% confidence interval ( ci)=0.780.97 ; p=0.012 ] and adjusted ( hr=0.87 ; 95% ci=0.780.97 ; p=0.010 ) analyses . in addition , there was no significant interaction among group types ( 2-fit vs. 1-fit ) by age , sex , or receipt of prior screening ( results not shown ) .
cox regression results : completion of fit 6 months after fit mailing age and receipt of prior crc screening were also significantly associated with completion of fit .
adults aged 60 years or older ( vs. < 60 years ) were found to be more likely to complete the fit on unadjusted ( hr=1.40 ; 95% ci=1.261.57 ; p<0.001 ) and adjusted ( hr=1.31 ; 95% ci=1.171.47 ; p<0.001 ) analyses .
finally , those who had received prior crc screening ( vs. nonreceipt of screening ) were found to be more likely to complete the fit on both unadjusted ( hr=1.89 ; 95% ci=1.682.14 ; p<0.001 ) and adjusted analyses ( hr=1.82 ; 95% ci=1.612.06 ; p<0.001 ) .
this randomized controlled trial found that a two - sample fit regimen resulted in a relative reduction in test completion ( 13% ; absolute reduction , 3.7% ) at 6 months after fit mailing , compared with the one - sample fit regimen , in a population of adults aged between 50 and 75 years at an average risk for crc .
we found this difference in test completion rates even after adjusting for age , sex , and prior screening .
older age and receipt of prior crc screening were associated with fit completion in both groups , a finding consistent with previous research ( mosen et al . , 2010 ) . however , there was no interaction between adherence and age , sex , or receipt of prior screening ; lower adherence in the 2-fit group was consistent across these subgroups .
the current study design was able to isolate the effect of requiring a second fecal sample on uptake of a mailed fit screening program . a previous small randomized adherence trial ( cole et al . , 2003 )
comparing participant uptake among three groups , two - sample fit , three - sample fit , and three - sample gfobt , used two different fits with unique packaging and sampling techniques .
they found increased uptake of the two - sample fit ( 39.6% ) as compared with the three - sample fit ( 23.4% ) , but it was unclear how the differences in test instructions and sampling techniques among brands may have affected completion .
( 2008 ) that found little difference in test completion between the 1-fit and 2-fit groups ( 1-fit=43.5% , 2-fit=42% ) had also compared two separate brands of fit .
our findings indicate that there is a 3.7% absolute decrease in uptake of the oc - micro fit when a second sample is required .
a prior study ( n=770 ) on oc - micro in an asymptomatic population found a 1415% increase in the sensitivity for crc detection with the addition of a second sample ( park et al . , 2010 ) .
a prior study on oc - micro in a high - risk ( symptomatic ) population found an 814% increase in the sensitivity for detection of advanced adenomas with the addition of a second sample ( rozen et al . , 2009 ) .
although magstream , another quantitative fit that uses a similar sampling technique ( morikawa et al . , 2005 ; launoy et al . ,
2005 ) , would likely have a similar reduction in uptake with the addition of a second sample , no published studies have evaluated this .
however , studies do suggest that lowering the cutoff concentration of hemoglobin for a single - sample test ( which is a capability of quantitative fits ) may achieve similar gains in sensitivity 813% for oc - micro ( park et al . , 2010 ; de wijkerslooth et al . , 2012 ) and 825% for magstream ( launoy et al . , 2005 ) with mild decreases in specificity .
the use of oc - micro in key studies makes optimization of fit performance important .
the two ongoing randomized trials comparing the effectiveness of fit and colonoscopy use a single - sample version of oc - micro , although with different cutoff concentrations ( 15 ghb / g feces and 20 ghb / g feces ; international units ; fraser et al . , 2012 ) for signifying a positive test . the results of these studies are likely to impact recommendations on the relative effectiveness of primary screening with both fit and colonoscopy . although we found a statistically significant difference in test completion rates between one - sample fit and two - sample fit , the 3.7% absolute difference could potentially be offset by investment of system resources to increase participant test completion .
our study did not utilize reminder calls or letters after the initial automated phone call to prompt participants to complete the fit that they had received .
prior studies have demonstrated that repeated use of automated phone calls ( mosen et al . , 2010 ; hendren et al .
, 2014 ) and tailored navigation ( myers et al . , 2007 , 2008 ; green et al . , 2013 )
increase completion rates in crc screening , with tailored navigation producing the highest completion rates ( myers et al .
in addition , although we did find lower participant uptake in the 2-fit group , 2.2% ( n=34 ) of the 2-fit group completed one of the two sampling procedures in the fit kit , suggesting an interest in test completion .
if this population had completed both fit sampling procedures , the differences in participant uptake between the 1-fit and 2-fit groups would have been reduced ( 43.3 vs. 41.8% ) .
further outreach and education efforts ( e.g. tailored navigation ) may reduce differences in 1-fit and 2-fit uptake .
further research ( including that underway by the authors ) will better illuminate the relative effects of sample number and cutoff concentration of hemoglobin on the effectiveness ( and cost - effectiveness ) of this and similar fits .
cost - effectiveness research is important as only a few rigorous studies have been completed ( goede et al . , 2013 ) .
first , the findings may not be generalizable beyond a group - model hmo setting . however , notwithstanding this limitation , study results are likely applicable to other delivery systems , given that the mailing of fit kits is a simple direct - to - participant intervention .
second , the study included few racial or ethnic minorities , limiting our ability to determine whether the main study findings would be similar in more diverse populations .
this randomized controlled trial found slightly lower completion rates of fit among those assigned two - sample fit kits , compared with those assigned one - sample fit kits , after adjusting for age , sex , and receipt of prior crc screening .
indicative of a nonsignificant interaction effect , lower participant uptake in the 2-fit group did not vary by age , sex , or receipt of prior crc screening .
this randomized controlled trial found slightly lower completion rates of fit among those assigned two - sample fit kits , compared with those assigned one - sample fit kits , after adjusting for age , sex , and receipt of prior crc screening .
indicative of a nonsignificant interaction effect , lower participant uptake in the 2-fit group did not vary by age , sex , or receipt of prior crc screening .
| backgroundfecal immunochemical tests ( fits ) are recommended to screen average - risk adults for colorectal cancer ( crc ) .
little research has examined whether a two - sample fit affects participant uptake , compared with a one - sample fit .
examining participant uptake is important , as evidence suggests that a two - sample fit may increase the sensitivity to detect crc.objectivethis study had two objectives : ( i ) to evaluate fit completion in a population that received either a one - sample fit kit ( 1-fit ) or a two - sample fit kit ( 2-fit ) and ( ii ) to understand whether uptake varies by age , sex , or receipt of prior crc screening.methodswe conducted a randomized controlled trial in which 3081 participants who were aged between 50 and 75 years and were at an average risk for crc , and who had requested fits , randomly received 1-fit ( n=1540 ) or 2-fit ( n=1541 ) kits .
fit completion was defined as the completion and return of a one - sample test by the patients in the 1-fit group or of both sample tests by those in the 2-fit group .
cox proportional hazard regression models were used to determine the independent effect of group type ( 2-fit vs. 1-fit ) on the completion of the fit , adjusting for age , sex , and receipt of prior crc screening.resultsthe 2-fit group had lower test completion rates ( hazard ratio=0.87 ; 95% confidence interval=0.780.97 ; p=0.01 ) after adjusting for age , sex , and receipt of prior crc screening .
participant uptake did not vary by age , sex , or receipt of prior crc screening.conclusionthis unique , rigorous randomized controlled trial found that the 2-fit regimen decreases completion of fit .
further research is needed to understand whether decreases in participant uptake are offset by increased gains in test sensitivity . |
eukaryotic genomes have developed a variety of strategies for efficiently orchestrating the complex patterns of gene expression required for proper cellular differentiation .
comparative genome analyses suggest that developmental evolution is largely driven by the increase in the complexity of these expression patterns .
consistent with this hypothesis , recent studies indicate that transcription factor - coding genes tend to be under greater positive evolutionary selection compared with other genes . to establish and maintain cell - specific patterns of gene expression ,
regions of the genome are kept in a silenced state while immediately adjacent regions are transcriptionally active because of the presence of promiscuous enhancer elements that can act over large distances .
insulators were originally described as dna regulatory elements that ensure the progress of an accurate transcriptional program by keeping in check communication between enhancers and promoters and creating boundaries that prevent inappropriate interactions between adjacent chromatin domains .
accu mu lating evidence suggests that these properties of insulators arise from their ability to mediate intra- and inter - chromosomal interactions , which result in the formation of chromatin loops through clustering of multiple insulator sites . depending on the complexity of the genome ,
the capability to mediate long - range interactions with other protein complexes may allow insulator proteins to carry out a variety of functions in the nucleus .
ccctc - binding factor ( ctcf ) is the only known insulator protein necessary for establishing patterns of nuclear architecture and transcriptional control in vertebrates .
this protein is also found in invertebrates such as anopheles gambiae , aedes aegypti and drosophila melanogaster . a recent study by heger et al . in bmc molecular biology has shown that the gene encoding ctcf is not present in the genomes of several model organisms , including saccharomyces cerevisiae , schizosaccharomyces pombe , arabidopsis thaliana and caenorhabditis elegans . because of the widespread presence of insulators and the essential role of ctcf in a wide variety of eukaryotic organisms , this absence of the gene in other organisms raises the possibility that other regulatory mechanisms might have evolved to replace the function of this protein . here
, we provide a brief overview of how insulator proteins work in drosophila and vertebrates , as well as how plants and fungi may have adapted different proteins to accomplish insulator function .
we also discuss how insulator proteins such as ctcf may have evolved new functions to handle more complex genomes in animals .
the mechanisms of insulator function are best understood from analyses of the gypsy element of drosophila .
gypsy insulator sites are bound by the suppressor of hairy - wing protein ( su(hw ) ) , in a sequence - specific manner .
this protein in turn recruits other factors , including centrosomal protein 190 kda ( cp190 ) , modifier of mdg4 ( mod(mdg4)2.2 ) , topoisomerase i - interacting rs protein ( dtopors ) and rna , to form clusters of ' insulator bodies ' ( consisting of these proteins and dna ) with multiple gypsy sites ( figure 1a ) .
recently , other drosophila insulator proteins , dctcf and boundary element asso ciated factor ( beaf ) , have also been shown to recruit cp190 to specific dna sites , suggesting that loop formation through long - range protein interactions mediated by cp190 might be the underlying mechanism for insulator function in drosophila .
loop formation through intra- and inter - chromosomal interactions is a common strategy for genome organization and insulation in different organisms .
( a ) in drosophila , the su(hw ) protein binds to specific dna elements and recruits the cp190 protein and mod(mdg4)2.2 proteins .
mod(mdg4)2.2 attaches the chromatin to the nuclear periphery through its interaction with topoisomerase i - interacting rs protein ( dtopors ) .
( b ) monoallelic expression at the igf2-h19 locus is regulated by binding of ctcf to the imprinted control region ( icr ) . on the maternal allele ,
ctcf mediates interactions between icr and dna methylated region 1 ( dmr1 ) that also involve joining of the dna strands by cohesin , insulating igf2 from the influence of downstream enhancers .
methylated icr sequences prevent ctcf from binding to the icr on the paternal allele , allowing downstream enhancers to switch on igf2 transcription .
( c ) in s. pombe , tfiiic binds to rna polymerase ( pol ) iii at trna genes and acts as a barrier against the spreading of heterochromatin .
it is also hypothesized to organize the chromatin into distinct loops by clustering various chromosome - organizing clamp ( coc ) loci to the nuclear periphery .
( d ) in a. thaliana , binding of the asymmetric leaves1 ( as1)-as2 complex at two specific dna sites flanking the enhancer is required to silence the expression of the bp gene .
recruitment of the histone chaperone hira is necessary for this process , and it probably acts by facilitating looping of the enhancer element .
the concept of intra- and inter - chromosomal interaction mediated by insulator proteins in drosophila seems to be applicable to the ctcf insulator in vertebrates , despite the involvement of a different set of protein complexes .
the mechanism of ctcf function in vertebrates is best illustrated by the mouse imprinted igf2-h19 locus , where four ctcf - binding sites are located at the imprinted control region ( icr ) that lies between the igf2 gene and its downstream enhancers ( figure 1b ) .
ctcf binds to these sites on the maternally inherited allele but not on the methylated paternal copy .
chromatin conformation capture ( 3c ) experiments revealed distinct long - range chromosomal interactions that are specific to the parent of origin ( figure 1b ) . on the maternal allele , a ctcf - dependent loop formed by contacts between dna methylated region 1 ( dmr1 ) and
however , on the paternal allele , contacts between dmr2 and icr allow downstream enhancers to activate the igf2 gene .
given that cp190 protein has been shown to interact with ctcf in drosophila , what proteins could then mediate ctcf - depen dent looping of chromatin in vertebrates ?
it is therefore plausible that cohesin can create or stabilize dna loops during interphase by physically connecting different ctcf - binding sites on the same or different dna molecules , in a manner similar to cp190 and mod(mdg4 ) proteins in drosophila .
if ctcf or functionally similar proteins have a role in establishing patterns of nuclear organization by mediating intra- and inter - chromosomal interactions , how do organisms that lack ctcf homologs accomplish the same goal ? in s. pombe and s. cerevisiae , the transcription factor tfiiic seems to have this role . in fission yeast , binding of tfiiic to b - box sequences in the inverted repeat boundary elements can prevent the spreading of heterochromatin from the silenced mating - type loci to neighboring euchromatic regions .
detailed genome - wide analyses reveal that tfiiic associates with rna polymerase ( pol ) iii on all trna genes , which are mostly found at pericentromeric heterochromatin domain boundaries .
in addition , tfiiic binds to many sites between divergent promoters in the absence of pol iii and acts as a chromosome - organizing clamp ( coc ) by tethering distant loci to the nuclear periphery ( figure 1c ) .
similarly , tfiiic recruited to trna genes in budding yeast can act as both an enhancer - blocking insulator and a heterochromatin barrier by preventing ectopic spreading of sir protein - mediated silencing .
these results uncover a general mechanism of genome organization involving the conserved tfiiic complex in yeast .
studies of the process by which knotted1-like homeobox ( knox ) genes are silenced during organogenesis suggest that a. thaliana may also use chromatin looping as a way of regulating gene expression .
stable knox gene silencing requires the dna - binding proteins asymmetric leaves1 ( as1 ) and as2 and the chromatin - remodeling factor hira . as1 and as2 form a repressor complex that binds directly to two dna motif sites that flank the enhancer element of the knox genes brevipedicellus ( bp ) and knotted - like arabidopsis ( knat2 ) .
these results suggest that as1-as2 complexes interact to create a loop in the knox promoter and , through recruitment of hira , to form a repressive chromatin state that blocks enhancer activity during organogenesis ( figure 1d ) .
this regulatory mechanism , which may be conserved among plants with compound leaves , is conceptually similar to the action of an insulator in drosophila and vertebrates .
recent phylogenetic studies using the zinc - finger protein sets from 35 completely sequenced nematodes has discovered the presence of ctcf - like genes in only three basal nematodes and not in other derived nematodes such as c. elegans .
this suggests that ctcf might have been lost during nematode evolution , probably as a result of a switch from gene regulatory mechanisms involving distantly acting elements and chromatin insulation to polycistronic transcriptional units .
however , the presence of higher - order genome organization in yeast suggests the possibility that other protein complexes may have evolved to replace ctcf functions in c. elegans .
the underlying theme governing insulator function seems to be the establishment of intra- and inter - chromosomal interactions that bring different sequences in close proximity within the nucleus to accomplish a variety of outcomes .
it is also clear that insulator proteins such as ctcf may have acquired additional functions with increased complexity of the genome ( reviewed in ) . in yeast ( s. cerevisiae ) , which has a haploid genome size of 13 megabases , the primary insulator function of tfiiic seems to be the demarcation of chromatin into distinct domains for blockage of heterochromatin silencing . in a. thaliana , in which genes are only infrequently interrupted by repetitive elements outside the centromeric regions
long - range interactions mediated by insulator proteins have wider functional implications for drosophila and mammals . in drosophila ,
different insulators have diverse dna occupancy patterns with respect to gene features , suggesting that the various insulator functions have diversified by using different insulator dna - binding proteins with a common interacting partner .
interestingly , vertebrate cells , which contain a larger genome that requires more complex forms of regulation , seem to require ctcf to have a wider set of regulatory roles . these include transcriptional regulation of gene expression at the major histocompatibility complex class ii , -globin and interferon- loci , v(d)j recombination at the immunoglobulin - encoding igh and igk loci , mono - allelic expression of imprinted genes and x - chromosome inactivation .
the ability to have such varied roles must rely on context - dependent interactions with a variety of partners .
work in the authors ' laboratory is supported by public health service award gm35463 from the national institutes of health . | insulator elements mediate intra- and inter - chromosomal interactions .
the insulator protein ccctc - binding factor ( ctcf ) is important for insulator function in several animals but a report in bmc molecular biology shows that caenorhabditis elegans , yeast and plants lack ctcf .
alternative proteins may have a similar function in these organisms . |
musculoskeletal tissues show increased bone fragility , loss of cartilage resilience , reduced ligament elasticity , loss of muscular strength , and fat redistribution decreasing the ability of the tissues to carry out their normal functions .
the loss of mobility and physical independence resulting from arthropathies and fractures can be particularly devastating in this population , not just physically and psychologically , but also in terms of increased mortality rates .
the aim of this article is to present some of the most frequent musculoskeletal disorders of the elderly , including some misleading presentations .
we used the following terms and some of its combinations : elderly , aged , epidemiology , fracture , osteoporosis , vertebral , hip , pelvis , arthritis , neoplasm , malignancy , myeloma , paget , gout , infection , microcrystal , and radiology .
articles without english abstracts were excluded . besides , certain relevant rheumatological , orthopedic , and radiological books were also used .
fractures are frequent in the elderly and result mainly from the effects of falls and osteoporosis .
low - impact falls , even from standing height , are the most common cause of injury in geriatric patients . falling is a multi - factorial problem due to both extrinsic ( e.g. , environmental and housing conditions ) and intrinsic risk factors ( e.g. , impaired mobility , loss of muscular strength , poor visual acuity , and medication , for instance corticoids).[46 ] osteoporosis , which is characterized by qualitatively normal , but quantitatively deficient bone , leads to bone fragility and increased risk of fractures .
the general prevalence of osteoporosis in women is approximately 50% at the age of 85 years , while in men the prevalence is about 20% at that age .
ethnic differences also exist : mineral bone density is higher in black women and lower in asian women , while in white women evidence shows an intermediate value .
due to its precision , the most widely used quantitative technique is dual energy x - ray absorptiometry , which makes it possible to diagnose osteoporosis early , predict the risk of fracture , determine therapeutic intervention , and monitor response to treatment . this method grades bone loss according to standard deviations ( sd ) from the mean young adult value .
a value less than 2.5 times the sd below the young adult mean , is considered to indicate osteoporosis .
the main radiographic features of osteoporosis are increased radiolucency and cortical thinning , mainly in the spine , giving rise to a well - demarcated outline of the vertebral body , which has been described as ,
picture framing. besides , in the spine , an increased biconcavity of the vertebral end plates , with a protrusion of the intervertebral disk into the vertebral body can be observed .
however , early radiographic changes are subtle , as a bone loss of approximately 30% must occur before it can be detected .
vertebral compression fractures are the most common osteoporotic fractures , with a greater incidence in women over 60 years of age .
they can be observed in up to 25% of women over 70 years of age and 40% of those over 80 years .
after one episode , the risk of subsequent vertebral fracture increases at least four - fold , with substantially increased rates during the first year . these fractures are associated with higher mortality and significant morbidity , even though they are afforded little clinical attention .
they often appear as multiple fractures with anterior wedging , and may be associated with significant deformity , leading to kyphosis .
they are usually well demonstrated on radiographs , but can be better assessed with computed tomography ( ct ) or magnetic resonance ( mr ) imaging , when necessary .
the latter imaging modality may be indicated in case of associated neurological symptoms a rare event or when a vertebroplasty is discussed , in order to better localize the recently fractured vertebra .
vertebral compression fractures in the elderly may involve several problems : first is differentiating between osteoporotic and malignant vertebral collapse ( vc ) , particularly metastatic vc , as the latter is by far the most common malignant tumor affecting the skeleton in the elderly . in most patients ,
multiple , relatively symmetrical thoracolumbar vcs , associated with diffuse increased radiolucency are suggestive of osteoporosis [ figure 1a ] .
the whole vertebral endplate is impacted , sometimes in association with increased or decreased radiolucency of the subjacent trabecular bone ( band - like distribution of the abnormalities under the fractured vertebral end plate ) .
gas can also be seen under the fracture and is nearly pathognomonic of the benign nature of the collapse .
there is no cortical osteolysis , although fractures can be identified with retropulsion of a bone fragment .
conversely , the following are a cause for concern : a single vc , involvement of the cervical spine , heterogeneous increased or decreased radiolucency that can not be explained by an underlying end plate fracture , a focal collapse ( on the ap or lateral view ) , or a bulging of the vertebral body or cortical osteolysis [ figure 1b ] . if in doubt or for a better assessment of the spinal canal and soft tissue , ct , or better yet , an mri can be performed , in order to differentiate between these two disorders . in benign fractures ,
an mri may show a band distribution of abnormal signal intensities on t1 and t2 weighted images , spared normal bone marrow signal intensity , retropulsion of a posterior bone fragment , and multiple compression fractures ; on the contrary , signs such as a convex posterior border of the vertebral body , abnormal signal intensity of the posterior elements , an epidural mass or a focal paraspinal mass are suggestive of spinal metastasis.[1921 ] second , vertebral fractures can be missed following moderate trauma , because the fracture may be difficult to identify in an osteoporotic radiolucent bone and / or because the pain is attributed to another painful condition , such as degenerative changes .
this is observed in particular in the cervical spine , particularly at c2 , and may lead to secondary neurological complications [ figure 2 ] .
ankylosis may be related to ankylosing spondylitis and diffuse idiopathic skeletal hyperostosis , which especially affect males and they have an estimated frequency of 5 to 15% in the elderly.[2225 ] these ankylosed spines become increasingly susceptible to injury , even in the event of low - energy impacts , and are prone to unstable vertebral fractures with an increased frequency of neurological complications , either primary or secondary , after unprotected transfers and manipulation .
these lesions may be missed on plain films when non - displaced or mildly displaced , especially in hyperextension , whereas , they are well demonstrated on ct or mr imaging . however
, the mri features can sometimes be misleading and mimic infectious spondylitis when signal abnormalities of the disco - vertebral junction are present .
caution is required when an elderly patient presents with an ankylosed spine , minor trauma or acute pain , especially if signal abnormalities of the anterior and posterior spine are observed [ figure 3 ] .
usual benign vertebral compression ( a ) multiple levels , diffuse radiolucency , and whole vertebral endplate involvement ( arrows ) ; usual malignant vertebral compression characteristics ( b ) single vertebral involvement , focal and bulging of the posterior wall ( arrowheads ) . missed fracture of the odontoid process and vertebral body of c2 ( arrows ) in a patient with a history of fall one month before .
transverse fracture of thoracic vertebral body ( arrow ) and posterior arch ( arrowhead ) with posterior epidural hematoma ( curved arrow ) in an ankylosed spine depicted on ( a ) t1- and ( b ) t2-weighted sequences .
other important sites of fractures are the hip and the pelvis , which are associated with increased mortality and specific diagnostic problems in the elderly population .
they are common and frequently result from lateral falls directly on the greater trochanter , in the case of hip fractures , and forward or backward falls in the case of pelvic fractures .
most fractures are easily diagnosed by conventional radiography , particularly fractures of the proximal femur .
however , non - displaced fractures may be negative or equivocal , particularly if the bone is osteoporotic .
if a clinical suspicion of a fracture persists , ct or better still mr imaging is advocated , as this modality can show the fracture line surrounded by bone marrow edema .
they may occur everywhere , but are particularly common in the hip and pelvis , the majority being located in the sacrum and pubic ramus [ figure 4 ] .
radiographic findings are often subtle or unremarkable , and in suspected cases mr imaging is indicated due to its superior accuracy as compared to other radiological methods .
all the images should be carefully analyzed , as multiple insufficiency fractures are frequent [ figure 5 ] .
subchondral fractures are particularly difficult to identify on radiographs , but the thin hypointense line that represents the fracture , surrounded by a variable degree of edema , is well demonstrated on an mri [ figure 6 ] . this kind of fracture can be complicated by a necrosis of the subchondral bone , which is hypointense on t2 weighted images , and is not enhanced following gadolinium administration .
insufficiency fractures ( arrows ) located in the sacrum with adjacent edema ( arrowheads ) , better depicted on ( a ) t1- and ( b ) t2- weighted sequences , respectively .
multiple fractures ( white arrows ) in ( a ) the proximal femur and ( b ) pubic ramus on coronal t1-weighted images subchondral fracture of the femoral head : ( a ) conventional radiography and ( b ) fat saturated sagittal t2-weighted image ( white arrow ) .
osteoarthritis ( oa ) can be defined as a group of distinct , but overlapping diseases , which may have different etiologies , but similar biological , morphological , and clinical outcomes affecting the articular cartilage , subchondral bone , ligaments , joint capsule , synovial membrane , and periarticular muscles .
pathological changes can include fibrillation of cartilage , disruption of collagen fibers , changes in proteoglycan staining , chondrocyte proliferation , necrosis , and neovascularization .
oa is the most common joint disease in persons 65 years of age and above , with a radiographic prevalence as high as approximately 90% in women and 80% in men.[3335 ] its etiology is not fully understood , although there are several related factors , such as female gender , genetics , metabolism , and excessive mechanical stress .
it frequently leads to decreased function and loss of independence . although the joints of the hand are the most commonly affected , they are less likely to be symptomatic than the knee or hip [ figure 7 ] . the diagnosis of oa is primarily based on clinical history and physical examination .
plain radiographs can help confirm both the diagnosis and grade the severity of the condition .
the cardinal radiographic features of oa are focal / non - uniform narrowing of the joint space in the areas subjected to the most pressure , subchondral cysts , subchondral sclerosis , and osteophytes .
however , the severity of the spondylolisthesis of the radiographic changes does not correlate with the clinical symptoms .
shoulder oa and rotator cuff disease are also fairly common in the elderly and are associated with significant shoulder pain and disability related to decreased shoulder movement .
direct signs of oa and indirect signs of large rotator cuff tears can be seen on plain films , including superior humeral head migration and remodeling of the acromion and the greater tuberosity .
ultrasound is another valuable tool for easy assessment of the rotator cuff tendons due to its good sensitivity and specificity [ figure 8 ] .
however , when surgical treatment is considered , arthro - ct , or mri may be preferred , in order to improve its planning .
the lumbar and cervical spine is also frequently affected , with degenerative changes of the disk spaces , facet joints , and spinous processes , and sometimes with progressive scoliosis .
although the intervertebral disks are not synovial joints , the pathological changes are similar to those seen in the articular cartilage .
ct and mri are routinely used for the evaluation of narrowing of the central canal , lateral recesses , and neural foramina , when such an assessment is required ( percutaneous or surgical treatment ) . besides , mri can be useful in evaluating marrow changes in the vertebral plate , especially inflammatory changes ( type i modic ) , which present a positive correlation with low back pain . typical osteoarthritis of ( a ) the distal and proximal interphalangeal joints and ( b ) hip joint : joint space narrowing ( arrows ) , subchondral cysts ( arrowheads ) , osteophytes ( curved arrows ) , and subchondral sclerosis ( thick arrow ) .
ultrasound images in ( a ) the long and ( b ) short axis of the supraspinatus tendon demonstrating a complete tear ( arrowheads ) .
the frequency of microcrystal disorders also increases with age ; this is mainly true of gout and calcium pyrophosphate dihydrate deposition ( cpdd ) arthropathy .
gout is the most common inflammatory arthritis in the elderly and is characterized by a disturbance of purine metabolism , with deposits in the joints , cartilage , and kidneys .
the first metatarsophalangeal joint is the most common site of involvement in gouty arthritis [ figure 9 ] , but any joint can be involved .
the typical radiographic features include eccentric nodular soft tissue masses ( particularly suggestive of tophus when they are dense ) , close erosions ( also suggestive when located at a distance from the joint and when associated with an elevated bony margin ) , preservation of the joint space , exuberant bony proliferation , and lack of periarticular osteoporosis .
when the clinical , biological , and radiographic findings are uncertain , an ultrasound may be particularly helpful , as this technique may demonstrate more tophi [ figure 10 ] and erosions than plain films , more synovitis than a clinical examination , suggestive hyperechoic aggregates in the synovium or in the joint fluid , which may be aspirated , and the double contour sign ( an irregular hyperechoic band over the superficial margin of the articular cartilage , related to crystal deposition).[4244 ] calcium pyrophosphate dihydrate deposition ( cpdd ) disease is characterized by articular and periarticular tissue deposits ( hyaline cartilage , fibrocartilage , and other soft - tissue structures ) , even in the spine [ figure 11 ] . unlike gout , in which the increase in serum urates leads to supersaturation and deposits in the joints , in cpdd , the calcium deposits usually appear in the cartilage in the absence of any serum abnormality .
even though such deposits may be seen in asymptomatic patients , they may be associated with the development of severe arthropathies or with acute pain related to the migration of the crystals in the synovial fluid , mimicking septic arthritis .
gout of the first mtp joint in conventional radiography : excentric dense nodular soft tissue mass ( arrows ) , large erosions ( arrowhead ) , lack of periarticular osteoporosis , and exuberant bony proliferation ( curved arrow ) . gout involvement of the mtp ( a ) shows the tophus ( arrow ) with hyperechogenic microcrystal deposits ( arrowheads ) and a thickened synovium ( curved arrows ) . another patient with tophus deposition in the dorsal midfoot ( b ) demonstrates microcrystal deposits ( arrowhead ) with acoustic shadows ( thick arrows ) .
calcium pyrophosphate dihydrate deposition disease demonstrated by deposits of microcrystals in the menisci ( arrow ) , articular cartilage ( arrowhead ) , and periarticular soft tissue ( curved arrow ) .
elderly patients are more prone to infection because of an increased incidence of predisposing disorders ( diabetes mellitus , peripheral vascular disease , poor dentition , ) , immunosuppression and surgical procedures in this population ( dental extractions , open heart surgery , prosthetic joint replacement , ) .
the infectious agents affecting elderly patients are similar to those found in the younger population ; although in the elderly , evidence shows an increased incidence of infection by nosocomial organisms ( due to institutionalization and hospitalization ) .
these infections can have a relatively benign course , as in the case of cellulitis , or serious consequences , as with necrotizing fasciitis .
in patients over 80 years of age , the knee , shoulder , and hip are the most frequently affected joints .
another peculiarity of the elderly , uncommon in adults , is acute hematogenous osteomyelitis that mainly affects the spine .
attention should , moreover , be paid to the diagnosis of tuberculosis , as early manifestations are subtle and advanced disease mimics other infections , granulomatous diseases , and malignancy .
tuberculosis may affect the spine ( about 50% of cases ) , with potential neurological consequences , or any joint , causing deformity [ figure 12 ] .
it should be noted that elderly men may present with bone lesions , as a manifestation of reactivation of the disease . as there are no pathognomonic imaging signs of musculoskeletal tuberculosis ,
the most conclusive means of reaching a diagnosis is by biopsy and culture , as chest radiographs and skin tests may not be positive in the elderly . as regards imaging techniques , magnetic resonance imaging is the modality of choice for musculoskeletal infection , as it best delineates the extension of soft tissue infections .
computed tomography , ultrasound , radiography , and nuclear medicine studies are considered to be ancillary . in some circumstances ultrasound
can be very useful , as it allows the aspiration of fluid collected in the joints or soft tissue , the evaluation of structures adjacent to orthopedic hardware , or the assessment of small peripheral joints . besides , in the case of debilitated elderly patients , a mobile ultrasound device can be easily moved close to their beds .
( a ) on conventional radiography there is mild osteoporosis , extensive soft tissue swelling , and large marginal erosion ( arrowhead ) , ( b ) on doppler ultrasound the synovitis ( arrows ) and bone erosion ( arrowhead ) are well - depicted .
paget 's disease is a bone disorder characterized by an increase in osteoclast - mediated bone resorption accompanied by osteoblast - mediated formation of new bone of inferior quality .
the frequency of this condition is decreasing , but it still exists in 1 5% of persons over 50 years of age , varying according to geographic areas.[5356 ] the radiographic signs include an advancing wedge of bone resorption , an accentuation and coarsening of the bone trabeculae along lines of stress , cortical thickening , and enlargement of the bone [ figure 13 ] . as a result , secondary osteoarthritis , insufficiency fractures , bowing of the bones , and even spinal cord or nerve root compression can be observed . in a minority of cases ,
sarcomatous degeneration may develop , mainly in the humerus , pelvis , and proximal femur , with a frequency believed to range from 0.9 to 2% .
paget 's disease affecting the iliac bone demonstrated with coarsening of the bone trabeculae and cortical thickening ( arrows ) .
tumors : tumors can be revealed by bone pain , pathological fractures , or disability , or be discovered as an incidental finding .
primary bone tumors in elderly patients are not common , but , due to the risk of metastases , any newly discovered bone lesion or one developing within a known pre - existing lesion must be assumed to be malignant until proven otherwise .
metastases : bone metastases are a common complication of malignant disease , especially of the breast , prostate , and lung .
although they are often multiple , a solitary metastasis is still more common than a primary neoplasm .
plain films are relatively insensitive for the detection of bone metastases , especially subtle lesions .
mr imaging is superior to ct in the detection of malignant marrow infiltration , and it has a better contrast resolution for visualizing soft tissue and spinal cord lesions . even with the advances in mri , especially for bone marrow screening , bone scintigraphy continues to be used as an effective method for initial evaluation of the whole body for bone metastases .
sarcomas : in the elderly population , many sarcomas are secondary to a pre - existing disorder of the bone , such as paget 's disease , or lesions treated by radiation .
chondrosarcoma must also be kept in mind , especially when isolated osteolytic lesions of the pelvis are seen , as this is the most common primary sarcoma of bone in adults .
the cartilaginous nature of the lesion may be suggested by the presence of calcifications or by a lobulated hyperintense lesion in an mri [ figure 14 ] .
chondrosarcoma of the pelvis in ( a ) conventional radiography appears as an isolated osteolytic lesion ( arrows ) , ( b ) coronal t2-weighted image demonstrates a lobulated hyperintense lesion ( arrowheads ) .
myeloma : myeloma is a characteristic disease in the elderly population , with a peak incidence in the eighth decade that results from an unregulated , progressive proliferation of neoplastic monoclonal plasma cells that accumulate in the bone marrow , leading to anemia and marrow failure .
osteolytic lesions may be present on plain films , but differentiating osteoporotic vertebral compression fractures from those associated with myeloma is a common diagnostic dilemma , as bone loss may be the first sign revealing the latter disease .
indeed , widespread osteoporosis , due to cytokine - mediated osteoclast activation , is common in patients with myeloma .
this possible association must be kept in mind , particularly if other features are present , including unexplained back or bone pain .
we used the following terms and some of its combinations : elderly , aged , epidemiology , fracture , osteoporosis , vertebral , hip , pelvis , arthritis , neoplasm , malignancy , myeloma , paget , gout , infection , microcrystal , and radiology .
articles without english abstracts were excluded . besides , certain relevant rheumatological , orthopedic , and radiological books were also used .
fractures are frequent in the elderly and result mainly from the effects of falls and osteoporosis .
low - impact falls , even from standing height , are the most common cause of injury in geriatric patients . falling is a multi - factorial problem due to both extrinsic ( e.g. , environmental and housing conditions ) and intrinsic risk factors ( e.g. , impaired mobility , loss of muscular strength , poor visual acuity , and medication , for instance corticoids).[46 ] osteoporosis , which is characterized by qualitatively normal , but quantitatively deficient bone , leads to bone fragility and increased risk of fractures .
the general prevalence of osteoporosis in women is approximately 50% at the age of 85 years , while in men the prevalence is about 20% at that age .
ethnic differences also exist : mineral bone density is higher in black women and lower in asian women , while in white women evidence shows an intermediate value . due to its precision
, the most widely used quantitative technique is dual energy x - ray absorptiometry , which makes it possible to diagnose osteoporosis early , predict the risk of fracture , determine therapeutic intervention , and monitor response to treatment . this method grades bone loss according to standard deviations ( sd ) from the mean young adult value .
a value less than 2.5 times the sd below the young adult mean , is considered to indicate osteoporosis .
the main radiographic features of osteoporosis are increased radiolucency and cortical thinning , mainly in the spine , giving rise to a well - demarcated outline of the vertebral body , which has been described as ,
picture framing. besides , in the spine , an increased biconcavity of the vertebral end plates , with a protrusion of the intervertebral disk into the vertebral body can be observed .
however , early radiographic changes are subtle , as a bone loss of approximately 30% must occur before it can be detected .
vertebral compression fractures are the most common osteoporotic fractures , with a greater incidence in women over 60 years of age .
they can be observed in up to 25% of women over 70 years of age and 40% of those over 80 years .
after one episode , the risk of subsequent vertebral fracture increases at least four - fold , with substantially increased rates during the first year .
these fractures are associated with higher mortality and significant morbidity , even though they are afforded little clinical attention .
they often appear as multiple fractures with anterior wedging , and may be associated with significant deformity , leading to kyphosis .
they are usually well demonstrated on radiographs , but can be better assessed with computed tomography ( ct ) or magnetic resonance ( mr ) imaging , when necessary .
the latter imaging modality may be indicated in case of associated neurological symptoms a rare event or when a vertebroplasty is discussed , in order to better localize the recently fractured vertebra .
vertebral compression fractures in the elderly may involve several problems : first is differentiating between osteoporotic and malignant vertebral collapse ( vc ) , particularly metastatic vc , as the latter is by far the most common malignant tumor affecting the skeleton in the elderly . in most patients ,
multiple , relatively symmetrical thoracolumbar vcs , associated with diffuse increased radiolucency are suggestive of osteoporosis [ figure 1a ] .
the whole vertebral endplate is impacted , sometimes in association with increased or decreased radiolucency of the subjacent trabecular bone ( band - like distribution of the abnormalities under the fractured vertebral end plate ) .
gas can also be seen under the fracture and is nearly pathognomonic of the benign nature of the collapse .
there is no cortical osteolysis , although fractures can be identified with retropulsion of a bone fragment .
conversely , the following are a cause for concern : a single vc , involvement of the cervical spine , heterogeneous increased or decreased radiolucency that can not be explained by an underlying end plate fracture , a focal collapse ( on the ap or lateral view ) , or a bulging of the vertebral body or cortical osteolysis [ figure 1b ] . if in doubt or for a better assessment of the spinal canal and soft tissue , ct , or better yet , an mri can be performed , in order to differentiate between these two disorders . in benign fractures , an mri may show a band distribution of abnormal signal intensities on t1 and t2 weighted images , spared normal bone marrow signal intensity , retropulsion of a posterior bone fragment , and multiple compression fractures ; on the contrary , signs such as a convex posterior border of the vertebral body , abnormal signal intensity of the posterior elements , an epidural mass or a focal paraspinal mass are suggestive of spinal metastasis.[1921 ] second , vertebral fractures can be missed following moderate trauma , because the fracture may be difficult to identify in an osteoporotic radiolucent bone and / or because the pain is attributed to another painful condition , such as degenerative changes .
this is observed in particular in the cervical spine , particularly at c2 , and may lead to secondary neurological complications [ figure 2 ] .
ankylosis may be related to ankylosing spondylitis and diffuse idiopathic skeletal hyperostosis , which especially affect males and they have an estimated frequency of 5 to 15% in the elderly.[2225 ] these ankylosed spines become increasingly susceptible to injury , even in the event of low - energy impacts , and are prone to unstable vertebral fractures with an increased frequency of neurological complications , either primary or secondary , after unprotected transfers and manipulation .
these lesions may be missed on plain films when non - displaced or mildly displaced , especially in hyperextension , whereas , they are well demonstrated on ct or mr imaging .
however , the mri features can sometimes be misleading and mimic infectious spondylitis when signal abnormalities of the disco - vertebral junction are present .
caution is required when an elderly patient presents with an ankylosed spine , minor trauma or acute pain , especially if signal abnormalities of the anterior and posterior spine are observed [ figure 3 ] .
usual benign vertebral compression ( a ) multiple levels , diffuse radiolucency , and whole vertebral endplate involvement ( arrows ) ; usual malignant vertebral compression characteristics ( b ) single vertebral involvement , focal and bulging of the posterior wall ( arrowheads ) . missed fracture of the odontoid process and vertebral body of c2 ( arrows ) in a patient with a history of fall one month before .
transverse fracture of thoracic vertebral body ( arrow ) and posterior arch ( arrowhead ) with posterior epidural hematoma ( curved arrow ) in an ankylosed spine depicted on ( a ) t1- and ( b ) t2-weighted sequences .
other important sites of fractures are the hip and the pelvis , which are associated with increased mortality and specific diagnostic problems in the elderly population .
they are common and frequently result from lateral falls directly on the greater trochanter , in the case of hip fractures , and forward or backward falls in the case of pelvic fractures .
most fractures are easily diagnosed by conventional radiography , particularly fractures of the proximal femur . however , non - displaced fractures may be negative or equivocal , particularly if the bone is osteoporotic .
if a clinical suspicion of a fracture persists , ct or better still mr imaging is advocated , as this modality can show the fracture line surrounded by bone marrow edema .
they may occur everywhere , but are particularly common in the hip and pelvis , the majority being located in the sacrum and pubic ramus [ figure 4 ] .
radiographic findings are often subtle or unremarkable , and in suspected cases mr imaging is indicated due to its superior accuracy as compared to other radiological methods .
all the images should be carefully analyzed , as multiple insufficiency fractures are frequent [ figure 5 ] .
subchondral fractures are particularly difficult to identify on radiographs , but the thin hypointense line that represents the fracture , surrounded by a variable degree of edema , is well demonstrated on an mri [ figure 6 ] . this kind of fracture can be complicated by a necrosis of the subchondral bone , which is hypointense on t2 weighted images , and is not enhanced following gadolinium administration .
insufficiency fractures ( arrows ) located in the sacrum with adjacent edema ( arrowheads ) , better depicted on ( a ) t1- and ( b ) t2- weighted sequences , respectively .
multiple fractures ( white arrows ) in ( a ) the proximal femur and ( b ) pubic ramus on coronal t1-weighted images subchondral fracture of the femoral head : ( a ) conventional radiography and ( b ) fat saturated sagittal t2-weighted image ( white arrow ) .
osteoarthritis ( oa ) can be defined as a group of distinct , but overlapping diseases , which may have different etiologies , but similar biological , morphological , and clinical outcomes affecting the articular cartilage , subchondral bone , ligaments , joint capsule , synovial membrane , and periarticular muscles .
pathological changes can include fibrillation of cartilage , disruption of collagen fibers , changes in proteoglycan staining , chondrocyte proliferation , necrosis , and neovascularization .
oa is the most common joint disease in persons 65 years of age and above , with a radiographic prevalence as high as approximately 90% in women and 80% in men.[3335 ] its etiology is not fully understood , although there are several related factors , such as female gender , genetics , metabolism , and excessive mechanical stress .
although the joints of the hand are the most commonly affected , they are less likely to be symptomatic than the knee or hip [ figure 7 ] . the diagnosis of oa is primarily based on clinical history and physical examination .
plain radiographs can help confirm both the diagnosis and grade the severity of the condition .
the cardinal radiographic features of oa are focal / non - uniform narrowing of the joint space in the areas subjected to the most pressure , subchondral cysts , subchondral sclerosis , and osteophytes .
however , the severity of the spondylolisthesis of the radiographic changes does not correlate with the clinical symptoms .
shoulder oa and rotator cuff disease are also fairly common in the elderly and are associated with significant shoulder pain and disability related to decreased shoulder movement .
direct signs of oa and indirect signs of large rotator cuff tears can be seen on plain films , including superior humeral head migration and remodeling of the acromion and the greater tuberosity .
ultrasound is another valuable tool for easy assessment of the rotator cuff tendons due to its good sensitivity and specificity [ figure 8 ] .
however , when surgical treatment is considered , arthro - ct , or mri may be preferred , in order to improve its planning .
the lumbar and cervical spine is also frequently affected , with degenerative changes of the disk spaces , facet joints , and spinous processes , and sometimes with progressive scoliosis . although the intervertebral disks are not synovial joints , the pathological changes are similar to those seen in the articular cartilage .
ct and mri are routinely used for the evaluation of narrowing of the central canal , lateral recesses , and neural foramina , when such an assessment is required ( percutaneous or surgical treatment ) . besides , mri can be useful in evaluating marrow changes in the vertebral plate , especially inflammatory changes ( type i modic ) , which present a positive correlation with low back pain . typical osteoarthritis of ( a ) the distal and proximal interphalangeal joints and ( b ) hip joint : joint space narrowing ( arrows ) , subchondral cysts ( arrowheads ) , osteophytes ( curved arrows ) , and subchondral sclerosis ( thick arrow ) .
ultrasound images in ( a ) the long and ( b ) short axis of the supraspinatus tendon demonstrating a complete tear ( arrowheads ) .
the frequency of microcrystal disorders also increases with age ; this is mainly true of gout and calcium pyrophosphate dihydrate deposition ( cpdd ) arthropathy .
gout is the most common inflammatory arthritis in the elderly and is characterized by a disturbance of purine metabolism , with deposits in the joints , cartilage , and kidneys .
the first metatarsophalangeal joint is the most common site of involvement in gouty arthritis [ figure 9 ] , but any joint can be involved .
the typical radiographic features include eccentric nodular soft tissue masses ( particularly suggestive of tophus when they are dense ) , close erosions ( also suggestive when located at a distance from the joint and when associated with an elevated bony margin ) , preservation of the joint space , exuberant bony proliferation , and lack of periarticular osteoporosis .
when the clinical , biological , and radiographic findings are uncertain , an ultrasound may be particularly helpful , as this technique may demonstrate more tophi [ figure 10 ] and erosions than plain films , more synovitis than a clinical examination , suggestive hyperechoic aggregates in the synovium or in the joint fluid , which may be aspirated , and the double contour sign ( an irregular hyperechoic band over the superficial margin of the articular cartilage , related to crystal deposition).[4244 ] calcium pyrophosphate dihydrate deposition ( cpdd ) disease is characterized by articular and periarticular tissue deposits ( hyaline cartilage , fibrocartilage , and other soft - tissue structures ) , even in the spine [ figure 11 ] . unlike gout ,
in which the increase in serum urates leads to supersaturation and deposits in the joints , in cpdd , the calcium deposits usually appear in the cartilage in the absence of any serum abnormality .
even though such deposits may be seen in asymptomatic patients , they may be associated with the development of severe arthropathies or with acute pain related to the migration of the crystals in the synovial fluid , mimicking septic arthritis .
gout of the first mtp joint in conventional radiography : excentric dense nodular soft tissue mass ( arrows ) , large erosions ( arrowhead ) , lack of periarticular osteoporosis , and exuberant bony proliferation ( curved arrow ) . gout involvement of the mtp ( a ) shows the tophus ( arrow ) with hyperechogenic microcrystal deposits ( arrowheads ) and a thickened synovium ( curved arrows ) . another patient with tophus deposition in the dorsal midfoot ( b ) demonstrates microcrystal deposits ( arrowhead ) with acoustic shadows ( thick arrows ) .
calcium pyrophosphate dihydrate deposition disease demonstrated by deposits of microcrystals in the menisci ( arrow ) , articular cartilage ( arrowhead ) , and periarticular soft tissue ( curved arrow ) .
elderly patients are more prone to infection because of an increased incidence of predisposing disorders ( diabetes mellitus , peripheral vascular disease , poor dentition , ) , immunosuppression and surgical procedures in this population ( dental extractions , open heart surgery , prosthetic joint replacement , ) .
the infectious agents affecting elderly patients are similar to those found in the younger population ; although in the elderly , evidence shows an increased incidence of infection by nosocomial organisms ( due to institutionalization and hospitalization ) .
these infections can have a relatively benign course , as in the case of cellulitis , or serious consequences , as with necrotizing fasciitis . in patients over 80 years of age ,
another peculiarity of the elderly , uncommon in adults , is acute hematogenous osteomyelitis that mainly affects the spine .
attention should , moreover , be paid to the diagnosis of tuberculosis , as early manifestations are subtle and advanced disease mimics other infections , granulomatous diseases , and malignancy .
tuberculosis may affect the spine ( about 50% of cases ) , with potential neurological consequences , or any joint , causing deformity [ figure 12 ] .
it should be noted that elderly men may present with bone lesions , as a manifestation of reactivation of the disease . as there are no pathognomonic imaging signs of musculoskeletal tuberculosis ,
the most conclusive means of reaching a diagnosis is by biopsy and culture , as chest radiographs and skin tests may not be positive in the elderly . as regards imaging techniques ,
magnetic resonance imaging is the modality of choice for musculoskeletal infection , as it best delineates the extension of soft tissue infections .
computed tomography , ultrasound , radiography , and nuclear medicine studies are considered to be ancillary . in some circumstances ultrasound
can be very useful , as it allows the aspiration of fluid collected in the joints or soft tissue , the evaluation of structures adjacent to orthopedic hardware , or the assessment of small peripheral joints . besides , in the case of debilitated elderly patients , a mobile ultrasound device can be easily moved close to their beds .
( a ) on conventional radiography there is mild osteoporosis , extensive soft tissue swelling , and large marginal erosion ( arrowhead ) , ( b ) on doppler ultrasound the synovitis ( arrows ) and bone erosion ( arrowhead ) are well - depicted .
paget 's disease is a bone disorder characterized by an increase in osteoclast - mediated bone resorption accompanied by osteoblast - mediated formation of new bone of inferior quality .
the frequency of this condition is decreasing , but it still exists in 1 5% of persons over 50 years of age , varying according to geographic areas.[5356 ] the radiographic signs include an advancing wedge of bone resorption , an accentuation and coarsening of the bone trabeculae along lines of stress , cortical thickening , and enlargement of the bone [ figure 13 ] . as a result , secondary osteoarthritis , insufficiency fractures , bowing of the bones , and even spinal cord or nerve root compression can be observed . in a minority of cases ,
sarcomatous degeneration may develop , mainly in the humerus , pelvis , and proximal femur , with a frequency believed to range from 0.9 to 2% .
paget 's disease affecting the iliac bone demonstrated with coarsening of the bone trabeculae and cortical thickening ( arrows ) .
tumors : tumors can be revealed by bone pain , pathological fractures , or disability , or be discovered as an incidental finding .
primary bone tumors in elderly patients are not common , but , due to the risk of metastases , any newly discovered bone lesion or one developing within a known pre - existing lesion must be assumed to be malignant until proven otherwise .
metastases : bone metastases are a common complication of malignant disease , especially of the breast , prostate , and lung .
although they are often multiple , a solitary metastasis is still more common than a primary neoplasm .
plain films are relatively insensitive for the detection of bone metastases , especially subtle lesions . mr imaging is superior to ct in the detection of malignant marrow infiltration , and it has a better contrast resolution for visualizing soft tissue and spinal cord lesions .
even with the advances in mri , especially for bone marrow screening , bone scintigraphy continues to be used as an effective method for initial evaluation of the whole body for bone metastases .
sarcomas : in the elderly population , many sarcomas are secondary to a pre - existing disorder of the bone , such as paget 's disease , or lesions treated by radiation .
chondrosarcoma must also be kept in mind , especially when isolated osteolytic lesions of the pelvis are seen , as this is the most common primary sarcoma of bone in adults .
the cartilaginous nature of the lesion may be suggested by the presence of calcifications or by a lobulated hyperintense lesion in an mri [ figure 14 ] .
chondrosarcoma of the pelvis in ( a ) conventional radiography appears as an isolated osteolytic lesion ( arrows ) , ( b ) coronal t2-weighted image demonstrates a lobulated hyperintense lesion ( arrowheads ) .
myeloma : myeloma is a characteristic disease in the elderly population , with a peak incidence in the eighth decade that results from an unregulated , progressive proliferation of neoplastic monoclonal plasma cells that accumulate in the bone marrow , leading to anemia and marrow failure .
osteolytic lesions may be present on plain films , but differentiating osteoporotic vertebral compression fractures from those associated with myeloma is a common diagnostic dilemma , as bone loss may be the first sign revealing the latter disease .
indeed , widespread osteoporosis , due to cytokine - mediated osteoclast activation , is common in patients with myeloma .
this possible association must be kept in mind , particularly if other features are present , including unexplained back or bone pain .
special attention is required in this population , as an early diagnosis can avoid delay in treatment , which is associated with increased morbidity and mortality . besides , a better understanding of musculoskeletal diseases can lead to the implementation of effective preventive measures , thus reducing public health expenditure , and improving the quality of life in the elderly . | musculoskeletal disorders are among the most common problems affecting the elderly .
the resulting loss of mobility and physical independence can be particularly devastating in this population .
the aim of this article is to present some of the most frequent musculoskeletal disorders of the elderly , such as fractures , osteoporosis , osteoarthritis , microcrystal disorders , infections , and tumors . |
institutional review board approval was obtained for this retrospective study , and informed consent requirement was waived .
a total of 133 cases from 108 patients that were between january and december of 2007 were included in this study .
the patient population was made up of 72 malignant nodule cases that were surgically confirmed , as well as 61 cases of benign nodules that were confirmed by surgery or by fnac .
our patients consisted of 96 women ( 89% ) and 12 men ( 11% ) and the mean age was 64.5 years ( range 26 - 74 years ) .
the 72 cases of malignant nodules consisted of one case of follicular adenocarcinoma , three cases of medullary carcinoma , and 68 cases of papillary carcinoma .
the benign nodules included 53 cases that were negative for malignancy by two sessions of fnac at a 6-month interval , and eight cases that were surgically confirmed ( four cases of nodular hyperplasia and four cases of follicular adenoma ) .
the mean size of the malignant nodules was 11.9 mm ( range 4.4 - 27.8 mm ) , whereas the size of the benign nodules was 25.7 mm ( 4.8 - 45.6 mm ) .
this study was designed to measure the interobserver agreement and performance discrepancy between the faculties and radiology residents through the first interpretation , and to determine whether these parameters would be improved by a training session . at our institution , all residents undergo a training schedule , which includes six months of neuroradiology imaging ( three months in 2nd year resident , two months in 3rd year resident and one month in 4th year resident ) , including performing the thyroid us and fnac and reporting it using the us criteria outlined by the thyroid study group of the korean society of neuroradiology and head and neck radiology ( ksnhnr ) ( 6 , 9 ) . to evaluate the observer variability and performance discrepancy according to years of experience , five faculties with 2 , 4 , 4 , 5 , and 8 years of thyroid imaging experience , respectively , and four residents reviewed the imaging without a special training session . to evaluate the difference of the agreement and performance between senior and junior resident groups ,
four residents were chosen ; two second - year residents who had completed the two months of thyroid imaging training and two fourth - year residents who had completed the six months of training . to examine the effect of training on the interobserver agreement
, the observers were given one training time , at eight weeks after the first interpretation . in the training session ,
a baseline consensus in the lexicon was reached through the discussion for 20 cases of pathologically confirmed benign and malignant nodules that were not included in the current study .
patient clinical histories , previous imaging results , and pathologic results were not available to the nine observers during the discussion .
after this training session , the primary data were randomly arranged , and then the secondary data were reviewed independently .
the us images were acquired using a 5 - 12 mhz linear probe ( hdi 5000 , advanced technology laboratories ; bothell , wa ) .
fnac was performed by two faculty radiologists ( 4 and 3 years of experience , respectively ) .
one investigator selected two representative transverse and longitudinal us images for each lesion and saved the images to powerpoint ( microsoft corporation , redmond , wa ) .
each observer independently analyzed the images and were unaware of the clinical information and pathologic results .
each nodule was analyzed based on the us criteria that were proposed by the thyroid study group of the korean society of neuroradiology and head and neck radiology ( ksnhnr ) .
the internal contents of the nodules were defined as solid ( more than 90% solid component ) , predominantly solid ( more than 50% solid component , but less than 90% ) , predominantly cystic ( more than 10% solid component , but less than 50% ) , and cystic ( less than 10% solid component ) .
the shape of the nodules was defined as ovoid to round , taller than wide ( the anteroposterior dimension longer than the transverse diameter ) , or irregular ( neither round to oval nor taller than wide ) .
the border characteristics were defined as well - defined smooth , spiculated , or ill defined .
the echogenicity was defined as markedly hypoechoic ( lower than the echogenicity of the strap muscle ) , hypoechoic ( lower than the echogenicity of the thyroid gland ) , isoechoic ( equal to the thyroid echogenicity ) , or hyperechoic ( higher than the echogenicity of the thyroid gland ) .
the calcifications were defined as microcalcifications ( tiny punctate hyperechogenicities either with or without acoustic shadowings less than 1 mm in diameter ) , macrocalcifications ( larger than 1 mm in diameter ) , or rim calcifications .
the malignant us characteristics were defined as a shape that was taller than wide , with a spiculated border , marked hypoechogenicity , and micro- or macro - calcifications .
if a nodule had any feature that was consistent with malignancy , it was classified as a suspicious malignant nodule .
a probably benign nodule was classified as either completely cystic or predominantly cystic with a comet tail artifact .
an indeterminate nodule was defined as a nodule that was not suspicious for malignancy or probably benign findings .
all kappa statistics were calculated using sas version 8.0 ( magree sas macro program , cary , nc ) to assess the proportion of interobserver agreement .
the method for estimating an overall kappa value in the case of multiple observers and multiple categories is based on the work of fleiss ( 10 ) .
the kappa value represents the degree of agreement in excess of that expected by chance .
it is a real number ranging from 0 to 1 , and the greater the value , the higher the level of agreement .
the level of agreement for cohen 's kappa is usually defined as follows : less than 0.20 as poor agreement , 0.21 - 0.40 as fair , 0.41 - 0.60 as moderate , 0.61 - 0.80 as good agreement , and greater than 0.80 as excellent agreement ( 11 , 12 ) .
for the evaluation of the overall observer performance , receiver operating characteristic ( roc ) curves for each observer were obtained by the medcalc version 10.1.6.0 ( medcalc software , ghent , belgium ) .
differences in the areas under the roc curves were assessed with a univariate z - score test . the sensitivity , specificity , positive predictive value , and negative predictive value for each category were determined for a subgroup of the observers .
a p - value of less than 0.05 was considered to indicate a statistically significant difference .
institutional review board approval was obtained for this retrospective study , and informed consent requirement was waived .
a total of 133 cases from 108 patients that were between january and december of 2007 were included in this study .
the patient population was made up of 72 malignant nodule cases that were surgically confirmed , as well as 61 cases of benign nodules that were confirmed by surgery or by fnac .
our patients consisted of 96 women ( 89% ) and 12 men ( 11% ) and the mean age was 64.5 years ( range 26 - 74 years ) .
the 72 cases of malignant nodules consisted of one case of follicular adenocarcinoma , three cases of medullary carcinoma , and 68 cases of papillary carcinoma .
the benign nodules included 53 cases that were negative for malignancy by two sessions of fnac at a 6-month interval , and eight cases that were surgically confirmed ( four cases of nodular hyperplasia and four cases of follicular adenoma ) .
the mean size of the malignant nodules was 11.9 mm ( range 4.4 - 27.8 mm ) , whereas the size of the benign nodules was 25.7 mm ( 4.8 - 45.6 mm ) .
this study was designed to measure the interobserver agreement and performance discrepancy between the faculties and radiology residents through the first interpretation , and to determine whether these parameters would be improved by a training session . at our institution , all residents undergo a training schedule , which includes six months of neuroradiology imaging ( three months in 2nd year resident , two months in 3rd year resident and one month in 4th year resident ) , including performing the thyroid us and fnac and reporting it using the us criteria outlined by the thyroid study group of the korean society of neuroradiology and head and neck radiology ( ksnhnr ) ( 6 , 9 ) .
to evaluate the observer variability and performance discrepancy according to years of experience , five faculties with 2 , 4 , 4 , 5 , and 8 years of thyroid imaging experience , respectively , and four residents reviewed the imaging without a special training session .
to evaluate the difference of the agreement and performance between senior and junior resident groups , four residents were chosen ; two second - year residents who had completed the two months of thyroid imaging training and two fourth - year residents who had completed the six months of training . to examine the effect of training on the interobserver agreement ,
the observers were given one training time , at eight weeks after the first interpretation .
in the training session , the us criteria for thyroid nodules were reviewed , and cases were discussed .
a baseline consensus in the lexicon was reached through the discussion for 20 cases of pathologically confirmed benign and malignant nodules that were not included in the current study .
patient clinical histories , previous imaging results , and pathologic results were not available to the nine observers during the discussion .
after this training session , the primary data were randomly arranged , and then the secondary data were reviewed independently .
the us images were acquired using a 5 - 12 mhz linear probe ( hdi 5000 , advanced technology laboratories ; bothell , wa ) .
fnac was performed by two faculty radiologists ( 4 and 3 years of experience , respectively ) .
one investigator selected two representative transverse and longitudinal us images for each lesion and saved the images to powerpoint ( microsoft corporation , redmond , wa ) .
each observer independently analyzed the images and were unaware of the clinical information and pathologic results .
each nodule was analyzed based on the us criteria that were proposed by the thyroid study group of the korean society of neuroradiology and head and neck radiology ( ksnhnr ) .
the internal contents of the nodules were defined as solid ( more than 90% solid component ) , predominantly solid ( more than 50% solid component , but less than 90% ) , predominantly cystic ( more than 10% solid component , but less than 50% ) , and cystic ( less than 10% solid component ) .
the shape of the nodules was defined as ovoid to round , taller than wide ( the anteroposterior dimension longer than the transverse diameter ) , or irregular ( neither round to oval nor taller than wide ) .
the border characteristics were defined as well - defined smooth , spiculated , or ill defined .
the echogenicity was defined as markedly hypoechoic ( lower than the echogenicity of the strap muscle ) , hypoechoic ( lower than the echogenicity of the thyroid gland ) , isoechoic ( equal to the thyroid echogenicity ) , or hyperechoic ( higher than the echogenicity of the thyroid gland ) .
the calcifications were defined as microcalcifications ( tiny punctate hyperechogenicities either with or without acoustic shadowings less than 1 mm in diameter ) , macrocalcifications ( larger than 1 mm in diameter ) , or rim calcifications .
the malignant us characteristics were defined as a shape that was taller than wide , with a spiculated border , marked hypoechogenicity , and micro- or macro - calcifications .
if a nodule had any feature that was consistent with malignancy , it was classified as a suspicious malignant nodule .
a probably benign nodule was classified as either completely cystic or predominantly cystic with a comet tail artifact .
an indeterminate nodule was defined as a nodule that was not suspicious for malignancy or probably benign findings .
all kappa statistics were calculated using sas version 8.0 ( magree sas macro program , cary , nc ) to assess the proportion of interobserver agreement .
the method for estimating an overall kappa value in the case of multiple observers and multiple categories is based on the work of fleiss ( 10 ) .
the kappa value represents the degree of agreement in excess of that expected by chance .
it is a real number ranging from 0 to 1 , and the greater the value , the higher the level of agreement .
the level of agreement for cohen 's kappa is usually defined as follows : less than 0.20 as poor agreement , 0.21 - 0.40 as fair , 0.41 - 0.60 as moderate , 0.61 - 0.80 as good agreement , and greater than 0.80 as excellent agreement ( 11 , 12 ) . for the evaluation of the overall observer performance , receiver operating characteristic ( roc ) curves for each observer
were obtained by the medcalc version 10.1.6.0 ( medcalc software , ghent , belgium ) .
differences in the areas under the roc curves were assessed with a univariate z - score test .
the sensitivity , specificity , positive predictive value , and negative predictive value for each category were determined for a subgroup of the observers .
a p - value of less than 0.05 was considered to indicate a statistically significant difference .
the interobserver variability for the nine observers and each subgroup ( faculties , residents , senior residents and junior residents ) is represented in table 1 . in all of the nine observers ,
there was a moderate degree of interobserver agreement for calcification ( = 0.44 ) , there was a fair degree of agreement for margin , internal content , category , shape , and echogenicity ( = 0.22 , 0.29 , 0.30 , 0.36 , and 0.37 , respectively ) , and there was a poor degree of agreement for echotexture ( = 0.19 ) ( figs . 1 - 3 ) .
for the five faculties , the interobserver agreement was good for internal content ( = 0.64 ) , there was a moderate degree of agreement for shape , echogenicity , calcification , and category ( = 0.42 , 0.57 , 0.55 , and 0.55 , respectively ) , and there was a fair degree of agreement for margin and echotexture ( = 0.34 and 0.26 , respectively ) .
for the four residents , the interobserver agreement was moderate for calcification ( = 0.42 ) and fair for echogenicity and shape ( = 0.23 and 0.29 , respectively ) .
the agreement for calcification was higher in both the residents and the faculties ( fig .
1 ) , and the agreement for echotexture was lower in both groups ( fig .
the agreement was one level higher for internal content , echogenicity , and calcification in the senior residents in relation to the junior residents .
the agreement for margin was one level higher in the junior residents , but the degree of agreement was fair .
there were similar degrees of agreement for shape , echotexture , and category between the two resident groups , but the degree of agreement was lower than fair .
the observers were gathered to receive education on the us criteria , including a consensus interpretation , and then performed the secondary interpretation .
the secondary interpretation demonstrated that all of the nine observers had a significantly greater degree of agreement for all of the criteria ( p < 0.05 ) . with regards to the changes seen in each group , the kappa value of some criteria was significantly greater in the faculty radiologists ( in four criteria ) and the senior residents ( in two criteria ) , but there was no significant change for the junior residents .
for the faculties , excluding criteria such as internal content , echogenicity and category , whose kappa value was the highest in the first interpretation , all of the criteria showed an increase in the degree of agreement . particularly in echotexture ,
whose kappa value was the lowest , the degree of agreement increased from fair to moderate ( fig .
2 ) . following the training , the degree of agreement was higher than moderate , excluding the margin ( = 0.40 ) . in the senior residents ,
for the junior residents ; however , there was no significant increase in kappa value and there was a poor degree of agreement for all the criteria except for the calcification and the shape ( fig .
3 ) . the sensitivity and specificity obtained from the faculties , senior residents , and junior residents are summarized in table 2 . for the faculty radiologists , the sensitivity was 75% , the specificity was 65% ,
the positive predictive value ( ppv ) for a suspicious malignant nodule was 77% , and the negative predictive value ( npv ) for a probably benign nodule was 69% .
for the senior residents , the sensitivity was 40% and lower than faculty ' results , but the specificity was 78% and was higher than faculty 's results . for the junior residents , the sensitivity was 70% and the specificity was 50% , which are both lower than the faculty 's results .
the area under the receiver operating characteristic curves ( auc ) was 0.72 for the faculty radiologists , 0.62 for the senior residents and 0.60 for the junior residents ( fig .
the performance of the faculties was better than the senior and junior residents ( p = 0.007 and p = 0.003 , respectively ) .
however , for the comparison between the senior and junior residents , there was no significant difference in the diagnostic performance .
following the training session , the auc was slightly greater for the faculty and the senior residents ( 0.73 and 0.65 , respectively ) .
for the junior residents , however , the auc was lower ( 0.57 ) . in each subgroup
the interobserver variability for the nine observers and each subgroup ( faculties , residents , senior residents and junior residents ) is represented in table 1 . in all of the nine observers ,
there was a moderate degree of interobserver agreement for calcification ( = 0.44 ) , there was a fair degree of agreement for margin , internal content , category , shape , and echogenicity ( = 0.22 , 0.29 , 0.30 , 0.36 , and 0.37 , respectively ) , and there was a poor degree of agreement for echotexture ( = 0.19 ) ( figs . 1 - 3 ) .
for the five faculties , the interobserver agreement was good for internal content ( = 0.64 ) , there was a moderate degree of agreement for shape , echogenicity , calcification , and category ( = 0.42 , 0.57 , 0.55 , and 0.55 , respectively ) , and there was a fair degree of agreement for margin and echotexture ( = 0.34 and 0.26 , respectively ) .
for the four residents , the interobserver agreement was moderate for calcification ( = 0.42 ) and fair for echogenicity and shape ( = 0.23 and 0.29 , respectively ) .
the agreement for calcification was higher in both the residents and the faculties ( fig .
1 ) , and the agreement for echotexture was lower in both groups ( fig .
the agreement was one level higher for internal content , echogenicity , and calcification in the senior residents in relation to the junior residents .
the agreement for margin was one level higher in the junior residents , but the degree of agreement was fair .
there were similar degrees of agreement for shape , echotexture , and category between the two resident groups , but the degree of agreement was lower than fair .
the observers were gathered to receive education on the us criteria , including a consensus interpretation , and then performed the secondary interpretation .
the secondary interpretation demonstrated that all of the nine observers had a significantly greater degree of agreement for all of the criteria ( p < 0.05 ) . with regards to the changes seen in each group , the kappa value of some criteria was significantly greater in the faculty radiologists ( in four criteria ) and the senior residents ( in two criteria ) , but there was no significant change for the junior residents .
for the faculties , excluding criteria such as internal content , echogenicity and category , whose kappa value was the highest in the first interpretation , all of the criteria showed an increase in the degree of agreement . particularly in echotexture ,
whose kappa value was the lowest , the degree of agreement increased from fair to moderate ( fig .
2 ) . following the training , the degree of agreement was higher than moderate , excluding the margin ( = 0.40 ) . in the senior residents ,
for the junior residents ; however , there was no significant increase in kappa value and there was a poor degree of agreement for all the criteria except for the calcification and the shape ( fig .
the sensitivity and specificity obtained from the faculties , senior residents , and junior residents are summarized in table 2 . for the faculty radiologists , the sensitivity was 75% , the specificity was 65% , the positive predictive value ( ppv ) for a suspicious malignant nodule was 77% , and the negative predictive value ( npv ) for a probably benign nodule was 69% . for the senior residents , the sensitivity was 40% and lower than faculty ' results , but the specificity was 78% and was higher than faculty 's results . for the junior residents , the sensitivity was 70% and the specificity was 50% , which are both lower than the faculty 's results .
the area under the receiver operating characteristic curves ( auc ) was 0.72 for the faculty radiologists , 0.62 for the senior residents and 0.60 for the junior residents ( fig .
the performance of the faculties was better than the senior and junior residents ( p = 0.007 and p = 0.003 , respectively ) .
however , for the comparison between the senior and junior residents , there was no significant difference in the diagnostic performance .
following the training session , the auc was slightly greater for the faculty and the senior residents ( 0.73 and 0.65 , respectively ) .
for the junior residents , however , the auc was lower ( 0.57 ) . in each subgroup
the us findings have been reported to be of great help in distinguishing malignant from benign thyroid nodules ( 1 - 6 ) .
the us findings that have been reported for malignant thyroid nodules included completely solid or predominantly solid nodules , a hypoechogenicity comparable to strap muscles , an irregular margin , intranodular microcalcifications , a taller than wide orientation , and an increase in intranodular vascularity .
( 6 ) reported that the findings suggested malignancy in those nodules with a taller than wide shape , a spiculated margin , a marked hypoechogenicity , and intranodular calcifications .
this study showed a high sensitivity ( 94% ) and negative predictive value ( 96% ) , and was performed in accordance to the thyroid study group of the korean society of neuroradiology and head and neck radiology ( ksnhnr ) . at most of the academic medical centers , us of the abdomen as well as the superficial organs , including the thyroid gland and breast , is performed by radiology residents and experienced radiologists .
then , the final report was confirmed by the attending faculty . to date , the studies about the difference in agreement for image interpretation between radiology residents and experienced radiologists have been conducted with a main focus on the examinations that were performed at an emergency center , which depend on the preliminary interpretation of radiology residents after working hours ( weekdays and on weekends ) .
previous literature has reported that the degree of agreement was greater than 90% between radiology residents and neuroradiologists in the interpretation of head ct and neuroradiology mr imaging ( 13 - 15 ) . according to a study that examined the difference in agreement for the interpretation of body ct and us at a level i trauma center ,
the agreement rate between the residents and the faculty was more than 90% ( 16 ) . under the clinical suspicion of pulmonary embolism ,
an interobserver variability between them showed a value of = 0.73 , indicating a good level of agreement for the interpretation of ct pulmonary angiography ( 17 ) . to our knowledge
, no studies have examined the difference in the interpretation of us images between residents and faculty . in the current study ,
the interobserver agreement between the faculties and residents showed a moderate agreement for calcification , but showed poor agreement for echotexture .
in addition , excluding a moderate agreement for calcification and a fair agreement for shape and echogenicity , the residents showed poor agreement overall . according to a study by moon et al .
( 6 ) , the observer agreement was good or higher for internal content and microcalcifications and was moderate for shape , margin , echotexture , and echogenicity for three experienced radiologists . compared to our results ,
the degree of agreement was higher for moon et al . presumably , this might be because moon et al .
furthermore , moon et al . performed two sessions of training before the study and thereby achieved a baseline consensus .
( 18 ) reported an interobserver variability between two experienced radiologists and showed that there was a good or higher agreement for calcification and the amount of cystic component .
in addition , there was fair agreement for echogenicity and there was poor agreement for border . compared to the results of the five faculty radiologists , their results showed lower agreement for echogenicity and border , as well as higher agreement for calcifications .
their results were similar with ours with respect to the amount of cystic component ( i.e. , the internal content ) .
the comparison of faculties and residents suggests that diagnostic performance was significantly higher for the faculties , but there was no significant difference between the junior and senior residents .
auc was 0.72 for the faculties , 0.62 for the senior residents , and 0.60 for the junior residents .
the secondary interpretation after the training session indicated that all nine observers had a significantly greater degree of agreement for all the categories ( p < 0.05 ) .
the faculty radiologists showed a significant increase in agreement in four categories and in two categories for the senior residents . for the junior residents , agreement
was improved , but not to a significantly and there was still a poor agreement for most lexicons .
the auc was slightly greater for the faculties and senior residents , but decreased in the junior residents , after the training session .
these results suggest that one training session was not of great help in improving the agreement level and performance in the junior residents .
the number of categories with significantly greater agreement was superior in the faculties in relation to the senior residents .
these results suggest that attending radiologists would require a more meticulous review and confirmation of the preliminary interpretation by the residents . the clinical experience through the practice of thyroid us and fnac
, the consistent feedback from the correlation with the pathologic results , and the continuous consensus interpretation would be necessary for the effective training of the residents .
namely , there is a selection bias since only images specifically selected by an investigator were used .
in addition , there was a relatively high percentage of malignant nodules in the sample . presumably , this is because our institution is a referral center for patients with suspicious thyroid lesions .
the low incidence of benign nodules is related to the fact that benign cases were only included when there were negative for malignancy by two sessions of fnac at a 6-month interval .
the current study enrolled residents as two groups and it is questionable whether these residents can be representative of all residents .
in other words , the observers were aware that their interpretations did not affect the patient care , thus lessening the concern that a patient would be recalled for a biopsy .
this may produce a discrepancy from the results that would have been obtained in an actual clinical setting ( 19 ) .
lastly , we saved the images in powerpoint for review , which could have resulted in a decrease in image resolution . in conclusion ,
. a continuous and specialized resident training program would be essential to enhance the degree of agreement and performance in residents . | objectiveto evaluate the interobserver variability and performance in the interpretation of ultrasonographic ( us ) findings of thyroid nodules.materials and methods72 malignant nodules and 61 benign nodules were enrolled as part of this study .
five faculty radiologists and four residents independently performed a retrospective analysis of the us images .
the observers received one training session after the first interpretation and then performed a secondary interpretation .
agreement was analyzed by cohen 's kappa statistic .
degree of performance was analyzed using receiver operating characteristic ( roc ) curves.resultsagreement between the faculties was fair - to - good for all criteria ; however , between residents , agreement was poor - to - fair .
the area under the roc curves was 0.72 , 0.62 , and 0.60 for the faculties , senior residents , and junior residents , respectively .
there was a significant difference in performance between the faculties and the residents ( p < 0.05 ) .
there was a significant increase in the agreement for some criteria in the faculties and the senior residents after the training session , but no significant increase in the junior residents.conclusionindependent reporting of thyroid us performed by residents is undesirable .
a continuous and specialized resident training is essential to enhance the degree of agreement and performance . |
the diagnosis is often made on the basis of a clinically typical lesion in conjunction with an appropriate history of exposure .
although cutaneous leishmaniasis ( cl ) is a spontaneously resolving disease usually within a year , the resulting disfigurement and the duration of the disease require an effective treatment . a wide range of therapeutic options
have been employed over the years but its optimal treatment is not yet known whereas drug resistance is becoming an increasing problem in countries of leishmaniasis endemicity .
amphotericin b ( amb ) , a polyene antibiotic and the gold standard for systemic fungal infections , also has excellent antileishmanial activity . due to the higher affinity of amb for 24-substituted sterols ,
aqueous pores are formed in the membrane leading to increased membrane permeability and killing of leishmania .
it is commonly administered intravenously as an alternative treatment in visceral and mucocutaneous leishmaniasis [ 57 ] . in a mouse model
it has been shown that topical amb as a complex either with cholesteryl sulfate or with phospholipids in the presence of ethanol can penetrate into the skin and cure cl in a localized manner using a very low total drug concentration . in another study
since liposomal amb is administered topically , it could be considered as a good alternative in the treatment of cl . in the present study we aim to compare the therapeutic effects of a formulation of topical liposomal amb with intralesional glucantime in the treatment of cl .
this clinical trial was carried out on cl patients who visited the dermatology clinic from march 2008 through september 2010 in ghaem hospital , mashhad , iran , where cl is endemic and 96.5% of cl cases are caused by l. tropica and less commonly l. major [ 10 , 11 ] .
110 patients with the clinical diagnosis of cl were recruited and were completely informed of the study goals and had filled in the consent required to participate in the trial , which was also approved by the ethics committee of mashhad university of medical sciences .
the inclusion criteria were patients with cutaneous leishmaniasis approved by either a direct smear stained with giemsa or a positive skin biopsy of lesions with less than 6-month duration , in cases with a previous history of anti - leishmaniasis therapy , a 3-month treatment - free interval from the last treatment course was taken into consideration .
the exclusion criteria were taking any other specific treatment while participating in the study , past medical history of any local or systemic disease during the last 2 months , a significant underlying disease such as cardiac , renal , or liver dysfunction .
the information collected from each patient included demographic data and characteristics of their disease .
liposomal amb was administered for 50 patients while the other 60 received intralesional glucantime . in the first group liposomal amb
was administered as 37 drops twice daily according to the lesion size . in the second group intralesional glucantime ( glucantime ; specia , paris , france ) was injected into each lesion once a week , to the point when the lesion 's surface became fully infiltrated and up to a maximum dose of 2 ml .
clinical response was determined on the basis of the lesion induration size of and the extent of re - epithelialization in ulcerative ones on every follow - up visit .
the treatment period was decided as 8 weeks for each group and the patients were followed up weekly during the treatment course while the changes in the lesion induration size and side effects were recorded in every session .
the patients were also studied once again , 6 months after termination of the treatment course .
the therapeutic results were classified as follows : slight improvement : decrease in induration size up to 25% , mild improvement : decrease in induration size between 25 and 50% , moderate improvement : decrease in induration size between 50 and 75% , marked improvement : decrease in induration size more than 75% .
egg lecithin , cholesterol , glucose , oleic acid and amb ( formulated with deoxycholate ) ( 250 g / ml ) were purchased from sigma - aldrich .
the equipments employed included a transmission electronic microscope ( leo 912 ab , germany ) , freeze drier ( labcon co. , usa ) , spectrophotometer ( uv-160a shimatzu , japan ) and a particle size analyzer ( psa ) ( klots , germany ) .
multilamellar large vesicle ( mlv ) liposomes containing amb were prepared through the freeze - drying method .
the method was based on the formation of a homogenous dispersion of lipids in water - soluble carrier materials . to obtain the lipid - containing solid dispersion ,
liposome - forming lipids and water - soluble carrier materials with amb were dissolved in t - butyl alcohol / water cosolvent systems to form an isotropic monophase solution , and then the resulting solution was frozen and lyophilized after sterilization by filtration through 0.2 m pores . adding water to the lyophilized product besides hard shaking followed by sonication spontaneously forms a homogenous liposome preparation .
for the formation of monophase solution and sterile filtration , egg lecithin ( 375 mg ) , cholesterol ( 125 mg ) , and oleic acid ( 25 mg ) were dissolved in t - butyl alcohol , while glucose ( 500 mg ) and amb were dissolved in water . then these two solutions were mixed together in appropriate ratios ( 1 : 1 ) to give a third clear isotropic monophase solution .
after the monophase solution was sterilized by filtration through 0.22 m pores , it was filled into the 100 ml freeze - drying flask vials with a fill volume of 10.0 ml .
the freeze - drying process was as follows : ( 1 ) freezing at 40c for 8 hrs ; ( 2 ) primary drying at 40c for 24 hrs ; ( 3 ) secondary drying at 25c for 10 hrs .
note that , lyophilized products can be stored for a long period of time under the dry ambient providing it is well sealed .
reconstitutionlyophilized products can be reconstituted by adding 10 ml of amb solution ( 250 g / ml ) and gentle sterile water with hard shaking followed by sonication , which will lead to the formation of the aqueous suspensions of homogeneous liposomes .
lyophilized products can be reconstituted by adding 10 ml of amb solution ( 250 g / ml ) and gentle sterile water with hard shaking followed by sonication , which will lead to the formation of the aqueous suspensions of homogeneous liposomes .
the encapsulation capacity of the liposome was found to be 81.4 3.12% by the uv spectroscopic method , indirectly .
the average particle size , which was measured by psa was 2.21 m ( pdi = 0.254 ) .
the apparent volume of distribution of liposomal form of amb is reported to be 0.10.44 lit / kg while the maximum therapeutic concentration of this drug is about 11.5 mg / kg . liposomal formulation of amb contains 5 mg of active ingredient per 1 ml of solution ; supposing each drop volume ( 0.05 ml ) involved 0.25 mg amphotericin , the amount of the drug in 2 drops ( one dose of treatment ) would be equivalent to 0.5 mg of active ingredient . considering the apparent volume of distribution , the drug concentration in the plasma of a 70 kg person will be between 0.016 and 0.07 mg / lit , which is less than the maximum therapeutic dose for this drug ( 2.2610 mg / lit ) . to detect a 35% difference in the cure rate between the two groups of liposomal amb and glucantime , assuming a 90% cure rate in liposomal amb group with a 95% power and a 5% two - sided type i error , 36 subjects were required in each group . also regarding a loss to follow up of 20% ,
the first approach was an intention - to - treat analysis that included all the 110 patients enrolled at the beginning of the trial and considered patients with irregular treatments and followups as therapeutic failures .
the second was more stringent and solely included the 76 patients with regular treatments and followups .
they were considered as good compliers and better represented an explanatory approach which allowed the interpretation of data in terms of effectively treated patients .
data was expressed as mean values sd , and the difference was considered significant when p < 0.05 .
, 11 patients in the liposomal amb and 23 in the glucantime groups were excluded due to taking two treatment methods simultaneously , not completing the treatment course , changing their home , and losing access for further followup while 76 completed the study including 39 in the study group ( liposomal amb ) and 37 in the control group ( intralesional glucantime ) .
demographic characteristics of the patients in both groups have been shown in table 1 . according to these data ,
the two groups were matched for sex , age , number of lesions , lesion duration , type , and location ( p > 0.05 ) but varied in the type and number of lesions which was a slightly higher number of papule and plaque lesions in the glucantime group .
the most common lesion site in all the studied cases was the upper limbs ( hand and forearm : 45.4% ) and the head and neck ( face : 43.6% ) , respectively , while the most common lesion type in both groups was papule and plaque ( 78.2% ) .
no significant difference in the treatment response between the males and females was seen in either group ( p = 0.840 ) .
figure 2 compares the improvement rate of both groups based on changes in induration size , and table 2 summarizes the results of the intention - to - treat approach and the analysis of compliers only , comparing therapeutic failure rates .
7 patients ( 11.7% ) in the glucantime group showed erythema and edema at the injection site which were managed with a cold compress and antihistamine drugs and they all completed the treatment course . in the latter group only 1 patient ( 1.7% ) complained of hypersensitivity .
also 5 patients ( 10% ) in the amb group showed mild pruritus around the lesions . upon 6 months of follow - up
, no recurrence of the disease was noted in the cured patients of either group .
mashhad located in the northeast of iran is endemic for cutaneous leishmaniasis mainly caused by l. tropica and less commonly l. major [ 10 , 11 , 15 ] .
pentavalent antimoniates have long been the most common treatment for leishmaniasis in our region , but acquired drug resistance towards them has increased during the recent years [ 16 , 17 ] , raising a strong need for new anti - leishmaniasis treatments .
knowing the fact that cl is a self - limiting disease , the main goal in its treatment would be controlling the spread of the disease in endemic regions besides decreasing scar formation ; therefore it would be more logical to use safe topical drugs in order to prevent any adverse reactions .
systemic liposomal amb has been recently administered in the treatment of drug - resistant cutaneous leishmaniasis [ 1820 ] .
preliminary results have shown that topically applied lipid - based formulations containing amb have a significant therapeutic effect in the treatment of cl lesion in adults .
even reported successful treatment of a 1.5-year - old infant with persistent cl by the administration of a topical colloidal solution of amb for 3 weeks . in a study conducted in 1999 on the treatment outcome of two similar lesions of the same individual ,
the topical liposomal amb - treated lesions showed significant improvement with no evidence of relapse when compared to the placebo - treated ones .
another study taking place in israel on 19 patients receiving 2 vials , one containing amb - cholesteryl sulfate dispersed in a 5% ethanol solution and one with 5% ethanol in water for half of each patient 's lesions , the results revealed a better therapeutic response in those lesions treated with topical liposomal amb in comparison to placebo .
although several studies have been performed on the efficacy of topical amb on cl , this study is the first which compares its effect with intralesional glucantime ; moreover , sample size of our study is not comparable with other similar ones . in the present study , comparing the effect of amb and intralesional glucantime on leishmania lesions , no significant difference was observed ( 56.4% versus 67.6% , p = 0.317 ) , indicating that topical amb has a similar efficacy to intralesional glucantime .
although preparing topical liposomal amb as a therapeutic drug is neither easy nor inexpensive , because of its simple , painless administration route by the patient himself , no transdermic passage into blood circulation causing less toxicity , and no need for recurrent visits , amb could be considered as an alternative treatment especially in children who do not tolerate painful methods , patients who can not make recurrent visits , and in cases where glucantime is contraindicated or unresponsive .
evaluating the effect of a drug on a self - limiting disease , in particular , considering the fact that variability in the disease length in different individuals can be of several months , would be quite difficult ; therefore a study in which patients with two similar leishmania lesions could simultaneously receive both treatments ( amb and glucantime ) is highly recommended in further studies on this issue . | background . topical treatment of cutaneous leishmaniasis is an attractive alternative avoiding toxicities of parenteral therapy while being administered through a simple painless route .
recently liposomal formulations of amphotericin b have been increasingly used in the treatment of several types of leishmaniasis .
aims .
the efficacy of a topical liposomal amphotericin b formulation was compared with intralesional glucantime in the treatment of cutaneous leishmaniasis .
methods . from 110 patients ,
the randomly selected 50 received a topical liposomal formulation of amphotericin b into each lesion , 37 drops twice daily , according to the lesion 's size and for 8 weeks .
the other group of 60 patients received intralesional glucantime injection of 1 - 2 ml once a week for the same period .
the clinical responses and side effects of both groups were evaluated weekly during the treatment course .
results .
per - protocol analysis showed no statistically significant difference between the two
groups ( p = 0.317 , 95% confidence interval ( ci ) = 1.610 ( 0.6324.101 ) ) . moreover , after intention - to - treat analysis , the same results were seen ( p = 0.650 , 95% ci = 0.1.91 ( 0.5602.530 ) ) .
serious post treatment side effects were not observed in either group .
conclusions .
topical liposomal amphotericin b has the same efficacy as intralesional glucantime in the treatment of cutaneous leishmaniasis . |
solid pseudopapillary tumor of the pancreas ( spt ) , also known as frantz - gruber tumor , was originally established as a separate entity in 1959 and represents 1% to 3% of all pancreatic tumors .
it is most commonly seen in young female patients , and only a few cases have been reported in male patients aged > 60 years .
the most frequent presenting symptom is abdominal pain , but patients may also remain asymptomatic .
other symptoms include nausea , vomiting , weight loss , and abdominal fullness . on clinical examination ,
these tumors can occur in any part of the pancreas and are characteristically surrounded by a defined capsule .
rarely , the tumor cells may invade the capsule and metastasize , most commonly to the liver .
typically , findings of the laboratory tests including serum amylase and tumor markers ( ca 199 , ca 125 , carcinoembryonic antigen [ cea ] , -fetoprotein ) are normal . the treatment of choice is surgical resection . because most of the patients affected by spt are young female patients , the cosmetic concerns may be of significance
. therefore laparoscopic surgical removal of this tumor is appropriate . a low incidence of recurrence and good prognosis even after reoperation
laparoscopic resection may therefore be appropriate for such pancreatic tumors if highly skilled surgeons are available .
this work describes 13 cases of spt treated at oslo university hospital rikshospitalet , a reference hospital in oslo , norway .
during the period from march 1997 to february 2011 , we performed 273 laparoscopic procedures on the pancreas at oslo university hospital rikshospitalet .
there were a wide range of laparoscopic operations , with 142 distal pancreas resections with splenectomy , 61 spleen - preserving distal resections , 32 enucleations , 2 whipple operations , and 36 other procedures mainly presenting as diagnostic laparoscopies with curative intent . among the 273 patients operated on ,
the most common complaint before surgery was abdominal pain and/or nausea and vomiting , which was present in 9 patients ( 69% ) .
three patients were incidentally diagnosed on computed tomography ( ct ) scanning for other reasons ( 23% ) . in one patient , drainage for what was suspected to be a pancreas pseudocyst was initially attempted , which eventually was histologically confirmed to be an spt .
occasionally , magnetic resonance imaging ( mri ) and abdominal or endoscopic ultrasonography were used as supplements .
preoperative biopsy of the lesion in the pancreas is not routinely performed in our department , but 5 of the patients underwent cytology / biopsy at other hospitals before referral to our institution .
the tumor was located in the head , body , and tail of the organ in 3 , 5 , and 5 patients , respectively . since the introduction of laparoscopic pancreatic surgery at our institution in 1997
, open pancreatic surgery for lesions located in the body or tail of the pancreas and encapsulated tumors in the head of the pancreas has been used only in very few cases with suspected vascular involvement . the surgical technique for laparoscopic pancreas resection
patients with lesions in the body or tail of the pancreas were placed in a 30 to 45 modified right lateral position . when tumors were localized to the head of the pancreas , the patient was placed in a supine position and trocar 2
was placed on the right side of the right rectus sheath , instead of the epigastrium , as shown in figure 1 .
postoperative view showing the standard trocar placement for a distal ( left - lateral ) resection .
this trocar and trocar 2 are the surgeon 's working ports , whereas the camera is placed at trocar site 3 .
the following preoperative and intraoperative criteria for safe enucleation were pursued : ( 1 ) clinical diagnoses , ( 2 ) ct scan confirming the tumor with a solid and cystic pattern surrounded by a capsule , and ( 3 ) the relation between the tumor and the pancreatic duct . in case of a very close relation ,
intraoperative ultrasonography of the pancreas was performed to localize the lesion and ensure a complete resection ( figure 2 ) .
when a left - lateral , distal resection was performed , a linear stapler ( endo gia green cartridge ; covidien , mansfield , massachusetts ) was used to divide the pancreas , and the margin of the remnant pancreas was in most cases covered with a tachosil patch ( nycomed , pharmaceutical co. ltd , roskilde , denmark ) .
a silicone tube ( aquerius , degania silicone ltd , degania bet , israel ) was routinely placed near the resection margins , and the concentration of amylase in the drainage fluid was checked daily . the decision to remove the drain
was based on a combination of the amount of fluid drained and the amylase concentration of the fluid .
the severity of the postoperative pancreatic fistulas was evaluated according to the international study group for pancreatic fistula ( isgpf ) definition : the amount of fluid drained on or after the third postoperative day with amylase content > 3 times the serum amylase level .
the fistulas were assigned 1 of 3 grades ( grade a , b , or c ) .
perioperative adverse events were assessed in accordance with standard grading systems the oslo classification of intraoperative incidents and the revised accordion classification .
statistical analysis was conducted with spss , version 18.0 ( ibm , armonk , new york ) .
the follow - up was performed by outpatient visits with abdominal ct scans as the preferred imaging modality .
of 13 patients diagnosed with spt , 9 underwent laparoscopic distal pancreatectomy , 1 of whom had a spleen - preserving procedure , whereas 4 underwent enucleation of the tumor . in 3 of the patients who underwent enucleation ,
the tumor was located in the head of the pancreas , thus avoiding major surgery such as pancreaticoduodenectomy ( whipple resection ) .
one of these 3 patients underwent reconstructive hepaticoduodenostomy after enucleation of the tumor with resection of the distal bile duct and cholecystectomy .
the median operative time was 197 minutes ( range , 68320 minutes ) in total , including 143 minutes ( range , 70243 minutes ) for distal resections and 205 minutes ( range , 68320 minutes ) for enucleations .
50750 ml ) in total , including < 50 ml ( range , < 50750 ml ) for distal resections and 50 ml ( range , < 50300 ml ) for enucleations . no metastases were verified intraoperatively .
the median size of the tumor was 6 cm ( range , 1.511 cm ) .
there were no cases in which infiltration of blood vessels , lymphatics , or other surrounding organs were described .
of these , one patient was reoperated on laparoscopically the same evening because of intra - abdominal bleeding ( accordion grade 4 complication ) .
there was a small bleeding artery at the corner of the pancreatic resection area , which was treated with a clip .
in one patient a left subphrenic abscess developed , which was managed conservatively with antibiotics ( grade 2 ) .
one patient had minor hemorrhage from the umbilical incision , which was controlled by compression ( grade 1 ) .
furthermore , one patient was readmitted twice , on the 10th and 16th postoperative day , with abdominal pain .
abdominal ultrasonography showed a small fluid collection near the resection area , and the patient was managed conservatively without any intervention ( grade 1 ) .
postoperatively , opioid medications were needed for a median of 1 day ( range , 05 days ) .
eight patients were able to start oral intake of fluids the same day as surgery , whereas the remaining 2 and 3 patients started oral intake on the first and second postoperative days , respectively .
the median number of days with the abdominal drain was 3 days ( range , 06 days ) .
the median duration of postoperative hospital stay was 5 days ( range , 212 days ) , similar for distal resections and enucleations .
the median follow - up period was 11 months ( range , 3121 months ) . at the constellation of this article ,
all 3 patients underwent laparoscopic enucleation of the tumors , thus avoiding the major surgical alternative procedure , which in most cases would be a pancreaticoduodenectomy .
of particular interest is the case of a 15-year - old girl who presented with a 5-month history of abdominal pain and vomiting , as well as a gradually increasing abdominal mass .
an abdominal ct scan showed a well - defined 7.8 10-cm mass in the head of the pancreas dorsal to the left lobe of the liver ( figure 3 ) .
the tumor was located to the right of the portal vein ; it was carefully dissected free from the head of the pancreas and the surrounding vessels and enucleated in toto without rupture of the capsule .
the patient was discharged on the eighth postoperative day , and there were no signs of recurrence after 36 months ' follow - up .
case x. a , preoperative contrast ct scan showing 103.7 77.8-mm pancreatic mass under the left lobe of the liver pushing the stomach to the left .
another 15-year - old girl was admitted to the emergency department with a 1-year history of increasing abdominal pain .
a ct scan showed a large tumor in the head of the pancreas ( figure 4 ) . during the laparoscopic removal
, the bile duct was shown to be adherent to the cranial portion of the tumor .
therefore , the choledochus was divided above the tumor , the gallbladder was removed , and a hepaticoduodenostomy with a 7-french stent was performed .
further ct and magnetic resonance cholangiopancreatography controls showed no pathology and no signs of recurrence after 56 months ' follow - up .
case y. a , preoperative ct scan showing an spt in the head of the pancreas .
all 3 patients underwent laparoscopic enucleation of the tumors , thus avoiding the major surgical alternative procedure , which in most cases would be a pancreaticoduodenectomy .
of particular interest is the case of a 15-year - old girl who presented with a 5-month history of abdominal pain and vomiting , as well as a gradually increasing abdominal mass .
an abdominal ct scan showed a well - defined 7.8 10-cm mass in the head of the pancreas dorsal to the left lobe of the liver ( figure 3 ) .
the tumor was located to the right of the portal vein ; it was carefully dissected free from the head of the pancreas and the surrounding vessels and enucleated in toto without rupture of the capsule .
the patient was discharged on the eighth postoperative day , and there were no signs of recurrence after 36 months ' follow - up .
case x. a , preoperative contrast ct scan showing 103.7 77.8-mm pancreatic mass under the left lobe of the liver pushing the stomach to the left .
another 15-year - old girl was admitted to the emergency department with a 1-year history of increasing abdominal pain .
a ct scan showed a large tumor in the head of the pancreas ( figure 4 ) . during the laparoscopic removal
, the bile duct was shown to be adherent to the cranial portion of the tumor .
hence , separation without violation of the tumor integrity was impossible . therefore , the choledochus was divided above the tumor , the gallbladder was removed , and a hepaticoduodenostomy with a 7-french stent was performed .
further ct and magnetic resonance cholangiopancreatography controls showed no pathology and no signs of recurrence after 56 months ' follow - up .
case y. a , preoperative ct scan showing an spt in the head of the pancreas .
cystic pancreatic neoplasms are very uncommon entities . first described by frantz in 1959 as a distinctive tumor entity
, this tumor was given the name solid pseudopapillary neoplasm by the world health organization in 1996 .
currently , nearly 1000 cases of established spt have been documented in the english - language literature with a female - male ratio of 10:1 .
the most frequent symptom of these tumors is upper abdominal pain , seen in nearly half of the patients .
a ct scan was the main diagnostic imaging modality used in our study , although we supplemented this with mri and ultrasonography in some patients .
ct scan and mri of abdomen show the characteristic features of this tumor , and the diagnosis can be made by combining these imaging modalities with the typical clinical presentation of spt .
tang et al reported that 30% of cases showed tumor calcification in their series . in our study
we also used intraoperative ultrasonography to verify the exact relations of the tumor to its surrounding structures . in the literature ,
numerous spts have been reported to be found incidentally on ct scans performed for some other reason . in our series
we had 3 such cases , 1 of whom was a 77-year - old man who had an abdominal ct scan after removal of a superficial bladder tumor . on the ct scan
successful laparoscopic resection of this tumor has been performed , and the patient is alive with a follow - up period of 12 months . in clinical practice , spt can be often mistaken for pancreatic pseudocyst . in our series
there was one case in which the patient underwent endoscopic ultrasonography - guided drainage of suspected pancreatic pseudocyst at a local hospital .
however , the stent could not drain the cyst , and biopsy findings showed spt .
the patient was discharged on the third postoperative day , and there were no signs of recurrence after 24 months of follow - up .
these are cystic pancreatic tumors , and it would be inappropriate if an enucleation was performed for certain tumors with a malignant potential , for example , intraductal papillary mucinous neoplasms . however , preoperative biopsy is not our hospital policy , and we avoid it because it has limited diagnostic accuracy and it may result in tumor dissemination in case of malignancy .
we advocate a more accurate diagnostic approach based on clinical findings , ct scan , intraoperative ultrasonography , and intraoperative instrumental palpation of the tumor . a recent report described 3 cases of spt in which recurrences developed after laparoscopic biopsy and/or resection .
butte et al reported on 45 patients , 18 of whom had preoperative biopsy , with a diagnostic accuracy of 56% . in a study by reddy et al ,
we did not investigate our patients with preoperative tumor markers such as ca 199 , ca 125 , cea , and -fetoprotein because various previous studies have shown normal preoperative tumor marker levels .
although the first laparoscopic pancreatic surgeries were performed > 15 years ago , conventional open laparotomies are still used for most resections of pancreatic tumors . however , a trend toward laparoscopic pancreatic tumor resection is developing .
laparoscopic excision of the spt is safe , feasible , more appropriate , and preferable to conventional open surgeries for these tumors in the pancreatic tail .
all patients were treated with laparoscopic resections because we have not been performing open surgery for the isolated lesions in the corpus and the cauda of the pancreas since the introduction of laparoscopic pancreatic resections at our institution . for lesions located in the head of the pancreas , many factors play a role , but if a well - defined capsule is present and there is no ingrowth into the adjacent organs , laparoscopic enucleation should be seriously considered .
li et al reported on 14 patients out of 34 who had tumors located in the head and neck of the pancreas , 10 of whom underwent whipple operations . with the availability of expertise , such extensive procedures can be avoided .
recently , alvise et al reviewed 10 cases of laparoscopic distal pancreatectomy with or without splenectomy with a median follow - up period of 47 months for spt in the body and tail of the organ . at the same time , laparoscopic surgery of the pancreas requires highly equipped institutions and surgeons with knowledge in pancreatic surgery and skills in advanced laparoscopy .
the spleen is an important immunologic organ , but in this series the spleen - preserving rate is low .
the reason is that spt has an uncertain pathogenesis and it is classified as a malignant tumor with a potential to metastasize to the liver , lymph nodes , and spleen , as well as in the splenic hilum .
second , the inflammatory process around the tumor makes it difficult to perform a safe dissection of the splenic vessels .
pancreatic resections for any reason lead to a 2% to 4% mortality rate and 30% to 50% morbidity rate . in our study
this is in accordance with our previous results in which the fistula incidence was 10% for 170 procedures , and to date , after 273 cases , it is still the same ( 10% ) .
we used a linear stapler ( autosuture , norwalk , connecticut , usa ) to divide the pancreas in distal resections .
our transection method for the pancreas might be a reason for the low numbers of complications , by using a green cartridge ( 60 mm ) instead of blue and red cartridges and slowly closing the stapler during the transection , which is important to avoid bursting of the parenchyma proximal to the stapling line . unfortunately , long - term follow - up data are still lacking for laparoscopic resections in spt patients .
one of these patients underwent laparoscopic distal pancreatectomy and remained alive and disease free for > 32 months .
our study shows that all of our patients are alive and disease free with a median follow - up period of 11 months ( range , 3121 months ) .
although there are reports of using postoperative chemotherapy and radiotherapy , none of our patients received this treatment modality .
laparoscopic resection has the advantages of minimally invasive surgery along with cosmetic benefits , a quicker recovery , and a shorter hospital stay . with the availability of expertise
, tumors in the head can be enucleated and extensive procedures such as pancreaticoduodenectomy can be avoided . | background and objectives : solid pseudopapillary tumors of the pancreas are rare and occur most frequently in young women .
they have an uncertain pathogenesis and unclear clinical behavior .
our aim was to evaluate the clinical presentation of solid pseudopapillary tumors and assess the efficacy of treatment with minimally invasive surgery.methods:from march 1997 to february 2011 , 13 of 273 patients who underwent laparoscopic procedures on the pancreas were found to have solid pseudopapillary tumors .
there were 12 female patients and 1 male patient .
the median age was 21 years ( range , 1577 years ) .
abdominal pain was the most common presenting symptom ( n = 9 ) .
tumors were incidentally found in 3 patients on computed tomography scans obtained for other reasons.results:enucleation of the tumor was performed in 4 patients , including 3 in whom the tumor was located in the head of the pancreas .
eight patients underwent distal pancreatectomy with splenectomy , whereas spleen - preserving distal pancreatectomy was performed in one case .
the median tumor size was 6 cm ( range , 1.511 cm ) , the median operative time was 197 minutes ( range , 68320 minutes ) , and the median blood loss was 50 ml ( range , < 50750 ml ) .
distal resections were performed with a linear stapler .
four patients had postoperative complications .
the median length of hospital stay was 5 days ( range , 212 days ) . during a median follow - up period of 11 months ( range , 3121 months ) , no local recurrences or distant metastases were found.conclusion:laparoscopic resections and enucleations of solid pseudopapillary tumors of the pancreas can be performed safely and with adequate resection margins even if the tumors are located in the head of the organ . |
histiopathologically , mucosal melanoma often presents with epidermal hyperplasia , vascularization , hemorrhage , and/or fibrosis , while melanin may be present or absent .
hence , it is difficult to reach an early diagnosis of musosal melanoma . on the other hand , angiofibroma ,
a benign tumor , is more readily diagnosed than mucosal melanoma because the histopathological findings are specific , including many extensively dilated vascular channels . to the best of our knowledge ,
a 59-year - old female was admitted to the ear , nose , and throat clinic of daejeon st .
mary s hospital in december 2013 complaining of nasal stuffiness and intermittent epistaxis from the right nasal cavity over the past year .
she had no systemic disease and no relevant medical or family history . on physical examination
, rhinoscopy revealed a polypoid mass in the right nasal cavity , which bled when lightly touched ( fig .
1 ) . a computed tomography ( ct ) scan revealed a dense soft tissue mass in the right paranasal sinuses and the right nasal cavity ( fig .
2 ) . magnetic resonance imaging ( mri ) revealed an enhanced right antral mass ( 3.2 cm 2.5 cm 2.2 cm in size ) with a widened maxillary ostium that extended to the right nasal cavity ( fig .
the patient underwent endoscopic sinus surgery ; however , the mass bled profusely and only a portion was removed for biopsy .
because of such bleeding tendency , angiography accompanied by tumor embolization was performed prior to reoperation ( fig .
the pathologic report of specimen from primary uncompleted operation pointed to a case of the angiofibroma , which was consistent with the patient s clinical features .
the tumor mass was found to be dark greenish and yellowish fragile , filling middle meatus and extending to the nasal cavity .
its medial extent was to the nasal septum , lateral to the lateral wall of maxillary sinus , superior to middle of the ethmoid sinus , inferior to the inferior maxillary wall , anterior to the anterior maxillary wall , and posterior to the nasopharynx .
the origin of the tumor was deduced to be the lateral wall of the nasal cavity near the middle meatus .
furthermore , a large part of the tumor was not adherent to the adjacent sinus wall except around the middle meatus .
excised masses were composed of angiofibroma components , which contained thin walled blood vessels and fibrous stroma and mucosal melanoma components , which contained hyperpigmentation in subepithelium on pathologic examination ( fig .
the patient was discharged with no complications , and we scheduled positron emission tomography ( pet ) ct and consultations with medical and radiation oncologists .
the patient underwent adjuvant radiation therapy with immunotherapy ( interferon- ) for 1 year , and intensity - modulated radiotherapy of the right paranasal sinus ( 5,000 cgy/25 fractions ) .
melanomas usually arise from melanocytes , which are in turn derived from the neuroectoderm of the basal layers of the skin .
melanomas of the nasal cavity or paranasal sinuses are rarer than cutaneous melanomas ; the former tumors constitute 3.6%4% of all nasal cancers .
mucosal melanomas in the head - and - neck region account for half of all mucosal melanomas .
apart from the head - and - neck region , they can arise in the genital organs of females or the anorectal and urinary tracts , and are far more aggressive with poorer prognoses than cutaneous melanomas .
furthermore , primary mucosal melanomas are often misdiagnosed due to their anatomical locations and the lack of discernible signs and symptoms .
epistaxis and nasal obstruction are common symptoms in both mucosal melanoma and nasal benign tumors .
ct is used to evaluate the primary tumor and cervical lymph nodes , whereas mri is employed to explore the extent of sinonasal tumors , particularly those that may involve the skull base and/or exhibit neurotropic spread .
also , mucosal melanoma may either contain or lack melanin , while exhibiting microscopic findings such as epidermal hyperplasia , vascularization , hemorrhage , and/or fibrosis .
melanomas are likely to be positive for hmb-45 , melan - a , s-100 protein , mart-1 , and tyrosinase .
the primary treatment modality is surgical resection with wide margins since incomplete resection is associated with poor survival rate . in addition , postoperative radiotherapy should be considered for most cases because of the high risk of local recurrence even after apparently complete resection .
chemotherapy is prescribed when a distant metastasis and/or recurrence is / are evident ; immunotherapy ( bacillus calmette gurin or interferon ) remains unreliable .
this is the first english - language report to describe a concurrent mucosal melanoma and angiofibroma .
moreover , the biopsy sample included angiofibroma tissue , leading the pathologist to diagnose melanocytes as hemosiderin - laden macrophages ( fig .
mucosal malignant melanomas are very rare , often presenting with atypical symptoms and masquerading both clinically and histologically as benign lesions .
when a mucosal melanoma and a benign sinusoidal tumor , such as angiofibroma occur together , accurate diagnosis is difficult .
immunohistochemical staining is required if there is even the slightest suspicion of a mucosal melanoma .
this case suggested possibility of coexistence of mucosal melanoma and hemangioma in the nasal cavity neoplasm .
malignant condition should be considered in easily bleeding masses in the nasal cavity as of its differential diagonosis . | malignant melanoma rarely develops in the paranasal sinuses , and generally has a poor prognosis .
however , mucosal melanoma can masquerade both clinically and histopathologically as a benign lesion , rendering accurate early diagnosis difficult . on the other hand , angiofibroma , a benign tumor ,
is more easily diagnosed than a mucosal melanoma , because the former exhibits specific histopathological features .
no cases of concurrent angiofibroma and mucosal melanoma have been reported to date .
we describe such a case below . |
the exponential development of highly advanced scientific and medical research analytical technologies throughout the past 30 years has arrived to the point where most ( if not all ) key molecular determinants deemed to affect human conditions and diseases can be scrutinized with great detail .
scientists and clinicians can now begin to attempt investigation of any individual dysregulations occurring within the genomic , transcriptomic , mirnomic , proteomic , and metabolomic levels thanks to advancing wet - lab technologies such as mass spectrometry , quantitative polymerase chain reaction ( qpcr ) and next generation sequencing , and detailed bioinformatics suites .
all these technologies are capable of extracting information from complex datasets to enable disease models to be developed for wet - lab testing .
the interplay between the wet and dry lab with specific clinical expertise not only is a main current component of translational medicine , but also is enabled by systems medicine .
however , there are drawbacks within this scientific brave new age , in that in most scientific studies it is only specific molecular levels which are individually investigated for their influence in affecting any particular health condition .
ideally , any form of medical research with the scope of rooting out dysregulated molecular pathway interactions should focus on investigating the holistic aspects of the complex and multifactorial medical condition / s .
this involves careful and methodical examination of all simultaneous molecular interactions occurring levels ( e.g. , genomic , transcriptomic , etc . ) .
bigger - picture research perspectives lead to a higher level of understanding for complex and multifactorial disease conditions and ultimately fast - track the identification and clinical diagnosis of specific molecular pathway dysregulations with pathogenesis value , together with the combined identification of novel drug targets for the development of effective translational therapeutics for the medical condition .
consequently , the urgent need to counteract such research shortcomings has been acquiesced through the emergence , in the last decade , of the novel research field of systems biology [ 1 , 2 ] .
in essence , the field of systems biology revolves around the principle that the phenotype of any individual living organism is a reflection of the simultaneous multitude of molecular interactions from various levels occurring at any one time , combined in a holistic manner to produce such a phenotype ( see figure 1 ) .
consequently , against the standard concept of reductionist approach where dysregulations in isolated molecular components are studied , data from dysregulations of multiple key molecular players from varying cellular levels of activity are pooled and studied in their entirety , for the purpose of identifying distinct changes in the pattern of intermolecular relationships , vis a vis the organism 's investigated phenotypes [ 3 , 4 ] .
the methods applied as the principal research tools vary , depending on the nature of the molecular level being investigated and also on the volumes of data generated ; therefore , nowadays most self - sufficient systems biology research groups are composed of research scientists with a discernable knowledge of experimental investigation for most molecular level research and/or are unique experts in their own specific research field .
consequently , systems biology is very much an interdisciplinary field of research , requiring the technology platforms and research expertise of individuals from a spectrum of scientific research niche [ 3 , 4 ] .
however , the measurement of all molecular parts of an organ or even biomedical pathway is far from routinely achievable , and great efforts to improve sensitivity of analysis and to make the output data possess a quantitative significance are starting to improve through implementation of field standards [ 5 , 6 ] . given current constraints , boolean approaches are assisting with production of 1st generation systems biology models . a main difference between systems
biology and systems medicine is that the former assumes the data to be correct and useable as often wet - lab data generation expertise is not the main goal but is assumed to be correct and useable .
systems medicine ( sometimes referred to as systems healthcare ) promises to lead with clinical and molecular know - how to produce exquisite datasets that are employed to generate pathway models and treatment and will hopefully directly contribute to stratified medicine en - route to personalized healthcare [ 4 , 811 ] .
in addition to performing function as an interdisciplinary research field , systems biology research methods rely heavily on the bioinformatics / computational and mathematical modeling components for achieving answers to the specific research questions [ 1218 ] . such informatics technology utilization can be twofold in system biology , namely , the implementation of a hypothesis driven
top - down approach or experimental data driven bottom - up approaches [ 11 , 19 ] .
the bottom - up , data driven approach initiates from the collection of large volume datasets derived through a spectrum of omics - based experimental procedures , followed by thorough mathematical modeling analyses to combine the relationships between key molecular players from the varying omics data results obtained [ 1921 ] .
one of the primary methodologies employed by the bottom - up systems biology conceptual approach is network modeling [ 2225 ] . a typical biological network model is composed of multiple nodes interacting with each other through edges , whereby nodes are classified as individual key molecular players from any omics level ( such as genes , noncoding rna family members , and proteins ) and the edges represent experimentally validated molecular interactions . both the nature and detail of the nodes and edges within any particular biological network may vary . in addition , highly active nodes interacting in a close - knit network are defined as hubs .
hubs can be further subdivided into two categories , namely , party hubs and date
party hubs represent nodes which commonly interact with multiple other molecular partners in a simultaneous manner , whereas date hubs are much more dynamic since they interact with other molecular partners across multiple timeframes and within varying locations .
conversely to the bottom - up experimental methodologies , the hypothesis driven top - down approach relies heavily on mathematical modeling for conducting studies on small - scale molecular interactions for a specific biological condition or phenotype [ 19 , 27 ] .
the dynamical modeling employed for such purpose involves the translation of molecular pathway interactions present in the studied organism into defined mathematical formats , such as ordinary differential equations ( odes ) and partial differential equations ( pdes ) that can be analysed and probed within a dry lab environment [ 2830 ] .
such a method can be utilized since most intermolecular activities occur with specific kinetics that can be mimicked ( e.g. , michaelis - menten kinetics ) by appropriate mathematical derivations .
however , dynamical modeling can only be effective if specific assumptions are imposed regarding the biomolecular interactions taking place , such as the selection of defined reaction rate kinetics occurring within the studied biomolecular interactions [ 31 , 32 ] . in summary , there are four main phases to develop accurately functioning dynamical modeling , namely , model design to identify the pillar intermolecular activities , model construction of such molecular interactions into representative differential equations , model calibration to identify and modulate nonspecific kinetics of individual biomolecular components of the model for the purpose of fine tuning the mathematical model to the experimental format , and model validation by inferring distinct predictions that can be verified in a wet - lab experimental scenario [ 11 , 31 ] .
interestingly , there can also be a third approach to systems biology research models that implement both the top - down and bottom - up methodologies , namely , the middle - out ( rational ) approach [ 33 , 34 ] .
the traditional reductionist approach to medical research has been discussed and can be restricted to the investigation of the biological effects of individual or minute quantities of key molecular players for complex , multifactorial human conditions , including cancer .
the application of systems biology within the remit of present day medical research can be defined as systems medicine , its concept dating back to 1992 .
such a wider perspective opens new doors of perception and insight into the holistic nature of such disease conditions , focusing mainly on the perturbations of overall pathway kinetics for the consequent onset and/or deterioration of the investigated condition / s .
systems medicine requires the employment of several vital facets in order to attain its clinical theranostic goals whenever such an approach is implemented ( see figure 2 ) .
the essential facets of systems medicine should ideally be established in order to provide proper support for the effective and rapid implementation of any novel research methodologies aimed at reaching the intended outcome for systems medicine - based projects .
undoubtedly , the laboratories involved in conducting systems medicine projects should have the necessary infrastructure and research protocol adaptations required for the intense interdisciplinary networking and consequent data handling and flow of information that are vital components for enabling successful systems medicine approaches .
another important component for systems medicine involves the employment of computation of computational and modeling sciences .
such expertise is a prerequisite for the effective handling of big datasets and also for the interpretation of wet laboratory data in terms of the development of complex interrelationships between varying key molecular players .
neuroblastoma is the first human condition that has been investigated from a systems level perspective in recent years .
constructed a regulatory network model for the main oncogene in neuroblastoma , mycn , and consequently evaluated the perturbation of this model through the introduction of retinoid drugs ( fenretinide , 13-cis - retinoic acid ) , therefore allowing enhanced insight into the responses of nb tumours to retinoid therapy through the identification of novel molecular interaction hypotheses that can be put to the test in a laboratory setting .
the study conducted by sarmady et al . is apt in demonstrating the versatility of systems - based computational analysis on previously existing experimental data from specific molecular interactions , for the purpose of identifying key molecular players affecting the pathogenesis and severity of the disease condition , in this case human immunodeficiency virus ( hiv ) .
the study applied a motif discovery algorithm on specific groups of hiv viral protein sequences , together with the sequences of immediate binding protein partners found on the host organism .
this algorithm ultimately selected only those statistically enriched motifs with conserved viral sequences binding to targeted host proteins .
such an interactome and sequence - based prediction methods allowed for the elucidation of the hiv nef protein as the main minding site to a multitude of host proteins such as mapk1 , vav1 , lck , hck , hla - a , cd4 , fyn , and gnb2l1 .
another example for the use of modeling sciences in systems medicine would be the study conducted by verma et al . , which constructed a systems - based protein regulatory network for the effects of micrornas ( mirnas ) influencing bcr.abl oncoprotein expression and phosphorylation levels within chronic myeloid leukaemia imatinib - resistant cell line models .
this protein regulatory network was deemed to be reliable to identify the varying effects of two specific classes of drugs ( tyrosine kinase inhibitors and bcr.abl-specific mirnas ) on cell lines with differing expression profiles and chemoresistance properties .
in addition , for the purpose of this study , quantitative pcr - based high - throughput mirna expression profiles were established , exemplifying the use of a systems - based approach to develop a protein regulatory network from large scale experimental datasets .
this study can also be utilized to illustrate the importance of quantitative analytical technologies ( in this case , high - throughput rt - qpcr ) for driving novel data collection within systems medicine research .
an alternative research scenario in which systems medicine approaches are highly valuable is in the field of biomarker discovery .
analysed in silico the expression data obtained from high - throughput mirna and mrna expression profiling analyses for both primary and metastatic prostate cancer . the results of this analysis highlighted the distinction between two separate mirna - mrna correlation and regulatory modular networks for primary and metastatic prostate cancer .
this study is a classic example to demonstrate the utility of systems level research for the identification of highly interactive biomarkers delineating differing classes and severity for an individual disease condition that can ultimately serve to monitor ( or predict ) specific treatment responses in the individual patient .
another crucial requirement for the successful implementation of systems medicine is the availability of significantly large , though also highly defined , patient groups .
such patient groups can be organized particularly well if patient samples are provided from curated biobanks .
the study conducted by albrecht et al . investigated the pathogenesis of hyperuricaemia through the analysis of high - throughput metabolomic profiling data for the regulation of serum urate , which directly induces gout condition in humans and is also associated with cardiovascular disease and diabetes type ii .
this study employed gaussian graphical modeling with a hypothesis - free approach for the analysis of 355 metabolites from a total of 1764 patients , with the intention to construct a metabolite network affecting serum urate production .
the results of this study elucidated a novel serum urate regulatory pathway involving 38 key metabolite components , with a high proportion of such components bearing a gender - specific trait .
the study carried out by mani et al . provides further evidence for the valuable role sustained by adopting a systems level approach for the prediction of oncogenes in cancer conditions .
this particular study focused on the analysis of the b - cell interactome and microarray - based datasets to predict novel oncogenes and molecular perturbation targets , through the identification of dysregulated molecular interactions , in three specific non - hodgkin 's lymphomas .
the advances in imaging sciences and quantitative data extraction methodologies have also been of immense value in attaining successful outcomes through systems medicine approaches .
examples of such technologies include the advent of high content imaging , laser assisted microdissection , and single cell sequencing technology to name but a few [ 4143 ] .
other medical conditions scrutinized through systems level research methodologies include the proliferative fibromatosis condition known as dupuytren 's disease [ 4446 ] and breast cancer and also within the remit of immunology research .
in essence , this change in research perspective by scrutinizing overall molecular network interactions , rather than individual molecules , allows for more effective and clinically applicable research outcomes .
the ever expanding value of systems medicine influences are also currently implemented in order to expedite various aspects of the drug discovery and development protocols within the realm of the pharmaceutical industry .
one of the main research challenges in which systems medicine perspectives can make a major difference is in the prediction of drug adverse effects during the early phases of the drug development process .
pharmacogenetics research for the purpose of drug development has , in the past , focused almost entirely on the effect of variations in individual genes for causing a specific adverse effect .
however , such adverse effects are most possibly due to multifactorial influences and as such a systems - based investigation can be far more effective in rooting out and/or predicting harmful adverse effects prior to any novel lead molecule progressing any further within the drug development pipeline .
the recent study conducted by zhao et al . investigated the possibility of identifying a suitable secondary drug to be administered in tandem with the antidiabetic drug rosiglitazone .
rosiglitazone has an associated high risk of myocardial infarction adverse effect ; consequently the investigators sought to identify a second drug with the capacity to reduce this risk in patients currently undergoing rosiglitazone .
the investigators utilized cell biological network analytical methods on data derived from the food and drug administration 's adverse event reporting system ( faers ) together with confirmation of any hypothesis with the use of animal models .
this systems - based approach led to the conclusion that exenatide is a suitable drug to administer for minimizing the rosiglitazone cardiac adverse effect risks , through its ability to regulate blood clotting processes .
this study demonstrated that apart from playing an important part in predicting drug adverse effects , systems medicine methodologies can also be employed for the prediction of ideal drug combination therapies to be adopted for specific disease conditions .
another area of drug development in which systems approaches are of significance is in the prediction of drug / target interactions .
the study carried out by babcock et al . investigated drug - induced gene expression profiles for predicting novel inhibitor molecules against the human ether - a - go - go related ( herg ) potassium channel , which plays an important part in the regulation of tumour cell proliferation and apoptosis [ 50 , 51 ] .
the study utilized the connectivity map ( cmap ) to select candidate herg inhibitors with similar gene signature expression profile induction , together with analytical methodologies from databases of experimental datasets for annotated herg inhibitor activities .
other systems - led methodologies can also be implemented for the purpose of drug / target interaction prediction studies , particularly for large and heterogeneous molecular interaction networks .
such methods include probabilistic matrix factorization and network - based random walk with restart on the heterogeneous network ( nrwrh ) [ 52 , 53 ] .
similarly , the importance of network pharmacology methods for the identification of novel drug / target networks for individual and/or multiple disease conditions is becoming ever more important due to the recent trend in the application of polypharmacology avenues for maximizing drug development efforts through enhanced treatment successes .
this approach is of crucial value particularly for complex and multifactorial clinical conditions such as cancer pathways , bearing a wide spectrum of druggable targets .
systems medicine approaches also play a central role in the emerging drug development area of drug repositioning , whereby drugs deemed to be dated or ineffective for one particular medical condition may however prove to be highly effective for a different condition altogether . the explorative study by jin et al .
focused on the analysis of transcriptomic expression profiles occurring before and after drug administration , as a means of examining and minimizing drug off target effects for major cancer - signaling pathways .
this study adopted an integration of one established systems - based analytical approach , namely , bayesian factor regression model ( bfrm ) , together with the novel cancer - signaling bridges ( csb ) network component , with the resultant systems approach termed as csb - bfrm .
the csb - bfrm was successful in predicting clinical response outcomes for the vast majority of the food and drug administration - approved drugs , with proof - of - concept studies in three separate cancer models ( breast cancer , prostate cancer , and leukaemia ) confirming the accuracy of the novel systems medicine - based analytical approach .
furthermore , other bioinformatic tools are being developed for aiding researchers to effectively conduct drug repositioning studies .
one such tool is the drugmap central ( http://r2d2drug.org/dmc.aspx ) , which allows the user to download any multilevel data for established drugs and molecules within one individual framework , in order to enhance swift access to such information .
finally , systems medicine approaches can also have a major impact on the possibilities of identifying novel disease networks , whereby the main investigation focuses on interactions of pathogenesis - influencing molecules that are commonly active and/or dysregulated in multiple disease conditions . a typical example to identify
since mirnas regulate transcripts , with one individual mirna possibly downregulating the expression levels of up to hundreds of downstream target genes , it is no wonder that such mirnas can be implicated in multiple clinical conditions , possibly in a simultaneous manner .
the development of bioinformatics web - tools such as the mirna bodymap allows for a clearer visual on the degree of molecular interactions that are directly influenced by mirna members of the mirnome , therefore easing the task for mirna researchers to establish the hubs and nodes for their network modeling approaches pertaining to their specific conditions under investigation .
systems medicine is definitely impacting the way academics , researchers , and clinicians look at medical research experimental approaches .
the possibility to simultaneously scrutinize multilevel data from both actual experimental and computational in silico sources provides greater insight into the intricate and intertwined , complex molecular interactions .
the interactome would otherwise remain hidden , as the associations of regulatory processes are not intuitively obvious .
this leads to the revealing of novel dynamic interactions that are critical for influencing the course of medical conditions and consequently also serve as clinically important key molecules for future diagnostic and therapeutic agent development
. however , there are still major challenges posing hurdles as emerging technologies such as next generation sequencing and ms provide vast quantities of data and the computational methodologies available at present are only just recently managing to cope with sifting through such high volumes of data to root out meaningful inferences for the posed research queries .
in addition , there is no one specific tool that can be utilized to help in the integration of multi - omics datasets , with the results that there is a high degree of subjectivity for the selection of the ideal systems - led approaches .
the future of systems medicine is also shifting its focus onto molecular hubs with a high and versatile influence on the effects of polypharmacology therapies , such as the varying classes of drug transporters within the cellular environment [ 59 , 60 ] .
in addition , systems biology and systems medicine tools should be further implemented and harnessed to achieve the highly ambitious goal of developing the virtual human , essentially encompassing all the intricate molecular networks and dynamic interactions on multiple omics - levels in order to render the tasks of drug development , through multiple system perturbations with lead molecules , less taxing due to the heavy computational elements provided by such a virtual human study model . in summary , the remaining conceptual shackles restraining the potential of systems - led research , such as the modernizing of the currently acknowledged dogma with lipinski 's rule of five for the selection of novel drugs for development , together with the traditional symptom first for novel drug development ( rather than shifting to a
additional challenges include the requirement for effective systems medicine models to integrate multiple data masses for accurate identification of novel drug targets , therapies , and also enhanced stratification of patient risk groups .
such effectiveness can only be achieved through proper handling of quantitative data , obtained using vetted and standardized methodologies , with effective data transfer capabilities between multiple software packages and data handling platforms in a smooth manner ( as the case is for rdml in handling of rt - qpcr data ) .
in addition , such data handling should be shared more efficiently across the pharmaceutical industry in order to allow for more rapid theranostic developments .
ultimately , with the adoption of such novel research perspectives , systems medicine will prove to become one of the mainstays in the way future research will be carried out , not only for extracting further mechanistic knowledge on disease processes but also through a faster and more effective drug development pipeline with the integration of systems - based analysis . | the exponential development of highly advanced scientific and medical research technologies throughout the past 30 years has arrived to the point where the high number of characterized molecular agents related to pathogenesis can not be readily integrated or processed by conventional analytical approaches .
indeed , the realization that several moieties are signatures of disease has partly led to the increment of complex diseases being characterized .
scientists and clinicians can now investigate and analyse any individual dysregulations occurring within the genomic , transcriptomic , mirnomic , proteomic , and metabolomic levels thanks to currently available advanced technologies . however , there are drawbacks within this scientific brave new age in that only isolated molecular levels are individually investigated for their influence in affecting any particular health condition . since their conception in 1992 , systems biology / medicine focuses mainly on the perturbations of overall pathway kinetics for the consequent onset and/or deterioration of the investigated condition / s . systems medicine approaches can therefore be employed for shedding light in multiple research scenarios , ultimately leading to the practical result of uncovering novel dynamic interaction networks that are critical for influencing the course of medical conditions .
consequently , systems medicine also serves to identify clinically important molecular targets for diagnostic and therapeutic measures against such a condition . |
hirschsprung 's disease ( hscr ) , or aganglionic megacolon , occurs due to the congenital absence of parasympathetic neuronal ganglia in a segment of the hindgut , resulting in malfunction of the affected segment .
the condition presents as a common cause of intestinal obstruction in neonates , with an incidence of 1 in 5,000 ( 0.02% ) live births and an overall risk to siblings of 4% ( 1)(3 ) .
a study of hscr indicates several clear - cut associations that are known or are suspected to be related to an increased risk of hscr .
these include its recurrence in families and the association with the major susceptibility genes points convincingly to genetic factors in its multifactorial pathogenesis .
the main susceptibility gene for hirschsprung 's disease is the ret ( rearranged during transfection ) proto - oncogene tyrosine kinase which is situated at chromosome 10q11.2 .
there are early reports of associations between hscr and a number of associated anomalies related to neural cell development .
these include neuroblastoma ( 1 ) , phaeochromocytoma ( 1),(4),(5 ) and multiple endocrine neoplasia ( men ) type 2 a and b syndromes ( 5)(7 ) , among others ( 1 ) .
reports on this relatively uncommon cosegregation of hscr and men2 in the same patient ( 6),(8)(20 ) exist because of the common factor of the ret gene being associated with both conditions ( hscr , men type 2 and medullary thyroid carcinoma ( mtc ) .
this is an extremely interesting observation , as it involves both gain and loss of function of the same gene in the same patient .
the men hscr association has been shown to cosegregate in hscr patients with both short- and long - segment aganglionosis ( 21 ) .
it seems to be particularly associated with long - segment aganglionic segments , and decker et al .
( 21 ) reported a long aganglionic segment ( l - hscr ) in seven out of 13 patients ( 54% ) .
our experience is of total colonic aganglionosis ( tca ) in the index patient in all three families identified in our series ( 22 ) .
it therefore appears that patients with long - segment hscr carry the highest risk of developing mtc and should have a detailed family history taken : the presence of a long - segment hscr should be an important selection criterion for gene testing in hscr .
it is important to explore this concept further in families where hscr and mtc coexist , as it will yield possible ret gene associations and insights into possible molecular reasons for the phenotypic expression .
it is generally accepted that aberrant ret protein synthesis , due to inactivating genetic variations , lead to the congenital malformation of the enteric nervous system ( ens ) which we call hirschsprung 's disease .
mtc relationship also appears to be bi - directional , and ret gene activation or suppression appeared to vary over succeeding generations within the same family ( 22 ) .
butter et al . ( 23 ) reported a 50% incidence of hscr in 20 patients undergoing a prophylactic thyroidectomy for ret - associated mtc risk ( a ret c620 mutation ) . in one further reported case of familial mtc ( 24 ) with a c620s point mutation ,
the mtc developed 12 years after surgical correction of hscr in the child plus a maternal mtc 7 years after the child 's birth . in our reported series ( 22 )
, mtc was detected in the parent 5 years after the birth of the affected child .
the ret proto - oncogene [ 10q11.22 ] is the major gene involved in the pathogenesis of hscr with causative loss - of - function mutations being identified in more than 70% of cases ( 25 ) .
in essence , the extracellular domain ret mutations alter the protein and possibly its processing in the endoplasmic reticulum ( 26 ) . as a result , ret transport to and its expression at the cell surface is decreased .
multiple endocrine neoplasia also results from autosomally dominant , inherited , highly penetrant germline ret mutations that predispose patients to the development of tumors in cells derived from neural crest origin . of the more than 25 ret proto - oncogene gene mutations which have been described in association with men type 2 syndromes , the most important
are associated with the six cysteine alleles of the extracellular portion of the ret proto - oncogene in men2a .
ret is a vital gene which directs the migration , proliferation and survival of the enteric neural crest - derived cells of the enteric nervous system ( ens ) during embryogenesis .
it is also responsible for the development of the autonomic nervous system as well as for controlling kidney development and spermatogenesis , among other functions .
genetic mutation and/or variation may result in ret malfunction , which has been associated with at least four clinical conditions ( hscr , men type 2 syndromes ( a and b ) and familial medullary thyroid carcinoma ( fmtc ) . in hscr , hypomorphic ret alleles may cause delayed neuroblast migration and non - apoptotic cell death .
this causes ens maldevelopment , resulting in aganglionosis ( hscr ) and other related conditions of the ens .
men2 association raises the question of which hscr patients are at greatest risk and should therefore be further investigated by ret gene analysis .
hereditary mtc can , with rare exceptions , be traced back in family trees ( 27 ) and the hscr men2 familial association
may be missed because the mtc may appear later in life without the connection being made . as a result ,
the risk of hscr patients later developing features of an men2 syndrome ( with mtc ) is thought to be under - evaluated .
the risk of a future thyroid carcinoma remains a matter of general concern in long - term hscr management .
it is becoming clear that there is a need for screening in order to determine which patients require ret gene analysis as a means of determining risk .
the most frequently identified mutation responsible for men2a involves the substitution of the cysteine amino acid at position 634 ( cys634arg or c634r ) by the amino acid arginine .
however , point mutations in the cysteine - rich ret area at the 620 position , along with some other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as being mostly associated with the hscr men2 phenotype . by way of contrast , in > 90% of men2b patients , the amino acid methionine is replaced by threonine at position 918 ( m918 t ) in the intracellular portion of the gene .
there are also a number of other ret variations that are associated with thyroid cancers and familial medullary thyroid carcinoma which may give rise to an overactive abnormal ret protein .
the cosegregation of hscr and men2 is particularly interesting as it involves both a switch off and a switch on of the gene in the same patient .
some remarkable family lineages have been reported which demonstrate the occurrence of the two conditions in family lineages ( 17),(22 ) .
like other receptor tyrosine kinases ( rtks ) , ret is made up of at least three functional areas ( extracellular , transmembrane and intracellular regions ) which appear to have specific roles in cellular function ( 28 ) .
it is interesting that , in contrast to other susceptibility areas , the ret mutations which have been identified as carrying both a risk for hscr as well as men2 approximate the transmembrane domain of the gene ( mostly c620r and occasionally c620s and rarely c620w ) ( 21 ) .
although the majority of reports connect these two conditions with point mutations in the cysteine - rich ret - area at the 620 position , other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as alternative sites . the high frequency with which the c620 ret mutation occurs in hscr
mutation in this position , which , like the roman god of doorways , can face in both directions ( i.e. activation ( men / mtc ) and inactivation ( hscr ) . our own studies ( 22 ) have shown the ret-620 cysteine variations to be present in 2.5% of hscr families ( three out of 118 families investigated ) , which is in keeping with other reports ( 21 ) .
there was , however , an uncertain prevalence of hscr men in related family members as not all could be tested .
studies have also shown that the closer mutations are to the transmembrane domain , the higher their importance in terms of the development of cellular proliferation and tumor activation ( 29 ) .
a strong self - association has been shown in the transmembrane portion of the gene ( ret - tm ) , which has been suggested as a possible explanation of the oncogenic activation due to ret cysteine mutations in oncogenesis ( 29 ) .
this suggests an area that plays an important role in mtc risk evaluation and may identify a target area for novel therapeutic strategies .
because men2a relates mostly to the ret alleles at the six cysteine positions in the extracellular domain of the gene , it appears to induce a different set of downstream signaling genes from that carrying the men 2b mutation .
the multidocking intracellular portion of the ret gene where men2b ret variations are situated appears to be vital to both tyrosine kinase function and downstream signaling due to the number of signaling molecules that interact there ( e.g. shc , src , frs2 , irs1 , gab1/2 , and enigma ) ( 30)(32 ) .
it is therefore easier to understand how mutations within this tyrosine - kinase rich region ( e.g. in 95% of men2b patients ) alters the substrate specificity of ret tyrosine kinase and results in gene activation .
genetic variations impair the ret tyrosine kinase response to tyrosine kinase activation , thus appearing to dictate downstream signaling cascade response ( 33 ) .
the induction of a disulfide - linked homodimerization resulting from the cysteine - related mutations within the extracellular portion of the ret proto - oncogene promote dimer formation within the gene as covalent receptor dimers are linked by disulfide bonds between unpaired cysteines ( 34),(35 ) .
it is known that the ret protein targets a number of intracellular signaling cascades , including the ras - raf - erk1/2 , pik3-akt , and stat transcription pathways ( 36 ) .
the activation of the mapk and ras / erk molecular signaling cascades involves grb2/msos recruitment ( 37 ) .
in addition , recent studies have suggested that the mammalian target of the rapamycin ( mtor ) intracellular signaling pathway is functionally activated in mtc ( especially in those with germline ret mutations ) ( 38 ) , and that the role of the other downstream ret tyrosine kinase signaling cascades ( e.g. braf , ras isoforms and pi3 kinase ) is less certain .
oncogenic ret mutations mostly occur de novo in sporadic mtc , and it is now well accepted that ret gene variations produce aberrant proteins which may bypass the normal linking to growth factors outside the cell , most probably triggering cells to grow and divide abnormally and , in turn , promoting tumor formation .
ret activation then promotes ret - dimer formation and activation of the tyrosine kinase outside of the normal ligand binding system .
however , little is known of the actual mechanisms whereby extracellular domain mutations ( e.g. c620s ) may result in c - cell proliferation ( 39 ) . current understanding of ret gene activation in mtc is that the gene is activated by alterations in autophosphorylation , or alternatively by the modification of the subcellular distribution of the active kinase or the induction of unusual interactions with other proteins ( e.g. ret / ptc ) ( 40 ) .
it is possible that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc ( 41 ) .
the less common codons c620 , c618 and c611 within exon 10 confer a weaker transforming activity in vitro than exon 11 ( c634 ) ret mutations ( 42 ) . it has been suggested that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc involving the endoplasmic reticulum which has been shown to decrease cell surface ret expression in hscr ( 26 ) .
changes in polarity in men2a hscr may result in the unfolding of the ret protein initially failing to achieve homeostasis via the unfolded protein response ( upr ) of the endoplasmic reticulum , leading to apoptosis and hscr .
subsequent upregulation of the upr may then induce changes which allow gene activation , thus providing a growth advantage to tumor cells .
oncogenic ret mutations affect protein synthesis and function , which then influence a number of downstream molecular signaling pathways ( 43 ) .
studies have demonstrated that ret influences the downstream phosphorylation of the insulin receptor substrate-2 ( irs 2 ) with subsequent activation of phosphatidylinositol 3 kinase ( pi 3-kinase ) and protein kinase b ( pkb / akt ) signaling pathways ( 44 ) .
in addition , the induction of phosphorylation of shc results in growth factor receptor binding protein 2 ( grb-2 ) binding and activation of the mitogen - activating protein ( map ) kinase pathway ( 45 ) .
the resulting mapk irs-2 , pi 3-kinase and pkb / akt activation could transduce the oncogenic ret signal to promote gene transcription , possibly through activation of the jun / ap-1 transcription cascades ( 44 ) .
this paper draws attention to the apparent genotype phenotype correlation which exists between ret and the men2 syndromes ( 46),(47 ) .
clinical awareness of possible mtc has led to timely intervention and early treatment of this poor prognosis chemo- and radioresistant tumor .
establishment of risk by genetic testing has become a classic model of molecular medicine being integrated into patient care .
it is therefore fairly clear that ret gene screening is of considerable value in familial screening , and offering ret testing is considered best practice for the clinical management of patients at risk of men2a and men2b .
gene mutation in the ret 620 position carries significant risk of developing hscr and/or mtc . in the interests of cost - effectiveness
, it may be part of a targeted investigation of high - risk areas of the gene in hscr patients at risk , thus facilitating follow - up and future management .
genetic screening is an extremely sensitive method of identifying risk in men2 syndromes ( 98% ) and prophylactic surgical intervention may prevent the onset of the radio- and chemoresistant mtc ( 48 ) .
better understanding of the ret-620 relationship would also allow for a more cost - effective method of identifying those at risk by focusing ret gene testing to this specific area as a hot spot .
in addition , a number of attractive targets are being identified which may be suitable for novel therapeutic signaling pathway - specific drug design ( 49 ) .
novel approaches to treatment based on this genetic knowledge have already resulted in randomized clinical trials into the effectiveness of multi - kinase inhibitors such as axitinib , sorafenib , motesanib , and xl-184 .
these have shown early promise in selected cases which may soon change the management of thyroid cancer ( 50 ) .
the men hscr association has been shown to cosegregate in hscr patients with both short- and long - segment aganglionosis ( 21 ) .
it seems to be particularly associated with long - segment aganglionic segments , and decker et al .
( 21 ) reported a long aganglionic segment ( l - hscr ) in seven out of 13 patients ( 54% ) .
our experience is of total colonic aganglionosis ( tca ) in the index patient in all three families identified in our series ( 22 ) .
it therefore appears that patients with long - segment hscr carry the highest risk of developing mtc and should have a detailed family history taken : the presence of a long - segment hscr should be an important selection criterion for gene testing in hscr .
it is important to explore this concept further in families where hscr and mtc coexist , as it will yield possible ret gene associations and insights into possible molecular reasons for the phenotypic expression .
it is generally accepted that aberrant ret protein synthesis , due to inactivating genetic variations , lead to the congenital malformation of the enteric nervous system ( ens ) which we call hirschsprung 's disease .
mtc relationship also appears to be bi - directional , and ret gene activation or suppression appeared to vary over succeeding generations within the same family ( 22 ) .
butter et al . ( 23 ) reported a 50% incidence of hscr in 20 patients undergoing a prophylactic thyroidectomy for ret - associated mtc risk ( a ret c620 mutation ) . in one further reported case of familial mtc ( 24 ) with a c620s point mutation ,
the mtc developed 12 years after surgical correction of hscr in the child plus a maternal mtc 7 years after the child 's birth . in our reported series ( 22 ) ,
mtc was detected in the parent 5 years after the birth of the affected child .
the ret proto - oncogene [ 10q11.22 ] is the major gene involved in the pathogenesis of hscr with causative loss - of - function mutations being identified in more than 70% of cases ( 25 ) . in essence , the extracellular domain ret mutations alter the protein and possibly its processing in the endoplasmic reticulum ( 26 ) . as a result , ret transport to and its expression at the cell surface is decreased .
multiple endocrine neoplasia also results from autosomally dominant , inherited , highly penetrant germline ret mutations that predispose patients to the development of tumors in cells derived from neural crest origin . of the more than 25 ret proto - oncogene gene mutations which have been described in association with men type 2 syndromes , the most important
are associated with the six cysteine alleles of the extracellular portion of the ret proto - oncogene in men2a .
ret is a vital gene which directs the migration , proliferation and survival of the enteric neural crest - derived cells of the enteric nervous system ( ens ) during embryogenesis .
it is also responsible for the development of the autonomic nervous system as well as for controlling kidney development and spermatogenesis , among other functions .
genetic mutation and/or variation may result in ret malfunction , which has been associated with at least four clinical conditions ( hscr , men type 2 syndromes ( a and b ) and familial medullary thyroid carcinoma ( fmtc ) . in hscr , hypomorphic ret alleles may cause delayed neuroblast migration and non - apoptotic cell death .
this causes ens maldevelopment , resulting in aganglionosis ( hscr ) and other related conditions of the ens .
men2 association raises the question of which hscr patients are at greatest risk and should therefore be further investigated by ret gene analysis .
hereditary mtc can , with rare exceptions , be traced back in family trees ( 27 ) and the hscr men2 familial association may be missed because the mtc may appear later in life without the connection being made . as a result
, the risk of hscr patients later developing features of an men2 syndrome ( with mtc ) is thought to be under - evaluated .
the risk of a future thyroid carcinoma remains a matter of general concern in long - term hscr management .
it is becoming clear that there is a need for screening in order to determine which patients require ret gene analysis as a means of determining risk .
the most frequently identified mutation responsible for men2a involves the substitution of the cysteine amino acid at position 634 ( cys634arg or c634r ) by the amino acid arginine .
however , point mutations in the cysteine - rich ret area at the 620 position , along with some other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as being mostly associated with the hscr men2 phenotype . by way of contrast , in > 90% of men2b patients , the amino acid methionine is replaced by threonine at position 918 ( m918 t ) in the intracellular portion of the gene .
there are also a number of other ret variations that are associated with thyroid cancers and familial medullary thyroid carcinoma which may give rise to an overactive abnormal ret protein .
the cosegregation of hscr and men2 is particularly interesting as it involves both a switch off and a switch on of the gene in the same patient .
some remarkable family lineages have been reported which demonstrate the occurrence of the two conditions in family lineages ( 17),(22 ) .
like other receptor tyrosine kinases ( rtks ) , ret is made up of at least three functional areas ( extracellular , transmembrane and intracellular regions ) which appear to have specific roles in cellular function ( 28 ) .
it is interesting that , in contrast to other susceptibility areas , the ret mutations which have been identified as carrying both a risk for hscr as well as men2 approximate the transmembrane domain of the gene ( mostly c620r and occasionally c620s and rarely c620w ) ( 21 ) .
although the majority of reports connect these two conditions with point mutations in the cysteine - rich ret - area at the 620 position , other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as alternative sites .
the high frequency with which the c620 ret mutation occurs in hscr men patients suggests the concept of the so - called janus gene
mutation in this position , which , like the roman god of doorways , can face in both directions ( i.e. activation ( men / mtc ) and inactivation ( hscr ) . our own studies ( 22 ) have shown the ret-620 cysteine variations to be present in 2.5% of hscr families ( three out of 118 families investigated ) , which is in keeping with other reports ( 21 ) .
there was , however , an uncertain prevalence of hscr men in related family members as not all could be tested .
studies have also shown that the closer mutations are to the transmembrane domain , the higher their importance in terms of the development of cellular proliferation and tumor activation ( 29 ) .
a strong self - association has been shown in the transmembrane portion of the gene ( ret - tm ) , which has been suggested as a possible explanation of the oncogenic activation due to ret cysteine mutations in oncogenesis ( 29 ) .
this suggests an area that plays an important role in mtc risk evaluation and may identify a target area for novel therapeutic strategies .
because men2a relates mostly to the ret alleles at the six cysteine positions in the extracellular domain of the gene , it appears to induce a different set of downstream signaling genes from that carrying the men 2b mutation .
the multidocking intracellular portion of the ret gene where men2b ret variations are situated appears to be vital to both tyrosine kinase function and downstream signaling due to the number of signaling molecules that interact there ( e.g. shc , src , frs2 , irs1 , gab1/2 , and enigma ) ( 30)(32 ) .
it is therefore easier to understand how mutations within this tyrosine - kinase rich region ( e.g. in 95% of men2b patients ) alters the substrate specificity of ret tyrosine kinase and results in gene activation .
genetic variations impair the ret tyrosine kinase response to tyrosine kinase activation , thus appearing to dictate downstream signaling cascade response ( 33 ) .
the induction of a disulfide - linked homodimerization resulting from the cysteine - related mutations within the extracellular portion of the ret proto - oncogene promote dimer formation within the gene as covalent receptor dimers are linked by disulfide bonds between unpaired cysteines ( 34),(35 ) .
it is known that the ret protein targets a number of intracellular signaling cascades , including the ras - raf - erk1/2 , pik3-akt , and stat transcription pathways ( 36 ) .
the activation of the mapk and ras / erk molecular signaling cascades involves grb2/msos recruitment ( 37 ) .
in addition , recent studies have suggested that the mammalian target of the rapamycin ( mtor ) intracellular signaling pathway is functionally activated in mtc ( especially in those with germline ret mutations ) ( 38 ) , and that the role of the other downstream ret tyrosine kinase signaling cascades ( e.g. braf , ras isoforms and pi3 kinase ) is less certain .
oncogenic ret mutations mostly occur de novo in sporadic mtc , and it is now well accepted that ret gene variations produce aberrant proteins which may bypass the normal linking to growth factors outside the cell , most probably triggering cells to grow and divide abnormally and , in turn , promoting tumor formation .
ret activation then promotes ret - dimer formation and activation of the tyrosine kinase outside of the normal ligand binding system .
current understanding of ret gene activation in mtc is that the gene is activated by alterations in autophosphorylation , or alternatively by the modification of the subcellular distribution of the active kinase or the induction of unusual interactions with other proteins ( e.g. ret / ptc ) ( 40 ) .
it is possible that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc ( 41 ) .
the less common codons c620 , c618 and c611 within exon 10 confer a weaker transforming activity in vitro than exon 11 ( c634 ) ret mutations ( 42 ) . it has been suggested that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc involving the endoplasmic reticulum which has been shown to decrease cell surface ret expression in hscr ( 26 ) .
changes in polarity in men2a hscr may result in the unfolding of the ret protein initially failing to achieve homeostasis via the unfolded protein response ( upr ) of the endoplasmic reticulum , leading to apoptosis and hscr .
subsequent upregulation of the upr may then induce changes which allow gene activation , thus providing a growth advantage to tumor cells .
oncogenic ret mutations affect protein synthesis and function , which then influence a number of downstream molecular signaling pathways ( 43 ) .
studies have demonstrated that ret influences the downstream phosphorylation of the insulin receptor substrate-2 ( irs 2 ) with subsequent activation of phosphatidylinositol 3 kinase ( pi 3-kinase ) and protein kinase b ( pkb / akt ) signaling pathways ( 44 ) .
in addition , the induction of phosphorylation of shc results in growth factor receptor binding protein 2 ( grb-2 ) binding and activation of the mitogen - activating protein ( map ) kinase pathway ( 45 ) .
the resulting mapk irs-2 , pi 3-kinase and pkb / akt activation could transduce the oncogenic ret signal to promote gene transcription , possibly through activation of the jun / ap-1 transcription cascades ( 44 ) .
this paper draws attention to the apparent genotype phenotype correlation which exists between ret and the men2 syndromes ( 46),(47 ) . clinical awareness of possible mtc has led to timely intervention and early treatment of this poor prognosis chemo- and radioresistant tumor .
establishment of risk by genetic testing has become a classic model of molecular medicine being integrated into patient care .
it is therefore fairly clear that ret gene screening is of considerable value in familial screening , and offering ret testing is considered best practice for the clinical management of patients at risk of men2a and men2b .
gene mutation in the ret 620 position carries significant risk of developing hscr and/or mtc . in the interests of cost - effectiveness
, it may be part of a targeted investigation of high - risk areas of the gene in hscr patients at risk , thus facilitating follow - up and future management .
genetic screening is an extremely sensitive method of identifying risk in men2 syndromes ( 98% ) and prophylactic surgical intervention may prevent the onset of the radio- and chemoresistant mtc ( 48 ) .
better understanding of the ret-620 relationship would also allow for a more cost - effective method of identifying those at risk by focusing ret gene testing to this specific area as a hot spot .
in addition , a number of attractive targets are being identified which may be suitable for novel therapeutic signaling pathway - specific drug design ( 49 ) .
novel approaches to treatment based on this genetic knowledge have already resulted in randomized clinical trials into the effectiveness of multi - kinase inhibitors such as axitinib , sorafenib , motesanib , and xl-184 .
these have shown early promise in selected cases which may soon change the management of thyroid cancer ( 50 ) . | the risk of patients with hirschsprung 's disease later developing multiple endocrine neoplasia remains a matter of concern .
the multiple endocrine neoplasia 2hirschsprung 's disease association has been shown to cosegregate in hirschsprung 's disease patients with both short- and long - segment aganglionosis , although patients with long - segment aganglionosis a to carry the greatest risk .
the hirschsprung 's disease
medullary thyroid carcinoma relationship also appears to be bi - directional , and activation or suppression of the rearranged during transfection gene appeared to vary over succeeding generations within the same family . rearranged during transfection gene variations are associated with both conditions .
the cosegregation of hirschsprung 's disease and multiple endocrine neoplasia 2 is particularly interesting as it involves both
switch off and switch on of the rearranged during transfection proto - oncogene in the same patient .
this cosegregation mostly relates to the cysteine - rich area on ret-620 ( the janus gene ) .
the mechanism whereby rearranged during transfection influences gene activation in multiple endocrine neoplasia 2 is complex , but genetic variations impair the rearranged during transfection tyrosine kinase response to tyrosine kinase activation , thus appearing to dictate downstream signaling cascade responses .
better understanding of the ret-620 relationship allows for a more cost - effective method of identifying those at risk by focusing rearranged during transfection gene testing to this specific area as a hot spot .
the clinical awareness of possible medullary thyroid carcinoma has led to timely intervention and early treatment of this chemo- and radioresistant tumor with poor prognosis .
establishment of risk by genetic testing has become a classic model of molecular medicine being integrated into patient care and offering rearranged during transfection - directed prophylactic surgical management .
in addition , novel approaches to treatment based on this genetic knowledge have already shown early promise in randomized clinical trials . |
between august 2008 and november 2011 , 4 male patients with escc experienced postoperative anastomotic fistulae with mediastinal sepsis after mckeown - type esophagectomy with two - field lymphadenectomy .
ajcc , american joint committee on cancer ; sm , superior mediastinum ; ps , pleural spaces ; sa , oligotrophic stenotrophomonas and aeromonas ; ca , candida albicans ; e. coli , escherichia coli ; pa , pseudomonas aeruginosa ; acb , acinetobacter calcoaceticus - baumannii ; etd , endoscopic transluminal drainage ; dtp , double - tube drainage of pleural cavity . the postoperative day on which the fistulae occurred .
all 4 patients underwent mckeown - type esophagectomy with two - field lymphadenectomy and cervically located anastomosis .
intravenous hyperali - mentation was performed to increase the recovery of gastrointestinal function after surgery , followed by enteral nutrition when warranted .
once a fistulae was confirmed , empiric antibiotics were administered immediately , followed by the appropriate antibiotics once culture results were obtained .
the presence of a fistulae was confirmed by clinical symptoms , meglumine diatriazoate swallowing , and endoscopy , with a computed tomography ( ct ) scan of the thorax and abdomen performed if necessary .
one was initially treated conservatively due to his mild symptoms and young age , followed by endoscopic transluminal drainage when conservative management failed .
two patients , both with sepsis and fluid within the superior mediastinal space , underwent transluminal drainage alone ; the other two also required transthoracic drainage for uncontained fistulae in both the superior mediastinal and pleural spaces .
markers of inflammation , such as white blood cell ( wbc ) count and c - reactive protein ( crp ) concentration , were measured during healing .
following the diagnosis of superior mediastinal fistulae , a guide wire was passed through the anastomotic defect endoscopically , and a nasogastric suction tube was placed over it and into the mediastinal abscess cavity from inside the esophagus . the decision to add side holes
the nozzle was placed as close to the bottom of the abscess as possible , with pumping used to ensure the correct position and patency .
the space was irrigated intermittently with saline to make the lumen pourable and dilute pus , thus eliminating the infected fluid and inducing the formation of granulation tissue .
two weeks later , meglumine diatriazoate was injected through the suction tube , and contrast imaging was performed weekly thereafter to determine the volume of the abscess cavity .
as the abscess collapsed , the tube was gradually withdrawn every three days until withdrawal was complete . at that time
all patients presented with hyperpyrexia and leukocytosis to various degrees . at 1 to 2 days after the aspiration of purulent material , the general condition of each patient began to improve , with steady decreases in body temperature and wbc counts ( figure 1 ) .
endoscopy or imaging was performed to monitor the clinical healing process of the fistulae while the patients were in the hospital ( figure 2 ) .
a , chest x - ray radiography shows the gas - fluid level ( red arrow ) in the right superior mediastinum caused by the fistulae .
c , endoscopy shows that a transluminal drainage tube ( blue arrow ) was inserted into the fistulae for irrigation and section .
d , the fistulae was healed after removal of the drainage tube ( blue arrow ) .
e , chest computed tomography shows partial abscess ( green arrow ) in the right chest before transluminal drainage .
patient 2 had a relatively short healing time ( 49 days ) , despite his old age .
severe sepsis and surgical strike resulted in cardiopulmonary insufficiency , which was managed by the placement of two endoscopic drains and prolonged inotropic cardiovascular support and ventilator treatment for 18 days . on day 22 in the hospital , he had a urinary infection ( figure 2 ) and was managed by bladder irrigation with nitrofurazone .
oral intake was initiated before complete healing of the suture line in this patient because the residual cavity was so small that it could be ignored , and the patient was closely monitored during this period .
conservative therapy in patient 4 resulted in a marked delay in performing transluminal drainage and prolonged the healing period to 76 days .
the therapeutic options include surgical repair or resection or conservative management , including the cessation of oral intake and antibiotic therapy . over the past two decades
, various conser - vative management regimens have been designed for patients with anastomotic fistulae , including the implantation of a self - expanding metallic stent , endoscopic clipping , and the application of fibrin glue or biodegradable fistulae plugs. despite these therapeutic modalities , treating an intrathoracic fistulae , especially a mediastinal fistulae , remains challenging , , , .
in addition , large blood vessels , such as the aorta , may rupture at any time due to corrosion by pus , particularly when fistulae is confined to the superior mediastinum .
moreover , the rarity , occultness , and difficult exposure of this condition often delay its diagnosis , by which time the affected esophageal wall may have become edematous and friable , and fibrinous mediastinitis may have developed , making primary surgical repair almost impossible. thus , despite the recently reported muscle onlay approach , which yielded satisfactory results , we preferred using more conservative interventional therapy . because the leading cause of death in patients with postoperative anastomotic fistulae is an uncontrollable intrathoracic or mediastinal abscess , the key to management is early and adequate drainage , , .
the timely management of our 4 patients resulted in rapid recovery and early discharge , suggesting that this method is effective and feasible , even in elderly individuals . compared with other conservative management regimens , such as endoscopic clipping and the application of fibrin glue or biodegradable fistulae plugs ,
endoscopic transluminal drainage achieve adequate drainage rather than simple closure of the fistulae . when diagnosis is combined with treatment , placing a suction tube into the abscess
intermittent irrigation with saline , which rinses the area and suppresses local inflammation , enhances drainage .
our patients showed improvement in their general condition , including a decreased wbc count , within 1 to 2 days after the insertion of drainage tubes .
in addition , this approach eliminated the need for a prolonged stay in the intensive care unit , unless a serious morbidity occurred .
complications after endoscopic stenting including stent migration , which is observed in 3% to 58% of patients , unplanned endoscopic reintervention , which is observed in 19% to 59% , and intestinal obstruction , which is observed in up to 16% , , , .
endoscopic transluminal drainage was more effective , resulting in spontaneous healing with little manual work .
contrast imaging can be used to assess abscess size by the depth intubated and the amount of meglumine diatriazoate injected , making tube withdrawal more objective and effective .
the conservative features of this approach make it suitable for many types of patients , especially those in poor general condition .
the length of hospitalization of our patients , which ranged from 49 to 76 days , was longer than that of patients in a united kingdom - wide audit , in which patients were hospitalized for 25 to 55 days .
the latter results , however , were obtained from european patients with esophagogastric cancer , most of whom underwent less invasive transhiatal esophagectomy and developed fistulae that were common but not fatal , such as cervical fistulae .
ct scans of 2 of our patients showed encapsulated abscesses , allowing these patients to be managed without chest tube drainage .
because a chest tube could not reach the occult abscess , transluminal irrigation combined with suction was the most direct and effective management .
rather , they are usually due to the development of an ignored fistulae that descends to the mediastinal space .
abnormal but nonspecific symptoms , including fever , dysphoria , arrhythmia , and tachycardia , may be due to fistulae development .
in summary , mediastinal fistulae remain a challenge for treatment . due to its rarity , no standard treatment method has yet been developed .
early detection and adequate drainage are important in preventing morbidity and mortality in these patients . | the management of postoperative leaks into the mediastinum after esophagectomy remains a challenge .
we describe our clinical management of this complication through endoscopic transluminal drainage . between 2008 and 2011 , 4 patients with esophageal squamous cell carcinoma ( escc ) who underwent mckeown - type esophagectomy with two - field lymphadenectomy experienced complicated anastomotic fistulae in the presence of superior mediastinal sepsis .
all 4 patients underwent endoscopic transluminal drainage , and all survived .
the mean healing period was 50 days ( range , 31 to 58 days ) , the mean stay in the intensive care unit was 7.3 days ( range , 1 to 18 days ) , and the mean hospital stay was 64.5 days ( range , 49 to 70 days ) .
endoscopically guided transluminal drainage should be considered for escc patients with superior mediastinal fistulae after esophagectomy . |
opioids have been increasing in usage and play an important role in every aspect of modern anesthesia . among opioids ,
fentanyl , alfentanil , sufentanil , and remifentanil are commonly chosen for analgesia , sedation , hemodynamic stability , as well as attenuation of stress response during anesthesia .
however , the administration of opioids has sometimes been found to induce unanticipated pain sensitivity changes , such as opioid - induced hyperalgesia ( oih ) or tolerance .
hyperalgesia is defined as enhanced pain response to a noxious stimulus , in this case induced by opiate use .
although still being debated , the presence of oih would be a clinical challenge not only in chronic cancer pain management , but also perioperative pain .
in addition to oih , administration of opioids may also tolerance , defined as a decreased response to the drug 's analgesic effects over time , followed by loss of analgesic efficacy .
although oih is frequently conflated with opioid tolerance in the literature as the clinical features are similar , in fact they are different phenomena ; increasing opioid dose aggravates pain in oih , whereas tolerance does not .
thus , although the mechanisms underlying these two phenomena are likely distinct , they are clearly related and on the same continuum of pain sensitization processes .
the prevalence of oih and tolerance related with opioids remains unknown , however , these states appear to occur have increased in frequency with the growing use of remifentanil . moreover , the clinical significance of occurrence of oih or tolerance after perioperative use of opioid is been still under debate .
the aim of this review is to present a brief overview of oih in the setting of surgical anesthesia .
an understanding of current knowledge of potential oh mechanisms underlying oih as well as the clinical implication should be helpful to clinical anesthesiologists in helping to plan better perioperative pain control strategies .
andrews first reported reduced pain thresholds after morphine administration in opioid addicts in 1943 . similarly , tilson et al . first demonstrated that abrupt cessation of opioids induced decreased pain thresholds in rats and showed that this enhanced pain sensitivity was highly correlated with the administered dose of opioid .
consistent with these animal results , clinical investigators demonstrated the occurrence of oih after intraoperative remifentanil infusion , characterized by increased pain , combined with increased consumption of postoperative opioid , which in turn , resulted in decreased opioid efficacy .
moreover , significant pain reduction was observed after detoxification from high dose opioids which was observed in surgical patients also supports the existence of perioperative oih .
although there have also been numerous experimental studies in human and animals on oih or opioid tolerance , the differentiation between them has been indistinct .
both oih and tolerance are more evident in patients receiving a high rather that low intraoperative opioid doses .
pharmacologically , tolerance is characterized by a loss of drug potency , likely by means of a desensitization of the antinociceptive pathways to opioids , while oih is characterized by increased pain sensitivity and involves sensitization of pronociceptive pathways , both phenomena resulting in increased dose requirements . in despite of these clear differences in definition and mechanism , it is very complicated to differentiate them in clinically because the symptoms of both are somewhat relieved by increased doses of opioid .
quantitative sensory testing ( qst ) has been shown to be the most accurate means of differentiating oih and tolerance , but the complexity of time - consuming process of qst limits its wide spread use .
the neurobiology of oih is complex and several mechanisms for oih have been proposed . to date ,
activation of central glutaminergic pathways , mainly via n - methyl d - aspartate ( nmda ) receptor , have been regarded as a key pronociceptive mechanism for inducing oih . in an early study , mao et al . proposed that an increase in responsiveness of the nmda receptor contributes to the development of opioid tolerance and hyperalgesia , as evidenced by his finding that the nmda antagonist mk-801 prevented the development of oih in rats .
these concepts also supported by the finding that ketamine , a clinically - used nmda receptor antagonist , reduced fentanyl - induced hyperalgesia . descending spinal facilitation mediated via changes in activity of on- and off- cells within the rostro - ventral medulla ( rvm ) involving nmda system comprises another suggested mechanism to explain oih .
these neurons , which project to the spinal cord and display changes in activity in response to noxious stimuli facilitate or inhibit nociceptive transmission respectively .
administration of -opioid receptor ( mor ) ligands changes the circuit into the off - cell state , whereas the presence of a prolonged noxious stimulus changes it into an on - cell state .
globally , oih may partly result from an unbalanced activity of the off- and on - cells underlying the apparent development of tolerance . in support of this theory ,
. demonstrated that injection of lidocaine into the rvm or bilateral lesions of the dorsolateral funiculus blocked opioid - induced hyperalgesia and restored antinociceptive morphine potency .
the opioid receptor family , part of the large g - protein - coupled receptor ( gpcr ) family , consists of 4 different distinct receptors : , ( dor / oprd ) , ( kor / oprk1 ) and opioid receptor - like ( orl1/oprl ) receptor , all of which are present in nuclei of the pain modulation circuit .
in contrast , kor agonists act presynaptically and orl1 agonists act postsynaptically to inhibit both on- and off - cells in the rvm .
when morphine is administered systemically or into the periaqueductal grey matter , the on - cells become silent and the off - cells fire continuously . in this off - cell state ,
this inhibition is reversed by inactivation of the rvm or selective inhibition of off - cell firing . in the off - cell
activated state , microinjection of either an orl1 or a kor agonist will inhibit off - cells and has anti - analgesic action .
adrenergic and opioid receptors both belong to the gpcr family , couple to analogous signal transduction pathways , and affect the nociceptive system .
various biochemical studies have proposed the existence of gpcr dimerization , which may facilitate transport of receptors to the cell surface and g protein coupling and activation .
a heterodimer formation between mor and -adrenoceptor units ( 2ar ) enhances mor signaling in response to morphine but severely decreases the opioid response following the simultaneous addition of morphine and 2ar agonist .
vilardaga et al . proposed a model in which morphine binding to the mor rapidly changes conformation of the activated 2ar , and this transconformational change permits direct inactivation of a gi protein .
the direct conformational switching of one receptor by the other that enables inhibition of receptor activation is likely a means of rapidly preventing overstimulation of signaling pathways and may contribute to oih .
some neuropeptides , which oppose anti - opioid peptides has been investigated and shown convincing results .
the administration of neuropeptide cholecystokinin , the neuropeptide ff , and orphanin fq / nociception have all demonstrated anti - hyperalgesic effect . as a possible third mechanism , spinal dynorphin , an endogenous opioid ligand ,
may also play an important role in the development of oih . increased concentration dynorphin in spinal cord and primary afferents after noxious stimuli
stimulates the release of calcitonin gene - related peptide and thus increase stimulus - evoked spinal excitation .
based on the fact that there exists individual difference in the occurrence of oih , there may well be a genetic predisposition of oih among the patients .
. found that polymorphisms of the catechol - o - methyl transferase gene were more prevalent in patients demonstrating oih and pain sensitization .
finally , beyond the physiological mechanisms discussed here , psychological factors including anxiety and catastrophizing about pain could be modulating factors in the development of oih .
clrier proposed a model of neuroadaptative changes linking oih . before the first exposure to opioid
, an initial equilibrium is associated with a low level balance between opioid - dependent analgesic systems ( pain inhibitory ) and nmda - dependent pronociceptive systems ( pain excitatory ) .
repeated opioid administrations induces a gradual decrease in the nociceptive threshold ( pronociceptive systems sensitization ) leading to hyperalgesic state .
this progressively shifts the unchanged analgesic response , giving the impression of less analgesia ( apparent tolerance ) .
after withdrawal of opioid , counter - adaptation of opioid - dependent analgesic systems is built by changes in the endogenous opioidergic system , and thus a new equilibrium between opioid - dependent analgesic systems and nmda - dependent pronociceptive systems is established .
this new , reset equilibrium ( allostasis ) balance leads to long - term pain vulnerability .
oih has been studied mainly after opioid - based anesthesia and during postoperative analgesia . for several decades ,
importantly , a meta - analysis of studies demonstrated that while oih is consistently present in patients given remifentanil , it 's occurrence with fentanyl administration has not been established .
thus , this review deals mainly with literature reports of clinical manifestation and modulatory factors associated with remifentanil infusion : dose , infusion duration , speed of withdrawal , and other combined anesthetic drugs .
oih manifests itself by increased sensitivity to painful stimulation which extends to throughout the entire body from the site of preexisting pain .
thus , oih exacerbates preexisting painful conditions and therefore can further progress a painful disease state . through the literature ,
high doses of remifentanil have been regarded as an important factor of oih : most trials show that oih is most likely to occur at infusion rates of > 0.32 ug / kg / min .
this dose dependency in inducing oih has been demonstrated both in animal and human study . in rats , a decrease in both thermal threshold and mechanical thresholds are directly proportional to the administered dose of remifentanil .
similarly , in surgical patients , postoperative pain scores and cumulative morphine consumption have been shown to be enhanced more in patients receiving high dose remifentanil . a potential mechanism underlying this dose dependence
was demonstrated in vitro in a patch clamp single - cell electrophysiologic study which demonstrated cumulative dose , duration of administration , and modality of withdrawal could all influence the extent of oih .
bolus only or shorter infusion of remifentanils led to long - term potentiation but with lower incidence
. moreover , tapered withdrawal more than 30 minutes after 1 hr infusion prevented long - term potentiation compared with abrupt withdrawal .
co - administration of n2o or propofol with remifentanil decreases oih development and consumption of analgesics .
all of these factors could be an auxiliary method to minimize the pronociceptive effects of opioids .
to date , possible treatment pharmacologic regimens for oih include partial mor agonist ( buprenorphine ) nmda receptor antagonists ( ketamine and dextromethorphan ) , cyclooxygenase ( cox ) inhibitors ( nonsteroidal anti - inflammatory drugs ) , and 2 receptor agonists .
buprenorhine , a partial mor agonist and - and - receptor antagonist , has a unique property : its antihyperalgesic effects lasted longer than its analgesic effects ( 2.6 times and 1.9 times for i.v . and s.c .
this effect may be mediated through the blockade of -receptors , as agonists at this receptor are known to promote hyperalgesia mediated by descending facilitation .
methadone also has an antihyperalgesic action , and has the potential to be widely used in the clinical setting to reduce oih .
spinal nmda receptors appear to contribute to the development and maintenance of oih . numerous animal and human studies
these studies have shown beneficial effects of supplementation of opioid treatment with ketamine : higher pain thresholds and lessened hyperalgesia in animals and better pain control scores and less use of postoperative morphine in humans .
another nmda receptor antagonist , dextromethorphan , has not been widely studied as a means of modulation of oih , likely due to its lack of antihyperalgesic action .
prostaglandins , including pge2 , can stimulate glutamate release in the spinal cord resulting in activation of nmda receptors .
thus , coadministration of the cox inhibitors parecoxib and ketorolac significantly decreased the area of pinprick hyperalgesia during remifentanil , however , pretreatment prior to remifentanil infusion was without effect .
. further study of this promising treatment is needed to guide cox inhibitor use in preventing oih .
several studies have provided biochemical evidence for the physical association of 2ar with mors and have identified that functional mor-2ar complexes can form in brain and spinal cord neurons .
although the significance and function of such a receptor complex are not fully understood , the effect of 2ar antagonist on oih could be accomplished by interactions with this heterodimer complex .
clinical and laboratory observations also indicate that 2-adrenoceptor agonists may deter the development of oih as well as alleviate the symptoms of opioid - withdrawal .
for example , coadministration of clonidine with morphine in rats wherein oih had been induced normalized both mechanical and thermal thresholds to baseline sensitivities .
clinically , a case report presented the experience of administering dexmedetomidine , an 2ar agonist , during opioid dose reduction in patients with oih , allowed normalization of nociceptive and antinociceptive responses . when compared to the chronic pain management setting ,
oih is less well recognized and the clinical implications less well understood in perioperative settings , despite the fact that there multiple articles have been published establishing this side effect of perioperative opioid administration .
several clinical trials of oih have reported increased postoperative pain and morphine consumption . however , those changes are typically controlled acutely without severe side effects by increased morphine consumption
. anesthesiologist should however improve their armamentarium in dealing with oih , using some modulatory or pharmacologic approaches to oih which should be helpful both in terms of eliciting fewer and less severe acute side effects but also limiting the lasting consequences of oih .
clinical anesthesiologists need to better understand oih and its implications for pain control and opioid usage during the perioperative period . although the clinical implication of oih is not fully established , we need to understand that oih could be a starting point of pain sensitization and pain chronicification .
therefore , anesthesiologists should endeavor to prevent or treat oih through modulatory or pharmacologic means based on and understanding of the likely mechanisms underlying oih and these treatment means . | pain is difficult to investigate and difficult to treat , in part , because of problems in quantification and assessment .
the use of opioids , combined with classic anesthetics to maintain hemodynamic stability by controlling responses to intraoperative painful events has gained significant popularity in the anesthetic field .
however , several side effects profiles concerning perioperative use of opioid have been published . over the past two decades ,
many concerns have arisen with respect to opioid - induced hyperalgesia ( oih ) , which is the paradoxical effect wherein opioid usage may decrease pain thresholds and increase atypical pain unrelated to the original , preexisting pain .
this brief review focuses on the evidence , mechanisms , and modulatory and pharmacologic management of oih in order to elaborate on the clinical implication of oih . |
terrestrial environment has been widely affected by humans and habitats of terrestrial species are facing irreplaceable transformation which in term would pose great threats to the survival of these species .
it is said that worldwide organisms are now facing the sixth mass extinction period [ 3 , 4 ] .
in such a context , ecologists have high pressures to facilitate conservation measures so as to better offer refuges for conserving species .
one of these measures is to understand the evolution and drivers of extinction risk of species [ 5 , 6 ] .
birds are an important vertebrate taxonomy and deserve to be allocated more conservation efforts because of their popularity for common people [ 79 ] .
understanding and modeling extinction risk of birds would be an important step to set up corresponding conservation strategies .
there are growing interests focusing on the diversification , biogeography , conservation , and extinction risk of bird species [ 1013 ] . in recent years ,
one of the trends in conservation biology is to sufficiently incorporate evolutionary information for the purpose to evaluate the impacts of species history on structuring species ' contemporary distribution , conservation priorities [ 15 , 16 ] , or threatened risk [ 2 , 17 , 18 ] .
one rationale for modeling extinction risk of species through phylogenetic tree is that the underlying ecological variables associated with extinction risk of species are related to evolutionary history of species , for example , distributional ranges [ 14 , 19 ] , morphological traits , physiological tolerance spectrum of environmental conditions , and others .
there are many previous studies working on the systematics , ecology , and conservation of birds in china [ 13 , 16 , 23 , 24 ] .
however , understanding the extinction risk of vertebrate taxa of china from an evolutionary perspective has never been seen in any of these previous literatures .
as such , in the present study , i explore the extinction risk of endemic birds of mainland china by analyzing the evolution of risk over the available species phylogenetic tree .
the list of the endemic birds of mainland china was gathered from previous studies [ 23 , 2527 ] and world bird database ( http://avibase.bsc-eoc.org/ ) .
threatened status of each species was collected from iucn red list database ( http://www.iucnredlist.org/ ) .
the following categories and associated abbreviations were used : en ( endangered ) , vu ( vulnerable ) , nt ( near threatened ) , and lc ( least concerned ) .
one species strix davidi did not have any records in the iucn red list , while another two species caprimulgus centralasicus and leucosticte sillemi were listed in the category of dd ( data deficient ) .
all of them were excluded for subsequent analyses . finally , another species ( ficedula beijingnica ) was found not to be included in the tree files of an online database described below . as such , in the present study , 48 endemic birds were included for the analyses ( table 1 ) .
the phylogenetic relationship of these birds was extracted from the birdtree.org database ( http://www.birdtree.org/ ) , which was derived from a full phylogeny of the global bird species in a previous study .
3000 trees for the possible phylogenetic affinities of these 48 endemic birds were retrieved and the resultant consensus tree with average branch lengths was obtained using dendropy python library .
the resultant dated tree was used for all subsequent analyses and was available as the supplemental material of the study ( see supplementary material available online at http://dx.doi.org/10.1155/2013/639635 ) .
i followed some previous studies to model extinction risk of species [ 2 , 18 ] . in detail , first , i assigned a discrete integer to each of the iucn categories as follows : en ( 1 ) , vu ( 2 ) , nt ( 3 ) , and lc ( 4 ) .
then , i applied the disparity through time ( dtt ) to model the pattern of iucn threatened status of species over different clades of the endemic bird phylogeny .
dtt is the standardized mean pairwise distance between species [ 2 , 31 ] . when the disparity of species is more remarkable between than within clades , dtt would be close to 0 towards the contemporary time and high dtt values are usually found at the time points near the root of the tree , implying that threatened status of species within a specific subclade tends to be similar .
in contrast , when the disparity is more remarkable within clades , dtt should approach 1 towards the contemporary time and high dtt values are located at time points closed to the tips of the tree , implying that threatened status of species within a specific clade tends to vary greatly . for any time point ,
when the observed dtt value is higher than the expected one ( on the randomized null curve ) , trait conservatism is suggested .
in contrast , when the observed dtt value lies below the expected one on the null curve , trait overdispersion was suggested . as such
, dtt index provided a way to understand the evolutionary paths of extinction risk of species along the evolutionary history .
i also applied different evolutionary models to model the evolution of threatened risk of species . in specific
, the following models were used to fit the evolution of extinction risk of species : delta , linearchange , tworate and null models .
detailed information about these models for characterizing the temporal patterns of extinction risk of species were presented in table 2 . during the modeling , the equal - rate transition model was assumed .
as showed in figure 1 , disparity within clades above the null line indicated that extinction risk of species tends to be similar within both old and young clades ( indicating phylogenetic conservatism within subclades ) .
in particular , there was a large difference between the observed and null dtt under randomization when evolutionary time window moves towards current time ( figure 1 ) .
although the two - rate shifting model had the lowest aic value ( aic = 125.46 ) ( table 3 ) , it was not considerably different from the aic value ( aic = 126.34 ) for the null model which assumes a single constant rate . also , the tworate model had a breakpoint at evolutionary time 0.013 , which is almost identical to the starting point of the phylogenetic tree ( hence becomes very unrealistic ) .
moreover , the tworate model has one more parameter in comparison to that of the constant - rate model .
therefore , the constant - rate evolutionary rate model could not be rejected and should be retained as the best one to quantify the evolution of extinction risk of endemic birds of mainland china .
the present short report showed that extinction risk of endemic birds of mainland china showed a conservatism pattern over evolutionary history ( figure 1 ) .
moreover , the relative high dtt values were found at time points near the root , indicating that extinction risk of endemic birds tends to be similar as long as they are in the same subclade . at last
, it was observed that the constant - rate evolutionary model is the best one to quantify the evolution of extinction risk of endemic birds of mainland china .
it was found that angiosperm and vertebrate species showed many fundamental differences at evolutionary perspectives .
for example , it was found that the less threatened taxa are found in more diverse clades for vertebrates [ 35 , 36 ] , while the more threatened species are present in more diverse clades for plants . in the present study , it was further found that vertebrates and plants can be different at the aspects of the evolutionary models for best quantifying trait evolution .
a recent study working on african angiosperm species showed that delta model was most favored , while in my study , the constant - rate model was the best one to explain evolution of extinction risk of endemic birds of china . however , it shares some similarities for the evolution of extinction risk between bird and angiosperm species .
for example , as mentioned above , there exists a large difference between the observed and null dtt under randomization when evolutionary time approaches current time .
this implies that late - bust model is applicable to explain the evolution of extinction risk of bird species , being similar to that for angiosperm species in the cape region of africa .
my present study may not be generalized to the situation when taking nonendemic avian taxa into consideration .
sampling issue is very sensitive for phylogenetic comparative studies [ 37 , 38 ] . as such , for future perspectives , it would be of broad implication to analyze a more comprehensive dataset by including all bird species found in mainland china so as to better quantify the evolution of threatened risk of birds .
i can not obtain either the phylogenetic positions or detailed distributional information of som other endemic bird species .
hence , they are not included in the present study , which in turn drives the conclusions of the present study to become biased more or less .
the omission of nonendemic species might further lead to a bias in bias the present results , although their distributional ranges are out of the territory of china .
second , species extinction rates could be related to a variety of complicated factors , for example , the contemporary habitat conditions , climatic variability , historical contingency , and level of disturbances that the species is facing . as such , modeling of species extinction risk from an evolutionary perspective
might not be of full help to elucidate the extinction mechanisms of species driven by anthropogenic disturbance . | the extinction risk of endemic birds of mainland china was modeled over evolutionary time .
results showed that extinction risk of endemic birds in mainland china always tended to be similar within subclades over the evolutionary time of species divergence , and the overall evolution of extinction risk of species presented a conservatism pattern , as evidenced by the disparity - through - time plot .
a constant - rate evolutionary model was the best one to quantify the evolution of extinction risk of endemic birds of mainland china .
thus , there was no rate shifting pattern for the evolution of extinction risk of chinese endemic birds over time . in a summary , extinction risk of endemic birds of mainland china
is systematically quantified under the evolutionary framework in the present work . |
reversible dysphonia or voice changes have been associated with antiangiogenic treatments such as bevacizumab , aflibercept , sunitinib , sorafenib , pazopanib , axitinib and regorafenib . as a non - life - threatening condition , vascular endothelial growth factor
( vegf)-related dysphonia may be overlooked and underreported ; however , it is an important consideration for quality of life , potentially leading to depression and frustration since the voice is so fundamental for communication and social interaction . in colorectal cancer
, bevacizumab is the most frequently administered biologic agent administered across all lines of therapy even after the development of treatment resistance . in this context , to improve quality of life and decrease the possibility of noncompliance , it is proportionately more important to heuristically recognize and treat even ( formerly ) rare side effects when they occur .
a 60-year - old man treated at walter reed national military medical center with metastatic colorectal adenocarcinoma was rechallenged with irinotecan and bevacizumab .
the patient improved symptomatically ; however , hoarseness of voice and periods of dysphonia / aphonia developed synchronously with bevacizumab and irinotecan re - treatment .
ear , nose and throat specialists were consulted , and endoscopy demonstrated edema and inflammation of the larynx .
interestingly , dysphonia was not a side effect during folfox and folfiri treatment with bevacizumab . despite the clear clinical benefit
, bevacizumab may be temporarily or permanently discontinued to investigate the reversibility of the voice loss .
bevacizumab , a humanized monoclonal antibody that intercepts vegf and inhibits angiogenesis , is indicated in the adjuvant setting for the treatment of advanced or metastatic colorectal cancer . however , it may also damage the microvasculature of normal tissue as well as neoplastic vessels , leading to adverse effects . experimental data from kamba et al . ,
which demonstrate that anti - vegf treatment leads to capillary regression in several mouse tissues , including the trachea and laryngeal mucosa , suggest that the mechanism of the clinical dysphonia may be related to disruption of these particularly sensitive capillaries ( fig .
1 ) . fortunately , however , vegf receptor - induced capillary regression may be reversible , with regrowth occurring over 1 - 2 weeks for the adult mouse tracheal mucosa .
therefore , discontinuation of bevacizumab may similarly lead to reversal of hoarseness in this patient .
we have presented this short clinical vignette for two reasons : ( 1 ) because vegf - induced dysphonia may be an underreported and underappreciated side effect , and ( 2 ) because this patient may be a bellwether for the development of formerly rare side effects like dysphonia due to the continual reuse of therapies such as bevacizumab . as life expectancy increases with improved systemic treatment
, it will be even more important to minimize side effects for maximal quality of life .
any subjects have given their informed consent , and the study protocol has been approved by the relevant institute 's institutional review board , also known as an independent ethics committee , ethical review board , or research ethics board .
the authors declare that there exist no conflicts of interest in the publishing of this case report . | inhibition of vascular endothelial growth factor ( vegf ) signaling , an initiator of tumor angiogenesis , inhibits tumor growth and invasion .
bevacizumab , a monoclonal antibody to vegf , in common use as an adjunct to standard chemotherapy like irinotecan in advanced colorectal cancer , also affects the normal ( nontumor ) vasculature .
dysphonia or voice changes have been anecdotally reported in patients that have been exposed to antiangiogenics . in this case report , we present an occurrence of severe dysphonia in a 60-year - old male with metastatic colorectal cancer after reintroduction of irinotecan and bevacizumab . to our knowledge , this is the first case of dysphonia associated with bevacizumab rechallenge . |
prediction of volume responsiveness is an important issue in critically ill patients because clinicians must find the best compromise between central blood volume depletion and volume overloading ( i.e. two opposing conditions potentially associated with poor outcome ) .
lung interaction are useful in the decision - making process regarding volume resuscitation in patients receiving mechanical ventilation with a tidal volume above 8 ml / kg and exhibiting neither inspiratory efforts nor arrhythmias .
it is beyond the scope of this commentary to review in detail the complex physiological background that underlies the use of these dynamic indices , which has been extensively covered in previous review articles [ 1 - 3 ] .
schematically , the influence of positive pressure ventilation on hemodynamics is greater when central blood volume is low than when it is normal or high . in this regard
, the larger the respiratory stroke volume variation , the larger the degree of volume responsiveness should be .
various indirect measures of stroke volume have been proposed to guide fluid therapy using the heart lung interaction . by virtue of their ability to display values
respiratory variations in arterial pulse pressure , in ' pulse contour ' stroke volume and in doppler aortic blood velocity have been shown to predict volume responsiveness far better than static markers of preload such as cardiac filling pressures or dimensions [ 4 - 7 ] . until now there has been no ideal tool because the devices that provide these indices either are fairly invasive or they require a lengthy training period before the clinician can acquire sufficient skill .
a nonivasive and easy - to - use device that can track changes in stroke volume in order to detect volume responsiveness would be particularly attractive .
the pulse oximeter used to monitor arterial blood saturation could be a good candidate because the pulse oximetry plethysmographic ( pop ) signal resembles the peripheral arterial pressure waveform .
indeed , analysis of the respiratory variation in pulse oximeter waveforms has long been proposed as a technique with which to assess blood volume status in mechanically ventilated patients . in some studies [ 8 - 10 ]
the degree of respiratory variation in the peak value of the plethysmographic waveform has been correlated with that of systolic arterial pressure .
in a recent issue of critical care , cannesson and coworkers reported a new finding by demonstrating a reasonably good correlation between respiratory variation in the amplitude of the ' pulse ' wave ( peak nadir ) calculated from variations in the pop waveform ( called pop by the authors ) and the respiratory variation in arterial pulse pressure recorded with an arterial catheter .
the strength of the study is that it takes into account the variation in the ' pulse ' wave rather than that in the peak of the wave . by reflecting the pulsatile changes in absorption of infrared light between the light source and the photo detector of the pulse oximeter
, the ' pulse ' wave is assumed to be the result of the beat - to - beat changes in stroke volume transmitted to arterial blood . in this respect , pop is potentially a marker of respiratory stroke volume variation . by contrast , the respiratory variation in the peak of the plethysmographic wave previously proposed for assessing volume status depends not only on local changes in arterial blood volume but also on the slower ventilatory changes in local venous blood volume resulting from the ventilatory changes in venous return that mainly affect the highly compliant venous bed .
the two figures presented in the report by cannesson and coworkers ( figs 1 and 4 ) clearly illustrate the slow ventilatory variation in the plethsymographic waveform ( particularly apparent at the wave ' nadir ' level ) in addition to the cyclic changes in the ' pulse ' wave .
the following weaknesses may limit the extent of the conclusions that may be drawn from the study : no volume challenge was performed and bland
furthermore , numerous limitations and pitfalls related to the pulse oximetry method must be highlighted .
for technical reasons , the pulse oximetry signal may be of poor quality in the presence of motion , hypothermia or arterial vasoconstriction , although the new generation of pulse oximeters allows one to optimize the recorded signal - to - noise ratio and thus improve the quality of the displayed signal . in this regard ,
the proprietary software included with pulse oximeter monitors generate plethysmographic signals that are substantially filtered , amplified and smoothed before they are displayed .
any significant signal processing makes the theoretical proportionality between respiratory variation in left ventricular stroke volume and indices such as pop highly questionable .
this may occur under conditions of low peripheral perfusion , in which amplification of the signal - to - noise ratio is maximized . in an attempt to limit the potential influence of the signal processing on the displayed waveform , the automatic gain incorporated into the pulse oximeter
this allowed the investigators to maintain a constant gain throughout the study , rendering quantitative analysis of the waveform easier .
additional studies including volume challenge are mandatory if we are to determine whether respiratory variation in pulse oximetry really can predict volume responsiveness in mechanically ventilated patients without arrhythmias or inspiratory effort . in such studies
it would be important to seek a threshold value of pop that permits acceptable prediction and to investigate whether this value differs between pulse oximeter models , because their signal processing software may differ .
finally , it would be important to determine the extent to which pop is able to decrease in parallel with the increase in cardiac output that occurs after volume loading .
achievement of these objectives is mandatory before oximetry waveform variation can be recommended as a guide to fluid therapy in mechanically ventilated patients in intensive care units and operating rooms , in the same way that arterial pulse pressure variation and other heart lung interaction indices are currently used .
professor jl teboul is a member of the medical advisory board of pulsion medical system ( germany ) . | the pulse oximetry plethysmographic signal resembles the peripheral arterial pressure waveform , and the degree of respiratory variation in the pulse oximetry wave is close to the degree of respiratory arterial pulse pressure variation .
thus , it is tempting to speculate that pulse oximetry can be used to assess preload responsiveness in mechanically ventilated patients . in this commentary
we briefly review the complex meaning of the pulse oximetry plethysmographic signal and highlight the advantages , limitations and pitfalls of the pulse oximetry method .
future studies including volume challenge must be performed to test whether the pulse oximetry waveform can really serve as a nonivasive tool for the guidance of fluid therapy in patients receiving mechanical ventilation in intensive care units and in operating rooms . |
a 5-year - old aboriginal girl presented with a 2-week history of ataxia and speech disturbance .
magnetic resonance imaging of the brain and spine showed a localized 46 mm37 mm mass present within the posterior fossa comprising of a solid and cystic component with no evidence of drop metastases or leptomeningeal spread .
gross total resection was performed with operative findings consisting of a right - sided cerebellar tumor extending through the foramen of luschka into the cerebello - pontine angle .
histologic examination revealed a diffusely anaplastic medulloblastoma , with no c - myc or n - myc amplification detected by fluorescence in situ hybridization .
she was treated according to the children s oncology group high - risk medulloblastoma protocol acns0332 .
she received 36 gy craniospinal radiation therapy with a 19.8 gy boost to the posterior fossa along with weekly vincristine ( 1.5 mg / m per dose ) .
after a 6-week rest period , maintenance chemotherapy was started comprising six 29-day cycles , each consisting of cisplatin ( 75 mg / m ) on day 1 , vincristine ( 1.5 mg / m ) on day 1 and 8 , and cyclophosphamide ( 1000 mg / m ) on day 2 and 3 .
three days into her second cycle she developed low - grade fever and was commenced on intravenous antibiotics as part of our institutional protocol .
the following day she was noted to have developed thrombocytopenia ( 710/l , normal range 150 to 40010/l ) and parainfluenza virus type 1 was isolated on nasopharyngeal aspirate . at this stage
however , by day 8 she had an 11% increase in weight , a tense , tender and distended abdomen , ascites , hepatomegaly , and persistent thrombocytopenia refractory to platelet transfusions .
g / l , normal range 115 to 155 g / dl ) , elevated liver enzymes alanine transaminase ( alt ) ( 152 u / l , normal range
< 30 u / l ) , aspartate transaminase ( ast ) ( 422 u / l , normal range < 50 u / l ) , and hypoalbuminemia ( 25
a large right - sided pleural effusion was present on chest x - ray . a repeat abdominal ultrasound scan and doppler study demonstrated reversal in portal vein flow and increased peak velocity in the hepatic arteries ( 450 cm / s ) .
hsos was diagnosed and she was started on defibrotide ( 25 mg / kg / d ) and ursodeoxycholic acid ( 20 mg / kg / d ) .
vincristine was withheld and she was transferred to the pediatric intensive care unit for supportive care , which included strict regulation of fluid balance and maintenance of urine output with frusemide and dopamine infusions , preservation of oncotic pressure with human albumin infusions , correction of coagulopathy using fresh - frozen plasma , supplementary oxygen , and broad spectrum intravenous antimicrobials for fever .
peak laboratory values included an ast of 3290 u / l , alt of 1370 u / l , and a total bilirubin of 310 mol / l , occurring 7 , 8 , and 12 days after the first manifestation of hsos ( thrombocytopenia ) , respectively .
her symptoms resolved over 19 days following supportive care and 2 weeks of defibrotide , with normalization of her liver function tests .
graphs 1 and 2 show the liver transaminase and bilirubin profiles during the second cycle of maintenance chemotherapy .
days on which defibrotide was started and stopped are shown on x - axis . the patient was subsequently able to complete her remaining 4 cycles of chemotherapy .
audiometric evaluation revealed grade 2 ototoxicity , resulting in a 50% reduction in the cisplatin dose for her third cycle .
in addition , there was a 25% dose reduction of cyclophosphamide due to delayed hematopoietic recovery and vincristine was omitted due to persistent hyperbilirubinemia ( 40
grade 3 ototoxicity resulted in a 75% dose reduction of cisplatin for the fourth cycle with full - dose administration of cyclophosphamide and vincristine .
prophylactic defibrotide ( 25 mg / kg / d ) was administered during the third and fourth maintenance cycles and ursodeoxycholic acid was continued throughout the duration of therapy . during cycles 5 and 6 ,
cisplatin was completely omitted due to grade 4 ototoxicity and cyclophosphamide and vincristine were administered at full dose .
the patient remained in clinical and radiologic remission for 8 months following the completion of therapy .
the incidence of hsos after hsct in children has been reported by a number of groups and ranges between 11% and 60% , with a mean incidence of 25%.8 risk factors in hsct recipients include younger age ( < 6.7 y ) , previous liver irradiation , previous gemtuzumab ozogamicin , prior hepatic disease , busulfan - containing conditioning regimens , and total body irradiation , with a higher risk for the latter 2 when administered in conjunction with cyclophosphamide . an increased risk is seen after hsct for neuroblastoma , familial hemophagocytic lymphohistiocytosis , and osteopetrosis.8 the incidence of hsos after therapy for wilms tumor ranges from 1.2% to 8%9 with actinomycin - d identified as the primary etiological agent .
additional risk factors in this group include young age , previous abdominal radiotherapy , right - sided tumors , and lower body weight.1012 hsos has also been reported during treatment for childhood rhabdomyosarcoma9,1319 with an incidence of 1.2% to 5.3%.14,18 identified risk factors in this population include vac ( vincristine , actinomycin - d , and cyclophosphamide ) chemotherapy and age < 36 months .
there is a single report of hsos occurring in a 2-year - old boy with recurrent yolk sac tumor receiving vac chemotherapy20 and a report of hsos after 2 doses of actinomycin - d in a 14-year - old girl with a paraspinal primitive neuroectodermal tumor who had received prior combination chemotherapy with etoposide , ifosfamide , cyclophosphamide , doxorubicin , vincristine , and external beam radiation partly involving the liver.20 in addition , hsos is a well - reported complication of oral 6-thioguanine during acute lymphoblastic leukemia ( all ) therapy,21,22 while there have been anecdotal reports of hsos during induction therapy for pediatric all23,24 and induction therapy for primary cns lymphoma.25 although the incidence of hsos in children undergoing hsct , treatment for wilms tumor , rhabdomyosarcoma , and all , has been established within large co - operative group trials , there are no reports within such trials of hsos in children undergoing therapy for medulloblastoma.2629 outside of the large co - operative group trials , there have only been 2 prior case reports of hsos following standard - dose chemotherapy for medulloblastoma.30,31 one patient was a 19-month - old girl who developed fatal hsos after 8 days of a vincristine , carboplatin , and lomustine based regimen , despite supportive measures and treatment with low - molecular weight heparin.30 the second was a 14-year - old boy who initially received 36 gy craniospinal radiation with a 20 gy boost to the posterior fossa with concurrent weekly vincristine and developed severe hsos 4 days after completion of the first cycle of a vincristine , carboplatin , and cyclophosphamide based regimen .
he was treated with 1 week of oral ursodeoxycholic acid and 3 days of parenteral n - acetylcysteine , with resolution of the hsos . to prevent recurrence ,
the patient subsequently received a reduction in the frequency of cyclophosphamide , with administration every second cycle.31 our case further highlights the occurrence of hsos outside the traditional settings discussed above .
hsos may have been precipitated in our patient by a number of factors including cyclophosphamide , young age , and scatter to the liver from her prior craniospinal radiotherapy .
notably , the only feature common to all 3 cases was the administration of vincristine , which also forms part of therapy for wilms tumor , rhabdomyosarcoma , and all .
this suggests that vincristine may not be an innocent bystander , but could have a potentiating role in the development of hsos .
severity of hsos is one of the key factors influencing the outcome of patients , with mortality in excess of 85% in severe disease,5 however , assessment of severity is difficult as it is generally retrospectively defined .
three grades of increasing severity have been classified : mild ( resolution of symptoms , decrease of serum bilirubin < 34.2 mol / l , with or without specific treatment ) , moderate ( clinical signs and symptoms of progressive disease , including ascites and/or pleural effusion but no multiorgan failure ) , and severe ( multiorgan failure needing oxygen or mechanical ventilation and/or renal failure and/or encephalopathy).1 in addition to supportive care measures , a number of therapeutic strategies have attempted to improve outcome including n - acetylcysteine,24,31,32 high - dose methylprednisolone,16,33 recombinant human tissue plasminogen activator alone34,35 and in combination with heparin,9,36,37 antithrombin iii,23,38 and prostaglandin e1 in combination with heparin39 and thrombomodulin,40 although the data for their use is limited .
there is increasing evidence , however , for the use of defibrotide , a polydisperse oligonucleotide with local antithrombotic , anti - ischemic , and anti - inflammatory activity .
the therapeutic potential of defibrotide has largely been studied in patients who developed hsos after hsct .
our case reports successful treatment with defibrotide for hsos after standard - dose chemotherapy for childhood medulloblastoma , with the dose of 25 mg / kg / d based on the recommendations from the outcome of a recent dose - finding trial.41 in summary , our case highlights the occurrence of hsos in a child receiving standard - dose chemotherapy for medulloblastoma after craniospinal radiotherapy .
a diagnosis of hsos should not be excluded based on the absence of classic risk factors and disease settings , with early consideration given in the presence of premature , unexplained thrombocytopenia after chemotherapy . | hepatic sinusoidal obstruction syndrome ( hsos ) , also known as veno - occlusive disease , is a well - recognized toxic complication after autologous and allogeneic hematopoietic stem cell transplant , during treatment of wilms tumor and rhabdomyosarcoma associated with actinomycin - d , and during acute lymphoblastic leukemia therapy due to oral 6-thioguanine .
however , its occurrence in the context of chemotherapy regimens for other childhood malignancies is rare .
we report a 5-year - old girl with high - risk anaplastic medulloblastoma , who developed severe hsos during her second cycle of maintenance chemotherapy , consisting of vincristine , cisplatin , and cyclophosphamide .
she was treated with defibrotide with complete resolution of the hsos .
these findings and a review of the literature , highlight the occurrence of hsos in children outside the established settings of hematopoietic stem cell transplantation , wilms tumor , rhabdomyosarcoma , and acute lymphoblastic leukemia . |
exercise is recognized as an important health - related behavior conducive to good mental and physical health and well - being .
regular physical activity ( pa ) has many health benefits , including reduced risk of cardiovascular disease , ischemic stroke , noninsulin - dependent diabetes ( type 2 ) , colon cancers , osteoporosis , and depression . despite these benefits ,
a large proportion of the population in many countries fails to participate in sufficient pa to achieve these outcomes .
pa among us adults is lower than of recommended level for health promotion and this issue determines as a target of public health intervention .
today , many jobs have been created with advances in technology ; unfortunately , these jobs are associated with the inactivity or sedentary lifestyle .
employees health will be affected by their depriving of the benefits of pa . in finland , more than one - third of the working population engages in pa less than recommended for health
one study in female japanese showed a high percentage of japanese women are not regularly active . in iran , a study conducted by robabi et al . in bank employees ( iranshahr )
have shown that a high percentage of employees did not have enough pa . also in jalilian et al .
study , on employees women in hamadan university of medical sciences , indicated that 65% of women employees did not have sufficient pa . based on our knowledge
, there are no any available data regarding the pa levels and its relevant affecting factors in isfahan university of medical sciences employees . nowadays
, health educators use health education models to explore health promotion behaviors and behavior change .
the transtheoretical model ( also called the stages of change model ) , developed by prochaska and diclemente in the late 1970s .
the ttm model has four constructs ; stages of change , self - efficacy , decisional balance , and processes of change .
the ttm consists of five stages of exercise behavior change : ( 1 ) precontemplation , ( 2 ) contemplation , ( 3 ) preparation , ( 4 ) action , and ( 5 ) maintenance . processes of change
cognitive processes are consciousness raising , dramatic relief , self - reevaluation , environmental reevaluation , and self - liberation and behavioral processes are social liberation , counter - conditioning , stimulus control , reinforcement management , and helping relationships .
another construct of the model is decisional balance that focuses on the importance of perceived positive ( pros ) and negative ( cons ) outcomes of a behavior change .
self - efficacy is one 's perceived confidence in the ability to carry out a specific behavior successfully ; and thus have different levels of confidence in their ability to maintain exercise benefits and to overcome exercise barriers .
study in japanese female employees and showed that 90% of subjects were in inactive stages ( precontemplation to preparation ) . in iran also ,
study showed 45.7% of employees women placed in precontemplation , contemplation and preparation stage and a significant relationship was found between the benefits , barriers , self - efficacy and stages of change .
study also stated that more than70% of the people in yazd were investigated in preaction stages .
the aim of this study was to determine the pa among employee women in isfahan university of medical sciences based on the transtheoretical model .
this cross - sectional study was conducted in 100 female employees of isfahan university of medical sciences in 2013 .
all participants were informed about the details of the study and were asked to read and sign a consent form .
the following are criteria for inclusion of women to the study : ruled employment as employees for more than 6 months , the desire to participate in the study , and not being pregnant .
data collected by self - administered questionnaire . the demographic information ( age , weight , height , number of child , level of education ) were obtained . for measuring exercising behaviors ,
weekly pa was used . in order to measure exercise behavior , the stage of exercise behavior change questionnaire developed by marcus and forsythused in this study .
this structure was measured by the process of change questionnaire developed by nigg et al .
this questionnaire contains 30 items that measure the 10 process of change ( cognitive and behavioral process ) . in this questionnaire
, participants were asked to determine the frequency of occurrence of each item on a five - point likert scale ( ranging from 1 , never to 5 ,
repeatedly ) . the decision balance scale for exercise , developed by plotnikoff et al . with 10 items based on lickert scale was used to assess pros and cons participants were asked to determine , on a five - point likert scale ( ranging from 1 , not at all important to 5 , extremely important ) . the perceived self - efficacy scale consisted of 6 items with four point scale ranging from 1 ( can not do ) to 4 ( certainly can do ) .
all the questionnaires were translated using forward translation , back - translation in farmanbar et al .
finally , content validity of questionnaires was assessed by an expert panel ( five expert in health education and pa ) .
the reliability was determined by cronbach 's alpha , and the scores of alpha for the process of change , self - efficacy , and decisional balance were 0.94 , 0.81 , and 0.78 continuously .
we used descriptive ( mean and frequency ) and analytical statistics ( independent t - test and one - way anova test ) .
anova test was used to compare the mean of processes of change construct and self - efficacy with stages structure .
the results showed that the average age was 37.61 7.99 , and there was no any significant relationship between age and level of pa .
the relationship between physical activity and demographic information distribution of people in stages of change was as follows : 26% precontemplation , 22% contemplation , 20% preparation , 13% action , and 19% maintenance .
there were significant differences between consciousness raising , dramatic relief , counter - conditioning , stimulus control , helping relationships , reinforcement management , and self - liberation with stages of change constructs [ table 2 ] . the relation between stages of change and processes of change furthermore , anova test showed there was no significant difference between environmental reevaluation , self - reevaluation , and helping relationship with stages of change constructs [ table 2 ] .
the mean of self - efficacy in stages of change the mean of pros are , respectively , as follows : precontemplation 58.15 22.29 , contemplation 70.73 22.81 , preparation 73.00 19.59 , action 75.69 16.93 , maintenance 86.10 18.40 .
the statistical test showed there were significant differences between pros and stages of change ( f = 5.304 , p = 0.001 ) . in relation to cons ,
anova do not show differences between cons and stages of change . while , the mean of cons was in precontemplation 82.00 11.66 , contemplation 77.82 13.11 , preparation 76.00 15.41 , action 70.15 14.11 , maintenance 75.58 17.17 ( f = 1.645 , p = 0.169 ) .
this study was conducted with the aim of determining the pa among women employees in isfahan university of medical sciences based on the transtheoretical model . in this study ,
26% of women were in contemplation , 22% in contemplation , 20% in preparation , 13% in action , and 19% in maintenance . indeed , 68% of subjects were inactive , and 32% were active .
it consist with this study , and this matter could be due to cultural similarities between people in two city ( isfahan and yazd ) .
there were significant differences between consciousness raising , dramatic relief , counter - conditioning , stimulus control , helping relationships , reinforcement management , and self - liberation with stages of change construct , also with progressing to maintenance , the mean of constructs is increasing .
study , all structures of the model were significantly different in stages of change . in kirk et al .
study , helping relationships , self - liberation , and consciousness raising increased from precontemplation to maintenance .
it seems that special attention needed to environmental reevaluation , self - reevaluation , and helping relationship for women .
based on the findings , the mean of self - efficacy is increasing from precontemplation to maintenance and the mean of action and maintenance stage is more than other stages . in marcus
study , finding show that people who were physical active had higher self - efficacy than inactive people .
other studies such as nishida et al . and gorely and bruce stated that those who have high self - efficacy for pa , they are more physically active .
purath and miller also showed women have more self - efficacy with an increase in the stages of change .
results indicated that in the movement from precontemplation to maintenance pros are increasing , and cons are decreasing .
this study has been done among the women , so there was no chance for inter gender comparison of pa in staff and also this limitation led to the small sample size .
long questionnaire and impossibility of assessing pa in different jobs were other limitations of this study .
this study has been done among the women , so there was no chance for inter gender comparison of pa in staff and also this limitation led to the small sample size .
long questionnaire and impossibility of assessing pa in different jobs were other limitations of this study .
because of a significant relationship between cognitive and behavioral processes and pa in this group , designing and implementing an educational program based on the transtheoretical model may be useful in promoting pa of a female employee
| introduction : today , many jobs are associated with the inactivity or sedentary lifestyle . employees health will be affected by their depriving of the benefits of physical activity ( pa ) .
therefore , the present study was undertaken to determine the pa among employee women in isfahan university of medical sciences based on the transtheoretical model.materials and methods : this is a cross - sectional study has been performed in isfahan university of medical sciences employee women ( 2013 ) .
a convenience sample of 100 women was selected .
data were collected by validated and reliable questionnaire in three parts ( demographics information , pa scale , and ttm constructs ) .
data were analyzed by spss spss ( version 16.0 ; spss , ibm , inc , chicago , il , usa ) and descriptive and analytical statistics such as anova and independent t - test were used .
a two - tailed p < 0.05 was considered statistically significant.results:the mean of pa was 21.17 27.30 min in a day .
weekly heavy , moderate , and light exercise mean was 0.72 1.81 , 0.89 1.87 and 0.57 1.57 days , respectively . in this study , 26% of women were in contemplation , 22% in contemplation , 20% in preparation , 13% in action , and 19% in the maintenance stage .
furthermore , there were significant differences between consciousness raising , dramatic relief , counter - conditioning , stimulus control , helping relationships , reinforcement management , and self - liberation with stages of change constructs.conclusion:because of a significant relationship between cognitive and behavioral processes and pa in this group , designing and implementing an educational program based on the transtheoretical model may be useful in promoting pa of a female employee . |
attention - deficit / hyperactivity disorder ( adhd ) is one of the most common neurobehavioral disorders of childhood , may continue to show symptoms in adolescence and adult life , and is characterized by symptoms of inattention and/or hyperactivity - impulsivity .
children with adhd may experience significant adaptation problems because their functional level and behavior may not correspond to their chronological age or expected development level.1,2 estimated prevalence rates in the general population vary from 3% to 7% .
the condition is more frequent in boys than in girls ( proportion varies between 9:1 and 2.5:1 according to the population studied ) , even though increasing numbers of girls affected by adhd are being identified .
adhd is a chronic disease , the symptoms of which can persist into adulthood and become lifelong.35 the diagnosis of adhd requires a complete medical evaluation to detect specific symptoms that have to be present in consistent contexts and with a persistent level of deterioration.6 the presence of symptoms is directly obtained from the child , parents , and teachers .
multiple scales have been created to identify specific symptoms in order to diagnose adhd , but most of the criteria are similar to those of the dsm - iv tr ( diagnostic and statistical manual of mental disorders fourth edition , text revision).6 adhd is classified into three subtypes , ie , adhd predominantly inattentive ( 10%15% of patients ) , adhd predominantly hyperactive - impulsive ( 5% ) , and adhd combined type ( 80%).79 pharmacologic treatment with stimulants usually has a direct effect of reducing overactivity and increasing attention,10 with these effects being evident within a short time . because of its efficacy and safety profile , methylphenidate is the most commonly used stimulant in adhd.10,11 the aim of this retrospective study was to evaluate the response of patients diagnosed with adhd to immediate - release methylphenidate ( mph - ir ) , and to obtain information on current treatment patterns and any adverse effects during follow - up .
patients of both genders , aged 465 years , diagnosed with adhd according to dsm - iv tr criteria , having an intelligence quotient higher than 80 , and treated with mph - ir at the start of follow - up were included in this study .
information on treatment patterns from january 2002 to december 2006 was collected from patient medical records in a sequential order .
patients whose response to mph - ir could not be evaluated and those participating in other clinical trials were excluded .
this observational , retrospective , noninterventional , multicenter study was carried out in the neurology , clinical neurophysiology , pediatric , and psychiatry departments of 25 spanish centers .
the study was conducted in accordance with the recommendations of the declaration of helsinki , the guidelines for good clinical practice , the international guidelines for ethical review of epidemiological studies ( 1991 ) , and the spanish epidemiological society.1214 the study was submitted to the corresponding ethics committee for approval and following the spanish law 15/1999 on personal character data protection concerning confidentiality of patient data .
baseline data included demographic information and the clinical history of adhd , ie , date of diagnosis , number of adhd symptoms according to dsm - iv tr subtypes , comorbidities , associated dsm - iv tr disorders , current methylphenidate therapy profile ( including previous treatments , methylphenidate dosage and frequency of administration , and modifications of adhd therapy in the year following baseline ) , and other related symptoms .
the clinical global impression ( cgi ) score was also collected as a reference for severity of illness and global improvement , whether or not these were related to therapy . a year after treatment , in addition to baseline information , satisfaction with current treatment
was evaluated on a five - point scale ( 1 , very satisfied ; 2 , satisfied ; 3 , neutral , neither satisfied or dissatisfied ; 4 , dissatisfied ; and 5 , very dissatisfied ) . information on continuity of treatment with mph - ir , use of concomitant medication , and
all parameters were assessed globally and by subgroup of age ( < 6 years , 616 years , and 1765 years ) .
the information collected was processed using sas version 9.1 software ( sas , cary , nc , usa ) .
categorical variables are presented according to the number and percentage of patients for each category .
continuous variables are expressed as the mean , standard deviation , median , inferior and superior quartile , and minimal and maximal values .
contingence tables were constructed for cross - analysis of data and parametric and nonparametric tests , depending on the results .
an exploratory analysis was undertaken to analyze the relationship between outcomes of interest and the different data recorded throughout the study .
safety analyses were performed on the safety dataset , defined as all patients who took at least one dose of mph - ir , whether or not the inclusion criteria were met .
safety outcomes included adverse events and serious adverse events reported , and their recurrence , duration , and relationship with the study drug .
the main variable , ie , number of dsm - iv tr symptoms , was evaluated at the start and end of treatment with mph - ir using inference statistic techniques to identify any significant changes between number of symptoms ( student s t - test for paired samples ) and any influence of a number of factors on the probability of response to treatment .
patients of both genders , aged 465 years , diagnosed with adhd according to dsm - iv tr criteria , having an intelligence quotient higher than 80 , and treated with mph - ir at the start of follow - up were included in this study .
information on treatment patterns from january 2002 to december 2006 was collected from patient medical records in a sequential order .
patients whose response to mph - ir could not be evaluated and those participating in other clinical trials were excluded .
this observational , retrospective , noninterventional , multicenter study was carried out in the neurology , clinical neurophysiology , pediatric , and psychiatry departments of 25 spanish centers .
the study was conducted in accordance with the recommendations of the declaration of helsinki , the guidelines for good clinical practice , the international guidelines for ethical review of epidemiological studies ( 1991 ) , and the spanish epidemiological society.1214 the study was submitted to the corresponding ethics committee for approval and following the spanish law 15/1999 on personal character data protection concerning confidentiality of patient data .
baseline data included demographic information and the clinical history of adhd , ie , date of diagnosis , number of adhd symptoms according to dsm - iv tr subtypes , comorbidities , associated dsm - iv tr disorders , current methylphenidate therapy profile ( including previous treatments , methylphenidate dosage and frequency of administration , and modifications of adhd therapy in the year following baseline ) , and other related symptoms .
the clinical global impression ( cgi ) score was also collected as a reference for severity of illness and global improvement , whether or not these were related to therapy . a year after treatment , in addition to baseline information , satisfaction with current treatment
was evaluated on a five - point scale ( 1 , very satisfied ; 2 , satisfied ; 3 , neutral , neither satisfied or dissatisfied ; 4 , dissatisfied ; and 5 , very dissatisfied ) .
information on continuity of treatment with mph - ir , use of concomitant medication , and adverse events were obtained .
all parameters were assessed globally and by subgroup of age ( < 6 years , 616 years , and 1765 years ) .
the information collected was processed using sas version 9.1 software ( sas , cary , nc , usa ) .
categorical variables are presented according to the number and percentage of patients for each category .
continuous variables are expressed as the mean , standard deviation , median , inferior and superior quartile , and minimal and maximal values .
contingence tables were constructed for cross - analysis of data and parametric and nonparametric tests , depending on the results .
an exploratory analysis was undertaken to analyze the relationship between outcomes of interest and the different data recorded throughout the study .
safety analyses were performed on the safety dataset , defined as all patients who took at least one dose of mph - ir , whether or not the inclusion criteria were met .
safety outcomes included adverse events and serious adverse events reported , and their recurrence , duration , and relationship with the study drug .
the main variable , ie , number of dsm - iv tr symptoms , was evaluated at the start and end of treatment with mph - ir using inference statistic techniques to identify any significant changes between number of symptoms ( student s t - test for paired samples ) and any influence of a number of factors on the probability of response to treatment .
patients were classified into three categories by age , ie , < 6 years ( 5.7% ) , 616 years ( 88.1% ) , and 1765 years ( 6.2% ) .
their mean age was approximately 11 years and 80.87% were males . based on dsm - iv tr criteria , the adhd predominantly inattentive subtype accounted for 29.7% ( < 6 years , 8.8% ; 1765 years , 31.4% ; 1765 years , 24.3% ) , predominantly hyperactive - impulsive subtype for 5.2% ( < 6 years,14.7% ; 1765 years , 4.4% ; 1765 years , 8.1% ) , and combined subtype for 65.1% ( < 6 years , 76.5% ; 1765 years , 64.2% ; 1765 years , 67.6% ) of patients .
comorbid dsm - iv tr disorders were identified in the total patient population and for subgroups by age .
anxiety disorder was diagnosed in 13.21% of all patients ( < 6 years , 8.8% ; 616 years , 13.3% ; 1765 years , 16.2% ) ; oppositional defiant disorder in 22.1% ( < 6 years , 38.2% ; 616 years , 22.4% ; 1765 years , 2.70% ) ; learning disorder in 47.3% ( < 6 years , 44.1% ; 616 years , 50.5% ; 1765 years , 5.4% ) ; conduct disorder in 28.6% ( < 6 years , 38.24% ; 616 years , 29.8% ; 1765 years , 2.7% ) ; depressive disorder in 6.35% ( < 6 years , 0% ; 616 years , 5.7% ; 1765 years , 21.6% ) ; tics in 6.86% ( < 6 years , 5.9% ; 616 years , 7.0% ; 1765 years , 5.41% ) ; and substance abuse disorder in 1.84% ( < 6 years , 0% ; 616 years , 0%0.38% ; 1765 years , 24.3% ) .
other associated symptoms were apathy ( 8.5% , all aged 616 years ) and anhedonia ( 3.85% , all aged 616 years ) .
information on the presence of adhd - associated disorders , in accordance with dsm - iv tr criteria , was also collected .
developmental coordination disorder was identified in 11.87% of patients ( < 6 years , 5.9% ; 616 years , 13.1% ) , development dysphasia in 9.87% ( < 6 years , 5.9% ; 616 years , 10.8% ) ; tourette s disorder in 0.84% ( < 6 years , 2.9% ; 616 years , 0.57% ; 1765 years , 22.7% ) , and generalized epilepsy in 1.67% ( < 6 years , 8.8% ; 616 years , 1.3% ) .
mean patient age at the start of treatment was 10.85 years ( < 6 years , mean 5.27 years ; 616 years , mean 9.77 years ; 1765 years , mean 31.26 years ) , with a mean interval of 2.59 months between diagnosis and start of medication ( < 6 years , 1.06 months ; 616 years , 2.74 months ; 1765 years , 1.89 months ) and a mean time on treatment of 9.85 months ( < 6 years , 11.01 months ; 616 years , 9.93 months ; 1765 years , 7.35 months ) .
the mean starting dose of mph - ir was 18.11 mg / day ( 11.84 mg / day for patients aged < 6 years , 17.04 mg / day for those aged 616 years , and 39.05 mg / day for those aged 1765 years ) . for patients who were still receiving methylphenidate after one year , the mean dose was 22.84 mg / day ( 19.58 mg / day for those aged < 6 years ; 22.18 mg / day for those aged 616 years ; 60 mg / day for those aged 1765 years ) .
there were significant statistical differences on average doses between the reported at baseline and those that correspond to follow up visits ( 1 month , 3 months , 6 months and a year ) .
dose modifications were required after one month of therapy in 25.08% of all patients ( < 6 years , 17.65% ; 616 years , 24.29% ; 1765 years , 43.24% ) .
this change was necessary after 6 months for 30.43% of patients ( < 6 years , 26.5% ; 616 years , 30.55% ; 1765 years , 32.4% ) and after one year for 34.45% of patients ( < 6 years , 20.59% ; 616 years , 32.83% ; 1765 years , 70.27% ) .
the most frequent reason for modification of therapy after one and 6 months was uptitration of the dose ( 67.33% and 46.70% , respectively ) .
after one year , a 30,58% of all dose changes were related to inefficacy of current dose . however , for a 54.85% there were not specific reasons registered .
a total of 365 ( 61.04% ) patients completed one year of treatment with mph - ir ( < 6 years , 70.6% ; 616 years , 63% ; 1765 years , 24.3% ) .
evaluation based on cgi score was performed by a specialist prior to and one year after starting treatment with mph - ir . on this basis ,
0.27% were considered to be normal - doubtfully ill at the beginning of therapy .
after one year , 2.46% of patients were considered to be moderately - severely ill , and 63.29% were considered to be normal - doubtfully ill . in patients
aged < 6 years , 83.33% versus 8.33% , respectively , were deemed to be in the moderate - severely ill
cgi category before and after one year of treatment with mph - ir ; the corresponding figures were 68.37% versus 1.81% for those aged 616 years and 88.9% versus 0% for those aged 1765 years ( table 2 ) .
of the 233 patients who did not continue with mph - ir beyond one year , 51.93% changed to extended - release methylphenidate ( mph - er ; < 6 years , 10% ; 616 years , 49.7% ; and 1765 years , 82.1% ) .
the principal reasons for the change from mph - ir to mph - er were other reasons
( all ages , 55.65% ; 616 years , 46.8% ; 1765 years , 95% ) , inefficacy ( all ages , 22.61% ; 616 years , 27.66% ) , and usual procedure ( all ages , 20.87% ; 616 years , 25.53% ) .
after one year of treatment with mph - ir , 86.9% were very satisfied or satisfied with therapy ( < 6 years , 87.8% ; 616 years , 73.91% ) .
patients who changed to mph - er during follow - up reported themselves as being very satisfied or satisfied in 65.69% of cases ( 616 years , 61.6% ; 1765 years , 87.5% ) after a mean 5.59 months of treatment .
satisfaction with mph - ir therapy is shown in figure 1 . at the end of the study ,
41.47% of all patients were still receiving mph - ir ( < 6 years 47.1% ; 616 years , 42.5% ; 1765 years , 21.6% ) .
for these patients ( n = 248 ) , the mean duration of mph - ir therapy was 3.73 years ( < 6 years , 3.73 years ; 616 years , 3.80 years ; 1765 years , 3.92 years ) .
of all the evaluable patients ( n = 598 ) , 25.92% received other medication concomitantly with mph - ir , with 17.06% having at least one concomitant medication .
of all the age groups , those aged < 6 years showed the highest concomitant medication use ( 29.41% , table 3 ) .
of all patients included in the safety analysis ( n = 730 ) , at least one adverse event was reported for 25.75% ( table 4 ) .
the most common adverse events in all age groups ( table 5 ) were appetite and nutrition disorders ( 29.91% of all specified adverse events ; < 6 years , 3.85% ; 616 years , 25.21% ; 1765 years , 0.85% ) .
patients were classified into three categories by age , ie , < 6 years ( 5.7% ) , 616 years ( 88.1% ) , and 1765 years ( 6.2% ) .
their mean age was approximately 11 years and 80.87% were males . based on dsm - iv tr criteria , the adhd predominantly inattentive subtype accounted for 29.7% ( < 6 years , 8.8% ; 1765 years , 31.4% ; 1765 years , 24.3% ) , predominantly hyperactive - impulsive subtype for 5.2% ( < 6 years,14.7% ; 1765 years , 4.4% ; 1765 years , 8.1% ) , and combined subtype for 65.1% ( < 6 years , 76.5% ; 1765 years , 64.2% ; 1765 years , 67.6% ) of patients .
comorbid dsm - iv tr disorders were identified in the total patient population and for subgroups by age .
anxiety disorder was diagnosed in 13.21% of all patients ( < 6 years , 8.8% ; 616 years , 13.3% ; 1765 years , 16.2% ) ; oppositional defiant disorder in 22.1% ( < 6 years , 38.2% ; 616 years , 22.4% ; 1765 years , 2.70% ) ; learning disorder in 47.3% ( < 6 years , 44.1% ; 616 years , 50.5% ; 1765 years , 5.4% ) ; conduct disorder in 28.6% ( < 6 years , 38.24% ; 616 years , 29.8% ; 1765 years , 2.7% ) ; depressive disorder in 6.35% ( < 6 years , 0% ; 616 years , 5.7% ; 1765 years , 21.6% ) ; tics in 6.86% ( < 6 years , 5.9% ; 616 years , 7.0% ; 1765 years , 5.41% ) ; and substance abuse disorder in 1.84% ( < 6 years , 0% ; 616 years , 0%0.38% ; 1765 years , 24.3% ) .
other associated symptoms were apathy ( 8.5% , all aged 616 years ) and anhedonia ( 3.85% , all aged 616 years ) .
information on the presence of adhd - associated disorders , in accordance with dsm - iv tr criteria , was also collected .
developmental coordination disorder was identified in 11.87% of patients ( < 6 years , 5.9% ; 616 years , 13.1% ) , development dysphasia in 9.87% ( < 6 years , 5.9% ; 616 years , 10.8% ) ; tourette s disorder in 0.84% ( < 6 years , 2.9% ; 616 years , 0.57% ; 1765 years , 22.7% ) , and generalized epilepsy in 1.67% ( < 6 years , 8.8% ; 616 years , 1.3% ) .
mean patient age at the start of treatment was 10.85 years ( < 6 years , mean 5.27 years ; 616 years , mean 9.77 years ; 1765 years , mean 31.26 years ) , with a mean interval of 2.59 months between diagnosis and start of medication ( < 6 years , 1.06 months ; 616 years , 2.74 months ; 1765 years , 1.89 months ) and a mean time on treatment of 9.85 months ( < 6 years , 11.01 months ; 616 years , 9.93 months ; 1765 years , 7.35 months ) .
the mean starting dose of mph - ir was 18.11 mg / day ( 11.84 mg / day for patients aged < 6 years , 17.04 mg / day for those aged 616 years , and 39.05 mg / day for those aged 1765 years ) . for patients who were still receiving methylphenidate after one year , the mean dose was 22.84 mg / day ( 19.58 mg / day for those aged < 6 years ; 22.18 mg / day for those aged 616 years ; 60 mg / day for those aged 1765 years ) .
there were significant statistical differences on average doses between the reported at baseline and those that correspond to follow up visits ( 1 month , 3 months , 6 months and a year ) .
dose modifications were required after one month of therapy in 25.08% of all patients ( < 6 years , 17.65% ; 616 years , 24.29% ; 1765 years , 43.24% ) .
this change was necessary after 6 months for 30.43% of patients ( < 6 years , 26.5% ; 616 years , 30.55% ; 1765 years , 32.4% ) and after one year for 34.45% of patients ( < 6 years , 20.59% ; 616 years , 32.83% ; 1765 years , 70.27% ) .
the most frequent reason for modification of therapy after one and 6 months was uptitration of the dose ( 67.33% and 46.70% , respectively ) .
after one year , a 30,58% of all dose changes were related to inefficacy of current dose . however , for a 54.85% there were not specific reasons registered .
a total of 365 ( 61.04% ) patients completed one year of treatment with mph - ir ( < 6 years , 70.6% ; 616 years , 63% ; 1765 years , 24.3% ) .
evaluation based on cgi score was performed by a specialist prior to and one year after starting treatment with mph - ir . on this basis ,
0.27% were considered to be normal - doubtfully ill at the beginning of therapy .
after one year , 2.46% of patients were considered to be moderately - severely ill , and 63.29% were considered to be normal - doubtfully ill . in patients
aged < 6 years , 83.33% versus 8.33% , respectively , were deemed to be in the moderate - severely ill
cgi category before and after one year of treatment with mph - ir ; the corresponding figures were 68.37% versus 1.81% for those aged 616 years and 88.9% versus 0% for those aged 1765 years ( table 2 ) .
of the 233 patients who did not continue with mph - ir beyond one year , 51.93% changed to extended - release methylphenidate ( mph - er ; < 6 years , 10% ; 616 years , 49.7% ; and 1765 years , 82.1% ) .
the principal reasons for the change from mph - ir to mph - er were other reasons
( all ages , 55.65% ; 616 years , 46.8% ; 1765 years , 95% ) , inefficacy ( all ages , 22.61% ; 616 years , 27.66% ) , and usual procedure ( all ages , 20.87% ; 616 years , 25.53% ) .
after one year of treatment with mph - ir , 86.9% were very satisfied or satisfied with therapy ( < 6 years , 87.8% ; 616 years , 73.91% ) .
patients who changed to mph - er during follow - up reported themselves as being very satisfied or satisfied in 65.69% of cases ( 616 years , 61.6% ; 1765 years , 87.5% ) after a mean 5.59 months of treatment .
satisfaction with mph - ir therapy is shown in figure 1 . at the end of the study ,
41.47% of all patients were still receiving mph - ir ( < 6 years 47.1% ; 616 years , 42.5% ; 1765 years , 21.6% ) .
for these patients ( n = 248 ) , the mean duration of mph - ir therapy was 3.73 years ( < 6 years , 3.73 years ; 616 years , 3.80 years ; 1765 years , 3.92 years ) .
of all the evaluable patients ( n = 598 ) , 25.92% received other medication concomitantly with mph - ir , with 17.06% having at least one concomitant medication .
of all the age groups , those aged < 6 years showed the highest concomitant medication use ( 29.41% , table 3 ) .
of all patients included in the safety analysis ( n = 730 ) , at least one adverse event was reported for 25.75% ( table 4 ) .
the most common adverse events in all age groups ( table 5 ) were appetite and nutrition disorders ( 29.91% of all specified adverse events ; < 6 years , 3.85% ; 616 years , 25.21% ; 1765 years , 0.85% ) .
adhd may cause difficulties at school , in the work place , and in the social environment .
subjects with adhd in this study were of the predominantly inattentive subtype ( 29.7% ) , predominantly hyperactive - impulsive subtype ( 5.2% ) , and combined subtype ( 65.1% ) .
however , long - term follow - up studies have demonstrated the persistence of symptoms in many adults diagnosed with adhd in childhood.2,1518 a meta - analysis of follow - up adhd studies reported that 15% of all cases show persistence of symptoms beyond childhood , and 40%50% of patients continue to have a partial diagnostic status and impairment.19,20 a meta - analysis of studies of the prevalence of adhd in adults reports a negative association with increasing age , conditioned by the gender composition of the sample.21 there is a clear predominance of adhd in males , who have a 57% possibility of inheritance.22 in the present study , 81% of patients diagnosed to have adhd were male , but this tendency decreased with increasing age ( < 6 years , 91% ; 1765 years , 76% ) .
adults with adhd had a significantly higher number of first - degree relatives with adhd than those without ( 28% versus 5% ) , and this finding is consistent with a recent report of strong familial clustering of adhd in first - degree relatives of adults with adhd in comparison with a control group.23 in that report , 32.6% had a family history of adhd .
results from our study showed the most frequent comorbidities to be learning disorders ( 47.3% ) , conduct disorders ( 28.6% ) , and oppositional defiant disorder ( 22.1% ) .
these rates are comparable with those found in the 2007 us national survey of children s health,24 where 46% of children with adhd had a learning disorder and 27% had a conduct disorder .
compared with the results of that survey , our findings with regard to psychological comorbidity showed lower rates of comorbid anxiety and depression ( 18% versus 13.2% , respectively , for anxiety ; 14% versus 6.2% , respectively , for depression ) .
other relevant studies have reported comorbid depressive disorder rates of 5%47% in children and adolescents with adhd.2527 evidence from a meta - analysis of prospective studies in children with adhd suggests that children with adhd have a higher risk of developing substance use disorders and cigarette smoking than those without adhd.28 in this meta - analysis , 24% of subjects aged 1765 years had a substance abuse disorder .
several studies have demonstrated the long - term efficacy and tolerability of mph - ir.2932 methylphenidate has been established as an effective agent and is widely used to ameliorate the symptoms of adhd.3336 a meta - analysis of randomized controlled trials comparing methylphenidate and placebo in the treatment of adhd identified a statistically significant beneficial clinical effect of mph - ir in the short - term treatment of individuals with adhd aged 18 years and younger.37 mph - ir also reduces adhd symptom scales in preschoolers,32 although the effect sizes are smaller than those found in school - aged children.33,37 improvements in cgi scores after one year of treatment with mph - ir have been reported in several studies of the effects of long - term treatment on symptom severity and social adjustment in adhd.37 there was a considerable reduction in cgi score after one year of treatment with mph - ir in patients previously categorized as moderately to severely ill ( from 60% to 2% ) . furthermore , treatment with mph - ir significantly decreased both cgi score and the number of dsm - iv tr symptoms in the study populations , with similar results in comparison with published studies.3840 it is important to point out the high percentage of patients ( 61% ) who completed one year of treatment with mph - ir , and it is also remarkable that , of patients who did not continue , a high percentage ( 52% ) changed to mph - er . in our study , global assessment of satisfaction with methylphenidate was high , ranging from 73% to 87% , within the three age groups . in all age groups ,
patients who changed to mph - er were less satisfied than those on mph - ir .
our results for mph - er are not consistent with those in the reference literature in which patients were more satisfied with mph - er treatment.4143 in this study , only 26% of patients experienced an adverse event , with appetite and nutrition disorders being the most frequent .
previous studies and reviews report insomnia , reduced appetite , abdominal pain , weight loss , tics , jitteriness , and headaches as the most common adverse effects of stimulant treatment , and , less frequently , anxiety , dizziness , and drowsiness,4446 but these are usually tolerable.47 overall , stimulants are relatively safe medications and the risks of not treating adhd usually outweighs the risk of using stimulants.47 a limitation of the study is that even when favorable results were found overall in reduction of the number of symptoms and a significant global improvement , these results are only preliminary due to the limited numbers of patients included . in conclusion , patients with adhd showed a good response to mph - ir and a good safety profile with this treatment . | background : the purpose of this multicenter spanish study was to evaluate the response to immediate - release methylphenidate by children and adults diagnosed with attention - deficit / hyperactivity disorder ( adhd ) , as well as to obtain information on current therapy patterns and safety characteristics.methods:this multicenter , observational , retrospective , noninterventional study included 730 patients aged 465 years with a diagnosis of adhd .
information was obtained based on a review of medical records for the years 20022006 in sequential order.results:the adhd predominantly inattentive subtype affected 29.7% of patients , adhd predominantly hyperactive - impulsive was found in 5.2% , and the combined subtype in 65.1% .
overall , a significant lower clinical global impression ( cgi ) score and mean number of dsm - iv tr ( diagnostic and statistical manual of mental disorders fourth edition , text revision ) symptoms by subtype were found after one year of treatment with immediate - release methylphenidate ; cgi decreased from 4.51 to 1.69 , symptoms of inattention from 7.90 to 4.34 , symptoms of hyperactivity from 6.73 to 3.39 , and combined subtype symptoms from 14.62 to 7.7 . satisfaction with immediate - release methylphenidate after one year was evaluated as very satisfied or satisfied by 86.90% of the sample ; 25.75% of all patients reported at least one adverse effect . at the end of the study ,
41.47% of all the patients treated with immediate - release methylphenidate were still receiving it , with a mean time of 3.80 years on therapy.conclusion:good efficacy and safety results were found for immediate - release methylphenidate in patients with adhd . |
a 9-year - old girl with developmental delay was born at 37 weeks gestation and had a birth weight of 2.84 kg .
her presenting height , weight and head circumference were 135.3 cm ( 10th percentile ) , 38 kg ( 50th percentile ) and 53 cm ( 50th percentile ) , respectively . past medical history , perinatal history and family history were unremarkable .
ophthalmologic examination revealed an esotropia of 8 prism diopters ( pd ) at distance and near in the primary position .
the pupils were isocoric and reactive to light , and the fundoscopic examination was normal .
cycloplegic refraction revealed a hyperopic astigmatism of + 1.75 dsph -0.50 dcyl 180a in both eyes .
, there were 4 pd of intermittent exotropia at distance and 2 pd of intermittent exotropia for near vision .
she fused 4 dots at a distance and near with the worth four - dot test .
the patient had sparse arched eyebrows , long palpebral f issures and eversion of the lateral third of the lower eyelids ( fig .
1 ) , a broad and depressed nasal tip , cleft palate , gynecomastia , short , incurved fifth fingers , epicanthal folds , retrognathia , a small mouth , a tented upper lip , a short nasal septum , and prominent ears .
the reported ocular findings associated with kabuki syndrome include amblyopia , refractive errors , ptosis , strabismus , nystagmus , ophthalmoplegia , sixth cranial nerve palsy , microphthalmia , microcornea , megalocornea , corneal opacities , peter 's anomaly , blue sclerae , cataracts , retinal pigmentation / hypopigmentation , abnormal electroretinogram and visual evoked potential , obstructed nasolacrimal ducts , tilted discs , and colobomas of the iris and retina [ 1 - 6 ] .
forty - three cases of strabismus have been reported out of 200 documented patients with kabuki syndrome .
one patient with a description of the pattern of strabismus showed a small angle of exotropia of 12 to 16 pd .
our patient showed a small angle of esotropia , which converted to a small angle of exotropia after a full correction of hyperopic astigmatism .
the most consistent finding was reported to be a long palpebral fissure , which was most significant at younger ages .
refractive errors such hyperopia , myopia , and astigmatism were reported ; therefore , the importance of a full ophthalmologic examination ( including refraction ) should be stressed , especially for patients who may not communicate their visual difficulties .
any potentially reversible causes of reduced vision should be identified and corrected in this group of patients with intellectual difficulties .
nocturnal lagophthalmos ( sleeping with eyes open ) was reported to be common in patients with kabuki syndrome ; therefore , the possibility of complications such as keratitis or conjunctivitis should be investigated .
our patient had a mild hyperopic astigmatism and a very small - angle esotropia that switched to a small - angle exotropia with full correction of the hyperopic astigmatism .
she also had a mild limitation of abduction in both eyes , which was too mild to meet criteria for paralysis of the sixth cranial nerve reported in kabuki syndrome .
she did not show any evidence of stereoacuity ; however , she showed a fusion response with the worth four - dot test .
the patient 's low intelligence may have contributed to the poor stereoacuity , but the possibility of the effect of longstanding esotropia on stereopsis could not be denied . this case illustrates the need for patients with a diagnosis of kabuki syndrome to have an ophthalmologic evaluation .
strabismus associated with kabuki syndrome may have a small angle that can be easily overlooked . | kabuki syndrome is characterized by long palpebral fissures , large ears , a depressed nasal tip , and skeletal anomalies associated with postnatal dwarfism and mental retardation .
there have been few prior detailed descriptions of strabismus or stereopsis in these patients .
we report a patient with kabuki syndrome who showed small - angle strabismus and poor stereopsis .
this case illustrates the need for patients with a diagnosis of kabuki syndrome to have an ophthalmologic evaluation .
strabismus associated with kabuki syndrome may have a small angle that can be easily overlooked . |
communication is one of the most important skills for healthcare professionals and service providers in the healthcare system ( 1 ) .
although these people tend to establish a clear communication with patients to provide information and education to them , in the process of communication with patients , they usually use specialized terms and jargons , which are familiar to them and are deemed as more accurate .
in addition , in communicating with patients , eventually they convey so much information that patients can not process .
therefore , the majority of patients , even those with strong language skills and good speaking and communication ability , encounter difficulties in processing information , because most of them are unfamiliar with medical terminology and had difficulty in focusing on the information provided .
they often find it hard to understand the information and training offered by health professionals ( 1 - 4 ) .
according to studies ; patients remember only 50 percent or less of what health specialists teach them ( 3 ) .
poor communication between patients and health care providers leads to frequent problems in the healthcare system such as inability to remember next doctor s visit time , poor self - care , misuse of drugs , delayed access to needed medical care , hospital re - admissions and the like ( 5 ) .
according to the literature , a significant proportion of patients facing these problems are people with limited health literacy .
in fact , the concept of limited health literacy describes patients who do nt have enough skills and abilities to acquire , interpret and understand health - related information needed for proper decision making and functioning in the health care system ( 6 , 7 ) and therefore , requires information and training provided in a different way than is done for others ( 8) . in general ,
health literacy includes knowledge , motivation and ability to obtain , understand , evaluate and implement health information in order to judge and make decisions about health care routines , disease prevention and health promotion , which finally affects maintaining and improving quality of life .
it is becoming increasingly important in healthcare systems and is related to people s capabilities for satisfying complex health needs in modern societies .
poor health literacy negatively affects the communication between health professionals and patients and is rapidly becoming a problem in the healthcare system ( 9 ) .
patients with low health literacy often use passive methods of communication , do not participate in partnership decision - making , and , as a result , face several problems in their interaction with therapists ( 10 - 13 ) .
effective communication is the foundation of patient - centered health care and health literacy is a key component for effective communication between patients and health professionals ( 14 ) and is thus one of the most important priorities for improving health care system ( 15 , 16 ) .
in fact , establishing effective communication between health professionals and patients increases the system s efficacy and patients satisfaction in the service provided in health centers .
it improves patient satisfaction as one of the main indicators of quality of health care , which will result in positive health outcomes ( 17 - 19 ) .
health literacy is considered by healthy people 2020 as one of the main priorities for improving the quality of health services , and one of the goals related to health literacy in this project is that of improving the communication between patients and health care providers ( 20 ) . in this
regard , joint commission and the world health organization also stressed the need to provide information and training in a standard and patient - centered approach to people with inadequate health literacy ( 18 ) . in this regard , sudore and schillinger ( 2009 ) in a study titled interventions to improve care for patients with limited health literacy , introduce best health literacy practices that benefit all patients , especially those with insufficient health literacy . according to these researchers , health literacy strategies include the use of simple and understandable language , limiting the number of points provided in each visit , using multiple modalities , including pictures , encouraging patients to ask questions and finally using simple and understandable media ( 21 ) . in general , if health professionals become familiar with the concept of health literacy strategies , when training patients , they offer materials using language and methods that help patients better understand and achieve a greater ability implement the expert advice ( 22 ) . since health literacy is a multi - faceted issue , which affects almost every aspect of health care ( 23 ) . therefore , all those who have to communicate with patients , their families and other people in clinical environments , in writing or verbally , must have necessary skills and knowledge in the area of health literacy ( 14 ) .
nurses , as a group of health care providers who are in the frontline of establishing safe and effective communication with patients and families with different levels of health literacy play a key role in patient education ( 24 - 26 ) .
unfortunately , research suggests that this largest group of health care providers do not have enough knowledge , attitudes and skills in the area of health literacy and responding to patients needs and most of them do not use effective communication strategies and methods in teaching and communicating with patients ( 27 , 28 ) . since , according to literature , a variety of factors , including individual , motivational , economic , and organizational factors can affect the performance of health care providers in clinical settings ( 29 ) , behavioral science theories can provide good information on the factors affecting the behavior of this class of people .
the theory of planned behavior ( tpb ) as one of the best behavioral science theories has been used in several studies to explain behavior and identify important factors affecting it . in this study , this theory is used as a conceptual research framework , because various studies have shown that it has performed well in predicting the intention and behavior of different groups of healthcare providers ( 30 , 31 ) .
tpb is based on the premise that people are reasonable and evaluate consequences before engaging in certain actions ( 32 ) .
based on the theory , behavioral intention , which is shaped by attitude toward behavior , subjective norms , and perceived behavioral control , can predict behavior .
attitude toward behavior is one s positive or negative evaluation of self - performance of the particular behavior .
subjective norm is one s perception about the particular behavior as influenced by social pressures and can lead to doing or abandoning the behavior .
perceived behavioral control is one s perceived ease or difficulty of performing the particular behavior .
the theory has done well in various studies in predicting the behavior of different groups of healthcare providers , including nurses ( 33 ) .
research has been conducted at the alzahra educational hospital which is one of the largest such facilities in iran .
it has 950 beds and more than 2600 personnel , and about 970 of them are nurse practitioners . the majority of this hospital s patients are from isfahan and surrounding provinces , which have a variety in ethnicity and races . because of the inexpensive services of educational hospitals and the geographical situation , a large number of patients who referred to this hospital are from low socioeconomic levels , low educated and many of them had difficulties in talking in persian language and low health literate ( 34 , 35 ) . communicating with such in danger of low health literacy patients requires its knowledge and techniques . having this in mind ,
the present study aims to predict factors influencing the nurses behaviors regarding use of health literacy strategies when communicating and educating low health literacy patients based on tpb .
this is a descriptive - analytical cross - sectional study carried out in 2014 on 148 nurses working in al - zahra hospital in isfahan , iran .
the sample was selected through simple random sampling from among the nurses of the hospital .
criteria for inclusion in the nurse group were having at least a bachelor s degree in nursing and consent to participate in the study .
the sample size was determined based on standard deviation taken from a pilot study by researchers on 30 nurses ( =0.64 ) . at the significance level of 0.95 and accuracy of 0.05 ,
the sample size was estimated as 148 using the formula ( n = z22/d2 ) .
research subjects were informed about the purpose of the project and privacy and were ensured that the project would not affect their evaluation . those who consented were included in the study . for data collection ,
the first part was about demographic characteristics of the participants and included items on age , gender , marital status , level of education , type of employment , experience , organizational position and the ward where they were working .
the second part of the questionnaire consisted of items based on tpb and was administered to determine predictors of nurses intention and behavior regarding the use of health literacy strategies .
the questionnaire consisted of 11 questions on attitude towards behavior , 9 question on subjective norms , 7 questions on perceived behavioral control and 6 questions on behavioral intention rated based on five - point likert scale anchored at 1 = completely agree and 5 = completely disagree .
the use of health literacy strategies in patient education was assessed by 10 items . to investigate the validity of the developed questionnaire ,
the face and content validity were assessed using a qualitative approach based on comments of a panel of experts and a quantitative approach via comparing the content validity ratio ( cvr ) . according to lawsche table ,
values of cvr for 10 experts above 0.62 were considered as necessary items in the instrument ( 36 ) .
the calculated cvr value for each of the constructs was above the acceptable level , and the mean ratio for the whole instrument was 0.85 indicating the content validity of the questionnaire . to determine the reliability of the instrument , internal consistency method was used .
to this end , the questionnaire was completed by 30 participants and cronbach s alpha was used to assess the internal consistency .
the alpha value was 0.74 for the attitude scale , 0.78 for subjective norms , 0.68 for perceived behavioral control and 0.81 for behavioral intention .
data were analyzed using independent t - test , anova , pearson s correlation coefficient and linear regression via spss v.17 .
a total of 148 nurses working in al - zahra hospital with a mean age of 36.75 5.78 participated in the study .
89 percent of participants were female , 80 percent were married , 64.8 percent had completed patient education retraining courses in last year , 37.8 percent of them were contract employees , 87.9 percent was working in the wards and about 12 percent worked as a supervisor
the mean score of nurses on use of health literacy strategies for patient education was 21.743.47 .
one - way anova showed a significant difference between the mean scores of nurses on use of health literacy strategies for patient education on the basis of variables such as marital status ( p=0.023 ) , attending retraining courses ( p=0.003 ) , type of employment ( p=0.02 ) , work experience ( p=0.004 ) , and organizational position ( p=0.003 ) .
, in other words , single nurses with 5 to 10 years of work experience and those with contract employment and attending retraining courses on patient education used more health literacy strategies and techniques for patient education than others did . results of pearson s correlation coefficient show that there is a significant positive correlation between construct of attitude toward behavior , subjective norms , and perceived behavioral control with intent and behavior of nurses regarding use of health literacy strategies for patient education ( table 1 ) .
correlation coefficient between constructs of tpb and implementation of health literacy strategies for patient education based on the results of linear regression analysis , perceived behavioral control ( =0.417 ) was the best predictor of intention ( table 2 ) .
the results of the regression model showed that ability of tpb constructs to predict nurses use of health literacy strategies in patient education is 0.31 . perceived behavior control was the strongest predictor of behavior and predicted 33% of the behavior change ( table 3 ) .
linear regression analysis of effects of tpb constructs on intention to use health literacy strategies in patient education ( dependent variable ) * p < 0.01 linear regression analysis of effects of tpb constructs on behavior of using health literacy strategies in patient education ( dependent variable ) * * p < 0.001*p
the purpose of this study is to determine the predictors of nurses intention and behavior regarding use of health literacy strategies and techniques in patient education based on tpb . according to literature ,
tpb is one of the best theories that explain the behavior of service providers in the healthcare system and can work well in identifying factors affecting the behavior of practitioners in clinical settings ( 30 ) . in this study ,
variables affecting nurses intention and behavior for use of these techniques based on tpb were identified and analyzed via regression model .
identifying and focusing on modifiable factors in nurses behavior is an important step in the selection of appropriate intervention to obtain the best results .
it is worth mentioning that this study is the first of its kind on assessing the use of health literacy strategies in patient education by iranian nurses .
therefore , similar studies that can be compared with the results of the present study were not at hand .
hence , in this section we reviewed the studies that examined the intention and behavior of nurses in similar issues . based on the results ,
single nurses with 5 to 10 years of work experience and those with contract employment and attending retraining courses on patient education used more health literacy strategies and techniques for patient education than others did .
results confirm the fact that patient education retraining courses and nurses familiarity with communication skills enhance the effectiveness of the training they provide to patients ( 37 ) . unlike results of this study
, caferio claimed that there is not any statistically significant relationship between demographics , intention and experience of using health literacy strategies among nurse practitioners ( 38 ) .
since service providers in clinical environments consider using health literacy techniques in patient education a time - consuming task , it appears that single nurses , who have fewer personal responsibilities and more time , use these techniques in patient education more than others do . in the present study ,
the constructs of attitude , subjective norms and perceived behavioral control were associated with nurses intention and behavior of using health literacy skills in patient education . in this study ,
this construct predicted 23 percent of the variance in intention and more than 45% of the variation in behavior .
in fact , if nurses perceive the use of these strategies as easy and under their control , they will have a strongest intention to use these strategies in patient education , and eventually they will do so .
in addition , they can cope more easily with potential problems during treatment . according to millstein et al .
, health professionals with higher perceived behavioral control performed better in training adults in the field of sexually transmitted diseases ( 39 ) .
nai - ying et al found perceived behavioral control to be the strongest predictor of nurses intention and volunteering to care for sars patients ( 29 ) . in bunce and birdi , perceived behavioral control predicted the behavior of physicians regarding doctors intentions to request hospital autopsies as a function of job control ( 40 ) .
unlike results of this study , renfroe et al found positive attitude toward behavior and subjective norms the best predictors of nurses intention and behavior regarding documentation .
based on their study , these two components predicted 46.1 percent of variance in nurses behavioral intention and 15.1 percent of the variance in their behavior ( 41 ) .
limitations : although the efficacy of the tpb to predict major factors affecting nurses behavior is well established in clinical settings , since behavior is a complex phenomenon , it is likely that other factors not included in tpb affect their use of health literacy strategies .
although the participants were chosen only from al - zahra hospital , which is one of the largest hospitals in isfahan , the results are not generalizable to other clinical settings .
whereas , in this study , attitude towards behavior and subjective norms did not predict nurses intention to use health literacy techniques in patient education .
it can be argued that the nurses attitude towards the use of health literacy strategies in patient education was positive .
therefore , nurses control beliefs and perceived ability to do the behavior and overcome obstacles can lead them towards using health literacy strategies to increase the effectiveness of patient education .
this is called perceived behavioral control , which deserves more attention . since the construct of perceived behavioral control was found to be the most important factor affecting nurses intention and behavior of using health literacy strategies , designing and implementing programs and educational interventions based on tpb with a focus on perceived behavioral control can increase nurses participation to provide patient education based on health literacy strategies . | background : health literacy is one of the most important priorities for improving health care quality through enhancing patient - provider communication . implementing health literacy strategies enable nurses to provide information and instructions for patients in a manner that is more commensurate and understandable .
the purpose of this study was to investigate the factors affecting nurses intention to implement health literacy strategies in patient education based on theory of planned behavior.methods:a cross - sectional study was done on 148 nurse practitioners of al - zahra educational hospital in isfahan , iran , using a descriptive - analytic method .
data collected via a standardized questionnaire based on theory of planned behavior constructed and analyzed by spss v.17 using anova , independent t - test , pearson correlation and linear regression.results:there was statistically significant correlation between using health literacy strategies and marriage status , attending in retraining courses , employment type , job history , and job status . perceived behavioral control was the most powerful predictor of intention ( =0.417 ) and use health literacy strategies in patient education and behavior of nurses ( =0.33).conclusion : according to the findings of this study , perceived behavioral control is a powerful determinant of nurses intention and behavior of using health literacy strategies in patient education . hence we recommend nurse educators to pay special attention to the constructs of this theory mainly perceived behavioral control in retrain courses about patient education and health literacy strategies . |
the stability of the distal radioulnar joint ( druj ) is a result of both the bony structure and the integrity of the surrounding soft tissues including the triangular fibrocartilage complex ( tfcc ) , pronator quadratus , and interosseous membrane ( figure 1 ) .
the dorsal and palmar radioulnar ligaments are regarded as the major factors of druj stability , whereas the bony structure accounts for about only 20% of the stability .
this instability often occurs in the setting of distal radius fractures ( drfs ) , with incidence rates following drfs reported to be between 10% and 19% .
as drfs are commonly associated with fractures of the ulnar styloid from which the tfcc originates , it is plain to see how they may cause druj instability .
distal radioulnar joint instability . in : wolfe sw , hotchkiss rn , pederson wc , kozin sh , eds .
philadelphia , pa : churchill livingstone elsevier ; 2011:524 .
the distal radioulnar joint with the triangular fibrocartilage complex .
distal radioulnar joint instability is a commonly missed diagnosis that can be easily hidden from clinical and radiographic examinations .
clinical suspicion of druj instability is strengthened with a history of wrist trauma , pain , and limited motion with supination and pronation .
different physical tests for the diagnosis of druj instability have been described , including the ballottement test , radius pull test , clunk test , extensor carpi ulnaris ( ecu ) test , and press test .
the ballottement test is considered the most reliable physical examination test for druj instability .
the radiographic evaluation of druj instability begins with posteroanterior ( pa ) and lateral radiographs of the wrist . in the pa view , relevant findings include widening of the distal radioulnar space as compared with the contralateral side . in the lateral view , druj instability is suggested by a radioulnar distance of more than 6 mm .
when conventional radiographic results are equivocal , a computed tomography ( ct ) scan can be of value in diagnosing druj instability . with this modality , there are 4 methods to assess instability , including the mino method , the congruency method , the epicenter method , and the radioulnar ratio method ( figure 2 ) .
the sensitivities of these methods vary from 55% to 100% , although malunions may often produce a false positive result .
in particular , the mino and congruency methods are associated with high false positive results .
the epicenter method is considered the most specific method in detecting a dislocation . compared with ct
, a magnetic resonance imaging test has a higher sensitivity in evaluating soft tissue , rather than bony , details .
while this modality has the ability to detect tfcc tears and ulnar styloid injuries , its role in evaluating druj instability is still unclear .
arthroscopy has been utilized as a diagnostic and therapeutic intervention for the treatment of tfcc injuries , with recent literature suggesting that it may be able to detect pathology at the articular surfaces of the distal radioulnar joint .
figure 2.computed tomography ( ct ) methods for assessing distal radioulnar joint ( druj ) instability .
d , radioulnar ratio . adapted with permission from adams bd . distal radioulnar joint instability . in : wolfe sw , hotchkiss rn , pederson wc , kozin sh , eds .
computed tomography ( ct ) methods for assessing distal radioulnar joint ( druj ) instability .
distal radioulnar joint instability . in : wolfe sw , hotchkiss rn , pederson wc , kozin sh , eds .
nonsurgical treatment of chronic druj instability is possible in some cases . in less active patients ,
, this treatment can only be used as an initial therapy in more active patients , and surgery is ultimately needed if nonsurgical treatment fails to restore normal function and stability of the forearm .
surgery should be considered for druj instability to recover bone and ligament injuries if nonsurgical treatment fails to restore forearm stability and function . to recover bone deformities , osteotomies of the radius , ulna , or , in some cases ,
consideration is given to soft tissue injury once the bone injuries are recovered . in cases where there is no druj arthritis and
the sigmoid notch is intact , reconstructive procedures are considered , including techniques of extrinsic radioulnar tether , ulnocarpal sling , tenodesis procedures , and reconstruction of the volar and dorsal radioulnar ligaments . in cases
where druj instability is associated with ulnocarpal impaction and arthrosis , various salvage procedures are proposed .
the most common surgical procedure performed for druj instability is the darrach procedure that involves resection of the entire ulnar head .
however , several studies have described various complications with this technique such as pain and ulnar stump clicking , loss of grip strength , loss of ulnar support , and radioulnar impingement as a result of ulnar stump instability . in their series of patients treated with the darrach procedure , field et
al reported satisfactory results in only 50% of their patients , which was lower than previously published reports .
some authors have recommended that this technique not be used in young patients due to these complications .
tulipan et al used a modified darrach procedure that involved minimal bone resection and reported good to excellent results in 91% of their patients .
they reported an increase in the mean ranges of supination ( from 52 preoperatively to 83 postoperatively ) and pronation ( from 60 preoperatively to 84 postoperatively ) accompanied by a 38% increase in grip strength . in another study ,
di benedetto et al studied 18 patients over an 8-year period who underwent darrach surgery with minimal bone resection and observed that mean supination and pronation values increased from 45 and 63 , respectively , to 82. furthermore , grip strength increased to 76% of the contralateral side . of the 18 patients , 4 experienced ulnar carpal translocation .
one of the most common reasons for progressive pain after the darrach procedure is convergence instability of the ulnar stump that is inclined to the radius . to alleviate this instability ,
several techniques have been proposed such as a transfer of the pronator quadratus origin to a more dorsal position and extensor carpi ulnaris and flexor carpi ulnaris tenodesis . however , these methods are not the best solutions . moreover ,
several methods of endoprosthesis have been created to replace the ulnar head in patients undergoing darrach surgery or another salvage procedure .
sauerbier et al observed better results when applying a prosthesis and therefore recommended an ulnar head endoprosthetic replacement instead of a soft tissue stabilization technique in recovering distal forearm instability following a darrach resection .
another technique for treating chronic druj instability with articular surface destruction is the sauv - kapandji ( s - k ) technique .
the s - k procedure differs from the darrach technique in that it does not eliminate ulnar support at the wrist .
theoretically , the s - k technique has several advantages compared to the darrach technique when employed in younger patients , including retention of the tfcc , ulnar head , and the origin of the ulnocarpal ligaments ; a more natural force transmission pattern from the hand to the forearm ; and prevention of extensor carpi ulnaris movement .
in their review of 28 patients with druj instability , rothwell et al introduced a new method of the s - k procedure and reported mean pronation and supination values of more than 80 in 19 and 20 cases , respectively .
the s - k technique is often employed after malunited fractures of the distal radius .
this technique is also indicated in cases of isolated druj instability created after ligament ruptures and chronic tfcc tears .
however , this technique is not without complications . these include ( 1 ) osseous or fibrous union ,
( 2 ) delayed union or nonunion of the arthrodesis , and ( 3 ) painful proximal ulnar stump instability . like the darrach resection ,
nakamura et al compared the darrach and s - k techniques and concluded that the latter had more satisfactory results in patients with chronic druj dislocation accompanied by deformity and joint damage .
however , in another comparative study that evaluated radiographic results of the s - k and darrach procedures in the rheumatoid wrist , the 2 techniques provided comparable restoration of carpal anatomy .
the authors observed a decrease in the carpal height ratio ( chr ) and an increase in the ulnocarpal distance ratio ( ucdr ) in both groups with no statistical significant differences between them . in another study ,
george et al compared these 2 methods in the treatment of druj derangement following malunion of dorsally displaced , unstable , intra - articular fractures of the distal radius .
they found no differences in both the disabilities of the arm , shoulder , and hand ( dash ) score and objective outcomes .
ross et al introduced a new salvage procedure for a failed s - k procedure , which involved ulnar lengthening using a bone graft from the iliac crest . in this manner ,
the ulnar bony continuity is preserved and is followed by resection of the pseudoarthrosis with the use of a matched hemiresection interposition arthroplasty .
this was conducted on 3 patients and they found no signs of instability after the surgery .
the mean supination and pronation values in this series were 60 and 65 , respectively .
bain et al conducted a retrospective review of patients with druj derangement who underwent hemiresection interposition arthroplasty after failing nonsurgical treatment .
they reported pain improvement and patient satisfaction in 72% and 84% of patients , respectively .
final values for supination and pronation were 72. in another study conducted by ahmed et al , patients were exposed to matched hemiresection interposition arthroplasty and 84% reported complete resolution of pain .
moreover , grip strength and range of motion were significantly improved with final pronation and supination values of 74 and 81 , respectively .
imbriglia and matthews recommended hemiresection interposition arthroplasty for cases of chronic posttraumatic dorsal subluxation of the distal ulna and for patients who are symptomatic , despite ligamentous stabilization . in their study , 17 of 23 patients showed good or excellent results with increases in the final range of motion and grip strength of 90% and 75% , respectively , compared to the contralateral side .
sauerbier et al found that the darrach technique caused more forearm instability than the hemiresection interposition technique and thus concluded that hemiresection interposition arthroplasty was superior to the darrach technique for treatment of druj arthrosis .
minami et al examined the results of all 3 salvage procedures for treatment of patients with osteoarthritis of the druj . after a mean 10-year follow - up , they found that both the s - k and hemiresection interposition arthroplasty techniques performed better with regard to pain improvement , flexion and extension , grip strength , and overall complications when compared to the darrach procedure . of note , supination and pronation values improved significantly for all groups .
the authors recommended the darrach technique for elderly patients with severe osteoarthritic changes in the druj , hemiresection interposition arthroplasty for patients with a reconstructible or intact tfcc , and the s - k technique for the patients with a non - reconstructible tfcc or positive ulnar variance more than 5 mm in spite of a functional tfcc .
distal radioulnar joint instability is a common , but frequently missed , clinical condition that typically occurs in the setting of associated distal radius and ulnar styloid fractures .
computed tomography has emerged as a valuable tool in assessing the integrity of the druj , and the roles of additional imaging modalities continue to be explored .
nonsurgical treatment can be considered as the primary therapy in less active patients , while surgery should be considered to recover bone and ligament injuries if nonsurgical treatment fails to restore forearm stability and function .
several salvage techniques have been described for druj instability , including the darrach procedure , the s - k technique , and hemiresection interposition arthroplasty .
each has its set of advantages and disadvantages , and the appropriate choice of treatment depends on the individual patient and specific derangement of the druj .
further studies are warranted to compare the techniques to better elucidate their role in the treatment of druj instability . | distal radioulnar joint ( druj ) instability is a common clinical condition but a frequently missed diagnosis .
both surgical and nonsurgical treatments are possible for chronic cases of druj instability .
nonsurgical treatment can be considered as the primary therapy in less active patients , while surgery should be considered to recover bone and ligament injuries if nonsurgical treatment fails to restore forearm stability and function .
the appropriate choice of treatment depends on the individual patient and specific derangement of the druj |
the fluoroquinolones have also become popular as there are minimal chances of bacterial resistance with these agents .
inspection of the pharmacokinetic behavior in various animal species reveals that the drug is poorly absorbed in goats following its oral administration .
one practical approach to enhance the bioavailability is by using herbal bio - enhancers with the antibacterial agents .
piper longum pretreatment has been successfully employed as a bio - enhancer with orally administered oxytetracycline in wlh poultry birds . in the present study , the effect of the herbal bio - enhancer , trikatu ( equal parts of piper longum , piper nigrum and zingiber officinale ) on the pharmacokinetic behaviour of pefloxacin in mountain gaddi goats is presented .
the study was conducted on six adult healthy mountain gaddi goats weighing 18 - 22 kg .
the same animals were used for both treatments after a wash out period of 15 days .
the goats were kept under close observation before beginning the experiments to enable them to acclimatize to the new environment . in the first treatment pefloxacin ( pelwin ;
wokhardt , india ) was given at the dose rate of 20 mg / kg body weight whereas in second treatment animals were orally administered trikatu ( piperine contents of trikatu 2.02% ( w / w ) ) at a dose rate of 2 g / kg for 14 days and on day 15 , pefloxacin was administered at the dose rate of 20 mg / kg .
5 ml blood samples were collected from each animal in heparinized tubes at 10 , 15 , 20 , 30 , 45 , 60 , 120 , 240 , 360 , 480 and 720 min post drug administration and were centrifuged at 3,000 rpm for 10 min for plasma separation .
the concentration of microbiologically active pefloxacin ( parent & metabolites ) in plasma were determined by the agar plate diffusion method using e. coli ( strain mtcc-443 ) as the test organism with the modification that large petri plates were used instead of large glass plates and only three punches were made for the microbial assay .
the plasma concentration - time profile of pefloxacin for each goat was used to determine the pharmacokinetics .
different pharmacokinetic parameters were analysed using the " method of least square " and the " method of residual yields " as described by gibaldi and perrier .
estimation of the area under the concentration - time curve ( auc ) and the area under the first moment of the plasma drug concentration time curve ( aumc ) were based on the trapezoidal rule .
the compartmental analysis of plasma concentration vs. time was carried out using the mono - exponential equation : where cp is the plasma drug concentration at time t , b is the zero time intercept of the regression line of the elimination phase , a is the zero time plasma drug concentration intercept of the regression line of the absorption phase , ka is the absorption rate constant , is the overall elimination rate constant , t is time and e is the natural logarithm base . the dosage regimen for maintaining mic of 0.1 - 0.8 g / ml for most organisms at dosage interval of 4 , 6 and 8 h was derived as per the method described by notari .
the difference between the means of the two treatments was determined by student 's t - test and the data were analyzed using graphpad instat ( graphpad software , usa ) .
the results of the study revealed that the mean plasma concentrations of pefloxacin were consistently lower in trikatu treated goats up to 2 h. the values were significantly lower at 10 min , 15 min and 20 min post drug administration ( table 1 and fig .
the values at 20 min post drug administration were 3.17 g / ml in control animals against 2.87 g / ml in trikatu treated goats .
in contrast , the plasma concentrations of pefloxacin were significantly higher at 4 , 6 , 8 and 12 h post pefloxacin administration .
the plasma levels were 1.28 g / ml in trikatu treated animals at 8 h whereas the plasma levels were 1.07 g / ml in control animals .
the values of the pharmacokinetic determinants in the control and trikatu treated animals are given in table 2 .
the values of the absorption rate constant ( ka ) and zero time intercept of the absorption phase ( a ) revealed a non significant difference between the two groups .
the findings of the present study further revealed significantly higher values ( 30.85 1.39 g / ml.h in trikatu treated animals against 27.10 g / ml.h in control animals ) for the area under curve ( auc ) , aumc , the mean residential time ( mrt ) and the total duration of pharmacological action ( td ) in the trikatu treated goats . the mean residential time was 5.27 0.27 h in trikatu treated animals against 4.47 0.16 h in control animals .
similarly , the total duration of the td was 24.16 1.46 h in trikatu treated animals against 19.72 0.38 h in control animals .
the bioavailability of the drug was also significantly higher ( p < 0.05 ) in trikatu treated goats ( 44.18 2.90% against 38.33 1.80% in control animals ) .
prior treatment of the goats with trikatu significantly reduced the elimination half life ( t1/2 ) and the zero time intercept of the elimination phase ( b ) .
the elimination half life was 3.30 0.19 /h in trikatu treated against 2.5 0.12/h in control animals .
the total body clearance ( clb ) , however , did not show any significant difference in the trikatu treated goats .
the indicators of drug distribution in the body i.e. apparent volume of distribution [ vd(area ) ] and volume of distribution based on the zero time plasma drug concentration intercept of the elimination phase [ vd(b ) ] were significantly higher in the trikatu treated goats .
the values of vd(area ) in trikatu treated goats were 1.37 0.11 l / kg whereas the values of vd(area ) were 1.11 0.08 l / kg in control animals . the oral priming and maintenance doses of pefloxacin based on the minimum inhibitory concentration ( mic ) of 0.1 , 0.2 , 0.3 , 0.4 and 0.6 and 0.8 g / ml for most of the organisms of clinical significance in the control and trikatu treated goats are given in table-2 .
on the basis of the data for microorganisms possessing a minimum inhibitory concentration of 0.8 g / ml , the priming dose of 7.0 mg / kg and maintenance dose of 2.59 mg / kg should be repeated at 8 h intervals . however , following trikatu administration the oral priming and maintenance doses would be 6.0 and 2.21 mg / kg , respectively and for practical purposes a priming dose of 6.0 mg / kg and maintenance dose of 2.0 mg / kg would be required to be administered following trikatu co - administration .
pefloxacin has excellent activity against a wide range of gram positive and gram negative microorganisms and it is being successfully used in the treatment of various human and animal diseases .
pefloxacin is partially metabolized in the liver to norfloxacin , which is a potent anti microbial agent . due to its favourable pharmacokinetic properties such as better bioavailability ,
better volume of distribution and minimal chances of resistance , it is one of the favoured anti bacterial agents for treatment of animal diseases .
the irregular absorption from the gastrointestinal tract of goats limits its therapeutic utility . in goats only about 42% of the drug administered orally is available to the systemic circulation .
trikatu is an ayurvedic preparation containing an equal ratio of long pepper ( piper longum ) , black pepper ( piper nigrum ) and ginger ( zingiber officinale ) .
piperine ( 1-piperoyl piperidine ) , an amide alkaloid , from a different species of pepper is mainly responsible for enhancing the bioavailability of concurrently administered drugs .
the observed plasma values of pefloxacin in goats by oral route were best described by a one compartment model .
this model has also been used by previous workers to describe the pharmacokinetics of pefloxacin in various domestic species .
the findings of the present study indicated that plasma concentrations of the drug remained lower up to 2 h post drug administration with consistently significantly lower concentrations up to 20 min .
in contrast , in our earlier studies in birds , higher plasma values of oxytetracycline were observed following piper longum treatment during the absorption phase .
the findings of the present study in goats therefore ruled out the possibility of vasodilatation of enteric vessels during absorption .
the findings of the present study agreed with those of lala et al . who also observed decreased plasma levels of declofenac sodium during the absorption phase in rabbits .
the decreased elimination of the drug was adequately supported by the higher values of t1/2 in the present study . however , the total body clearance ( clb ) remained unaffected in the trikatu treated goats .
further , higher values of the apparent volume of distribution values based on the apparent volume of distribution based on the total area under the plasma drug concentration time curve [ vd(area ) ] indicated a better penetration of the drug in various body tissues .
this was supported by the higher value for the apparent volume of distribution based on the zero time plasma concentration intercept of elimination phase [ vd(b ) ] the higher values of auc , aumc , and mrt in the piperine treated goats were indicative of enhanced systemic availability of pefloxacin following trikatu administration .
the enhanced bioavailability was not due to increased absorption but because of decreased elimination as evidenced by the higher values of t1/2. the decreased elimination could either be due to suppression of drug metabolizing activities or due to decreased renal excretion . in the present study td and mrt
based on the mic data , only a marginal reduction in the dose ( 6 - 15% ) was possible following trikatu administration . | the pharmacokinetics of orally administered pefloxacin were studied to evaluate the bio - enhancing effect of the herbal bio - enhancer , trikatu , in mountain gaddi goats ( n = 6 ) .
the findings of the study revealed a decreased plasma concentration ( p > 0.05 ) of pefloxacin following trikatu administration during the absorption phase ( 10 , 15 , 20 min post pefloxacin administration ) .
in contrast , the plasma concentrations of pefloxacin were significantly higher at 4 , 6 , 8 and 12 h ( during the elimination phase ) of the pefloxacin administration .
the findings of the investigation revealed higher values for the area under the curve , the area under the first moment of the plasma drug concentration time curve , the mean residential time , the total duration of pharmacological action and bioavailability .
trikatu treatment , however , significantly reduced the elimination half life ( t1/2 ) and zero time intercept of the elimination phase .
the apparent volume of distribution based on the total area under the plasma drug concentration curve [ ( vd(area ) ] and the apparent volume of distribution based on the zero time plasma concentration intercept of the elimination phase [ vd(b ) ] were significantly higher in trikatu treated animals indicating a better penetration of the drug .
based on the mic of 0.8 g / ml of pefloxacin , a priming dose of 6.0 mg / kg and a maintenance dose of 2.21 mg / kg is required to be administered at 8 h intervals . for practical purposes in goats this would mean a priming dose of 6 mg / kg and a maintenance dose of 2 mg / kg given by the oral route , to be repeated at 8 h intervals . |
patent ductus arteriosus ( pda ) has been associated with significant morbidity in preterm infants , especially in very low - birth - weight infants ( vlbw ) . in a hemodynamically significant pda ( hspda ) , there is significant shunting of blood from the systemic to the pulmonary circuit resulting in increased pulmonary blood flow with reduction in effective systemic blood flow .
the diastolic runoff from the systemic circulation may lead to major complications like necrotizing enterocolitis ( nec ) , intraventricular hemorrhage ( ivh ) , and renal perfusion abnormalities .
the increased pulmonary blood flow contributes to the acute worsening of rds and chronic lung disease later .
early treatment of an hspda has been shown to improve symptoms , the need for surgical ligation , duration of ventilator support and hospitalization in premature infants . currently clinical , radiological and echocardiographic assessments used to diagnose a hemodynamically significant pda have substantial limitations . clinical findings like a continuous murmur and
bounding pulses are not always present especially in vlbw infants on high ventilator support where the pda could be
silent. although echocardiogram has been considered as the gold standard for the diagnosis , it provides assessment at only one point of time and may not give a picture of the rapidly changing dynamic circulation especially in vlbw infants .
there is also a lack of consensus in defining an hspda by echocardiographic criteria and size does not always correlate with the degree of shunting .
( bnp ) have been used as indirect indicators of pulmonary blood flow and left ventricular volume overload .
the inactive fragment of bnp , nt - probnp with longer half - life and no circadian variation may serve as a better marker than bnp for assessment of ventricular dysfunction and volume overload . for assessing a reduction in the effective cardiac output ,
the resistive indices of the superior mesenteric artery ( sma ) measured as pulsatility index ( pi ) have been used to indirectly assess the diastolic steal associated with an hspda .
this study was undertaken to assess the sensitivity and specificity of nt - probnp in predicting an hspda diagnosed by clinical , traditional and functional echocardiographic criteria including a measure of the sma blood flow pi in vlbw preterm infants .
this study was undertaken to assess the sensitivity and specificity of nt - probnp in predicting an hspda diagnosed by clinical , traditional and functional echocardiographic criteria including a measure of the sma blood flow pi in vlbw preterm infants .
this was a prospective study conducted at the brookdale university hospital and medical center from january 2008 to september 2009 .
vlbw infants ( less than 1500 g birth weight ) were eligible for entry into the study .
infants with congenital heart defects , major congenital anomalies , confirmed sepsis , renal failure , persistent pulmonary hypertension and death within 3 days of admission to nicu were excluded .
the study was approved by the institutional review board and consent was taken from parents before enrollment of the babies into the study .
all babies enrolled in the study were evaluated with echocardiograms on the 3 5 day of life and then every week until the echo showed either a closed pda or non - hspda .
a phillips 5500 ultrasonography machine ( phillips medical systems , na , bothell , wa ) incorporating 2-dimensional , color flow , pulsed and continuous wave doppler was used . if a pda was diagnosed the point of maximal constriction of the color flow jet was measured in millimeters by frame by frame analysis to assess ductal size .
the left atrium and aortic root dimensions were measured in the parasternal short axis view at the level of the aortic valve and the la : ao ( left atrial : aortic ) ratio was calculated .
in addition left ventricular dimensions in systole and diastole , tricuspid regurgitant jet gradients to assess systolic pulmonary artery pressures and systolic function by % shortening fraction ( sf ) were measured .
a sagittal subcostal view was used to image the superior mesenteric artery ( sma ) .
the pi of the sma calculated as peak systolic velocity - end diastolic velocity / time averaged mean velocity ( vti ) was measured as an index of change in the local vascular resistance and reduction in effective cardiac output .
all measures were performed based on the american society of echocardiography guidelines and an average of two readings were taken and reviewed by a single cardiologist blinded to the clinical status or laboratory data of the patient .
hspda was defined as pda size of > 1 mm with at least two additional features of pda ( continuous murmur , pulse pressure > 25 mmhg , worsening respiratory status , la / ao ratio > 1.4 , pi of sma > 6 , base excess > -5 ) .
infants with hspda were treated with indomethacin , ibuprofen or surgery depending on the clinical status of the infant and discretion of the neonatologist .
blood samples ( 0.5 ml ) for plasma nt - probnp were collected by arterial or venous catheter aspiration or by venous blood sampling along with other routine blood sampling to avoid extra needle sticks and excessive blood sampling .
it was collected on the same day that the echocardiogram was done and analyzed immediately .
plasma nt - probnp was measured with vitros nt - probnp reagent pack using intellicheck technology ( ortho clinical diagnostics , a johnson and johnson company ) .
data including body weight changes , fluid intake and output , respiratory and cardiovascular status were collected every week and data on the length of stay , prevalence of nec , bronchopulmonary dysplasia ( bpd as defined by need for supplemental oxygenation at 36 weeks ' postmenstrual age ) , ivh , and mortality were collected from the charts and neonatal database .
analysis was performed using spss , version 15 ( spss inc , chicago , il )
. demographics and clinical characteristics were compared between hspda and non - hspda groups using fishers exact and chi - square tests .
t - test and mann - whitney u test were used to compare continuous variables .
pearsons correlation coefficient was used to test for correlations between plasma nt - probnp levels and other continuous clinical and echocardiographic variables . the receiver operator characteristic (
roc ) curve was created to select the best cut - off point of nt - probnp for detection of hspda .
analysis was performed using spss , version 15 ( spss inc , chicago , il )
. demographics and clinical characteristics were compared between hspda and non - hspda groups using fishers exact and chi - square tests .
t - test and mann - whitney u test were used to compare continuous variables .
pearsons correlation coefficient was used to test for correlations between plasma nt - probnp levels and other continuous clinical and echocardiographic variables . the receiver operator characteristic (
roc ) curve was created to select the best cut - off point of nt - probnp for detection of hspda .
sixty - nine babies with mean gestational age ( ga ) of 272.6 weeks were included in the study for whom a total of 121 echocardiographic studies were done .
the hspda group had 22 patients while the non - hspda group had 47 patients .
the hspda group had a significantly lower gestational age and birth weight compared to the non - hspda group [ table 1 ] .
the hspda group had significantly higher nt - probnp levels [ figure 1 ] , lower base excess , wider pulse pressure and lower mean and diastolic blood pressures .
weekly nt - probnp levels demographic and clinical parameters the hspda group had significantly higher estimated pulmonary artery pressures measured by the tr jet gradient and lower pda systolic and diastolic pressure gradients indicating higher pulmonary artery pressures [ table 2 ] .
echocardiogram parameters there were significant positive correlations of nt - probnp with echo parameters of pda size , la / ao ratio , the resistive index of sma blood flow and higher estimated pa pressures .
significant negative correlations were found with low birth weight , gestational age , diastolic blood pressure and base excess [ table 3 ] .
correlations with nt - probnp in the hspda group , 45% of the infants received intervention ; 6 received ibuprofen , one received indomethacin and 3 underwent surgical ligation .
in the hspda group , 6 infants ( 27% ) died and the remaining 16 infants ( 73% ) had pda closure at a mean age of 2.7 weeks . in the non - hspda group , 13 infants ( 28% ) had pda of whom 2 infants ( 3% ) died and the remaining had pda closure at mean age of 2.1 weeks .
the hspda group had a higher , but not statistically significant incidence of ivh ( 27% in hspda group vs. 15% in the non - hspda group , p=0.2 ) , chronic lung disease ( 36% in hspda group vs. 17% in the non - hspda group , p=0.1 ) , and a significant increase in mortality within 2 weeks ( 27% in hspda group vs. 4% in the non - hspda group , p=0.01 ) .
the nt - probnp levels continued to decline over time in both groups although the mean values remained higher at all times in the hspda group [ figure 1 ] . using the receiver operating characteristic curve ( roc ) , nt - probnp levels were a good predictor of an hspda with the area under the curve of 0.981 ( p<0.001 ) . using a cut off of 5900 pg / ml was associated with a 96% sensitivity and 90% specificity of accurately diagnosing an hspda . on multivariate analysis , nt - probnp levels and weight were significant independent predictors of hspda . in a subgroup analysis of 12 patients who had nt - probnp measured both with a hspda and
later a non - hspda , the meansem levels were significantly higher for hspda compared to non - hspda ( 243223857 pg / ml vs. 3381578 pg / ml , respectively , p<0.001 by paired t - test ) .
the hspda group had significantly higher estimated pulmonary artery pressures measured by the tr jet gradient and lower pda systolic and diastolic pressure gradients indicating higher pulmonary artery pressures [ table 2 ] .
echocardiogram parameters there were significant positive correlations of nt - probnp with echo parameters of pda size , la / ao ratio , the resistive index of sma blood flow and higher estimated pa pressures .
significant negative correlations were found with low birth weight , gestational age , diastolic blood pressure and base excess [ table 3 ] .
in the hspda group , 45% of the infants received intervention ; 6 received ibuprofen , one received indomethacin and 3 underwent surgical ligation . in the hspda group ,
6 infants ( 27% ) died and the remaining 16 infants ( 73% ) had pda closure at a mean age of 2.7 weeks . in the non - hspda group , 13 infants ( 28% )
had pda of whom 2 infants ( 3% ) died and the remaining had pda closure at mean age of 2.1 weeks .
the hspda group had a higher , but not statistically significant incidence of ivh ( 27% in hspda group vs. 15% in the non - hspda group , p=0.2 ) , chronic lung disease ( 36% in hspda group vs. 17% in the non - hspda group , p=0.1 ) , and a significant increase in mortality within 2 weeks ( 27% in hspda group vs. 4% in the non - hspda group , p=0.01 ) .
the nt - probnp levels continued to decline over time in both groups although the mean values remained higher at all times in the hspda group [ figure 1 ] . using the receiver operating characteristic curve ( roc ) , nt - probnp levels were a good predictor of an hspda with the area under the curve of 0.981 ( p<0.001 ) . using a cut off of 5900 pg / ml was associated with a 96% sensitivity and 90% specificity of accurately diagnosing an hspda . on multivariate analysis , nt - probnp levels and weight were significant independent predictors of hspda . in a subgroup analysis of 12 patients who had nt - probnp measured both with a hspda and later a non - hspda ,
the meansem levels were significantly higher for hspda compared to non - hspda ( 243223857 pg / ml vs. 3381578 pg / ml , respectively , p<0.001 by paired t - test ) .
this study supports the previously shown increased morbidity and mortality in vlbw premature infants with hspda . our hspda group showed a significantly higher prevalence of chronic lung disease , and early mortality compared to those without an hspda and similar findings
have been shown by other investigators . in spite of the high prevalence of a pda in nearly 60 - 70% of vlbw infants and its associated morbidity
there are no universally accepted methods to diagnose an hspda and no accepted indications for intervention or the timing of intervention .
one of the major reasons for this is the dynamic nature of the ductal tissue and its varied sensitivity to a number of vasodilators and vasoconstrictors in the preterm infant .
factors that alter the pulmonary and systemic vascular resistance will also influence ductal shunting irrespective of ductal size .
clinical signs such as a heart murmur , hyperdynamic precordium , bounding pulses and metabolic acidosis are not accurate predictors of a significant ductus in the first few days of life .
even traditional echocardiographic parameters like the size of the ductus , left atrial dimensions , left atrial to aortic root ratio ( la : ao ) are not specific for determining an hspda and may take a few days before these features are evident by echo . to assess lv volume overload related to a pda shunt we used nt - probnp , a brain natriuretic peptide , a biomarker used in previous studies as an indicator of left ventricular volume overload .
bnp is mainly synthesized by the ventricles of the heart in response to volume and pressure loading and leads to diuresis , vasodilatation and inhibition of renin / aldosterone production .
it is synthesized as a pro - hormone pro - bnp which is cleaved into the biologically active bnp ( half - life of 20 min ) and the inactive fragment nt - probnp ( half - life of 90 min ) .
therefore , it can be kept for later analysis and may serve as a better marker than bnp for assessment of ventricular dysfunction and volume overload .
previous studies in healthy full - term infants have shown that the plasma bnp level rapidly rises after birth , reaching its peak at day 2 - 3 of life suggesting a physiological role for bnp in the transitional neonatal circulation .
recent studies have also shown high plasma bnp levels to correlate with degree of ductal shunting .
a decline of bnp level was also noted after pda was closed by indomethacin . in this study
we used serial nt - probnp levels to assess correlation with echo and clinical features of a pda over time .
the first measurement was done on day 3 - 5 when the expected early adjustments in the premature transitional circulation would be over and the effect of the left to right pda shunt more evident on the left ventricle volume status .
our data confirms the previous findings that nt - probnp levels are significantly higher in patients with a hspda compared to the non - hspda group and also showed a significant drop in levels when the duct was closed or no longer hemodynamically significant .
previous investigators have shown similar trends in bnp levels with age and after use of indomethacin .
patients identified with hspda were noted by echocardiogram to have significantly lower mean septal and posterior wall thickness although there was no difference in their mean lv diastolic and systolic dimensions .
this implies that patients with an hspda may have an altered ventricular remodeling response to the volume overload .
gastrointestinal blood flow is affected in the early stages of an hspda secondary to ductal steal and redistribution of blood to vital organs .
the superior mesenteric artery ( sma ) supplies most of the intestines and changes in blood flow in this vessel reflect changes in bowel perfusion .
there are several studies which have shown decreased intestinal blood flow and changes in resistive indices of the sma in patients with a symptomatic pda . in this study
, we used the sma pi of greater than 6 to characterize an hspda based on our preliminary data correlating the currently accepted echo and clinical parameters with values of the pi giving a sensitivity and specificity of > 80% in predicting an hspda . including this as a feature for diagnosing an hspda added a measure of the effective systemic output and ductal steal in addition to the other echocardiographic and clinical parameters .
the limitations of this study were a small sample size and no standard protocol for management .
also there are a few confounding factors that can influence the validity of nt - probnp levels such as increased pulmonary vascular resistance , concomitant renal impairment , hydration status and sepsis .
the strengths of the study were that this was a prospective study performed on all premature infants less than 1500 grams in a single medical center , at preset time intervals thus reducing selection bias and one of the only studies to our knowledge that has used a measure of systemic blood flow and pulmonary blood flow to gauge an hspda .
until further randomized control trials are done in vlbw infants to assess the effect of medical treatment and/ or surgical ligation vs. conservative management on short - term and long - term morbidity and mortality , frequent clinical assessments , directed functional echocardiography utilizing measures to assess both pulmonary and effective systemic blood flow and biomarkers like bnp or nt - probnp together may help direct timing and treatment strategies for those patients with an hspda .
use of biomarkers could also help determine the relative contribution of filling pressures to worsening respiratory status associated with intermittent reactive pulmonary hypertension in severe rds . this marker may help direct management towards improving ventricular function and reducing the volume overload with the judicious use of inotropes , fluid restriction , diuretics and interventions to close the pda .
the pda and premature transitional circulation is dynamic and can lead to rapid and frequent changes in hemodynamic status .
serial nt - probnp levels can be used as a simple screening test which is cost effective , easily available and can supplement the information obtained from functional echocardiography to aid in the diagnosis and management of an hspda . | purpose : a hemodynamically significant patent ductus arteriosus ( hspda ) in premature infants is known to be associated with significant morbidity .
recently brain natriuretic peptides and superior mesenteric artery ( sma)-resistive indices have been used to effectively diagnose hspda.objective:to assess the sensitivity and specificity of n - terminal probnp ( nt - probnp ) in predicting an hspda diagnosed by clinical and echocardiographic criteria including pulsatility index ( pi ) of sma.materials and methods : all preterm neonates < 1500 g were evaluated with echocardiograms and nt - probnp levels on the 3rd to 5th day of life and then every week until the echo showed either a closed pda or non-hspda.results:sixty-nine babies with mean gestational age of 27 weeks were included in the study .
nt - probnp levels were significantly higher in the hspda group ( n=22 ) with a meansem of 244203190 compared to 3072332 in the non - hspda group ( n=47 ) ( p<0.001 ) .
nt - pro bnp level of 5900 pg / ml had 96% sensitivity and 90% specificity of predicting hspda.conclusions:with frequently changing hemodynamics in low - birth weight infants , including nt - probnp and pi of sma improve the ability of assessing the effects of a hspda and will help timing of intervention . |
insulin resistance ( ir ) is the important pathophysiological basis of diseases such as type 2 diabetes mellitus ( t2 dm ) , hypertension , hyperlipidemia , and obesity [ 1 , 2 ] .
skeletal muscle , which is responsible for more than 30% of energy consumption , is the major peripheral tissue of glucolipid metabolism under insulin stimulation .
several cytokines and peptides , also called myokines , can be synthesized by skeletal muscle cells in type 2 diabetes and are possibly involved in ir .
previously , tripartite motif family protein 72 ( trim72 ) , also named mg53 , is the one with three conserved domains known as
molecular bandage for muscle cell damage [ 57 ] , while recent studies [ 8 , 9 ] found that trim72 expression is obviously upregulated in pathogenesis of ir and acts as an e3 ligase targeting the insulin receptor and insulin receptor substrate-1 ( irs-1 ) for ubiquitin - dependent degradation , subsequently inhibiting pi3-k / akt signal transduction . during ir pathogenesis ,
abnormally high trim72 expression in skeletal muscles was higher than that in other organs , which was the important originating mechanism leading to systemic metabolic disorders [ 1012 ] ; it suggests that trim72 may be a specific muscle factor in early stage of ir pathological genesis .
moreover , trim72 expression is increased under the condition of oxidative stress induced with high - fat diet .
these findings suggest that regulation of trim72 to akt signal pathway is involved in the ir pathogenesis .
the insulin receptor substrate ( irs ) family of proteins plays a central role in insulin signal transduction .
following activation of the insulin receptor kinase , irs-1 , irs-2 , irs-3 , and irs-4 undergo phosphorylation of multiple tyrosine residues in unique sequence motifs throughout the molecule . as the studies shown mice with targeted disruption of the irs genes
lend some support to both situations . despite the absence of irs-1 and irs-2 , which are the major irs expressed in all tissues
could induce ir , irs-1 and irs-2 produce different phenotypes [ 1318 ] ; this suggests that irs-1 and irs-2 play significant and nonredundant roles in growth and regulation of glucose homeostasis .
studies also demonstrated that irs-3 and irs-4 show a restricted tissue distribution and are not critically involved in regulating growth and glucose homeostasis [ 1921 ] .
although studies showed that trim72 was targeting irs-1 , whether expression of irs-2 , irs-3 , and irs-4 is also involved in the trim72 in ir rats fed with high - fat diet should need further studies . convincing evidences
demonstrate that exercise can improve ir [ 22 , 23 ] partially through pi3-k / akt signal pathway [ 24 , 25 ] .
we therefore established the ir model in sprague - dawley rats fed with high - fat diet to observe the effect of swimming exercise on parameters such as lipid deposition , oxidative stress , and trim72 expression in the skeletal muscles of the ir rats ( see figure 1 ) .
we hypothesized that ir can be effectively improved by exercise through regulating trim72/irs-1/akt pathway and that the decreased trim72 may be mediated by the lower levels of ros which are induced by exercise .
male sprague - dawley rats , aged 5 weeks old with body weight of 130 20 g , provided by the experimental animal center of jiangsu university ( certification number scxk ( su ) 2009 - 0002 ) , were housed under standard conditions ( 22 2c , humidity 50 10% , cycles of 12 h light/12 h dark ) .
experimental procedures were performed in accordance with the guidance suggestions for the care and use of laboratory animals , formulated by the ministry of science and technology of the people 's republic of china in 1998 , and were approved by the animal ethics committee of shanghai normal university .
thirty sprague - dawley rats were randomly divided into 3 groups : standard diet as control ( con ) , high - fat diet ( hfd ) , and hfd plus swimming exercise ( ex - hfd ) .
the control diet contained 65% carbohydrates , 22% protein , and 13% fat and the high - fat diet consisted of 40% carbohydrates , 22% protein , and 38% fat .
the modifications of exercise program were conducted in accordance with the bendford program . in brief , rats in ex - hfd group were trained to swim 1030 min per session for 5 days to reduce water - induced stress .
rats were placed in a plastic pool of 150 60 70 cm with a water temperature at 3032c ; the rats underwent swimming exercise for 45 min twice / day , 6 days / week , for 8 weeks .
twenty hours after the final session of swimming exercise , all rats were anesthetized by single - dose intraperitoneal injection of 10% chloral hydrate ( 50 mg / kg ) .
blood samples were collected from abdominal aorta and serum was separated by centrifugation at 1200x rpm for 10 min .
serum glucose level was measured using an autoanalyzer ( rt-1904c ; rayto , china ) .
the homa - ir was calculated using the following formula : fbg ( mmol / l ) fin ( miu / l)/22.5 , where fbg is fasting blood glucose and fins is fasting insulin concentration . the improved kraegen method was used to measure the glucose infusion rate ( gir ) .
briefly , the rats were injected with 50 mg / kg anesthesia containing 10% chloral hydrate and then fixed in supine position .
a thin silicon tube was inserted into the jugular vein to connect with peristaltic pump for infusion of insulin and peristaltic pump for infusion of 10% glucose through a three - way tube .
insulin at 4 mukgmin and 10% glucose were infused through the bilateral veins ( constant speed ) .
blood sample was collected every 10 min through the venule to measure the blood glucose level , and gir was constantly adjusted until glucose homeostasis was achieved .
six gir values were recorded within 60 min under glucose homeostasis , and the average value was used as the gir under glucose homeostasis . after injecting peritoneal anesthesia with 10% chloral hydrate for 50 mg / kg , the red quadriceps femoris of the bilateral thighs was isolated , placed into liquid nitrogen immediately , and stored at 80c .
subsequently , 0.9% normal saline was added to the skeletal muscle tissue with a ratio of 50 mg : 50 l ( quality fraction : 10% ) to prepare a tissue homogenate by using an ultrasonic crasher ( 40 amp , 5 sec each time , 10 sec for each interval ; operation was repeated five times ) .
supernatant was collected and stored at 20c for further testing the level of skeletal muscle tg and oxidative stress parameters .
the levels of ffa , tg , sod , gsh - px , and mda in skeletal muscle were determined with free fatty acid determination kit ( sigma ) , triglyceride determination kit ( sigma ) , superoxide dismutase determination kit ( sigma ) , and glutathione peroxidase determination kit ( sigma ) , respectively , following the manufacturer 's instructions .
the 8-hydroxyl - deoxyguanosine ( 8-ohdg ) content was measured using enzyme - linked immunosorbent assay ( elisa ) ( r&d , minneapolis , usa ) .
total rna was extracted and purified from the cells using the rna isolator total rna extraction reagent ( takara , kusatsu , japan ) and subjected to reverse transcription using the primescript rt master mix kit ( takara , kusatsu , japan ) . the real - time pcr and data collection
were subsequently performed as described previously using the aceq qpcr sybr green master mix kit ( takara , kusatsu , japan ) on abi 7500 system ( abi , new york , usa ) .
primers used for the amplification were as follows : trim72-f : 5-cgagcaggaccgcacactt-3 , trim72-r : 5-ccaggaacatccgcatctt-3 ; insulin receptor substrate-1 ( irs-1 ) f : 5-gaagaagtggcggcacaagt3 , irs-1 r : 5-gtcaggcagaggcggtagat-3 ; irs-2 f : 5-ataccgcctatgcctgtctg-3 , irs-2 r : 5-agaagaagctgtccgagtgg-3 ; irs-3 f : 5-gcagagcagcaaacatggta-3 , irs-3 r : 5-gcgaagatccaagactcagg-3 ; irs-4 f : 5-ttgctgacagtgccatttgc-3 , irs-4 r : 5-tgcacttcttcctgcctagc-3 ; and glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) f : 5-gc accgtcaaggctgagaac-3 , gapdh r : 5-tggtgaagacgccagtgg a-3. the relative expression levels of the indicated mrna normalized against gapdh mrna were calculated using the 2 methods .
briefly , the samples were placed in protein extraction solution ( lysis in ripa ) and ultrasonicated at maximum speed at 4c for 30 s ( sonics , newtown , usa ) .
after denaturation , the samples were subjected to 10% sds - page and transferred onto polyvinylidene fluoride membranes ( millipore , billerica , usa ) .
the membranes were then blocked with 5% nonfat dried milk and incubated with primary antibodies and followed by incubation with horseradish peroxidase- ( hrp- ) linked secondary antibodies .
the antibodies used in the current study were rabbit polyclonal anti - irs-1 ( 1 : 2000 , cell signaling technology , ma , usa ) , rabbit polyclonal anti - pirs-1 ( ser307 ) ( 1 : 2000 ) , rabbit polyclonal anti - irs-2 ( 1 : 1000 , cst ) , and hrp - linked anti - rabbit igg ( 1 : 2000 ) ; rabbit polyclonal anti - irs-3 ( 1 : 200 , santa cruz biotechnology , ca , usa ) , goat polyclonal anti - irs-4 ( 1 : 200 ) , goat polyclonal anti - trim72 ( 1 : 200 ) , and hrp - linked anti - goat igg ( 1 : 2000 ) ; and mouse monoclonal anti - gapdh ( 1 : 1000 ) and hrp - linked donkey anti - goat igg ( 1 : 3000 ) ( kangchen bio - tech , shanghai , china ) .
immunoreactive protein bands were visualized with the pierce ecl plus western blot substrate ( thermo fisher scientific , rockford , il , usa ) .
gapdh was performed as an internal loading control , and quantification of the band intensity was performed using imagej software ( nih ) and defined as the fold - change of the con after being normalized against gapdh .
firstly , we test the normality of data distribution ; the data with normal distribution were expressed as mean ( m ) standard deviation ( sd ) and the data with skewed distribution were log - transformed .
pearson correlation analysis was performed for the parameters , and one - way anova for significance was employed for intergroup data .
to evaluate insulin sensitivity , euglycemic clamp was firstly performed ; the results showed that the gir of group hfd considerably decreased ( p < 0.01 ) compared with that in group con , while the gir in rats of group ex - hfd significantly increased ( p < 0.01 ) compared with that in group hfd ( figure 2(a ) ) .
furthermore , to assess ir , we next detected fasting blood glucose ( fbg ) and fasting blood insulin ( fin ) to calculate homa - ir index .
as shown in figures 2(b ) , 2(c ) , and 2(d ) , there were no significant differences of fbg among group con , group hfd , and group ex - hfd ( p > 0.05 , figure 2(b ) ) ; the level of the fin in group hfd was significantly higher than that in group con ( p < 0.01 ) ; the fin in the ex - hfd group was significantly lower than that in hfd group ( p < 0.01 , figure 2(c ) ) ; and the homa - ir was markedly increased ( p < 0.01 ) compared with that in group con . however , the homa - ir was greatly decreased ( p < 0.01 ) compared with that in group hfd ( figure 2(d ) ) .
these results proved that the animal model prepared using high - fat diet is suitable for the current study , and an 8-week swimming exercise can improve ir in rats induced by high - fat diet . to observe the lipid accumulation in skeletal muscles after a long - time high - fat diet in rats , we measured the levels of ffa and tg .
as shown in table 1 , the ffa and tg of the skeletal muscle in group hfd were significantly higher than those in group con ( p < 0.01 , resp . ) .
the ffa and tg of the skeletal muscle in group ex - hfd were significantly lower than those in group hfd ( p < 0.05 ) .
moreover , to confirm the oxidative stress in skeletal muscles after a long - time high - fat diet in rats , we also detected the levels of sod , gsh - px , mda , and 8-ohdg in rat skeletal muscles .
for the test , the levels of sod and gsh - px in group hfd were significantly decreased ( p < 0.05 , resp . ) than those in group con , while mda and 8-ohdg contents of the skeletal muscles in group hfd obviously increased ( p < 0.05 and p < 0.01 , resp . ) . after 8 weeks of exercise , the sod and gsh - px activities in group ex - hfd significantly increased compared with those in group hfd ( p < 0.05 and p < 0.01 , resp . ) .
however , the mda and 8-ohdg contents in group ex - hfd significantly decreased ( p < 0.05 and p < 0.01 , resp . ) .
these findings indicate that 8-week swimming exercise can reduce the lipid accumulation and the level of oxidative stress in skeletal muscles of rats after being fed with high - fat diet .
since high - fat diet could induce oxidative stress , we further verified the effects of exercise on trim72 and irs gene expression in skeletal muscle induced by oxidative stress after high - fat diet , and qpcr was performed .
as shown in figure 3 , the mrna expression of trim72 and irs-3 in group hfd was significantly higher than those in group con ( p <
0.01 and p < 0.01 , resp . ) ; mrna expression of irs-1 and irs-2 in group hfd was significantly lower than that in group con ( p < 0.01 , resp . ) . compared with group hfd ,
the mrna expression of trim72 and irs-3 in group ex - hfd significantly decreased ( p < 0.01 and p < 0.05 , resp . ) ; the mrna expression of irs-1 and irs-2 in group ex - hfd was significantly increased than those in group hfd ( p < 0.01 ) .
no significant differences of mrna expression of irs-4 were shown among the group con , group hfd , and group ex - hfd .
these findings demonstrate that exercise can decrease the mrna expression of trim72 and irs-3 and increase the mrna expression of irs-1 and irs-2 of skeletal muscles in rats fed with high - fat diet .
trim72 , pirs-1 , irs-1 , irs-2 , irs-3 , irs-4 , pakt , and akt protein expression levels were detected by western blot method in skeletal muscle . to prove the effects of exercise on protein expression of trim72 , irs , and akt in skeletal muscle induced by long - term high - fat diet , we performed western blot .
as shown in figure 4 , the trim72 protein expression in group hfd was significantly higher than that in group con ( p < 0.01 ) ; the trim72 protein expression in group ex - hfd significantly decreased compared with that in group hfd ( p < 0.01 ) . furthermore , compared with group con , the phosphorylation level of irs-1 was significantly increased ( p < 0.01 ) ; the expression level of irs-1 and irs-2 protein was significantly decreased in group hfd ( p < 0.01 ) .
after swimming exercise for 8 weeks , compared with group hfd , the phosphorylation level of irs-1 significantly decreased ( p < 0.01 ) ; the expression level of irs-1 and irs-2 protein significantly increased ( p < 0.01 ) in group ex - hfd while the expression of irs-3 and irs-4 showed no significance among group con , group hfd , and group ex - hfd . in addition , the proteins of pakt and akt in group hfd were significantly lower than those in group con ( p < 0.01 and p < 0.05 , resp . ) , but significantly increased in group ex - hfd than those in group hfd ( p < 0.01 and p < 0.05 , resp . ) .
these findings suggest that swimming exercise could decrease the protein expression of trim72 , upregulate the protein expression of irs-1 and irs-2 , and phosphorylation level of akt ( ser473 ) of skeletal muscles in rats fed with high - fat diet .
in present study , we tested the levels of oxidative stress parameters and performed qpcr and western blot to detect the mrna and protein of trim72 , irs ( irs-1 , irs-2 , irs-3 , and irs-4 ) , and akt and protein of phosphorylation of irs-1 ( ser307 ) and akt ( ser473 ) . the results showed that the elevation of oxidative stress , trim72 , and pirs-1 expression and the reduction of protein expression of irs-1 and pakt of skeletal muscle in rats fed with high - fat diet , while the swimming exercise was effective in reversing ir induced by high - fat diet .
our findings indicate that an 8-week of swimming exercise not only effectively reduced the oxidative stress of skeletal muscle , but also alleviated the expression of trim72 , upregulated the akt signaling pathway , and reversed ir .
it has been widely accepted that lipid accumulation and oxidative stress are strongly correlated with the ir in peripheral tissues ( muscle and liver ) [ 3137 ] .
long - term excessive intake of high calories could lead to excessive fat accumulation in fat cells , consequently resulting in fats flowing to other tissues except fat tissues .
studies [ 4 , 38 ] have shown that excessive tg accumulation in nonfat tissue has been known to have a toxic effect on cells and to reduce sensitivity to insulin , eventually leading to diabetes and metabolic syndrome [ 31 , 39 ] .
we fed the rats with high - fat diet , and we noticed that high - fat diet induced the increase in visceral fat content along with fat decomposition , which could lead to massive ffa and tg in the skeletal muscle .
the present study also demonstrated that gir greatly decrease in rats fed with high - fat diet , and the isi significantly increased simultaneously , while homa - ir was obviously decreased , suggesting that the 8-week high - fat diet led to a presence of ir in rats .
however , the gir and isi were significantly increased in rats from the exercise group that were also fed with high - fat diet , whereas homa - ir considerably decreased , implying that ir genesis and progress in rats fed with high - fat diet can be effectively relieved by swimming exercise .
changes in in vivo metabolism ( such as massive lipid accumulation and increased ros ) [ 10 , 40 ] eventually lead to cell damage .
trim72 , as a specific cell repair factor of skeletal muscle , is rapidly and massively transposed toward the damaged sites .
when experiencing a long - term high - fat diet , the oxidative stress could occur , which consequently results in oxidative damage in skeletal muscle cells .
previous studies have demonstrated that sod , mda , gsh - px , and 8-ohdg can evaluate the oxidative stress [ 4145 ] .
several studies have shown that systemic ir can be effectively improved by exercise through reduction of oxidative stress [ 46 , 47 ] . in the present study ,
we tested sod , mda , gsh - px , 8-ohdg , and trim72 levels in the skeletal muscles of rats in all the groups ; the oxidative stress was found increased after long - term feeding with high - fat diet , and , in hfd group , the trim72 showed a significant - level promotion on both mrna and protein expression ; this is in accordance with song et al .
2013 ) , although some publications from different groups showed that hfd treatment does not alter expression of trim72 [ 4853 ]
. we analyzed and inferred the possible reasons : firstly , the differences of the high - fat diet composition : the multiple researchers use the high - fat diet with 45% or more calories from fat or extra cholesterol added . in our study ,
meanwhile , multiple researchers performed feeding mice with high - fat diet for a long time ( 8 weeks , 16 weeks , or more weeks ) ; secondly , song et al . showed that trim72 expression increased at the early stage of ir , in other words , trim72 expression increased when mild ir existed . while the multiple studies fed mice with high - fat diet ( 45% , 60.9% , or more calories from fat ) for long , the data showed the seriously impaired insulin action ; it indicated severe ir progression in mice .
however , we fed rats with high - fat diet ( 38% calories from fat ) for 8 weeks , the ir was milder than those mice fed with high - fat diet ( 45% , 60.9% , or more calories from fat ) ; it might be the early stage of ir .
therefore , we observed that trim72 expression markedly increased in group hfd , in keeping with song et al .
in addition , we found that , in hfd group , the mrna and protein expression of irs-1 and irs-2 were both notably elevated ; the mrna expression of irs-3 was greatly increased , while its protein expression showed no significance ; the mrna and protein expression of irs-4 have not obviously changed .
however , these levels can be effectively reduced by an 8-week swimming exercise . in the present study
, we also detected the expression of irs ( irs-1 , irs-2 , irs-3 , and irs-4 ) .
meanwhile , the akt signal was determined . in the group hfd , pirs-1 , irs-1 , irs-2 , and pakt
expressions were at a lower level . while 8 weeks of swimming exercise later , these levels of protein were all increased
therefore , we infer that 8-week high - fat diet can result in high expression of trim72 mrna and protein , and trim72 acts as an e3 ligase targeting the insulin receptor and irs-1 for ubiquitin - dependent degradation , then inhibiting pi3-k / akt signal transduction and subsequently producing ir . in the study , we found that the level of irs-2 increasing is not relevant to the pathway that we studied , which may be through other ways .
previous studies have shown that systemic ir can be effectively improved by exercise through reduction of oxidative stress . in the present experiment ,
relevant parameters such as expression of trim72 , irs , and akt in skeletal muscles of rats in ex - hfd groups showed that oxidative stress reduced after long - term exercise with high - fat diet .
subsequently , the expression of trim72 mrna and protein levels was decreased , and insulin signal transduction was enhanced through swimming exercise .
these results suggest that an 8-week swimming exercise improves hfd - induced insulin resistance , maybe through a reduction of trim72 in skeletal muscle and enhancement of akt signal transduction .
ir induced by high - fat diet can be effectively improved during an 8-week swimming exercise . the possible mechanism in rats fed with
high - fat diet during exercise implied that the degree of damage in the skeletal muscle cells can be relieved by the decrease in lipid deposition and inhibition of oxidative stress in skeletal muscles .
consequently , this finding indicates reduced trim72 expression level and increased irs-1 protein expression level can enhance skeletal muscular pi3-k / akt signal transduction in rat skeletal muscles , then finally improving ir . | we aimed to investigate whether swimming exercise could improve insulin resistance ( ir ) by regulating tripartite motif family protein 72 ( trim72 ) expression and akt signal pathway in rats fed with high - fat diet .
five - week - old rats were classified into 3 groups : standard diet as control ( con ) , high - fat diet ( hfd ) , and hfd plus swimming exercise ( ex - hfd ) .
after 8 weeks , glucose infusion rate ( gir ) , markers of oxidative stress , mrna and protein expression of trim72 , protein of irs , p - aktser473 , and akt were determined in quadriceps muscles .
compared with hfd , the gir , muscle sod , and gsh - px were significantly increased ( p < 0.05 , resp . ) , whereas muscle mda and 8-ohdg levels were significantly decreased ( p < 0.05 and p < 0.01 ) in ex - hfd .
expression levels of trim72 mrna and protein in muscles were significantly reduced ( p < 0.05 and p < 0.01 ) , whereas protein expression levels of irs-1 , p - aktser473 , and akt were significantly increased in ex - hfd compared with hfd ( p < 0.01 , p < 0.01 , and p < 0.05 ) .
these results suggest that an 8-week swimming exercise improves hfd - induced insulin resistance maybe through a reduction of trim72 in skeletal muscle and enhancement of akt signal transduction . |
sheehan 's syndrome ( ss ) is one of the commonest causes of hypopituitarism in underdeveloped and developing countries .
it occurs as a result of ischemic pituitary necrosis due to severe postpartum hemorrhage.[13 ] although a small percentage of patients with ss may present as abrupt onset acute hypopituitarism immediately after delivery , most patients have a mild disease and go undiagnosed and untreated for years together.[46 ] the spectrum of clinical presentation of ss is extremely varied and ranges from non - specific complaints such as weakness , fatigue , and anemia to severe pituitary insufficiency resulting in coma and death . as in other types of hypopituitarism ,
other associations include anemia , pancytopenia , and cardiac abnormalities like cardiomyopathy.[810 ] ss presenting as acute kidney injury ( aki ) is rare .
only few cases have been reported in the literature and most are precipitated by rhabdomyolysis.[1113 ] we report a case of aki in a middle- aged female with ss who recovered dramatically after being started on intravenous steroids and volume replacement .
our case suggests that besides hypothyroid myopathy leading to rhabdomyolysis and consequently compromised renal function and aki , chronic adrenal insufficiency can also predispose to the risk of aki .
a 56-year - old woman was referred to our hospital with a 45 day history of nausea , two episodes of vomiting , and few episodes of loose motions , followed by oliguria at home .
she denied any history of fever , dysentery , abdominal pain , trauma , muscle pain , or change in color of urine .
she also denied history of any drug intake . on enquiring , the patient gave history of longstanding ill health in the form of generalized weakness , easy fatigability , cold intolerance , constipation , hair loss , and weight gain starting after her last child birth some 22 years back .
last delivery was a full - term normal delivery conducted by a local midwife at her home .
she denied any history of profuse bleeding or blood transfusion during her last peripartum period .
however , she had lactation failure and had menstrual cycles for a few months before complete cessation of menses after her last delivery .
physical examination revealed an ill - looking , dehydrated patient with pulse of 54 beats/ minute , blood pressure of 90/60 mm hg without any postural drop , respiratory rate of 18/ minute , and oral temperature of 97.6f ( 36.4c ) .
the patient had mild pallor , dry tongue , coarse and dry skin with non - pitting edema of the lower extremities .
hypopigmented area was seen around right nasal orifice and there was loss of lateral eyebrows .
central nervous system examination revealed slow mentation in the form of delayed response to verbal commands .
examination of motor system did not reveal any focal neurodeficit , but deep tendon jerks were markedly delayed .
kidney function test was deranged with initial urea of 71 mg / dl ( normal value 2040 mg / dl ) and serum creatinine of 4.5 mg / dl ( normal value 0.51.5 mg / dl ) .
muscle enzymes were slightly elevated with creatine phosphokinase ( cpk ) being 168 1u / l ( normal value 1070
arterial blood gas and electrolyte analysis revealed ph of 7.31 , pco2 of 27 mm hg , bicarbonate of 13 mmol / l , serum sodium 130 mmol / l , and potassium of 3.6 mmol / l .
chest x - ray was normal and 12-lead ecg revealed sinus bradycardia with low - voltage qrs complex .
routine urine examination revealed pus cells 45 , rbcs 23 , absent albumin and casts .
renal ultrasound revealed relatively small - sized kidneys ( right 8.5 3.2 cm , left 8.7 3.4 cm ) with increased echogenicity , with maintained corticomedullary differentiation bilaterally .
the diagnosis of panhypopituitarism most likely secondary to ss associated with acute renal failure was made on the basis of her past medical history of failure to lactate post her last child birth with gradual cessation of menses , peripheral signs and symptoms of hypothyroidism , and abnormal biochemical and hormone profile .
basal anterior pituitary hormones and serial kidney function tests during admission the patient was given intravenous fluids in the form of dextrose normal saline with close monitoring of urine output , replacement therapy in the form of intravenous hydrocortisone 50 mg intravenously 6 hourly , and levothyroxine given orally at a starting dose of 50 mcg/ day .
on repeating renal function tests and other biochemical tests , there was dramatic improvement in serial renal function parameters .
with improvement in the general condition of the patient , intravenous antibiotics were stopped in view of absence of fever and negative septic screen .
she was shifted to oral prednisolone 5 mg twice daily , while levothyroxine was continued at a dose of 50 mcg / day .
she was discharged on the same medication on 10th day of admission and was advised to taper prednisolone to 5 mg/ day after 2 weeks .
four weeks after discharge , the patient had general sense of well - being with better appetite and renal function had normalized with creatinine 0.64 mg/ dl and serum urea 23 mg / dl .
the patient was subjected to magnetic resonance imaging ( mri ) brain with sellar and parasellar focus which revealed empty sella with normal rest of the brain parenchyma [ figure 1 ] .
mri pituitary sagittal view showing pituitary fossa filled with cerebrospinal fluid and stalk touching the base of pituitary floor ; features suggestive of empty sella
the present report describes a 56-year - old woman with ss who presented with acute renal insufficiency owing to depletion of intravascular volume secondary to gastroenteritis .
the chronic hypocortisol state has increased the predisposition to renal injury which was precipitated by mild acute gastroenteritis .
ss , first described by hl sheehan in 1937 , classically refers to postpartum hypopituitarism due to pituitary necrosis occurring during severe hypotension or shock secondary to massive bleeding at or just after delivery .
the frequency of ss has gradually decreased especially in developed countries , as a result of improved obstetric care including treatment of hemodynamic complications with rapid blood transfusion and/or intravenous fluid replacement .
it , however , continues to be the most common cause of hypopituitarism in underdeveloped and developing countries .
enlarged pituitary volume , small sellar size , prothrombotic nature of pregnancy , and autoimmunity have been suggested to play a role in the pathogenesis of ss in women who suffer from severe postpartum hemorrhage . on the other hand ,
the spectrum of clinical presentation of ss is quite variable and ranges from non - specific symptoms such as weakness , fatigue , and anemia to severe pituitary insufficiency resulting in coma and death .
clinical manifestations of ss may change from one patient to another , as hormonal deficiency varies from loss of one trophic hormone to classical panhypopituitarism.[157 ] failure of postpartum lactation is the most consistent feature of patients with ss and failure of regaining menstrual flow postpartum is the most common symptom of ss . despite the failure to menstruate ,
gonadotrophin reserve may still be preserved in some patients and these patients can even conceive spontaneously .
another important clinical presentation in ss is related to secondary hypothyroidism and patients may present with weight gain , cold intolerance , tiredness , aches and pains , and muscle disorders ranging from elevation of muscle enzymes to frank rhabdomyolysis and renal failure.[1113 ] our patient also had severe central hypothyroidism as was evident from history , examination , and hormone tests .
adrenal insufficiency in ss can be catastrophic and can range from non - specific complaints to hypotension , sallow skin , and severe adrenal crisis , particularly under stressful conditions such as infection .
only few cases have been reported in which aki was caused by rhabdomyolysis.[1113 ] aki has been defined as rapid decline in kidney function , as measured by rising serum creatinine or decline in urine output ( oligo / anuria )
. introduced by acute kidney injury network , specific criteria exist for diagnosing aki . our case presented with rapid deterioration of renal function in the form of oliguria together with rise in serum creatinine , thus meeting the criteria for aki .
although , as stated earlier , aki can occur in ss , hypothyroid myopathy is the most common etiological factor.[1113 ] hypothyroid myopathy is usually manifested by delayed relaxation of tendon reflexes , muscle stiffness , proximal muscle weakness , myalgia , muscle cramps , and occasional elevated muscle enzymes , however , rhabdomyolysis is rare .
rhabdomyolysis can occur spontaneously or is precipitated by hypoxemia , hypotension , sepsis , or vigorous exercise .
the exact cause of rhabdomyolysis in hypothyroidism is unclear , but both impaired glycogenolysis and oxidative mitochondrial metabolism have been implicated.[1113 ] although our patient had subtle features of hypothyroid myopathy as revealed by history , examination , and lab evaluation , there was no evidence of rhabdomyolysis .
the most probable cause of aki in our patient was chronic hypocortisolemia as renal function in our patient rapidly improved after initiation of intravenous hydrocortisone ; an association between adrenal insufficiency and disturbed renal function has been demonstrated repeatedly .
a study was done by christine waterhouse and henry keutmenn in 1947 , in which kidney function of 13 patients with adrenal insufficiency was studied .
it was concluded that there is reduction in effective vascular bed in the kidney , resulting in decreased renal plasma flow with concomitant decrease in the rate of glomerular filtration . besides
, it has been found that cortisol has major effects on hemodynamics and absence of cortisol causes decrease in cardiac index with an inadequate response of systemic vascular resistance to maintain the mean arterial pressure . in summary , a middle - aged woman with ss presented with aki which reversed completely with conservative management including glucocorticoids . | sheehan 's syndrome occurs as a result of ischemic pituitary necrosis secondary to severe postpartum bleeding .
it is one of the most common causes of hypopituitarism , characterized by variable clinical presentation .
acute kidney injury occurs rarely in sheehan 's syndrome and most of the cases have been found to be precipitated by rhabdomyolysis .
we here present a case of sheehan 's syndrome with acute kidney injury where theprecipitating cause was chronic hypocortisolemia .
we believe this is the first reported case of sheehan 's syndrome in which acute kidney injury was precipitated by adrenal insufficiency . |
rheumatoid arthritis ( ra ) is a chronic disease characterized by synovitis and autoantibody such as rheumatoid factor ( rf ) and anti - cyclic citrullinated peptide antibody ( anti - ccp ) [ 1 , 2 ] . besides the destruction of cartilage and bone , ra also leads to system damage including cardiovascular , pulmonary , and psychological systems [ 3 , 4 ] .
blockage of proinflammatory cytokines activity involved in the chronic inflammation of ra , such as tumor necrosis factor - alpha ( tnf- ) and interleukin-6 ( il-6 ) , was applied in clinical therapy .
il-6 is a pleiotropic proinflammatory cytokine produced by synovial cells and endothelial cells [ 6 , 7 ] .
il-6 favors t - cell activation , b - cell proliferation , and immunoglobulin secretion .
moreover , il-6 participates in the synthesis of acute phase proteins in the liver and proliferation and differentiation of hematopoietic precursor cells .
previous studies have defined the relationship between inflammatory factors and insulin resistance [ 1012 ] . increased levels of serum inflammatory marker
in addition , il-6 treatment induces beta - cell apoptosis via stat-3-mediated nitric oxide production [ 1315 ] .
recent reports have shown that the prevalence of diabetes mellitus ( dm ) in patients with ra is about 15%19% , which is significantly higher than that of the global dm [ 16 , 17 ] .
the fasting plasma glucose ( fbg ) in ra patients with type 2 diabetes mellitus ( t2 dm ) is higher than that of t2 dm patients , suggesting that the islet -cell damage in ra patients complicated with t2 dm is more serious , and these may be related to their long - term systemic inflammatory status [ 18 , 19 ] .
however , the mechanism of ra with -cell damage is still uncertain . in this study , the model of cia
was established to observe the expressions of fbg , fins , il-6 , and islet caspase-3 .
furthermore , in line with increased il-6 expression , the apoptosis related enzyme caspase-3 was also markedly increased .
these data showed that the possible mechanism of ra complicated with abnormal glucose metabolism might result from the -cell apoptosis induced by il-6 .
female wistar rats , weighing 150180 g , were purchased from kaifu district , changsha city , east laboratory animal service department , and were bred in a specific pathogen - free ( spf ) environment .
all rats were maintained ( 2024c and 5560% humidity ) under a standard 12-hour light / dark cycle .
il-6 elisa kits were purchased from raybiotech company ( norcross , usa ) ; insulin elisa kits were purchased from wuhan elabscience biotechnology co. , ltd .
( wuhan , china ) ; bovine type ii collagen ( c7806 ) and complete freund 's adjuvant were purchased from sigma company ( shanghai , china ) ; rabbit anti - rat caspase-3 was provided by abcam company ( cambridge , usa ) .
two - step immunohistochemical kits and diaminobenzidine ( dab ) color liquid were purchased from beijing zhong shan - golden bridge biological technology co. , ltd .
( beijing , china ) . bovine type ii collagen ( 10 mg ) was dissolved in 5 ml 0.1 mol / l acetic acid solution , maintained at 4c overnight , and set aside . an equal dose of collagen solution and complete freund 's adjuvant was thoroughly mixed and completely emulsified ; then , a cii / ifa emulsion ( 1 mg / ml ) was freshly manufactured .
rats were injected with emulsion at the base of the tail and back within three points ( day 1 ) ; animals were boosted with the dose of 0.2 ml cii - ifa emulsion at day 7 by the same method .
the control group were treated with complete freund 's adjuvant according to the same protocol .
after initial immunization , the rats ' arthritis index ( ai ) was scored as in a previous report .
blood samples were collected from the intraocular adjoined veins of the rats on the 17th day after initial immunization .
the pancreatic tissue was fixed in 4% paraformaldehyde ( ph 7.4 ) for histological analysis . to detect the expression of caspase-3
, the slides were incubated with antibody diluted at 1 : 80 overnight at 4c , followed by dab coloration , and stained with hematoxylin dye and dehydrated ( transparent ) .
image - pro plus 6.0 was used to analyze and carefully delineate the scope of each field in the islets , to measure the mean absorbance of the islets , as an index for expression of islets caspase-3 . the protein extracted from the pancreatic tissue
antibodies against cleaved caspase-3 were obtained from cell signaling technology ( ma , usa ) . after incubating with secondary antibody conjugated horseradish peroxidase , the immunoreactivity was developed by an ecl system ( pierce ) .
paired student 's t - test was used for paired data . a value of p < 0.05 was considered as statistically significant .
in recent studies , there has been increased evidence of the relationship between glucose metabolism dysfunction and human autoimmune disease . to explore the mechanism of this observation in rheumatoid arthritis , rat collagen - induced arthritis model was established . in this study , on day 17 after the primary immunization , the cia rats showed mild edema in one or both sides of the hind limbs .
furthermore , histological analysis showed hyperplasia of the synovial membrane and the infiltration of inflammatory cells in cia rats ( figures 1(a ) and 1(b ) ) .
as expected , a markedly increased level of fbg was observed in cia rats when compared with the control group .
meanwhile , a decreased level of fins was observed in cia rats when compared with the control group ( figure 2 ) .
il-6 is a critical inflammatory cytokine in the pathogenesis of ra , and blockage of its activity by il-6r antibody was applied in clinical treatment .
here , we also observed an increased expression of il-6 in cia rats when compared with control ( figure 3 ) .
next , to determine the role of il-6 in the regulation of glucose metabolism in cia rats , the correlation between il-6 and fbg or fins was analyzed .
the result met our expectations ; a significantly positive correlation was observed between il-6 and fbg ( figure 4(a ) ) .
in addition , a negative correlation was depicted in il-6 and fins ( figure 4(b ) ) .
a critical role of -cell apoptosis has been demonstrated in the development of diabetes . in line with an increased expression of il-6 ( figure 3 ) , the apoptosis related enzyme caspase-3 was also markedly increased in cia rats ( figures 5(a)5(c ) ) .
furthermore , the cleaved caspase-3 was also detected , as expected , and the cia rats showed an increased level when compared with control rats .
previous studies have shown that il-6 treatment induces beta - cell apoptosis via stat-3-mediated nitric oxide production .
accordingly , a positive correlation between caspase-3 and il-6 was observed in our study . taken together
, these results suggest that the abnormal glucose metabolism might be due to the -cell apoptosis induced by inflammatory cytokine il-6 ( figure 5(d ) ) .
recent studies have shown that the prevalence of ra patients with abnormal glucose metabolism was significantly increased [ 11 , 16 ] , and the decreased insulin sensitivity and islet -cell function due to islet -cell excessive apoptosis in these patients and the mechanism might be related to overexpressed proinflammatory cytokines . in this experiment ,
the expression of il-6 in group cia was significantly higher than that of control group , and the abnormal glucose metabolism was accompanied by the increased il-6 expression .
furthermore , in line with increased il-6 expression , the apoptosis related enzyme caspase-3 was also markedly increased .
these data showed that the abnormal glucose metabolism in ra might result from the -cell apoptosis induced by il-6 .
il-6 , an important proinflammatory cytokine , could promote insulin secretion at low concentration of il-6 .
the cytotoxicity of high il-6 concentrations could upregulate the expression of cleaved caspase-3 and phosphorylated p38 mitogen - activated protein kinase and phosphorylated nuclear factor-b , in part via signal transducers and activators of transcription-3-mediated no production .
in addition , il-6 can increase lipolysis in adipocytes as well as the release of free fatty acids , thereby damaging the mitochondria and glucose transporter 2 ( glut2 ) function and insulin sensitivity . here , in our study , we also observed elevated il-6 expression in cia , which positively correlated with glucose .
furthermore , il-6 can also induce the production of il-1 , il-2 , and tnf- and enhance the biological effects when combined with these cytokines .
the previous studies have also found that tnf- produced by adipose tissue can induce insulin resistance ( ir ) ; these data showed the relationship between inflammatory factors and insulin resistance .
not only were il-6 levels in cia rats significantly increased , but also other proinflammatory cytokines like tnf- and ifn- were overexpressed .
il-6 can also be combined with tnf- , il-1 , and induced classical caspase - dependent apoptosis pathway , thereby increasing the apoptosis of -cells and causing a reduction of insulin secretion .
these might be the reason for the high prevalence of diabetes mellitus ( dm ) in patients with ra when compared with healthy controls .
insulin is one of the most important hormones in an organism that regulates blood sugar levels , which is secreted by pancreatic -cells ; insulin deficiency can lead to elevated blood glucose levels .
as expected , we observed that fasting serum insulin levels were significantly decreased in cia .
when the cells are stimulated by the proapoptotic factors , caspase-3 can be activated and then induce their apoptosis [ 24 , 25 ] .
in addition , il-6 was positively correlated with caspase-3 production which leads -cell to apoptosis in our study .
the elevated levels of il-6 inhibiting the insulin secretion of islet -cells might be through promoting -cells apoptosis .
this study suggests the significantly increased fbg and decreased fins in cia rats , which might be a result from autoimmune inflammatory mediators such as il-6 .
il-6 induced abnormal glucose metabolism might be through upregulating caspase-3 expression , because of the positive correlation between il-6 and apoptosis related enzyme caspase-3 . taken together , these data showed that the elevated fbg and reduced fins level in cia may be induced by the inflammatory cytokines generated by arthritis , which is significantly different from the traditional t2 dm .
the treatment of the primary disease in ra combined with dm can improve glucose metabolism . | the aim of this study was to explore the possible mechanism of rheumatoid arthritis- ( ra- ) related abnormal glucose metabolism .
the model of collagen - induced arthritis ( cia ) was established by intradermal injection of type ii collagen into wistar rats ; complete freund 's adjuvant injections were used as the control group . fasting plasma glucose ( fbg )
was measured by the glucose oxidase method .
fasting insulin ( fins ) and the expressions of il-6 were detected by elisa .
islet caspase-3 was examined by immunohistochemistry . on day 17 after immunization , fbg of the cia group showed an elevated fbg value compared with the control group . meanwhile , the fins of group cia was lower when compared with the control group .
interestingly , the inflammatory cytokine il-6 expression was significantly increased when compared with the control group .
as expected , the abnormal glucose metabolism was accompanied by the increased il-6 expression .
furthermore , in line with the upregulated il-6 expression , the apoptosis related enzyme caspase-3 was also markedly increased .
these data showed that the elevated fbg in cia may be associated with the reduced fins level secondary to the overapoptosis of pancreas islet cells induced by il-6 . |
acute pancreatitis is an uncommon side effect of interferon ( ifn ) and ribavirin ( rbv ) combination therapy , and only few such cases have been reported in the english language literature .
it has been described in three cases of hepatitis c virus ( hcv)-infected patients treated with pegylated interferon ( peg - ifn ) plus rbv .
the pathogenesis of acute pancreatitis related to a stimulated immune system , however , has not been described .
we present three cases of acute pancreatitis which may have been caused by the immune system stimulated by tumor necrosis factor alpha ( tnf- ) and interleukin-6 ( il-6 ) associated with peg - ifn plus rbv treatment of chronic hepatitis c ( chc ) , genotype 1b with high serum hcv rna levels .
a 67-year - old woman with chc was admitted to kobe asahi hospital in september 2007 for the treatment of abdominal pain . in june 2007 ,
the patient with 44 kg body weight had been started on a weekly subcutaneous injection of 60 g of peg - ifn -2b plus a daily oral dose of 600 mg rbv .
reverse transcription - polymerase chain reaction ( rt - pcr ) revealed 2,300 kiu / ml of hcv rna and the hepatitis b surface antigen ( hbsag ) and hepatitis b virus dna were negative .
laboratory tests revealed the following : total protein ( tp ) 6.2 g / dl ( normal 6.7 - 8.3 ) , albumin ( alb ) 3.8 g / dl ( normal 3.8 - 5.3 ) , aspartate aminotransferase ( ast ) 40 iu / l ( normal 0 - 38 ) , alanine aminotransferase ( alt ) 29 iu / l ( normal 0 - 19 ) , platelets ( pl ) 13.9 10/l ( normal 14 - 34 ) ; liver biopsy revealed stage 1 fibrosis .
the patient tolerated the therapy well until week 14 , when she presented with severe epigastric pain radiating to her back , nausea , and vomiting .
laboratory tests at that time revealed the following : amylase ( amy ) 178 iu / l ( normal 38 - 136 ) , lipase ( lipa ) 521 iu / l ( normal 23 - 300 ) , ast 29 iu / l , alt 10
iu / l , alkaline phosphatase ( alp ) 226 iu / l ( normal 110 - 354 ) , total billirubin ( t - bil ) 0.5 mg / dl ( normal 0.2 - 1.2 ) , white blood cell ( wbc ) count 50 10/l ( normal 40 - 90 ) , calcium ( ca ) 9.4 mg / dl ( normal 8.7 - 10.1 ) , total cholesterol ( t - cho ) 140 mg / dl ( normal 150 - 219 ) , triglycerides ( tg ) 153 mg / dl ( normal 50 - 149 ) , igg4 20.1 mg / dl ( normal 4.8 - 105 ) .
tnf- and il-6 were 8.8 pg / ml ( normal < 5.0 ) and 3.4 pg / ml ( normal < 4.0 ) , respectively . the patient had no history of pancreatitis , denied alcohol use , and was not taking any medications . imaging studies such as ultrasound ( us ) , computed tomography ( ct ) and magnetic resonance imaging ( mri ) revealed no swelling of the pancreas or dilation of the pancreatic duct .
peg - ifn a-2b and rbv were discontinued at 15 weeks after the start of therapy , and the patient was treated with ulinastatin 150,000 units / day for 4 weeks and camostat mesilate 600 mg / day orally for two weeks under the diagnosis of acute pancreatitis .
a 60-year - old man was admitted to kobe asahi hospital in october 2007 for the treatment of appetite loss and general fatigue . in november 2006 the patient with 58 kg
body weight had been started on a weekly subcutaneous injection of 80 g of peg - ifn a-2b plus a daily oral dose of 600 mg rbv for the treatment of chc .
the rt - pcr revealed 5,100 kiu / ml of hcv rna , and the genotype was 1b ; hbsag was negative .
laboratory tests revealed the following : tp 8.8 g / dl , alb 3.5 g / dl , ast 53 iu / l , alt 36 iu / l , pl 9.9 10/l ; liver biopsy was not done .
the patient tolerated the therapy well and completed the 48-week course of peg - ifn plus rbv in september 2007 . soon thereafter , the patient presented with appetite loss and general fatigue .
laboratory tests at admission revealed the following : amy 316 iu / l , lipa 1,373 iu / l , ast 42 iu / l , alt 10 iu / l , alp 312 iu / l , t - bil 0.5 mg / dl , wbc count 34 10/l , ca 7.7 mg / dl , t - cho 135 mg / dl , tg 107 mg / dl , igg4 5.5 mg / dl . tnf- and il-6 were = 5 and 12.8 pg / ml , respectively .
the patient had no history of pancreatitis , denied alcohol use , and was not taking any medications . us ,
ct and mri revealed no swelling of the pancreas or dilation of the pancreatic duct .
the patient was treated with ulinastatin 150,000 units / day for 3 weeks under the diagnosis of acute pancreatitis .
a 75-year - old woman , admitted to kobe asahi hospital in april 2008 for the treatment of chc , had 44 kg body weight and was started on a weekly subcutaneous injection of 90 g of peg - ifn a-2a plus a daily oral dose of 600 mg rbv .
taqman real - time pcr revealed 6.9 log kiu / ml of hcv rna and the genotype was 1b ; hbsag and hepatitis b virus dna were negative .
laboratory tests revealed the following : tp 7.1 g / dl , alb 3.7 g / dl , ast 78 iu / l , alt 112 iu / l , pl 7.7 10/l ; the liver biopsy revealed stage 3 fibrosis .
the patient tolerated the therapy well until week 3 , after which she complained of severe epigastric pain radiating to her back , nausea , and vomiting .
laboratory tests at that time revealed the following : amy 155 iu / l , lipa 1,153 iu / l , ast 43
iu / l , alt 62 iu / l , alp 213 iu / l , t - bil 0.3 mg / dl , wbc count 98 10/l , ca 8.9 mg / dl , t - cho 120 mg / dl , tg 161 mg / dl , igg4 24.2 mg / dl .
the patient had no history of pancreatitis , denied alcohol use , and was not taking any medications .
imaging studies such as us , ct and mri revealed no swelling of the pancreas or dilation of the pancreatic duct .
peg - ifn a-2a and rbv were discontinued at 3 weeks after the start of therapy , and the patient was treated with ulinastatin 150,000 units / day for 4 weeks and camostat mesilate 600 mg / day for 4 weeks under the diagnosis of acute pancreatitis .
the pancreatitis resolved and the patient was discharged in june 2008 ( table 1 ) .
drug - induced pancreatitis is an uncommon side effect of ifn a , although several such cases have been published .
acute pancreatitis is described in a 9-year - old girl treated for 14 months with ifn a , 3 million units daily , for chronic myelogenous leukemia .
two other incidences of acute pancreatitis are described in adults treated with high doses ( up to 10 million units daily ) of ifn a for chronic myelogenous leukemia : one of the two patients developed recurrent pancreatitis after being rechallenged with a daily dose of 10 million units of ifn a . in the english language literature ,
only one case of acute pancreatitis has been reported in a 38-year - old man with hcv treated with only ifn a. the patient developed acute pancreatitis 2 h after receiving the first 5 million units injection of ifn a-2b .
although his symptoms resolved within 2 days , the patient developed recurrent pancreatitis 5 weeks after being rechallenged with 3 million units of ifn a-2b .
onset of pancreatitis has not been reported among 1,010 patients treated with ifn a-2b plus rbv therapy in a large international multicenter registration trial .
although only few cases of acute pancreatitis have been reported in patients treated with ifn a-2b and rbv combination therapy , the acute pancreatitis has been attributed to rbv , with the antiviral treatment being resumed with ifn alone .
nonetheless , such patients developed acute pancreatitis within hours of being rechallenged with ifn a-2b .
acute pancreatitis has been reported in 3 cases of hcv - infected patients treated with peg - ifn plus rbv therapy ; however , its pathogenesis has not been described . in our cases ,
the drug - induced acute pancreatitis was diagnosed on the basis of the presence of symptoms such as epigastric pain , appetite loss , elevated amylase and lipase levels , and the absence of other identifiable causes of pancreatitis .
the patients showed no evidence of gallstones , alcohol consumption , or other potential causes of pancreatitis such as autoimmune pancreatitis with no elevation of igg4 .
the onset of pancreatitis during peg - ifn a plus rbv therapy and the resolution of the symptoms after discontinuing the treatment confirmed our diagnosis .
moreover , the consequent absence of recurrent pancreatitis also suggested that the medications were the most likely cause of acute pancreatitis .
peg - ifn and rbv combination therapy is a potential cause of drug - induced pancreatitis in patients with chc , and ifn a can cause pancreatitis through several potential mechanisms .
treatment with ifn a can result in severe hypertriglyceridemia , a well - described cause of acute pancreatitis . in our cases , however , severe hypertriglyceridemia was not observed .
alternatively , peg - ifn a may cause acute pancreatitis by stimulating the immune system , leading to autoimmune destruction of the pancreas .
high tnf- and il-6 have been described as inducing and mediating acute pancreatitis , as have immunomodulatory cytokines .
indeed , high tnf- was observed in case 1 and high il-6 in cases 2 and 3 .
ifn a is known to precipitate or exacerbate other autoimmune disorders such as thyroid disease and diabetes .
based on the published literature , ifn a is more likely than rbv to cause acute pancreatitis , although rbv is known to exert immunomodulatory effects ; also , rbv alone or synergistically with ifn a may stimulate the immune system to cause pancreatitis through an autoimmune mechanism . in our cases , however , high tnf- ( case 1 ) and high il-6 ( cases 2 and 3 ) may be markers of immune system stimulation by peg - ifn and rbv or by acute pancreatitis itself . in conclusion ,
peg - ifn a and rbv combination therapy is a potential cause of drug - induced pancreatitis in patients with chc . in such individuals ,
pancreatitis is often severe enough to warrant hospitalization , although symptoms promptly resolve after discontinuation of antiviral therapy .
patients should be closely monitored during treatment and the medications should be discontinued when signs or symptoms of acute pancreatitis appear .
further studies are warranted to determine which of these two medications is associated with drug - induced pancreatitis , to investigate the mechanisms of pancreatic injury , and to evaluate the incidence of acute pancreatitis in hcv - infected patients treated with peg - ifn and rbv . | acute pancreatitis , an uncommon side effect of pegylated interferon ( peg - ifn ) and ribavirin ( rbv ) combination therapy , has rarely been reported in the english language literature . here , acute pancreatitis associated with peg - ifn plus rbv treatment is described in three patients with chronic hepatitis c , genotype 1b with high serum hepatitis c virus rna levels .
the patients had been started on weekly subcutaneous injections of peg - ifn ( 60 , 80 , and 90 g ) plus a daily oral dose of rbv ( 600 mg ) .
the therapy was discontinued , however , because of the onset of acute pancreatitis ( after 15 weeks , 48 weeks , and 3 weeks respectively ) .
the drug - induced pancreatitis was diagnosed on the basis of elevated levels of amylase and lipase and the absence of other identifiable causes .
high tumor necrosis factor- was found in one patient and high interleukin-6 in the other two .
the immune system stimulated by peg - ifn and rbv combination therapy might have caused the acute pancreatitis .
further study is needed to clarify the mechanism of the onset of drug - induced pancreatitis by peg - ifn and rbv combination therapy . |
a passive surveillance system of encephalitis in equine and avian species was set up to detect any occurrence of clinical signs of wnv infection .
at the same time , a serologic investigation for wnv was conducted in guadeloupe archipelago .
a cross - sectional study was performed on the most susceptible animal species ( birds and horses ) .
maarten island ( 635-185 ) on domestic ducks ( family : anatidae , anas species ) , domestic geese ( family : anatidae , anser sp . ) , and on laughing gulls ( larus atricilla ) , a resident wild species .
the french part of the island belongs to guadeloupe s archipelago and is located 270 km north of the main island .
it is a major resting place for migratory birds , which spend some days or weeks on the ponds before migrating south in the fall ( or north in the spring ) .
therefore , st . martin was chosen to increase the probability of detecting the earliest serologic conversions on resident birds and to prove the circulation of wnv among resident birds and domestic avian species .
a total of 50 ducks and geese from four backyards as well as ducks from the st .
three gulls were caught and released after blood collection . on guadeloupe island ( 6130-1615 ) , blood samples were drawn from 20 chickens from two different farms neighboring a horse - riding center in december 2002 . the survey on horses was planned to be as exhaustive as possible in guadeloupe and the nearby island of marie galante ( 6115-1555 ) .
serum samples from 360 of 400 horses thought to live in guadeloupe were collected in july 2002 ( figure ) . in locations where positive horses were detected during the first survey ,
another sampling was drawn from horses from december 2002 to january 2003 to measure the rate of serologic conversion and the incidence of the infection .
insert : locations of horse and chicken sampling places in guadeloupe and marie galante islands .
red triangle , farm with seropositive chicken ; blue circle , equine center with seropositive horses identified from july 2002 ; gold circle , equine center with seropositive horses identified from december 2002 to january 2003 ; black circle , equine center with no seropositive horses .
enzyme - linked immunosorbent assays ( elisa ) were performed to detect specific immunoglobulin ( ig ) g antibodies to wnv in horses , ducks , geese , and chickens .
additional immunocapture igm elisa was performed on horses positive for wnv by igg elisa ( 8) .
most positive serum samples were tested by plaque reduction neutralization test ( prnt 80 ) for both wnv and st .
all the birds ( 36 ducks , 14 geese , and 3 gulls ) sampled from five farms and one pond in st .
maarten at the end of july 2002 tested negative for wnv by igg elisa ( the elisa test for the gulls has not been validated ) . in july 2002 ,
10 of 360 horses tested positive for wnv by igg elisa , and 2 of them were also positive by igm elisa .
seropositive horses were located in four different places , two in guadeloupe and two in marie galante .
the results of the survey undertaken in december 2002 to january 2003 in equine centers where positive animals were detected in july 2002 indicated a high rate of wnv seroconversion in horses in these locations ( table 1 ) . in july 2002 ,
the overall wnv prevalence rate ( igg elisa ) was 2.8% , reaching 10.4% in places where infected horses were found ( locations a , b , c , d ) . in january 2003 , in these and related places ( where some horses were moved from the former areas in july 2002 ) , the prevalence rate increased to 50% .
on paired samples , 54 of 114 horses that tested negative in july 2002 were positive in january 2003 .
the incidence rate calculated for the places where outbreaks were noticed ( a to i ) is 7.9% per month . in december 2002 and january 2003
chickens were collected from two backyards ( 10 chickens in each place ) neighboring one horse - riding club where positive animals were detected .
eleven of these chickens tested positive by igg elisa in december 2002 . to confirm the specificity of the results ,
positive horses samples were tested by prnt against wnv and slev ; all the animals showed a higher titer for wnv than for slev ( table 2 ) .
the serologic survey conducted on horses indicated an active focus of wnv infection in guadeloupe , probably linked to the first infestation of the archipelago by the virus .
the absence of igm antibodies in horses at the end of 2002 indicates that the seroconversions did not occur during the last weeks of the year but earlier .
these results ( i.e. , the presence of igm antibodies in 2 of 10 positive animals in july 2002 ) suggest that the first wmv infections in horses probably occurred during the first 6 months of 2002 and spread in the equine population in the middle of the year . when birds migrate , they cross the lesser antilles ( 6 )
. a migratory bird , infected before leaving north america or the caribbean islands , may develop viremia when reaching st .
martin , marie galante , or guadeloupe islands and transmit the virus to mosquito vectors during the resting period .
migratory birds from the north usually arrive in guadeloupe later than july ; thus , the infection observed in horses in july 2002 was probably not derived from migrating birds that year .
after one or more introductions , the virus may have gradually spread in the local vector populations and amplified in resident birds even over the winter , when vectors are still active in the caribbean .
then , 6 months later , the virus spread to susceptible species ( horses ) , in which it was first detected . in guadeloupe
, both animal and human surveillance systems have been set up and are interacting to detect virus circulation . in that respect ,
the surveillance of susceptible animal species can provide important indicators for the possible appearance of the disease in humans . as shown in the united states ,
the death of wild birds is a pertinent indicator for human risk ( 9 ) . in avian species , mortality and sentinel surveillance
this could be related to the absence in guadeloupe of species known to be extremely susceptible to the infection ( corvidae ) , vector competence , or the virus strain .
a random survey is being implemented on domestic birds to assess the geographic distribution of the infection , in june through july 2003 ( beginning of the rainy season ) , when populations of vectors increase markedly in guadeloupe .
a new serologic prevalence survey in horses is also in process , and clinical surveillance is ongoing . despite a high rate of wnv - seropositive animals , no clinical disease has been observed .
this situation could be related to the virus titer , the rate of infected vectors ( which could be too low during the first year after wnv is introduced ) , or the virus strain . in 2003 , mosquito surveillance was implemented in places where deaths in birds or encephalitis cases in horses were observed .
virus detection using reverse transcription polymerase chain reaction will be used in our laboratory to test dead birds and pools of mosquitoes .
these surveys are intended to provide the public health services with distribution and prevalence maps . | to determine whether west nile virus ( wnv ) had reached the archipelago of guadeloupe , a serologic study in horses and birds was conducted in 2002 .
immunoglobulin ( ig ) g , igm , enzyme - linked immunosorbent assay , and seroneutralization tests identified wnv infection in horses and chickens .
six months later , a high rate of seroconversion was observed in horses . |
arterial stiffness is an important risk factor for cardiovascular morbidity and mortality and can be assessed using several methods including pulse pressure ( pp ) , the augmentation index ( ai ) , and pulse wave velocity ( pwv ) .
these parameters are readily determined on an outpatient basis and are well correlated with the risk of cardiovascular events [ 13 ] . the cardioankle vascular index ( cavi )
is a novel marker of arterial stiffness that is calculated from the pwv and adjusted according to the bp values .
in addition , cavi has been shown to be a biomarker for the evaluation of the severity of arterial fibrosis with higher sensitivity and specificity than pwv .
both experimental data and clinical evidence suggest that the renin - angiotensin system ( ras ) contributes to the pathogenesis of a number of cardiovascular diseases .
angiotensin ii type 1 receptor blockers ( arbs ) are currently some of the most wildly used antihypertensive drugs .
we have demonstrated that losartan , candesartan , and telmisartan improve arterial stiffness as assessed by cavi [ 68 ] .
olmesartan ( olm ) significantly decreases cavi in patients with hypertension and diabetes [ 9 , 10 ] , but whether it is more effective alone than together with azelnidipine ( azl ) treatment remains uncertain .
the aim of this study was to evaluate the protective effects of olm and add - on azl on arterial stiffness in patients with essential hypertension .
arterial stiffness was assessed by measuring cavi , the augmentation index ( ai ) , and the maximum of the carotid intima - media thickness ( max - imt ) .
the subjects of the present study were 52 consecutive hypertensive patients with arterial stiffness and untreated hypertension or uncontrollable hypertension treated with medications other than ras inhibitors . in patients without comorbid illness ,
hypertension was defined as a clinic systolic bp of > 140 mmhg at any time and/or a clinic diastolic bp of > 90 mmhg at any time and/or a systolic bp of > 130 mmhg in the morning and/or a diastolic bp of > 85 mmhg in the morning . in patients with diabetes mellitus and chronic kidney disease ,
hypertension was defined as a clinic systolic bp of > 130 mmhg at any time and/or a clinic diastolic bp of > 80 mmhg at any time . in patients with metabolic syndrome ,
hypertension was defined as a clinic systolic bp of > 130 mmhg at any time and/or a clinic diastolic bp of > 85 mmhg at any time .
all of the patients were randomly assigned to either a group treated with olm alone ( monotherapy group ) or a group treated with olm combined with azl ( combination therapy group ) .
the target bp was defined as < 130/85 mmhg in patients without any complications and < 130/80 mmhg in patients with diabetes mellitus , chronic kidney disease , or metabolic syndrome .
patients in the monotherapy group were first treated with 20 mg / day of olm for 4 weeks , and the dose of the olm was subsequently titrated up to 40 mg / day . if the target bp was not achieved , additional antihypertensive medications other than ras inhibitors and calcium channel blockers were added .
patients treated with combination therapy were first treated with 20 mg / day of olm for 4 weeks , and 16 mg / day of azl was subsequently added .
the dose of the olm was increased up to 40 mg / day until the target bp was attained .
additional antihypertensive agents other than ras inhibitors and calcium channel blockers were further added unless the bp fell below the target bp despite treatment with 40 mg / day of olm combined with 16 mg / day of azl .
clinical and biological parameters were measured before and 12 months after the start of this study . during the study period , previous medications and therapies other than antihypertensive drugs were continued .
the study was approved by the review board of keio university medical school hospital and written informed consent was obtained from every subject .
serum levels of creatinine ( cr ) , estimated glomerular filtration rate ( egfr ) , cystatin c , potassium ( k ) , uric acid ( ua ) , triglyceride ( tg ) , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein cholesterol ( ldl - c ) , glycoalbumin ( ga ) , plasma levels of atrial natriuretic peptide ( anp ) , brain natriuretic peptide ( bnp ) , the active renin concentrations ( arc ) , and aldosterone were measured in venous blood samples . the albumin creatinine ratio ( acr )
was measured in urinary samples drawn on the morning after an overnight fast on the same days as the ankle - brachial index ( abi ) , cardioankle brachial index ( cavi ) , augmentation index ( ai ) , and bp measurements and the maximum of carotid intima - media thickness ( max - imt ) measurements were performed . an oscillometric - based device ( tm-2431 ; a&d co. , tokyo , japan )
the bp was measured every 30 minutes during the day ( between 6:00 am and 10:00 pm ) and every 60 minutes during the night ( between 10:00 pm and 6:00 am ) .
the mean values and the standard deviations of the ambulatory bp for each subject were calculated for a 24-hour period .
the standard deviation of the ambulatory bp values was recorded as the variability of ambulatory bp in this study . the nocturnal decrease in bp
was calculated as the average systolic bp during the day minus the average systolic bp during the night .
the morning bp surge was calculated as the highest systolic bp during the first 2 hours after waking minus the lowest systolic bp during the night .
the cavi was measured using a vasera vs-1000 vascular screening system ( fukuda denshi co. ltd . ,
cuffs were applied to bilateral upper arms and ankles , with the subjects lying in a supine position and holding their heads along the midline .
ecg electrodes were placed on both wrists , and a microphone for detecting heart sounds was placed over the sternum .
the patients rested in this supine position for at least 10 minutes before the start of monitoring .
the cavi was calculated using the following formula :
( 1)cavi = a { ( 2p)ln ( pspd ) pwv2}+b ,
where , ps is the systolic blood pressure , pd is the diastolic blood pressure , p is ps pd , is blood density , and a and b are constants .
the ai was measured using an automated tonometric device ( hem-9000ai ; omron healthcare co. , ltd . , kyoto , japan ) , as described previously .
peripheral pressure waveforms were recorded over 30 seconds from the radial artery at the wrist with the subjects in a sitting position after resting for at least 5 minutes .
the ai was calculated using the following formula
( 2)ai = ( late systolic bpdiastolic bp ( dbp))(systolic bpdbp)100 ( % ) .
acr was evaluated on the basis of the mean albumin - to - creatinine ratio in three nonconsecutive overnight urine samples .
the urinary concentrations of albumin and creatinine were determined using a turbidimetric immunoassay with a superior - microalbumin kit ( dpc co. , tokyo , japan ) and with the jaff reaction using an autoanalyzer .
ultrasonography b - mode imaging of the carotid artery was performed using a powervision 6000 machine ( toshiba , tokyo , japan ) at a transducer frequency of 7.5 mhz .
each subject was examined while in a supine position . up to 4 cm of the common carotid artery and the carotid bulb
intima - media thickness ( imt ) was defined as the distance between the leading edge of the lumen - intima interface and the leading edge of the media - adventitia interface of the far wall .
the greatest imt value in the bilateral longitudinal projections was recorded as the max - imt .
the mean intraobserver and interobserver coefficients of variation for the maximum imt were 4.3% and 4.7% , respectively .
fisher 's exact test was used to analyze sex and the frequency of diabetes mellitus , smoking , and the use of statins .
the mann - whitney u test was used to analyze the age and body mass index .
the changes in the biological parameters were analyzed using a student t - test and a two - way analysis of variance for repeated measures combined with tukey - kramer posthoc tests .
the contributions of changes in variables to changes in cavi were tested using a regression analysis and an analysis of covariance . a p value < .05 was considered significant .
no significant differences were observed in the baseline patient characteristics between the monotherapy group and the combination therapy group , with the exception of the serum k level ( table 1 ) . during the 12-month treatment period , the clinic systolic bp , the clinic diastolic bp , the 24-hour ambulatory systolic bp , the 24-hour ambulatory diastolic bp , the daytime systolic bp , the daytime diastolic bp , and the nighttime systolic bp decreased significantly both after the monotherapy and combination therapy ,
the nighttime diastolic bp decreased significantly after combination therapy whereas it did not change significantly after monotherapy .
the nocturnal decrease reduced significantly after monotherapy whereas it did not change significantly after combination therapy .
no significant changes in the morning sbp surge or the sbp variability were seen during the 12-month observation period in either group .
figure 1 shows the changes in primary outcomes including acr , anp , bnp , abi , max - imt , and arterial stiffness as assessed by cavi and ai in both groups .
the cavi decreased significantly from 8.4 0.2 to 7.8 0.2 after combination therapy , whereas it did not change significantly after monotherapy .
the ai decreased significantly after both monotherapy and combination therapy , from 83.8 2.8 to 71.9 3.7 , and from 75.2 4.3 to 68.8 3.3 , respectively .
the acr , anp , bnp , and max - imt did not change significantly in either group . during the 12-month observation period ,
the serum ldl - c level decreased significantly from 127 6 to 109 8 mg / dl after combination therapy whereas a significant change was not observed after monotherapy ( figure 2 ) .
the plasma aldosterone level decreased significantly after both monotherapy and combination therapy , from 205 23 to 155 20 pg / dl , from 194 18 to 125 9 pg / dl , respectively , but no significant difference was observed between the two groups . during the 12-month observation period ,
the reduction in cavi , abi , and serum ldl - c level was significantly greater after the combination therapy than the monotherapy after adjustment by the baseline value ( figures 3 and 4 ) .
an ancova analysis to examine whether the changes in the ldl - c , plasma aldosterone , abi , ai , clinical bp , 24-h bp , daytime bp , and nighttime bp affected the change in cavi during the combination therapy ( table 3 ) .
the changes in the abi and clinic sbp contributed significantly to the decrease in cavi after combination therapy .
the present study demonstrates that olm plus azl significantly improve the cavi in hypertensive patients , which reflects arterial stiffness .
although the reduction in the cavi in the combination therapy group was correlated with clinic sbp , the beneficial effect of olm and azl on arterial stiffness was independent of bp changes .
there was no significant difference in the reduction of brachial systolic bp between the two treatments .
it has been shown that the combination of olm and azl has beneficial effects on the properties of the cardiovascular system .
stimulation of the angiotensin ii type 1 receptor results in stimulation of l - type calcium channels and induces the influx of extracellular calcium through calcium channels .
the l - type calcium channel blocker ( ccb ) azl enhances the effect of arbs on vascular remodeling independently of blood pressure .
moreover , azl has been implicated in augmenting the inhibitory effect of arb compared with other l - type ccbs such as nifedipine and amlodipine .
coadministration of azl and olm synergistically blunts oxidative stress partly through the inhibition of akt activity and exerts antiatherogenic actions by inhibiting vsmc migration and vascular remodeling .
combination therapy has a beneficial effect on central systolic bp and arterial stiffness , and enhances the effects of monotherapy with these drugs in treating atherosclerosis [ 1417 ] . the combination of azl with olm acts to prevent hypertensive heart failure with preserved systolic function in a rat model of this disease .
combination therapy produces a greater reduction in cardiac fibrosis by inhibiting the increase in elastolytic activity induced by activation of nadph oxidase [ 18 , 19 ] .
simultaneous treatment with exercise and olm plus azl produces renal protective effects in the rat model .
this suggests that the treatment may affect macrophage infiltration to the glomerulus , fibroblast accumulation in the glomerulus , mesangial activation , and podocyte differentiation .
combination therapy protects against cyst enlargement in polycystic kidney disease by suppressing interstitial inflammation , fibrosis , and oxidative stress through upregulating enos expression during the course of the disease .
taken together , the combination of olm plus azl provides additional cardiovascular protective effects on arterial stiffness resulting in an improvement in the cavi . since
arterial stiffness is a powerful and independent risk factor for mortality in cardiovascular events , olm plus azl could be a first - line antihypertensive drug .
the ai is another marker of arterial stiffness and reflects the central aortic pressure [ 23 , 24 ] .
vascular stiffening causes an increase in the amplitude and early return of the reflected wave during systole , with augmentation of the central systolic bp and a resultant increase in ai .
we have shown that arbs decrease the ai [ 7 , 8 ] but there has not been any prior study focusing on the effect of olm on ai . in the present study , olm produced a reduction in the ai whereas azl has been previously shown to cause a significant reduction in ai in combination with arbs .
this was confirmed in the present study indicating that combination therapy results in a reduction in ai .
since there was not any difference in the decrease in the ai between the two therapies , the reduction could be explained by the vascular protective effects of the olm . in this
study a significant reduction in the serum ldl - c levels after the combination therapy was observed .
this improvement in the serum ldl - c levels can be attributed to azelnidipine , since olm monotherapy did not produce a decrease in the serum ldl - c levels .
a previous study showed that the antioxidant effect of azelnidipine may have participated in the reduction of plasma malondialdehyde - modified ldl ( mda - ldl ) levels .
the antioxidant effect of azl possibly participated in the reduction of plasma mda - ldl levels [ 28 , 29 ] . in this respect ,
combination therapy would be preferable for hypertensive patients with comorbid dyslipidemia . in the present study
this confirms previous reports that show that the incidence of adverse events is similar in the combination and the monotherapy groups .
these include that the trial population was comparatively small and the observation period was relatively short
. a longer observation with a larger number of subjects might more clearly elucidate the beneficial and adverse effects of olm and azl .
therefore , further studies are needed to confirm the benefits and safety of olm and azl therapy . in conclusion ,
the combination treatment with olm and azl compared with olm monotherapy produces beneficial effects on arterial stiffness as assessed by cavi , as well as by the level of ldl - c , despite a similar reduction of bp .
since these markers are known to influence the future risk for cardiovascular events in hypertensive patients , the combination of olm and azl could well be a reasonable antihypertensive management for the treatment of hypertensive patients . | background / aims .
arterial stiffness is an independent risk factor for cardiovascular morbidity and mortality .
this study was conducted to determine the effect of olmesartan ( olm ) and azelnidipine ( azl ) on arterial stiffness using the cardio - ankle vascular index ( cavi ) , which is a novel blood pressure ( bp)-independent marker for arterial stiffness in hypertensive patients . methods .
fifty - two consecutive hypertensive patients were randomly assigned either to a group treated with olm monotherapy or to a group treated with olm and azl combination therapy .
clinical and biological parameters were measured before and 12 months after the start of this study . results . both therapies significantly and similarly reduced bp , augmentation index , and plasma aldosterone levels .
the combination therapy significantly decreased cavi and serum low - density lipoprotein ( ldl - c ) levels and these reductions were significantly greater than those produced with monotherapy .
no significant differences in metabolic parameters were observed between the two therapies . conclusion .
the combination therapy with olm and azl had beneficial effects on arterial stiffness assessed by cavi , ldl - c , and metabolism , despite the similar bp reduction , compared with olm monotherapy .
since these markers are known to influence the future risk of cardiovascular events , combination therapy with olm and azl could be a useful choice for treating hypertensive patients . |
few surgical procedures can rival the efficiency of modern mastoidectomy as a life - saving procedure .
it is important for the new generation of otologists to be cognizant of the origins of mastoidectomy as well as the difficulties our predecessors encountered and the solutions they devised to improve otologic surgery . before the mid-19 century
, mastoidectomy was performed only sporadically and in most cases as a desperate attempt to save the lives of people suffering from complications of infectious otitis .
barber surgeons with red , warm , and painful abscesses behind the ear that were occasionally drained through an incision .
this procedure was described by lucas van leyden in 1524 ( figure 1 ) .
early mastoid surgery as performed by a barber surgeon . incision to drain abscesses has been practiced since ancient times .
the drainage of acute abscesses became a common procedure at the beginning of the 20 century , within the pre - antibiotic era .
francis a. sooy ( 19151986 ) , a renowned surgeon from san francisco , said that until 1940 , he frequently completed his patient appointments and then crossed the street to the surgery room to
mastoid clubpicture from the time of the first world war illustrating how frequently mastoidectomies were performed .
mastoidectomy was developed as a method for draining purulent secretions from the infected mastoid cavity . throughout history , many surgeons have suggested ( even without supporting documentation ) that such abscesses should have been treated with mastoid surgery rather than by drainage .
the greek physician galen ( ad 129217 ) , among others , recognized the importance of draining an infected ear . in his writings , he suggested that otorrhea was beneficial for the infected ear because it allowed the drainage of purulent secretions from the ear and recommended against any procedure intended to impede otorrhea .
adam politzer2 interpreted galen 's writings to mean that galen had already been removing carious bone from infected mastoids .
however , lusting and cols3 found no proof of this when they revisited galen 's work .
politzer may have deliberately misrepresented galen 's recommendation to allow purulent secretions to drain from the ear in order to justify mastoidectomy to the conservative medical community .
he based his work on an understanding of anatomy ; however , this understanding was gained from studies of dissected animals rather than from humans4
5
6
7 . the first documented surgical incision to drain an infected ear
was described by the french physician ambroise par in the 16 century8
9
10
11 .
par is credited with recommending drainage to franois ii , king of france , in 156012 .
the king died of ear infection soon after ; he did not undergo surgery because his mother , catherine de medicis , would not allow it13 .
the first documented recommendation of mastoidectomy was found in the writings of johannes riolanus the younger from 1671 .
he then became a medical professor , whereas his father with the same name was the director of the faculty of medicine of paris .
in many of his writings , riolanus recommended mastoidectomy unless the surgical procedure would endanger the life of the patient : if an intolerable and throbbing inflammatory pain fills and obstructs the release of purulent secretion from the head , an incision in the posterior region of the head might be the only solution14
15 . in his text anthropographia
, riolanus describes the procedure as a small and narrow incision that gradually expands to the carious bone with small depressions like cells of a honeycomb16 .
the credit for performing the first mastoidectomy for the removal of purulent secretions went to jean - louis petit . unlike his predecessors , petit clearly established the procedure as a method for drilling the bone with the deliberate intent of removing pus .
petit ( 16741750 ) was an 18 century french surgeon who received his surgical degree in 1700 and became a member of the royal academy of sciences in 1715 ( figure 3 ) .
subsequently , in 1731 , the king of france founded the royal academy of surgery and recommended petit as its first director . according to his bibliography presented at the academy , his great renown stemmed from his experience with several surgical procedures , including the surgical management of bone diseases .
french surgeon who was the first to formally describe opening the mastoid , in a text published posthumously in 1774 .
petit worked in a military hospital beginning in 1692 and mentored military surgeons throughout europe . during this period
this was applied as a screw tourniquet and was used to contain hemorrhage before and after surgical procedures .
petit is credited with a level of expertise in mastoid surgeries unequaled in his time17 . rather than simply making a hole in the bone , which led to the formation of a persistent fistulous tract , petit advocated a deliberate search for purulent secretions in the mastoid .
petit described mastoid surgery in his trait des maladies chirurgicales , where he wrote ,
the walls of bone cavities can not expand when filled with purulent secretions ; while there , the pus remains completely encapsulated by compression and forms caries that can not be reached by any topical application , often inaccessible even by surgery18
19 .
petit advised that if signs of inflammation indicated an abscess under the cortical mastoid , the physician should not to hesitate to remove the external wall of the mastoid and open it by drilling with a chisel and hammer .
he thought that trepanation was justified because drainage might result in decompression before the purulent secretions could spontaneously drain via perforation of the external wall , thus limiting the course of the disease .
petit observed that the patient would recover immediately upon the removal of the external wall of the mastoid by means of a chisel and hammer , as follows :
these abscesses may remain and develop in the diploic layer for a long time and lead to death of the patient .
however , early abscesses may be opened without waiting for them to destroy the bone .
this is always risky for the patient as purulent secretions do not drain spontaneously and other causes may lead the disease to become complicated and fatal .
this treatment for mastoiditis was very different from the method accepted at the time , which involved topical applications of different substances .
petit claimed that this was why his treatment method was not accepted among his colleagues .
he also described the resistance that he encountered when he attempted to make incisions and open the skull when no signs of external injury were observed .
however , mastoidectomies were also carried out for other purposes , particularly for the treatment of deafness and tinnitus , during various periods .
these cases in which the procedure was performed to treat conditions presenting no clear indications for mastoidectomy were responsible for the unpopularity of this procedure .
j. l. jasser , a prussian military surgeon of the 18 century , made a retroauricular incision into the mastoid of a soldier suffering from a retroauricular abscess .
he found a large hole in the mastoid cells . while irrigating this area with a syringe inserted into the incision ,
jasser observed a significant amount of purulent material exiting from the external ear canal and nose .
although jasser performed the procedure to treat infection , this episode encouraged him to try this operation to treat hearing loss due to mastoiditis and , subsequently , deafness due to any cause .
riolanus wrote in the book anthropographia that the noise developed as a consequence of a fresh air stream that was retained inside the ear .
how could we release this air ? certainly , there was no other way except drilling the mastoid .
further improvement in mastoidectomy was critically compromised by the death of baron johann von berger , a danish court physician , in 1833 . according to several authors13
18
19
20
21 ,
the 68-year - old physician had suffered for many years from tinnitus and deafness and required mastoidectomy .
this event brought attention to the possible complications of this procedure and was cited by its opponents for many years .
nevertheless , the development of this procedure by many surgeons furthered their understanding of the pathophysiology of the disease and the effect of mastoidectomy .
the importance of mastoidectomy and its inherent potential are summarized in the optimistic feelings of jasser , who wrote , no good book or any good thing shows at first its best side.13 .
however , most surgeons performed mastoidectomy only in certain situations and for specific indications . in 1838 ,
j. e. dezeimeris wrote that reports describing complications due to mastoidectomies should be collected before the procedure was definitively abandoned . in his article
l'xperience , published in the journal of medicine and surgery , dezeimeris wrote , those who oppose the procedure of drilling the mastoid process reported that surgical complications that could possibly occur due to this procedure could be worse than the disease itself .
. the question was whether mastoidectomy was inherently risky or whether the real danger was the injuries that might occur in the inner ear before the removal of the purulent secretions .
dezeimeris described several cases of successful surgeries as well as cases in which complications were referable to contraindications or in which negative outcomes were caused by the course of the disease itself .
he noted that the poor outcomes in these cases did not reflect the safety or effectiveness of the surgical procedure22
23 .
a new era for mastoidectomy was inaugurated by sir william wilde with his introduction of the eponymous retroauricular incision ( figure 4 ) .
wilde used the retroauricular incision only to drain purulent secretions rather than to enter the mastoid cavity .
( portmann g. a treatise on the surgical technique of otorhinolaryngology ; baltimore : william wood ; 1939 ) .
building on his father 's career , he entered the practice of medicine ( figure 5 ) . as a young surgeon inspired by the need for infrastructure for the medical and surgical care of non - privileged individuals , wilde founded a small hospital in dublin that initially aimed to meet the ophthalmologic and otologic needs of the poor .
the hospital subsequently moved to larger facilities , and for a while it was the only facility in england to perform ear surgeries .
wilde published aural surgery , a series of essays about the most common diseases of the ear , and continued his leadership role until his death in 1864 .
his personal life was equally exciting , involving numerous lovers and illegitimate children ; his own temperament was also rude and eccentric24
25 .
perhaps one of the most significant ironies of this pioneering surgeon 's life was his difficult relationship with his famous son , the writer oscar wilde , who suffered from chronic otorrhea and died from meningitis caused by otitis .
wilde stated that mastoiditis results from what was originally otorrhea of the mucosa and occurs when the inflammation of the periosteal membrane reaches the bone .
he recommended that physicians not hesitate to make an incision at least 1 inch long when
the mastoid process enlarges or even in the presence of a slight floating sensation . for safe separation of the periosteum , the head should be placed on a fixed support and the scalpel inserted to the bone . because of the degree of inflammation , it is often necessary to insert the scalpel an inch deep .
wilhelm kramer28 from berlin , who also published a famous textbook on ear diseases and a review of the book aural surgery ( written by wilde in 1853 ) , wrote that his negative opinion as the state of the art of english otologic surgery did not improve after publication of his aural surgery .
kramer 's criticism may well be considered retribution for wilde 's public disapproval of his own book , published 4 years earlier in the journal of medical sciences of dublin .
the controversy between these 2 medical doctors can be attributed to the competition between the german and british schools . however , the editor of the lancet clearly supported kramer and suggested that wilde 's book should be given to the trunkmaker .
we can speculate that the editor , based in london , was not concerned with any rivalry with continental europe and was referring instead to the superiority of the english over the irish .
joseph toynbee , who practiced at the same time but did not agree with wilde about the performance of the incision , related afterwards the importance of draining the infection .
this was reflected in his comment about a patient suffering from acute mastoiditis : it is likely that somehow a large portion of the tympanic membrane is removed as soon as mastoiditis develops , thus allowing the content to be released from the mastoid cells .
this clears the bone from the disease13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29 .
toynbee supported drilling the mastoid in another patient , saying , drilling of the mastoid process also indicates that the surgery might be performed with almost no hesitation in patients in which the purulent secretion is filling so much of their ear cavity , causing severe symptoms that will lead to death , if not removed .
i never performed this surgery , although i would not hesitate if the life of the patient were at risk29 .
amedee forget , a french surgeon , attempted a different procedure to remove the infection in 1860 .
he dissected the antrum and transferred the tissue of the meatus to the antrum so that it passed to the other side through the surgical wound , thus allowing drainage in both directions . despite periodic transfer of the tissue ,
therefore , the patient underwent a second surgery in which bone and necrotic tissue were removed , after which a significant improvement in the symptoms was observed13 .
when the then - typical treatment of bacon fat infusion twice a day and subsequent irrigation of the external acoustic meatus failed to relieve the symptoms , german surgeon anton friedrich baron von troltsch21 performed a retroauricular incision to the level of the bone .
von troltsch , professor of otology at the university of wurzburg in 1864 , had studied ear diseases in dublin with wilde and in london with toynbee30 . in 1861
, he published a case report of a 16-year - old girl who presented with otalgia , deafness , erythema , and mastoid edema associated with scarlet fever .
von troltsch reported that as soon as the incision was performed , the purulent secretions quickly filled the meatus while fresh blood started to be released .
when the symptoms and pain increased , the retroauricular edema relapsed , forcing von troltsch to explore the previous incision .
he then inserted a tampon into the wound with the intention of trying again the next day .
however , he then realized that the nidus of infection behind the ear was releasing fluid that was initially transparent but later became opaque .
small volumes of fluid were also released by the meatus . the following day , von troltsch continued advancing with the probe , and the symptoms subsequently improved .
i was not successful using only a probe ; i should have the courage to adopt measures with other instruments that proved to be more efficient . in situations that are similar
, i now would perform deeper incisions and dissect the first bone layer with a chisel , as it seems thin and easy to break21 .
he encouraged them to study mastoidectomy , stating , if this procedure was forgotten or disregarded it was due to misapplications that occurred in the last century and to the peculiar and unusual position of the otologic literature until a short time ago .
von troltsch published an article describing a new method and its indications , as the procedures that other surgical disciplines consider necessary under certain circumstances could not be applied to diseases of the ear21 .
it is worth remembering that until that time , surgeons did not specialize ; for the most part they were general surgeons and performed all kinds of surgical operations , including procedures in ears .
in particular , von troltsch motivated his student hermann schwartze to standardize the procedures and indications for mastoidectomy . in 1873
it was the first systematic description of how and under what conditions the procedure should be performed .
the article explained that curettage of the interior wound might cure the mastoid in patients who presented with destruction of the mastoid cortex .
schwartze also reported a case of a patient who presented with mastoid suppuration with a cortex soft enough to be easily penetrated with a probe .
however , he suggested although the cortex was more often hard , the firm bone could be penetrated with trocars .
schwartze defined the concept of a standard surgical procedure for mastoidectomy , recommending the use of a chisel and hammer to remove the bone in such a way that the antrum could be properly inspected and efficiently drained .
schwartze also stated clear indications for the procedure : to treat purulent secretion through the attic , without consideration for the hearing capacity and removing the malleus and incus to treat chronic purulent otorrhea of the tympanic cavity with positive signs of erosion of the incus and malleus as well as to treat cholesteatoma of the tympanic cavity to improve hearing and treat subjective noise when the malleus is fixed and incurable obstruction of the eustachian tube is observed as well as to treat sclerosis of the tympanic cavity with no signs of death of the auditory nerve . after the publication of schwartze 's findings , a professor at the renowned halle clinic sought to reintroduce mastoidectomy30
31 .
schwartze mastoidectomy , as it was known at the time , was used to establish a direct connection between the mastoid process and the tympanic cavity to enable irrigation with antiseptic solution .
while initially performed in patients suffering from acute mastoiditis , schwartze mastoidectomy was later used to treat exacerbations of chronic infections in which the fistula was found to pass through the bone and , finally , to treat patients suffering from persistent suppurative otitis media .
schwartze studied in berlin and wurzburg and then received his medical degree from the university of berlin in 1853 .
he studied under the tutelage of anton von troltsch and served as an assistant at the anatomopathological institute of the university of wurzburg .
he became professor and director of the otologic clinic at the university of halle in 1859 .
in 1863 , schwartze , with von troltsch ( 18291890 ) and adam politzer ( 18351920 ) , founded the journal archiv fur ohrenheilkunde , the first journal dedicated exclusively to the pathology and treatment of the ear .
schwartze then founded his own clinic to treat patients suffering from ear diseases32 . during the franco - prussian war
, he served as a doctor at a field hospital and received the medal of the iron cross , second class . in 1903 , he was the first ear surgeon in germany to receive the title of full professor for this discipline .
the university of halle established the hermann - schwartze medal , to be awarded for scientific contributions . near the end of his life , schwartze suffered from restlessness , vertigo , and mental confusion33
34 .
curiously , his mentor von troltsch experienced the same problems ; his obituary reported that ,
recently , an insidious neurosis removed all his energy and finally left him in total need of help .
a simple mastoidectomy or antrostomy was observed to be sufficient in cases of acute mastoiditis .
radical mastoidectomy , a major procedure , was developed for treatment of chronic otitis or acute cases presenting with intracranial complications .
ernst kuster and ernst von bergmann , both general surgeons , were credited with developing the radical surgery , which was known for some time as kuster - bergmann surgery .
they advocated combining the dissection of several spaces of the attic , antrum , and middle ear , transforming these into a single large cavity , into one surgical procedure .
ernst kuster , a german general surgeon , suggested that the schwartze surgery could be extended . in 1888 , kuster presented this idea to the german medical society ; he later published a study reporting that according to his knowledge , abscesses that developed in hard bone at any depth should be completely exposed by dissecting the entire source of the infection .
in contrast to the dissection of the antrum suggested by schwartze , this procedure should open the bone surrounding the antrum as well as the posterior wall of the meatus .
he suggested that in principle , all infectious bone disease should be opened and fully exposed , thus enabling removal of all of the affected tissue and extirpation of the source of suppuration .
only this level of dissection represents true adherence to the surgical principles suggested by kuster .
in particular , if the tympanic cavity was filled with granulations and the membrane as well as the ossicles were partially or totally destroyed , i try to go deeper
. then , guided by my eye , i could remove all the disease with the aid of a sharp spoon36 .
in 1889 , von bergmann reported in a seminar that between the upper wall of the external auditory canal and the lower and lateral side of the middle cranial fossa , a thick layer of bone might be observed .
a sizel might penetrate up to the bone of the tympanic membrane without opening the cranial cavity . after a detailed description of how to reach the posterior wall with the aid of a sizel , von bergmann suggested that upon removal of the wall of the meatus , a single funnel cavity might be created and a finger introduced up to the tympanic cavity to remove the remaining ossicles , granulations , and purulent material with a sharp spoon37
38 .
von bergmann also recommended caution with regard to the depth of the insertion of the sizel in the posterior wall because of the possibility of facial nerve injury .
arthur hartmann from berlin39 reported the commentary of an american otologist on visiting berlin in 1895 :
i was in berlin for only 2 days and saw 3 cases of facial paralysis after a mastoid surgery performed using a chisel , whereas in america i never assisted in any .
emanual zaufal40 further improved radical surgery by dissecting from the antrum to the attic . in 1890 , he modified the schwartze procedure by suggesting removal of the posterior wall .
he revealed his findings at the association of german doctors in april 1890 and later at the 20th convention of swiss and southern german otologists , which was held in prague in may 1890 .
he explained that this procedure was to be performed using a gouge , or a chisel and a hammer , with the aim of passing through the mastoid and reaching the eardrum .
zaufal performed the operation with a forceps - like clamp , placing one scalpel in the channel and the other in the antrostomy .
he then removed the entire wall of the channel with one movement , exposing the entire cavity and the incudomalleolar joint . now ,
he wrote , we have the important mission of removing [ the ] malleus , incus as well as the remaining tissue and bone using a sharp spoon or forceps.39
40
zaufal opted to close the retroauricular wound rather than leaving a drain in place . in 1890 ,
ludwig stacke , a german otologist , introduced the idea of opening through the external auditory canal to seek the source of the infection ( as in subcortical procedures ) .
this allowed him to remove layers with the option of leaving a skin flap to promote better epithelialization . in 1893 ,
sir william macewan42 established the concept of the suprameatal triangle , also called the macewan triangle .
dissection of the mastoid antrum could be safely performed within this triangle , which is formed by the posterior root of the zygomatic process in front , the superoposterior segment of the external acoustic meatus bone at the bottom , and an imaginary perpendicular line joining these 2 areas and extending from the posterior meatus bone to the root of the zygomatic process at the back .
suddenly , traditional procedures regained popularity due to their ability to preserve hearing and middle ear function .
radical mastoidectomy is one of the surgeries with the higher number of unsatisfactory results . before surgery ,
after surgery , the hearing worsens when the patient is not completely deaf , whereas the otorrhea often continues .
gustave bondy ( figure 6 ) was credited with improving the procedure that was the precursor of the modified radical mastoidectomy in 191044
45
46
47
48
49 .
gustave bondy ( 18701954 ) , austrian surgeon ( university of vienna ) , popularized the modified radical mastoidectomy in which some or all of the middle ear structures were preserved in order to attempt to preserve hearing . in order to release the purulent secretions confined within the antrum and the attic , bondy removed the bone up to the external wall of the attic .
he intended to preserve the tense part of the tympanic membrane and , if possible , the ossicles .
a meatal skin flap was used to seal the defect between the epitympanum and mesotympanum ; alternatively , when the ossicles were preserved , the flaps could be used to cover the exposed bodies49
50
51 .
gustave bondy was born in austria in 1870 ( fig 5 ) and received his medical degree at the university of vienna in 1894 . in 1897
, he began working at the department of otology of the general polyclinic , where he remained an assistant until 1907 , the year he became the first assistant of professor victor urbantschitsch .
bondy became famous for his work , published in 1907 , on the comparative anatomy of auditory organs : beitrage zur vergleichenden anatomie des gohorogans
53 .
with expertise in otologic surgery and the treatment of intracranial otologic complications , he became famous for developing criteria for the modified radical mastoidectomy .
moreover , he developed his criteria based on the evaluation of postoperative results assessed by his associate erich ruttin , who performed 1000 radical mastoidectomies in 1910 .
bondy noted that although many of the patients had presented with a normal tympanic membrane , intact ossicles , and relatively normal preoperative hearing associated with attic cholesteatomas that affected only the pars flaccida of the tympanic membrane , their hearing worsened after surgery . before the second world war
, bondy moved from vienna to australia , where he lived for the rest of his life . since the 1930s
, mastoidectomy has evolved into a procedure that is now accepted as a standard otologic technique .
the discovery of penicillin by alexander fleming changed the natural course of potentially fatal otologic infections that had previously required surgery despite the risks for complications .
access to preventive medical treatments and the greater possibility for antibiotic therapy allowed armstrong to treat secretory otitis with a ventilator in 1970 .
the incidence of complications of chronic otitis media has recently decreased significantly in developed countries , although it remains high in poor regions .
concern about regaining functional capacity and apprehension regarding reconstruction increased significantly with the introduction of other options .
concomitantly , mastoidectomy was increasingly used for other purposes , including labyrinthectomy , access to the internal auditory canal , and removal of glomus tumors . in recent years
, the advent of implantable hearing prostheses ( cochlear implants and other prostheses ) has increased the importance of the otologic surgeon 's knowledge of mastoidectomy .
wullstein of wrsburg , germany , introduced the surgical microscope after working with zeiss to adapt a microscope developed for colposcopy and in situ diagnosis of uterine cervical cancer .
the present article mainly describes the origins and development of mastoidectomy for the treatment of chronic otitis media and its complications .
however , we can not fail to mention a major , if not the greatest , otologist of the 20th century , dr . william house ( figure 7 ) from los angeles , california , united states .
he began his career as a dental surgeon , following in the steps of his father , who was a famous dentist in california in the 1930s and 40s .
he was an innovator who introduced new procedures for the reduction of jaw fractures .
american surgeon who introduced modern techniques of mastoidectomy and the use of mastoid access in otoneurosurgery .
as he wrote in his memoir ( 2011 ) , the advent of penicillin and decreased rates of infection significantly diminished interest in otorhinolaryngology , and residency positions in this field were left vacant53 .
william house fell in love with otology during his medical residency , when he encountered cases of deafness in children for which nothing could be done .
he introduced access to the facial nerve recess ( posterior tympanotomy ) , which led to tympano - ossicular reconstructions with mastoidectomy ( the so - called closed - cavity mastoidectomy or tympanomastoidectomy ) as well as the use of traditional mastoidectomy for the treatment of chronic suppurative and cholesteatomatous otitis , now practiced worldwide .
he introduced other innovative techniques in otology , but we have highlighted posterior tympanotomy because of its importance in mastoidectomy . throughout its history , mastoidectomy has shown a tendency to preserve or restore hearing .
currently , mastoidectomy is performed with the aim of preserving the anatomy of the ear , which may require several reoperations because of the tendency of cholesteatomas to recur .
the first mastoidectomy performed in brazil was carried out in 1893 by henrique guedes de melo in rio de janeiro .
it was re - introduced by house with the aim of reaching the internal acoustic meatus and the posterior fossa through the translabyrinthic tract . in 1972 ,
pulec and hitzelberger used the mastoid to access the retrolabyrinthic tract to perform neurectomy initially of the trigeminal nerve and later of the vestibular nerve54 . in 1995 , bento and colleagues presented the possibility of removing acoustic neuromas via the transmastoid and retrolabyrinthine approaches and thereby preserving the cochlear nerve55
56 .
its improvement has relied on the introduction of more elaborate surgical procedures and particularly on advancements in surgical equipment made during the last century .
mastoidectomy was developed as a method for draining purulent secretions from the infected mastoid cavity . throughout history , many surgeons have suggested ( even without supporting documentation ) that such abscesses should have been treated with mastoid surgery rather than by drainage .
the greek physician galen ( ad 129217 ) , among others , recognized the importance of draining an infected ear . in his writings
, he suggested that otorrhea was beneficial for the infected ear because it allowed the drainage of purulent secretions from the ear and recommended against any procedure intended to impede otorrhea .
adam politzer2 interpreted galen 's writings to mean that galen had already been removing carious bone from infected mastoids .
however , lusting and cols3 found no proof of this when they revisited galen 's work .
politzer may have deliberately misrepresented galen 's recommendation to allow purulent secretions to drain from the ear in order to justify mastoidectomy to the conservative medical community .
he based his work on an understanding of anatomy ; however , this understanding was gained from studies of dissected animals rather than from humans4
5
6
7 . the first documented surgical incision to drain an infected ear
was described by the french physician ambroise par in the 16 century8
9
10
11 .
par is credited with recommending drainage to franois ii , king of france , in 156012 .
the king died of ear infection soon after ; he did not undergo surgery because his mother , catherine de medicis , would not allow it13 .
the first documented recommendation of mastoidectomy was found in the writings of johannes riolanus the younger from 1671 .
he then became a medical professor , whereas his father with the same name was the director of the faculty of medicine of paris .
in many of his writings , riolanus recommended mastoidectomy unless the surgical procedure would endanger the life of the patient : if an intolerable and throbbing inflammatory pain fills and obstructs the release of purulent secretion from the head , an incision in the posterior region of the head might be the only solution14
15 . in his text anthropographia
, riolanus describes the procedure as a small and narrow incision that gradually expands to the carious bone with small depressions like cells of a honeycomb16 .
the credit for performing the first mastoidectomy for the removal of purulent secretions went to jean - louis petit . unlike his predecessors , petit clearly established the procedure as a method for drilling the bone with the deliberate intent of removing pus .
petit ( 16741750 ) was an 18 century french surgeon who received his surgical degree in 1700 and became a member of the royal academy of sciences in 1715 ( figure 3 ) .
subsequently , in 1731 , the king of france founded the royal academy of surgery and recommended petit as its first director . according to his bibliography presented at the academy , his great renown stemmed from his experience with several surgical procedures , including the surgical management of bone diseases .
jean louis petit ( 16741750 ) . french surgeon who was the first to formally describe opening the mastoid , in a text published posthumously in 1774 .
petit worked in a military hospital beginning in 1692 and mentored military surgeons throughout europe . during this period
this was applied as a screw tourniquet and was used to contain hemorrhage before and after surgical procedures .
petit is credited with a level of expertise in mastoid surgeries unequaled in his time17 . rather than simply making a hole in the bone , which led to the formation of a persistent fistulous tract , petit advocated a deliberate search for purulent secretions in the mastoid .
petit described mastoid surgery in his trait des maladies chirurgicales , where he wrote , the walls of bone cavities can not expand when filled with purulent secretions ; while there , the pus remains completely encapsulated by compression and forms caries that can not be reached by any topical application , often inaccessible even by surgery18
19 .
petit advised that if signs of inflammation indicated an abscess under the cortical mastoid , the physician should not to hesitate to remove the external wall of the mastoid and open it by drilling with a chisel and hammer .
he thought that trepanation was justified because drainage might result in decompression before the purulent secretions could spontaneously drain via perforation of the external wall , thus limiting the course of the disease .
petit observed that the patient would recover immediately upon the removal of the external wall of the mastoid by means of a chisel and hammer , as follows :
these abscesses may remain and develop in the diploic layer for a long time and lead to death of the patient .
however , early abscesses may be opened without waiting for them to destroy the bone .
this is always risky for the patient as purulent secretions do not drain spontaneously and other causes may lead the disease to become complicated and fatal .
this treatment for mastoiditis was very different from the method accepted at the time , which involved topical applications of different substances .
petit claimed that this was why his treatment method was not accepted among his colleagues .
he also described the resistance that he encountered when he attempted to make incisions and open the skull when no signs of external injury were observed .
historically , mastoidectomies were normally performed to treat infections . however , mastoidectomies were also carried out for other purposes , particularly for the treatment of deafness and tinnitus , during various periods .
these cases in which the procedure was performed to treat conditions presenting no clear indications for mastoidectomy were responsible for the unpopularity of this procedure .
j. l. jasser , a prussian military surgeon of the 18 century , made a retroauricular incision into the mastoid of a soldier suffering from a retroauricular abscess .
he found a large hole in the mastoid cells . while irrigating this area with a syringe inserted into the incision ,
jasser observed a significant amount of purulent material exiting from the external ear canal and nose .
three weeks later , the patient reported improvement in his hearing20 . although jasser performed the procedure to treat infection , this episode encouraged him to try this operation to treat hearing loss due to mastoiditis and , subsequently , deafness due to any cause .
riolanus wrote in the book anthropographia that the noise developed as a consequence of a fresh air stream that was retained inside the ear .
how could we release this air ? certainly , there was no other way except drilling the mastoid .
further improvement in mastoidectomy was critically compromised by the death of baron johann von berger , a danish court physician , in 1833 . according to several authors13
18
19
20
21 ,
the 68-year - old physician had suffered for many years from tinnitus and deafness and required mastoidectomy .
this event brought attention to the possible complications of this procedure and was cited by its opponents for many years .
nevertheless , the development of this procedure by many surgeons furthered their understanding of the pathophysiology of the disease and the effect of mastoidectomy .
the importance of mastoidectomy and its inherent potential are summarized in the optimistic feelings of jasser , who wrote , no good book or any good thing shows at first its best side.13 .
interest in mastoid surgery did not fade completely in the early 19th century . however , most surgeons performed mastoidectomy only in certain situations and for specific indications . in 1838 ,
j. e. dezeimeris wrote that reports describing complications due to mastoidectomies should be collected before the procedure was definitively abandoned . in his article
l'xperience , published in the journal of medicine and surgery , dezeimeris wrote , those who oppose the procedure of drilling the mastoid process reported that surgical complications that could possibly occur due to this procedure could be worse than the disease itself .
the question was whether mastoidectomy was inherently risky or whether the real danger was the injuries that might occur in the inner ear before the removal of the purulent secretions .
dezeimeris described several cases of successful surgeries as well as cases in which complications were referable to contraindications or in which negative outcomes were caused by the course of the disease itself .
he noted that the poor outcomes in these cases did not reflect the safety or effectiveness of the surgical procedure22
23 .
a new era for mastoidectomy was inaugurated by sir william wilde with his introduction of the eponymous retroauricular incision ( figure 4 ) .
wilde used the retroauricular incision only to drain purulent secretions rather than to enter the mastoid cavity .
( portmann g. a treatise on the surgical technique of otorhinolaryngology ; baltimore : william wood ; 1939 ) .
building on his father 's career , he entered the practice of medicine ( figure 5 ) .
as a young surgeon inspired by the need for infrastructure for the medical and surgical care of non - privileged individuals , wilde founded a small hospital in dublin that initially aimed to meet the ophthalmologic and otologic needs of the poor .
the hospital subsequently moved to larger facilities , and for a while it was the only facility in england to perform ear surgeries .
wilde published aural surgery , a series of essays about the most common diseases of the ear , and continued his leadership role until his death in 1864 .
his personal life was equally exciting , involving numerous lovers and illegitimate children ; his own temperament was also rude and eccentric24
25 .
perhaps one of the most significant ironies of this pioneering surgeon 's life was his difficult relationship with his famous son , the writer oscar wilde , who suffered from chronic otorrhea and died from meningitis caused by otitis .
wilde stated that mastoiditis results from what was originally otorrhea of the mucosa and occurs when the inflammation of the periosteal membrane reaches the bone .
he recommended that physicians not hesitate to make an incision at least 1 inch long when
the mastoid process enlarges or even in the presence of a slight floating sensation . for safe separation of the periosteum , the head should be placed on a fixed support and the scalpel inserted to the bone . because of the degree of inflammation , it is often necessary to insert the scalpel an inch deep .
wilhelm kramer28 from berlin , who also published a famous textbook on ear diseases and a review of the book aural surgery ( written by wilde in 1853 ) , wrote that his negative opinion as the state of the art of english otologic surgery did not improve after publication of his aural surgery .
kramer 's criticism may well be considered retribution for wilde 's public disapproval of his own book , published 4 years earlier in the journal of medical sciences of dublin .
the controversy between these 2 medical doctors can be attributed to the competition between the german and british schools . however , the editor of the lancet clearly supported kramer and suggested that wilde 's book should be given to the trunkmaker .
we can speculate that the editor , based in london , was not concerned with any rivalry with continental europe and was referring instead to the superiority of the english over the irish .
joseph toynbee , who practiced at the same time but did not agree with wilde about the performance of the incision , related afterwards the importance of draining the infection .
this was reflected in his comment about a patient suffering from acute mastoiditis : it is likely that somehow a large portion of the tympanic membrane is removed as soon as mastoiditis develops , thus allowing the content to be released from the mastoid cells .
this clears the bone from the disease13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29 .
toynbee supported drilling the mastoid in another patient , saying , drilling of the mastoid process also indicates that the surgery might be performed with almost no hesitation in patients in which the purulent secretion is filling so much of their ear cavity , causing severe symptoms that will lead to death , if not removed .
i never performed this surgery , although i would not hesitate if the life of the patient were at risk29 .
amedee forget , a french surgeon , attempted a different procedure to remove the infection in 1860 .
he dissected the antrum and transferred the tissue of the meatus to the antrum so that it passed to the other side through the surgical wound , thus allowing drainage in both directions . despite periodic transfer of the tissue ,
therefore , the patient underwent a second surgery in which bone and necrotic tissue were removed , after which a significant improvement in the symptoms was observed13 .
when the then - typical treatment of bacon fat infusion twice a day and subsequent irrigation of the external acoustic meatus failed to relieve the symptoms , german surgeon anton friedrich baron von troltsch21 performed a retroauricular incision to the level of the bone .
von troltsch , professor of otology at the university of wurzburg in 1864 , had studied ear diseases in dublin with wilde and in london with toynbee30 . in 1861
, he published a case report of a 16-year - old girl who presented with otalgia , deafness , erythema , and mastoid edema associated with scarlet fever .
von troltsch reported that as soon as the incision was performed , the purulent secretions quickly filled the meatus while fresh blood started to be released .
the symptoms were significantly relieved 2 days later . when the symptoms and pain increased , the retroauricular edema relapsed , forcing von troltsch to explore the previous incision .
he then inserted a tampon into the wound with the intention of trying again the next day .
however , he then realized that the nidus of infection behind the ear was releasing fluid that was initially transparent but later became opaque .
small volumes of fluid were also released by the meatus . the following day , von troltsch continued advancing with the probe , and the symptoms subsequently improved .
i was not successful using only a probe ; i should have the courage to adopt measures with other instruments that proved to be more efficient . in situations that are similar
, i now would perform deeper incisions and dissect the first bone layer with a chisel , as it seems thin and easy to break21 .
he encouraged them to study mastoidectomy , stating , if this procedure was forgotten or disregarded it was due to misapplications that occurred in the last century and to the peculiar and unusual position of the otologic literature until a short time ago .
von troltsch published an article describing a new method and its indications , as the procedures that other surgical disciplines consider necessary under certain circumstances could not be applied to diseases of the ear21 .
it is worth remembering that until that time , surgeons did not specialize ; for the most part they were general surgeons and performed all kinds of surgical operations , including procedures in ears . in particular , von troltsch motivated his student hermann schwartze to standardize the procedures and indications for mastoidectomy .
in 1873 , hermann schwartze and adolf eysell31 published an article describing the procedure for mastoidectomy .
it was the first systematic description of how and under what conditions the procedure should be performed .
the article explained that curettage of the interior wound might cure the mastoid in patients who presented with destruction of the mastoid cortex .
schwartze also reported a case of a patient who presented with mastoid suppuration with a cortex soft enough to be easily penetrated with a probe .
however , he suggested although the cortex was more often hard , the firm bone could be penetrated with trocars .
schwartze defined the concept of a standard surgical procedure for mastoidectomy , recommending the use of a chisel and hammer to remove the bone in such a way that the antrum could be properly inspected and efficiently drained .
schwartze also stated clear indications for the procedure : to treat purulent secretion through the attic , without consideration for the hearing capacity and removing the malleus and incus to treat chronic purulent otorrhea of the tympanic cavity with positive signs of erosion of the incus and malleus as well as to treat cholesteatoma of the tympanic cavity to improve hearing and treat subjective noise when the malleus is fixed and incurable obstruction of the eustachian tube is observed as well as to treat sclerosis of the tympanic cavity with no signs of death of the auditory nerve . after the publication of schwartze 's findings , a professor at the renowned halle clinic sought to reintroduce mastoidectomy30
31 .
schwartze mastoidectomy , as it was known at the time , was used to establish a direct connection between the mastoid process and the tympanic cavity to enable irrigation with antiseptic solution .
while initially performed in patients suffering from acute mastoiditis , schwartze mastoidectomy was later used to treat exacerbations of chronic infections in which the fistula was found to pass through the bone and , finally , to treat patients suffering from persistent suppurative otitis media .
schwartze studied in berlin and wurzburg and then received his medical degree from the university of berlin in 1853 .
he studied under the tutelage of anton von troltsch and served as an assistant at the anatomopathological institute of the university of wurzburg .
he became professor and director of the otologic clinic at the university of halle in 1859 . in 1863 ,
schwartze , with von troltsch ( 18291890 ) and adam politzer ( 18351920 ) , founded the journal archiv fur ohrenheilkunde , the first journal dedicated exclusively to the pathology and treatment of the ear .
schwartze then founded his own clinic to treat patients suffering from ear diseases32 . during the franco - prussian war
, he served as a doctor at a field hospital and received the medal of the iron cross , second class . in 1903 , he was the first ear surgeon in germany to receive the title of full professor for this discipline .
the university of halle established the hermann - schwartze medal , to be awarded for scientific contributions . near the end of his life , schwartze suffered from restlessness , vertigo , and mental confusion33
34 .
curiously , his mentor von troltsch experienced the same problems ; his obituary reported that ,
recently , an insidious neurosis removed all his energy and finally left him in total need of help .
a simple mastoidectomy or antrostomy was observed to be sufficient in cases of acute mastoiditis .
radical mastoidectomy , a major procedure , was developed for treatment of chronic otitis or acute cases presenting with intracranial complications .
ernst kuster and ernst von bergmann , both general surgeons , were credited with developing the radical surgery , which was known for some time as kuster - bergmann surgery .
they advocated combining the dissection of several spaces of the attic , antrum , and middle ear , transforming these into a single large cavity , into one surgical procedure .
ernst kuster , a german general surgeon , suggested that the schwartze surgery could be extended . in 1888 , kuster presented this idea to the german medical society ; he later published a study reporting that according to his knowledge , abscesses that developed in hard bone at any depth should be completely exposed by dissecting the entire source of the infection .
in contrast to the dissection of the antrum suggested by schwartze , this procedure should open the bone surrounding the antrum as well as the posterior wall of the meatus . he suggested that in principle , all infectious bone disease should be opened and fully exposed , thus enabling removal of all of the affected tissue and extirpation of the source of suppuration . the release of purulent secretions should not be prevented .
only this level of dissection represents true adherence to the surgical principles suggested by kuster .
in particular , if the tympanic cavity was filled with granulations and the membrane as well as the ossicles were partially or totally destroyed , i try to go deeper .
then , guided by my eye , i could remove all the disease with the aid of a sharp spoon36 . in 1889 , von bergmann reported in a seminar that between the upper wall of the external auditory canal and the lower and lateral side of the middle cranial fossa , a thick layer of bone might be observed .
a sizel might penetrate up to the bone of the tympanic membrane without opening the cranial cavity .
after a detailed description of how to reach the posterior wall with the aid of a sizel , von bergmann suggested that upon removal of the wall of the meatus , a single funnel cavity might be created and a finger introduced up to the tympanic cavity to remove the remaining ossicles , granulations , and purulent material with a sharp spoon37
38 .
von bergmann also recommended caution with regard to the depth of the insertion of the sizel in the posterior wall because of the possibility of facial nerve injury .
arthur hartmann from berlin39 reported the commentary of an american otologist on visiting berlin in 1895 :
i was in berlin for only 2 days and saw 3 cases of facial paralysis after a mastoid surgery performed using a chisel , whereas in america i never assisted in any .
emanual zaufal40 further improved radical surgery by dissecting from the antrum to the attic . in 1890 , he modified the schwartze procedure by suggesting removal of the posterior wall .
he revealed his findings at the association of german doctors in april 1890 and later at the 20th convention of swiss and southern german otologists , which was held in prague in may 1890 .
he explained that this procedure was to be performed using a gouge , or a chisel and a hammer , with the aim of passing through the mastoid and reaching the eardrum .
zaufal performed the operation with a forceps - like clamp , placing one scalpel in the channel and the other in the antrostomy .
he then removed the entire wall of the channel with one movement , exposing the entire cavity and the incudomalleolar joint .
now , he wrote , we have the important mission of removing [ the ] malleus , incus as well as the remaining tissue and bone using a sharp spoon or forceps.39
40
zaufal opted to close the retroauricular wound rather than leaving a drain in place .
in 1890 , ludwig stacke , a german otologist , introduced the idea of opening through the external auditory canal to seek the source of the infection ( as in subcortical procedures ) .
this allowed him to remove layers with the option of leaving a skin flap to promote better epithelialization . in 1893 ,
sir william macewan42 established the concept of the suprameatal triangle , also called the macewan triangle .
dissection of the mastoid antrum could be safely performed within this triangle , which is formed by the posterior root of the zygomatic process in front , the superoposterior segment of the external acoustic meatus bone at the bottom , and an imaginary perpendicular line joining these 2 areas and extending from the posterior meatus bone to the root of the zygomatic process at the back .
suddenly , traditional procedures regained popularity due to their ability to preserve hearing and middle ear function .
radical mastoidectomy is one of the surgeries with the higher number of unsatisfactory results . before surgery ,
after surgery , the hearing worsens when the patient is not completely deaf , whereas the otorrhea often continues .
gustave bondy ( figure 6 ) was credited with improving the procedure that was the precursor of the modified radical mastoidectomy in 191044
45
46
47
48
49 .
gustave bondy ( 18701954 ) , austrian surgeon ( university of vienna ) , popularized the modified radical mastoidectomy in which some or all of the middle ear structures were preserved in order to attempt to preserve hearing . in order to release the purulent secretions confined within the antrum and the attic , bondy removed the bone up to the external wall of the attic .
he intended to preserve the tense part of the tympanic membrane and , if possible , the ossicles .
a meatal skin flap was used to seal the defect between the epitympanum and mesotympanum ; alternatively , when the ossicles were preserved , the flaps could be used to cover the exposed bodies49
50
51 .
gustave bondy was born in austria in 1870 ( fig 5 ) and received his medical degree at the university of vienna in 1894 . in 1897
, he began working at the department of otology of the general polyclinic , where he remained an assistant until 1907 , the year he became the first assistant of professor victor urbantschitsch .
bondy became famous for his work , published in 1907 , on the comparative anatomy of auditory organs : beitrage zur vergleichenden anatomie des gohorogans
53 . with expertise in otologic surgery and the treatment of intracranial otologic complications , he became famous for developing criteria for the modified radical mastoidectomy .
moreover , he developed his criteria based on the evaluation of postoperative results assessed by his associate erich ruttin , who performed 1000 radical mastoidectomies in 1910 .
bondy noted that although many of the patients had presented with a normal tympanic membrane , intact ossicles , and relatively normal preoperative hearing associated with attic cholesteatomas that affected only the pars flaccida of the tympanic membrane , their hearing worsened after surgery . before the second world war , bondy moved from vienna to australia , where he lived for the rest of his life .
since the 1930s , mastoidectomy has evolved into a procedure that is now accepted as a standard otologic technique .
the discovery of penicillin by alexander fleming changed the natural course of potentially fatal otologic infections that had previously required surgery despite the risks for complications .
access to preventive medical treatments and the greater possibility for antibiotic therapy allowed armstrong to treat secretory otitis with a ventilator in 1970 .
the incidence of complications of chronic otitis media has recently decreased significantly in developed countries , although it remains high in poor regions .
concern about regaining functional capacity and apprehension regarding reconstruction increased significantly with the introduction of other options .
concomitantly , mastoidectomy was increasingly used for other purposes , including labyrinthectomy , access to the internal auditory canal , and removal of glomus tumors . in recent years
, the advent of implantable hearing prostheses ( cochlear implants and other prostheses ) has increased the importance of the otologic surgeon 's knowledge of mastoidectomy .
wullstein of wrsburg , germany , introduced the surgical microscope after working with zeiss to adapt a microscope developed for colposcopy and in situ diagnosis of uterine cervical cancer .
the present article mainly describes the origins and development of mastoidectomy for the treatment of chronic otitis media and its complications .
however , we can not fail to mention a major , if not the greatest , otologist of the 20th century , dr .
he began his career as a dental surgeon , following in the steps of his father , who was a famous dentist in california in the 1930s and 40s .
he was an innovator who introduced new procedures for the reduction of jaw fractures .
american surgeon who introduced modern techniques of mastoidectomy and the use of mastoid access in otoneurosurgery .
as he wrote in his memoir ( 2011 ) , the advent of penicillin and decreased rates of infection significantly diminished interest in otorhinolaryngology , and residency positions in this field were left vacant53 .
william house fell in love with otology during his medical residency , when he encountered cases of deafness in children for which nothing could be done .
he introduced access to the facial nerve recess ( posterior tympanotomy ) , which led to tympano - ossicular reconstructions with mastoidectomy ( the so - called closed - cavity mastoidectomy or tympanomastoidectomy ) as well as the use of traditional mastoidectomy for the treatment of chronic suppurative and cholesteatomatous otitis , now practiced worldwide . he introduced other innovative techniques in otology , but we have highlighted posterior tympanotomy because of its importance in mastoidectomy . throughout its history , mastoidectomy has shown a tendency to preserve or restore hearing .
currently , mastoidectomy is performed with the aim of preserving the anatomy of the ear , which may require several reoperations because of the tendency of cholesteatomas to recur .
the first mastoidectomy performed in brazil was carried out in 1893 by henrique guedes de melo in rio de janeiro .
it was re - introduced by house with the aim of reaching the internal acoustic meatus and the posterior fossa through the translabyrinthic tract . in 1972 ,
pulec and hitzelberger used the mastoid to access the retrolabyrinthic tract to perform neurectomy initially of the trigeminal nerve and later of the vestibular nerve54 . in 1995 , bento and colleagues presented the possibility of removing acoustic neuromas via the transmastoid and retrolabyrinthine approaches and thereby preserving the cochlear nerve55
56 .
its improvement has relied on the introduction of more elaborate surgical procedures and particularly on advancements in surgical equipment made during the last century . | summary
aim : to describe to the new generation of otologists the origins of mastoidectomy as well as the difficulties our predecessors encountered and the solutions they devised to improve otologic surgery .
method : retrospective literature review - based study .
results : before the mid-19th century , mastoidectomy was performed only sporadically and in most cases as a desperate attempt to save the lives of people suffering from complications of infectious otitis .
the drainage of acute abscesses became a common procedure at the beginning of the 20th century , within the pre - antibiotic era .
the first documented surgical incision to drain an infected ear was described by the french physician ambroise par in the 16th century .
the credit for performing the first mastoidectomy for the removal of purulent secretions went to jean - louis petit .
mastoidectomies were normally performed to treat infections .
however , mastoidectomies were also carried out for other purposes , particularly for the treatment of deafness and tinnitus , during various periods .
sir charles ballance credited johannes riolanus with recommending mastoidectomy for the treatment of tinnitus .
william wilde began the era of modern mastoidectomy with his introduction of the eponymous retroauricular incision .
conclusion : mastoidectomy has evolved significantly throughout its history .
improvements in mastoidectomy have relied on the introduction of more elaborate surgical procedures , especially the advances in surgical equipment during the last century .
mastoidectomy continues to be a life - saving surgical procedure . |
a 74-year - old woman presented as an emergency with a several day history of fevers , malaise and a right subcostal mass .
she had no significant past medical history ; however , she had a negative laparotomy following a road traffic accident many years previously . on examination ,
the patient was apyrexial with a 7 3 cm tender , erythematous mass palpable over the right upper quadrant .
the white cell count on admission was 10.0 10/l , c - reactive protein was 68 mg / l and liver function tests were normal apart from a marginally deranged alkaline phosphatase of 121 iu / l and a gamma glutamyl transferase of 50 iu / l .
a subsequent ct scan of the abdomen confirmed the clinical suspicion of a superficial abscess , which extended superiorly to the costal margin and inferiorly to the right iliac crest .
no other abnormality was demonstrated apart from the incidental finding of a simple cyst on her right kidney .
the abscess discharged spontaneously , the pus culture from it revealed coliforms but tissue from a needle core biopsy demonstrated inflammatory changes only .
the patient was discharged only to return 2 months later with a recurrent abscess that was then formally incised and drained .
again , biopsies revealed chronic inflammatory changes only and there was no evidence of tuberculosis either on biopsies or tissue culture .
as the wound was slow to heal , a further ct scan was performed which suggested a communication between the gallbladder and the abscess cavity ( fig .
1 ) . at subsequent laparotomy , a very fibrotic and inflamed gallbladder , full of large cholesterol stones , was found to be adherent to the anterior abdominal wall via a fistulous track .
this track was divided , thereby freeing the gallbladder from the abdominal wall and then a retrograde cholecystectomy was carried out .
the fistulous track was enlarged , curetted out and irrigated thoroughly with a betadine saline solution . then the cavity was loosely packed with an alginate dressing and left to heal by secondary intention .
the incidence of complications like cholecystocutaneous fistulae has fallen dramatically since the advent of intravenous antibiotics and the emergence of elective and emergency cholecystectomies for gallbladder disease , such that now it is seen as a vanishingly rare phenomenon .
there have been fewer than 25 reports in the medical literature over the past half - century .
spontaneous perforation of calculous cholecystitis to abdominal viscera is not uncommon , particularly to the duodenum and colon , and it has also been seen in the bronchial tree , stomach and urinary tract .
cholecystocutaneous fistulae typically present in the elderly female , as a painless draining sinus tract in the right upper quadrant of the abdomen , but this tract may alternatively drain to the right iliac fossa , right groin , right gluteal region , umbilicus or left upper quadrant .
there is usually a history of chronic biliary tract disease , however patients generally do not report a previous distinct episode of acute cholecystitis .
increased intraluminal pressure in the gallbladder secondary to calculous obstruction is thought to impair blood flow and lymphatic drainage , thereby leading to mural necrosis and perforation , which can either be an acute or indolent process .
acutely , gallbladders may perforate , leading to peritonitis or an abscess around the gallbladder .
a chronic perforation can lead to an internal or external biliary fistula and these arise most commonly from the fundus of the gallbladder .
a combination of microbiology , ct of the abdomen and laparoscopy were sufficient in this case .
following control of the acute inflammatory process in the abdominal wall , an elective cholecystectomy is advisable in these patients .
an open approach is usually favoured , although a laparoscopic technique has been described by kumar . in conclusion , this case underlines the fact that all patients presenting with right - sided abdominal wall abscesses need to be investigated thoroughly for underlying pathology , particularly on a background of calculous biliary tract disease . | spontaneous cholecystocutaneous fistula is an exceptionally unusual complication of chronic calculous cholecystitis now .
the remarkable drop in incidence is probably associated with the introduction of antimicrobial therapy and early surgical management of biliary tract disease .
we report a case of spontaneous cholecystocutaneous fistula in a patient who presented with an abscess in the right upper quadrant . |
in consecutive type 2 dm patients with acs undergoing pci with drug eluting stent implantation , we performed a prospective , randomized , single - center , single - blind , investigator - initiated , crossover study to compare platelet inhibition by 90 mg ticagrelor twice daily versus 10 mg prasugrel once daily . at the time of pci , clopidogrel - naive patients and those on 75 mg clopidogrel for < 7 days without initial loading dose received 600 mg clopidogrel .
patients on clopidogrel < 7 days but with 300-mg loading or those on clopidogrel for > 7 days did not receive any additional loading .
patients were excluded if they had periprocedural iib / iiia inhibitor administration , a history of stroke / transient ischemic attack , age 75 years , body weight < 60 kg , active bleeding , bleeding diathesis , chronic oral anticoagulation treatment , pci or coronary artery bypass grafting during the previous 3 months , hemodynamic instability , platelet count < 100,000/l , hematocrit < 30% , hba1c > 10% , creatinine clearance < 30 ml / min , severe hepatic dysfunction , use of strong cyp3a inhibitors or inducers , increased risk of bradycardia , or severe chronic obstructive pulmonary disease .
all patients were on dm treatment for at least 1 month , which was kept constant during the study period .
after a baseline blood sampling while on clopidogrel and at least 24 h post - pci , patients were randomized ( day 0 ) in a 1:1 ratio using computerized random - number generation by an independent investigator to 90 mg ticagrelor twice daily or 10 mg prasugrel once daily , until day 15 postrandomization . at day
15 2 , a visit was performed for pr measurement and safety evaluation , with the blood sample being obtained 24 h after the last study drug dose , followed by crossover directly to the alternate therapy for an additional 15 days without an intervening washout period .
30 2 , patients returned for the clinical and laboratory assessment as they did on day 15 .
physicians and operators who performed platelet function testing were blinded as to the actual drug used , while an independent physician monitored bleeding and adverse event data .
the study complied with the declaration of helsinki and was approved by the institutional review board of our institution .
peripheral venous blood samples were drawn in a fasting state with a loose tourniquet through a short venous catheter inserted into a forearm vein .
the first 24 ml of blood was discarded to avoid spontaneous platelet activation , and blood was collected in 3.2% citrate ( 1.8-ml draw plastic vacuette tubes ; greiner , monroe , nc ) .
platelet function testing was performed with the verifynow ( accumetrics inc . , san diego , ca ) point - of - care p2y12 function assay as previously described ( 17 ) .
the results are reported in p2y12 reaction units ( pru ) , base , and percent inhibition .
the percent inhibition is calculated as : ( [ base pru]/base ) 100 .
a value 230 pru was considered as an indication of hpr based on a previous investigation , linking the cutoff point to post - pci ischemic risk ( 18 ) .
the primary end point was pr assessed at the end of the two ( precrossover and postcrossover ) study periods .
the hpr rate during the same periods was a secondary end point . bleeding ( per the bleeding academic research consortium [ barc ] definition ) and major adverse cardiac events ( cardiovascular death , myocardial infarction , and stroke ) were evaluated during the pre- and postcrossover period .
based on previously published data and on diabetic subgroup analysis ( 15 ) , we hypothesized that 90 mg ticagrelor twice daily would be superior to 10 mg prasugrel once daily , resulting in an absolute pr difference of 40 pru ( with the assumption that the within - patient standard deviation of the response variable is 50 ) . choosing a power of 80% and a two - sided -level of 0.05
, at least 27 patients in total were required to reach statistical significance based on the above assumptions .
categorical data are presented as frequencies and group percentages , normally distributed continuous data as means sd , and skewed continuous data as medians and range .
the two - sample student t test , mann - whitney u test , and fisher exact test were used for comparison of normal continuous , skewed continuous , and categorical data , respectively .
the primary study end point was analyzed via a mixed linear model , adjusting for period , treatment sequence ( carryover ) , and treatment effect ( fixed factors ) , with patient indicator as a random intercept and pr at baseline as a covariate .
platelet inhibition ( % ) at the end of treatment periods was analyzed with a similar model with period , treatment sequence ( carryover ) , and treatment effect as fixed factors , patient indicator as random intercept , and percent inhibition at baseline as a covariate .
least squares ( ls ) estimates of the mean difference are presented , with 95% cis .
separate ancovas were conducted for the pre- and postcrossover period , with treatment as a fixed effect and pr ( pru ) or inhibition ( % ) at baseline as a covariate .
all tests were two - tailed , and statistical significance was considered for p values < 0.05 .
analyses were performed using spss for windows ( version 16.0 ; spss inc . , chicago , il ) .
in consecutive type 2 dm patients with acs undergoing pci with drug eluting stent implantation , we performed a prospective , randomized , single - center , single - blind , investigator - initiated , crossover study to compare platelet inhibition by 90 mg ticagrelor twice daily versus 10 mg prasugrel once daily . at the time of pci , clopidogrel - naive patients and those on 75 mg clopidogrel for < 7 days without initial loading dose received 600 mg clopidogrel .
patients on clopidogrel < 7 days but with 300-mg loading or those on clopidogrel for > 7 days did not receive any additional loading .
patients were excluded if they had periprocedural iib / iiia inhibitor administration , a history of stroke / transient ischemic attack , age 75 years , body weight < 60 kg , active bleeding , bleeding diathesis , chronic oral anticoagulation treatment , pci or coronary artery bypass grafting during the previous 3 months , hemodynamic instability , platelet count < 100,000/l , hematocrit < 30% , hba1c > 10% , creatinine clearance < 30 ml / min , severe hepatic dysfunction , use of strong cyp3a inhibitors or inducers , increased risk of bradycardia , or severe chronic obstructive pulmonary disease .
all patients were on dm treatment for at least 1 month , which was kept constant during the study period .
after a baseline blood sampling while on clopidogrel and at least 24 h post - pci , patients were randomized ( day 0 ) in a 1:1 ratio using computerized random - number generation by an independent investigator to 90 mg ticagrelor twice daily or 10 mg prasugrel once daily , until day 15 postrandomization . at day
15 2 , a visit was performed for pr measurement and safety evaluation , with the blood sample being obtained 24 h after the last study drug dose , followed by crossover directly to the alternate therapy for an additional 15 days without an intervening washout period .
30 2 , patients returned for the clinical and laboratory assessment as they did on day 15 .
physicians and operators who performed platelet function testing were blinded as to the actual drug used , while an independent physician monitored bleeding and adverse event data .
the study complied with the declaration of helsinki and was approved by the institutional review board of our institution .
peripheral venous blood samples were drawn in a fasting state with a loose tourniquet through a short venous catheter inserted into a forearm vein .
the first 24 ml of blood was discarded to avoid spontaneous platelet activation , and blood was collected in 3.2% citrate ( 1.8-ml draw plastic vacuette tubes ; greiner , monroe , nc ) .
platelet function testing was performed with the verifynow ( accumetrics inc . , san diego , ca ) point - of - care p2y12 function assay as previously described ( 17 ) .
the results are reported in p2y12 reaction units ( pru ) , base , and percent inhibition .
the percent inhibition is calculated as : ( [ base pru]/base ) 100 .
a value 230 pru was considered as an indication of hpr based on a previous investigation , linking the cutoff point to post - pci ischemic risk ( 18 ) .
the primary end point was pr assessed at the end of the two ( precrossover and postcrossover ) study periods .
bleeding ( per the bleeding academic research consortium [ barc ] definition ) and major adverse cardiac events ( cardiovascular death , myocardial infarction , and stroke ) were evaluated during the pre- and postcrossover period .
based on previously published data and on diabetic subgroup analysis ( 15 ) , we hypothesized that 90 mg ticagrelor twice daily would be superior to 10 mg prasugrel once daily , resulting in an absolute pr difference of 40 pru ( with the assumption that the within - patient standard deviation of the response variable is 50 ) . choosing a power of 80% and a two - sided -level of 0.05
, at least 27 patients in total were required to reach statistical significance based on the above assumptions .
categorical data are presented as frequencies and group percentages , normally distributed continuous data as means sd , and skewed continuous data as medians and range .
the kolmogorov - smirnov test was used to test the normality of the samples . the two - sample student t test ,
mann - whitney u test , and fisher exact test were used for comparison of normal continuous , skewed continuous , and categorical data , respectively .
the primary study end point was analyzed via a mixed linear model , adjusting for period , treatment sequence ( carryover ) , and treatment effect ( fixed factors ) , with patient indicator as a random intercept and pr at baseline as a covariate .
platelet inhibition ( % ) at the end of treatment periods was analyzed with a similar model with period , treatment sequence ( carryover ) , and treatment effect as fixed factors , patient indicator as random intercept , and percent inhibition at baseline as a covariate .
least squares ( ls ) estimates of the mean difference are presented , with 95% cis .
separate ancovas were conducted for the pre- and postcrossover period , with treatment as a fixed effect and pr ( pru ) or inhibition ( % ) at baseline as a covariate .
all tests were two - tailed , and statistical significance was considered for p values < 0.05 .
between june 2012 and september 2012 , all 30 randomized patients completed both treatment periods and served as their own control .
there was no difference in patient demographic and clinical characteristics between groups ( table 1 ) .
the primary end point was significantly lower for ticagrelor ( 45.2 pru [ 95% ci 27.463.1 ] ) compared with prasugrel ( 80.8 pru [ 63.098.7 ] ) with ls mean difference of 35.6 pru ( 55.2 to 15.9 , p = 0.001 ) ( table 2 ) .
the secondary end point of the hpr rate was 0% for ticagrelor and 3.3% for prasugrel ( 1 of 30 , p = 1.0 ) .
demographic characteristics of randomized patients pr ( in pru ) at the end of treatment periods pr ( in pru ) by treatment sequence , ls estimates , and 95% cis are presented .
( a high - quality color representation of this figure is available in the online issue . ) platelet inhibition ( % ) at the end of treatment periods individual pr values according to treatment .
( a high - quality color representation of this figure is available in the online issue . )
no major bleedings or major adverse cardiovascular events occurred in either treatment group . in total , six patients ( 20% ) reported a barc-1 bleeding event ( four and two while under ticagrelor and prasugrel , respectively ) .
mild to moderate dyspnea not leading to study drug discontinuation occurred in seven patients ( 23.3% ) while receiving ticagrelor .
in this first direct pharmacodynamic comparison of ticagrelor versus prasugrel in an exclusively dm population , we have demonstrated that ticagrelor provides stronger platelet inhibition than prasugrel . however ,
these results are in the same line of evidence with studies in mixed ( dm and non - dm ) patient populations ( 15,16 ) . in the optimus-3 study , in dm patients with cad , prasugrel resulted in a higher inhibitory platelet activity than high - dose clopidogrel ( 11 ) . in prasugrel - treated patients ,
pr was 120 pru at 7 days ( 24 h after the last maintenance dose ) , and the hpr rate was 2.9% . in dm patients also undergoing pci for acs and treated by clopidogrel ,
switching to 10 mg prasugrel daily resulted in a reduction of pr and hpr at 1 month ( 19 ) .
our findings concerning prasugrel are in agreement with these results . to our knowledge , there has been no previous pharmacodynamic study with ticagrelor exclusively in dm patients . in diabetic rats ,
the consistent , very low pr levels achieved with ticagrelor in our dm patients are similar to those described in stable cad and in acs patients undergoing pci and exhibiting hpr while on clopidogrel and receiving this agent ( 15,21 ) . in the triton - timi
38 trial , the primary end point 's absolute reduction with prasugrel compared with clopidogrel was 4.8% , while in the plato trial , the primary end point 's absolute reduction with ticagrelor compared with clopidogrel was 2.1% . this has led to the suggestion that prasugrel treatment may a be a more appropriate choice when treating dm patients ( 14 ) .
our results point in the opposite direction , since ticagrelor appears to be a stronger antiplatelet agent than prasugrel in dm patients , in consistency with pharmacodynamic results from direct comparisons of the two agents in mixed populations ( 15,16 ) .
this hypothesis , however , should be clinically tested with a direct comparison of the two agents in a dm population .
if this scenario proves to be valid , our study suggests that differences other than pr reduction will be sought between the two agents .
the possibility that , despite very high levels of platelet inhibition achieved by ticagrelor , this treatment may not be sufficient for adequate protection against ischemic events in patients with dm has been raised previously , along with the possible requirement of other therapy , beyond the antiplatelet , antithrombin , or long - term anticoagulation one ( 3 ) .
of note , in the diabetic cohort of the targeted platelet inhibition to clarify the optimal strategy to medically manage acute coronary syndromes ( trilogy acs ) trial , prasugrel did not significantly reduce the frequency of the primary end point , as compared with clopidogrel , a finding consistent with the overall trial results ( 22 )
. only one method of platelet function testing was used , and in a recent study , altering antiplatelet therapy on the basis of results from verifynow did not change clinical outcomes ( 23 ) . however , the verify now assay is most likely the best validated platelet function test and has been found to correlate well with light transmittance aggregometry , which is considered to be the gold standard method .
since the majority of acs patients in our area still receive clopidogrel at first medical contact , switching thereafter to the newer agent most commonly in the pci hospital , we did not study clopidogrel - naive patients for recruitment purposes .
our study was a pharmacodynamic one , and no conclusions on the clinical outcome of dm patients treated with ticagrelor or prasugrel can be drawn . therefore , our results could be considered preliminary , though hypothesis generating . in dm patients with acs who had been pretreated with clopidogrel and underwent pci , ticagrelor achieved a significantly higher platelet inhibition than prasugrel
the relevance of these findings to the clinical efficacy and safety of ticagrelor and prasugrel in dm patients needs further elucidation . | objectiveit has been postulated that prasugrel might be the preferred treatment option in diabetes mellitus ( dm ) patients with acute coronary syndrome ( acs ) undergoing percutaneous coronary intervention ( pci ) .
we aimed to compare the pharmacodynamic action of ticagrelor versus prasugrel.research design and methodsin a prospective , single - center , single - blind , crossover study , 30 consecutive acs patients with dm who had been pretreated with clopidogrel were randomized to either 90 mg ticagrelor twice daily or 10 mg prasugrel once daily with a 15-day treatment period .
platelet reactivity ( pr ) was assessed with the verifynow p2y12 function assay , measured in p2y12 reaction units ( pru).resultspr was significantly lower after ticagrelor ( 45.2 pru [ 95% ci 27.463.1 ] ) compared with prasugrel ( 80.8 pru [ 63.098.7 ] ) , with a least squares mean difference of 35.6 pru ( 55.2 to 15.9 , p = 0.001 ) .
high pr rate was 0% for ticagrelor and 3.3% for prasugrel
( p = 1.0).conclusionsin dm patients with acs who had been pretreated with clopidogrel and who undergo pci , ticagrelor achieves a significantly higher platelet inhibition than prasugrel .
both antiplatelet agents effectively treat high pr .
the relevance of these findings to the clinical efficacy and safety of ticagrelor and prasugrel in dm patients needs further elucidation . |
chronic myeloid leukemia ( cml ) is a clonal myeloproliferative disorder of the primitive hematopoietic stem cell and is characterized by the presence of unique translocation , i.e. , bcr / abl1 known as philadelphia chromosome . in pre imatinib era , cml was treated primarily with radiotherapy , bulsulphan , hydroxyurea , interferon alpha , cytarabine or later with allogeneic hematopoietic stem cell transplantation .
however , at that time also , it was a known fact that the bcr / abl1 , a fusion oncoprotein which is consitutively active tyrosine kinase , plays the central role in the pathogenesis of cml and its suppression can lead to halt in disease progression .
this fact led to the advent of imatinib , tyrosine kinase inhibitor ( tki ) , which inhibits the leukemogenic kinase activity of bcr - abl1 oncoprotein .
imatinib was then evaluated by the famous international randomized study of interferon versus sti571 trial , initiated in the year 2000 . in this trial ,
newly diagnoised chronic phase cml patients were randomized to be either treated with imatinib 400mg / day or interferon plus cytarabine .
the results of this study , as we know , completely changed the therapeutic landscape for philadelphia chromosome positive cml patients ( as shown in table 1 ) .
showing changing trends in survival of cml patients over the years a decade later , since the advent of imatinib , the changing trends in the treatment and the introduction of new tkis have shed light on various aspects of cml . in this era of 2 and 3
generation tki , it is important to understand the basic trends of cml disease , tolerability of the drug , drug resistance and need of transplant in our indian patients . the fact that there is scarcity of the data from india on cml and on the changing trends in the treatment of cml in india , a meeting was conceived to share the in - depth views and clinical data of cml patients from all over india as shown in figure 1 .
indian evidence of cml - mylestone was held on 24 and 25 july 2010 .
kumar prabhash , associate professor , tmh mumbai in collaboration with indian cooperative oncology network . in this meeting
18 oncology centers also submitted their manuscripts and in this article we are presenting the summary of the collaborated data from the submitted manuscripts .
it is imperative to say that this data is retrospective and has its limitations ; however , at the same time it gives useful insight to the presentation , treatment modalities and its outcome in an indian patient with cml . map of india showing location of 22 oncology centers represented at myelstone chronic myeloid leukemia meeting july 2010 another important fact that needs to be mentioned is that with the presence of various patient assisted programs such as gipap , gleevec have been made available to hundreds of non - affording patients and has played a pertinent role in the improvement of the overall outcome of cml patients in india .
there were total 6677 patients from 18 centers and the total number of patients from each individual center is shown in figure 2 .
number of patients from various oncology centers represented at myelstone chronic myeloid leukemia meeting july 2010
incidence : as stated in various cancer registries , cml is one of the commonest adult leukemia in indian population accounting for 30% to 60% of all adult leukemias . the data presented at cml meeting showed that the incidence of cml cases varied from 70% of all leukemia cases at igims , rcc , patna to 16.6% gcri , gujaratthis huge difference in incidence of cml cases at two different centres is difficult to explain , as these are not population based registries and may be because of different cancer populations they cater to.sex ratio : there is male preponderance .
the male to female sex ratio varied from 1:08 ( sterlings , gujarat ) to 3:1 ( tmh , mumbai).median age : the median age of the population varied from minimum 32 years ( nizam institute of medical sciences , hyderabad , south india ) to maximum 42 years ( ashirwad center , mumbai , southwest india ) .
this decade younger population was the most consistent fact presented in almost all studies confirming that in india , median age at presentation is a decade younger compared with the age presented in european ( median age 55years)as well as in american ( median age 66 years ) literature.symptoms at presentation : the most common symptom was splenomegaly ranging from 100% ( wia , chennai ) to 81% ( igims , patna ) followed by hepatomegaly , fatigue , weakness , dragging pain , pallor or sometimes asymptomatic seen in 30% cases ( hcg , bio , bangalore ) . no organomegaly was seen in 5.4% patients ( ihtm , kolkata)in comparison to western data where approximately 40% of patients are asymptomatic and diagnosed on the basis of abnormal counts , majority of indian patients are symptomatic and mostly present with dull aching pain in the left hypochondriac region secondary to splenomegaly.blood counts at presentation : the median hemoglobin ( hb ) ranged from 9 g / dl ( igims , patna ) to 11 g / dl ( aiims , india ) ; the median white blood cell count ranged from 0.46 10/cumm ( rgci , delhi ) to 1.86 10/cumm ( wia , chennai ) .
cml is a myeloproliferative disease , but it can present with as low counts as 0.18 10/cumm ( pgi , chandigarh).cml phase at presentation : the percentage of patients presenting in chronic phase varied from 85% ( pgi , chandigarh ) to 97% ( igims , patna ) with a median of 89.5% as shown in figure 3 , while in european data , the presentation of cml in chronic phase has been reported to be as high as 96.8% .
figure 3chronic myeloid leukemia phase at the time of diagnosis
sokal risk category : the sokal risk category data being retrospective is not complete .
however , few centers have presented their data and it seems the majority of patients are in intermediate risk category ranging from 27% to 47% , while low risk category range from 25% to 55% and high risk category range from 12% to 28% of patients as shown in figure 4 .
figure 4sokal risk category at the time of chronic myeloid leukemia diagnosis
incidence : as stated in various cancer registries , cml is one of the commonest adult leukemia in indian population accounting for 30% to 60% of all adult leukemias .
the data presented at cml meeting showed that the incidence of cml cases varied from 70% of all leukemia cases at igims , rcc , patna to 16.6% gcri , gujaratthis huge difference in incidence of cml cases at two different centres is difficult to explain , as these are not population based registries and may be because of different cancer populations they cater to .
the male to female sex ratio varied from 1:08 ( sterlings , gujarat ) to 3:1 ( tmh , mumbai ) .
median age : the median age of the population varied from minimum 32 years ( nizam institute of medical sciences , hyderabad , south india ) to maximum 42 years ( ashirwad center , mumbai , southwest india ) .
this decade younger population was the most consistent fact presented in almost all studies confirming that in india , median age at presentation is a decade younger compared with the age presented in european ( median age 55years)as well as in american ( median age 66 years ) literature .
symptoms at presentation : the most common symptom was splenomegaly ranging from 100% ( wia , chennai ) to 81% ( igims , patna ) followed by hepatomegaly , fatigue , weakness , dragging pain , pallor or sometimes asymptomatic seen in 30% cases ( hcg , bio , bangalore ) . no organomegaly was seen in 5.4% patients ( ihtm , kolkata)in comparison to western data where approximately 40% of patients are asymptomatic and diagnosed on the basis of abnormal counts , majority of indian patients are symptomatic and mostly present with dull aching pain in the left hypochondriac region secondary to splenomegaly .
blood counts at presentation : the median hemoglobin ( hb ) ranged from 9 g / dl ( igims , patna ) to 11 g / dl ( aiims , india ) ; the median white blood cell count ranged from 0.46 10/cumm ( rgci , delhi ) to 1.86 10/cumm ( wia , chennai ) .
cml is a myeloproliferative disease , but it can present with as low counts as 0.18 10/cumm ( pgi , chandigarh ) .
cml phase at presentation : the percentage of patients presenting in chronic phase varied from 85% ( pgi , chandigarh ) to 97% ( igims , patna ) with a median of 89.5% as shown in figure 3 , while in european data , the presentation of cml in chronic phase has been reported to be as high as 96.8% .
figure 3chronic myeloid leukemia phase at the time of diagnosis
chronic myeloid leukemia phase at the time of diagnosis sokal risk category : the sokal risk category data being retrospective is not complete .
however , few centers have presented their data and it seems the majority of patients are in intermediate risk category ranging from 27% to 47% , while low risk category range from 25% to 55% and high risk category range from 12% to 28% of patients as shown in figure 4 .
figure 4sokal risk category at the time of chronic myeloid leukemia diagnosis
sokal risk category at the time of chronic myeloid leukemia diagnosis it is difficult to interpret the treatment response from various centers . as the time
taken for response varies and also the treated population is quite heterogeneous . the most of the centers there is no mention of early chronic phase ( ecp ) or late chronic phase ( lcp ) at presentation . in many of the centers patients were treated with hydroxyurea , interferon at first and then shifted to imatinib .
the primary resistance to imatinib in newly diagnosed patients can vary from 0.1% ( omega , hyderabad ) to 3% ( aio , raheja ) .
the treatment response of patients at various centers
( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients .
data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients .
ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients.glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m .
the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm .
another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm.safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly .
aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions .
however , there were uneventful outcomes except one baby had meningocele.mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation .
( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients . data from aio , raheja
, mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients .
ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients .
glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m .
the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm .
another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm .
safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly .
aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions .
mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation .
the most common non - hematological toxicity seen was changes in skin pigmentation followed by weight gain , edema , diarrhea , myalgias , arthralgias and transaminitis . some have reported ototoxicity , decrease in vision also ( rcc , patna ) and second malignancies ( aio , raheja , mumbai ) . among non - hematological toxicity most common were anemia and thrombocytopenia .
grade iii / iv toxicity requiring intervention was seen less than 1% ( gcri , gujarat ) and was reported up to 16% by ashirwad , mumbai .
toxicity profile of imatinib drug as reported from various centers the survival varies from 81% to 100% in various studies as shown in table 4 .
it is difficult to interpret the treatment response from various centers . as the time taken for response varies and
the most of the centers there is no mention of early chronic phase ( ecp ) or late chronic phase ( lcp ) at presentation . in many of the centers patients were treated with hydroxyurea , interferon at first and then shifted to imatinib .
the primary resistance to imatinib in newly diagnosed patients can vary from 0.1% ( omega , hyderabad ) to 3% ( aio , raheja ) .
( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients .
data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients .
ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients.glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m . the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm .
another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm.safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly .
aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions .
however , there were uneventful outcomes except one baby had meningocele.mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation .
( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients .
data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients .
ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients .
glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m .
the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm .
another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm .
safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly .
aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions .
mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation .
the most common mutation seen was t315i ( 4 patients ) and m351 t ( 4 patients ) .
the most common non - hematological toxicity seen was changes in skin pigmentation followed by weight gain , edema , diarrhea , myalgias , arthralgias and transaminitis . some have reported ototoxicity , decrease in vision also ( rcc , patna ) and second malignancies ( aio , raheja , mumbai ) . among non - hematological toxicity most common were anemia and thrombocytopenia .
grade iii / iv toxicity requiring intervention was seen less than 1% ( gcri , gujarat ) and was reported up to 16% by ashirwad , mumbai .
the survival varies from 81% to 100% in various studies as shown in table 4 .
various studies confirm that age at presentation is a decade younger and majority presents in chronic phase .
few reports have studied the factors responsible for response and survival of patients with cml .
one such study from ashirwad mumbai shows that on cox regression analysis , age under 40 years , low sokal score , chr and ccyr were significant predictive factors for event free survival event free survival while on multivariate analysis , low sokal score and early chronic phase were the significant predictive factors for ccyr .
similarly from aio , raheja also reiterated that early chronic phase , better tolerability to the drug , no primary resistance are significant indicators of better survival of patients with cml .
socio - economic ( se ) status of patients also had an impact on the response to imatinib .
study by sms , jaipur shows that patients with upper se status had 100% chr while le status had 90.3% chr , also le patients with increased disease burden with 25% having high sokal scores compared with only 6% in upper se patients .
another important finding documented by data from tmh , mumbai is regarding the compliance of the drug .
patients who had more than 4 weeks of gap had only 57% ccyr compared with 80% ccyr in patients taken less than 4 weeks of gap in their treatment .
most important limitation of the retrospective data was uniformity and consistency in the response evaluation .
however , most studies have regularly followed patients with blood counts , other modalities such as cytogenetic response ; molecular response and mutation analysis have been done onlyat few centres .
the main limitation is financial constraints and the second argument is non - availability of better options than imatinib again due to financial reasons .
however , this collective data gives us some insight into patient presentation , tolerability , response and outcome of cml patients in indian settings . | in an effort to collaborate the data of chronic myeloid leukemia ( cml ) patient from all over india , meeting was conceived by icon ( indian cooperative oncology network ) in 2010 .
this article presents the summarized picture of the data presented in the meeting . in the meeting
8115 patients data was presented and 18 centres submitted their manuscripts comprising of 6677 patients .
this data represents large series of patients from all over the country treated on day to day clinical practice and presents the actual outcomes of cml patients in india .
the compilation of data confirms the younger age at presentation , increased incidence of resistance and poor outcomes in patients with late chronic phase .
it also addresses the issues like glivec versus generic drug outcomes , safety of imatinib during pregnancy and mutational analysis among resistant patients .
it concludes that survival and quality of life of cml patients in india has improved over the years especially when treated in early chronic phase .
the generic drug is a good option where original is unable to reach the patient due to various reasons .
hopefully , this effort will provide a platform to conduct systematic studies in learning the best treatment options among cml patients in indian settings . |
nanoparticles have shown promise in many potential applications for the characterization and production of hydrocarbon producing formations ( mokhatab et al .
2006 ) . the use of nanoparticles as sensors ( prodanovic et al . 2010 ) , enhanced oil recovery ( eor ) agents ( holcomb 2012 ; moon 2008 ) or drilling fluid additives ( cai et al .
2011 ) are among the main topics of research . in the process of designing nanoparticles to be used as sensors or eor agents ,
the retention of nanoparticles due to the adsorption onto minerals and/or at the water / oil interface is the fundamental issue .
the degree of adsorption would determine the extent of contact angle change ( wettability alteration ) and/or decrease in interfacial tension ( ift ) .
therefore , it plays an important role in choosing the types of nanoparticles or surface modifying agents for said nanoparticles .
silica nanoparticles are good candidates for such applications due to their low cost of fabrication , their ready availability , and the ability to modify their surfaces by known chemical methods .
the surface modification of silica nanoparticles would allow one to control their hydrophilicity and also to improve their salt tolerance .
there exists a critical salt concentration ( csc ) below which previously studied silica nanoparticles stayed well dispersed in water ( metin et al .
the surface modification significantly improves csc especially for divalent cations ( ca and mg ) .
therefore , they can be injected in reservoir rocks where brine salinity is large and remain as a stable dispersion .
the interaction of nanoparticles with liquids ( water / oil interface ) or solids ( mineral surfaces ) determines the mechanisms of retention of nanoparticles in reservoir rocks .
characterization of the surface charge of nanoparticles by measuring their zeta potential , tracking nanoparticles in the bulk phase or at interface by uv
visible spectroscopy provided means to analyze the effect of ph , surface modification of nanoparticles and their sizes on the stability of nanoparticles at fluid interfaces .
a comprehensive literature review on nanoparticles at fluid interfaces is presented by bresme and oettel ( 2007 ) .
( 2005 ) presented an experimental study on the structure of hydrophobically surface - modified 4.6 nm cadmium selenide nanoparticle assembly at fluid interfaces .
they observed that nanoparticles assembled at the interface of two immiscible liquids ( toluene and water ) as a densely packed monolayer . in the case of particles with different sizes , larger particles displaced smaller particles at a rate consistent with their adsorption energy .
the assembly at the water / toluene interface was liquid - like with no long - range order .
( 2006 ) studied the monolayer behavior of 500 nm silica particles in the presence of a cationic surfactant at the air / water interface . they compared
chemically grafted and physically modified nanoparticles and found that modification methods and chain length of modifying agents determined the structure of particle layering at the interface .
( 2006 ) discussed three types of interactions that are dominant for a charged nanoparticle ( less than 16 nm gold nanoparticles ) at a water / oil interface : energy of water / organic , water / particle and particle / organic interfaces , electrostatic repulsion between particles and van der waals interactions between particles at the interface .
binks and fletcher ( 2001 ) studied the theoretical adsorption of amphiphilic spherical particles ( janus particles ) at the oil / water interface .
later , binks and whitby ( 2005 ) found that precipitated silica particles with a primary particle size ranging from 3.5 to 101 nm could stabilize oil - in - water emulsions .
bresme and quirke ( 1999 ) analyzed the wetting behavior of spherical particles at liquid / water interface by using md simulation .
young s equation provided an accurate estimation of the contact angle even for particle of size 1.5 nm .
contact line tension appeared to have no effect on the contact angle when the surface tensions were on the order of that of water .
particle structuring in a wedge film and the role of structural component of disjoining pressure on displacement of the contact line were studied by wasan and nikolov ( 2003 ) .
the authors observed by video microscopy , a crystal like ordering of 1-m diameter latex particles in the liquid film - meniscus region of wedge - like shape , which resulted in a structural component of disjoining pressure .
then , the authors argued that the structural component of the disjoining pressure was strong enough for a nanofluid composed of 8-nm diameter micelles to move the contact line at oil droplet / glass / aqueous micellar solution interface .
this particle structure formation in the wedge film was confirmed by the theoretical results of boda et al .
however , it is not clear that the structural disjoining pressure is the only mechanism influencing this enhanced spreading of a droplet in the presence of nanoparticle suspensions .
( 2006 ) conducted contact angle measurements of droplets containing 2.5 nm bismuth telluride nanoparticles , which are surface - modified with thioglycolic acid , on glass and silicon wafer substrates in air .
the authors observed that the variation in contact angle depended on the solid surface material and nanoparticle size . at a given concentration
, smaller diameter nanoparticles resulted in greater changes in contact angle than larger diameter nanoparticles would .
the authors argued that greater amount of smaller diameter nanoparticles can fit into this region than larger diameter ones .
the spreading of a sessile droplet on solid surface was also studied theoretically by yang et
, we investigate the interaction of unmodified or surface - modified silica nanoparticles with mineral surfaces and decane / water interface .
ift measurements provide insightful information on the interaction of silica nanoparticles with decane / water interface .
the effects of particle size , concentration and surface type of silica nanoparticles are also studied in detail .
we highlight the importance of surface modifiers on silica nanoparticles and the design of experiments when studying the adsorption of nanoparticles with minerals or water / hydrocarbon interface .
contact angle measurements confirm our findings from nanoparticle dispersion / mineral and nanoparticle dispersion / decane interactions .
the materials studied were aqueous dispersions of silica particles as provided by 3 m , co ( st .
the mean diameters of primary particles are 5 , 25 , and 75 nm , which have an unmodified surface or a modified surface with sulfonate , peg or quaternary ammonium and peg .
the surface modifications describe the surface of the particles after using alkoxysilanes as surface modifying agents .
the zeta potential of the mineral powders were also measured using the zetasizer and were found to be 55 mv for quartz and 31 mv for calcite.table 1zeta potential of silica nanoparticles dispersed in waterparticle diameter ( nm)surface typezeta potential ( mv)5peg24.125peg39.375peg50.05sulfonate31.325sulfonate44.275sulfonate52.85quat9.325quat1.175quat15.25unmodified48.725unmodified60.375unmodified79.8 zeta potential of silica nanoparticles dispersed in water we used a cary 50 ultraviolet visible spectrophotometer ( uv vis ) to determine the concentration of nanoparticles in the supernatant liquid .
a rame - hart contact angle goniometer was used to determine the contact angle of decane droplets on mineral samples immersed in water or nanoparticle dispersion .
pieces of minerals were submersed in the various nanoparticle dispersions for 24 h. the liquid of an amount of 3 ml was separated from the mineral by pipette and centrifuge . the supernatant liquid
was then analyzed by uv vis spectroscopy to determine the silica nanoparticle concentration remaining in the liquid .
principal component analysis combined with multiple regression was applied to construct calibration curves for the particle concentration analysis using the unscrambler chemometric software .
the supernatant liquid was centrifuged at 14,000 rpm for 40 min to separate fines generated by the mineral grains .
the nanoparticle dispersions of 0.04 , 0.2 , and 1 wt% were added to mineral to 10:1 and 5:2 dispersion to mineral weight ratios .
these liquid - to - solid ratios were chosen based on the range of the ratios commonly used during sorption experiments published in literature ( antelmi and spalla 1999 ; marczewski and szymula 2002 ; flury et al .
the calcite mineral was first ground using an agate mortar and pestle set and sieved using meshed sieves ranging from 20 to 100 mesh for 20 min under the agitation of a ro - tap sieve shaker .
the grains were then cleaned by deionized ( di ) water before the adsorption tests .
the uv vis absorbance of the supernatant was measured as a part of the cleaning procedure to make sure that the substrate was cleaned with di water . then the clean calcite grains were air dried at room temperature .
we use 20/35 ( 841/500 m ) mesh calcite and 20/40 ( 841/420 m ) mesh quartz sand . to study the effect of mineral size
the surface energy of clean and dry quartz sand and calcite grains were measured using an inverse gas chromatography ( igc ) method .
igc involves the sorption of a known adsorbate ( vapor ) and an unknown adsorbent stationary phase ( solid sample ) .
the principle of this method has been described in detail elsewhere ( saint flour and papirer 1982 ) .
the series of alkanes used for determining the dispersive surface energy were obtained from acros organics and were of the high performance liquid chromatography ( hplc ) grade .
the cleaned calcite or quartz samples were then packed into the column and flushed with the carrier gas , he at 105 c for 2 h to remove any trace of moisture contamination .
the column is then conditioned for another 2 h by passing the carrier gas , helium at the desired temperature and relative humidity .
the possibility of any moisture accumulation is removed because of continuous outgassing of the column first at elevated temperature and then at the desired temperature .
then a series of solvent pulse injections are carried out and their retention behavior monitored by the flame ionization detector ( fid ) and thermal conductivity detector ( tcd ) placed at the end of the column .
the retention times are recorded and used to determine the total surface energy of the quartz and calcite samples ( saint flour and papirer 1982 ) .
the batch adsorption experiments were carried out with 150 and 500 m calcite grains using silica nanoparticle concentrations of 0.04 , 0.2 , and 1.0 wt% .
the uv vis spectra of the 5 nm unmodified silica nanoparticle dispersions are presented in fig . 1 before and after contact with calcite grains .
for the silica concentrations studied ( 0.04 , 0.2 , and 1 wt% ) there is no significant adsorption of nanoparticles on calcite surfaces .
the effect of grain size was studied with 60/100 mesh calcite and no significant adsorption is observed.fig .
1uv vis spectra of 0.04 , 0.2 , and 1 wt% 5 nm unmodified silica nanoparticle dispersion with and without nacl before and after contact with quartz sand or calcite grains uv vis spectra of 0.04 , 0.2 , and 1 wt% 5 nm unmodified silica nanoparticle dispersion with and without nacl before and after contact with quartz sand or calcite grains the effect of electrolyte on adsorption of silica nanoparticles onto a calcite surface was tested by adding 0.25 wt% nacl to 0.2 wt% unmodified silica nanoparticle dispersion .
the nacl concentration is below csc at 0.5 wt% ( csc ) ( metin et al .
figure 2 shows that there is no significant adsorption in the presence of nacl .
moreover , increasing the size of nanoparticles ( 25 nm diameter ) does not influence the adsorption of unmodified silica nanoparticles on calcite surface ( fig
2uv vis spectra of 0.2 wt% 25 nm unmodified silica nanoparticle dispersion with or without nacl before and after contact with quartz sand or calcite grains uv vis spectra of 0.2 wt% 25 nm unmodified silica nanoparticle dispersion with or without nacl before and after contact with quartz sand or calcite grains we also studied the effect of the surface modification of silica nanoparticles on the adsorption behavior .
the results show that there was no significant adsorption of peg- or sulfonate - modified nanoparticles on calcite ( fig .
3uv vis spectra of 0.04 and 0.2 wt% 5 nm sulfonate or peg - modified silica nanoparticle dispersion after contact with quartz sand or calcite grains uv vis spectra of 0.04 and 0.2 wt% 5 nm sulfonate or peg - modified silica nanoparticle dispersion after contact with quartz sand or calcite grains the adsorption of silica nanoparticles onto quartz sand was studied with batch adsorption experiments . from fig . 1
, we concluded that there is no significant adsorption of unmodified silica nanoparticles onto quartz surface .
the effect of grain size was studied with 60/100 mesh quartz sand and no significant adsorption was observed .
figure 2 shows that at 0.5 wt% nacl concentration , there was not any significant adsorption of silica nanoparticles on quartz surface .
the effect of the surface treatment is presented in fig . 3 for sulfonate- and peg - modified particles , respectively .
similar to the observations with unmodified particles there was not any significant adsorption of surface - modified particles on quartz sand .
dlvo ( derjaguin and landau 1941 ; verwey and overbeek 1948 ) theory was used to model the particle mineral interactions and compare those results to the experimental results .
the electrostatic repulsion energy can be expressed for two parallel , infinite plates with flat double layers as.1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\rm r } = \frac{\varepsilon \kappa } { 8\pi } \left [ { \left ( { \psi_{1}^{2 } + \psi_{2}^{2 } } \right)\left ( { 1 - \coth \kappa h } \right ) + 2\psi_{1 } \psi_{2 } \cos ech(\kappa h ) } \right ] , $ $ \end{document}where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \psi_{1 } $ $ \end{document } and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \psi_{2 } $ $ \end{document } are the surface potential of plates 1 and 2 , is the inverse of electrical double layer , and h is the separation distance . for two spherical colloidal particles , derjaguin approximation for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \kappa a \gg 1 $ $ \end{document } gives2\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\text{r } }
= \frac{{\varepsilon a_{1 } a_{2 } \left ( { \psi_{1}^{2 } + \psi_{2}^{2 } } \right)}}{{4(a_{1 } + a_{2 } ) } } \left [ { \frac{{2\psi_{1 } \psi_{2 } } } { { \left ( { \psi_{1}^{2 } + \psi_{2}^{2 } } \right)}}\ln \left ( { \frac{1 + \exp ( - \kappa h)}{1 - \exp ( - \kappa h ) } } \right ) + \ln \left ( { 1 - \exp ( - 2\kappa h ) } \right ) } \right ] , $ $ \end{document}where a1 and a2 are the radii of particles .
huckel approximation works well even at large surface potentials for h > a. thin , slightly overlapping cloud of a spherical particle and a flat plate gives a repulsive energy approximated by eq .
3.3\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\rm r } = 16\varepsilon a\left ( \frac{kt}{ze } \right)^{2 } \tanh \left ( { \frac{{ze\psi_{\rm s } } } { 4kt } } \right)\tanh \left ( { \frac{{ze\psi_{\rm p } } } { 4kt } } \right)\exp \left ( { - \kappa h } \right ) , $ $ \end{document}where subscripts s and p represent the spherical particle and the flat plate , respectively . derjaguin s approximation is valid for all values of surface potentials provided that a h 1 .
the van der waals attraction potential between two spheres of radii a1 and a2 is given in eq .
4.4\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \begin{aligned } v_{\text{a } } & = & - \frac{{a_{132 } } } { 6}\left [ { \frac{{2a_{1 } a_{2 } } } { { r^{2 } - ( a_{1 } + a_{2 } ) ^{2 } } } + \frac{{2a_{1 } a_{2 } } } { { r^{2 } - ( a_{1 } - a_{2 } ) ^{2 } } } + \ln \left ( { \frac{{r^{2 } - ( a_{1 } + a_{2 } ) ^{2 } } } { { r^{2 } - ( a_{1 } - a_{2 } ) ^{2 } } } } \right ) } \right ] \\ r & = & a_{1 } + a_{2 } + h \\
a_{132 } & = & \left ( { \sqrt { a_{11 } } - \sqrt { a_{33 } } } \right)\left ( { \sqrt { a_{22 } } - \sqrt { a_{33 } } } \right ) \\ \end{aligned } , $ $ \end{document}where a132 , the hamaker constant of silica nanoparticle ( 1 ) , water ( 3 ) and mineral ( 2 ) is calculated from the measured dispersive surface energies of calcite ( 71.76 mj / m ) and quartz ( 107.78 mj / m ) .
the results of a132 for calcite and quartz are calculated as 1.09 10 and 1.62 10 j , respectively .
similarly , the van der waals attraction between sphere and a planar half - space plate can be expressed as5\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\text{a } } = - \frac{{a_{132 } a}}{6h}\left [ { 1 + \frac{h}{2a + h } + \frac{h}{a}\ln \left ( { \frac{h}{2a + h } } \right ) } \right ] $ $ \end{document}for details of above equations , please see hunter ( 2001 ) , goodwin ( 2009 ) and hogg et al .
the total interaction potential vt = va + vr is calculated for the 25 nm unmodified silica nanoparticles
although the energy barrier is small , the predictions by dlvo indicate that there is no adsorption without background nacl concentration .
however , at 0.5 wt% nacl concentration the interaction between the silica nanoparticle and the calcite grain is attractive .
the interaction potential by dlvo theory was also calculated for 5 nm unmodified silica nanoparticle
( note that the condition , a 1 , in the approximation of repulsive energy is not satisfied for these small size nanoparticles ) .
the interaction energy is repulsive in the absence of background nacl concentration , however , the magnitude of the energy barrier is also small which can be easily overcome by the kinetic energy of particles in dispersion.fig .
4total interaction energy between calcite plate and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs . 3 , 5 ) total interaction energy between calcite plate and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs .
3 , 5 ) similar results in dlvo curves are obtained for 25 nm unmodified silica nanoparticles
5 ) for the condition where there is no background electrolyte , but we did not observe any significant adsorption at 0.5 wt% nacl as predicted by dlvo . for 5 nm unmodified silica nanoparticles
quartz interaction potential the particle size is too small to satisfy the condition a 1 .
a small energy barrier occurs which would be overcome by silica nanoparticles promoting the adsorption on quartz . however , insignificant adsorption is experimentally observed.fig .
5total interaction energy between 420-m diameter quartz grain and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs . 2 , 4 ) total interaction energy between 420-m diameter quartz grain and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs . 2 , 4 ) the effects of nanoparticles on interfacial properties
are investigated with unmodified and surface - modified silica nanoparticle dispersions . the wilhemy plate method with a kruss k100 tensiometer
was used to determine the effect of nanoparticles on the ift of decane / water interface .
unmodified silica nanoparticles at various concentrations do not have any effect on ift of water / decane interface ( 43 dynes / cm ) , as presented in figs .
the surface - modified silica nanoparticles with sulfonate surface modification also do not influence the ift either .
a slight decrease is observed as particle concentration increases , but this decrease may be due to the presence of the sulfonate surface modifier . when the ift in presence of sulfonate - modified particles is compared with just the sulfonate modifier in water , almost the same decrease in ift
therefore , the decrease in ift corresponds to the effect of sulfonate molecules not to the presence of the nanoparticles.fig .
6ift of decane / water in presence of 5 nm silica unmodified or surface - modified nanoparticlesfig . 7ift of decane / water in presence of nanoparticles .
the effect of nanoparticle size and concentration is shown ift of decane / water in presence of 5 nm silica unmodified or surface - modified nanoparticles ift of decane / water in presence of nanoparticles .
the effect of nanoparticle size and concentration is shown a significant decrease in ift ( 24 dynes / cm ) occurs with peg - modified silica particles . to determine whether this decrease is because of the peg itself or not
therefore , the presence of peg , attached to silica nanoparticle or free in solution , determines the decrease in ift of water / decane interface .
all the unmodified silica nanoparticle dispersions ( 5 , 25 , and 75 nm ) have almost the same ift value as water / decane , and it appears not to be sensitive to particle concentration or size . based on these findings , it can be concluded that unmodified silica nanoparticles do not stay at the water / interface .
however , with the surface - modified nanoparticles , a decrease in ift is observed as particle concentration increases at a given size or as particle size decreases at a given nanoparticle concentration .
these trends are consistent with the increasing amount of the surface modifiers as the nanoparticle concentration increases and the nanoparticle size decreases . in the case of surface - modified nanoparticles , deviations from ift of water / decane
occur , especially in case of peg - modified silica nanoparticles , as seen in fig .
the type and amount of surface treatment attached to silica nanoparticles determines the extent of the change in ift of water / decane interface .
the degree of ift change is identical for aqueous solutions of surface modifying material in the absence of nanoparticles.fig .
8schematic presentation of adsorption of peg to water / decane interface a in the absence of silica nanoparticle and b attached to silica nanoparticle schematic presentation of adsorption of peg to water / decane interface a in the absence of silica nanoparticle and b attached to silica nanoparticle insignificant adsorption of unmodified silica nanoparticles at the decane / water interface shows that the silica nanoparticles are not amphiphiles and the surface modification alone determines the adsorption of silica nanoparticles on interfaces as observed with the peg - modified silica nanoparticles .
the concentration of peg in aqueous solution and peg attached to silica nanoparticles partitioned to the interface was quantitatively determined by using thermodynamic theory of partitioning ( gibbs equation):6\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{{{\text{d}}\gamma } } { { { \text{d}}c_{2 } } } = - \upgamma_{2 } \frac{rt}{{c_{2 } } } , $ $ \end{document}where r is the universal gas constant , t is the temperature , c2 is the bulk concentration , ift , and 2 is the concentration at interface . the results are presented in fig .
the model parameters , k and max are 52.8 and 9.04 ( molecules / nm ) , respectively.7\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \upgamma_{2 } = \upgamma_{\hbox{max } } \frac{{kc_{2 } } } { { 1 + kc_{2 } } } $ $ \end{document}fig .
9adsorption of peg or peg - modified silica nanoparticles on decane / water interface adsorption of peg or peg - modified silica nanoparticles on decane / water interface the contact angle goniometer was used to monitor and measure the contact angle of decane droplet on quartz or calcite plate immersed in silica nanoparticle dispersions .
the contact angle is measured through the denser phase ( water or nanoparticle dispersion ) . a schematic
the contact angle = 0 corresponds to a surface completely water wet and = 180 corresponds to completely oil wet surface . for effective displacement of oil by water , we need < 90.fig .
10schematic of an oil droplet on a solid substrate ( mineral ) immersed in water schematic of an oil droplet on a solid substrate ( mineral ) immersed in water calcite and quartz plates were immersed in decane for 1 week before the contact angle experiments .
the pictures of a decane droplet immersed in water or silica nanoparticle dispersion are presented in figs .
the effect of particle size and surface type on the contact angle of water / decane on a mineral was studied .
the decane droplet is injected with an inverted j - syringe underneath the substrate . however ,
the pictures in figs . 11 , 12 , and 13 are digitally inverted using a pax - it 2 + digital camera connected directly to the microscope for visual purposes .
11decane droplet on quartz plate immersed in a water and b 5 nm unmodified silica nanoparticle dispersion of 1 wt% .
12decane droplet on quartz plate immersed in a water and b 25 nm unmodified silica nanoparticle dispersion of 1 wt% .
13decane droplet on quartz plate immersed in a water and b 75 nm unmodified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 56 and b 52. the color in b is digitally altered to more easily see the droplet .
( color figure online ) decane droplet on quartz plate immersed in a water and b 5 nm unmodified silica nanoparticle dispersion of 1 wt% . the contact angle is a 59 and b
46 decane droplet on quartz plate immersed in a water and b 25 nm unmodified silica nanoparticle dispersion of 1 wt% .
52 decane droplet on quartz plate immersed in a water and b 75 nm unmodified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 56 and b 52. the color in b is digitally altered to more easily see the droplet .
( color figure online ) the image on the left side in each figure corresponds to the contact angle of water / decane / mineral without nanoparticles and the image on the right side shows the contact angle at nanoparticle dispersion / decane / mineral .
figures 11 , 12 , and 13 show the effect of unmodified silica nanoparticles and their size on the contact angle on quartz plate .
the contact angle does not change significantly in the presence of unmodified nanoparticles of 5 , 25 , or 75 nm diameter .
the unmodified nanoparticles do not change ift of water / decane nor do they adsorb to the quartz surface .
figures 15 , 16 , 17 in the appendix show the effect of sulfonate - modified silica nanoparticles and their size on the contact angle on quartz plate .
the contact angle does not change significantly in the presence of sulfonate - modified nanoparticles of 5 , 25 , or 75 nm diameter .
the sulfonate - modified nanoparticles do not significantly change the ift of water / decane interface nor do they adsorb to the quartz surface .
similar results for contact angle are observed with the quat - modified silica nanoparticles of 5 , 25 , or 75 nm diameter ( figs .
although peg - modified nanoparticles reduce the ift of water / decane from 45 to 24 dynes / cm there is no significant change in contact angle in the presence of these nanoparticles , under the experimental conditions .
figures 21 , 22 , and 23 in appendix show the effect of peg - modified silica nanoparticles and their size on the contact angle on quartz plate .
the contact angle does not significantly change in the presence of peg - modified nanoparticles of 5 , 25 or 75 nm diameter .
the effect of temperature is investigated with 5 nm peg - modified nanoparticles at 80 c , fig . 24 in appendix
. we did not observe any significant change in the contact angle at the higher temperature .
figures 25 , 26 , and 27 in appendix show the effect of sulfonate - modified silica nanoparticles and their size on the contact angle on calcite plate .
the contact angle does not significantly change in the presence of sulfonate - modified nanoparticles of 5 , 25 , or 75 nm diameter .
the change in contact angle in the presence of nanoparticles is plotted as a function of nanoparticle diameter .
14the change in contact angle in the presence of 1 wt% silica nanoparticles the change in contact angle in the presence of 1 wt% silica nanoparticles
the batch adsorption experiments were carried out with 150 and 500 m calcite grains using silica nanoparticle concentrations of 0.04 , 0.2 , and 1.0 wt% .
the uv vis spectra of the 5 nm unmodified silica nanoparticle dispersions are presented in fig . 1 before and after contact with calcite grains .
for the silica concentrations studied ( 0.04 , 0.2 , and 1 wt% ) there is no significant adsorption of nanoparticles on calcite surfaces .
the effect of grain size was studied with 60/100 mesh calcite and no significant adsorption is observed.fig .
1uv vis spectra of 0.04 , 0.2 , and 1 wt% 5 nm unmodified silica nanoparticle dispersion with and without nacl before and after contact with quartz sand or calcite grains uv vis spectra of 0.04 , 0.2 , and 1 wt% 5 nm unmodified silica nanoparticle dispersion with and without nacl before and after contact with quartz sand or calcite grains the effect of electrolyte on adsorption of silica nanoparticles onto a calcite surface was tested by adding 0.25 wt% nacl to 0.2 wt% unmodified silica nanoparticle dispersion .
the nacl concentration is below csc at 0.5 wt% ( csc ) ( metin et al .
figure 2 shows that there is no significant adsorption in the presence of nacl .
moreover , increasing the size of nanoparticles ( 25 nm diameter ) does not influence the adsorption of unmodified silica nanoparticles on calcite surface ( fig
2uv vis spectra of 0.2 wt% 25 nm unmodified silica nanoparticle dispersion with or without nacl before and after contact with quartz sand or calcite grains uv vis spectra of 0.2 wt% 25 nm unmodified silica nanoparticle dispersion with or without nacl before and after contact with quartz sand or calcite grains we also studied the effect of the surface modification of silica nanoparticles on the adsorption behavior .
the results show that there was no significant adsorption of peg- or sulfonate - modified nanoparticles on calcite ( fig .
3uv vis spectra of 0.04 and 0.2 wt% 5 nm sulfonate or peg - modified silica nanoparticle dispersion after contact with quartz sand or calcite grains uv vis spectra of 0.04 and 0.2 wt% 5 nm sulfonate or peg - modified silica nanoparticle dispersion after contact with quartz sand or calcite grains the adsorption of silica nanoparticles onto quartz sand was studied with batch adsorption experiments . from fig . 1
, we concluded that there is no significant adsorption of unmodified silica nanoparticles onto quartz surface .
the effect of grain size was studied with 60/100 mesh quartz sand and no significant adsorption was observed .
figure 2 shows that at 0.5 wt% nacl concentration , there was not any significant adsorption of silica nanoparticles on quartz surface .
the effect of the surface treatment is presented in fig . 3 for sulfonate- and peg - modified particles , respectively .
similar to the observations with unmodified particles there was not any significant adsorption of surface - modified particles on quartz sand .
dlvo ( derjaguin and landau 1941 ; verwey and overbeek 1948 ) theory was used to model the particle mineral interactions and compare those results to the experimental results .
the electrostatic repulsion energy can be expressed for two parallel , infinite plates with flat double layers as.1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\rm r } = \frac{\varepsilon \kappa } { 8\pi } \left [ { \left ( { \psi_{1}^{2 } + \psi_{2}^{2 } } \right)\left ( { 1 - \coth \kappa h } \right ) + 2\psi_{1 } \psi_{2 } \cos ech(\kappa h ) } \right ] , $ $ \end{document}where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \psi_{1 } $ $ \end{document } and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \psi_{2 } $ $ \end{document } are the surface potential of plates 1 and 2 , is the inverse of electrical double layer , and h is the separation distance . for two spherical colloidal particles , derjaguin approximation for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \kappa a \gg 1 $ $ \end{document } gives2\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\text{r } }
= \frac{{\varepsilon a_{1 } a_{2 } \left ( { \psi_{1}^{2 } + \psi_{2}^{2 } } \right)}}{{4(a_{1 } + a_{2 } ) } } \left [ { \frac{{2\psi_{1 } \psi_{2 } } } { { \left ( { \psi_{1}^{2 } + \psi_{2}^{2 } } \right)}}\ln \left ( { \frac{1 + \exp ( - \kappa h)}{1 - \exp ( - \kappa h ) } } \right ) + \ln \left ( { 1 - \exp ( - 2\kappa h ) } \right ) } \right ] , $ $ \end{document}where a1 and a2 are the radii of particles .
huckel approximation works well even at large surface potentials for h > a. thin , slightly overlapping cloud of a spherical particle and a flat plate gives a repulsive energy approximated by eq .
3.3\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\rm r } = 16\varepsilon a\left ( \frac{kt}{ze } \right)^{2 } \tanh \left ( { \frac{{ze\psi_{\rm s } } } { 4kt } } \right)\tanh \left ( { \frac{{ze\psi_{\rm p } } } { 4kt } } \right)\exp \left ( { - \kappa h } \right ) , $ $ \end{document}where subscripts s and p represent the spherical particle and the flat plate , respectively . derjaguin s approximation is valid for all values of surface potentials provided that a h 1 .
the van der waals attraction potential between two spheres of radii a1 and a2 is given in eq .
4.4\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \begin{aligned } v_{\text{a } } & = & - \frac{{a_{132 } } } { 6}\left [ { \frac{{2a_{1 } a_{2 } } } { { r^{2 } - ( a_{1 } + a_{2 } ) ^{2 } } } + \frac{{2a_{1 } a_{2 } } } { { r^{2 } - ( a_{1 } - a_{2 } ) ^{2 } } } + \ln \left ( { \frac{{r^{2 } - ( a_{1 } + a_{2 } ) ^{2 } } } { { r^{2 } - ( a_{1 } - a_{2 } ) ^{2 } } } } \right ) } \right ] \\ r & = & a_{1 } + a_{2 } + h \\
a_{132 } & = & \left ( { \sqrt { a_{11 } } - \sqrt { a_{33 } } } \right)\left ( { \sqrt { a_{22 } } - \sqrt { a_{33 } } } \right ) \\ \end{aligned } , $ $ \end{document}where a132 , the hamaker constant of silica nanoparticle ( 1 ) , water ( 3 ) and mineral ( 2 ) is calculated from the measured dispersive surface energies of calcite ( 71.76 mj / m ) and quartz ( 107.78 mj / m ) .
the results of a132 for calcite and quartz are calculated as 1.09 10 and 1.62 10 j , respectively .
similarly , the van der waals attraction between sphere and a planar half - space plate can be expressed as5\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ v_{\text{a } } = - \frac{{a_{132 } a}}{6h}\left [ { 1 + \frac{h}{2a + h } + \frac{h}{a}\ln \left ( { \frac{h}{2a + h } } \right ) } \right ] $ $ \end{document}for details of above equations , please see hunter ( 2001 ) , goodwin ( 2009 ) and hogg et al .
the total interaction potential vt = va + vr is calculated for the 25 nm unmodified silica nanoparticles
although the energy barrier is small , the predictions by dlvo indicate that there is no adsorption without background nacl concentration .
however , at 0.5 wt% nacl concentration the interaction between the silica nanoparticle and the calcite grain is attractive .
the interaction potential by dlvo theory was also calculated for 5 nm unmodified silica nanoparticle
( note that the condition , a 1 , in the approximation of repulsive energy is not satisfied for these small size nanoparticles ) .
the interaction energy is repulsive in the absence of background nacl concentration , however , the magnitude of the energy barrier is also small which can be easily overcome by the kinetic energy of particles in dispersion.fig .
4total interaction energy between calcite plate and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs . 3 , 5 ) total interaction energy between calcite plate and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs .
3 , 5 ) similar results in dlvo curves are obtained for 25 nm unmodified silica nanoparticles
5 ) for the condition where there is no background electrolyte , but we did not observe any significant adsorption at 0.5 wt% nacl as predicted by dlvo . for 5 nm unmodified silica nanoparticles
quartz interaction potential the particle size is too small to satisfy the condition a 1 .
a small energy barrier occurs which would be overcome by silica nanoparticles promoting the adsorption on quartz . however , insignificant adsorption is experimentally observed.fig .
5total interaction energy between 420-m diameter quartz grain and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs . 2 , 4 ) total interaction energy between 420-m diameter quartz grain and 25-nm diameter silica nanoparticles as a function of nacl concentration ( eqs . 2 , 4 )
the effects of nanoparticles on interfacial properties are investigated with unmodified and surface - modified silica nanoparticle dispersions .
the wilhemy plate method with a kruss k100 tensiometer was used to determine the effect of nanoparticles on the ift of decane / water interface .
unmodified silica nanoparticles at various concentrations do not have any effect on ift of water / decane interface ( 43 dynes / cm ) , as presented in figs .
the surface - modified silica nanoparticles with sulfonate surface modification also do not influence the ift either .
a slight decrease is observed as particle concentration increases , but this decrease may be due to the presence of the sulfonate surface modifier . when the ift in presence of sulfonate - modified particles is compared with just the sulfonate modifier in water , almost the same decrease in ift
therefore , the decrease in ift corresponds to the effect of sulfonate molecules not to the presence of the nanoparticles.fig .
6ift of decane / water in presence of 5 nm silica unmodified or surface - modified nanoparticlesfig
the effect of nanoparticle size and concentration is shown ift of decane / water in presence of 5 nm silica unmodified or surface - modified nanoparticles ift of decane / water in presence of nanoparticles .
the effect of nanoparticle size and concentration is shown a significant decrease in ift ( 24 dynes / cm ) occurs with peg - modified silica particles . to determine whether this decrease is because of the peg itself or not , we prepared a solution having the same peg concentration , but without nanoparticles .
therefore , the presence of peg , attached to silica nanoparticle or free in solution , determines the decrease in ift of water / decane interface .
the results are consistent with our findings for 5 nm particles . all the unmodified silica nanoparticle dispersions ( 5 , 25 , and 75 nm ) have almost the same ift value as water / decane , and it appears not to be sensitive to particle concentration or size . based on these findings
, it can be concluded that unmodified silica nanoparticles do not stay at the water / interface .
however , with the surface - modified nanoparticles , a decrease in ift is observed as particle concentration increases at a given size or as particle size decreases at a given nanoparticle concentration .
these trends are consistent with the increasing amount of the surface modifiers as the nanoparticle concentration increases and the nanoparticle size decreases . in the case of surface - modified nanoparticles , deviations from ift of water / decane
occur , especially in case of peg - modified silica nanoparticles , as seen in fig
the type and amount of surface treatment attached to silica nanoparticles determines the extent of the change in ift of water / decane interface .
the degree of ift change is identical for aqueous solutions of surface modifying material in the absence of nanoparticles.fig .
8schematic presentation of adsorption of peg to water / decane interface a in the absence of silica nanoparticle and b attached to silica nanoparticle schematic presentation of adsorption of peg to water / decane interface a in the absence of silica nanoparticle and b attached to silica nanoparticle insignificant adsorption of unmodified silica nanoparticles at the decane / water interface shows that the silica nanoparticles are not amphiphiles and the surface modification alone determines the adsorption of silica nanoparticles on interfaces as observed with the peg - modified silica nanoparticles .
the concentration of peg in aqueous solution and peg attached to silica nanoparticles partitioned to the interface was quantitatively determined by using thermodynamic theory of partitioning ( gibbs equation):6\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{{{\text{d}}\gamma } } { { { \text{d}}c_{2 } } } = - \upgamma_{2 } \frac{rt}{{c_{2 } } } , $ $ \end{document}where r is the universal gas constant , t is the temperature , c2 is the bulk concentration , ift , and 2 is the concentration at interface .
the model parameters , k and max are 52.8 and 9.04 ( molecules / nm ) , respectively.7\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \upgamma_{2 } = \upgamma_{\hbox{max } } \frac{{kc_{2 } } } { { 1 + kc_{2 } } } $ $ \end{document}fig .
9adsorption of peg or peg - modified silica nanoparticles on decane / water interface adsorption of peg or peg - modified silica nanoparticles on decane / water interface
the contact angle goniometer was used to monitor and measure the contact angle of decane droplet on quartz or calcite plate immersed in silica nanoparticle dispersions .
the contact angle is measured through the denser phase ( water or nanoparticle dispersion ) . a schematic
the contact angle = 0 corresponds to a surface completely water wet and = 180 corresponds to completely oil wet surface . for effective displacement of oil by water , we need < 90.fig .
10schematic of an oil droplet on a solid substrate ( mineral ) immersed in water schematic of an oil droplet on a solid substrate ( mineral ) immersed in water calcite and quartz plates were immersed in decane for 1 week before the contact angle experiments .
the pictures of a decane droplet immersed in water or silica nanoparticle dispersion are presented in figs .
the effect of particle size and surface type on the contact angle of water / decane on a mineral was studied .
. however , the pictures in figs . 11 , 12 , and 13 are digitally inverted using a pax - it 2 + digital camera connected directly to the microscope for visual purposes .
11decane droplet on quartz plate immersed in a water and b 5 nm unmodified silica nanoparticle dispersion of 1 wt% .
12decane droplet on quartz plate immersed in a water and b 25 nm unmodified silica nanoparticle dispersion of 1 wt% .
13decane droplet on quartz plate immersed in a water and b 75 nm unmodified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 56 and b 52. the color in b is digitally altered to more easily see the droplet .
( color figure online ) decane droplet on quartz plate immersed in a water and b 5 nm unmodified silica nanoparticle dispersion of 1 wt% . the contact angle is a 59 and b
46 decane droplet on quartz plate immersed in a water and b 25 nm unmodified silica nanoparticle dispersion of 1 wt% .
the contact angle is a 60 and b 52 decane droplet on quartz plate immersed in a water and b 75 nm unmodified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 56 and b 52. the color in b is digitally altered to more easily see the droplet .
( color figure online ) the image on the left side in each figure corresponds to the contact angle of water / decane / mineral without nanoparticles and the image on the right side shows the contact angle at nanoparticle dispersion / decane / mineral .
figures 11 , 12 , and 13 show the effect of unmodified silica nanoparticles and their size on the contact angle on quartz plate .
the contact angle does not change significantly in the presence of unmodified nanoparticles of 5 , 25 , or 75 nm diameter .
the unmodified nanoparticles do not change ift of water / decane nor do they adsorb to the quartz surface .
figures 15 , 16 , 17 in the appendix show the effect of sulfonate - modified silica nanoparticles and their size on the contact angle on quartz plate .
the contact angle does not change significantly in the presence of sulfonate - modified nanoparticles of 5 , 25 , or 75 nm diameter .
the sulfonate - modified nanoparticles do not significantly change the ift of water / decane interface nor do they adsorb to the quartz surface .
similar results for contact angle are observed with the quat - modified silica nanoparticles of 5 , 25 , or 75 nm diameter ( figs .
although peg - modified nanoparticles reduce the ift of water / decane from 45 to 24 dynes / cm there is no significant change in contact angle in the presence of these nanoparticles , under the experimental conditions .
figures 21 , 22 , and 23 in appendix show the effect of peg - modified silica nanoparticles and their size on the contact angle on quartz plate .
the contact angle does not significantly change in the presence of peg - modified nanoparticles of 5 , 25 or 75 nm diameter .
the effect of temperature is investigated with 5 nm peg - modified nanoparticles at 80 c , fig . 24 in appendix
. we did not observe any significant change in the contact angle at the higher temperature .
figures 25 , 26 , and 27 in appendix show the effect of sulfonate - modified silica nanoparticles and their size on the contact angle on calcite plate .
the contact angle does not significantly change in the presence of sulfonate - modified nanoparticles of 5 , 25 , or 75 nm diameter .
the change in contact angle in the presence of nanoparticles is plotted as a function of nanoparticle diameter .
14the change in contact angle in the presence of 1 wt% silica nanoparticles the change in contact angle in the presence of 1 wt% silica nanoparticles
significant adsorption of unmodified , sulfonate , or peg - modified silica nanoparticles on quartz and calcite surfaces is not observed under the experimental conditions reported in this paper .
increase in particle size from 5 to 25 nm or addition of nacl less than csc does not promote adsorption of nanoparticles on mineral surfaces .
unmodified nanoparticles or those with an anionic ( sulfonate ) or cationic surfactant ( quat ) do not influence the ift of water / decane interface .
however , the presence of peg as a surface coating material significantly decreases the ift .
the degree of change is the same for aqueous solutions of surface modifying materials in the absence of nanoparticles .
based on these results , it can be concluded that silica nanoparticles are not amphiphiles .
a slight change in contact angle is observed in the presence of unmodified or surface - modified nanoparticles with anionic , cationic or nonionic surfactants ( sulfonate , quat , or peg ) .
we further the study of wasan and nikolov ( 2003 ) , binks and whitby ( 2005 ) and lee et al .
( 2006 ) and investigate the effect of nanoparticles and surface treatment on ift , adsorption on minerals and finally on contact angle change .
we show that surface - modified silica nanoparticles have minimal interaction with minerals and the water / decane interface and hence the change in contact angle is not significant .
we isolate the effect of surface treatment on the ift change and conclude that the type and amount of surface treatment attached to silica nanoparticles determines the extent of the change in ift of water / decane interface .
see figs . 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , and 27.fig .
15decane droplet on quartz plate immersed in a water and b 5 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
16decane droplet on quartz plate immersed in a water and b 25 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
17decane droplet on quartz plate immersed in a water and b 75 nm sulfonate - modified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 55 and b 43. the color in b is digitally altered to see the droplet clearly since the light transmittance of nanoparticle dispersion is low because of particle size .
18decane droplet on quartz plate immersed in a water and b 5 nm quat / peg ( 50:50)-modified silica nanoparticle dispersion of 1 wt% . the contact angle is a 91 and b 14fig .
19decane droplet on quartz plate immersed in a water and b 25 nm quat / peg ( 50:50)-modified silica nanoparticle dispersion of 1 wt% .
20decane droplet on quartz plate immersed in a water and b 75 nm quat / peg ( 50:50)-modified silica nanoparticle dispersion of 0.5 wt% .
21decane droplet on quartz plate immersed in a water and b 5 nm peg - modified silica nanoparticle dispersion of 1 wt% .
the contact angle is a 20 and b 14. the quartz plate in a is not tiltedfig .
22decane droplet on quartz plate immersed in a water and b 25 nm peg - modified silica nanoparticle dispersion of 1 wt% .
23decane droplet on quartz plate immersed in a water and b 75 nm peg - modified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 52 and b 49. the color in b is digitally altered to see the droplet clearly since the light transmittance of nanoparticle dispersion is low because of particle size .
24decane droplet on quartz plate immersed in a water at 80 c and b 5 nm peg - modified silica nanoparticle dispersion of 1 wt% at 80 c .
25decane droplet on calcite plate immersed in a water and b 5 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
26decane droplet on calcite plate immersed in a water and b 25 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
27decane droplet on calcite plate immersed in a water and b 75 nm sulfonate - modified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 38 and b 36 decane droplet on quartz plate immersed in a water and b 5 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
20 decane droplet on quartz plate immersed in a water and b 25 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
the contact angle is a 51 and b 38 decane droplet on quartz plate immersed in a water and b 75 nm sulfonate - modified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 55 and b 43. the color in b is digitally altered to see the droplet clearly since the light transmittance of nanoparticle dispersion is low because of particle size .
( color figure online ) decane droplet on quartz plate immersed in a water and b 5 nm quat / peg ( 50:50)-modified silica nanoparticle dispersion of 1 wt% .
14 decane droplet on quartz plate immersed in a water and b 25 nm quat / peg ( 50:50)-modified silica nanoparticle dispersion of 1 wt% .
20 decane droplet on quartz plate immersed in a water and b 75 nm quat / peg ( 50:50)-modified silica nanoparticle dispersion of 0.5 wt% .
26 decane droplet on quartz plate immersed in a water and b 5 nm peg - modified silica nanoparticle dispersion of 1 wt% .
the contact angle is a 20 and b 14. the quartz plate in a is not tilted decane droplet on quartz plate immersed in a water and b 25 nm peg - modified silica nanoparticle dispersion of 1 wt% .
51 decane droplet on quartz plate immersed in a water and b 75 nm peg - modified silica nanoparticle dispersion of 0.5 wt% .
the contact angle is a 52 and b 49. the color in b is digitally altered to see the droplet clearly since the light transmittance of nanoparticle dispersion is low because of particle size .
( color figure online ) decane droplet on quartz plate immersed in a water at 80 c and b 5 nm peg - modified silica nanoparticle dispersion of 1 wt% at 80 c .
45 decane droplet on calcite plate immersed in a water and b 5 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
24 decane droplet on calcite plate immersed in a water and b 25 nm sulfonate - modified silica nanoparticle dispersion of 1 wt% .
18 decane droplet on calcite plate immersed in a water and b 75 nm sulfonate - modified silica nanoparticle dispersion of 0.5 wt% . | the adsorption of silica nanoparticles onto representative mineral surfaces and at the decane / water interface was studied .
the effects of particle size ( the mean diameters from 5 to 75 nm ) , concentration and surface type on the adsorption were studied in detail . silica nanoparticles with four different surfaces [ unmodified , surface modified with anionic ( sulfonate ) , cationic ( quaternary ammonium ( quat ) ) or nonionic ( polyethylene glycol ( peg ) ) surfactant ] were used .
the zeta potential of these silica nanoparticles ranges from 79.8 to 15.3 mv .
the shape of silica particles examined by a hitachi - s5500 scanning transmission electron microscope ( stem ) is quite spherical .
the adsorption of all the nanoparticles ( unmodified or surface modified ) on quartz and calcite surfaces was found to be insignificant .
we used interfacial tension ( ift ) measurements to investigate the adsorption of silica nanoparticles at the decane / water interface .
unmodified nanoparticles or surface modified ones with sulfonate or quat do not significantly affect the ift of the decane / water interface .
it also does not appear that the particle size or concentration influences the ift .
however , the presence of peg as a surface modifying material significantly reduces the ift . the peg surface modifier alone in an aqueous solution , without the nanoparticles , yields the same ift reduction for an equivalent peg concentration as that used for modifying the surface of nanoparticles .
contact angle measurements of a decane droplet on quartz or calcite plate immersed in water ( or aqueous nanoparticle dispersion ) showed a slight change in the contact angle in the presence of the studied nanoparticles .
the results of contact angle measurements are in good agreement with experiments of adsorption of nanoparticles on mineral surfaces or decane / water interface .
this study brings new insights into the understanding and modeling of the adsorption of surface - modified silica nanoparticles onto mineral surfaces and water / decane interface . |
epidemiological studies report about 700 000 cases ( including 300 000 new - onset cases ) of oral cancer worldwide in the past 5 years , with 145 000 deaths .
although there has been improvement in diagnosis and treatment of oral cancer , prognosis of oral squamous cell carcinoma ( oscc ) is still poor , the 5-year survival rate is low , and the average 5-year survival rate is about 50% .
the high mortality of oscc is mainly due to invasion and metastasis in tumor cells .
a growing number of studies have confirmed that the inflammatory tumor microenvironment was associated with the development , invasion , and metastasis of tumor cells
. tumor necrosis factor alpha ( tnf- ) is secreted by macrophages and plays an vital role in the process of infection and immune response . according to research on renal cell carcinoma , small doses of tnf- in the tumor microenvironment
can enhance tumor cell proliferation , invasion , and metastasis , increase white blood cells , form blood vessels , and induce upregulation of other cytokines ( e.g. , angiogenesis factor and matrix metalloproteinases ) , and trigger epithelial - mesenchymal transition ( emt ) of tumor cells . in addition , an animal experiment also found that silencing the tnf- gene can inhibit the proliferation and migration of gastric cancer cells .
extensive research on the tnf-/nf-b / snail pathway confirmed that tnf- can regulate the expression of transcription factor snail to induce emt and promote the invasive and migratory activities of tumor cells .
the nf-b pathway is activated by tnf- to promote tumor cell proliferation and inhibition of apoptosis , and enhances the tumor angiogenesis ability and the potential of invasion and metastasis .
the nf-b signaling pathway includes receptors and the proximal signal link protein , ib kinase complexes , and ib and nf-b dimers .
normally , nf-b is hidden by combining with ib when cells are stimulated by various inflammatory stimuli such as growth factors and infectious microbes , activating ikk , which leads to ib degradation , and release of nf-b dimers .
then , nf-b is transferred to the nucleus with further activation , and combines with the gene to promote transcription of the target gene .
nf-b is a transcription factor for different biological processes : immune response ; cell growth , proliferation , survival and apoptosis ; stress response ; embryogenesis ; and development .
nf-b is also essential to human health , but the abnormal activation of the nf-b can cause a variety of autoimmunity , inflammation , and malignant diseases , including rheumatoid arthritis , atherosclerosis , inflammatory bowel disease , multiple sclerosis , and malignant tumors .
recent data showed that ikk is involved in the main pathway of proinflammatory genes , and expression of ikk plays a central role in tnf--mediated nf-b activation and expression .therefore , inhibition of the nf-b signaling pathway could be of use in treating cancer and inflammatory diseases .
based on the above studies , the present study explored the role of nf-b in oscc progression .
we observed invasive and migratory activities of oscc after activation of the nf-b pathway by tnf- and inhibition of nf-b pathway signaling with the use of an inhibitor ( bay11 - 7082 ) .
three human oscc cell lines ( hn4 , hn6 , and cal27 ) were purchased from the american type culture collection ( atcc , manassas , va , usa ) .
oscc cells were cultured in dmem / f12 ( gibco , france ) supplemented with 10% fetal bovine serum ( fbs ) ( gibco ) , 100 u / ml penicillin , and streptomycin ( 100 g / ml ) at 37c in a 5% co2 humidified incubator .
the experimental group cells were stimulated with 10 ng / ml tnf- for 3 h , 6 h , 12 h , 24 h , 48 h , and 72 h. hn6 cells were stimulated with 5 um bay11 - 7082 , hn4 , and cal27 cells , as the suppression group , were stimulated with 10 um bay11 - 7082 for 24 h , 48 h , and 72 h , respectively .
total rna of the experimental group , suppression group , and control group oscc cells was extracted using the trizol reagent ( ambion , usa ) .
rna was reverse - transcribed into cdna with a one - step rt - pcr kit ( tiangen biotech co. , ltd .
real - time quantitative pcr , using realmaster mix ( sybr green ) ( tiangen ) with a 7800 abi rt - pcr system ( applied biosystems , foster city , ca , usa ) .
pcr proceeded under the conditions of 95c for 30 s , 95c for 15 s , 60c for 30 s , and 68c for 30 s ( 40 cycles ) .
the relative gene expression was calculated using the 2 method in at least 3 independent experiments .
the primers used for the rt - pcr were as followed : ikk ( 5-acctcgagaccagcgaactg-3 , 5-tgctatccgggcttccactg-3 ) , p65 ( 5-tcctgtgcgtgtctccatgc-3 , -tggctgatctgcccagaagg-3 ) , b - action ( 5-gccgggacctgactgactac-3 , 5-cggagtacttgcgctcagga-3 ) .
hn4 , hn6 , and cal27 oscc cells were seeded in 6-well plates ( 10 cells / well ) , and , after various treatments , they were lysed in pre - warmed laemmli buffer ( sigma , usa ) .
these membranes were subsequently blocked for 1 h with 5% non - fat milk in tbst at room temperature and then incubated overnight at 4c with primary antibodies .
a 1 : 500 dilution of ikk , p65 , and a 1 : 1000 dilution of b - actin was used .
hn4 , hn6 , and cal27 oscc cells were seeded in 6-well plates and cultured to reach 90% confluency in complete medium .
next , a sterile 10-ul pipet tip was used to scrape 3 wounds through the cell monolayer , and the cells were gently rinsed with pbs .
the experimental group cells were treated with 10 ng / ml tnf- in serum - free medium .
the suppression group cells were treated with bay11 - 7082 in serum - free serum .
pictures were taken immediately before treatment as the control and after treatment for 6 h , 12 h , and 24 h on an inverted microscope ( olympus ) .
hn4 , hn6 , and cal27 oscc cells suspended in 200 ul of serum - free medium were loaded onto an upper 8-m pore size chamber inserted in a 24-well cell culture plate .
the lower chamber was filled with dmem / f12 supplemented with 10% fbs as a chemoattractant .
the cells were allowed to adhere before being treated with 10 ng / ml tnf- and then incubated for 24 h at 37c in 5% co2 . after this incubation ,
the inserts were removed and the remaining non - migrating cells on the upper surface of the membrane were removed with a cotton swab .
the cells that migrated to the lower surface of the membrane were fixed with 10% paraformaldehyde ( beyotime ) for 30 min at room temperature , washed with pbs , and then stained with 0.1% crystal violet ( beyotime ) .
pictures of 5 randomly chosen fields were taken , and migrating cells were counted using image j software .
the assays were repeated in 3 or more independent experiments and results are expressed as the mean s.d .
three human oscc cell lines ( hn4 , hn6 , and cal27 ) were purchased from the american type culture collection ( atcc , manassas , va , usa ) .
oscc cells were cultured in dmem / f12 ( gibco , france ) supplemented with 10% fetal bovine serum ( fbs ) ( gibco ) , 100 u / ml penicillin , and streptomycin ( 100 g / ml ) at 37c in a 5% co2 humidified incubator .
the experimental group cells were stimulated with 10 ng / ml tnf- for 3 h , 6 h , 12 h , 24 h , 48 h , and 72 h. hn6 cells were stimulated with 5 um bay11 - 7082 , hn4 , and cal27 cells , as the suppression group , were stimulated with 10 um bay11 - 7082 for 24 h , 48 h , and 72 h , respectively .
total rna of the experimental group , suppression group , and control group oscc cells was extracted using the trizol reagent ( ambion , usa ) .
rna was reverse - transcribed into cdna with a one - step rt - pcr kit ( tiangen biotech co. , ltd .
real - time quantitative pcr , using realmaster mix ( sybr green ) ( tiangen ) with a 7800 abi rt - pcr system ( applied biosystems , foster city , ca , usa ) .
pcr proceeded under the conditions of 95c for 30 s , 95c for 15 s , 60c for 30 s , and 68c for 30 s ( 40 cycles ) .
the relative gene expression was calculated using the 2 method in at least 3 independent experiments .
the primers used for the rt - pcr were as followed : ikk ( 5-acctcgagaccagcgaactg-3 , 5-tgctatccgggcttccactg-3 ) , p65 ( 5-tcctgtgcgtgtctccatgc-3 , -tggctgatctgcccagaagg-3 ) , b - action ( 5-gccgggacctgactgactac-3 , 5-cggagtacttgcgctcagga-3 ) .
hn4 , hn6 , and cal27 oscc cells were seeded in 6-well plates ( 10 cells / well ) , and , after various treatments , they were lysed in pre - warmed laemmli buffer ( sigma , usa ) .
these membranes were subsequently blocked for 1 h with 5% non - fat milk in tbst at room temperature and then incubated overnight at 4c with primary antibodies .
a 1 : 500 dilution of ikk , p65 , and a 1 : 1000 dilution of b - actin was used .
hn4 , hn6 , and cal27 oscc cells were seeded in 6-well plates and cultured to reach 90% confluency in complete medium .
next , a sterile 10-ul pipet tip was used to scrape 3 wounds through the cell monolayer , and the cells were gently rinsed with pbs .
the experimental group cells were treated with 10 ng / ml tnf- in serum - free medium .
the suppression group cells were treated with bay11 - 7082 in serum - free serum .
pictures were taken immediately before treatment as the control and after treatment for 6 h , 12 h , and 24 h on an inverted microscope ( olympus ) .
hn4 , hn6 , and cal27 oscc cells suspended in 200 ul of serum - free medium were loaded onto an upper 8-m pore size chamber inserted in a 24-well cell culture plate .
the lower chamber was filled with dmem / f12 supplemented with 10% fbs as a chemoattractant .
the cells were allowed to adhere before being treated with 10 ng / ml tnf- and then incubated for 24 h at 37c in 5% co2 . after this incubation , the inserts were removed and the remaining non - migrating cells on the upper surface of the membrane were removed with a cotton swab . the cells that migrated to the lower surface of the membrane were fixed with 10% paraformaldehyde ( beyotime ) for 30 min at room temperature , washed with pbs , and then stained with 0.1% crystal violet ( beyotime ) .
pictures of 5 randomly chosen fields were taken , and migrating cells were counted using image j software .
the assays were repeated in 3 or more independent experiments and results are expressed as the mean s.d .
we observed that ikk and p65 in hn4 , hn6 , and cal27 cells increased significantly after tnf- stimulation . after being treating with 10 ng / ml tnf- for 0 h ,
3 h , 6 h , 12 h , 24 h , 48 h , and 72 h , rt - pcr and western blot analysis revealed that the level of ikk and p65 were significantly increased after 24 h , 48 h , and 72 h ( figure 1a , 1b ) .
firstly , hn4 , hn6 , and cal27 cells were treated with bay11 - 7082 before 1-h tnf- stimulation . after being treated with bay11 - 7082 for 0 h , 24 h , 48 h , and 72 h , real - time rt - pcr and western blot analysis
reveal that the level of ikk and p65 were not significantly changed after 24 h,48 h , and 72 h ( figure 2a , 2b ) .
the results of western blot analysis indicated no statistically significant difference ( figure 2c ) , showing that the nf-b signaling pathway was not activated by tnf- after blocking by bay11 - 7082 in oral cancer cells .
oscc cells in the experimental group treated with tnf- almost closed the scratch wound at 24 h , but the suppression group and control group could not , especially in hn4 and hn6 cells ( figure 3a ) .
there was no significant difference in migration ability between the bay11 - 7082 treatment group and the control group ( figure 3b ) .
the photographs of transwell invasion assay demonstrate that the experimental group cells treated with tnf- were more invasive than in the suppression group and control group ( figure 4a ) .
the quantitative analysis confirmed that the invasive abilities were significantly increased in hn4 ( 2.785-fold ) , hn6 ( 2.512-fold ) , and cal27 ( 2.058-fold ) after tnf- treatment ( figure 4b ) .
there was no significant difference in invasive ability between the bay11 - 7082 treatment group and the control group ( figure 4c ) .
thus , we conclude that bay11 - 7082 inhibits the migratory and invasive ability of oscc cells promoted by tnf-.
we observed that ikk and p65 in hn4 , hn6 , and cal27 cells increased significantly after tnf- stimulation . after being treating with 10 ng / ml tnf- for 0 h ,
3 h , 6 h , 12 h , 24 h , 48 h , and 72 h , rt - pcr and western blot analysis revealed that the level of ikk and p65 were significantly increased after 24 h , 48 h , and 72 h ( figure 1a , 1b ) .
firstly , hn4 , hn6 , and cal27 cells were treated with bay11 - 7082 before 1-h tnf- stimulation . after being treated with bay11 - 7082 for 0 h , 24 h , 48 h , and 72 h , real - time rt - pcr and western blot analysis
reveal that the level of ikk and p65 were not significantly changed after 24 h,48 h , and 72 h ( figure 2a , 2b ) .
the results of western blot analysis indicated no statistically significant difference ( figure 2c ) , showing that the nf-b signaling pathway was not activated by tnf- after blocking by bay11 - 7082 in oral cancer cells .
oscc cells in the experimental group treated with tnf- almost closed the scratch wound at 24 h , but the suppression group and control group could not , especially in hn4 and hn6 cells ( figure 3a ) .
there was no significant difference in migration ability between the bay11 - 7082 treatment group and the control group ( figure 3b ) .
the photographs of transwell invasion assay demonstrate that the experimental group cells treated with tnf- were more invasive than in the suppression group and control group ( figure 4a ) .
the quantitative analysis confirmed that the invasive abilities were significantly increased in hn4 ( 2.785-fold ) , hn6 ( 2.512-fold ) , and cal27 ( 2.058-fold ) after tnf- treatment ( figure 4b ) .
there was no significant difference in invasive ability between the bay11 - 7082 treatment group and the control group ( figure 4c ) .
thus , we conclude that bay11 - 7082 inhibits the migratory and invasive ability of oscc cells promoted by tnf-.
our results showed that the mrna and protein expression of ikk and p65 in oscc cells increase after tnf- stimulation , and the invasion and metastasis ability of oscc cells are enhanced . after adding bay11 - 7082 to oscc cells , the stimulating effect of tnf- decreased .
the results show that tnf- promotes oral cancer cell invasion and metastasis by activating the nf-b signaling pathway .
the stimulating effect of tnf- in oscc cells decreased significantly but did not disappear completely after inhibiting the nf-b signaling pathway
tnf- can promote oral cancer cell invasion and metastasis , and this effect may be associated with activation of the nf-b signaling pathway .
cancer recurrence and death in cancer patients are mostly due to invasion and metastasis of tumor cells .
tumor metastasis involves tumor cells spreading from the primary site to regional lymph nodes or spreading to a distant site through a variety of ways .
tumor cells grow and proliferate after arriving in other tissues and organs , forming secondary tumors with the same nature as the primary tumor .
tumor cells are surrounded by the tumor microenvironment , which contains a variety of cell types ( e.g. , epithelial cells , fibroblasts , and inflammatory cells ) , as well as extracellular matrix and extracellular molecules ( e.g. , tnf - alpha and tgf - beta ) .
the tumor microenvironment also plays an important role in the occurrence , development , and metastasis of oral cancer .
tnf- in the tumor microenvironment acts as an inflammatory mediator that triggers emt of tumor cells and promotes tumor metastasis .
signaling pathways and transcription factors activated by tnf- are considered key to invasion and metastasis in cancer cells .
the growth of cancer cells is inhibited and the apoptosis of cancer cells is promoted through targeted inhibition of transcription factors and signaling pathways .
tnf- promotes oral cancer cell invasion and metastasis , which relies on nf-b signaling pathway activation .
interacts with cyclind1 , cyclin e , and c - myc to promote tumor cell proliferation , and promotes survival and inhibits apoptosis through bcl-2 and bcl - xl , which regulate transcription of the cellular inhibitor of apoptosis .
nf-b has also been found to regulate the expression of matrix metalloproteinases ( mmps ) , especially the expression of mmp9 , which degrades and reshapes the extracellular matrix to enhance invasion of tumor cells .
several studies showed that the expression of snail , slug , zeb1/2 , and twist1 is altered via nf-b activation and triggers emt .
a breast cancer model experiment found that ent was reversed and metastasis was reduced through inhibiting nf-b .
research on pneumonia demonstrated that tnf- and tgf- upregulated snail twist1 , slug , and zeb2 , dependent on nf-b activation , and triggered emt .
in addition to the nf-b signaling pathway , there are some other pathways related to tumor cell invasion and biological behavior .
. found that pi3k / akt / nf-b pathway activation can enhance lung cancer cells invasive ability .
the pi3k / akt signaling pathway upregulated snail and slug to inhibit of the expression of e - cadherin ; and promoted the degradation by elevating mmps , which directly induced emt and strengthened the invasion ability .watson confirmed that liver cancer cells secreted vegf , activating the p38mapk signaling pathway , and promoting cell adhesion and angiogenesis . a study on colon cancer and prostate cancer cells found that tnf- induced snail stabilization through the akt / gsk signaling pathway to induce emt . in colorectal tumor transplantation , model tumor growth was inhibited by suppressing the notch and wnt pathways .
cultivation of oral cancer cells in vitro found that tnf- and nf-b had high expression levels .
our previous experiments showed that after the application of tnf - a stimulation in oscc cultivated in vitro in a simulated tumor microenvironment , snail of oscc cells was upregulated , and invasion of oscc cells also increased , probably via activation of the nf-b pathway .
our results suggest that tnf- enhances the invasion and metastasis ability of oral cancer cells via the nf-b signaling pathway . | backgroundrecent evidence reveals that the inflammatory microenvironment is associated with tumor migration , invasion , and metastasis .
tumor necrosis factor- ( tnf- ) play a vital role in regulation of the inflammatory process in tumor development .
nuclear factor - kappa b ( nf-b ) is one of the key transcription factors which regulate processes in tumor promotion .
the aim of this study was to explore the role of nf-b on the invasion and migration of oral squamous cell carcinoma ( oscc).material / methodsthe ikk and p65 mrna and protein levels were determined by quantitative rt - pcr and western blot .
wound scratch healing assays and transwell migration assays were used to evaluate the effect of tnf- and bay11 - 7082 on the migration of the oscc cell lines ( hn4 , hn6 , and cal27).resultswe observed a significant increase of the expression level of ikk and p65 in oscc cells from the experimental group at 24 h , 48 h , and 72 h after tnf- stimulation .
invasion and metastasis of oscc cells was obviously improved after the tnf- stimulation .
invasion and metastasis ability of oscc cells was inhibited in the suppression group , and no significant changes were observed in expression level of ikk and p65 after the use of bay11-7082.conclusionsour results suggest that tnf- enhances the invasion and metastasis ability of oscc cells via the nf-b signaling pathway . |
cancer represents a
major worldwide health problem , with nearly
1.6 million new cases estimated to occur in 2014 in the u.s . alone .
the past 40 years of research and development
of therapeutics brought improved patients survival ; however , malignant neoplasias remain the second
most common cause of death in the u.s . , accounting for over 20% of
all deaths .
consequentially , major efforts
are being put into the development of novel therapeutic approaches .
classical approaches comprise surgery , chemotherapy ,
radiation therapy , and immunotherapy , the method of choice depending
on tumor type and progression stage .
cancer
chemotherapy has recently seen important conceptual advances , such
as tumor - specific tissue targeting , prodrug
modifications , and development of small
molecule inhibitors of aberrant signaling nodes in cancer .
a significant drawback of molecules targeted
to tumor - specific features is the introduction of evolutionary pressure
upon the cancer cells , which often results in the emergence of resistant
clones .
broadly cytotoxic chemotherapeutics
( e.g. , cis - platin or doxorubicin ) on the other hand
commonly exhibit severe side effects , such as cardiotoxicity , neurotoxicity , and
neutropenia .
imidazole
( py - im ) polyamides are a modular class
of dna - binding small molecules capable of binding defined sequences
with affinities and specificities comparable to those of dna - binding
proteins .
they are cell - permeable scaffolds and have been shown to displace various transcription
factors from cognate binding sites , leading
to altered gene expression profiles .
inhibition of rna pol ii elongation
was observed , accompanied by degradation of the large rna pol ii subunit
and induction of the p53 stress response , without concomitant dna
damage .
most recently , our laboratory
has transitioned to in vivo experimentation , demonstrating bioavailability and efficacy of varying py - im polyamides in
tumor xenografts models in mouse .
antitumor
effects with limited systemic toxicity were observed with the subcutaneous
lncap prostate cancer model .
our recent
c-14 based quantitation study established significant enrichment of
a py - im polyamide in the lncap tumor xenograft tissue over lung and
kidney .
the present investigation evaluates
the biodistribution of the c-14 radioactively labeled py - im polyamide 1 ( figure 1a ) in a range of tumor xenografts ,
addresses the influence of xenografted cell line on systemic polyamide
elimination , and provides an extended biodistribution profile of the
molecule .
initial experiments compared the accumulation of compound 1 in lncap and a549 subcutaneous tumor xenografts ( figure 1a ) . in order to minimize the injection - associated
experimental error , both tumors were grafted on the opposing flanks
of the same host animal , following the schedule displayed in figure si 1 ( see experimental
section for experimental details ) .
a mean compound concentration
of 1.04 mg / kg ( 0.74 m ) was measured for the lncap xenograft
tissue , comparable with liver - associated levels of 1.12 mg / kg ( figure 1b ) .
strikingly , a549 tumors were found to uptake
substantially lower amounts of polyamide 1 ( average of
0.23 mg / kg ) , closely resembling the values obtained for the kidney
( 0.27 mg / kg ) and approximately 2-fold higher than lung tissue ( 0.15
mg / kg ) . comparisons with the corresponding single - xenograft versions
of the experiment were conducted for both tumor types ( figure 1c ) .
the lncap single tumor experiment revealed a
mildly elevated concentration with respect to the double xenograft
counterpart ( 42% , p < 0.05 ) , whereas the values obtained for a549 were not distinguishable
between the two experiment types .
overall , py - im polyamide 1 localized to lncap ( prostate ) tumors at concentrations 5- to 7-fold
higher than those measured with a549 ( lung ) . ( a )
c-14 radiolabeled
py - im polyamide 1 , targeted
to the dna sequence 5-wgwwcw-3. ( b ) compound levels
of 1 in lncap and a549 tumor xenografts , compared against
major host organs ( kidney , liver , lung ) .
( c ) calibration
of the dual xenograft experiment against the respective single - tumor
versions .
all injections were performed intraperitoneally at 20 nmol
per animal ( nsg male mouse , n = 10 ) and tissues harvested
24 h following administration .
each data point represents an individual
organ / tumor analyzed . to gain deeper understanding of the phenomenon , immunohistochemical
analyses were conducted , assaying for tumor - associated microvessels
( figures si 2 and si 3 ) .
however ,
lncap xenografts were hemorrhagic and exhibited vascular spaces with
extravasated red blood cells at the microscopic level , which were
absent with a549 . in order to broaden the scope of the investigation
,
the u251 ( brain ) cell line was additionally evaluated in the xenograft
setting with regard to uptake of 1 ( figure 2 ) .
a mean value of 0.65 mg / kg ( 0.47 m ) was measured .
the u251-associated xenograft uptake profile was found to be distinct
from both lncap and a549-derived tissues , which were 2.3-fold higher
and 2.8-fold lower , respectively .
tumor levels of py - im polyamide 1 as a function of
cell line engrafted .
all injections were performed intraperitoneally
at 20 nmol per animal ( nsg male mouse , n = 10 ) and
tissues harvested 24 h following administration .
none of the tumor - associated levels of py - im polyamide 1 , discussed above , exhibited a correlation with tumor size
over the
window analyzed ( figure si 4a d , f ) .
the major host organs
kidney , liver , and lung were interrogated with regard to concentrations
of 1 for all xenograft experiments and benchmarked against
the naive background control ( figure 3 ) .
kidney
concentrations spanned a range from 0.22 mg / kg ( naive control and
a549 xenograft animals ) to 0.27 mg / kg ( double xenograft experiment ) .
lung tissue showed similar variance in concentration of 1 as a function of xenografted cell line ( 0.120.15 mg / kg ) .
a more significant difference was noted for the liver - associated compound
levels . whereas naive reference animals were indistinguishable from
u251- or a549-xenograft bearers ,
grafting of the lncap cell line resulted
in liver values that were about 2-fold higher ( 1.04 mg / kg vs 0.57
mg / kg ; p < 0.001 ) .
concentrations of polyamide 1 in the host organs kidney
( a ) , liver ( b ) , and lung ( c ) as a function of cell line engrafted .
all
injections were performed intraperitoneally at 20 nmol per animal
( nsg male mouse ,
we chose to evaluate the influence of matrigel
on uptake of 1 for xenografts derived from the a549 cell
line .
systematic analysis of tumor polyamide concentration as a function
of size revealed that larger tumors accumulated substantially higher
quantities of compound 1 when matrigel was employed during
engraftment ( figure si 4f ) .
this was
in striking contrast with the observations made for the same cell
line grafted without matrigel ( figure si 4a , c ) .
plotting of tumor - associated levels of 1 as a function
of postengraftment time revealed a clear trend ( figure 4 ) . at 3 or 4 weeks past engraftment , there was no statistically
significant difference measurable between the a549 xenografts produced
with or without matrigel , with an averaged concentration of 0.23 mg / kg
( 0.16 m ) .
whereas matrigel - negative tumors showed levels of
compound 1 indistinguishable from earlier time points
( 0.25 mg / kg ) , a marked increase was noted for the matrigel - positive
xenografts . a mean concentration of 0.59 mg / kg was measured ( p < 0.001 ) , with the highest value amounting to 0.89
mg / kg , therewith reaching values comparable to those obtained for
lncap tumors ( cf .
a549 tumor levels of py - im polyamide 1 as a function
of time ( 35 weeks ) , presence of the lncap tumor on the opposite
flank ( denoted as d.f . ) , and matrigel used to engraft ( mg ) .
all injections were performed intraperitoneally at 20 nmol per animal
( nsg male mouse ) and tumors harvested 24 h following administration .
each data point represents an individual tumor analyzed : |( ) p < 0.001| . in order to obtain a more complete picture of biodistribution
of py - im polyamide 1 ,
a comprehensive tissue analysis
following administration of 1 was conducted in the balb / c
mouse strain .
blood , bone marrow ( bm ) , brain , fat tissue , intestinal
tissue , heart , kidney , liver , lung , muscle , pancreas , prostate , and
spleen were interrogated independently ( figure 5 and table si 1 ) .
because the balb / c
male mouse of comparable age possesses a body weight that is reduced
by some 25% with regard to its nsg counterpart , compound 1 was administered at 15 nmol per animal here , as opposed to 20 nmol
per animal employed with nsg mice .
extended tissue distribution analysis
of py - im polyamide 1 in wild - type mice .
injections were
performed intraperitoneally
at 15 nmol per animal ( balb / c male mouse ) and organs harvested 24
h following administration .
the majority of tissues exhibited concentrations of 1 below 0.1 mg / kg , with the brain not showing any significant
evidence
of polyamide uptake .
kidney and liver were found to contain comparable
compound levels to those determined for the nsg strain ( 0.23 mg / kg
vs 0.22 mg / kg and 0.57 mg / kg vs 0.49 mg / kg for kidney and liver , respectively ) .
interestingly , bone marrow concentration of 1 amounted
to 0.24 mg / kg , therewith being over 10-fold higher than blood .
the
spleen exhibited a concentration of 1 of 0.32 mg / kg ,
whereas the pancreas contained compound 1 at 0.15 mg / kg .
the majority of organs contained the py - im polyamide 1 at concentrations that were significantly lower than those determined
for any of the tumor xenografts examined above .
the xenograft approach is a popular method to interrogate a prospective
antitumor agent in vivo .
it can be subdivided
into two main categories , namely , subcutaneous ( ectopic ) and orthotopic
xenografts .
orthotopic inoculation is considered to recapitulate the
tumor setting more closely than the subcutaneous approach because
cancer cells are grafted into the host organ of tumor origin . with
the exception of lung and blood cancer , for which orthotopic xenografts
are readily achievable by tail vein injection ,
genetically
engineered animal tumor models represent an attractive alternative
to xenograft experimentation , since they tend to recapitulate certain
aspects of disease progression , such as tumor vascularization , tumor
the studies are , however , elaborate to perform , requiring extended
experimentation time frames and large animal group sizes .
furthermore ,
xenografts allow the assessment of efficacy against human cancer cell
lines and primary cells , whereas genetically engineered animal models
are limited to neoplasias of the species employed .
given the above ,
subcutaneous xenografts remain an attractive method to generate initial
estimates of efficacy for molecules of interest .
the present study was initiated to rationalize the
apparent discrepancy
between cell culture results and the corresponding xenograft experiments
that we observed in preceding investigations . specifically , in vitro cytotoxicity evaluation for the nonradioactive
analogue of 1 revealed a549 and lncap to possess comparable
sensitivities toward polyamide treatment ( ic50 values of
1.5 0.2 m and 2.1 0.3 m , respectively ) .
this contrasted with the outcome of our
in vivo investigations , with lncap xenografts exhibiting tumor burden
reduction in response to treatment with 1 in the xenograft
setting , while related studies with
the a549 cell line were unsuccessful .
the present investigation demonstrates this unanticipated result
to be rooted , at least in part , in the pronounced difference in polyamide
uptake between the two xenograft types , lncap tumors accumulating
the compound at 5- to 7-fold higher levels than their a549 counterparts
( figure 1 ) in both the dual and the single
xenograft experiments conducted with a549 and lncap , respectively . additional discrepancy may stem from the
difference in the time frame employed for in vitro cytotoxicity measurement
( 3 days ) and in vivo antitumor evaluation ( at least 7 days ) and the
fact that the polyamide concentration is kept constant over the course
of the experiment in vitro but not in vivo .
comparison with u251 xenografts revealed an uptake profile
that
was distinct from both lncap- and a549-derived tumors ( figure 2 ) .
this leads to the important realization that
neither lncap nor a549 could be considered an outlier .
each cell line
examined yielded tumors with characteristic uptake features , which ,
while clearly dependent on the cell line grafted , could not have been
predicted from in vitro experiments .
the u251-derived xenografts exhibited
higher microvessel densities than both a549 and lncap tumors , without
however possessing the vascular spaces characteristic of lncap .
it was surprising to find that liver accumulation
of 1 was dependent on the cell line grafted . whereas
the grafting of
a549 or u251 cells showed no influence , the presence of lncap - derived
tumors resulted in levels that were elevated by about 2-fold ( figure 3 ) .
this was possibly due to the increased leakiness
of the tumor vasculature in lncap xenografts , as compared with a549
( figure si 2 ) and u251 .
matrigel - positive xenografts did not result in increased
liver compound values as compared to their matrigel - negative counterparts
( 0.65 mg / kg vs 0.55 mg / kg , p = 0.17 ) .
it is possible
that the leaky lncap tumor vasculature creates liver stress , which
in turn could result in impeded clearance of py - im polyamide 1 .
this phenomenon is likely to operate with other types of
small molecule therapeutics , although the magnitude of the effect
will be dependent on specifics , which could lead to alternative clearance
mechanisms .
the influence of matrigel on uptake of 1 by a549 xenografts
was of interest due to the common use of matrigel to facilitate engraftment
of tumor cells in vivo .
an effect indeed
became manifest , albeit only at the most advanced postengraftment
time points ( figure 4 and figure si 4e ) .
it appears likely that the a549
tumor architecture diverges at advanced time points , as a function
of matrigel . supporting this ,
slightly higher weights were noticed
in the matrigel - positive group than in the matrigel - negative control
at the point of divergence ( average of 409 mg vs 271 mg ; p < 0.05 ) . influence of matrigel employment on tumor proliferation ,
vascularization , and metastasis has been previously documented . the xenograft host
tumor interface being
artificial a priori , it is unclear whether the matrigel - positive or
-negative tumors give rise to more accurate models .
comparisons
of uptake between tumors and the corresponding healthy
host tissues were of interest in order to probe for potential enrichment
in cancer lesions .
organ tissues were derived from wild - type mice
of the balb / c strain .
this strain is likely to offer a superior representation
of healthy organs than its heavily immunosuppressed nsg counterpart .
the lncap xenografts exhibited concentrations ranging from 0.5 to
2.0 mg / kg , thus being an order of magnitude higher than what was determined
for mouse prostate , which possessed an averaged value below 0.1 mg / kg .
it is therefore possible that the compound quantities measured in
lncap subcutaneous xenografts provide optimistic estimates .
however ,
tumor formation does perturb organ integrity , and it therefore appears
likely that diseased prostate tissue should exhibit values different
from the healthy organ in both the orthotopic and the genetically
induced disease model setting .
it should furthermore be noted that
lncap was derived from a metastatic lymph node lesion , which , although
having originated from a prostate tumor , likely possessed a distinct
architecture .
tumors derived from the a549 cell line ( nonsmall lung
carcinoma ) can be compared with lung tissue concentrations of 1 . with exception of the elevated values that were determined
in matrigel - positive tumors at extended time points , they averaged
at approximately 0.2 mg / kg , whereas healthy lung tissue exhibited
concentrations of 1 of around 0.1 mg / kg . whether this
is a coincidence or indeed evidence that a549 xenografts mimic the
lung tissue setting more adequately remains unclear .
lung colonization
experiments may be useful to shed further light onto this question
in future studies .
u251 is a glioblastoma - derived cell line , and the
healthy organ of origin is the brain .
the corresponding comparison
between tumor and tissue of origin lacks substance , since the subcutaneous
xenograft can not be expected to recapitulate the blood
overall , and keeping the above - mentioned caveats in mind ,
tumors generally accumulated higher amounts of compound 1 than the corresponding healthy tissues of origin .
our investigation gave insight into the intricacies of various
important aspects of tumor xenograft experimentation .
the present
study identified a marked difference in xenograft uptake levels of
py - im polyamide 1 in the three cell lines tested .
lncap - derived
tumors exhibited a mean concentration of the polyamide that was over
5-fold higher than the corresponding a549-associated value .
compound 1 was found to localize to u251 xenografts at a concentration
that was substantially lower than what was found for lncap but significantly
higher than a549 .
this demonstrates the necessity to examine uptake
into tumor xenografts on a case by case basis in order to rationalize
outcomes of antitumor studies and to identify viable cell lines for
future xenograft experiments .
unexpectedly , elimination of 1 from the liver was impaired in lncap xenograft - bearing animals .
matrigel was found to influence uptake of 1 , resulting
in a 2-fold elevation at longer postengraftment time points with a549-derived
tumors .
comparison with the corresponding healthy tissues revealed
that higher concentrations of 1 were associated with
xenografts , animal prostate tissue exhibiting order of magnitude lower
values than those measured with lncap tumors .
the compound was confirmed by analytical hplc
to possess a purity of > 99% and coeluted with its nonradioactive
analog .
polyamide 1 was quantitated employing liquid scintillation
with the activity constant of 55 mci / mmol , which was provided by the
vendor ( arc ) .
quench correction was conducted against a standard curve
that was reported by our laboratory in a preceding account .
the cell lines a549 , lncap , and u251 were obtained from atcc and
cultured following provider s recommendations , not exceeding
passage number 25 .
cells were only employed for xenograft experimentation
where a viability of 95% or higher was recorded ( trypan blue stain ) .
nod - scid - gamma ( nsg ) male mice were purchased at 8 weeks of age from
jax and housed in an immunocompromised facility ( level a ) in accordance
with iacuc regulations .
they were taken forward for experiments after
an acclimatization period of at least 3 days .
all engraftments were
conducted subcutaneously with 2.5 m cells per inoculation in 200 l
vehicle ( either media or 1:1 mixture with matrigel ) .
male balb / c mice
were obtained from jax and housed in a level b animal facility .
compound 1 was quantitated by liquid scintillation
counting prior to injection and administered intraperitoneally at
either 20 nmol ( nsg ) or 15 nmol ( balb / c ) per animal in a fume hood
dedicated exclusively to c-14 in vivo radioexperimentation .
tissues
were harvested , placed into scintillation vials , and solubilized at
+ 65 c for at least 12 h employing the proprietary dissolution
agent solvable ( perkinelmer ) .
the resultant solutions were decolorized
with 2 200 l hydrogen peroxide ( 30% , sigma - aldrich )
at ambient temperature for at least 2 h , followed by heating to + 65
c for 30 min .
samples were treated with 10 ml of the scintillation
cocktail hionic - fluor ( perkinelmer ) , vortexed and the amounts of c-14
quantitated by liquid scintillation counting at the beckman coulter
ls6500 multipurpose scintillation counter .
bone marrow
weights were calculated as the difference between the femur and tibia
bones subjected to tissue solubilization and the insoluble residue ,
which was isolated subsequent to c-14 quantitation . in order to obtain
dry bone residues ,
the scintillation fluid was decanted and the solids
were triturated ( twice with ethanol , then three times with meoh ) and
dried at + 65 c overnight .
two - tailed t - tests
assuming unequal variance were applied to all data sets . | subcutaneous
xenografts represent a popular approach to evaluate
efficacy of prospective molecular therapeutics in vivo . in the present study ,
the c-14 labeled radioactive pyrrole
imidazole
( py - im ) polyamide 1 , targeted to the 5-wgwwcw-3
dna sequence , was evaluated with regard to its uptake properties in
subcutaneous xenografts , derived from the human tumor cell lines lncap
( prostate ) , a549 ( lung ) , and u251 ( brain ) , respectively .
significant
variation in compound tumor concentrations was seen in xenografts
derived from these three cell lines .
influence of cell line grafted
on systemic polyamide elimination was established . with a549 , a marked
variation in localization of 1 was determined between
matrigel - negative and -positive xenografts .
an extensive tissue distribution
analysis of 1 in wild - type animals was conducted , enabling
the comparison between the xenografts and the corresponding host organs
of origin . |
globally , about 36 million children are suffering from moderate acute malnutrition ( mam ) .
these children are usually supplemented with uncooked food supplements such as corn soy blend , often substituted with sugar and oil . in 2008 , a who / unicef / wfp / unhcr meeting focused on management of mam children and highlighted the importance of dietary management by providing both nutritional counseling and locally adapted food supplements [ 3 , 4 ] . to date
, fortified peanut / milk paste ready - to - use therapeutic foods ( rutfs ) , which are mainly commercially produced at international or national levels , have been tested with promising weight gain for severely , moderately , and mildly wasted children in the community - based settings [ 59 ] .
more recently , alternative ready - to - use foods ( rufs ) in the form of fortified cereal / nut / legume - based biscuits were designed at the university of hohenheim , germany , for severe acute malnutrition ( sam ) among children . out of nine ruf recipes ,
two were locally selected , produced at village level , and tested for the children suffering from moderate forms of wasting on nias island , indonesia , within daily ( in semi - urban areas ) and weekly supervision and distribution programs ( in rural remote regions ) .
this study reports comparison between daily and weekly program outcomes of moderately wasted children whose diets were supplemented with locally produced ruf - nias biscuits .
the study was part of a research project that aimed to compare different intervention programs to prevent and rehabilitate mildly wasted ( results presented elsewhere ) and moderately wasted children in the church world service ( cws ) project area on nias island , indonesia , from october 2007 to june 2008 . during the field work period , the children were recruited from the preexisting community - based screening programs in the cws project area .
inclusion criteria of the children were weight - for - height z - score ( whz ) 3 to < 2 sd according to who reference data , aged 6 months to < 60 months old , and no birth defect or disease that could limit the ad libitum food intake .
eligible children in semi - urban areas were allocated to daily programs , while those in rural remote regions were assigned to weekly programs ( no randomization ) .
individual discharge criterion was whz 1.5 sd . to detect a weight increment difference of 2.1 2.4 g / kg body weight / day ( g / kg / day ) , with a confidence level of 95% and a power of 0.8 , a minimum sample size of 20 children per program
was calculated [ 13 , 14 ] . in this study , 34 children were appointed to the daily ( semi - urban settings ) and 20 to the weekly distribution and supervision program settings ( in rural areas ) , respectively .
the study conformed to the provisions of the declaration of helsinki and was approved by the ethics committee of the faculty of medicine , brawijaya university , malang , indonesia ( no .
screening of children was ongoing on a monthly basis to identify new cases of wasted children . in total , 618 children were screened for the ruf - nias biscuits intervention study .
a total of 99 of these children were mildly wasted , and 54 of them were moderately wasted . of the moderately wasted children , 34 and 20
children were allocated to daily ( semi - urban settings ) and weekly programs ( in rural remote regions ) , respectively ( figure 1 ) .
a longitudinal nonrandomized food - based intervention study was applied in the preexisting nutrition centers ( at village level ) in cws project area . in each nutrition center ,
ruf - nias biscuits were produced by voluntary workers , cws field officers , and motivated mothers / caregivers once a week . in daily programs , each eligible child ( index child )
was provided with a portion of ruf - nias biscuits every day ( except sunday ) , and about one - third of which was to be eaten within a supervised feeding setting in the nutrition center .
compliance with the take - home ration of ruf - nias biscuits and morbidity were routinely assessed the following day at the nutrition center .
the index children were weighed 2 - 3 times per week ; height was measured once per month . in weekly programs ,
however , all basic activities were performed only once per week and mothers / caregivers received take - home portions for the index children for each of the other days of the week , with the advice to offer it daily between meals .
compliance with ruf - nias biscuits consumption could only be observed and monitored once a week .
whz , height - for - age z - score ( haz ) , and mid - upper arm circumference ( muac ) were collected for each index child at program admission , during the intervention period , and discharge / closure .
the weight of the index child was assessed using a hanging spring scale ; height was measured using a height / length board for children above / below 2 years of age ; muac was determined by using muac inserting tape ( ministry of health , indonesia ) .
general background information ( e.g. , age and sex ) and a 24-hour dietary intake recall of the index children during admission time , as well as socio - economic characteristics of their families , were provided by the mothers / caregivers on the basis of a standardized questionnaire .
length of stay for the children who reached discharge criterion ( rdc ) was defined as number of days until whz 1.5 sd was reached , while length of stay for non - rdc children included the time from admission until program closure .
defaulter was defined for children who were absent in at least two consecutive scheduled daily / weekly program activities , who were home visited at least two times because they were absent in the program activities , and whose mothers / caregivers withdrew from the program .
additionally , field - note observations and interviews with seven non - rdc caregivers ( four and three caregivers from daily and weekly programs , resp . ) , who were willing to participate in in - depth interviews for about 60 to 80 minutes , were carried out to understand the underlying causes and culturally determined reasons for not reaching discharge criterion during the program period .
after organoleptic and sensory evaluation for appearance , color , texture , smell , shelf life , and taste under given local climate conditions , two out of nine recipes ( soybean based and mungbean based ) were selected and locally produced for this intervention study .
ingredients of the locally produced ruf - nias biscuits were wheat flour , peanut flour , refined sugar , palm oil , egg yolk and white , soybean or mungbean flour , and micronutrient powder donated from dsm nutritional product ltd . ,
flour from soybean / mungbean was used interchangeably and was roasted prior to biscuit production to reduce the phytate content and to improve bioavailability of antioxidants and iron [ 1517 ] .
originally , the ruf - nias biscuits were developed for rehabilitation of children suffering from severe acute malnutrition ( sam ) [ 10 , 18 ] , and therefore the amounts of macro- and micronutrients are comparable to the level of proposed intake for children suffering from sam ( see table 1 ) .
children in daily and weekly programs received a calculated ruf portion per day based on the weight of the individual child , to cover about 60% of the recommended daily energy requirements , as per indonesian guidelines .
about 10% was added to the original estimation of 50% daily energy requirement fulfillment for moderately wasted children [ 8 , 20 ] in order to compensate for the possibility of the ruf - nias biscuits being shared with other family members .
in addition , we stressed that ruf - nias biscuits should be considered as a medicine for the index children and consumed in - between meals ( see figure 2 ) .
continuous data was first checked for normal distribution using quintile - quintile plots of normality .
all nutritional indicators , which were found to be skewed , were log transformed in order to reach normal distribution for further analyses . for allowing comparison with other published studies ,
differences in continuous variables , such as weight , height , whz , haz , and muac between daily and weekly programs were analyzed using independent t - test , while fisher 's exact test was used to analyze differences in proportions between daily and weekly programs and rdc versus non - rdc .
multivariate logistic and linear regression analyses with a forward stepwise approach were applied to identify independent risk factors of not reaching discharge criterion and predictors of the children 's weight gain at program discharge / closure , respectively .
the following covariates were assessed : children 's age and whz at admission , compliance on ruf consumption , type of program , and morbidity of the children during the program period .
statistical analyses were performed using pasw / spss version 18.0 for windows software packages ( spss inc . ,
data on weight and height were transformed to z - scores of whz and haz according to who reference data 2005 using emergency nutrition assessment ( ena for smart ) version 2007 .
as shown in figure 3 , mean selected nutrients from habitual intake of the index children ( based on a 24-hour recall at admission ) together with average consumption of ruf - nias biscuits ( collected during program period ) were compared in relation to the dietary guidelines for mam children .
all children admitted into daily or weekly ruf - nias biscuit intervention programs had similar age and anthropometric indicators ( weight , height , whz , haz , and muac ) .
program outcomes between girls and boys did not differ significantly ( p = 0.260 ) in daily ( 41% girls ) and weekly ( 60% girls ) programs .
mean age , education , and occupation of the mothers are shown in table 2 . in daily programs ,
women were significantly younger , less likely to work as farmers and had nearly the same education level as women in weekly programs . a very high proportion of respondents in daily and weekly programs ( 91.2 versus 100% , p = 0.287 ) came from families with a total household income lower than us$ 1.25/day of purchasing parity power ( ppp ) per family member . moderately wasted children in the daily and weekly programs had similar inadequate habitual dietary intake prior to admission ( table 3 ) .
average percent fulfillment of selected macro- and micronutrient intake at baseline was considerably below dietary recommendations for well - nourished indonesian children .
the majority of the children 's mean habitual nutrient intake , together with the calculated amount of ruf - nias biscuits , was approaching the 2009 published recommended levels for mam children ( figure 3 ) .
as shown in table 4 , weight gain at program discharge / closure of children assigned in daily and weekly programs was 3.9
g / kg / day and 2.0 g / kg / day ( p = 0.117 ) , respectively .
whz score at discharge / closure was significantly higher in daily than in weekly programs ( p = 0.027 ) .
the proportion of children who reached discharge criterion of whz 1.5 within a similar average length of stay ( 79 weeks ) was significantly higher in daily than in weekly programs ( 76.5% versus 35% , p = 0.004 ) . weight gain ( in g / kg / day ) of children at program discharge / closure was highly predicted by high compliance ( r = 0.228 , p < 0.001 ) .
children with a high compliance ( 80% consumption of prescribed ruf biscuits ) had a higher mean daily weight gain of 1.33 ( 95% ci 1.16 to 1.53 ) g / kg body weight than children with low compliance ( < 80% ruf biscuit consumption ) .
logistic regression analysis revealed low compliance and weekly versus daily program as independent risk factors of not reaching discharge criterion ; children in the low compliant versus high compliant group had a 40- ( 95% ci 5 to 320 ) fold and children in the weekly versus the daily program had a 17- ( 95% ci 3 to 92 ) fold higher risk of not reaching the discharge criterion ( both p < 0.001 ) .
children 's age and whz at admission and morbidity during program periodwere not associated with the risk of not reaching discharge criterion in this study setting . in table 5 ,
a pooled dataset of children who reached discharge criterion ( rdc ) versus non - rdc is presented showing that the nutritional indicators of rdc and non - rdc children in daily and weekly programs were not significantly different .
children who reached discharge criterion ( whz 1.5 sd ) showed significantly better improvements in weight , whz , and muac than non - rdc children . in both programs , poor compliance ( consumption of <
80% of the daily allotted portion of ruf - nias biscuits ) was most likely in non - rdc children ( 50% ) compared to rdc children ( 6% ) .
based on a 24-hour dietary recall , mean habitual nutrient intake of the moderately wasted children was considerably lower than the dietary guidelines for indonesian well - nourished children ( see table 3 ) .
together with the fortified ruf - nias biscuits , about two - thirds of the recommended levels of micronutrients were reached , while energy , vitamin b1 , and protein reached or even exceeded the rnis for mam children ( see figure 3 ) .
average habitual protein intake of the moderately wasted children was relatively high because of the daily fish consumption ( e.g. , sardines and anchovies ) on nias island .
moderately wasted children who consumed about 100 g ( 500 kcal ) ruf - nias biscuits in the daily programs gained 3.9 3.8
g / kg / day in about 51 days , whereas weight gain of those in the less - supervised weekly programs was 2.0 2.0 g / kg / day within approximately 62 days . the proportion of children who reached whz
in contrast , the proportion of rdc children was significantly lower in less - supervised weekly programs ( 35.0% ) .
monitoring results of the children 's diseases during the program period suggested that , in most cases , frequent illnesses were not the main cause of lack for appropriate weight gain of moderately wasted children in our study area .
however , the cost of medicine and geographic settings in combination with limitations of local health systems seemed to constrain them from seeking early medication .
this situation was more profound among the children in the weekly programs who lived in rural remote regions that linked with challenging infrastructure and poor public / health facilities , which could contribute to the lower proportion of rdc children in the weekly than in the daily programs . prior to this study
, cws had already established nutrition intervention programs like cooking demonstrations at its diverse sites .
geographical differences ( more urban / accessible versus more rural / less accessible ) largely influenced the regularity of program delivery ( daily versus weekly , resp . ) .
we note that randomization of nutrition centers could not be applied because , in the more urban ( i.e. , semi - urban ) areas , they were established too close together and it was difficult to avoid exchange of information , as well as possible jealousy that could arise over more or less intensive supervision in a neighboring program . with regard to the more remote rural research sites , houses were scattered and often far away from the nutrition center ; daily supervision was impractical . based on results of in - depth interviews among mothers of non - rdc children who were willing to be interviewed , children preferred snacks bought from nearby shops ( e.g. , candies , chocolates , wafers , biscuits , and jellies ) as compared to the distributed ruf - nias biscuits because the latter was perceived as boring in terms of taste and appearance .
mothers of children who did not reach discharge criterion also mentioned that illnesses were considered among the reasons for not reaching the criterion .
a few lower income caregivers , as well as lower educated mothers and grandmothers , tended toward noncompliance with instructions for giving ruf - nias biscuits . additionally , we observed that all voluntary workers and all caregivers in the nias project were female and that they lived in a patrilineal and patriarchal social system [ 23 , 24 ] .
about 4760% of the respondents lived together with the husband 's extended family in one house ( see table 2 ) .
other families lived in separate houses that were located close to the houses of the husband 's parents .
as mentioned above , these living arrangements intensify the strong influence of the husband 's family and most particularly that of the paternal grandmother . on average , the majority of women in the study area were engaged in income generating activities outside the home and spent only about two hours in direct child care .
therefore , child feeding practices at home and the type / variety of foods given are greatly influenced by grandmothers , particularly on the paternal side .
although longer travelling time to a nutrition center meant that rural mothers / caregivers had to leave their households and farming activities for a longer period , we observed that they were nevertheless very willing to attend the nutrition center 's activities .
with consideration for the additional time involved , caregivers in semi - urban areas regularly complained about time constraints created by program involvement .
prior to this intervention study , nutrition - related teaching activities had already been introduced in every village where more than 6 wasted children were found .
we found that village randomization was not feasible in the semi - urban areas because the existing nutrition centers were located too close to each other , and on the other hand a daily program was impractical in rural areas .
therefore , we recommend performing a similar intervention study in larger regions by randomizing semi - urban nutrition centers to daily and weekly ruf supplements for comparison of the mode of service delivery .
our results also confirmed that a weekly program was feasible in a rural remote region and produced a satisfactory program outcome . besides provision of locally produced ruf - nias biscuits ,
we also administered locally produced peanut / milk paste ( pmp - nias ) with similar macro- and micronutrient contents to eight moderately and thirty - seven mildly wasted children in another region ( figure 1 ) on nias island .
of eight moderately wasted children , five did not reach discharge criterion of whz 1.5 sd , two defaulted from the programs , and only one child recovered fully .
generally , we observed that ruf - nias biscuits were highly accepted by both the caregivers and the concerned children in contrast to peanut / milk paste mainly because children were not accustomed to its taste and parents did not like the recipe ( will be published elsewhere ) .
compliance with ruf - nias biscuits consumption should be enhanced by altering the recipe through inclusion of different types of local foods rich in micronutrients ( e.g. , local seeds , spices , and milk or fish powder ) that were already included in the original nine recipes of rufs . furthermore , frequent home visits for children with poor compliance records and inclusion of other family members , especially paternal grandmothers , in behavioral change communication sessions are also recommended to improve the compliance on ruf - biscuits consumption .
locally produced ruf - nias biscuits in the form of in - between snacks resulted in promising weight gain in moderately wasted children on nias island , indonesia .
provision of locally produced ruf biscuits resulted in a significant weight gain in moderately wasted children and could be an alternative approach to the commercially produced ruf .
further studies are needed to identify ways in which compliance of ruf consumption could be improved in both daily and weekly programs . | this study reports the outcomes of daily ( semi - urban areas ) and weekly ( remote rural regions ) programs for moderately wasted children supplemented with locally produced ready - to - use foods in the form of fortified cereal / nut / legume - based biscuits on nias island , indonesia ( ruf - nias biscuit ) .
thirty - four children in daily and twenty children in weekly programs aged 6 to < 60 months with weight - for - height z - score ( whz ) 3 to < 2 sd were recruited ( october 2007june 2008 ) on nias and admitted into existing nutrition centers in the church world service project area .
individual discharge criterion was whz 1.5 sd .
weight gain of the children in daily and weekly programs was 3.9 3.8 and 2.0 2.0
g / kg / day , respectively . a higher proportion of children in daily than weekly programs reached target whz ( 76% vs. 35% , p = 0.004 ) . weight gain at program discharge / closure
was highly predicted ( r2 = 0.228 , p < 0.001 ) by compliance to ruf biscuits : high vs. low compliance resulted in a 1.33 ( 95% ci 0.16 to 1.53 ) g / kg / day higher weight gain .
compliance and admission in daily programs were significant factors in reducing the risk of not reaching the discharge criterion .
however , mothers complained more frequently about time constraints in the daily relative to weekly programs . |
, this improvement has been experienced unequally across the population , being higher among better off .
about 80% of dentists work in major cities in india , compared to the population where more than 70% of the indians reside in the rural areas .
the dentist to population ratio is 1:10,000 in urban areas whereas 1:150,000 in rural areas .
even with a workforce of 118,000 qualified dentists in the country , the most basic oral health education and simple interventions are also not available to vast majority of population .
oral health is not only important for appearance and sense of well - being but also for overall health .
dental caries and periodontal diseases may contribute to many serious conditions , such as diabetes and respiratory diseases .
poor oral health can affect the quality of life , appearance , and self - esteem , and has been linked to sleeping problems , as well as behavioral and developmental .
it has been proven that early diagnosis and appropriate treatment can prevent worsening of the oral diseases .
thus , maintaining good oral health includes both prevention of oral disease occurrence as well as treatment of any existing condition . according to who
, the provision of oral health care services is very little in rural parts of india , further complexity is lent by the great variation that occurs across this population on social parameters such as income and education .
few of the studies conducted on the rural population of india have concluded that the unmet treatment need of the population is very high and the services present are inadequate in most parts of the country.[57 ] equity in access to health care is one of the objectives of health care system .
mooney argues that access is merely a question of supply , while utilization depends on both supply and demand
. individual utilization of health care is possibly affected by many factors that are not connected to health care per se but shape individuals demand for health care .
hence the present study was conducted to evaluate the types of patients , disease pattern , and services provided in outreach programs .
the retrospective study was conducted using the data collected from the various outreach programs conducted by swami devi dyal hospital and dental college in last 3 months ( october , november and december , 2011 ) .
these outreach programs were carried out in the rural area of the panchkula district , haryana .
the data included the information about the diagnosis as well as the treatment of the patients .
the descriptive statistics as used to describe the type of patients , pattern of oral diseases , and services provided in the outreach programs .
a total of 1371 subjects in the age group of 4 - 70 years were included in the study .
table 1 shows the frequency distribution of study subjects attending the outreach programs according to their socio - demographic characteristics .
the maximum number of patients ( 35.7% ) belonged to the age group of 36- -55 years and least number of patients ( 15.4% ) attending out reach program were in the age group of > 55 years . the female attendance ( 56.8% ) was more than male attendance ( 43.2% ) .
a total of 61.2% of the total subjects were unskilled laborers , that is most of them being farmers , students , and housewives and only 2.1% belonged to managerial class .
distribution of study subjects according to sociodemographic characteristics table 2 shows the disease pattern of the study subjects attending the out reach programs .
the prevalence of dental caries was found to be 43.7% and for gingivitis and periodontitis it was 27.2% and 22.9% respectively .
the other conditions included partial or complete edentulousness , fractured teeth , malocclusion , dental fluorosis , and soft tissue lesions which were found to be 6.2% .
distribution of study subjects according to the disease pattern table 3 shows the various services provided to the study subjects according to the diagnosis .
these included oral prophylaxis ( 51.2% ) , restorations ( 22.9% ) , and extractions ( 8.8% ) . out of total , 20%
the enjoyment of highest attainable level of health is a fundamental right of every human being without discrimination based on race , religion , socioeconomic condition .
there are several challenges faced in the delivery of oral health care services to the rural population such as deficiency of manpower , poor accessibility , affordability , and availability .
the utilization of health care services depends upon health attitudes , social structure , and social demographic factors along with affordability and accessibility and the need for use of services . in many developing countries like india , it is often difficult for the rural population to get access to oral health services .
so the present study was conducted to study the type of patient , disease pattern , and services that can be provided at free dental outreach programs .
it was found that most of the patients attending the dental out reach programs were in the age group 15 - 55 years ( 65.3% ) , hence less utilization by the children and older individuals , > 55 years of age , which was in agreement with other studies .
it may reflect the attitude of the older individuals toward their oral health and of the parents toward the oral health of their children .
meng et al , found that dental fear and fear of dental pain have independent negative effects on dental utilization which could be the factor associated with utilization in the present study .
the utilization of dental services was found to be higher in females compared to males which is in accordance with findings of other studies.[1013 ] it may be due to the fact that females have a greater tendency to expect good outcome from dental attendance and also because most of the females were housewives they could attend the outreach programs , while men were bread earners hence were not available at their homes .
a total of 56.1% patients attending the outreach program were either illiterate or had low level of education which might be because of the location of the outreach program being rural areas .
the most common services provided in the outreach programs were oral prophylaxis , restoration , and extractions . hence in order to improve the dental attendance , the barriers have to be identified and controlled by appropriate education and intervention .
the results indicate that there is a need to motivate people giving them information but paying attention to the individual reasons which restrict their behavior .
the limitation of the present study was localization of the study ; therefore , to determine the relative effects of the barriers , further investigation should be conducted . in order to gain a better understanding of how people use dental services and why
the utilization of dental services in the outreach programs has been found to be influenced by sociodemographic characteristics of the population .
the services provided in the outreach programs should be based on the felt needs of the population so that both attendance and the utilization of dental services can be increased thereby improving the oral health status of the population . | background : the availability of oral health services are very scarce in rural india ; therefore the unmet treatment needs of rural population are very high .
hence , a retrospective study was conducted to evaluate the types of patients , disease pattern , and services rendered in outreach programs in rural areas of haryana.materials and methods : a the data were obtained from records of outreach programs conducted , in last 3 months , by swami devi dyal hospital and dental college .
the data from were analyzed using descriptive statistics.results:a total of 1371 individuals in the age group of 4 - -70 years ( 56.8% males and 43.2% females ) attended the outreach program seeking the treatment .
dental caries ( 43.7% ) , gingivitis ( 27.2% ) , and periodontitis ( 22.9% ) were commonly observed dental diseases .
the services provided were oral prophylaxis ( 51.2% ) , restoration ( 22.9% ) , referral ( 20% ) , and extractions ( 8.8%).conclusion : the attendance and utilization of dental services in the out reach programs seem to be influenced by sociodemographic characteristics of the population . |
ecosystems are the information technology advancements being used worldwide for the efficient exchange of health information among health personal and patients ( 1 , 2 ) .
a lot of work is being focused worldwide for improvement of security issues associated with the above technology ( 3 ) .
benkler refers to economic and technological ecosystem as a dynamic structure , which entails of an interconnected population of organizations ( 4 ) . on the other hand ,
hadzic and chang ( 5 ) group is inclined towards digital ecosystem design methodology for the health domain .
moreover , the same group also suggested that the analogy between information systems and biological systems could be extended into the systems design space .
the present review article is focused on the current views of ecosystem in the health sector .
we searched the electronic database of medline , embase , and pubmed for clinical controlled trials , pre clinical studies , and research articles reporting utilization of ecosystem advances in health information technology .
the better planning is essential need at present in health sector for examining the potential utility of ecosystems concepts in support of understanding the hospital management information system ( hmis ) .
the main problem predicted in firms involved in production of health information systems has been ruled out to be the prediction of the effects of future technological developments on the value of present technologies ( 5 ) .
furthermore , a recent study presented another view describing information systems as assets of information advancements in the health sector ( 6 ) . on the other hand
, investigators from financial service industry highlighted the importance of planning with regard to inspiration to practitioners in health sector furthermore , a case study from the financial services industry specifically studied the issue of information systems planning .
further , the impact of is and it planning might be , on planning and decisions in the hospital management environment .
organizations should dedicate towards establishment of a strategic plan in relation to key information systems acquisitions ( 8) .
another explanatory research in the it systems planning space in healthcare revealed that there is a range of different kinds of it strategies in healthcare that require diverse decisions , investments and prioritized actions as well as differing implementation approaches ( 9 ) .
a key underpinning of this research is a desire to see more effective implementation and usage of information systems in the healthcare environment , and more particularly in the hmis environment .
there is certainly healthcare literature pointing to success and failure in relation to hospital information systems , and the reasons for it , but there is theory and some principles describing the success of is as well as it projects .
for instance , importance of management support and the role of task interdependence as a moderating factor collectively contributed towards the success of information systems in hospital environment ( 10 , 11 ) .
moreover , end user training as well as moderating factors contributes a lot towards success of it and is ecosystems ( 11 ) .
moreover , utuat - the unified theory of acceptance and use of technology is another contribution of above study in the field of is circles . in terms of the potential for information technology to assist in health care , the possible gains are great .
for instance , gonzalez - moler et al . studied the implementation of novel approach of telemedicine in the patients affected by diabetes ( 13 ) .
most of the potential benefits of information systems , in healthcare are collectively grouped in a study ( 14 ) .
the authors undertook a cost benefit analysis in relation to the implementation of an electronic medical record ( emr ) system .
successful implementation of planning of it and is in health sectors resulted in ease of creation of medical records , decreased full time equivalent ( fte ) employees and prevented adverse drug events too .
another , recent study reported potential benefits of it planning success to the hospital managers of health it systems ( 9 ) .
this implementation and duration of use of health information technologies resulted in better follow - up of mediation guidelines at us hospitals .
the collectively suggested many further insights can be obtained about it planning and implementation in health care , it is possible that an examination of technology ecosystems could have a beneficial impact in this regard as a new lens through which to examine these issues .
the better planning is essential need at present in health sector for examining the potential utility of ecosystems concepts in support of understanding the hospital management information system ( hmis ) .
the main problem predicted in firms involved in production of health information systems has been ruled out to be the prediction of the effects of future technological developments on the value of present technologies ( 5 ) .
furthermore , a recent study presented another view describing information systems as assets of information advancements in the health sector ( 6 ) . on the other hand
, investigators from financial service industry highlighted the importance of planning with regard to inspiration to practitioners in health sector furthermore , a case study from the financial services industry specifically studied the issue of information systems planning .
further , the impact of is and it planning might be , on planning and decisions in the hospital management environment .
organizations should dedicate towards establishment of a strategic plan in relation to key information systems acquisitions ( 8) .
another explanatory research in the it systems planning space in healthcare revealed that there is a range of different kinds of it strategies in healthcare that require diverse decisions , investments and prioritized actions as well as differing implementation approaches ( 9 ) .
a key underpinning of this research is a desire to see more effective implementation and usage of information systems in the healthcare environment , and more particularly in the hmis environment .
there is certainly healthcare literature pointing to success and failure in relation to hospital information systems , and the reasons for it , but there is theory and some principles describing the success of is as well as it projects .
for instance , importance of management support and the role of task interdependence as a moderating factor collectively contributed towards the success of information systems in hospital environment ( 10 , 11 ) .
moreover , end user training as well as moderating factors contributes a lot towards success of it and is ecosystems ( 11 ) .
moreover , utuat - the unified theory of acceptance and use of technology is another contribution of above study in the field of is circles . in terms of the potential for information technology to assist in health care , the possible gains are great .
for instance , gonzalez - moler et al . studied the implementation of novel approach of telemedicine in the patients affected by diabetes ( 13 ) .
most of the potential benefits of information systems , in healthcare are collectively grouped in a study ( 14 ) .
the authors undertook a cost benefit analysis in relation to the implementation of an electronic medical record ( emr ) system .
successful implementation of planning of it and is in health sectors resulted in ease of creation of medical records , decreased full time equivalent ( fte ) employees and prevented adverse drug events too .
another , recent study reported potential benefits of it planning success to the hospital managers of health it systems ( 9 ) .
this implementation and duration of use of health information technologies resulted in better follow - up of mediation guidelines at us hospitals .
the collectively suggested many further insights can be obtained about it planning and implementation in health care , it is possible that an examination of technology ecosystems could have a beneficial impact in this regard as a new lens through which to examine these issues .
this is obvious from above discussion that technological eco systems are the key players in the successes of health informatics .
further , improvements in these ecosystems will definitely upshot in better health information management system in near future .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . | background : the existing models of information technology in health sciences have full scope of betterment and extension .
the high demand pressures , public expectations , advanced platforms all collectively contribute towards hospital environment , which has to be kept in kind while designing of advanced technological ecosystem for information technology .
moreover , for the smooth conduct and operation of information system advanced management avenues are also essential in hospitals .
it is the top priority of every hospital to deal with the essential needs of care for patients within the available resources of human and financial outputs . in these situations of high demand ,
the technological ecosystems in health informatics come in to play and prove its importance and role .
the present review article would enlighten all these aspects of these ecosystems in hospital management and health care informatics.methods:we searched the electronic database of medline , embase , and pubmed for clinical controlled trials , pre - clinical studies reporting utilizaiono of ecosysyem advances in health information technology.results:the primary outcome of eligible studies included confirmation of importance and role of advances ecosystems in health informatics .
it was observed that technological ecosystems are the backbone of health informatics.conclusion:advancements in technological ecosystems are essential for proper functioning of health information system in clinical setting . |
during july 816 , 2009 , a total of 6 norway rats , 3 male and 3 female , 65432 g , were trapped in manholes of the sewer system of hamburg , northern germany , at the same locations where 12 months before hev rna had been detected in rat feces ( 10 ) .
initial serologic screening with a commercial genotype 1based elisa ( axiom , brstadt , germany ) detected no reactive antibodies in transudates of any of the 6 rats .
313 g ) rat yielded an amplification product of the expected size ( 331334 nt ) and a sequence identity of 83.8%94.6 % with the hev sequences recently obtained from rat feces ( data not shown ) . using a strategy according to schielke et al .
( 4 ) , we determined the entire rat hev genome sequences from each sample to be 6,945 nt and 6,948 nt ; the sequences differed by an insertion deletion polymorphism in the 3 noncoding region .
the sequence identity between each complete sequence was 95.3% and reached 55.1%55.9% to hev genotypes 14 and 49.3%50.2% to avian hev strains ( table ) .
using prediction software , we identified the major orfs 1 , 2 , and 3 in the new genomes in an organization typical for hev ( figure 1 , panel a ) .
in contrast to hev genotypes 13 , rat hev orfs 1 and 3 do not overlap .
three additional putative orfs of 280600 nt that overlap with orfs 1 or 2 were predicted for each rat hev genome ( figure 1 , panel a ) .
however , before the meaning of these findings can be verified , sequence information from additional rat hev strains and experimental proof are needed .
phylogenetic analyses of a 1,576-nt segment available for all published rat hev sequences demonstrated clear separation from mammalian genotypes 14 and avian strains ( figure 1 , panel b ) .
the same 3 phylogenetic clusters were obtained when the complete genomes were analyzed ( figure 1 , panel c ) and when the nucleotide and deduced amino acid sequences of orf1 , orf2 , and orf3 were investigated separately ( data not shown ) . * hev , hepatitis e virus ; orf , open reading frame .
genome structure and localization of putative open reading frames ( orfs ) and functional domains in orf1 of hepatitis e virus ( hev ) sequences from norway rats nos .
63 and 68 , collected in germany , july 2009 ( a ) ; phylogenetic trees based on a partial nucleotide sequence of 1,576 nt ( b ) ; and the complete genomes ( c ) .
rna was isolated from liver samples by using the rneasy mini kit and a qiashredder ( qiagen , hilden , germany ) .
the entire rat hev genome sequences of each rat were determined by a primer walking strategy and rapid amplification of cdna ends protocols ( genbank accession nos .
orfs were predicted by using the seqbuilder module of the dnastar software package ( lasergene , madison , wi , usa ) .
putative functional domains in orf1 were compared with those predicted in the corresponding regions of orf1 from hev genotypes 14 ( 11 ) .
the methyltransferase ( met ) , helicase ( hel ) , and rna - dependent rna polymerase ( rdrp , gdd motif indicated ) domains are conserved and in the same order in the rat hev genomes . in contrast , the papain - like protease domain ( plp ) and the proline - rich domain ( prol ) were more variable .
three additional orfs ( 4 , 5 , 6 ) were predicted for both rat hev genomes , for which no similar amino acid sequence could be found by blastp ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) search , sequence profile search in pfam , and no functional pattern by prosite ( www.expasy.ch/prosite/ ) search ; however , several similar sequences were retrieved from the uniprot collection by comparison of translated nucleotide sequences with blastx ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) .
in addition , these orfs showed less difference to the host codon usage than orf3 as determined by graphical codon usage analyzer ( http://gcua.schoedl.de/ ) and strap ( http://3d-alignment.eu/ ) .
phylogenetic relationships were reconstructed by using neighbor - joining and bayesian algorithms after substitution model estimation ( 12 ) .
robustness of nodes in phylogenetic trees is given above branches for bayesian algorithms ( sampling every 10 of 1 million generations ; first 25,000 samples discarded as burn - in ) and below branches for neighbor joining ( 10,000 bootstrap replicates ) .
only support values for main nodes that connect genotypes or major evolutionary lineages are displayed .
* indicates that neighbor - joining algorithms suggest instead a closer phylogenetic relationship between genotypes 3 and 4 with genotype 1 basal to these 2 .
scale bar indicates phylogenetic distances in nucleotide substitutions per site . to compare viral load in different tissues of the 2 hev positive rats
, we developed a real - time rt - pcr selective for a region in the orf2 of rat hev .
parallel analysis of rna isolated from 10 mg of each tissue or 10 l of blood reproducibly showed the highest viral load to be in the liver ; cycle threshold values for liver were 20.5 and 21.6 for each animal and lower for all other tissues ( figure a1 ) .
further , immunohistochemical analysis , using anti - hev serum , detected viral antigen in the cytoplasm of a few hepatocytes from each hev - positive rat .
hematoxylin - eosin staining showed a marginally increased number of monocytes and granulocytes in sinusoids as well as a moderately increased number of lymphocytes and plasma cells in some glisson triads of the livers ( data not shown ) .
immunohistochemical staining ( peroxidase - antiperoxidase ( pap ) technique ) of liver samples from 2 rat - hepatitis e virus ( hev)positive norway rats from germany , july 2009 .
arrows indicate immunohistochemical positive reactions in the cytoplasm of single hepatocytes ( a ) and in a few foci in hepatocytes and stellate cells ( b ) . for pap staining ,
deparaffinized slides of liver samples were incubated with anti - hev positive human serum , which had been previously used to detect rat hev by using solid phase immunoelectron microscopy ( 10 ) , for 1 h at 37c with protein a ( sigma - aldrich , steinheim , germany ) at a dilution of 1:100 for 45 min at 37c and finally with pap complexes from rabbits ( sigma , st .
louis , mo , usa ) at a dilution 1:200 for 45 min at 37c .
aec ( 3-amino-9-ethylcarbazol ; sigma chemie gmbh , deisenhofen , germany ) was used as the substrate chromogene .
phylogenetic analyses and nucleotide and amino acid sequence comparisons demonstrated that the complete rat hev genome sequences were consistently well separated from those of mammalian genotypes 14 and the tentative avian genotype .
this finding suggests that these sequences represent an additional genotype ( figure 1 , table ) . in our analyses ,
the recently described hev strain found in domestic rabbits , proposed to represent a separate genotype ( 13 ) , clustered with human hev genotypes irrespective of the genome part , nucleotide , or deduced amino acid sequences analyzed ( figure 1 , panels b , c , and data not shown ) .
therefore , this strain may represent the consequence of recent spillover rather than the result of long - term virus
in contrast , the nonzoonotic avian hev strains strongly differ from the mammalian hev genotypes 14 ( figure 1 , panels b , c ) .
although in the genus hepevirus no species demarcation criteria have been defined , the marked sequence diversities suggest that the rat hev represents an additional virus species other than hev-1 , hev-2 , hev-3 , hev-4 , and the tentative species avian hev , which are currently classified in this genus ( 14 ) .
detection of rat hev rna and antigen in the liver cells of the infected norway rats may indicate hepatotropism of this virus .
therefore , regarding its organ and cell - type tropism , this virus seems to be similar to the human and pig hev genotypes ( 15 ) . because the virus was also detected in the intestine and , in the previous study , in feces ( 10 ) , fecal
the common properties of this virus and the human hev genotypes suggest the usefulness of developing an hev model in laboratory rats .
in addition , the detection of rat hev in animals from an urban region in germany raises questions about the putative epidemiologic role of rat hev for hepatitis e in humans . | human hepatitis e virus infections may be caused by zoonotic transmission of virus genotypes 3 and 4 . to determine whether rodents are a reservoir
, we analyzed the complete nucleotide sequence of a hepatitis e like virus from 2 norway rats in germany .
the sequence suggests a separate genotype for this hepatotropic virus . |
severe obesity is defined as a body mass index ( bmi ) > 40 kg / m which is associated with comorbidities such as insulin resistance , diabetes mellitus , systemic hypertension , dyslipidemia , and cancer .
furthermore , severely obese subjects have an increased total mortality with a concomitant increased risk of sudden death , which may be caused by fatal arrhythmias .
heart rate variability ( hrv ) which is the fluctuation of heart rate around mean heart rate that may be assessed with a 24-hour cardiac holter monitoring provides valuable information on the activity of the cardiac autonomic nervous system ( ans ) .
the ans is an important contributor to the regulation of both the cardiovascular system and energy expenditure and it is assumed to play a role in the pathophysiology of obesity and related complications [ 1 , 2 ] . in obese subjects , many studies have observed abnormalities in the sympathetic and the parasympathetic ans activity , which could partly explain the relation between obesity , comorbidities , sudden death , and arrhythmias [ 1 , 3 ] .
available data regarding the metabolic and ans impacts of weight loss in severely obese subjects by other methods than gastric bypass [ 4 , 5 ] and hypocaloric diet [ 3 , 69 ] are sparse .
obesity is associated with decreased left ventricular ( lv ) systolic function and impaired lv diastolic function [ 1 , 10 ] .
whereas some studies using surgical procedures have reported that substantial weight loss induces significant improvements in lv diastolic function [ 1014 ] , the effect of modest weight loss on lv diastolic dysfunction in obese subjects has been less extensively investigated but has never been reported in severe obesity .
diet and exercise programs are associated with disappointing long - term results on weight loss in severely obese subjects .
weight loss medication is recommended for subjects with a bmi > 30 kg / m or with a bmi > 27 kg / m associated with 1 risk factor of cardiovascular disease .
orlistat is a gastrointestinal lipase inhibitor , reducing fat absorption , which may result in weight loss of approximately 5%10% of the initial weight after one year
. it may be relevant to investigate the impact of modest weight loss on lv diastolic function and on hrv since these parameters may be associated with increased cardiovascular risk [ 18 , 19 ] .
this pilot study aimed to determine the impact of weight loss induced by orlistat on hrv and on lv diastolic function in severely obese patients with type 2 diabetes .
a total of 38 severely obese patients with type 2 diabetes were recruited from the waiting list of bariatric surgery in our institution .
the experimental protocol was approved by the ethics committee of iucpq and we certify that all applicable institutional and governmental regulations concerning the ethical use of human volunteers were followed during this research .
subjects were excluded if they used medication known to influence hrv or if they had documented chronic heart failure and/or kidney failure .
subjects were randomized to a control group or to a treatment group , which consisted of 120 mg of orlistat ( xenical roche , nutley , nj , usa ) thrice a day , 30 minutes before meal , for 12 weeks .
the medication was provided at no cost . for both treated and control groups , no reinforced specific nutritional intervention
was recommended during this study other than the usual nutritional advice regarding the medication , reflecting a real clinical context .
follow - up was systematically conducted by phone for all subjects at 4 and 8 weeks into the study , in order to ensure subject 's compliance with the medication and to note any significant changes in lifestyle .
( 1 ) one underwent bariatric surgery , ( 2 ) one had medication change within follow - up period , and ( 3 ) five did not attend their follow - up visit . in the treated group , ( 1 ) one
had clinically significant side effects on the medication , and ( 2 ) one did not attend the follow - up visit .
total body mass , lean and fat mass , height , and bmi have been determined with an electrical bioimpedance balance ( tanita tbf-350 , tokyo , japan ) .
blood pressure and resting heart rate were measured following a 30-minute resting period while subjects were lying on their side during the echocardiogram study .
blood pressure was measured using an adapted size blood pressure cuff and an electronic sphygmomanometer ( welch - allyn , 5200 series , arden , nc , usa ) .
glycemia was determined using an enzymatic method ( hitachi , 717 auto analyzer ; roche , laval , canada ) and glycated hemoglobin ( hba1c ) was measured by binding affinity ( abbot imx , mississauga , canada ) .
plasma cholesterol and triglycerides concentrations were measured using previously described methods ( hitachi , 717 auto analyzer ; roche , laval , canada ) [ 20 , 21 ] .
serum hdl - cholesterol was analysed with an enzymatic precipitation of ldl - cholesterol and vldl - cholesterol , using phosphotungstate and mgcl2 .
echocardiographic measures were performed with a commercial ultrasound system ( sonos 5500 ; hewlet packard , andover , massachusetts ) .
standard parasternal , short - axis , and apical views were performed in accordance with the recommendations of the american society of echocardiography and the same observer , who was blinded to randomisation , obtained all recordings and measurements .
left ventricular diastolic dysfunction ( lvdd ) , using transmitral and pulmonary veins recordings , was evaluated using well - standardized criteria as previously reported [ 20 , 21 ] .
left ventricular mass ( lvm ) was calculated according to the following formula : lvm ( g ) = 0.8 1.04[(lvedd + ivst + pwt ) ( lvedd ) ] + 0.6 , where lvedd represents the left ventricle end diastolic dimension , ivst the interventricular septal thickness , and pwt the posterior wall thickness .
heart rate variability ( hrv ) was derived from a 24-hour holter monitoring system ( marquette electronics inc . ,
numerous indices in the frequency and the time domains were determined [ 7 , 21 ] : mean value of all rr intervals ( mean nn ) , standard deviation of the rr intervals ( sdnn ) , standard deviation of the mean nn intervals for each 5 minutes period ( sdann ) , square root of the mean squared difference of successive rr intervals ( rmssd ) , percentage of differences between adjacent normal rr intervals exceeding 50 milliseconds ( pnn50 ) , high frequency ( hf ) , and low frequency ( lf ) . within the 24-hour evaluation ,
three periods were assessed : ( 1 ) 24 hours , ( 2 ) daytime period defined as 8:00 am to 8:00 pm , and ( 3 ) night time period defined as 12:00 am to 6:00 am .
comparisons between normal , spontaneous , and pseudonormal pattern of lv filling pre and posttreatment were conducted with a mixed anova design .
this analysis allowed us to first compare groups ( treatment versus control ) in regards to baseline data and to determine the treatment effect as well as interactions between groups and treatment .
the dependent variable associated to lv diastolic function was analysed using a cumulative multinomial distribution with an independent covariance structure . thereafter ,
if significant differences occurred , a posteriori tukey 's comparison technique was performed to determine differences .
relationships among variables were measured using pearson 's correlation coefficients . in order to test the normality distribution of the data ,
brown and forsythe 's variation of levene 's statistics test was used to verify the homogeneity of variances .
data were analysed using the statistical packages sigma stat ( chicago , il , usa ) and sas ( sas institute inc . , cary , nc , usa ) .
table 1 presents clinical characteristics of patients in both groups before and after treatment .
there were no significant statistical differences between the two groups for all parameters at the beginning of the study ( table 1 ) .
after 3 months of treatment with orlistat , there was a significant reduction in body weight ( p < .001 ) , bmi ( p = .003 ) , and waist circumference ( p = .005 ) .
when compared to the control group , mean weight loss ( 3.7 3.0 versus 0.5 2.2 kg ; p = .003 ) , corresponding to a percentage of weight loss of 2.9 2.5 versus 0.3 1.5% ( p = .003 ) , was statistically different .
weight loss in the treatment group was associated with improvements in fasting glycemia , which decreased only in the group treated with orlistat ( p = .03 ) .
however , there was a significant decrease in hba1c ( controls : p < .001 and treated : p = .02 ) as well as in the ldl - cholesterol levels in both groups ( controls : p = .05 and treated : p = .03 ) . in the treatment group ,
no significant difference was observed between the two groups after treatment for the other anthropometric and metabolic parameters ( table 1 ) . in the 24-hour hrv indices
, there was a significant increase in rmssd ( p = .02 ) as well as in pnn50 ( p = .03 ) in the treated group following weight loss ( table 2 ) . while there was no significant change in the hrv daytime indices , night time measures showed a significant improvement in rmssd in the treated group only ( p = .023 ) .
following weight loss , high - frequency ( hf ) power measured during the 24-hour period increased significantly ( p = .05 ) , but during daytime and night time , increments did not reach statistical significance ( daytime : p = .056 and night time : p = .1 ) ( table 2 ) .
the lf / hf ratio decreased significantly in the treated group in the 24-hour assessment ( p = .038 ) as well as during daytime ( p = .006 ) .
echocardiographic parameters measured in both groups as well as normal values are shown in table 3 .
there were no statistically significant differences in heart dimensions or parameters of lv diastolic function between the control group and the orlistat - treated group at the beginning of the study . despite normal baseline values
, we observed a nonstatistical increment in ejection fraction after treatment with orlistat ( p = .054 ) , the values after treatment being also significantly greater than the ejection fraction values of the control group ( p = .04 ) .
there were 11 out of 16 subjects with impaired lv diastolic function ( 7 spontaneous and 4 pseudonormal lvdd ) in the treatment group while there were 7 out of 13 subjects ( 5 spontaneous and 2 pseudonormal lvdd ) in the control group ( figure 1 ) .
isovolumetric relaxation time , a wave velocity , e / a ratio , deceleration time , as well as the a wave duration were not statistically different following treatment .
however , e wave velocity significantly increased in the treatment group ( p = .046 ) . during the valsalva manoeuvre
, we observed a significant decrease of the a wave velocity in the treatment group ( p = .007 ) , concomitant to a significant increase in the e / a ratio ( p = .024 ) .
this increment was statistically different to the effect observed in the control group ( p = .027 ) .
accordingly , for the patients with a pseudonormal diastolic function , using the e / a value assessed during the valsalva manoeuvre in order to account for the increased pressure of lv filling , there was a significantly enhanced lv diastolic function in the treatment group ( p = .014 ) .
thirty - height percent of the subjects ( 6/16 ) in the treatment group significantly improved their lv diastolic function ( p = .03 ) .
in contrast , in the control group , there was no improvement ( p = .35 ) except for one subject while 3 subjects worsen their lv diastolic function .
the amelioration of lv diastolic function in the treated group was significantly different to the control group ( p = .026 ) .
as expected , a positive correlation was found between body weight and bmi and lv mass ( r = 0.68 and r = 0.44 , resp . ; both p
an inverse correlation was also observed between body weight , bmi , and lv ejection fraction ( r = 0.48 and r = 0.52 , resp . ; both p < .001 ) .
there was positive correlation between e / a ratio and 24-hour measurement of hf ( r = 0.361 ; p < .01 ) , rmssd ( r = 0.456 ; p < .001 ) , and pnn50 ( r = 0.458 ; p < .001 ) .
changes in e / a ratio and delta lf / hf ratio during 24-hour and daytime also showed correlations ( r = 0.377 ; p = .048 and r = 0.458 ; p = .014 , resp . ) .
we observed that modest orlistat - induced weight loss enhances sympathovagal balance and cardiac function in severely obese patients with type 2 diabetes .
after a 3-month treatment period with orlistat , subjects lost significantly more weight than subjects in the control group .
akehi et al . reported that very - low calorie diet - induced weight loss in moderately obese subjects improved nn , sdnn , sdann , rmssd , hf , and lf / hf ratio values .
similarly , poirier et al . reported that a 10% diet - induced weight loss in 8 severely obese subjects was associated with significant improvement in autonomic cardiac modulation through enhancement of parasympathetic modulation which translates clinically into decreased heart rate and increased hrv . in our study ,
rmssd , pnn50 , and hf values of the 24-hour hrv were significantly improved in the treated group .
all these indices are considered to reflect the parasympathetic system and being protective from a cardiovascular disease viewpoint .
furthermore , another significant improvement was the decrease in the lf / hf ratio assessed during 24 hours and during daytime in the treatment group .
accordingly , poirier et al . observed that the improvement in hrv after weight loss occurred mainly during the daytime period .
our results show similar improvement in the parasympathetic modulation and in the sympathovagal balance , particularly during daytime .
studies [ 10 , 14 , 26 ] reported that , following bariatric surgery which induced important weight loss in severely obese subjects , lv mass was significantly reduced . in our study , weight loss in the treatment group was accompanied with a significant decrease in the posterior wall thickness and in lv mass as also reported by others [ 2729 ] . to our knowledge , there are no data available in severely obese subjects investigating the impact of weight loss on the pseudonormal pattern of lv filling using the valsalva manoeuvre .
we observed an improvement of lv diastolic function in over half of the treated subjects compared to only one patient who had an improved lv diastolic function in the control group .
of note , the relations between hrv and echocardiographic parameters revealed that rmssd and hf values correlate with e / a ratio .
interestingly , we also found a significant positive correlation between changes in e / a ratio and changes in lf / hf ratio during 24-hour and daytime .
these associations suggest that improvement in the parasympathetic function is related to improvement in the cardiac lv diastolic function parameters , as we previously reported in overweight subjects with diabetes . of note
, there are only few reported studies using pharmacological approach in severely obese patients [ 3032 ] and hrv and diastolic function has not been evaluated within the same study in this population .
the magnitude of weight loss induced by the medication is smaller ( 2.9 2.5% ) but may be comparable to findings previously reported , accounting for the time - treatment period .
sjstrm et al . have reported a 10% weight lost ( 10 kg ) after a year of treatment with orlistat in a cohort of overweight to severely obese subjects .
other studies using orlistat for a longer period ( 12 to 24 months ) have also reported similar results [ 3439 ] .
taking into account that our study only lasted three months , we may speculate that subjects of our study could have possibly lost comparable amount of weight if had our study lasted 12 months .
indubitably , the definitive treatment in this obesity category is bariatric surgery , but clinicians aim at a 5%10% weight loss in order to achieve better metabolic profile in obese subjects [ 1 , 15 ] .
accordingly , fujioka et al . reported that every 4.5 kg reduction in weight should result in a 1.1 mmol / l decrement in fasting glycemia and to a 0.5% reduction in hba1c .
however , we also observed a significant decrease in hba1c in the control group , which was not different to the decrease observed in the treated group .
we also observed a significant decrease in ldl cholesterol in the treated group as well as in the control group .
this is not unusual and it is often encountered in placebo groups of weight loss studies .
indeed , similar results have been reported in obese subjects after a 4-week run - in period before treatment with orlistat [ 34 , 35 ] .
studies [ 38 , 39 ] in overweight to obese type 2 diabetic patients with longer treatment duration ( 6 to 12 months ) resulting to greater weight loss report greater changes in metabolic profiles , leading after 12 months to significant differences between orlistat - treated group and control group .
however , weight loss was significant in the treated group whereas it was not in the control group .
also , a few echocardiographic measurements , mainly those regarding the pulmonary veins assessment , were not adequately recorded because of technical reasons due to the corpulence of the subjects .
other indices of lv diastolic function , such as tissue doppler - derived indices , may be less load - dependent . however , dumesnil et al . reported that tissue doppler - derived indices are not totally preload independent and
should be interpreted in light of the other doppler parameters and the use of valsalva 's manoeuvre .
the aim of this study was to determine the impact of orlistat - induced weight loss on the metabolic profile and cardiovascular function in severely obese type 2 diabetes patients .
twenty - nine severely obese patients with type 2 diabetes were randomized either to a nonplacebo control group or to a treatment group with orlistat thrice a day .
metabolic profile , anthropometric parameters , heart rate variability indices , and echocardiographic variables were measured before and after a 12-week treatment period .
our results suggest that a modest weight loss improves fasting glycemia , diastolic function , and sympathovagal balance in severely obese patients with type 2 diabetes .
despite modest but significant weight loss , we observed that subjects treated with orlistat showed improvements in fasting glycemia .
we also observed improvements in hrv as well as in the lv diastolic function .
the improvement in the cardiac parasympathetic ans modulation was associated with enhancement in lv diastolic function .
our results emphasize the benefit of even modest weight loss in severely obese patients with diabetes .
roche company had no role in the design , collection , analysis , or interpretation of the data nor in the decision to submit the study for publication . | objective . determine the impact of orlistat - induced weight loss on metabolic profile and cardiovascular function in severely obese patients with type 2 diabetes
. methods .
twenty - nine patients were randomized either to a nonplacebo control group or to a treatment group with orlistat thrice a day .
metabolic profile , anthropometric parameters , heart rate variability indices , and echocardiographic variables were measured before and after a 12-week treatment period .
results .
treatment with orlistat induced a modest but significant weight loss compared to controls ( 3.7 3.0 versus 0.5 2.2 kg , resp . ; p = .003 ) .
there was significant decrease in fasting glycemia ( 7.9 3.0 versus 6.7 2.2 mmol / l ; p = .03 ) and significant improvements in left ventricular diastolic function ( p = .03 ) and in the sympathovagal balance ( lf / hf ratio ) ( p = .04 ) in the orlistat group .
conclusion .
these results suggest that a modest weight loss improves fasting glycemia , left ventricular diastolic function , and sympathovagal balance in severely obese patients with type 2 diabetes . |
we used the methodology described by glenn and schable ( 2005 ) to construct a microsatellite - enriched library .
the extraction of genomic dna was performed using the qiagen ( www.qiagen.com ) dneasy blood & tissue kit using approximately 25 mg of whole male and female biotype b whiteflies from a laboratory - reared population sampled from arizona .
we then separately digested the dna with the restriction enzymes rsai and bstui ( new england biolabs , www.neb.com ) .
digested fragments were ligated to the supersnx24 linker oligos and amplified with polymerase chain reaction ( pcr ) .
following evidence of successful ligation , the linker - ligated dna from both digestions was pooled before enrichment .
we enriched for microsatellite sequences using streptavidin - coated beads ( dynalbead ) and the following mix of 3-biotinylated probes : ( actg)4 , ( acct)4 , ( aaag)4 , ( aatc)4 , ( aatg)4 , ( aaac)4 , ( acag)4 , and ( actc)4 . those probes were selected to isolate tetranucleotides to minimize scoring errors and polymerase slippage . also , di- and trinucleotides were already available in the literature , and most did not cross - amplify successfully in other biotypes .
a pcr of the enrichment using the supersnx primer was performed to recover sequences containing repeats .
this pcr product was enriched again using the same mix of probes as above and again recovered with pcr .
pcr products were inserted into a vector and transformed into escherichia coli using the topo ta cloning kit ( invitrogen , www.invitro gen.com ) .
four cloning reactions were performed , and colonies were grown overnight . in total , 384 positive clones were then picked , cultured overnight , and pcr amplified using the m13 forward and reverse primers .
a set of 194 clones seemed to have inserts of the appropriate size ( 3001,200 bp ) .
pcr products from these clones were purified using exosap - it ( ge healthcare , www.gehealthcare.com ) and sequenced in the forward and reverse directions with the m13 primers and bigdye version 3.1 ( applied biosystems , abi , www.appliedbiosystems.com ) on an abi 3730 dna analyzer . of the clones sequenced successfully , 79 appeared to contain microsatellite sequences .
primers were designed manually for the best 18 candidates ( see supp material [ online only ] ) and analyzed using the integrated dna technologies ( integrated dna technology 2007 .
www.idtdna.com ) oligoanalyzer tool , resulting in 18 primer pairs that were synthesized by idtdna .
the primer pairs were tested over a range of annealing temperatures and mgcl2 concentrations , and eight pairs that failed to amplify the expected loci were discarded and were not tested further .
the remaining 10 loci were tested for variation by screening across two populations belonging to biotype b. for fragment analysis , microsatellite forward primers were synthesized and labeled with a fluorescent dye by applied biosystems ( table 1 ) .
the pcr conditions were optimized to work across all 10 loci using a touchdown protocol .
reactions were done in 10 l volumes using 1 l of genomic dna , 0.75 mm dntps mix , 0.5 m of each primer , 1 l of 0.1 mg / ml bovine serum albumin ( bsa , new england biolabs , www.neb.com ) , 1.25 l of 10 pcr buffer from applied biosystems ( 12.5 mm tris - hcl , ph 8.3 , 62.5 mm kcl ) , 0.751.125 mm mgcl2 ( abi ) ( table 1 ) , and 0.5 u of amplitaq gold dna polymerase ( abi ) .
amplification of all loci was done using touchdown pcr with the following thermocycling conditions : 1 cycle of 95c for 10 min followed by 2 cycles of 94c for 1 min , 60c for 1 min , 70c for 35 s followed by 18 cycles of 45 s at 93c , 45 s at 59c ( lowering 0.5c each cycle ) , and 45 s at 70c .
the final amplification step consisted of 20 cycles of 30 s at 92c , 30 s at 50c , and 1 min at 70c followed by a final extension step at 70c for 5 min .
final pcr products were mixed with a cocktail of 48:1 hi - di formamide ( abi)/liz500 size standard ( abi ) ( 0.5 l of pcr product , 0.2 l of liz , and 9.3 l of formamide ) and were denatured at 95c for 5 min .
fragments were run on an abi 3730 dna sequencer , and genotypic data were visualized and scored manually using the software genemapper version 4.0 ( abi ) .
table 1.properties of nine polymorphic tetra- and pentanucleotide microsatellite loci cloned from bemisia tabaci biotype bmicrosatellite locus nameprimer sequence ( 53 direction)repeat motiffluorescent dye color ( applied biosystems)mgcl2 ( mm)accession numbersbiotypes ( other than b ) and haplotypes successfully cross - amplifiedwf1b11f : gcattgaacatttttctgcatgcgcg(cctga)12impned1jq436838a , h , k , l , m , ms , q , s , t , african , asian , australian , and new world haplotypesr : gcacacagctctccaaaagaaaggtcwf2c01f : atgataccgcacgaaaaagaggacg(gttt)11impned1jq436842l , m , q , african , asian , and new world haplotypesr : cttgaattacatcaaacgcagcagcwf2h06f : tattcgccaatcgattcctt(tttg)11ned0.75jq436844a , l , m , ms , q , african , new world , and yemen haplotypesr : cggcggaaatttcgataaawf1b06f : tctcatagaaaattttggagaaagaaa(actc)8pet0.75jq436837l , ms , q ( only spain q or q1 ) , african , new world , and yemen haplotypesr : tgcggaatctcagggtcatawf2e11f : tctccaaccataatttttaatctcg(gatt)27imppet1jq436843l , m , ms , q , african , new world , and yemen haplotypesr : gtctgggcaggaaaacgatwf1d04f : gttgttaggttacagggtttgtc(caaa)166-fam1jq436839a , s , t , african , and new world haplotypesr : gtctttacttctcttttcctccgwf1g03f : ctccaaaatgggacttgaac(gttt)8ned1.125jq436840h , k , m , ms , q , t , african , asian , australian , and new world haplotypesr : gtagaagccacacatactagcacwf2a05f : attgatcattttcggctaccttatc(caaa)12impned1.125jq436841r : cgacccttctgtaaatgatagactwf2a02f : gaagtgcataaaaacatcgtcgccg(cttt)10impned1jx853746r : caattgaaaggctagactccctggcimp , imperfect.locus name , primer sequences , repeat motif , fluorescent dye color used in fragment analysis , mgcl2 concentration , genbank accession numbers , and successful cross - amplification in non - b biotypes and haplotypes .
properties of nine polymorphic tetra- and pentanucleotide microsatellite loci cloned from bemisia tabaci biotype b locus name , primer sequences , repeat motif , fluorescent dye color used in fragment analysis , mgcl2 concentration , genbank accession numbers , and successful cross - amplification in non - b biotypes and haplotypes .
screening was done using 30 females from each population belonging to biotype b ( from cyprus and egypt ) .
observed and expected heterozygosities , and allelic richness were calculated using genalex 6.1 ( peakall and smouse 2006 ) .
deviation from hardy weinberg equilibrium and gametic linkage disequilibrium were tested using genepop ( raymond and rousset 1995 ) .
an analysis for the presence of null alleles was carried out using the software microchecker ( van oosterhout et al .
among the 10 loci that were examined , one was difficult to score , showing ambiguous peaks .
we selected the remaining nine loci to report and use in subsequent analyses , which showed good amplification results in populations from both biotypes and were easily scored , with clear , reproducible peaks .
the nine loci had 212 alleles in the tested populations , with observed heterozygosity ranging from 0.033 to 0.967 and expected heterozygosity ranging from 0.033 to 0.854 ( table 2 ) .
there was no significant deviation from hardy weinberg equilibrium after correcting for multiple comparisons using the sequential bonferroni correction ( rice 1989 ; p < 0.05 ) , and no significant linkage disequilibrium was detected between loci ( p < 0.05 ) . however , one locus ( wf2co1 ) showed evidence for null alleles in the two populations ( table 2 ) .
table 2.population-specific characteristics of the nine microsatellite loci tested in two populations from biotype b population testedcyprus biotype begypt biotype blocus nameallele size range ( bp ) ( na)f null allelesnho / heallele size range ( bp ) ( na)f null allelesnho
/hewf1b11106193
( 11)0.0137300.800/0.825106173 ( 8)0.0596300.700/0.808wf2c01150187 ( 10)0.1478300.567/0.838150187 ( 9)0.1662300.500/0.799wf2h06172196 ( 7)0.0235300.867/0.824172204 ( 8)0.0432300.867/0.789wf1b06158162 ( 2)0.0005300.033/0.033146162 ( 3)0.0305300.200/0.238wf2e11220260 ( 9)0.0459290.655/0.735199260 ( 12)0.0509300.667/0.756wf1d04124172 ( 12)0.0688300.967/0.840124164 ( 10)0.0114300.833/0.854wf1g03139162 ( 5)0.0077300.167/0.158158162 ( 2)0.0005300.033/0.033wf2a05141158 ( 4)0.0134230.217/0.201154158 ( 2)0.0724220.045/0.127wf2a02155159 ( 2)0.0028260.077/0.074155159 ( 2)0.001220.045/0.044loci with evidence for null alleles in this population after analysis in microchecker ( van oosterhout et al .
2004 ) are in bold.allele size range , na : number of observed alleles and n : number of individuals scored , estimated null allele frequency ( van oosterhout et al .
population - specific characteristics of the nine microsatellite loci tested in two populations from biotype b loci with evidence for null alleles in this population after analysis in microchecker ( van oosterhout et al .
allele size range , na : number of observed alleles and n : number of individuals scored , estimated null allele frequency ( van oosterhout et al . 2004 ) , and observed ( ho ) and expected ( he ) heterozygosity . of the loci reported here , seven were successfully amplified in non - b biotypes and haplotypes from worldwide mtcoi clades of b. tabaci as indicated in table 1 .
this successful cross - biotype amplification may be attributed to the fact that tetranucleotides have a lower mutation rate compared with dinucleotides ( chakraborty et al .
1999 ) , and thus may be more useful in studies of sibling species species that are more closely related than any other pair of species but more genetically divergent compared with populations within a single species as seems to be the case of b. tabaci .
this is the first study that reports the isolation and characterization of a number of tetranucleotides from b. tabaci and may prove particularly useful in subsequent studies of multiple biotypes .
the loci reported here are being used to study the population genetic structure of worldwide biotypes within the b. tabaci species complex , to examine gene flow between mediterranean populations belonging to invasive biotypes b and q , and to study the invasion history of biotype q in the united states . | nine microsatellites were isolated from bemisia tabaci ( gennadius ) biotype b and screened across 60 individuals from two populations ( biotype b ) to examine polymorphism .
two to 12 alleles were observed per locus . observed and expected heterozygosities ranged from 0.033 to 0.967 and 0.033 to 0.854 , respectively .
there was no significant deviation from hardy weinberg equilibrium and no significant linkage disequilibrium between loci .
one locus showed evidence for null alleles .
these loci will be useful in future studies of the genetic structure of worldwide biotypes and gene flow analyses between and within biotypes of b. tabaci . |
during external beam radiation therapy ( ebrt ) for prostate cancer patients , interfractional anatomical variations often occur due to organ motion and/or deformation . before the emergence of on - board 3d imaging techniques ,
these variations were accounted for by adding margins to the clinical target volume ( ctv ) to generate the planning target volume ( ptv ) [ 1 , 2 ] .
however , the large deformation / shift of organs around the prostate and the seminal vesicles can still lead to incomplete coverage of the target .
figure 1 shows one such example , due to shape and volume variations of the bladder and the rectum , the daily ctvs ( prostate and seminal vesicles ) exhibit not only the position variations , but also shape changes , which lead to mismatch between high - dose region and the daily ctv . to improve daily ctv coverage , image - guided radiation therapy ( igrt )
for example , at our institution , in - room imaging systems such as on - board imager ( obi , varian medical systems , palo alto , ca ) are used to guide the on - line patient positioning as well as target alignment .
the patient / target position correction schemes include 2d-2d matching , where on - board orthogonal megavoltage ( mv)/kilovoltage ( kv ) images are matched with digitally reconstructed radiographs ( drrs ) from planning ct data [ 35 ] , and 2d-3d matching , where planning ct is shifted / rotated in three dimensions to match drrs with daily mv / kv images [ 58 ] .
the on - board cone - beam ct ( cbct ) imaging has also led to wide implementation of 3d soft tissue target matching and repositioning .
such matching is based on daily contours [ 9 , 10 ] , or grey - scale values of the on - board and planning 3d images [ 1114 ] . in most clinical protocols ,
soft - tissue matching is limited to translational position corrections due to restricted dimensions on couch motion . to further improve
daily dose delivery accuracy , on - line and off - line plan adaptation or modification utilizing daily volumetric imaging has been actively studied by several groups [ 1327 ] .
plan adaptation can account for not only target position variation , but also the deformation of target and/or organ - at - risk ( oar ) volumes , which occur frequently during prostate cancer treatment .
some groups have proposed modification of the multileaf collimator ( mlc ) segments ( aperture shape ) directly based on daily structure shapes and positions [ 1317 , 19 , 20 ] ; while others have investigated off - line replanning techniques based on patient - specific target shape / volume variation trends [ 2125 , 28 ] .
we have recently developed an on - line plan reoptimization technique that can correct large anatomical variations and generate highly conformal daily plans using linear programming models [ 5 , 18 ] . in this paper , we summarize our approach towards a clinically applicable on - line adaptive radiation therapy ( art ) system . the paper is divided into four sections .
first , we present the online plan adaptation technique and demonstrate that the adaptation can be implemented with speed comparable to the repositioning - based igrt techniques .
second , the dosimetric benefits of this on - line art technique are evaluated against repositioning - based igrt techniques with retrospective clinical patient case studies .
further , plan quality of the adapted plans is compared with standard imrt plans of the same anatomy .
a dose - volume histogram ( dvh ) evaluation tool is also developed for assessment of the art plan quality .
the actual dvh is assessed by comparing to predicted achievable dvh based on daily anatomical structures and the learned anatomy - dvh correlations from 198 existing treatment plans .
finally , a clinical implementation scheme is illustrated to maximize the efficiency of the art strategy by combining both soft - tissue target matching for simple target position variation and on - line reoptimization techniques for large anatomical variations .
developing a fast replanning algorithm is the first step for an adaptive radiation therapy program . recently , several groups have proposed different on - line plan adaptation methods .
they can be categorized into two groups : ( 1 ) for fluence map - based imrt plans , modifying mlc leaf positions directly based on changes in anatomical structure positions and shapes [ 13 , 15 , 16 ] and ( 2 ) for direct aperture optimization- ( dao- ) based plans , modifying the aperture shapes and weights using the projection of the target - organ deformation information [ 14 , 20 ] .
these methods feature fast adaptation but are based on manipulating either 2d fluence maps or discrete 2d beam apertures in the attempt to approximate the 3d target - oar geometry variation and regain the 3d dose conformality of the original plan .
our approach is to directly reoptimize the fluence map based on the initial imrt plan ( dose distribution ) [ 5 , 18 ] .
first , after the daily image is acquired , deformation fields are computed from deformable registration between daily cbct and planning ct images .
the original dose distribution is then deformed via the deformation fields to provide the goal dose distribution for the daily anatomy
. structures of interest ( soi ) are contoured by the same attending physician who contours on the planning ct images or propagated from planning ct to cbct via deformation fields . in the early stages of the art implementation ,
cbct image sets with physician - contoured structures have been used in our initial studies .
the deformed dose is visually checked for shape irregularities and excessively high / low dose spots before being sent to the reoptimization process [ 5 , 18 ] .
a linear programming model is chosen for its speed and robustness for the fluence map reoptimization .
once these new intensity maps are generated , dose distributions are recalculated and dose - volume histograms ( dvhs ) are computed and displayed for plan evaluation .
figure 2 illustrates the flow of the on - line plan adaptation process . to evaluate the dosimetric benefits of the online art technique
, a clinical study is performed to compare this technique with current repositioning - based igrt techniques .
this retrospective study includes 6 prostate patient cases , each with 1 planning ct and 5 daily cbct image sets . for all image sets ,
soi including ctv ( prostate + sv ) and oars ( bladder and rectum ) are contoured by a single attending physician at our institution .
the urethra is not contoured in this study since it is difficult to spare in ebrt and is generally not included in the dosimetric constraints .
the ptv is expanded with 5 mm uniform margin from ctv for all plans .
the soft - tissue - matching - based repositioning plans ( soft ) are performed by trying to cover the daily ctv with the initial planning ptv , simulating standard clinical practice of soft - tissue matching igrt .
the on - line art ( adapt ) plans are generated using our in - house developed reoptimization technique .
this plan optimization process is finished within two minutes for each of the 30 cbct image sets .
dosimetric comparisons of the adapt versus soft plans are performed . to evaluate the art plan quality ,
two methods are used to assess the dose distributions to the ctvs and the oars .
one way of evaluating plan quality is to perform head - to - head comparison between an adapted plan and a complete new plan designed in the clinical environment for the same anatomy .
this is the step we have taken during the initial implementation of the online art technique . for each adapt plan described in section 2b , a complete new plan ( new )
this new plan is performed with the clinical treatment planning system ( eclipse ) and is used as the control sample of imrt planning . the minimum dose to the hottest 99% of the ctv volume ( d99 ) and the maximal dose to ctv ( dmax )
are used to compare the adapt plan quality to the new plan for target coverage .
minimum doses to the hottest 90% ( d90 ) , 50% ( d50 ) , and 30% ( d30 ) of the oar volumes are chosen as comparison parameters for oar sparing , which represent dose sparing in low- , median- , and high - dose ranges , respectively .
although head - to - head comparison provides intuitive and direct assessment based on clinical standards , it is time consuming .
furthermore , the individual new plan performed in clinical planning system ( eclipse ) uses a trial - and - error iterative optimization scheme , thus the plan quality would be dependent of planner 's experience and time invested and should be performed by expert planners . to provide standardized plan quality assessment for art implementation
, a plan evaluation tool is developed to predict the achievable / ideal dose volume histograms ( dvhs ) based on patient anatomy information and the learned correlation between the anatomy and achieved dvh from prior treatment plans at our institution ( as shown in figure 3 ) .
first , anatomical information and dvhs of the ptvs and oars are extracted from a database of clinical treatment plans .
principal component analysis ( pca ) is used to characterize the dvh and the anatomy structure information of these existing plans . for a new set of anatomy structures
, this algorithm will predict the achievable / ideal dvhs for the bladder and the rectum in the given anatomy ( assuming that the ptv coverage remains the same for all plans ) . these predicted oar dvhs provide guidelines to judge the conformity of the adapted treatment plan . clinical implementation and integration of art
our art implementation utilizes an automatic plan - selection engine to determine whether repositioning or reoptimization should be used for the specific daily anatomy , with the goal of minimizing the frequency of reoptimization while maintaining uniform ctv coverage and improved oar sparing .
for each patient , a patient - specific plan database is created after the completion of initial treatment planning .
once the daily cbct is acquired , the ctv and oars are contoured by the attending physician or via deformable registration . the daily ctv
is then compared to the ptvs of all existing plans ( 1st treatment day only has original ct plan ) in this patient 's plan database , and the plan that covers > 99% daily ctv and minimizes exposure to the oars is selected as the best fit . if multiple plans meet the criteria , the selection engine then chooses the plan with the smallest ptv . in this way
if no plan in the database can meet the criteria , our replanning process will adapt the initial plan by re - optimizing the fluence maps ( as described in section 2.1 ) .
after delivery , this adapted plan is added to the plan database for future fractions .
to evaluate the efficacy of the art scheme , the daily plans from this proposed dual - technique scheme ( dual ) are compared with daily reoptimized new plans ( new ) , which represent the most conformal plans for the anatomy of the day , and with the currently used repositioning technique based on soft - tissue target matching plans ( soft ) .
such comparison is based on the following key dosimetric parameters : dose to 99% ctv volume ( d99 ) and doses to 90% ( d90 ) , 50% ( d50 ) , and 30% ( d30 ) volumes of the oars .
the efficiency of the art implementation scheme is measured as the reduction of frequency of reoptimization while maintaining the similar ctv coverage and oar sparing as the daily new plans . although the dose warping and reoptimization process using our algorithm takes about 2 min , it is a complicated procedure , and the qa takes additional time .
by contrast , existing plans in the patient plan database are approved plans that can be directly reused without significant change in current clinical flow . therefore
, reducing the frequency of reoptimization would generally improve the overall efficiency of art implementation .
all the dose distributions of the adapt plans are calculated in plunc ( department of radiation oncology , university of north carolina , chapel hill , north carolina ) , and dose distributions of the new , the soft , and the dual plans are calculated in eclipse .
the dose calculation engines in these two systems are different , as plunc uses delta - sar - based method and eclipse uses pencil - beam convolution method .
the discrepancies between dose distributions calculated by these two systems are within 2% for 3d conformal prostate treatment planning .
however , a study at our institution demonstrated that the difference is minimal ; the mu / cgy differences were less than 1% for most phantom cases , and the isodose distribution from two calculations agreed very well .
yang et al . also reported that dose computed based on ct and cbct agreed to within 1% .
the original ct plan , the repositioning only plan ( soft ) , and the adapted plan ( adapt ) are presented . due to the significant deformation of the bladder ( red contours ) and the rectum ( green contours ) , the position and volume of daily ptv ( black contours ) are substantially different from that of the planning ptv on the original ct .
therefore , even after repositioning , the daily ptv suffers significant underdosage in the superior direction , illustrated by part of volume not covered by the 95% isodose line in the soft plan .
in addition , a large portion of rectum is irradiated with high dose in the soft plan .
improvement of target coverage and oar sparing is achieved in the adapt plan , with highly conformal isodose lines to the daily ptv .
the cbct images used in this study may not have the same image quality , for example , soft tissue contrast , compared to the planning ct ; therefore , the contouring on cbct images is more challenging .
to assure consistency , all the structures on both ct and cbct images studied in this paper were retrospectively contoured by a single experienced attending physician at our institution .
we assume the contours in cbct are consistent with those in the planning ct , as well as between fractions . in this example
, the relative locations of prostate and sv significantly alter the ptv shape , causing discrepancies between the daily and the planning anatomies .
the proposed reoptimization technique is especially beneficial if large deformational variation of organs is present . in clinical practice ,
such large variation of bladder and/or rectum shape and volumes may sometimes be reduced by patient instructions and additional preparations , for example , treating with a full bladder or emptying rectal gas .
the benefit of implementing art system is to be further validated against such attempt in future work .
figure 6 shows the d99 ( minimum dose to ctv ) of the daily ctvs for the 6 clinical cases with 30 total treatment fractions .
the adapted plans ( adapt ) from our fast reoptimization algorithm are evaluated against the repositioning plans ( soft ) . as shown ,
the adapt plans feature highly consistent full ctv coverage , demonstrated by all d99 values ranging within ( 100 2.5)% of the prescription dose .
the daily d99 of the repositioning technique , on the other hand , fluctuates substantially , ranging from 45% to 103% .
overall , the ctv coverage is compromised in 46% of the soft plans . to evaluate oar sparing between the adapt and the soft plans , the percentage dose differences delivered to each volume indices ( 90% , 50% , and 30% volume , resp . )
figure 7 shows the statistical analysis between the adapt and the soft plans for the d90 , d50 , and d30 of the bladder and the rectum .
positive values on the y - axis suggest that the reoptimization technique has reduced dose compared to the repositioning technique for the corresponding volume , and vice versa .
the red lines , blue boxes , and black dashed lines represent the median , 50% range and full range of data in each group , respectively .
notches on boxes indicate the intervals of 95% confidence level . for both bladder and rectum ,
the median values are all above zero , and majority of data support the assumption that reoptimization technique is superior to repositioning technique , at 95% confidence level .
single - side t - test reveals that the online art technique is superior to the soft - tissue - based repositioning technique in low - dose ( p = .0156 ) and median - dose ( p = .0377 ) ranges for the bladder , and in low - dose ( p < .0001 ) and high - dose ( p = .0247 ) ranges for the rectum .
the advantage of adapt plans over soft plans in high - dose range for the bladder and median dose for the rectum is statistically insignificant ( p = .1318 and .1672 , resp . ) . as seen in figure 7 , for some cases ,
figure 8 shows an example case . in this case , although the soft plan provides better sparing for the bladder and the rectum in the high - dose regions , the ctv coverage is significantly compromised , with d99 at 84.6% .
such false oar sparing with compromised ctv coverage is often seen in cases with large sv shift due to bladder and/or rectum deformation . the random error in daily ctv coverage
could be washed out when cumulative dose of all fractions is calculated [ 31 , 32 ] . in this study , only fractional dose was compared since the focus of our online art system is to achieve desired dose of each treatment .
head - to - head comparison between the adapt plans and the new plans is performed for the same 6 patients .
figure 9 shows the comparisons between the adapt plans and the corresponding new plans for ctv coverage . both d99 ( green ) and dmax
( blue ) values are compared by calculating the difference between the adapt and the new plans .
the y - axis indicates the deviation of the adapt plans from the new plans .
if adapt plans have identical d99 and dmax to the new plans , the deviations would be zero .
positive value suggests that the adapt plan gives higher d99/dmax compared to the new plan , whereas negative value indicates that the adapt plan has lower d99/dmax .
the deviations for d99 are within 0.3% to 1.4% of the prescription dose , and the deviations for dmax .
range within 3% to 2% , indicating that the capability of controlling low - dose ( cold spot ) and high - dose ( hot spot ) regions in the adapt plans is similar to the new plans .
the y - axis indicates the difference in average d90/d50/d30 between the adapted plans and the new plans .
positive value suggests that the adapt plans give higher dose to a particular volume than the new plan , whereas negative value indicates better sparing achieved by the adapt plans . in general , the adapt plans are slightly inferior to the new plans in the median- and high - dose ranges ( d50 , d30 ) , demonstrated by positive values being the majority , but in most cases the discrepancies are within 5% , with the rest ranging from 8% to 10% . in low - dose range ( d90 ) ,
most of the adapt plans are similar to the new plans ( within 2.5% ) , with one exception in which the adapt plan shows 8% lower dose than the new plan .
the plan quality evaluation tool is based on machine learning and is trained using a database of previous 198 expert plans to establish an anatomy - dvh model . as shown in figure 11 , the evaluation system utilizes the anatomical structure information from input cases and uses the trained model to predict the achievable / ideal dvh bands ( colored lines ) with 95% confidence levels for 14 test cases . also shown
highlighted by black boxes are plans whose actually achieved dvhs are inferior to the predicted dvhs , indicating possible improvement on plan quality .
for this proof - of - concept study , the prediction algorithm implemented in this study is learned from a database of plans at our institution and demonstrated to be effective using test cases acquired from the same clinical settings , for example , imaging device , contouring conventions .
however , care should be taken when implementing this algorithm at another institution , and the learned model in this study should be tested and validated for the particular clinical settings at that institution .
further , the algorithm can be re - trained to the new plan database of that institution .
figure 12 shows the histograms of the ctv coverage of the dual - technique art plans ( dual ) , the repositioning igrt plans ( soft ) , and the daily reoptimization plans ( new ) , respectively .
both the dual and the new plans exhibit highly uniform ctv coverage ; d99 values for all plans are mostly concentrated in the 98% to 105% prescription dose range .
oar sparing of the dual plans is also compared against the new and the soft plans , and the result is illustrated in figure 13 .
quantitative analysis is based on averaged d90 , d50 , and d30 over 10 cbct fractions for each patient .
each column in figure 13 shows the full range ( dashed lines ) , the 25th to 75th percentile range ( color boxes ) , and median value ( red lines ) of the d30 , d50 , and d90 values .
compared to the soft plans , both the new and the dual plans feature smaller median value and smaller ranges for all three parameters for both organs , indicating better and more consistent oar sparing performance .
the new plans represent the control sample with the most conformal isodose distribution and therefore have best oar sparing performance .
the dual plans offer bladder sparing comparable to the new plans within 5% variation in both median value and 25th75th ranges . for the rectum ,
the dual plans have less sparing compared with the new plans but still show improvement over the soft plans . for some patients , the soft plans
have lower dose to the oar compared to the new plans , as seen in d30 for the bladder and d50 for the rectum , but such apparent sparing is often associated with compromised ctv coverage , as illustrated in figure 8 .
the efficiency of the dual - technique art implementation scheme is presented in figure 14 .
solid black bars are the numbers of patients that are treated with daily reoptimized plans for a particular fraction , due to the unsuccessful matching between the daily structures and the existing plans in the patient - specific database .
as more fractions are delivered and more reoptimized plans are cumulated in the patient plan database , the number of necessary replanning patients decreases ( shorter black bars ) , corresponding to the increasing number of patients treated with existing plans in the database , that is , original ct plan ( dark grey bars ) and previous daily reoptimized plans ( light grey bars ) .
the reduction on the need for reoptimization could benefit institutions treating large number of patients at the same time , as reusing existing plans from the database requires minimal change in the current clinical flow .
this paper provides an overview of different components of our on - going work towards developing an adaptive radiation therapy system .
there are still several technical challenges that need to be addressed before this art system can be clinically implemented .
the online reoptimization process has been implemented in plunc and cplex ( ibm corp . ) , while currently in the clinical practice at our institution , eclipse and aria ( varian medical systems , palo alto , ca ) are the treatment planning and delivery platforms . to integrate the online reoptimized plan to the clinic , data interfaces between plunc - cplex and eclipse - aria need to be configured in order to transfer the adapted plans .
also , efficient quality assurance ( qa ) technique for art plans needs to be developed to maximize the efficiency of art .
finally , the evaluation of the benefit of our art system should be extended to radiobiological indices , including eud , tcp , and ntcp .
an on - line adaptive radiation therapy ( art ) system for prostate cancer is developed to efficiently account for interfractional organ motion / deformation and improve daily target coverage and oar sparing .
our fast plan reoptimization algorithm produces adapted plans featuring substantially improved daily target coverage and oar sparing compared to current igrt technique based on repositioning .
the plan quality of reoptimized plans is comparable to those generated by full - fledge inverse planning and optimization in commercial treatment planning system .
in addition , a plan quality evaluation tool , predicting achievable dvh based on patient 's daily anatomical structure information and learned anatomy - dvh model , is developed to ensure that reoptimized plan meets clinical requirement .
finally , the dual - technique scheme , in which repositioning is expanded to all delivered plans in the patient - specific plan database and integrated with reoptimization technique on a need - based fashion , is clinically feasible , highly efficient , and dosimetrically beneficial . in conclusion ,
the on - line art system is technically achievable with deformable registration , fast reoptimization algorithm , and the proper integration of multiple systems . | the purpose of this paper is to evaluate the feasibility and clinical dosimetric benefit of an on - line , that is , with the patient in the treatment position , adaptive radiation therapy ( art ) system for prostate cancer treatment based on daily cone - beam ct imaging and fast volumetric reoptimization of treatment plans .
a fast intensity - modulated radiotherapy ( imrt ) plan reoptimization algorithm is implemented and evaluated with clinical cases .
the quality of these adapted plans is compared to the corresponding new plans generated by an experienced planner using a commercial treatment planning system and also evaluated by an in - house developed tool estimating achievable dose - volume histograms ( dvhs ) based on a database of existing treatment plans .
in addition , a clinical implementation scheme for art is designed and evaluated using clinical cases for its dosimetric qualities and efficiency . |
bone hemangiomas account for about 1% of all bone tumors and commonly involve the vertebrae and the skull ( 1 ) .
hemangioma of the rib is uncommon and its diagnosis based on its 2-deoxy-2-[18f]-fluoro - d - glucose ( 18f - fdg ) avidity on positron emission tomography ( pet ) scan is extremely rare .
herein , we report a 63-year - old man in whom a hemangioma of the left sixth rib was incidentally detected on a plain radiograph . for further investigation ,
a 63-year - old man was admitted to our hospital for evaluation of an incidentally detected rib mass on a plain chest radiograph
an anterior - posterior view of a plain chest radiograph taken at another outpatient clinic revealed a moderately defined mass in the left upper hemithorax arising from the sixth rib ( figure 1 ) .
for further evaluation , ct scan ( somatom definition flash , siemens healthcare , forchheim , germany ) was performed .
it demonstrated an osteolytic eccentric expansive mass with sunburst calcification and focal cortical disruption at the posterolateral arc of the left sixth rib , measuring 5.5 2.5 1.5 cm ( figure 2 ) .
based on ct scan findings , differential diagnoses of malignant tumors , including chondrosarcoma , metastatic tumor , or multiple myeloma were considered . to distinguish between the differential diagnoses , a 18f - fdg pet / ct scan
was obtained ( ge , discovery , milwaukee , wi , usa ) , on which the lesion showed low 18f - fdg avidity ( the maximum standardized uptake value [ suvmax ] was 2.4 ) .
no other significant 18f - fdg uptake was observed on the pet / ct scan ( figure 3 ) .
a definite diagnosis of cavernous hemangioma was made based on histopathology examination results of the resected mass ( figure 4 ) .
the mass was composed of thin - walled blood vessels with dilated channels containing red blood cells and lined by a single layer of endothelial cells .
histologically , there are four types of hemangiomas : cavernous , capillary , venous , and mixed type .
cavernous hemangiomas are the most common and account for up to 50% of all hemangiomas .
they consist of dilated vessels lined by a single layer of endothelial cells surrounded by a fibrous stromal layer .
capillary hemangiomas account for 10% of all hemangioma cases and consist of multiple tortuous small vessels lined with epithelium , while venous and mixed type hemangiomas are rare ( 2 ) .
most cases of bone hemangiomas develop in the vertebral body or the skull ( 1 ) .
hemangioma of the rib is rare , both as a rib tumor and as a bone hemangioma ( 3 ) .
about 50% of rib tumors are malignant , and it is difficult to distinguish a rib hemangioma from a malignant tumor such as a chondrosarcoma , metastatic tumor , or multiple myeloma ( 5 ) .
hemangiomas in flat bones including the ribs can appear as aggressive tumors demonstrating cortical destruction with extraosseous mass formation and osteolytic lesions . as these imaging findings are typically observed in malignant lesions , the diagnosis of a rib hemangioma based on imaging findings alone might be challenging .
18f - fdg pet can detect the elevated glucose metabolism of cells , and is widely used for differentiation between benign and malignant neoplasms .
malignant lesions tend to be 18f - fdg avid and benign lesions generally show lower 18f - fdg avidity ( 6 ) .
a benign lesion showing typical low fdg avidity includes osteochondroma , enchondroma , hemangioma , and intraosseous lipoma ( 7 - 12 ) .
choi et al . reported that the mean suvmax values in the benign rib lesions were 2.5 1.1 ( 13 ) .
the suvmax of our patient s lesion was 2.4 , which implied that the lesion was more likely to be a benign tumor rather than a malignant one .
rib hemangiomas and malignant bone lesions can appear the same on imaging scans ; therefore , most of the patients with a rib hemangioma undergo rib resection .
however , if ct scans show an osteolytic expansive lesion containing sunburst calcifications with low 18f - fdg avidity , a diagnosis of rib hemangioma should be considered . | hemangioma of the rib is a rare benign vascular tumor .
herein , we report a 63-year - old man presenting with hemangioma of the left sixth rib .
an osteolytic eccentric expansive mass with calcification and focal cortical disruption was detected on chest computed tomography ( ct ) .
the mass showed low 2-deoxy-2-[18f]-fluoro - d - glucose ( 18f - fdg ) avidity on positron emission tomography .
the patient underwent resection of the left sixth rib .
based on the histopathology findings , a diagnosis of cavernous hemangioma was made .
rib hemangiomas and malignant lesions appear similar on ct scans ; therefore , most cases of rib hemangiomas reported in the literature were treated with rib resection .
however , rib hemangiomas should be included in the differential diagnosis of an asymptomatic patient if an osteolytic expansive lesion containing sunburst calcifications with low 18f - fdg avidity is observed on a ct scan . |
development of economically important animals in laboratory environments can be critical for their successful survival , and in vitro - produced ( ivp ) embryos may determine the fate of large multi - cellular animals .
poor in vitro development and uncontrolled growth are major obstacles to high - quality , large - scale production of ivp embryos .
the main obstacles in ivp embryo development are the production of excessive free radicals and the exposure of embryos to oxidative stress .
a preimplantation embryo is vulnerable to reactive oxygen species ( ros ) . in preimplantation embryos and during oocyte development
such ros negatively affect the production , quality , and development of embryos ; thus , it is important that the ros level is low in embryo culture media .
ros accumulation negatively affects protein synthesis and endoplasmic reticulum ( er ) homeostasis in embryos .
when ros production exceeds the antioxidant capacity of preimplantation embryos , oxidative stress occurs , and oxidative stress suppresses the embryo 's defense capacity against ros .
normally , the production of ros is counterbalanced by antioxidants , such as glutathione , vitamins c and e , and enzymes ( e.g. , catalase , superoxide dismutase , and glutathione peroxides ) , which convert the lethal ros into less damaging molecules .
excessive production of ros causes different types of cell injuries including disturbed metabolism , amino and nucleic acid oxidation , mitochondrial and er dysfunction , adenosine triphosphate ( atp ) depletion , and apoptosis .
bain and colleagues reported that developmental arrest and damage in embryos are associated with excessive production of ros during in vitro development .
the er is the major intracellular compartment responsible for protein folding and processing . in eukaryotic cells ,
the er is responsible for the production and modification of proteins and the accurate delivery of these proteins to target sites via the secretory pathway .
all secretory proteins in the secretory pathway first enter the er , where proper protein folding occurs .
the term er quality control ( erqc ) refers to proper folding of proteins , which are then exported to the golgi complex , while improperly folded proteins are retained in the er to either complete correct folding or to be targeted for degradation via er - associated degradation ( erad ) .
accumulation of misfolded proteins in the er disturbs er functions , which ultimately triggers er stress .
the response to er stress is referred to as an unfolded protein response ( upr ) , which maintains cellular homeostasis ; however , if the stress exceeds the tolerable level of the er , apoptotic signaling is initiated .
the most crucial issue is to make the in vitro environment similar to that of the oviduct and uterus . in vivo ,
oocytes and embryo are able to resist oxidative stress as a result of the actions of antioxidants present in follicular fluid or those produced by the embryo and the oviduct . because protein folding is an important process in cell survival
, all cells have sophisticated mechanisms to ensure that proper protein folding occurs and to prevent the accumulation / aggregation of misfolded proteins .
yoon et al . reported that when the oxygen concentration is similar to the in vivo concentration , the chances of er stress and upr are minimal .
any stresses that interrupt protein folding are a threat to cell viability . in eukaryotic cells , all proteins that transit to the secretory pathway first enter the er , where they are assembled and folded into multi - subunit complexes before transiting to the golgi compartment .
a preimplantation embryo needs to replace maternal rna with embryonic rna , which requires extensive new protein synthesis , to continue its development .
these new proteins must be properly folded in the lumen of the er in order to maintain preimplantation development .
various factors / processes that lead to an imbalance in the protein folding process in the lumen of the er will activate the upr , ultimately inhibiting blastocyst formation during preimplantation embryo development in vitro . in this review , we will briefly summarize the role of the er in the development of preimplantation embryos and the molecular pathways activated after ros production .
ros is a broad term that not only refers to oxygen radicals ( superoxide and hydroxyl ) , but also to some non - radical derivatives of molecular oxygen ( o2 ) , such as hydrogen peroxide ( h2o2 ) . in embryos
, the metabolism of molecular oxygen is important , and the average consumption rate in morula- and blastocyst - stage bovine preimplantation embryos is 2 nl per embryo per hour . in embryonic metabolic reactions , during the intermediate steps of oxygen reduction , ros are formed from the superoxide anion radical o2h2o2 , and the hydroxyl radical oh . in blastocyst - stage rabbit preimplantation embryos , h2o2 and o2 are produced at the fourth and fifth days post - coitum and remain for the rest of the preimplantation period .
the production of h2o2 during mouse embryo development is higher in vitro than in vivo . in in vitro culture , the level of ros production is particularly important ; an increased concentration of ros results in oxidative stress and impaired mitochondrial function in germinal vesicle- and metaphase ii - stage mouse oocytes .
the amount of ros production differs among the various stages of embryo development . in mouse embryos ,
a large quantity of ros is produced at two times : at fertilization and at the g2/m phase of the second cell cycle .
oxidative stress contributes to the etiology of defects in embryonic development , and the production of ros is triggered by embryonic metabolism and/or by the embryo 's surroundings .
the source of ros and the irrelative contribution to the development of oxidative stress appear to differ depending on the species , the developmental stage , and the culturing conditions .
there are several exogenous and endogenous factors and culture conditions that can enhance the production of ros .
endogenous ros is produced by various metabolic pathways and enzymes such as oxidative phosphorylation , -nicotinamide adenine dinucleotide phosphate ( -nadph ) reduced oxidase , and xanthine oxidase ( xo ) .
exogenous factors such as oxygen concentration , metallic cations , visible light , amine oxidases , and spermatozoa also have important roles in ros production . in preimplantation embryos ,
inhibition of oxidative phosphorylation ( oxphos ) reduces ros production , which produces a positive effect in both porcine and bovine in vitro embryo development .
manes and lai described the production of superoxide anions and h2o2 through nadph oxidase on the rabbit blastocyst surface , whereas nasr - esfahani and johnson reported that an inhibitor of nadph oxidase reduces h2o2 production in mouse embryos . in preimplantation embryo development , the end product of purine metabolism is xanthine , and inhibition of xo results in a low level of ros in preimplantation embryos .
oxygen concentration is also a factor in inducing ros production . in monkey and rabbit oviducts ,
the o2 concentration is one - quarter to one - third of the atmospheric o2 concentration . in in vitro culture medium at 37 , the o2 concentration is considerably higher than the normal concentration of o2 within cells . in vitro culture at the atmospheric o2 concentration elevates the ros level in both mouse and bovine embryos , while a decreased o2 concentration ( 5% ) increases embryo development in mouse .
fischer and bavister reported that an increased o2 concentration during in vitro culture of embryos leads to increased ros production , which adversely affects embryo development and quality .
in addition , the exposure of embryos to visible light increases the production of ros in embryos during in vitro development .
the er is the first compartment of the secretory pathway in eukaryotic cells and is responsible for synthesis , modification , and delivery of proteins to the proper target site within the secretory pathway . in the er
, a process termed quality control exports correctly folded proteins to the golgi complex , while incompletely folded proteins are retained in the er to complete the folding process .
proper folding of proteins or degradation of improperly folded proteins or folded polypeptides occurs in the er , and er - resident chaperones try to prevent aggregation of proteins through the erqc system .
when the erqc system fails to respond , unfolded proteins accumulate in the er . the upr includes different methods to re - establish protein synthesis , namely , translational attenuation to stop new protein entry into the er , transcriptional activation of genes involved in protein folding , and transcriptional activation of genes encoding components of the erad system to decrease the number of misfolded proteins and inhibit activation of the apoptotic pathway to remove defective cells . several signaling pathways are involved in the upr , which helps to maintain the normal physiological status of cells .
the upr is increased in preimplantation mouse embryos at the 8-cell , morula , and blastocyst stages .
er transmembrane protein sensors are involved in maintaining cellular homeostasis , including inositol - requiring enzyme 1 ( ire1 ) , double - stranded activated protein kinase - like er kinase ( perk ) , and activated transcription factor 6 ( atf6 ) , along with the er molecular chaperone immunoglobulin - binding protein ( bip ) , also known as glucose - regulated protein 78 .
bip , which belongs to the hsp70 family , is a stress - inducible chaperone .
bip consists of three domains , a peptide - binding domain , an atpase domain , and a c - terminal domain . to prevent aggregation of unfolded proteins and promote proper folding , bip binds to unfolded peptides through its peptide - binding domain and uses energy from atp to promote proper folding .
bip also maintains er calcium homeostasis by binding to calcium , helping to immobilize calcium . under normal physiological conditions
, bip interacts with ire1 , perk , and atf6 ; however , when the level of misfolded / unfolded proteins increases , bip is released from these inducers , leading to activation of the upr .
spliced xbp1 ( sxbp1 ) encodes a transcription factor that induces transcription of er chaperones to maintain cellular homeostasis by participating in er protein folding , whereas atf6 cleavage is required for transcription of xbp1 which subsequently undergoes ire1 dependent splicing .
attenuation of active xbp1 protein expression in mouse embryos at the 2-cell stage improves embryo development until the blastocyst stage .
. reported that the upr in mouse preimplantation embryos contributes to embryo death . increased er stress during preimplantation embryo development
mori and colleagues reported that ire1-p is a bifunctional protein that possesses site - specific endoribonuclease ( rnase ) activity .
suppression of ire1-alpha causes embryonic lethality in mice , whereas suppression of ire1-beta has no phenotypic effect , and those mice were only susceptible to experimental intestinal colitis . under normal conditions ,
ire1 is bound to bip and is in an inactive form ; however , an increased ros level causes stress . under such stress ,
ire1 is released from bip and changes to an active form to control cellular homeostasis by participating in protein folding . in cloned mammalian cells ,
overexpression of ire1 activates bip- and chop - encoding genes to promote cell death . during bovine preimplantation embryo development , the activated form of ire1 upregulates non - conventional xbp1 splicing , activating transcriptional activator genes , which specifically results in the transcription of er chaperones and the halting of embryo growth .
inhibition of sxbp1 increases porcine embryo development and the expression of antiapoptotic genes , whereas the expression of proapoptotic genes decreases .
moreover , inhibition of xbp1 splicing in mouse preimplantation embryos reduces apoptosis and enhances embryo development .
, as well as patil and walter , reported that ire1 is maintained in an inactive monomeric form due to its interaction with the protein chaperone bip , whereas under er stress conditions , ire1-p is released from bip and activates its rnase activity through homodimerization and trans - autophosphorylation , the rnase activity of ire1-p cleaves a 252-base intron from the mrna encoding the basic leucine zipper - containing transcription factor hac1p ; the spliced hac1 mrna encodes a protein that activates the transcriptional upr element .
also investigated the role of bip in preimplantation embryo development and found that the active form of bip prevents blastocyst formation . during activation of the upr
, the ire1 rnase cleaves xbp1 mrna to remove a 26-nucleotide intron , which creates a translational frame shift to generate a large form of xbp1 .
the sxbp1 acts as a transcriptional activator that has a major role in the activation of a wide variety of upr target genes , which include some genes that require the ire1/xbp1 pathway and encode proteins that function in erad .
these observations suggest that cells deficient in either ire1 or xbp1 are defective in erad ( fig .
because er stress responses are increased in eukaryotes containing additional sensors for the upr , which promote stress adaptation or cell death in a more complex but coordinated manner , immediate transient attenuation of mrna translation occurs in order to prevent continued influx of newly synthesized polypeptides into the stressed er .
perk is an er transmembrane sensor protein present in the lumen of the er and is attached to bip . upon accumulation of unfolded proteins in the er lumen , dimerization of perk released from bip and trans - autophosphorylation lead to activation of the eukaryotic translational initiation factor 2 alpha ( eif2 ) kinase function .
bip plays a key role in proliferation and protection from apoptosis in the inner cell mass during early embryo development in mice .
eif2- phosphorylation inhibits the guanine nucleotide exchange factor eif2- , which leads to inhibition of the exchange of guanosine diphosphate ( gdp ) with guanosine triphosphate ( gtp ) to form elf2--gtp - trna .
aternary translation initiation complex is formed , which is required for aug initiation codon recognition and joining of the 60s ribosomal subunit at the beginning of polypeptide chain synthesis .
translation initiation is dependent on the ternary complex , and a low level of ternary complex results in a low level of translation initiation .
activating transcription factor 4 ( atf4 ) is one of the basic transcription factors whose translation is initiated upon perk - mediated phosphorylation of eif2 ( fig .
perk , eif2 , and atf4 phosphorylation are required for genes involved in amino acid biosynthesis and transport functions and the antioxidative stress response , as well as for genes that encode apoptosis - inducing factors such as growth arrest and dna damage 34 and chop .
ros enhance the expressions of atf4 and chop , which negatively affect the development of bovine embryos .
phosphorylation of eif2 mediates the majority of perk signals , but nuclear factor erythroid-2 ( nrf2 ) also mediates perk signals . nrf2 is attached to the microtubule - associated protein kelch - like ech - associated protein 1 ( keap1 ) in the cytoplasm . under conditions that induce the upr , perk phosphorylates nrf2 to support its dissociation from keap1 .
perk is required for cell survival , and nrf2 is a direct perk substrate and perk affecter .
the er membrane contains several camp response element - binding ( creb ) proteins such as the creb / atf6 transcription factors , which regulate multiple upr - related genes .
the most well - known of these proteins is atf6 , which forms the third branch of the upr , together with perk and ire1 .
bip regulates atf6 in a manner similar to the way it regulates perk and ire1 .
bip regulates atf6 through activation of two independent golgi localization sequences , gls1 and gls2 .
bip is attached to gls1 , but not to gls2 ; thus , gls1 is suppressed . however , bip lacking gls2 is dominant , which results in translocation of atf6 to the golgi complex and causes activation of atf6 . under normal conditions ,
atf6 is in its resting form in the er and is attached to bip . upon unfolded protein accumulation , atf6 is released from bip and translocated to the golgi complex . in the golgi complex
these actions release the cytosolic n - terminal portion of atf6 encoding a basic leucine zipper transcription factor ( fig .
this binding requires nuclear factor alpha y subunit and ccaat - binding factor ( nf - y / cbf ) .
important genes targeted by atf6 are bip , xbp1 , and chop / gadd153 during the upr . in bovine preimplantation embryos , an increased ros level enhances atf6 expression , leading to upregulation of bip , xbp1 , and chop , resulting in decreased blastocyst formation .
a high level of palmitic acid in cumulus - oocyte complexes activates atf6 , negatively affecting mouse embryo development .
atf6-alpha and atf6-beta positively regulate transcription of er - resident molecular chaperones and foldases , as shown by performing gene profiling analyses using overexpression of atf6-alpha and atf - beta ; however , the heterodimer complex of atf6-alpha and atf6-beta is a transcriptional repressor of the bip promoter .
mori and colleagues reported that ire1-p is a bifunctional protein that possesses site - specific endoribonuclease ( rnase ) activity .
suppression of ire1-alpha causes embryonic lethality in mice , whereas suppression of ire1-beta has no phenotypic effect , and those mice were only susceptible to experimental intestinal colitis . under normal conditions ,
ire1 is bound to bip and is in an inactive form ; however , an increased ros level causes stress . under such stress ,
ire1 is released from bip and changes to an active form to control cellular homeostasis by participating in protein folding . in cloned mammalian cells ,
overexpression of ire1 activates bip- and chop - encoding genes to promote cell death . during bovine preimplantation embryo development , the activated form of ire1 upregulates non - conventional xbp1 splicing , activating transcriptional activator genes , which specifically results in the transcription of er chaperones and the halting of embryo growth .
inhibition of sxbp1 increases porcine embryo development and the expression of antiapoptotic genes , whereas the expression of proapoptotic genes decreases .
moreover , inhibition of xbp1 splicing in mouse preimplantation embryos reduces apoptosis and enhances embryo development .
, as well as patil and walter , reported that ire1 is maintained in an inactive monomeric form due to its interaction with the protein chaperone bip , whereas under er stress conditions , ire1-p is released from bip and activates its rnase activity through homodimerization and trans - autophosphorylation , the rnase activity of ire1-p cleaves a 252-base intron from the mrna encoding the basic leucine zipper - containing transcription factor hac1p ; the spliced hac1 mrna encodes a protein that activates the transcriptional upr element .
also investigated the role of bip in preimplantation embryo development and found that the active form of bip prevents blastocyst formation . during activation of the upr
, the ire1 rnase cleaves xbp1 mrna to remove a 26-nucleotide intron , which creates a translational frame shift to generate a large form of xbp1 .
the sxbp1 acts as a transcriptional activator that has a major role in the activation of a wide variety of upr target genes , which include some genes that require the ire1/xbp1 pathway and encode proteins that function in erad .
these observations suggest that cells deficient in either ire1 or xbp1 are defective in erad ( fig .
because er stress responses are increased in eukaryotes containing additional sensors for the upr , which promote stress adaptation or cell death in a more complex but coordinated manner , immediate transient attenuation of mrna translation occurs in order to prevent continued influx of newly synthesized polypeptides into the stressed er .
perk is an er transmembrane sensor protein present in the lumen of the er and is attached to bip . upon accumulation of unfolded proteins in the er lumen , dimerization of perk released from bip and trans - autophosphorylation lead to activation of the eukaryotic translational initiation factor 2 alpha ( eif2 ) kinase function .
bip plays a key role in proliferation and protection from apoptosis in the inner cell mass during early embryo development in mice .
eif2- phosphorylation inhibits the guanine nucleotide exchange factor eif2- , which leads to inhibition of the exchange of guanosine diphosphate ( gdp ) with guanosine triphosphate ( gtp ) to form elf2--gtp - trna .
aternary translation initiation complex is formed , which is required for aug initiation codon recognition and joining of the 60s ribosomal subunit at the beginning of polypeptide chain synthesis .
translation initiation is dependent on the ternary complex , and a low level of ternary complex results in a low level of translation initiation .
activating transcription factor 4 ( atf4 ) is one of the basic transcription factors whose translation is initiated upon perk - mediated phosphorylation of eif2 ( fig .
perk , eif2 , and atf4 phosphorylation are required for genes involved in amino acid biosynthesis and transport functions and the antioxidative stress response , as well as for genes that encode apoptosis - inducing factors such as growth arrest and dna damage 34 and chop .
ros enhance the expressions of atf4 and chop , which negatively affect the development of bovine embryos .
phosphorylation of eif2 mediates the majority of perk signals , but nuclear factor erythroid-2 ( nrf2 ) also mediates perk signals .
nrf2 is attached to the microtubule - associated protein kelch - like ech - associated protein 1 ( keap1 ) in the cytoplasm . under conditions that induce the upr , perk phosphorylates nrf2 to support its dissociation from keap1 .
perk is required for cell survival , and nrf2 is a direct perk substrate and perk affecter .
the er membrane contains several camp response element - binding ( creb ) proteins such as the creb / atf6 transcription factors , which regulate multiple upr - related genes .
the most well - known of these proteins is atf6 , which forms the third branch of the upr , together with perk and ire1 .
bip regulates atf6 in a manner similar to the way it regulates perk and ire1 .
bip regulates atf6 through activation of two independent golgi localization sequences , gls1 and gls2 .
bip is attached to gls1 , but not to gls2 ; thus , gls1 is suppressed . however , bip lacking gls2 is dominant , which results in translocation of atf6 to the golgi complex and causes activation of atf6 . under normal conditions ,
atf6 is in its resting form in the er and is attached to bip . upon unfolded protein accumulation , atf6 is released from bip and translocated to the golgi complex . in the golgi complex
these actions release the cytosolic n - terminal portion of atf6 encoding a basic leucine zipper transcription factor ( fig .
this binding requires nuclear factor alpha y subunit and ccaat - binding factor ( nf - y / cbf ) .
important genes targeted by atf6 are bip , xbp1 , and chop / gadd153 during the upr . in bovine preimplantation embryos , an increased ros level enhances atf6 expression , leading to upregulation of bip , xbp1 , and chop , resulting in decreased blastocyst formation .
a high level of palmitic acid in cumulus - oocyte complexes activates atf6 , negatively affecting mouse embryo development .
atf6-alpha and atf6-beta positively regulate transcription of er - resident molecular chaperones and foldases , as shown by performing gene profiling analyses using overexpression of atf6-alpha and atf - beta ; however , the heterodimer complex of atf6-alpha and atf6-beta is a transcriptional repressor of the bip promoter .
in vitro fertilization and embryo development provide a unique window into embryonic cells , revealing cellular foundations that drive embryonic growth and development from the fertilized ovum into a competent blastocyst . a preimplantation embryo , while relatively simple in appearance , contains the cellular foundations to produce a highly complex mammalian organism .
an increased ros level in a preimplantation embryo leads to er stress , which is involved in the etiology of defective embryo development . when er stress exceeds the threshold of the upr , apoptosis occurs .
the adaptive response to er stress , the upr , is aimed at correcting overall protein processing in order to reduce the accumulation of misfolded proteins and restore normal cell function .
if er stress is severe or if the adaptive upr fails , then cell death occurs . in the field of upr research , further molecular research
is required regarding the pathways that are activated after upr signaling , especially in preimplantation embryos , because of the limited availability of previous reports .
additionally , further research is needed to determine whether one or several antioxidants should be used to detoxify ros .
determining the most suitable medium for in vitro development of preimplantation embryos would provide the best possible start toward achieving the goal of an ros - free environment .
further elucidation of new and relevant upr signaling mechanisms in preimplantation embryos may provide useful clues regarding the regulation of normal embryonic development in vitro . | excessive production of reactive oxygen species ( ros ) and endoplasmic reticulum ( er ) stress - mediated responses are critical to embryonic development in the challenging in vitro environment .
ros production increases during early embryonic development with the increase in protein requirements for cell survival and growth .
the er is a multifunctional cellular organelle responsible for protein folding , modification , and cellular homeostasis .
er stress is activated by a variety of factors including ros .
such stress leads to activation of the adaptive unfolded protein response ( upr ) , which restores homeostasis . however , chronic stress can exceed the toleration level of the er , resulting in cellular apoptosis . in this review ,
we briefly describe the generation and impact of ros in preimplantation embryo development , the ros - mediated activation mechanism of the upr via the er , and the subsequent activation of signaling pathways following er stress in preimplantation embryos . |
assessment of functional capacity is important for identifying the physical implications of
stroke , since it is currently considered the main cause of serious long - term disability in
adults1 , impairing physical ,
psychological , and social functions2 .
after a stroke ,
individuals remain with several residual impairments , especially those
related to motor function , which lead to reduced functional ability3 . in this sense ,
instruments that adequately capture several
aspects of disability progression / regression are essential within clinical settings ,
implement more specific and effective disability management4 .
the use of functional tests is sometimes impossible during rehabilitation , due to the need
for specialized equipment , expertise and space . in this sense
, it is already known that
aerobic capacity assessed on a treadmill , by analyzing the oxygen consumption
( vo2 ) is the gold standard measure of functional performance for disabled
individuals5 . however , the widespread
utilization of this method is limited by expertise , associated with the need for the use of
specific and expensive equipment6 . on the
other hand , an easy assessment , such as the six - minute walking test ( 6mwt ) ,
which is
routinely used to assess functional walking capacity of stroke individuals4 , 7 , 8 requires only a chronometer and a 30-meter
corridor to be performed9,10,11 .
the
establishment of valid and simple ways to use alternative measures of functional capacity
after stroke would be , therefore , clinically relevant .
the use of a simple tool for the
assessment of functional capacity may allow clinicians to obtain clinically useful methods
to estimate an important outcome , which can determine the degree of constraint imposed by
the stroke , as well as its importance , by being a factor in diagnosis , prognosis , and a
strong predictor of mortality12 .
an easily administered questionnaire was developed to assess functional capacity by the
prediction of oxygen consumption ( vo2 ) without the need for maximal
cardiopulmonary exercise testing13 .
the
duke activity status index ( dasi ) is a short , simple questionnaire that can be administered
to patients with physical limitations .
it has been previously validated with physiological
measurements , such as vo2 in cardiac patients14 , 15 .
although it was
originally designed to evaluate patients with cardiovascular diseases , the dasi has also
been shown to be valid and appropriate for the assessment of functional capacity of disabled
individuals , such as those with moderate to severe chronic obstructive pulmonary disease
( copd)16 . in order to allow for its
clinical use in individuals with stroke , this study investigated the associations between
the dasi scores and valid and extensively used functional capacity measures ( distance
covered and oxygen consumption obtained during the 6mwt ) .
therefore , the specific research question for this study was : are there significant
associations between the dasi scores and the distance covered and relative vo2
during the 6mwt in individuals with chronic stroke ?
individuals with chronic stroke were recruited from the general community of the city of
belo horizonte , brazil , according to the following criteria : were 20 years old , had a mean
time since the onset of a unilateral stroke between 1 and 5 years , were able to walk with or
without assistive devices , and had no cognitive deficits , as determined by an
education - adjusted cutoff score on the mini - mental state examination : 18/19 for the
individuals with illiteracy and 24/25 for individuals with a basic education17 , and no other neurological or orthopedic
disorders .
this study was approved by the ethics review board of the universidade federal de
minas gerais , and all participants provided written consent , prior to data collection .
initially , the participants underwent a physical examination and an interview for the
collection of clinical and demographical data , which included age , gender , body mass ,
height , time since stroke onset , number of medications , associated diseases , and habitual
walking speed ( 10-meter walking test)18 , 19 .
at least 500 ml of water was provided
prior to the tests , to guarantee normal hydration .
the questions were read
loud and repeated if necessary , and none of the participants had difficulties in
understanding them .
then , the participants performed the 6mwt without metabolic monitoring
equipment , and the distance covered was recorded .
the test was carried out in a 30-meter
corridor according to the procedures and recommendations of the american thoracic
society9 , which were adapted to the
brazilian portuguese language11 .
then ,
the individuals performed the 6mwt test with a portable metabolic system , which was
previously calibrated .
the means of the relative vo2
( mlkgmin ) values for the final three
minutes of the 6mwt ( steady state condition ) were recorded for analyses20 . the brazilian version of the dasi was employed to assess the individuals perceived
functional capacity14 , 16 .
its scores reflect the role of physiological factors in
the individual s daily life and consider all important spheres related to functional
capacity status , such as personal care , ambulation , household tasks , sexual function , and
recreational activities21 .
it is composed
of 12 items which describe daily living activities , with their correspondent metabolic
equivalents ( mets ) , and are answered with yes or no .
the
dasi scores ranged from 0 to 58.2 , and higher scores reflect higher functional capacity14 , 16 .
the distance covered during the 6mwt , which appropriately reflects functional capacity
status , was recorded for analyses10 , 22 .
the cortex metamax 3b is a portable metabolic system that allows online data transmission
for a distance up to 800 meters .
the measures are adjusted in real time , according to the
environmental test conditions , by means of temperature and internal pressure sensors , and an
electronic barometer .
its face mask has a low dead space volume and two inspiratory valves
with low inspiratory resistance , and it allows the removal of exhaled air during testing ,
which leads to improved quality of the analyzed gases .
the instrument has been shown to have
adequate validity and reliability , when used in various activities with individuals with
stroke23 and to reflect the capture ,
transport and peripheral oxygen consumption .
descriptive statistics and tests for normality ( shapiro - wilk test ) were carried out for all
outcomes .
pearson correlation coefficients were calculated to explore the relationships
between the dasi scores , distance covered , and the relative vo2 during the 6mwt .
the magnitudes of the correlations were classified as follows : low or none
( 0.00<r < 0.25 ) , fair ( 0.25<r < 0.50 ) ,
moderate to good ( 0.50<r<0.75 ) , and good to excellent
( r>0.75)24 .
all
analyses were carried out with the spss software ( release 17.0 ) with a significance level of
5% .
they had a mean age of
58.613 years , and a mean time since the onset of stroke ranging from 12 to 60 months .
they
had a mean dasi score of 27.314.4 , a mean oxygen consumption of 9.62.3
mlkgmin , and a mean distance covered of
325.2140.2 m during the 6mwt .
their characteristics are described in table 1table 1.characteristics of the participantscharacteristicn=31age ( years ) , mean ( sd)58.6 ( 13)gender , men , n ( % ) 17 ( 54.8)body mass index ( kg / m ) , mean ( sd)25.7 ( 4.2)time since the onset of stroke ( months ) , mean
( sd)28.3 ( 15.1)number of medications , mean ( sd)4.6 ( 2.1)associated diseases , mean ( sd)1.8 ( .96)mmse ( scores : 030 ) , mean ( sd)25.6 ( 3)habitual walking speed ( m / s ) , mean ( sd)0.8 ( 0.3)dasi ( scores : 058.2 ) , mean ( sd)27.3 ( 14.4)6mwt ( distance , in meters ) , mean ( sd)325.2 ( 140.2)relative vo2
( ml.kg.min ) , mean ( sd)9.6 ( 2.3)sd : standard deviation ; mmes : mini - mental state examination ; dasi : duke activity
status index ; 6mwt : 6-minute walking test ; vo2 : oxygen consumption .
sd : standard deviation ; mmes : mini - mental state examination ; dasi : duke activity
status index ; 6mwt : 6-minute walking test ; vo2 : oxygen consumption moderate to good correlation coefficients were found between the dasi scores and the
distance covered during the 6mwt ( r=0.68 , p<0.0001 ) .
significant and
fair associations were also found between the dasi scores and the relative vo2
obtained during the 6mwt ( r=0.45 , p= 0.03 ) .
to the best of our knowledge , this was the first study to use a brief and self - administered
questionnaire to assess functional capacity in individuals with stroke , and the results
answered the main question of this study .
this study used a sample of ambulatory ,
individuals with chronic stroke with high functional levels , as demonstrated by their
walking capacity and speed .
significant correlations were found between the dasi scores , the
relative vo2 , and the distance covered during the 6mwt . in agreement with the
findings of previous studies with other health conditions14 , 25 ,
the dasi scores were
significantly associated with both the physiological and physical performance measures .
the
results of the present study supported the use of the dasi as a tool to assist in clinical
evaluations related to the functional capacity of individuals with chronic stroke .
previous studies observed significant associations between the dasi scores and several
outcomes in cardiac patients , such as metabolic equivalent26 , 27 , new york heart
association28 , canadian cardiovascular
society of angina29 , and body mass
index27 .
the associations between the
dasi scores and the distance covered during the 6mwt were previously investigated in
cardiac6 and in copd patients16 , and moderate to good correlations were
found between the investigated variables ( r=0.68 ; p<0.001 and
r=0.58 , p<0.0001 , respectively )
. additionally , bagur et al.28 also found moderate to good correlations
between the dasi scores and the distance covered during the 6mwt in patients , who underwent
transcatheter aortic valve implantation at baseline ( r=0.55 , p<0.0001 )
and at six - month follow - up ( r=0.66 , p<0.0001 ) .
these results are in line
with the findings of the present study , which found correlation coefficients of similar
magnitudes .
these similarities could be explained by the fact that all studies had
participants with chronic diseases and several disabilities .
in addition , individuals with
stroke have some cardiac dysfunctions as the main associated morbidity and risk factors for
new episodes of stroke2 .
no previous studies were found that investigated the associations between relative
vo2 during the 6mwt and the dasi scores .
several studies found associations
between the dasi scores and peak vo2 during maximal tests on cycle and arm
ergometers , as well on treadmills with various populations , such as patients with vascular
diseases ( r=0.51 , p<0.001)14 , copd patients ( 0.34<r<0.38 ,
p<0.0001)16 , and cardiac patients
( 0.58<r<0.81 , p<0.0001)13 . in the present study , fair correlations between the relative
vo2 during the 6mwt and dasi scores were found .
regarding these findings ,
jakovljevic et al.30 pointed out that the
ability of the skeletal muscles to extract oxygen is decreased after stroke , but their
cardiac function and pumping capability were preserved .
additionally , it was found that
individuals with stroke showed reduced blood flow , higher lactic acid production , and
decreased capacity to oxidase free fatty acids by their paretic muscles31 .
these findings could partially explain the results of the
present study , since fair correlations were found .
however , it is well known that stroke
individuals exhibit a constellation of impairments , as well as comorbidities , which were not
investigated in the present study , and these could have influenced the results .
it is important to notice that this was the first study to analyze the associations between
self - reported and direct measures of functional capacity and found associations of
magnitudes ranging from fair to good .
these results are in agreement with those of
teixeira - salmela , devaraj , and olney32 ,
who found good relationships between self - reported physical activity levels and observed
performances of individuals with chronic stroke .
taking together , these findings reinforce
the importance of taking the patients ` perceptions into consideration during the
rehabilitation process . due to the design of this study , causal relationships can not be determined .
the sample size
was composed of individuals at the chronic stages after stroke , who had a time since the
onset of the stroke ranging from one to five years , were able to walk independently , and had
good functional levels ( mean walking speed of 0.81 m / s and mean distance covered during the
6mwt of 325 meters ) . in this sense , the results of the present study can not be generalized
to individuals with different functional levels and at the acute and subacute phases after
stroke33 .
for instance , it is well known that
the major motor deficit after stroke is weakness , which is found in 80% of stroke survivors .
it is important
for health professionals to focus on the implications of a given health condition on an
individual s life14 .
thus , some
instruments should be used based upon their impact on their real life contexts .
the dasi has
been demonstrated to be a useful tool for clinical and research purposes , since it provides
insights regarding function that may not be captured by physiological measures14 , 16 .
the results of the present study revealed positive , significant , and moderate to good
associations between the dasi scores and the distance covered during the 6mwt and positive ,
significant , and fair correlations between the dasi scores and the relative vo2
during the 6mwt .
these findings support the utility and validity of a self - report measure in
providing an indirect index of functional capacity . | [ purpose ] the aim of this study was to investigate the associations between self - reported
and valid performance - based measures of functional capacity in individuals with chronic
stroke . [ subjects and methods ] self - reported measures of functional capacity of 31
individuals with chronic stroke were assessed by the duke activity status index scores ,
whereas performance - based measures were assessed by the distance covered ( in meters ) and
oxygen consumption ( relative oxygen consumption , in
mlkg1min1 ) during the six - minute walking
test .
[ results ] the subjects had a mean age of 58.613 years and a mean time since the
onset of stroke of 28.315.1 months .
they had a mean duke activity status index of
27.314.4 , mean distance covered of 325.2140.2 m , and mean relative oxygen consumption of
9.62.3 mlkg1min1 .
significant , positive , and
moderate to good correlation coefficients were found between the duke activity status
index scores and the distance covered during the six - minute walking test
( r=0.68 ) .
significant , positive , and fair associations were also found
between the duke activity status index scores and relative oxygen consumption values
obtained during the six - minute walking test ( r=0.45 ) .
[ conclusion ] the
findings of the present study support the clinical use of the duke activity status index
as a tool to assist in clinical evaluations of functional capacity of individuals with
chronic stroke . |
research on child psychopathology has been traditionally treated like a step child . despite clinical emphasis on the childhood roots of adult disorders ,
one of the greatest handicaps to research and communication on child psychopathology has been the lack of standardised objectives and reliable way of describing and classifying behavioural disorders .
children under 16 years of age constitute over 40 percent of india 's population and information about their mental health needs is a national imperative . till date , indian studies reported prevalence rates of psychiatric disorders among children ranging from 2.6 to 35.6 percent.[26 ] small group of community - based studies provided some benchmarks for the rates of psychiatric disturbance among indian children .
the term psychopathology in children covers various psychological problems such as behavioural problems , low intelligence , anxiety , conduct disorders , psychotic symptoms , and physical illness with emotional problems and somatic disorders .
thus clinically significant psychopathology can be defined as a disorder in one or more of the following areas i.e. overt behaviour , emotional states , interpersonal relationships and cognitive functions .
mental health of a child is greatly influenced by many environmental factors and life events such as adverse family circumstances , maternal separation or deprivation , birth of a sibling , parental divorce , bereavement , physical handicap , urbanism and maternal depression . in a particular socio - cultural context
kim - cohen et al in their follow back study from new zealand reported that 50% of adult psychiatric disorder cases had onset by age of 15 years .
costello alin their updated review of epidemiology of childhood psychiatric disorders have opined that onset before adulthood may be a characteristic of the majority of adult psychiatric disorders .
early intervention for these has the potential to substantially alter the developmental course of these adult disorders , significantly reducing the morbidity .
psychiatric problems in children in india are rising and reported - cases represent only the tip of the iceberg , large number remains unreported .
there is a need to conduct a large scale survey of childhood psychiatric disorders in india to see the nature and extent of prevailing morbidity to trace its developmental course and study its psychosocial determinants which are known to contribute to psychiatric disorders .
studies of psychiatric disorders in children would give us baseline data for mental health planning for children , identify children at risk , generate hypothesis for aetiology and suggest strategies for preventive intervention .
the present study focuses on the findings related to the prevalence of psychiatric morbidity at different schools in a city of north india .
the study was carried out at four randomly selected boys and girls schools during the month of july - august 2010 in a city of north india .
children in the age group of 10 - 15 years were included which covered classes from fifth to ninth standard .
the tools used in this study were childhood psychopathology measurement schedule ( cpms ) developed and standardized by malhotra et al , and another schedule consisting of questions pertaining to socio - demographic data of the children which was prepared separately and pre - tested before final administration .
cpms contained 74 questions pertaining to 8 factors i.e. intelligence with behaviour problems , conduct disorders , anxiety , depression , psychotic symptoms , special symptoms , physical illness emotional problems and somatisation .
each question was directed to the mother regarding the child 's behaviour during past one year .
those children who scored 10 or more on this score were considered positive for psychopathological disorders .
all the children were clinically examined and anthropometric measurements were recorded . using this cut - off score , the sensitivity and specificity for detecting probable psychopathological disorders reported by authors was 82% and 87% respectively . after taking permission of respective principals and parents of the children , personal data sheets were distributed separately for each school on separate days . after collecting the data sheet , cpms was distributed to the same children . after completion of cpms by parents of the children , these were collected back and analysed .
the children who scored more than 10 were assessed further and interviewed clinically and were diagnosed according to international classification of diseases-10 ( icd-10 ) criteria .
in the present study among 982 children , 528 ( 53.8% ) were males and 454 ( 46.2% ) were females . mean age of the students was 12.52.4 years .
most of the children were from the income group of 10000 - 20000 inr / month , which was higher among the male students . among 982 students , 181 students ( 31.7% ) scored > 10 in cpms score .
there was no significant difference between male and female groups regarding cpms score [ table 1 ] .
socio - demographic characteristics and childhood psychopathology measurement schedule score after screening 311 students , 199 students ( 20.2% ) found to have psychiatric illness according to icd-10 criteria .
it was observed that most of the students ( 57 students , 28.6% ) having psychiatric illness were in the age group of 13 - 14 years followed by 23.6% in age group of 14 - 15 years and 22.1% in the age of 12 - 13 years .
children having psychiatric illness mostly ( 87 students , 43.7% ) were from the income group 10,000 - 20,000 inr which was significantly higher ( p<0.001 ) than the other two economical groups .
psychiatric disorders were seen prevalent in the children having second birth order ( 111 students , 55.7% ) which was significantly higher ( p<0.001 ) than two other groups .
the table also shows that significantly higher ( p<0.001 ) number of students ( 98 students , 49.2% ) were in the score of 10 - 20 in the cpms scale [ table 2 ] .
socio - demographic variable wise distribution of children having psychiatric disorder most of the children ( 39 students ) were having specific isolated phobia ( 19.6% ) , other non organic sleep disorders like sleep talking , bruxism etc ( 24 students , 12.0% ) and tension headache ( 23 students , 11.5% ) .
hyperkinetic disorder found in 12 students ( 6% ) , pica in 11 students ( 5.5% ) , enuresis in 9 students ( 4.5% ) , sleep terror in 15 students ( 7.5% ) , and epilepsy in 7 ( 3.5% ) of the students .
in the present study 311 ( 31.7% ) students had cpms score > 10 whereas rahi et al , in 2005 showed 16.5% of children being cpms positive .
study conducted by who in four developing countries ( 1981 ) including india in the state haryana , showed prevalence of 21% .
a study by indian council of medical research ( icmr ) in 2001 showed prevalence to be 13.4% in the age group 0 - 16 years .
study have revealed the prevalence rates to be 12.5% in 0 - 16 yrs community based sample from bangalore , 9.4% in 8 - 12 yrs olds from a community sample in kerala , and 6.3% in 4 - 11 yrs old school children in chandigarh .
overall rates of childhood and adolescent mental disorders in india and other middle and low income countries range between 6%-15% which are on the lower side as compared to reported rates from certain western countries such as canada ( 18.1% ) , germany ( 20.7% ) , ( 22.5% ) , and usa ( 21% ) . in our study prevalence of psychiatric disorder
is 20.2% which corroborates with the findings of who study in india , ( 21% ) and by other studies too.[1618 ] out of 199 students , children of the age group of 13 - 14 year and 14 - 15 year had more number of ill children as compared to younger age group .
there may be number of factors operative for this phenomenon like increasing burden of studies in higher classes , emotional disturbances related to early adolescence , or mothers perception of any resultant undesired change in behaviour as abnormal . in the study of rahi
et al , psychopathology was found more commonly in the age group of 7 - 10 years .
most of the studies have shown a male preponderance for psychiatric disorders , but the present study did nt show any significant difference among male and female students .
prevalence was significantly higher ( p<0.001 ) in the middle income group ( 10000 - 20000inr ) while in most of the studies the prevalence increased as the socio - economic status lowered , the highest in lower class .
distribution of family structure was of no significance as illness was equally distributed in both nuclear and joint family .
it corroborates with the findings of lal et al , and deivasigamini , whereas verghese et al , more cases in nuclear families .
lack of awareness about child rearing practices , over protection of first child , neglect of second child , sibling rivalry , unwanted child , economic burden after second child could contribute to this finding .
other studies like studies by offord , and rahi et al , showed majority of the ill children were first born . among different disorders ,
most of the children were having specific isolated phobia ( 19.6% ) , other non organic sleep disorders like sleep talking , bruxism etc ( 12.0% ) and tension headache ( 11.5% ) .
deivasinagamini , found prevalent psychiatric disorders to be conduct disorder ( 14.3% ) , enuresis ( 14.3% ) , mental retardation ( 2.9% ) and hyperkinetic disorder ( 1.7% ) . in our study
hyperkinetic disorder found in 6% of the students , enuresis in 4.5% and mental retardation in 1.5% of the students . in another study in 4 - 16 yr age group children by srinath et al , was preceded by enuresis ( 6.2% ) followed by specific phobia ( 2.9% ) and hyperkinetic disorder ( 1.6% ) and stuttering ( 1.5% ) . in view of the above discussion
, it is concluded that it is imperative to carry out this type of epidemiological survey more in number and to follow up them longitudinally to understand the natural history of childhood and adolescent disorders .
the results of the study have implications for clinical training , practice and policy initiatives . integrating mental health into general health care ,
effective mass media coverage , networking between mental health - professionals and other health professionals , community - based health services and involvement of professionals from the education sector , would be essential .
the study has been done in a small number of children where male children are significantly higher in number than female .
cross sectional study should be followed by longitudinal study to find out the course and pattern of their disorder .
moreover , other socio - demographic entities should be searched for and compared to find out any possible correlation . | background : psychiatric problems in children are rising and reported cases represent only the tip of the iceberg ; large number remains unreported in india .
there is limited data on childhood mental disorders and mental health needs in northern-india.aims and objective : the main objective of this research was to study the extent and nature of psychiatric disorders in school children in a defined geographical area and to study their psychosocial correlates.materials and methods : in this cross sectional study , childhood psychopathology measurement schedule ( cpms ) was used to measure the magnitude of 982 students in the age group of 10 - 15 years from four randomly selected schools in a city of north india .
screening stage was followed by detailed evaluation stage in which children were diagnosed by icd-10 criteria .
statistical analysis was done by percentage and chi - square test.results:the results showed that among 982 students , 199 ( 20.2% ) had psychiatric morbidity .
most of them were in the age group of 13 - 14 yrs , from middle income group and were second in birth order .
no significant sexual preference was found regarding distribution of the disorders .
specific phobia ; other non organic sleep disorders like sleep talking , bruxism ; tension headache found to be the most prevalent disorders followed by sleep terror , hyperkinetic disorder , pica , enuresis.conclusion:epidemiological studies should be started early in childhood and carried longitudinally for development of preventive , promotional and curative programme in the community . |
gestational diabetes mellitus ( gdm ) is a common medical complication of pregnancy defined as any degree of glucose intolerance with onset or first recognition during pregnancy [ 1 , 2 ] .
the initial criteria for diagnosis were established more than 40 years ago ; however , these criteria did not necessarily identify pregnancies with increased risk of adverse pregnancy outcome .
the hyperglycaemia and adverse pregnancy outcome ( hapo ) study was conducted to clarify the associations between maternal hyperglycaemia and adverse outcomes .
the study showed associations between increasing levels of fasting blood glucose ( fbg ) , 1-hour and 2-hour plasma glucose obtained following an oral glucose tolerance test ( ogtt ) , and birthweight > 90th centile and cord - blood serum c - peptide level > 90th centile .
the secondary outcomes of premature delivery , shoulder dystocia or birth injury , admission to intensive neonatal care unit , hyperbilirubinemia , and preeclampsia were also increased by maternal hyperglycaemia .
the consideration of hapo data led to a recommendation in 2010 by the international association of diabetes and pregnancy study groups ( iadpsg ) for the fbg and 1 h and 2 h glucose levels to diagnose gdm .
the diagnostic threshold values were the average glucose values at which the odds for birthweight > 90th centile , cord c - peptide > 90th centile , and percent body fat > 90th centile reached 1.75 times the estimated odds of the outcomes at mean glucose values [ 4 , 5 ] .
however , concern has been expressed that adoption of the new diagnostic criteria would lead to a dramatic increase in the incidence of gdm .
one australian study reported that the change in diagnostic criteria from the previously utilised australasian diabetes in pregnancy society ( adips ) 1999 criteria to the new iadpsg 2010 criteria would increase the prevalence of gdm from 9.6% to 13.0% .
national debate continues on the workforce implications of the revised criteria and their clinical impact [ 9 , 10 ] .
the aim of this study was to audit the impact of the change from the adips 1999 criteria to the iadpsg 2010 diagnostic criteria within a geographically defined region .
a prospective audit of all pregnancies diagnosed with gdm commenced from july 1 , 2010 , following publication of hapo and the iadpsg recommendations .
the institutional ethics committee determined that the project fulfilled the criteria of an audit project as pregnancy outcomes were being audited and no intervention other than routine care according to existing clinical protocols was planned .
all pregnant women greater than 20-week gestation referred for public maternity care who resided within the postcodes 60016007 , 6147 , 6148 , 6151 , 6152 , and 6155 within the north metropolitan health service of the western australian department of health between july 1 , 2010 , to june 30 , 2014 , were included in the audit .
women with a history of preexisting diabetes mellitus ( type 1 or 2 ) were specifically excluded from the project .
all women had an ogtt between 24 and 28 weeks of gestation in accordance with the existing clinical protocol .
the adips 1999 criteria were used to diagnose gdm in the period from july 1 , 2010 , to december 31 , 2011 .
women had a 75-gram ogtt with glucose samples taken after an overnight fast and at 2 hr postprandially .
gdm was diagnosed if the fasting glucose was 5.5 mmol / l ( 100 mg / dl ) and/or the 2 h glucose was 8.0 mmol / l ( ~145 mg / dl ) . from january 1 , 2012 , to june 30 , 2014 ,
women had a 75-gram ogtt with glucose samples taken after an overnight fast and at 1 hr and 2 hr postprandially .
one or more abnormal values were needed for a diagnosis of gdm to be made : fbg > 5.0
the majority of ogtt in the audit period was performed at the western diagnostics pathology laboratories . a small number ( 2.8% )
all patients had their weight ( kg ) and height ( m ) recorded at their booking visit to calculate their body mass index ( bmi ) .
patients with a bmi greater than 40 had their antenatal care at the local maternity hospital but were referred for delivery to the regional tertiary hospital .
all pregnancies diagnosed with gdm across the audit period received identical clinical care according to a written protocol .
this involved an initial consultation with a diabetic educator , dietician , and obstetric doctor .
patients commenced self - monitoring of blood sugar levels and adopted a diabetic diet . a review visit a fortnight
delivery outcomes were entered into a computerized database called meditec by attending midwifery staff as part of routine practice .
delivery outcomes were subsequently extracted from meditec , case note audit , and a postnatal clinical service for all women with gdm conducted by one author ( julie quinlivan ) .
these were mode of delivery , elective or emergency caesarean section , estimated blood loss , and 3rd or 4th degree perineal tear .
these were gestational age at birth , birthweight , birthweight > 90th centile adjusted for gestational age , apgar at 1 and 5 minutes , umbilical artery and vein ph , admission to special care unit , and serious perinatal complications such as stillbirth , neonatal death , or birth trauma including shoulder dystocia .
a power calculation assumed that the change in incidence of gdm would be 30% , a conservative estimate based on the previous australian and new zealand studies [ 7 , 8 ] .
the baseline rate of gdm in the audit region was approximately 3.5% . assuming a power of 80% and alpha error of 0.05 , a sample of 10,994 women was required across the audit period to detect a change in incidence from 3.5 to 4.6% .
descriptive statistics of predefined clinical outcomes were compared using student 's t - test for continuous variables and chi square test or fisher exact test for discrete data .
of 10,296 women delivering in the audit period , antenatal ogtt results could be traced for 10,277 women ( 99.8% ) . the remaining 19 ( 0.2% )
of these women , 5 attempted an ogtt and were unable to complete the test due to nausea and/or vomiting .
the other 14 women either presented for care too late for testing or declined testing .
the overall incidence was not significantly different with 3.4% diagnosed under the adips 1999 criteria and 3.5% under the iadpsg 2010 criteria . in the subgroup of 342 women with a bmi > 40 ( representing 3.3% of the study population )
the incidence of gdm was 3.7% using adips 1999 criteria and 8.5% using iadpsg 2010 criteria .
this difference was not statistically significant ( p = 0.11 ) ; however , the audit was not adequately powered to detect a difference in the subgroup of women with high bmi . across the audit period
the proportion of women with gdm who required management with medication ( metformin or insulin ) in addition to diet was not significantly different ( 25% in women diagnosed by adips 1999 criteria and 28% in women diagnosed by iadpsg 2010 criteria , resp . ) .
delivery data for 10,277 ( 98% ) women were available for audit through meditec , case note audit , or the postnatal clinical service .
babies born to women diagnosed with gdm according to the iadpsg 2010 criteria had significantly higher umbilical artery ph ( 7.28 versus 7.21 ; p = 0.01 ) .
they had a significant lower birthweight ( 3360 gms versus 3470 gms ; p = 0.02 ) and birthweight above the > 90th centile adjusted for gestational age ( 11% versus 18% ; p = 0.04 ) .
the audit found no significant difference in the incidence of gdm before and after the introduction of the iadpsg 2010 criteria , with the overall incidence being low at 3.5% .
our results differ from the previous australian and new zealand studies [ 7 , 8 ] .
one explanation may be that prevalence of gdm in our region is low compared to many other sites .
our rate of 3.5% contrasts higher background rates in the sites involved in the hapo trial where incidences ranged from 8 to 25% .
however , hapo study sites were specifically included because of their high rates of gdm .
they were tertiary sites where women with high bmi and other pregnancy complications were referred for antenatal and delivery management [ 5 , 12 ] .
our study was based upon a geographical region rather than a hospital cohort and thus captured women of all risk levels , including a majority who were of normal risk , unlike the patient population within a tertiary centre . a second explanation for the observed difference in outcome between our study and previous ones may be the racial mix of the population .
although our geographic maternity cohort reflected the wider australian public maternity cohort in terms of maternal age and parity , racial background was overwhelmingly english speaking caucasian .
our geographic catchment has a low prevalence of overweight and obese patients compared to many sites .
lower obesity levels mean that the underlying risk of metabolic hyperglycaemia is lowered . of note , in our subgroup of women with a bmi
> 40 the incidence of gdm rose from 3.7% to 8.5% under the iadpsg 2010 criteria , more in line with studies elsewhere [ 7 , 8 ] .
as a secondary consideration , the adoption of the iadpsg 2010 criteria did not adversely impact upon our predefined maternal and newborn outcomes .
there was a significant improvement in three newborn outcomes , being an increase in umbilical artery ph and a reduction in birthweight and birthweight > 90th centile adjusted for gestational age .
firstly , data were extracted from a defined geographic region before and after implementation of the iadpsg 2010 diagnostic criteria .
thirdly , there was high compliance with screening for gdm ( 99.8% ) and ascertainment of outcome ( 98% of women ) .
a study limitation is the low background incidence of gdm that limits generalizability to regions where incidence rates are higher .
a second limitation is that only 3.3% of women presented with a bmi > 40 . in this subgroup of women ,
centres where the obstetric population has a higher incidence of obesity may report an increase in the incidence in gdm utilising the new diagnostic criteria .
however , it is likely that this reflects a genuine increase in metabolic pathology , as obesity is a major risk factor for gdm and adverse pregnancy outcome .
the iadpsg used a consensus process to redefine gdm based on its association with adverse pregnancy outcomes .
however , in our audit study of 10,296 women , we observed no significant increase in the incidence of gdm . | background . controversy surrounds the decision to adopt the international association of diabetes and pregnancy study groups ( iadpsg ) criteria for the diagnosis of gestational diabetes mellitus ( gdm ) as fears that disease prevalence rates will soar have been raised . aims . to investigate the prevalence of pregnancy complicated with gdm before and after the introduction of the iadpsg 2010 diagnostic criteria .
materials and methods . a prospective audit of all women who delivered from july 1 , 2010 , to june 30 , 2014 , in a predefined geographic region within the north metropolitan health service of western australia .
women were diagnosed with gdm according to australian diabetes in pregnancy society ( adips 1991 ) criteria until december 31 , 2011 , and by the iadpsg 2010 criteria after this date .
incidence of gdm and predefined pregnancy outcomes were audited .
results . of 10,296 women , antenatal oral glucose tolerance test ( ogtt ) results and follow - up data were obtained for 10,103 women ( 98% ) , of whom 349 ( 3.5% ) were diagnosed with gdm .
the rate of gdm utilising adips criteria was 3.4% and the rate of utilising iadpsg criteria was 3.5% ( p = 0.92 ) .
conclusion .
iadpsg diagnostic criteria did not significantly increase the incidence of gdm in this low prevalence region . |
rheumatoid arthritis is a common form of arthritis , second only after osteoarthritis in prevalence , and is still for most patients a severe , painful , and debilitating disease .
histologically , the ra joint is characterized by an expanding and invasive inflammation , which includes t and b cell infiltrates , sometimes well organized into ectopic follicles , as well as macrophages , dendritic cells , and granulocytes [ 24 ] .
beginning in the earliest stages of ra , the synovial fluid has a particularly high content of neutrophils .
their presence correlates with joint stiffness , changes in the lubricating properties of the synovial fluid , and the escalating inflammation of the surrounding joint tissue referred to as synovitis .
in addition , there are early indications that neutrophils may be key for the generation of the anti - citrullinated peptide autoantibodies , which are characteristic for ra .
the amino acid citrulline arises from arginine by deimination through the action of protein - arginine deiminases ( pad ) , one of which , pad4 , is particularly highly expressed in neutrophils .
single - nucleotide polymorphisms in the gene for pad4 , padi4 , are consistently associated with ra [ 7 , 8 ] in asian population and possibly also in caucasian populations , further strengthening the notion that granulocyte - derived pad4 may be a key player in the citrullination of proteins in the synovial fluid , which subsequently acts as autoantigens to trigger an immune response resulting in anti - citrulline - peptide antibodies . in this paper
, we characterize the hypercitrullination reaction , which can be triggered in neutrophils by perforin and the membrane attack complex of activated complement .
our experiments suggest that these triggers , both of which have been suggested to be present in the ra joint , simply act by flooding the cytoplasm of neutrophils with supraphysiological levels of calcium .
we also show that varying degrees of hypercitrullination can be induced in many leukocyte lineages by perforin , ionomycin , and triton - x .
other activating stimuli fail to induce this response , presumably because they do not elevate the intracellular calcium concentrations to the approximately 250 m required for detectable citrullination to occur .
human blood from healthy volunteers was obtained with informed consent under medimmune 's blood donation program and studies using human cells were performed in accordance with the institutional review board guidelines of medimmune llc .
peripheral blood mononuclear cells ( pbmc ) and neutrophils were isolated from heparin anticoagulated blood from healthy donors on a discontinuous gradient as previously described .
monocytes and t cells were subsequently isolated by negative immunoselection ( stemcell technologies , negative selection markers for monocytes were cd2 , cd3 , cd16 , cd19 , cd20 , cd56 , cd66b , cd123 , and glycophorin a and for t cells were cd14 , cd16 , cd19 , cd20 , cd36 , cd56 , cd66b , cd123 , and glycophorin a ) and b cells by positive immunoselection ( miltenyi biotec , positive selection marker cd19 ) following the manufacturer 's instructions with a purity of over 95% .
plasmacytoid dendritic cells ( pdcs ) , myeloid dendritic cells ( mdcs ) , and natural killer cells ( nk cells ) were isolated by negative immunoselection from fresh leukopacks obtained from healthy donors ( stemcell technology , negative selection markers for nk cells were cd3 , cd4 , cd14 , cd19 , cd20 , cd36 , cd66b , cd123 , hla - dr , and glycophorin a ; pdc and mdc selection markers were not disclosed by manufacturer ) following manufacturer 's instructions with a purity of over 95% .
all cell populations were then washed and resuspended at a density of 10 10 cells / ml in rpmi medium with 5 mm hepes ( invitrogen ) . to assess the requirements for calcium , dose - responses using 0 ,
31.25 m , 62.5 m , 125 m , 250 m , 500 m , 1 mm , and 2 mm calcium chloride were added to the medium .
cells were activated with a range of doses of either ionomycin ( invitrogen ) for different times at 37c , 100 nm pma ( invitrogen ) for 1 h or 4 h at 37c , or 0.005% triton - x for up to 1
we chose 100 nm of pma as this concentration is typically used as a standard concentration for inducing neutrophil extracellular trap formation ( netosis ) .
the sublytic concentration of perforin ( enzo life sciences ) was determined to be 500 ng / ml for human neutrophils in a previous study .
we used 150 ng / ml , 250 ng / ml , and 500 ng / ml to treat neutrophils at 37c for various times ( 15 min , 30 min , 1 h , and 4 h ) .
all reactions were stopped by adding lithium dodecyl sulfate ( lds ) sample buffer ( invitrogen ) and boiling .
for controls , neutrophils were either immediately boiled in lds sample buffer after isolation ( time 0 control ) or incubated for different times at 37c before boiling in lds sample buffer .
proteins from an equivalent number of cells ( 50,000 cells ) were separated by gel electrophoresis on 412% sds gel and then transferred to nitrocellulose membrane . for immunoblots with the monoclonal anti - citrulline antibody ( clone f95 , mouse igm , emd millipore ) and hrp conjugated -actin ( sigma - aldrich ) , membranes were directly blocked with fish gelatin without chemical modification .
alternatively , membranes were chemically modified as previously described , blocked with milk , and detected with anti - modified citrulline antibody ( amc , rabbit polyclonal , kindly provided by dr .
the primary antibodies were used as follows : anti - modified citrulline antibody ( 1 : 4,000 , 4c , overnight ) , monoclonal anti - citrulline f95 antibody ( 1 : 1,000 , 4c , overnight ) , and -actin ( 1 : 40,000 , 37c , 1 h ) . for -actin , enhanced chemiluminescence ( ecl )
, hrp conjugated anti - rabbit igg and anti - mouse igm were , respectively , used as secondary antibody before ecl detection .
we deployed two independent methods to detect the presence of citrulline residues in cellular proteins .
the first used the anti - citrulline antibody f95 from emd millipore , which was raised against a polycitrulline peptide coupled to keyhole limpet hemocyanin .
the second detection method , which we refer to as anti - modified citrulline ( amc ) , is based on the chemical modification of citrulline residues at low ph to form a ureido group adduct , which is detected by anti - ureido group antibodies .
reactivity to both antibodies was essentially undetectable in untreated human neutrophil samples but increased in a time - dependent manner in cells treated with ionomycin ( figure 1(a ) ) .
the band patterns detected by the two detection methods were overlapping but differed in several bands presumably due to differences in the specificities of the antibodies for citrulline residues in different amino acid sequence contexts .
the amc blots also detected a band of mr ~16 kda in untreated neutrophils , which may represent histone as this antibody was raised against citrullinated calf histones .
in contrast , clone f95 was raised against a synthetic peptide consisting of ten citrulline residues , suggesting that clone f95 may preferentially recognize epitopes with more than one citrulline residue .
nevertheless , since the results generated with the two detection approaches were similar , we mostly used the more convenient f95 antibody for detection of hypercitrullination in subsequent experiments .
since neutrophil hypercitrullination was reported to be induced by membrane lytic stimuli such as perforin or activated complement , we hypothesized that membrane leakage caused by a mild detergent like triton - x may also lead to hypercitrullination . while cell integrity was not affected by a 4 h treatment with ionomycin or perforin
, we did observe that treatment of cells with 0.005% triton - x for longer than 1 h resulted in significant cell loss , as assessed by trypan blue exclusion .
as shown in figure 1(b ) , treatment with 0.005% triton - x for one hour induced a similar hypercitrullination in neutrophils as the perforin and ionomycin treatments .
a densitometry scan ( figure 1(c ) ) revealed that ionomycin , triton - x , and perforin treatment resulted in protein citrullination patterns with only subtle differences , which may reflect differences in precise kinetics of triggered calcium influx , as well as the difference in the integrity of cellular lipid bilayers , proteolysis , or other factors .
consistent with the previous study , treatment of neutrophils with phorbol ester did not lead to hypercitrullination ( figure 1(b ) ) at any time point between 15 min and 4 h ( data not shown ) .
at the same time , pma treatment induced a netosis response confirmed by confocal microcopy ( not shown ) .
consequently , pma treatment also reduced plasma cell membrane integrity at the 2 and 4 h time points , as observed by dna staining . other neutrophil activating stimuli , such as formyl - peptides , gm - csf , il-6 , il-8 , and tnf , also failed to induce hypercitrullination ( data not shown ) .
time - course experiments with ionomycin , triton - x , and perforin showed that much of the hypercitrullination reaction occurred within the first 15 min ( figure 2(a ) ) .
the dose - responses to ionomycin and perforin showed that 1 m of the former and 500 ng / ml of the latter were most active ( figure 2(b ) ) , with slight variation from donor to donor in the intensity of the bands .
for induction of t cells proliferation , ionomycin is often used at 300 nm , suggesting that the hypercitrullination response in neutrophils requires higher calcium concentrations than those required to promote the proliferative responses in t cells .
in vitro , the enzymes responsible for protein citrullination require millimolar calcium concentration to be fully active . as in previous studies
, we initially used 2 mm ca in the cell culture medium . to test how much calcium was required for the hypercitrullination reaction in human neutrophils
, we induced this reaction with ionomycin in the presence of different calcium concentrations ( figure 3(a ) ) .
neutrophils from most donors showed a half - maximal response around 0.5 mm ca , but with some heterogeneity among donors with ec50 values between 0.25 and 2 mm ( data not shown ) .
notably , hypercitrullination was completely blocked when edta was added to the medium ( figure 3(b ) ) .
since neutrophils can induce hypercitrullination , they have been implicated to play a role in the citrullination of proteins detectable in synovium of ra patients .
however , the enzymes responsible for citrullination , particularly pad4 and pad2 , are also expressed in other leukocytes .
therefore , we wanted to determine if hypercitrullination could also be induced in other cells . first , in parallel with neutrophils we tested human blood mononuclear cells ( pbmc ) .
as shown in figure 4 , hypercitrullination was induced in both neutrophils ( figure 4(a ) ) and pbmc ( figure 4(b ) ) from the same donor . on a cell equivalent basis ( 50,000 cells )
, hypercitrullination was less intense in the pbmc samples and the pattern of bands was somewhat different .
next we isolated additional immune cell populations and determined if they could be induced to undergo hypercitrullination .
monocytes responded to ionomycin with a clear hypercitrullination response ( figure 4(c ) ) , comparable to neutrophils , while t cells responded with a weaker , but readily detectable , hypercitrullination ( figure 4(d ) ) . as estimated by a titration experiment , where neutrophils and t cells were compared side by side ( starting with 50,000 cells for both cell types , titrated neutrophil loading down to 1/5 , 1/10 , 1/100 , and 1/500 of t cells ) , the level of citrullination in t cells was 10100 times lower than in neutrophils ( data not shown ) .
it is also notable that the hypercitrullination reaction was below the detection limit in t cells from some donors .
in contrast to t cells and monocytes , b cells did not show any response in any of our experiments ( figure 4(e ) ) .
we tested purified b cells from five different donors with ionomycin treatment and used neutrophils from the same donors as positive controls , and we loaded up to 5 times more cell equivalents per lane .
nevertheless , no hypercitrullination response was detected with either f95 or amc antibodies ( figure 4(e ) ) .
in contrast , nk cells isolated from human blood underwent hypercitrullination upon ionomycin activation ( figure 4(f ) ) , while neither myeloid nor plasmacytoid dendritic cells were able to generate a hypercitrullination response under our conditions ( figure 4(f ) ) .
studies with patient - derived anti - citrulline autoantibodies have shown that multiple different citrullinated proteins can act as autoantigens in ra patients . mass spectrometry studies to identify citrullinated proteins in patient samples have also confirmed that numerous citrullinated proteins exist in these samples [ 1416 ] , including abundant extracellular proteins such as fibrinogen and fibronectin , as well as intracellular proteins , some of which are expressed primarily in neutrophils ( e.g. , neutrophil cytosol factor 1 ) .
based on these discoveries , it appears that extensive citrullination of cellular proteins occurs in ra , some of them inside cells like the neutrophil .
nevertheless , it remains to be elucidated whether the rapid hypercitrullination reaction in neutrophils , and as we show here , is instrumental in the pathogenesis of ra .
it also remains to be determined if the induction of citrullination in other immune cells plays a role in ra .
the presence of extensive citrullination of extracellular proteins also implies that catalytically active pads gain access to these substrates through a poorly understood process that may involve leakage from damaged cells , perhaps through perforin- or complement membrane attack complex - induced pores .
alternatively , pads may not be released into the extracellular milieu until cells break apart . in our hands , a low dose of the detergent triton - x induced a strong hypercitrullination response at low concentrations that presumably allow extracellular calcium to enter the cells to activate pads but do not lyse the cells within the first hour .
. a key feature of all studied human pads is their requirement for millimolar concentrations of calcium for catalytic activity in vitro . in a previous study , perforin and
complement membrane attack complexes were shown to cause neutrophil hypercitrullination in medium with 2 mm ca , but not in the presence of edta , suggesting that abundant influx of calcium was involved .
our experiments confirm these data and extend them to show that submillimolar concentrations of calcium may be sufficient , at least in some donors .
while this brings the response more firmly into the physiologically relevant calcium concentration range , it also may suggest that intracellular pads are subject to somewhat different calcium requirements than the purified pad4 and pad2 enzymes in the test tube .
indeed , it has been suggested that pad4 can citrullinate histones and transcription factors in the nucleus of stem cells , under conditions where local calcium concentrations likely are well below 200 nm .
hence , other cellular factors , for example , associated proteins , may exist in the cells to regulate pads .
pad4 has been suggested to be necessary for the neutrophil extracellular trap extrusion response , referred to as netosis . during netosis
, pad4 was proposed to citrullinate histones to aid in the unwinding of nucleosomal dna and to be subsequently found on the extruded dna fibers .
however , under our experimental conditions , pma stimulation did not induce hypercitrullination , perhaps because pma does not induce a calcium response . as in the case of nuclear pad4 in stem cells ,
this physiological role of pad4 in netosis must be regulated quite differently from the high calcium - induced hypercitrullination reaction , which may well occur only under pathological conditions . in this paper , we provide more detailed kinetic data on neutrophil hypercitrullination . while earlier studies have documented the kinetics of neutrophil histone citrullination in response to inflammatory stimuli , a more detailed time - course of the neutrophil hypercitrullination response has not , to the best of our knowledge , been reported before .
previous neutrophil hypercitrullination papers have used rather long incubation times and did not report short time points or / and dose - responses to relevant stimuli or extracellular calcium .
we found that hypercitrullination occurs within minutes and requires doses of ionomycin or perforin that cause high levels of calcium influx and that it was abolished by edta or egta ( data not shown ) . by titrating calcium concentrations
, we found that neutrophils from most donors showed a half - maximal response around 0.5 mm of extracellular ca , but there was some heterogeneity among donors with ec50 values between 0.25 and 2 mm .
the instances of lower calcium requirements are particularly intriguing because they are well within the physiological ca concentrations present in synovial fluid and tissues .
we can only speculate whether the observed individual variations are representative of differences in intact human subjects and , if so , whether they have any relevance for the susceptibility of individuals to citrullination and the development of ra .
our study confirms that hypercitrullination readily occurs in neutrophils and monocytes but extends the observation to nk cells and t cells , but not to b cells or dendritic cells .
these differences may be caused by cell lineage - specific differences in the expression of different pads or differential regulation of the activity of pads in different immune cells .
further work will be required to determine if hypercitrullination is a more universal response in cells to membrane lytic stimuli under physiological calcium conditions .
our study shows that a robust hypercitrullination can be induced in human neutrophils within minutes by pore - forming or membrane lytic stimuli in medium with > 0.5 mm extracellular calcium . a hypercitrullination response ( albeit at much lower levels )
can also be induced in monocytes , nk cells , and t cells ( at least from some healthy donors ) , but not in b cells or dendritic cells .
collectively , these cells are the likely source of citrullinated proteins that activated a citrulline - directed immune response in patients with rheumatoid arthritis . | autoantibodies against citrullinated proteins are diagnostic for rheumatoid arthritis .
however , the molecular mechanisms driving protein citrullination in patients with rheumatoid arthritis remain poorly understood . using two independent western blotting methods
, we report that agents that trigger a sufficiently large influx of extracellular calcium ions induced a marked citrullination of multiple proteins in human neutrophils , monocytes , and , to a lesser extent , t lymphocytes and natural killer cells , but not b lymphocytes or dendritic cells .
this response required 2501,000 m extracellular calcium and was prevented by edta .
other neutrophil activating stimuli , such as formyl - peptides , gm - csf , il-6 , il8 , tnf , or phorbol ester , did not induce any detectable increase in protein citrullination , suggesting that receptor - induced calcium mobilization is insufficient to trigger hypercitrullination . we conclude that loss of membrane integrity and subsequent influx of high levels of calcium , which can be triggered by perforin released from cytotoxic cells or complement mediated formation of membrane attack complexes in the joints of rheumatoid arthritis patients , are sufficient to induce extensive protein citrullination in immune cells , notably neutrophils
. this mechanism may provide the citrullinated autoantigens that drive autoimmunity in this devastating disease . |
the unique chemical and physical properties of perfluorocarbon liquids ( pfcl ) have enabled internal displacement of subretinal fluid and stabilization of mobile retina , transforming the surgical approach to complex retinal detachments . despite these advantages ,
use of pfcl may be complicated by inadvertent retention of pfcl droplets in the subretinal space.1 subfoveal pfcl may be visually significant , and prompt surgical removal or displacement is indicated according to the visual prognosis.2 while peripheral subretinal pfcl can often be observed , migration of peripherally located droplets towards the fovea is well recognized , although the mechanisms of migration remain unknown.3 spontaneous resolution of subfoveal pfcl without surgical evacuation or displacement has rarely been described.4 we present a case of a large single retained subfoveal pfcl droplet that demonstrated spontaneous resolution 3 weeks postoperatively .
a 72-year - old man was referred with a history of recurrent retinal detachment in the right eye ( figure 1a ) repaired with prior vitrectomy and subsequent encircling scleral buckle , vitrectomy , and silicone oil . upon referral ,
he was noted to have counting fingers visual acuity with a recurrent macula - involving retinal detachment under silicone oil with diffuse posterior and anterior preretinal grade c proliferative vitreoretinopathy .
retinal detachment repair was subsequently performed with 23-gauge vitrectomy , extensive peeling of preretinal posterior and anterior membranes , stabilization of the posterior pole with pfcl ( perfluoron , alcon , fort worth , tx , usa ) , 180 inferior relaxing retinectomy , laser photocoagulation , and 1,000 centistoke silicone oil tamponade .
on postoperative day 1 and then at postoperative week 1 , the patient had counting fingers vision with retinal attachment under silicone oil , but a large subfoveal pfcl droplet was noted on ophthalmoscopy and confirmed with optical coherence tomography ( oct ) imaging , which revealed a focal area of severely thinned retinal tissue overlying the droplet ( figure 1b ) .
the decision was made with the patient to proceed with surgical displacement of the subfoveal pfcl droplet , but for personal reasons , he required delaying surgery until the third postoperative week .
on postoperative day 21 , in the preoperative holding area , he casually noted sudden improvement in his vision 2 days prior .
ophthalmoscopy was performed , demonstrating absence of previously seen subretinal pfcl at the fovea , at the retinectomy edge , or anywhere in the subretinal space .
oct performed that day revealed a restored foveal depression with focal outer retinal granulation and thinning ( figure 1c ) . without any surgical intervention , these architectural changes improved over the subsequent months , with restoration of the ellipsoid zone band at the fovea ( figure 1d ) .
his visual acuity remained at the counting fingers level until removal of his silicone oil 4 months following placement .
his visual acuity improved to 20/150 at one day following oil removal and to 20/70 at 6 weeks following oil removal , with sustained retinal attachment , absence of any retained pfcl , and continued improvement of the retinal contour and microarchitecture .
subretinal pfcl retention is a well described complication following its use in retinal detachment repair.1 while migration of subretinal pfcl toward the fovea is a recognized phenomenon,3 spontaneous resolution of subfoveal pfcl has rarely been described .
in one recent report , a cluster of subfoveal pfcl droplets spontaneously migrated to the inferior subretinal periphery after being stable for several years following retinal detachment repair.4 to the authors knowledge , no other reports of spontaneous subfoveal pfcl resolution have been documented . in this report , we demonstrate a second case of spontaneous resolution of subfoveal pfcl . surprisingly , careful inspection of the posterior and peripheral retina did not reveal any subretinal pfcl droplets following resolution , including at the retinectomy edge .
it is possible that the single large pfcl droplet separated into smaller subretinal droplets that were not ophthalmoscopically visible , but we feel this is unlikely , as even small pfcl droplets in the subretinal space are usually seen .
it may be possible that the large pfcl droplet was hidden by other structures , but we feel this is also unlikely given the successful reattachment without recurrent proliferative vitreoretinopathy and a clear view under silicone oil .
alternatively , pfcl droplets may have migrated through the subretinal space past the retinectomy edge into the vitreous cavity , but we think this is also unlikely given the sustained retinal attachment including at the lasered retinectomy edge .
rather , we hypothesize , based on a putative defect identified on oct within the thin retina overlying the pfcl droplet ( figure 1b , arrowhead ) that the surface tension of the pfcl droplet resulted in tangential forces that , compounded by accompanying peeling of preretinal proliferative vitreoretinopathy membranes , resulted in a focal overlying defect at the fovea .
we suggest that the pfcl droplet extruded through this retinal defect into the vitreous cavity , where it remained undetected , but was subsequently removed during silicone oil removal .
the possibility of retinal hole formation due to chronic subretinal pfcl retention with a very thin overlying retina has been entertained in the literature.5 in our case , we hypothesize that resolution of the tangential forces after extrusion of the pfcl droplet led to spontaneous closure of the hole , resulting in a course of granulation and closure similar to that seen following full - thickness macular hole repair .
this case demonstrates that resolution of subfoveal pfcl can occur spontaneously either through presumed extrusion into the vitreous cavity or , as has been previously reported , through peripheral migration in the subretinal space . the mechanism and triggering forces of these rare events
are poorly understood , and we advocate prompt surgical removal or displacement of subfoveal pfcl . in the future , improved understanding of the mechanisms of spontaneous resolution may enable the development of nonsurgical methods to displace subfoveal pfcl . | perfluorocarbon liquids ( pfcl ) have transformed the surgical approach to complex retinal detachments , but their use can be complicated by subretinal retention .
migration of peripherally located subretinal pfcl towards the fovea is well established , but spontaneous resolution of subfoveal pfcl without surgical evacuation or displacement has rarely been described .
we present a case of a large single retained subfoveal pfcl droplet following vitrectomy with membrane peeling , inferior relaxing retinectomy , and silicone oil tamponade that demonstrated spontaneous resolution 3 weeks postoperatively , with subsequent anatomic and visual improvement .
no residual subretinal pfcl was noted , and we hypothesize that the pfcl droplet spontaneously extruded through a transient hole created in the thinned retina overlying the droplet , which subsequently closed spontaneously
. further understanding of the mechanisms of pfcl migration and resolution may facilitate improved treatments for this complication . |
treatment of disease by multiple dosing strategies and using conventional drug formulation poses many drawbacks . among them
are fluctuation of drug plasma concentration , the various side effects due to toxic plasma level of drug , or ineffectiveness treatment because of the lower concentration of drug than its therapeutic index [ 2 , 3 ] .
another important limitation of multiple dosing regimens is poor patient compliance especially for diseases for which patient must take drugs for a long time such as epilepsy [ 4 , 5 ] or for some specific drugs such as naltrexone hydrochloride which is used for maintenance abstinence in detoxified addicted persons after withdrawal phase of opioids and alcohol [ 6 , 7 ] .
nowadays scientists are interested in novel drug delivery systems which are used to direct drugs to the specific site of action and to achieve a controlled release of drug with a desirable release kinetics [ 1 , 8 ] . among the most studied of these systems are hydrogels which are insoluble matrices of hydrophilic block copolymers which swell in presence of fluids [ 9 , 10 ] .
smart hydrogels are the polymeric networks which release drugs in response to the environmental parameters such as temperature [ 1113 ] , ph [ 14 , 15 ] , light [ 16 , 17 ] , magnetisms [ 18 , 19 ] .
thermoresponsive hydrogels are extensively investigated smart hydrogels because of their simple application , low adverse effect on tissues compared with some other stimuli , and the difference between room and body temperature [ 12 , 20 ] .
amphiphilic triblock copolymers , pcl - peg - pcl , composed of polyethylene glycol ( peg ) and poly ( -caprolactone ) ( pcl ) , form a thermoresponsive , in situ forming , and biodegradable hydrogel [ 21 , 22 ] which have been studied as drug delivery systems [ 2325 ] .
mw irradiation for the high - speed , reproducible , and scalable preparation of polymeric materials has been utilized to reduce reaction times from days and hours to minutes and seconds and facilitate scale - up procedure and technology transfer from bench to industry [ 26 , 27 ] . in this study , pcl - peg - pcl with various weight ratios of each block of copolymer ( pcl : peg : pcl ) , 1000 : 1000 : 1000 and 500 : 1000 : 500 , was synthesized by three different methods : using stainless steel reactor , two - necked round - bottomed flask , and under microwave irradiation .
structure , molecular weight ( mw ) , and sol - gel transition of copolymers were investigated .
also in vitro drug release behavior was evaluated in this study using naltrexone hydrochloride and vitamin b12 .
poly ( ethylene glycol ) ( peg , mn = 1000 , merck , germany ) , -caprolactone ( sigma aldrich , usa ) , stannous octoate ( sn(oct)2 , sigma aldrich , usa ) , naltrexone hydrochloride was kindly donated by razak co. , iran , and vitamin b12 were kindly donated by iran hormone co. , iran .
synthesis of pcl - peg - pcl copolymers was carried out with two different block lengths of ( pcl : peg : pcl ) : 1000 : 1000 : 1000 ( copolymer 1 ) and 500 : 1000 : 500 ( copolymer 2 ) by a ring - opening polymerization technique .
the synthesis in stainless steel reactor and two - necked round - bottomed flask was performed as described before by gong et al .
the copolymer was also synthesized using microwave irradiation . briefly to synthesize 1000 : 1000 : 1000 , 10 g dried peg1000 , 20 g -caprolactone , and 2 g sn(oct)2 were added to a glassy flask fitted with condenser and was placed in a microwave .
the mixture was irradiated and stirred at 800 watt while temperature was kept at 130c .
the irradiation time was different in each synthesis ( 15 , 20 , 25 min ) to choose an optimum time for rapid preparation of the copolymer . in order to purify the product , at first , obtained copolymers were dissolved in 20 ml dichloromethane . by gradually adding 800 ml of petroleum ether , the viscous copolymer precipitants appeared . at the final step ,
the purification process was done 3 times and the final product was dried by freeze drying method .
the yield of reaction by each method was calculated by dividing the weight of the purified pcl - peg - pcl to the weight of initial materials used in the polymer preparation .
the copolymer structure and number - average molecular weights ( mn ) were determined using nuclear magnetic resonance analysis ( h - nmr , ac 80 brucker , germany ) at 80 mhz and 25c in cdcl3 .
gel permeation chromatography ( gpc , agilent gpc - addon apparatus and rid - a refractive index signal detector coupled to plgel columns ) was utilized to determine the weight - average molecular weight ( mw ) , mn , and polydispersity of the block copolymers using tetrahydrofuran as the solvent and eluent with a rate of 1 ml / min and polystyrene as the calibration standard . to determine the sol to gel and gel to precipitant transition temperatures ,
3 ml of the copolymers solution in distilled water ( 15 , 20 , 25 , and 30% ( w / v ) ) was poured in to 5 ml vials kept in a refrigerated bath circulator ( p-22 wisd , south korea ) .
the temperature increased with a rate of 1c/3 min from 10 0.1 to 60 0.1c .
after each 3 min , the vials were inverted to evaluate the viscosity of the content .
the temperature which the content did not flow by inverting vials was assumed as the sol - gel transition temperature .
this study was done before and after drug loading to determine the effect of drug on the phase transition temperatures .
the reversibility of the gel and the precipitant forming was also investigated by decreasing the temperature . to determine the time of the formation of the gels , all samples were transferred to a 37c water bath ( n - biotek-304 , south korea ) and the time of sol - gel transition was recorded .
all experiments were performed 3 times . according to the result of the polymer characterizations and the phase transition evaluations , two appropriate concentrations of copolymer 1 ( 1000 - 1000 - 1000 ) , which was synthesized by a microwave irradiation in 15 min , were chosen as a drug delivery system for the in vitro drug release experiment . for the purpose of preparing drug loaded hydrogels , adequate amount of the copolymer
2 ml of each formulation was placed in tubes and was transferred to the reciprocal water bath at 37. after the formation of the hydrogels , 4 ml of the phosphate buffer solution ( pbs , ph = 7.4 ) was added to each sample tube as a release media and samples were shaken at a rate of 60 times / min . in each sampling time , 0.5 ml of the medium was withdrawn and replaced by 0.5 ml fresh buffer .
drug analysis in samples was performed using high performance liquid chromatography ( hplc , acme 9000 young lin , south korea , c18 ( 4.6 250 mm , 52 m ) column ) .
mobile phase for naltrexone hydrochloride was composed of 14% acetonitrile , 85.5% deionized water , and 0.5% acetic acid ( v / v ) and for b12 was a mixture of 30% methanol and 70% deionized water .
the flow rate in both analyses was 1 ml / min and the uv detection wave length was set at 281 and 305 nm for naltrexone hydrochloride and b12 , respectively .
in order to compare different copolymer synthesis methods , the copolymerization was done by three different procedures that two of them , using two - necked flask and the stainless steel reactor , were conventional methods and take longer time compared to the other method which was a high - speed microwave - assisted way of the copolymer synthesis . since the microwave heating process provided a reaction condition with a higher temperature and pressure , the reaction took relatively short times and also the side reaction was limited and consequently greater yields were usually obtained . according to the yield of each method ( table 2 ) , the microwave - assisted synthesis was the best method in which the reaction just took a few minutes . by increasing the time of the reaction from 15 min to 25 min , no significant difference was found in the yield of the reaction or the quality of the products .
thus we considered 15 min as an adequate time for the microwave - assisted synthesis of the pcl - peg - pcl copolymers .
yields of the copolymers synthesized by the stainless steel reactor method were a little higher than the two - necked flask method . the h - nmr spectrum of the pcl - peg - pcl ( 1000 - 1000 - 1000 ) synthesized by the stainless steel reactor is shown in figure 1 .
the signals appeared in 3.6 ( a ) , 4.1 ( h ) , 2.2 ( d ) , and 1.5 ( e , f , g ) ppm are related to the protons of peg ( a ) and the ch2 groups of caprolactone ( h , d , e , f , g ) .
the mn of the copolymer was calculated by the integration of the signals pertaining to each monomer .
mn of the copolymer ( 1000 - 1000 - 1000 ) synthesized by the reactor and the microwave ( 15 min ) were 2590 and 3412 , respectively .
as the mn of the copolymers indicated , the one which was prepared by the reactor , in contrast to the one which prepared by the microwave - assisted method , has mn lower than the theoretical amount ( 3000 ) .
mw and mn obtained from h - nmr and gpc , the polydispersity of the copolymer which was estimated by mw / mn obtained from gpc , and the caprolactone ( cl ) to peg ratio obtained from h - nmr are presented in table 3 .
the data in table 3 belongs to copolymer 1 synthesized by the microwave - assisted method .
the pcl - peg - pcl tri - block copolymers are in situ gel - forming thermo - responsive copolymers composed of the hydrophobic pcl and the hydrophilic peg blocks . when hydrophobic blocks of pcl are surrounded by water molecules , they aggregate to reduce their exposed surface area in an aqueous environment and form micelles .
but this phenomenon is temperature dependent . in temperatures below ( lower critical solution temperature ) lcst , since there is hydrogen bonding between hydrophilic peg blocks and water molecules , the system is in sol condition and contains micelles . by increasing the temperature above lcst , weakening of the hydrogen bonds and the formation of the hydrophobic bridge between micelles through pcl segments
the sol - gel transition temperatures of the copolymers with various concentrations are presented in table 4 .
copolymer 1 ( 1000 - 1000 - 1000 ) could form gel in all concentrations , but copolymer 2 ( 500 - 1000 - 500 ) prepared by both conventional synthesis method could not form gel at the concentration of 15% and not even at the concentration of 20% for the two - necked flask method ( w / v ) due to its shorter hydrophobic segments ( cl ) compared to copolymer 1 and an incomplete copolymer synthesis by these methods . although the copolymer 1 ( 1000 - 1000 - 1000 ) formed gel in all concentrations , the sol - gel transition occurred in lower temperatures when it was synthesized using the microwave irradiation ( p < 0.05 ) . in all methods , as the copolymer concentrations increased ,
the phase transition temperatures shifted to the lower temperatures due to an increase in hydrophobic interactions .
there was no significant difference between the gel forming temperatures of the copolymers synthesized by the microwave method in different reaction times ( p > 0.05 ) .
the phase transition temperatures in all concentrations of copolymer 1 synthesized by the microwave irradiation were below the room temperature .
this causes copolymer 1 synthesized by the microwave to become a good candidate for an injectable carrier which converts to the gel in the body and releases the drug loaded inside in a sustained and controlled manner .
the phase transition temperatures of all copolymers synthesized by the conventional methods were above the body temperature and therefore could not gel in the body and were not suitable as a drug carrier .
another limitation of the conventional synthesized copolymers was the delay in gel formation that may cause a dose dumping effect in the body .
for the microwave - assisted synthesized copolymers , the sol - gel transition occurred in about 20 seconds , whereas this amount was 20 min for some of the copolymers synthesized by the conventional methods . the effect of the copolymer concentration on the phase transition temperature was shown in figure 3 .
as it is indicated , by increasing copolymer 1 concentration ( microwave synthesized ) , the sol - gel transition temperatures decreased and the precipitation temperatures increased due to a larger number of hydrophobic interactions .
we also investigated the effect of the drug content on the sol - gel transition temperature . as it was indicated in table 5 ,
loading vitamin b12 , a large molecule having 9 positions on it that can form hydrogen bonds with water molecules , lowered the activity of water and favored hydrophobic interactions between the pcl blocks of the copolymers .
however , loading a fairly small molecule such as naltrexone hydrochloride in copolymers does not have a significant effect on the phase transition temperatures . in vitro drug release through the pcl - peg - pcl ( 1000 - 1000 - 1000 ) synthesized by the microwave - assisted method
the rate of drug release through the hydrogels with the same concentration of the copolymer but a different concentration of the drug was not significant ; just a negligible increase in the rate of drug release after an increase in naltrexone hydrochloride concentration was observed .
this could be due to the fact that naltrexone hydrochloride , which is a small molecule in contrast to b12 , was released by diffusion rather than the hydrogel degradation . according to the fick 's law of diffusion , increasing drug concentration causes the rate of diffusion and the consequent drug release increases . as it is shown in figures 4 and 5 , the release of naltrexone hydrochloride and vitamin b12 through the hydrogels with higher copolymer concentration was slower .
this could be attributed to the fact that higher copolymer concentration made the hydrogels low porous with a big tortuosity and viscosity . here
, the effect of the molecular weight on the drug release through the hydrogels was also investigated by comparing the naltrexone hydrochloride and vitamin b12 loaded systems . as indicated in figure 6 , vitamin b12 with a higher molecular weight ( mw = 1355 ) compared to naltrexone hydrochloride
the release kinetics of both drugs was determined by fitting data according to zero order ( release by hydrogel erosion ) and higuchi kinetic models [ 31 , 32 ] .
since r of both models were approximately similar in all formulations , it was assumed that both mechanisms of diffusion and the hydrogel erosion played an important role in the drug release through the hydrogels ( table 6 ) .
synthesis of pcl - peg - pcl using microwave irradiation is the fast , simple , and cost effective method which causes higher yield of reaction .
pcl 1000-peg 1000-pcl 1000 tri - block copolymer solution which forms gel in body temperature even with low concentration of polymer appears to be a suitable in situ forming system as the pharmaceutical and clinical purpose .
different parameters such as polymer concentration and drug structure have influence on profile of drug release from systems . | traditional drug delivery systems which are based on multiple dosing regimens usually pose many disadvantages such as poor compliance of patients and drug plasma level variation . to overcome the obstacles of traditional drug formulations , novel
drug delivery system pcl - peg - pcl hydrogels have been purposed in this study .
copolymers were synthesized by rapid microwave - assisted and conventional synthesis methods .
polymer characterizations were done using gel permeation chromatography and 1h - nmr .
phase transition behavior was evaluated by inverting tube method and in vitro drug release profile was determined using naltrexone hydrochloride and vitamin b12 as drug models .
the results indicated that loaded drug structure and copolymer concentration play critical roles in release profile of drugs from these hydrogels .
this study also confirmed that synthesis of copolymer using microwave is the most effective method for synthesis of this kind of copolymer . |
in vertebrates different master genes acting on sex determination have been identified . in most mammals ,
sry ( testis - determining gene ) located in the y chromosome is the transcription factor that triggers the testis determining cascade .
the first non - mammalian master gene was discovered in fish ( oryzias latipes dmy ) . in birds ,
dmrt1 ( double - sex - mab-3 related transcription factor 1 ) located in the z chromosome plays this role while in xenopus laevis , dm - w a truncated copy of dmrt1 found in the w chromo - some , determines ovary fate in this species ( marn and baker , 1998 ; graves and peichel , 2010 ) .
recently , four strong master sex determining candidate genes were identified in fish : amhy in odontesthes hatchei , gsdf in oryzias luzonensis , amhr2 in takifugu rubripes and sdy in oncorhynchus mykiss .
three of the four sex determining candidate genes ( amhy , gsdf and amhr2 ) code for growth factors and one of their receptors demonstrating that novel actors , other than transcription factors , can be recruited at the top of the sex determination cascade ( reviewed by kikuchi and hamaguchi , 2013 ) .
downstream genes involved in sex differentiation regulatory cascades are conserved in vertebrates and invertebrates ( smith et al . , 1999 ) . among these genes , a dm gene family , dmrt ( doublesex - mab-3 related transcription factor )
is expressed in association with the development of sex - specific organs in all animals studied to date ( kopp , 2012 ) .
the first identified family member : dmrt1 , exhibits an expression pattern mainly involved in postnatal ( or post hatching ) male gonad development ( hodgkin , 2002 ; yamaguchi et al . , 2006 ) . in some fish species ,
its expression pattern is restricted to testes ( e.g oryzias latipes , kobayashi et al . ,
2004 ) while in others it is expressed in both gonads ( e.g. odontesthes bonariensis ,
fernandino et al . , 2008 ) . in hermaphrodite fish species
dmrt1 expression is related to male differentiation phases ( herpin and schartl , 2011 ) .
the interest in this gene was greater after the discovery that dmrt1 paralogs have moved up in the regulatory hierarchy from downstream position in gonad differentiation to the top of sex determination cascade in at least three distantly related organisms ( o. latipes , xenopus laevis and chicken kopp , 2012 ) . in o. latipes the male sex specific dmrt1 copy , dmrt1b(y ) ( nanda et al . , 2002 ) or dmy ( matsuda et al . , 2002
) , is located in the y chromosome with a function equivalent to mammalian sry ( male master sex determining gene).the dmrt1b(y ) gene is expressed in male embryos before gonadal differentiation ( early development : neurula stage , nanda et al . , 2002 ) .
it is involved in the specification and maintenance of sertoli cells fate and inhibits male germ cell division at the beginning of gonadal differentiation ( herpin et al . , 2007 ) .
the autosomal paralogue dmrt1a begins its expression between 2030 days post hatching during testicular differentiation ( kobayashi et al . , 2004 ) .
in adult testes both paralogues are expressed but dmrt1a predominates ( hornung et al . , 2007 ) .
it has been demonstrated that an insertion of a transposable element is responsible for the regulation of dmrt1by expression and also contributed to the establishment of this new regulatory hierarchy ( herpin et al . , 2010 ) .
fishes represent the most basal and diverse vertebrate group enclosing next to 28,000 species ( nelson , 2006 ) .
this diversity includes different mechanisms involved in sex determination ( genetic and environmental ) and sex differentiation ( unisexuality , hermaphroditism : synchronic or sequential and gonochorism : undifferentiated or differentiated ) ( devlin and nagahama , 2002 ) .
sex determination systems differ in closely related fish species , even in populations of the same species ( conover and kynard , 1981 ; devlin and nagahama , 2002 ) .
the evolutionary basis of this variability could be explained by ancient genomic duplication events that caused extra gene copies capable to acquire new functions and probably additional plasticity in the sex determination gene networks .
the ability to modify sex determination control could be selected in response to environmental disturbances affecting sexual proportions ( mank et al . , 2006 ) .
this fact could be critical as an adaptation to environmental shifts ( e.g. temperature increments ) that result in one sex proportion bias affecting population survival . in this context ,
the possibility to modify sex determination mechanisms could restore sex ratio balance according to the specific habitat condition in threatened species ( volff et al . , 2007 ) .
annual fishes ( cyprinodontiformes ; aplocheiloidei ) constitute a freshwater teleosts group with a short lifespan exposed to an extremely variable environment . they inhabit temporary ponds in south america and africa that dry out during dry season leading to juvenile and adult death .
the species survival depends on desiccation - resistant embryos that remain hidden in the bottom mud until the next rainy season when they hatch ( myers , 1952 ; wourms , 1967 , berois et al . , 2012 ) .
in particular , austrolebias charrua ( costa and cheffe , 2001 ) is an annual fish species distributed from southern brazil ( patos - mern lagoon ) to eastern uruguay ( rocha department ) .
chromosomal studies and analyses at dna level demonstrated high genetic variations ( garca , 2006 ) and the existence of ancestral polymorphisms in certain a. charrua populations ( garca et al . , 2009 ) .
aspects related to reproductive diversity are essential to understand the evolution of these mechanisms as well as management of species that are considered potential environmental pollution biomonitors ( devlin and nagahama , 2002 ) .
sex differentiation , determination of sexual strategy , and gametogenesis of this species were previously established ( arezo et al . , 2007 ) .
there is no evidence about the mechanism of sex determination and no genetic sex markers have been identified so far .
therefore , the aim of the present work is to focus on the identification of a key gene involved in a. charrua sex determination . as a first step we explored the presence of a candidate master sex - specific gene and its expression during ontogenesis .
a total of 12 males and 18 females of a. charrua were collected from the same temporal ponds ( rocha department , uruguay , gps : 33 54 09
s/53 40 38 w ) and euthanized by anesthesia ( 1 2-phenoxy - ethanol , sigma ) according to a protocol approved by the animal experimentation committee from the universidad de la repblica , chea ( comisin honoraria de experimentacin animal ; protocol code 13 - 02 - 08 ) .
genomic dna was isolated from ethanol - fixed liver tissue using sodium chloride protein precipitation , followed by ethanol precipitation ( modified from medrano et al . , 1990 ) .
the dna quality was determined in a 0.5% gelred ( biotium ) stained 1% agarose gel using 1xtae ( tris - acetate - edta ) .
amplification of a candidate sex - specific gene was performed by the polymerase chain reaction ( pcr ) with the specific primers dmtyh ( 5 tctgctgag ctccccggg 3 ) and dmtyi ( 5 gcctcgcagcttctca 3 ) , designed to isolate the male specific sex determining gene in o. latipes ( nanda et al . , 2002 ) .
the pcr was carried out in a 15 ltotal volume using 9.9 lofh2o ( amresco ) , 1.5 lof10x buffer , 0.6 l of mgcl2 ( 50 mm ) , 0.3 l of dntps ( 10 mm ) , 0.5 l of each primer ( 10 m ) , 0.2 l of taq dna polymerase ( 5 u/l ) ( invitrogen ) and 1.5 l of dna , under the following conditions : 94 c for 5 min , 35 cycles of 30 s at 94 c , 30 s at 55 c ; 1 min at 72 c , and a final extension step of 7 min at 72 c .
pcr products were visualized in 0.5% gelred ( biotium ) stained agarose gels using 1xtae ( tris - acetate - edta ) .
fragments of different length amplified in each individual were eluted with the gfx pcr dna and gel band purification kit ( ge healthcare life sciences ) and cloned with the genejet 1.2 pcr cloning kit according to manufacturer s instructions ( fermentas ) . recombinant plasmids were obtained by dna minipreparations of individual clones by alkaline lysis ( sambrook et al . , 1989 ) .
sequencing reactions were performed on each template using the primers supplied in the cloning kit ( pjet1.2 forward and pjet1.2 reverse ) in a perkin - elmer abi prism 377 automated sequencer ( macrogen , seoul , korea ) .
nucleotide sequences were compared against the national center for biotechnology information ( ncbi ) protein database using the blast program on the basic local alignment search tool ( blast ) network service ( altschul et al . ,
embryos were obtained , cultured and classified in : 1128 cells ( n = 8) , early blastula ( n = 7 ) , dispersion phase ( annual fish late blastula ) ( n = 7 ) , reaggregation ( annual fish gastrula ) ( n = 10 ) , 010 somites ( n = 8) , 1020 somites ( n = 11 ) , 2030 somites ( n = 11 ) , 3 weeks post - fertilization ( n = 8) , one month post - fertilization ( n = 10 ) and pre - hatching embryos ( n = 10 ) as described by arezo et al .
male and female juveniles ( n = 6 ) and adult fishes ( n = 6 ) were euthanized as described above .
total rna was extracted with trizol reagent ( invitrogen ) from different embryo stages ( table 1 ) .
reverse transcription was carried out using 10 ng of total rna , 1 l oligo ( dt)20 50 m ( invitrogen ) and superscript iii reverse transcriptase ( invitrogen ) . to evaluate cdna synthesis and absence of genomic dna contamination , a pcr with -actin primers from danio rerio ( barrallo et al . , 1999 )
were also performed using the cdna samples and the same pcr protocol already described except for the annealing temperature ( 58 c).the obtained products were re - amplified modifying only the annealing temperature to 59 c .
all pcr products were separated in 1% agarose gels ( 1xtae buffer ) and visualized with 0.5% gelred ( biotium ) .
fragments were eluted , cloned , sequenced and compared against the ncbi database as described above .
the obtained rna sequence was analyzed online at the rnafold webserver ( gruber et al .
default parameters at 20 c were selected . in order to resolve the phylogenetic relationships , an alignment with a. charrua isolated genomic fragments as described above and the dmrt gene family sequences retrieved from genbank ( table 2 )
was conducted using clustalw ( thompson et al . , 1997 ) implemented in mega4 ( tamura et al . , 2007 ) .
three data set were generated to develop phylogenetic analyses : a ) one including four a. charrua isolated genomic fragments ( two for male and two for female ) vs. dmrt gene family sequences from different fish groups ( table 2 ) ; b ) we also carried out an analysis to reveal relationships between the expressed a. charrua partial cdna fragment and dmrt1 mrnas retrieved from genbank ( table 3 ) ; c ) a reduced data set including four a. charrua isolated genomic fragments , the expressed a. charrua partial cdna fragment and the dsx d. melanogaster sequence .
dmrt1 and doublesex gene sequences obtained from genbank and the expressed partial cdna sequence isolated from austrolebias charrua .
we used a non - model based method ( mp , maximum - parsimony ) in paup * 4.0b10 ( swofford , 2002 ) .
an equally weighted mp analysis was performed using heuristic search ( mulpars option , stepwise addition , tree - bisection - reconnection [ tbr ] branch swapping , 100 replicates ) .
the degree of confidence assigned to nodes in the trees was assessed by bootstrapping with 500 replicates .
we also used two model - based approaches , i.e. , maximum - likelihood ( ml ) and bayesian inference ( bi ) implemented in beast v.1.5.4 ( drummond and rambaut , 2007 ) . for the ml and bayesian analyses ,
the best - fitted nucleotide substitution models for the data set were determined in modeltest v.3.7 ( posada and crandall , 1998 ) based on the akaike information criterion ( akaike , 1974 ) , which simultaneously compares multiple nested or non - nested models . for data set a ) the best fit out of the 56 models was obtained with the general time - reversible model ( gtr + g , rodriguez et al . , 1990 ) , which includes six different nucleotide substitution types and variable substitution rates among sites drawn from a gamma distribution ( g ) .
b ) the best fitted model selected was k81uf+g model ( k81+g : kimura 3-parameter plus gamma , kimura 1981 ) with a gamma distribution shape parameter of 0.6519 . in dataset c ) , hky85 ( hasegawa et al . 1985 ) resulted in the best fitted model of molecular evolution . for
data set a ) the likelihood scores estimated for the selected model gtr + g was used as the prior settings for the ml analysis ( -ln l = 32940.4721 ) . a heuristic ml search ( again with 100 replicates of stepwise addition and tbr branch swapping ) implemented in paup * 4.0b10 ( swofford , 2002 ) was used .
the robustness of the nodes was determined after 500 bootstrapping replicates as implemented in phyml 3.0 , according to the algorithm developed by guindon et al .
( 2010 ) . in this case , the nni ( a fast nearest neighbour edge interchange search ) swapping algorithm option was implemented . for data set
b ) the likelihood scores estimated for the selected model k81+g were used as the prior settings for the ml analysis ( -ln l = 15985.54790 ) .
finally , for the c ) data set the likelihood scores estimated for the selected model hky85 were used as the prior settings for the ml analysis ( -lnl=723.286 ) .
all trees were rooted by means of an outgroup criterion using more distantly related sequences in each data set .
bayesian posterior probabilities of the trees were calculated using the beast v.1.5.4 program ( drummond and rambaut , 2007 ) .
beast performs bayesian statistical inferences of parameters , such as divergence times , using mcmc as a framework .
input files were generated using beauti v.1.5.4 ( drummond and rambaut , 2007 ) , assuming uncorrelated log - normal trees and a constant population size as prior information .
this prior tree is the most suitable for trees describing the relationships between individuals in the same population / species ( drummond and rambaut , 2007 ) .
the nucleotide substitution model and its parameter values were selected based on the aforementioned modeltest v.3.7 ( posada and crandall , 1998 ) results .
trees and parameters were sampled every 1,000 iterations , with a burn - in of 10% .
results for each run were visualized using the tracer v.1.5 program ( rambaut and drummond , 2009 ) to ensure stationarity and convergence .
each analysis was repeated many times to optimize the operators of the parameters until no suggestion message appeared in the log file .
posterior probabilities and the maximum credibility tree were calculated using the treeannotator v.1.5.4 program ( drummond and rambaut , 2007 ) .
a total of 12 males and 18 females of a. charrua were collected from the same temporal ponds ( rocha department , uruguay , gps : 33 54 09
s/53 40 38 w ) and euthanized by anesthesia ( 1 2-phenoxy - ethanol , sigma ) according to a protocol approved by the animal experimentation committee from the universidad de la repblica , chea ( comisin honoraria de experimentacin animal ; protocol code 13 - 02 - 08 ) .
genomic dna was isolated from ethanol - fixed liver tissue using sodium chloride protein precipitation , followed by ethanol precipitation ( modified from medrano et al . , 1990 ) .
the dna quality was determined in a 0.5% gelred ( biotium ) stained 1% agarose gel using 1xtae ( tris - acetate - edta ) .
amplification of a candidate sex - specific gene was performed by the polymerase chain reaction ( pcr ) with the specific primers dmtyh ( 5 tctgctgag ctccccggg 3 ) and dmtyi ( 5 gcctcgcagcttctca 3 ) , designed to isolate the male specific sex determining gene in o. latipes ( nanda et al . , 2002 ) .
the pcr was carried out in a 15 ltotal volume using 9.9 lofh2o ( amresco ) , 1.5 lof10x buffer , 0.6 l of mgcl2 ( 50 mm ) , 0.3 l of dntps ( 10 mm ) , 0.5 l of each primer ( 10 m ) , 0.2 l of taq dna polymerase ( 5 u/l ) ( invitrogen ) and 1.5 l of dna , under the following conditions : 94 c for 5 min , 35 cycles of 30 s at 94 c , 30 s at 55 c ; 1 min at 72 c , and a final extension step of 7 min at 72 c .
pcr products were visualized in 0.5% gelred ( biotium ) stained agarose gels using 1xtae ( tris - acetate - edta ) .
fragments of different length amplified in each individual were eluted with the gfx pcr dna and gel band purification kit ( ge healthcare life sciences ) and cloned with the genejet 1.2 pcr cloning kit according to manufacturer s instructions ( fermentas ) . recombinant plasmids were obtained by dna minipreparations of individual clones by alkaline lysis ( sambrook et al . , 1989 ) .
sequencing reactions were performed on each template using the primers supplied in the cloning kit ( pjet1.2 forward and pjet1.2 reverse ) in a perkin - elmer abi prism 377 automated sequencer ( macrogen , seoul , korea ) .
nucleotide sequences were compared against the national center for biotechnology information ( ncbi ) protein database using the blast program on the basic local alignment search tool ( blast ) network service ( altschul et al . ,
embryos were obtained , cultured and classified in : 1128 cells ( n = 8) , early blastula ( n = 7 ) , dispersion phase ( annual fish late blastula ) ( n = 7 ) , reaggregation ( annual fish gastrula ) ( n = 10 ) , 010 somites ( n = 8) , 1020 somites ( n = 11 ) , 2030 somites ( n = 11 ) , 3 weeks post - fertilization ( n = 8) , one month post - fertilization ( n = 10 ) and pre - hatching embryos ( n = 10 ) as described by arezo et al .
male and female juveniles ( n = 6 ) and adult fishes ( n = 6 ) were euthanized as described above .
total rna was extracted with trizol reagent ( invitrogen ) from different embryo stages ( table 1 ) .
reverse transcription was carried out using 10 ng of total rna , 1 l oligo ( dt)20 50 m ( invitrogen ) and superscript iii reverse transcriptase ( invitrogen ) .
to evaluate cdna synthesis and absence of genomic dna contamination , a pcr with -actin primers from danio rerio ( barrallo et al . , 1999 )
were also performed using the cdna samples and the same pcr protocol already described except for the annealing temperature ( 58 c).the obtained products were re - amplified modifying only the annealing temperature to 59 c .
all pcr products were separated in 1% agarose gels ( 1xtae buffer ) and visualized with 0.5% gelred ( biotium ) .
fragments were eluted , cloned , sequenced and compared against the ncbi database as described above .
the obtained rna sequence was analyzed online at the rnafold webserver ( gruber et al .
in order to resolve the phylogenetic relationships , an alignment with a. charrua isolated genomic fragments as described above and the dmrt gene family sequences retrieved from genbank ( table 2 ) was conducted using clustalw ( thompson et al . , 1997 )
three data set were generated to develop phylogenetic analyses : a ) one including four a. charrua isolated genomic fragments ( two for male and two for female ) vs. dmrt gene family sequences from different fish groups ( table 2 ) ; b ) we also carried out an analysis to reveal relationships between the expressed a. charrua partial cdna fragment and dmrt1 mrnas retrieved from genbank ( table 3 ) ; c ) a reduced data set including four a. charrua isolated genomic fragments , the expressed a. charrua partial cdna fragment and the dsx d. melanogaster sequence .
dmrt1 and doublesex gene sequences obtained from genbank and the expressed partial cdna sequence isolated from austrolebias charrua .
we used a non - model based method ( mp , maximum - parsimony ) in paup * 4.0b10 ( swofford , 2002 ) . an equally weighted mp analysis was performed using heuristic search ( mulpars option , stepwise addition , tree - bisection - reconnection [ tbr ] branch swapping , 100 replicates ) .
the degree of confidence assigned to nodes in the trees was assessed by bootstrapping with 500 replicates .
we also used two model - based approaches , i.e. , maximum - likelihood ( ml ) and bayesian inference ( bi ) implemented in beast v.1.5.4 ( drummond and rambaut , 2007 ) . for the ml and bayesian analyses ,
the best - fitted nucleotide substitution models for the data set were determined in modeltest v.3.7 ( posada and crandall , 1998 ) based on the akaike information criterion ( akaike , 1974 ) , which simultaneously compares multiple nested or non - nested models . for data set a ) the best fit out of the 56 models was obtained with the general time - reversible model ( gtr + g , rodriguez et al . , 1990 ) , which includes six different nucleotide substitution types and variable substitution rates among sites drawn from a gamma distribution ( g ) .
set b ) the best fitted model selected was k81uf+g model ( k81+g : kimura 3-parameter plus gamma , kimura 1981 ) with a gamma distribution shape parameter of 0.6519 .
in dataset c ) , hky85 ( hasegawa et al . 1985 ) resulted in the best fitted model of molecular evolution . for data set a ) the likelihood scores estimated for the selected model gtr + g
was used as the prior settings for the ml analysis ( -ln l = 32940.4721 ) . a heuristic ml search ( again with 100 replicates of stepwise addition and tbr branch swapping ) implemented in paup * 4.0b10 ( swofford , 2002 ) was used .
the robustness of the nodes was determined after 500 bootstrapping replicates as implemented in phyml 3.0 , according to the algorithm developed by guindon et al .
( 2010 ) . in this case , the nni ( a fast nearest neighbour edge interchange search ) swapping algorithm option was implemented . for data set
b ) the likelihood scores estimated for the selected model k81+g were used as the prior settings for the ml analysis ( -ln l = 15985.54790 ) .
finally , for the c ) data set the likelihood scores estimated for the selected model hky85 were used as the prior settings for the ml analysis ( -lnl=723.286 ) .
all trees were rooted by means of an outgroup criterion using more distantly related sequences in each data set .
bayesian posterior probabilities of the trees were calculated using the beast v.1.5.4 program ( drummond and rambaut , 2007 ) .
beast performs bayesian statistical inferences of parameters , such as divergence times , using mcmc as a framework .
input files were generated using beauti v.1.5.4 ( drummond and rambaut , 2007 ) , assuming uncorrelated log - normal trees and a constant population size as prior information .
this prior tree is the most suitable for trees describing the relationships between individuals in the same population / species ( drummond and rambaut , 2007 ) .
the nucleotide substitution model and its parameter values were selected based on the aforementioned modeltest v.3.7 ( posada and crandall , 1998 ) results .
trees and parameters were sampled every 1,000 iterations , with a burn - in of 10% .
results for each run were visualized using the tracer v.1.5 program ( rambaut and drummond , 2009 ) to ensure stationarity and convergence .
each analysis was repeated many times to optimize the operators of the parameters until no suggestion message appeared in the log file .
posterior probabilities and the maximum credibility tree were calculated using the treeannotator v.1.5.4 program ( drummond and rambaut , 2007 ) .
the pcr amplifications employing the dmrt1by specific oligonucleotides ( nanda et al . , 2002 ) detected two fragments of 1000 and 900 bp in the a. charrua genome .
they were cloned , sequenced and named m n1a and m n1b in male , and h n2a and h n2b in female respectively ( figure 1 ) .
the alignment of these sequences and highly related ones retrieved from genbank ( table 2 ) revealed the existence of 1084 variable sites and 1054 of parsimony informative sites .
the average of the ts / tv ratio calculated from all pairwise comparisons of samples was r = 1227 indicating a low saturation level in the data set .
mr : mass ruler dna ladder ( fermentas ) , m : a. charrua male , f : a. charrua female , o.l : o. latipes male ( positive control ) , nc : negative control .
mr : mass ruler dna ladder ( fermentas ) , m : a. charrua male , f : a. charrua female , o.l : o. latipes male ( positive control ) , nc : negative control .
phylogenetic analysis based on ml and bi phylogenetic tree reconstruction ( figure 2 ) showed a topology with three main supported clades integrated by : 1 ) autosomic dmrt1 sequences from o. latipes , o. hatcheri and monopterus albus , dmrt1by from o. latipes , dmy from o. curvinotus and the isolated genomic sequences from a. charrua ( 70% bootstrap support ) ; 2 ) dmrt2 sequences from danio rerio , xiphophorus maculatus and takifugu rubripes ( 100% boostrap support ) and 3 ) dmrt3 sequences from d. rerio and t. rubripes ; dmrt4 sequences from x. maculatus and t. rubripes genes and dmrt5 sequences from o. latipes , x. maculatus , d. rerio and t. rubripes ( 63% boostrap support ) .
tetraodon nigroviridis dmrt3 and dmrt4 resulted in most divergent sequences of this data set which collapsed in a basal polytomy with the aforementioned clades .
maximum likelihood analyses [ under general time - reversible model with gamma correction ( gtr+g ) ] , based on partial genome sequences isolated from austrolebias charrua and dmrt gene family sequences retrieved from genbank ( table 2 ) .
numbers above the branches ( left to right ) correspond to the bayesian posterior probability for clades obtained using beast 1.5.4v , followed by ml and mp boostrap support ( > 60% ) respectively , recovered in 1000 replicates .
m n1a , m n1b , h n2a and h n2b : austrolebias charrua genomic fragments . the rt - pcr amplifications with the same oligo - nucleotides ( nanda et al . , 2002 ) revealed an expressed 205 bp cdna fragment in embryo stages from dispersed phase ( late blastula ) to pre - hatching embryos . later on ( juveniles and adults stages ) , the fragment was only detected in male individuals ( figure 3 ) .
this sequence showed 8% of identity ( e - value = 0.67 ) with dmrt1 by from o. latipes strain hni ( accession number ay129241.1 ) and dmy ( accession number nm001104680.1 ) .
remarkably there is an absence of a conserved dm domain in the partial cdna fragment ( 205 bp ) isolated in a. charrua male .
a)1 : mass ruler dna ladder ( fermentas ) ; embryo stages : 2:1128 cells ; 3 : early blastula ; 4 : dispersion phase ( annual fish late blastula ) ; 5 : reaggregation ( annual fish gastrula ) ; 6 : 0 to 10 somites ; 7 : 10 to20somites ; 8 : 20 to 30 somites ; 9 : 3 weeks post fertilization ; 10 : 1 month post fertilization ; 11 : pre - hatching embryo ; 12 : m : male juvenile ; 13 : f : female juvenile .
c ) rt - pcr of the same embryonic , juvenile and adult cdnas using -actin primers .
all phylogenetic analyses ( mp , ml and bi ) of the isolated partial cdna sequence with dmrt1 mrna sequences from different fish species mus musculus dmrt1 as well as d. melanogaster dsx gene were carried out ( figure 4 ) .
the major one is subdivided into four subclades embracing : 1 ) dmrt1 mrnas from some oryzias species ( o. latipes , o. luzonensis , o. curvinotus , o. mekognensis , o. marmoratus and o. celebensis ) , dmrt1by ( male specific duplication ) and alternative splicing dmrt1 variants from o. latipes and o. curvinotus ( 99% bootstrap support ) ; 2 ) dmrt1 mrnas from o. bonariensis and o. hatcheri ( 97% bootstrap support ) ; 3 ) dmrt1 mrnas from poecilia reticulata and x. maculatus ( 98% bootstrap support ) and 4 ) dsx mrna from drosophila , two alternative splicing versions of dmrt1 from o. latipes and the partial cdna sequence from a. charrua ( 84% bootstrap support ) .
the minor one is integrated by alternative splicing versions of dmrt1 from clarias gariepinus ( bootstrap support of 94% ) .
the mrna dmrt1 sequence from mus musculus is the most divergent and not well supported basal taxon which collapsed in a basal polytomy with the remaining aforementioned clades .
maximum likelihood analyses [ under k81+g model with gamma correction ) ] , based on the expressed partial sex - specific cdna sequence isolated from austrolebias charrua ( a.ch cdna ) , dmrt1/dmrt1by mrna like sequences and dsx from drosophila retrieved from genbank ( table 3 ) .
numbers above the branches ( left to right ) correspond to the bayesian posterior probability for clades obtained using beast 1.5.4v , followed by ml and mp boostrap support ( > 60% ) respectively , recovered in 1000 replicates .
all tree topology reconstruction methods revealed that the isolated partial cdna sequence is more closely related to the small fragments amplified from male ( m n1b ) and female ( h n2b ) genomes ( hpp > 96 ) and straightforward support the relationships of these sequences with the dsx d. melanogaster gene ( hpp > 97 ) ( figure 5 ) . tree topology generated using the hky85 model of molecular evolution based on male ( m n1a and mn1b ) and female ( h n2a and h n2b ) genomes , on the expressed partial sex - specific cdna sequence isolated from austrolebias charrua ( a.ch cdna ) and the dsx _
numbers above the branches ( left to right ) correspond to the bayesian posterior probability for clades obtained using beast 1.5.4v , followed by ml and mp boostrap support ( > 60% ) respectively , recovered in 1000 replicates .
two fragments ( m n1a and m n1b ) were isolated from the a. charrua male genome . this pattern was similar to o. latipes male where a fragment of 1289 nucleotides corresponds to the dmrt1 gene and other of 965 nucleotides to the male specific duplicated gene version , dmrt1by ( nanda et al . , 2002 ) .
it is worthy of notice that the same pattern was also found in the a. charrua female genome .
nucleotide sequence comparison of the larger fragments , m n1a and h n2a ( 1000 bp ) , showed 42% similarity while the smaller fragments ( 900 bp ) , m n1b and h n2b are 99% similar .
thus , the smaller fragment is present in both sexes of the a. charrua genomes . in fish ,
five classes of dmrt genes have been described : dmrt 1 , 2 , 3 , 4 and 5 ( huang et al . , 2002 ) .
a moderate similarity was detected among the a. charrua genomic fragments and the dmrt1 sequences .
therefore these results suggest a non conclusive relationship between the isolated fragments and the dmrt1 from different fish groups .
the absence of a conserved dm domain in the partial cdna fragment ( 205 bp ) isolated in a. charrua males could be explained by restricted sequence information .
the fragment length covers about the 11% of complete dmrt1by and dmrt1 mrnas reported in the genbank .
another possibility could be that the dm domain is not present in the a. charrua fragment , as was shown for the dmrt1c isoform from c. gariepinus and c. batrachus ( raghuveer and senthilkumaran , 2009 ) and for the dmrt1 gonadal isoform from mouse ( lu et al .
phylogenetic relationships among dm domain containing genes are not obvious in vertebrates , as different taxa show little sequence conservation outside this domain ( volff et al . , 2003 ) .
phylogenetic analyses grouped the a. charrua expressed cdna fragment with dmrt1 alternative splicing versions c and d from o. latipes ( beloniformes ) instead of dmrt1 sequences from more closely related species of cyprinodontiformes ( k. marmoratus , x. maculatus and p. reticulata ) .
evolution of homoplastic characters results from adaptations of different lineages in response to selective pressures in similar environments ( futuyma , 2005 ; wake et al . , 2011 ) .
beloniformes and cyprinodontiformes are considered sister groups , while atheriniformes occupies a basal position ( parenti , 2005 ; nelson , 2006 ; setiamarga et al . ,
thus , this discordance may be explained by ancestral polymorphism maintenance , as in the topology the a. charrua fragment grouped with o. latipes dmrt1 c and d alternative splicing versions and drosophila dsx .
discordance between dmrt1 sequence relationships was also evidenced in phylogenetic analyses performed with dmrt1 from o. bonariensis ( atheriniformes ) and other fish species ( fernandino et al . , 2006 ) .
although homology relationships among members of the dmrt family have not been clearly established in metazoans , it is interesting to consider that the dmrt1 gene is the closest related member in terms of structure and function to drosophila dsx and caenorhadbitis elegans mab-3 ( herpin and schartl , 2011 ) . in this sense , all phylogenetic analyses in the present work straightforward grouped drosophila dsx with a. charrua expressed cdna partial fragment and amplified sequences from male ( m n1b ) and female ( h n2b ) genomes showing high posterior probability of occurrence for such clade .
the expression pattern of cdna partial sequence during the ontogeny of the studied species showed that this sequence is detected from dispersed phase ( late blastula ) .
this suggests that its expression depends on the zygotic genome activation ( mid - blastula transition ) .
since no sex specific molecular markers are available to genotype the sex of the embryos , another possibility is that all the embryos analyzed at early stages ( 1 to 128 cells and early blastulas ) were 100% females . in 1 to 128 cell embryos
this probability is , however , only 0.004% and in early blastula stage it is 0.008% .
the probability of simultaneous occurrence of two or more independent events is calculated as the product of probabilities of each independent event ( canavos , 1988 ) .
we assumed the probability for a given embryo to be male or female to be 0.5 .
for this reason , we consider that the absence of fragment amplification in these developmental stages indicates that it is not maternally supplied and that its expression depends on zygotic genome activation .
oryzias latipes dmrt1by begins its expression during the neurula stage ( 1 day post fertilization ) , while dmrt1a starts its expression during testis differentiation ( about 20 days post hatching ) ( iwamatsu , 2004 ; nanda et al .
in a. charrua cdna partial fragment expression was detected in an even earlier developmental stage than dmrt1by .
for instance , dmrt1 gene expression is identified later in ontogeny when a gonadal primordium is present ( mouse , raymond et al . , 1999 ; turtles , kettlewell et al . ,
in most fish species analyzed , dmrt1 gene expression was reported in post hatching stages ( c. gariepinus ,
raghuveer et al . , 2011 ; oreochromis niloticus , ijiri et al . , 2008 ;
, 2007 ; gobiocypris rarus ,
zhang et al . , 2008 ; epinephelus coloides ,
he et al . , 2003 ; m. albus ,
huang et al . , 2005 ; o. bonariensis ,
strssman et al . , 1996 ; t. rubripes ,
yamaguchi et al . , 2006 ; squalius alburnoides ,
pala et al . , 2009 , oncorhynchus mykiss
marchand et al .
therefore , the finding that this cdna partial sequence is expressed very early during a. charrua development and its closely phylogenetic relationships with the dsx_d .
melanogaster gene , could be indicative that this sequence could play an essential role during the sex determination process and might be located near the top of the sex determination cascade in this species
. taken together , these results suggest that both isolated a. charrua genomic sequences and the expressed cdna partial sequence are more closely related to dsx from d. melanogaster than the two alternative splicing dmrt1sequences from o.latipes .
the observed male - specific expression pattern supports the hypothesis that this sequence probably belongs to an alternative splicing dmrt1 gene version in a. charrua , as this gene is present in both sexes and represents the most conserved downstream gene member implicated in male sex development during vertebrate evolution . nevertheless , it is also possible that the isolated cdna sequence belongs to a class of abundant non - coding rnas with potential regulatory function .
regulatory rnas from 100 to 100,000 nucleotides are referred to as long non - coding rnas ( lncrnas ) because they have typical structures .
it has furthermore been documented that splicing isoforms encode a protein , whereas other specific splicing isoforms encode regulatory lncrnas that show tissue specificity and dynamic expression during development ( amaral et al . , 2008 , 2011 ) .
the results obtained with rnafold analysis ( gruber et al . , 2008 ; lorenz et al
. , 2011 ) evidenced that the 205 bp cdna sequence is capable of generating a stable secondary structure ( 84.39 kcal / mol at 20 c ) ( figure 6 ) .
this predicted secondary structure could be formed by lncrnas , as mrnas are usually not structured .
nevertheless , it is essential to obtain more sequence information ( e.g. stage - specific transcriptomes ) to elucidate a. charrua expressed cdna sequence identity . to further evaluate
if this rna is effectively translated ( characterization of expression pattern in temporal and spatial scales ) the generation of specific antibodies would be necessary .
c ) mountain plot of minimum free energy structure , the thermodynamic ensemble of rna , centroid structures and entropy for each position . for sex determination studies in a given species
( 2003 ) which emphasizes the presence of sex chromosomes as strong evidence for genetic sex determination ( gsd ) .
sex chromosomes were , however , not identified in a. charrua ( garca , 2006 ) , in agreement with data obtained from most studied teleosts .
cytogenetically differentiated sex chromosomes are sporadic in different fish taxa , suggesting a recent and polyphyletic origin of sex chromosomes in this vertebrate group ( mank et al . , 2006 ) .
fish sex chromosomes are difficult to evidence by classic cytogenetic techniques due to their putative recent origin ( homomorphic chromosomes ) .
ultrastructural analyses of synaptonemic complexes could reveal tiny unpaired regions allowing sex chromosome pair recognition in the heterogametic sex ( devlin and nagahama , 2002 ) .
this approach made it possible to identify sex chromosomes in o. niloticus ( carrasco et al .
for this reason we can not discard the presence of homomorphic sex chromosomes in a. charrua . even in the absence of sex chromosomes , gsd may be demonstrated by the construction of a microsatellite - based linkage map to define genome regions involved in sex determination .
this approach allowed the identification of the male sex determining non - recombinant region in the african annual fish nothobranchius furzeri ( valenzano et al . , 2009 ) , similar to those identified in other phylogenetically related fish species as o. latipes ( matsuda et al .
, 2002 ; nanda et al . , 2002 ) , gasterosteus aculeatus ( peichel et al . , 2004 ) , x. maculatus ( schultheis et al . , 2009 ) and p. reticulata ( tripathi et al . , 2009 ) . | evolution of sex determination and differentiation in fishes involves a broad range of sex strategies ( hermaphroditism , gonochorism , unisexuality , environmental and genetic sex determination ) .
annual fishes inhabit temporary ponds that dry out during the dry season when adults die .
the embryos exhibit an atypical developmental pattern and remain buried in the bottom mud until the next rainy season .
to elucidate genomic factors involved in the sex determination in annual fish , we explored the presence of a candidate sex - specific gene related to the cascade network in austrolebias charrua .
all phylogenetic analyses showed a high posterior probability of occurrence for a clade integrated by nuclear sequences ( aprox .
900 bp ) from both adults ( male and female ) , with partial cdna fragments of a. charrua from juveniles ( male ) and the dsx d. melanogaster gene .
the expressed fragment was detected from blastula to adulthood stages showing a sexually dimorphic expression pattern .
the isolated cdna sequence is clearly related to dsx d. melanogaster gene and might be located near the top of the sex determination cascade in this species . |
zinc is a research tool for investigators
seeking chemical matter for their biological targets .
it incorporates
purchasable compounds from over one hundred vendors and annotated
compounds from over twenty databases . since it first appeared eight
years ago
, zinc has grown over 10-fold
in size , the quality of its 3d molecular representations have been
improved , and new features have been added to its interface . whereas
it retains its original focus on biologically relevant forms for molecular
docking , zinc now supports other chemoinformatic techniques . to be useful for research , a database for
ligand discovery should
be big , the compounds purchasable , the molecules relevant , and in
biologically applicable forms , i.e. representations that actually
bind to proteins .
it should be available in useful subsets , easy to
search and download , and ready to use without additional processing .
to maximize its coverage of chemical space ,
hypothesis
testing of computationally predicted ligands for proteins is fastest
if the compounds are purchasable , and thus current information about
expected delivery is crucial .
the user should have some say in how
long he is willing to wait for delivery . to minimize screening artifacts ,
it is common practice to filter out compounds containing problematic
functional groups , but reasonable people disagree about exactly which
rules should be applied .
ideally , the user should have some choice
about whether to be strict or permissive about including molecules
that are only sometimes problematic . using the relevant protonated
and tautomeric molecular form for molecular docking is important ,
as exemplified by recent studies .
a suitable database should
include all relevant protonated and tautomeric forms and as few irrelevant
ones as possible .
some forms such as deprotonated sulfonamides , thiols ,
and aromatic alcohols are only relevant at high ph , for instance in
the binding site of a zinc metalloenzyme .
on the other hand , some
protein sites bind protonated anilines , but these same forms would be irrelevant decoys for most binding
sites
current opinion favors general purpose screening
libraries that are filtered by physicochemical properties , particularly
for molecules that have low complexity .
two are particularly popular : lead - like for assays and techniques where binding is not
observed directly and requires higher affinities and therefore more
mass ; and fragment - like , for techniques such as xray crystallography , nuclear magnetic resonance ,
and surface plasmon resonance where high concentrations and weak affinities
can be detected . for compatibility with historical studies in the
field and to be generally useful , the library should also be available
as a drug - like subset .
the database should allow known compounds to be looked up by the
target they bind .
experimentally known compounds can be used as experimental
controls , chemical probes , as starting points for hit - to - lead optimization
or to calibrate docking calculations . whereas compound bioactivity
data are available in the literature , actually assembling sets of
purchasable bioactives has remained labor intensive .
database searching
should be fast and easy for nonexperts while offering flexibility
and power for experts
. it should be possible to also search by molecular
similarity , substructure , physical properties , delivery time , and
even name and cas number .
libraries of purchasable natural products ,
metabolites , drugs and experimental compounds would be useful for
research , because it would allow known bioactives to be docked and
then acquired for testing . for instance
, docking metabolites can be
used for protein function prediction , and docking drugs might be useful for predicting off - target effects
or repurposing .
zinc has a unique focus , but inevitably overlaps
to some extent with other databases .
chembl , pubchem , drugbank , bindingdb , and tcm@taiwan , for instance , all contain biological activity
data but lack zinc s focus on docking and purchasability .
chemspider
( www.chemspider.com ) combines both biological activity
data and purchasing information but does not have zinc s focus
on biologically relevant representation for docking , or its organization
into discovery - oriented subsets .
procurement agents and compound vendors
offer purchasability and , increasingly , e - commerce sites and downloadable
screening libraries , including target - focused libraries for compounds
in their collection , but they do not share zinc s focus on
relevant 3d forms and subsets for docking . in an effort to improve
ligand discovery and virtual screening , we describe here an improved
public resource of purchasable molecules that are relevant for medicinal
chemistry and chemical biology . the salient criteria for zinc are
as follows .
the database
should contain biologically relevant molecules represented in biologically
relevant protonated and tautomeric forms and be organized into subsets
that are ready for screening .
the database should be quick to search
and download , and it should be straightforward to obtain regular updates .
in many cases , it should be possible to simply look up the biological
activities of molecules , or to look up compounds that are active against
a particular target .
zinc was loaded from 134
commercial supplier catalogs and 36 annotated catalogs ( table 1 ) .
if a salt , the largest organic component is taken ,
and molecules containing an atom other than h , c , n , o , f , s , p , si , cl ,
br , or i are removed , a limitation due to our use of the merck forcefield
mmff94 .
filtering rules are implemented in openeye s oechem and are listed in text and graphical form at filtering.docking.org ( see the supporting information ) .
additional detailed information
is provided in the supporting information and online at zinc.docking.org / catalogs/. nb numbers are approximate because zinc
contents change frequently .
catalogs are obtained
as 2d sdf files and converted to isomeric smiles using openeye s
oechem software .
a trial 3d
structure is first generated using molecular networks corina
program to generate a single canonical
conformation with the best ring puckering if applicable ( arguments
are -d neu , wh , rc , mc = 1 , canon ) .
molecules are generated in four
ph ranges using schrodinger s epik version 2.1209 as follows . at ph of 7.05 ,
-ph 7.05 -ms 1 .
for the range ph of 68 ( i.e. , 7 1 ) ,
additional protonated
and tautomeric forms are generated such that they have a relative
population of at least 20% within that ph range using the arguments :
ph 7.0 -pht 1.0 -tp 0.20 .
similarly for high ph of
79.5 ( i.e. , 8.75 0.75 ) and low ph of 4.56 ( i.e. ,
5.25 0.75 ) , the arguments are
-ph 8.75 -pht 0.75 -tp
0.20 and -ph 5.25 -pht 0.75 -tp 0.20 respectively .
for flexibase files used by dock 3.6
, conformations
are calculated using openeye s omega library with the following settings : warts(true ) , fromct(false ) ,
fixmaxmatch(1 ) , enumnitrogen(false ) , enumring(false ) , energywindow(12.5 ) ,
maxconfgen(100000 ) , maxconfs(600 ) , rmsthreshold(0.80 ) .
atomic charges
and desolvation are calculated using amsolusing a protocol we have reported previously .
the zinc processing pipeline continues to evolve and is
described online in more detail at http://wiki.bkslab.org/index.php/zpp .
we use molinspiration s
mib software ( www.molinspiration.com ) to calculate logp ,
polar surface area ( psa ) , molecular weight , number of hydrogen - bond
donors and acceptors , and number of rotatable bonds .
we use amsol to calculate polar and apolar desolvation energies , using the protocol
of wei .
the zinc user interface
has been completely rewritten in php and javascript / ajax .
this flexible
architecture allows for easy implementation of new chemical tools ,
which will further facilitate development of zinc .
this software ,
zinc12gui , is available for free from our web site and will be published
separately .
then , we use the subset 1.0
algorithm to progressively select compounds
that differ from those previously selected by at least the tanimoto
cutoff , using chemaxon ( budapest , hungary ) axonpath fingerprints in
jchem .
first , each representative differs from all the others by at least
the tanitmoto cutoff .
second , all the molecules in the subset are
within the tanimoto cutoff of at least one representative . thus the
representatives can be said to cover the chemical space of the subset
at a given tanimoto level .
we took all natural products
known to us via public sources and fragmented them with mib ( www.molinspiration.com ) using the r1 flag .
we then compared
them to zinc , accepting all molecules that had a tanimoto coefficient
of 80% or higher to at least one natural product or its fragments
using chemaxon axonpath fingerprints in jchembase ( budapest , hungary ) .
we wanted to combine
annotations for highly related species ( e.g. , drd2_rat , drd2_mouse ,
drd2_human ) and also to recognize that annotated ligands can be from
very different chemical series . to do this
, we first used the organism_class table in chembl12 to group annotations of
10um or better into six organism classes : archaea , bacteria , eukaryotes ,
fungi , viruses , and other ( unclassified ) . for each annotation with
a swissprot code
swissprot codes for which we could not find a uniprot
code were left unchanged .
for instance , drd1_human and drd1_rat were
grouped into a single annotation drd1-e
, e for eukaryotic
whereas dyr_human and dyr_ecoli were in two different groupings , dyr - e
and dyr - b , respectively . for each grouped annotation
, we used single
level sphere exclusion clustering ( sphex ) with a minimum separation
between cluster centroids of 0.85 as implemented in the jklustor program
version 5.8.2 ( chemaxon , budapest , hungary ) .
this resulted in typically
one to three clusters for most grouped targets ; a few targets required
as many as ten clusters because of the chemical diversity among the
ligands .
a new version of zinc that is substantially
enlarged and improved since the previous paper is now available . the number of catalogs of purchasable compounds
has grown from 9 to over 150 ( table 1 ) .
each
molecule is now represented in multiple biologically relevant 3d forms
organized into four ph ranges to better model the appropriate molecular
species .
the database is organized into subsets that better reflect
current opinion in the field .
the molecules in each subset have physical
properties suitable for drug - discovery ( figure 1 ) .
there are now more subset choices : by properties , by delivery
time , and by whether potentially reactive groups are present .
filtering
by functional group ( clean subsets ) or delivery time
( now subsets ) results in subsets that , while smaller ,
retain similar property distributions ( figure 2 ) .
twenty catalogs of compounds annotated for biological activity
such as chembl have been added , and new
special subsets of natural products , metabolites , drugs , and building
blocks have been created , enabling new research . the user interface
and the software behind zinc have been completely rewritten to enable
new queries , such as searches by biological target and delivery time .
an authentication and shopping cart system allow the user to organize
research in progress .
zinc aims to follow the 90/90 rule : 90%
of the molecules in zinc are verified as being for sale within 90
days .
we begin with new and improved features , followed by examples
of how zinc may be used for research .
color scheme : lead - like ( blue ) ; fragment - like ( red ) ; drug - like
( green ) , all - purchasable ( purple ) , everything ( cyan ) .
nine properties :
( a ) molecular weight ( daltons ) ; ( b ) calculated logp ; ( c ) heavy atom
count ; ( d ) rotatable bonds ; ( e ) polar surface area ( a ) ;
( f ) hydrogen - bond donors ; ( g ) hydrogen - bond acceptors ; ( h ) polar desolvation
energy ( kcal / mol ) ; ( i ) apolar desolvation energy ( kcal / mol ) . physical properties of lead - like subsets . color scheme :
lead - like ( blue ) ; clean - leads , containing only benign chemical functionality
( red ) ; leads - now , in stock for two week delivery ( green ) .
nine properties :
( a ) molecular weight ( daltons ) ; ( b ) calculated logp ; ( c ) heavy atom
count ; ( d ) rotatable bonds ; ( e ) polar surface area ( a ) ;
( f ) hydrogen - bond donors ; ( g ) hydrogen - bond acceptors ; ( h ) polar desolvation
energy ( kcal / mol ) ; ( i ) apolar desolvation energy ( kcal / mol ) .
purchasability is critical to rapid
hypothesis testing and thus is a central focus of zinc . in the previous
version , there was only one kind of catalog : purchasable screening
compounds .
now , there are eight catalog types corresponding to variation
in cost , delivery time , and quantity for sale , allowing subsets and
search results to better match user requirements . building
blocks are available in gram quantities for synthesis and
are often also available in milligram quantities for screening .
screening compounds are available in milligram quantities
at an average price of up to $ 100 per sample .
procurement
agents incorporate many examples of these two catalog types
and can simplify the logistics of compound acquisition .
these three
classes are all treated as in stock for delivery within two weeks ,
with a purchase success rate , in our experience around 85% .
make - on - demand catalogs of both building blocks and screening
compounds have delivery times of 610 weeks and in our experience
a 65% purchase success rate or better .
collabocules , a portmanteau of collaborate
and molecules , denotes molecules that are not for sale but may be
available via collaboration , such as brazilian natural products or
compounds made by investigators in the enzyme function initiative.annotated catalogs are databases ,
not vendors , in which many compounds have a biological measurement
or annotation , often available via a url .
boutique catalogs contain compounds that do not fit into any of these categories ,
often because they are building blocks that are not sold in small
pack sizes and therefore are thought to be too expensive for screening .
we assess vendors by their responsiveness and ability to supply compounds
in a timely fashion to our own requests and requests of our colleagues .
unresponsive vendors are rare , but when we have evidence they are
removed from zinc .
filtering out compounds
with potentially problematic functional groups is common practice , but reasonable people disagree about exactly which rules should
be applied . in the previous version ,
a single set of filtering rules
prevented the most reactive compounds such as triflates , alkyl halides ,
and percholorates from being loaded .
but what about compounds with more nuanced
reactivity , such as michael acceptors , aldehydes , and thiols ?
our
approach is to load these compounds , and then flag them as not having
benign functionality .
now zinc users have a choice : standard subsets , which exclude the most reactive and problematic compounds ,
and clean subsets , which contain only molecules having
benign functional groups ( table 2 ) .
we ourselves
often choose a standard subset , because they contain a broader diversity
of chemistry and nonbenign compounds are not necessarily a problem .
for instance , in a recent experimental screen of 70 000 compounds
against ampc beta lactamase , none of the nonbenign compounds were
hits .
in a recent study against dopamine
d3 , several hits were classified nonbenign and would have thus been
missed if the clean subset had been screened .
standard subsets are the biggest and have the most chemical diversity with
010 week delivery times .
clean subsets have
only molecules with benign functionality ; all molecules with potentially
problematic functionality such as thiols , aldehydes , and michael acceptors
have been removed .
now subsets are in stock only
for rapid 2 week delivery times ( see figure 2 ) .
recent studies continue to demonstrate the importance of using the
relevant protonated and tautomeric molecular form for docking . in the previous version , we calculated
the most relevant forms for docking without regard to ph . as a consequence ,
deprotonated sulfonamides and thiols necessary for docking to metalloenzymes
were also included in the docking library when no metal was present .
in this context , they were , at best , biologically irrelevant distractions
and , at worst , decoys that could be the cause of much wasted effort .
now , molecular representations are enumerated and classified into
four ph ranges ( see methods ) allowing ph - dependent
subsets of zinc .
most proteins are screened near physiological ph ,
requiring representations between ph 6 and 8 .
some metalloenzymes
require higher ph representations , between 8 and 9.5 , where most thiols
and sulfonamides and some aromatic alcohols can deprotonate . at the
other end of physiological ph ,
targets such as the w191 g mutant of
cytochrome c peroxidase binds protonated aniline , requiring that representations
between ph 4.5 and 6 be included in a docking screen ( figure 3 ) .
every zinc subset is
now available in ph dependent subsets , and every search result and
shopping cart may be downloaded in representations filtered by ph
range using the representation selector in the results control bar ( figures 4 and 5 ) .
( a ) protonation of histidine , ( b ) tautomerization of
folate , ( c ) deprotontation of sulfonamide for metals , and ( d ) protonation
of aniline at low ph .
the drawing panel is to
the left , and the smiles field displays and allows editing of the
smiles of the current molecule .
the similarity
level selector may be used to select the tanimoto cutoff
to be used , or substructure .
it contains page size specification , format selector , representations selector , purchasability selector , and a run query button . to the right
is shown the property selection control bar ,
including the preset selector ( top right ) allowing
easy selection of popular choices .
molecules may be added to the active cart by clicking on them , making
them blue .
hovering the mouse over a molecule reveals a popup with
additional detail about purchasability , physical properties , and other
similar molecules .
the report control bar allows additional report
formats and changes to purchasability and ph .
it contains page number ,
next page button , page size specification , format selector , representations
selector , purchasability selector , add all to add
all molecules to the active cart , and refresh to
apply any changes that are made .
annotated compounds can be
important controls for docking calculations and thus have an important
role to play in zinc .
these include catalogs of metabolites such the
human metabolome database and metacyc , natural products such as tcm@taiwan , approved drugs and clinical compounds such as drugbank and drugstore as
well as actives from the medicinal chemistry literature such as chembl , bindingdb , and
pubchem . for each annotated catalog ,
zinc offers both the full library and a subset containing only those
that may be purchased , which we call purchasable bioactive
compounds ( pbcs ) .
pbcs are of particular interest because
they are both biologically active and commercially available and thus
may be immediately useful as controls , probes , or chemical starting
points for optimization .
the prior interface to zinc
had numerous weaknesses : slow , unreliable queries , and a single inflexible
result format , for instance .
some basic queries were either arcane
or impossible to formulate , and some functions were simply unreliable .
to address these problems and enable new research ,
the new modular interface makes interesting questions
easy to construct for both beginners and experts ( figure 4 ) .
queries may be composed using the search menu , the quick search bar , or by composing a url
directly ( see the supporting information ) .
results may be formatted in over ten ways to suit a range of needs
and tastes .
small subsets of up to 5000 molecules
by biological target , combinations of searches , or arbitrary criteria
may be created , edited , shared , prioritized , and downloaded quickly
and easily .
the user s compounds may be uploaded and processed
using the standard zinc molecule processing pipeline , even for compounds
that are not already in zinc , provided they pass the basic zinc filters
( see methods ) .
new
tools to simplify compound acquisition are available . a growing number
of vendors now support direct transfer of the zinc shopping cart to
their e - commerce sites . in all , seven new and four improved search
types are available , which we now take up in turn . in the first version ,
now , zinc
uses chemaxon s jchembase for similarity and substructure search .
as a result , users can now expect to search twenty seven million molecules
in a few seconds in most cases .
the software that translates what
is entered on the web page into an executable query , runs it , and
presents the results has been completely redesigned .
to support
more users and more devices , we now use the webme drawing tool , a
java - free ajax technology that runs in all browsers and on all devices
we have tried .
smiles are now presented in a text window as the structure
is drawn , and both the smiles and its depiction are alternately editable .
multiple smiles may be searched at once , each at its own similarity
level .
each smiles may be viewed and edited separately , and up to
one hundred smiles may be pasted from the clipboard and searched in
a single transaction . in the prior
version
now , the physical property range specification tool allows maximum
and minimum values to be specified either by typing or by sliding
graphical controls .
presets such as lead - like , fragment - like , and drug - like simplify the
most popular choices . in the original version
now , each search
type has its own page , and a combination page allows
complex queries when required . in the previous version , it was not
possible to search zinc by just typing text .
now , a quick search bar
enables many queries with google - like simplicity . in the prior version ,
zinc did not keep track of cas numbers and drug names . in this version
names , synonyms and cas numbers as supplied by vendors and annotated
catalogs have been loaded and may be searched using the quick search
bar .
text search can also search by target , by catalog , by original
catalog code , by smiles , and by zinc i d .
wildcards ( see the supporting information ) . in the prior version ,
only one catalog could be specified per search .
the new version contains
a catalog selection tool , allowing fine control over
which catalogs will be searched .
catalogs may be selected individually
or the purchasability may be specified by catalog purchasability type .
the vendor page also allows searching by original catalog code , providing
a list of partial matches on the fly using ajax .
up to 100 catalog codes may be uploaded by pasting from
the clipboard and searched in a single transaction . in the prior version , there was
no biological activity data in zinc . now using chembl ,
compounds annotated
for biological activity may be searched using the target name or uniprot
or swissprot code .
three chembl annotation types are supported : binding
affinity , functional assay , and adme / t assay data . only compounds
reported active at 10um or better are incorporated in zinc .
in addition
to original chembl organism - specific annotations labeled by uniprot
codes , we have grouped annotations by chembl organism class and clustered
them by chemotype to provide a complementary way to organize compound
annotations ( see methods ) . in the prior version there
was a single report format , listing all the information in zinc for
each molecule , in rows .
now zinc offers many report formats with
several customization options to support many needs .
report formatting
and filtering may be selected using the report control bar ( figure 4 ) .
the format selector offers six on - screen reports , seven downloadable reports , and five
links to third party applications such as chimera ( ucsf ) , pymol ( schrodinger , inc . ) , and instant jchem ( chemaxon ,
budapest , hungary ) . the representations selector allows
the ph range to be specified .
the purchasability selector is used to choose which catalog types to include and thus the purchasability
of the compounds .
the report control bar is available in search results
reports , on the search page , and in the shopping carts .
now , all queries available
via the graphical user interface may also be scripted .
a comprehensive
query construction syntax is supported that covers all aspects of
selection , filtering , and formatting . as a result , other databases
may now link to zinc directly using queries by target , molecule , name ,
properties , and other criteria ( see the supporting
information ) .
the query details tab on the results page includes embeddable javascript , a reusable
url and zinc command language for each query . in the previous
version
, there was no way to combine the results of several searches ,
or to retain results for future use . in the current version ,
a shopping
cart allows the user to collect molecules from multiple searches ,
review them , and share them with colleagues .
compounds in a shopping
cart may be prioritized by opinion using collaborative tools and an
academic grading scheme of a+ through c. the shopping cart
can generate a purchasability report ranking vendors in descending
order of the number of molecules in the cart they sell .
the contents
of the cart for each vendor can be sent to that vendor by e - mail ,
or directly to the vendor s e - commerce site , if supported .
users who request a free login and authenticate can access additional
features , such as multiple and persistent shopping carts and collaborative
tools for prioritizing compounds .
a new feature allows authenticated
zinc users to create physically matched decoys for the contents of
a shopping cart .
for each ligand , 33 compounds with similar physical
properties ( molecular weight , logp , charge , h - bond donors , h - bond
acceptors ) but chemically distinct are selected from zinc .
the shopping
cart is currently limited to 1500 compounds , and therefore , a maximum
of 45 actives are currently used for finding decoys ( 45 33
= 1485 ) . in the previous
version , a facility was available to upload molecules to the zinc
web site to prepare molecules for docking using the zinc processing
pipeline , regardless of whether the molecules were already in zinc .
in the new version , the upload facility has been updated and incorporated
into the shopping cart facility and is only available to authenticated
users .
having described the new and improved features of zinc ,
we now turn to examples of how zinc can be used to discover chemical
reagents for biology .
the first five focus on acquisition of libraries
for docking screens or chemical informatics research .
three address
topics that were not easy before zinc but are now straightforward .
we conclude with some not - so - simple questions that can now be answered
easily using zinc .
the original design goal of zinc was to be a source of general
purpose screening libraries for docking . among these ,
lead - like and
fragment - like most closely reflect current thinking in the field .
clean subsets sacrifice chemical diversity for the expectation
of fewer screening artifacts due to reactivity by filtering out even
marginally reactive compounds .
now subsets trade rapid sourcing from
vendor stock for decreased coverage of chemical space ( table 2 ) .
we also offer ready - to - download - and - dock versions
of every catalog in zinc . for annotated catalogs , there are two forms :
the full catalog , and a subset of those that can be purchased , termed purchasable bioactive compounds ( pbcs ) .
unique to zinc ,
we also offer special subsets of purchasable bioactive compounds drawn
from many catalogs : drugs , metabolites , natural products , and natural
product - like compounds ( see methods ) .
problem : the user wishes to discover
ligands with new chemistry for a protein target using docking and ,
thus , requires a library of purchasable lead - like compounds .
( a ) from the subsets menu in zinc , choose properties ( figure 4 ) .
( b ) from among
the kinds of subsets on the horizontal axis , choose lead - like .
( c )
from among the types of subsets on the vertical axis , choose standard .
( d ) click on the word lead - like in the top left corner
of the table to go to the lead - like subset detail page .
( e ) to download
the subset in sdf format on a unix or mac computer in the usual physiologically
relevant forms , click on the sdf link next to unix download under quick links at the
bottom of the subset detail page .
( f ) for finer control ,
click on the downloads tab just below the main menu ,
where fine control over ph - dependent subsets is available . variations .
( i ) the user may also
download the database in mol2 , flexibase , or smiles formats .
( ii )
the user may also select clean subsets when the tolerance for screening
artifacts is very low or now subsets when compounds are needed immediately .
( iii ) the user may also select fragment - like , drug - like , all purchasable ,
and everything subsets .
target - focused
subsets using data from chembl can be useful in silico , to test whether
a docking model can recapitulate known actives , and in vitro as commercially
available experimental controls .
zinc provides target - focused purchasable
docking libraries for over 2400 protein targets , 700 functional assays ,
and 140 adme / t assays , all active at 10 m or better , as per
chembl .
for instance , if the
user is docking against a homology model of schistosoma
mansoni hmg coa reductase , he might wish to investigate
how well approved drugs for the human form ( statins ) dock to the model . approach .
( b ) in the text field under chembl / swissprot ,
type hmg .
a popup menu appears after a second or
two allowing the user to select hmdh_human , the first
choice .
( c ) the user clicks on run query , and in
a few seconds , approximately 50 compounds appear as tiles .
( d ) the
user downloads these in the usual biologically relevant forms in mol2
format by selecting mol2 from the format selector
in the results control bar and then clicking on refresh
( i ) the user
may also choose to download in sdf or smiles format .
( ii ) the user
may request only a single form at ph 7 by selecting single in the representations selector and clicking on refresh .
( iii ) the user may specify all compounds , not just
the purchasable ones , by choosing everything from the purchasability
selector and clicking on refresh .
( iv ) the
user may type the word all into the page size field
or click the all button to specify that all available compounds should
be downloaded .
( v ) a complete listing of all available purchasable
annotated libraries using chembl annotations is available by choosing
targets from the subsets menu . ( vi )
annotations that have been clustered
by organism type ( archaea , eukaryotes , bacteria , fungi , viruses , and
other ) as per chembl organism class and uniprot prefixes are also
available by using the selector under clustered target instead of chembl / swissprot .
the
user might want to explore around an initial hit by testing analogs .
analogs may also be used to expand a set of known actives from chembl
to include possible actives for docking or testing . in cases where
no chembl actives are for sale for an annotation , searching for purchasable
analogs may yield commercially accessible controls or probes .
there
are two ways to look for analogs : overall similarity illustrated here
and substructure , illustrated in example 4 below .
for instance ,
in a phenotypic screen , the drug cetirizine was a hit .
the user thus
wants to dock and purchase analogs of cetirizine , an h1 receptor antagonist ,
to investigate structure activity relationships .
( b ) to see full details
about the compound on the right , click on its zinc i d number , 19364230 ,
in the top left corner of the tile to display its molecule
detail page .
( c ) to find close analogs , click on the 80%
link under the word analogs , on the right side of
the page . at time of writing , 26 purchasable compounds , including
stereoisomers , are available .
( e ) add them all to the shopping cart by clicking on add all in the top right corner of the page .
( f ) switch
to the shopping cart by clicking on active cart in
the top right corner of the page .
( g ) click on purchasability
report for an analysis of how to buy them . as of the time
of writing , toronto research chemicals ( trc ) sold more of these compounds
than any other vendor .
( h ) to enquire about price and availability ,
click on email quote request .
if the user is logged
in , the e - mail may be sent directly .
if anonymous , the text may be
cut and pasted to an e - mail client . variations .
( i ) to find more analogs , select a more permissive similarity
level , e.g. 70% .
( ii ) instead of using add all , put
compounds in the cart individually by clicking on them .
( iii ) authentication allows
persistent carts and other features not available to anonymous users . problem .
for instance , the user has read that
molecules containing quinuclidine ( smiles : c1cn2ccc1cc2 ) are often
active against muscarinic targets . to investigate this
, the user wishes
to download a library of fragment - like compounds containing this functional
group for docking .
( b ) clear any previous search by clicking on
the blank sheet icon to the right of the smiling face
in the webme drawing tool .
( c ) in the text field above the drawing
panel , enter c1cn2ccc1cc2 , click the update drawing icon , and select substructure from the similarity
level selector or draw it using the drawing tool .
( d ) in the properties panel to the right , select the predefined set fragment - like from the preset selector in
the top right corner .
( f ) page through five pages to see the results using the next button in the results control bar .
( g ) to download these in smiles
text format , select smiles from the format selector ,
type all in the page size field ,
and click refresh . variations .
( i ) to download in mol2 or sdf formats , make the appropriate
choice from the format selector and click refresh .
( ii ) to choose only compounds available for 2 week
delivery , select in - stock only from the purchasability
selector and click refresh . problem .
the user is interested
in discovering the function of proteins by docking and , therefore ,
wishes to only dock biogenic molecules .
( c ) select znp zinc natural products , by clicking on the znp link .
( d ) download as before , either under quick
links or using the downloads tab
( i ) other special
subsetsinclude drugs , research compounds , building blocks ,
and natural - product - like compounds .
( ii ) additional libraries of purchasable
bioactive compounds are available as purchasable bioactive
compounds(pbcs ) , by choosing catalogs from
the subsets menu and clicking on the pbcs tab .
the user wishes to discover which vendors
sell the most bioactives for a particular target .
for instance , the
user is interested in exploring the bias between beta - arrestin and
g - coupled signaling pathways of beta-2 adrenergic receptor ligands .
to study this experimentally
, the user wants to buy many compounds
at low cost and would thus like to know which vendor sells the most
known to bind at 1 m or better .
( d ) next to the human annotation , adbr2_human , click on
the catalogs link to perform a market analysis . at
the time of writing
, the company sigma aldrich sold 29 compounds ,
by far the most of any single vendor , not counting chemonaut and molport ,
which are purchasing agents .
( f ) to add these to the shopping cart , click on add all .
( g ) there is more than one page , so click next to go to page 2 and click on add all again .
( h ) click on active cart in the top right
of the page to view the shopping cart .
( i ) click on purchasability
report to see vendors sorted in decreasing order of the number
of compounds they sell .
( j ) click on e - mail quote request to compose a message to the vendor .
authenticated users may modify
and send this email directly to the vendor , whereas anonymous users
must copy and paste the text into their own e - mail program to prevent
spam . variations .
( i ) over
3000 targets are available to choose based on chembl bioactivity data .
( ii ) the user may combine the ligands from several annotations ( e.g. ,
rat , mouse and human ) by adding them each to the shopping cart , and
individual compounds in the cart may be removed by clicking on them .
zinc can generate dud - style decoy molecules with
similar physical properties chemically dissimilar to the actives as
a bias - controlled docking benchmark .
decoys
are useful for testing that docking enrichment is not artificial and
therefore misleadingly good due simply to gross physical differences
between the actives and the decoys . problem .
the user wants to benchmark docking using actives and physically
matched decoys . at a high level ,
the approach involves logging in ,
putting the actives or their representatives into a shopping cart ,
clicking on generate decoys , confirming , waiting
a few minutes , and then downloading from a new cart .
( a ) log in
by clicking on sign in , in the top right of the page .
( b ) create a new cart , select it , and put the actives into it .
there
are many ways to supply actives : using chembl annotations , uploading
zinc ids or smiles while creating a cart , or hand picking compounds
from several queries . in this example
, we will generate decoys for
grik4 , the glutamate receptor ka-1 ( swissprot code q16099 ) .
( c ) click
on manage my carts ( must be logged in ) .
( d ) in section
2 , for cart name , type grik4 and click submit .
( i ) in the cart , click on generate
decoys . on the confirmation page that follows ,
the decoy procedure runs asynchronously in
the background and loads the decoys into the grik4-decoys cart when
it has finished , which typically takes a few minutes and depends on
system load .
( j ) when ready , the decoys may be downloaded in smiles ,
mol2 , or sdf .
the user has identified 100 molecules
she likes by docking or chemical informatics . before purchasing ,
she
wants to enlist the help of her colleagues to help prioritize them
for purchase .
we call this a hit picking party , a standard procedure
in our lab . buying compounds can be expensive , and a hit picking party
can help avoid blunders and solicit experience learned from other
projects . hit picking parties can also be didactically useful , because
they foster discussion about the biophysics and trade - offs involved
in protein ligand binding . approach .
( a ) log in to zinc by clicking on sign in , in the top right of the page .
( b ) go to cart management by clicking
on manage my carts ( top right ) .
( c ) create a new
cart named mygreatproject by using option 2 , typing mygreatproject in the text field , and clicking on submit .
optionally ,
the user may populate the cart by uploading a file of zinc ids or
smiles , one per line . in the large text area ,
( d ) in section
4 of the cart management page , add teammates to the cart by typing
part of their user name or part of their email address in the text
field and clicking on the plus ( + ) button .
each teammate requires
a docking.org i d , which is free on request . for subsequent projects
,
the cart can inherit the teammates from a previous project by clicking
on the buttons displayed below .
pis can
see all teammates scores , whereas peers can
only see their own scores .
( f ) teammates may view the cart by choosing carts from the subsets menu , then rating the molecules using an a+ to c scoring scheme .
( g ) the user
may see teammates ratings by viewing the cart and clicking
on hit picking party above the report control
bar .
a few brief examples illustrate some
possibilities . before
purchasing a library , the user wishes to learn what targets it hits . approach . from the subsets menu in zinc , choose catalogs .
click on the targets or clustered targets tabs to see
a target - focused analysis of the vendor s library .
click on
the catalogs link of any target to see a ranked list
of vendors selling compounds for that target .
two complementary kinds
of annotation are available : native species - specific chembl annotations
and annotations grouped by organism class and then clustered by chemotype . approach . from the subsets menu in zinc , choose properties and , then , choose the special tab . for drugs ,
this subset is
ready to download , or click on sample molecules to
browse .
the user can also see which drugs are not for sale by
clicking on sample molecules to browse and then choosing not for sale from the purchasability selector in the results control bar .
these are drugs that ,
according to zinc , are not for sale as pure substances .
if it is available ,
we would appreciate being informed of where it can be purchased so
that we can update zinc .
library diversity is
a huge topic with many nuances , but for many users , a simplistic analysis
from zinc may be good enough for some applications . approach . in the subsets menu
in zinc , choose catalogs and , then , click the diversity tab .
for instance , clicking on 60% sorts by the number
of clustered representatives at the tanimoto 60% level ( see methods ) .
the results in zinc show that there is
far more chemical diversity represented in annotated catalogs such
as chembl and bindingdb with sixteen and twelve thousand representatives
at the 60% tanimoto level respectively than is present in even the more diverse
single vendor libraries such as vitas - m and chembridge , with about
eight thousand each
the molecule , including purchasing
information and ready - to - dock files , is available .
the pattern * azepam will find purchasable drugs that hit gaba and * pride will find drugs that hit dopamine d2 , as well as
some other compounds .
this could be because
the compound is not in zinc or we do not yet know about the name used .
our list of cas numbers
is drawn from vendor catalogs , and as such may be incomplete .
for the current versions of these protocols , please visit
our web site , http://wiki.bkslab.org/index.php/zinc2012paper .
three main results emerge from this work .
first , zinc represents a much larger database of commercially available
compounds for ligand discovery and virtual screening than before .
second , zinc molecules are represented
in improved , biologically relevant forms and organized into discovery - relevant
subsets such as lead - like and fragment - like that are ready for downloading
and docking .
third , zinc can now be used to discover the biological
targets for a compound by simple mouse - click , or to find purchasable
compounds for a given target , based on literature annotations .
we
take up each of these results in turn . at over 20 million purchasable
molecules , zinc is the largest database of commercially available
compounds for virtual screening .
the over 150 vendor catalogs used
to create zinc provide a diverse range of chemistry , including drugs
such as ketoconazole , metabolites such as thebaine , natural products
such as harmaline , and synthetic compounds such as 2-(3,5-dihydroxyphenyl)ethylamine .
zinc catalogs are categorized by type and delivery time to allow the
user to select molecules that match research goals . for projects with
tight deadlines , subsets consisting only of compounds from stock offer
rapid delivery and high acquisition success rates , whereas projects
that can afford to wait can benefit from on average twice as many
molecules , albeit with lower acquisition success rates .
when a target
screen can not tolerate reactive groups , subsets containing only benign
chemistry can be used , whereas other projects can benefit from subsets
with significantly more compounds , but also a higher risk of artifacts .
docking is often challenging , frequently because of all the things
that can go wrong with a docked molecule .
possible problems include
incorrect protonation state , irrelevant tautomeric form , wrong conformation ,
and commercial unavailability .
zinc improves docking compared to previous
versions by providing better representations of biologically relevant
molecules organized into refined subsets that are relevant for discovery .
a primary focus of zinc is on the protonation state and tautomeric
form of a molecule . in our own docking projects , we are constantly
examining molecular forms that are automatically generated by our
pipeline of programs .
when we find errors , we fix the pipeline , or ,
if necessary , individual molecules themselves .
another common problem
is wrong conformations , often associated with less common aliphatic
rings or functional group combinations .
when we identify these problems ,
often during a hit picking party , we compare conformations against
the cambridge structural database and
amend the molecule , our protocol , or both as needed .
we have found
docking to be an outstanding way to find errors in a library and in
our molecule - processing pipeline , because incorrect molecules often
rise to the top of the docking hit list , demanding scrutiny .
even
if the molecule is ideal from the chemical and physical perspective ,
if it is unavailable to purchase , too expensive , or takes too long
to arrive , it is also irrelevant .
a static database would rapidly
become less useful since at least one million new compounds become
available every year , and more than half as many become unavailable .
database curation for relevance is an ongoing , unavoidable process
if we are to have discovery - relevant docking libraries .
when
looking for ligands for a target , the simplest place to start is often
the literature .
zinc incorporates a subset of chembl , the medicinal
chemistry database , to provide a simple way to find purchasable compounds
for over 3000 targets and biological activities for hundreds of thousands
of compounds .
compounds with experimentally known affinities can be
useful as experimental controls , chemical probes , as starting points
for hit - to - lead optimization , as well as controls for a docking calculation .
until recently , assembling sets of purchasable bioactives for a target
could take weeks of combing the literature .
now with zinc and chembl ,
compounds are available in ready - to - dock formats in seconds , making
it easier to test docking models whenever ligands are available in
the literature .
zinc also provides the ability to generate physically
matched yet chemically distinct decoys , which can help avoid library
bias in docking calculations .
building zinc is prone to numerous
pitfalls , perhaps the biggest of which is irrelevant molecules . among
these , incorrect protonation states and tautomeric forms are decoys
that waste an investigator s time .
compounds that are no longer
for sale are irrelevant , wasting time with false hopes of acquisition .
and there is more to drive the perfectionist to tears : catalogs
that are not yet in zinc , biological activity errors in the literature ,
data transcription errors , and coding errors in the interface .
whenever
a problem is brought to our attention , we aim to investigate it and
fix it promptly if we can .
zinc by its very nature is imperfect , as
each improvement allows new problems to surface .
it
supports molecular docking and chemoinformatics and is a general purpose
source of relevant molecules for other techniques .
increasingly , biological
activity for compounds can be simply looked up , or purchasable bioactives
for a given target can be identified .
we hope zinc will help investigators
to find reagents for their biological targets and to discover the
mechanism of action of their bioactive compounds . | zinc is a free public resource for ligand discovery .
the database contains over twenty million commercially available molecules
in biologically relevant representations that may be downloaded in
popular ready - to - dock formats and subsets .
the web site also enables
searches by structure , biological activity , physical property , vendor ,
catalog number , name , and cas number .
small custom subsets may be
created , edited , shared , docked , downloaded , and conveyed to a vendor
for purchase . the database is maintained and curated for a high purchasing
success rate and
is freely available at zinc.docking.org . |
gangrenous cholecystitis is one of the most severe forms of acute cholecystitis and is encountered in 2% to 39% of patients with acute cholecystitis .
earlier studies question the role of laparoscopic cholecystectomy , but more recent studies show improved outcomes when the procedure is feasible .
this study was undertaken to determine the impact of laparoscopic cholecystectomy in the treatment of gangrenous cholecystitis , evaluating outcomes in the decade before and after its introduction in clinical practice .
between 1982 and 2002 , data from all patients with gangrenous cholecystitis undergoing cholecystectomy at the bexar county hospital in san antonio , texas or at the south texas veteran health care system were prospectively collected in a database .
sex , age , race , american society of anesthesia ( asa ) preoperative classification , year , type and duration of the procedure ( primary open vs laparoscopic approach ) , morbidity , mortality , and length of hospital stay were recorded .
we excluded patients who underwent another operation at the same time , such as interventions for perforated peptic ulcer .
complications were classified according to clavien : grade i complications are defined as requiring bedside interventions only , grade ii requiring an invasive procedure , grade iii complications leading to a permanent disability , and grade iv death . patients who underwent conversion from the laparoscopic to the open procedure were included in the initial laparoscopic cholecystectomy group in an intention to treat analysis .
statistical calculations were performed using the unpaired student t test , chi - square , and fisher 's exact tests where appropriate .
between 1982 and 2002 , 11,360 patients underwent cholecystectomy at our institutions . during that time
, 3752 patients were found to have acute cholecystitis and of those , 238 patients ( 6.3% ) were diagnosed with gangrenous cholecystitis .
seventy - two women and 166 men underwent surgery for gangrenous cholecystitis , a ratio of 1:2.3 .
the mean age for all patients was 54 years ( range , 16 to 87 ) .
eighty - four percent of the patients were hispanic , 16% white , and 0.4% african american .
hispanic patients presented at a significantly younger age with gangrenous cholecystitis than white patients did , had lower asa scores , and less morbidity and mortality ( table 1 ) .
open cholecystectomy was performed in 141 patients , and in 97 patients , the cholecystectomy was attempted laparoscopically .
intense inflammation obscured the anatomy , causing laparoscopic cholecystectomy to be unsafe in 73% of the patients requiring conversion .
nine percent of the patients were converted due to bleeding that could not be controlled adequately and 6% due to an abscess or perforation .
one patient ( 3% ) underwent conversion because a cholangiogram could not be performed , one ( 3% ) due to colonic deserosalization , and in 6% , the reason was not documented .
the number of patients undergoing laparoscopic cholecystectomy and the conversion rates for the first and second half of the last decade are shown in figure 1 .
18.5% for all patients undergoing attempted laparoscopic cholecystectomy , 17% after successful laparoscopic cholecystectomy , and 21% in the converted group ( p = ns ) .
figure 2 demonstrates the distribution of these complications according to their severity as described by clavien et al .
patients who incurred complications were slightly older and exhibited slightly higher asa scores , but this did not reach statistical significance ( 56.4 vs. 52.8 years , p=0.14 ; asa 2.45 vs. 2.23 , p=0.1 respectively ) .
patients with complications stayed a mean of 15 days in the hospital , while patients without complications stayed 7 days ( p<0.01 ) .
patients with bile leaks or intraabdominal abscesses were less likely to have had an ioc during surgery compared with the overall patient group ( 20% vs. 49.5% respectively ; p<0.02 ) .
percentage of attempted laparoscopic cholecystectomies in patients with gangrenous cholecystitis and conversion rate over time .
morbidity rate by clavien classification and operative methods in patients presenting with gangrenous cholecystitis from 1982 to 2002 .
patient demographics by race complications in patients with gangrenous cholecystitis by operative method lc = laparoscopic cholecystectomy , oc = open cholecystectomy .
five patients died ( 2% ) : 4 after open and 1 after laparoscopic cholecystectomy .
the asa score and age in this group of patients was significantly higher than the mean asa score and age ( 4.2 vs. 2.23 ; p<0.001 ; 74.1 vs. 52.8 years ; p<0.001 , respectively ) .
the first and second decade of the study period were examined regarding the presence of preexisting disease , morbidity , mortality , and length of hospital stay ( table 3 ) .
comparison of preexisting disease , morbidity , mortality , and length of hospital stay between the first and second decade of the study period asa = american society of anesthesia preoperative classification .
the p - values for operating room time , intensive care unit admissions , and length of stay refer to the differences between the laparoscopic cholecystectomy ( lc ) or attempted - lc group and the open cholecystectomy ( oc ) or converted groups .
significant differences existed between both completed and attempted lc in comparison with the open cholecystectomy .
no statistically significant difference existed between the oc and converted groups in any of these categories .
subgroup analysis for patients undergoing cholecystectomy after 1992 revealed that patients undergoing laparoscopic cholecystectomy had a lower mean asa score than did patients undergoing open cholecystectomy ( 2.28 vs. 2.73 ; p<0.01 ) .
comparison of patient demographics and outcome data by operative method used lc = laparoscopic cholecystectomy , oc = open cholecystectomy , asa = american society of anesthesia preoperative classification .
comparison of demographics and outcome data for patients with perforated and nonperforated gangrenous gallbladder asa = american society of anesthesia preoperative classification .
the use of laparoscopic cholecystectomy in the management of gangrenous cholecystitis has been challenged by some authors .
most studies report conversion rates for patients with gangrenous cholecystitis that are substantially higher than for patients undergoing elective laparoscopic cholecystectomy ( table 6 ) . however , bender et al found no change in the conversion rates over a 7-year study period .
similarly , singer and mckeen found no significant difference in the length of hospital stay and a longer operative time in laparoscopically treated patients .
gangrenous cholecystitis we reviewed our experience with the minimally invasive treatment of gangrenous cholecystitis and compared it with that of the previous decade of open cholecystectomy at the same institution .
morbidity and mortality rates were not significantly different between the 2 decades or in relation to the surgical approach used .
conversion did not appear to add significant morbidity . despite increased asa scores , the morbidity rate did not increase in the second decade , which likely reflects improved perioperative care .
grade iii complications ( including heart attack , heart failure , stroke ) were more frequent in patients who had undergone the open procedure ( primarily or after conversion ) .
bile leaks appeared more frequently with the laparoscopic approach , but this did not reach statistical significance ( table 2 ) .
although no easily identifiable cause exists for the increased incidence of postoperative bile leaks and abscesses in our data , the observation that significantly fewer intraoperative cholangiograms were performed in these patients might indicate the severity of the disease that made cholangiogram unfeasible .
in our study , the operative time and length of hospital stay favor the laparoscopic approach . until 1997 , few patients with gangrenous cholecystitis underwent laparoscopic cholecystectomy .
only after the experience with the laparoscopic procedure at our institution increased was it offered to most patients with severe gallstone disease .
this is reflected in the significantly lower mean asa scores for the laparoscopic group compared with asa scores in patients undergoing the primary open procedure during the same period .
lacking precise predictors for conversion to the open procedure , we feel that laparoscopic cholecystectomy should be offered to most patients .
men are more commonly affected , and hispanic patients present at a younger age than caucasians do but have lower morbidity from the disease .
laparoscopic cholecystectomy can be safely performed in most patients and leads to shorter hospital stays and fewer intensive care unit admissions and possibly less severe morbidity .
laparoscopy should be the initial approach in the treatment of most patients with gangrenous cholecystitis even in the face of higher conversion rates .
the increased incidence of intraabdominal abscesses with the minimally invasive approach calls for new methods to decrease this complication . | background : gangrenous cholecystitis is a severe form of acute cholecystitis with high morbidity .
this study investigate the outcomes for patients undergoing cholecystectomy for gangrenous cholecystitis in the decade before and after the introduction of laparoscopic technology at our institution.methods:from 1982 to 2002 , all patients undergoing cholecystectomy for gangrenous cholecystitis were prospectively entered into a database .
demographic data , method of surgery , and outcome variables were assessed and compared over time.results:cholecystectomy was performed to treat gangrenous cholecystitis in 238 patients ( mean age , 54 years ) . from 1982 to 1992 , 98 patients underwent cholecystectomy for gangrenous cholecystitis , and from 1992 to 2002 , 140 patients underwent the procedure .
ninety - seven patients underwent laparoscopic cholecystectomy , and 33 patients ( 34% ) required conversion .
the open and laparoscopic cholecystectomy group differed in the number of intensive care unit admissions ( 13% vs. 5% , p<0.05 ) , overall length of hospital stay ( 10 vs. 5.7 days , p<0.001 ) and rate of intraabdominal abscesses ( 8% vs. 0.7%).conclusion : gangrenous cholecystitis remains a disease with high morbidity .
laparoscopic cholecystectomy shortened hospital stay and can be offered without increasing morbidity .
methods to decrease intraabdominal abscess formation in patients undergoing laparoscopic cholecystectomy for gangrenous cholecystitis are needed . |
recently , there has been growing interest in one - dimensional nanomaterials such as nanorods , nanowires , nanofibers , and nanotubes of various oxide materials , because of their fundamental scientific interest and also their potential applications in a variety of functional devices [ 1 - 4 ] . among many one - dimensional nano - structured metal oxides , tio2 , zno , and sno2
have been demonstrated to be excellent candidates for ultrasensitive and highly miniaturized chemical sensors because of their high surface - to - volume ratios and special physical and chemical properties [ 4 - 7 ] .
gas sensing property of semiconductor gas sensors is based on the conductivity ( or resistance ) change of the materials due to the interaction with the gases to be detected .
a nano - structured oxide is particularly useful for fabricating gas sensors because its conductivity can be controlled by the chemi - adsorbed species on its surface .
it has been demonstrated to be a highly sensitive material for the detection of many toxic gases .
the detection of toxic gases by a semiconductor sensor is extremely important for human and environmental protection .
hence , research on the gas sensors aims at obtaining new sensing materials to achieve highly sensitive and selective devices .
however , several problems exist with these single component oxides due to their similar sensitivity to different gases .
similar problems were observed in other oxides when used for solar cells and catalysts applications .
all these results show that oxide sensor characteristics like response , recovery , reproducibility , stability , and linearity vary considerably , and no single oxide sensor provides the desired characteristics .
to overcome these limitations , one approach is to synthesize these sensors by coupling different oxide semiconductors . in such couplings , sno2 and tio2 or zno and sno2
these coupled oxide semiconductors possess characteristics of both the component oxides and allow the possibility of tuning their materials properties as per the requirement for novel applications
. a better understanding of such coupled oxides is important in tailoring the properties of next - generation chemical sensors .
zno and sno2 belong to wide direct band gap semiconductors , and their eg band gaps are , respectively , 3.4 and 3.6 ev . difference in their band gap widths is also found to be very effective way to slow the recombination of electron hole pairs .
this attracted considerable interest , and many investigators exploited various synthesis methods to couple and to obtain nanocomposites of zno and sno2 including ball milling , microemulsion , partial solid state reduction , and co - precipitation [ 14 - 17 ] .
each preparation method and nanomaterial form has unique advantages and disadvantages depending upon the requirement of applications .
sno2 nanofibers as ethanol sensors . however , detailed literature survey reflects that there has been no systematic study to understand the morphological and optical properties of these nanocomposite nanofibers
present work focuses on the synthesis of nanocomposite nanofibers of mixed oxides containing zno and sno2 using electrospinning method .
these nanofibers were characterized by field emission scanning electron microscopy ( fe - sem ) , x - ray diffraction ( xrd ) , transmission electron microscopy ( tem ) , and photoluminescence ( pl ) spectroscopy .
polyvinyl alcohol ( pva ) ( practical guaranteed grade , duksan pure chemicals corp . ) with a molecular weight of ~80,000 , zinc acetate ( zn(ch3co2)2 , 99.99% , sigma
aldrich corp . ) , and tin chloride dihydrate ( sncl22h2o , 98% , sigma
aldrich corp . ) were used as the precursor materials to synthesize the nominal stoichiometry of ( 1 x)zno-(x)sno2 nanofibers .
first of all , 2 g of pva and 1 g of zn(ch3co2)2 were dissolved in 18 g of deionized water by stirring for 10 h at 6570c .
next , various amounts of sncl22h2o were added to the solution while stirring for 6 h at 70c . in this study , we prepared six electrospinning solutions of x = 0.08 , 0.20 , 0.29 , 0.36 , 0.45 , and 0.62 in the nominal ( 1 x)zno-(x)sno2 composition .
these solutions were loaded into a glass syringe , equipped with a 21-gauge stainless steel needle .
the distance between the tip of the syringe needle and the collector of the al plate was fixed at 20 cm .
a positive voltage of 15 kv was applied to the needle while the metal collector was grounded . at the same time , a negative voltage of 10 kv was applied to the metal collector to accelerate the electrospinning process .
the feeding rate of the solutions was adjusted at a constant rate of 0.2 ml / h by using a syringe pump .
the electrospun nanofibers were distributed uniformly over si wafers , placed on the metal collector .
the as - spun nanofibers were calcined at various temperatures and durations in oxygen atmosphere using a tube - type furnace to obtain required phase and morphology .
the content of sn was varied by assuming the stoichiometry to be ( 1 x)zno-(x)sno2 .
thermogravimetric - differential thermal analysis ( tg - dta , sta 409 pc , netzsch ) was used to determine the calcination temperature required to remove water and other decomposable organic contents in as - spun nanofibers as well as to decompose the precursors into their corresponding oxide phases .
the crystalline structure including the phase purity and morphological features of the synthesized nanofibers were examined using xrd ( xerpt mpd pro , philips ) , fe - sem ( s-4300se , hitachi ) , and tem ( jem2100f , jeol ) .
the distribution of chemical species was investigated using energy dispersive x - ray spectroscopy ( eds ) inbuilt with the tem .
pl ( spex 1403 , spex ) spectra were measured to understand the substitution effect of sn in their optical properties .
the morphologies of the as - spun ( 1 x)zno-(x)sno2 nanofibers spread on si substrates were studied using fe - sem .
tg - dta was carried out to determine a suitable calcination temperature of as - spun nanofibers .
200c , water in the as - spun nanofibers evaporates . between 200 and 575c , the organics belonged to pva , ch3coo group of zinc acetate and some volatile tin species such as chloride composites evaporate .
the dta curve of the as - spun nanofibers reveals that semiconductor characteristics are present only after annealing at temperatures above 575c , because below this temperature , both solvent and organic molecule residues can act as obstacles for charge carrier accumulation and transportation in the conduction band .
the phase transformation from amorphous ( i.e. , as - spun nanofibers ) to crystalline states ( calcined nanofibers ) also occurs at this temperature .
it should be noted that there was no change in weight loss above 575c , revealing that a calcination temperature of > 575c is needed to remove the solvent and polymer as well as to fully decompose zinc acetate and tin chloride into a pure zno
sno2 phase . a a typical fe - sem image of as - spun nanofibers synthesized by electrospinning method .
b thermal profiles obtained from tg - dta for the as - spun nanofibers of x = 0.45
. c xrd patterns of ( 1 x)zno-(x)sno2 nanofibers calcined at 600c for 6 h in o2 ambient in this study , the calcination temperature was optimized to 600c based on the tg - dta results .
after calcination at 600c in air for 6 h , well - defined nanofibers get rigid , but their diameter turns thinner due to the decomposition of pva and the conversion of the metal precursors to the metal oxides .
1c . the composite nanofibers have a polycrystalline nature attributable to various diffraction planes of zno and sno2 .
the xrd profiles exhibit sharp crystalline peaks of high intensity corresponding to the peaks of zno and sno2 .
all diffraction peaks can be perfectly indexed as the tetragonal rutile structure for sno2 and a hexagonal wurtzite structure for zno .
no characteristic peaks for impurity , such as sno , znsno3 , and zn2sno4 , were observed .
figure 2 displays the morphological evolution , observed by fe - sem , of nanocomposite ( 1 x)zno-(x)sno2 nanofibers , before and after calcination at 600c in o2 ambient for 6 h , for various sn concentrations .
figure 2a and 2b show the typical morphologies of as - spun nanofibers of x = 0.08 and 0.45 , respectively .
diameters of each composition were measured from the fe - sem images and are plotted in fig .
, the diameter of the nanofibers depends on the concentration of sn . according to the results of fe - sem ,
nanofibers are formed up to the composition of x = 0.45 , and above this level , they become sn - rich nanocomposite clusters and no longer nanofibers .
this may be due to the change in the critical limit of processing parameters like viscosity , voltage , and concentration of the electrospinning solutions with increased sn contents .
as mentioned in the experimental part , we kept all the processing parameters constant except the sn content .
more studies by varying the processing parameters of the electrospinning method may help us to understand the reason for the sn cluster formation .
fe - sem images of as - spun nanofibers : ax = 0.08 and b 0.45 .
fe - sem images of ( 1 x)zno-(x)sno2 nanofibers calcined at 600c in o2 ambient for 6 h : cx = 0.08 , d 0.20 e 0.29 , f 0.36 , g 0.45 , and h 0.6 . the nanofibers are formed up to the composition of x = 0.45 , and above this critical level , they become sn - rich clusters and no longer nanofibers variation in the diameter of nanocomposite ( 1 x)zno-(x)sno2 nanofibers as a function of sn content before and after calcinations the tem image of ( 1 x)zno-(x)sno2(x = 0.36 ) nanofibers is shown in fig .
4 . the inset shows a selected area electron diffraction pattern , indicating a polycrystalline nature of the nanofibers .
the eds elemental mapping of the same nanofiber region , indicating spatial distribution of o ( blue ) , sn ( green ) , and zn ( red ) , respectively , is shown in fig .
similar behavior has been observed for all other compositions up to x = 0.45 , and it is not shown here to avoid repetition . a a typical tem image of a calcined ( 1 x)zno-(x)sno2(x = 0.36 ) nanofiber
. the inset shows a selected area electron diffractions pattern , indicating its polycrystalline nature .
eds elemental mapping of the same nanofiber region , showing spatial distribution of b zn ( red ) , c o ( blue ) , and d sn ( green ) figure 5 shows the pl spectra of ( 1 x)zno-(x)sno2 nanofibers synthesized on si substrates for various sn compositions . the pl spectrum of zno nanofibers ( i.e.,x = 0 ) shows a sharp , narrow ultraviolet ( uv ) band at 370 nm and a broad band centered at around 600 nm .
the pl spectra for other compositions show a broad spectra and major peak at around 575 nm .
a strong uv band edge peak is responsible for the recombination of the free excitons of zno .
generally , nanocrystalline zno exhibits two peaks in the pl spectrum around 380 and 500 nm . in the present case ,
the uv emission is observed at a different wavelength compared with most of the reported values for zno nanostructures .
this may be due to difference in the dimensionality and diameter of the zno nanofibers .
chakrabarti et al . also observed two peaks in the visible region at 470 and 510 nm in zno nanoparticles [ 20 - 22 ] .
the cause of a uv band emission in zno is more or less well understood .
this is due to a near band edge transition of wide band gap of zno , namely the recombination of free excitons through an exciton
the green emission of 450600 nm is usually believed to be related to the intrinsic defect structures , in particular oxygen vacancies .
the potential difference between zno and sno2 allows photoelectrons to easily migrate from the zno surfaces to the sno2 conduction band .
this results in a decrease in the radiation combination of photoinduced electrons on the zno surfaces , and further weakening the pl signal .
the pl intensity is suppressed with sn concentration , while overall spectral features remain almost the same .
typical pl spectra of nanocomposite ( 1 x)zno(x)sno2 nanofibers calcined at 600c for 6 h. coupling sno2 shows a significant effect on the pl intensities of pure zno nanofibers the crystalline nanograins of zno and sno2 coexist in the nanocomposites nanofibers .
it is not the case where sn occupies zn site or vice versa and form mixed nanofibers of zn(sn)o .
the change in ( 1 ) polymer solution parameters like molecular weight , solution viscosity , surface tension , solution conductivity , and dielectric effect of solvent , etc . , ( 2 ) processing conditions namely , voltage , feeding rate , temperature , effect of collector , diameter of syringe orifice / needle , and distance between the tip and collector , and ( 3 ) ambient parameters including humidity , type of atmosphere , and pressure , etc . has been investigated and found to determine the morphology and properties of the synthesized nanofibers . in our synthesis process , we only varied the concentration of sn content in the electrospinning solution and kept the other parameters the same .
as described above , we used zinc acetate and tin chloride dihydrate , respectively , for zn and sn , and these precursors are immiscible
this possibly results in the formation of separate zno and sno2 nanocomposites of nanofibers up to x 0.45 . from the electronic structure point of view , these zn and sn ions possess different ionic radii and electro - negativities , again implying immiscible nature under normal preparation methods .
thus , these nanocomposites nanofibers are composed of nanograins of sno2 and zno with crystalline nature .
applications that have been demonstrated with zno + sno2 nanoparticles and thin films , etc . may be extended to these nanocomposite nanofibers .
in particular , the nanocomposites of ( 1 x)zno-(x)sno2 ( x < 0.45 ) nanofibers are likely to enhance gas sensitivity with better long - term stability , fast response , and recovery time compared with conventional sensors employing simple oxides like sno2 , tio2 , and zno . their microstructural changes over time will be reduced due the presence of zno and sno2 nanograins , since both will act in reverse directions . apart from this , these sensing materials react with selectively with gases unlike gas sensors based on sno2 or zno alone .
this implies that these nanocomposites effectively use the electronic and chemical reactivity of materials for better sensing and photocatalytic applications .
thus , these nanocomposites containing semiconductors like sno2 and zno are likely to overcome several problems that currently exist with devices fabricated using either just with sno2 or zno , and the resulting system has the potential for tunable sensitivity and selectivity for many applications . in addition , since these are in the form of nanofibers , it may have advantage in the field of photovoltaic .
one of the known ways to increase the conversion efficiency is reducing the radiation losses at the front surface of the solar cell .
zno has been shown to be plasma resistant and to have 9697% transmission over the visible spectrum .
photogenerated excess charge carriers can recombine via recombination centers and thus not contribute to the photocurrent .
it is a key feature when describing carrier transport in semiconductors , because it strongly affects the electrical response of the semiconductor at all levels of external excitation .
present study reported the synthesis and characterization of mixed oxides of ( 1 x)zno-(x)sno2(x 0.45 ) nanofibers synthesized by electrospinning technique .
pva , zn(ch3co2)2 , and sncl22h2o were used as the precursor materials to synthesize these nanocomposite nanofibers .
the as - spun nanofibers exhibited uniform , smooth fibrous morphology for the compositions of x 0.45 . above x > 0.45 , there was a formation of nanoclusters .
the xrd patterns confirmed the presence of zno and sno2 phases and the absence of sno , znsno3 , and zn2sno4 .
the pl measurements showed that there was a change in the blue / violet luminescence confirming the presence of sn in zn - rich composition .
above study shows that crystalline ( 1 x)zno-(x)sno2(x 0.45 ) nanofibers stabilize after calcination and possess morphological and optical properties that strongly depend on sn content .
this work was supported by a grant from the fundamental r&d program for core technology of materials funded by the ministry of knowledge economy , republic of korea .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . | we report the characterization of mixed oxides nanocomposite nanofibers of ( 1 x ) zno-(x)sno2 ( x 0.45 ) synthesized by electrospinning technique .
the diameter of calcined nanofibers depends on sn content .
other phases like sno , znsno3 , and zn2sno4 were absent .
photoluminescence studies show that there is a change in the blue / violet luminescence confirming the presence of sn in zn - rich composition .
present study shows that the crystalline nanocomposite nanofibers with stoichiometry of ( 1 x)zno-(x)sno2 ( x 0.45 ) stabilize after the calcination and possess some morphological and optical properties that strongly depend on sn content . |
we review 4 patients with severe gbs and one patient with miller fisher syndrome ( mfs ) admitted to our institution from 2012 to 2013 .
all patients received very high - dose ivig ( total dose of at least 4 g / kg , equivalent to 2 standard treatment courses [ 2 g / kg ] ) administered over fewer than 14 days . all patients with gbs did not respond initially , prompting a second course of treatment ( table ) .
as this was a retrospective review of a small case series , institutional review board approval was not required .
all of the patients with non - o blood types ( 3/5 ) treated with very high - dose ivig developed clinically significant anemia requiring blood transfusion . when tested ( 2/3 cases ) , there was clear evidence of hemolysis ( positive direct antiglobulin test , low haptoglobin , high lactate dehydrogenase / bilirubin ) .
in addition , there were no other medical comorbidities or medications commonly implicated in causing autoimmune hemolytic anemia ( table ) .
patient 4 developed hematuria prior to discharge with normal hemoglobin and returned with massive hemolysis leading to pigmentary nephropathy and requiring hemodialysis .
patients with o blood type did develop anemia , but it was mild and clinically asymptomatic .
in addition , the patients with o blood type did not have evidence of hemolysis .
antibodies to blood group antigens ( a and b ) found in ivig due to pooling from donors with o type blood are proposed as the hemolytic mechanism in many prior observations .
the current industry standard antibody titers are < 1:64 for anti - a and < 1:32 for anti - b .
privigen , a commonly used liquid ivig formulation , currently has anti - a < 1:32 and anti - b < 1:16 .
however , the titers of anti - a and anti - b may vary within lots .
therefore , patients who are given higher doses of ivig will be exposed to higher levels of anti - a and anti - b antibodies .
although our patients received privigen , ha has been reported with use of many liquid ivig formulations .
antibodies to blood group antigens ( a and b ) found in ivig due to pooling from donors with o type blood are proposed as the hemolytic mechanism in many prior observations . the current industry standard antibody titers are < 1:64 for anti - a and < 1:32 for anti - b .
privigen , a commonly used liquid ivig formulation , currently has anti - a < 1:32 and anti - b < 1:16 .
however , the titers of anti - a and anti - b may vary within lots .
therefore , patients who are given higher doses of ivig will be exposed to higher levels of anti - a and anti - b antibodies .
although our patients received privigen , ha has been reported with use of many liquid ivig formulations .
we propose that risk of ivig - related ha is increased with high doses , significant in non - o blood types , and more likely to occur when administered over a short interval ( i.e. , < 2 weeks ) .
ha has not been frequently observed in patients receiving maintenance ivig , likely due to the lower dose , longer time intervals between infusions ( typically 34 weeks ) , and 23 week half - life of anti - a / b igg .
although all of our patients had gbs / mfs , ha has been reported in many other conditions treated with high - dose ivig such as postpolio syndrome , chronic inflammatory demyelinating polyneuropathy , myasthenia gravis , renal transplantation , and kawasaki disease .
the applicability of our findings is limited by a small number of cases , retrospective analysis , and hemolysis testing in only 2 of the 3 patients .
however , our findings raise relevant , novel considerations such as a possible maximum tolerated dose of ivig in a short time frame . in addition
, practitioners should exercise caution if considering escalating ivig dosages to > 2 g / kg in < 14 days .
hemoglobin and creatinine levels should be monitored closely during and after treatment with high - dose ivig ( up to 12 weeks ) to detect this untoward complication . in the literature
, nadir hemoglobin level seemed to occur within 2 weeks of treatment , commonly within 45 days .
if anemia occurs , testing should include direct antiglobulin test , peripheral blood smear , bilirubin , haptoglobin , lactate dehydrogenase , and reticulocyte count .
manufacturers should label anti - a and anti - b titers on their product and consider more stringent industry standards .
we propose that there is a maximal tolerated dose of ivig over a 2-week period , which is dependent on patient abo blood group and ivig 's anti - a / anti - b titers .
| objective : we describe an underrecognized side effect of high - dose iv immunoglobulin ( ivig ) , hemolytic anemia.background:there are no established guidelines on treating patients with guillain - barr syndrome ( gbs ) who relapse or do not improve after a standard course of treatment ( ivig or plasma exchange ) .
some centers will opt for a second course of the initial treatment .
there is an ongoing trial of a second course of ivig in patients with severe gbs.methods:we retrospectively reviewed 4 patients with severe gbs who received high - dose ivig .
one patient inadvertently received a high dose of ivig for miller fisher syndrome .
all patients received a total of at least 2 courses of the standard dose of ivig ( total > 4 g / kg ) .
we review their clinical course and side effects.results:all patients with non - o blood types developed clinically significant hemolytic anemia requiring blood transfusion.conclusion:hemolytic anemia may limit doses of ivig for treatment of severe gbs in patients with non - o blood types . |
in recent years , we have witnessed the wide application of high - throughput screening ( hts ) technologies to approach biological questions . arguably , the most promising hts approach for discovering gene function is based on rna interference ( rnai ) . rnai results in the silencing of a gene through the specific degradation of its mrna , which is triggered by double - stranded rna ( dsrna ) fragments complementary to that transcript . in drosophila
, rnai can be achieved in cell lines and primary cells simply by adding long dsrna to the medium ( 1,2 ) .
the long dsrna are taken up by the cells , and are rapidly processed to 2124 nt short - interfering rnas ( sirnas ) that guide the specific degradation of target mrnas .
the biochemical steps involved in the processing of dsrnas and loading of the sirnas into the rna - induced silencing complex ( risc ) are carried out by a number of proteins , including members of the dicer protein family ( 3 ) . in the last 2 years
that technique has been adapted to hts , allowing genome - wide screens to be performed efficiently in 384-well assay plates ( 1 ) . with the support of a grant from nigms
, we created in may 2003 the drosophila rnai screening center ( drsc ) ( ) with the following goals :
make genome - wide rnai screening technology available to the scientific community by providing a facility with the required infrastructure and expertise.provide a common platform to diminish variables between screens , allowing for functional comparisons across studies.create a database , in a standardized format , for the repository of results from all screens , which , upon publication , are made available to the public .
the public database is divided into sections that offer researchers several basic data viewing options as well as a number of bioinformatic tools and links to other databases .
the long - term purpose of the database is to provide experimental information to functionally annotate uncharacterized genes in drosophila , to give a comprehensive list of genes involved in distinct cell biological and cell signaling processes and to be a resource for data mining by the scientific community .
make genome - wide rnai screening technology available to the scientific community by providing a facility with the required infrastructure and expertise .
provide a common platform to diminish variables between screens , allowing for functional comparisons across studies .
create a database , in a standardized format , for the repository of results from all screens , which , upon publication , are made available to the public .
the public database is divided into sections that offer researchers several basic data viewing options as well as a number of bioinformatic tools and links to other databases .
the long - term purpose of the database is to provide experimental information to functionally annotate uncharacterized genes in drosophila , to give a comprehensive list of genes involved in distinct cell biological and cell signaling processes and to be a resource for data mining by the scientific community .
visiting scientists typically perform their screens in duplicate screening against two full - genome sets .
raw data from duplicate genome sets are collected along with phenotype and hit information .
data are primarily stored by plate and well , rather than by dsrna , which allows for comparison between genome sets and facilitates plate - wide analysis .
the scientists perform their screens blind only learning the identity of the dsrna in a particular well after entering the data from that well into the system .
once the screen is completed , the data are held privately until the results are published or a 2 year period passes after completion of the screen .
the scientists have password - protected accounts which give them access to data entry interfaces and direct links to their personal data , both published and unpublished .
any changes the scientist may make to the experimental data display ( as described below ) are saved between sessions .
the logged in user also has access to some tools for viewing data a plate at a time , direct links to the bioinformatic tools ( listed below ) and functions for directly querying the quality control ( qc ) information for the source plates .
an important aspect of how the database is organized is in the distinction among genes , amplicons and dsrnas .
the dsrna library was designed in collaboration with r. paro 's group and collaborators ( zmbh heidelberg ) ( 4 ) .
the approach taken was to generate gene - specific primers to 21396 putative open reading frames ( orfs ) covering the entire drosophila genome .
choice of the primers was based on the combined genome annotations available from bdgp / celera ( 5 ) and the sanger center .
a pair of a specific forward and reverse primer was used to amplify a genomic region ( henceforth called amplicon ) corresponding to each predicted orf .
each amplicon , flanked by rna polymerase t7 promoters , was in turn used as a template in an in vitro transcription reaction to generate dsrna .
as new releases of the drosophila genome result in slightly revised annotations , the predicted gene target of each amplicon may change accordingly . because of this unavoidable issue , result and
hit information from screens is focused more on amplicons and the corresponding dsrna than on genes .
however , the key piece of information that remains invariant is the nucleotide sequence of the specific region encompassed by an amplicon and by extension of its related dsrna . for the purpose of data tracking in the database
, the term amplicon can refer to two distinct biological entities that are related through their sequences : the dna fragment amplified with specific primers or its corresponding dsrna .
this page has four major parts ; a menu bar to the left , a link to the gene lookup page ( search for genes in public screens ) , a list of public screens below it for which all data are accessible , and a list of ongoing screens for which the data are kept confidential until the time of publication or the 2 year limit after their completion , whichever comes first ( figure 1 ) .
about us link provides general information about the drsc , such as personnel , location , equipment , funding and drsc news .
screening header opens up a how - to section and summarizes the current protocols in use at the drsc to conduct rnai screens in the 384-well plate format ( 1 ) .
applications link is for scientists interested in submitting an application to come and carry out a screen at the drsc .
links pages are lists of external resources that the drsc wishes to highlight for rnai screeners .
the tools section consists of a number of small bioinformatics applications that we have developed to help screeners or interested scientists search for and manage information displayed in the data section of the database .
it also offers links to other databases with the purpose of providing additional information on particular genes or gene function .
the published screens page is organized by screen publication date , the most recent of which are listed first .
a pdf file of the publication , as well as the supplementary data ( when available ) , are included whenever possible .
one or more direct links are provided to access the raw data , with a listing of the dsrnas ( or their corresponding amplicons ) found to have an effect in the assay under study . immediately below
the record , which is updated as is appropriate , of the published screens ( 613 ) follows a list of screens that have just been completed at the drsc .
these screens are yet to be fully analyzed and have not yet reached the stage of publication . for each unpublished screen listed , the title and brief summary of the screen are given along with details about the scientists involved in the screen ( names , academic affiliation , etc . ) .
each screen has links to one or more listings of the amplicons for which phenotypic data was entered during that assay .
multiple listings appear in cases when several different assays were combined in the screen , such as when two different cell lines are screened for comparison .
the user can use search criteria to display a subset of rows , or use check boxes to indicate the rows to display when a redisplay button is pressed .
more significantly , the user can sort the data , based on any displayed column of information , by clicking the column header .
the set of columns that is displayed is likewise configurable via a selection menu at the bottom of the page , which offers a choice of over 40 columns of information per row ( table 1 ) .
when the page displays data to the user 's liking , the displayed contents of the page can be saved as a tab - delimited text file , to be imported into the user 's spreadsheet program of choice . for further details about any row
, the user can click the triangle icon at the start of the row to go to the amplicon detail page for that amplicon .
this page provides a link to the gene and amplicon lookup page ( figure 3 ) .
the gene and amplicon lookup function provides a simple interface that allows visitors to get information on any amplicon in the drsc library related to a particular gene .
the search function is flexible and accepts queries by gene name , gene alias , flybase gene number ( fbgn ) , cg accession number or by our internal drsc i d number .
when a gene is queried , the user is presented with a detailed page of information about the amplicon(s ) found and any gene(s ) targeted by it .
a gene may have more than one amplicon as the original collection was based on early annotations of the drosophila genome ( 5 ) .
subsequent revision of the annotation resulted in several cases in the merging of two orfs into a single gene .
if any amplicon targeting a queried gene has been associated with a phenotype in any public screens , then that information is presented at the top of the page .
the top section of the results page shows whether a particular gene and its related amplicon(s ) have been identified in a public screen as
if so , the targeting amplicon is listed with the name of the screen , the phenotype and the screener 's evaluation of the strength of that hit ( see also table 1 ) . below that , there is a section for each amplicon in the drsc library that targets that gene .
it is broken into subsections detailing general information about the amplicon ( predicted sequence , primer sequences , length , etc . ) , genomic position , detailed information about the gene , links to other databases and some historical information relating to the creation of the amplicon .
an additional important tool is the off - target sequence search tool . as in the mammalian field ,
the issue of off - target effects caused by sirnas is emerging as a significant issue in drosophila ( 14,15 ) and potential off - targets associated with dsrnas for caenorhabditis elegans have been annotated at rnaidb ( 16 ) .
an initial review of the data at the drsc confirms that off - target effects do happen in drosophila and need to be taken into account when interpreting knock - down data by long dsrnas ( m. booker , s. silver , m. kulkarni , a. friedman , n. perrimon and b. mathey - prevot , manuscript in preparation ) . as discussed earlier ,
long dsrna ( typically 400 nt ) are processed to 2123 nt sirnas by the dicer protein .
dicer does not appear to have a sequence preference for where processing will occur and as a result we do not know in advance which and how many sirnas are produced from any particular dsrna .
however , we can check any possible 21mer sequence that is included in a given dsrna ( or within its corresponding amplicon ) for a possible match with other mrnas which are not the intended target .
ideally , only one match corresponding to the targeted mrna should be found . to facilitate this search ,
we have developed a bioinformatics tool based on our own faster algorithm , somewhat similar to that published by arziman et al .
( 17 ) except that it does not have a built - in primer design component .
our off - target search tool allows a user to provide one or more dna sequences in fasta format and search those sequences for predicted off - targets among all fly gene transcripts .
the user can specify an off - target length ( 1650 bp ) with a default value of 21 bp .
a color - coded map of gene matches for a given sequence is returned to the user .
the map shows regions of the submitted sequences that are devoid of predicted matches with genes other than the intended target ( no off - target ) as well as stretches which do have matches with off - target genes .
the intended or primary target is determined based on a match over all or most of the length of submitted sequence .
the sequence extraction tool allows users to retrieve multiple fasta - formatted drsc amplicon sequences .
the flybase identifier retrieval tool allows the user to do a batch query for flybase fbgn identifiers by giving a list of fly gene symbols , names , synonyms and cg accessions .
the genetic interactions tool allows the user to construct a graph of genes of interest for their reported genetic interactions based on data stored at flybase .
the user may query for these by submitting one or more gene symbols , synonyms or fbgn identifiers .
the screen analysis tutorial is a series of web pages that provides screen analysis assistance to drsc screeners as well as to public users interested in mining the data available in our database .
this guide offers the user multiple resources and some graphical approaches to help integrate and explore relational associations between drsc hits and other gene function , ontology or expression data sources .
the drsc database / interface is constantly evolving and new experimental data accrue at a pace of 2030 genome - wide screens a year .
the drsc library of amplicons ( and dsrnas ) is also evolving as new drosophila genome annotations come on line , and new insights about the specificity of our dsrnas come to our attention ( e.g. the need to replace amplicons associated with off - target effects ) .
we are committed to the idea that our database be an important resource for public data mining and will make available all screen data as soon as it is permitted by the general agreement signed between the screeners and the drsc .
we will work to provide additional bioinformatic tools and search capabilities to enhance our current database , and we welcome any suggestion or collaboration to improve the integration of our database with others .
finally , we encourage comments to make our database more useful to scientists and hope that similar databases will be created to collect information from rnai screens in mammalian cells .
screens awaiting publication are listed below , bordered in gray . the experimental data summary page .
this master page of amplicon information is available from the gene and amplicon lookup and data display pages . | rna interference ( rnai ) has become a powerful tool for genetic screening in drosophila . at the drosophila rnai screening center ( drsc ) , we are using a library of over 21 000 double - stranded rnas targeting known and predicted genes in drosophila .
this library is available for the use of visiting scientists wishing to perform full - genome rnai screens .
the data generated from these screens are collected in the drsc database ( ) in a flexible format for the convenience of the scientist and for archiving data .
the long - term goal of this database is to provide annotations for as many of the uncharacterized genes in drosophila as possible .
data from published screens are available to the public through a highly configurable interface that allows detailed examination of the data and provides access to a number of other databases and bioinformatics tools . |
we present the case of a patient who dissolved the tablets and then injected intravenously oxymorphone extended release tablets ( opana er ; endo pharmaceuticals inc . ,
malvern , pa , usa ) and developed unexplained thrombotic thrombocytopenic purpura ( ttp ) .
the patient was a 30-year - old , single , caucasian man who presented for opioid dependence to a substance use disorders inpatient rehabilitation program .
prior to admission , he was hospitalized for ttp - like illness after injecting opana .
the patient reported that his opiate dependence evolved over time , finding that injecting opana became his only method of use , injecting a 20 mg tablet of opana every 8 hours .
for both admissions for ttp , the patient presented complaining of feeling sick , tired , confused , and had difficulty breathing . upon admission
, he was found to have a mild fever and generalized purpura without mucosal involvement .
his comprehensive metabolic panel was within normal limits except for a platelet count of 30,000 per l .
a chest x - ray was unremarkable , and electrocardiogram ( ekg ) sinus tachycardia was 120 bpm .
for both admissions , his treatment was uneventful and consisted of 3 days of glucocorticoids ( prednisone ) .
his platelets continued to trend upward throughout his rehabilitation admission , but he left prior to completing the program .
opana is one of the trade names of oxymorphone , a semi - synthetic opioid used to treat moderate to severe chronic pain.1 ttp is a rare blood coagulation disorder that causes microscopic clots to form in small blood vessels throughout the body that is typically associated with an infectious or inflammatory process , yet it is only seen in approximately one in 100,000 people.1 a case controlled study found 15 cases of ttp - like illness associated with intravenous opana er abuse in tennessee.2 our case is the only example , to our knowledge , where ttp reemerged following a re - challenge with iv oral opana . using iv oral opana is a growing concern . on a google search
, there were 119,000 results for opana er iv , including tutorials on how to prepare opana tablets as an injectable , suggesting that its misuse is significant .
this case report and others suggest that health care professionals should be aware of the possibility of developing ttp in those who misuse opana . | we present the case of a patient who developed thrombotic thrombocytopenic purpura ( ttp ) following intravenous injection of opana er . ttp reemerged after three months of abstinence with opana misuse .
this case report brings awareness to the possibility of developing ttp in those who misuse opana , which is a growing concern . |
the cvrn ls - icd has been described in detail previously.5 the data for this study were derived from 2 sources .
data on icd eligibility , clinical characteristics , and device and provider details were collected from the national cardiovascular data registry ( ncdr ) icd registry , a national registry that was formed as part of a coverage - with - evidence requirement of the centers for medicare and medicaid services.13 the ncdr implements a rigorous data - quality program that includes data and range checks , outlier analysis , and random audits.14 data on outcomes including device - related complications , hospitalization , and death were obtained from the cvrn virtual data warehouse ( vdw ) , a standardized repository of clinically enriched administrative data generated in a distributed fashion using identical protocols at each participating health plan.15 institutional review boards at participating sites approved the study .
we identified 3649 consecutive adult patients ( aged > 18 years ) undergoing first - time icd implantation for the primary prevention of sudden cardiac death in 15 hospitals within 7 integrated health systems in the cvrn between january 1 , 2006 , and december 31 , 2010 .
we excluded patients not enrolled in 1 of the 7 cvrn health plans at the time of implantation ( n=610 ) and those with a left ventricular ejection fraction ( lvef ) > 0.35 ( n=85 ) .
the study cohort , when compared with patients not enrolled , were older on average ( median age 69 versus 67 years , p<0.001 ) , included a lower proportion of women ( 25.8% versus 30.2% , p=0.02 ) , were more often white ( 63.0% versus 43.7% , p<0.001 ) , and had new york heart association ( nyha ) i to ii symptoms more often ( 61.5% versus 49.3% , p<0.001 ) .
the end points included time to death from any cause , time to hospitalization from any cause and from heart failure , and device - related complications within the first 90 days after implantation .
death was ascertained through the vdw , which uses health system databases , social security administration vital status files , and state death certificate registries , depending on the participating cvrn site .
hospitalizations were assessed using the vdw , which includes admission and discharge dates and diagnoses for all hospitalizations . because health plans are responsible for coverage of all health services for members , hospitalizations outside of health plan facilities
hospitalizations for heart failure were identified using the principal discharge diagnosis for heart failure ( table1 ) , an approach that has been applied widely in studies of heart failure.16 follow - up for death and hospitalization was obtained through december 31 , 2011 , providing up to 6 years of follow - up .
icd-9-cm , cpt , and hcpsc codes used to ascertain clinical events in the cardiovascular research network virtual data warehouse cpt indicates current procedural terminology codes ; hcpcs , healthcare common procedure coding system ; icd-9-cm , international classification of diseases , ninth revision , clinical modification . to ascertain hospitalizations attributed to heart failure , only the principal discharge diagnosis was considered .
device - related complications were ascertained using a modification of the approach developed for purposes of reporting complications after icd implantation used for hospital public reporting.17 this approach applies a variable ascertainment time frame ( either 30 or 90 days ) depending on the complication .
we identified events using codes from the international classification of diseases , ninth revision , clinical modification ; the current procedural terminology ; and the healthcare common procedure coding system , in any position on an inpatient claim ( table1 ) .
complications ascertained over the first 30 days after icd implantation included pneumothorax or hemothorax requiring a chest tube , hematoma requiring transfusion or evacuation , cardiac tamponade or pericardiocentesis , or death .
complications ascertained over the first 90 days included device - related infection and mechanical complications of the icd requiring system revision and device reimplantation .
those patients with incomplete follow - up data for the complications end point ( n=72 ) were excluded from the complications analysis .
patient characteristics included demographics ( age , sex , and race or ethnicity ) , cardiovascular history ( nyha class , lvef , ischemic heart disease , nonischemic cardiomyopathy , atrial fibrillation ) , noncardiovascular comorbidities , laboratory values ( blood urea nitrogen , hemoglobin , and creatinine ) at the time of implantation , electrocardiographic findings ( qrs morphology and duration ) , and device type .
for the death and hospitalization end points , we also considered the prescription of medications for heart failure known to influence heart failure outcomes ( angiotensin - converting enzyme inhibitors or angiotensin receptor blockers , beta blockers , and aldosterone antagonists ) at hospital discharge . to avoid case - wise deletion ,
missing values were imputed using approaches that varied based on the proportion of missing values .
variables were generally missing infrequently ( < 2.2% ) ; in these cases , continuous variables were imputed using the median value of known measurements in the population , and categorical variables were imputed as the most common response in the population . because qrs morphology and qrs duration were missing more frequently ( 12% ) , a dummy variable for missing status was used in structuring these variables as candidates for the multivariable models.18 baseline data are presented as proportions for categorical variables and as means with sds for continuous variables .
comparisons of variables in sex and age strata were performed using chi - square tests for categorical variables and student t tests for continuous variables . for the death and hospitalization outcomes , crude rates of events
were calculated per 1000 person - years of follow - up with associated 95% cis .
time - to - event analysis was performed with log - rank tests to compare actuarial survival rates between respective comparison groups .
bivariate associations with p<0.20 were included in multivariable analyses after removing any potentially collinear variables . in each case , collinearity among candidate variables was examined using eigenvalues obtained through principal component analysis . from the principal component results ,
conditional indices > 3 were considered potentially collinear . the corresponding covariates were examined for collinearity in the multivariable model . if including both covariates resulted in instability in estimates or variance , the variable with the stronger bivariate association with the outcome was retained as a candidate . for death and the hospitalization outcomes ,
multivariable survival analysis was performed using cox proportional hazards regression . in cox models for death
, patients were censored at the time of last documented encounter regardless of the continuity of health plan enrollment ; for the hospitalization outcome , patients were censored at the time of first health plan disenrollment or death .
all multivariable models accounted for the clustering of patients by site . for hospitalizations , a random - site effect was included in the multivariable cox models . for mortality ,
a fixed - site effect was included in the multivariable cox models because of lack of convergence of a random - effects model . for complications ,
generalized estimating equations were used in logistic models , with site treated as a random effect . in all multivariable models , age , sex , lvef , nyha symptom status , and etiology of lvsd were included . to test for variability in relationships of age and sex to these outcomes , interaction terms between either age or sex with 3 dichotomous variables reflecting heart failure status ( nyha class
i to ii versus iii to iv , lvef < 0.30 versus 0.30 to 0.35 , and ischemic versus nonischemic etiology ) were tested individually within the outcome models in which a significant primary age or sex association was identified .
we used sas version 9.2 and 9.3 ( sas institute inc ) for all analyses .
this study was funded by the agency for healthcare research and quality ; the national heart , lung , and blood institute of the nih ; and the american college of cardiology foundation . the study was reviewed and approved by the research and publications committee of the ncdr icd registry .
the cvrn ls - icd has been described in detail previously.5 the data for this study were derived from 2 sources .
data on icd eligibility , clinical characteristics , and device and provider details were collected from the national cardiovascular data registry ( ncdr ) icd registry , a national registry that was formed as part of a coverage - with - evidence requirement of the centers for medicare and medicaid services.13 the ncdr implements a rigorous data - quality program that includes data and range checks , outlier analysis , and random audits.14 data on outcomes including device - related complications , hospitalization , and death were obtained from the cvrn virtual data warehouse ( vdw ) , a standardized repository of clinically enriched administrative data generated in a distributed fashion using identical protocols at each participating health plan.15 institutional review boards at participating sites approved the study .
we identified 3649 consecutive adult patients ( aged > 18 years ) undergoing first - time icd implantation for the primary prevention of sudden cardiac death in 15 hospitals within 7 integrated health systems in the cvrn between january 1 , 2006 , and december 31 , 2010 .
we excluded patients not enrolled in 1 of the 7 cvrn health plans at the time of implantation ( n=610 ) and those with a left ventricular ejection fraction ( lvef ) > 0.35 ( n=85 ) .
the study cohort , when compared with patients not enrolled , were older on average ( median age 69 versus 67 years , p<0.001 ) , included a lower proportion of women ( 25.8% versus 30.2% , p=0.02 ) , were more often white ( 63.0% versus 43.7% , p<0.001 ) , and had new york heart association ( nyha ) i to ii symptoms more often ( 61.5% versus 49.3% , p<0.001 ) .
the end points included time to death from any cause , time to hospitalization from any cause and from heart failure , and device - related complications within the first 90 days after implantation .
death was ascertained through the vdw , which uses health system databases , social security administration vital status files , and state death certificate registries , depending on the participating cvrn site .
hospitalizations were assessed using the vdw , which includes admission and discharge dates and diagnoses for all hospitalizations . because health plans are responsible for coverage of all health services for members , hospitalizations outside of health plan facilities
hospitalizations for heart failure were identified using the principal discharge diagnosis for heart failure ( table1 ) , an approach that has been applied widely in studies of heart failure.16 follow - up for death and hospitalization was obtained through december 31 , 2011 , providing up to 6 years of follow - up .
icd-9-cm , cpt , and hcpsc codes used to ascertain clinical events in the cardiovascular research network virtual data warehouse cpt indicates current procedural terminology codes ; hcpcs , healthcare common procedure coding system ; icd-9-cm , international classification of diseases , ninth revision , clinical modification . to ascertain hospitalizations attributed to heart failure , only the principal discharge diagnosis was considered .
device - related complications were ascertained using a modification of the approach developed for purposes of reporting complications after icd implantation used for hospital public reporting.17 this approach applies a variable ascertainment time frame ( either 30 or 90 days ) depending on the complication .
we identified events using codes from the international classification of diseases , ninth revision , clinical modification ; the current procedural terminology ; and the healthcare common procedure coding system , in any position on an inpatient claim ( table1 ) .
complications ascertained over the first 30 days after icd implantation included pneumothorax or hemothorax requiring a chest tube , hematoma requiring transfusion or evacuation , cardiac tamponade or pericardiocentesis , or death .
complications ascertained over the first 90 days included device - related infection and mechanical complications of the icd requiring system revision and device reimplantation . those patients with incomplete follow - up data for the complications end point ( n=72 )
patient characteristics included demographics ( age , sex , and race or ethnicity ) , cardiovascular history ( nyha class , lvef , ischemic heart disease , nonischemic cardiomyopathy , atrial fibrillation ) , noncardiovascular comorbidities , laboratory values ( blood urea nitrogen , hemoglobin , and creatinine ) at the time of implantation , electrocardiographic findings ( qrs morphology and duration ) , and device type . for the death and hospitalization end points , we also considered the prescription of medications for heart failure known to influence heart failure outcomes ( angiotensin - converting enzyme inhibitors or angiotensin receptor blockers , beta blockers , and aldosterone antagonists ) at hospital discharge . to avoid case - wise deletion ,
missing values were imputed using approaches that varied based on the proportion of missing values .
variables were generally missing infrequently ( < 2.2% ) ; in these cases , continuous variables were imputed using the median value of known measurements in the population , and categorical variables were imputed as the most common response in the population . because qrs morphology and qrs duration were missing more frequently ( 12% ) , a dummy variable for missing status was used in structuring these variables as candidates for the multivariable models.18
baseline data are presented as proportions for categorical variables and as means with sds for continuous variables .
comparisons of variables in sex and age strata were performed using chi - square tests for categorical variables and student t tests for continuous variables . for the death and hospitalization outcomes , crude rates of events
were calculated per 1000 person - years of follow - up with associated 95% cis .
time - to - event analysis was performed with log - rank tests to compare actuarial survival rates between respective comparison groups .
bivariate associations with p<0.20 were included in multivariable analyses after removing any potentially collinear variables . in each case , collinearity among candidate variables was examined using eigenvalues obtained through principal component analysis . from the principal component results ,
the corresponding covariates were examined for collinearity in the multivariable model . if including both covariates resulted in instability in estimates or variance , the variable with the stronger bivariate association with the outcome was retained as a candidate . for death and the hospitalization outcomes ,
multivariable survival analysis was performed using cox proportional hazards regression . in cox models for death ,
patients were censored at the time of last documented encounter regardless of the continuity of health plan enrollment ; for the hospitalization outcome , patients were censored at the time of first health plan disenrollment or death .
all multivariable models accounted for the clustering of patients by site . for hospitalizations , a random - site effect was included in the multivariable cox models . for mortality ,
a fixed - site effect was included in the multivariable cox models because of lack of convergence of a random - effects model . for complications ,
generalized estimating equations were used in logistic models , with site treated as a random effect . in all multivariable models , age , sex , lvef , nyha symptom status , and etiology of lvsd were included . to test for variability in relationships of age and sex to these outcomes , interaction terms between either age or sex with 3 dichotomous variables reflecting heart failure status ( nyha class
i to ii versus iii to iv , lvef < 0.30 versus 0.30 to 0.35 , and ischemic versus nonischemic etiology ) were tested individually within the outcome models in which a significant primary age or sex association was identified .
we used sas version 9.2 and 9.3 ( sas institute inc ) for all analyses .
this study was funded by the agency for healthcare research and quality ; the national heart , lung , and blood institute of the nih ; and the american college of cardiology foundation .
the study was reviewed and approved by the research and publications committee of the ncdr icd registry .
the study population consisted of 2954 patients receiving an icd for primary prevention ; 769 ( 26.0% ) were women , and 1827 ( 61.8% ) were aged > 65 years ( table2 ) .
compared with men , women were less frequently white ( 58.5% versus 64.3% , p<0.001 ) , more likely to have advanced heart failure symptoms ( 48.0% with nyha classification iii or iv versus 35.2% , p<0.001 ) , less likely to have a history of atrial fibrillation ( 23.5% versus 35.1% , p<0.001 ) , and less likely to have ischemic cardiomyopathy ( 44.1% versus 68.5% , p<0.001 ) .
study population characteristics and according to sex and age ace indicates angiotensin - converting enzyme ; arb , angiotensin receptor blocker ; crt - d , cardiac resynchronization therapy with defibrillator ; gfr , estimated glomerular filtration rate ; lvef , left ventricular ejection fraction ; nyha , new york heart association . compared with younger patients , those aged > 65 years were more likely to have advanced heart failure symptoms ( 41.2% versus 34.3% , p<0.001 ) ; were more frequently white ( 68.1% versus 54.2% , p<0.001 ) ; and had a higher prevalence of coexisting conditions , including atrial fibrillation ( 38.0% versus 22.5% , p<0.001 ) , hypertension ( 79.6% versus 63.3% , p<0.001 ) , and chronic lung disease ( 21.8% versus 16.9% , p<0.001 ) .
older patients were more likely to have ischemic cardiomyopathy ( 70.1% versus 49.3% , p<0.001 ) .
the crude incidence rates , unadjusted risks , and adjusted risks for adverse outcomes in the total cohort and in patients further stratified by age and sex are shown in table3 .
the median duration of enrollment was 2.4 years ( interquartile range 1.3 to 3.8 years ) .
the incidence rate of death was 110 per 1000 patient - years , which was lower in women compared with men ( crude incidence 86 versus 118 , adjusted hazard ratio [ hr ] 0.67 , 95% ci 0.56 to 0.80 ) and higher in patients aged > 65 years compared with younger patients ( crude incidence 133 versus 67 , adjusted hr 1.55 , 95% ci 1.30 to 1.86 ) .
the incidence rate of all - cause hospitalization was 438 per 1000 patient - years and did not differ significantly between men and women or between younger and older patients .
the incidence rate of hospitalization for heart failure was 111 per 1000 patient - years , which was lower in women compared with men ( crude incidence rates 102 versus 115 , adjusted hr 0.82 , 95% ci 0.68 to 0.98 ) and higher in older compared with younger patients ( crude incidence rates 127 versus 84 , adjusted hr 1.25 , 95% ci 1.05 to 1.49 ) .
the overall proportion of patients who developed any device - related complication was 8.36% and was higher in women than in men ( crude proportions 10.74% versus 7.52% , adjusted odds ratio 1.38 , 95% ci 1.01 to 1.90 ) .
with respect to individual complications , women had a significantly higher risk of tamponade ( 1.89% versus 0.47% , p<0.001 ) ; the sex differences in risks of other complications were not statistically significant ( table4 ) .
older patients had a significantly higher risk of hematoma requiring evacuation or transfusion compared with younger patients ( 1.01% versus 0.27% , p=0.03 ) .
the rates of complications varied by device type ( single lead 4.63% , dual lead 8.34% , and cardiac resynchronization therapy
defibrillator 12.20% ; p<0.001 ) and were generally higher in women than in men across device types , although the device - specific differences in complications by sex were statistically significant among single - lead devices ( table5 ) .
none of the comparisons of the differences in complication rates by device were statistically significant between age groups .
event rates and risk ratios according to age and sex fully adjusted multivariable models included the following variables for each outcome in addition to accounting for clustering of patients by cardiovascular research network site .
death : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs non - ischemic ) , new york heart association symptom classification , blood urea nitrogen , atrial fibrillation , diabetes , hypertension , chronic lung disease , hemoglobin , qrs duration , icd device type , ace / arb therapy , and beta blocker .
all - cause hospitalization : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs nonischemic ) , new york heart association symptom classification , race , atrial fibrillation , diabetes , hypertension , lung disease , estimated glomerular filtration rate , blood urea nitrogen , hemoglobin , icd device type , qrs duration , ace / arb therapy , and beta blocker . heart failure hospitalization : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs nonischemic ) , new york heart association symptom classification , race , atrial fibrillation , diabetes , hypertension , lung disease , estimated glomerular filtration rate , blood urea nitrogen , hemoglobin , icd device type , qrs duration , ace / arb therapy , and aldosterone antagonist .
complications : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs non - ischemic ) , new york heart association symptom classification , atrial fibrillation , diabetes , blood urea nitrogen , hemoglobin , icd device type , left bundle branch block , and qrs duration .
ace indicates angiotensin - converting enzyme ; arb , angiotensin receptor blocker ; icd , implantable cardioverter - defibrillator .
rates expressed as incidence per 1000 patient - years ; ratios expressed as hazard ratios with 95% cis .
rates of individual device - related complications by sex and age ascertained over 30 days after icd implantation .
rates of device - related complications by sex and age stratified by device type crt - d indicates cardiac resynchronization therapy with defibrillator .
rates of individual device - related complications stratified by device type crt - d indicates cardiac resynchronization therapy with defibrillator . ascertained over 30 days after icd implantation . ascertained over 90 days after icd implantation .
differences in study outcomes were stratified by nyha symptom status , lvef , and etiology of lvsd when the principal age or sex relationship was significant ( figures1a through 1c and 2a and 2b ) .
the interactions between sex and these heart failure characteristics were not statistically significant , with 2 exceptions .
first , women had a higher risk of complications compared with men in the stratum of patients with nyha i to ii symptoms ( women versus men : hr 1.94 , 95% ci 1.26 to 3.01 ) versus those with iii to iv symptoms ( hr 1.03 , 95% ci 0.68 to 1.57 ; sex nyha interaction , p=0.03 ) ( figure 1c ) .
second , older patients had a higher risk of heart failure hospitalizations compared with younger patients in the stratum of patients with ischemic cardiomyopathy ( aged > 65 versus 65 years : hr 1.46 , 95% ci 1.15 to 1.85 ) versus those with nonischemic cardiomyopathy ( hr 1.03 , 95% ci 0.80 to 1.34 ; age
outcomes comparing women with men in strata according to nyha symptom status , lvef , and etiology of left ventricular systolic dysfunction ( a , mortality ; b , heart failure hospitalization ; c , complications ) .
all interaction terms are not significant except for the interaction between sex and nyha in the complications model ( c , p=03 ) .
hr indicates hazard ratio ; lvef , left ventricular ejection fraction ; nidcm , nonischemic dilated cardiomyopathy ; nyha , new york heart association ; or , odds ratio . outcomes comparing patients aged > 65 years compared with those aged 65 years in strata according to nyha symptom status , lvef , and etiology of left ventricular systolic dysfunction ( a , mortality ; b , heart failure hospitalization ) .
hr > 1 indicates a higher risk in patients aged > 65 years compared with younger patients .
all interaction terms are not significant except for the interaction between age and etiology ( nonischemic vs ischemic ) in the hospitalizations model ( b , p=0.05 ) .
hr indicates hazard ratio ; lvef , left ventricular ejection fraction ; nidcm , nonischemic dilated cardiomyopathy ; nyha , new york heart association .
the study population consisted of 2954 patients receiving an icd for primary prevention ; 769 ( 26.0% ) were women , and 1827 ( 61.8% ) were aged > 65 years ( table2 ) .
compared with men , women were less frequently white ( 58.5% versus 64.3% , p<0.001 ) , more likely to have advanced heart failure symptoms ( 48.0% with nyha classification iii or iv versus 35.2% , p<0.001 ) , less likely to have a history of atrial fibrillation ( 23.5% versus 35.1% , p<0.001 ) , and less likely to have ischemic cardiomyopathy ( 44.1% versus 68.5% , p<0.001 ) .
study population characteristics and according to sex and age ace indicates angiotensin - converting enzyme ; arb , angiotensin receptor blocker ; crt - d , cardiac resynchronization therapy with defibrillator ; gfr , estimated glomerular filtration rate ; lvef , left ventricular ejection fraction ; nyha , new york heart association . compared with younger patients , those aged > 65 years were more likely to have advanced heart failure symptoms ( 41.2% versus 34.3% , p<0.001 ) ; were more frequently white ( 68.1% versus 54.2% , p<0.001 ) ; and had a higher prevalence of coexisting conditions , including atrial fibrillation ( 38.0% versus 22.5% , p<0.001 ) , hypertension ( 79.6% versus 63.3% , p<0.001 ) , and chronic lung disease ( 21.8% versus 16.9% , p<0.001 ) .
older patients were more likely to have ischemic cardiomyopathy ( 70.1% versus 49.3% , p<0.001 ) .
the crude incidence rates , unadjusted risks , and adjusted risks for adverse outcomes in the total cohort and in patients further stratified by age and sex are shown in table3 .
the median duration of enrollment was 2.4 years ( interquartile range 1.3 to 3.8 years ) .
the incidence rate of death was 110 per 1000 patient - years , which was lower in women compared with men ( crude incidence 86 versus 118 , adjusted hazard ratio [ hr ] 0.67 , 95% ci 0.56 to 0.80 ) and higher in patients aged > 65 years compared with younger patients ( crude incidence 133 versus 67 , adjusted hr 1.55 , 95% ci 1.30 to 1.86 ) . the incidence rate of all - cause hospitalization was 438 per 1000 patient - years and did not differ significantly between men and women or between younger and older patients .
the incidence rate of hospitalization for heart failure was 111 per 1000 patient - years , which was lower in women compared with men ( crude incidence rates 102 versus 115 , adjusted hr 0.82 , 95% ci 0.68 to 0.98 ) and higher in older compared with younger patients ( crude incidence rates 127 versus 84 , adjusted hr 1.25 , 95% ci 1.05 to 1.49 ) .
the overall proportion of patients who developed any device - related complication was 8.36% and was higher in women than in men ( crude proportions 10.74% versus 7.52% , adjusted odds ratio 1.38 , 95% ci 1.01 to 1.90 ) .
with respect to individual complications , women had a significantly higher risk of tamponade ( 1.89% versus 0.47% , p<0.001 ) ; the sex differences in risks of other complications were not statistically significant ( table4 ) .
older patients had a significantly higher risk of hematoma requiring evacuation or transfusion compared with younger patients ( 1.01% versus 0.27% , p=0.03 ) .
the rates of complications varied by device type ( single lead 4.63% , dual lead 8.34% , and cardiac resynchronization therapy
defibrillator 12.20% ; p<0.001 ) and were generally higher in women than in men across device types , although the device - specific differences in complications by sex were statistically significant among single - lead devices ( table5 ) .
none of the comparisons of the differences in complication rates by device were statistically significant between age groups .
event rates and risk ratios according to age and sex fully adjusted multivariable models included the following variables for each outcome in addition to accounting for clustering of patients by cardiovascular research network site .
death : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs non - ischemic ) , new york heart association symptom classification , blood urea nitrogen , atrial fibrillation , diabetes , hypertension , chronic lung disease , hemoglobin , qrs duration , icd device type , ace / arb therapy , and beta blocker .
all - cause hospitalization : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs nonischemic ) , new york heart association symptom classification , race , atrial fibrillation , diabetes , hypertension , lung disease , estimated glomerular filtration rate , blood urea nitrogen , hemoglobin , icd device type , qrs duration , ace / arb therapy , and beta blocker .
heart failure hospitalization : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs nonischemic ) , new york heart association symptom classification , race , atrial fibrillation , diabetes , hypertension , lung disease , estimated glomerular filtration rate , blood urea nitrogen , hemoglobin , icd device type , qrs duration , ace / arb therapy , and aldosterone antagonist .
complications : left ventricular ejection fraction , etiology of cardiomyopathy ( ischemic vs non - ischemic ) , new york heart association symptom classification , atrial fibrillation , diabetes , blood urea nitrogen , hemoglobin , icd device type , left bundle branch block , and qrs duration .
ace indicates angiotensin - converting enzyme ; arb , angiotensin receptor blocker ; icd , implantable cardioverter - defibrillator .
rates expressed as incidence per 1000 patient - years ; ratios expressed as hazard ratios with 95% cis .
rates of individual device - related complications by sex and age ascertained over 30 days after icd implantation .
rates of device - related complications by sex and age stratified by device type crt - d indicates cardiac resynchronization therapy with defibrillator .
rates of individual device - related complications stratified by device type crt - d indicates cardiac resynchronization therapy with defibrillator . ascertained over 30 days after icd implantation . ascertained over 90 days after icd implantation .
differences in study outcomes were stratified by nyha symptom status , lvef , and etiology of lvsd when the principal age or sex relationship was significant ( figures1a through 1c and 2a and 2b ) .
the interactions between sex and these heart failure characteristics were not statistically significant , with 2 exceptions .
first , women had a higher risk of complications compared with men in the stratum of patients with nyha i to ii symptoms ( women versus men : hr 1.94 , 95% ci 1.26 to 3.01 ) versus those with iii to iv symptoms ( hr 1.03 , 95% ci 0.68 to 1.57 ; sex nyha interaction , p=0.03 ) ( figure 1c ) .
second , older patients had a higher risk of heart failure hospitalizations compared with younger patients in the stratum of patients with ischemic cardiomyopathy ( aged > 65 versus 65 years : hr 1.46 , 95% ci 1.15 to 1.85 ) versus those with nonischemic cardiomyopathy ( hr 1.03 , 95% ci 0.80 to 1.34 ; age
outcomes comparing women with men in strata according to nyha symptom status , lvef , and etiology of left ventricular systolic dysfunction ( a , mortality ; b , heart failure hospitalization ; c , complications ) .
all interaction terms are not significant except for the interaction between sex and nyha in the complications model ( c , p=03 ) .
hr indicates hazard ratio ; lvef , left ventricular ejection fraction ; nidcm , nonischemic dilated cardiomyopathy ; nyha , new york heart association ; or , odds ratio .
outcomes comparing patients aged > 65 years compared with those aged 65 years in strata according to nyha symptom status , lvef , and etiology of left ventricular systolic dysfunction ( a , mortality ; b , heart failure hospitalization ) .
hr > 1 indicates a higher risk in patients aged > 65 years compared with younger patients .
all interaction terms are not significant except for the interaction between age and etiology ( nonischemic vs ischemic ) in the hospitalizations model ( b , p=0.05 ) .
hr indicates hazard ratio ; lvef , left ventricular ejection fraction ; nidcm , nonischemic dilated cardiomyopathy ; nyha , new york heart association .
in this study of a community - based cohort of patients with lvsd receiving an icd for primary prevention , the burden of adverse outcomes , including death and hospitalization for heart failure over 3 years , was substantial and varied by age and sex .
after accounting for differences in other characteristics , women had a lower risk of death and hospitalization for heart failure than men and higher risks of device - related complications .
older patients had higher risks of death and heart failure related hospitalizations but not for all - cause hospitalizations .
the age and sex differences in these outcomes generally did not vary by severity of heart failure symptoms , etiology of systolic dysfunction , or lvef .
the results of this study provide estimates of the risks of several clinically important adverse outcomes in contemporary practice .
these data can inform the decision - making process and the design of trials of therapies in the growing population of patients receiving icd therapy .
furthermore , the results of this multisite longitudinal study provide greater context for understanding sex- and age - related differences in this high - risk patient population . the results of this observational study provide estimates of the risks of adverse outcomes in a demographically diverse population with high rates of guideline - recommended medical therapies for lvsd receiving an icd for primary prevention with long - term follow - up for a wide variety of outcomes important to patients .
although several prior studies have focused on outcomes in this population , these studies have been limited by the lack of heterogeneity of the study population with respect to age or sex , the lack of follow - up beyond 1 year , and the availability of follow - up in patients across a limited age spectrum or by the inability to characterize outcomes other than death.611 the results of this study suggest that in this diverse population of patients with systolic dysfunction who are treated with an icd , the risks of adverse outcomes other than death are high , including a substantial burden of hospitalization across patient strata during long - term follow - up after device implantation .
the randomized trials of icd therapy for primary prevention that underlie current guideline recommendations enrolled younger patients and few women.24 moreover , because a number of these trials were published > 2 decades ago , therapy for patients with heart failure has evolved substantially , the estimates of outcomes from these trials are of limited value , particularly in these important demographic groups . although a number of observational studies have focused on outcomes after icd implantation , in some cases these studies are also limited because of a lack of contemporary data , relatively limited follow - up , or a primary focus on death . because of the diversity of the cvrn cohort , we were able to characterize sex- and age - specific risks of death , hospitalization , and device - related complications .
studies of sex differences in clinically meaningful long - term outcomes after icd placement have been conflicting , perhaps in part due to differences in study design , population , time period , and length of follow - up .
post hoc analyses of individual randomized trials have shown variable differences in mortality based on patient sex1921 ; a meta - analysis of the major primary prevention trials found no sex - based differences in mortality between men and women.22 because of the differences between the populations enrolled in trials and those receiving icd therapy in practice,5 observational studies provide complementary information .
although the finding of a lower risk of death among women in our study is similar to that of a prior single - center study of women receiving primary - prevention devices , other studies have found no mortality differences.7,8,12,23 prior studies , however , have been heterogeneous and have included patients receiving icds for both primary and secondary prevention or focused on older patients with a shorter time frame of follow - up , possibly influencing the frequency and correlates of adverse outcomes .
the relationship between sex and hospitalizations has not been the frequent focus of other investigations ; although a recent study from the ncdr identified a higher risk of hospitalizations for women , this study was conducted in an older cohort followed for 6 months and did not include cardiac resynchronization therapy devices.12 women have been noted to be at consistently higher risk for icd - related complications.12,23,24 the current study provides an estimate of the magnitude of these differences in a contemporary population , including the differences across the spectrum of the devices commonly used in clinical practice .
not surprisingly , age has been identified as an important determinant of adverse outcomes in a wide variety of cardiovascular conditions ; however , the data generated in this study are important because they provide contemporary estimates of the magnitude of the age - associated risks for a broad variety of outcomes with long - term follow - up . in a cohort from ontario , canada , including patients receiving both primary and secondary prevention icd therapy , advanced age was an important risk factor for death and hospitalization.25 the death rates in that cohort were somewhat lower than in this study . although the cardiovascular characteristics of the populations of our study and that from ontario were similar , the burden of comorbidities was greater in the cvrn cohort .
in addition , the follow - up in the current study was , on average > 1 year longer .
rates of all - cause and heart failure related hospitalizations were not reported in the ontario study , limiting comparisons with our study . despite observed increases in the risk of death with older age ,
analyses of data from published randomized trials have not identified clear evidence that effectiveness of icd therapy among eligible patients is sensitive to age.26 nonetheless , the rates of adverse outcomes in the demographically diverse population of this study provide a perspective in terms of what patients might expect after icd implantation and emphasize the need for additional effective therapies and treatment strategies to reduce the longer term risks of death or hospitalization .
reasons for age and sex differences in outcomes after icd implantation are not clear . with regard to sex ,
proposed mechanisms range from inherent biological differences to differences in the severity of heart failure in patients receiving this therapy .
some data suggest , for example , important biological differences between men and women that could result in lower risks of death associated with lvsd in women.27 this sex variability could also reflect differences in heart failure severity or the extent and etiology of lvsd of patients who are selected for icd therapy .
women , for example , might have better survival if they have less advanced heart failure than men when they are identified for icd therapy ; however , in our patient cohort , this was not the case because a higher proportion of women in the cvrn cohort had advanced heart failure symptoms . with regard to age
, older patients may have competing causes of death that would render icds less effective , especially in those with less severe heart failure .
the age and sex differences observed in this study persisted after accounting for a wide variety of factors and did not vary according to the burden of heart failure symptoms , severity of lvsd , or etiology of heart failure .
. better understanding of the underlying reasons for these differences could refine the identification of patients who might derive maximal benefit from icd therapy .
certain factors should be considered in the interpretation of the results of this study . because all patients received an icd , it was not possible to estimate differences in outcomes associated with the icd therapy itself . in an observational context , identifying suitable untreated control groups
nonetheless , characterizing the risks of adverse outcomes is pertinent to the growing population of patients receiving icd therapy for primary prevention in contemporary practice .
in addition , the study sample was identified from integrated health plans and thus may not be representative of some patient populations such as the uninsured ; however , the population was demographically diverse , with robust representation of women , racial and ethnic minorities , and elderly patients and similar to larger us populations of patients receiving an icd for primary prevention.5 in this cohort study of a diverse population of patients with lvsd receiving an icd for primary prevention , the burden of adverse outcomes in the 3 years following device implantation was substantial and varied importantly by age and sex . observed age and sex differences were generally consistent across the spectrum of heart failure symptoms , left ventricular systolic function , and heart failure etiology .
the risks of death , hospitalization , and device - related complications delineated in this study are important to the large population of patients with lvsd who are considering icd therapy for primary prevention , to the clinicians caring for them , and to investigators interested in understanding the risks of clinically meaningful outcomes in the growing population of patients receiving this potentially life - saving therapy .
290 - 05 - 0033 from the agency for healthcare research and quality , us department of health and human services as part of the developing evidence to inform decisions about effectiveness ( decide ) program ; and by the american college of cardiology foundation ; with support from the national heart , lung , and blood institute ( u19hl091179 ) .
although the sponsoring organizations have been involved in discussions of this research as it has progressed and have provided oversight and guidance , the authors of this report are solely responsible for its content . sponsorship may not be construed as an endorsement of all statements in the report by the agency for healthcare research and quality , the national heart , lung , and blood institute , the us department of health and human services or the american college of cardiology foundation .
dr peterson is supported by funding from agency for healthcare research and quality ( k08hs019814 ) .
dr masoudi has a contract with the american college of cardiology for his role as the senior medical officer of the national cardiovascular data registries .
dr gupta serves as local site pi on multi - center clinical trials sponsored by st . | backgroundpatient sex and age may influence rates of death after receiving an implantable cardioverter - defibrillator for primary prevention .
differences in outcomes other than mortality and whether these differences vary by heart failure symptoms , etiology , and left ventricular ejection fraction are not well characterized.methods and resultswe studied 2954 patients with left ventricular ejection fraction 0.35 undergoing first - time implantable cardioverter - defibrillator for primary prevention within the cardiovascular research network ; 769 patients ( 26% ) were women , and 2827 ( 62% ) were aged > 65 years . in a median follow - up of 2.4 years
, outcome rates per 1000 patient - years were 109 for death , 438 for hospitalization , and 111 for heart failure hospitalizations .
procedure - related complications occurred in 8.36% .
in multivariable models , women had significantly lower risks of death ( hazard ratio 0.67 , 95% ci 0.56 to 0.80 ) and heart failure hospitalization ( hazard ratio 0.82 , 95% ci 0.68 to 0.98 ) and higher risks for complications ( hazard ratio 1.38 , 95% ci 1.01 to 1.90 ) than men ; patients aged > 65 years had higher risks of death ( hazard ratio 1.55 , 95% ci 1.30 to 1.86 ) and heart failure hospitalization ( hazard ratio 1.25 , 95% ci 1.05 to 1.49 ) than younger patients . age and sex differences were generally consistent in strata according to symptoms , etiology , and severity of left ventricular systolic dysfunction , except the higher risk of complications in women , which differed by new york heart association classification ( p=0.03 for sex new york heart association interaction ) , and the risk of heart failure hospitalization in older patients , which differed by etiology of heart failure ( p=0.05 for age
etiology interaction).conclusionsthe burden of adverse outcomes after receipt of an implantable cardioverter - defibrillator for primary prevention is substantial and varies according to patient age and sex .
these differences in outcome generally do not vary according to baseline heart failure characteristics . |
blunt trauma to the gallbladder is a rare entity , particularly when no other organ is injured . in isolated blunt traumatic injury to the gallbladder , treatment options vary depending on the specific injury . the types of blunt trauma injuries to the gallbladder and their appropriate management are discussed .
a passenger admitted after a high - speed front - end motor vehicle crash was safely managed with laparoscopic surgery for a rare case of isolated gallbladder trauma .
the preoperative and operative management are discussed as well as the application of minimally invasive surgery for this rare process .
minimally invasive techniques may be safely applied to blunt trauma of the gallbladder in certain circumstances .
perceived shortcomings of laparoscopy for the detection and management of traumatic injuries include inadequate visualization and altered tactile haptic feedback , which might increase the risk of missed injuries and affect patient morbidity and mortality .
we report a case of traumatic gallbladder injury from blunt abdominal trauma that was diagnosed preoperatively and safely treated with laparoscopic cholecystectomy .
a 35-year - old female was the restrained front - seat passenger in a high - speed motor vehicle collision .
on arrival to the trauma center , she was awake and alert with a glasgow coma score of 15 and complaints of right upper quadrant ( ruq ) abdominal pain .
a physical examination of her abdomen revealed a soft , nondistended abdomen with moderate ruq tenderness but no palpable mass or signs of peritoneal irritation .
plain radiographs of the cervical spine , chest , and pelvis showed no evidence of acute injury .
laboratory findings were within normal limits , with the exception of a hemoglobin of 10.0 mg / dl .
computerized tomography of the abdomen showed a massively dilated gallbladder with pericholecystic fluid and heterogeneous intraluminal fluid consistent with blood and thrombus ( figure 1 ) . while under observation , the patient developed increasing ruq pain and localized peritonitis .
laparoscopy revealed a massively dilated gallbladder without evidence of hepatic , duodenal , or pancreatic injury ( figure 2 ) .
gross inspection of the specimen showed a markedly enlarged gallbladder filled with thrombus without evidence of cholelithiasis ( figure 3 ) .
although the gallbladder is the most commonly injured segment of the extrahepatic biliary tree , trauma to this organ is a rare entity , comprising only 0.5% to 0.6% of all traumatic intraabdominal injuries .
factors believed to predispose the gallbladder to blunt injury include a thin gallbladder wall , postprandial distention , and alcohol ingestion .
in blunt trauma , associated intraabdominal injuries particularly to the liver , spleen , and duodenum are common .
an average of greater than 3 intraabdominal injuries per patient was reported in 1 series .
several classification systems have been reported in the literature to describe the spectrum of injury that may occur to the gallbladder .
none has gained widespread use or acceptance perhaps because of the rare nature of the injury and the lack of a clear continuum of injury as seen in the grading systems of solid organs . rather than conceptualize a spectrum of injury to the gallbladder
, it may be more appropriate to define 4 separate patterns of injury : contusion , perforation , avulsion , and traumatic hemorrhagic cholecystitis .
gallbladder contusion represents isolated injury to the gallbladder wall and may be associated with intramural hemorrhage .
the progression of an area of contusion to ischemia and necrosis with perforation has been reported , but probably represents a very rare event .
free perforation of the gallbladder with extravasation of bile into the peritoneal cavity is seen most commonly .
gallbladder avulsion may be partial , with some degree of attachment to the gallbladder fossa , or complete , with complete separation of the gallbladder from the liver bed .
complete separation of the gallbladder from the liver with division of the cystic duct and artery has been described as
traumatic hemorrhagic cholecystitis , as we have described in this report , has been described previously , and represents either direct hemorrhage into the gallbladder from injury to the wall or mucosa or hemorrhage into the biliary tree with reflux of blood into the gallbladder .
most often , cholecystectomy is undertaken at the time of open laparotomy for other associated injuries .
intraoperative evaluation of the biliary tree is imperative to rule out concomitant bile duct injury .
we have demonstrated that laparoscopic surgical techniques may be safely used in instances where the likelihood of associated injuries is low , and definitive treatment can be rendered without increasing patient morbidity and mortality . | background and objectives : blunt trauma to the gallbladder is a rare entity , particularly when no other organ is injured . in isolated blunt traumatic injury to the gallbladder , treatment options vary depending on the specific injury . the types of blunt trauma injuries to the gallbladder and their appropriate management are discussed .
in addition , a case successfully managed with minimally invasive techniques is presented.methods:a passenger admitted after a high - speed front - end motor vehicle crash was safely managed with laparoscopic surgery for a rare case of isolated gallbladder trauma .
the preoperative and operative management are discussed as well as the application of minimally invasive surgery for this rare process.results:laparoscopic cholecystectomy was performed successfully .
the patient did well postoperatively with no complications .
no other injuries were identified at the time of laparoscopy.conclusion:minimally invasive techniques may be safely applied to blunt trauma of the gallbladder in certain circumstances . |
synthetic pyrethroidal compounds undergo biodegradation in mammals both oxidatively and hydrolytically , and depending on the type of compound , either of the pathways may predominate . thus , ( + ) - or ( + /-
) -trans isomers of the chrysanthemumate ester of primary alcohols such as fenothrin , furamethrin , proparthrin , resmethrin , and tetramethrin ( and possibly permethrin , too ) are metabolized mainly through hydrolysis of the ester linkage , with subsequent oxidation and/or conjugation of the component alcohol and acid moieties . on the other hand ,
the corresponding ( + ) -cis enantiometers and chrysanthemumate of secondary alcohols like allethrin are resistant to hydrolytic attack , and biodegraded via oxidation at various sites of the molecule .
these rapid metabolic degradations , together with the presumable incomplete absorption from the gastrointestinal tract , would generally contribute to the low acute toxicity of synthetic pyrethroids .
these compounds are neither skin irritants nor skin sensitizers , and inhalation toxicity as well as dermal toxicity are fairly low . neither is teratogenic in rats , mice , and/or rabbits or mutagenic on various bacterial strains .
subacute and chronic feeding of higher amounts of the compounds to rats invariably causes some histopathological changes in liver ; however , these are neither indicative nor suggestive of tumorigenicity . based on existing toxicological information , the present recommended use patterns might afford sufficient safety margin on human population .
however , in extending usage to agricultural pest control , much more extensive investigations should be forthcoming from both chemical and biological aspects , since there is scant information on the fate of these pyrethroids in the environment
. also several of the compounds may be very toxic to certain kinds of fish and arthropods.imagesfigure 2 . |
|
mesothelial cells , the progenitor cells of the asbestos - induced tumor mesothelioma , are particularly sensitive to the toxic effects of asbestos , although the molecular mechanisms by which asbestos induces injury in mesothelial cells are not known .
we asked whether asbestos induced apoptosis in mesothelial cells and whether reactive oxygen species were important .
rabbit pleural mesothelial cells were exposed to crocidolite asbestos or control particles ( 1 - 10 micrograms / cm2 ) over 24 hr and evaluated for oligonucleosomal dna fragmentation , loss of membrane phospholipid asymmetry , and nuclear condensation .
asbestos fibers , not control particles , induced apoptosis in mesothelial cells by all assays .
induction of apoptosis was dose dependent ; crocidolite ( 5 micrograms / cm2 ) induced apoptosis ( 15.0 + /-
1.1% , mean + /-
se ; n = 12 ) versus control particles ( < 4% ) , as measured by appearance of nuclear condensation .
apoptosis induced by asbestos , but not by actinomycin d , was inhibited by extracellular catalase , superoxide dismutase in the presence of catalase , hypoxia ( 8% oxygen ) , deferoxamine , and 3-aminobenzamide ( an inhibitor of the nuclear enzyme , poly(adenosine diphosphate - ribosyl ) polymerase ) .
we conclude that asbestos induces apoptosis in mesothelial cells via reactive oxygen species .
we speculate that escape from this pathway could allow the abnormal survival of mesothelial cells with asbestos - induced mutations.imagesfigure 1 .
afigure 1 .
b |
|
nodular fasciitis is a benign lesion that develops due to proliferation of fibroblastic and myofibroblastic cells within subcutaneous tissue ( 1 - 3 ) , commonly found in soft tissues ( 4 ) .
the lesion is seen more frequently in the upper limbs and trunk of young to middle - aged individuals , so development in the breast area is rare ( 4 ) .
the definitive etiology of this lesion is unclear ( 4 - 6 ) , but it develops within the breasts of females aged 36 to 48 ( 1 - 3 ) .
this tumor - like lesion consists of myofibroblastic cells , which , are seeded through a mucopolysaccharide stroma in a circular pattern with a feathery appearance .
nodular fasciitis is well known to dermatologists and pathologists , due to its preferential occurrence in subcutaneous tissues and importance in the differential diagnosis of soft - tissue tumors .
nodular fasciitis is rarely encountered in other fields of clinical practice . in this case report
, we describe a patient with nodular fasciitis in the breast tissue that mimicked a breast cancer manifestation .
the patient was a 43 year - old female who had detected a mass within the upper - lateral quadrant of her left breast 20 days earlier .
due to a harsh mastalgia , some diagnostic sonographies had been conducted on her breasts during the previous year .
therefore , a follow - up schedule including annual sonography and physical examination was recommended to the patient .
two months after the last survey , the patient detected a mass within the aforementioned site of her left breast . in examination ,
complementary studies including sonography , mammography and excisional biopsy were established and the following findings were reported : in the sonogram , a 10 mm diameter hypoechoic mass was detected in the 12 oclock position within the left breast .
the first sonography of the lesion [ with a birads category of 2 ] showed a suspicious mass and the second sonography [ in which the birads category increased to 4 ] revealed the mass is growing ( figure 1 ) . considering the position of the lesion , mammography showed no evidence of mass , but
finally , according to the pathologic study , macroscopic and microscopic findings are listed below : macroscopic appearances : a gray - cream tissue with the size of 2 1.5 1 cm contained a creamy nodular lesion with 1.5 cm in diameter and loose formidability .
microscopic features : the tissue was composed of fusiform fibroblastic cells with the bright ellipsoid - like nuclei , elevated nucleolus and also mitotic formations were obvious .
low cellular and high cellular zones with hyaline fibrosis and erythrocyte accumulation beside a light lymphocytic infiltration existed . considering all of these features in addition to adipocytic accumulation within margins of this lesion ,
nodular fasciitis rarely develops within the breast ( 5 ) and commonly presents with subcutaneous manifestations ( 6 ) .
the incidence ratio of nodular fasciitis between males and females is 1:1 ( 4 , 6 ) .
however , in this lesion , nipple discharge is absent and the mass grows rapidly ( 1 - 3 ) . for the patient in our example , the mass growth had progressed within only 20 days . in 36% of cases ,
nodular fasciitis develops in the forearm and 20% in the head and neck region , but the occurrence of this lesion within the breast is quite rare . as shown in table 1 , in our wide internet search , there were only 19 cases of this kind from 1988 until now ( 4 , 6 ) in table 1 , we describe cases reported from 2010 till 2014 .
all of the cases that introduced nodular fasciitis from 1980 until the present totaled 150 , but the presence of nodular fasciitis in the breast tissue was rare .
differential diagnosis between nodular fasciitis and breast cancer is difficult when using radiography or mammography , so the definitive diagnosis is established using accurate histopathology ( 1 - 3 ) . in sonography , this lesion manifests as an ellipsoid mass .
however , we can not discriminate nodular fasciitis from breast cancer with this technique ( 7 , 8) .
nodular fasciitis develops within the breasts of middle - aged females from 36 to 48 year - old ( 1 - 3 ) . considering this age range for incidence of nodular fasciitis
, it could be thought that our patient is in the middle of this range .
fifty percent of all lesions are located within superficial fascias whereas others are within deep ones , correlated with muscles , tendons , vessels , neuronal sheaths and periosteums ( 4 , 6 ) .
the size of the mass is commonly around 1 to 3 cm and rarely is more than 5 cm ( 4 , 6 ) . finally , considering the extreme similarity between nodular fasciitis and breast cancer , the use of cytologic techniques could reduce unnecessary biopsies and enable physicians to decide whether interventional surgical procedure is more suitable .
this also reduces the risk of iatrogenic harm to the patient ( 1 - 3 ) . | nodular fasciitis of the breast is a rare benign pathology of soft tissue that is a consequence of fibroblastic hyperplasia within breast .
it can mimic breast cancer clinically , radiologically , and histopathologically.a-43 year - old female with a painless mass within upper - lateral quadrant of her left breast complained of rapid and progressive growth during previous few days .
no evidence of nipple discharge or sensation of pain was expressed .
the mass was tender to palpation , but the size was too tiny to detect .
the definitive diagnosis was established with sonography , which detected a hypoechogenic lesion , 10 mm in diameter .
the excisional biopsy delivered a tissue composed of fusiform fibroblastic cells with bright ellipsoid - like nuclei and elevated nucleolus .
mitotic formations were also obvious .
low cellular and high cellular zones with hyaline fibrosis and erythrocyte accumulation existed , as well as a light lymphocytic infiltration .
all of these features , in addition to adipocytic accumulation within the margins of this lesion , suggested a definitive diagnosis of nodular fasciitis .
the diagnosis of nodular fasciitis is difficult and often is indiscriminable from breast cancer , so paying close attention to this matter is critical . |
the history of tobacco use in india can be traced back to almost 400 years .
the etiologic role of gutkha , a prepackaged mixture of areca nut , tobacco , slaked lime and flavoring agents in oral precancer and cancer is well documented.1 currently , available nicotine replacement therapy ( nrt ) products like chewing gums , transdermal patches have achieved considerable success in smoking cessation .
there are basic differences in the addiction of smoked and smokeless form of tobacco.2 so , there is a need to understand the biologic basis of gutkha addiction to successfully achieve gutkha cessation .
very few studies have been done to assess the exact nature of gutkha addiction and to evaluate the efficacy of nrt products.2 - 4 the present study was aimed to analyze the addiction biology of gutkha chewing and to evaluate the efficacy of cessation program based on nrt and psychological counseling .
a total of 400 male gutkha chewers in the age group of 25 - 30 years with a minimum habit history of 5 years and employed in heavy industries were randomly selected for the study .
they were enrolled in a preliminary questionnaire- based survey to analyze the pattern of addiction after obtaining written consent in accordance with the declaration of helsinki ( 1975 ) .
60 subjects who consented for enrollment in the cessation program were divided into three groups .
subjects who chewed 1 - 5 gutkha per day ( n = 20 ) ( group a ) , subjects who chewed 6 - 10 gutkha per day ( n = 20 ) ( group b ) and more than 10 gutkha per day ( n = 20 ) ( group c ) .
urine cotinine levels of subjects were determined by using capillary gas chromatography ( shimadzu ) on the 1 day of enrollment into the study . among 400 subjects ,
arm one was pharmacological arm consisting of 4 mg nicotine polacrilex chewits 4 - 15 times per day for 1 week .
then depending on the compliance of subjects , dosage was altered to 2 mg chewets 4 - 15 times per day for 2 week .
group ra , rb , and rc were designated for the number of relapsed cases from groups a , b , and c , respectively .
comparison of mean urine cotinine levels of relapse cases and relapse - free cases was made within the same subgroups made on the basis of frequency of chewing .
arm two of the study comprised of periodic psychological counseling which was specifically designed on the basis of outcomes of questionnaire and involved explaining the patient about the degree of dependence , possible reasons for relapse and means of dealing with withdrawal symptoms .
among 400 randomly selected subjects , average frequency of gutkha chewing was 4 - 15 times per day .
73.5% of gutkha chewers were from lower socio - economic strata , 25.5% were from middle strata while only 1% subjects were from higher socio - economic strata .
close coexistence in time of chewing habit and day to day activities was observed ( table 1 ) . the mean urinary cotinine level of group a was 4680.91 g / g creatine , group b was 5898.22 g / g creatine and group c was 6287.35 3198 g / g creatine .
association of chewing habits and day to day activities . among 60 subjects who underwent nrt ,
relapse rate was higher in the first ( 41.6% ) and second ( 37.9% ) week of nrt .
the most common reported reason for relapse was unacceptable taste and form of nicotine chewing gums .
other factors reported for relapse were an adverse effect of nrt , gastrointestinal problems , and unsatisfactory effect of tobacco ( table 2 ) .
chi - square analysis was done to check the correlation between frequency of habit and relapse , as well as chewing time and relapse .
the intensity of craving was reported to be highest in the morning within 30 min after waking up .
results have showed that the relapse was more in lower ( 85.7% ) and middle ( 83.3% ) socio - economic class as compare to higher ( 33.3% ) socio - economic class .
relapse was higher in illiterate persons ( 90% ) than literate ( 80% ) . a mean urinary cotinine level of relapsed group ( ra ) was 5891.68 g / g creatine , group ( rb ) was 6018.18 g / g creatine , and group ( rc ) was 6001.28 g / g creatine .
various studies have shown a significant correlation between relapse and age , frequency of smoking , duration of habit , withdrawal symptoms such as craving and depressed mood in smokers.5 - 7 however , in the present study no statistically significant correlation was found between relapse rate and age , frequency , gender or time of chew .
patients who abruptly stop using smokeless tobacco may experience withdrawal symptoms similar to that observed in smokers.8 the time course of withdrawal symptoms varied among individuals of all three study groups , but withdrawal symptoms were at its peak within a few days and then began to subside over the next several weeks .
nrt does not appear to shorten the course of the symptoms but can reduce symptom severity to the generally more tolerable levels.9 in this study , 20% of subjects reported withdrawal symptoms even after taking nrt .
the differences between the urine cotinine levels of relapse - free and relapsed cases were not found to be statistically significant .
this fact indicates that nicotine probably plays a minor role in gutkha addiction . at present , there are very few nrt products specific to gutkha cessation
. these products do not take into account the pathways of addiction related to the oral sense of gratification caused by physical form and flavoring agents in gutkha .
arecoline present in areca nut is reported to have profound effect on the cholinergic nervous system and has considerable addiction potential.10 the observations made in the present study probably suggest that in the absence of free of cost nrt products , motivational support , and periodic counseling , relapse rate would have been higher than that found in the present study .
gutkha addiction can be considered as a form of conditioned reflex , rather than actual craving for nicotine , which probably plays a minor role in addiction .
further development of nrt products with similar physical form and flavor to gutkha would probably aid in similar oral gratification and might lower the rates of relapse . | background : a pre - packaged mixture of areca nut , tobacco , slaked lime , catechu , and flavoring agents is popularly known as gutkha .
aim of study is to analyze the addiction biology of gutkha chewing and to assess efficacy of a cessation program based on nicotine replacement therapy ( nrt).materials and methods : patterns of addiction of 400 gutkha chewers were analyzed with a questionnaire - based survey .
urine cotinine levels of 60 subjects undergoing nrt were periodically estimated using gas chromatography.results:mean urine cotinine levels of relapse and relapse - free cases were 5800.38 g / g of creatine and 5622.16 g / g of creatine .
the difference was not found to be statistically significant .
a 83.3% of the subjects associated their chewing habit with day to day activities .
overall relapse rate was found to be 79% .
the most common reported reason for relapse was unacceptable taste and form of nicotine chewing gums.conclusion:repetitive coexistence in time of an indifferent act and the act of chewing gutkha where , the act of chewing is almost always preceded by the indifferent act sets in a conditioned reflex . gutkha addiction can be considered as a form of conditioned reflex , rather than actual craving for nicotine . |
chylous ascites is considered a relatively rare postoperative complication , but it can not be disregarded because van der gaag et al . 1 reported that the incidence after pancreaticoduodenectomy was 9% , and malik et al .
2 reported that it was 6.7% . for treatment , there are conservative and surgical treatments .
however , no reliable treatment method has been established , and treatment is difficult in many cases . therapeutic lipiodol contrast imaging has recently been attracting attention , but it is necessary to puncture a lymph duct to perform lymphangiography and sclerotherapy . generally , a lymph duct is punctured with a 30g butterfly needle [ 3 , 4 ] , but lymph ducts are very thin and fragile , and cannulation may perforate the duct or its fixation is difficult .
we encountered a patient with chylous ascites after surgery for pancreatic cancer in whom a lymph duct was secured under a microscope and punctured with a catheter for the neonatal central vein .
lymphangiography and lipiodol injection could be stably applied , and a favorable outcome was achieved .
he was diagnosed with pancreatic body cancer and underwent total pancreatectomy at the department of surgery . after surgery , ascites accumulation persisted , but the general condition was stable .
thus , the patient was discharged 2 months after surgery . however , abdominal distension gradually aggravated , and marked ascites was observed on ct ( fig . 1 ) .
in addition to fasting , highcalorie infusion management , and several applications of abdominocentesis , internal medical treatment , such as octreotide and etilefrine administration , were performed , but the condition was not improved .
the patient was referred to our department 9 months after surgery to perform a therapeutic lipiodol contrast imaging .
we performed a new technique of lymph duct puncture to perform lipiodol contrast imaging and sclerotherapy .
the patient was a 65yearold man who was diagnosed with chylous ascites caused by chyle leakage after total pancreatectomy for pancreatic cancer .
indocyanine green ( icg , daiichi sankyo company , tokyo , japan ) was intracutaneously injected into the right dorsum pedis , and the lymph duct distribution was observed using an infrared camera ( photo dynamic eye ( pde ) , hamamatsu photonics , japan ) . after applying local anesthesia with 1% xylocaine epinephrine ,
a 12mm incision was made in the right lower leg using a scalpel ( fig . 2 ) .
a lymph duct was identified and secured under a microscope ( fig . 3 ) .
a 3/4 circumference incision was made in the lymph duct , and 80 nylon thread was applied to the upper end as an auxiliary thread ( fig . 4 ) .
a 28g singlelumen catheter for the neonatal central vein ( argyle pi catheter kit , 0.42mm diameter 20 cm , covidien ltd .
firstly , the guidewire was inserted into the lymph duct , the skin was punctured with a 23g needle on the distal side of the incision , and the outer catheter was subcutaneously passed through and advanced into the lymph duct using the guidewire ( fig . 4 ) .
the outer catheter was fixed to the lymph duct by ligation with 80 nylon thread at three sites , and the guidewire was removed ( fig .
urografin ( 60% , bayer yakuhin , ltd . , japan ) was injected , and cannulation into the lymph duct was confirmed on radiography ( fig .
the skin was sutured with 50 nylon , and surgery was completed . after returning to the ward
, 12 ml of lipiodol ( guerbet japan , japan ) was injected at a rate of 6 ml / h through the catheter .
after intracutaneous indocyanine green injection , the lymph duct distribution was confirmed using an infrared camera and an incision above the duct was designed .
the subcutaneous region was exposed under a microscope , and a lymph duct was identified and secured .
a 3/4 circumference incision was made in the lymph duct , and 80 nylon thread ( blue arrow ) was applied to the upper end as an auxiliary thread to open the duct .
the guidewire in the 28g catheter for the neonatal central vein ( red arrow ) was inserted , followed by insertion of the outer catheter .
the outer catheter was fixed to the lymph duct by ligation with 80 nylon thread at three sites , which made the duct resistant to the pressure of drug injection .
the lymph duct is not obstructed by slightly strong ligation because the guidewire is contained in the catheter .
the skin was then punctured with a 23g needle on the distal side of the incision , and the outer catheter was subcutaneously passed through .
lipiodol was noted around the aorta , confirming that it had reached the cistern of chyle ( fig .
recovery was favorable , and the patient was discharged 1 month after our surgery .
one year has passed since the surgery , but recurrence has not been admitted ( fig .
lipiodol was noted around the aorta , confirming that it had reached the cistern of chyle .
postoperative chyle leakage due to lymph duct damage is a relatively rare complication . for treatment , there are conservative and surgical treatments . for conservative treatment , a lowfat diet ,
fasting and nutrition management by central venous alimentation are basic 5 . as ulibarri et al .
6 reported the efficacy of somatostatin administration for the treatment of chyle leakage in 1992 , the usefulness of a somatostatin derivative , octreotide , for intractable chylous ascites has been reported 7 . in 1999 , guillem et al .
reported that the combination of octreotide and etilefrine with sympathetic nerve 1 action improved lymphorrhea 8 . on the other hand ,
surgical treatment includes lowinvasive drainage , a peritoneovenous shunt 9 , and highinvasive lymph duct ligation and clipping by laparotomy
. however , no reliable treatment method has been established , and treatment is difficult in many cases .
therapeutic lipiodol contrast imaging for postoperative chyle leakage has recently been attracting attention 10 . in the present patient ,
all conservative treatments were applied , but remission could not be achieved , and surgical lymphangiography and lipiodol embolization were selected .
the mechanism of healing lymphorrhea by lipiodol has not been clarified , but the promotion of granulation by lipiodolinduced embolization and inflammation of the lymph duct damage site are considered 11 . it is necessary to puncture a lymph duct to perform lymphangiography and sclerotherapy . in previous lymphangiography , isosulfan blue or indigo carmine was subcutaneously injected into the region between the toes ,
the dorsum of the foot was incised , a stained lymph duct was identified , and the lymph duct was cannulated with a 30g puncture needle for lymphangiography 3 , 4 .
this method requires the cannulation technique and damages the lymph duct , or the puncture needle detaches while injecting contrast medium , being unreliable .
thus , we designed a new method which secures a lymph duct under a microscope using a catheter for the neonatal central vein and ensures cannulation into the lymph duct and stable injection of a drug .
first , it was performed under a microscope so that handling of a thin lymph duct was easy compared with that under direct vision .
second , using icg and a pde camera to confirm the distribution of lymph duct , it is possible to incise the center of the lower leg instead of the dorsum of the foot , thus securing thicker lymph duct .
third , a 3/4 circumference incision was made in the lymph duct , and 80 nylon thread was applied to the upper end as an auxiliary thread .
this is an important point because the lymph duct likely to escape or be smashed can be retained using this thread , and the application of cannulation becomes easy .
passing the guidewire through the incised lymph duct makes the subsequent advancement of the catheter easy .
fifth , the outer catheter was fixed to the lymph duct by ligation with 80 nylon thread at three sites , which made the duct resistant to the pressure of drug injection .
lymphorrhea from the punctured site may occur , but it did not occur in this patient .
this new method is advantageous in that the previous complex procedures of lymph duct puncture and drug injection can be easily and stably applied .
lymphangiography and sclerotherapy can be easily applied by cannulation with a catheter for the neonatal central vein to the lymph duct under a microscope .
tk , kh , and sm : managed the patient 's case , contributed to the literature search , and wrote the manuscript .
tk , kh , sm , ki , and kt : made substantial contributions to the concept and design of this surgical method . te : also managed the patient .
se , fn , io , mi , th , mt , and mi : aggregated the data and helped draft the discussion of the manuscript .
| key clinical messagetherapeutic lipiodol lymphangiography for postoperative chyle leakage due to lymph duct damage has recently been attracting attention .
lymph duct puncture is technically complex and difficult .
lymphangiography and sclerotherapy can be easily applied by cannulation with a catheter for the neonatal central vein to the lymph duct under a microscope . |
close reduction by extension - block k - wire fixation for acute mallet fracture is based on two sound orthopedic principles stable arc splinting and early protected motion .
distal interphalangeal joint splinting is still the technique commonly used for mallet fractures with significant morbidity and only moderate functional outcome .
we have demonstrated here ishiguro s technique in a partially treated 2 weeks old mallet fracture with the flexion deformity at distal interphalangeal ( dip ) joint after proper preoperative assessment .
reduction of the avulsion fracture was done by extension block k - wire and intra - articular k - wire was inserted subsequently to hold the reduction in place and dip joint in extension . later on k - wires
closed extension block pinning can give acceptable functional outcome even in delayed mallet finger injuries .
full range of movement at the affected joint is an important pre - requisite for the same .
disruption of the extensor tendon mechanism of the distal phalanx resulting in an extensor lag of the distal interphalangeal joint is commonly referred to as a baseball or mallet finger deformity. the underlying mechanism of injury is axial loading of the distal phalanx .
there are three types of mallet finger injuries namely the rupture of the extensor tendon , avulsion of the extensor tendon at its attachment to the bone and the avulsion fracture of dorsal base of the distal phalanx , which is typically known as mallet fracture .
mallet injury with or without a bony defect is traditionally treated with an immobilization splint in extension for eight weeks , followed by night splinting for an additional month .
if the splint is removed and the distal interphalangeal ( dip ) joint of the finger goes into flexion , the eight weeks splinting in extension must start again .
cochrane review published online in 2008 found that the most important factor in the success of splint treatment is that of patient compliance . on the other hand ,
close reduction by extension - block k - wire pinning technique described by ishiguro for the management of mallet fractures[4 , 5 ] is technically simple with good clinical outcome .
a 29 year old male presented to us with pain and flexion deformity of the dip joint of the middle finger .
there was history of injury to left middle finger while playing cricket 2 weeks back .
patient had initially taken treatment at primary health centre , where a finger splint was advised for 2 weeks .
on local examination there was swelling with associated tenderness on the dorsal aspect and flexion deformity of 20 degrees at distal interphalangeal ( dip ) joint of ( l ) middle finger .
antero - posterior and lateral radiographs of ( l ) middle finger showed dorsally displaced intra - articular fracture fragment from the base of the distal phalanx involving about 50 % of the articular surface without comminution and volar subluxation of the distal phalanx ( fig .
patient was planned for close reduction by extension - block k ( kirschner)-wire along with trans - articular k - wire pinning of the dip joint .
patient was operated under digital block anesthesia on a radiolucent operating table in supine position with intraoperative c - arm image intensifier control .
being a closed procedure , no tourniquet was used . with the dip joint held in maximum flexion , a 1.5 mm k - wire introduced just behind the fracture fragment and driven proximally into the head of the middle phalanx at an angle so that it should not slip while insertion and it should get purchase in the head of the middle phalanx and leaving ample room for another transarticular k - wire .
the fracture was reduced by the pressure of the proximal end of the distal phalanx indirectly i.e. on the already inserted k - wire levering the fracture fragment into its original position as the dip joint is brought into full extension .
another 1.5 mm k - wire was then advanced through the distal phalanx across the dip joint in extension into the head of the middle phalanx to maintain the reduction .
again , the reduction was confirmed with the use of c - arm image intensifier .
k - wires were bent and left protruding outside the skin to facilitate removal later ( fig .
the pip ( proximal interphalangeal ) joint remained free and its mobilization was started from day one postoperatively .
the wires were removed as an opd procedure after 6 weeks and active mobilization of the dip joint was started .
night splinting of the finger with dip joint in extension was continued for another 2 weeks .
there was no pain or extensor lag with full flexion of the dip joint at the end of 3 months follow up .
this evaluation of the outcome was done on the basis of crawford criteria , which evaluates the results as- excellent- full dip joint extension , full flexion , no pain good- 0 - 10 degrees of extension deficit , full flexion , no pain ; fair- 10 - 25 degrees of extension deficit , any flexion loss , no pain ; poor- more than 25 degrees of extension deficit or persistent pain . in this case
the result was excellent as per crawford s criteria , and patient had full dip joint extension , full flexion , no pain with no medio - lateral instability .
antero - posterior and lateral radiographs of ( l ) middle finger showing mallet fracture with dorsally displaced intra - articular fracture fragment from the base of the distal phalanx involving about 50 % of the articular surface without comminution and volar subluxation of the distal phalanx .
post - operative antero - posterior and lateral radiographs showing in - situ extension - block and trans - articular k - wires .
extension - block k - wire is radial - ward and trans - articular kwire is ulnar - ward .
position of k - wires was dictated by position of the mallet fragment as seen during intraoperative fluoroscopy .
antero - posterior and lateral radiographs at 3 months follow up . no extensor lag present .
the dorsal intra - articular avulsion fracture of the base of the distal phalanx or the bony mallet finger , constitutes about 5 10 % of mallet finger injuries [ 7 , 8 ] .
the management of these injuries is dependent on the size of the avulsed intra - articular fragment and congruency of the dip joint .
the management of acute mallet fingers with extensor tendon rupture or a small fracture fragment involving less than one - third of the articular surface of the distal phalanx is usually done by continuous distal interphalangeal joint volar splinting in extension with molded polythene ( stack ) or aluminum splint for 6 to 8 weeks .
however , care must be taken when applying them to prevent maceration and ulceration of the skin .
conservative treatment has been advocated by wehbe and schneider , regardless of the size of bony fragment or extent of fracture displacement or subluxation of the dip joint .
skin slough , tape allergy , transverse nail plate grooves , splint - related pain , and tender dorsal prominence can complicate conservative treatment [ 11 , 12 ] . however , the management of mallet fractures involving more than one - third of the articular surface has been found to be more controversial .
wehbe and schneider observed 33% complication rate in open - surgically managed group as compared to 9% in conservatively managed group .
most authors agree for operative management for mallet fracture involving more than one - third of the articular surface .
but , open reduction is fraught with many complications , like scar formation , nail deformity , prominent dorsal bump , osteomyelitis , non - union or avascular necrosis of the fragment , or recurrent mallet or residual finger flexion deformity etc . in 1988 , ishiguro et al introduced a new method for close pinning by extension block for effective reduction of mallet fragment and simultaneously decreasing the complications of open surgery [ 5 , 13 ] .
ishiguro et al observed that the trans - articular k - wire should be introduced from the radial or ulnar side to prevent the pin penetrating the fracture surface which may lead to loss of reduction or interfere with fracture healing . in our case
, intraoperative fluoroscopy revealed that the mallet fragment was slightly radial - wards , so the extension - block k - wire was placed on the radial side , and the transarticular k - wire was placed slightly towards ulnar side to attain good reduction and to prevent transarticular pin coursing through fracture line ( fig .
2 ) . understandably , pin - tract infection is one of the potential complications of this technique , so due pin - tract care is imperative .
removal of the callus in chronic mallet fractures for correct anatomical reduction is not possible by percutaneous techniques .
however , percutaneous procedures have been found to be associated with the technical difficulty in accessing the dip joint correctly , achieving reduction of the small articular fragment and potential chances of injury to the tenuous soft tissue envelope [ 10 , 13 ] .
extension block pinning technique is a minimally invasive method of managing mallet fractures with low morbidity and good functional outcome .
this technique when properly applied has been found to produce satisfactory functional results with good fracture union .
thus to conclude , ishiguro s extension - block k - wire fixation technique is a novel method for the management of mallet fractures and should be considered for such cases .
this case report based review on the technique of the management of mallet fracture using closed extension block method has been presented to highlight the efficacy and easiness to perform this procedure , requiring attention to only few technical details with good functional outcome .
closed extension block pinning method can be successfully used with good functional outcome for the management of mallet fracture with less than 1/3rd of the distal phalanx involvement , presenting even as late as 2 weeks since injury .
although , more number of cases may be required to highlight the issue of the outcome , one key factor for a good outcome can be the availability of full passive range of motion at the dip joint in the cases which are presenting late to the treating surgeon especially in developing countries | introduction : close reduction by extension - block k - wire fixation for acute mallet fracture is based on two sound orthopedic principles stable arc splinting and early protected motion .
distal interphalangeal joint splinting is still the technique commonly used for mallet fractures with significant morbidity and only moderate functional outcome.case report : we have demonstrated here ishiguro s technique in a partially treated 2 weeks old mallet fracture with the flexion deformity at distal interphalangeal ( dip ) joint after proper preoperative assessment .
peroperatively , proper anatomical localization of mallet fragment was done under fluoroscopy .
reduction of the avulsion fracture was done by extension block k - wire and intra - articular k - wire was inserted subsequently to hold the reduction in place and dip joint in extension . later on k - wires
were removed at the end of 6 weeks follow up .
patient was subjected to the physiotherapy during the course of the treatment .
excellent functional outcome was noted at the end of three months.conclusion:closed extension block pinning can give acceptable functional outcome even in delayed mallet finger injuries . full range of movement at the affected joint is an important pre - requisite for the same . |
prostate cancer is currently the most common cancer type among men in the united states .
screening protocols aimed at cancer prognosis include digital rectal examinations ( dre ) , prostate - specific antigen ( psa ) measurements , and in vivo imaging techniques ( ct , mri , or ultrasound ) .
however , these tests allow the pathologists to know that there is a reason to be suspicious , rather than the actual cause of the problem , so if the doctor finds any irregularity in these examinations , he usually requires the patient to undergo a biopsy in order to make an accurate diagnosis .
early detection is essential to overcome the disease , but a third of the affected patients present a highly developed scenario when they are initially diagnosed .
once the biopsy is performed , tissue samples are stained with some biomarker , usually hematoxilyn - eosin ( h&e ) , and placed onto a transparent slide .
then , doctors place that slide under a microscope and examine it looking for suspicious areas , gradually increasing the level of detail ( changing the objective to obtain higher magnification ) if they find any clue of cancer .
samples are classified using the gleason score , which quantifies both cancer spreading grade and its aggressiveness from 1 to 5 .
robotic microscopes equipped with digital cameras , along with whole slide imaging ( wsi ) methods , allow pathologists to watch the sample on a screen rather than using a microscope directly , and also provide the starting point for computer - based biopsy processing , providing a complete toolkit for computer - aided diagnosis ( cad ) .
one of the problems working with wsi is the image size , which usually takes several gigabytes depending on the magnification of the objective used in the digitization process . despite fast improvement in image processing techniques , there are few software tools that are able to analyze prostate biopsy images in a fully automated way , in order to find roi in those images . in recent years , there have been several studies that focus on h&e prostate biopsy image processing .
however , these systems are focused on the extraction of descriptors that may be useful for automatic tissue classification , rather than in roi segmentation .
used an algorithm that calculates multiwavelet coefficients from 100 magnification images , and then computes energy and entropy from them , using those values for image classification into grades 2 - 5 of the gleason score .
texture features are extracted from the preprocessed images and clustered using a k - means algorithm .
have developed a classification system that is able to differentiate between 40 magnification images of benign epithelium , benign stroma , gleason grade 3 , and gleason grade 4 .
they use first and second order statistics , as well as wavelet features , and support vector machines ( svm ) for classification .
naik et al.[1113 ] have worked on the integration of high - level a - priori information ( such as size and structure of the glands ) with the image features computed . using this approach
, they are able to detect and accurately segment glands in h&e images using bayesian probability and level sets . their system is also able to differentiate images of benign tissue , gleason grade 3 , and gleason grade 4 .
xu et al . also propose a way to improve robustness of level set segmentation which is suitable for histopathological images .
perform prostate biopsy segmentation using a variation of fuzzy c - means that includes a spatial constraint to the traditional clustering to initially classify the image pixels into four classes ( two classes for epithelial nuclei , one for lumen , and one for cytoplasm ) . then
their main aim is the correct segmentation of nuclei , and they obtain an 85% accuracy versus manual segmentation .
first , none of the systems uses complete mosaics but rather fragments of them ( with the exception of ref . ) , and they were tested with high magnification ( up to 100 ) images , which are slow to acquire and extremely large to be processed without a dedicated cluster .
our proposed algorithm works with images acquired with low magnification ( 5 , 10 ) , and thus requires much lower computational resources .
second , the previous algorithms aim at the segmentation of the different structures within the images , that is , lumen , cytoplasm , and nuclei , whereas our method , presented here , is aimed at separating rois from non interesting areas .
the method that will be described here is able to work with mosaics created at different magnification . here
, the method is illustrated with image digitized at 5 magnification , whose typical sizes take from 12 up to 500 mb .
the aim of this system is the segmentation of roi from these images in a way that mimics the method used by the doctors , that is , identifying at low magnification the regions with high concentration of cells or where the architectural distribution between lumen and cells is relevant .
thus , in order to fulfill the criteria used by pathologists to identify rois , two techniques have been implemented .
the methods are called lumen centered expansion and cell density localization , and they are based on level - set segmentation and mean filtering respectively .
experimental work carried out so far , as well as discussion and future work , is presented in sections 3 and 4 respectively .
the images that we are working with were digitized using an alias ii motorized microscope from lifespan biosciences inc .
this microscope acquires tiles with a size of 20002000 pixels and 24 bits per pixel ( rgb ) .
these tiles are stored in an uncompressed raw file , with no header , and planar format ( first part of the file is used to store the red channel , second one to store the green channel , and last part to store blue channel ) .
the alias microscope is equipped with five different objectives , whose magnifications are 2.5 , 5 , 10 , 20 , and 40. although the method is magnification independent , in this work the results are provided on samples digitized at 5 magnification .
the slides have been provided by the anatomic pathology department of the hospital general universitario de ciudad real ( hgucr ) .
this group of pathologists has also specified for us the most relevant features that should be considered when analyzing prostate biopsies at these magnifications , such as minimum size of relevant regions , or their architectural distribution .
h and e stained prostate biopsies have three types of well - differentiated structures of interest : lumen , cytoplasm , and cells [ figure 1 ] .
furthermore , if the biopsied tissue is not perfectly extracted and placed onto the slide , folded tissue and/or tissue cuts are likely to be present .
examples of structures of interest : lumen ( 1 ) , cytoplasm ( 2 ) , and cells ( 3 ) for pathological purposes , the most relevant structures are cells
. their density , morphology , distribution between them , and relationship with lumen and cytoplasm are the most relevant features that pathologists consider to elaborate a diagnosis .
thus , groups of cells are especially important , and they may appear either surrounding a lumen area , or packed very closely in isolated clusters . as mentioned above , the method takes into account the pathologists criteria .
the technique is able to detect complete rois , where a roi is composed by the conjunction of three different structures , that is , lumen , cytoplasm , and cells .
therefore , we focus on the following : ( a ) regions where the three structures of interest appear concentrically : lumen is surrounded by cytoplasm , which is surrounded by cells .
the concentric regions are detected using our novel lumen centered expansion approach , while the latter are detected using another novel approach , which we term cell density localization . in the first case , since there are three different structures of interest , we have developed our algorithm to sequentially segment each type of structure .
then , for each of them , two different level sets are used to segment cytoplasm and cells .
although h and e images are typically digitized using rgb format , this approach only uses the green channel of the original rgb image . as shown in figure 2b , the green channel provides better contrast between the lumen areas and the other types of structures of interest than either the red [ figure 2a ] or the blue [ figure 2c ] channels .
this decision is also aimed at lowering the memory requirements of the processing , which may be huge if the input image is large .
( a ) red ; ( b ) green ; ( c ) blue channels of figure 1 flowchart of the lumen centered expansion algorithm the first step of the segmentation , once the green channel is extracted , consists in smoothing the image to remove noise .
since the acquisition conditions are very well controlled , there is little noise on the images .
however , smoothing with an anisotropic diffusion filter reduces pixel intensity variance , which improves the result of subsequent processing . after smoothing ,
the image is binarized with high threshold , so that only high intensity areas such as lumen ( and empty areas containing no tissue at all ) appear at foreground .
we are currently using a fixed threshold , because all images in our test set have similar intensities .
this threshold has been set to 200 ( the range of possible intensities using 8 bits is 0 - 255 ) .
each set of touching foreground pixels ( i.e. , each connected component ) from the binarization output is considered a blob .
the physical size of each blob is measured and those which are too small or too large to be considered lumen areas are removed , since they probably represent noise in the former case , and areas lacking any tissue in the latter .
minimum blob size has been set to 500 nm , and maximum size to 20,000 nm .
thresholding usually produces blobs that are not compact and contain small holes , so a voting technique is used to fill in those holes .
the voting method is similar to morphologic dilation , but it is more restrictive . in traditional dilation , a structuring element ( kernel )
is moved along the image and all the background pixels that lie in the region covered by the kernel when it is centered in a foreground pixel are automatically promoted to the foreground set . in comparison ,
when using voting , instead of directly promoting the pixels , they receive a vote , and only the pixels that receive a certain number of votes are subsequently moved to the foreground set .
potential lumen areas are processed one by one , in a sequential loop , in order to expand them outward in search of concentric regions . for each of them , a working region ( a square with its sides separated 120 pixels in each direction from the potential lumen ) is defined .
then , the contour of the potential lumen area is used as initial zero set for a geodesic active contours level set .
figure 4a shows the lumen areas in pseudocolor ( red ) , and their contours as initial zero set .
the evolution function of this level set is established so that it can grow freely almost everywhere except on cell regions , where it gets stuck and , as stated in ref . , it can be represented as partial and final results of the lumen centered expansion algorithm .
( c ) final result with cell segmentation where a is the advection term , p is the propagation term , and z the curvature term .
the first term attracts the curve to desired areas , the second term regulates the speed with which the curve moves outward ( always in a normal direction of the curve ) , and the third term controls how much the curve may bend itself , preventing uncontrolled growth . it should be noted that the curve may split and merge at any time . since the objective is to make the curve grow from the contour of the lumen to the inner contour of the cells , the advection term is constructed so that the curve is attracted by cells .
the curvature and propagation terms are calculated using a distance map where the lumen contour is zero valued , points inside the contour are negative , and points outside it are positive . in this scenario ,
the curve grows outward , and such behavior allows it to include the glandular border into the segmented region . propagation and curvature coefficients are set to low values compared to the advection coefficient , so that the curve grows slowly and is able to bend ( creating high - curvature edges if necessary ) .
these coefficients are set to 1.0 for the advection term , 0.1 for the propagation term , and 0.3 for the curvature term .
it should be remarked that , for each potential lumen area , the presence of other lumen areas does not affect the level set evolution , because the distance map is calculated based only on the working region , and thus only one potential lumen area contributes for each distance map at any time .
when the geodesic level set has finished its evolution , the curve should be touching the inner border of the cells that surround the lumen and cytoplasm .
since the region of interest also includes the cells , a second level set is used to obtain the roi .
the initialization of this second level set is a dilation of the output of the previous one , so that the initial zero set goes across the cells .
this time , the curve may either grow or contract , but the evolution function is simpler , and it just depends on the intensity values of the image .
an expansion interval is determined by a lower and upper threshold ( l , u ) .
the mean between l and u is called maximum expansion value ( mev ) . for each pixel
belonging to the curve , if its intensity is inside the interval ( l , u ) , then the level set will expand with a speed proportional to the distance to the mev as shown in figure 5 .
threshold segmentation propagation term the evolution function for this level set does not consider an advection term .
rather , it just considers propagation and curvature , and propagation does not depend on the distance from the initial contour . according to ref . , the evolution of this level set is it has been observed that this level set works better if the mev is set close to the mean value of the pixels that are to be segmented .
the targets are the cells which have medium - low intensity values in the green channel of the image , so the lower and upper thresholds were set to 60 and 160 , respectively .
the weights for the propagation and advection terms were the same as in the geodesic level set .
finally , outputs of both level set segmentations are merged into just one , which represents the segmented region . if the potential lumen area was really a true one ( composed of the three structures of interest in the predicted fashion ) the output of the segmentation should be the full roi .
, this approach just uses one of the channels , in this case , the red channel of the original rgb image .
as figure 2 shows , the red channel provides better contrast between the cells and the other types of structures of interest than any other channel . as said before , using just one channel also reduces memory requirements , which is a nice side effect .
flowchart of the cell density localization algorithm the first step of the segmentation , once the red channel has been extracted , is thresholding that channel to separate the cells from the rest of the tissue .
the cells are darker than the rest of the tissue , which is almost white ( figure 2 , red channel ) .
the threshold has been set to the 80% of the maximum intensity of the image ( around 200 when using 8-bit images ) , so that any pixel with an intensity lower than the threshold is considered a cell .
the result of the thresholding is used to compute the cell density of the image . for each pixel in the image , a circular neighborhood of radius 7 pixels is used to calculate its cell density .
the pixel density is easily computed using a mean filter : where n is the number of pixels in the neighborhood , and pi are each one of those pixels . in order to keep the regions that feature a higher cell density , only pixels with a cell density higher than 30%
radius 7 was chosen because it is small enough to keep the calculations localized , and large enough to let each pixel be influenced by more than one cell . in order to obtain a smooth and compact final result , several operations are performed .
first , a dilation using a 33 kernel ( 4-neighbors , 5 iterations ) is executed .
this aims at closing small gaps between cells , so that groups of cells are merged into big blobs .
next , in case that any of those blobs is not compact ( i.e. , it has holes inside it ) , it is filled .
then erosion using the same kernel and number of iterations is used to restore the size of the blobs previously dilated .
finally the blobs that are not big enough ( at least 110 m in perimeter ) to be relevant are discarded .
all these steps are only performed in the regions of the image where there is tissue present . in order to know where the tissue is present ,
the background of the image ( which is almost white , due to illumination used in the microscope ) , is extracted by thresholding the green channel of the image .
pixels with an intensity higher than 90% and not surrounded by any tissue are considered background .
although h and e images are typically digitized using rgb format , this approach only uses the green channel of the original rgb image . as shown in figure 2b , the green channel provides better contrast between the lumen areas and the other types of structures of interest than either the red [ figure 2a ] or the blue [ figure 2c ] channels .
this decision is also aimed at lowering the memory requirements of the processing , which may be huge if the input image is large .
( a ) red ; ( b ) green ; ( c ) blue channels of figure 1 flowchart of the lumen centered expansion algorithm the first step of the segmentation , once the green channel is extracted , consists in smoothing the image to remove noise . since the acquisition conditions are very well controlled , there is little noise on the images .
however , smoothing with an anisotropic diffusion filter reduces pixel intensity variance , which improves the result of subsequent processing . after smoothing
, the image is binarized with high threshold , so that only high intensity areas such as lumen ( and empty areas containing no tissue at all ) appear at foreground .
we are currently using a fixed threshold , because all images in our test set have similar intensities .
this threshold has been set to 200 ( the range of possible intensities using 8 bits is 0 - 255 ) .
each set of touching foreground pixels ( i.e. , each connected component ) from the binarization output is considered a blob .
the physical size of each blob is measured and those which are too small or too large to be considered lumen areas are removed , since they probably represent noise in the former case , and areas lacking any tissue in the latter .
minimum blob size has been set to 500 nm , and maximum size to 20,000 nm .
thresholding usually produces blobs that are not compact and contain small holes , so a voting technique is used to fill in those holes .
the voting method is similar to morphologic dilation , but it is more restrictive . in traditional dilation , a structuring element ( kernel ) is moved along the image and all the background pixels that lie in the region covered by the kernel when it is centered in a foreground pixel are automatically promoted to the foreground set . in comparison , when using voting , instead of directly promoting the pixels , they receive a vote , and only the pixels that receive a certain number of votes are subsequently moved to the foreground set .
potential lumen areas are processed one by one , in a sequential loop , in order to expand them outward in search of concentric regions .
for each of them , a working region ( a square with its sides separated 120 pixels in each direction from the potential lumen ) is defined .
then , the contour of the potential lumen area is used as initial zero set for a geodesic active contours level set .
figure 4a shows the lumen areas in pseudocolor ( red ) , and their contours as initial zero set .
the evolution function of this level set is established so that it can grow freely almost everywhere except on cell regions , where it gets stuck and , as stated in ref .
, it can be represented as partial and final results of the lumen centered expansion algorithm .
( c ) final result with cell segmentation where a is the advection term , p is the propagation term , and z the curvature term .
the first term attracts the curve to desired areas , the second term regulates the speed with which the curve moves outward ( always in a normal direction of the curve ) , and the third term controls how much the curve may bend itself , preventing uncontrolled growth .
since the objective is to make the curve grow from the contour of the lumen to the inner contour of the cells , the advection term is constructed so that the curve is attracted by cells .
the curvature and propagation terms are calculated using a distance map where the lumen contour is zero valued , points inside the contour are negative , and points outside it are positive . in this scenario ,
the curve grows outward , and such behavior allows it to include the glandular border into the segmented region . propagation and curvature coefficients are set to low values compared to the advection coefficient , so that the curve grows slowly and is able to bend ( creating high - curvature edges if necessary ) .
these coefficients are set to 1.0 for the advection term , 0.1 for the propagation term , and 0.3 for the curvature term .
it should be remarked that , for each potential lumen area , the presence of other lumen areas does not affect the level set evolution , because the distance map is calculated based only on the working region , and thus only one potential lumen area contributes for each distance map at any time . when the geodesic level set has finished its evolution ,
the curve should be touching the inner border of the cells that surround the lumen and cytoplasm .
since the region of interest also includes the cells , a second level set is used to obtain the roi .
the initialization of this second level set is a dilation of the output of the previous one , so that the initial zero set goes across the cells .
this time , the curve may either grow or contract , but the evolution function is simpler , and it just depends on the intensity values of the image .
an expansion interval is determined by a lower and upper threshold ( l , u ) .
the mean between l and u is called maximum expansion value ( mev ) . for each pixel belonging to the curve , if its intensity is inside the interval ( l , u ) , then the level set will expand with a speed proportional to the distance to the mev as shown in figure 5 .
threshold segmentation propagation term the evolution function for this level set does not consider an advection term .
rather , it just considers propagation and curvature , and propagation does not depend on the distance from the initial contour . according to ref . , the evolution of this level set is it has been observed that this level set works better if the mev is set close to the mean value of the pixels that are to be segmented .
the targets are the cells which have medium - low intensity values in the green channel of the image , so the lower and upper thresholds were set to 60 and 160 , respectively .
the weights for the propagation and advection terms were the same as in the geodesic level set .
finally , outputs of both level set segmentations are merged into just one , which represents the segmented region . if the potential lumen area was really a true one ( composed of the three structures of interest in the predicted fashion ) the output of the segmentation should be the full roi .
as with lumen centered expansion , this approach just uses one of the channels , in this case , the red channel of the original rgb image . as figure 2 shows , the red channel provides better contrast between the cells and the other types of structures of interest than any other channel . as said before , using just one channel also reduces memory requirements , which is a nice side effect .
flowchart of the cell density localization algorithm the first step of the segmentation , once the red channel has been extracted , is thresholding that channel to separate the cells from the rest of the tissue .
the cells are darker than the rest of the tissue , which is almost white ( figure 2 , red channel ) .
the threshold has been set to the 80% of the maximum intensity of the image ( around 200 when using 8-bit images ) , so that any pixel with an intensity lower than the threshold is considered a cell .
the result of the thresholding is used to compute the cell density of the image . for each pixel in the image , a circular neighborhood of radius
the pixel density is easily computed using a mean filter : where n is the number of pixels in the neighborhood , and pi are each one of those pixels . in order to keep the regions that feature a higher cell density , only pixels with a cell density higher than 30%
radius 7 was chosen because it is small enough to keep the calculations localized , and large enough to let each pixel be influenced by more than one cell . in order to obtain a smooth and compact final result , several operations are performed .
first , a dilation using a 33 kernel ( 4-neighbors , 5 iterations ) is executed .
this aims at closing small gaps between cells , so that groups of cells are merged into big blobs .
next , in case that any of those blobs is not compact ( i.e. , it has holes inside it ) , it is filled .
then erosion using the same kernel and number of iterations is used to restore the size of the blobs previously dilated .
finally the blobs that are not big enough ( at least 110 m in perimeter ) to be relevant are discarded .
all these steps are only performed in the regions of the image where there is tissue present . in order to know where the tissue is present ,
the background of the image ( which is almost white , due to illumination used in the microscope ) , is extracted by thresholding the green channel of the image .
pixels with an intensity higher than 90% and not surrounded by any tissue are considered background .
a dataset of 100 complete prostate h and e stained biopsy images has been used to test the algorithms .
all the image were acquired with 5 magnification , with memory requirements ranging from 12 mb ( 20002000 pixels ) to 500 mb ( 14,00012,000 pixels ) .
some selected fragments that exemplify the lumen centered expansion and the cell density localization algorithms are shown in figures 7a c , and figures 7d f respectively .
( d)-(f ) results of the cell density localization algorithm although the images used to test the algorithm were large , computational times were not deemed excessive .
figure 8 shows a scatter plot with the computational time for both algorithms run with the 100 images .
the level set algorithm takes from 6 seconds to 9 minutes for 12 mb and 500 mb images respectively [ figure 8a ] , and mean filtering method takes from 1 second to 38 seconds [ figure 8b ] .
the testing machine was equipped with an intel core i7 950 ( 3.07 ghz ) processor and 12 gb ram . computational times .
( b ) times of the cell density localization algorithm a quantitative validation based on roc analysis was carried out with our set of 100 different tissue samples of wsi , stained with a variety of h and e dyes ( weak and dark ) .
the results of both algorithms were compared to the manual selection of rois done by pathologists from the local hospital ( hgucr ) .
thus , the rates of true positive ( tp ) , true negative ( tn ) , false positive ( fp ) , and false negative ( fn ) detections were calculated . the roc analysis for the algorithms of lumen centered expansion and cell density localization
( b ) roc of the cell density localization algorithm in the case of the lumen centered expansion algorithm , the rate of both fp and tp is higher than that for the cell density localization algorithm .
however , the errors ( fp and fn ) are kept quite low for both methods .
thus , in the case of the lumen expansion [ figure 9a ] , an average of 5% detections were fn , 0.39% were fp , 95% were tp , and 99.61% were tn . in the case of the cell density technique
[ figure 9b ] , an average of 20% detections were fn , 0.08 were fp , 80% were tp , and 99.92 were tn .
the results show an average sensitivity of 95% and 80% with specificity above 99% for the lumen centered expansion and cell density localization respectively.the type i and ii errors , that is , the fp and fn for the 100 images are illustrated in figure 10a for the lumen centered expansion and figure 10b for the cell density localization algorithms .
most of the fp errors occur in those samples stained with weak h&e dye , above all for the lumen centered algorithm .
( b ) errors for the cell density localization algorithm the accuracy ( acc ) and matthews correlation coefficient ( mcc ) were also obtained .
these quantitative metrics are defined by both the acc [ figure 11a ] and the mcc [ figure 11b ] give good results .
an average of 99% acc with 0.87 mcc is obtained for the lumen expansion and 99% acc with 0.71 mcc for the cell density algorithm .
the mcc is a correlation coefficient between the truth values and detected ones ; it returns a value between -1 and + 1 .
a coefficient of + 1 represents a perfect prediction , 0 an average random prediction , and -1 an inverse prediction .
( b ) matthews correlation coefficient the results on the wsi for both algorithms are illustrated in figure 12 .
figure 12a c are the manual roi selection , ( figure 12d f ) show the rois obtained with the lumen centered expansion segmentation , and ( figure 12g
( g - i ) rois obtained with the cell density localization algorithm the algorithms were also tested with images at 10 magnification and up to 1228 mb ( 24,00016,000 pixels ) obtaining similar results .
further improvements shall consider the fusion of information in the two algorithms together with texture analysis and methods based on invariant color information .
in this paper , an approach to roi segmentation in whole - slide images of prostate biopsies has been described .
the method proposed is based on level set and mean filtering techniques for lumen centered expansion and cell density localization respectively .
the approach followed in this paper is different from previous work that attempts to segment all significant regions such as nuclei , lumen , and epithelial cytoplasm .
the novelty of the technique lies in the ability to detect complete rois , where a roi is composed by the conjunction of three different structures , that is , lumen , cytoplasm , and cells with a high density of cells and the architectural distribution between lumen and cells .
the proposed algorithm is also original because it works on large images acquired with low magnification , thus being different from other algorithms that require higher magnification and have been tested only on small samples . in this way , the method tries to mimic the manual procedure of expert clinicians .
it could be integrated into a slide visualization environment to highlight the rois for the pathologists , either for slide analysis or even with teaching purposes .
another possible use of the roi segmentation is virtual microscopy systems . in order to avoid the full digitization of all samples ,
they could be first digitized at low magnification ( 5 , or 10 ) , and then processed to locate the rois , which would be the only regions to be subsequently digitized at higher magnification .
the system could also be used as a previous step in classification applications , since it could reduce the amount of information to be processed , and probably speed up the whole classification process .
a dataset of 100 prostate biopsies wsi stained with a variety of h and e dyes ( weak and dark ) has been used to test the algorithms .
all the images were acquired with 5 magnification , with memory requirements ranging from 12 mb to 500 mb .
the segmentation accuracy by means of roc analysis and the matthews correlation coefficient give good results .
an average 99% acc with 0.87 mcc , sensitivity of 95% and specificity of 99.61% is obtained for the lumen expansion , and 99.92% acc with 0.71 mcc , sensitivity of 80% , and specificity of 99% is obtained for the cell density algorithm . although segmentation accuracy is not high enough to be used in a medical environment in the short term , we consider that our results are promising and we are confident that future enhancements to the system will improve the results .
further improvements shall consider the fusion of information in the two algorithms together with texture analysis and methods based on invariant color information . | with modern automated microscopes and digital cameras , pathologists no longer have to examine samples looking through microscope binoculars .
instead , the slide is digitized to an image , which can then be examined on a screen .
this creates the possibility for computers to analyze the image . in this work , a fully automated approach to region of interest ( roi ) segmentation in prostate biopsy images
is proposed .
this will allow the pathologists to focus on the most important areas of the image .
the method proposed is based on level - set and mean filtering techniques for lumen centered expansion and cell density localization respectively .
the novelty of the technique lies in the ability to detect complete rois , where a roi is composed by the conjunction of three different structures , that is , lumen , cytoplasm , and cells , as well as regions with a high density of cells .
the method is capable of dealing with full biopsies digitized at different magnifications . in this paper ,
results are shown with a set of 100 h and e slides , digitized at 5 , and ranging from 12 mb to 500 mb .
the tests carried out show an average specificity above 99% across the board and average sensitivities of 95% and 80% , respectively , for the lumen centered expansion and cell density localization .
the algorithms were also tested with images at 10 magnification ( up to 1228 mb ) obtaining similar results . |
in the overview of systematic reviews , outcome measures of the effectiveness of communication skills programs were patients satisfaction , their obedience to the medical decisions , and physicians self - confidence and self - efficacy . moreover , the findings of some studies have revealed the relationship between the doctors communication skills and patients satisfaction with medical services .
for instance , qualitative content analysis of eight research reports revealed that patients dissatisfaction with both the quality and quantity of the doctor - patient relationship is still at the top of the patients complaint list .
in other words , despite many invaluable endeavors to provide the medical students with the best training courses in communication skills , communication skills programs are not as effective as they are intended to be and increasing rate of the patients dissatisfaction is an objective indicator of physicians undesirable communication skills .
it is assumed that finding the factors , which influence the effectiveness of doctor - patient relationships and designing the interventions based on those factors , would improve the physicians doctor - patient communication skills and consequently would augment the patients satisfaction with doctors communication behavior . believing that some theory - based studies are needed to find the physicians behavioral indicators of an effective doctor - patient relationship
, researchers conducted a mixed - method study to evaluate an intervention applying precede proceed model on interns doctor - patient communication behavior and their patients satisfaction .
the emerging data from directed interviews with respondents were categorized under eight constructs of social cognitive theory ( sct ) .
this article discusses the relationship between two of those eight constructs , knowledge and self - efficacy of interns , in communicating with their patients . according to the theory of self - efficacy ,
it is attributed to individuals beliefs in their capabilities to follow a given behavior successfully .
in addition , teaching and implementing useful strategies to build perceived self - efficacy can lead to considerable improvements in job- related outcomes such as self- and customer satisfaction .
while reviewing the videotapes , researchers provided 53 internal medicine residents with some feedback on their doctor - patient communication skills , immediately after they visited a simulated patient ( sp ) in an objective structured clinical examination ( osce ) station .
for the most part , residents had poor communication skills and did not believe in their proficiencies to successfully communicate with the sp in the osce station . in a study ,
doctors self - efficacy in building a relationship with patients was increased from 6.85 to 7.84 ( p<0.001 ) by communication skills training . in previous studies , different determinants of doctor- patient communication behavior , such as physicians knowledge and self - efficacy and the relationship between them ,
in addition , finding the relationship between physicians self - efficacy and the other determinants of their communication behavior has been suggested .
the authors of a study , applying sct , have investigated the relationship between nurses knowledge and self - efficacy and have not reported a statistically significant relationship between the nurses knowledge and self - efficacy .
this paper aims to explore the relationship between medical interns knowledge about establishing an effective relationship with patients and their self - efficacy , as a part of a larger study , based on precede model and social cognitive theory(sct ) .
this cross - sectional study as a part of a larger study , based on precede model and social cognitive theory(sct ) was conducted in 2014 at medical schools of tehran and shahid beheshti universities of medical sciences , iran .
totally , 203 interns , who were willing to participate in the study , were recruited using convenience , non - probability sampling .
they were informed about their right to withdraw from participation at any time . applying precede model , we conducted semi - structured interviews with both interns and teaching faculty members in order to investigate their insights about building an effective relationship between patients and physicians . during the planning phase of the precede model , barriers to effective doctor - patient relationship
pro factors ( predisposing , enabling and reinforcing factors ) of interns communication behavior as well as social and behavioral indicators of interns successful relationship with their patients were considered .
the contents of the interviews were combined with the items from review of literature about doctors communication skills .
the resulting items were cultivated in order to be classified under the suitable constructs of the theories in hehp .
203 questionnaires were filled out by interns ( response rate was : 83 percent ) .
the condensed meaning units , which emerged from interviews , were combined with those from review of literature .
social cognitive theory ( sct ) was employed to categorize the items into different constructs . in doing so ,
this article describes only two constructs of interns doctor - patient communication behavior and not the other six constructs .
the construct of knowledge : it measured the interns learning of facts and gaining of insights related to building an effective relationship with patients and contained 12 items .
the interns evaluated each item on a five - point likert scale ( 1 : never , 2 : seldom , 3 : sometimes , 4 : usually and 5 : always ) .
the construct of self - efficacy : it measured the interns confidence in their capability to follow an effective relationship with patients and included 11 items .
the items for measuring the interns knowledge and self - efficacy as to building effective doctor - patient relationship are displayed in tables 1 and 2 , respectively .
items used for measuring the interns knowledge items for measuring the interns self - efficacy qualitative face validity of the questionnaire was examined by 40 medical interns . both quantitative face validity and content validity of the research questionnaire
were evaluated by 14 experts of medicine and health education and health promotion . in order to measure the quantitative face validity ,
impact score ( is ) for each item was calculated and is greater than 1.5 was considered suitable .
content validity ratio(cvr ) greater than 0.51 and content validity index(cvi ) greater than 0.79 were acceptable . having the theoretical framework of sct , exploratory factor analysis ( efa ) was skipped .
confirmatory factor analysis ( cfa ) was performed on 203 questionnaires . doing cfa , both construct validity and the magnitude and significance of the theory - based assumed causal relationships among different constructs were tested .
this article , as a part of a larger study , based on precede model and social cognitive theory(sct ) , discusses the findings about 2 constructs , knowledge and self - efficacy .
fitness of both measurement and structural models to the data was assessed by acceptable fit indices : the root mean square error of approximation ( rmsea ) 0.08 , the relative chi - square statistic ( x2/df ) 3 , normed fit index(nfi ) , non - normed fit index(nnfi ) , comparative fit index(cfi ) and incremental fit index(ifi ) 0.90 , and root mean square residual(rmr ) around zero .
internal consistency of each construct was tested by the cronbach s alpha coefficient and composite reliability of the constructs was measured based on the findings from cfa . the causal relationship between the interns knowledge and their self - efficacy was investigated by univariate linear regression analysis .
the data from completed questionnaires was analyzed using spss for windows version 21.0 and lisrel 8.80 .
the ethical approval for this research was obtained from tarbiat modares university s ethics committee .
participants were informed of both the objectives of the study , confidentiality of their information , and their right to withdraw from participation at any time .
this cross - sectional study as a part of a larger study , based on precede model and social cognitive theory(sct ) was conducted in 2014 at medical schools of tehran and shahid beheshti universities of medical sciences , iran .
totally , 203 interns , who were willing to participate in the study , were recruited using convenience , non - probability sampling .
they were informed about their right to withdraw from participation at any time . applying precede model , we conducted semi - structured interviews with both interns and teaching faculty members in order to investigate their insights about building an effective relationship between patients and physicians . during the planning phase of the precede model , barriers to effective doctor - patient relationship
pro factors ( predisposing , enabling and reinforcing factors ) of interns communication behavior as well as social and behavioral indicators of interns successful relationship with their patients were considered .
the contents of the interviews were combined with the items from review of literature about doctors communication skills .
the resulting items were cultivated in order to be classified under the suitable constructs of the theories in hehp .
203 questionnaires were filled out by interns ( response rate was : 83 percent ) .
the condensed meaning units , which emerged from interviews , were combined with those from review of literature .
social cognitive theory ( sct ) was employed to categorize the items into different constructs . in doing so ,
this article describes only two constructs of interns doctor - patient communication behavior and not the other six constructs .
the construct of knowledge : it measured the interns learning of facts and gaining of insights related to building an effective relationship with patients and contained 12 items .
the interns evaluated each item on a five - point likert scale ( 1 : never , 2 : seldom , 3 : sometimes , 4 : usually and 5 : always ) .
the construct of self - efficacy : it measured the interns confidence in their capability to follow an effective relationship with patients and included 11 items .
the items for measuring the interns knowledge and self - efficacy as to building effective doctor - patient relationship are displayed in tables 1 and 2 , respectively .
both quantitative face validity and content validity of the research questionnaire were evaluated by 14 experts of medicine and health education and health promotion . in order to measure the quantitative face validity , impact score (
is ) for each item was calculated and is greater than 1.5 was considered suitable .
content validity ratio(cvr ) greater than 0.51 and content validity index(cvi ) greater than 0.79 were acceptable . having the theoretical framework of sct , exploratory factor analysis ( efa ) was skipped .
confirmatory factor analysis ( cfa ) was performed on 203 questionnaires . doing cfa , both construct validity and the magnitude and significance of the theory - based assumed causal relationships among different constructs were tested .
this article , as a part of a larger study , based on precede model and social cognitive theory(sct ) , discusses the findings about 2 constructs , knowledge and self - efficacy .
fitness of both measurement and structural models to the data was assessed by acceptable fit indices : the root mean square error of approximation ( rmsea ) 0.08 , the relative chi - square statistic ( x2/df ) 3 , normed fit index(nfi ) , non - normed fit index(nnfi ) , comparative fit index(cfi ) and incremental fit index(ifi ) 0.90 , and root mean square residual(rmr ) around zero .
internal consistency of each construct was tested by the cronbach s alpha coefficient and composite reliability of the constructs was measured based on the findings from cfa .
the causal relationship between the interns knowledge and their self - efficacy was investigated by univariate linear regression analysis .
the data from completed questionnaires was analyzed using spss for windows version 21.0 and lisrel 8.80 .
the ethical approval for this research was obtained from tarbiat modares university s ethics committee .
participants were informed of both the objectives of the study , confidentiality of their information , and their right to withdraw from participation at any time .
in all , 203 interns participated in the study ( response rate : 83% ) .
the mean age of the interns was 241 years old , ranging from 24 to 31 . despite the interns gender and marital status , their age was a significant contributor to their mean self - efficacy score ( pearson chi - square sig .
the characteristics of the participants and their mean scores for the constructs of knowledge and self - efficacy by demographic status are shown in table 3 .
characteristics of the study sample ( 203 interns ) and their mean scores for the constructs of knowledge and self - efficacy by demographic status mean ( sd ) . higher values indicate better self - efficacy ; results derived from one - way analysis of variance ; results derived from t - test content validity ratio ( cvr ) and content validity index ( cvi ) of the items were acceptable at the ranges of 0.57 to 1 and 0.86 to 1 , respectively .
the impact score ( is ) of the items was acceptable , between 3.66 and 5 . in all , 48.8 percent of the changes of interns doctor - patient communication behavior were explained by eight constructs of sct .
knowledge and self - efficacy were the two most important predictors of interns successful doctor - patient relationship and together explained about 23 percent of the changes of interns doctor - patient communication behavior .
descriptive statistics of the knowledge and self - efficacy measures are shown in table 4 .
descriptive statistics of the knowledge and self - efficacy measures ( n=203 interns ) correlation is significant at the 0.01 level ( 2-tailed ) both the measurement model of the construct of knowledge with 12 items and the measurement model of the construct of self - efficacy with 11 items showed a good fit to the data .
figure 1 shows the measurement modeling of the constructs of knowledge and self - efficacy .
fit indices from confirmatory factor analysis were satisfactory as below : the root mean square error of approximation ( rmsea)=0.08 , the relative chi - square statistic ( x2/df)=1.33 , normed fit index(nfi)=0.89 , non - normed fit index(nnfi)=0.93 , comparative fit index(cfi)=0.93 , incremental fit index(ifi)=0.93 and root mean square residual(rmr)=0.036
. results of the confirmatory factor analysis ( knowledge and self - efficacy are latent variables and the items are observed variables ) univariate linear regression analysis of the structural model between the interns knowledge and self - efficacy explained how much the changes of interns self - efficacy in building effective doctor - patient relationship were dependent on the changes of their knowledge about .
table 5 represents the model summary and parameter estimates of the model , in which interns self - efficacy is dependent on their knowledge .
according to the findings of this study , the interns self - efficacy in building a relationship with patients was significantly influenced by their knowledge about effective doctor - patient relationship .
furthermore , knowledge and self - efficacy were the two most important predictors of the interns successful communication behavior and totally explained 23 percent of variance in interns communication skill .
this means that communication skills training programs should focus on improving the physicians knowledge as well as their self - efficacy as to doctor - patient relationship .
opponents assert that physicians self - esteem or self - confidence are already high and they do not need to attend such training programs and health researchers should not give priority to self - efficacy in instructional designs . on the other hand , considering the facts that perceived self - efficacy refers to a person s estimation of his or her ability to do a specific job successfully and self - esteem refers to the judgment of self - worth , proponents claim that self - efficacy and self - esteem are completely different from each other and medical doctors high self - esteem does not mean that their self - efficacy as to building a relationship with patients is high , as well
. moreover , self - efficacy is behavior specific and physicians self - efficacy , which is specific to their communication behavior needs to be improved .
furthermore , self - efficacy has become a valid predictor of students motivation and learning after many years of research .
for this reason , medical students self - efficacy should be a crucial concern of educators in designing , planning and implementing educational programs in order to improve the physicians confidence in building effective relationship with patients and increase their job satisfaction . according to the findings of this study ,
the interns self - efficacy was significantly influenced by their knowledge and 53 percent of the changes in interns self - efficacy as to building an effective relationship with patients were explained by the changes in their knowledge about effective doctor - patient relationship .
this means , learning facts and gaining insights about effective doctor - patient relationship can increase the interns self - efficacy and consequently can improve their doctor - patient communication behavior .
self - efficacy was reported as a significant predictor of the knowledge sharing behavior of 274 participants in a research based on social cognitive theory in taiwan .
this finding is inconsistent with our study in which interns self - efficacy was the second most important predictor of interns doctor - patient communication behavior . applying social cognitive theory in a research , we reported a statistically significant correlation between 25 nurses knowledge and self - efficacy about pain management .
there was also no significant relationship between 273 diabetic adult patients literacy and their self - efficacy in shared decision making .
hence , further theory - based studies are recommended to investigate the relationship between the constructs of knowledge and self - efficacy . in the present study ,
the items for measuring the interns knowledge and self - efficacy as well as their communication behavior were derived from content analysis of the participants interviews . therefore , target group participation in designing of the research tool was the main strength of this study .
however , the small sample size primarily limited this study . including interns from other universities of medical sciences could expand the sample size .
a narrow range of the interns age in the universities in this study represented low diversity of participants . including multiple universities could diversify the ages represented in our sample and benefit our results in terms of exploring the causal relationship between interns demographic characteristics and their mean self - efficacy score .
in the present study , the items for measuring the interns knowledge and self - efficacy as well as their communication behavior were derived from content analysis of the participants interviews .
therefore , target group participation in designing of the research tool was the main strength of this study .
however , the small sample size primarily limited this study . including interns from other universities of medical sciences could expand the sample size .
a narrow range of the interns age in the universities in this study represented low diversity of participants . including multiple universities could diversify the ages represented in our sample and benefit our results in terms of exploring the causal relationship between interns demographic characteristics and their mean self - efficacy score .
in this study , both the magnitude and significance of the causal relationship between the interns knowledge about effective doctor - patient relationship and their self - efficacy were noteworthy .
conducting further research by applying theories and models of behavior change is suggested in order to explore other important predictive determinants of medical students communication behavior . moreover
, confirmation of the effectiveness of communication skills programs , which predominantly focus on physicians knowledge and self - efficacy , will require much more time and combined evaluation methods .
for example , patients with chronic diseases , who are regularly visited in university affiliated clinics , can be requested to provide feedback about the quality of physicians communication skills many times , before and after these physicians attend such training programs .
indeed , it is believed that synthesizing the patients feedback with physicians self - evaluation can well clarify the effectiveness of communication skills training programs , which mainly concentrate on the physicians knowledge and self - efficacy . in all , according to the findings of this study , reflecting on practice - based barriers and examining the interns insights about physicians routine behavior will improve their shared vision and consequently the quality of their knowledge about building an effective relationship with patients .
hence , planning for augmenting doctors knowledge and self - efficacy in instructional design of any communication skills program can improve medical students communication skills .
however , as changes in interns knowledge explained about 53 percent of the changes in their self - efficacy , the approaches to improving interns self - efficacy as to building effective relationship with patients might be to target the strategies more than increasing their knowledge . | background : after many years of teaching , both the efficiency and efficacy of communication skills programs are under question because patients dissatisfaction with doctors communication behavior is at the top of the complaint lists .
it is assumed that finding the specific role of different determinants of doctors communication behavior , instructional designers can plan more effective training programs .
this study aims to explore the predictive value of interns knowledge and self - efficacy in building effective relationship with patients and determine the causal relationship between interns knowledge and self - efficacy about effective doctor - patient relationship.methods:in this cross - sectional study , precede model was applied and the analyzed content from semi - structured interviews with 7 interns and 14 faculty members was combined with the items from literature review .
all the emerged items were categorized under eight constructs of social cognitive theory .
the validity and reliability of the items of the research questionnaire were examined by 40 interns and an expert panel of 14 faculty members .
the questionnaires were completed by 203 medical interns and confirmatory factor analysis ( cfa ) was done on the items .
the data were analyzed by spss.21 and lisrel 8.80.results:cfa indicated a good fit to the data .
knowledge and self - efficacy , together , explained 23 percent of the variance in interns communicative behavior .
53 percent of the changes in interns self - efficacy were attributed to the changes in interns knowledge.conclusion:improving the interns shared vision can increase the quality of their knowledge and instructional designs based on learning facts , and gaining insights about effective doctor - patient relationship can increase the interns self - efficacy and consequently improve the interns communication skills . |
in 1986 , the italian environment ministry has officially recognized a number of high - risk areas across italy , and over the last two decades other areas have been added to the list . the current number of high - risk areas is 53 , including 3 in sicily , where past and current industrial activities caused environmental changes that may be harmful to human health .
the sicilian region has three contaminated sites : the areas of milazzo - valle del mela , augusta - melilli - priolo , and gela . a recent epidemiological study in a cohort of subjects living in the gabbia district ( valle del mela area ) showed that mortality rate and hospital discharge records for cancer were enhanced . in agreement with this finding ,
the analysis of the epidemiological observatory for specific cancers showed statistically significant increases in the percentage of colon and rectum tumours and multiple myeloma .
furthermore , this analysis pointed out that female population showed an increased incidence of breast cancer , while male population had a significant increase in malignant cancer of the trachea , bronchi and lungs , central nervous system , and thyroid .
very few studies have addressed the possible effects of chronic low environmental exposure to mixtures of heavy metals in the general population of industrialized countries , especially with regard to their possible interactions with organs and tissues .
furthermore , there is a definite paucity of data concerning children ; this is a specific cause for concern : in fact , children are known to absorb metals more readily than adults and are particularly sensitive for biologic and developmental reasons .
most of our knowledge concerning the health effects of toxic metals largely stems from studies conducted on populations with relatively high exposure , such as workers in industry or in heavily polluted environments . only in the last years
few studies concerning human biomonitoring ( hbm ) have addressed the possible effects of chronic low environmental exposure to mixtures of these metals in the general population of industrialized countries , especially that particularly susceptible such as adolescents .
indeed , concerns have been raised that children may be more susceptible to toxic exposure than adults because they have proportionally more intake of food contaminants , active developmental processes , multiple exposure pathways , and susceptible sociobehavioral activities .
looking at the hbm preexisting situation in italy , the evaluation of the internal dose of metals in the general population is available only for a few geographical areas in italy and only the lazio region investigated children [ 5 , 6 ] .
furthermore , no data is available for the sicilian region . to overcome this lack of information , some countries derive reference values for the general adolescent population using data from surveys of large numbers of individuals , such as the german environmental survey ( geres iv ) [ 7 , 8 ] and the u.s . national health and nutrition examination survey . in light of these observations ,
the primary goal of this paper was to perform a biomonitoring study in adolescents living in the milazzo - valle del mela area to identify their exposure to arsenic , cadmium , chromium , lead , mercury , nickel , and vanadium : in fact , these heavy metals are typical emissions by oil refinery and thermal power plants that are localized nearby .
we used the methodically based criteria for the application of human biomonitoring developed from the human commission of the federal german environmental agency . the working principles and procedures of the commission
children ( 1214 years ) in the exposed group were recruited from those born and living in the area of milazzo - valle del mela ( including the following districts : condr , gualtieri sicamin , milazzo , pace del mela , san filippo del mela , santa lucia del mela , and san pier niceto ) ; the distance between the industrial and the residential districts was in a range between 1 and 7 km .
starting from december 2012 and up to january 2013 , we met the parents in the different schools and , after an exhaustive explanation of the project , we obtained a written consent from the parents of all the subjects involved in the study .
a total of 215 exposed children , 113 males and 102 females , aged 1214 years , were enrolled . as control group , we enrolled 29 children ( 16 males and 13 females ) , aged 1214 years and living 45 km far from the industrial plants in the montalbano elicona district ( figure 1 ) .
exclusion criteria for both exposed and controls were as follows : being of sicilian origin , living in the selected area from at least 10 years , and absence of confounding diseases ( i.e. , diabetes , anaemia , etc . ) .
all children were provided with urine collection containers for 24-hour specimens and their parents were instructed for appropriate procedure and storage .
urine collection was performed 1 or 2 days before the medical visit and stored at 26c to avoid any loss of sample or contamination .
the 24-hour collection was done on sunday , when the children were not at school .
all medical visits were performed on monday and tuesday , afternoon , in the outpatient of milazzo hospital . as part of the visit ,
urine containers were collected and blood was withdrawn from a peripheral vein of the forearm .
in addition , both parents and children were administered a multiple - choice questionnaire to assess their lifestyle , quality of life , and risk perception .
following biological sample collection , the investigators delivered the samples to the pharmacology and toxicology laboratory of the university of messina .
urine total volume was recorded ; samples ( 100 ml ) were treated with 2 ml of 90% pure hno3 and then stored at 20c until analysis at the laboratori riuniti scarl ( catania , italy ) .
urine samples were analysed for the following heavy metals : arsenic , cadmium , chromium , mercury , nickel , and vanadium , and were determined to be blinded on coded samples .
the perkin - elmer ( norwalk , ct ) aanalyst 300 atomic absorption spectrometer ( aas ) with an automated turret , deuterium arc background correction ( aa - bg ) , and hga-800 graphite furnace was used for all analyses .
the blood used for lead analysis was collected according to the italian institute of health guidelines .
lead in blood samples was analyzed with a zeeman/5 100 pc atomic absorption spectrophotometer with hga-600 graphite furnace and as-60 autosampler ( all from perkin - elmer ) .
an intensitron hollow cathode lead lamp ( perkin - elmer ) was the light source .
when the results exceeded the reference value , repeated sampling was performed according to guidelines . according to the iupac guideline
, the reference value is defined within the 95% confidence interval of the 95th population percentile of the distribution of concentrations of a specific compound or element in a body fluid of a reference population [ 7 , 11 ] .
the results in the form of descriptive statistics were expressed in g / l for either blood or urine . in fact , the presentation of creatinine - based analytical data and reference values is not anymore recommended .
data normality was tested with d'agostino - pearson normality test and differences between exposed and control groups were evaluated with mann - whitney u test ; p < 0.05 was considered statistically significant .
the percentiles and maximum values are shown in the tables to help describe the sample distribution .
the percentiles ( p5 , p25 , p75 , and p95 ) provided for each metal convey useful information about the upper distribution of levels in the population . the 95th percentile levels and appropriate confidence intervals were used for reference values proposal .
overall , the distributions of metals in blood and urine were described by the following statistical parameters : number of participants ( n ) , percentiles ( p25 ; p50 ; p75 ; p95 ) , upper value ( u - gm ) , lower value ( l - gm ) , geometric mean ( gm ) , and the 95% confidence interval for the geometric mean ( ci - gm ) . when the percentage of samples < lod was too elevated ( as for lead , mercury , nickel , arsenic , and vanadium ) , we transformed the data ( 0 for values
< lod and 1 for values > lod ) in order to compare the percentage of samples below / above the lod for each metal between exposed and control groups , thus estimating the relative risk to exceed lod , using fisher 's exact test .
each test was considered statistically significant if the p value was equal to or less than 0.05 .
a post hoc power calculation revealed that the power of the study was 100% assuming urinary cadmium as the main variable .
the test was performed according to rosner , using the following formula : power = {z1/2 + /1/n1 + 2/n2 } , where n1 was the sample size for the group of control adolescents , n2 was the sample size for the group of exposed adolescents , was the absolute difference between the means relative to the primary variable of our study ( urinary cadmium concentration ) , 1 and 2 were the variances of such means in our two study groups ( exposed and control , resp . ) , was the probability of type i error ( set to 0.05 ) , was the probability of type ii error ( set to 0.2 ) , z was the critical value for , and was the function converting a critical z value to power .
215 adolescents ( 113 males and 102 females ) , born and resident in the milazzo - valle del mela area , were recruited .
no differences were observed in age and body mass index ( bmi ) . to determine whether age or bmi might contribute to body burden of each metal ,
table 2 represents the limit of detection ( lod ) of the analytical method used for determining heavy metal levels in biological matrix samples and the percentage number of samples below the limit . due to the large amount of samples under lod for arsenic , lead , mercury , nickel , and vanadium ( table 2 ) ,
table 3 shows heavy metals concentration determined in biological matrices of the exposed and control groups .
data are expressed as geometric means and 95% confidence intervals and were subdivided in percentiles from p5 to p95 .
the concentration of each analyzed metal was compared between exposed and control groups ( table 4 ) .
cadmium levels were significantly higher in exposed adolescents than in control ones ( 0.55 g / l versus 0.26 g / l , resp . ;
we also observed that cadmium levels were higher in males than in females ( p = 0.0009 ; table 4 ) in control group . analyzing the number of samples over - lod for arsenic , lead , mercury , nickel , and vanadium
, we found a significant increased relative risk ( > 1.54-fold ; ci : 1.152.04 ; p = 0.01 ) to be exposed to arsenic ( figure 2 ) for exposed adolescents compared with controls ; furthermore , the same analysis revealed that the control subjects were 3-fold more at risk of pb exposure than those in the exposed group ( figure 2 ; relative risk : 3.07 ; ci : 1.496.32 ; p < 0.0001 ) .
heavy metals levels of both exposed and control children were compared with the reference values for not exposed adolescents as stated by previously published surveys ( table 5 ) .
cadmium levels of exposed population were significantly augmented when compared with the reference values ( table 5 ) .
previous studies have investigated heavy metals exposure in adolescents living in other exposed areas of europe ; thus comparing our results to those , it was observed that cadmium values of adolescents living in our exposed area were higher than those of czech and spanish ones and similar to those of polish ones ( table 6 ) .
we administered a questionnaire to the adolescents and their parents for the identification of modifying elements , including socioeconomic and lifestyle ones which could provide important information on susceptibility factors .
table 7 shows the most relevant answers provided by either exposed group or control group regarding quality of life , risk perception , and food habits . from the obtained answers , it is possible to observe that none of the enrolled kids stated to be a smoker .
overall , adolescents living in the exposed area and their parents had higher perception of living in a high - risk environment .
environmental pollution by heavy metals in industrialized countries is the consequence of present or past emissions by petrochemicals industries .
unfortunately , few stringent measures and controls have been put into place and , as a consequence , high levels of these pollutants still persist in the soils and sediments causing concerns for the food chain integrity and unwanted consequences for the populations living in those areas . in the present study
, we evaluated heavy metals exposure in the adolescent population , resident in the milazzo - valle del mela area , identified as a high - risk area by local authorities .
a total of 215 adolescents aged 1214 years were recruited in the seven schools located in the municipalities of condr , gualtieri sicamin , milazzo , pace del mela , san filippo del mela , santa lucia del mela , and san pier niceto .
an age - matched control group resident in a rural area of sicily was also studied .
adolescents represent an essentially important population sample : in fact , exposure to heavy metals from the early childhood could have a negative impact on the developmental status .
in addition , this population has not yet too many complicating influences , such as occupational exposure , moving house , which may cause variability in the data evaluation and interpretation .
the first most relevant result emerging from our survey is the presence of high levels of urinary cadmium in exposed adolescents compared with control ones , having levels within the range of the reference values [ 7 , 9 ] . as a matter of fact
, there are several industrial plants and metal - work - related factories , currently operating in the area , that use cadmium compounds as stabilizers for pvc products , color pigments , alloys , and rechargeable nickel cadmium batteries .
in addition , the thermal power plant and metallurgical industries , still active and located in the area , use cadmium as an anticorrosion agent ( cadmiation ) . in the present study , we identified gender difference in the urinary levels of cadmium in the exposed group : this may reflect either a different tissue accumulation or absorption in the two sexes , as already reported .
airborne cadmium could be readily absorbed by plants and taken up through the roots to edible leaves , fruits , and seeds [ 17 , 18 ] , and this might also explain the elevated values observed in the adolescents : in fact , results from the questionnaire show that 67% of adolescents eat fruits and vegetables grown in their own garden .
all these observations , taken together , led us to hypothesize that the elevated urinary levels of this heavy metal are due to a high burden of pollutants in both the ecosystem and the food chain .
the urinary cadmium concentration is mainly influenced by the body burden and is proportional to the concentration in the kidneys . in general , nonsmokers have urinary cadmium concentrations of 0.020.7 g / l , and their cadmium levels slowly increase with age together with the accumulation of cadmium in the kidney .
therefore , elevated urinary cadmium excretion is a read - out of high intake of cadmium and also of elevated gastrointestinal absorption of the heavy metal in children , as recently pointed out by kippler et al . .
however , the increased levels of cadmium of exposed adolescents compared with controls do not allow drawing any final conclusion about the health risk of the population living in the milazzo - valle del mela area . as a matter of fact ,
the german human biomonitoring commission recommends the use of two different kinds of criteria to assess exposure : reference values and hbm values .
the reference values indicate the upper margin of background exposure to a given pollutant in a given population at a given time .
by contrast , hbm values derive two different kinds of values : hbm i represents the concentration of a substance in human biological material below which there is no risk for adverse health effects and , consequently , no need for action ; hbm ii represents the concentration above which there is an increased risk for adverse health effects .
adverse health effects should be considered for concentrations in the range between hbm i and hbm ii .
the geometric mean of the urinary cadmium levels in our exposed adolescents was higher than the specific hbm i value ( 0.50 g / l ) settled by german human biomonitoring commission and fell in the range between hbm i and hbm ii ( 2 g / l ) . in another study , called democophes , a pan - european hbm project involving 120 mother and child ( 611 years ) couples , cadmium levels were found higher in younger children , suggesting that the prepubertal age is even more sensitive to metals ' accumulation ; given the different age - range , it is difficult to compare those results with our study . intense industrialization and other activities have led to the global occurrence of soluble chromium , which is readily leached from soil to ground water in concentrations above permissible levels .
this naturally occurring element was found elevated in either exposed or control adolescents when compared with reference values .
this could be due to nonanthropogenic contamination of drinking water : in fact , most of the local mineral water has shown an elevated content of this metal ( up to 50 g / l ) during routine checks by the sicilian environmental protection agency ( arpa , sicilia ) .
besides , it should be pointed out that we measured total chromium but not its hexavalent form that more correlates with an increased healthy risk .
finally , there is no survey showing reference value for this specific heavy metal in adolescents ; of the previous surveys , only one carried out in a cohort of spanish adolescents evaluated urinary chromium , demonstrating lower levels compared to the present study .
therefore , our present data represent a warning for the local , regional , and national authorities that should undertake immediate action to reduce exposure to cadmium and chromium .
surprisingly , we found higher blood lead levels in the control population than in exposed adolescents : this unexpected finding is likely linked to high levels of lead water pipes that have not yet been replaced in the rural houses .
another explanation could be the higher frequency of smoking parents as suggested by the results of our life style and habits questionnaire .
adolescents living in milazzo - valle del mela area had an increased risk of being more exposed to arsenic than those living 45 km away from the industrial site ; this mainly reflects the frequency of fish consumption , in agreement with results of questionnaires , where it appears that the 40% of exposed adolescents ( versus the 14% of controls ) eat fish twice a week .
furthermore , the sicilian environmental agency report ( arpa , sicilia ) has detected overruns for arsenic in groundwater in the milazzo - valle del mela area .
however , arsenic urine levels of the adolescents living in the industrial area were below the reference values [ 22 , 25 ] .
mercury urinary levels were above reference value , in exposed children ; however , the high percentage of samples below the limit of quantification makes the comparison with other studies particularly difficult .
besides the industrial emission , mercury levels are most likely due to the large use of dental amalgam fillings , and methylmercury exposure derives also from fish consumption .
in conclusion , the present biomonitoring study clearly shows that adolescents living in the milazzo - valle del mela area have increased urinary levels of cadmium which requires an action to reduce human exposure . besides
, this study will serve as a basis for the health risk assessment and management process to favour the implementation of preventive measures to control emissions from the industrial plants of the area . | in the milazzo - valle del mela area , the presence of industrial plants and the oil refinery make local residents concerned for their health . for this reason
, we evaluated the levels of heavy metals in 226 children aged 1214 years , living in the 7 municipalities of the area .
a control age - matched population ( n = 29 ) living 45 km far from the industrial site was also enrolled .
arsenic , cadmium , chromium , mercury , nickel , and vanadium were analysed in 24 h urine samples , while lead concentration was evaluated in blood samples . a questionnaire regarding life style and risk perception
was also administered .
adolescents from milazzo - valle del mela had cadmium levels significantly higher compared to either controls ( p < 0.0001 ) or the reference values of the european germany environmental survey ( geres - iv ) and the american national health and nutrition examination survey ( nhanes ) .
furthermore , children had higher perception of living in a high - risk environment .
the present data , for the first time , clearly indicate that adolescents living in milazzo - valle del mela have increased body concentration of cadmium , which may be harmful to human health .
these results deserve particular attention by the local and regional government to initiate prevention programmes in this susceptible population . |
chrysotile fibers promoted the fusion of human erythrocyte membranes and the hemolysis and fusion of fowl erythrocytes .
amosite and glass fibers did not show the same effect .
these findings provide a model for the internalization of the fibers by animal cells.imagesfigure 1 .
afigure 1 .
bfigure 1 .
cfigure 2 .
afigure 2 .
bfigure 3 .
afigure 3 .
bfigure 3 .
cfigure 3 .
d |
|
bateson ( 3 ) distinguished endobronchial chondroma from pulmonary chondroma based on the histogenesis of lung chondroma .
the former grows into the bronchial lumen and accounts for < 25% of all benign cartilage neoplasms of the lung .
the latter grows into lung parenchyma and has an incidence of about 0.1% of all benign lung tumor types . between july 2003 and june 2015 ,
29 patients with pulmonary chondroma underwent surgical operation at the affiliated hospital of north sichuan medical college ( nanchong , china ) .
the present paper aimed to summarize the clinicopathological features and the outcome of surgical treatment of pulmonary chondroma .
additionally , the present study clarified the differences between pulmonary chondroma and other benign pulmonary tumor .
the present study was approved by the ethics committee of north sichuan medical college ( nanchong , china ) .
the clinical data for each of the 29 patients is shown in table i. a total of 29 patients were pathologically diagnosed pulmonary chondroma , including 16 males and 13 females , with an average age of 57 years ( range , 3978-years - old ) . of these patients ,
18 exhibited no clinical symptoms and the pulmonary chondroma was detected by routine medical examination , 7 patients were characterized by coughing , hemoptysis , shortness of breath and other symptoms , only 3 patients presented with chest pain as the predominant symptom and 1 patient with esophageal cancer was identified by preoperative examination .
physical examination revealed only 3 patients with low breath sounds and others without obvious abnormalities .
lung tumor - like lesions , nodules and varying degrees of calcification was demonstrated by chest computed tomography ( ct ) scan ( fig .
pulmonary masses of 9 patients were in the right lower lobe , 2 were in the right upper lobe , 3 were in the right middle lobe , 11 were in the left upper lobe and 4 were in the left lower lobe .
the mean tumor diameter was 3.6 cm , ranging between 1.0 cm and 8.5 cm .
no obvious abnormalities were revealed by other routine preoperative examinations , including head ct scan , radionuclide bone scan and abdominal ultrasound .
preoperatively , 13 patients were considered hamartoma , 14 patients were considered benign nodules , only 2 patients with chest wall adhesion were suspected of malignant infiltration and no patient was diagnosed pulmonary chondroma .
the thoracotomy pneumonectomy was performed under general anesthesia with single - lung ventilation , which may be accomplished with double - lumen endotracheal tubes .
the patients were placed in the lateral decubitus position with the upper arm suspended on a crossbar .
firstly , a 1.5 cm incision was placed in the seventh intercostal space at mid axillary line .
another incision ( ~79 cm long ) was made in the fourth intercostal space under the armpit if there was no adhesion , or else anterolateral incision was used . during conventional thoracotomy ,
the mass revealed no malignant cells by intraoperative frozen section examination and was therefore confirmed as benign tumors .
the data were analyzed using spss 22.0 ( ibm spss , chicago , il , usa ) and the results were presented as the mean standard deviation .
the present study was approved by the ethics committee of north sichuan medical college ( nanchong , china ) .
the clinical data for each of the 29 patients is shown in table i. a total of 29 patients were pathologically diagnosed pulmonary chondroma , including 16 males and 13 females , with an average age of 57 years ( range , 3978-years - old ) . of these patients ,
18 exhibited no clinical symptoms and the pulmonary chondroma was detected by routine medical examination , 7 patients were characterized by coughing , hemoptysis , shortness of breath and other symptoms , only 3 patients presented with chest pain as the predominant symptom and 1 patient with esophageal cancer was identified by preoperative examination .
physical examination revealed only 3 patients with low breath sounds and others without obvious abnormalities .
lung tumor - like lesions , nodules and varying degrees of calcification was demonstrated by chest computed tomography ( ct ) scan ( fig .
pulmonary masses of 9 patients were in the right lower lobe , 2 were in the right upper lobe , 3 were in the right middle lobe , 11 were in the left upper lobe and 4 were in the left lower lobe .
the mean tumor diameter was 3.6 cm , ranging between 1.0 cm and 8.5 cm .
no obvious abnormalities were revealed by other routine preoperative examinations , including head ct scan , radionuclide bone scan and abdominal ultrasound .
preoperatively , 13 patients were considered hamartoma , 14 patients were considered benign nodules , only 2 patients with chest wall adhesion were suspected of malignant infiltration and no patient was diagnosed pulmonary chondroma .
the thoracotomy pneumonectomy was performed under general anesthesia with single - lung ventilation , which may be accomplished with double - lumen endotracheal tubes .
the patients were placed in the lateral decubitus position with the upper arm suspended on a crossbar .
firstly , a 1.5 cm incision was placed in the seventh intercostal space at mid axillary line .
another incision ( ~79 cm long ) was made in the fourth intercostal space under the armpit if there was no adhesion , or else anterolateral incision was used . during conventional thoracotomy ,
the mass revealed no malignant cells by intraoperative frozen section examination and was therefore confirmed as benign tumors .
the data were analyzed using spss 22.0 ( ibm spss , chicago , il , usa ) and the results were presented as the mean standard deviation .
the present study was approved by the ethics committee of north sichuan medical college ( nanchong , china ) .
the clinical data for each of the 29 patients is shown in table i. a total of 29 patients were pathologically diagnosed pulmonary chondroma , including 16 males and 13 females , with an average age of 57 years ( range , 3978-years - old ) . of these patients ,
18 exhibited no clinical symptoms and the pulmonary chondroma was detected by routine medical examination , 7 patients were characterized by coughing , hemoptysis , shortness of breath and other symptoms , only 3 patients presented with chest pain as the predominant symptom and 1 patient with esophageal cancer was identified by preoperative examination .
physical examination revealed only 3 patients with low breath sounds and others without obvious abnormalities .
lung tumor - like lesions , nodules and varying degrees of calcification was demonstrated by chest computed tomography ( ct ) scan ( fig .
pulmonary masses of 9 patients were in the right lower lobe , 2 were in the right upper lobe , 3 were in the right middle lobe , 11 were in the left upper lobe and 4 were in the left lower lobe .
the mean tumor diameter was 3.6 cm , ranging between 1.0 cm and 8.5 cm .
no obvious abnormalities were revealed by other routine preoperative examinations , including head ct scan , radionuclide bone scan and abdominal ultrasound .
preoperatively , 13 patients were considered hamartoma , 14 patients were considered benign nodules , only 2 patients with chest wall adhesion were suspected of malignant infiltration and no patient was diagnosed pulmonary chondroma .
the thoracotomy pneumonectomy was performed under general anesthesia with single - lung ventilation , which may be accomplished with double - lumen endotracheal tubes .
the patients were placed in the lateral decubitus position with the upper arm suspended on a crossbar .
firstly , a 1.5 cm incision was placed in the seventh intercostal space at mid axillary line .
another incision ( ~79 cm long ) was made in the fourth intercostal space under the armpit if there was no adhesion , or else anterolateral incision was used . during conventional thoracotomy ,
the mass revealed no malignant cells by intraoperative frozen section examination and was therefore confirmed as benign tumors .
the data were analyzed using spss 22.0 ( ibm spss , chicago , il , usa ) and the results were presented as the mean standard deviation .
a total of 29 patients were pathologically diagnosed with pulmonary chondroma , including 16 males and 13 females , with an average age of 57 years ( range , 3978 years ) . of these patients ,
18 exhibited no clinical symptoms and the pulmonary chondroma was detected by routine medical examination , 7 were characterized by coughing , hemoptysis , shortness of breath and other symptoms , 3 patients presented with chest pain as the predominant symptom and 1 patient with esophageal cancer was identified by preoperative examination .
physical examination revealed only 3 patients with low breath sounds and others without obvious abnormalities .
lung tumor - like lesions , nodules and varying degrees of calcification was demonstrated by chest computed tomography ( ct ) scan ( fig .
pulmonary masses of 9 patients were found in the right lower lobe , 2 were in the right upper lobe , 3 were in the right middle lobe , 11 were in the left upper lobe and 4 were in the left lower lobe .
no obvious abnormalities were revealed by other routine preoperative examinations , including head ct scan , radionuclide bone scan and abdominal ultrasound .
preoperatively , 13 patients were considered hamartoma , 14 patients were considered benign nodules , 2 patients with chest wall adhesion were suspected of malignant infiltration and no patient was diagnosed with pulmonary chondroma .
carney 's triad was excluded by abdominal magnetic resonance imaging ( mri ) and gastroscopy .
the operative duration ranged between 48 and 215 min ( mean , 12622 min ) .
the estimated blood loss ranged between 5 and 350 ml ( mean , 8223 ml ) . additionally , no patient required a blood transfusion .
all patients , with the exception of 5 patients , had an uneventful postoperative course ( 82.8% ) .
of the five complications , two were postoperative encapsulated pleural effusion and three were pulmonary infection .
these 5 patients recovered well following percutaneous catheter drainage by ct - guided and anti - infection therapy .
the drainage duration ranged between 2 and 8 days ( mean , 3.11.8 days ) and the postoperative hospital duration ranged between 4 and 13 days ( mean , 4.02.1 days ) .
patients were followed - up between 2 and 135 months . during follow - up , 23 patients were alive without recurrence , 1 patient succumbed to esophageal cancer after 19 months post - surgery , 3 patients succumbed to other diseases .
connective tissues , reticulocytes developed into original direction by certain stimulate conditions , became the embryo of mesenchymal tissue , and then developed into chondrocytes .
the tumor tissues were pale and translucent , hard and lobulated on the lateral section . under the microscope ,
the tumors were observed to be formed by differentiation of mature cartilage tissue , wrapped around the cartilage matrix .
cartilage tissues can be hyaline cartilage , elastic cartilage and fibrous cartilage , or diverse cartilage mixed together without other mesenchymal tissue components , abnormal mitotic and adipose tissues .
pulmonary chondroma was common in adult females of 4050-years - old and neonatal cases were occasionally reported ( 2 ) .
however , in the present group , 16 males and 13 females with an average age of 57 years ( range , 3978-years - old ) , different from the literature ( 2,4,5 ) . pulmonary chondroma may occur in each pulmonary lobe , particularly the right lower lobe .
of the 29 patients , 9 exhibited pulmonary chondroma located in the right lower lobe and 15 were located in left lung , also inconsistent with previous literature .
the mean diameter of pulmonary chondroma was 2.8 cm and was usually asymptomatic ( 4 ) . in the present study ,
of the patients , 18 presented without any clinical symptoms , 1 with esophageal cancer was identified by preoperative examination .
the symptoms of pulmonary chondroma depended on the size and location of the tumor . if the bronchus were oppressed , atelectasis was caused .
respiratory symptoms , including cough with sputum or hemoptysis and shortness of breath , can occur ( 6,7 ) . in the present study ,
intraoperatively , the tumor shrunk without invasion into the chest wall . as a result of the compression of intercostal nerves ,
if 2/3 clinical features are present , it can be diagnosed as carney 's triad ( 9 ) .
the syndrome is rare and predominantly affects young women ; however , the etiology remains unknown .
a total of 104 patients with carney 's triad were reported to have survival rates of 10 and 40 years , for 100 and 73% , respectively ( 10 ) . for young women , a gastrointestinal stromal tumor or pulmonary chondroma
in addition , gastrointestinal stromal tumors and extra - adrenal paraganglioma in carney 's triad were potentially fatal , and eliminating the syndrome for patients with pulmonary chondroma was necessary .
the correct diagnosis for patients of carney 's triad is essential to provide the appropriate treatment and result in a good prognosis . to exclude carney 's triad , the 29 patients in the present study underwent abdominal mri examination and gastroscopy 3 months after surgery and no abnormalities were detected . as a result of the heterochrony of the three tumors , lifelong follow - up of patients with pulmonary chondroma
is necessary . a chest x - ray , enhanced ct scan of the chest or mri made it easier to identify the benign or malignant calcification lumps .
the ct is more commonly used , often displaying as round or oval nodules , moderate soft tissue density , inhomogeneous density with calcification and clear boundaries .
no glitches , satellite lesions or enlarged lymph nodes at the hilus of lung or mediastinum were observed ( 11 ) . in the present study ,
patients with enhanced ct scan presented similarly with those in the literature . ultimately , pathological diagnosis of the tumor is required .
pulmonary chondroma can be easily misdiagnosed as tuberculosis tumor , hamartoma ( particularly cartilage hamartoma ) and peripheral lung cancer . in the present study
a total of 13 patients were considered to have hamartoma , 14 patients were considered to exhibit benign nodules , 2 patients with chest wall adhesion were suspected of malignant infiltration and all patients were not diagnosed as pulmonary chondroma .
patients with a previous history of tuberculosis was usually considered to have pulmonary tuberculoma ( 12 ) .
calcifications and cavity were found in the lesion and were characterized by circular structures by enhanced ct scan .
the most common benign tumor of the lung was hamartoma , which accounted for 510% of solitary pulmonary nodules ( 13 ) .
calcification looked like popcorn or the image of fat density with enhanced ct scan and allowed the differentiation of points of hamartoma .
notably , calcification of pulmonary chondroma was smaller , mostly point - like or scaly . in the present study ,
13 patients ( 44.8% ) were misdiagnosed as having hamartoma . for older individuals who smoked perennially ,
enhanced ct scans revealed a burr - like structure of the tumor , pleural indentation and inhomogeneous enhancement often accompanied by enlarged lymph nodes at the hilus of the lung or mediastinum ( 14 ) .
although the average age in the present study was older , varying degrees of calcification were revealed in the ct .
in addition , previous medical history , including primary malignant tumor and solitary pulmonary metastases , was difficult to identify with non - calcified pulmonary chondroma .
although primary lung tumors are benign tumors of cartilage , there remains the possibility of malignant transformation .
mei et al ( 15 ) reported a case of giant primary mesenchymal chondrosarcoma of the lung , followed - up for 6 months and this patient succumbed to tumor recurrence and metastasis ( 15 ) .
certain patients succumb to carney 's triad as a result of malignant alteration of lesions .
therefore , the patients with carney 's triad must be given a medical check periodically .
it was more difficult to identify malignant pulmonary chondroma with chondrosarcoma on the image presentations .
surgical resection was the preferred treatment for pulmonary chondroma . with the advantages of less trauma and faster recovery , thoracoscopy or subaxillary minithoracotomy
pulmonary chondroma is a rare benign tumor of the lung and the etiology remains unknown .
pulmonary chondroma can be easily misdiagnosed as a tuberculosis tumor , hamartoma ( particularly cartilage hamartoma ) and peripheral lung cancer . as a result of the possibility of the malignant transformation ,
pulmonary chondroma are possibly an initial clinical presentation of carney 's triad ; therefore , following the diagnosis of pulmonary chondroma , further examination is required to exclude the carney 's triad . | the present retrospective study was designed to review the clinicopathological features and outcome of surgical treatment of pulmonary chondroma , and to accumulate data for the clinical diagnosis and therapy .
the clinicopathological data from 29 patients , aged between 38- and 78-years - old , with pulmonary chondroma who underwent surgical operation between july 2003 and june 2015 were reviewed .
of these patients , 18 exhibited no clinical symptoms , 7 were characterized by coughing , hemoptysis , shortness of breath and other symptoms and only 3 patients exhibited chest pain as the predominant symptom .
the average size of the neoplasms was 3.6 cm .
all patients were pathologically diagnosed .
operative time was 12622 min , the mean intraoperative blood loss was 8223 ml and the drainage duration was 3.11.8 days .
a total of 6 postoperative complications were noted .
the patients were followed - up for 2135 months .
a total of 23 patients were alive without recurrence , 4 patients succumbed to mortality , 2 patients were lost at follow - up .
pulmonary chondroma is a rare benign tumor of the lung .
the clinical symptoms were concealed and often misdiagnosed as a tuberculosis tumor , hamartoma , peripheral lung cancer or a single metastatic tumor .
complete resection was the best treatment providing patients with a good prognosis .
after definite diagnosis , it is necessary to exclude carney 's triad . |
the procedures involving phlebotomy , for example , time of tourniquet application [ 14 ] and blood drawing using vacuum tubes [ 5 , 6 ] are poorly studied as potential sources of errors . in the daily practices of laboratory medicine ,
all diagnostic products can be divided into two major categories : in vitro diagnostic ( ivd ) devices , such as laboratory instruments , reagents , assays , and blood collection tubes , and medical devices , such as specimen collection devices ( needles and sets ) .
necessary improvements and potential sources of nonconformities , either technical or concerning the quality management system , shall be identified and all laboratory process shall be validated . some ivd devices ( e.g. , blood collection vacuum tubes and syringes for blood analyses ) are not validated before the quality laboratory managers decide to start using or to change the brand .
frequently the laboratory or hospital managers select the vacuum tubes for blood collection based on cost considerations or on relevance of a brand .
one important question that all quality laboratory managers need to answer is as follows : low cost is synonym of low quality or of large scale production thus implying economy ?
it is well known that there are several different brands of vacuum tubes for blood collection and a huge competition exists as for the producers to sell their own ivd devices .
the aim of this study was to validate two dry k3edta vacuum tubes of different brands for routine hematological testing .
a group of 100 apparently healthy volunteers from university of verona , italy , consented to blood withdrawal after twelve hours fasting .
this study was submitted and approved by our internal review board ( irb ) and all volunteers signed informed consent .
the collection of all diagnostic blood specimens was performed by a single , expert phlebotomist , following the international standard from clinical laboratory standard institute - clsi .
all volunteers were maintained seated during 15 minutes prior to phlebotomy in order to eliminate possible interferences of blood distribution due to different posture .
after this interval , a vein was located on forearm by a subcutaneous tissue transilluminator device ( venoscpio iv plus , duan do brasil , brazil ) in order to avoid the venous stasis interference [ 13 ] , and two amounts of blood were consecutively drawn by venipuncture with 20 g straight needles ( terumo europe nv , leuven , belgium ) , directly into two different brands of vacuum tubes containing ethylenediamine tetraacetic acid tripotassium salt ( k3edta ) ; tube i : 4.5 ml labor import lot 20100505 ( concentration of k3edta inside the tube is not made known by shandong weigao group medical polymer , weihai , china ) ; tube ii : 1.2 ml s - monovette lot 0092201 with 1.6 mg k3edta ( sarstedt , nmbrecht , germany ) . to eliminate any possible interferences due to either the contact phase or the tissue factor , about 2 ml blood
were preliminarily collected in a tube without additive vacuette lot a101004d ( greiner bio - one gmbh , kremsmnster , austria ) before the sequence above reported , and then discarded .
all the samples were processed for routine hematological testing immediately after collection ( < 15 min ) on the same advia 2120i hematology system ( siemens healthcare diagnostics , deerfield , il , usa ) .
the parameters tested included red blood cells count ( rbc ) , haematocrit ( hct ) , haemoglobin ( hgb ) , mean red cell volume ( mcv ) , mean red cell haemoglobin content ( mchc ) , red blood cell distribution width ( rdw ) , white blood cells ( wbc ) count , and wbc differential , including lymphocytes ( lympho ) , monocytes ( mono ) , neutrophils ( neu ) , eosinophils ( eos ) , basophils ( baso ) and large unstained cells ( luc ) , platelet count ( plt ) , mean platelet volume ( mpv ) , and platelet distribution width ( pdw ) , the instrument was calibrated against appropriate proprietary reference standard material and verified with the use of proprietary controls . a multicenter evaluation of the within - run precision of the advia 2120 system showed coefficients of variation ranging from 1.6% to 2.3% for wbc , from 2.1% to 2.8% for platelets , from 0.6% to 0.9% for rbc , and always lower than 0.7% for hemoglobin , mcv and mch .
the significance of the differences between two different manufactures of k3edta vacuum tubes for collection of diagnostic blood specimens was assessed by paired student 's t - test after checking for normality by the d'agostino - pearson omnibus test . as nonnormal distribution was found for mcv , mchc , rdw , and pdw , results were assessed by wilcoxon ranked - pairs test .
finally , the biases from tube i and tube ii were compared with the current desirable quality specifications for bias ( b ) , derived from biological variation according to the formula b
< 0.25(cvw
+ cvg
) where cvw and cvg are , respectively , within - and between - subject cvs , derived from biological variation .
significant differences were observed for the following : rbc , hct , mcv , plt , mpv and pdw .
no significant differences ( p > 0.05 ) were observed by paired student 's t - test for : hgb , wbc , lympho , mono , neu , eos , baso , and luc also by wilcoxon ranked - pairs test in mchc and rdw .
moreover , clinically significant variations , as compared with the current desirable quality specifications , were observed only for mpv and pdw .
our results showed that this new vacuum tubes do not represent a clinical relevant new source of error in clinical laboratory for several routine hematological laboratory parameters . obviously the most prevalent errors and interferences
documented [ 1625 ] as regards the preanalytical phase in laboratory medicine need be prevented , and more so it is important to follow the correct procedures for the collection of diagnostic blood specimens by venipuncture that need be respected and observed by all laboratory quality managers [ 11 , 1626 ] .
nevertheless , as regards mpv and pdw our results showed that different brands do represent a novel source of variability . during many years
mean platelet volume and platelet distribution width are markers of platelet activation [ 2731 ] .
increased mpv is associated with presence and prognosis of vascular disease , including peripheral , cerebrovascular , and coronary artery disease , elevated mpv is found even in diabetes mellitus , especially in the presence of microvascular complications [ 3336 ] . moreover
, pdw can be use to evaluate microvascular complication in diabetes patients or to distinguishing thrombocytopenia in pediatric acute lymphocytic leukemia from immune thrombocytopenia .
mpv and pdw are higher in nondiabetic patients with severe obstructive sleep apnoea syndrome and are correlated with different parameters of breathing function during sleep .
modern automated hematology counters can provide clinicians with fast results that are characterized by a high degree of precision and accuracy .
nevertheless , it is known that even little details like fasting time , that is not usually solicited for laboratory hematology complete blood count ( cbc ) , can influence the results interpretation .
different tube brands , possibly with small differences in additives may produce appreciable differences in cbc .
as regard our findings , the positive aspect is that different brands do not represent a source of variability for rbc count , total and/or differential wbc count , so such relevant parameters of cbc do not undergo an extra analytical issue that could induce mistakes in diagnoses and/or in the followup of patients [ 21 , 23 , 24 ] .
we decided to evaluate these brands of k3edta because one is among the most frequently used in europe and in america laboratory settings where the authors are living , and the other has been newly introduced .
obviously , we would like to encourage more quality 's laboratory managers from other countries , for example , from china where many other brands of vacuum tubes are employed , to perform a similar evaluation .
our results showed that different brand 's tubes can represent a clinically relevant source of variations on mpv and pdw .
the differences observed among dry edta vacuum tubes are probably due to the different preparations , for example , ( a ) dry edta particles of different size and delivery inside the vacuum tube , ( b ) concentration of dry edta , ( c ) materials of tubes and stoppers .
nevertheless , the above issues can add only little to the possible variations if the final user follows the criteria recommended for item 4.6 of iso15189 , thus giving attention to quality first and foremost , giving secondary importance to the price selling issues . | background and objective .
some in vitro diagnostic devices ( e.g , blood collection vacuum tubes and syringes for blood analyses ) are not validated before the quality laboratory managers decide to start using or to change the brand .
frequently , the laboratory or hospital managers select the vacuum tubes for blood collection based on cost considerations or on relevance of a brand . the aim of this study was to validate two dry k3edta vacuum tubes of different brands for routine hematological testing .
methods .
blood specimens from 100 volunteers in two different k3edta vacuum tubes were collected by a single , expert phlebotomist .
the routine hematological testing was done on advia 2120i hematology system .
the significance of the differences between samples was assessed by paired student 's t - test after checking for normality .
the level of statistical significance was set at p < 0.05 .
results and conclusions .
different brand 's tubes evaluated can represent a clinically relevant source of variations only on mean platelet volume ( mpv ) and platelet distribution width ( pdw ) .
basically , our validation will permit the laboratory or hospital managers to select the brand 's vacuum tubes validated according to him / her technical or economical reasons for routine hematological tests . |
our society depends heavily on fossil fuels ( e.g. , oil , natural gas , coal , etc . ) .
these resources are not sustainable energy sources and are being depleted at a rapidly increasing rate , leading to concerns regarding dwindling fossil - fuel resources , environmental consequences of co2 emission , and economic problems .
biomass is the only renewable and carbon - neutral resource for production of liquid fuels ( biofuels ) and carbon - based chemicals to replace fossil fuels in the current energy production and conversion system .
lignocellulosic biomass ( e.g. , woods , grass , energy crop , agricultural waste , etc . ) , which is currently the most abundant and least expensive biomass source , has attracted the most attention as a way to produce biofuels via various thermochemical and biological routes .
three primary routes have been the focus of the recent research : 1 ) biochemical or chemical conversion to sugars followed by aqueous - phase catalytic and biochemical processing to biofuels ; 2 ) gasification to synthesis gas followed by catalytic conversion to biofuels or alcohols ; and 3 ) pyrolysis or liquefaction to liquid bio - oils followed by catalytic upgrading to biofuels .
pyrolysis integrated with upgrading is considered to be a near - term viable technology for the direct production of biofuels .
pyrolysis is the thermal decomposition of lignocellulosic biomass at temperatures between 400 and 550 c in the absence of oxygen.a number of reactions , such as depolymerization , dehydration , and cc bond cleavage , occur during pyrolysis and lead to the formation of a complex mixture of more than 200 oxygenated compounds .
bio - oils in high yields ( up to 75 wt% of dry feed ) could be produced with up to 70% of the energy stored in the biomass feedstocks retained .
however , direct use of the produced pyrolysis bio - oil as transportation fuels in standard equipment is problematic because of the high oxygen and water content , which lead to different physical and chemical properties such as high viscosity , corrosiveness , poor volatility , low heating value , and poor stability .
therefore , extensive oxygen removal is required to upgrade bio - oils to fuel - range hydrocarbons .
catalytic hydrotreating using solid catalysts in hydrogen is the most common route to upgrade bio - oil by oxygen removal through hydrodeoxygenation and hydrogenation reactions .
currently , one of the primary challenges for pyrolysis followed by hydrotreating is to achieve long - term steady operation , especially for the hydrotreating process in which the thermal instability of the bio - oil and inorganic and sulfur residues in bio - oil cause significant catalyst deactivation .
the thermal instability of bio - oil has been addressed by low - temperature hydrogenation to stabilize the active species in bio - oil .
cleanup of bio - oil by removing inorganic residues , which could catalyze repolymerization of bio - oil fractions and deactivate hydrotreating catalysts by deposition , may be valuable .
hot - vapor filtration is one of the techniques to effectively reduce the inorganic content in bio - oil by removing char particulates during pyrolysis .
hot - vapor filtration is used downstream of the pyrolysis reactor to separate char fines from the pyrolysis gas / vapor stream at high temperature before condensation of the vapors .
we report here the protocol used at the national renewable energy laboratory ( nrel ) for biomass fast pyrolysis both with and without hot - vapor filtration to produce bio - oils using a fluidized - bed reactor and at pacific northwest national laboratory ( pnnl ) for bio - oil hydrotreating to produce biofuels in a continuous - flow packed - bed catalytic reactor .
the configurations of the reactor systems , the operating procedures , and the processing and analysis of feedstocks , bio - oils , and biofuels are described in detail .
results of pyrolysis processing of a representative biomass feedstock with or without hot - vapor - filtering and hydrotreating of the produced bio - oil are also presented along with an assessment of the impact of hot - vapor filtration .
biomass feedstock preparation
mill the biomass to a particle size of < 2 mm . store in a cool , dry place .
connect cooling air to jacket.mount and connect auger motor.mount solid feeder 30 to 60 cm directly above the vertical opening of the auger port.mount lock hopper between the solid feeder outlet and the vertical opening of the auger port .
connect to the auger port with nylon - braid , reinforced vinyl tubing with an inner diameter of 25 mm .
connect to feeder with a light - weight , clear , loose plastic slip - fit .
close - couple receiver to cyclone.mount hot filter ( made of stainless steel with a pore size of 2 m ) in the filter housing .
connect nitrogen purge and pressure relief to cyclone outlet.use heat tape and insulating blankets to heat the trace from the cyclone inlet to the condenser inlet .
note : mount the pieces of the condenser system in a fume hood using laboratory - jacks , ring - stands , and laboratory clamps .
for the first condenser , couple 15 to 30 cm of 1.2-cm ( outer diameter ) stainless steel tubing to borosilicate tubing with a standard taper joint .
connect the first condenser to a 500-ml , two - necked ( standard taper ) , round - bottomed flask ( receiver ) placed in a container that will serve as an ice bath .
make connections between vessels downstream of this point with 9- to 12-mm clear vinyl tubing secured with hose clamps on ground glass joints , spherical joints , and hose barbs on the glassware.connect the outlet of the first condenser flask to the lower side port ( inlet ) of the electrostatic precipitator ( esp).connect the upper side port ( outlet ) of the esp to the small upper connection of the dry - ice trap ( cold - finger condenser).connect a u - tube to line between the esp and the dry - ice trap .
fill the u - tube half full with water.connect the dry - ice trap to a 500-ml , two - necked , round - bottomed flask ( receiver ) placed in a container that will serve as a dry - ice bath.connect the outlet of the 500-ml flask to the inlet ( center port ) of the housing of the coalescing filter.place a container for holding dry ice around the bottom of the filter housing.connect the filter outlet to the dry - test meter and other gas analysis instruments ( e.g. , non - dispersive infra - red analyzers for co , co2 , and ch4 , thermal conductivity detector for hydrogen , and micro - gas chromatography ( micro - gc ) for co , co2 , nitrogen , hydrogen , and c1-c4 hydrocarbons ) and then to vent .
pictures of the biomass feeder , pyrolyzer , cyclone , hot - vapor filter , and the condensers of the pyrolysis reactor system are shown in figures s1 to s5 in the supplemental file .
connect cooling air to jacket.mount and connect auger motor.mount solid feeder 30 to 60 cm directly above the vertical opening of the auger port.mount lock hopper between the solid feeder outlet and the vertical opening of the auger port .
connect to the auger port with nylon - braid , reinforced vinyl tubing with an inner diameter of 25 mm .
connect to feeder with a light - weight , clear , loose plastic slip - fit .
mount and connect auger motor . mount solid feeder 30 to 60 cm directly above the vertical opening of the auger port .
mount lock hopper between the solid feeder outlet and the vertical opening of the auger port .
connect to the auger port with nylon - braid , reinforced vinyl tubing with an inner diameter of 25 mm .
connect to feeder with a light - weight , clear , loose plastic slip - fit .
close - couple receiver to cyclone.mount hot filter ( made of stainless steel with a pore size of 2 m ) in the filter housing .
connect nitrogen purge and pressure relief to cyclone outlet.use heat tape and insulating blankets to heat the trace from the cyclone inlet to the condenser inlet .
mount hot filter ( made of stainless steel with a pore size of 2 m ) in the filter housing .
connect nitrogen purge and pressure relief to cyclone outlet . use heat tape and insulating blankets to heat the trace from the cyclone inlet to the condenser inlet .
note : mount the pieces of the condenser system in a fume hood using laboratory - jacks , ring - stands , and laboratory clamps . for the first condenser , couple 15 to 30 cm of 1.2-cm ( outer diameter ) stainless steel tubing to borosilicate tubing with a standard taper joint .
connect the first condenser to a 500-ml , two - necked ( standard taper ) , round - bottomed flask ( receiver ) placed in a container that will serve as an ice bath .
make connections between vessels downstream of this point with 9- to 12-mm clear vinyl tubing secured with hose clamps on ground glass joints , spherical joints , and hose barbs on the glassware.connect the outlet of the first condenser flask to the lower side port ( inlet ) of the electrostatic precipitator ( esp).connect the upper side port ( outlet ) of the esp to the small upper connection of the dry - ice trap ( cold - finger condenser).connect a u - tube to line between the esp and the dry - ice trap .
fill the u - tube half full with water.connect the dry - ice trap to a 500-ml , two - necked , round - bottomed flask ( receiver ) placed in a container that will serve as a dry - ice bath.connect the outlet of the 500-ml flask to the inlet ( center port ) of the housing of the coalescing filter.place a container for holding dry ice around the bottom of the filter housing.connect the filter outlet to the dry - test meter and other gas analysis instruments ( e.g. , non - dispersive infra - red analyzers for co , co2 , and ch4 , thermal conductivity detector for hydrogen , and micro - gas chromatography ( micro - gc ) for co , co2 , nitrogen , hydrogen , and c1-c4 hydrocarbons ) and then to vent .
pictures of the biomass feeder , pyrolyzer , cyclone , hot - vapor filter , and the condensers of the pyrolysis reactor system are shown in figures s1 to s5 in the supplemental file .
for the first condenser , couple 15 to 30 cm of 1.2-cm ( outer diameter ) stainless steel tubing to borosilicate tubing with a standard taper joint .
connect the first condenser to a 500-ml , two - necked ( standard taper ) , round - bottomed flask ( receiver ) placed in a container that will serve as an ice bath .
make connections between vessels downstream of this point with 9- to 12-mm clear vinyl tubing secured with hose clamps on ground glass joints , spherical joints , and hose barbs on the glassware .
connect the outlet of the first condenser flask to the lower side port ( inlet ) of the electrostatic precipitator ( esp ) .
connect the upper side port ( outlet ) of the esp to the small upper connection of the dry - ice trap ( cold - finger condenser ) .
connect a u - tube to line between the esp and the dry - ice trap .
connect the dry - ice trap to a 500-ml , two - necked , round - bottomed flask ( receiver ) placed in a container that will serve as a dry - ice bath .
connect the outlet of the 500-ml flask to the inlet ( center port ) of the housing of the coalescing filter .
connect the filter outlet to the dry - test meter and other gas analysis instruments ( e.g. , non - dispersive infra - red analyzers for co , co2 , and ch4 , thermal conductivity detector for hydrogen , and micro - gas chromatography ( micro - gc ) for co , co2 , nitrogen , hydrogen , and c1-c4 hydrocarbons ) and then to vent .
pictures of the biomass feeder , pyrolyzer , cyclone , hot - vapor filter , and the condensers of the pyrolysis reactor system are shown in figures s1 to s5 in the supplemental file .
load pyrolysis reactor
pour 200 ml of sand ( 330 g ) into the reactor.pour 2 kg of ground biomass into the feed hopper .
leak check pyrolysis system
cap off system at the condenser inlet.pressurize to 0.05 mpa or expected maximum operating pressure , whichever is higher .
ensure that the flow required to maintain the pressure is < 200 ml / min . if not , locate and fix leak , and repeat this step.relieve pressure , uncap system , connect condensation system , cap at exit end of condensation system.pressurize to 0.01 mpa .
ensure that a flow of < 200 ml / min maintains the pressure . if not , locate and fix the leak , and repeat this step.depressurize and reconnect the condensation system to instruments .
ensure that the flow required to maintain the pressure is < 200 ml / min . if not , locate and fix leak , and repeat this step .
relieve pressure , uncap system , connect condensation system , cap at exit end of condensation system .
ensure that a flow of < 200 ml / min maintains the pressure . if not , locate and fix the leak , and repeat this step .
heat up reactor
turn on cooling air , set fluidizing nitrogen flow to 3 standard l / min and auger nitrogen flow to 1 standard l / min.set furnace target temperature to 500 c and other heaters to 400 to 500 c.ramp temperature up to target temperatures at a rate of 1 to 10 c / min .
turn on cooling air , set fluidizing nitrogen flow to 3 standard l / min and auger nitrogen flow to 1 standard l / min .
set furnace target temperature to 500 c and other heaters to 400 to 500 c .
ramp temperature up to target temperatures at a rate of 1 to 10 c / min .
prepare to operate
increase fluidizing nitrogen flow rate to 14 standard l / min , auger nitrogen flow rate to 1.4 standard l / min , and introduce purge gas at a flow rate of 0.5 standard l / min .
most of the purge goes into the rupture - disk port on the cyclone outlet.fill bath under first condenser with ice .
fill dry - ice trap , container under its receiver , and container around coalescing filter with dry ice.monitor temperature inside of coalescing filter with thermocouple placed on the surface of the filter and adjust dry - ice level so it is 0 c .
increase fluidizing nitrogen flow rate to 14 standard l / min , auger nitrogen flow rate to 1.4 standard l / min , and introduce purge gas at a flow rate of 0.5 standard l / min .
most of the purge goes into the rupture - disk port on the cyclone outlet .
fill dry - ice trap , container under its receiver , and container around coalescing filter with dry ice .
monitor temperature inside of coalescing filter with thermocouple placed on the surface of the filter and adjust dry - ice level so it is 0 c .
perform pyrolysis experiment
turn on lock - hopper valves ( use 4 second cycle ) and auger.turn on esp . set voltage to 5 to 10 kv as needed to observe an arc at least once every 2 sec.use micro - gc to verify that no oxygen is present .
verify that turning on the auger and lock hopper did not cause a decrease in output gas flow rate , which would indicate the presence of a leak.turn on feeder at 100 g / hr .
observe the bed temperature and increase the set point as needed to compensate for increased heat load.when temperature has recovered to within 2 c of 500 c , increase feed rate by 100
g / hr . repeat this until a feed rate of 420 g / hr is reached.every 15 min , record bed temperature , feed rate on feeder controller , gas concentrations by micro - gc , dry test meter rate , and system pressures by pressure gauges .
turn on esp . set voltage to 5 to 10 kv as needed to observe an arc at least once every 2 sec .
verify that turning on the auger and lock hopper did not cause a decrease in output gas flow rate , which would indicate the presence of a leak .
observe the bed temperature and increase the set point as needed to compensate for increased heat load .
when temperature has recovered to within 2 c of 500 c , increase feed rate by 100
every 15 min , record bed temperature , feed rate on feeder controller , gas concentrations by micro - gc , dry test meter rate , and system pressures by pressure gauges .
shutdown
after feeding 1 kg of biomass , stop feeding.after gas levels have decayed to less than 10% of steady - state values , turn off all heaters , turn down fluidizing flow to 3 standard l / min and auger flow to 1 standard l / min .
turn off esp , lockhopper valves , and auger.allow system to cool ( 4 to 6 hr ) before opening the hot sections .
after gas levels have decayed to less than 10% of steady - state values , turn off all heaters , turn down fluidizing flow to 3 standard l / min and auger flow to 1 standard l / min .
turn off esp , lockhopper valves , and auger . allow system to cool ( 4 to 6 hr ) before opening the hot sections .
alternatively , use acetone to clean the glassware.empty char receiver into a jar . remove hot filter , empty the housing , and brush off the filter into the char jar . weigh the filter . remove and weigh the bed material .
use a hepa vacuum with a knock - out vessel for this service .
weigh all parts of the condenser system to obtain total liquid yield . pour liquids from the condenser receivers into a common jar or bottle .
remove hot filter , empty the housing , and brush off the filter into the char jar . weigh the filter . remove and weigh the bed material . use a hepa vacuum with a knock - out vessel for this service .
oxidize the system .
seal the reactor , cyclone receiver , and cleaned hot filter .
check for leaks as described above in section 1.4.install a metal line from the condenser inlet to the outlet of the coalescing filter to bypass the condensation system.heat the reactor to 550 c with 3 standard l / min nitrogen as the fluidizing gas and 1 standard l / min auger nitrogen flow.add air to the fluidizing gas .
start at 0.2 standard l / min and gradually increase to 4 l / min .
install a metal line from the condenser inlet to the outlet of the coalescing filter to bypass the condensation system .
heat the reactor to 550 c with 3 standard l / min nitrogen as the fluidizing gas and 1 standard l / min auger nitrogen flow .
start at 0.2 standard l / min and gradually increase to 4 l / min .
calculate liquid yield as the total change in mass of the condensation system.calculate char yield as the sum of the weight change in the bed , the weight change of the hot filter , and the char collected from the cyclone receiver and hot - filter housing .
note : additional char could be estimated from the oxidation of the system , but this is usually unimportant.calculate gas yield as the total weight of gaseous products from the gas concentrations measured on the gc and the flow rate of the dry test meter .
calculate char yield as the sum of the weight change in the bed , the weight change of the hot filter , and the char collected from the cyclone receiver and hot - filter housing .
note : additional char could be estimated from the oxidation of the system , but this is usually unimportant .
calculate gas yield as the total weight of gaseous products from the gas concentrations measured on the gc and the flow rate of the dry test meter .
note : the bio - oil samples produced at nrel were shipped to pnnl for catalytic hydrotreating on a hydrotreater system .
hydrotreater system
ensure that the hydrotreater system is in operational condition by checking each component . note : the hydrotreater reactor system used is configured as a single - pass , co - current , continuous , down - flow catalytic reactor .
the system consists of three major components : 1 ) a gas and liquid feeding component , 2 ) a heated reactor , and 3 ) a gasliquid product separation component ( figure 2 ) .
the system is designed to operate at up to 13.6 mpa ( 2,000 psig ; maximum operating pressure ) with a maximum catalyst temperature 500 c ( only the reactor is rated at this temperature).ensure that the hydrotreater monitoring and controlling system and the safety control system are in operational condition . note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located .
the outlet gas flow rate is measured by a flow meter , and data are recorded by its accompanying software .
the program also controls the power supply of major equipment of the reactor . during an experiment ,
if the reactor undergoes an unwanted change in operating conditions in terms of specific pressure changes and/or temperature changes , or a combustible gas is present above the safety limit , and/or if the ventilation system fails , the program could automatically shut down the system to ensure safety . pressure relief valves and a rupture disc
note : the hydrotreater reactor system used is configured as a single - pass , co - current , continuous , down - flow catalytic reactor .
the system consists of three major components : 1 ) a gas and liquid feeding component , 2 ) a heated reactor , and 3 ) a gasliquid product separation component ( figure 2 ) .
the system is designed to operate at up to 13.6 mpa ( 2,000 psig ; maximum operating pressure ) with a maximum catalyst temperature 500 c ( only the reactor is rated at this temperature ) .
ensure that the hydrotreater monitoring and controlling system and the safety control system are in operational condition .
note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located .
the outlet gas flow rate is measured by a flow meter , and data are recorded by its accompanying software .
the program also controls the power supply of major equipment of the reactor . during an experiment ,
if the reactor undergoes an unwanted change in operating conditions in terms of specific pressure changes and/or temperature changes , or a combustible gas is present above the safety limit , and/or if the ventilation system fails , the program could automatically shut down the system to ensure safety . pressure relief valves and a rupture disc
catalyst loading and pretreatment
catalyst preparation
crush both catalysts , ru / c , as the stage - i catalyst and como / al2o3 as the stage - ii catalyst , and sieve to retain 0.25 to 0.60 mm ( 30 to 60 mesh ) grains . note : ru / c catalyst was prepared in - house and como / al2o3 catalyst was a commercial product .
catalyst loading into the reactor
use stainless steel tubes and screens as the support media for the catalyst beds . slowly pour the stage - ii catalyst grains , the stage - i catalyst grains , and the original stage - i catalyst extrudates , which were used as distributor , into the reactor sequentially while " tapping " on the outside of the reactor to form packed catalyst beds .
load 32 ml of each catalyst to form a two - stage catalyst bed with 24 ml of each catalyst located in the isothermal zone ( figure 3 ) .
install the reactor to the hydrotreater system
place the reactor into the hydrotreater system by installing the two heaters and then connecting the reactor to the gas and liquid feed component and the gasliquid separation component .
note : two heat tape - heated aluminum sheaths enclose the tubular reactor to provide heat .
each heated sheath is used independently to heat the portion of reactor during catalyst pretreatment and during hydrotreatment testing .
each aluminum sheath is wrapped with a high temperature heat tape and insulation and heated using a temperature controller .
the tubular fixed - bed catalytic reactor is made of 316 stainless steel and with an inner diameter of 13 mm and a length of 64 cm .
a thermocouple well ( 4.7 mm outside diameter ) is located in the center of the reactor , and two thermocouples are placed in the well to measure the temperature of the catalyst beds .
check the pressure of the hydrotreater system for leaks using 12.0 mpa nitrogen gas by keeping the system at the pressure and ensuring that the drop of pressure is lower than 1 psig per hour .
heat both catalyst beds from room temperature to 150 c at a rate of 120 c / hr in hydrogen at 242 ml / min.maintain both catalyst - bed temperatures at 150 c for 2 hr in hydrogen at 242 ml / hr and sulfiding agent at 0.128 ml / min ( 35 wt% di - tert - butyldisulfide in decane fed by a feeding pump).heat the stage - i bed from 150 to 250 c at a rate of 83.3 c / hr , and maintain at 250 c for 5.8 hr . during the same period , heat the stage - ii bed from 150 to 400 c at a rate of 83.3 c / hr , and maintain at 400 c for 4 hr . during the procedure , keep the pressure of the reactor at 10.3 mpa , the sulfiding agent flow rate at 0.128 ml / min , and the hydrogen flow rate at 242 ml / min.stop the sulfiding agent flow and maintain hydrogen flow .
note : the sulfiding agent flow rate is determined by the amount of catalyst used and the sulfiding agent liquid hourly space velocity ( lhsv ) of 0.12 ml / ml - cat / hr for overall catalysts .
the hydrogen flow rate is determined by the sulfiding agent flow rate and the hydrogen - to - sulfiding agent flow ratio at 1,890 ml hydrogen / ml sulfiding agent liquid . the gas and liquid feeding components of the hydrotreater system consist of two high - pressure syringe pumps .
the gas and sulfiding agent is introduced to the pre - reactor zone of the reactor where the liquid is mixed before they pass downward through the catalyst bed in the reactor .
catalyst preparation
crush both catalysts , ru / c , as the stage - i catalyst and como / al2o3 as the stage - ii catalyst , and sieve to retain 0.25 to 0.60 mm ( 30 to 60 mesh ) grains . note : ru / c catalyst was prepared in - house and como / al2o3 catalyst was a commercial product .
crush both catalysts , ru / c , as the stage - i catalyst and como / al2o3 as the stage - ii catalyst , and sieve to retain 0.25 to 0.60 mm ( 30 to 60 mesh ) grains . note : ru / c catalyst was prepared in - house and como / al2o3 catalyst was a commercial product .
catalyst loading into the reactor
use stainless steel tubes and screens as the support media for the catalyst beds . slowly pour the stage - ii catalyst grains , the stage - i catalyst grains , and the original stage - i catalyst extrudates , which were used as distributor , into the reactor sequentially while " tapping " on the outside of the reactor to form packed catalyst beds .
load 32 ml of each catalyst to form a two - stage catalyst bed with 24 ml of each catalyst located in the isothermal zone ( figure 3 ) .
use stainless steel tubes and screens as the support media for the catalyst beds . slowly pour the stage - ii catalyst grains , the stage - i catalyst grains , and the original stage - i catalyst extrudates , which were used as distributor , into the reactor sequentially while " tapping " on the outside of the reactor to form packed catalyst beds .
load 32 ml of each catalyst to form a two - stage catalyst bed with 24 ml of each catalyst located in the isothermal zone ( figure 3 ) .
install the reactor to the hydrotreater system
place the reactor into the hydrotreater system by installing the two heaters and then connecting the reactor to the gas and liquid feed component and the gasliquid separation component .
note : two heat tape - heated aluminum sheaths enclose the tubular reactor to provide heat .
each heated sheath is used independently to heat the portion of reactor during catalyst pretreatment and during hydrotreatment testing .
each aluminum sheath is wrapped with a high temperature heat tape and insulation and heated using a temperature controller .
the tubular fixed - bed catalytic reactor is made of 316 stainless steel and with an inner diameter of 13 mm and a length of 64 cm .
a thermocouple well ( 4.7 mm outside diameter ) is located in the center of the reactor , and two thermocouples are placed in the well to measure the temperature of the catalyst beds .
place the reactor into the hydrotreater system by installing the two heaters and then connecting the reactor to the gas and liquid feed component and the gasliquid separation component . note : two heat tape - heated aluminum sheaths enclose the tubular reactor to provide heat .
each heated sheath is used independently to heat the portion of reactor during catalyst pretreatment and during hydrotreatment testing .
each aluminum sheath is wrapped with a high temperature heat tape and insulation and heated using a temperature controller .
the tubular fixed - bed catalytic reactor is made of 316 stainless steel and with an inner diameter of 13 mm and a length of 64 cm .
a thermocouple well ( 4.7 mm outside diameter ) is located in the center of the reactor , and two thermocouples are placed in the well to measure the temperature of the catalyst beds .
check the pressure of the hydrotreater system for leaks using 12.0 mpa nitrogen gas by keeping the system at the pressure and ensuring that the drop of pressure is lower than 1 psig per hour .
heat both catalyst beds from room temperature to 150 c at a rate of 120 c / hr in hydrogen at 242 ml / min.maintain both catalyst - bed temperatures at 150 c for 2 hr in hydrogen at 242 ml / hr and sulfiding agent at 0.128 ml / min ( 35 wt% di - tert - butyldisulfide in decane fed by a feeding pump).heat the stage - i bed from 150 to 250 c at a rate of 83.3 c / hr , and maintain at 250 c for 5.8 hr . during the same period , heat the stage - ii bed from 150 to 400 c at a rate of 83.3 c / hr , and maintain at 400 c for 4 hr . during the procedure , keep the pressure of the reactor at 10.3 mpa , the sulfiding agent flow rate at 0.128 ml / min , and the hydrogen flow rate at 242 ml / min.stop the sulfiding agent flow and maintain hydrogen flow .
note : the sulfiding agent flow rate is determined by the amount of catalyst used and the sulfiding agent liquid hourly space velocity ( lhsv ) of 0.12 ml / ml - cat / hr for overall catalysts .
the hydrogen flow rate is determined by the sulfiding agent flow rate and the hydrogen - to - sulfiding agent flow ratio at 1,890 ml hydrogen / ml sulfiding agent liquid . the gas and liquid feeding components of the hydrotreater system consist of two high - pressure syringe pumps .
the gas and sulfiding agent is introduced to the pre - reactor zone of the reactor where the liquid is mixed before they pass downward through the catalyst bed in the reactor .
heat both catalyst beds from room temperature to 150 c at a rate of 120 c / hr in hydrogen at 242 ml / min .
maintain both catalyst - bed temperatures at 150 c for 2 hr in hydrogen at 242 ml / hr and sulfiding agent at 0.128 ml / min ( 35 wt% di - tert - butyldisulfide in decane fed by a feeding pump ) .
heat the stage - i bed from 150 to 250 c at a rate of 83.3 c / hr , and maintain at 250 c for 5.8 hr . during the same period ,
heat the stage - ii bed from 150 to 400 c at a rate of 83.3 c / hr , and maintain at 400 c for 4 hr . during the procedure ,
keep the pressure of the reactor at 10.3 mpa , the sulfiding agent flow rate at 0.128 ml / min , and the hydrogen flow rate at 242 ml / min .
note : the sulfiding agent flow rate is determined by the amount of catalyst used and the sulfiding agent liquid hourly space velocity ( lhsv ) of 0.12 ml / ml - cat / hr for overall catalysts .
the hydrogen flow rate is determined by the sulfiding agent flow rate and the hydrogen - to - sulfiding agent flow ratio at 1,890 ml hydrogen / ml sulfiding agent liquid . the gas and liquid feeding components of the hydrotreater system consist of two high - pressure syringe pumps .
the gas and sulfiding agent is introduced to the pre - reactor zone of the reactor where the liquid is mixed before they pass downward through the catalyst bed in the reactor .
bio - oil hydrotreating
adjust the hydrogen flow to 152 ml / min and maintain the system pressure at 10.3 mpa .
set the temperatures of the stage - i catalyst bed and the stage - ii catalyst bed to 220 and 400 c , respectively .
note : the hydrogen flow rate is determined by the amount of catalyst used , the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage , and the hydrogen - to - bio - oil ratio of 1,900 ml hydrogen / ml bio-oil.record the bed temperature and hydrogen flow baselines when the temperature , pressure , and hydrogen flow become stable.add di - tert - butyl disulfide to bio - oil feed at an amount equal to 150 ppm sulfur in bio - oil .
fill the bio - oil feed in one of the feeding pumps and purge the feeding line until a liquid flow that is free of air bubbles is achieved.pressurize the pump to 10.3 mpa , and then connect to the reactor by opening the connecting valves . start feeding the bio - oil at a flow rate of 4.8 ml / hr . this action starts the bio - oil hydrotreating test .
note : bio - oil flowrate is determined by the amount of catalyst used and the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage .
the hydrogen gas and bio - oil are introduced to the pre - reactor zone of the reactor where the gas and liquid are mixed before they pass downward in an assumed trickle flow through the catalyst bed in the reactor.check the status of the reactor and record the parameters , such as temperature , pressure , flow rate , and volume , periodically . ensure the catalyst - bed temperatures are within 2 c of the desired temperature , the gas and liquid flow rates are exactly the same as the desired settings , and reactor pressure is within 0.15 mpa of the desired pressure .
note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located.analyze outlet gas samples every 2 hr by directing the off - gas through an on - line micro - gc .
note : the micro - gc is an a four - channel micro - gc and calibrated using a calibration gas before each hydrotreating test.collect liquid samples every 6 hours using the following procedure : switch the sampling trap to the bypass trap , reduce the pressure of the sampling trap , drain the liquid sample to collecting vials , purge the sampling trap with nitrogen , pressurize the sampling trap with nitrogen , and redirect product flow to the sampling trap .
operate a series of two- and three - way valves that divert the gases and products in the desired directions .
note : once the reactants pass through the catalyst beds , the liquid products and unreacted liquids are separated from the gaseous products and unreacted gases in the gas - liquid separation system .
the hot gases pass through one of two pressurized , chilled , liquid / gas cold traps ( sample trap or bypass trap ) placed in parallel downstream of the reactor system
. the off - gas then passes through the back - pressure regulator where the pressure is reduced to atmospheric pressure .
the off - gas is then passed through a gas meter to measure the flowrate.conduct the test for 60 hr on stream ( time on stream [ tos ] ) .
set the reactor temperature to 100 c and hydrogen flow rate to 100 ml / min .
note : the test could be operated for toss ranging from fifty to several hundred hours .
adjust the hydrogen flow to 152 ml / min and maintain the system pressure at 10.3 mpa .
set the temperatures of the stage - i catalyst bed and the stage - ii catalyst bed to 220 and 400 c , respectively .
note : the hydrogen flow rate is determined by the amount of catalyst used , the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage , and the hydrogen - to - bio - oil ratio of 1,900 ml hydrogen / ml bio - oil .
record the bed temperature and hydrogen flow baselines when the temperature , pressure , and hydrogen flow become stable .
add di - tert - butyl disulfide to bio - oil feed at an amount equal to 150 ppm sulfur in bio - oil .
fill the bio - oil feed in one of the feeding pumps and purge the feeding line until a liquid flow that is free of air bubbles is achieved . pressurize the pump to 10.3 mpa , and then connect to the reactor by opening the connecting valves .
start feeding the bio - oil at a flow rate of 4.8 ml / hr . this action starts the bio - oil hydrotreating test .
note : bio - oil flowrate is determined by the amount of catalyst used and the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage .
the hydrogen gas and bio - oil are introduced to the pre - reactor zone of the reactor where the gas and liquid are mixed before they pass downward in an assumed trickle flow through the catalyst bed in the reactor .
check the status of the reactor and record the parameters , such as temperature , pressure , flow rate , and volume , periodically .
ensure the catalyst - bed temperatures are within 2 c of the desired temperature , the gas and liquid flow rates are exactly the same as the desired settings , and reactor pressure is within 0.15 mpa of the desired pressure .
note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located .
analyze outlet gas samples every 2 hr by directing the off - gas through an on - line micro - gc .
note : the micro - gc is an a four - channel micro - gc and calibrated using a calibration gas before each hydrotreating test .
collect liquid samples every 6 hours using the following procedure : switch the sampling trap to the bypass trap , reduce the pressure of the sampling trap , drain the liquid sample to collecting vials , purge the sampling trap with nitrogen , pressurize the sampling trap with nitrogen , and redirect product flow to the sampling trap . operate a series of two- and three - way valves that divert the gases and products in the desired directions .
note : once the reactants pass through the catalyst beds , the liquid products and unreacted liquids are separated from the gaseous products and unreacted gases in the gas - liquid separation system .
the hot gases pass through one of two pressurized , chilled , liquid / gas cold traps ( sample trap or bypass trap ) placed in parallel downstream of the reactor system
. the off - gas then passes through the back - pressure regulator where the pressure is reduced to atmospheric pressure .
the off - gas is then passed through a gas meter to measure the flowrate .
conduct the test for 60 hr on stream ( time on stream [ tos ] ) . terminate the test by stopping the bio - oil feed
. set the reactor temperature to 100 c and hydrogen flow rate to 100 ml / min .
note : the test could be operated for toss ranging from fifty to several hundred hours .
post - test procedure
use acetone to clean the feeding pump for feeding bio - oil .
load the cleaned feeding pump with acetone.purge the catalyst bed with 400 ml acetone at an acetone flow rate of 10 to 40 ml / min and a hydrogen flow rate of 100 ml / min when the catalyst - bed temperatures are at 100 c.shut off the heaters of the reactor , depressurize the system to ambient pressure , and purge the reactor with nitrogen for at least 24 hr.remove the reactor from the system and remove the spent catalysts from the reactor .
use acetone to clean the feeding pump for feeding bio - oil .
purge the catalyst bed with 400 ml acetone at an acetone flow rate of 10 to 40 ml / min and a hydrogen flow rate of 100 ml / min when the catalyst - bed temperatures are at 100 c .
shut off the heaters of the reactor , depressurize the system to ambient pressure , and purge the reactor with nitrogen for at least 24 hr .
remove the reactor from the system and remove the spent catalysts from the reactor .
product processing and result analysis
for liquid product processing , separate the two phases and weigh individually .
the liquid products are normally in two phases , a light oil phase ( oil product ) and a heavy aqueous phase ( aqueous product).conduct the following analyses of the oil product : density measurement ; karl fischer titration for water content ; elemental analysis ( d5291/d5373 , d5373mod , and d1552/d4239 ) for carbon , hydrogen , nitrogen , oxygen , and sulfur ; semi - micro color indicator titration ( d3339 ) for total acid number ; inductively coupled plasma - optical emission spectroscopy for inorganic content ; and simulated distillation ( astm d2887 ) to assess the relative amounts of fuel products in the gasoline , diesel , jet fuel , and residual ranges .
conduct the following analyses of the aqueous products : karl fischer titration for water content and elemental analysis ( d5291/d5373 ) for carbon , hydrogen , and nitrogen content.calculate the yields of produced oil product , aqueous product , and gaseous product ; the hydrogen consumption ; and the mass balance based on the inlet reactant flow rate and density , inlet hydrogen flowrate , outlet oil product weight , water content of the outlet oil product , outlet aqueous product weight , outlet gas flow rate , and outlet gas composition.analyze spent catalysts by inductively coupled plasma - optical emission spectroscopy .
for liquid product processing , separate the two phases and weigh individually .
the liquid products are normally in two phases , a light oil phase ( oil product ) and a heavy aqueous phase ( aqueous product ) .
conduct the following analyses of the oil product : density measurement ; karl fischer titration for water content ; elemental analysis ( d5291/d5373 , d5373mod , and d1552/d4239 ) for carbon , hydrogen , nitrogen , oxygen , and sulfur ; semi - micro color indicator titration ( d3339 ) for total acid number ; inductively coupled plasma - optical emission spectroscopy for inorganic content ; and simulated distillation ( astm d2887 ) to assess the relative amounts of fuel products in the gasoline , diesel , jet fuel , and residual ranges .
conduct the following analyses of the aqueous products : karl fischer titration for water content and elemental analysis ( d5291/d5373 ) for carbon , hydrogen , and nitrogen content .
calculate the yields of produced oil product , aqueous product , and gaseous product ; the hydrogen consumption ; and the mass balance based on the inlet reactant flow rate and density , inlet hydrogen flowrate , outlet oil product weight , water content of the outlet oil product , outlet aqueous product weight , outlet gas flow rate , and outlet gas composition .
biomass feedstock preparation
mill the biomass to a particle size of < 2 mm . store in a cool , dry place .
connect cooling air to jacket.mount and connect auger motor.mount solid feeder 30 to 60 cm directly above the vertical opening of the auger port.mount lock hopper between the solid feeder outlet and the vertical opening of the auger port .
connect to the auger port with nylon - braid , reinforced vinyl tubing with an inner diameter of 25 mm .
connect to feeder with a light - weight , clear , loose plastic slip - fit .
close - couple receiver to cyclone.mount hot filter ( made of stainless steel with a pore size of 2 m ) in the filter housing .
connect nitrogen purge and pressure relief to cyclone outlet.use heat tape and insulating blankets to heat the trace from the cyclone inlet to the condenser inlet .
note : mount the pieces of the condenser system in a fume hood using laboratory - jacks , ring - stands , and laboratory clamps .
for the first condenser , couple 15 to 30 cm of 1.2-cm ( outer diameter ) stainless steel tubing to borosilicate tubing with a standard taper joint .
connect the first condenser to a 500-ml , two - necked ( standard taper ) , round - bottomed flask ( receiver ) placed in a container that will serve as an ice bath .
make connections between vessels downstream of this point with 9- to 12-mm clear vinyl tubing secured with hose clamps on ground glass joints , spherical joints , and hose barbs on the glassware.connect the outlet of the first condenser flask to the lower side port ( inlet ) of the electrostatic precipitator ( esp).connect the upper side port ( outlet ) of the esp to the small upper connection of the dry - ice trap ( cold - finger condenser).connect a u - tube to line between the esp and the dry - ice trap .
fill the u - tube half full with water.connect the dry - ice trap to a 500-ml , two - necked , round - bottomed flask ( receiver ) placed in a container that will serve as a dry - ice bath.connect the outlet of the 500-ml flask to the inlet ( center port ) of the housing of the coalescing filter.place a container for holding dry ice around the bottom of the filter housing.connect the filter outlet to the dry - test meter and other gas analysis instruments ( e.g. , non - dispersive infra - red analyzers for co , co2 , and ch4 , thermal conductivity detector for hydrogen , and micro - gas chromatography ( micro - gc ) for co , co2 , nitrogen , hydrogen , and c1-c4 hydrocarbons ) and then to vent .
pictures of the biomass feeder , pyrolyzer , cyclone , hot - vapor filter , and the condensers of the pyrolysis reactor system are shown in figures s1 to s5 in the supplemental file .
connect cooling air to jacket.mount and connect auger motor.mount solid feeder 30 to 60 cm directly above the vertical opening of the auger port.mount lock hopper between the solid feeder outlet and the vertical opening of the auger port .
connect to the auger port with nylon - braid , reinforced vinyl tubing with an inner diameter of 25 mm .
connect to feeder with a light - weight , clear , loose plastic slip - fit .
mount and connect auger motor . mount solid feeder 30 to 60 cm directly above the vertical opening of the auger port .
mount lock hopper between the solid feeder outlet and the vertical opening of the auger port .
connect to the auger port with nylon - braid , reinforced vinyl tubing with an inner diameter of 25 mm .
connect to feeder with a light - weight , clear , loose plastic slip - fit .
close - couple receiver to cyclone.mount hot filter ( made of stainless steel with a pore size of 2 m ) in the filter housing .
connect nitrogen purge and pressure relief to cyclone outlet.use heat tape and insulating blankets to heat the trace from the cyclone inlet to the condenser inlet .
mount hot filter ( made of stainless steel with a pore size of 2 m ) in the filter housing .
connect nitrogen purge and pressure relief to cyclone outlet . use heat tape and insulating blankets to heat the trace from the cyclone inlet to the condenser inlet .
note : mount the pieces of the condenser system in a fume hood using laboratory - jacks , ring - stands , and laboratory clamps . for the first condenser , couple 15 to 30 cm of 1.2-cm ( outer diameter ) stainless steel tubing to borosilicate tubing with a standard taper joint .
connect the first condenser to a 500-ml , two - necked ( standard taper ) , round - bottomed flask ( receiver ) placed in a container that will serve as an ice bath .
make connections between vessels downstream of this point with 9- to 12-mm clear vinyl tubing secured with hose clamps on ground glass joints , spherical joints , and hose barbs on the glassware.connect the outlet of the first condenser flask to the lower side port ( inlet ) of the electrostatic precipitator ( esp).connect the upper side port ( outlet ) of the esp to the small upper connection of the dry - ice trap ( cold - finger condenser).connect a u - tube to line between the esp and the dry - ice trap .
fill the u - tube half full with water.connect the dry - ice trap to a 500-ml , two - necked , round - bottomed flask ( receiver ) placed in a container that will serve as a dry - ice bath.connect the outlet of the 500-ml flask to the inlet ( center port ) of the housing of the coalescing filter.place a container for holding dry ice around the bottom of the filter housing.connect the filter outlet to the dry - test meter and other gas analysis instruments ( e.g. , non - dispersive infra - red analyzers for co , co2 , and ch4 , thermal conductivity detector for hydrogen , and micro - gas chromatography ( micro - gc ) for co , co2 , nitrogen , hydrogen , and c1-c4 hydrocarbons ) and then to vent .
pictures of the biomass feeder , pyrolyzer , cyclone , hot - vapor filter , and the condensers of the pyrolysis reactor system are shown in figures s1 to s5 in the supplemental file .
for the first condenser , couple 15 to 30 cm of 1.2-cm ( outer diameter ) stainless steel tubing to borosilicate tubing with a standard taper joint .
connect the first condenser to a 500-ml , two - necked ( standard taper ) , round - bottomed flask ( receiver ) placed in a container that will serve as an ice bath .
make connections between vessels downstream of this point with 9- to 12-mm clear vinyl tubing secured with hose clamps on ground glass joints , spherical joints , and hose barbs on the glassware .
connect the outlet of the first condenser flask to the lower side port ( inlet ) of the electrostatic precipitator ( esp ) .
connect the upper side port ( outlet ) of the esp to the small upper connection of the dry - ice trap ( cold - finger condenser ) .
connect a u - tube to line between the esp and the dry - ice trap .
connect the dry - ice trap to a 500-ml , two - necked , round - bottomed flask ( receiver ) placed in a container that will serve as a dry - ice bath .
connect the outlet of the 500-ml flask to the inlet ( center port ) of the housing of the coalescing filter .
connect the filter outlet to the dry - test meter and other gas analysis instruments ( e.g. , non - dispersive infra - red analyzers for co , co2 , and ch4 , thermal conductivity detector for hydrogen , and micro - gas chromatography ( micro - gc ) for co , co2 , nitrogen , hydrogen , and c1-c4 hydrocarbons ) and then to vent .
pictures of the biomass feeder , pyrolyzer , cyclone , hot - vapor filter , and the condensers of the pyrolysis reactor system are shown in figures s1 to s5 in the supplemental file .
load pyrolysis reactor
pour 200 ml of sand ( 330 g ) into the reactor.pour 2 kg of ground biomass into the feed hopper .
leak check pyrolysis system
cap off system at the condenser inlet.pressurize to 0.05 mpa or expected maximum operating pressure , whichever is higher .
ensure that the flow required to maintain the pressure is < 200 ml / min . if not , locate and fix leak , and repeat this step.relieve pressure , uncap system , connect condensation system , cap at exit end of condensation system.pressurize to 0.01 mpa .
ensure that a flow of < 200 ml / min maintains the pressure . if not , locate and fix the leak , and repeat this step.depressurize and reconnect the condensation system to instruments .
ensure that the flow required to maintain the pressure is < 200 ml / min . if not , locate and fix leak , and repeat this step .
relieve pressure , uncap system , connect condensation system , cap at exit end of condensation system .
ensure that a flow of < 200 ml / min maintains the pressure . if not , locate and fix the leak , and repeat this step .
heat up reactor
turn on cooling air , set fluidizing nitrogen flow to 3 standard l / min and auger nitrogen flow to 1 standard l / min.set furnace target temperature to 500 c and other heaters to 400 to 500 c.ramp temperature up to target temperatures at a rate of 1 to 10 c / min .
turn on cooling air , set fluidizing nitrogen flow to 3 standard l / min and auger nitrogen flow to 1 standard l / min .
set furnace target temperature to 500 c and other heaters to 400 to 500 c .
ramp temperature up to target temperatures at a rate of 1 to 10 c / min .
prepare to operate
increase fluidizing nitrogen flow rate to 14 standard l / min , auger nitrogen flow rate to 1.4 standard l / min , and introduce purge gas at a flow rate of 0.5 standard l / min .
most of the purge goes into the rupture - disk port on the cyclone outlet.fill bath under first condenser with ice .
fill dry - ice trap , container under its receiver , and container around coalescing filter with dry ice.monitor temperature inside of coalescing filter with thermocouple placed on the surface of the filter and adjust dry - ice level so it is 0 c .
increase fluidizing nitrogen flow rate to 14 standard l / min , auger nitrogen flow rate to 1.4 standard l / min , and introduce purge gas at a flow rate of 0.5 standard l / min .
most of the purge goes into the rupture - disk port on the cyclone outlet .
fill dry - ice trap , container under its receiver , and container around coalescing filter with dry ice .
monitor temperature inside of coalescing filter with thermocouple placed on the surface of the filter and adjust dry - ice level so it is 0 c .
perform pyrolysis experiment
turn on lock - hopper valves ( use 4 second cycle ) and auger.turn on esp . set voltage to 5 to 10 kv as needed to observe an arc at least once every 2 sec.use micro - gc to verify that no oxygen is present .
verify that turning on the auger and lock hopper did not cause a decrease in output gas flow rate , which would indicate the presence of a leak.turn on feeder at 100 g / hr .
observe the bed temperature and increase the set point as needed to compensate for increased heat load.when temperature has recovered to within 2 c of 500 c , increase feed rate by 100
g / hr . repeat this until a feed rate of 420 g / hr is reached.every 15 min , record bed temperature , feed rate on feeder controller , gas concentrations by micro - gc , dry test meter rate , and system pressures by pressure gauges .
turn on esp . set voltage to 5 to 10 kv as needed to observe an arc at least once every 2 sec .
verify that turning on the auger and lock hopper did not cause a decrease in output gas flow rate , which would indicate the presence of a leak .
observe the bed temperature and increase the set point as needed to compensate for increased heat load .
when temperature has recovered to within 2 c of 500 c , increase feed rate by 100
every 15 min , record bed temperature , feed rate on feeder controller , gas concentrations by micro - gc , dry test meter rate , and system pressures by pressure gauges .
shutdown
after feeding 1 kg of biomass , stop feeding.after gas levels have decayed to less than 10% of steady - state values , turn off all heaters , turn down fluidizing flow to 3 standard l / min and auger flow to 1 standard l / min .
turn off esp , lockhopper valves , and auger.allow system to cool ( 4 to 6 hr ) before opening the hot sections .
after gas levels have decayed to less than 10% of steady - state values , turn off all heaters , turn down fluidizing flow to 3 standard l / min and auger flow to 1 standard l / min .
turn off esp , lockhopper valves , and auger . allow system to cool ( 4 to 6 hr ) before opening the hot sections .
alternatively , use acetone to clean the glassware.empty char receiver into a jar . remove hot filter , empty the housing , and brush off the filter into the char jar . weigh the filter . remove and weigh the bed material .
use a hepa vacuum with a knock - out vessel for this service .
weigh all parts of the condenser system to obtain total liquid yield . pour liquids from the condenser receivers into a common jar or bottle .
remove hot filter , empty the housing , and brush off the filter into the char jar . weigh the filter . remove and weigh the bed material . use a hepa vacuum with a knock - out vessel for this service .
oxidize the system .
seal the reactor , cyclone receiver , and cleaned hot filter .
check for leaks as described above in section 1.4.install a metal line from the condenser inlet to the outlet of the coalescing filter to bypass the condensation system.heat the reactor to 550 c with 3 standard l / min nitrogen as the fluidizing gas and 1 standard l / min auger nitrogen flow.add air to the fluidizing gas .
start at 0.2 standard l / min and gradually increase to 4 l / min .
install a metal line from the condenser inlet to the outlet of the coalescing filter to bypass the condensation system .
heat the reactor to 550 c with 3 standard l / min nitrogen as the fluidizing gas and 1 standard l / min auger nitrogen flow .
start at 0.2 standard l / min and gradually increase to 4 l / min .
calculate liquid yield as the total change in mass of the condensation system.calculate char yield as the sum of the weight change in the bed , the weight change of the hot filter , and the char collected from the cyclone receiver and hot - filter housing .
note : additional char could be estimated from the oxidation of the system , but this is usually unimportant.calculate gas yield as the total weight of gaseous products from the gas concentrations measured on the gc and the flow rate of the dry test meter .
calculate char yield as the sum of the weight change in the bed , the weight change of the hot filter , and the char collected from the cyclone receiver and hot - filter housing .
note : additional char could be estimated from the oxidation of the system , but this is usually unimportant .
calculate gas yield as the total weight of gaseous products from the gas concentrations measured on the gc and the flow rate of the dry test meter .
note : the bio - oil samples produced at nrel were shipped to pnnl for catalytic hydrotreating on a hydrotreater system .
hydrotreater system
ensure that the hydrotreater system is in operational condition by checking each component .
note : the hydrotreater reactor system used is configured as a single - pass , co - current , continuous , down - flow catalytic reactor .
the system consists of three major components : 1 ) a gas and liquid feeding component , 2 ) a heated reactor , and 3 ) a gasliquid product separation component ( figure 2 ) .
the system is designed to operate at up to 13.6 mpa ( 2,000 psig ; maximum operating pressure ) with a maximum catalyst temperature 500 c ( only the reactor is rated at this temperature).ensure that the hydrotreater monitoring and controlling system and the safety control system are in operational condition .
note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located .
the outlet gas flow rate is measured by a flow meter , and data are recorded by its accompanying software .
the program also controls the power supply of major equipment of the reactor . during an experiment ,
if the reactor undergoes an unwanted change in operating conditions in terms of specific pressure changes and/or temperature changes , or a combustible gas is present above the safety limit , and/or if the ventilation system fails , the program could automatically shut down the system to ensure safety . pressure relief valves and a rupture disc
note : the hydrotreater reactor system used is configured as a single - pass , co - current , continuous , down - flow catalytic reactor .
the system consists of three major components : 1 ) a gas and liquid feeding component , 2 ) a heated reactor , and 3 ) a gasliquid product separation component ( figure 2 ) .
the system is designed to operate at up to 13.6 mpa ( 2,000 psig ; maximum operating pressure ) with a maximum catalyst temperature 500 c ( only the reactor is rated at this temperature ) . ensure that the hydrotreater monitoring and controlling system and the safety control system are in operational condition .
note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located .
the outlet gas flow rate is measured by a flow meter , and data are recorded by its accompanying software .
the program also controls the power supply of major equipment of the reactor . during an experiment ,
if the reactor undergoes an unwanted change in operating conditions in terms of specific pressure changes and/or temperature changes , or a combustible gas is present above the safety limit , and/or if the ventilation system fails , the program could automatically shut down the system to ensure safety . pressure relief valves and a rupture disc
catalyst loading and pretreatment
catalyst preparation
crush both catalysts , ru / c , as the stage - i catalyst and como / al2o3 as the stage - ii catalyst , and sieve to retain 0.25 to 0.60 mm ( 30 to 60 mesh ) grains . note : ru / c catalyst was prepared in - house and como / al2o3 catalyst was a commercial product .
catalyst loading into the reactor
use stainless steel tubes and screens as the support media for the catalyst beds . slowly pour the stage - ii catalyst grains , the stage - i catalyst grains , and the original stage - i catalyst extrudates , which were used as distributor , into the reactor sequentially while " tapping " on the outside of the reactor to form packed catalyst beds .
load 32 ml of each catalyst to form a two - stage catalyst bed with 24 ml of each catalyst located in the isothermal zone ( figure 3 ) .
install the reactor to the hydrotreater system
place the reactor into the hydrotreater system by installing the two heaters and then connecting the reactor to the gas and liquid feed component and the gasliquid separation component .
note : two heat tape - heated aluminum sheaths enclose the tubular reactor to provide heat .
each heated sheath is used independently to heat the portion of reactor during catalyst pretreatment and during hydrotreatment testing .
each aluminum sheath is wrapped with a high temperature heat tape and insulation and heated using a temperature controller .
the tubular fixed - bed catalytic reactor is made of 316 stainless steel and with an inner diameter of 13 mm and a length of 64 cm .
a thermocouple well ( 4.7 mm outside diameter ) is located in the center of the reactor , and two thermocouples are placed in the well to measure the temperature of the catalyst beds .
check the pressure of the hydrotreater system for leaks using 12.0 mpa nitrogen gas by keeping the system at the pressure and ensuring that the drop of pressure is lower than 1 psig per hour .
heat both catalyst beds from room temperature to 150 c at a rate of 120 c / hr in hydrogen at 242 ml / min.maintain both catalyst - bed temperatures at 150 c for 2 hr in hydrogen at 242 ml / hr and sulfiding agent at 0.128 ml / min ( 35 wt% di - tert - butyldisulfide in decane fed by a feeding pump).heat
the stage - i bed from 150 to 250 c at a rate of 83.3 c / hr , and maintain at 250 c for 5.8 hr . during the same period ,
heat the stage - ii bed from 150 to 400 c at a rate of 83.3 c / hr , and maintain at 400 c for 4 hr . during the procedure , keep the pressure of the reactor at 10.3 mpa , the sulfiding agent flow rate at 0.128 ml / min , and the hydrogen flow rate at 242 ml / min.stop the sulfiding agent flow and maintain hydrogen flow .
note : the sulfiding agent flow rate is determined by the amount of catalyst used and the sulfiding agent liquid hourly space velocity ( lhsv ) of 0.12 ml / ml - cat / hr for overall catalysts .
the hydrogen flow rate is determined by the sulfiding agent flow rate and the hydrogen - to - sulfiding agent flow ratio at 1,890 ml hydrogen / ml sulfiding agent liquid . the gas and liquid feeding components of the hydrotreater system consist of two high - pressure syringe pumps .
the gas and sulfiding agent is introduced to the pre - reactor zone of the reactor where the liquid is mixed before they pass downward through the catalyst bed in the reactor .
catalyst preparation
crush both catalysts , ru / c , as the stage - i catalyst and como / al2o3 as the stage - ii catalyst , and sieve to retain 0.25 to 0.60 mm ( 30 to 60 mesh ) grains . note : ru / c catalyst was prepared in - house and como / al2o3 catalyst was a commercial product .
crush both catalysts , ru / c , as the stage - i catalyst and como / al2o3 as the stage - ii catalyst , and sieve to retain 0.25 to 0.60 mm ( 30 to 60 mesh ) grains . note : ru / c catalyst was prepared in - house and como / al2o3 catalyst was a commercial product .
catalyst loading into the reactor
use stainless steel tubes and screens as the support media for the catalyst beds . slowly pour the stage - ii catalyst grains , the stage - i catalyst grains , and the original stage - i catalyst extrudates , which were used as distributor , into the reactor sequentially while " tapping " on the outside of the reactor to form packed catalyst beds .
load 32 ml of each catalyst to form a two - stage catalyst bed with 24 ml of each catalyst located in the isothermal zone ( figure 3 ) .
slowly pour the stage - ii catalyst grains , the stage - i catalyst grains , and the original stage - i catalyst extrudates , which were used as distributor , into the reactor sequentially while " tapping " on the outside of the reactor to form packed catalyst beds .
load 32 ml of each catalyst to form a two - stage catalyst bed with 24 ml of each catalyst located in the isothermal zone ( figure 3 ) .
install the reactor to the hydrotreater system
place the reactor into the hydrotreater system by installing the two heaters and then connecting the reactor to the gas and liquid feed component and the gasliquid separation component .
note : two heat tape - heated aluminum sheaths enclose the tubular reactor to provide heat .
each heated sheath is used independently to heat the portion of reactor during catalyst pretreatment and during hydrotreatment testing .
each aluminum sheath is wrapped with a high temperature heat tape and insulation and heated using a temperature controller .
the tubular fixed - bed catalytic reactor is made of 316 stainless steel and with an inner diameter of 13 mm and a length of 64 cm .
a thermocouple well ( 4.7 mm outside diameter ) is located in the center of the reactor , and two thermocouples are placed in the well to measure the temperature of the catalyst beds .
place the reactor into the hydrotreater system by installing the two heaters and then connecting the reactor to the gas and liquid feed component and the gasliquid separation component .
note : two heat tape - heated aluminum sheaths enclose the tubular reactor to provide heat .
each heated sheath is used independently to heat the portion of reactor during catalyst pretreatment and during hydrotreatment testing .
each aluminum sheath is wrapped with a high temperature heat tape and insulation and heated using a temperature controller .
the tubular fixed - bed catalytic reactor is made of 316 stainless steel and with an inner diameter of 13 mm and a length of 64 cm .
a thermocouple well ( 4.7 mm outside diameter ) is located in the center of the reactor , and two thermocouples are placed in the well to measure the temperature of the catalyst beds .
check the pressure of the hydrotreater system for leaks using 12.0 mpa nitrogen gas by keeping the system at the pressure and ensuring that the drop of pressure is lower than 1 psig per hour .
heat both catalyst beds from room temperature to 150 c at a rate of 120 c / hr in hydrogen at 242 ml / min.maintain both catalyst - bed temperatures at 150 c for 2 hr in hydrogen at 242 ml / hr and sulfiding agent at 0.128 ml / min ( 35 wt% di - tert - butyldisulfide in decane fed by a feeding pump).heat the stage - i bed from 150 to 250 c at a rate of 83.3 c / hr , and maintain at 250 c for 5.8 hr . during the same period ,
heat the stage - ii bed from 150 to 400 c at a rate of 83.3 c / hr , and maintain at 400 c for 4 hr . during the procedure ,
keep the pressure of the reactor at 10.3 mpa , the sulfiding agent flow rate at 0.128 ml / min , and the hydrogen flow rate at 242 ml / min.stop the sulfiding agent flow and maintain hydrogen flow .
note : the sulfiding agent flow rate is determined by the amount of catalyst used and the sulfiding agent liquid hourly space velocity ( lhsv ) of 0.12 ml / ml - cat / hr for overall catalysts .
the hydrogen flow rate is determined by the sulfiding agent flow rate and the hydrogen - to - sulfiding agent flow ratio at 1,890 ml hydrogen / ml sulfiding agent liquid . the gas and liquid feeding components of the hydrotreater system consist of two high - pressure syringe pumps .
the gas and sulfiding agent is introduced to the pre - reactor zone of the reactor where the liquid is mixed before they pass downward through the catalyst bed in the reactor .
heat both catalyst beds from room temperature to 150 c at a rate of 120 c / hr in hydrogen at 242 ml / min .
maintain both catalyst - bed temperatures at 150 c for 2 hr in hydrogen at 242 ml / hr and sulfiding agent at 0.128 ml / min ( 35 wt% di - tert - butyldisulfide in decane fed by a feeding pump ) .
heat the stage - i bed from 150 to 250 c at a rate of 83.3 c / hr , and maintain at 250 c for 5.8 hr .
during the same period , heat the stage - ii bed from 150 to 400 c at a rate of 83.3 c / hr , and maintain at 400 c for 4 hr . during the procedure , keep the pressure of the reactor at 10.3 mpa , the sulfiding agent flow rate at 0.128 ml / min , and the hydrogen flow rate at 242 ml / min .
note : the sulfiding agent flow rate is determined by the amount of catalyst used and the sulfiding agent liquid hourly space velocity ( lhsv ) of 0.12 ml / ml - cat / hr for overall catalysts .
the hydrogen flow rate is determined by the sulfiding agent flow rate and the hydrogen - to - sulfiding agent flow ratio at 1,890 ml hydrogen / ml sulfiding agent liquid . the gas and liquid feeding components of the hydrotreater system consist of two high - pressure syringe pumps .
the gas and sulfiding agent is introduced to the pre - reactor zone of the reactor where the liquid is mixed before they pass downward through the catalyst bed in the reactor .
bio - oil hydrotreating
adjust the hydrogen flow to 152 ml / min and maintain the system pressure at 10.3 mpa .
set the temperatures of the stage - i catalyst bed and the stage - ii catalyst bed to 220 and 400 c , respectively .
note : the hydrogen flow rate is determined by the amount of catalyst used , the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage , and the hydrogen - to - bio - oil ratio of 1,900 ml hydrogen / ml bio-oil.record the bed temperature and hydrogen flow baselines when the temperature , pressure , and hydrogen flow become stable.add di - tert - butyl disulfide to bio - oil feed at an amount equal to 150 ppm sulfur in bio - oil . fill the bio - oil feed in one of the feeding pumps and purge the feeding line until a liquid flow that is free of air bubbles is achieved.pressurize the pump to 10.3 mpa , and then connect to the reactor by opening the connecting valves .
start feeding the bio - oil at a flow rate of 4.8 ml / hr . this action starts the bio - oil hydrotreating test .
note : bio - oil flowrate is determined by the amount of catalyst used and the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage .
the hydrogen gas and bio - oil are introduced to the pre - reactor zone of the reactor where the gas and liquid are mixed before they pass downward in an assumed trickle flow through the catalyst bed in the reactor.check the status of the reactor and record the parameters , such as temperature , pressure , flow rate , and volume , periodically . ensure the catalyst - bed temperatures are within 2 c of the desired temperature , the gas and liquid flow rates are exactly the same as the desired settings , and reactor pressure is within 0.15 mpa of the desired pressure . ensure the pressure drop across the catalyst bed is < 0.35 mpa . note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located.analyze outlet gas samples every 2 hr by directing the off - gas through an on - line micro - gc .
note : the micro - gc is an a four - channel micro - gc and calibrated using a calibration gas before each hydrotreating test.collect liquid samples every 6 hours using the following procedure : switch the sampling trap to the bypass trap , reduce the pressure of the sampling trap , drain the liquid sample to collecting vials , purge the sampling trap with nitrogen , pressurize the sampling trap with nitrogen , and redirect product flow to the sampling trap .
operate a series of two- and three - way valves that divert the gases and products in the desired directions .
note : once the reactants pass through the catalyst beds , the liquid products and unreacted liquids are separated from the gaseous products and unreacted gases in the gas - liquid separation system .
the hot gases pass through one of two pressurized , chilled , liquid / gas cold traps ( sample trap or bypass trap ) placed in parallel downstream of the reactor system
. the off - gas then passes through the back - pressure regulator where the pressure is reduced to atmospheric pressure .
the off - gas is then passed through a gas meter to measure the flowrate.conduct the test for 60 hr on stream ( time on stream [ tos ] ) .
set the reactor temperature to 100 c and hydrogen flow rate to 100 ml / min .
note : the test could be operated for toss ranging from fifty to several hundred hours .
adjust the hydrogen flow to 152 ml / min and maintain the system pressure at 10.3 mpa .
set the temperatures of the stage - i catalyst bed and the stage - ii catalyst bed to 220 and 400 c , respectively .
note : the hydrogen flow rate is determined by the amount of catalyst used , the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage , and the hydrogen - to - bio - oil ratio of 1,900 ml hydrogen / ml bio - oil .
record the bed temperature and hydrogen flow baselines when the temperature , pressure , and hydrogen flow become stable .
add di - tert - butyl disulfide to bio - oil feed at an amount equal to 150 ppm sulfur in bio - oil .
fill the bio - oil feed in one of the feeding pumps and purge the feeding line until a liquid flow that is free of air bubbles is achieved .
pressurize the pump to 10.3 mpa , and then connect to the reactor by opening the connecting valves .
start feeding the bio - oil at a flow rate of 4.8 ml / hr . this action starts the bio - oil hydrotreating test .
note : bio - oil flowrate is determined by the amount of catalyst used and the bio - oil lhsv of 0.20 ml / ml - cat / hr for each stage .
the hydrogen gas and bio - oil are introduced to the pre - reactor zone of the reactor where the gas and liquid are mixed before they pass downward in an assumed trickle flow through the catalyst bed in the reactor .
check the status of the reactor and record the parameters , such as temperature , pressure , flow rate , and volume , periodically .
ensure the catalyst - bed temperatures are within 2 c of the desired temperature , the gas and liquid flow rates are exactly the same as the desired settings , and reactor pressure is within 0.15 mpa of the desired pressure .
note : the system is monitored and partially controlled by an in - house built computer program with various sensors .
sensors include thermocouples and pressure transducers for the reactor as well as hydrogen and ventilation sensors in the enclosure where the reactor is located .
analyze outlet gas samples every 2 hr by directing the off - gas through an on - line micro - gc .
note : the micro - gc is an a four - channel micro - gc and calibrated using a calibration gas before each hydrotreating test .
collect liquid samples every 6 hours using the following procedure : switch the sampling trap to the bypass trap , reduce the pressure of the sampling trap , drain the liquid sample to collecting vials , purge the sampling trap with nitrogen , pressurize the sampling trap with nitrogen , and redirect product flow to the sampling trap . operate a series of two- and three - way valves that divert the gases and products in the desired directions .
note : once the reactants pass through the catalyst beds , the liquid products and unreacted liquids are separated from the gaseous products and unreacted gases in the gas - liquid separation system .
the hot gases pass through one of two pressurized , chilled , liquid / gas cold traps ( sample trap or bypass trap ) placed in parallel downstream of the reactor system .
the off - gas then passes through the back - pressure regulator where the pressure is reduced to atmospheric pressure .
the off - gas is then passed through a gas meter to measure the flowrate .
conduct the test for 60 hr on stream ( time on stream [ tos ] ) .
set the reactor temperature to 100 c and hydrogen flow rate to 100 ml / min .
note : the test could be operated for toss ranging from fifty to several hundred hours .
post - test procedure
use acetone to clean the feeding pump for feeding bio - oil .
load the cleaned feeding pump with acetone.purge the catalyst bed with 400 ml acetone at an acetone flow rate of 10 to 40 ml / min and a hydrogen flow rate of 100 ml / min when the catalyst - bed temperatures are at 100 c.shut off the heaters of the reactor , depressurize the system to ambient pressure , and purge the reactor with nitrogen for at least 24 hr.remove the reactor from the system and remove the spent catalysts from the reactor .
use acetone to clean the feeding pump for feeding bio - oil .
purge the catalyst bed with 400 ml acetone at an acetone flow rate of 10 to 40 ml / min and a hydrogen flow rate of 100 ml / min when the catalyst - bed temperatures are at 100 c .
shut off the heaters of the reactor , depressurize the system to ambient pressure , and purge the reactor with nitrogen for at least 24 hr .
remove the reactor from the system and remove the spent catalysts from the reactor .
product processing and result analysis
for liquid product processing , separate the two phases and weigh individually .
the liquid products are normally in two phases , a light oil phase ( oil product ) and a heavy aqueous phase ( aqueous product).conduct the following analyses of the oil product : density measurement ; karl fischer titration for water content ; elemental analysis ( d5291/d5373 , d5373mod , and d1552/d4239 ) for carbon , hydrogen , nitrogen , oxygen , and sulfur ; semi - micro color indicator titration ( d3339 ) for total acid number ; inductively coupled plasma - optical emission spectroscopy for inorganic content ; and simulated distillation ( astm d2887 ) to assess the relative amounts of fuel products in the gasoline , diesel , jet fuel , and residual ranges .
conduct the following analyses of the aqueous products : karl fischer titration for water content and elemental analysis ( d5291/d5373 ) for carbon , hydrogen , and nitrogen content.calculate the yields of produced oil product , aqueous product , and gaseous product ; the hydrogen consumption ; and the mass balance based on the inlet reactant flow rate and density , inlet hydrogen flowrate , outlet oil product weight , water content of the outlet oil product , outlet aqueous product weight , outlet gas flow rate , and outlet gas composition.analyze spent catalysts by inductively coupled plasma - optical emission spectroscopy .
for liquid product processing , separate the two phases and weigh individually .
the liquid products are normally in two phases , a light oil phase ( oil product ) and a heavy aqueous phase ( aqueous product ) .
conduct the following analyses of the oil product : density measurement ; karl fischer titration for water content ; elemental analysis ( d5291/d5373 , d5373mod , and d1552/d4239 ) for carbon , hydrogen , nitrogen , oxygen , and sulfur ; semi - micro color indicator titration ( d3339 ) for total acid number ; inductively coupled plasma - optical emission spectroscopy for inorganic content ; and simulated distillation ( astm d2887 ) to assess the relative amounts of fuel products in the gasoline , diesel , jet fuel , and residual ranges . conduct the following analyses of the aqueous products : karl fischer titration for water content and elemental analysis ( d5291/d5373 ) for carbon , hydrogen , and nitrogen content .
calculate the yields of produced oil product , aqueous product , and gaseous product ; the hydrogen consumption ; and the mass balance based on the inlet reactant flow rate and density , inlet hydrogen flowrate , outlet oil product weight , water content of the outlet oil product , outlet aqueous product weight , outlet gas flow rate , and outlet gas composition .
the fast pyrolysis of a representative herbaceous biomass , switchgrass , with or without hot - vapor filtration and the catalytic hydrotreating of the product bio - oil are used as an example for the process reported here .
hot - vapor - filtered fast pyrolysistable 1 shows bio - oil , char , and gas yields produced with and without the hot - vapor filter for a typical herbaceous feedstock . for the control experiment without hot - vapor filtration ,
this kept the residence time in the two experiments the same so any difference is due to the filter only .
the bio - oil yields were 52% to 56% , indicating successful conversion of the major portion of the biomass to liquid intermediate oils .
light vapors that were not properly collected in the condensation train were one source of mass loss .
pyrolysis oils contain several low - boiling - point compounds , such as hydroxyacetaldehyde ( boiling point 20.2 c ) , that are difficult to condense . adding
a second dry - ice trap will improve the recovery of the light condensable compounds . performing experiments with higher biomass feed rates than reported here
will improve recovery of the light vapors by increasing the vapor concentration prior to condensation .
the escape of light condensable compounds can be verified by gas chromatography - mass spectroscopy analysis of the exit gas .
the mass balances were relatively low for the herbaceous feedstock , likely because of escaping light char , which was produced from the switchgrass in relatively large quantities .
cracking reactions occur at the filter so inclusion of the hot - vapor filter reduced the oil yields and increased the gas yields .
table 2 and figures 5 and 6 show the analysis results of herbaceous feedstock and the bio - oils produced .
hot - vapor filtering reduced the ash residue in the bio - oil from 1.45% to below the detection limit .
various inorganics , such as aluminum , calcium , iron , potassium , magnesium , sodium , phosphorous , and silicon , were observed in the bio - oils , and they mainly originate from the biomass feedstock .
hot - vapor filtering significantly decreased the inorganic contents in the bio - oil , indicating that hot - vapor filtering was a powerful protocol for effectively reducing the trace element content in the bio - oils by removing char and ash particulates .
hot - vapor filtering also decreased the carbon content and increased the oxygen content in the bio - oils .
woody feedstocks have low ash contents compared to herbaceous feedstocks , and lower reductions in the bio - oil ash and inorganic contents are observed .
catalytic hydrotreating of bio - oil the analytical results of the produced bio - oil were consistent with the fact that bio - oils produced from such process are not of sufficient quality for direct use in internal combustion engines .
the two bio - oil samples were upgraded by catalytic hydrotreating in the hydrotreater system under the conditions discussed above .
bio - oils are known to plug the hydrotreating reactors as chars or polymerization products of active species in bio - oils accumulate in the catalyst bed .
therefore , the pressure drop across the catalyst beds during the hydrotreating tests is an important indicator of accumulating chars or polymerization products .
the hot - vapor filtered bio - oil performed nearly flawlessly for 60 hours tos in the hydrotreating test .
however , the non - filtered bio - oil had 5 wt% undissolved solids , which separated out in the pump and were not treated . even with these untreated solids ,
there was still a pressure drop buildup after 50 hours tos , probably because of the residual solids in the non - filtered bio - oil plugging the packed catalyst bed .
tables 3 and 4 and figures 5 and 7 list the yield of the products for bio - oil hydrotreating at different toss .
phase - separated liquid products , including an upgraded oil phase and an aqueous phase , and gaseous products , including ch4 , c2h6 , c3h8 , c4h10 , co , and co2 , were produced .
table 5 shows the analysis results of upgraded oil and figure 5 compares the elemental analysis results of the bio - oil and the upgraded oil .
hydrotreating was very effective at reducing oxygen , sulfur , and nitrogen and adding hydrogen significantly from the bio - oil feed .
the oxygen content in the upgraded oil was 2.0 wt% , which was significantly lower than 35 to 40 wt% of oxygen in the bio - oil feed .
the hydrogen - to - carbon ratio of the upgraded oil was 1.7 , compared to 1.3 for the bio - oil feed .
the trend of density of the upgraded oil , which increased from 0.81 to 0.83 g / ml over the period of the test , suggests a mild catalyst deactivation over the 60 hour tos .
as shown in figure 7 , comparisons of hydrotreated products between the hot - vapor filtered and non - filtered bio - oil showed that hot - vapor filtered bio - oil led to a slightly higher water - to - upgraded oil ratio , which is consistent with the higher oxygen content in the hot - vapor - filtered bio - oil feed .
the major difference between the hydrotreating of hot - vapor - filtered and non - filtered bio - oil was that the used catalyst beds of hot - vapor - filtered bio - oil showed much less deposition of inorganics compared to the catalyst beds used with non - filtered bio - oils .
there is a hot - vapor filter , a condensation system , and a gas - measurement system .
( mfc : mass flow controller ; rd : rupture disc ; pt : pressure transducer ; pi : pressure indicator ( gauge ) ; bpr : back - pressure regulator ; pr : pressure regulator ) please click here to view a larger version of this figure . figure 3 .
the temperature profile of the catalyst bed is shown in the left and the position of catalysts of each stage is shown in the right .
photos of a representative bio - oil samples ( left ) and a representative upgraded oil sample ( right )
comparison of elemental analysis results of the herbaceous feedstock ( switchgrass ) , the bio - oil produced with hot - vapor filtration , and the upgraded oil .
carbon , hydrogen , and oxygen content did not change much after fast pyrolysis of biomass , however , oxygen content decreased significantly and hydrogen content increased after bio - oil hydrotreating
comparison of oil yield , carbon efficiency , and some properties of bio - oil from hot - vapor filtered and non - filtered pyrolysis .
hot gas filtration eliminates inorganic residues but it also affects pyrolysis oil yield [ 3-lm ] and oil properties such as oil oxygen content
comparison of hydrotreating results of bio - oils from hot - vapor filtered and non - filtered pyrolysis .
hot - vapor filtered bio - oil leads to a slightly higher water - to - fuel ratio and the properties of upgraded fuel for the two bio - oils are very similar . the major difference between hydrotreating of the two pyrolysis oils is that the catalyst bed of hot - vapor - filtered bio - oil showed much less deposition of minerals .
yields of major pyrolysis products ( bio - oil , char , and gas ) and mass balance closures for pyrolysis of an herbaceous feedstock ( switchgrass ) with and without hot - vapor filtration .
analysis of the representative herbaceous feedstock ( switchgrass ) and bio - oil produced with and without hot - vapor filtration .
yield of major hydrotreating products at the different toss for hot - vapor filtered and non - filtered representative bio - oil .
analysis of the upgraded oil products from the hydrotreating of representative bio - oils .
in this paper , we described a detailed procedure for converting lignocellulosic biomass to fuel - range hydrocarbons via fast pyrolysis and catalytic hydrotreating .
the nrel pyrolysis reactor system with a 5-cm inner diameter fluidized - bed reactor and the pnnl hydrotreater system with a 1.3-cm inner diameter fixed - bed catalytic reactor and their operation procedures are described in detail .
these reactor systems could be used to conduct pyrolysis and hydrotreating tests in an efficient and safe manner .
we used representative herbaceous feedstocks to produce liquid bio - oils in the pyrolysis reactor system , and then , the bio - oils were processed in the hydrotreating system with a two - stage catalyst bed including sulfided ru / c and como / al2o3 as catalysts to produce fuel - range liquid hydrocarbons .
the process also is applicable to pyrolysis of a wide range of biomass feedstocks including wood , grass , and corn stover and then upgrading the produced bio - oil to produce biofuels .
the hydrotreater and hydrotreating process also could be used for upgrading other biomass - generated intermediates such as liquefaction oil ( bio - crude ) from biomass such as wood and algae .
maximizing bio - oil yield during pyrolysis requires heating the biomass rapidly to sufficient temperature to achieve maximum volatilization of the biomass . for most biomass
a fluidized bed provides rapid heat transfer from the sand to the biomass , providing a high heating rate .
typically a few percent higher bio - oil yield is achieved with biomass ground to < 0.5 mm than with biomass ground to < 2 mm . maximizing
yield also means minimizing thermal cracking of the vapors by keeping the residence time at temperature low ( 1 to 2 seconds ) .
thus , the hot piping tends to become fouled with liquid , repolymerized vapors and char . to avoid this condition , keep the auger temperature below 100 c and all surfaces between the reactor and condensation train above 400 c to avoid fouling , but below 500 c to minimize thermal cracking .
thorough coverage with heat tape is necessary to prevent cold spots and provide a uniform temperature
. sewn insulation pads with closures on them generally provide more uniform coverage , thereby resulting in more uniform temperature .
it is important that the temperature drops rapidly in the first condenser to minimize the opportunity for repolymerization of high - boiling - point materials , which could lead to blockage of the condenser inlet .
it also is necessary to use dry ice in the second condenser to maximize liquid recovery and prevent damage to gas - measurement and analysis instruments .
in addition , it is useful to measure differential pressure across the reactor and cyclone and to measure the final pressure and temperature at the dry test meter ( to enable accurate volume calculations ) .
it also is helpful to have additional thermocouples in the pyrolysis bed to verify that the bed is fluidizing uniformly enough to provide uniform temperatures .
when a larger amount of oil is needed , it is helpful to install a valve on the bottom of the char receiver and mount a secondary char receiver below that , which in turn has a valve at the bottom with a jar loosely mounted to it .
this makes it possible to empty the char receiver into the secondary receiver and finally down into the jar so that continuous operation can be maintained for many hours .
manual pounding of the pipes can be used , but an automatic vibrator provides more reliable agitation .
these can be operated continuously on the lock hopper and auger port to maintain a smooth feed flow through the feeder .
also , using an automatic vibrator on the secondary char receiver during char draining makes that operation much more reliable . hot - vapor filtration enhances cracking and reduces bio - oil yield as shown above . keeping the temperature of the filter low but still above condensation temperature
the major limitation of the fast pyrolysis process is that the produced bio - oil has some major problematic properties such as high viscosity , corrosiveness , poor volatility , low heating value , and chemical instability , which limits their direct utilization and causes some issues during their upgrading . a variant of fast pyrolysis , catalytic fast pyrolysis , wherein fast pyrolysis is integrated with a catalysis process to upgrade the pyrolysis vapor , and hydropyrolysis , wherein fast pyrolysis conducted in the presence of reactive gases such as h2 , can lead to a higher quality bio - oil but suffer higher operational complexity and low product yield .
two - stage catalytic hydrotreating showed good processing results for converting bio - oil to fuel - range hydrocarbons .
bio - oils are known to be chemically unstable because of the presence of active species such as carbonyl and phenolic compounds that could undergo repolymerization and condensation at a low temperature , leading to a high propensity for forming carbonaceous materials and consequent catalyst deactivation and even plugging of catalyst bed .
therefore , the first stage hydrogenation step was critical for the process , and was used to stabilize bio - oil by hydrogenation of carbonyls and phenolics at a relative low temperature by using a proper hydrogenation catalyst .
the performance of the hydrogenation catalyst was the key of the long - term stability and operability of the process .
oxygen removal by hydrodeoxygenation occurred at the second stage by a sulfide - based hydrotreating catalyst .
the yield and properties of produced final oil product depended on the catalysts and conditions used in the second stage . maximizing the yield of liquid final fuels could be achieved by using catalysts capable of generating c - c bonds , such as alkylation function , and optimized reaction parameters including reaction temperature , pressure , and space velocity .
the major limitation of the hydrotreating process is that , because of some problematic properties in bio - oil such as chemical instability and the presence of contaminants , the lifetime of hydrotreating catalysts , especially the first step hydrogenation catalysts , are still limited , which makes the overall process costly . maximizing the lifetime of the catalysts used
could be achieved by using more robust catalysts ; optimized reaction parameters including reaction temperature , pressure , and space velocity ; or pretreatment to lower the content of the active species or contaminants in bio - oil feeds .
the hydrotreater was operated at high pressures and reactor temperatures with flammable gases and liquids involved .
| lignocellulosic biomass conversion to produce biofuels has received significant attention because of the quest for a replacement for fossil fuels . among the various thermochemical and biochemical routes ,
fast pyrolysis followed by catalytic hydrotreating is considered to be a promising near - term opportunity .
this paper reports on experimental methods used 1 ) at the national renewable energy laboratory ( nrel ) for fast pyrolysis of lignocellulosic biomass to produce bio - oils in a fluidized - bed reactor and 2 ) at pacific northwest national laboratory ( pnnl ) for catalytic hydrotreating of bio - oils in a two - stage , fixed - bed , continuous - flow catalytic reactor .
the configurations of the reactor systems , the operating procedures , and the processing and analysis of feedstocks , bio - oils , and biofuels are described in detail in this paper .
we also demonstrate hot - vapor filtration during fast pyrolysis to remove fine char particles and inorganic contaminants from bio - oil .
representative results showed successful conversion of biomass feedstocks to fuel - range hydrocarbon biofuels and , specifically , the effect of hot - vapor filtration on bio - oil production and upgrading .
the protocols provided in this report could help to generate rigorous and reliable data for biomass pyrolysis and bio - oil hydrotreating research . |
many well - established medicines come from plants , for example , aspirin from willow bark and digoxin from foxglove .
traditional herbal medicine is just one of the many different approaches to the use of plants as remedies . today , herbal remedies are a common therapy .
ginkgo biloba is used for mental clarity and to delay the onset of alzheimer 's disease .
medicinal plants serve as a therapeutic alternative or safer choice , or in some cases , as the only effective treatment .
it is common among people of different cultures and areas to believe that particular local plants can cure their medical problems both cheaply and safely .
many think that chemical and synthetic medicinal drugs have more side effects and cost more than do their plant counterparts .
a large number of these plants and their extracts have shown beneficial effects , including antioxidant , immunomodulatory , anti - inflammatory , and anti - cancer effects [ 5 - 8 ] .
carthamus tinctorius ( ct ) , or safflower , is a plant species that is widely used both in the food industry ( as an additive , flavoring , etc ) and in the herbal industry .
reproductive medicine is another area of medicine that uses herbal medicines and that has undergone tremendous changes over the past decade .
increasing concern has been expressed about the declining sperm count of humans over the past few decades .
this may be due to exposure to environmental or chemical substances , which can lead to infertility and health problems .
ideally , evaluation of the infertile male should result in identification of the specific abnormality responsible for the infertility .
infertility in male patients is treated with specific therapy , including herbal remedies , in an attempt to improve the semen parameters .
there is no proven effective medical therapy for idiopathic oligoazoospermia , and the synthetic drugs that have been tried have proven to be costly and not always available .
the present study was designed to study the probable effects of an herbal remedy on the male reproductive system and spermatogenesis .
the aim of this study was to investigate the effects of safflower extracts on sperm parameters , hormones , and reproductive organs in male sprague - dawley rats treated with busulfan as an infertile or subfertile animal model .
in this study , 60 male sprague - dawley rats aged more than 2 months old with body weights ranging from 250 to 350 g were randomly selected from the university animal facility .
all rats were acclimated to the laboratory condition for 1 week before the experiment . during the period of the study , they were maintained in a controlled temperature ( 22 to 24 ) environment with a regular light and dark period ( 12 hours light , 12 hours dark ) and with free access to food and water . at the beginning of the experiment ,
the animals were weighed . in four groups of animals , a single intraperitoneal injection of 5 mg / kg / body weight of busulfan ( b2635 , sigma - aldrich co. , st .
the purpose of the busulfan injection in this study was to create a partially infertile or subfertile animal model .
after the injection of busulfan , three experimental groups received 10 , 25 , or 50 mg / kg / day safflower extract , respectively , through a feeding needle for 35 days .
the normal control group received distilled water only for 35 days , and the infertile control model group received 5 mg / kg busulfan only . dried safflower flowers were prepared from traditional medicine centers .
after identification and specification ( voucher no . 93 ) at the department of botany at the school of plant sciences of the university , the dried plant material was ground and stored for use in this study .
then , the powder from the dried safflower was placed in a sieve in a soxhlet apparatus and mixed with distilled water for a period of time .
after concentration with the rotator apparatus , the extract was dried at room temperature ; its volume was measured , and it was stored at 4 until use . then it was dissolved in distilled water to prepare solutions of 10 , 25 , and 50 mg / kg to be used as treatment doses .
after 35 days of administrating the extract or distilled water to the experimental and control groups , the animals were sacrificed under deep anesthesia .
the animals were dissected and blood was taken from the heart immediately for hormonal assay . then the testis and epididymis were carefully dissected out and trimmed of all fat and blood . the epididymis was removed and the sperm in its caudal part was compressed to the distal part and squeezed in a defined volume of hbss for assessment of sperm parameters .
the left testis , epididymis , and seminal vesicle were removed and after washing in normal saline , their weight and volumes were measured .
after a 5-minute incubation of the sperm in hbss , a drop of it was loaded under the hemocytometer and sperm counting was done .
then another drop was prepared for sperm motility evaluation and some drops of the sperm solution were used for smear preparation and dried at room temperature .
these slides were used to assess morphology and dna denaturation . in each slide , 10 fields were randomly selected . in each field , 10 sperm were assessed ; motile , semimotile , and nonmotile sperm cells were counted ; and the mean percentage of all slides was calculated .
these data were used for the statistical analysis . for assessment of sperm morphology , the sperm smears were stained with eosin and 10 fields in each slide were randomly selected . for every field ,
the percentage of the sperm with normal morphology was counted , and the mean percentage of all the slides was calculated and recorded .
acridine orange is a fluorescent stain for distinguishing double - stranded ( normal ) from single - stranded ( abnormal ) dna .
if the stain reacts to double - stranded dna , it emits a green fluorescent color ; in reaction to single - stranded dna , it shows a red color . in this experiment ,
the percentage of the sperm with normal dna ( green ) and abnormal dna ( red ) can be distinguished and recorded .
the numbers of normal and abnormal sperm cells in the 10 fields were counted cells and the percentage of each group in each slide was calculated .
in this study , 60 male sprague - dawley rats aged more than 2 months old with body weights ranging from 250 to 350 g were randomly selected from the university animal facility .
all rats were acclimated to the laboratory condition for 1 week before the experiment . during the period of the study , they were maintained in a controlled temperature ( 22 to 24 ) environment with a regular light and dark period ( 12 hours light , 12 hours dark ) and with free access to food and water . at the beginning of the experiment ,
the animals were weighed . in four groups of animals , a single intraperitoneal injection of 5 mg / kg / body weight of busulfan ( b2635 , sigma - aldrich co. , st .
the purpose of the busulfan injection in this study was to create a partially infertile or subfertile animal model .
after the injection of busulfan , three experimental groups received 10 , 25 , or 50 mg / kg / day safflower extract , respectively , through a feeding needle for 35 days .
the normal control group received distilled water only for 35 days , and the infertile control model group received 5 mg / kg busulfan only .
dried safflower flowers were prepared from traditional medicine centers . after identification and specification ( voucher no .
93 ) at the department of botany at the school of plant sciences of the university , the dried plant material was ground and stored for use in this study .
then , the powder from the dried safflower was placed in a sieve in a soxhlet apparatus and mixed with distilled water for a period of time .
after concentration with the rotator apparatus , the extract was dried at room temperature ; its volume was measured , and it was stored at 4 until use . then it was dissolved in distilled water to prepare solutions of 10 , 25 , and 50 mg / kg to be used as treatment doses .
after 35 days of administrating the extract or distilled water to the experimental and control groups , the animals were sacrificed under deep anesthesia . the animals were dissected and blood was taken from the heart immediately for hormonal assay .
then the testis and epididymis were carefully dissected out and trimmed of all fat and blood .
the epididymis was removed and the sperm in its caudal part was compressed to the distal part and squeezed in a defined volume of hbss for assessment of sperm parameters .
the left testis , epididymis , and seminal vesicle were removed and after washing in normal saline , their weight and volumes were measured .
after a 5-minute incubation of the sperm in hbss , a drop of it was loaded under the hemocytometer and sperm counting was done .
then another drop was prepared for sperm motility evaluation and some drops of the sperm solution were used for smear preparation and dried at room temperature .
in each slide , 10 fields were randomly selected . in each field , 10 sperm were assessed ; motile , semimotile , and nonmotile sperm cells were counted ; and the mean percentage of all slides was calculated .
these data were used for the statistical analysis . for assessment of sperm morphology , the sperm smears were stained with eosin and 10 fields in each slide were randomly selected . for every field ,
the percentage of the sperm with normal morphology was counted , and the mean percentage of all the slides was calculated and recorded .
acridine orange is a fluorescent stain for distinguishing double - stranded ( normal ) from single - stranded ( abnormal ) dna .
if the stain reacts to double - stranded dna , it emits a green fluorescent color ; in reaction to single - stranded dna , it shows a red color . in this experiment ,
the percentage of the sperm with normal dna ( green ) and abnormal dna ( red ) can be distinguished and recorded .
the numbers of normal and abnormal sperm cells in the 10 fields were counted cells and the percentage of each group in each slide was calculated .
in each slide , 10 fields were randomly selected . in each field , 10 sperm were assessed ; motile , semimotile , and nonmotile sperm cells were counted ; and the mean percentage of all slides was calculated .
for assessment of sperm morphology , the sperm smears were stained with eosin and 10 fields in each slide were randomly selected . for every field ,
the percentage of the sperm with normal morphology was counted , and the mean percentage of all the slides was calculated and recorded .
acridine orange is a fluorescent stain for distinguishing double - stranded ( normal ) from single - stranded ( abnormal ) dna .
if the stain reacts to double - stranded dna , it emits a green fluorescent color ; in reaction to single - stranded dna , it shows a red color . in this experiment ,
the percentage of the sperm with normal dna ( green ) and abnormal dna ( red ) can be distinguished and recorded .
the numbers of normal and abnormal sperm cells in the 10 fields were counted cells and the percentage of each group in each slide was calculated .
as the results of this study show , there were evident differences between the normal control ( group 1 ) and the busulfan infertile or subfertile ( group 2 ) and three experimental groups treated with 10 , 25 , and 50 mg / kg ct extract ( groups 3 , 4 , and 5 , respectively ) .
as shown in table 1 , the sperm count was 2410/ml in the subfertile busulfan group , 35.510/ml in the control , and 45.5510/ml in the group treated with 10 mg / kg ct extract .
the difference between the subfertile group and the group treated with 10 mg / kg ct was significant ( p=0.00001 ) .
the higher doses of the extract did not improve the sperm count , and in fact it decreased to 1710/ml with the 50-mg / kg dose .
the percentage of motile sperm was 78% in the 10-mg / kg treated group and 58% in the subfertile busulfan group , which was a significant difference ( p=0.03 ) .
motility dropped to 18% in the group treated with 50 mg / kg , which was much lower in comparison with the other groups .
the mean percentage of sperm with good morphology was 90% in the 10-mg / kg group and 75% in the subfertile group , and the difference was significant ( p=0.002 ) .
the sperm with good morphology in the higher dose or 50-mg / kg group was 43% , a decrease to around half of the value of the 10-mg / kg group .
as these results indicated , all of the sperm parameters were improved at the 10-mg / kg dose and the effects of the ct extract at this dose were statistically significant and higher in comparison with the subfertile group .
although the testosterone level increased from 0.74 ng / ml in the subfertile group to 1.1 ng / ml in the 10-mg / kg group , the difference was not statistically significant .
the testis weight results showed that mean testis weight was 0.96 g in the subfertile group and 1.18 g in the 10-mg / kg group ( table 2 ) .
the mean testis volume in the subfertile group was 0.89 ml , whereas in the 10-mg / kg group was 1.16 ml , which was a significant improvement ( p=0.003 ) .
as indicated in table 3 , the epididymis weight in the subfertile group was 0.58 g , whereas in the 10-mg / kg group it was 0.72 g , which was a significant difference ( p=0.0005 ) .
the epididymis volume in the busulfan - treated group was 0.56 ml and in the 10-mg / kg group it was 0.66 ml , which was a significant difference ( p=0.003 ) .
seminal vesicle weight was 1.26 g in the subfertile group and 1.56 g in the 10-mg / kg group , which was a significant difference ( p=0.001 ) .
the volume of the seminal vesicle changed from 1.06 ml in the busulfan group to 1.52 in the 10-mg / kg group ( p=0.0006 ) . by use of the acridine orange stain ,
the percentage of normal sperm cells regarding the presence of double - stranded dna was assessed . in all groups in this study ,
these results suggest that the safflower extract changed the sperm parameters , reproductive organs , and hormone levels of male rats positively .
in addition to its use as a food additive and in coloring , ct or safflower has immense medicinal and therapeutic properties .
the petals of ct contain many components , such as carthamin , gamma linolenic , and flavonoids ( luteolin - acetyl - glucoside and quercetin - acetyl - glucoside ) ; these two flavonoid components have potent antioxidative activities against lipid peroxidation .
dried ct petals , which are used in folk medicine , have been shown to invigorate the blood circulation , break up blood stasis , promote menstruation , and relieve inflammation .
neuroprotective effects of carthamin and the polyphenol components of ct have also been reported . in the present study , we investigated the effects of the safflower extract on sperm parameters , reproductive organs , and testosterone hormone in male rats treated with busulfan as a subfertile animal model . for this purpose ,
busulfan is a bifunctional alkylating chemotherapeutic and cytostatic agent that can remove the endogenous germ cells from the testis of the treated animal , thus creating a subfertile model .
our results showed that all the sperm parameters and reproductive organs were recovered after treatment with safflower extract .
therefore , the components of the extract of this plant can help to improve spermatogenesis and consequently promote fertility .
moreover , the results of the present study showed that the sperm count was increased about two - fold in comparison with the busulfan group ( 45.5510/ml and 2410/ml , respectively ) .
the sperm count was 35.510/ml in the normal control group , which was less than that in the treated extract group .
it seems that the isoflavone , carthamin , and polyphenol components of safflower increased spermatogenesis and the sperm count in this study .
these effects may be due to increasing blood circulation and the antioxidant activity of the safflower extract .
although the increase in the testosterone level was not statistically significant , it changed from 0.74 ng / ml in the busulfan group to 1.11 ng / ml in the 10-mg / kg group ; it seems that the safflower extract could affect spermatogenesis through hormonal changes . as zirkin reported , testosterone is necessary for spermatogenesis , and high concentrations of this hormone can lead to negative feedback mechanisms .
sperm motility , which declined to 58% in the busulfan group , was increased to 78% in the 10-mg / kg group ; the morphology also increased from 75% in the busulfan - treated group to 90% in the 10-mg / kg groups .
these results showed that the extract not only could promote sperm motility and morphology but also could improve sperm quality .
the improvement of the sperm parameters was most effective at the dose of 10 mg / kg of safflower ; at that dose , the sperm count was almost doubled in comparison with the busulfan control group .
this effectiveness appeared to be different at various doses ; at the higher doses of 25 mg / kg and 50 mg / kg , the ct extract actually decreased sperm parameters , sometimes to less than half of the 10-mg / kg dose .
this negative feedback can depend on the effects of high levels of hormone and of extract on the hypothalamo - hypophysial axis [ 22 - 24 ] .
therefore , the higher concentrations of the extract , such as 25 and 50 mg / kg , may have an adverse effect on these parameters as the result of factors in the extract or as a result of the concentration of testosterone , which can affect the hypothalamo - hypophysial axis .
the acridine orange staining for dna integrity showed no significant differences between the control , busulfan , and experimental groups .
this result may have been due to the chromatin dna structure , the role of which in spermatogenesis and mitosis is very critical and which is one of the key molecules for cell division .
therefore , it can be concluded that after the dna was improved in all the groups , new sperm generation with normal sperm chromatin occurred . as the results of the study on testis weight and volume showed , the testis weight was significantly increased in comparison with the busulfan group ( 0.96 g in the busulfan group and 1.18 g in the 10-mg / kg group ) .
the testis volume was increased from 0.89 ml in the busulfan group to 1.16 ml in the 10-mg / kg group .
as the data for sperm parameters showed , the sperm count was increased significantly and this occurred in parallel with the increase in the weight and volume of the testis . as reported previously
, safflower can promote the blood circulation and has antioxidant activity ; therefore , the higher sperm count could be due to the increased spermatogenesis through blood circulation in the testes , which would lead to gains in weight and volume in the testes .
epididymis weight and volume also increased significantly ; the weight changed from 0.58 g in the busulfan subfertile group to 0.72 g in the 10-mg / kg group , which was significantly different ( p=0.0005 ) .
the volume of the epididymis increased from 0.56 ml in the busulfan group to 0.66 ml in the 10-mg / kg group , which was also significant ( p=0.003 ) .
increases in the weight and volume must be dependent on the improvement in spermatogenesis caused by the safflower extract ; testes send more sperm to the epididymis , which of course will make it heavier and larger in weight and volume .
the weight of the seminal vesicle was 1.26 g in the busulfan group and 1.56 g in the 10-mg / kg extract - treated group .
the volume of the seminal vesicle changed from 1.06 ml in the busulfan group to 1.52 ml in the 10-mg / kg groups .
these changes in both weight and volume of the seminal vesicle were significant ( p=0.001 and p=0.0006 , respectively ) .
as previous studies have reported , the seminal vesicle and its secretion impact fertility and spermatogenesis ; therefore , the increased weight of this organ as the result of treatment with the ct extract could help the sperm parameters .
as the results indicated , busulfan treatment reduced all the values assessed in this study , and most of them had still not recovered to the level of the control group at 35 days after administration .
treatment with the ct extract , however , had positive effects on the values assessed . in conclusion , ct and its flavonoid antioxidant components along with increased blood circulation in the reproductive system could improve fertility . | purposetraditional herbal medicine is just one of the many different approaches using plants in the remedy of diseases .
carthamus tinctorius ( ct ) or safflower is a popular plant that is used for coloring and flavoring in food industries .
the effect of ct on spermatogenesis and sperm parameters has been reported in traditional medicine but has not yet been confirmed scientifically .
therefore , this study was designed to determine the effects of ct on spermatogenesis and the male reproductive system in an animal model.materials and methodssixty male rats were divided into five groups .
four groups were injected with 5 mg / kg of busulfan as a model of partial infertility .
then , the experimental groups were treated with 10 mg / kg , 25 mg / kg , or 50 mg / kg of ct extract for 35 days .
the control was treated with busulfan ( infertile control ) or distilled water only .
after this period , the animals were sacrificed and blood samples were taken for hormonal assay . the semen was collected from the epididymis and the reproductive organs were assessed . sperm count and motility
were measured and smears were prepared for assessment of the other parameters.resultsthe results indicated that the percentage of sperm with good morphology , motility , and count increased significantly in the group treated with 10 mg / kg ct ( p=0.002 , p=0.03 , and p=0.00001 , respectively ) .
the effects on hormonal changes and genital organ weights were also positive.conclusionsit is probable that the ct extract affects spermatogenesis and as a result sperm quality .
further studies are needed . |
in common with many non - communicable diseases , alcohol - related health harms result from a broad range of social , economic and political determinants that are affected by policies made in a number of non - health sectors . recognizing this , the health in all policies movement calls for health professionals to work synergistically with non - health sectors to negotiate policy changes that enhance health and well - being .
a range of non - health sectors share concerns regarding alcohol - related harms in particular crime , disorder and lost economic productivity presenting an opportunity for incorporating health goals across alcohol control policies . yet
broadly similar aims belie differences in how sectors prioritize alcohol control interventions , in particular the relative policy importance of targeting acute intoxication or chronic overconsumption .
while many determinants impact on both acute and chronic harms for example alcohol outlet density is associated with violence , assault and health the relative magnitude of this impact may differ . whether a government body is concerned with the immediate or long - term effects of alcohol consumption not only
influences its policy preferences , but also leads to distinct operating principles and practices that may be at odds with population health considerations .
alcohol consumption is regulated by a complex mix of government institutions that act within country - specific legal and political contexts . in england and wales ,
local governments are directly responsible for controlling alcohol provision through licensing , planning and trading standards .
however , local government powers are limited to activity within a national framework of prescribed legal considerations and policy objectives .
this legal framework focuses predominantly on balancing individual liberties and economic considerations with immediate societal harms resulting from acute alcohol intoxication .
systematic reviews , national and international guidelines consistently emphasize the health importance of reducing the affordability and physical availability of alcohol . the most effective interventions from a health perspective
include reducing licensed alcohol outlet density , their opening days and times , increasing taxation and minimum unit pricing .
conversely , standalone server or design interventions for on - premises are less consistently effective and less likely to impact on chronic consumption . in keeping with this evidence ,
the uk government 's 2012 alcohol strategy included pledges to introduce national minimum unit pricing and to consult on proposals to ban off - trade multi - buy promotions and introduce a cumulative impact health licensing objective for local alcohol policy .
however , despite positive progress in scotland , recent government statements suggest these policies are no closer to becoming a reality in england .
public health practitioners tackling alcohol - related health harms are therefore faced with a paradox : interventions with the most evidence supporting their effectiveness often appear the least feasible to implement .
individual - level interventions , despite good evidence for the effectiveness of brief interventions in reducing alcohol consumption , are unlikely to be sufficient in isolation to reduce the 31% of women and 44% of men in england who drink more than recommended weekly alcohol limits .
localism , the best opportunities to intervene on the physical availability and affordability of alcohol currently appear to be at the local government level .
this article analyses the implications for local alcohol control of recent changes in alcohol licensing laws and practice in england and wales .
we present uk case studies to show how alcohol - related health harms can be tackled through licensing , planning and local partnerships .
while this legal framework is specific to england and wales , the challenge of reconciling population health needs with the legal and political principles governing alcohol regulation is internationally relevant .
a focused search was conducted in april 2013 to identify laws , legal rulings and government policy documents relevant to current english local government alcohol control policies , processes or practices .
lexis and westlaw uk database searches identified the legislative framework for local alcohol control in england and wales , drawing on legal commentary and secondary sources including halsbury 's laws of england .
policy articles were identified from medline , web of science and google scholar database searches ; hand - searching relevant non - governmental and local government websites and contacting key experts from local government and non - governmental organizations .
documents were reviewed and analysed for their implications for the ability of local government practitioners to enact effective policies to address alcohol - related health harms .
policy implementation processes were analysed by drawing on the authors ' prior legal , public health and policy experiences , combined with contacting key informants known to the researchers for non - audio recorded discussions of policy implementation to ensure the accuracy of our process descriptions .
powers to control local alcohol supply and consumption are established by the licensing act 2003 , which transferred authority for granting and reviewing licenses from magistrate courts to local authorities . implemented in 2005 , the act sets out the licensing process ( box 1 ) and defines the statutory licensing objectives that legally underpin all licensing activities ( box 2 ) .
the police reform and social responsibility act 2011 granted health leads a statutory role in the licensing process for the first time and gave local authorities additional powers to address the cumulative impact of alcohol sales .
the recent return of public health to local authorities presents additional opportunities for cross - sector collaboration on shared objectives .
in contrast with scotland , potential health opportunities arising from this new legislation in england and wales must contend with the absence of a statutory health licensing objective .
box 1 overview of the process and legal framework governing licensing decisions in england and wales box 2 licensing objectives in england and wales as defined by the licensing act ( 2003 ) prevention of crime and disorder : based on police advice concerning , preventing crime and maintaining order .
public safety : physical safety of people using a premises , immediate harms , e.g. accidents , injuries , unconsciousness .
prevention of public nuisance : noise nuisance , light pollution , noxious smells , litter and where an effect is prejudicial to health. protection of children from harm : moral , psychological and physical harm , including underage sale of alcohol . local health leads in england and wales have , as responsible authorities , a recognized role in commenting on all licensing applications , yet evidence they present must legally be framed in terms of non - health objectives .
the licensing process ( box 1 ) is primarily a method for controlling immediate harms associated with alcohol sales at a particular premises .
all license decisions must relate specifically to the premises in question and the promotion of the four statutory licensing objectives ( box 2 ) .
government guidance explicitly states that public health should not be the primary consideration for a licensing decision , although health considerations can support concerns regarding a statutory licensing objective .
alcohol - related injury rates , for example , are considered relevant to public safety .
rates of chronic conditions , on the other hand , are harder to link directly with any of the four licensing objectives , despite accounting for 75% of alcohol - related hospital admissions in england .
licensing authorities can only consider health - related evidence that directly links the premises in question to a threat to one of the named licensing objectives ( box 2 ) .
the more specifically evidence relates to the premises or location of concern , the greater its legal weight and the less vulnerable it is to appeal .
routine health data , rarely collected in a way that can be linked to individual premises , are unlikely to be considered relevant .
an area where pub or supermarket chains hold an advantage , since evidence of good operating practice by their company elsewhere is considered relevant to new applications .
the practical challenges of acquiring sufficiently detailed health data to support licensing decisions must be weighed against the potential consequences of submitting weakly justified health representations .
repeated submissions based on health evidence that is unrelated to the licensing objectives , or not deemed
relevant to the applicant , may weaken the credibility of future representations to the licensing sub - committee .
conversely , and somewhat paradoxically , not submitting a health representation for an application may be interpreted as evidence that the application holds no health threat .
a 2008 high court decision suggests that the absence of expert representation in this case by the police signified that there were no serious concerns about the impact on licensing objectives within that responsible authority 's domain of expertise . despite these limitations ,
licensing policy statements can be powerful tools to support and coordinate local government actions against alcohol - related harms .
licensing statements , open to challenge on appeal or by way of judicial review , must still be consistent with promoting the four licensing objectives .
they do , however , allow for broader responses to alcohol consumption above the individual premises level by designating special policies or establishing the local relevance of particular licensing approaches .
special policies can be implemented to address area - wide impacts of alcohol consumption , namely : cumulative impact zones ( cizs ) , early morning restriction orders and late night levies .
policy statements can also document population - level data , including health impacts , at a higher spatial scale than individual license decisions allow . using policy statements to clearly set out a licensing authority 's reasoning and justification for a licensing approach , backed up by appropriate local evidence , can make individual representations more legally robust while reducing the time needed to write them .
this could include , for example , establishing a health rationale for limiting the density of alcohol premises using rates of local alcohol - related hospital admissions .
local authorities can designate cizs to control new on- or off - premises alcohol outlets in areas where the cumulative stress caused by existing overprovision of alcohol outlets demonstrably threatens the licensing objectives .
licensing decisions are normally made with a presumption in favour of the applicant . under a ciz ,
the burden of proof is reversed and it is the applicant who must demonstrate how they will avoid threatening the licensing objectives .
cizs do not , however , affect existing license holders and decisions are still made on a case - by - case basis .
for example , an initial refusal to grant a license within a ciz in leeds was overturned on appeal due to the applicant 's short opening hours , clientele and history of running trouble - free premises .
although yet to be implemented by any local authority , early morning restriction orders ( emro ) and late night levies ( lnl ) offer additional mechanisms for controlling alcohol sales from both on- and off - premises between 12 and 6 a.m. emros are designed to address recurrent licensing objective infringements that are not attributable to a single premises , such as night time anti - social behaviour .
lnls recoup financial costs associated with late night alcohol provision by levying a charge on any premises licensed to sell alcohol between specified night hours .
acting outside of the licensing process , emros and lnls are decided on an area rather than individual - premises basis .
lnls must apply to the whole of a licensing authority 's area , while emros can apply to selected parts of this area .
the absence of a health licensing objective does not preclude addressing health needs where they concern other licensing objectives .
producing specific evidence linking local alcohol consumption practices with licensing objectives does , however , require a change of approach from traditional local health data analysis , demonstrated by the ongoing difficulties scottish licensing boards face in reflecting health evidence in licensing decisions ( box 3 ) even since the introduction of an explicit public health licensing objective .
more successfully , the cardiff model has pioneered the production of detailed local health data for use by non - health sectors .
linking anonymized data on alcohol - related injuries with the precise location of where the injury occurred provides evidence that is highly relevant to the public safety objective .
box 3 case study : scotland 's experience of a public health licensing objective licensing policy in scotland in contrast to england and wales , scottish licensing decisions have been required to promote a fifth licensing objectiveprotecting and improving public healthas set out in the licensing ( scotland ) act 2005 , implemented in 2009 .
two years after implementation , a report by alcohol focus scotland concluded that the potential to tackle alcohol - related health harms through this objective had not been met . a major barrier identified was the discrepancy between the population perspective of public health considerations and the case - by - case perspective of licensing decisions . in practice ,
the public health objective in most scottish licensing statements has most commonly equated to the provision of health information in licensed premises .
the few licensing boards who did recognize population - level health determinants , including the overprovision of alcohol , justified their policy positions using systematically gathered and analysed evidence that they documented in policy statements .
what international lessons can be learnt from scotland 's experience of a health licensing objective ?
first , broadening the scope of alcohol control frameworks to explicitly address health concerns does not change the underlying legal principles governing individual licensing decisions .
, population - level evidence can nevertheless be used to justify local policy positions and , to a degree , mitigate legal uncertainty regarding individual licensing decisions . even without a health licensing objective , there are examples of licensing authorities in england and wales establishing the relevance of certain health indicators to current licensing objectives within their policy statements , including child protection cases , domestic violence , alcohol - related injuries and under-18 health attendances associated with alcohol . while not fully reflecting the health harms caused by alcohol consumption , such indicators if linked specifically enough with a particular area or premises can be used to justify licensing decisions even without further national legislative changes .
innovations by a number of local authorities demonstrate that the existing licensing objectives in england and wales can promote health needs even in the absence of a legal public health objective . while isolated licensing rulings on individual premises are unlikely to impact considerably on health , case studies give an indication of what the licensing process allows and examples of how local authorities can implement innovative policy ahead of national regulation .
arguably the greatest strengths of recent legislative and organizational changes are the new opportunities for collaboration within local government to address a broad range of alcohol - related harms .
box 4 gives an example of where a commitment across newcastle city council to tackle alcohol - related harms has led , among other initiatives , to the introduction of minimum unit pricing license conditions for certain premises .
planning processes and strategic partnerships are two opportunities to align strategic alcohol goals across sectors including planning , trading standards , police and community safety as well as public health .
box 4 case studies : local authority interventions addressing alcohol affordability in newcastle and westminster as part of a pro - active council - wide approach to tackling alcohol harms , newcastle city council have recently granted new licenses for a small number of premises on the condition that they agree to a minimum unit pricing policy .
the mup condition is one of a number of cross - sectoral initiatives addressing alcohol overprovision and overconsumption .
set at 1.25/unit , significantly higher than the mup level proposed nationally , this condition has been introduced for bars applying for licenses in one street covered by one of a number of cumulative impact policies .
so far , this condition has only been applied to high - end on - premises licensees who would probably have priced their drinks above the minimum level even without the condition
the impetus behind these conditions was precautionary to protect against the future transfer of the license to owners with business models based around large volume sales of heavily price - promoted drinks .
nevertheless , this example joins cases elsewhere of licensing authorities implementing health - relevant policies despite the absence of a health objective .
for example , westminster council have granted a supermarket license with a condition banning drinks promotions .
these demonstrate the potential for health leads to use existing statutory powers available to local governments to address population - level determinants of alcohol - related health harms .
in contrast to licensing , the legal framework governing planning is broad enough to include the goal of health promotion .
furthermore , there is precedence for using spatial planning to improve health through regulating the concentration and proximity of takeaway food outlets . where licensing and planning conditions differ
, a premises must comply with both , for example by observing whichever specified closing time is earliest .
there is therefore scope for addressing long - term population health impacts by controlling local alcohol availability through local development frameworks and development plans .
partnership working has formed an important part of local alcohol control policy for many years and is encouraged in the government 's alcohol strategy . where individual partners ' interests conflict with the partnership 's overall aims , however , such collaborations may not be effective .
alcohol industry partnerships , including community alcohol partnerships , may prioritize individual - focused interventions such as health information campaigns over more effective population - level regulation .
joint strategic needs assessments or strategic partnerships led by local government , for example the safer newham crime and disorder reduction partnership , may offer more effective ways of simultaneously addressing a broad range of alcohol harms .
powers to control local alcohol supply and consumption are established by the licensing act 2003 , which transferred authority for granting and reviewing licenses from magistrate courts to local authorities . implemented in 2005 , the act sets out the licensing process ( box 1 ) and defines the statutory licensing objectives that legally underpin all licensing activities ( box 2 ) .
the police reform and social responsibility act 2011 granted health leads a statutory role in the licensing process for the first time and gave local authorities additional powers to address the cumulative impact of alcohol sales .
the recent return of public health to local authorities presents additional opportunities for cross - sector collaboration on shared objectives .
in contrast with scotland , potential health opportunities arising from this new legislation in england and wales must contend with the absence of a statutory health licensing objective .
box 1 overview of the process and legal framework governing licensing decisions in england and wales box 2 licensing objectives in england and wales as defined by the licensing act ( 2003 ) prevention of crime and disorder : based on police advice concerning , preventing crime and maintaining order .
public safety : physical safety of people using a premises , immediate harms , e.g. accidents , injuries , unconsciousness .
prevention of public nuisance : noise nuisance , light pollution , noxious smells , litter and where an effect is prejudicial to health. protection of children from harm : moral , psychological and physical harm , including underage sale of alcohol .
local health leads in england and wales have , as responsible authorities , a recognized role in commenting on all licensing applications , yet evidence they present must legally be framed in terms of non - health objectives . the licensing process ( box 1 ) is primarily a method for controlling immediate harms associated with alcohol sales at a particular premises .
all license decisions must relate specifically to the premises in question and the promotion of the four statutory licensing objectives ( box 2 ) .
government guidance explicitly states that public health should not be the primary consideration for a licensing decision , although health considerations can support concerns regarding a statutory licensing objective .
alcohol - related injury rates , for example , are considered relevant to public safety .
rates of chronic conditions , on the other hand , are harder to link directly with any of the four licensing objectives , despite accounting for 75% of alcohol - related hospital admissions in england .
licensing authorities can only consider health - related evidence that directly links the premises in question to a threat to one of the named licensing objectives ( box 2 ) .
the more specifically evidence relates to the premises or location of concern , the greater its legal weight and the less vulnerable it is to appeal .
routine health data , rarely collected in a way that can be linked to individual premises , are unlikely to be considered relevant .
an area where pub or supermarket chains hold an advantage , since evidence of good operating practice by their company elsewhere is considered relevant to new applications .
the practical challenges of acquiring sufficiently detailed health data to support licensing decisions must be weighed against the potential consequences of submitting weakly justified health representations .
repeated submissions based on health evidence that is unrelated to the licensing objectives , or not deemed
relevant to the applicant , may weaken the credibility of future representations to the licensing sub - committee .
conversely , and somewhat paradoxically , not submitting a health representation for an application may be interpreted as evidence that the application holds no health threat .
a 2008 high court decision suggests that the absence of expert representation in this case by the police signified that there were no serious concerns about the impact on licensing objectives within that responsible authority 's domain of expertise . despite these limitations ,
licensing policy statements can be powerful tools to support and coordinate local government actions against alcohol - related harms .
licensing statements , open to challenge on appeal or by way of judicial review , must still be consistent with promoting the four licensing objectives .
they do , however , allow for broader responses to alcohol consumption above the individual premises level by designating special policies or establishing the local relevance of particular licensing approaches .
special policies can be implemented to address area - wide impacts of alcohol consumption , namely : cumulative impact zones ( cizs ) , early morning restriction orders and late night levies .
policy statements can also document population - level data , including health impacts , at a higher spatial scale than individual license decisions allow . using policy statements to clearly set out a licensing authority 's reasoning and justification for a licensing approach , backed up by appropriate local evidence , can make individual representations more legally robust while reducing the time needed to write them .
this could include , for example , establishing a health rationale for limiting the density of alcohol premises using rates of local alcohol - related hospital admissions .
local authorities can designate cizs to control new on- or off - premises alcohol outlets in areas where the cumulative stress caused by existing overprovision of alcohol outlets demonstrably threatens the licensing objectives .
licensing decisions are normally made with a presumption in favour of the applicant . under a ciz ,
the burden of proof is reversed and it is the applicant who must demonstrate how they will avoid threatening the licensing objectives .
cizs do not , however , affect existing license holders and decisions are still made on a case - by - case basis .
for example , an initial refusal to grant a license within a ciz in leeds was overturned on appeal due to the applicant 's short opening hours , clientele and history of running trouble - free premises .
although yet to be implemented by any local authority , early morning restriction orders ( emro ) and late night levies ( lnl ) offer additional mechanisms for controlling alcohol sales from both on- and off - premises between 12 and 6 a.m. emros are designed to address recurrent licensing objective infringements that are not attributable to a single premises , such as night time anti - social behaviour .
lnls recoup financial costs associated with late night alcohol provision by levying a charge on any premises licensed to sell alcohol between specified night hours .
acting outside of the licensing process , emros and lnls are decided on an area rather than individual - premises basis .
lnls must apply to the whole of a licensing authority 's area , while emros can apply to selected parts of this area .
the absence of a health licensing objective does not preclude addressing health needs where they concern other licensing objectives .
producing specific evidence linking local alcohol consumption practices with licensing objectives does , however , require a change of approach from traditional local health data analysis , demonstrated by the ongoing difficulties scottish licensing boards face in reflecting health evidence in licensing decisions ( box 3 ) even since the introduction of an explicit public health licensing objective .
more successfully , the cardiff model has pioneered the production of detailed local health data for use by non - health sectors .
linking anonymized data on alcohol - related injuries with the precise location of where the injury occurred provides evidence that is highly relevant to the public safety objective .
box 3 case study : scotland 's experience of a public health licensing objective licensing policy in scotland in contrast to england and wales , scottish licensing decisions have been required to promote a fifth licensing objectiveprotecting and improving public healthas set out in the licensing ( scotland ) act 2005 , implemented in 2009 .
two years after implementation , a report by alcohol focus scotland concluded that the potential to tackle alcohol - related health harms through this objective had not been met .
a major barrier identified was the discrepancy between the population perspective of public health considerations and the case - by - case perspective of licensing decisions . in practice ,
the public health objective in most scottish licensing statements has most commonly equated to the provision of health information in licensed premises .
the few licensing boards who did recognize population - level health determinants , including the overprovision of alcohol , justified their policy positions using systematically gathered and analysed evidence that they documented in policy statements .
what international lessons can be learnt from scotland 's experience of a health licensing objective ?
first , broadening the scope of alcohol control frameworks to explicitly address health concerns does not change the underlying legal principles governing individual licensing decisions .
, population - level evidence can nevertheless be used to justify local policy positions and , to a degree , mitigate legal uncertainty regarding individual licensing decisions . even without a health licensing objective , there are examples of licensing authorities in england and wales establishing the relevance of certain health indicators to current licensing objectives within their policy statements , including child protection cases , domestic violence , alcohol - related injuries and under-18 health attendances associated with alcohol . while not fully reflecting the health harms caused by alcohol consumption , such indicators if linked specifically enough with a particular area or premises can be used to justify licensing decisions even without further national legislative changes .
innovations by a number of local authorities demonstrate that the existing licensing objectives in england and wales can promote health needs even in the absence of a legal public health objective . while isolated licensing rulings on individual premises are unlikely to impact considerably on health , case studies give an indication of what the licensing process allows and examples of how local authorities can implement innovative policy ahead of national regulation .
arguably the greatest strengths of recent legislative and organizational changes are the new opportunities for collaboration within local government to address a broad range of alcohol - related harms .
box 4 gives an example of where a commitment across newcastle city council to tackle alcohol - related harms has led , among other initiatives , to the introduction of minimum unit pricing license conditions for certain premises .
planning processes and strategic partnerships are two opportunities to align strategic alcohol goals across sectors including planning , trading standards , police and community safety as well as public health .
box 4 case studies : local authority interventions addressing alcohol affordability in newcastle and westminster as part of a pro - active council - wide approach to tackling alcohol harms , newcastle city council have recently granted new licenses for a small number of premises on the condition that they agree to a minimum unit pricing policy .
the mup condition is one of a number of cross - sectoral initiatives addressing alcohol overprovision and overconsumption .
set at 1.25/unit , significantly higher than the mup level proposed nationally , this condition has been introduced for bars applying for licenses in one street covered by one of a number of cumulative impact policies .
so far , this condition has only been applied to high - end on - premises licensees who would probably have priced their drinks above the minimum level even without the condition
the impetus behind these conditions was precautionary to protect against the future transfer of the license to owners with business models based around large volume sales of heavily price - promoted drinks .
nevertheless , this example joins cases elsewhere of licensing authorities implementing health - relevant policies despite the absence of a health objective .
for example , westminster council have granted a supermarket license with a condition banning drinks promotions .
these demonstrate the potential for health leads to use existing statutory powers available to local governments to address population - level determinants of alcohol - related health harms .
in contrast to licensing , the legal framework governing planning is broad enough to include the goal of health promotion .
furthermore , there is precedence for using spatial planning to improve health through regulating the concentration and proximity of takeaway food outlets . where licensing and planning conditions differ
, a premises must comply with both , for example by observing whichever specified closing time is earliest .
there is therefore scope for addressing long - term population health impacts by controlling local alcohol availability through local development frameworks and development plans .
partnership working has formed an important part of local alcohol control policy for many years and is encouraged in the government 's alcohol strategy . where individual partners ' interests conflict with the partnership 's overall aims , however , such collaborations may not be effective .
alcohol industry partnerships , including community alcohol partnerships , may prioritize individual - focused interventions such as health information campaigns over more effective population - level regulation .
joint strategic needs assessments or strategic partnerships led by local government , for example the safer newham crime and disorder reduction partnership , may offer more effective ways of simultaneously addressing a broad range of alcohol harms .
this article describes the mechanisms currently available for addressing alcohol - related health harms at a local level in england and wales . while decisions regarding specific policy interventions depend on the particular needs and context of the target population , our analysis clarifies which interventions local practitioners can feasibly implement . although the current licensing framework imposes a number of constraints on public health , local government interventions continue to be one of the most important ways of addressing alcohol - related health harms . at present
, licensing decisions must be framed around non - health arguments and processes . local alcohol policy currently focuses on criminal justice and the immediate management of drunkenness .
in contrast to the routine public health data and evidence reviews that public health practitioners are more commonly familiar with , licensing committees need data and arguments specific to the individual geography of the premises or circumstances of the applicant .
although it is important to recognize and respect individual rights within the licensing legal framework , public health needs to find ways to highlight the considerable burden of alcohol harms in licensing processes . local public health efforts can be supported nationally in a number of ways .
developing resources including evidence reviews , evaluation tools and case studies of best practice will strengthen local representations . providing evidence linking local contexts to alcohol harm will support appropriate licensing policy statements by , for example , justifying how alcohol outlet density influences drinking behaviour . advocating for
the addition of a health licensing objective would allow licensing decisions to reflect the growing evidence for alcohol - related health harms and make health representations less burdensome on already overstretched health leads . without a public health licensing objective , health leads face the prospect of being responsible for addressing the potential health harms of granting a license without the clear legal authority to do so .
licensing has largely confined its focus to on - premises and immediate harms associated with alcohol consumption .
the uk government 's 2012 alcohol strategy marks a shift towards public health - oriented alcohol policy ; however , the majority of this strategy 's content has yet to be enacted .
the challenges faced by local governments responsible for local alcohol control without appropriate powers to address important health determinants have been described in new zealand and australia .
this article adds to the international literature by analysing legal as well as policy frameworks for local alcohol control within england and wales .
alcohol health concerns can be addressed within the current alcohol control framework by utilizing the potential for cross - sector collaboration within local government .
pre - emptive data collection to support representations and identify priority areas can improve effectiveness while reducing costs .
aligning local planning policy with licensing can improve the long - term control of alcohol availability . finally , local partnerships can harness mechanisms from across local government to address shared concerns related to alcohol consumption .
joint strategic needs assessments and joint health and well - being strategies are two mechanisms for public health to collaborate with non - health sectors , but it is important to work with other powerful allies including the police and community safety .
our legal analysis is specific to england and wales ; details of our findings can not be assumed to apply directly to other legal contexts .
however , the challenges of overcoming the tensions between tackling acute and chronic , social and health harms caused by alcohol consumption while respecting individual freedoms are likely to apply to alcohol policy - making in all contexts .
our findings should be interpreted alongside other country - specific policy analyses and international alcohol policy comparisons .
this article describes the mechanisms currently available for addressing alcohol - related health harms at a local level in england and wales . while decisions regarding specific policy interventions depend on the particular needs and context of the target population , our analysis clarifies which interventions local practitioners can feasibly implement . although the current licensing framework imposes a number of constraints on public health , local government interventions continue to be one of the most important ways of addressing alcohol - related health harms . at present
, licensing decisions must be framed around non - health arguments and processes . local alcohol policy currently focuses on criminal justice and the immediate management of drunkenness .
in contrast to the routine public health data and evidence reviews that public health practitioners are more commonly familiar with , licensing committees need data and arguments specific to the individual geography of the premises or circumstances of the applicant .
although it is important to recognize and respect individual rights within the licensing legal framework , public health needs to find ways to highlight the considerable burden of alcohol harms in licensing processes . local public health efforts can be supported nationally in a number of ways .
developing resources including evidence reviews , evaluation tools and case studies of best practice will strengthen local representations . providing evidence linking local contexts to alcohol harm will support appropriate licensing policy statements by , for example , justifying how alcohol outlet density influences drinking behaviour . advocating for
the addition of a health licensing objective would allow licensing decisions to reflect the growing evidence for alcohol - related health harms and make health representations less burdensome on already overstretched health leads . without a public health licensing objective , health leads face the prospect of being responsible for addressing the potential health harms of granting a license without the clear legal authority to do so .
licensing has largely confined its focus to on - premises and immediate harms associated with alcohol consumption .
the uk government 's 2012 alcohol strategy marks a shift towards public health - oriented alcohol policy ; however , the majority of this strategy 's content has yet to be enacted .
the challenges faced by local governments responsible for local alcohol control without appropriate powers to address important health determinants have been described in new zealand and australia .
this article adds to the international literature by analysing legal as well as policy frameworks for local alcohol control within england and wales .
alcohol health concerns can be addressed within the current alcohol control framework by utilizing the potential for cross - sector collaboration within local government .
pre - emptive data collection to support representations and identify priority areas can improve effectiveness while reducing costs .
such data can justify cumulative impact policies and support license policy statements . aligning local planning policy with licensing
can improve the long - term control of alcohol availability . finally , local partnerships can harness mechanisms from across local government to address shared concerns related to alcohol consumption .
joint strategic needs assessments and joint health and well - being strategies are two mechanisms for public health to collaborate with non - health sectors , but it is important to work with other powerful allies including the police and community safety .
our legal analysis is specific to england and wales ; details of our findings can not be assumed to apply directly to other legal contexts .
however , the challenges of overcoming the tensions between tackling acute and chronic , social and health harms caused by alcohol consumption while respecting individual freedoms are likely to apply to alcohol policy - making in all contexts . our findings should be interpreted alongside other country - specific policy analyses and international alcohol policy comparisons .
despite health not being a legally recognized licensing objective , our analysis demonstrates how public health practitioners can address local health consequences of alcohol consumption in england through non - health sector policies .
important barriers to working collaboratively across sectors include differences in prioritizing interventions and the types of evidence that can be used to justify policy decisions .
collaborations with non - health sectors are more likely to succeed if these differences are understood and addressed .
there is , however , a limit to what can be achieved at a local level .
this includes using the greater fiscal control available to the national government to upholding pledges to reduce alcohol affordability , for example by introducing minimum unit pricing and multi - buy promotion bans .
successful local implementation of minimum unit pricing as a licensing condition or across a province could act as test cases for the introduction of similar national policies , thus embedding health objectives more robustly in alcohol policies .
this work was supported by the national institute for health research ( nihr ) 's school for public health research ( sphr ) .
the views expressed are those of the author(s ) and not necessarily those of the nhs , the nihr or the department of health .
funding to pay for the open access charges was provided by the nihr school for public health research . | backgroundthe power to influence many social determinants of health lies within local government sectors that are outside public health 's traditional remit .
we analyse the challenges of achieving health gains through local government alcohol control policies , where legal and professional practice frameworks appear to conflict with public health action.methodscurrent legislation governing local alcohol control in england and wales is reviewed and analysed for barriers and opportunities to implement effective population - level health interventions .
case studies of local government alcohol control practices are described.resultsaddressing alcohol - related health harms is constrained by the absence of a specific legal health licensing objective and differences between public health and legal assessments of the relevance of health evidence to a specific place .
local governments can , however , implement health - relevant policies by developing local evidence for alcohol - related health harms ; addressing cumulative impact in licensing policy statements and through other non - legislative approaches such as health and non - health sector partnerships .
innovative local initiatives for example , minimum unit pricing licensing conditions can serve as test cases for wider national implementation.conclusionsby combining the powers available to the many local government sectors involved in alcohol control , alcohol - related health and social harms can be tackled through existing local mechanisms . |
hyperdiploidy is one of the common chromosomal abnormalities in the childhood pre - b acute lymphoblastic leukemia ( pre - b - all ) and involves 30% of patients with the disease .
the cause of hyperdiploidy in this condition is not well known but several hypothesis exist .
one of the important question is whether all the chromosomes are randomly represented in this hyperdiploidy or there are some preferential chromosomes , which are present more often in multiple numbers . in hyperdiploidy
certain chromosomes e.g. no . 4 , 6 , 10 , 14 , 17 , 18 , 20 , 21 and x were found to be added frequently .
certain chromosomes are also lost in this disease but there is paucity of data on the composition of chromosome loss . in this paper , we analyzed our data on the composition of hyperdiploid chromosomes in well - characterized cohort of childhood pre - b - all .
a total of 126 childhood pre - b - all patients presenting in various hospitals in mumbai and referred to this institute for detailed work - up in the patient population based on complete blood count , peripheral smear examination and routine biochemistry including serum lactate dehydrogenase and uric acid levels .
bone marrow aspirate in all these patients were evaluated for morphology for fab classification , immunophenotyping and both conventional and molecular cytogeneitc studies .
immunophenotype was done in bd facs aria ( b - d ) using monoclonal antibodies cd10 , cd19 , cd5 , cd7 , cd3 , cd33 , cd3 , hla - dr , peroxidase , cd34 and anti - kappa , anti - lambda immunohematology antibodies .
gating was done with forward light scatter / laser scanning cytometry and cd45 positive areas .
pre - b - all was diagnosed as cd45 , cd34 , cd10 , cd19 , cytoplasmic igg , cd33 and cd3 .
fluorescence in situ hybridization ( fish ) studies were done in hyperdiploid cases with bcr - abl t ( 9;22 ) , mll - af4 t ( 4;11 ) , tel - aml1 t ( 12;21 ) and e2a / pbx t ( 1;19 ) using vysis probes and its technique described in the kit .
giemsa banded karyotypes were analyzed by one of us ( lk ) and the chromosomes were counted and identified using standard international system for cytogenetic nomenclature 2005 method .
flt3 internal tandem duplication and tyrosine kinase domain ( it d and tkd ) mutations were tested using standard techniques which were already applied in this laboratory .
out of 126 pre - b - all patients , 90 patients had abnormal karytoype / fish studies , 24 had normal cytogenetic pattern and in 12 patients karyotyping failed and no fish abnormality was seen with the probes used .
the present study involves these 50 patients with hyperdiploid karyotype ( male : female 33:17 , age 2 - 15 years ) .
leucocyte count at presentation varied between 2 10/l and 78 10/l , hemoglobin 46 - 87
the distribution of different chromosomes in these hyperdiploid phenotypes are presented in figure 1 and table 1 . in this study ,
gain of chromosomes in childhood hyperdiploid pre - b cell acute lymphoblastic leukemia prevalence of hyperdiploidy of different chromosomes in hyperdiploid childhood b - all cases in 46 ( 92% ) hyperdiploid patients , the number of an extra chromosome 21 varied between 1 and 5 .
there were only four patients ( 8% ) where chromosome number 21 was not involved in hyperdiploidy and in 2 ( 4% ) patient this chromosome was the only one which involved in hyperdiploidy .
chromosomes 5 , 15 , 16 , 17 and y were less often involved ( 18 - 20% ) in hyperdiploidy . individual chromosomal deletion was seen in hyperdiploid cases too .
chromosomes 2 , 3 , 4 , 5 , 6 , 10 , 21 , x and y showed no deletion .
chromosmes 1 , 7 , 8 , 9 , 11 , 12 , 14 , 15 , 22 showed deletion in 10/50 ( 20% ) cases [ figure 2 and table 2 ] .
twenty - two patients ( 22/50 i.e. 44% ) had additional chromosomal abnormalities of which tel - aml1 fusion was present in 12/50 ( 24% ) of hyperdiploid patients .
t ( 9;22 ) and t ( 4;11 ) were not seen in any of these patients though t ( 1;19 ) and t ( 12;20 ) were seen in 2% each [ table 3 ] .
no flt3 mutation ( itd / tkd ) was observed in any of the patients .
loss of chromosome in hyperdiploid childhood pre - b cell acute lymphoblastic leukemia patients chromosomal deletion in hyperdiploid pre - b - all translocations in hyperdiploid pre - b - all
hyperdiploidy is a frequent phenomenon in childhood all and it is a good prognostic marker . in our series , 50/90 ( 55.5% )
patients showing abnormal karyotype had hyperdiploidy and 50/126 ( 40% ) cases of pediatric all showed hyperdiploidy , whether the karyotype failed or it was abnormal .
if we would have done dna index study using flow cytometry ( index > 1.2 ) we could have obtained few more hyperdiploid patients where karyotype was failed .
there are few studies who have evaluated the contribution of individual chromosome to hyperdiploidy with a view to understand ( i ) why hyperdiploid chromosome pretends good prognosis ( ii ) what possible mechanism may under lie to produce hyperdiploid phenotype .
certain chromosomes e.g. 9 , 10 , 14 , 17 , 18 , 20 and 21 are found to be more often involved in the hyperdiploid karyotype . in our series chromosome 9 , 10 , 11 , 12 , 18 , 21 and 22 were found to be frequently involved in 42 ( 92% ) hyperdiploid cases [ table 1 ] . by far the most common chromosome involved in hyperdiploidy was chromosome 21 ( 92% ) and 2 ( 4% ) patients in our series had only this anomaly showing that this anomaly may be the primary one .
44% of our patients had additional chromosome abnormalities of which t ( 12;21 ) was found to be the most common ( 24% ) one .
several studies have shown that t ( 12;21 ) that is tel - aml1 fusion are present in prognostically favorable group of all patients .
prevalence of this condition in an unselected group of all patients in india have shown between 4% and 9% of the cases depending on the technique used to detect this abnormality . in our series of 126 patients 19.8% that is , 25/126 patients showed this abnormality . hence tel - aml1 fusion in both hyperdiploid 12/50 ( 24% ) and nonhyperdiploid 22/74 ( 29% ) are not statistically different ( y test , p > 0.05 ) .
though chromosome 21 was present in excess number in 92% of hyperdiploid karyotype , in 8% of the patients this chromosome was not involved , in fact none of these 8% patient had any chromosomal deletion too .
single chromosome deletion was seen in 60% of these cases . in 2/50 ( 4% ) cases
chromosome 17 was deleted and this chromosome is well - known for the gene p53 whose importance as gate keeper of the genome is very well - known .
hence , involvement of chromosome 21 in hyperdiploid pediatric all seems to be the primary pathology .
we could not do refined studies with extended molecular probes for chromosome 21 to see if the 4 of our patients where chromosome 21 involvement was seen , did any additional chromosome 21 segment hidden within the other chromosomes .
about 44% of our patients had additional chromosomal abnormalities where t ( 12;21 ) was the most common one . however , none of the four patients those who did not have additional chromosome no .
one of the root questions in this subtype of all is how this hyperdiploidy arise ?
( i ) is it by mitotic events when a haploid cell is produced and subsequent mitosis and loss of chromosome leads to hyperdiploidy or a single mitotic event producing hyperdiploid ( tetraploid ) karyotype then loss of chromosomes in subsequent cell division cause the detectable karyotypic change .
our study suggest none of the two mechanism can explain infrequent loss of chromosome with highly gain in chromosome number 21 .
sometimes , the gain in individual chromosome can vary from + 1 to + 5 .
endoreduplication of chromosomes due to silencing of some of the cell cycle controlling genes cause natural polyploidy in cells like megakaryocytes
. it may be possible that similar such mechanism coupled with weakness of the mitotic spindle and which cause loss of chromosome in subsequent mitosis .
however , this pathology also fails to explain why we have a high rate of translocation events in addition to hyperdiploidy in childhood hyperdiploid pre - b - all . unless we assume that some of these mooring less extra chromosomes interact with other chromosome to produce the translocation or partial deletion events . to explain why hyperdiploid karyotype in pediatric b -
all is associated with good prognosis , it has been shown that these cells are extremely sensitive to methotrexate and one of the folate carrier protein e.g. reduced folate carrier ( rfc ) gene is encoded in chromosome 21 .
hence multiple copies of chromosome 21 probably lead to high amount of rfc in the cell leading to higher methotrexate concentration in the cell .
present study shows that in addition to involvement of chromosome 21 as hyperdiploidy a large proportion ( 24% ) of these cases also have additional chromosome pathology e.g. tel - aml1 fusion , which may contributes to improve prognosis in these cases .
several authors have shown high flt3 mutation in hyperdiploid all patients however in our series we could not demonstrate either it d or tkd mutation of flt3 gene . whether this finding is true for indian pediatric all patients ? though
, the present report does not conclusively provide the mechanism of hyperdiploidy in all except as a conjecture .
it definitely shows that existing hypothesis of hyperdiploidy are inadequate to explain the phenomenon in its entirety . | background : hyperdiploid pre - b - cell acute lymhoblastic leukemia ( pre - b - all ) is a common form of childhood leukemia with very good prognosis with present day chemotherapy .
however , the chromosomal composition of the hyperdiploidy has not been extensively studied and possible mechanism for this pathology remains so far conjectural.objective:to analyze the pattern of chromosome involvement in a cohort of childhood hyperdiploid pre - b - all from india and from this pattern to develop an understanding on the causation of such pathology . whether such patients also carry translocations and flt3 mutations in addition to their hyperdiploid karyotype.materials and methods : one hundred and twenty - six childhood pre - b - all patients were studied .
bone marrow aspirate of these patients were evacuated for morphology , fab classification , immunophenotyping and both conventional and molecular cytogenetics.results:of 126 patients with pre - b - all ( age 2 - 15 years ) , 90 patients with abnormal karyotype showed 50 with hyperdiploid karyotype ( 50/90 i.e. 55.5% ) .
chromosomes 9 , 10 , 14 , 17 , 18 , 20 and 21 were more often involved in hyperdiploidy .
chromosome 21 duplication was present in 92% of the cases .
chromosomes 5 , 15 , 16 , 17 and y were less often involved ( 18 - 20% ) in hyperdiploidy .
about 44% of patients with hyperdiploidy had additional karyotypic abnormality of which tel - aml1 was predominant ( 24% ) .
chromosome loss was rare and accounted for 20% of the cases only .
we did not find any flt3 mutation in our patients.conclusion:in this study , the pattern of chromosome involvement in hyperdiploid karyotype of all patients is same as other studies except some chromosomes like 1 , 6 , 11 , 12 , 19 and 22 have some more frequent involvement than other studies .
this study also showed the occurrence of tel / aml1 fusion is more ( 19.8% ) than other reports from india . |
patient experience is a central dimension of healthcare quality ( iom 2001 ; asco 2006 ; ludwig et al . 2006 ; nhs 20132014 ) .
consequently , measurement of patient experience in large nationwide samples of patients is becoming common practice in several countries .
for example , in the united states , the hospital consumer assessment of healthcare providers and systems survey measures the experience of over a million hospital patients every year ( goldstein et al .
a potential barrier in translating patient experience information into improvement actions is that data often relate to patients with a wide spectrum of conditions .
patients with cancer , in particular , have very different care pathways compared with other inpatients with non - neoplastic disease ( e.g. , elective surgery patients or those with exacerbations of a chronic disease ) .
therefore , experience surveys of patients with cancer are increasingly being considered in different countries ( iversen et al . 2012 ; evensen et al .
a national programme of repeatable surveys specifically dedicated to the measurement of the experience of patients with cancer was introduced recently ( department of health 20112012a ) .
cancer charities and consumer groups strongly support and engage with the dissemination of the results of these surveys , which cover a wide spectrum of items on different domains of experience ( macmillan cancer support 20122013 ) .
because this survey encompasses patients with any type of cancer , it provides an opportunity to explore variation among patients with different diagnoses ( including common , rarer and rare cancers ; department of health 20112012a ; lyratzopoulos et al . 2012b ; el turabi et al .
appreciating how patient experience varies among patients with different socio - demographic characteristics , and crucially , different cancers , is an important first step in helping to understand responsible mechanisms and the development of targeted interventions for improvement .
because large national surveys of the experience of patients with many different cancers are a recent development , our current understanding of variation in experience by cancer diagnosis is limited .
the ease and speed by which a diagnosis can be established , the treatment burden and the prognosis of different cancers vary substantially .
we would hypothesise that the experience of care will vary substantially among patients with different cancers ; specifically , patients with prolonged diagnostic intervals , higher treatment burden and worse prognosis may provide more critical evaluations of their care .
although inequalities in reported experience among socio - demographic groups may be driven by differential prior expectations of quality , variation in experience among patients with different cancers should be relatively robust to such confounding , more directly reflecting disease factors . further , as results for the cancer patient experience survey are reported publicly for each survey item , we were a priori interested in potential inequalities in respect of each survey item ; and on the degree of consistency in patterns of variation across different research questions and aspects of experience . with these prior considerations , we analysed data from the english cancer patient experience survey 2011/2012 to explore variation in the experience of care between patients with cancer for all survey questions .
specifically , our objective was to describe and summarise variation in patient experience by age , gender , deprivation , ethnicity and cancer diagnosis across all survey questions .
we used anonymous data from the cancer patient experience survey 2011/2012 , a national postal survey of patients with cancer treated in english national health service hospitals commissioned by the uk department of health and undertaken by quality health ( chesterfield , uk ) , a specialist survey provider ( department of health 20112012a ) .
patients were included in the survey sampling frame if cancer was recorded as the primary diagnosis in any hospital care record during september to november 2011 .
primary data collection for the survey was approved by the ethics and confidentiality committee of the national information governance board ( reference ecc 3 - 04(d)/2011 ; department of health 20112012a ) .
anonymous data from the survey are available for not - for - profit research from the uk data archive ( http://www.data-archive.ac.uk/ ) the source of data used in the present study ( department of health 20112012b ) .
the survey questionnaire included evaluative questions that covered patient experience along the care pathway of patients with cancer , encompassing experience of presentation , diagnostic testing , treatment decisions , doctor and nurse communication , informational integration between hospital and community services after discharge , experience of chemotherapy and radiotherapy treatment , and outpatient follow - up care ( appendix 1 ) .
cognitive testing of survey items was carried out by the survey provider in panels of volunteers identified by macmillan cancer support , a national cancer charity ( department of health 20112012a ) . the same postal methodology used for the final survey
testing encompassed the assessment of patients ' ability to complete the questionnaire , their understanding of questions and general exploration of patient views about the survey .
most questions had four or five ordered ( likert ) response options , ranging from very positive to very negative experience , although some report - type questions had a binary ( yes / no ) format .
for each survey question , public reporting is based on the proportion of patients who provided responses indicating good or very good experience ( department of health 20112012a ) . as this is how the survey findings are used by clinicians and managers to inform quality improvement efforts , and also by members of the public when accessing information about the comparative performance of different english hospitals , in this analysis , we used the same binary categorisation of experience ( positive / negative ) as used in public reporting .
hospital record recorded cancer diagnosis classified using the international classification of diseases 10th edition ( icd-10 ) diagnostic code , patient age and gender , and hospital of treatment were available for all respondents .
self - reported ethnic group information was used in the analysis ( office of national statistics classification ) as the gold - standard approach to ethnic group assignment ( saunders et al .
2013 ) . therefore , and in the context of highly complete information ( 96.3% )
, the analysis was restricted to survey respondents for whom information on self - reported ethnicity was available .
age was categorised into eight groups ( 1624 , 2534 in 10 year groups to 7584 and 85 + ) .
socio - economic status information was not available in the 2011/2012 dataset ; however , patients ' deprivation score ( index of multiple deprivation 2007 score of lower super output area of residence ) was available for the 2010 survey ( indices of deprivation 2007 ; department of health 2010 ) .
consequently , in supplementary analysis , we examined socio - economic inequalities in cancer patient experience using the latter dataset .
we included patients with any cancer , using 36 diagnosis groups based on the icd-10 classification ( table 1 ; appendix 2 ) .
multidisciplinary team or mdt groups in the united kingdom and in other european countries , e.g. , urological , gynaecological or haematological specialty groups ) ( european partnership action against cancer consensus group et al .
specialty groups encompass patients with cancers typically treated by the same oncology service and within shared premises ( e.g. , wards or outpatient clinics ) ; these patients are also often treated by the same multidisciplinary group of oncologists , surgeons , nurses and other healthcare professionals , specialising in the treatment of cancers of the same body system ( table 2 ; appendix 2 ) .
socio - demographic and clinical characteristics of survey respondents ethnic group was defined using a six - group classification ( white , mixed , asian or asian british , black or black british , chinese and other ) . deprivation quintile groups ( for data from the 2010 survey only ) were defined by applying national ( england ) quintile - defining points ( 8.257 , 13.525 , 20.741 , and 33.511 ) to index of multiple deprivation ( imd ) scores .
anal c21 ; bladder c67 ; bone sarcoma c40 , c41 ; brain c71 ; breast c50 ; cervical c53 ; colon c18 ; ductal carcinoma in situ ( dcis ) d05 ; endometrial c54 , c55 ; gynaecological not otherwise specified ( gynaecological nos ) c57 ; hepato - biliary c22 , c23 , c24 ; hodgkin lymphoma c81 ; laryngeal c32 ; leukaemia c91 , c92 , c93 , c94 , c95 ; lung c34 , c33 ; melanoma c43 ; mesothelioma c45 ; multiple myeloma c90 ; non - hodgkin lymphoma c82 , c83 , c85 , c84 ; oesophageal c15 ; ophthalmic and rarer central nervous system ( cns ) c47 , c69 , c70 , c72 ; oropharyngeal c00
c14 , c30 , c31 ; ovarian c56 ; pancreatic c25 ; prostate c61 ; rectal c19 , c20 ; renal c64 ; secondary c77 , c78 , c79 ; small - intestine c17 , c26 ; soft tissue sarcoma c48 , c49 , c46 ; stomach c16 ; testicular c62 ; thyroid c73 ; ureter and rarer urological c60 , c63 , c65 , c66 , c68 ; vulval / vaginal c51 , c52 ; any other cancer diagnosis c37 , c38 , c39 , c74 , c75 , c76 , c80 , c97 , c58 , c88 , c96 .
initially , we calculated the unadjusted proportion of positive responses for each question and by each variable group .
then , for each ( of 65 ) evaluative questions separately , we fitted a mixed - effect logistic regression model with positive / negative experience categories as the outcome , and adjusting for age group , sex , ethnicity and cancer diagnosis as categorical variables . a random effect for hospital of treatment was also included in these models , to account for potential confounding by differential concentration of patients with different characteristics ( e.g. , ethnic minority patients ) in differentially performing hospitals .
for one question ( question 28 , whether a patient was happy to be asked to take part in research ) the model did not converge , and this question was excluded from further analyses ; patient experience for this question was highly positive ( 95.5% ) .
we visually summarised patterns of inequality across all questions similar approaches for visually summarising multiple observations across many cancer sites have been used previously ( moller et al . 2009 ) . by survey question , for each variable we assigned ranks to each one of its categorical groups ( i.e. , among the 36 cancers , we assigned ranks of 1 and 36 to those cancers associated with the best and worst reported experience , respectively , and similarly for all other variable categories by question ) .
we subsequently used a red - amber - green colour coding convention ( red = most negative experience rank / group , green = most positive experience rank / group ) to further visually summarise the findings across questions , reporting odds ratios ( ors ) and a rank - based colour code .
we used a joint ( wald ) test to examine whether each variable improved the fit of model to the data , and where it did not we did not apply the colour coding .
subsequently , as we observed overall consistent patterns of inequalities in patient experience by cancer , we estimated the average association between cancer diagnosis and patient experience across the entire survey .
for this analysis we included all responses to all questions and adjusted for question to account for the fact that the proportion of patients reporting positive experience varies by question ; and that some questions do not apply to all patients ( see appendix 1 ) .
we also adjusted for age , gender and ethnicity , and accounted for within - respondent correlation of responses using a linear regression within a generalised estimating equation approach
. this approach increases power to explore within specialty group ( i.e. , within mdt ) variation , enabling us to better distinguish inequalities even between cancers with relatively small sample sizes . to explore whether there are inequalities in cancer patient experience among patients with cancers treated by the same specialty groups we tested the equality of ors for diagnoses within each specialty group using a wald test .
we chose the largest cancer diagnosis group with approximately balanced gender distribution ( rectal ) as the baseline , while for further analysis comparing cancer experience within specialty group , we chose the largest bi - gender cancer diagnosis in each group .
colour coding was applied using ms excel 2010 ( microsoft excel ( 2010 ) [ computer software ] ) .
we used anonymous data from the cancer patient experience survey 2011/2012 , a national postal survey of patients with cancer treated in english national health service hospitals commissioned by the uk department of health and undertaken by quality health ( chesterfield , uk ) , a specialist survey provider ( department of health 20112012a ) .
patients were included in the survey sampling frame if cancer was recorded as the primary diagnosis in any hospital care record during september to november 2011 .
primary data collection for the survey was approved by the ethics and confidentiality committee of the national information governance board ( reference ecc 3 - 04(d)/2011 ; department of health 20112012a ) .
anonymous data from the survey are available for not - for - profit research from the uk data archive ( http://www.data-archive.ac.uk/ ) the source of data used in the present study ( department of health 20112012b ) .
the survey questionnaire included evaluative questions that covered patient experience along the care pathway of patients with cancer , encompassing experience of presentation , diagnostic testing , treatment decisions , doctor and nurse communication , informational integration between hospital and community services after discharge , experience of chemotherapy and radiotherapy treatment , and outpatient follow - up care ( appendix 1 ) .
cognitive testing of survey items was carried out by the survey provider in panels of volunteers identified by macmillan cancer support , a national cancer charity ( department of health 20112012a ) . the same postal methodology used for the final survey
testing encompassed the assessment of patients ' ability to complete the questionnaire , their understanding of questions and general exploration of patient views about the survey .
most questions had four or five ordered ( likert ) response options , ranging from very positive to very negative experience , although some report - type questions had a binary ( yes / no ) format .
for each survey question , public reporting is based on the proportion of patients who provided responses indicating good or very good experience ( department of health 20112012a ) . as this is how the survey findings are used by clinicians and managers to inform quality improvement efforts , and also by members of the public when accessing information about the comparative performance of different english hospitals , in this analysis , we used the same binary categorisation of experience ( positive / negative ) as used in public reporting .
hospital record recorded cancer diagnosis classified using the international classification of diseases 10th edition ( icd-10 ) diagnostic code , patient age and gender , and hospital of treatment were available for all respondents .
self - reported ethnic group information was used in the analysis ( office of national statistics classification ) as the gold - standard approach to ethnic group assignment ( saunders et al .
2013 ) . therefore , and in the context of highly complete information ( 96.3% )
, the analysis was restricted to survey respondents for whom information on self - reported ethnicity was available .
age was categorised into eight groups ( 1624 , 2534 in 10 year groups to 7584 and 85 + ) .
socio - economic status information was not available in the 2011/2012 dataset ; however , patients ' deprivation score ( index of multiple deprivation 2007 score of lower super output area of residence ) was available for the 2010 survey ( indices of deprivation 2007 ; department of health 2010 ) .
consequently , in supplementary analysis , we examined socio - economic inequalities in cancer patient experience using the latter dataset .
we included patients with any cancer , using 36 diagnosis groups based on the icd-10 classification ( table 1 ; appendix 2 ) .
multidisciplinary team or mdt groups in the united kingdom and in other european countries , e.g. , urological , gynaecological or haematological specialty groups ) ( european partnership action against cancer consensus group et al .
specialty groups encompass patients with cancers typically treated by the same oncology service and within shared premises ( e.g. , wards or outpatient clinics ) ; these patients are also often treated by the same multidisciplinary group of oncologists , surgeons , nurses and other healthcare professionals , specialising in the treatment of cancers of the same body system ( table 2 ; appendix 2 ) .
socio - demographic and clinical characteristics of survey respondents ethnic group was defined using a six - group classification ( white , mixed , asian or asian british , black or black british , chinese and other ) . deprivation quintile groups ( for data from the 2010 survey only ) were defined by applying national ( england ) quintile - defining points ( 8.257 , 13.525 , 20.741 , and 33.511 ) to index of multiple deprivation ( imd ) scores .
anal c21 ; bladder c67 ; bone sarcoma c40 , c41 ; brain c71 ; breast c50 ; cervical c53 ; colon c18 ; ductal carcinoma in situ ( dcis ) d05 ; endometrial c54 , c55 ; gynaecological not otherwise specified ( gynaecological nos ) c57 ; hepato - biliary c22 , c23 , c24 ; hodgkin lymphoma c81 ; laryngeal c32 ; leukaemia c91 , c92 , c93 , c94 , c95 ; lung c34 , c33 ; melanoma c43 ; mesothelioma c45 ; multiple myeloma c90 ; non - hodgkin lymphoma c82 , c83 , c85 , c84 ; oesophageal c15 ; ophthalmic and rarer central nervous system ( cns ) c47 , c69 , c70 , c72 ; oropharyngeal c00
c14 , c30 , c31 ; ovarian c56 ; pancreatic c25 ; prostate c61 ; rectal c19 , c20 ; renal c64 ; secondary c77 , c78 , c79 ; small - intestine c17 , c26 ; soft tissue sarcoma c48 , c49 , c46 ; stomach c16 ; testicular c62 ; thyroid c73 ; ureter and rarer urological c60 , c63 , c65 , c66 , c68 ; vulval / vaginal c51 , c52 ; any other cancer diagnosis c37 , c38 , c39 , c74 , c75 , c76 , c80 , c97 , c58 , c88 , c96 .
initially , we calculated the unadjusted proportion of positive responses for each question and by each variable group .
then , for each ( of 65 ) evaluative questions separately , we fitted a mixed - effect logistic regression model with positive / negative experience categories as the outcome , and adjusting for age group , sex , ethnicity and cancer diagnosis as categorical variables . a random effect for hospital of treatment was also included in these models , to account for potential confounding by differential concentration of patients with different characteristics ( e.g. , ethnic minority patients ) in differentially performing hospitals . for one question ( question 28 ,
whether a patient was happy to be asked to take part in research ) the model did not converge , and this question was excluded from further analyses ; patient experience for this question was highly positive ( 95.5% ) .
we visually summarised patterns of inequality across all questions similar approaches for visually summarising multiple observations across many cancer sites have been used previously ( moller et al . 2009 ) . by survey question , for each variable we assigned ranks to each one of its categorical groups ( i.e. , among the 36 cancers , we assigned ranks of 1 and 36 to those cancers associated with the best and worst reported experience , respectively , and similarly for all other variable categories by question ) .
we subsequently used a red - amber - green colour coding convention ( red = most negative experience rank / group , green = most positive experience rank / group ) to further visually summarise the findings across questions , reporting odds ratios ( ors ) and a rank - based colour code .
we used a joint ( wald ) test to examine whether each variable improved the fit of model to the data , and where it did not we did not apply the colour coding .
subsequently , as we observed overall consistent patterns of inequalities in patient experience by cancer , we estimated the average association between cancer diagnosis and patient experience across the entire survey .
for this analysis we included all responses to all questions and adjusted for question to account for the fact that the proportion of patients reporting positive experience varies by question ; and that some questions do not apply to all patients ( see appendix 1 ) .
we also adjusted for age , gender and ethnicity , and accounted for within - respondent correlation of responses using a linear regression within a generalised estimating equation approach .
this approach increases power to explore within specialty group ( i.e. , within mdt ) variation , enabling us to better distinguish inequalities even between cancers with relatively small sample sizes . to explore whether there are inequalities in cancer patient experience among patients with cancers treated by the same specialty groups we tested the equality of ors for diagnoses within each specialty group using a wald test .
we chose the largest cancer diagnosis group with approximately balanced gender distribution ( rectal ) as the baseline , while for further analysis comparing cancer experience within specialty group , we chose the largest bi - gender cancer diagnosis in each group .
colour coding was applied using ms excel 2010 ( microsoft excel ( 2010 ) [ computer software ] ) .
of an initial total of 113 808 patients , 71 793 completed the survey ( a response rate of 68% , after excluding patients who died soon after their inclusion in the sampling frame ) ; 69 086 responses with valid self - reported ethnicity were included in the final analysis sample . the sample characteristics and number of responses by survey question
are shown in table 1 and appendix 1 . the unadjusted proportion of patients reporting positive experience ranged from 24% ( q68 was the patient offered a written care plan ) to 95% ( q63 correct patient records available at outpatient appointment ) .
hereafter and unless otherwise noted , the adjusted ors for reporting a more negative experience of care compared with the baseline group are presented for question 70 ( overall rating of care , table 2 ) .
the results for this question are a typical reflection of inequalities observed in respect of other survey questions ( tables 3 and 4 and appendix 3 ) .
clinical and socio - demographic variation ci , confidence interval ; ophthalmic and rarer cns , ophthalmic and rarer central nervous system ; gynaecological nos , gynaecological not otherwise specified ; mdt , multidisciplinary team .
patients in the 6574-year group reported a positive experience more often than any other age group , while younger patients , and also the very old , reported comparatively poorer experience .
patients from ethnic minorities and women were also more likely to report poor experience ( p < 0.0001 for all ) .
there was also evidence ( p < 0.0001 ) of considerable inequalities in experience across cancer diagnoses , with patients with ductal carcinoma in situ and breast cancer being the most likely to report positive experiences and patients with thyroid and hepatobiliary cancer the least likely to do so [ or for negative experience compared with rectal cancer ; ductal carcinoma in situ or = 0.40 ( 95% confidence interval 0.310.53 ) , breast or = 0.55 ( 0.480.62 ) , thyroid or = 1.44 ( 1.121.84 ) , hepatobiliary cancer or = 1.46 ( 1.141.87 ) ] .
there was evidence ( p < 0.05 ) of inequalities within cancer specialty for four of the nine specialty groups .
for example , among patients with haematological cancers , patients with multiple myeloma were most likely to report poor experience ( or compared with non - hodgkin lymphoma patients 1.56 , 95% confidence interval 1.341.82 ) and within the urology group , compared with patients with bladder cancer , patients with testicular cancer had substantially lower odds of reporting a negative overall experience ( or = 0.59 , 95% confidence interval 0.390.89 ) noting that this difference was adjusted for age .
to aid interpretation , the full crude and case - mix adjusted proportions of patients reporting a negative experience by variable category ( age group , gender , ethnic group and cancer diagnosis ) for question 70 are shown in appendix 4 . for example , the case - mix adjusted proportion of participants reporting a negative experience was 6% and 8% for patients with ductal carcinoma in situ or breast cancer , whereas it was 18% and 19% for patients with thyroid and hepatobiliary cancer respectively .
visual summaries of inequalities in patient experience by age , gender , deprivation , ethnic group and cancer diagnosis across survey questions is provided by tables 3 and 4 and appendix 3 .
association between patient socio - demographic characteristics and cancer patient experience association between cancer diagnosis and patient experience age : poor experience across the cancer patient journey is consistently more common among younger ages than older groups , and decreases in older age groups .
very old patients ( i.e. , aged 85 + ) tend to report slightly poorer experience than 7584-year - olds .
younger patients more often report a positive experience for questions relating to provision of information or explanation than older patients , for example regarding treatment side effects ( questions 1718 ) .
they also report more positive experience of being offered financial support ( question 25 ) and experience of cancer research ( questions 2729 ) .
gender : women consistently report poor cancer patient experience more often than men . after adjustment for age , ethnicity and cancer ,
this gender inequality becomes more apparent than it could be appreciated by simply observing crude patterns of variation .
this is partly explained by the overall positive experience of women with breast cancer , masking the poorer experience of female patients with cancer overall .
ethnic group : patients from white ethnic groups report more positive experiences than patients from ethnic minority groups .
the only question where patients from all ethnic minority groups had a more positive experience was for the provision of a written care plan ( question 68 ) .
deprivation : there was evidence of ( relatively small ) disparities in patient experience by socio - economic group for about half the survey items ; however , there is no consistent pattern in the direction of this effect .
cancer diagnosis : positive experiences are most often reported among patients with ductal carcinoma in situ , breast , melanoma , endometrial , cervical and testicular cancers . it should be noted that in crude analysis , two of these cancers ( cervical and testicular ) are associated with relatively poor reported experience , before adjustment is made for age and other variables ( appendix 5 ) . on the other hand ,
positive experience was least often reported by patients with anal , pancreatic , renal and hepatobiliary / gall bladder cancers and multiple myeloma .
there are disparities among specialty groups , for example we note particularly that overall inpatient experience ( questions 3154 ) among patients with gynaecological cancers is more often positive than for patients with lower gastrointestinal cancers .
finally , there are a few notable associations for individual questions , for example , patients with mesothelioma are very likely to report positive experiences of information about financial support ( question 25 ) , reflecting established statutory compensation schemes for this occupational cancer .
there are only a few questions where the overall patterns of inequality in experience by cancer differ from the general trend .
experience of cancer research ( question 27 ) is one of these ; this is perhaps explained by patients with common cancers ( such as breast cancer ) being less likely to be invited to take part in research than patients with rarer cancers , where the pool of potential research participants is smaller .
experience of outpatient waiting times ( question 61 ) is a further question where inequalities do not follow the general pattern of variation by cancer , but overall variation in experience of outpatient waiting times is not strongly associated with any particular diagnosis .
lastly , given overall consistent inequalities across questions , we examined the average experience of patients across the whole survey .
we found significant variation in patient experience by socio - demographic characteristics ( p < 0.0001 for all ) , cancer diagnosis ( fig .
1 , p < 0.0001 ) and within cancer specialty group ( fig . 2 , p < 0.0001 for five of nine specialty groups , appendix 57 ) . on average
, patients with ductal carcinoma in situ , breast cancer and melanoma report the most positive patient experience and those with anal , hepatobiliary , multiple myeloma and small - intestine cancers the least positive , overall consistent with the patterns observed across individual questions .
regarding inequalities within cancer specialty groups , patients with endometrial cancer tended to report more positive experience than patients with ovarian cancer [ or for reporting a poor experience = 0.81 ( 0.750.86 ) , p < 0.0001 ] .
there was also heterogeneity in experience among patients with haematological malignancies ( p < 0.0001 ) , with patients with multiple myeloma reporting the poorest experience [ or for reporting a poorer experience = 1.25 ( 1.191.31 ) compared with patients with non - hodgkin lymphoma ] .
patients with anal , hepatobiliary and renal cancer also tended to report notably worse experiences compared with patients with other gastrointestinal and urological cancers respectively ( p < 0.001 ) .
association between cancer diagnosis and overall patient experience ( average ) across the survey / patient journey .
results are compared with the experience of patients with rectal cancer as a baseline , with a lower odds ratio indicating more positive experiences .
ophthalmic and rarer cns , ophthalmic and rarer central nervous system ; gynaecological nos , gynaecological not otherwise specified .
p - values are presented , and are a wald test of whether odds ratios vary within cancer specialty group .
ophthalmic and rarer cns , ophthalmic and rarer central nervous system ; gynaecological nos , gynaecological not otherwise specified .
age : poor experience across the cancer patient journey is consistently more common among younger ages than older groups , and decreases in older age groups .
very old patients ( i.e. , aged 85 + ) tend to report slightly poorer experience than 7584-year - olds .
younger patients more often report a positive experience for questions relating to provision of information or explanation than older patients , for example regarding treatment side effects ( questions 1718 ) .
they also report more positive experience of being offered financial support ( question 25 ) and experience of cancer research ( questions 2729 ) .
gender : women consistently report poor cancer patient experience more often than men . after adjustment for age , ethnicity and cancer ,
this gender inequality becomes more apparent than it could be appreciated by simply observing crude patterns of variation .
this is partly explained by the overall positive experience of women with breast cancer , masking the poorer experience of female patients with cancer overall .
ethnic group : patients from white ethnic groups report more positive experiences than patients from ethnic minority groups .
the only question where patients from all ethnic minority groups had a more positive experience was for the provision of a written care plan ( question 68 ) .
deprivation : there was evidence of ( relatively small ) disparities in patient experience by socio - economic group for about half the survey items ; however , there is no consistent pattern in the direction of this effect .
cancer diagnosis : positive experiences are most often reported among patients with ductal carcinoma in situ , breast , melanoma , endometrial , cervical and testicular cancers . it should be noted that in crude analysis , two of these cancers ( cervical and testicular ) are associated with relatively poor reported experience , before adjustment is made for age and other variables ( appendix 5 ) . on the other hand ,
positive experience was least often reported by patients with anal , pancreatic , renal and hepatobiliary / gall bladder cancers and multiple myeloma .
there are disparities among specialty groups , for example we note particularly that overall inpatient experience ( questions 3154 ) among patients with gynaecological cancers is more often positive than for patients with lower gastrointestinal cancers .
finally , there are a few notable associations for individual questions , for example , patients with mesothelioma are very likely to report positive experiences of information about financial support ( question 25 ) , reflecting established statutory compensation schemes for this occupational cancer .
there are only a few questions where the overall patterns of inequality in experience by cancer differ from the general trend .
experience of cancer research ( question 27 ) is one of these ; this is perhaps explained by patients with common cancers ( such as breast cancer ) being less likely to be invited to take part in research than patients with rarer cancers , where the pool of potential research participants is smaller .
experience of outpatient waiting times ( question 61 ) is a further question where inequalities do not follow the general pattern of variation by cancer , but overall variation in experience of outpatient waiting times is not strongly associated with any particular diagnosis .
using data from a large nationwide survey with a relatively high response rate , we describe overall consistent inequalities in the experience of patients with cancer across different survey items .
younger and very old patients and those belonging to ethnic minorities tended to evaluate their care experience more critically across the great majority of questions ; to a lesser degree , this is also true for women .
for example , among patients with 36 distinct diagnostic groups , patients with melanoma and breast cancer tended to most often report positive experiences and those with hepatobiliary cancer and multiple myeloma were more likely to report negative experiences .
further , there were also substantial differences among patients with different cancers treated by the same clinical specialties , and therefore , within the same mdt service environments .
specifically , patients with ovarian , multiple myeloma , anal , hepatobiliary and renal cancer tended to report worse experiences compared with patients with other gynaecological , haematological , upper gastrointestinal and urological cancers respectively .
the observed socio - demographic differences in experience are concordant with other patient survey evidence ( note : not necessarily from patients with cancer ) generally suggesting that younger and ethnic minority patients and women provide more critical evaluations of their care ( campbell et al .
2001 ; weech - maldonado et al . 2003 ; mead & roland 2009 ; goldstein et al . 2010 ; elliott et al . 2012 ; lyratzopoulos et al .
a us study of the experience of patients with lung and colorectal cancer also indicates worse experiences by ethnic minority patients ( ayanian et al .
2010 ) . using data from the english cancer patient experience surveys , inequalities in the experience of promptness of diagnostic suspicion in primary care , shared decision making and overall evaluation of care have been previously reported ( lyratzopoulos et al .
the present study substantially amplifies these previous analyses as it explores variation in experience across every survey question and all experience domains ( including the experience of diagnosis , treatment and community care , across 64 items ) . in spite of the observed inequalities among different patient groups , hospital performance in respect of cancer patient experience scores
is only marginally affected by patient case - mix ; this finding principally reflects the homogeneity of patient case - mix among most english hospitals ( abel et al .
2014 ) . strengths of our study include its high ( for a postal patient survey ) response rate ; its nationwide sample ; its large population ; the inclusion of patients with any type of cancer ; and the relatively high completeness of information on exposure variables .
we had no information on a range of variables that may influence experience , for example , on health performance status , or the influence of the actual treatments and care experienced by the patients ( ayanian et al .
it should also be noted that the proportion of patients in active treatment or in remission ( under surveillance ) will vary across cancers . even in the context of a survey with a relatively high response rate , there is potential for non - response bias . specifically regarding the overall summary analysis of inequalities by caner type , it should be noted that it is based on a linear regression model , which essentially represents the adjusted mean variation by cancer across all survey questions .
these mean - reported values are therefore susceptible to the influence of outliers and for some cancers , the mean variation in experience may not be the same as the typical variation ( e.g. , as observed for patients with mesothelioma ) . in order to characterise variation across all survey questions , it was necessary to consider a large number of models ( i.e. , for each outcome ) .
we have made no attempt to correct for multiple testing as this concern is inapplicable .
standard corrections for multiple testing are designed to avoid undue attention being given to a small number of significant results that are observed when a large number of tests are considered ( often also assuming that tests are independent ) .
this consideration does not apply here as almost all associations presented are statistically significant , which strongly argues against chance findings .
length of time since diagnosis may also differentially influence recall of care experiences ; however , previous work found minimal differences in overall patterns of variation by cancer when restricting the analysis to patients diagnosed within the last year ( lyratzopoulos et al .
2012b ) . being diagnosed with cancer in a young age is associated with particular practical and psychological difficulties ( nice 2005 ; harrison et al .
it is therefore plausible that younger patients have greater needs for information about their tests , condition and treatment , and communication with their providers .
our findings would indicate that these needs are on the whole not currently being fully met .
it is , however , encouraging that , against the overall pattern of differences in experience by age , younger patients reported better experiences in respect of information about their treatment , access to a specialist nurse , information about access to peer and financial support , and participation in cancer research ( questions 15 , 20 , 24 , 25 and 27 respectively ) , concordant with national guidance supporting access to key workers and participation to clinical trials for young patients with cancer ( nice 2005 ) .
inequalities in experience among different socio - demographic groups , and particularly among patients of different ethnicity , may reflect either variation in actual provision of care or differences in expectations of quality ( the so - called same care worse experience hypothesis ) ( mead & roland 2009 ; lyratzopoulos et al .
understanding the proportion of inequalities that is due to either of these two potential sources of variation is evidently critical for helping to inform appropriate improvement strategies . distinguishing among differences in expectations of quality and actual differences in delivered care is , however , challenging , and it is likely that ethnic differences in patient experience may be the result of both differences in expectations of care quality and the care that is actually delivered ( mead & roland 2009 ; weinick et al .
communication difficulties , either because of differences in socio - cultural norms of medical consultation or language barriers , can commonly result in poorer experience .
use of translators for patients with limited english language skills can help to improve communication and satisfaction with care ( karliner et al .
hospitals with higher levels of cultural competency scores have lower levels of ethnic disparity in patient experience ( weech - maldonado et al .
it would be unreasonable to assume that , after adjusting for age , gender and ethnicity , patients with different cancers have different prior expectations of care quality .
it is theoretically possible that some of the differences may relate to inequalities in the quality of care provided by different specialist services ( e.g. , haematology compared with urology ) .
however , notable inequalities in experience are observed even between patients with different cancers treated by the same clinical specialty and mdt service environments .
therefore , the observed differences in experience among patients with different cancers are likely to chiefly reflect disease - specific factors ; differences in the promptness of diagnosis , treatment burden and prognosis are likely to be important contributors .
for example , among patients with haematological cancers , those with multiple myeloma report the most critical experience , and they are also the patients who are likely to have experienced a greater number of pre - referral consultations with a general practitioner with relevant symptoms ( lyratzopoulos et al . 2012b , 2013 ) .
similarly , among patients with lower gastrointestinal tract cancers , those with anal cancer tend to report the most critical experiences , possibly a reflection of associated treatment burden , as ( compared with patients with colon cancer ) .
appreciation of worse prognosis may also be a factor , as advanced stage is associated with poorer experience of cancer care ( ayanian et al . 2010 ) .
independent of their exact causes ( in respect of the precise influence of promptness of diagnosis , treatment burden and prognosis ) , large within specialty group variations in experience should be considered as indicators of different healthcare needs of patients with different diagnoses .
specialty teams may therefore be able to prioritise interventions to improve the experience of their patients specifically targeting those patients within their specialty with greater needs for patient - centred care .
such interventions can , for example , include the provision of additional information and emotional or peer - support , or additional access and time for communication with nurses or doctors , for patients with diagnoses that confer a higher risk of poorer experience .
although the findings are broadly consistent across the survey , appreciation of patterns of variation in respect of each question ( tables 3 and 4 ) may help to identify priorities for improving specific aspects of experience for different patient groups .
given the findings , oncology teams specialising in gynaecological , haematological , gastrointestinal and urological cancers could prioritise the development and evaluation of interventions to improve the experience of patients with ovarian , multiple myeloma , anal , hepatobiliary and renal cancer respectively . in conclusion
, we report inequalities in experience among patients with cancer with different characteristics and diagnosis .
the findings could guide improvement efforts targeting patients with cancer who are at greater risk of poorer experience of care .
specialty teams may be able to provide additional ( targeted and tailored ) support to improve the experience of patients with those cancers associated with greater care needs .
data from the english cancer patient experience survey provide an example of how nationwide surveys can provide intelligence to help inform and motivate both national and local initiatives to improve the care experience of patients with cancer .
identifying patterns of variation that we describe in other country populations and healthcare settings will be particularly useful .
additional supporting information may be found in the online version of this article at the publisher 's web - site : appendix 1 .
adjusted percentage of patients reporting a negative experience of care ( question 70 ) results come from the model for which odds ratios are presented in table 2 .
unadjusted and adjusted association between patient socio - demographic characteristics and experience ( average measure across all survey questions / the whole patient journey ) .
unadjusted and adjusted association between patient cancer diagnosis and experience ( average measure across all survey questions / the whole patient journey ) .
appendix 7 . adjusted ors for overall experience by cancer diagnosis ( average measure across all survey questions / the whole patient journey ) . | patient experience is a critical dimension of cancer care quality . understanding variation in experience among patients with different cancers and characteristics is an important first step for designing targeted improvement interventions .
we analysed data from the 2011/2012 english cancer patient experience survey ( n = 69 086 ) using logistic regression to explore inequalities in care experience across 64 survey questions .
we additionally calculated a summary measure of variation in patient experience by cancer , and explored inequalities between patients with cancers treated by the same specialist teams .
we found that younger and very old , ethnic minority patients and women consistently reported worse experiences across questions .
patients with small intestine / rarer lower gastrointestinal , multiple myeloma and hepatobiliary cancers were most likely to report negative experiences whereas patients with breast , melanoma and testicular cancer were least likely ( top - to - bottom odds ratio = 1.91 , p < 0.0001 ) .
there were also inequalities in experience among patients with cancers treated by the same specialty for five of nine services ( p < 0.0001 ) .
specifically , patients with ovarian , multiple myeloma , anal , hepatobiliary and renal cancer reported notably worse experiences than patients with other gynaecological , haematological , gastrointestinal and urological malignancies respectively .
initiatives to improve cancer patient experience across oncology services may be suitably targeted on patients at higher risk of poorer experience . |
in spite of the high frequency of digeorge syndrome ( dgs ) , the commonest chromosome deletion syndrome , its diagnosis is often not suspected .
variable clinical phenotypes and different abnormalities may be caused by 22q11.2 deletion : thymus dysfunction , cardiac diseases , immunodeficiency , and other clinical problems.1 in our country , few cases have been reported , but the clinical phenotypes associated with digeorge syndrome should be well known so that patients receive an early diagnosis and correct treatment.2,3 most patients with dgs have a partial form of the disease and thymic hypoplasia .
autoimmune diseases have been associated with dgs , probably in consequence of t cell regulatory defects and impaired central tolerance.4 cardiac abnormalities , mainly conotruncal defects , have been found in dgs , and several authors have pointed out that isolated congenital heart disease may be associated with it.5 parathyroid dysfunction may cause hypocalcemia and seizures in the neonatal period .
several authors recommend that newborns undergo screening for lymphopenia , which may assist in the early diagnosis of severe combined immunodeficiency and dgs.6 most dgs patients are hemizygous for a 3 mb region on human chromosome 22 while others have a smaller 1.5 mb nested deletion .
these observations suggest that haploinsufficiency of one or more genes on human chromosome 22 are responsible for its etiology .
this study describes the most important clinical phenotypes resulting from dgs and draws attention to the frequency of this disease and its diagnosis .
fourteen ( 14 ) patients with dgs were evaluated ( 8 males ) . the mean age was 8y10 m ( 8 m
all patients met the following inclusion criteria : small or normal number of circulating t cells , normal number of circulating b cells , normal or low serum immunoglobulin level , hypoparathyroidism , conotruncal defect , facial abnormalities , and 22q11.2 or 10p deletions.7 the patients were referred from the genetic unit and instituto do corao of hospital das clnicas of universidade de so paulo ( hcfmusp ) , so paulo , brazil .
this study was approved by the ethics committee of the institution where it was conducted , and all patients and controls signed an informed consent to participate in this study .
all patients underwent a clinical and epidemiological protocol to collect information about personal characteristics and history , family history , heart disease , facial abnormalities , dimorphisms , neurological or behavioral disorders , recurrent infections , and other comorbidities .
patients were examined by the same investigators ( an immunologist and a geneticist ) and their anthropometric measurements were recorded .
the levels of serum triiodothyronine ( t3 ) , thyroxin ( t4 ) , free thyroxin ( ft4 ) , tsh , and thyroid antibodies ( thyroglobulin and peroxidase ) were measured .
all patients had a complete blood count , and the comansbitter values were used as reference to lymphocytes.8 eight ( 8) patients ( described in table 1 ) had microdeletions in 22q11.2 , detectable only by fish ( fluorescence in situ hybridization ) , a technique that integrates the use of classical cytogenetics with molecular genetics , using dna probes labeled with fluorescent material that identify specific regions of the genome.9,10 two ( 2 ) were used as probes for this analysis : the n25 ( which hybridizes at d22s75 , located within the region commonly deleted in sd22q11 ) and tuples 1 ( which binds to any gene tuples and a part of the dna located close to their ends ) .
the lost of heterozygosity detected by these markers could be used as a real tool of diagnosis in patients suspected of sd22q11 .
giolipereira et al.,11 researching snps ( single nucleotide polymorphisms ) located in 22q11.2 , in a brazilian population , found these markers are efficient to determine the loss of heterozygosity in up to 92.9% of cases .
five ( 5 ) patients ( igbs , mass , asi , css and tps ) were referred from instituto do corao , their mutations having been detected by the snps technique following the procedures described by giolipereira et al.11
all patients underwent a clinical and epidemiological protocol to collect information about personal characteristics and history , family history , heart disease , facial abnormalities , dimorphisms , neurological or behavioral disorders , recurrent infections , and other comorbidities .
patients were examined by the same investigators ( an immunologist and a geneticist ) and their anthropometric measurements were recorded .
the levels of serum triiodothyronine ( t3 ) , thyroxin ( t4 ) , free thyroxin ( ft4 ) , tsh , and thyroid antibodies ( thyroglobulin and peroxidase ) were measured .
all patients had a complete blood count , and the comansbitter values were used as reference to lymphocytes.8
eight ( 8) patients ( described in table 1 ) had microdeletions in 22q11.2 , detectable only by fish ( fluorescence in situ hybridization ) , a technique that integrates the use of classical cytogenetics with molecular genetics , using dna probes labeled with fluorescent material that identify specific regions of the genome.9,10 two ( 2 ) were used as probes for this analysis : the n25 ( which hybridizes at d22s75 , located within the region commonly deleted in sd22q11 ) and tuples 1 ( which binds to any gene tuples and a part of the dna located close to their ends ) .
the lost of heterozygosity detected by these markers could be used as a real tool of diagnosis in patients suspected of sd22q11 . giolipereira
et al.,11 researching snps ( single nucleotide polymorphisms ) located in 22q11.2 , in a brazilian population , found these markers are efficient to determine the loss of heterozygosity in up to 92.9% of cases .
five ( 5 ) patients ( igbs , mass , asi , css and tps ) were referred from instituto do corao , their mutations having been detected by the snps technique following the procedures described by giolipereira et al.11
she was included in the study because she met other criteria at the time of diagnosis : hypocalcemia , facial dimorphism , and lymphopenia , according to notarangelo et al.7 isolated or combined cardiac malformations were the most frequent findings , and 12 patients ( 86% ) were affected with the followed distributions : 5 had tetralogy of fallot ; 5 ventricular septal defect ( 3 isolated and 2 associated with atrial septal defects ) ; 1 isolated transposition of great vessels ; 1 aortic arch disruption associated with septal defects ; 1 truncus arteriosus associated with septal defects ; and 1 pulmonary atresia .
eleven ( 11 ) patients ( 85.7% ) had facial dimorphisms , and the most prevalent were oral defects , alone or in combinations .
microstomia was found in 64.3% ( 9/14 ) of the patients , and 57.2% ( 8/14 ) had palate defects , micrognathia , and short stature .
elongated fingers were observed in 50% of the patients ; straight facial profile , dental abnormalities and overfolded ear helix in 42.8% ( 6/14 ) ; hypertelorism in 35.8% ( 5/14 ) ; and strabismus in 21.5% ( 3/14 ) .
seven ( 7 ) patients had recurrent infections , mainly pneumonia , and only one of them was free of any cardiac defect that might explain lung infections .
five ( 35.8% ) patients had hypocalcemia and four of them were under treatment for hypoparathyroidism .
all patients currently have normal leukocyte counts , but two have low lymphocyte counts , below the normal range for their age .
five ( 35.8% ) patients had hypocalcemia and four of them were under treatment for hypoparathyroidism .
all patients currently have normal leukocyte counts , but two have low lymphocyte counts , below the normal range for their age . these data are shown in table 2 .
patients with 22q11.2 deletion syndromes , such as the velocardiofacial , shprintzen and digeorge syndromes may have several clinical abnormalities and different degrees of organ commitment.12 the syndromes received the name of the author that first described each one separately .
later , with the advance of the diagnostic methods in the field of genetics , it was found that the 22q11.2 chromosome was deleted in all of them .
the 22q11.2 deletion syndromes because of the difficulties in choosing a single term.13 the 22q11.2 deletion is the most common human chromosome deletion , and its incidence is about 1:3000 live births.13 in this study , held in a teaching hospital and reference center for primary immunodeficiency , the number of patients available for inclusion in the study was small , which confirmed the difficulty that physicians have in diagnosing it and determining phenotypes .
the distribution of patient age in this series corroborates the difficulty of diagnosing dgs : only 28.5% of the patients were younger than 4 years , and most were older .
currently , 180 clinical signs and symptoms , such as physical and behavioral abnormalities , have been described , but typical findings are not found in all cases.14 the facial phenotype , although easily recognized , may be subtle in some patients , and growth of the face and consequent accentuation of abnormalities become more noticeable as they grow older .
dgs diagnoses are based on a set of clinical findings or 22q11.2 deletion , but 22q11.2 deletion is only investigated when there are signs suggesting that the patient may have the syndrome . during the selection of patients in this study ,
this patient , without heart disease , had a severe cleft palate that required several corrective surgeries , a small number of lymphocytes , and a history of neonatal hypocalcemia .
diagnosis becomes more difficult when a patient with classic features of velocardiofacial syndrome or dgs has no evidence of deletion by fish .
a point mutation , which has been described in a few patients , might be present in tbox 1 ( tbx1).15 this mutation , a deletion that is too small to be detected by standard fish , or a nonchromosome 22 cause can also be associated with the same clinical manifestations as in chromosome 22q11.2 deletion syndrome .
recently , mlpa hd ( multiplex ligation dependent probe amplification with highdensity ) was reported16 as a technique that detects copy number changes at 37 loci on velocardiofacial syndrome , the cat eye syndrome , and more distal regions in 22q11 that have been deleted .
novel and variant chromosome 22 aberrations have been detected by this methodology along with the common recurrent deletions associated with digeorge syndrome and velocardiofacial syndrome .
only mlpa with high density analysis can detect uncommon deletions and establish the clinical diagnosis of 22q11 deletion.16,17 the international union of immunological societies primary immunodeficiency diseases classification committee7 proposed criteria to help to establish the diagnosis of dgs .
these criteria refer primarily to immune disorders and include the number of circulating t cells and the most frequent clinical characteristics , such as hypoparathyroidism , conotruncal malformation , facial abnormalities , and chromosomes 22q11.2 or 10p deletion .
oskarsdottir et al.18 conducted a retrospective study with 100 patients that had dgs and reported the clinical findings of patients diagnosed before and after 2 years of age .
the frequency of delayed diagnoses , also reported in their study , according to age groups was : 26% in the neonatal period ; 17% between 25 years ; 41% between 612 years ; and 16% in adolescence , i.e. , between 1316 years .
heart disease was the finding that most frequently led to the diagnosis of dgs at any age , which was similar to our findings .
for children diagnosed before the age of 2 , recurrent infections and thymic hypoplasia were the most frequent findings , followed by hypocalcemia . in the group that was diagnosed later , recurrent infections , soft palate defects , and delayed language acquisition were the most important signs and symptoms .
facial abnormalities were the least frequent in the two groups , which confirms the observation that these changes are established over a span of years.18 the comparison of our results with findings reported by oskarsdottir18 revealed that only 28% of the patients were diagnosed before the age of four years , and that heart malformations were the most prevalent findings , although cardiac defects were not the reason for referral to our institution .
jiang et al . suggested that even isolated congenital heart disease has a strong association with dgs , and that 22q11.2 deletion should be investigated in such cases.5 the frequency of cardiac malformations in patients with dgs ranges from 49% to 83% .
conotruncal defects are the most commonlyseen heart diseases , which suggests that patients may have the tetralogy of fallot . in the brazilian patients described here ,
the tetralogy of fallot was found in 50% of the patients , in agreement with data in the literature.19,20 the 22q11.2 deletion should be investigated in all patients with heart malformations , such as tetralogy of fallot , disrupted aortic arch , septal defects , and truncus arteriosus .
this is one of the reasons why pediatric cardiology centers , where the earliest diagnoses are made , often report case series.21,22 this practice does not seem to be usual in our country yet ; the number of patients that undergo cardiac surgery to correct conotruncal defects is significant , the number of referrals to our service is small , and reports of patients with dgs are still scarce .
our patients were older , and mouth , eye , and tooth abnormalities , as well as the perception of impaired speech development and behavior , are more easily noticed , as related by butts.23 in schoolchildren , short stature , long fingers , long face , and a cylindricallyshaped nose are enough to raise the hypothesis of dgs .
both patients underwent psychotherapy ; despite treatment , they still do not have good school performance , and their family relations are inadequate . according to some authors
, these patients should be followed for a long time , because depression and anxiety may precede the establishment of psychoses.24 when first described , dgs was characterized by severe immunodeficiency at birth .
the early onset of recurrent infections due to severe immunodeficiency is no longer the main clinical feature of dgs , because only patients with complete dgs have an increased susceptibility to infection
. the number of lymphocytes may be normal , and immune disorders may appear only in adulthood .
currently , other clinical signs and symptoms are also important , such as neonatal hypocalcemia , hypothyroidism , and conotruncal defects , even in the absence of facial abnormalities or recurrent infections .
infants with dgs may have breastfeeding difficulties due to several factors , such as hypotonia , cardiac problems , and airway obstruction secondary to jaw malformations .
many cases are not detected at birth or in childhood because dgs is a progressive disease and clinical signs that may appear later in life .
at least 30% of the patients do not have heart defects , and many cardiac malformations , such as rightsided aorta , are
pediatricians , neonatologists , ents , and cardiac surgeons should be aware of the possible presence of congenital heart defects , especially conotruncal defects , neonatal hypocalcemia , and defects in the palatal region at birth , which may be detected soon after birth .
other signs and symptoms , such as facial abnormalities and impaired development , may appear only years later and delay the diagnosis .
this is the first report of brazilian patients with dgs and , although the frequency of dgs is high , few patients with a confirmed diagnosis are followed up .
this work was supported by grants from fundao amparo a pesquisa do estado de so paulo ( fapesp 2008/582384 ) . | introduction : the digeorge syndrome was first described in 1968 as a primary immunodeficiency resulting from the abnormal development of the third and fourth pharyngeal pouches during embryonic life .
it is characterized by hypocalcemia due to hypoparathyroidism , heart defects , and thymic hypoplasia or aplasia .
its incidence is 1:3000 live births and , despite its high frequency , little is known about its natural history and progression .
this is probably due to diagnostic difficulties and the great variety of names used to describe it , such as velocardiofacial , shprintzen , digeorge , and catch 22 syndromes , as well as conotruncal facial anomaly .
all represent the same genetic condition , chromosome 22q11.2 deletion , which might have several clinical expressions.objectives:to describe clinical and laboratorial data and phenotypic characteristics of patients with digeorge syndrome.methods:patients underwent standard clinical and epidemiological protocol and tests to detect heart diseases , facial abnormalities , dimorphisms , neurological or behavioral disorders , recurrent infections and other comorbidities.results:of 14 patients ( 8 m
18y11 m ) , only one did not have 22q11.2 deletion detected .
the main findings were : conotruncal malformation ( n = 12 ) , facial abnormalities ( n = 11 ) , hypocalcemia ( n = 5 ) and low lymphocyte count ( n = 2).conclusion : the authors pointed out the necessity of dgs suspicion in all patient presenting with heart defects , facial abnormalities ( associated or not with hypocalcemia ) , and immunological disorders because although frequency of dgs is high , few patients with a confirmed diagnosis are followed up . |
enterococci have changed from commensal intestine organisms in human beings to a significant cause of infection ( 1 ) .
these bacteria are important causes of nosocomial infections , such as urinary tract infections , bacteremia , and endocarditis ( 2 ) .
recently , enterococci have become considerably resistant to a broad range of antimicrobial agents , particularly glycopeptides , -lactam , and aminoglycosides ( 3 ) . due to inappropriate use of antibiotics in nosocomial infections ,
the prevalence of antibiotic resistance among e. faecium is higher than in e. faecalis ( 4 ) .
enterococci are either intrinsically resistant to antibiotics or acquire the resistance genes ( 5 , 6 ) .
the resistance is due to inadequate transfer of antibiotics across the cytoplasmic membranes of bacteria .
antibiotics that are effective on the cell wall of the bacteria , such as -lactam or vancomycin , have a synergistic effect in the treatment of enterococci infections ( 7 ) .
the presence of high - level gentamicin resistant ( hlgr ) species is globally important due to their multi - resistant nature ( 8) .
unfortunately , enterococci with high - level aminoglycoside - resistance ( hlar ) ( mic > 500 g / ml ) do not seem to be sensitive to this synergistic effect , making treatment more difficult ( 9 ) .
the most common genes coding ame are aac(6)-aph(2 ) and aph(3)-iiia ( 10 ) .
ames eliminate the synergism effect of aminoglycosides when combined with a cell - wall - active agent . aac(6)aph(2 ) is the most common gene causing hlgr in enterococci , and aph(3)-iiia is common in high - level kanamycin and streptomycin resistance ( 11 ) .
an increase in the prevalence of hlgr has been observed in european , asian , and south american countries .
the prevalence of hlgr isolates recently soared by 10 times , to above 50% in blood culture isolates from e. faecium , which seems to be a rising trend ( 12 ) .
imam reza hospital in kermanshah is a referral center in the western part of iran , with different wards and specialties .
the recognition of antimicrobial resistance patterns , particularly in nosocomial infections , can serve as a guideline for selecting suitable treatments and effective antibiotics .
the present study was designed to identify the prevalence of , and to compare , the aac(6)-aph(2 ) and aph(3)-iiia genes and their antimicrobial resistance patterns among e. faecalis and e. faecium isolates from patients at imam reza hospital in 2011 - 2012 .
the study was performed on 138 isolates of enterococcus obtained from patients hospitalized in different wards of imam reza hospital during 2011 - 2012 .
the antibiotic susceptibility patterns of the isolates were determined by the disk diffusion method according to clinical and laboratory standard institute ( clsi ) guidelines ( 13 ) .
the antimicrobial disks used were kanamycin , teicoplanin , streptomycin , imipenem , ciprofloxacin , and ampicillin ( mast , uk ) .
the minimum inhibitory concentrations ( mics ) of the aminoglycosides gentamicin , kanamycin , streptomycin , and amikacin were measured by the microbroth dilution method , with antibiotic dilutions ranging from 16 to 8192 g / ml . in this study ,
pcr was employed to detect two ame genes : aac(6)-aph(2 ) and aph(3)-iiia , which have been reported to be considerably distributed among enterococci .
pcr reactions were performed in 15 l volumes with 1.5 mm of mgcl2 , 200 m of each dntp , 0.5 m of each primer , 1x pcr buffer , 1 u taq dna polymerase , and 100 ng of the enterococcal chromosomal dna . after heating at 95c for 5 min ,
amplification was performed over 30 cycles : 95c for 30 s , 30 s at the specific annealing temperature for each primer , and 72c for 30 second , followed by 72c for 5 minutes ( 15 ) .
pcr products were analyzed by electrophoresis at 90 v for 60 minutes on 1% agarose gel .
finally , the gel was stained with ethidium bromide , photographed , and analyzed with the gel documentation system ( bio - rad , singapore ) .
the sequence of the primers and the size of pcr products are shown in table 1 .
in this study , pcr was employed to detect two ame genes : aac(6)-aph(2 ) and aph(3)-iiia , which have been reported to be considerably distributed among enterococci .
pcr reactions were performed in 15 l volumes with 1.5 mm of mgcl2 , 200 m of each dntp , 0.5 m of each primer , 1x pcr buffer , 1 u taq dna polymerase , and 100 ng of the enterococcal chromosomal dna . after heating at 95c for 5 min ,
amplification was performed over 30 cycles : 95c for 30 s , 30 s at the specific annealing temperature for each primer , and 72c for 30 second , followed by 72c for 5 minutes ( 15 ) .
pcr products were analyzed by electrophoresis at 90 v for 60 minutes on 1% agarose gel .
finally , the gel was stained with ethidium bromide , photographed , and analyzed with the gel documentation system ( bio - rad , singapore ) .
the sequence of the primers and the size of pcr products are shown in table 1 .
among 138 isolates obtained from patients in different wards , 33 ( 24.1% ) were e. faecium and 63 ( 46% ) were e. faecalis .
enterococcus isolates were identified to the species level based on biochemical tests , and pcr was done in order to investigate hlgr genes .
the antibiotic susceptibility patterns of the isolates were determined by the disk diffusion method according to clsi guidelines .
the rates of enterococcal resistance to antibiotics were : ciprofloxacin 20 ( 20.8% ) , teicoplanin 7 ( 7.3% ) , imipenem 9 ( 9.4% ) , tobramycin 11 ( 11.4% ) , kanamycin 77 ( 80.2% ) , erythromycin 88 ( 91.7% ) , and ampicillin 82 ( 85.4% ) .
erythromycin and ampicillin showed the highest level of resistance , while the lowest level was related to teicoplanin . among the aminoglycosides , the highest level of mic50
the aac(6)-le - aph(2)la and aph(3)-llla genes were determined by pcr according to specific primers .
figure 1 and 2 show the gel electrophoresis results for these genes . based on the pcr method ,
the aac(6)-le - aph(2)la and aph(3)-llla genes were found in 64 ( 61.6% ) and 22 ( 19.6% ) of the isolates , respectively .
m , 100 bp marker ; 1 , negative control ; 2 , positive control ; 3 and 4 , positive samples for aac(6)-le - aph(2)la pcr .
m , 100 bp marker ; 1 , positive control ; 2 , negative control ; 3 , positive sample ; 4 , negative sample for aph(3)-llla pcr .
the antibiotic susceptibility patterns of the isolates were determined by the disk diffusion method according to clsi guidelines .
the rates of enterococcal resistance to antibiotics were : ciprofloxacin 20 ( 20.8% ) , teicoplanin 7 ( 7.3% ) , imipenem 9 ( 9.4% ) , tobramycin 11 ( 11.4% ) , kanamycin 77 ( 80.2% ) , erythromycin 88 ( 91.7% ) , and ampicillin 82 ( 85.4% ) .
erythromycin and ampicillin showed the highest level of resistance , while the lowest level was related to teicoplanin .
among the aminoglycosides , the highest level of mic50 was related to kanamycin and gentamicin . for mic90 , kanamycin , gentamicin , and
the aac(6)-le - aph(2)la and aph(3)-llla genes were determined by pcr according to specific primers .
figure 1 and 2 show the gel electrophoresis results for these genes . based on the pcr method ,
the aac(6)-le - aph(2)la and aph(3)-llla genes were found in 64 ( 61.6% ) and 22 ( 19.6% ) of the isolates , respectively .
m , 100 bp marker ; 1 , negative control ; 2 , positive control ; 3 and 4 , positive samples for aac(6)-le - aph(2)la pcr .
m , 100 bp marker ; 1 , positive control ; 2 , negative control ; 3 , positive sample ; 4 , negative sample for aph(3)-llla pcr .
in recent years , enterococci have become important causes of nosocomial infections throughout the world , and it has been proven that enterococcal strains are the main cause of 82% of urinary tract infections in iran ( 18 ) .
aminoglycosides are frequently used to treat enterococcal infections , which can lead to the spread of aminoglycoside - resistant isolates in iranian hospitals ( 19 ) .
the increasing number of enterococcal species resistant to antibiotics are currently a challenge with regard to treatment . in the present study , enterococcal isolates obtained from imam reza hospital , a referral hospital in kermanshah ,
were studied to determine the prevalence of e. faecalis and e. faecium among hospitalized patients .
the patterns of antimicrobial resistance of the isolates and two important hlgr genes , aac(6)-le - aph(2")-la and aph(3 ) , were also investigated . among the different species of enterococci that are currently recognized ,
e. faecalis is responsible for 85% - 95% of enterococcal infections , while 5% - 10% of infections are caused by e. faecium ( 20 ) . in a similar study in iran
, it has been reported that e. faecalis and e. faecium strains have the highest incidence , 80% - 85% and 15% - 20% , respectively ( 21 , 22 ) .
in contrast , european studies have reported that e. faecium was the most prevalent isolate , followed by e. hirae and e. faecalis ( 23 ) .
aleksandrowicz ( 24 ) showed that e. faecalis was the most frequent enterococcal species in all samples , more than 70% , followed by e. faecium ( 20.4% ) . in our study ,
enterococci have become increasingly resistant to a broad range of antimicrobial agents , particularly glycopeptides , - lactams , and aminoglycosides ( 25 ) . among the resistance mechanisms , hlar
is widely reported , while glycopeptide - resistant or -lactam - resistant enterococci are prevalent mostly in western countries ( 26 ) .
hlar leads to the loss of synergy between cell wall synthesis - inhibiting antibiotics , such as penicillins or glycopeptides , which allows aminoglycosides to penetrate through the impermeable bacterial cell wall ( 27 ) . in the present study ,
most isolates were sensitive to imipenem ( 91.9% ) , and the rates of resistance to erythromycin , ampicillin , and kanamycin were 63.2% , 58.8% , and 55.1% , respectively .
a turkish study by akhter et al . ( 28 ) showed that imipenem was considered to have the highest level of sensitivity . compared to our study , imanifooladi et al .
( 22 ) showed that most isolates of enterococci were resistant to erythromycin , tetracycline , and ciprofloxacin .
with regard to aminoglycoside resistance , 8.1% of isolates were resistant to tobramycin and 55.1% to kanamycin , while 89% of all isolates were hlgr . in comparison to our study ,
emaneini s survey in tehran showed 52% of isolates to be hlgr , and hasani s 2012 study in tbariz reported that 60.45% of isolates were hlgr with mics of 512 g / ml ( 29 , 30 ) .
our study showed that hlgr isolates are more popular in kermanshah . according to the literature
, hlgr is more common in iran , and it is predicted that gentamicin will have no place in the treatment of enterococcal infections . isolates that express high - level resistance to amikacin , gentamicin , kanamycin , and streptomycin were investigated for the presence of genes encoding the aac(6)-ie - aph ( 2)ia and aph(3)-iiia enzymes .
the hlar in enterococci is usually coded by the aac(6)-aph(2 ) gene encoding the aac(6)-aph(2 ) enzyme ( 31 ) .
the pcr results for the isolates demonstrated that 68.3% of e. faecalis and 36.4% of e. faecium isolates contain the aac(6)-aph(2 ) gene .
a similar study in japan showed the prevalence of this gene to be 40.1% among e. faecalis and 12.9% among e. faecium samples ( 32 ) . in denmark ,
32% of isolates were defined as e. faecalis , and all of them contained this gene ( 12 ) . according to our study , the prevalence of aph(3 ) was 23.8% and 21.2% for e. faecalis and e. faecium , respectively .
it can be concluded that the most prevalent gene leading to aminoglycoside resistance is aac(6)-aph(2 ) , and in the current study , the presence of this gene was more common than aph(3 ) in both e. faecalis and e. faecium .
the large differences among hospitals in both the use of antimicrobials and the prevalence of resistance indicate the potential for further improvement of antibiotic policies , and possibly for hospital infection - control in order to maintain low resistance levels ( 1 ) .
physicians are obliged to use antibiotics appropriately and to comply with infection - control policies in an effort to prevent further spread of these resistant organisms . | background : enterococci are important pathogens in nosocomial infections .
various types of antibiotics , such as aminoglycosides , are used for treatment of these infections .
enterococci can acquire resistant traits , which can lead to therapeutic problems with aminoglycosides.objectives:this study was designed to identify the prevalence of , and to compare , the aac(6)-aph(2 ) and aph(3)-iiia genes and their antimicrobial resistance patterns among enterococcus faecalis and e. faecium isolates from patients at imam reza hospital in kermanshah in 2011 - 2012.patients and methods : one hundred thirty - eight clinical specimens collected from different wards of imam reza hospital were identified to the species level by biochemical tests .
antimicrobial susceptibility tests against kanamycin , teicoplanin , streptomycin , imipenem , ciprofloxacin , and ampicillin were performed by the disk diffusion method .
the minimum inhibitory concentrations of gentamicin , streptomycin , kanamycin , and amikacin were evaluated with the microbroth dilution method .
the aminoglycoside resistance genes aac(6)-aph(2 ) and aph(3)-iiia were analyzed with multiplex pcr.results:the prevalence of isolates was 33 ( 24.1% ) for e. faecium and 63 ( 46% ) for e. faecalis .
eighty - nine percent of the isolates were high - level gentamicin resistant ( hlgr ) , and 32.8% of e. faecium isolates and 67.2% of e. faecalis isolates carried aac(6)-aph(2 ) .
the prevalence of aph(3)-iiia among the e. faecalis and e. faecium isolates was 22.7% and 77.3% , respectively.conclusions:remarkably increased incidence of aac(6)-aph(2 ) among hlgr isolates explains the relationship between this gene and the high level of resistance to aminoglycosides . as the resistant gene among enterococci can be transferred , the use of new - generation antibiotics is necessary . |
a decade ago , francis collins and victor mckusick predicted that by the year 2010 , it is expected that predictive genetic tests will be available for as many as a dozen common conditions , allowing individuals who wish to know this information to learn their individual susceptibilities and to take steps to reduce those risks for which interventions are or will be available ( collins and mckusick 2001 ) .
they predicted that with the increase of genetic information about common disorders , many primary care clinicians would become practitioners of genomic medicine , having to explain complex statistical risk information to healthy individuals who are seeking to enhance their chances of staying well .
however , with respect to common disorders and susceptibility testing , the anticipated increase of genomic science in the traditional healthcare system has not materialized .
in fact , it is private companies who are taking the lead and marketing susceptibility tests directly to consumers .
furthermore , according to some authors , commercial companies may even come to displace clinicians as the primary providers of genetic information related to health promotion
indeed , in the last 3 years , many companies have been advertising and selling genetic tests directly to consumers . in many cases ,
consumers have been able to purchase genetic testing services without any input from a health care professional .
this article reviews relevant issues surrounding the recent history of the direct - to - consumer ( dtc ) genetic testing ( gt ) phenomenon .
in particular , we consider the following subjects : ( 1 ) the elements that allowed for the creation of the dtc gt market ; ( 2 ) information regarding the size and potential success or failure of the dtc gt market ; ( 3 ) recent changes in the market ; and ( 4 ) recent events that could have an impact on the regulatory oversight of these services and the future development of the market .
direct - to - consumer genetic testing is not , strictly speaking , a new phenomenon ; by 2003 , williams - jones reported 12 for - profit companies advertizing on the internet for susceptibility testing , three of which were also offering the tests dtc ( williams - jones 2003 ) . given the lack of high - profile popularity of these services for the following 4 to 5 years , however , this review is focused on the commercial activities since 20072008 , which roughly marks a period during which a large number of companies entered the dtc genetic testing market . presently , according to an overview by the genetics and public policy center
, approximately 30 companies are currently offering genetic testing services directly to consumers ( genetics and public policy center 2009 ) .
the types of tests being offered are extremely varied and include traditional monogenic testing as well as tests that offer information regarding health enhancement ( nutrigenomics , dermatogenetics ) , drug response ( pharmacogenomics ) , and susceptibility for common complex disorders ( cardiovascular diseases , depression , osteoporosis , type 2 diabetes ) .
furthermore , some companies are offering genetic profiles or genome scans which involve testing hundreds of thousands of single nucleotide polymorphisms . based on these results , consumers
are then given their personal risks of developing various disorders compared to the average risk in a population . in order to understand how the phenomenon of dtc genetic testing may evolve in the future , it is important to better understand how this field came into being . as hedgecoe and martin ( 2003 )
describe it , understanding the formation , mobilization , and shape of the created vision is central to the analysis of an emerging biotechnology .
the articulation of a vision constitutes a particular class of expectations that legitimizes a new technology , helps to mobilize funds , allows decision - making , and reduces the uncertainty inherent in technological developments ( hedgecoe and martin 2003 ) .
the progress in genetic sequencing and genotyping technologies has changed dna analysis from an intensive , burdensome , and expensive process to a relatively cheap and easy one .
elaborating on the results of genomewide association studies , there is a drive to develop valid disease risk predictions and consequently offer tailor - made disease management and treatment .
based on this scientific progress and the relatively small presence of genetics in the primary healthcare setting , private companies moved ahead and made it possible for consumers to order genetic testing directly via the internet .
the principle notions used in the marketing of dtc genetic tests are autonomy , empowerment , prevention , convenience , and privacy .
one of the main aspects outlined in the vision of these companies is that individuals want to play a greater role in the process of obtaining , storing and protecting their genetic information .
they promote the notion that avoiding the traditional encounter with a healthcare professional will result in a better guarantee of privacy , at least with respect to insurance companies and employers .
moreover , dtc genetic tests allow consumers to collect their own saliva samples ( from which dna is then extracted ) from the comfort of their own home . for some tests
, the companies argue that it eliminates the hassle of scheduling an appointment with a physician and it eliminates an appointment fee that would otherwise be billed in addition to the laboratory fee ( berg and fryer - edwards 2008 ) .
companies also allege that this model will allow for the increased access of genetic technologies for all consumers .
furthermore , companies advance that this provides the foundation for truly personalized medicine in which individuals are empowered not only with self - knowledge of their genetic risk , but also with the ability to take informed actions to prevent disease and preserve health
no one is going to invest in a start - up company , or a large - scale scientific endeavor , such as the human genome project , unless they genuinely believe it has the potential to yield significant returns in a defined timescale ( nightingale and martin 2004 ) .
the emergence of this field has rested heavily on the creation of high expectations in order to get access to researchers , venture capital , and customers .
now that companies are operating , it is a question of convincing the public that they need to buy these tests . among many others
, the following aspects will be important determinants of consumer acceptance : the price , their belief , and understanding of marketing messages and whether this commercial product responds to their expectations and needs .
presently , little is known about the actual number of genetic tests sold by dtc genetic testing companies .
a few studies have shown that only a relatively small percentage of the us population is aware of the availability of direct - to - consumer genetic tests and only a fraction of these have purchased such tests ( goddard et al .
, the authors attempted to estimate the size of the dtc whole genome scan market using the internet traffic on three companies websites as a proxy for their commercial activity ( wright and gregory - jones 2010 ) . despite the limited scope of interpretation and generalization allowed by this method ,
their conclusion that the demand for whole genome scans is fairly small is congruent with the previously mentioned studies .
that being said , they still estimated the market for the three most prominent genome profiling companies ( 23andme , decode and navigenics ) to be around us $ 1020 million in 2009 .
this implies that these companies certainly know how to attract certain consumers ; however , in order to be a sustainable business , they need be able to do more than simply attract a bunch of enthusiastic early adopters of new technologies . the announcement in november 2009 by the biotech company decode genetics , ( which markets the dtc genetic service called decodeme ) that it had filed a voluntary petition for relief under chapter 11 of the usa bankruptcy code raised the question whether other companies offering dtc genomics services would also follow suit ( hayden 2009 ) .
an analysis of dtc genetic testing companies activities in this field shows that various genetic tests that were marketed are no longer available for purchase from certain companies .
for example , the following tests ( from certain companies ) are no longer available for purchase : tests that predicted aids progression based on an analysis of ccr5-delta 32 and ccr2 - 64i genes ( www.hivgene.com , www.hivmirror.com ) ; nutrigenomic tests ( www.mycellf.com , www.genecare.co.za , www.integrativegenomics.com ) ; risk assessment tests of various common disorders such as cardiovascular disease , osteoporosis , immune system defects , alzheimer disease ( www.genovations.com , www.smartgenetics.com , www.qtrait.com ) ; tests for addiction ( www.docblum.com ) ; pharmacogenomic tests ( www.signaturegenetics.com ) ; carrier testing for disorders such as cystic fibrosis ( www.udlgenetics.com ) . meanwhile , additional companies retracted their product from the market temporarily for unknown reasons ( www.genotrim.com , www.psynomics.com ) , and it is unclear whether they will be available again . other initiatives , such as the free comprehensive genetic test ( www.geneview.com ) , also disappeared . since these companies have , for the most part , left the market in silence , it is difficult to understand exactly their reasons for doing so .
one may suggest that the consequences of the global financial crisis ( initiated in 20072008 ) may have contributed to the downfall of some of these companies ( i.e. , failure to find enough paying customers ) .
that being said , it seems that various companies also struggled with intellectual property protection ( bandelt et al .
2008 ; knowledge 2009 ) and the legal requirement that a physician should be involved in the ordering of genetic tests ( wadman 2008 ) ( which is the case in some states in the usa such as connecticut and michigan ; the genetics and public policy center 2010 ) .
furthermore , companies testing only a few mutations ( with each mutation corresponding to one trait ) may have had difficulties competing with companies like 23andme , which offer full genome scans ( hayden 2008 ) .
other companies deliberately chose to focus on ancestry testing and have avoided making statements about health risks ( altman 2009 ) .
such companies offering dna tests for genealogical information now exist in abundance ( bandelt et al .
as with any new market , commercial success for dtc gt companies will depend greatly on the public demand for these services .
this consumer demand , in turn , will depend on many factors , including consumers desire or need to obtain genetic testing services outside of the traditional health care system . with this in mind
, the dtc model of genetic testing may have underestimated the consumer s attachment to their physician .
a report by the investment bank burril & company ( san francisco ) revealed that physicians remain the most likely source to which individuals will turn for health and genetic information .
( burril & company / change wave research 2008 ) a few studies also showed that two thirds of consumers who ordered genetic tests directly to consumer shared their test results with their healthcare professional or were planning to do so ( kolor et al .
in general , the dtc model creates concerns for potential consumers regarding credibility of tests , security of dna use , privacy of genetic risk information , and lack of confidence in non face - to - face genetic counseling ( wilde et al .
2010 ; people science and policy ltd 2002 ) . with this in mind , it is not surprising that various companies have opted for dtc advertising instead of dtc sales of their services . they have combined the dtc advertising along with the involvement of regular healthcare professionals who then order the test for their patients . depending on the test , some companies require an order from a physician ( e.g. , www.hairdx.com ) or an oncologist ( e.g. , www.collabrx.com ) .
the company counsyl , ( www.counsyl.com ) which offers pre - conceptional carrier testing , changed its policy since its launch in february 2010 . at the time
, counsyl underlined the possibility of ordering the test directly from the company : you can order the test directly from our website to receive your kit immediately .
everyone has a prescription : the american college of medical genetics ( acmg ) recommends that adults of reproductive age be offered carrier testing for cystic fibrosis and spinal muscular atrophy , two of the many conditions assayed by the universal genetic test .
( https://www.counsyl.com/learn/easy/ accessed 04/05/2010 ) since may 2010 , however , testing from counsyl can only be requested through a physician ; therefore , consumers first need to find a physician that offers the test .
the company also sends the results directly to the physician for interpretation , thereby , technically no longer selling tests directly to consumers ( https://www.counsyl.com/learn/easy/ accessed 06/06/2010 ) . the offer through physicians
may eliminate some of the concerns that arose about information provision but does not remove the issue of the appropriateness of the test provided . in this context
it becomes important whether physicians will take a role of gatekeeper for tests that may prove to be inappropriate .
furthermore , one must question whether physicians are appropriately educated to take on this role , and we must guard against physicians simply becoming tools for commercial genetic testing companies to look more legitimate and sell more tests . moreover
, it is no surprise that some companies have tried to get financial support from the healthcare system ( brdicka and macek 2009 ) or insurance companies , and are attempting to gain the support of physicians working within the health care system .
dtc gt companies are also developing tools to store genomic information in electronic health files as well as to enable physicians to access the genomic information of their consenting patients ( vanier 2009 ) .
moreover , companies are also trying to establish collaborations with healthcare institutions and academic researchers .
ironically , the highly hyped dtc offer of genetic testing could vanish in this way , as it may merge into the regular healthcare system ( while still , marketing tests directly to consumers and to physicians ) .
next to the volume of sales , the future of the dtc market will be highly influenced by regulations meant to govern the sales and marketing of dtc genetic testing services .
discussions about this phenomenon regularly reveal the deficiencies in the current regulatory frameworks ( kaye 2008 ) .
as many companies operate from the usa , it will be crucial to see how this country will develop regulatory oversight in the future . after the partnership announcement between pathway genomics and the drugstore chain walgreens to sell dtc genetic tests , the us food and drug administration ( fda ) decided to investigate the activities of dtc companies more carefully ( allison 2010 ; genetics and public policy center 2010 ) . between may and july 2010
, the fda sent letters to various companies telling them that they were unable to identify any food and drug administration clearance or approval number
( food and drug administration 2010b ) . moreover , in mid - july 2010 , the fda held a meeting to discuss the oversight of laboratory developed tests ( ldts ) ( food and drug administration 2010a ) .
the issue of ( lack of ) oversight of ldts or home brews is closely related to that of dtc gt since many of the tests offered by dtc gt companies could be considered ldts . until now
, the fda did not require that most ldts be reviewed for clinical validity ( the exception being those genetic tests that produce a result for the purpose of diagnosing , treating , or preventing disease
( e.g. , breast cancer and prostate cancer ) ) ( genetics and public policy center 2010 ) . immediately after this fda meeting
, the committee on energy and commerce held a public hearing on july 22 2010 ( committe on energy and commerce 2010 ) , during which the report direct - to - consumer genetic tests .
misleading test results are further complicated by deceptive marketing and other questionable practices by the us government accountability office was presented ( united states government accountability office 2010 ) . although no concrete regulatory changes have taken place since these events , it has to be expected that regulatory oversight will increase in the near future . in europe ,
the human genetics commission of the uk presented in august its framework of principles on dtc genetic testing ( human genetics commission 2010 ) .
these principles were developed by a working group including representatives from the dtc genetic testing industry , clinical , and molecular geneticists , genetic counselors , experts in regulation , and those with experience in offering support to individuals with genetic conditions .
the principles are mainly aimed at self - regulation of the dtc genetic testing market by promoting standards in the provision of genetic tests amongst commercial providers at an international level .
the principles have been designed with the will to protect the interests of consumers and to allow the industry to grow .
however , the principles have been criticized for being weak and meaningless by genewatch uk ( genewatch 2010 ) and an editorial in the lancet calls the guidelines insufficient and questions their practical value ( the lancet 2010 ) .
furthermore , the professional and public policy committee of the european society of human genetics had criticized the consultation document for focusing too much on the requirements the test providers should fulfill while paying too little attention to the quality of the genetic tests that are being sold and remained concerned about the quality of the tests provided and believed that the clinical validity ( and not only the analytical validity ) of genetic tests should be proven before one can even begin to consider selling such tests directly to consumers
( professional and public policy committee of the european society of human genetics 2009 ) . with this in mind , the european society of human genetics endorsed in june 2010 a statement in which it recommended to ensure , among other issues , the quality of the testing services , the provision of pretest information and genetic counseling , a face to face consultation , and oversight of this industry .
( european society of human genetics 2010 ) as may be the case in the usa , stronger regulatory oversight may be forthcoming in europe considering that the european commission is in a process of revising the directive 98/79/ec of the european parliament and of the council of 27 october 1998 on in vitro diagnostic medical devices .
a specific question addressed is the need to create additional requirements or restrictions for direct - to - consumer genetic tests in order to ensure a better health protection
further implementation of the additional protocol concerning genetic testing for health purposes to the convention on human rights and biomedicine may lead to the legal obligation to ensure scientific validity and clinical utility of the tests offered as well as the need for individualized and face - to - face medical supervision ( borry 2008 ) .
moreover , some individual european countries , such as germany , switzerland , and france have legislations that prohibit direct - to - consumer genetic testing .
as it stands now , the many companies that have left the direct - to - consumer genetic testing market are an indication that hyped products and unrealistic expectations may not create the expected return on investment . further regulatory oversight may well make it impossible for dtc genetic testing companies to operate using the same business model in the future .
although regulation may restrict or ban dtc genetic testing hereafter , these actions will not necessarily address important underlying issues within the dtc gt phenomenon , namely the questions of how and when to translate genomic discoveries into healthcare .
furthermore , important ethical and social issues regarding dtc gt including , among others , concerns regarding privacy , confidentiality , the use of consumers samples in research activities , the testing of minors , and the potential overconsumption of limited healthcare resources ( borry et al .
2009 , 2010 ; howard and borry 2008 ; howard et al . 2010 ) must also be addressed .
the fact that some dtc gt companies stopped their online delivery of genetic tests and yet continued the dtc marketing and are now working through healthcare professionals strengthens the debate on the integration of genomics knowledge into healthcare .
the healthcare system will have to be prepared for the implementation of useful testing as well as to resist collaboration with commercial companies that offer tests without clinical utility .
initiatives such as the evaluation of genomic applications in practice and prevention , gene dossiers ( uk national health system ) , and gene cards ( eurogentest ) which synthesizes available data on the clinical validity and utility of specific genetic tests will be crucial in this regard . | in recent years , various private companies have been marketing and offering genetic tests directly to consumers .
this article reviews the recent history of this commercial phenomenon . in particular ,
we discuss and describe the following subjects : ( 1 ) the factors that allowed for the creation of the direct - to - consumer ( dtc ) genetic testing ( gt ) market ; ( 2 ) information regarding the size and potential success or failure of the dtc gt market ; ( 3 ) recent changes in the dtc gt market ; and ( 4 ) the recent events that may have an impact on the regulatory oversight of dtc genetic testing and the future evolution of this market .
this review of factors suggests that despite the possibility of a change of business model as well as increased regulation , the commercialization of genetic testing is here to stay . as such it is important to pay close attention not only to the science underlying these tests but also to the ethical , legal , and social issues
. |
graphene thin film was obtained by mechanically peeling of natural graphite onto silicon substrate with 300-nm thermal oxide .
a 10-nm siox thin film was evaporated onto graphene using e - beam evaporator operated at 10 torr .
this fresh oxide surface was functionalized with p(s - r - mma ) random copolymer ( polymer source , mn : 11000 , mw / mn : 1.15 , styrene 55 mol% , functionalized -hydroxyl and -tempo moiety ) by spin coating a thin film from 1 wt% toluene solution .
this film was annealed at 170 c for 72 hours to anchor the polymer onto oxide surface through end hydroxyl group , and then rinsed with toluene to remove unanchored polymer .
p(s - b - mma ) with molecular weight of 77000 g mol ( ps - pmma : 55000 - 22000 , mw / mn : 1.09 ) and 47700 g mol ( ps - pmma : 35500 - 12200 , mw / mn : 1.04 ) were purchased from polymer source and dissolved in toluene .
the block copolymer thin film was prepared on the neutralized surface by spin coating 1 wt% filtered polymer solution at 2500 rpm followed by annealing at 180 c for 12 hours .
the degraded pmma domains were removed by immersing in glacial acid for 20 min followed by extensive water rinsing .
we used reactive ion etcher ( sts mesc multiplex advanced oxide etcher ) to etch down to graphene layer .
firstly , an o2 plasma process ( 50 w , 4 mtorr ) was used to remove exposed random copolymer . controlled over etching here
then , chf3 plasma ( 50 w , 6 mtorr ) was employed to punch holes into evaporated siox to expose underlying graphene layer .
additional o2 plasma was used to completely etch away exposed region of graphene or to further undercut the graphene nanomesh .
tem samples were prepared by spin coating 300 nm thick of pmma polymer resist onto the graphene mesh substrate and baked at 100 c .
the pmma - graphene mesh film was then lifted off in hf solution and transferred onto the lacey film coated copper grid .
after pmma was removed by acetone vapour , the sample was characterized by jeol 1200 operated at 80kv . tapping mode afm
graphene thin film was obtained by mechanically peeling of natural graphite onto silicon substrate with 300-nm thermal oxide .
a 10-nm siox thin film was evaporated onto graphene using e - beam evaporator operated at 10 torr .
this fresh oxide surface was functionalized with p(s - r - mma ) random copolymer ( polymer source , mn : 11000 , mw / mn : 1.15 , styrene 55 mol% , functionalized -hydroxyl and -tempo moiety ) by spin coating a thin film from 1 wt% toluene solution .
this film was annealed at 170 c for 72 hours to anchor the polymer onto oxide surface through end hydroxyl group , and then rinsed with toluene to remove unanchored polymer .
p(s - b - mma ) with molecular weight of 77000 g mol ( ps - pmma : 55000 - 22000 , mw / mn : 1.09 ) and 47700 g mol ( ps - pmma : 35500 - 12200 , mw / mn : 1.04 ) were purchased from polymer source and dissolved in toluene .
the block copolymer thin film was prepared on the neutralized surface by spin coating 1 wt% filtered polymer solution at 2500 rpm followed by annealing at 180 c for 12 hours .
the degraded pmma domains were removed by immersing in glacial acid for 20 min followed by extensive water rinsing .
we used reactive ion etcher ( sts mesc multiplex advanced oxide etcher ) to etch down to graphene layer .
firstly , an o2 plasma process ( 50 w , 4 mtorr ) was used to remove exposed random copolymer . controlled over etching here
then , chf3 plasma ( 50 w , 6 mtorr ) was employed to punch holes into evaporated siox to expose underlying graphene layer .
additional o2 plasma was used to completely etch away exposed region of graphene or to further undercut the graphene nanomesh .
tem samples were prepared by spin coating 300 nm thick of pmma polymer resist onto the graphene mesh substrate and baked at 100 c .
the pmma - graphene mesh film was then lifted off in hf solution and transferred onto the lacey film coated copper grid .
after pmma was removed by acetone vapour , the sample was characterized by jeol 1200 operated at 80kv . tapping mode afm
| graphene has significant potential for application in electronics1 - 5 , but can not be used for effective field - effect transistors operating at room temperature because it is a semimetal with a zero bandgap6,7 .
processing graphene sheets into nanoribbons with widths of less than 10 nm can open up a bandgap that is large enough for room temperature transistor operation8 - 19 , but nanoribbon devices often have low driving currents or transconductances18,19 .
moreover , practical devices and circuits will require the production of dense arrays of ordered nanoribbons , which is of significant challenge20,21 .
here we report the production of a new graphene nanostructure - which we call graphene nanomesh - that can open up a band gap in a large sheet of graphene to create a semiconducting thin film .
the nanomeshes are prepared with block copolymer lithography and can have variable periodicities and neck widths down to 5 nm .
graphene nanomesh field - effect transistors can support currents nearly 100 times greater than individual graphene nanoribbon devices , and the on - off ratio - which is comparable with the values achieved in individual nanoribbon devices - can be tuned by varying the neck width .
the block copolymer lithography approach used to make the nanomesh devices is intrinsically scalable and could allow for the rational design and fabrication of graphene - based devices and circuits with standard semiconductor processing . |
recent studies have shown that only quinones with a 2-methoxy group
can act simultaneously as the primary ( qa ) and secondary
( qb ) electron acceptors in photosynthetic reaction centers
from purple bacteria such as rb .
sphaeroides .
13c hyscore measurements of the 2-methoxy group in the semiquinone
states , sqa and sqb , were compared with dft
calculations of the 13c hyperfine couplings as a function
of the 2-methoxy dihedral angle .
x - ray structure comparisons support
2-methoxy dihedral angle assignments corresponding to a redox potential
gap ( em ) between qa and
qb of 175193 mv . a model having a methyl group
substituted for the 2-methoxy group exhibits no electron affinity
difference .
this is consistent with the failure of a 2-methyl ubiquinone
analogue to function as qb in mutant reaction centers with
a em of 160195
mv .
the conclusion reached is that the 2-methoxy group is the principal
determinant of electron transfer from qa to qb in type ii photosynthetic reaction centers with ubiquinone serving
as both acceptor quinones . |
|
tuberculosis is a major global public health problem affecting millions of new cases each year .
a significant proportion the new cases , especially in low - prevalence settings such as seen in affluent countries result from the reactivation of latent tuberculosis infection ( ltbi ) .
individuals with ltbi are typically asymptomatic , have normal chest radiograph , but have a positive purified protein derivative ( ppd ) skin test . a variety of treatment regimens have been evaluated for the management of ltbi , with the aim of reducing the likelihood of subsequent reactivation of tuberculosis .
isoniazid ( inh ) is currently considered the most appropriate therapy in children with ltbi.1 although inh related hepatotoxicity is well recognized , the burden of severe liver dysfunction requiring liver transplantation due to this therapy in children remains obscure given the lack of studies in this population .
moreover , development of liver failure can occur even with the discontinuation of inh at the onset of symptoms of liver dysfunction.2 therefore , documentation of such cases is a vital step to enhancing our comprehension of how to manage a given patient with liver failure due to inh therapy .
similarly , careful analysis of theses cases may have a significant impact on the evolution of certain aspects of guidelines for ltbi management in children .
herein , we report a five year - old girl who developed progressive hepatic failure associated with inh prophylaxis for ltbi .
liver histology was consistent with drug - induced injury and the patient favorably responded to supportive care and corticosteroid therapy .
this case highlights the potential severity of inh related hepatic injury and underscores the significance of vigilant clinical monitoring throughout the duration of the therapy in children .
a previously healthy five year - old hispanic female presented with a three week history of progressive anorexia and jaundice . at the time of presentation , she had only three days left to complete a nine - month course of isoniazid ( inh ) monotherapy for a positive ppd skin test and a normal chest radiograph performed at the local health department .
she was born in the united states but spent several months with her family in mexico one year before ppd testing .
the patient received oral inh and vitamin b6 ( 25 mg ) twice weekly by directly observed therapy .
she reported to clinic each month for follow - up , and her initial oral 350 mg inh dose was increased to 400 mg twice weekly six months after initiation of therapy to adjust for weight . apart from echinacea and multi - vitamins , no over the counter medications were given during the prescribed inh therapy .
a few days prior to hospitalization , comprehensive metabolic panel at a local clinic revealed an aspartate aminotransferase ( ast ) of 2929 u / l , alanine transaminase ( alt ) of 1941 u / l ( normal < 45 for both ) , and total bilirubin of 20.5 mg / dl ( normal < 0.8 mg / dl ) . at the time of hospitalization , the patient had marked conjuntival icterus and dermal jaundice but she was afebrile and had no acute distress .
physical findings were otherwise normal except for a mildly distended , non - tender abdomen and hepatomegaly with a liver edge palpable four centimeters below the right costal margin at the mid- clavicular line on inspiration .
the spleen was not enlarged and there were no cutaneous stigmata of chronic liver disease .
neurologically , the patient had normal mental status , strength , tone , and deep tendon reflexes .
initial laboratory analysis showed albumin 3.6 mg / dl ( 4.05.3 g / dl ) , alkaline phosphatase 399 u / l ( 130560 u / l ) , ast 3485 u / l ( normal 545 u / l ) , alt 2327 ( normal 545)u / l , ggt 48 u / l ( normal 524 u / l ) , ammonia 45 mol / l ( normal 1768 mol / l ) , pt 26.1 seconds ( normal 10.112 seconds ) , and ptt 47.7 seconds ( normal 2636 seconds ) . hepatitis a , b and c virus , cytomegalovirus and human immunodeficiency virus serology , alpha-1 antitrypsin and ceruloplasmin concentrations , antinuclear , smooth - muscle and liver - kidney - microsomal antibodies and chest radiograph yielded negative - normal results . results of epstein - barr virus serology were consistent with past infection .
she developed progressive pruritis despite ursodeoxycholic acid therapy [ total bilirubin 24.6 mg / dl , direct bilirubin 15.6 mg / dl ( 0 to 0.4 mg / dl ) ] and remained mildly coagulopathic ( pt 16.1 seconds ) despite daily intravenous vitamin k. attempted transjugular liver biopsy was unsuccessful and she was transferred for formal liver transplant evaluation .
histological examination of liver tissue obtained by laparoscopy showed lymphoplasmacytic infiltration in portal , interface and lobular areas , with hepatic architectural collapse , fibrosis and severe cholestasis .
these histological abnormalities were consistent with drug induced injury and systemic corticosteroids were therefore started . within a few days , her overall condition including coagulopathy and liver tests improved and she was discharged home .
six months after discontinuing corticosteroids , the patient was clinically well and without residual liver dysfunction ( fig .
centers for disease control and prevention ( cdc ) recommends that children with ltbi should be treated with inh prophylaxis for 9 months as a daily self - administered therapy at a dose of 1020 mg / kg ( maximum dose 300 mg ) or twice weekly directly observed therapy at a dose of 2040 mg / kg ( maximum dose 900 mg ) .
these recommendations are accessible through cdc web page,3 which aim to not only cure the individual patient , but also minimize the transmission of mycobacterium tuberculosis to healthy populations . indeed due to the public health perspective , cdc takes a vigorous stand for the successful completion of inh therapy .
whereas this therapy is generally well tolerated with excellent results , the development of significant liver dysfunction is well known in pediatric patients.2,48 we report this case to : a ) underscore the significance of optimal clinical monitoring , and a timely cessation of therapy in the event of significant hepatoctoxicity ; and b ) to review the literature on severe liver dysfunction due to inh prophylaxis to ascertain if a common theme can be formulated for the identification and management of such cases .
consistent with previously reported pediatric cases of inh - induced hepatotoxicity , the reasons for the severity of liver damage in our patient are unclear .
history , clinical examination and laboratory evaluation provided no evidence of prior chronic liver disease and excluded other potential causes for liver disease .
whether or not echinacea contributed to the hepatic insult in our patient is not known .
being a non - regulated dietary supplement , there is inadequate published data about the significance of echinacea in liver injury . similarly ,
younger age of our patient is also an unlikely contributor , because , inh - related liver dysfunction has been most often sited in adult population , although this may be at least partly due to a reporting bias .
similarly , continued use of inh for three weeks after the onset of progressive anorexia and jaundice prior to her presentation at the local health department may have significantly contributed to the liver injury .
although liver injury was noted to follow a chronic disease model ( evident from liver biopsy ) , one can postulate that discontinuation of therapy three weeks earlier in her treatment might have averted progression to hepatic failure . indeed similar reports of inh administration beyond the onset of hepatitis symptoms have been documented in children as the most likely reason for severe liver injury.7,9 this underscores the importance of appropriate training of the workers for direct observational therapy and educating the family about what to look for and what to do if symptoms of hepatotoxicity develop .
in addition to allied health care workers and physicians prescribing inh for ltbi should , apart from clinical monitoring , ensure that parental education is reinforced at each monthly visit.10 by the same token , in the case of non - english speaking families ( such as the case presented here ) , the caregivers should be provided a summary of possible adverse effects , written in their native language along with specific instructions to follow in the event toxicity occurs . because severe hepatotoxicity and death have been documented with continued inh therapy after the onset hepatitis,9 the emphasis of the education should be on cessation of this drug at the very onset of symptoms of liver disease .
similar to our case , at least thirteen children have been reported to undergo evaluation for orthotopic liver transplantation ( olt ) due to inh - related hepatotoxicity indicating severe liver injury due to this therapy.2,48 for example , wu et al , through a survey of liver transplantation centers described 10 patients who required olt due with inh - associated hepatic failure .
in addition , this study reported that six children died as a result of inh hepatotoxicity without receiving a transplant.2 similar reports of significant morbidity and mortality due to inh associated liver injury have been made by others.1113 apart from the monitoring issues discussed above , collectively , these reports raise the question of whether there any clinical or biochemical determinants of severe liver dysfunction , and if so , how to utilize these determinants to avoid significant morbidity and mortality for a given patient .
unfortunately , the pathogenesis of inh - related liver injury remains elusive , precluding the development of inh - hepatotoxicity - prediction models .
therefore , a priori forecasting about who will be at risk to develop severe inh - relate liver injury remains insuperable at the moment .
however , inh - related hepatotoxicity is believed to be mediated by mono - acetyl hydrazine , a metabolite of inh which is activated by cytochrome p-450 ( cyp ) enzyme system , and detoxified by n - acetyltransferase-2.14 the activity of both of these enzymes is well known to be influenced by genetic variability .
for example , a constellation comprised of slow acetylator status coupled with cyp 2e1 genetic polymorphism is known to be a risk for inh related hepatotoxici.15 similarly , concomitant administration of rifampicin , a cyp-450 inducer , can significantly increase the risk of liver injury due to inh.16,17 although these insights are important for understanding the basis of liver injury , due to substantial costs , routine assessment of cyp 2e1 polymorphism or n - acetyltransferase-2 activity is not feasible .
therefore , to prevent acute or sub - acute liver failure due to inh , the emphasis remains on early detection of inh related hepatitis and avoiding concurrent administration of other hepatotoxic drugs such as rifampicin . in summary , inh therapy for ltbi prophylaxis in children has been the standard of care for many years .
given the burden of active tuberculosis and a well accepted therapeutic appeal of inh for ltbi , any drastic amendments to decrease the duration of therapy are unlikely .
however , due to poorly understood mechanisms , some patients may develop significant liver injury requiring care at a center with resources to perform liver transplantation .
early recognition and cessation of inh therapy is necessary to prevent the progression of subclinical liver injury to liver failure .
this report illustrates the significance of appropriate education of the health care workers and the family and vigilant clinical monitoring throughout the duration of the therapy . | isoniazid ( inh ) monotherapy has gained widespread acceptance as an efficacious therapy for latent tuberculosis infection ( ltbi ) especially in low - prevalence settings .
although inh related hepatotoxicity is well recognized , progression to severe liver dysfunction requiring care at a transplant center remains unpredictable .
we report the management of a five year - old girl who developed progressive liver failure due to inh prophylaxis .
this highlights the potential severity of inh related hepatic injury and underscores the significance of vigilant clinical monitoring throughout the duration of the therapy in children . |
gastrointestinal ( gi ) endoscopy is the most fundamental and prerequisite clinical examination in order to diagnose and treat various diseases that occur in the gi tract . after electronic endoscopes and fiber optic endoscopy
were developed in 1983 , the endoscopic sector advanced rapidly , resulting in video endoscopes , with built - in coupled charged device ( ccd ) being developed and subsequently introduced into the clinic in 1987.1 this completed the development of the endoscopic system most commonly used by gastroenterologists today . with further advancement of imaging technology , the system was recently converted to high definition images with enhanced resolution.2 since image quality is the most important factor in observing suspicious lesions with a gastroscope or colonoscope , we have performed a survey to analyse diverse globally available endoscope systems from olympus ( tokyo , japan ) , pentax ( tokyo , japan ) , fujinon ( fujifilm , tokyo , japan ) , and , recently , karl storz ( tuttlingen , germany ) , with a focus on comparing image quality . since a survey comparing image quality between products and determine the differences has not , to date , been performed , a prospective study to compare the image quality from various endoscopes might be prerequisite .
in video endoscopes , the ccd is mounted on the tip of the endoscope and serves as the image - sensing device , in which color separation is achieved through use of a red - green - blue ( rgb ) filter housed within the light source unit .
the rgb filter consists of three band filters and covers all wavelengths of the visible spectrum , ranging from approximately 400 to 800 nm.3 in this rgb - based endoscopy system , narrow band imaging ( nbi ) is an endoscopic technique that may enhance the accuracy of diagnosis using narrow - bandwidth filters in an rgb system.4 the basic principle of nbi is that the depth of penetration of light into the mucosa depends on the wavelength of that light ; deep penetration is achieved with red light , intermediate penetration with green light and only superficial penetration with blue light.5 because gi cancers originate in the mucosa , the use of blue , light of a short - wave - length , which can penetrate only into the mucosa , may be useful for early detection of gi cancer . since black and white images have a low resolution , the light absorbed by the ccd is composited into rgb to generate color images.6 i - scan technology is the newly - developed image - enhanced endoscopic technology from pentax .
it consists of three types of algorithms : surface enhancement ( se ) , contrast enhancement ( ce ) , and tone enhancement ( te ) .
se improves light / dark contrast and allows for detailed observation of the mucosal surface structure .
ce adds blue color in relatively dark areas and allows one to distinguish subtle irregularities around the mucosal surface . with te , the rgb components of an ordinary endoscopic image are disintegrated into each component , followed by a re - synthesis to yield a reconstructed image . in the olympus system , nbi is an optical - filter technology that uses two narrow - band filters to provide tissue illumination in the blue and green light spectra.7 color management technology has progressed a great deal , yet there remains a limitation in terms of color reproducibility when employing rgb three primary color systems . in addition , the rgb values obtained in conventional systems often have different meanings , depending on the device characteristics or color processing .
for example , many conventional color imaging systems are designed for user preference ; thus , the rgb values do not represent objective color information . as a result
, the rgb signal does not display one - to - one correspondence to the tri - stimulus values perceived by human vision.8 optimal band imaging ( obi ) , the generic term for flexible spectral imaging color enhancement , enhances the visualization of mucosal structure and microcirculation by the selection of spectral transmittance of a dedicated wavelength .
in contrast to rgb , in which the bandwidth of the spectral transmittance is narrowed by optical filters , the obi system is based on a new computed spectral - estimation technique . in obi ,
the endoscopist can select 60 spectral images per 5 nm at visible wavelengths between 400 and 695 nm.910 image 1 storz professional image enhancement software ( spies ) is the newly developed color spectrum shifting technology from karl storz .
the bright red portions of the visible spectrum are filtered out and the remaining color portions are expanded , making it easier to differentiate between tissue types .
the light / dark contrast is enhanced by obtaining luminance intensity data for each pixel and applying an algorithm that allows for the detailed observation of mucosal surface structures .
spies clara , on the other hand , supports proper illumination in each part of the endoscopic image , allowing for a clear display of details in both the light and dark areas of the image .
finally , spies chroma intensifies the color contrast in the image ; thus , clearly visible structure surfaces are given added emphasis while retaining the natural color perception of the image .
preferences for image quality of products from the four leading companies were surveyed at 4th september 2014 . for this survey , karl storz ( model , image 1 spies ; scope , silver scope 13825nks ) , fujinon ( model , epx-4450hd ; scope , 590wr ) ,
olympus ( model , clv-290sl ; scope , gif - h290 ) , and pentax ( model , epk i7000 ; scope , eeg29-i10 ) endoscopes , with the highest image resolution among the products from each of the four companies on the market today , were selected and compared objectively .
preferences were divided into four elements that determine image quality , including elements of definition , boundaries , brightness , and ' light and shade . ' a video indicating the butterfly pattern ( in vitro ) ( fig . 1 ) and actual early gastric cancer ii a lesions ( in vivo ) ( fig .
2 ) on the endoscopic screen was shown to study participants and they were required to respond to the survey . in particular , unique spectral images from each endoscope were compared for boundaries .
comparisons were also performed with images generated using functions unique to the karl storz system , since its products were equipped with unique functions for brightness and ' light and shade . '
the 209 respondents that participated in the current survey for image quality analysis were made up of 26 nurses , 32 medical students , and 151 gi endoscopy specialists .
based on the outcome of the survey , the selection rate of each element was calculated and analysis was conducted to determine whether there was agreement in the selections for definition , boundaries , brightness , and ' light and shade . ' the agreement , in terms of these selections , between the butterfly pattern and gastric lesions was also analyzed for each of the four elements ( kappa value , k value ) .
all statistical analyses were performed using spss version 19 ( ibm co. , armonk , ny , usa ) . in terms of the results of the survey , a total of 209 people participated in the survey and
for the purposes of the survey , ( a ) , ( b ) , ( c ) , and ( d ) shall represent karl storz , fujinon , pentax , and olympus , respectively . in the survey results for the butterfly pattern , the selection rate in terms of definition was in the order of ( c , 56.9%)>(d , 36.8%)>(a , 5.3%)>(b , 1% ) ; in terms of boundaries was ( d , 50.2%)>(c , 32.5%)>(a , 8.6%)=(b , 8.6% ) ; brightness was ( a , 32.1%)>(b , 30.6%)>(c , 24.9%)>(d , 12.4% ) ; ' light and shade ' was ( a , 36.4%)>(c , 34%)>(d , 27.3%)>(b , 2.4% ) ; and the overall preferences were in order of ( c , 37.1%)>(d , 31.7%)>(a , 20.6%)>(b , 10.6% ) . in the survey results for the gastric lesions , selection rate for definition was in the order of ( a , 34.9%)>(b , 33.5%)>(d , 23%)>(c , 8.6% ) ; boundaries were ( d , 48.3%)>(b , 32.1%)>(a , 11.5%)>(c , 8.1% ) ; brightness was ( c , 44%)>(d , 24.9%)>(b , 19.1%)>(a , 12% ) ; ' light and shade ' was ( a , 32.1%)>(b , 29.7%)>(d , 26.3%)>(c , 12% ) ; and the overall preferences were in the order of ( d , 30.625%)>(b , 28.6%)>(a , 22.625%)>(c , 18.175% ) ( tables 1 , 2 , fig .
3 ) . a k value was calculated to determine whether there was agreement in the selection of definition , boundaries , brightness and ' light and shade . '
however , the agreement in terms of selection between each product family was low , with a maximum k value of 0.117 .
the agreement in selection for definition , boundaries , brightness , and ' light and shade ' between the butterfly pattern and gastric lesions was also low .
an endoscope is a medical instrument used to examine the interior of a body cavity or organ by insertion of the instrument into the body .
disease in the body can be diagnosed and direct biopsy sampling can be feasibly performed under vision with an endoscope . aside from diagnosis ,
the basic structure of an endoscope consists largely of a probe that is inserted into the body to generate image information , a controller that operates the probe , and a medical image visualization system that visualizes the image information.11 for instance , early neoplasia lesions usually occur at the surface of mucous membranes and a common occurrence is microvascular proliferation at the mucosal surface layer.12 since early cancer is literally a very early state of the disease , distinguishing it from the surrounding normal tissue by visual identification under a normal endoscope is challenging.13 however , endoscopes with specialized functions , such as magnification endoscopes , nbi endoscopes , and other spectroscopy can yield higher detection and delineation in order to facilitate therapeutic intervention in addition to high detection .
these advancements in optical technologies have enabled an increase in the detection rate for even precancerous lesions before overt malignancy.14 the objective of our current survey was to identify differences in the image quality of products from the leading companies in the world 's endoscope market today , without selection bias or conflict of interest .
unfamiliarity and unease in adapting to a new instrument can lead to a preference for the products of a certain endoscopy company , manifesting as a monopoly on such products by one particular company . however , such situations are not helpful to either doctors or patients .
endoscope selection requires a broad range of choices of instrument , since each product has its own advantages and disadvantages depending on the training required and frequency of use .
the development of instruments and competitive pricing of products can be expected with a wide range of choices , which prevents the monopolistic position of particular products . as far as diagnosis and treatment is concerned , image quality is the most important factor , for which the introduction of diverse endoscope technologies should be considered . not only is the lens used to capture the image significant , but the technologies used to correct and process the obtained image are also important .
we look forward to the use of endoscopes developed in our own country with are of a higher quality , but developed under the smart and qualified imaging technologies , for which gastroenterologists should be trained with diverse , technology - based endoscopy beyond the most popularly adapted rgb technology . | arising from human curiosity in terms of the desire to look within the human body , endoscopy has undergone significant advances in modern medicine . direct visualization of the gastrointestinal ( gi ) tract by traditional endoscopy was first introduced over 50 years ago , after which fairly rapid advancement from rigid esophagogastric scopes to flexible scopes and high definition videoscopes has occurred . in an effort towards early detection of precancerous lesions in the gi tract ,
several high - technology imaging scopes have been developed , including narrow band imaging , autofocus imaging , magnified endoscopy , and confocal microendoscopy .
however , these modern developments have resulted in fundamental imaging technology being skewed towards red - green - blue and this technology has obscured the advantages of other endoscope techniques . in this review article , we have described the importance of image quality analysis using a survey to consider the diversity of endoscope system selection in order to better achieve diagnostic and therapeutic goals .
the ultimate aims can be achieved through the adoption of modern endoscopy systems that obtain high image quality . |
a significant number of patients with diabetes remain poorly controlled , mainly as a result of poor diet compliance .
the important choices that affect blood glucose control in people with diabetes are made by themselves , and not by their physicians or other medical professionals .
people with diabetes are advised to adopt an appropriate diet including dietary habits and meal patterns on a lifelong basis .
traditionally , recognition of the relationship between dietary constituents and glucose tolerance has contributed to the development of nutritional prescriptions .
such strategies aim to restrict energy intake and provide macronutrient balance . however , some diabetic patients may have difficulty understanding diets based on a restrict energy intake , as well as changing their daily food habits .
hyperglycemia is associated with increased risk for atherosclerosis by suppressing endothelium - dependent vasodilation , activating thrombosis , and increasing oxidative stress in people with type 2 diabetes mellitus ( t2d ) , with impaired glucose tolerance ( igt ) , and even in subjects with normal glucose tolerance ( ngt ) . a reduction in postprandial hyperglycemia by an -glucosidase inhibitor delayed progression of carotid intima - media thickening in subjects with t2d .
vegetables , including seaweed and mushrooms , before carbohydrates , including potatoes , pumpkin , and corn , etc . on the reduction in postprandial glucose levels .
we reviewed the effect of eating vegetables before carbohydrates on postprandial plasma glucose and insulin in patients with t2d .
we conducted a randomized crossover study in 15 outpatients with t2d controlled by diet ( male / female ; 7/8 , age ; 61.7 11.6 y , duration of diabetes ; 5.3 8.8 y , body mass index ( bmi ) ; 24.7 4.3 kg / m , hba1c ; 6.4 0.6% , fasting plasma glucose ( fpg ) ; 6.28 1.12 mm ) .
patients ate test meals consisting of 150 g white rice and vegetable salad ( sliced tomato and cabbage with olive oil dressing ) , eating either vegetables before carbohydrates or vice versa .
plasma glucose and serum insulin levels were evaluated at 0 , 30 , 60 and 120 min after each test meal .
plasma glucose and serum insulin levels between eating vegetables before carbohydrates and the reverse regimen were examined using the student s paired t test with spss 15.0 for windows ( spss inc , chicago , il ) .
postprandial plasma glucose levels in those following the vegetables before carbohydrates regimen were reduced at 30 and 60 min compared to the reverse regimen ( fig .
postprandial serum insulin decreased significantly at 30 and 60 min in the vegetables before carbohydrates regimen ( fig .
a continuous glucose monitoring system ( cgms ) is capable of detecting hypoglycemia and hyperglycemia that may be undetectable by self monitoring blood glucose and glycated hemoglobin .
particularly , the mean amplitude of glycemic excursions ( mage ) is a significant determinant of overall metabolic control , as well as increased risk of diabetes complications .
we examined whether eating vegetables before carbohydrates could reduce the daily postprandial glucose excursions assessed by cgms in japanese patients with t2d and subjects with ngt .
all participants were assigned to cgms ( medtronic minimed gold , northridge , ca ) for 72-h by eating test meals of vegetables before carbohydrates and carbohydrates before vegetables on the 2nd and the 3rd day in a randomized crossover design .
all study protocols were approved by the ethics committee of the school of comprehensive rehabilitation at osaka prefecture university , and each subject provided written informed consent before enrollment in the studies .
the test meals consisted of rice / bread , meat / fish , 500 g of vegetables ( tomato , spinach , broccoli , and radish , etc . ) , and contained 21 g of dietary fiber and 125.6 kj kg per day .
energy intake was adjusted by the amount of rice and bread for each participant and the rest of the meals were identical .
the energy ratio of protein , fat , and carbohydrates was 17% , 25% , and 58% , respectively .
the subjects ate the first dishes of vegetables for 5 min , then the main dish for 5 min , and consumed rice or bread for 5 min successively within a 15 to 20 min total eating time for each meal , and vice versa .
nineteen outpatients with t2d ( male / female ; 6/13 , age ; 65.5 9.4 y , duration of diabetes ; 16.4 10.2 y , bmi ; 22.5 3.1 kg / m , hba1c ; 7.2 1.0% , fpg ; 8.06 2.67 mm , diet / oral hypoglycemic agents / insulin treatment ; 3/3/13 : mean sd or n ) and 21 subjects with ngt ( male / female ; 2/19 , age ; 29.8 11.3 y , bmi ; 20.8 3.0
kg / m , hba1c ; 5.4 0.6% , fpg ; 4.89 0.50 mm ) were enrolled in the study .
glycemic parameters between the day of eating vegetables before carbohydrates and the day of eating carbohydrates before vegetables were examined using the student s paired t test with spss 15.0 for windows .
the mean of the daily glucose values was plotted to show the reduction in glucose excursions of eating vegetables before carbohydrates compared to the reverse regimen in subjects with t2d and ngt ( fig . 2 ) .
the levels of sd , mage , large amplitude of glycemic excursions ( lage ) , mean 1-h postprandial glucose ( ppg ) , mean incremental area under the glucose curve0 - 3h ( iauc0 - 3h ) , and mean incremental glucose peak ( igp ) were all significantly reduced when the participants ate vegetables before carbohydrates compared to the reverse regimen in both subjects with t2d and ngt ( table 1 ) .
the mean blood glucose levels did not show any difference between the two treatments because the hyperglycemia and hypoglycemia were suppressed when subjects ate vegetables before carbohydrates .
in addition to lowering acute postprandial glucose levels , we studied whether educating diabetic patients to eat vegetables before carbohydrates was effective on long - term glycemic control . to test this hypothesis
, we carried out a retrospective study in patients with t2d that compared changes in hba1c as the primary outcome and changes in weight , serum lipids , and blood pressure as the secondary outcomes .
a total of 333 outpatients were divided into two groups to receive instructions about eating vegetables before carbohydrates ( educational group , n = 196 ) or a control group ( n = 137 ) who underwent a medical examination by a doctor .
all patients were scheduled for return visits every 4 weeks with a physical examination and patients in the educational group were routinely scheduled to see dietitians at every visit . depending on the patient s current dietary intake , intervention aimed to encourage increased consumption of vegetables , including seaweed and mushrooms , and eating them first for 5 min , then the main dishes ( meat , fish , soybeans , etc . ) for 5 min , and rice or bread , including potatoes , pumpkin , corn , etc .
, successively within a 15 to 20 min eating time using an original educational brochure in the educational group ( fig . 3 ) .
the patients in the control group were given general information about lifestyle and diabetes risk by either the doctor or nurses at every visit .
student s t tests were used to assess the difference between the clinical parameters in the two study groups and paired t tests were performed to analyze them within groups over time .
improvements in glycemic control were observed in patients in the educational group after the intervention and the levels of blood pressure , total cholesterol , and ldl cholesterol decreased significantly in both groups after 1 and 2.5 y ( table 2 ) .
after the intervention , dietary energy intake , protein , fat , and carbohydrates decreased in the educational group .
these reductions in dietary nutrients were due to a decrease in the consumption of grain ( rice ) , fruits , oil , sweets , and beverages . on the other hand , consumption of vegetables increased after intervention in the educational groups .
this evidence supports the effectiveness of eating vegetables before carbohydrates on glucose excursions in the short - term and glycemic control in the long - term in patients with t2d .
dietary carbohydrates consumed after vegetables were digested slowly and required less insulin for subsequent metabolic disposal by the dietary fiber in the vegetables .
other factors may influence the glycemic response and digestion of carbohydrates in the small intestine , including the rate of digestion , cooking method , transit time , and rate of intestinal absorption .
similar to our study , horowitz et al . reported that whey protein and olive oil consumed before meals resulted in a substantial reduction in postprandial glycemia in patients with diabetes .
protein and oil given before carbohydrates stimulate glucagon - like peptide 1 ( glp-1 ) secretion , and delay gastric emptying which leads to a reduction in glycemic excursions .
however , in contrast to the reduced insulin secretion observed after eating vegetables , whey protein augmented insulin secretion , possibly by a combination of the incretin effect and the direct stimulation of -cells by absorbed amino acids .
effects of eating vegetables before carbohydrates are probably similar to the gut peptide - based therapies for diabetes which may act predominantly by slowing gastric emptying , particularly when eating vegetables and protein before the carbohydrates .
dietary intervention should aim not only to suppress hyperglycemia and hypoglycemia , but also glucose excursions in order to reduce vascular damage .
the approach of eating vegetables before carbohydrates supports the concept of emphasizing food choices , what to eat first , how to eat and not just to concentrate on energy intake .
the most important point was that the method made it easy to make the appropriate behavioral changes , to increase the consumption of vegetables and to reduce the consumption of rice and sweets for patients .
as one aspect of nutritional education , eating vegetables before carbohydrates should be advised to patients with t2d and this advice could even be applicable to healthy people in order to prevent future cardiovascular events .
| the aim of this review was to evaluate whether eating vegetables before carbohydrates could reduce the postprandial glucose , insulin , and improve long - term glycemic control in japanese patients with type 2 diabetes .
we studied the effect of eating vegetables before carbohydrates on postprandial plasma glucose , insulin , and glycemic control for 2.5 y in patients with type 2 diabetes .
the postprandial glucose and insulin levels decreased significantly when the patients ate vegetables before carbohydrates compared to the reverse regimen , and the improvement of glycemic control was observed for 2.5 y. we also compared the postprandial glucose and glucose fluctuations assessed by continuous glucose monitoring system for 72-h in patients with type 2 diabetes and subjects with normal glucose tolerance when subjects ate vegetables before carbohydrates and carbohydrates before vegetables in a randomized crossover design .
the glycemic excursions and incremental glucose peak were significantly lower when the subjects ate vegetables before carbohydrates compared to the reverse regimen .
this evidence supports the effectiveness of eating vegetables before carbohydrates on glucose excursions in the short - term and glycemic control in the long - term in patients with type 2 diabetes . |
it was commonly used throughout europe as an anti - anginal medication , and was soon found to restrain arrhythmias . however ,
first descriptions of amiodarone induced pulmonary toxicity ( aipt ) were published in 1980 by rotmensch .
numerous investigations took place in the 1980s in order to find the pathomechanism of amiodarone lung damage .
aipt is a relatively common side effect with a reported incidence of 2 to 15 percent per year , .
it is known that aipt is up to nine times more likely in patients with preexisting lung disease .
our case report wants to point out , that this also relates to well trained healthy subjects and ought not to be underestimated .
diagnosing the pulmonary side effects of amiodarone induced damages is like looking for a needle in a haystack , since no secure clinical marker is known to proof aipt .
several methods have to be combined to conclude the quest , such as bodyplethysmography , bal , blood parameters , and clinical signs .
the patient agreed to the use of his clinical data and written informed consent was obtained for this report .
the endurance - trained 65 year old male marathon runner ( 175 cm ; 75 kg ) appears in a very good state of physical fitness . before the diagnosis of atrial fibrillation in autumn 2003 no cardiac or pulmonary diseases were known . since 1976
the patient repeatedly took part in various marathon runs ( 15 complete runs ) and achieved his best time in 3 hours and 15 minutes .
also he took part in numerous half - marathons and short - distance competitions ( since 1976 a total count of 29,300 km training distance ) . in preparation for each marathon he embarked upon a 12 week training period , with three 15 km runs a week and additional physical workout in a gym .
while exercising for a marathon atop the chinese wall in 2002 the patient underwent a special physical examination program at the university hospital in freiburg , germany , dept . for rehabilitation , prevention and sports medicine , showing no evidence of cardiac or pulmonary complications or hypertension . during a routine check up in august 2003 atrial fibrillation and perpetual arrhythmia
he was sent to the university hospital in freiburg to undergo medical cardioversion with flecainide and anticoagulatory treatment with phenprocoumon , followed by ass .
after primary conversion with 4 x 100 mg flecainide a stabilizing dose of 2 x 100 mg flecainide was prescribed , but several relapses occurred for the following 9 to 11 months due to bad compliance in medication intake .
there were no signs of oedema , extrasystole or lung complications , such as dyspnea on exertion ; blood pressure rose to 150/90 mmhg , but this did not receive any special attention .
after an interval of 11 months of treatment with flecainide , anti - coagulation and recurring relapses the medication was changed to amiodarone . at this time
the patient already felt slight sensations of dyspnea due to atrial fibrillation . on july 1 , 2004
he was advised to take an initial loading dose of 4x200 mg amiodarone for three days ; anticoagulatory treatment was kept . on july 5 ,
the loading dose medication was set to 5x200 mg amiodarone for the next three days .
on july 8 the ecg showed a regular sinus rhythm with a first degree a - v block .
due to a misunderstanding the patient kept on taking the loading dose for the following six weeks .
routine lung function on july 21 , 2004 showed no abnormalities ( figure 1 ( fig .
however , after that he experienced an increasing sensation of dyspnea on exertion and lowered resilience .
this led to emergency treatment in the university hospital in freiburg on august 12 , 2004 .
blood levels of amiodarone ( 1.4 gml ) and its degradation product desethylamiodarone ( 0.9 gml ) were nonetheless within normal limits . in a chest radiography and chest hr - ct
with contrast medium no signs of amiodarone induced changes in lung parenchyma , interstitial tissue or fibrosis could be detected .
no high - attenuation infiltrates could be detected by the radiologist . in order to evaluate a specific t - lymphocyte activation due to amiodarone a lymphocyte proliferation test ( lpt )
the result was highly positive showing a si of 15.1 with 100 pmol amiodarone clearly exceeding the individual treshold value of 5.1 .
in contrast , lymphocytes from a healthy person disclosed a si of 2.9 as the highest value not exceeding the individual threshold value of 3.7 . due to the possibility of lung affections under amiodarone and the patient 's dyspnea , bronchofibroscopy ,
functional lung testing , bodyplethysmography and carbon monoxide diffusing capacity ( dlco ) was measured .
a bronchial lavage ( bal ) was taken from the upper left bronchus which showed a reduced percentage of macrophage cell count ( 74% ) , neutrophile granulocytes ( 10% ) and a discrete cd prominent lymphocytosis ( 15% ) with a cd / cd - quotient of 0.17 .
bodyplethysmography records and analysis of blood gases and dlco were available from july 2004 and showed no signs of lung disease or affection .
after the high dose intake of amiodarone lung function analysis showed a significant reduction in the dlco with no relevant changes in vital capacity and fev1 ( figure 1 ( fig .
walking test losses in pao2 ( minimal value 08/18/04 : 48 mmhg ) could be recorded three weeks running .
a presumptive diagnosis of an amiodarone - induced pulmonary disease was made clinically , according to the results of the bal with the positive lpt .
in addition nebivovol 5 mg / d was given for five days to reduce sensations of arrhythmia .
1 ) complete remission of dlco to normal values was achieved and maintained through follow - up inspections .
no signs of other amiodarone - induced side effects could be detected . in a follow up
inspection in february 2005 at the department of cardiology cardiac function proved to be a stable sinus rhythm , long term ecg and blood pressure controls did not show any pathological evidence .
in this case , an endurance - trained individual developed pneumonitis while receiving an accidentally high dose of amiodarone .
the most common side effects of amiodarone therapy are skin discoloration , photodermatitis , hepatitis and hepatic cellular necrosis , thyroid dysfunction , corneal deposits , paresthesia , tremor , ataxy , drug interactions , and bone marrow suppression , , , none of which could be found in our patient .
etiology of amiodarone lung toxicity is still not understood in all its details , but it is believed that a sequence of events damages the mitochondrial functions and atp regeneration in lung cells . a favored attribute of amiodarone is its long half life . on the contrary this leads to accumulation of dea , which is even more destructive than amiodarone , in peripheral tissue , contributing to its toxicity in the lung .
a reduced percentage of macrophages , an increase in neutrophiles and cd lymphocytes in bal fluids in comparison to normal are a common finding , but does not allow a differentiation between amiodarone induced pneumonitis and other comparable forms .
thus , bal can be a good method for differential diagnosis in patients examined for aipt .
lpt gauges the frequency of antigen - specific t cells , i.e. high stimulation indices indicate a high number of cells proliferating after the recognition of the specific antigen .
lpt is frequently used to differentiate chronic beryllium disease and sarcoidosis , , or to estimate adverse effects of anti - tuberculosis therapy .
these tests are specific and can differentiate between different causative agents , which are also indicated by the clear difference in si between patient and control .
we did not determine the sub - population of t cells reacting in the amiodarone lpt , however , due to the decreased cd / cd ratio it is feasible that cd cells are important in the pathophysiology of amiodarone induced pneumonitis and may represent the proliferating sub - population in lpt .
patients who develop lung damages often show increased blood levels of amiodarone and even higher levels of dea .
these parameters , too , do not allow a diagnosis of amiodarone induced lung damages , since other reports also point out , that amiodarone - induced side effects can occur without elevated blood levels of amiodarone or dea . therefore blood concentrations prove not to be a reliable indicator for the occurrence of side effects . in april 2003
the food and drug administration ( fda ) approved a change in the labeling of amiodarone and the pulmonary side effects are now clearly noted .
retrospective studies stated that an amiodarone intake of more than 400 mg per day leads to an estimated 10% to 17% of lung damages in patients of which 10% turned out to be fatal .
the most common changes developing from amiodarone intoxication are dyspnea , pneumonitis and pulmonary fibrosis .
point out that there is only a weak correlation between the degree of exposure to amiodarone ( in dosage and duration of treatment ) and the development of lung affections ; the only predicitive risk in developing adverse effects are initial abnormalities in pulmonary function such as a reduced dlco and pathological findings in chest x - ray .
additionally there is an increasing role of amiodarone induced ards in patients with pre - existing lung damages and surgical patients , .
show that even low dose treatment ( 200 mg per day ) is a risk factor for developing lung damages ranging from mild symptoms such as cough to ards .
therefore it is notable that not even a low dose of amiodarone is presently a safe medication , but may decrease the incidence of pulmonary side effects .
it is noteworthy that our patient did not show any signs of amiodarone or dea intoxication in his blood , despite his high dosage and prolonged intake .
most patients with amiodarone lung damages show a greater loss in dlco than normal patients .
show that there was a mean loss of 20.3% in dlco levels in patients under treatment with amiodarone than in comparison with normal subjects .
on the other hand it is shown by gleadhill et al . that an isolated fall in dlco does not necessarily require a discontinuation of amiodarone treatment when no clinical signs of intoxication are given .
therefore , an unchanged dlco value appears to be a reliable negative predictor of pulmonary toxicity .
pulmonary function testing is also not proven to be statistically relevant for diagnosis , since it does not allow to a distinction from other pulmonary diseases . in our case , no changes in vc and fev1 could be measured ( figure 1 ( fig .
that our patient did not show any evidence of amiodarone induced lung changes for the first three weeks of his high dose intake .
the first notable changes occurred in the time period july 21 to august 12 , 2004 ( figure 1 ( fig .
1 ) ) . the time span , in which aipt develops varies from acute onset up to long term affection .
dusman et al . noted aipt from the sixth day of treatment up to the 60th month , with the highest incidence occurring during the first 12 months .
even though amidarone side effects are more likely to occur with increasing duration of treatment and cumulating dosage . in patients of the icu following thoracic surgery acute aipt and ards
can develop within 2 days postoperative and may turn out fatal , especially in these patients , .
corticosteroids might be helpful to reduce inflammation , but are not intended for general usage .
reversibility of pulmonary changes , even fibrosis , by discontinuation of amiodarone treatment is a well described phenomenon , , .
our case report , although a single one can act as a reminder of the clinical uncertainties of amiodarone use and patient compliance .
amiodarone is surely a safe and very effective anti - arrhythmic drug , but should be administered with a close clinical monitoring and the lowest dosage possible for arrhythmia control . | patients undergoing treatment with amiodarone can develop severe pulmonary side effects .
this effect , which is often highly underestimated , can lead to dyspnea , pneumonitis , and further fibrosis .
a recent change in the labeling of amdiodarone by the american food and drug administration ( fda ) supports this suspicion .
tracing the symptoms back to the causing agent can be difficult , as shown in our report.the subject of this case report is an endurance - trained 65 year old male marathon runner who appeared with atrial fibrillation during a routine check up in autumn 2003 .
after medical cardioversion with flecainide a complaint free interval of 8 months was followed by a relapse , which resulted in a change of medication to amiodarone .
due to misunderstandings the patient kept on taking the amiodarone loading dose for six weeks and returned with severe dyspnea on exertion .
losses in co diffusing capacity , a lowered macrophages count and a positive lymphocyte transformation test were the only first hand clinical evidence of amiodarone intoxication , despite the sensation of dyspnea .
this case shows that special care has to be taken in treatment with amiodarone .
side effects can be hard to trace and do not evidently show a clear connection to amiodarone . |
technology has created a new dimension for visual teaching and learning with web - delivered interactive media . with new web technologies
, rich online learning media can supply current biomedical information to the students and the faculty of medical sciences and promote their technology proficiencies , contributing to their professional development .
critical care medicine is becoming more and more popular and important tool for decreasing morbidity and mortality of patients .
the understanding and modeling of human physiology and the respective reactions on drug delivery is fundamental for patient care in the intensive care unit ( icu ) environment .
although the best way to study these principles is to practice on real patients , not all pathophysiological relationships are found in every patient . to overcome these limitations and to provide realistic teaching environments ,
full - scale simulators are addressed , which support a mixture of mathematical , mechanical and physiochemical models in a software and hardware combination .
simulation and modeling of human physiology , e.g. , medical simulators , is highly complex and always includes the question of model choice due to computational complexity . using simulation technology to provide healthcare professionals with the opportunity to practice procedures and diagnostic methods on computer - based models , medical simulators give clinicians hands - on experience by replicating realistic clinical scenarios , with the added benefit of eliminating the risk to an actual patient .
these interactive tutorials allow students and the faculty of medical sciences to practice , repeat and fine tune procedures in order to identify and correct mistakes and maximize clinical outcomes when presented with real - life scenarios .
while small dedicated models are widely used , e.g. , simulation of oxygen transport and basic life support models , full - scale descriptions are still rare , especially the combination of different existing models and the correlation of their interactions , causing the increase in the complexity substantially.[68 ]
the government of india and the information communication technology ( ict ) has made it a national mission on education through a centrally sponsored scheme to leverage its potential in teaching and learning process for the benefit of all the learners in higher educational institutions anytime and anywhere ( www.sakshat.ac.in ) .
nptel ( national program on technology enhanced learning , which is a joint venture of seven iits ( indian institute of technology ) and iisc 's ( indian institute of science ) , was launched in 2003 with its main aim to enhance the quality of engineering education in the country by developing curriculum - based video and web courses .
it was divided into two phases : phase i ( 20032009 ) consisted of five engineering programs at the undergraduate level , which included more than 250 courses , including 130 in broadcast quality video form .
all course materials were deployed through television ( eklavya channel gyan darshan , since 2004 ) , internet ( youtube since sept 2006 ) , streaming videos for video - on - demand through internet , dvd - roms for individual users and mobile - accessible files .
course - specific workshops were also conducted for more than 1000 faculty from engineering institutions all over the country , with pre- and post - workshop testing .
phase ii ( 20092012 ) consists of major engineering , science , management and some social sciences programs at undergraduate / postgraduate level with more than 950 courses , including 500 in broadcast quality video form .
many institutions would be included as associate partner institutions for content development and thousands of faculty are to be trained in teaching / learning processes .
content is for both web and video courses with additional quadrants of learning ( wiki - type supplementary information , slides , animations , simulations , quizzes ) and assignments with solutions , and should be universally circulated .
video and web - based material is free of cost to all educational institutions in india under a national virtual private network , set up through national mission on education through information and communication technology ( nme - ict ) , national knowledge network ( nkn ) and bharat sanchar nigam ltd .
it will be a two - way web content , where497 universities have been enrolled out of which 300 universities are already having the two way connectivity .for prepration of web content , if required further grants are given by nkn and university grants commission the web content is reviewed by nptel / a - view ( amrita virtual interactive e - learning world , amrita institute ) before uploading .. a - view software is available free of cost , provided by the ministry of human resource development ) .
weekly discussions using a - view , which is a part of nme - ict , holds online sessions where further guidance is provided through online spoken tutorials / virtual classrooms .
the emphasis is on nme through ict , which includes building connectivity and knowledge network among and within institutions of higher learning in the country with a view of achieving critical mass of researchers in any given field .
it also aims at spreading digital literacy for teacher empowerment and would bridge the digital divide .
nme aims at development of knowledge modules having the right content to take care of applications of the academic community and to address the personalized needs for learners .
standardization and quality assurance of e - content would be done to make them world class with research in the field of pedagogy for development of efficient learning modules for a disparate group of learners .
this content would be made available for e - knowledge free of cost to its stakeholders and would also provide support for the creation of virtual technological university . combining approaches to model physiological processes in a real - time software environment leads to a novel model for simulation of human patient physiology especially relevant for icus . using dedicated hardware
software interfaces , simulated patient signals are measurable with standard monitoring systems . therefore , this system , based on realistic simulations is very well suited for teaching and education
. additionally , the environment is usable for inferring patient - specific model structures and parameters .
an infrastructure for providing intensivist - led care from a distance is receiving much attention .
two years ago , a report examined the poor uptake of information technology into medicine and presented a way of incorporating a technological change into the process of intensive care provision . this allows a specialist intensivist located at one hospital to supervise a resuscitation team located at a peripheral hospital and also in situations of clinical degradation during a night shift . it would be attractive and interactive software , which would provide help from a central district hospital to the peripheries
this would look into all the medical needs of those far apart from medical care and enhance the support of critical care , treating them effectively .
a possible software is to be designed so that all information required by the intensivist to make judgments on patient treatment is available in real time , as if he or she were present at the peripheral hospital .
this is achieved by transmitting several high - quality digital video channels , high - quality audio , vital signs data , written notes and medical images .
two - way high - bandwidth video permits natural , low - latency telepresence interaction with the intensivist .
the system would be designed in such a manner that it would be robust , fault - tolerant and easy to use in the highly stressful atmosphere of the emergency department .
this would also remove the manpower deficits and has good future prospects as a profession and an important and helpful tool for postgraduate students .
the critical care society should come forward in making web - based content for uploading on university sites , thus empowering the students and teachers with recent knowledge and creating a virtual classroom .
interactive e - content so produced on evidence base on different aspects of critical care medicine would further support the mobility and accessibility of the intensivists not only in india but will also provide the forum to communicate abroad as well . in the future , extension of simulation model can be applied as an extension to predict potential risks and to avoid critical situations in the icu and will be an interesting and exciting research area . | critical care medicine is an important tool for decreasing morbidity and mortality of patients .
there is a need to develop effective web content for use of intensivists and related disciplinaries .
use of simulators and production of good quality videos and their uploading on national connectivity can add fillip to the national mission of education started by the government of india . |
as the global suicide rate increases by 60% in 50 years in the underdeveloped and developing countries , paraphenylenediamine ( ppd ) poisoning is emerging as an important etiological factor reported from india .
ppd ingestion is a very common form of poisoning in india as this compound is a component of hair dyes and is easily available .
it is brown or black colored solid substance , easily soluble in hydrogen peroxide and not in water .
it is a good hydrogen donor and metabolized by electron oxidation to an active radical by cytochrome p450 peroxidase to form a reactive compound called benzoquinone diamine .
this can be further oxidized to a trimer known as brandowaski 's base , a well known compound , reported to cause anaphylaxis and mutation .
it is traditionally used for dyeing palms and soles along with henna and to dye the hairs .
ingestion of ppd causes rapid development of edema of the face , neck , pharynx , tongue and larynx initially and rhabdomyolysis later
. finally , an acute renal failure supervenes as renal tubular necrosis occurs due the deposits of the toxic metabolites of ppd .
a 24-year - old young man who had ingested ppd pellets ( an exact amount could not be ascertained ) with suicidal intention .
he developed generalized itching and intermittent lacrimation for a few days and was treated symptomatically by a nearby medical practitioner from whom he concealed the history of consumption of ppd pellets .
he presented after 6 days with complaints of pain and stiffness of both lower limbs and passage of chocolate colored urine followed by anuria .
his blood urea and serum creatinine were 210 mg / dl and 12.4 mg / dl , respectively .
he was managed symptomatically with diuretics , phosphate binders , sodium bicarbonate , oral calcium and alkalization of urine . in view of his persistent oliguria and deranged metabolic parameters ,
myocarditis , myocardial rhabdomyolysis and shock have also been described in ppd poisoning . though the cervicofacial edema is also a common manifestation , it was not a prominent clinical feature in this case .
the alteration in the prominent clinical features may be due to the symptomatic management in the initial stages .
the major cause of mortality is respiratory distress due to edema , complications related to myocarditis and renal .
the cause of acute tubular necrosis in ppd poisoning , independent of rhabdomyolysis is due to concentration of ppd in the renal tubules .
this occurs due to aromatic structure of ppd , which makes it readily absorbable and concentrated in the tubules .
gastric lavage with 2% sodium bicarbonate is also effective . due to low molecular weight and hydrophilic nature
an acute renal failure is managed with adequate input and output charting , treating metabolic complications due to renal failure like hyperkalemia , hypocalcemia , hyperphosphatemia and metabolic acidosis by hemodialysis .
renal biopsy may be done when there is undue delay in recovery of renal function .
apart from an intentional or accidental excessive exposure to ppd , which results in above manifestations , routine use of this compound on regular basis for a long time can also lead to toxic effects .
association between personal hair dye use and non - hodgkin 's lymphoma , multiple myeloma , leukemia and other bladder cancer have been reported but have not been consistently observed .
however , the united states environmental protection agency has not classified ppd as a carcinogen . therefore , no warnings of toxicity are printed on boxes of hair dye .
but , in view of an easy availability and potential toxicity , awareness about the toxic effects of this compound and adequate warnings for the users may be useful . | the commonest constituent of all hair dyes is paraphenylene diamine ( ppd ) .
hair dye poisoning is emerging as one of the emerging causes of intentional self - poisoning to commit suicide . in this article
, we report a case of ppd poisoning and the importance of clinical of hair dye poisoning .
the lack of specific diagnostic tests , a specific antidote for paraphenylene diamine poisoning and the importance of early supportive treatment modalities are also discussed . |
currently , the detection and diagnosis of parasite infections rely on several laboratory methods in addition to clinical symptoms , clinical history , travel history , and geographic location of patient .
the primary tests currently used to diagnose many parasitic diseases have changed little since the development of the microscope in the 15th century by antonie van leeuwenhoek .
furthermore , most of the current tests can not distinguish between past , latent , acute , and reactivated infections and are not useful for following response to therapy or for prognosis .
recent developments in new diagnostic tools , however , have opened new avenues for a vast improvement in parasite detection .
firstly , a number of newer serology - based assays that are highly specific and sensitive have emerged , such as the falcon assay screening test elisa ( fast - elisa ) , dot - elisa [ 2 , 3 ] , rapid antigen detection system ( rdts ) , and luciferase immunoprecipitation system ( lips ) .
secondly , molecular - based approaches such as loop - mediated isothermal amplification ( lamp ) , real - time polymerase chain reaction , and luminex have shown a high potential for use in parasite diagnosis with increased specificity and sensitivity .
thirdly , proteomic technology has also been introduced for the discovery of biomarkers using tissues or biological fluids from the infected host .
the aim of this review is to highlight the potential for these new technologies in parasite diagnosis . for convenience ,
the diagnostic tools offered by the cdc ( centre for disease control , atlanta , usa ) and the nrcp ( national reference centre for parasitology , montral , canada ) are also highlighted in tables 3 and 4 .
for many years , microscopy has been the only tool available for the detection of parasites through inspection of blood smears [ 1014 ] , tissue specimens [ 1517 ] , feces , lymph node aspirates [ 18 , 19 ] , bone marrow , and even cerebrospinal fluid .
however , sample preparation for direct observation is time - consuming , labour intensive , and proper diagnosis depends on qualified laboratory technicians . in the case of slide reading ,
a second independent reading is preferable , but not always required for accurate diagnosis . if need be , divided readings are resolved by a third reader . in endemic regions , where resources are limited , this proves to be difficult and misdiagnosis can significantly impact patient care . in reality ,
all major intestinal helminth infections are still solely dependent on microscopy for diagnosis . as for other parasite infections ,
many are confirmed by the use of microscopy in conjunction to other methods of diagnosis including serology - based assays and more recently molecular - based assays .
in situations where biologic samples or tissue specimens are unavailable , serology alone is the gold standard for diagnosis .
serology - based diagnosis tools can be divided into two categories : antigen - detection assays and antibody - detection assays .
these include the enzyme - linked immunosorbent assay ( elisa ) , also called enzyme immunoassay ( eia ) , and all its derived tests such as the falcon assay screening test elisa ( fast - elisa ) and the dot - elisa .
other assays include the hemagglutination ( ha ) test , indirect or direct immunofluorescent antibody ( ifa or dfa ) tests , complement fixation ( cf ) test , and immunoblotting and rapid diagnostic tests ( rdts ) .
although the ease of use and turnaround times for serologic assays are similar to microscopy , serology - based assays are more sensitive and specific .
it becomes important for individuals whose blood smears do not permit identification of the parasite ( e.g. , differentiating between babesia and plasmodium ) or for patients exhibiting low - parasitemia and/or who are asymptomatic ( e.g. , chagasic patients ) .
classifying an infected asymptomatic patient as negative could lead to transmission of the parasite during blood transfusions or organ transplants . in the case of fasciola infection , serology tests
have also been shown to be useful in the confirmation of chronic fascioliasis when egg production is low or sporadic .
finally , having these tests readily available allows for the monitoring of parasite clearance following therapy .
the falcon assay screening test elisa ( fast - elisa ) consists of using synthetic and recombinant peptides to evaluate antibody responses to an antigen . in the past
, the method has been applied to the study of malaria , fasciolosis , schistosomiasis ( reviewed in ) , and taeniasis .
however , this technique is subjected to the same drawbacks as most serology - based tests . antibodies raised against a peptide from one parasite protein may cross - react with proteins from other species .
moreover , antibodies raised against a peptide may react in some assays but not in others and some regions of a peptide may be more immunogenic than others .
no recent studies have been published on the use of the fast - elisa for the diagnosis of parasitic infections .
the main difference between the regular elisa and the dot - elisa lies in the surface used to bind the antigen of choice . in the dot - elisa ,
the plastic plate is replaced by a nitrocellulose or other paper membrane onto which a small amount of sample volume is applied .
the choice of binding matrix greatly improved the specificity and sensitivity of the assay by reducing the binding of nonspecific proteins usually observed when plastic binding matrixes are used .
the dotted membrane is incubated first with an antigen - specific antibody followed by an enzyme - conjugated anti - antibody .
the addition of a precipitable , chromogenic substrate causes the formation of a colored dot on the membrane which can be visually read .
the benefits of this technique include its ease of use , its rapidity , and the ease of result interpretation .
it is fast , and cost - effective and more importantly can be used in the field ( e.g. , as a dipstick ) . for all these reasons ,
the dot - elisa has been and still is extensively used in the detection of human and animal parasitic diseases , including amebiasis , babesiosis , fascioliasis , cutaneous and visceral leishmaniasis , cysticercosis , echinococcosis , malaria , schistosomiasis , toxocariasis , toxoplasmosis , trichinosis , and trypanosomiasis ( all reviewed in ) . in the last few years , published studies have demonstrated the use of the dot - elisa for the detection of fasciola gigantica , haemonchus contortus , theileria equi , trypanosoma cruzi , and trypanosoma brucei . in the latter study
the researchers were able to demonstrate that the dot - elisa had better sensitivity and specificity than the elisa in the detection of antineurofilament and antigalactocerebrosides antibodies in cerebrospinal fluid of subjects infected with african trypanosomes .
they attributed the greater sensitivity and specificity of the dot - elisa to the use of the nitrocellulose membrane and showed that their assay was successfully reproducible in the field .
rapid antigen detection tests ( rdts ) based on immunochromatographic antigen detection have been implemented in many diagnostic laboratories as an adjunct to microscopy for the diagnosis of malaria .
rdts consist of capturing soluble proteins by complexing them with capture antibodies embedded on a nitrocellulose strip .
a drop of blood sample is applied to the strip and eluted from the nitrocellulose strip by the addition of a few drops of buffer containing a labeled antibody .
the antigen - antibody complex can then be visualized directly from the membrane . since the appearance of the first rdts in the 990s , major improvements have been made to the technique , making the use of rdts in rural endemic regions feasible .
rdts are now rapid , stable at temperatures up to 40c , easy to use , and cost - effective thereby providing many advantages over traditional microscopic methods .
rdts are useful in the identification of p. falciparum and p. vivax infections but can not be used to identify p. malariae and p. ovale infections .
more than 80 rdts exist for the detection of either histidine - rich protein ( hrp ) specific to p. falciparum or species - specific isotypes of lactate dehydrogenase ( ldh ) .
malaria rdts have recently been introduced in african countries to help prevent misdiagnosis of malaria infections and to subsequently reduce the practice of presumptive treatment .
in fact , the tendency to treat slide - negative samples with antimalarials is still a common phenomenon .
this practice causes concern not only for the patient 's health care but also to the costs it generates in prescribing the more expensive antimalarial sulfadoxine / pyrimethamine and artemisinin - based combinations . finally , misuse of antimalarials could lead to the appearance of drug - resistant strains
the luciferase immunoprecipitation system ( lips ) is a modified elisa - based assay in which serum containing antigen - specific antibodies can be identified by measuring light production .
basically , an antigen of choice is fused to the enzyme reporter renilla luciferase ( ruc ) and expressed as a ruc - fusion in mammalian cells to allow for mammalian - specific posttranslational modifications .
the crude protein extract is then incubated with the test serum and protein a / g beads . during the incubation ,
the ruc - antigen fusion becomes immobilized on the a / g beads , which allows the antigen - specific antibody to be quantitated by washing the beads and adding coelenterazine substrate and measuring light production . in recent years
, lips has been successfully applied for the identification of sera samples infected with strongyloides stercoralis ( using a ruc - nie fusion ) and loa loa ( using a ruc - llsxp-1 fusion ) .
some of the advantages of the lips technology include its rapidity and accuracy in detecting infected patients .
sensitivity is improved in part by the use of mammalian cells which produce fusion antigens free of contaminating bacterial proteins .
in addition , the strongyloides lips based on the nie antigen showed greater specificity than the elisa as no cross - reaction was observed with serum from filarial - infected subjects .
2008 were able to obtain 100% specificity and sensitivity when performing an lips assay based on the loa loa sxp-1 antigen with only a small - degree of cross - reactivity with a few onchocerca volvulus- and wuchereria bancrofti - infected patient sera . by decreasing the incubation times of a normal lips assay , they were able to minimize cross - reaction .
many of the o. volvulus sera samples tested as positive with the lips assay were negative using this 15-minute lips assay also called qlips . of interest for the application of this technique in the field
is the observation that blood obtained by finger - prick ( contaminated with red blood cells and other components ) did not interfere with the lips assay .
further studies will be useful in exploring and validating the accuracy and potential usefulness of the lips and qlips assays in the field .
parasitic diseases such as amebiasis , cryptosporidiosis , filariasis , giardiasis , malaria , cysticercosis , schistosomiasis , and african trypanosomiasis do not have commercially or fda approved antibody detection tests for their diagnosis .
experimental results have been too variable due to the type of antigen preparations used ( e.g. , crude , recombinant purified , adult worm , egg ) and also because of the use of nonstandardized test procedures .
cross - reaction leading to false - positives and misdiagnosis is also a problem , especially in regions where more than one parasite is endemic . despite the fact that some parasites in south america share common epitopes , it is common to see coinfection with trypanosoma cruzi and leishmania species .
it is also a problem in africa , where cross - reactivity exists between filarial and other helminth antigens . to a lesser extent but nonetheless important is the inability of antibody - detection tests to differentiate between past and currently active infections .
furthermore , antibody - detection tests can not be used in parasitic infections that do not develop a significant antibody response .
this has been observed in some individuals carrying echinococcus cysts or during cutaneous leishmaniasis ( http://www.dpd.cdc.gov/dpdx/html/leishmaniasis.htm ) .
similarly , in the case of african trypanosomiasis diagnosis , such tests are of limited use because seroconversion occurs only after the onset of clinical symptoms . for all these reasons ,
there is still a need to improve on the current diagnosis approaches available . since the advent of the polymerase chain reaction ( pcr )
, parasitologists have turned to molecular - based approaches in the hopes to better the existing diagnosis tools .
the many limitations of microscopy and serology - based assays have influenced parasitologists towards the use of gene amplification methods made possible with the advent of the polymerase chain reaction ( pcr ) . besides the traditional pcr , including nested and multiplexed pcr , we have seen the implementation of the real - time pcr ( rt - pcr ) for the detection of several parasitic infections .
newer technologies such as loop - mediated isothermal amplification and luminex - based assays have also emerged as possible new approaches for the diagnosis of parasitic diseases .
molecular - based approaches based on nucleic acids offer greater sensitivity and specificity over the existing diagnostic tests .
they permit the detection of infections from very low parasitized samples including those from asymptomatic patient 's samples .
moreover , multiplexed pcr allows for the detection of multiple sequences in the same reaction tube proving useful in the diagnosis of several parasitic infections simultaneously .
rt - pcr system unlike conventional pcr , allow for the quantification of the original template 's concentration through the use of various fluorescent chemistries , such as sybergreen , taqman probes , fluorescence resonance energy transfer ( fret ) , and scorpion primers .
this eliminates the need to visualize the amplicons by gel electrophoresis thereby greatly reducing the risk of contamination and the introduction of false - positives .
when multiplexed , rt - pcr allows for the high - throughput analysis of different sequences in one single - closed tube reaction . using multiplexed rt - pcr , shokoples et al .
were able to identify the four human plasmodium species ( falciparum , vivax , malariae , and ovale ) in a single reaction tube even in very low parasitized samples . running
the multiplex assay not only reduced the cost per test but also allowed for a rapid turnaround time , the assay taking only three hours to complete .
it is a clear advantage over microscopy which is labour intensive and time - consuming with slow turnaround times especially during high - throughput settings .
similarly , multiplexed rt - pcr proved useful in differentiating drug - sensitive strains of malaria .
this is important for proper antimalarial prescription . in another example , diez et al .
were able to detect the presence of t. cruzi infection following heart transplants using pcr .
this allowed immediate treatment of the patients before reactivation of chagas disease could occur .
these examples demonstrate that efficient and early diagnosis can directly impact patients care and that pcr - based approaches have the potential to help in making the right choice for treatment .
although dna - based methods have shown excellent sensitivity and specificity , the introduction of these methods in daily laboratory practice is still uncommon especially in rural endemic regions .
in addition , as observed with many serology - based assays , pcr - based methods also suffer by the lack of standardization .
dna extraction , choice of primer sets , and use of various amplification protocols are all factors that may cause this diversification in results . adding an automated dna extraction step would certainly improve pcr assays for use in the diagnosis of parasitic diseases .
loop - mediated isothermal amplification ( lamp ) is a unique amplification method with extremely high specificity and sensitivity able to discriminate between a single nucleotide difference .
it is characterised by the use of six different primers specifically designed to recognise eight distinct regions on a target gene , with amplification only occurring if all primers bind and form a product . in the past , lamp has been successfully applied for the rapid detection of both dna and rna viruses such as the west nile and sars viruses .
recently , parasitologists have adapted the lamp approach for the detection of several parasitic diseases including the human parasites entamoeba , trypanosoma , taenia , plasmodium , and cryptosporidium , the animal parasites theilera and babesia [ 178 , 179 ] , and even to the identification of vector mosquitoes carrying plasmodium and dirofilaria immitis parasites .
most of these studies have brought to light the many advantages of this method over the common pcr technique . unlike a regular pcr reaction ,
lamp is carried out at a constant temperature ( usually in the range of 6065c ) .
this unique feature not only results in higher yields , but also eliminates the need to buy a thermal cycler and shortens the reaction time by eliminating time lost during thermal changes .
in addition , the reaction can be carried out without extracting the dna from the collected samples as shown in the case of rime , a nonautonomous retroelement found in trypanosoma brucei rhodesiense and t. b. gambiense . in 35 minutes , using a simple water bath , rime lamp was able to detect both t. b. gambiense and t. b. rhodesiense directly from blood , serum , and csf samples .
in addition to the above advantages , lamp reactions are easy to set up , and results can readily be assessed . the sample of interest is mixed with primers , substrates , and a dna polymerase capable of strand displacement in a microcentrifuge tube . during the reaction ,
large amounts of pyrophosphate ions are produced , leading to the formation of a white precipitate .
this turbidity is proportional with the amount of dna synthesized therefore one can assess the reaction by real - time measurement of turbidity or more importantly , simply through the naked - eye . for all these reasons , the future adoption of lamp
furthermore , as more groups apply lamp to the field of parasitology , we will see the appearance of lamp - modified assays that meet specific detection needs .
for example , in a recent study on bovine babesia , a multiplex - lamp ( mlamp ) assay was developed to simultaneously detect b. bovis and b. bigemina from dna extracted from blood spotted on filter paper .
similarly , han et al . implemented a lamp assay based on the 18s rrna gene for the detection of the four human plasmodium species ( falciparum , vivax , malariae , and ovale ) .
lamp had a similar sensitivity and a greater specificity than nested pcr , yielding similar results but at a faster turnaround time .
their results are consistent with other studies demonstrating the rapidity and the improved specificity and sensitivity obtained using the lamp assay .
luminex technology is a bead - based flow - cytometric assay that allows the detection of various targets simultaneously ( http://www.luminexcorp.com/ ) .
the microsphere beads can be covalently bound to antigens , antibodies , or oligonucleotides that will serve as probes in the assay . up to 100 microspheres are available each emitting unique fluorescent signals when excited by laser therefore allowing the identification of different targets . adapted to the study of parasites ,
the luminex assay could identify multiple organisms or different genotypes of one particular organism during the same reaction utilizing very low volume .
the approach could prove useful in the study of antigenic diversity and drug - resistance alleles and for the diagnosis of parasitic diseases .
luminex was applied to the study of cryptosporidium . c. hominis and c. parvum can not be distinguished using antigen detection or serology assays .
only dna - based approaches have been successful in doing so by exploiting the single nucleotide difference in the microsatellite-2 region ( ml-2 ) of both species .
ultimately dna sequencing is the diagnosis tool of choice but it is costly , labour - intensive and time - consuming . in a recent study , bandyopadhyay et al . successfully detected and distinguished c. hominis and c. parvum in 143 dna extracts using luminex technology by using oligonucleotide probes specific to the ml-2 regions of each species .
turnaround time was about 5 hours making this assay not only much faster but also less expensive than pcr followed by dna sequencing .
it also proved to be 100% specific and more sensitive than a direct fluorescent antibody ( dfa ) test , a method routinely used to identify cryptosporidium and giardia species .
note that dfa can not differentiate between c. hominis and c. parvum .
similarly in other research , luminex technology was able to detect all - blood stage parasite levels of the four human plasmodium species ( falciparum , vivax , malariae , and ovale ) simultaneously .
this study demonstrated that luminex technology can improve the speed , the accuracy , and the reliability of other pcr methods .
for example , the need for gel electrophoresis to differentiate the ldr products representing the four human plasmodium species is eliminated .
second , all samples are handled simultaneously and continuously through a 96-well plate format from dna extraction all through data analysis .
finally , the high - throughput capability of the luminex system confers it a clear advantage over the use of labour - intensive microscopy for large scale studies . since proteins are the main catalysts , structural elements , signalling messengers , and molecular machines of biological tissues , proteomic studies are able to provide substantial clinical relevance .
proteins can be utilized as biomarkers for tissues , cell types , developmental stages , and disease states as well as potential targets for drug discovery and interventional approaches .
the next generation of diagnostic tests for infectious diseases will emerge from proteomic studies of serum and other body fluids .
recent advances in this area are attributable largely to the introduction of mass spectrometry platforms capable of screening complex biological fluids for individual protein and peptide biomarkers .
proteomic strategy can identify proteins in two ways : bottom - up and top - down approaches . in the former
, the proteins in a biological fluid are proteolytically shattered into small fragments that can be easily sequenced and the resultant spectra are compared with those in established peptide databases .
bottom - up strategies are difficult to quantitate and can not identify modified molecules ( e.g. , alternately spliced , glycosylated ) .
since each open reading frame in the human genome is thought to generate at least 10 modified proteins , this issue is a major limitation .
top - down strategies seek to identify proteins and peptides ( and their natural variants ) in complex biological fluids .
two - dimensional ( 2d ) gel electrophoresis was first described in 1975 . with this method ,
proteins are resolved in the first dimension based on ph ( a process called isoelectric focusing ) and in the second dimension by their molecular weight .
this technique is labor intensive , and low throughput and requires large amounts of sample .
other techniques used for the expression analysis of proteins are matrix - assisted laser desorption ionization time - of - flight mass spectrometry ( maldi - tof ms ) , surface - enhanced laser desorption ionization time of flight mass spectrometry ( seldi - tof ms ) , liquid chromatography combined with ms ( lc ms ms ) , isotope - coded affinity tags ( icat ) , and isotope tags for relative and absolute quantification ( itraq ) .
the development of automated , high - throughput proteomic technologies such as maldi - tof and seldi - tof ms has enabled large numbers of clinical samples to be analyzed simultaneously in a short time .
all proteomics - based diagnostic efforts seek to identify biomarkers that , alone or in combination , can distinguish between case and control groups . the main limitation of seldi compared to maldi resides in the fact that seldi has lower resolution and lower mass accuracy . in addition , seldi is unsuitable for high molecular weight proteins ( > 100 kda ) and is limited to the detection of bound proteins on to the proteinchip array .
the seldi , a derivation of maldi , allows sample binding to chemically active proteinchip surfaces .
several types of proteinchip arrays are available with differing abilities to bind proteins with different chemical ( anionic , cationic , hydrophobic , metallic , and normal phase ) or biological ( antibody , enzymes , receptors ) properties , thereby allowing the direct analysis of proteins from complex biological samples without the need for prior separation by 2d gel electrophoresis .
the output of the seldi is a spectrum of mass - to - charge ratios ( m : z values ) with their corresponding relative intensities ( approximating to relative abundance ) .
seldi analyses were initially applied to the discovery of early diagnostic or prognostic biomarkers of cancer ( reviewed in ) .
recently , this technique has been applied to the study of serum biomarkers of infectious diseases such as severe acute respiratory syndrome , african trypanosomiasis , fascioliasis , cysticercosis , and chagas diseases ( ndao et al . , submitted ) .
such studies have focused on identifying a distinctive configuration of circulating serum proteins that are indicative of a specific pathophysiological state , a so - called proteomic fingerprint .
the real potential of proteomic fingerprinting is in its use as a discovery tool for novel biomarkers that can then be incorporated into simple bedside diagnostics based on affordable technologies such as immunologically based antigen - detection tests that could be implemented in dipstick or cassette formats . | methods for the diagnosis of infectious diseases have stagnated in the last 2030 years .
few major advances in clinical diagnostic testing have been made since the introduction of pcr , although new technologies are being investigated .
many tests that form the backbone of the modern microbiology laboratory are based on very old and labour - intensive technologies such as microscopy for malaria . pressing needs include more rapid tests without sacrificing sensitivity , value - added tests , and point - of - care tests for both high- and low - resource settings . in recent years
, research has been focused on alternative methods to improve the diagnosis of parasitic diseases .
these include immunoassays , molecular - based approaches , and proteomics using mass spectrometry platforms technology .
this review summarizes the progress in new approaches in parasite diagnosis and discusses some of the merits and disadvantages of these tests . |
methicillin - resistant staphylococcus aureus ( mrsa ) and vancomycin - resistant enterococcus ( vre ) are multidrug resistant organisms and are particularly frequent causes of hospital - acquired infections that are often difficult and expensive to treat . methicillin resistance in s. aureus is primarily mediated by the meca gene , which codes for the modified penicillin - binding protein 2a ( pbp 2a ) .
several studies on s. aureus suggest that mrsa infection usually follows prior carriage rather than occurring from direct transmission during invasive procedures by staff or from intensive care unit ( icu ) environment [ 25 ] , meaning that mrsa infection is preceded by colonization with an mrsa strain that is genetically indistinguishable from the disease causing isolation in at least 56% of patients .
these data support the view that prevention of colonization of icu patients with mrsa could reduce the frequency of mrsa infections and can assist in the design of effective prevention strategies against mrsa infection .
their emergence as important pathogens in the past two decades is largely due to their resistance to many commonly used antibiotics .
most enterococcal infections have been attributed to endogenous sources ( normal flora of individual patient ) , yet transmission occurs by contaminated hands of personnel , contaminated patient - care equipment , and/or environmental surfaces .
treatment of some enterococcal infection has become a significant challenge , especially with the emergence of strains resistant to vancomycin .
the vana and vanb genes are those predominantly encountered in vancomycin - resistant enterococci ( vre ) .
they are transferable and can spread from organism to organism and are the only ones that are clinically relevant . in contrast , vanc genes are not transferable , have been associated less commonly with serious infections , and have not been associated with outbreaks .
early screening of patients for vre carriage to identify those patients that require isolation can be part of an effective infection control program for vre [ 9 , 10 ] . in most laboratories conventional culture and identification method
since results need a turnaround time ( tat ) of 24 days which is not compatible to being proactive in terms of infection prevention and control , a test that has a faster tat and is comparable to culture in efficiency and cost - effectiveness is needed [ 1113 ] .
recently several rapid diagnostic tests have been introduced that would be very beneficial in decreasing the time to detection ( several hours ) , therefore reducing the risk of nosocomial transmission and infections especially in high risk patients [ 1318 ] .
the bd geneohm mrsa assay is a multiplex quantitative real - time pcr assay and is a us food and drug administration ( fda ) cleared qualitative in vitro test for direct detection of nasal colonization by mrsa .
the use of this assay in clinical setting requires confirmation especially on swabs from sites other than the nose .
it detects the sccmec cassette ( carrying the meca gene ) and an s. aureus specific sequence located within the orfx gene , allowing discrimination between mrsa and methicillin - resistant coagulase - negative staphylococci .
the bd geneohm vanr assay is a ce - mark in vitro test for the rapid detection of vancomycin - resistant ( vana and vanb ) genes directly from perianal and/or rectal swabs .
the bd geneohm vanr assay can be used as an aid to identify , prevent , and control vancomycin - resistant colonization in healthcare settings .
it is not intended to diagnose vre infection nor to guide or monitor treatment for vre .
king fahad specialist hospital dammam ( 600 bed total capacity ) has oncology centre and is establishing bone marrow and solid organ transplant programs and does have guidelines for hospital wide screening of new hospital admission for mrsa and vre .
the development of reliable and rapid method for the identification of patients colonized with mrsa and vre is central to the containment of this agent within the hospital environment . to this end
, we investigated the performance of the bd geneohm assays as an alternative to culture which requires 2 - 3 days before implementing it as a rapid screening method in the hospital .
2267 duplicate swabs were collected ( 728 nasal and 1539 groin swabs ) between january 2008 and june 2009 from all new hospital admissions .
in addition , 300 duplicate rectal swabs were collected consecutively between january 2009 and june 2009 from the all patients admitted to the intensive care unit .
nasal and groin swabs were analyzed for the presence of mrsa by conventional culture method and bd geneohm mrsa assay .
rectal swabs were analyzed for the presence of vre by culture and bd geneohm vanr assay .
the duplicate nasal , groin , and rectal swabs from each patient were obtained by nursing staff using bbl cultureswab liquid stuart single swab ( becton dickinson ) . for each assay
one swab was used for direct and enrichment broth culture , while pcr was performed with the other swab .
if processing of the swabs was not possible on the same day , swabs were stored overnight at 4c .
the bd geneohm mrsa assay is fda approved for the direct detection of nasal colonization by mrsa only .
. collected swabs were inoculated onto blood agar plate ( ba ) , mannitol salt agar ( msa ) , mueller hinton with 4% nacl and oxacillin ( mox ) agar , columbia polymyxin nalidixic acid and bacitracin agar ( pnba ) and then inoculated into salt broth .
plates were incubated at 37c for 24 h. suspected colonies were identified by conventional laboratory methods , including gram stain , catalase test , and coagulase production by the tube method .
coagulase positive strains were inoculated on oxacillin screen plate and tested for susceptibility to cefoxitin disc and oxacillin e - test strips .
strains of staphylococcus aureus isolated directly from the agar and/or broth cultures that give a zone of 21 mm with cefoxitin or an mic of 4 with the oxacillin e - test were reported as mrsa according to clinical and laboratory standards institute ( clsi ) guidelines .
the tip of the swab was broken off into an mrsa sample buffer tube containing a tris - edta sample preparation buffer , provided by the manufacturer .
after the sample buffer tube was vortexed for 1 min , 50 l of the solution was transferred into a lysis tube .
the lysis tube was vortexed for 5 minutes at high speed and received a quick spin in the centrifuge to bring the contents to the bottom of the tube before incubation at 95c in a dry heating block for 2 minutes .
the pcr processing was performed as recommended by the manufacturer using the smart cycler ii instrument ( cepheid , sunnyvale , calif , usa ) .
the assay results were interpreted as follows : neg , no mrsa dna was detected ; pos , mrsa dna was detected ; unresolved , the ic was inhibited or there was reagent failure ; not determined , there was an i - core module malfunction .
in addition to the previously mentioned pcr control for each run , a reference mrsa strain ( atcc 4300 ) and a reference mssa strain ( atcc 29213 ) were included in each assay and on day of use with mox agar .
rectal swabs for culture were first inoculated onto columbia pnba and then into salt broth .
plates were incubated at 35c in ambient air and examined for growth at 24 and 48 hours .
any suspected colonies were identified by conventional laboratory methods , including gram stain , catalase test , bile esculin agar ( bea ) test , and bvs ( vancomycin screening agar that incorporates the use of 6 ug / ml of vancomycin in brain - heart infusion ( bhi ) agar ) .
black colonies ( esculin - positive ) were then subcultured onto a blood agar plate for purity .
following 24 hours of incubation , a definite spot of growth or greater than one colony present at the site of inoculation on the bvs agar indicates that the enterococci may be a vre .
faecium ) was confirmed by performing gp on the vitek 2 system ( biomerieux ; gp colorimetric identification card ) .
susceptibility testing was performed on confirmed enterococcal isolates using vancomycin ( 0.016 to 256 g / ml ) and teicoplanin ( 0.016 to 256 g / ml ) e - test strips .
the determination of the mics and the interpretation of vancomycin resistance ( mic 32 g / ml ) were done according to clinical and laboratory standards institute ( clsi ) guidelines . for the interpretation of the teicoplanin results , combination of the intermediate and resistant mics
was done as previously published for the assignment of isolates as having vana ( mic 16 g / ml ) or vanb ( mic < 16 g / ml )
. for bd geneohm vanr assay , the assay was performed by following the manufacturer protocol and as described elsewhere .
the tip of the swab was broken off into a vanr sample buffer tube containing a tris - edta sample preparation buffer , provided by the manufacturer .
after the sample buffer tube was vortexed for 1 min , 50 l of the solution was transferred into a lysis tube .
the lysis tube was vortexed for 5 minutes at high speed and received a quick spin in the centrifuge to bring the contents to the bottom of the tube before incubation at 95c in a dry heating block for 2 minutes .
the pcr processing was performed as recommended by the manufacturer using the smart cycler ii instrument ( cepheid , sunnyvale , calif , usa ) .
the assay results were interpreted as follows : negative , no vana or vanb dna was detected ; positive , vana and vanb dna was detected ; presumptive pos , vanb dna was detected ; pos ,
vana was detected ; unresolved , the ic was inhibited or there was reagent failure ; invalid assay run , the pcr control ( positive or negative ) failed ; not determined , there was an i - core module malfunction .
in addition to the previously mentioned pcr control for each run , a reference vre strain ( e. faecalis atcc 51299 ) and a reference e. faecalis vancomycin susceptible strain ( atcc 29212 ) were included in each assay and on day of use with the bvs agar .
if any of the bd geneohm for mrsa and vre was unresolved , that generally would indicate some amount of pcr inhibition .
the assay was repeated once using the frozen lysate as recommended in the kit directions .
unresolved specimens after repetition were excluded from final analysis . for the only sample in which the bd geneohm was negative for mrsa but the culture was mrsa positive
, the original frozen lysate and the corresponding isolate were tested again by the bd geneohm mrsa assay .
bd geneohm positive samples , which were culture negative , were examined again by inoculating 300 l of cell suspension from the sample buffer including the swab into a salt enrichment broth .
this was followed by incubation for 1824 hours in air at 35c and the subculture onto appropriate culture media .
descriptive statistical performance characteristics were calculated for the bd geneohm mrsa and vanr assays relative to gold standard direct culture and broth enrichment culture results . the sensitivity , specificity , positive predictive value ( ppv ) , and negative predictive value ( npv ) were calculated according to standard formulas .
for detection of mrsa , a total of 2283 swabs were collected and tested as described above .
thirty - two ( 32 ) specimens were inhibited in the pcr assay with an initial unresolved rate being 1.4% of which 16 ( 0.7% ) were resolved following freeze thaw of the lysate and repeat of pcr testing .
the remaining 16 unresolved samples were excluded in the data analysis resulting in 2267 total swabs .
of the 728 nasal swabs , 35 swabs ( 4.8% ) revealed mrsa by culture . the 1539 groin swabs revealed mrsa in 32 swabs ( 2.1% ) by culture . in the bd geneohm mrsa assay , 39 nasal swabs ( 5.4% ) were positive and 52 groin swabs ( 3.4% ) were positive . tables 1 and 2
one mrsa nasal isolate was detected by culture and was negative by pcr ( false negative ) .
four nasal ( 0.5% ) and 20 groin swabs ( 1.3% ) were positive with the bd geneohm mrsa assay and did not reveal mrsa in culture ( false positive ) .
the bd geneohm mrsa assay showed sensitivity ( the proportion of actual mrsa positives which are correctly identified as such ) , specificity ( the proportion of actual mrsa negatives which are correctly identified as such ) , ppv ( the proportion of positive mrsa with pcr who are correctly diagnosed ) , and npv ( the proportion of negative mrsa with pcr who are correctly diagnosed ) of 97.2% , 99.4% , 89.7% and 99.9% , respectively for direct detection from nasal swabs . for direct detection from groin samples
table 3 shows sensitivity , specificity , ppv , and npv of the bd geneohm mrsa assay using nasal and groin swabs .
the 300 rectal swabs revealed vre in 8 samples by culture , and 292 samples were negative .
the 8 strains were e. faecium and all of them were resistant to vancomycin and sensitive to teicoplanin ( phenotype b ) .
twenty - six rectal swabs ( 8.7% ) revealed vanb gene by bd geneohm vanr assay but did not grow enterococci in culture ( false + ve ) .
the distribution of positive and negative samples by both methods is shown in table 4 .
compared to conventional culture , the bd geneohm vanr assay showed a sensitivity ( the proportion of actual vre positives which are correctly identified as such ) , specificity ( the proportion of actual vre negatives which are correctly identified as such ) , ppv ( the proportion of positive vre with pcr who are correctly diagnosed ) , and npv ( the proportion of negative vre with pcr who are correctly diagnosed ) of 100% , 91.1% , 23.5% , and 100% , respectively .
active surveillance culture from patients for carriage of mrsa and vre facilitates early contact isolation , thus preventing spread in hospital and reducing costs .
king fahad specialist hospital - dammam has guidelines for hospital wide screening of new hospital admissions for mrsa and vre .
a rapid , accurate tool that identify carriers is a key component of any infection control program to reduce transmission . in this study
, we evaluated the detection performance of the bd geneohm vanr assay , a rapid real - time pcr test that detects the presence of vana and/or vanb , and the bd geneohm mrsa assay which detects sccmec cassette and s. aureus specific sequence located within the orfx gene , allowing discrimination between mrsa and methicillin - resistant coagulase - negative staphylococci .
bd geneohm for both mrsa and vanr assays offer rapid identification of mrsa and vre colonized patients in as little as 2 hours .
the bd geneohm mrsa assay showed a high specificity with nasal and groin samples ( 99.4% and 98.7% , resp . ) .
the sensitivity was also higher in our group of patients ( 97.2% and 100% ) compared with that of lucke et al . who reported a lower sensitivity ( 84.3% ) .
this may be attributed to the type of specimens that was collected from different clinical conditions and from different sites .
therefore , we examined 1539 specimens to come across a minimum of 50 specimens that contain the target analyte and a minimum of 100 specimens that lack the target analyte .
there is a general consensus for multiple body site screening to achieve optimal detection of mrsa .
considering pooling of the specimen may reduce the cost of the assay ; bishop et al . showed sensitivities and specificities for pooled nose - groin specimen comparable to those processed separately with the bd geneohm mrsa assay . in our group ,
the ppv was 89.7% with the nasal swabs and it was diminished to 61.5% with the groin swabs .
recent studies [ 19 , 27 ] reported ppvs ranging from 63% in a community setting to 94% in hospital setting .
the high npv in this study ( nasal 99.9% and groin 100% ) and those reported by others [ 28 , 29 ] suggest that this assay provides a rapid method for the identification of persons who are not colonized with mrsa and in that context is likely to be useful for epidemiologic or surveillance activity in a hospital environment .
the 24 swabs that detected mrsa by the bd geneohm mrsa assay and were not recovered in culture may belong to patients receiving antibiotics .
the bd geneohm mrsa assay result may sometimes be unresolved and may require retesting that can lead to a delay in obtaining final results .
this problem was met with 32 of our samples and half of them were resolved after repeat testing of the corresponding frozen lysates for specimen and controls .
the frozen - thaw cycles have been shown to reduce pcr inhibitors substances in the specimen lysate [ 29 , 30 ] .
one of our mrsa isolates from the nose was not detected by the bd geneohm mrsa assay giving false negative result .
this was also reported in a study done by bartels et al . in copenhagen , as more than one - third of their mrsa isolates were not detected .
they recommended that the bd geneohm mrsa assay be evaluated against the local mrsa diversity before being established as a standard assay , and due to the constant evolution of sccmec cassettes , a continuous global surveillance is advisable in order to update the assay . in the present study ,
the bd geneohm mrsa assay had a high sensitivity ( 97% and 100% for nasal and groin swabs , resp . ) and thus , can be regarded as reliable in our hospital . in conclusion ,
the bd geneohm mrsa assay represents a reliable screening test when applied to nasal and groin specimens .
the true strength of this assay is its exceptionally high npv ( 98.9% ) making the test an ideal tool for rapid exclusion of mrsa carriers in hospitals . as a consequence ,
the bd geneohm vanr assay detected vanb gene in 34 samples , eight of them revealed e. faecium that were phenotypically vanb .
the bd geneohm vanr assay has specificity 91.1% with a positive predictive value of 23.5% .
this was explained by the high prevalence of vanb genes not associated with vre from human rectal swabs .
. demonstrated high rates of nonenterococcal vanb carriage in hemodialysis patients ( 45% ) , community adults ( 63% ) , and children ( 27% ) .
this is attributed to the presence of gut anaerobes carrying the vanb containing transposons tn 5382 and tn 1549 .
hence , a positive vanb pcr is poorly predictive and requires culture to differentiate vre positive patients from vre negative patients ( i.e. , pcr false positive ) and hence , the vanb gene is the only one detected in our group of patients . relying on a positive vanb result in our hospital would result in unnecessary utilization of hospital resources and infection control prevention measures for patients who are not harboring vre . in this study ,
we need to weigh the convenience of rapid negative results with the requirement for additional testing . in conclusion
, the bd geneohm vanr assay may be used as a rapid screening method for vana and vanb carriers , given the high sensitivity and negative predictive value .
however , the high number of false positive for vanb will necessitate culture confirmation of these results . | objectives . the aim of this study was to evaluate the diagnostic performance of bd geneohm vanr assay , a rapid pcr test that detects the presence of vana and/or vanb genes and the performance of bdgeneohm mrsa assay which detects the staphylococcal cassette chromosomemec ( sccmec cassette ) carrying the meca gene and staphylococcus aureus specific sequence located within the orfx gene . methods .
300 duplicate rectal swabs collected consecutively were analyzed for the presence of vre by culture and bd pcr .
2267 duplicate swabs were collected ( 728 nasal and 1539 groin swabs ) and analyzed for the presence of mrsa by culture method and bd pcr . results . compared to culture ,
the bd geneohm vanr assay showed a sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of 100% , 91.1% , 23.5% , and 100% , respectively .
the bd geneohm mrsa assay revealed sensitivity , specificity , ppv , and npv of 97.2% , 99.4% , 89.7% , and 99.9% , respectively , for nasal swabs . for groin swabs
, it was 100% , 98.7% , 61.5% and 100% , respectively .
conclusion .
the bd geneohm vanr assay is a good screening test for rapid exclusion of vre carriers in hospitals .
the bd geneohm mrsa assay represents a reliable screening test .
the true strength of the bd geneohm assay for mrsa and vre is its exceptionally high npv making the test an ideal tool for rapid exclusion of mrsa and vre carriers in hospitals . as a consequence ,
this would dramatically shorten the patient isolation time . |
intravenous ( iv ) drug abuse is an increasing social and health problem . repeated punctures under septic conditions along with needle sharing habits among iv drug abusers result in various vascular complications .
in addition , patients who present with these complications frequently have viral infections , which are hazardous to healthcare workers .
infected femoral artery pseudoaneurysms are one of the most common arterial complications in iv drug abusers .
this situation can not only be limb - threatening , but also be life - threatening and poses a difficult management problem for vascular surgeons all over the world .
excision and ligation of affected artery along with local debridement is traditional treatment for this difficult problem .
therefore , some vascular surgeons , advocate a more aggressive approach including concomitant revascularization using synthetic or autogenous vein grafts sited either intra- or extra - anatomically .
some vascular surgeons have adopted a more conservative approach towards revascularization as a delayed procedure . with these existing controversies of optimal surgical management of infected pseudoaneurysm
, we reviewed the epidemiology of pseudoaneurysm , surgical techniques used for their treatment and their clinical outcome in a population of iv drug abusers of northern india .
this is a retrospective descriptive study , covering the period from january 1989 to december 2008 from a tertiary care center of northern india
. medical records of 72 consecutive patients who presented with pseudoaneurysms due to iv drug abuse were reviewed .
data regarding demography , age , gender , period of iv drug abuse , site of injection , presentation , surgical management , and outcome was analyzed .
in this 20-year study period , all patients were males excepting one lady who had a brachial pseudoaneurysm .
the mean age standard deviation ( sd ) of patients was 32.7 9.6 ( range 18 - 72 ) years [ table 1 ] . out of 72 , 17 patients were unemployed and one was a student
. the mean duration of iv drug abuse was 27.3 11.2 months [ table 2 ] .
buprenorphine ( 51% ) , morphine ( 43% ) , benzodiazepines ( 22.2% ) , pentazocine ( 16.6% ) , promethazine hcl ( 16.6% ) , and pheniramine maleate ( 6.9% ) were most commonly abused drugs .
sixty - one patients had femoral , eight had brachial , two had radial , and one had an axillary pseudoaneurysms [ table 3 ] .
ten patients were hepatitis c virus ( hcv ) positive out of which two were also hepatitis b surface antigen ( hbsag ) positive .
table 4 summarizes the history , physical findings , and chief presenting features of the 72 patients who were included in this study .
forty - three patients had positive wound swab cultures and seven patients had a positive blood culture .
staphylococcus aureus ( 36.9% ) , pseudomonas ( 19.7% ) , escherichia coli ( 15.5% ) , streptococcus ( 4.1% ) , and acinetobacter ( 4.1% ) were commonly isolated organisms .
this was achieved with extra - anatomical obturator bypass with a synthetic polytetrafluoroethylene ( ptfe ) graft in one case and vein graft in other case .
seventeen patients showed signs of claudication which was mild in nature and was not affecting patient 's lifestyle and daily routine .
two patients who had severe claudication after ligation of the affected artery were readmitted for revascularization .
it was done after 4 weeks in one patient and after 3 months in other patient .
four affected lower limbs required amputation after ligation and excision of the pseudoaneurysm , all of them had gangrenous changes at the time of admission .
one patient died due to hemorrhagic shock following incisional drainage of infected pseudoaneurysm done outside .
he went into disseminated intravascular coagulation ( dic ) and died on 2 postoperative day .
age and sex distribution duration of drug abuse distribution of injection site history and physical findings of patients with infected pseudoaneurysm outcome in patients with infected pseudoaneurysm following ligation and excision
the most common arterial complication is infected pseudoaneurysm of femoral artery in iv drug abusers .
the tendency to inject in the groin area is highest as compared to other sites .
patients usually present late with complications like bleeding , sepsis , and limb ischemia due to socioeconomic problems . among
the patients studied , the first site of approach for iv access in most cases was cubital fossa , but the site most affected with pseudoaneurysm was the groin .
seventeen patients were wrongly diagnosed outside as groin abscess and underwent incision and drainage which led onto devastating bleeding in these patients .
previous studies also revealed that if general practitioners are not aware of the clinical findings of infected pseudoaneurysm , then this diagnosis can be missed .
the pathogenesis of these pseudoaneurysms in iv drug abusers consists of introduction of infected material by nonsterile techniques combined with inadvertent or intentional arterial trauma when venous access is impossible because of thrombosis . if left untreated
, they can lead to hemorrhage , sepsis , limb loss , and even death .
there is also high incidence of hiv / hbsag / hcv because of needle sharing habits .
we found broken needle tips in seven patients adjacent to the site of femoral pseudoaneurysm due to intense fibrosis .
x - ray of the site of aneurysm should always be done as a precautionary measure to avoid any needle prick during surgery . almost all the patients were males ( 98.61% ) correlating with high prevalence of male iv drug abusers .
mean age in this study population was 32.7 years , which is corresponding to most of the previous studies .
arterial pseudoaneurysms from self - injection of drugs occur most commonly in the groin region .
the most common presentations were bleeding , either spontaneous or followed by incision and drainage .
current treatment options include :
excision and debridement of infected pseudoaneurysms with ligation of affected artery without revascularizationextensive debridement of infected pseudoaneurysms with routine revascularization .
excision and debridement of infected pseudoaneurysms with ligation of affected artery without revascularization extensive debridement of infected pseudoaneurysms with routine revascularization .
this revascularization can be achieved with an autogenous or synthetic graft placed either in situ or extra - anatomically .
excision of pseudoaneurysm without arterial reconstruction has been reported by several authors as a viable option . in a study by arora
et al . , simple arterial ligation without reconstruction was done without any associated amputation and only mild claudication .
reddy carried out arterial ligation in 39 patients with two ( 5% ) postoperative amputations .
choice of graft is also a challenging issue , if revascularization is to be attempted . great saphenous vein ,
these are usually associated with high reinfection risk even when placed in extra - anatomic route through obturator foramen .
these drug dependent patients can also abuse these reconstructed vessels which is of grave consequences .
we performed excision and ligation in all patients with delayed revascularization in only two patients .
there were four amputations in this study , but these four patients had ischemic compromised limbs at the time of presentation .
seventeen patients showed signs of claudication which was mild in nature and was not affecting patient 's lifestyle and daily routine .
vascular complications caused by iv drug abuse are on the increase with infected pseudoaneurysms affecting femoral arteries as the commonest one .
high index of suspicion for infected pseudoaneurysm helps in their timely diagnosis and management . its awareness among general practitioners and surgeons
infected pseudoaneurysms should be managed by simple ligation and excision of involved vessel with delayed revascularization when required .
early reconstruction is not recommended since most of pseudoaneurysms are infected at the time of presentation .
iv drug abusers have tendency to reuse reconstructed vessels because of easy access to extra - anatomically placed subcutaneous grafts and the arterial reconstruction may be in jeopardy of recurrent infection and can be threat to life . | background : infected pseudoaneurysm in intravenous ( iv ) drug abusers is a serious clinical problem , with difficult and controversial management . with existing controversies regarding their optimal management , we present the results of simple ligation and local debridement for treatment of infected pseudoaneurysms.patients and methods : records of 72 consecutive patients with pseudoaneurysms in iv drug abusers over the last 20 years were reviewed retrospectively.results:ligation and excision of pseudoaneurysm was done in all patients with delayed revascularization in only two patients .
four patients had amputations because they had gangrenous limbs on presentation .
all other patients had healthy limbs at the time of discharge .
there were three deaths , two due to sepsis with multiorgan dysfunction and one with hemorrhagic shock.conclusion:infected pseudoaneurysm should be managed by simple ligation of involved artery with delayed revascularization , if required . |
peripheral neuropathies result when damage occurs to peripheral nerves due to a systemic disease , toxicant exposure or due to direct nerve injury .
even though the severity and symptoms depend on the causative agent and the nerve affected , neuropathic pain develops when the damage occurs to somatosensory nervous system .
in fact , neuropathic pain is the most common clinical manifestation of peripheral neuropathy resulting from diabetes , chronic alcohol intake , certain cancers , vitamin b deficiency , infections , nerve - related diseases , toxins , and certain drugs .
symptoms of peripheral nerve damage include muscle wasting and pain in motor neuropathies and dysautonomia in case of autonomic neuropathies . another way of classifying peripheral neuropathies is based on their inheritance .
genetically inherited neuropathies consist of a broad variety of diseases associated with neuronal damage like charcot marie tooth disease , familial dysautonomia , congenital neuropathies and other inherited motor , sensory , autonomic neuropathies etc .
the incidence of inherited neuropathies is genetically determined , acquired neuropathies occur in majority of cases due to a disease condition , infection , spinal cord injury or due to drug therapy .
recently it has been experimentally proved that most of these inherited and acquired neuropathies are found to be mediated through dysfunctioning of mitochondria and other important signaling pathways [ 5 - 7 ] .
innumerable number of genes associated with mitochondrial genome were found to be mutated in several inherited neuropathies . acquired neuropathies such as diabetic peripheral neuropathy , chemotherapy induced peripheral neuropathy and trauma/ injury induced neuropathies occur as a result of enhanced oxidative stress and inflammation in peripheral neurons .
mitochondria have been identified to have vital regulatory role in cellular physiology and pathology , thus attracted focus of many researchers .
indeed it has been transformed from a status of extraneous prokaryotic organelle to the organelle of potential therapeutic importance .
being a source for fundamental cellular reactive oxygen species ( ros ) , mitochondria are expected to have regulation over cellular oxidative stress and consequent inflammatory signaling .
besides that , mitochondria also plays a critical role in regulating apoptosis and bioenergetic metabolism which were known to be deregulated in various toxic neuropathies . on the whole
, the complex interwoven relation among these pathways culminates in mitochondrial dysfunction in peripheral neurons and result in nerve dysfunction .
the current review is aimed at identifying the role of mitochondrial dysfunction in peripheral neurotoxic changes associated with various acquired neuropathies .
efforts put forth by eminent neurologists in the field of mitochondrial biology could lead to the identification of several therapeutic ways of modulating mitochondrial functioning and dynamics in various neurodegenerative disorders .
those therapeutic options amenable to alter the peripheral neuropathies are discussed herein with their possible therapeutic potential .
the article also emphasizes the necessity of maintaining a healthy mitochondrial phenotype via pharmacological modulation to produce neuroprotection against various depicts associated with peripheral neuropathy .
diabetes is one of the most debilitating conditions affecting majority of people in both developed and developing countries .
one of the important vascular complications of diabetes is peripheral symmetrical polyneuropathy , which affects the nerves in the limbs .
diabetic neuropathy ( dn ) is known to have a prevalence of 50 - 60% in people with enduring diabetes . by 2035 ,
patient toll with diabetes is expected to rise to a number of 592 million ( international diabetes federation ) . with dn ,
patient experiences progressive increase in unpleasant sensory symptoms including tingling , burning , shooting , lancinating , contact pain , abnormal sensation to heat and cold , persistent aching in the limbs and cramp like sensations in the feet .
though the etiology of neuropathy may differ depending on types of diabetes , pathophysiology may underlie a unifying mechanism i.e. hyperglycemic injury to peripheral neurons .
hyperglycemic neuronal damage is predominantly mediated through the enhanced generation of ros , lack of proper bioenergetic supply , increased activation of pro - inflammatory markers , inefficient removal of damaged proteins and organelles [ 14 , 15 ] . furthermore , lack of insulinotropic support to neurons makes them deprived of the growth signals .
it has been also identified that glucose induced generation of advanced glycation end products activates the nuclear factor kappa light chain enhancer of b cells ( nf-b ) and leads to production of several proinflammatory mediators resulting in neuroinflammation , a predecessor to peripheral myelin damage .
all these events occur individually or in combination with others , mediate peripheral nerve damage and eventually leads to neuropathy ( fig .
chronic dn results in amputations or limb loss which is known to affect major proportion of diabetic patients in us and other developed countries .
several treatment options that are available for dn could relieve only symptoms of neuropathy , by virtue of their effect on neurotransmission .
examples include sodium valproate , duloxetine , paroxetine , carbamazepine , pregabalin and gabapentin . despite their efficacy to relieve symptoms of neuropathic pain ,
they were found to be ineffective in complete eradication of neuronal dysfunction associated with hyperglycemia .
significant work done in last two decades to understand the molecular pathology to a considerable extent , has helped and provided directions to discover new therapeutic strategies for the treatment of neuropathy .
however , translational failures have resulted in pursuit for an ideal therapeutic intervention for management of dn .
several lines of evidence have clearly shown that hyperglycemia impairs mitochondrial structure , function and dynamics [ 6 , 8 ] .
in fact , the hyperglycemic overload on neuronal cells and activation of various metabolic pathways co - integrate through mitochondrial generation of reactive oxygen species ( ros ) .
mitochondria have been proven experimentally to be a principle mediator of apoptosis , redox and inflammatory pathways which play major role in the pathophysiology of dn [ 22 , 23 ] .
in addition to the dysfunction , impaired mitochondrial fusion , excessive fission and aberrant axonal transport of mitochondria are also being suspected in contribution of damage in peripheral nerves of diabetic patients resulting in production of small , fragmented and non functional mitochondria which precipitate neurodegeneration .
defective autophagy / mitophagy signaling is known to occur in metabolic conditions like insulin resistance , diabetes and is expected to be impaired in dn , a metabolic disease of peripheral nervous system .
hence , identification of drugs which sustain the mitochondrial function and health could aid the search of finding a better therapeutic strategy , which might open new vistas in the treatment of dn .
peripheral neuropathy is a set of symptoms caused by the damage of the peripheral nerves and spinal cord .
cipn is caused by neuronal derangement due to chemotherapeutic agents and most of the time stands as a severe dose limiting and disabling side effects . some of the common agents which causes cipn includes taxanes , vinca alkaloids , platinum compounds and also newer effective anticancer agents like bortezomib .
it is the most prevalent neurological complication of chronic cancer treatment and affects almost 30 - 40% of patients receiving chemotherapy .
the increased incidence of cipn in patients is a cause of concern and is also influenced by factors like patient s age , dose intensity , cumulative dose , therapy duration and pre - existing conditions like alcoholism , diabetes etc .
however , 60% of incidence has been reported with the usage of taxanes , vinca alkaloids , platinum compounds and bortezomib .
oxaliplatin , a third generation platinum compound reported to cause peripheral neuropathy in 29 - 67% , whereas bortezomib indicated for multiple myeloma , incidences up to 64% have recently been reported .
symptoms of cipn include a blend of sensory , sensorimotor and autonomic nerve dysfunction symptoms resulting in aberrant somatosensory processing of peripheral and central nervous system .
peripheral neuropathy seriously affects both small fiber axons that cause shooting pain , tingling sensation , numbness , cold sensitivity etc . , and large fiber sensory axons that affect proprioception and strength of muscles .
the common clinical symptoms begin with paresthesias and dysesthesias in feet that spread proximally to affect the lower and upper extremities in a characteristic glove and stocking distribution .
cipn can persist from months to years , reversible or irreversible beyond the chemotherapy completion , extremely painful and disabling that impairs the functional capacity and compromising the quality of life .
therapeutic management of cipn still remained as a difficult task in cancer therapeutics as it ruins the oncological prognosis and quality of life .
taxanes , vinca alkaloids , platinum compounds and bortezomib are the major group of chemotherapeutic drugs that adversely affect the peripheral nervous system through dissimilar mechanisms as shown in fig .
all these mechanisms culminate in damage to the sensory neurons such as a and c fibers , leading to neuropathic pain characterized by hyperalgesia and allodynia .
however , oxidative stress and mitochondrial dysfunction have been suggested to be major contributors in the pathophysiology of cipn .
vinca alkaloids like vincristine and vinblastine are widely used chemotherapeutics for the treatment of non hodgkin s lymphoma , hodgkin s lymphoma and acute lymphoblastic leukemia are reported to cause symmetric distal sensory neuropathy in patients .
the features of vincristine induced neuropathy are found to be mediated through the actions of a second messenger , nitric oxide ( no ) and the other inflammatory mediators .
recent studies indicated the impairment of several genes concerned with mitochondrial function in vincristine induced peripheral neuropathy , which rendering the possible involvement of mitochondrial dysfunction and corresponding oxidative stress generation in the disease pathology .
the axonopathy and axon transport failure resultant of vinca alkaloid chemotherapy may be due to mitochondrial dysfunction and bioenergetic failure apart from the microtubule dysfunction [ 29 , 32 ] .
the vincristine induced neurotoxicity is produced due to the peroxynitrite induced dna damage and the poly adp ribose polymerase ( parp ) enzyme overactivation which directly activates the mitochondrial mediated apoptosis and neurodegeneration through bioenergetic failure [ 33 , 34 ] .
cisplatin is mainly used to treat solid malignancies like small cell lung cancer and ovarian cancer .
oxaliplatin is widely used in combination with fluorouracil for the treatment of colorectal cancer under the trade name of folfox .
these platinum compounds accumulate in the neurons ; generate ros and damage dna by forming pt - dna adducts with ndna ( nuclear dna ) and mt dna ( mitochondrial dna ) that induces neuronal apoptosis [ 37 - 39 ] .
this cumulative dna damage also activates parp enzyme which causes bioenergetic depletion and drives the cell towards death .
the mt - dna damage results in the production of defective etc components which further increases the accumulation of ros and causes mitochondrial dysfunction [ 41 , 42 ] .
several in vitro and in vivo studies proved the involvement of nitro oxidative stress and loss of antioxidant defense with the platinum compounds induced peripheral neuropathy [ 43 , 44 ] .
platinum antineoplastic agents have been shown to reduce plasma antioxidant levels , due to oxidative stress in human studies .
recent insights in molecular studies have proved the involvement of mitochondrial dysfunction and reduced mitochondrial membrane potential in the disease pathogenesis .
several other intervention studies conducted using antioxidants attenuated the neuropathic pain symptoms , thereby confirming the hypothesis that the platinum compounds induced neuronal damage is through the increased oxidative , nitrosative stress [ 46 , 47 ] .
neurotoxicity induced by these compounds has been explained as channelopathy as they alter the function of voltage gated ion channels .
especially oxaliplatin induced neurotoxicity have long been attributed to oxalate , its metabolite which could disrupt ca channels by chelating ca and also inhibit nerve growth factor ( ngf ) mediated neuronal growth .
oxaliplatin induced channelo- pathy can be correlated to the mitochondrial dysfunction attributed bioenergetic failure [ 49 , 50 ] .
the taxane derivatives like paclitaxel and docetaxel have been found to cause sensorimotor axonal polyneuropathy .
paclitaxel is widely used to treat kaposi s sarcoma whereas docetaxel is used for the treatment of breast and prostate cancers .
being microtubule stabilizers , they were thought to mediate the neuronal damage through interfering with microtubule function and axonal transport [ 37 , 51 ] .
recent experimental studies showed that the neuronal injury in pns leads to the formation of peroxynitrite followed by the activation of nitric oxide synthase ( nos ) , nadph oxidase and inactivation of mnsod at spinal level through the release of cytokines on glial cell activation contributes to taxane induced neuropathic pain [ 52 , 53 ] .
some recent studies also exemplified the involvement of peroxynitrite mediated damage to the glial derived proteins known to be involved in glutaminergic transmission in paclitaxel induced peripheral neuropathy .
recent reports suggest that the possible link between oxidative stress and mitochondrial dysfunction ; associated with swollen and vacuolated mitochondria in peripheral neurons of paclitaxel treated rats that further fortify the oxidative stress induced mitotoxicity hypothesis in the pathogenesis of taxane induced neuropathic pain [ 42 , 55 ] .
bortezomib , a proteasome inhibitor widely used to treat multiple myeloma has also been known to induce peripheral neuropathy in 30% of patients .
bortezomib induced neuronal dysfunction is characterized by interference with transcription , nuclear processing , transport and cytoplasmic translation of mrna s in the drg neurons which might be due to the accumulation of aggresomes resulted through the proteasome inhibition .
these aggresomes also induce endoplasmic reticulum and mitochondrial stress , which is evident from the presence of vacuolated and swollen organelles in the neurons of animals with bortezomib induced peripheral neuropathy ( bipn ) .
this ultimately results in mitochondrial dysfunction and accumulation of free radicals [ 58 - 60 ] .
, genetic studies have been performed to identify the markers of increased susceptibility to bipn , which revealed that there is a loss of mnsod function in bortezomib treated patients which make neurons more susceptible to the oxidative stress .
this might be due to the posttranslational nitration of mnsod by nitro oxidative stress and experimental studies also proved the decreased incidence of bipn with peroxynitrite scavengers . on a whole , oxidative stress and mitochondrial impairment
although the symptoms of cipn are similar to the diabetic neuropathy , its treatment may not necessarily be helpful for preventing or treating cipn .
current treatment for cipn is based on two pillars ; one is prevention/ prophylactic treatment where antioxidants , nutraceuticals , vitamins , minerals , chelating agents and neurotrophic factors which are administered to achieve the neuroprotective effect and the other option is symptomatic treatment for the existing cipn where analgesic therapeutics like steroids , tricyclic antidepressants , anticonvulsants , opioids etc .
the treatment options and therapeutics used for cipn have been giving only symptomatic relief , but the effective treatment to prevent or cure the cipn has to be found .
this is due to the existence of unmet clinical needs like questionable safety and efficacy of present drugs , spontaneous improvement of symptoms in many cases and partial success which may be completely reversible .
finding an effective treatment to prevent or cure cipn is challenging today , because of the limited research on the pathobiology of cipn , ambiguity in understanding the pathomechanisms , lack of standard diagnostic methods to detect cipn etc .
as the role of oxidative stress and mitochondrial dysfunction has recently surfaced in the cipn pathogenesis , modulating the mitochondrial pathways using pharmacological interventions could be beneficial in the prevention or cure of the cipn .
neuropathic pain , a consequence of nerve injury of peripheral nervous tissue with allodynia and hyperalgesia as characteristic features , is one of the neurodegenerative diseases that reduces quality of life , decreases ability to participate in daily routines and compromises patients social life .
it is one of the challenges for clinicians , as it is serious and treatment resistant type of chronic pain .
the major nerve injury induced neuropathic pain has been identified to be a result of trauma or surgery induced peripheral neuropathy . the exact incidence of this type of neuropathy is difficult to define because of the heterogeneity and quality of studies .
a latest study uncovered that peripheral nerve injuries were 87% of trauma and 12% owing to surgery .
nerve injuries occurred 81% of the instance in the upper extremities and 11% in the lower extremities , with the balance in other areas .
clinical symptoms of neuropathic pain are characterized by abnormalities in the pain sensation which may be stimulus independent sensations like shooting pain , burning , tingling and numbness whereas , a stimulus evoked pain perceptions including thermal & mechanical hyperalgesia , tactile allodynia and sometimes negative symptoms like hypoalgesia .
it has been well demonstrated that next to the peripheral nerve injury the neuroinflammatory cascade of events and structural and functional alterations affects the peripheral nervous system , including nerve endings , afferent fibers , drg and also central afferent terminals in the spinal cord .
this results in events like nociceptor sensitization , ectopic discharges , collateral sprouting , central sensitization and disinhibition .
peripheral nerve injury follows spontaneous discharge of inflammatory mediators and other modulators like proteinases , prostaglandins ( pg s ) , atp , serotonin , substance p , bradykinin , nerve growth factor ( ngf ) etc .
. then , inflammatory mediators induce hyperexcitability in the neurons resulting in short term peripheral sensitization ( fig .
3 ) . nerve injury also affects the voltage gated ion channels along with the length of the sensory axons and drg which can cause ectopic discharges .
these changes in the peripheral nervous system activate stress signaling pathways like pkc , erk , camkii etc .
, in central afferent fibers resulting in altered gene expression of receptors like nmda , ampa , neurokinin-1 ( nk-1 ) , tyrosine kinase b etc .
these changes may also jointly contribute to long term sensitization due to an increase in excitatory synaptic transmission central sensitization .
in addition to these changes , there occurs a phenomenon called disinhibition i.e. inhibition of inhibitory neurotransmitters ( gaba and glycine ) which further provoke the sensitization process .
therefore , injury induced neuropathic pain can be said to be a consequence of peripheral and central sensitization but the mounting evidence proposed that the oxidative stress induced organelle damage and neuroinflammation are also the major contributors to the pathogenesis of neuropathic pain [ 71 , 72 ] .
it has been recently revealed that next to the nerve injury the inflammatory mediators not only produced at the site of injury through immune cells and schwann cells but also due to glial cell activation .
the activated and proliferated glial cells upregulate several signaling pathways like erk , nf-b , jnk etc . , which are the key mediators of oxidative stress , neuroinflammation and apoptosis [ 74 , 75 ] .
research evidences suggest that mapk and ngf starvation leads to apoptosis in the nerves confirmed by tunel assay .
cell death after injury is associated with alteration in the ratio of bcl-2 to bax leading to mitochondrial mediated apoptosis .
nf-b induced nitric oxide ( no ) synthesis and release of tnf- , il-1 , and il-6 , causes oxidant induced damage to the cell organelles like endoplasmic reticulum and mitochondria .
recent studies also examined that decrease in the expression of mitochondrial atp synthase after the sciatic nerve injury causes bioenergetic deficits .
thus , protection of mitochondria from inflammatory mediators induced damage through oxidative stress is essential to maintain cellular quality and nervous tissue function .
pharmacological treatment for neuropathic pain include tricyclic antidepressants ( amitriptyline ) , serotonin noradrenaline reuptake inhibitors ( venlafaxine , duloxetine ) , anticonvulsants ( pregabalin , gabapentin , carbamazepine ) , opioids analgesics ( morphine , oxycodeine ) and miscellaneous analgesics like capsaicin , lidocaine patches , nmda antagonist , botulinum toxin , cannabinoids .
these pharmacological agents provide symptomatic relief and acts by virtue of their effects on neurotransmission .
but recent lines of evidence suggest that nerve injury induced neuropathic pain is not merely a symptom of disease , but also a consequence of the aberrant functioning of peripheral nervous system induced by oxidative stress directed neuronal organelle dysfunction and microglia activated neuroinflammatory pathways .
therefore , we need to focus on preventing the oxidative stress and neuroinflammation induced neurodegeneration due to the organelle dysfunction .
treatment for neuropathic pain today is an uphill battle for clinicians as the pathogenic mechanism underlying the pain is poorly known and also due to the existing difficulty in distinguishing between nociceptive and neuropathic pain .
currently existing remedies for neuropathic pain are not effective and associated with severe adverse effects .
the major unmet clinical needs include , their effectiveness is variable among the patients and sometimes relief from the symptoms is only partial [ 2 , 64 ] .
diabetes is one of the most debilitating conditions affecting majority of people in both developed and developing countries .
one of the important vascular complications of diabetes is peripheral symmetrical polyneuropathy , which affects the nerves in the limbs .
diabetic neuropathy ( dn ) is known to have a prevalence of 50 - 60% in people with enduring diabetes . by 2035 ,
patient toll with diabetes is expected to rise to a number of 592 million ( international diabetes federation ) . with dn ,
patient experiences progressive increase in unpleasant sensory symptoms including tingling , burning , shooting , lancinating , contact pain , abnormal sensation to heat and cold , persistent aching in the limbs and cramp like sensations in the feet . though the etiology of neuropathy may differ depending on types of diabetes , pathophysiology may underlie a unifying mechanism i.e. hyperglycemic injury to peripheral neurons .
hyperglycemic neuronal damage is predominantly mediated through the enhanced generation of ros , lack of proper bioenergetic supply , increased activation of pro - inflammatory markers , inefficient removal of damaged proteins and organelles [ 14 , 15 ] . furthermore , lack of insulinotropic support to neurons makes them deprived of the growth signals .
it has been also identified that glucose induced generation of advanced glycation end products activates the nuclear factor kappa light chain enhancer of b cells ( nf-b ) and leads to production of several proinflammatory mediators resulting in neuroinflammation , a predecessor to peripheral myelin damage .
all these events occur individually or in combination with others , mediate peripheral nerve damage and eventually leads to neuropathy ( fig .
chronic dn results in amputations or limb loss which is known to affect major proportion of diabetic patients in us and other developed countries .
several treatment options that are available for dn could relieve only symptoms of neuropathy , by virtue of their effect on neurotransmission .
examples include sodium valproate , duloxetine , paroxetine , carbamazepine , pregabalin and gabapentin . despite their efficacy to relieve symptoms of neuropathic pain ,
they were found to be ineffective in complete eradication of neuronal dysfunction associated with hyperglycemia .
significant work done in last two decades to understand the molecular pathology to a considerable extent , has helped and provided directions to discover new therapeutic strategies for the treatment of neuropathy . however , translational failures have resulted in pursuit for an ideal therapeutic intervention for management of dn .
several lines of evidence have clearly shown that hyperglycemia impairs mitochondrial structure , function and dynamics [ 6 , 8 ] .
in fact , the hyperglycemic overload on neuronal cells and activation of various metabolic pathways co - integrate through mitochondrial generation of reactive oxygen species ( ros ) .
mitochondria have been proven experimentally to be a principle mediator of apoptosis , redox and inflammatory pathways which play major role in the pathophysiology of dn [ 22 , 23 ] .
in addition to the dysfunction , impaired mitochondrial fusion , excessive fission and aberrant axonal transport of mitochondria are also being suspected in contribution of damage in peripheral nerves of diabetic patients resulting in production of small , fragmented and non functional mitochondria which precipitate neurodegeneration .
defective autophagy / mitophagy signaling is known to occur in metabolic conditions like insulin resistance , diabetes and is expected to be impaired in dn , a metabolic disease of peripheral nervous system . hence ,
identification of drugs which sustain the mitochondrial function and health could aid the search of finding a better therapeutic strategy , which might open new vistas in the treatment of dn .
peripheral neuropathy is a set of symptoms caused by the damage of the peripheral nerves and spinal cord .
cipn is caused by neuronal derangement due to chemotherapeutic agents and most of the time stands as a severe dose limiting and disabling side effects .
some of the common agents which causes cipn includes taxanes , vinca alkaloids , platinum compounds and also newer effective anticancer agents like bortezomib .
it is the most prevalent neurological complication of chronic cancer treatment and affects almost 30 - 40% of patients receiving chemotherapy .
the increased incidence of cipn in patients is a cause of concern and is also influenced by factors like patient s age , dose intensity , cumulative dose , therapy duration and pre - existing conditions like alcoholism , diabetes etc .
however , 60% of incidence has been reported with the usage of taxanes , vinca alkaloids , platinum compounds and bortezomib .
oxaliplatin , a third generation platinum compound reported to cause peripheral neuropathy in 29 - 67% , whereas bortezomib indicated for multiple myeloma , incidences up to 64% have recently been reported .
symptoms of cipn include a blend of sensory , sensorimotor and autonomic nerve dysfunction symptoms resulting in aberrant somatosensory processing of peripheral and central nervous system .
peripheral neuropathy seriously affects both small fiber axons that cause shooting pain , tingling sensation , numbness , cold sensitivity etc . , and large fiber sensory axons that affect proprioception and strength of muscles .
the common clinical symptoms begin with paresthesias and dysesthesias in feet that spread proximally to affect the lower and upper extremities in a characteristic glove and stocking distribution .
cipn can persist from months to years , reversible or irreversible beyond the chemotherapy completion , extremely painful and disabling that impairs the functional capacity and compromising the quality of life .
therapeutic management of cipn still remained as a difficult task in cancer therapeutics as it ruins the oncological prognosis and quality of life .
taxanes , vinca alkaloids , platinum compounds and bortezomib are the major group of chemotherapeutic drugs that adversely affect the peripheral nervous system through dissimilar mechanisms as shown in fig .
all these mechanisms culminate in damage to the sensory neurons such as a and c fibers , leading to neuropathic pain characterized by hyperalgesia and allodynia .
however , oxidative stress and mitochondrial dysfunction have been suggested to be major contributors in the pathophysiology of cipn .
vinca alkaloids like vincristine and vinblastine are widely used chemotherapeutics for the treatment of non hodgkin s lymphoma , hodgkin s lymphoma and acute lymphoblastic leukemia are reported to cause symmetric distal sensory neuropathy in patients .
the features of vincristine induced neuropathy are found to be mediated through the actions of a second messenger , nitric oxide ( no ) and the other inflammatory mediators .
recent studies indicated the impairment of several genes concerned with mitochondrial function in vincristine induced peripheral neuropathy , which rendering the possible involvement of mitochondrial dysfunction and corresponding oxidative stress generation in the disease pathology .
the axonopathy and axon transport failure resultant of vinca alkaloid chemotherapy may be due to mitochondrial dysfunction and bioenergetic failure apart from the microtubule dysfunction [ 29 , 32 ] .
the vincristine induced neurotoxicity is produced due to the peroxynitrite induced dna damage and the poly adp ribose polymerase ( parp ) enzyme overactivation which directly activates the mitochondrial mediated apoptosis and neurodegeneration through bioenergetic failure [ 33 , 34 ] .
cisplatin is mainly used to treat solid malignancies like small cell lung cancer and ovarian cancer .
oxaliplatin is widely used in combination with fluorouracil for the treatment of colorectal cancer under the trade name of folfox .
these platinum compounds accumulate in the neurons ; generate ros and damage dna by forming pt - dna adducts with ndna ( nuclear dna ) and mt dna ( mitochondrial dna ) that induces neuronal apoptosis [ 37 - 39 ] .
this cumulative dna damage also activates parp enzyme which causes bioenergetic depletion and drives the cell towards death .
the mt - dna damage results in the production of defective etc components which further increases the accumulation of ros and causes mitochondrial dysfunction [ 41 , 42 ] .
several in vitro and in vivo studies proved the involvement of nitro oxidative stress and loss of antioxidant defense with the platinum compounds induced peripheral neuropathy [ 43 , 44 ] . platinum
antineoplastic agents have been shown to reduce plasma antioxidant levels , due to oxidative stress in human studies .
recent insights in molecular studies have proved the involvement of mitochondrial dysfunction and reduced mitochondrial membrane potential in the disease pathogenesis .
several other intervention studies conducted using antioxidants attenuated the neuropathic pain symptoms , thereby confirming the hypothesis that the platinum compounds induced neuronal damage is through the increased oxidative , nitrosative stress [ 46 , 47 ] .
neurotoxicity induced by these compounds has been explained as channelopathy as they alter the function of voltage gated ion channels .
especially oxaliplatin induced neurotoxicity have long been attributed to oxalate , its metabolite which could disrupt ca channels by chelating ca and also inhibit nerve growth factor ( ngf ) mediated neuronal growth .
oxaliplatin induced channelo- pathy can be correlated to the mitochondrial dysfunction attributed bioenergetic failure [ 49 , 50 ] .
the taxane derivatives like paclitaxel and docetaxel have been found to cause sensorimotor axonal polyneuropathy .
paclitaxel is widely used to treat kaposi s sarcoma whereas docetaxel is used for the treatment of breast and prostate cancers .
being microtubule stabilizers , they were thought to mediate the neuronal damage through interfering with microtubule function and axonal transport [ 37 , 51 ] .
recent experimental studies showed that the neuronal injury in pns leads to the formation of peroxynitrite followed by the activation of nitric oxide synthase ( nos ) , nadph oxidase and inactivation of mnsod at spinal level through the release of cytokines on glial cell activation contributes to taxane induced neuropathic pain [ 52 , 53 ] .
some recent studies also exemplified the involvement of peroxynitrite mediated damage to the glial derived proteins known to be involved in glutaminergic transmission in paclitaxel induced peripheral neuropathy .
recent reports suggest that the possible link between oxidative stress and mitochondrial dysfunction ; associated with swollen and vacuolated mitochondria in peripheral neurons of paclitaxel treated rats that further fortify the oxidative stress induced mitotoxicity hypothesis in the pathogenesis of taxane induced neuropathic pain [ 42 , 55 ] .
bortezomib , a proteasome inhibitor widely used to treat multiple myeloma has also been known to induce peripheral neuropathy in 30% of patients .
bortezomib induced neuronal dysfunction is characterized by interference with transcription , nuclear processing , transport and cytoplasmic translation of mrna s in the drg neurons which might be due to the accumulation of aggresomes resulted through the proteasome inhibition .
these aggresomes also induce endoplasmic reticulum and mitochondrial stress , which is evident from the presence of vacuolated and swollen organelles in the neurons of animals with bortezomib induced peripheral neuropathy ( bipn ) .
this ultimately results in mitochondrial dysfunction and accumulation of free radicals [ 58 - 60 ] . some patients develop severe neuropathy even at conventional dose . as a result
, genetic studies have been performed to identify the markers of increased susceptibility to bipn , which revealed that there is a loss of mnsod function in bortezomib treated patients which make neurons more susceptible to the oxidative stress .
this might be due to the posttranslational nitration of mnsod by nitro oxidative stress and experimental studies also proved the decreased incidence of bipn with peroxynitrite scavengers . on a whole , oxidative stress and mitochondrial impairment are underpinning the pathobiology of cipn .
although the symptoms of cipn are similar to the diabetic neuropathy , its treatment may not necessarily be helpful for preventing or treating cipn .
current treatment for cipn is based on two pillars ; one is prevention/ prophylactic treatment where antioxidants , nutraceuticals , vitamins , minerals , chelating agents and neurotrophic factors which are administered to achieve the neuroprotective effect and the other option is symptomatic treatment for the existing cipn where analgesic therapeutics like steroids , tricyclic antidepressants , anticonvulsants , opioids etc . , are advised which relieve the unremitting pain of cipn . till date
the treatment options and therapeutics used for cipn have been giving only symptomatic relief , but the effective treatment to prevent or cure the cipn has to be found .
this is due to the existence of unmet clinical needs like questionable safety and efficacy of present drugs , spontaneous improvement of symptoms in many cases and partial success which may be completely reversible .
finding an effective treatment to prevent or cure cipn is challenging today , because of the limited research on the pathobiology of cipn , ambiguity in understanding the pathomechanisms , lack of standard diagnostic methods to detect cipn etc .
as the role of oxidative stress and mitochondrial dysfunction has recently surfaced in the cipn pathogenesis , modulating the mitochondrial pathways using pharmacological interventions could be beneficial in the prevention or cure of the cipn .
neuropathic pain , a consequence of nerve injury of peripheral nervous tissue with allodynia and hyperalgesia as characteristic features , is one of the neurodegenerative diseases that reduces quality of life , decreases ability to participate in daily routines and compromises patients social life .
it is one of the challenges for clinicians , as it is serious and treatment resistant type of chronic pain .
the major nerve injury induced neuropathic pain has been identified to be a result of trauma or surgery induced peripheral neuropathy . the exact incidence of this type of neuropathy is difficult to define because of the heterogeneity and quality of studies .
a latest study uncovered that peripheral nerve injuries were 87% of trauma and 12% owing to surgery .
nerve injuries occurred 81% of the instance in the upper extremities and 11% in the lower extremities , with the balance in other areas .
clinical symptoms of neuropathic pain are characterized by abnormalities in the pain sensation which may be stimulus independent sensations like shooting pain , burning , tingling and numbness whereas , a stimulus evoked pain perceptions including thermal & mechanical hyperalgesia , tactile allodynia and sometimes negative symptoms like hypoalgesia .
it has been well demonstrated that next to the peripheral nerve injury the neuroinflammatory cascade of events and structural and functional alterations affects the peripheral nervous system , including nerve endings , afferent fibers , drg and also central afferent terminals in the spinal cord .
this results in events like nociceptor sensitization , ectopic discharges , collateral sprouting , central sensitization and disinhibition .
peripheral nerve injury follows spontaneous discharge of inflammatory mediators and other modulators like proteinases , prostaglandins ( pg s ) , atp , serotonin , substance p , bradykinin , nerve growth factor ( ngf ) etc .
. then , inflammatory mediators induce hyperexcitability in the neurons resulting in short term peripheral sensitization ( fig .
3 ) . nerve injury also affects the voltage gated ion channels along with the length of the sensory axons and drg which can cause ectopic discharges .
these changes in the peripheral nervous system activate stress signaling pathways like pkc , erk , camkii etc .
, in central afferent fibers resulting in altered gene expression of receptors like nmda , ampa , neurokinin-1 ( nk-1 ) , tyrosine kinase b etc . these changes may also jointly contribute to long term sensitization due to an increase in excitatory synaptic transmission central sensitization .
in addition to these changes , there occurs a phenomenon called disinhibition i.e. inhibition of inhibitory neurotransmitters ( gaba and glycine ) which further provoke the sensitization process .
therefore , injury induced neuropathic pain can be said to be a consequence of peripheral and central sensitization but the mounting evidence proposed that the oxidative stress induced organelle damage and neuroinflammation are also the major contributors to the pathogenesis of neuropathic pain [ 71 , 72 ] .
it has been recently revealed that next to the nerve injury the inflammatory mediators not only produced at the site of injury through immune cells and schwann cells but also due to glial cell activation .
the activated and proliferated glial cells upregulate several signaling pathways like erk , nf-b , jnk etc . ,
which are the key mediators of oxidative stress , neuroinflammation and apoptosis [ 74 , 75 ] .
research evidences suggest that mapk and ngf starvation leads to apoptosis in the nerves confirmed by tunel assay .
cell death after injury is associated with alteration in the ratio of bcl-2 to bax leading to mitochondrial mediated apoptosis .
nf-b induced nitric oxide ( no ) synthesis and release of tnf- , il-1 , and il-6 , causes oxidant induced damage to the cell organelles like endoplasmic reticulum and mitochondria .
recent studies also examined that decrease in the expression of mitochondrial atp synthase after the sciatic nerve injury causes bioenergetic deficits .
thus , protection of mitochondria from inflammatory mediators induced damage through oxidative stress is essential to maintain cellular quality and nervous tissue function . pharmacological treatment for neuropathic
pain include tricyclic antidepressants ( amitriptyline ) , serotonin noradrenaline reuptake inhibitors ( venlafaxine , duloxetine ) , anticonvulsants ( pregabalin , gabapentin , carbamazepine ) , opioids analgesics ( morphine , oxycodeine ) and miscellaneous analgesics like capsaicin , lidocaine patches , nmda antagonist , botulinum toxin , cannabinoids .
these pharmacological agents provide symptomatic relief and acts by virtue of their effects on neurotransmission .
but recent lines of evidence suggest that nerve injury induced neuropathic pain is not merely a symptom of disease , but also a consequence of the aberrant functioning of peripheral nervous system induced by oxidative stress directed neuronal organelle dysfunction and microglia activated neuroinflammatory pathways .
therefore , we need to focus on preventing the oxidative stress and neuroinflammation induced neurodegeneration due to the organelle dysfunction .
treatment for neuropathic pain today is an uphill battle for clinicians as the pathogenic mechanism underlying the pain is poorly known and also due to the existing difficulty in distinguishing between nociceptive and neuropathic pain .
currently existing remedies for neuropathic pain are not effective and associated with severe adverse effects .
the major unmet clinical needs include , their effectiveness is variable among the patients and sometimes relief from the symptoms is only partial [ 2 , 64 ] .
peripheral nervous system ( pns ) is vulnerable to a plethora of pathophysiological insults ranging from metabolic , inflammatory damage to trauma / injuries .
lack of efficient blood nerve barrier system and lymph drainage , directly expose neurons to neurotoxins thus making them susceptible to damage . since , peripheral neurons require high energy for their functioning and mitochondria are the principal source of cellular energy , most of these neurotoxins known to act by a common mechanism of mitochondrial injury i.e. mitotoxicity .
sensory neurons are more susceptible to the hyper- glycemic , chemotherapeutic insults as they contain long mitochondria rich axons that directly access blood supply .
mitochondria are crucial cell organelles involved majorly in energy production , calcium homeostasis , maintenance of membrane potential , release and uptake of neurotransmitters at synapses .
mitochondrial dynamic functions are required for axonal transport and for facilitating exocytosis mediated neurotransmitter release which helps in preserving neuronal plasticity .
growing pool of evidence suggests that peripheral neuropathies are resultant of dysfunctional mitochondrial metabolism , functioning and dynamics [ 7 , 71 ] .
the mechanism of mitotoxicity and underlying neurodegeneration has been well characterized in neurodegenerative disorders but , less explained in the case of peripheral neuropathies .
the following discussion briefly summarizes the role of mitochondria and associated pathways in the pathophysiology of various peripheral neuropathies .
hyperglycaemia and chemotherapy are known to generate oxidative stress in the neuronal cells through their effect on mitochondria .
the higher metabolic flux through etc is the cause for ros in the case of hyperglycemia whereas the mitochondrial dna ( mtdna ) damage is the basis for chemotherapeutic insult [ 83 , 84 ] .
structural damage to the mitochondria is manifested in the form of reduced membrane integrity , causing cytochrome c translocation , mtdna damage resulting in accumulation of swollen , vacuolated mitochondria [ 42 , 85 ] .
functional disturbances associated with damaged mitochondria includes , reduced atp supply through etc chain , loss of membrane potential , release of pro apoptotic mediators from mitochondria to cytosol through the opening of mitochondrial permeability transition pore ( mptp ) and calcium dyshomeostasis .
in addition to the role of neuronal mitochondria , mitochondria of schwann cells are also found to be essential for maintaining high metabolic activity in neurons , which is crucial for neurotransmission .
hyperglycemic insult may lead to altered proteome of schwann cells , even in absence of oxidative stress .
oxidative damage induced production of cellular byproducts like 4-hydroxy nonenal ( 4-hne ) , malondialdehyde ( mda ) alters mitochondrial physiology and functioning by forming mitochondrial protein adducts .
nitrosative stress is also known to profoundly affect mitochondrial function through peroxynitrite focused etc damage and inhibiting the import of specific nuclear proteins into mitochondria .
a burst release of ros / rns is also responsible for depletion of several mitochondrial antioxidant enzymes such as mnsod , gsh which further aggravates the mitochondrial damage .
reduced atp / adp ratio as a consequence of failed coupling efficiency of etc chain results in bioenergetic crisis causes necrotic death of neurons .
prolonged ros production destabilizes the mtdna and cause transcriptional repression by preventing the attachment of transcription factors .
the dynamics of mitochondria i.e. fission and fusion are two important , highly regulated cellular functions which enable mitochondria to combine and distribute their components to meet cellular energy requirements and to maintain a healthy mitochondrial phenotype .
the regulation of these events is known to go awry in certain pathologies especially in diseases associated with neurodegeneration .
mitochondrial fission helps to enhance the number of mitochondria , which can be efficiently distributed to each corner of neuronal cells and thus helps them to maintain their energy demands .
mitochondrial fission is highly essential during the periods of energy starvation to produce new , efficient mitochondrial energy generating systems .
however , enhanced fission associated with bioenergetic crisis causes bax foci formation on mitochondrial membrane and thus causes mitochondrial outer membrane permeabilization ( momp ) , releasing cytochrome c and other pro apoptotic mediators into cytosol , results in apoptosis .
impairment in the mitochondrial dynamics has also been observed in case of inflammatory neuropathies and oxaliplatin induced neuropathy .
excessive nitric oxide is known to cause s - nitrosylation of dynamin related protein-1 ( drp-1 ) , and increases the mitochondrial fission [ 95 , 96 ] .
tumor necrosis factor- ( tnf- ) reported to inhibit the kinensin 1 protein , and thus impairs trafficking by halting mitochondrial movement along axons .
in addition to impaired dynamics , aggregates of abnormal shaped , damaged mitochondria are responsible for aberrant mitochondrial trafficking , which contributes to axonal degeneration observed in various peripheral neuropathies .
autophagy is the discerning cellular catabolic process responsible for recycling the damaged proteins/ organelles in the cells .
mitophagy is a selective autophagic process involved in recycling of damaged mitochondria and helps in supplying the constituents for mitochondrial biogenesis .
excessive accumulation and impaired clearance of dysfunctional mitochondria are known to be observed in various disorders associated with oxidative stress .
oxidative damage to atg 4 , a key component involved in mitophagy causes impaired autophagosome formation and clearance of damaged mitochondria .
loss in the function of molecular chaperons and associated accumulation of damaged proteins are known to be involved in various peripheral neuropathies including trauma induced neuropathy [ 102 , 103 ] .
a model of demyelinating neuropathy corresponds to the accumulation of improperly folded myelin protein pmp-22 is also being observed recently [ 104 , 105 ] .
mitochondrial dysfunction and associated disturbances are well connected to neuroinflammatory changes that occur in various neurodegenerative diseases .
several mitochondrial toxins have been found to inhibit the respiration in microglial cells and also inhibit il-4 induced alternative anti inflammatory response and thus potentiates neuroinflammation .
mitochondrial ros are well identified to be involved in several inflammatory pathways such as nf-b , mapk activation .
similarly , the pro inflammatory mediators released as a result of an inflammatory episode found to be interfere with the functioning of the mitochondrial electron transport chain and thus compromise atp production .
tnf- is known to inhibit the complex i , iv of etc and decreases energy production .
nitric oxide ( no ) is a potent inhibitor of cytochrome c oxidase ( complex iv ) and similarly il-6 is also known to enhance mitochondrial generation of superoxide .
mitochondrial dysfunction initiates inflammation by increased formation of complexes of damaged mitochondrial parts and cytoplasmic pattern recognition receptors ( prr s ) .
the resulting inflammasome directed activation of interleukin-1 production , which starts an immune response and leads to chronic inflammation .
mitochondrial dna and n - formyl peptides released from mitochondria during oxidative damage can serve as an effective damage associated molecular patterns ( damps ) , which acts on several receptors to stimulate neutrophil chemotaxis and cytokine secretion .
these damps can also activate nlrp3 ( nlr family , pyrin domain - containing 3 ) inflammasome , the inflammatory responses of which have been implicated in microbial infections , tissue damage and metabolic disturbances . in fact , traumatic injury and corresponding inflammation are considered to occur as a result of an increased burst of mitochondria at the injured site .
all together an imbalance in the ultra structure , physiology and dynamics of mitochondria results in lack of cell to cell communication , calcium buffering capacity , failure in axonal transport , neuronal and synaptic plasticity ( fig .
4 ) . these events subsequently manifest in the form of distal axonal neurodegeneration , a major feature of several peripheral neuropathies .
neurodegeneration in these types of neuropathies is associated with mitochondrial dysfunction without any clinically proved gene mutation as seen with inherited neuropathies and diseases like parkinson s , alzheimer s , huntington s etc . , but the expression of mitochondrial proteins were altered as discussed [ 4 , 9 ] .
dysfunctional mitochondria associated with neuro- degeneration results in enhanced oxidative stress , accumulation of damaged proteins/ organelles , glial inflammation and neurovascular impairment .
these strategies include a broad range of pharmacological modulators with potential effects on the function and dynamics of mitochondria and associated components . even another way of altering the mitochondrial function through genetic manipulation has been identified .
mitochondrial permeability transition pore ( mptp ) is found to be responsible for the release of certain pro apoptotic mediators from the mitochondria to cytosol and found to mediate apoptosis .
several in vitro studies have clearly indicated the possible involvement of apoptotic neuronal death as a pathophysiological damage involved in neurodegeneration .
hence , the therapeutic strategies directed at preventing neuronal apoptosis through modulation of mptp would be one of the therapeutic options .
the mptp is a protein complex present in mitochondrial membrane made of different protein subunits .
alteration in protein components can change the dynamics of mptp ; therefore such drugs can be used to target mptp .
vdac ( voltage dependent anion channel ) , hexokinase ( hk ) , cyclophilin d binding site of mptp can be pharmacologically modulated through several natural and synthetic modulators . as
increased intracellular calcium is responsible for opening mptp , interventions targeted at preventing the ca accumulation in mitochondria can also prevent mptp opening .
oxidative stress and related ros generation are identified to be responsible for etiopathogenesis of many diseases .
in fact , it is the most common mechanism of cellular / tissue damage in several disease pathologies .
a wide variety of cellular sources of ros have been identified , ranging from xanthine oxidase enzyme system to nadph oxidase system .
most of these enzymes mediate ros generation and are known to be involved in the physiological redox signaling and phagocytosis .
however , excessive oxidative stress may lead to an intense oxidative burst followed by inflammation .
mitochondrial electron transport chain ( etc ) is known to be a potential source of cellular ros mainly superoxide ( o2 ) .
this superoxide generation occurs as a result of the partial electron transfer to oxygen during their movement through redox centers in the inner mitochondrial membrane .
electron leakage or uncoupling of electron transfer through etc mainly occurs at complexes i and iii of etc , the resultant uncoupling of etc reduces atp generation .
an imbalanced mitochondrial etc functioning , oxidative stress and bioenergetic dysfunction are known to exert their pathological foot print in various peripheral neuropathies [ 42 , 122 ] .
mainly hyperglycemic and chemotherapeutic neuronal damage are associated with mitochondrial dysfunction and corresponding oxidative stress .
several therapeutic drugs directed at these mitochondrial abnormalities have been reported to benefit in various metabolic and neuro- degenerative diseases [ 123 , 124 ] .
these mitochondrial targeted drugs encompass a broad range of antioxidant molecules conjugated to a lipophilic or peptide moiety .
many of the available antioxidants are conjugated to tri phenyl phosphonium ( tpp ) , a cationic , lipophilic molecule and successfully delivered to the mitochondria .
these tpp conjugated molecules can easily cross the inner mitochondrial membrane because of its large negative charge inside the mitochondrial matrix .
similarly , antioxidant nutraceuticals have been successfully targeted to mitochondria using szeto - schiller ( ss ) peptides , which are made up of a backbone consisting of alternating four basic amino acids .
in addition to these antioxidants , mitochondrial dysfunction and associated energy depletion can be rescued by using redox active agents with mild redox potential .
these mild redox agents , regulates the electron flow through the etc chain , prevents the electron leakage and thus maintain enough atp production , which is essential for neuronal function .
the dynamic functions of mitochondria are especially important for functioning of the neurons due to their high requirement for mitochondrial atp .
some neurons have very long axons and hence maintaining the atp production far distant from cell body is highly essential to maintain vital neurotransmission and impulse conduction . in this
in addition to it , fission and fusion of mitochondria are the two important functions which keep the mitochondrial quantity at a constant number per cell .
hence modulation of these pathways by pharmacological tuning could mitigate the disease condition by facilitating mitochondrial function .
accumulation of shortened mitochondria was observed in the neurons of diabetic animals resulting in an impaired axonal transport and therefore , therapeutics aimed at inhibiting excessive mitochondrial fission ( e.g. dynamin related protein 1 ( drp1 ) inhibitors such as mdivi , dynasore etc . ) may be useful in the treatment of dn .
mitophagy is the selective removal of damaged mitochondria from the cellular system by self digestion .
mitophagy and autophagy are self driven cellular catabolic pathways during the periods of bioenergetic crisis .
accumulation of damaged mitochondria due to oxidative stress is well identified in several neuropathies and neurodegenerative diseases .
hence , efficient removal of these damaged organelles with production of new healthy mitochondria is essential to maintain neuronal health and metabolism [ 130 , 131 ] .
the protein machinery of mitophagic pathway can be pharmacologically modulated by several means ( fig . 5 ) .
for example , enhancement of mitophagy by ampk activation ( e.g. metformin ) or hdac inhibition ( e.g. valproic acid , saha ) augments the survival conditions of neurons in neuropathies and thus can be explored .
in addition to the above mentioned means of targeting mitochondria , its function can also be modulated through transcriptional regulation of various nuclear genes ( fig .
peroxisome proliferator activated receptor- coactivator-1 ( pgc-1 ) is an important transcription factor responsible for mitochondrial function and maintenance .
it enhances the production of several mitochondrial enzymes such as enzymes of the tri carboxylic acid cycle ( tca ) and fatty acid oxidation through nuclear respiratory factor-1 ( nrf-1 ) expression .
pgc-1 also plays a key role in the mitochondrial protein synthesis by increasing the production of mitochondrial transcription factor a ( tfam ) .
more convincing evidence of pgc-1 upregulation is known to enhance the nuclear erythroid factor ( nef)-2 related factor ( nrf-2 ) and thereby facilitating the production of several antioxidants such as glutathione ( gsh ) , superoxide dismutase ( sod ) , glutathione - s - transferase ( gst ) , hemeoxygenase-1 ( ho-1 ) , nadph quinone oxidase reductase-1 ( nqor-1 ) [ 137 , 138 ] .
although a physical interaction between pgc-1 and nrf2 protein has not been discovered , it has been identified that activation of one transcription factor induces the other during the period of redox imbalance .
elevated nrf2 expression effectively inhibits the cellular oxidative damage ; therefore the pgc-1 expression is not only associated with enhanced mitochondrial function but also with reduced oxidative mitochondrial damage and thus is important for maintaining a healthy mitochondrial phenotype .
several drugs are known to act as pgc-1 activators and proved to have therapeutic potential in many neurodegenerative disorders .
it has been recently observed that ppar agonists can effectively prevent the glucose induced neurotoxicity and various deficits in streptozotocin ( stz ) induced experimental dn .
recently it has been identified that pgc1 is inactivated in the dorsal root ganglion of stz induced rats .
pgc-1 null diabetic mice have shown typical features of exacerbated protein damage and nerve degeneration , which indicates the critical importance of pgc-1 mediated mitoprotection .
indeed a reduced tfam levels in the drg of diabetic rats and corresponding reduction in mt biogenesis has been identified to play an important role in the pathogenesis of dn .
tfam upregulation was found to ameliorate nerve conduction and improve the epidermal nerve fiber density in experimental dn .
being a mitochondrial sensor , pgc-1 function and expression is regulated by several cellular signaling proteins and transcription factors .
few of important upstream activators of pgc-1 include adenosine monophosphate kinase ( ampk ) and silent information regulators of transcription ( sirt-1 ) .
ampk and sirt1 act as cellular metabolic sensors which respond to the changes in level of atp and nadh respectively .
ampk is activated in response to reduced atp / adp ratio , and further activates several key metabolic pathways and inhibits anabolic pathways .
sirt-1 deacetylates several genes involved in energy utilization pathways which result in transcriptional modulation of these genes . in addition to direct action on metabolic pathways , ampk and sirt-1 are known to activate nuclear pgc-1 through direct phosphorylation and deacetylation respectively .
activation of pgc-1 by ampk and sirt-1 accelerates the mitochondrial tca cycle and free fatty acid oxidation and thus enhances bioenergetic supply .
ampk and sirt-1 are well - known to activate cellular nrf2 signaling through pgc-1 expression and found to inhibit oxidative damage by ros [ 148 , 149 ] .
further , activation of ampk and sirt-1 facilitates the cellular self digestion process , autophagy by activating its protein machinery [ 150 , 151 ] .
particularly , ampk is associated with activation of mitophagy ( an autophagic process involving the removal of damaged mitochondria ) .
the dual effect of ampk on mitophagy and pgc-1 directed transcription facilitates the replacement of cellular damaged mitochondria with new functional mitochondria .
similarly , sirt-1 is also known to activate mitophagy by indirectly regulating the nad / nadh ratio .
in addition to the above mentioned protective roles , activation of ampk and sirt1 intensifies bioenergetic supply and supports the metabolism of malnourished neurons in neurodegenerative conditions . on the whole , activation of ampk / sirt1/pgc-1 axis helps in maintaining a healthy mitochondrial pool by improving the function and by reducing oxidative damage .
thus , pharmacological activators of this pathway are expected to produce a potentially beneficial therapeutic effect in various secondary mitochondrial diseases .
the therapeutic potential of ampk and sirt1 is explored in certain neurodegenerative , metabolic diseases and their effect needs to be explored in various peripheral neuropathies . with an overwhelming evidence of mitochondrial dysfunction and oxidative stress in the pathogenesis of various peripheral neuropathies
, one can clearly state that pharmacological modulation of ampk and sirt1 offers a potential foreseeable therapeutic choice for the treatment of neuropathies .
the role of mitochondria in various physiological functions has been well characterized and realized , but the role of aberrant mitochondrial functioning and associated cellular signaling in the pathogenesis of various metabolic , neurodegenerative diseases has been observed recently . in spite of various etiological factors ,
mitochondrial pathology has been found to be a major pathomechanism underlying the neuronal dysfunction associated with peripheral neuropathies .
pharmacological modulation of mitochondria either directly or indirectly through transcriptional facilitation is expected to yield therapeutic relief from various primary and secondary mitochondrial diseases .
crosstalk among mitochondria and associated oxidative stress , energy supply , autophagy and apoptotic pathways can be better targeted for maintaining healthy mitochondrial population .
in addition to the above mentioned strategies , identification of inter organellar association between mitochondria and other organelles such as nucleus , endoplasmic reticulum could lead to provide further molecular insight into the neuropathology and can be appreciated therapeutically .
| background : peripheral neuropathies are a group of diseases characterized by malfunctioning of peripheral nervous system .
neuropathic pain , one of the core manifestations of peripheral neuropathy remains as the most severe disabling condition affecting the social and daily routine life of patients suffering from peripheral neuropathy .
method : the current review is aimed at unfolding the possible role of mitochondrial dysfunction in peripheral nerve damage and to discuss on the probable therapeutic strategies against neuronal mitotoxicity . the article also highlights the therapeutic significance of maintaining a healthy mitochondrial environment in neuronal cells via pharmacological management in context of peripheral neuropathies .
results : aberrant cellular signaling coupled with changes in neurotransmission , peripheral and central sensitization are found to be responsible for the pathogenesis of variant toxic neuropathies .
current research reports have indicated the possible involvement of mitochondria mediated redox imbalance as one of the principal causes of neuropathy aetiologies .
in addition to imbalance in redox homeostasis , mitochondrial dysfunction is also responsible for alterations in physiological bioenergetic metabolism , apoptosis and autophagy pathways .
conclusions : in spite of various etiological factors , mitochondrial dysfunction has been found to be a major pathomechanism underlying the neuronal dysfunction associated with peripheral neuropathies .
pharmacological modulation of mitochondria either directly or indirectly is expected to yield therapeutic relief from various primary and secondary mitochondrial diseases . |
therapy should not only focus on pain reduction or better elimination but also on the modification of the exposed cervical dentin area based on the defect type .
dentin hypersensitivity ( dhs ) describes a painful symptom of the exposed and innervated cervical pulp
its prevalence greatly varies and ranges from 3 up to 98 % and can be explained in part by different evaluation methods and different patient populations , e.g. , patients suffering from periodontitis .
it is important to acknowledge that localized attachment loss is probably the most widespread and relevant factor leading to any root surface denudation and dental hard tissue sequelae , including dhs .
several predisposing factors of gingival recessions have been identified , e.g. , dehiscency or fenestration of the alveolar bone and soft tissue morphotype , but triggering pathological , therapeutic , or iatrogenic factors are also crucial for its development .
loss of dental hard tissue in the coronal aspect , especially enamel , is considered an alternative pathway of cervical dentin exposure and is mainly caused by erosion , abrasion , and abfraction or a combination thereof .
thus , differential diagnostic aspects play a pivotal role and a thorough anamnestic evaluation is indispensable to identify etiopathogenic factors .
this decision process is important to effectively control and treat underlying causative and modifying factors .
cause - related therapy primarily aims to mechanically or chemically protect the pulp dentin complex or to suppress or modify the nerve stimulation while controlling the predisposing factors .
however , no treatment has been found so far , which could serve as a defined therapeutic gold standard , which predictably and completely eliminates pain perception , especially in the long term .
root canal therapy may be considered as the last resort , but there is a consensus that this invasive treatment should not be considered in the first line .
if these are not successful at reevaluation , subsequently more invasive and maybe more expensive or even irreversibe treatment options should be envisioned .
table 1 gives an overview of a suggested decision tree for intervention and additional differential diagnosis.table 1proposed evaluation and decision steps proposed evaluation and decision steps if a patient self - reports pain , the necessity of dhs treatment is evident .
most commonly , air application and/or gentle scratching with a probe are used for this purpose .
if this pain provocation test is positive and other pathologies can be excluded ( differential diagnosis ) , dhs therapy should be initiated . in the case of a negative provocation test ,
special emphasis should be put on the differential diagnosis and the cause of the pain should be carefully evaluated ( endodontic or cariologic origin , orofacial pain , etc . ) .
if a patient reports no hypersensitive episodes , a provocation test is optional but recommended during routine dental screening . in the case of exposed cervical areas which are sensitive upon provocation , a treatment can be considered in prophylactic terms . in case of a negative provocation test
it is important to acknowledge that not all patients report hypersensitivity experiences , and dentists and prophylaxis personnel should therefore screen for dhs on a routine basis .
different materials and techniques are critically discussed and future perspectives are shown . whenever possible , systematic reviews were used to document the success / failure of a method .
thus , primary prevention of dentin exposure as a result of recession formation and/or dental hard tissue damage by any prophylactic measures or erosive / abrasive diet is the best way to actually treat this phenomenon and its associated painful symptoms .
special focus must thus be set on the prevention of dhs , such as to avoid erosive drinks or foods and choose nonabrasive toothbrushes , brushing techniques , etc .
the management of dhs can be generally divided in two different approaches : self - performed therapy at home ( professionally dispensed self - applied or over the counter ) or in - office treatment .
the latter normally applies more sophisticated noninvasive or invasive methods using professional materials and techniques . in general
, all interventions should start with noninvasive , reversible , nonhazardous , easy to perform , and inexpensive options . only if they prove to be ineffective at reevaluation should more invasive interventions be considered .
conceptually , treatment of dhs aims either to suppress the nerve impulse by direct neurological interaction or by mechanical blockage of the tubules .
potassium ions can decrease the excitability of a fibers , which surround the odontoblasts , thus resulting in a significant reduction in tooth sensitivity .
toothpastes for instance contain mostly 5 % potassium nitrate , but there is still a debate concerning its effectiveness .
aside from nerve desensitization , occlusion of the dentinal tubules is the main therapeutic approach ( fig . 1 ) .
there is a plethora of agents , materials , and products available on the market for this purpose .
different mechanisms can be identified to modify the dentin surface or tubules by chemical , mechanical , and/or physical means , e.g. , protein precipitation , plugging of dentin tubules , sealing , or laser applications.fig .
1sem image of dentin treated with a precipitating agent : panel a shows treated ( bottom left ) and untreated ( top right ) areas .
however , despite clear evidence of crystallite deposition , uncovered dentin areas and tubule entrances can be seen ( b ) sem image of dentin treated with a precipitating agent : panel a shows treated ( bottom left ) and untreated ( top right ) areas . however , despite clear evidence of crystallite deposition , uncovered dentin areas and tubule entrances can be seen ( b ) aqueous glutaraldehyde - containing solutions have shown to be effective in reducing dentin hypersensitivity .
they have been shown to close dentinal tubules by precipitative intratubular occlusion and thereby to a significant decrease of dentin permeability , even under clinical conditions [ 9 , 10 ] . as a positive side effect , glutaraldehyde disinfects dentin in vitro and seems compatible with adhesive systems
different plugging agents have been described and most products belong to this group of action . among these , oxalates have been used to precipitate and occlude the tubules .
however , a systematic review recently revealed that with the possible exception of 3 % monohydrogen monopotassium oxalate , available evidence does not currently support the recommendation of dentin hypersensitivity treatment with oxalates .
products containing arginine / calcium carbonate , bioactive glass , or strontium acetate have been introduced in the market with similar modes of action ( occlusion of the tubule openings ) and seem to provide good clinical results and pain relief [ 1618 ] .
xfluoride varnishes have also shown to protect the dentin surface by forming a protective layer of calcium fluoride [ 1921 ] .
whereas lasers have been frequently assessed in the management of dhs , their clinical success is questionable .
a reliable technique to close dentin tubules is the application of a chemomechanical barrier between the dentin and the oral environment based on adhesive bonding techniques .
however , most of the bonding agents have no fillers , which potentially leads to wear in exposed areas .
all methods described above are indicated especially in cases with limited amounts of dental hard tissue loss , i.e. , no classical abrasive or erosive defect characteristics . in cases where a class v filling is indicated
regenerative mucogingival therapy also remains an alternative , where hard and soft tissue conditions allow ( fig . 2 ) .
a suggested strategy for dhs management , taking these morphological aspects into consideration , is depicted in fig .
it should be noted that adequate diagnosis and prophylactic measures are a prerequisite for any successful management strategy , which is complemented with a strict long - term maintenance program in harmony with the special needs of dhs.fig .
2restitution of the anatomy of the cervically exposed dentin using a restorative approach with an adhesive class v filling ( a / c ) , thereby covering and protecting the sensitive dentin . as an alternative , a recession coverage using a connective tissue graft before can be indicated , especially if the tooth substance loss is limited and the soft tissue morphology is adequate for a mucogingival approach ( panel b before treatment and d 1 year after mucogingival surgery using a coronally advanced flap and connective tissue graft)fig .
3flow chart of the decision - making process based on the underlying defect . depending on the dental hard tissue damage and the morphology of the surrounding soft tissues ( according to miller 1985 )
, an adequate therapy can be initiated restitution of the anatomy of the cervically exposed dentin using a restorative approach with an adhesive class v filling ( a / c ) , thereby covering and protecting the sensitive dentin . as an alternative , a recession coverage using a connective tissue graft before can be indicated , especially if the tooth substance loss is limited and the soft tissue morphology is adequate for a mucogingival approach ( panel b before treatment and d 1 year after mucogingival surgery using a coronally advanced flap and connective tissue graft ) flow chart of the decision - making process based on the underlying defect .
depending on the dental hard tissue damage and the morphology of the surrounding soft tissues ( according to miller 1985 ) , an adequate therapy can be initiated
most patients develop coping strategies . however , especially in cases where we are confronted with moderately symptomatic and more severe episodes , finding the right solution is difficult , and trial and error strategies are still a daily occurrence .
thus , the development of new materials and methods is greatly needed , including the development of improved precipitating materials , which effectively bind to the exposed dentin wound and reduce the outflow of dentinal fluid .
the use of lasers in combination with such materials could be beneficial , leading to better precipitation or controlled melting mechanisms and impregnation .
in addition , as we are dealing with exposed cervical dental hard tissue areas , a focus also has to be put on improving the caries resistance of these involved surfaces .
the development of prophylactic measures with less risk of recession formation or abrasion is also warranted .
another aspect is the placebo effect , which is an important and potentially beneficial side effect when dealing with pain , and its treatment and management .
using arthritis of the knee as an example in the medical field , it has been impressively shown that sham endoscopic interventions lead to the same reduction of pain and symptoms as conventional treatment modalities .
in addition , prescription of differently colored pills resulted in significant differences in pain reduction . whereas a red placebo tablet , for instance , showed comparable pain relief as the best antirheumatic test pill used , the blue equivalent showed the least effect .
thus , improved psychological co - therapeutic strategies may one day become an important auxiliary aspect in dhs management , especially when it comes to changing patients expectations of treatment outcomes and confidence .
while there is no necessarily acute pathological risk for the affected tooth site at the moment , patients may suffer greatly and future damage due to the persisting pain challenge and its causative factors , i.e. , the co - etiopathological factors , can not be excluded . therefore , a therapy should not only focus on pain reduction or better elimination but also on the modification of the exposed cervical dentin area based on the defect type .
preventive , restorative , and periodontal options may be individually indicated to resolve the pain problem , while concomitantly reducing the risk for future damage to the pulp dentin complex .
| objectivesthe aim of the article was to present an overview of the management strategies of dentin hypersensitivity ( dhs ) and summarize and discuss the therapeutic options.materials and methodsa pubmed literature search was conducted to identify articles dealing with dentin hypersensitivity prophylaxis and treatment .
we focussed on meta - analyses of available or controlled clinical trials.resultsdhs therapy should start with noninvasive individual prophylactic home - care approaches . in - office therapy
follows with nerve desensitizing , precipitating , or plugging agents
. if the hypersensitivity persists , depending on the hard and soft tissue components at reevaluation , i.e. , presence or absence of cervical lesions and the gingival contour , adhesive restorations including sealing or mucogingival surgery may be an option .
they allow for the establishment of a physicomechanical barrier . as the placebo effect may play an important role , adequate patient management strategies and positive reinforcement
may improve the management of dhs in the future.conclusionslifelong maintenance under the premise of strict control of the causative factors is crucial in the management of dhs.clinical relevanceclinicians are faced with a broad spectrum of therapeutic options .
therapy should not only focus on pain reduction or better elimination but also on the modification of the exposed cervical dentin area based on the defect type . |
chiral sulfides are
important for the synthesis of a wide range
of biologically relevant molecules and are also versatile synthetic
intermediates for a variety of organic transformations . in recent years
, a number of methods have been
developed for the direct formation of stereogenic carbon centers
bearing sulfur .
the most successful is the -sulfenylation of
carbonyl coumpounds such as ketones , lactams , esters , and amides .
all
of these methods involve the formation of a metalloenolate or
enamine precursor followed by reaction
with sulfur - based electrophiles ( e.g. , sulfenyl chlorides , sulfenylamines ,
thiosulfonates , or disulfides ) to produce -thiofunctionalized
carbonyl compounds . already in 1979 , sato reported the enantioselective
sulfenylation
of 4-alkylcyclohexanones using chiral sulfonamides
as sulfenylating reagents .
six years
later , paterson reported the use of chiral o - silylated
imide enolates derived from acyl oxazolidinones in the
sulfenylation of masked ketones using phenylsulfenyl chloride .
unfortunately , both methods afforded low to modest
levels of enantioselection ( 45:5517:83 er ) . improved
enantioselectivities for thiofunctionalization of
ketones
were reported some years later by mukaiyama , who employed in situ - generated tin(ii ) enolates that reacted in the presence
of a chiral diamine ligand to afford 25:758:92 er . since these early reports ,
a wide variety
of methods have been
introduced , using a range of chiral auxiliaries for the synthesis
of -thiofunctionalized compounds ( e.g. , phenylethylamine , imidazolidinones , oxazolidines / oxazolines , pyrrolidines , and pyrazoles ) . however , until
recently , only a few examples that employ chiral sulfenylating
reagents have been reported .
a novel approach
for the synthesis of -thiofunctionalized
-dicarbonyl compounds was described by togni and co - workers ,
who reported the first catalytic , asymmetric sulfenylation of
-keto esters using a ti[taddol(ato ) ] complex that
afforded products with good yields and high enantioselectivities
( up to 94:6 er ) .
most recently ,
feng reported a catalytic , enantioselective
sulfenylation of unprotected 3-substituted oxindoles via
cooperative catalysis of a chiral bispiperidine - n , n-dioxide sc(otf)3 complex
in the presence of a brnsted base . using the readily available n - phenylthiophthalimide
as the sulfur source ,
a wide range of enantiomerically enriched
3-phenylthiooxindoles are obtained in excellent yields ( 8298% )
and excellent enantioselectivities ( > 99:1 er ) under mild
reaction
conditions .
the asymmetric synthesis of 3-sulfenylated n - boc - protected
oxindoles has been demonstrated by enders and co - workers , who reported
the use of a hydrogen - bonding squaramide - based organocatalyst
in combination with n-(sulfanyl)succinimides
to be a highly efficient method for the preparation of a wide range
of enantiomerically enriched 3-phenylthiooxindoles . using a similar and equally enantioselective
approach
, n - bn - protected oxindoles could also be
thiofunctionalized with a high level of enantioselectivity
using ( dhqd)2phal in the presence of a wide range
of n-(sulfanyl)succinimides , as reported
by jiang , who also applied a closely
related catalytic system to the enantioselective sulfenylation
of azlactones . among the most
recent advances
is the enantioselective -sulfenylation
of aldehydes and ketones through the intermediacy of in situ - generated enamines .
wang and co - workers employed a chiral pyrrolidine
trifluoromethanesulfonamide using n - phenylthiophthalimide as the sulfur source to produce
racemic -phenylthio ketones and -phenylthio aldehydes . shortly thereafter , jrgensen reported
the first example of enantioselective -sulfenylation
of aldehydes using diphenyl - l - prolinol tms ether as the catalyst
together with benzylsulfenyl-1,2,4-triazole as the sulfenylating
agent .
the corresponding sulfenylated
products are obtained in high yields and excellent enantioselectivities
( up to > 99:1 er ) .
finally , zhu and co - workers also demonstrated
the
direct sulfenylation of -keto esters , -keto phosphonates , and -nitroesters using
diaryl - l - prolinols .
chiral brnsted bases such
as cinchona alkaloid
derivatives can also catalyze the direct -sulfenylation
of other substrates such as lactones , lactams , and -dicarbonyl
compounds to afford enantiomerically enriched -sulfenylated
compounds in moderate to high yields ( up to 95% ) and enantioselectivities
( up to 96:4 er ) .
the highly enantioselective
sulfenylation of -keto
esters via base - free asymmetric phase - transfer catalysis was reported
by maruoka and co - workers in 2013 . using
a novel , bifunctional quaternary phosphonium salt , in
combination with an n - thioaryl- or n - thiobenzylphthalimide
, the -sulfenylated products
can be isolated in excellent yields and excellent enantioselectivities
( 96:497.5:2.5 er ) .
-thiofunctionalized carbonyl
compounds can also be prepared
from silyl enol ethers of ketones as first reported by murai , albeit
to form only racemic products .
a catalytic
version that employs tmsotf was introduced by saigo , and the same lewis acid was also employed by
kita to promote the facile and efficient
alkyl- and aryl - sulfenylation of ketones and esters in high
yields but again in racemic form .
finally , in a method that
constructs the carbon sulfur bond
in an electronically reversed fashion compared to all those methods
highlighted above , coltart and co - workers reported the sulfenylation
of nitrosoalkenes using a nucleophilic sulfur source . in their report , in situ - derived
cyclic and acyclic nitrosoalkenes , formed from their corresponding
-chloro oximes and base , are combined with a range of aromatic
and heteroaromatic thiols in the presence of a hydrogen - bonding
thiourea - based catalyst to give -sulfenyl oximes , which could
be oxidized to the corresponding -sulfenyl ketones in high
yields using 2-iodoxybenzoic acid ( 83:1794:6 er ) .
thus , despite considerable effort , no examples of catalytic , enantioselective
-sulfenylation of unactivated ketones are extant .
the mechanism of electrophilic addition and , in particular , the
addition of arylsulfenyl chlorides to olefins , is well documented .
it was first reported in the literature in 1937 , which was also the first time an onium ion
was postulated .
the classical mechanistic description of this process
suggests a rate - determining formation of an episulfonium ( thiiranium )
ion that undergoes a nucleophilic , invertive opening by
chloride ion to give an overall anti addition .
other mechanisms have also been proposed , such
as the formation of a sulfurane , but valid support for this hypothesis
is lacking , especially when compared with all the structural and reactivity
studies on thiiranium ions .
these processes can be divided into two main
types : ( 1 ) sulfenocyclizations and ( 2 ) sulfenofunctionalizations
of isolated alkenes .
a third area , represented with few examples ,
is the sulfenylation of more reactive alkenes such as silyl
enol ethers and silyl ketene acetals . as part of our continuing
program on lewis base activation of lewis
acids ,
we have reported the catalytic , enantioselective thiofunctionalization
of unactivated alkenes using oxygen , carbon , and nitrogen nucleophiles .
thus , the combination of n - phenylthiophthalimide ,
a chiral lewis base catalyst , and a brnsted acid ( msoh ) produces
enantioenriched thiiranium ions that could be captured intramolecularly
by either alcohols or electron - rich aromatic compounds ( scheme 1 ) . using this procedure , it is
also possible promote the intermolecular capture
of thiiranium ions by nucleophiles .
treatment of an
olefin with n - phenylthiophthalimide at
room temperature in the presence of 1.0 equiv of meoh and the same
chiral lewis
base / brnsted acid combination produces the phenylthio
methyl ether in 93% yield and 92:8 er ( scheme 2 ) .
these promising results stimulated the investigation of
the direct ,
catalytic thiofunctionalization of enol derivatives , e.g. ,
silyl enol ethers that formally can be considered as activated olefins .
consideration of the proposed catalytic cycle
for the lewis base - catalyzed
-sulfenylation of silyl enol ethers reveals a number
of concerns that have not been addressed in the previous studies ( scheme 3 ) .
initial protonation of the sulfenylating
agent ( het - sph ) by a stoichiometric amount of brnsted
acid , in the presence of a catalytic amount of lewis base , generates
the activated catalytic complex i. subsequent reaction
of sulfenyl cation i with a silyl enol ether forms oxocarbenium
ion ii .
it is important to highlight that this might
occur directly or via an intermediate thiiranium ion iii , the latter scenario more closely resembling our previous work on
the catalytic asymmetric sulfenylation of unactivated alkenes
( outlined above ) .
finally , the -sulfenylated ketone would be
isolated upon work - up . in the presence of a chiral
lewis base ,
the formation of oxocarbenium
ion ii would be the enantiodetermining step in
the scenario not involving an intermediate thiiranium ion iii .
however , if iii is generated , then its formation
would be assumed enantiodetermining in the presence of a chiral
lewis base .
previous studies in these laboratories demonstrated that
simple thiiranium ions are configurationally stable at 20
c .
the configurational stability
of iii is unknown , but its opening to form ii is expected to be rapid and irreversible ( perhaps driven by desilylation
with the conjugate base of the brnsted acid ) .
moreover , the
greater nucleophilicity of the silyl enol ether compared to
isolated alkenes raises the specter of a racemic background reaction .
finally , the requirement for a strong brnsted acid ( msoh ) is
incompatible with the silyl enol ether due to rapid protonolysis .
thus , the successful development of this transformation will
require reevaluation of critical reaction parameters and scope :
( 1 ) the pka of the brnsted acid
and its effect on the activity of the electrophile , ( 2 ) the
reactivity of the sulfenylating reagent , and ( 3 ) the ability
of the lewis base to generate adduct i , along with ( 4 )
the usual reaction parameters ( time , temperature , solvent ) , ( 5 ) the
identity of suitable lewis bases that can catalyze the process and
optimize their characteristics , e.g. , the basicity , steric bulk , and
type of chiral scaffold , and ( 6 ) the scope of the reaction with substrates
having different characteristics , e.g. , silyl groups , geometries ( e vs z double bond ) , steric factors , and
nucleophilicity .
the enhanced reactivity of silyl enol ethers
raises the possibility that a sufficiently electrophilic sulfenylating
agent could be employed that does not require activation with a brnsted
acid .
this possibility obviates the incompatibility issue but increases
the undesired intervention of a racemic background reaction .
the catalytic cycle for this variant is shown
in scheme 4 . in this scenario ,
the role of the heteroaromatic nucleofuge ,
generated after the transfer of the sulfenium ion , requires
more consideration . in the case of thiiranium ion formation ( vi ) , the resulting ion pair could influence the lifetime of
the ion before the rearrangement to v. however , its presence
could also promote the desilylation of v , accelerating
the formation of the final product and potentially reducing the lifetime
of the thiiranium ion , if formed .
the z - trimethylsilyl
enol ether of propiophenone
( ( z)-1a ) was selected for orienting
experiments . using conditions described by ireland
on the basis of previous studies , three
different electrophiles were examined ( figure 1 ) .
n - phenylthiophthalimide ( 2 ) is the least reactive toward isolated alkenes and requires
the use of a strong brnsted acid , e.g. , ch3so3h ( pka = 2.6 in water ) ,
to activate the leaving group and thus increase the phenylsulfenium
ion donor character .
this feature also dictates that only weakly brnsted
basic lewis bases can be employed ( to avoid protonation of the lewis
base catalyst ) .
n-1-phenylthiobenzotriazole
( 3 ) is more reactive than 2 and thus requires
the use of a weaker brnsted acid , e.g. , trifluoroacetic
acid ( tfa , pka = 0.23 in water ) , to be
activated .
finally , n - phenylthiosaccharin ( 4 ) is the most
reactive of the three and requires an even weaker acid , trichloroacetic
acid ( pka = 0.71 in water ) , to be activated . sulfenylating agents . on the basis of these considerations
, all three phenylthio
transfer
agents would be tested in the presence and in the absence of the corresponding
brnsted acid in the -sulfenylation of ( z)-1a . this survey was conducted at room temperature
using dichloromethane as solvent ( 0.2 m ) .
the reaction was quenched
with a ph 9 buffer solution in order to remove any acid present .
the
formation of 1-phenyl-2-(phenylthio)-propan-1-one ( 5 )
was monitored by gas chromatography ( gc ) with an internal standard
after 2 and 24 h. as shown in table 1 , when n - phenylthiophthalimide ( 2 ) was employed ,
no desired product was observed in the presence or absence of msoh
after 24 h. the absence of brnsted acid allowed recovery of
the silyl enol ether ; however , the presence of msoh resulted in complete
hydrolysis to the corresponding ketone .
similarly , no reaction was
observed in the case of n-1-phenylthiobenzotriazole
( 3 ) without an acid additive .
in contrast , the addition
of tfa generated the sulfenylated ketone 5 in 79.8%
conversion ( gc ) , accompanied by a small amount of hydrolyzed starting
material .
no further conversion was detected after 2 h. monitored by gc with internal
standard . brnsted
acid added 10 min
after the addition of the silyl enol ether . brnsted acid added 10 min
before the addition of the silyl enol ether .
n - phenylthiosaccharin ( 4 ) provided 5 in 47.6% conversion , even without
an acid activator .
the
detrimental effect of acid is evident in the use of trichloroacetic
acid , which causes extensive hydrolysis of ( z)-1a .
as has been observed in previous entries , the starting
material is consumed in 2 h. it should be noted that the order of
addition of the acid is consequential to the amount of 5 produced : the addition of trichloroacetic acid to 4 gave a slightly higher conversion to 5 ( 33.7% ) compared
to that of the reversed sequence of addition ( 17.0% ) . to minimize
the formation of sulfenylated ketone 5 in the absence
of lewis base catalysis , the -sulfenylation
of ( z)-1a was investigated at low temperature
( table 2 ) . at 10 c , n-1-phenylthiobenzotriazole ( 3 ) , together
with a stoichiometric amount of tfa ,
lowering the temperature
to 78 c gave only a small reduction in conversion ( table 2 , entries 1 and 2 ) .
1.0 equiv was used and added 10
min after the addition of the silyl enol ether . monitored by gc with internal standard .
interestingly , in the absence of
acid , n - phenylthiosaccharin
( 4 ) showed the same chemical efficiency at room temperature
and at 10 c .
however , when the reaction was conducted
in the presence of trichloroacetic acid at 10 c ,
the conversion was increased to 50% , due to the inhibition of the
hydrolysis process ( entry 5 , cf .
when the temperature was decreased to 25 c , the
-sulfenylation of ( z)-1a was slow in the absence of acid ( 19.6% conversion after 24 h ) . finally , the reaction was investigated at 78 c . in
the presence of trichloroacetic acid ,
ketone 5 was
obtained with a moderate conversion , but , interestingly , in the absence
of acid , both the -sulfenylation process and the hydrolysis
process were significantly slowed ( only 8.8% conversion after 24 h ) .
on the basis of these results
, it was now possible to almost completely
suppress the background reaction at 78 c , using 4 as electrophile , without a brnsted acid .
the stage
was now set to evaluate the ability of lewis bases to turn on the
catalytic ( and stereoselective ) pathway .
the survey of achiral lewis bases
was performed on a 0.2 mmol scale
using dichloromethane as solvent in the presence of 10 mol %
of a lewis base .
an extensive survey of a wide range of more than 50 lewis bases was
carried out , and these results are presented in their entirety in
the supporting information .
a qualitative
schematic of these data is presented in figure 2 to allow for a general comparison of the efficiency of different
lewis bases to catalyze this process .
it was clear that the most efficient lewis
bases
were those derived from tertiary amines , sulfides , and selenophosphoramides .
in particular , in the case of tertiary amine - based nucleophiles ,
the steric environment around the nitrogen atom was demonstrated to
be important , with n - i - pr - piperidine
significantly less effective than n - me - piperidine . during the course of these studies , a highly effective quench procedure
was developed to ensure rapid and complete hydrolysis of any remaining
trialkylsilyl enol ether before warming the reaction , prior to work - up .
an efficient quench was required not only to obtain accurate information
on reaction conversion but also , upon the development of an enantioselective
protocol , to prevent a racemic background reaction which could occur
upon warming and therefore lead to an overall reduction in the enantioselectivity
observed .
the optimized quench procedure involved the addition of
a precooled ( 78 c ) solution of hfpyridine in methanol
( derived from a solution of hf in pyridine , ca .
using this procedure , the extent of
the uncatalyzed , background reaction amounted to 2.4% conversion to 5 after 24 h at 78 c .
the selection of suitable chiral lewis
bases was guided by the results
of the initial catalyst survey . because tertiary amines , tetrahydrothiophene ,
and selenophosphoramides showed the best catalytic activity ,
the use of chiral lewis bases derived from these three classes was
chosen for initial investigation . following previous experience ,
chiral c2-symmetric
tetrahydrothiophenes 6 and 7 were
tested first ( scheme 5 ) . as anticipated , the
use of ( 2r,5r)-2,5-dimethyltetrahydrothiophene
( 6 ) led to the formation of 5 with quantitative
conversion
after 2 h at 78 c unfortunately , however , in
racemic form . it is presumed that the stereocenters are too
far away from the catalytic site and that the methyl groups are too
small for a preferential selection of one of the two enantiotopic
faces of the silyl enol ether .
however ,
this lewis base promoted the -sulfenylation of ( z)-1a to only 15% conversion after 24 h at
78 c again with negligible control over the stereochemical
outcome ( er , 54:46 ) .
raising the temperature to 20 c
afforded the desired product with 80% conversion after 24 h but with
similar enantiomeric ratio ( 57:43 ) .
initially , ( )-sparteine and ( + ) -n - methylephedrine
along with a variety of monomeric and dimeric dihydrocinchonine
and cinchonidine derivatives were examined : ( dhqd)2phal ,
( dhq)2phal , and ( dhq)2aqn , nicotine ,
( r , r)-1,2-bis(dimethylamino)cyclohexane , ( r , r)-2,2-bis(n - methyl)pyrrolidine ,
and ( s , s)-2,5-dimethyl - n - benzylpyrrolidine .
the most encouraging results were obtained from ( dhq)2phal ,
which afforded an 84% conversion of ( z)-1a to 5 under standard conditions with a 61:39 er . the use of chiral
selenophosphoramides as catalysts for
stereoselective transformations was first reported from these
laboratories for the asymmetric thiofunctionalization
of unactivated alkenes . following the
same synthetic route , a family of different selenophosphoramides
was prepared for subsequent evaluation in the enantioselective
-sulfenylation of 1 ( scheme 6 ) .
( s)-binam ( 9 ) was prepared
from 2-naphthylamine and was converted ,
in two steps , to the n - methylated binam ( s)-10 . following a protocol
developed in these laboratories ,
this
precursor was transformed into a variety of selenophosphoramides
that possessed various substituents on the external nitrogen .
the catalytic efficiency and selectivity of the different
selenophosphoramides
were investigated in the -sulfenylation of ( z)-1a ( figure 3 ) .
conversion was
measured by gc analysis with an internal standard , and the enantiomeric
ratios were determined after chromatographic purification by
csp - hplc .
gratifyingly , selenophosphoramides derived from
binam
bearing a cyclic amine , e.g. , piperidine ( 12a ) , azepane
( 12b ) , and azocane ( 12c ) , were able to promote
the reaction with good conversions and high levels of enantioselection
( up to 13:87 er for 12c ) .
it is noteworthy that the reduced
rate observed using these lewis bases meant that 24 h was required .
interestingly , the use of 12d , bearing a less basic amine ,
was able to maintain the same level of stereoselection but with
a decreased rate .
this observation confirms that the use of more - basic ,
aliphatic amines is important for the chemical efficiency of the catalyst .
on the basis of these results ,
5 was produced with comparable conversions . using the selenophosphoramide 12e , derived from diethylamine , afforded 5 with 79% conversion in 86:14 er . modification or elongation of the
amine chain , e.g. , 12f and 12 g , afforded
the product with comparable efficiencies and selectivities .
77% conversion and 10:90
er . the selectivity improved to 7:93 when the diisopropylamino - derived
catalyst 12j was employed .
the use of lewis base 13 , wherein the binaphthyl backbone was substituted with the
less bulky biphenyl system , led to decreases in catalytic efficiency
and selectivity . in view of the highly encouraging
results described above
however , at this stage , a number of
significant challenges had been identified that would need to be addressed
as part of this endeavor .
because
selenophosphoramide 12j afforded this highest
enantioselectivity for the
conversion of ( z)-1a to 5 , it was chosen for the survey of the remaining substrates .
however ,
the general preparation outlined in scheme 6 was not suitable for the bulky diisopropylamine needed in
the last step .
thus , an improved preparation was developed that installs
the diisopropylamino group as part of the diazaphosphepine
ring formation ( scheme 7 ) .
the reaction is
somewhat scale - dependent , but yields up to 78% have been achieved .
the syntheses of a large number of the
silyl enol ethers used in
this work are known and are therefore not described here . however , for a number of substrates , preparative
methods had to be developed .
importantly , they had to provide enol
ethers in high purity and high ( z)-diastereoselectivity .
high purity was required to aid final purification of the -sulfenylated
products , and high ( z)-diastereoselectivity
was found to have an impact on the enantiomeric purity of the
products .
the configuration of all enol ethers shown
below was confirmed by nuclear overhauser enhancement ( noe ) spectroscopy .
although trimethylsilyl enol ether ( z)-15 , derived from 1-(naphthalenyl)-1-propanone ( 14 ) , is
known , the method reported was found
to be irreproducible , and therefore alternative conditions were developed
with the combination of tmsotf and et3n , giving complete
conversion of 14 to ( z)-15 as a 95:5 z / e mixture .
trimethylsilyl
enol ether ( z)-15 was isolated in a
78% yield ( scheme 8) .
h nmr spectroscopic analysis of enol ether ( z)-15 was not in accordance with that reported but was confirmed by noe spectroscopy .
the use of lithium 1,1,3,3-tetramethyl-1,3-diphenyldisilazide
was first reported by masamune and co - workers for the highly ( z)-selective synthesis of silyl enol ethers derived from
dialkyl ketones bearing one small and one medium - sized substituent .
this protocol was successfully applied to the
synthesis of tetrahydropyranyl - based silyl enol ether ( z)-17 .
25:1 ) were possible , and
the method was amenable to scale - up .
separation of the enol ether
from disilazane and disilazane - related materials proved nontrivial
but was possible by column chromatography using basic alumina , activity
grade iii , allowing isolation of enol ether ( z)-17 in 35% yield ( scheme 8) . the n - t - boc - piperidine - based silyl enol ether
( z)-19 could also be prepared , using
the lithiodisilazide base , in excellent diastereoselectivity
( z / e > 25:1 ) .
the fate
of any unreacted enol ether , upon reaction work - up , was
hydrolysis to the parent ketone .
separation of this ketone from the
-sulfenylation product proved to be difficult , especially as
the chiral lewis base also showed very similar interactions with all
stationary phases during attempts to purify using column chromatography .
silica gel , basic alumina , and reverse - phase c-18 chromatography were
all evaluated , with silica gel showing the best resolution .
radial
chromatography was also found to be very effective . however , the increased
acidity of the silica gel required to prepare the chromatography plates
used for radial chromatography caused epimerization of the products .
the solution to this issue required ( 1 ) the preparation of enol ethers
of high purity ( i.e. , not contaminated with parent ketone ) , ( 2 ) that
the reaction be as close to completion as possible upon work - up , and
( 3 ) careful chromatographic purification of the product ( sio2 and reverse - phase c-18 ) .
the
low temperatures at which the reactions were conducted ( typically
78 c ) rendered accurate reaction monitoring difficult
because of the difficulties associated with removing a sample from
the reaction mixture and quenching it before it had the opportunity
to warm up ( from 78 c ) .
direct quench of the entire
reaction mixture at 78 c would ensure an accurate result ;
however , this would mean multiple reaction runs per substrate .
the
long reaction times of 2448 h would make this an even less
efficient approach .
the solution to this issue was to sample using
precooled , narrow - bore needles ( 78 c ) with precooled
quench solutions ( also 78 c ) .
this optimized technique
could allow , after work - up of the aliquot and h nmr analysis ,
an accurate understanding of the reaction .
this approach was validated
by comparison to a direct reaction quench . with a set
of standard reaction conditions and a wide range of enol ethers prepared ,
as detailed above , ( z)-1a was fully converted to 5 after 24
h at 78 c to afford a high isolated yield ( 72% ) with
excellent er ( 93:7 , entry 1 ) .
it should be noted that the catalyst
loading was increased to 15 mol % to ensure full conversion of substrates
to the -sulfenylated products .
as noted earlier , if not fully
converted , residual enol ether would be hydrolyzed to the parent ketone
upon work - up , complicating purification .
the enantiomeric ratio
was
determined by csp - sfc analysis or csp - hplc analysis , as required .
enol ether ( e)-1a also showed full
conversion after 24 h at 78 c , but in racemic form ( entry
2 ) .
investigation of the effect of the r substituent of
the silyl enol ether was then carried out ( table 3 , entries 3 and 4 ) . with an ethyl substituent , full conversion
was observed after 24 h at 78 c , and product 21 was obtained in a similar yield ( 75% ) and enantiomeric composition
( er 90:10 ) . however , increasing size of the r substituent
beyond an ethyl substituent caused a dramatic reduction in rate at
78 c , and the reaction had to be warmed to 50
c to give high conversion ( entry 4 ) .
variation
of the r substituent of the silyl enol ether
was far better tolerated ( entries 57 ) .
the ( z)-enol ether derived from pentan-3-one ( entry 5 ) showed a rate similar
to that of ( z)-1 and afforded 25 in good enantiomeric purity ( er 91:9 ) and isolated
yield ( 75% ) .
unfortunately , epimerization was observed during
column chromatography , and the enantiomeric composition was
compromised ( er 87:13 ) .
increasing the steric bulk of the r group to cyclohexyl had little effect on the rate of the reaction ,
which was close to complete after 24 h ( > 90% ) but was allowed to
proceed
for an additional 12 h to ensure complete conversion .
again , the isolated
yield and enantioenrichment of the product were very good ( entry
6 , 78% , 94:6 er ) . further increasing
the steric bulk with a tert - butyl substituent at the 1-position was again well
tolerated ( entry 7 ) .
in fact , in this case only 10 mol % of ( r)-12j was required to achieve very good isolated
yield and er after 24 h at 78 c ( 74% , 98:2 er ) . the next phase of the survey evaluated the effect of electronically
modulating the enol ether by varying the substituents on the r aromatic substituent .
a 4-methoxy - substituted silyl enol
ether was observed to give quantitative conversion at 78 c
after 24 h with very good er ( 90:10 , entry 9 ) .
the reduction in selectivity ,
relative to ( z)-1 , may be a result of
increased background reaction or lewis base catalysis by the methoxy
substituent .
attenuation in electron density of the enol ether by
the attachment of a 4-chlorophenyl substituent led to a significant
reduction in reaction rate : after 48 h at 78 c , the
conversion was only 87% ( entry 10 ) .
a moderate isolated yield of 34 could still be obtained ( 66% ) , with slightly reduced enantiopurity
( er 88:12 ) relative to entry 1 .
although the reason for the lower
selectivity is not clear , the electron - deficient ketone would be more
easily epimerized upon work - up .
the 4-phenyl - substituted enol ether
behaved well to afford 36 in good yield and high selectivity
( entry 11 ) .
the compatibility of lewis basic functionalities
in the substrates
was then examined ( entries 12 and 13 ) . both the tetrahydropyranyl-
and n - t - boc - piperidinyl - substituted
silyl enol ethers were good substrates and afforded products with
yields and enantiomeric purities very similar to those observed
with the cyclohexyl - based substrate ( compare entries 6 , 12 , and 13 ) .
41 reacted in the same way previously
seen with acyclic enol ether ( e)-1a ;
conversion was complete at 24 h , but the er was found to be very poor .
next , to investigate the possibility of preparing of tertiary sulfides ,
the trimethylsilyl enol ether of 2-methyltetralone 43 was tested .
this enol ether was targeted specifically to
serve as a comparison to previous results with 41 .
the
rate of sulfenylation of 43 was much reduced in
comparison to that of 41 , presumably a consequence of
increased hindrance ; only 77% conversion was obtained after 48 h at
40 c .
interestingly , the selectivity in this case was
higher than for silyl enol ether 41 ( 85:15 vs 75:25 ) .
the enantiomeric ratio could be upgraded to > 99:1 after a
single
recrystallization from meoh .
the absolute configuration of the
products was established for product 36 from the sulfenylation
of ( z)-35 , which gave a crystalline
product ( scheme 9 ) .
after 36 h at 78
c , complete conversion of ( z)-35 was achieved , and product 36 was obtained in very good
yield and enantioenrichment ( 77% , 94:6 er ) . after purification ,
the -sulfenyl ketone provided crystals from meoh suitable for
single - crystal x - ray analysis .
the refinement
demonstrated that ( r)-12j produced ( s)-36 . the configurations of the other products
were assigned by analogy and confirmed via circular dichroism spectroscopy ;
comparison demonstrated that all substrates displayed a negative cotton
effect .
reaction of the chiral , enantioenriched
lewis base with n - phenylthiosaccharin 4 is proposed to give the lewis base - bound sulfenyl cation iv .
this active sulfenylating
agent then reacts with the silyl enol ether to produce silyloxycarbenium
ion v or thiiranium ion vi .
finally , nucleophilic
removal of the trimethylsilyl group from either v or vi by the saccharin anion affords the -sulfenylated
product and n - trimethylsilylsaccharin .
although
detailed kinetic studies have not been carried out with this system ,
in the related sulfenylation of isolated alkenes , thiiranium ion formation
is rate - determining and intramolecular capture is rapid .
since this variant does not have a capture step
and the rate of reaction is not dependent upon the size of the silyl
group , it is safe to assume that electrophilic
attack on the silyl enol ether is rate- and stereo - determining here
as well .
furthermore , the rate of the reaction decreases dramatically
with increasing steric bulk at the 2-position of the enol ether , further
supporting the notion that sulfenyl group transfer is rate - determining . proposed catalytic cycle . to establish whether thiiranium ion vi is a
reasonable
intermediate in this process , dft calculations ( b3lyp/6 - 31g(d ) )
were performed on the two limiting reaction profiles shown in scheme 10 . for computational simplicity , the phenylsulfenylating
agent derived from hmpa(se ) ( vii ) was employed in combination
with ( z)-5 .
mechanism 1 posits the formation
of thiiranium ion vi as a stable intermediate that may
open to silyloxycarbenium ion v or undergo direct
collapse to the sulfenylated product .
mechanism 2 posits the
direct formation of silyloxycarbenium ion v. computationally ,
thiiranium ion vi could not be located as a stationary
state starting from a number of different geometries , whereas silyloxycarbenium
ion v was found to be a stable entity .
the transition
structure for formation of v from ( z)-1a and vii was located and ( as expected )
was highly unsymmetrical , with significantly different distances between
the sulfur atom and the two carbons of the enol ether ( figure 5 ) . energy profile and transition structure for sulfenyl group transfer . to provide
more detailed insight into the origin of enantioselectivity
,
the structures of the catalytically active species and the transition
states for the various stereochemical pathways for the -sulfenylation
reaction were investigated by computational analysis .
previous studies
strongly suggested that the catalytically active species ( i , scheme 3 or iv , scheme 4 ) is the sulfenylated selenophosphoramide
( s)-viii ( figure 6 ) .
the calculations on this species were performed by first establishing
a rough structure with molecular mechanics and then refining the structure
prior to dft calculations .
the dft method employed the b3lyp - d3 hybrid
functional , with a lacvp(+ ) * basis set .
dft - minimized
structure of ( s)-viii ( hydrogens removed
for clarity ) .
the first calculations
focused on the geometry of the phenylsulfenyl
group with respect to the lewis base .
interestingly , the diisopropylamino
group is turned such that the phenylsulfenyl group is pointing
toward the binaphthyl moiety and perpendicular to the naphthyl ring .
this structural feature provides an important insight for the high
selectivity seen with branched dialkylamino - derived catalysts . using the optimized geometry of the catalytically active species
( s)-viii , four different -sulfenylation
transition states for the sulfenyl group transfer to ( z)-1a were located using b3lyp/6 - 31g(d ) at 78
c in the gas phase , and their structures are shown in figure 7 .
all four transition states have highly unsymmetrical
structures with significantly different distances between the sulfur
atom and the two carbons of the enol ether , consistent with the conclusions
from the foregoing analysis .
the transition - state structures tsre-1 and tsre-2 will lead
to product ( r)-5 , whereas tssi-1 and tssi-2 lead to ( s)-5 .
the most stable transition state leading
to ( r)-5 ( tsre-1 ) is 0.9 kcal / mol
more stable than the lowest energy transition state leading to ( s)-5 ( tssi-1 ) , which agrees with the experimental
stereochemical outcome ( 91:9 calcd ; 93:7 obsd ) .
however , careful inspection of these competing transition
structures failed to identify any obvious interactions that
would disfavor tssi-1 with respect to tsre-1 .
the highly unsymmetrical transition states
allow for a significant distance between the aryl residue and the
catalytically active species , obviating any severe nonbonding interactions .
optimized
structures and energies of tsre-1 , tsre-2 , tssi-1 , and tssi-2 . to provide additional insight into the origin of enantioselectivity ,
these results mirror those from the dft analysis and suggest
that a more subtle effect may be operative . as highlighted in bold
type , tsre-1 possesses the lowest activation energy , 0.6 kcal / mol lower than
that of tssi-1 .
interestingly , even though tssi-1 benefits from a greater interaction energy
( ei = 0.6 kcal / mol ) ,
this advantage is offset by a greater distortion energy ( ed = 1.2 kcal / mol ) .
the greater interaction energy
associated with tsre-1 was substantiated by the nbo analysis , which provided the
stabilization energies arising from orbital overlap from the -bond
of the silyl enol ether to the antibonding ( * ) orbital
of the sulfur selenium bond .
the stabilization energies for tsre-1 and tssi-1 are nearly
identical ( and are the largest of the four transition states ) , indicating
similar levels of orbital overlap .
however , to achieve those levels
of overlap requires greater distortion of the orbitals in tssi-2 ( likely resulting
from nonideal approach of the silyl enol ether ) .
thus , whereas unfavorable
steric interactions are not the apparent cause of the enantioselectivity ,
it is likely that the avoidance of unfavorable steric interactions
leads to a nonideal approach of the silyl enol ether that manifests
in the greater distortion energy contribution to that transition state . a =
silyl enol ether
( z)-1a .
(c = c)*(s se )
orbital interaction energy is calculated by nbo analysis .
the composite picture gleaned from
empirical results reveals the
sensitivity of the catalytic species to the shape of the olefin substrate
( figure 8) .
these characteristics comport well
with the trends deduced from analysis of the intramolecular
carbosulfenylation of alkenes using the same catalyst
and presumably the same catalytically active species .
the superior performance of ( e)-alkenes
in that analysis is reflected in the higher selectivities observed
with ( z)-silyl enol ethers in this work , as the carbon - based
substituents on the double bond are effectively trans .
moreover , the
observed decrease in selectivity with decreasing size of the r substituent also agrees with the poor selectivity seen with
( z)-alkenes , because with a small r group ,
the silyloxy substituent becomes the sterically dominant substituent
on that side of the double bond , leading to a net ( z)-alkene shape .
the development of a catalytic , asymmetric , lewis base - catalyzed
-sulfenylation of silyl enol ethers has been described .
to establish the conditions for a successful catalytic process
, a
new sulfenylating agent was developed that did not require activation
by a brnsted acid because of the sensitivity of silyl enol ether
to acidic hydrolysis .
these investigations identified n - phenylthiosaccharin to be a suitable electrophile and
highlighted three classes of suitable lewis bases : tertiary amines ,
sulfides , and selenophosphoramides . in addition , reaction
monitoring and quench procedures were developed to ensure the suppression
of background reaction and that the catalytic process went to completion .
the success of the reaction does not depend on the size of the silyl
group but is highly sensitive to the double bond geometry and the
bulk of the substituents on the double bond .
extension of this process
to the -sulfenylation of ketene acetals and related nucleophiles
is ongoing and will be reported in due course . | a catalytic , enantioselective , lewis
base - catalyzed -sulfenylation
of silyl enol ethers has been developed .
to avoid acidic hydrolysis
of the silyl enol ether substrates , a sulfenylating agent that did
not require additional brnsted acid activation , namely n - phenylthiosaccharin , was developed .
three classes
of lewis bases tertiary amines , sulfides , and selenophosphoramides were
identified as active catalysts for the -sulfenylation reaction .
among a wide variety of chiral lewis bases in all three classes , only
chiral selenophosphoramides afforded -phenylthio
ketones in generally high yield and with good enantioselectivity .
the selectivity of the reaction does not depend on the size of the
silyl group but is highly sensitive to the double bond geometry and
the bulk of the substituents on the double bond .
the most selective
substrates are those containing a geminal bulky substituent on the
enoxysilane .
computational analysis revealed that the enantioselectivity
arises from an intriguing interplay among sterically guided approach ,
distortion energy , and orbital interactions . |
the incidence of intramedullary tumors of the spinal cord is 2 - 4% of all central nervous system tumors .
intraspinal dermoid cysts are less than 1% in incidence , commonly seen in extradural location in lumbar area .
we report a case of large intramedullary dermoid cyst of the spinal cord associated with a dermal sinus in mid - dorsal - spine in an 18-months - old female child presenting early with fever due to intermittent sinus discharge and infection .
an eighteen - months - old female child presented with history of mild fever and intermittent discharge from a sinus in the mid - dorsal area . on examination , she was febrile with normal power and sensation in all limbs except mild stiffness of left leg .
posterior aspect of mid - dorsal spine ( d5 ) shows a skin dimple with no active discharge at presentation [ figure 1 ] . magnetic resonance imaging ( mri ) of whole spine revealed a large intramedullary cystic lesion in the dorsal segment of spinal cord extending from d2 to d7 vertebral level with single posterior sinus tract opening to skin at d5 vertebral level .
the cystic lesion shows t1-weighted ( t1w ) hypointense , t2-weighted ( t2w ) and short tau inversion recovery ( stir ) hyperintense signal , restricted diffusion in diffusion - weighted image ( dwi ) and apparent diffusion coefficient ( adc ) image .
post - contrast mri image shows no enhancement of the lesion [ figure 2 ] .
intramedullary spinal epidermoid / dermoid with posterior sinus tract was given as possible radiological differential .
the child shows dermal sinus tract opening to skin as skin dimple over the posterior aspect of dorsal spine in midline intramedullary cystic lesion of spinal cord extends from d2 to d7 vertebral level and shows t1w hypointense ( a ) , t2w hyperintense ( b ) , stir hyperintense signal ( c ) , non - enhancement in post - contrast image ( d and e ) and restriction of diffusion in dwi ( f ) and adc ( g ) sequence .
the dermal sinus track is seen as hypointense linear structure in t2w and stir image ( b and c ) dorsal d1 to d8 laminectomy was done .
injection methyl prednisolone was given as bolus dose ( 30 mg / kg body weight ) during intra operative period and continued for 24 hour in post - operative period with a dose of 5.4 mg / kg body weight .
tuft of hair and cheesy material with a thin capsule were removed in piece meal ; portion of the capsule could not be removed as it was densely adhered to the cord .
dermal sinus tract was ending within the dermoid capsule [ figure 3 ] and was also excised .
post operatively she developed mild weakness of left lower limb ( grade - iv power ) which she recovered by 10 post - operative day .
intraoperative picture shows the dermal sinus merging to the intramedullary dermoid the histopathological diagnosis of the lesion confirmed dermoid cyst [ figure 4 ] .
microphotograph showing the cyst lined by squamous epithelium containing keratinous flakes in the lumen ; and the wall shows dermal appendages , adipocytes and nerve bundles which confirmed it as dermoid cyst
dermal sinus is an epithelium - lined track , which extends inward from the skin surface for varying distances and often connects the body surface with the central nervous system or its coverings .
it results due to focal area of incomplete disjunction of cutaneous ectoderm from neural ectoderm during the process of neurulation .
the patients become symptomatic due to infection or because of compression of neural structures by an associated dermoid or epidermoid tumor .
acute worsening of neurological deficit may be seen due to spontaneous rupture of dermoid cyst resulting in ventriculitis and meningitis .
dermal sinuses in midline are commonly associated with a dermoid cyst and those in paramedian location with epidermoid cyst .
dermoids are most frequently seen in dorsolumbar area ( 75% ) out of which 63% are in intradural extramedullary location and 38% in intramedullary location .
dermoid cyst is thought to arise from inclusion of embryological ectodermal rest cell in neural epithelium during neural tube closure in 3 to 5 week of gestational age .
intramedullary dermoid cyst usually presents late in 2 or 3 decade of life with significant neurological compromise . in presence of a dermal sinus , presentation becomes early due to sinus discharge and infection .
the appearance of dermoid cyst on mri is variable , sometimes showing high signal intensity on t1-weighted images ( t1w ) , but more commonly having low to intermediate signal intensity on t1-weighted images and high signal intensity on t2-weighted images ( t2w ) .
the lack of a fatty signal may be a result of secretions from sweat glands within the tumor causing increased water content .
dermoid shows diffusion restriction and no post - contrast enhancement unless they are infected like epidermoid .
t1-weighted images with wide window settings best show the sub - cutaneous portion of the sinus tracts , whereas t2-weighted images show the sinus tract as a hypointense linear or curvilinear structure . in our case
the dermoid shows predominant t1 hypointense , t2w / stir heterogeneously hyperintense signal and diffusion restriction with t2w hypointense sinus track .
the arachnoid cyst shows cerebrospinal fluid ( csf ) signal with no diffusion restriction whereas epidermoid shows hyperintense signal in fluid attenuation recovery sequence and restriction of diffusion .
total microsurgical excision of dermoid cyst along with the capsule is the treatment of choice .
partial excision of dermoid cyst wall with decompression in case of dense adhesion of lesion with spinal cord also gives good clinical outcome . in our case ,
the whole of the dermoid cyst along with the sinus tract was excised except small portion of capsule which was attached firmly to the spinal cord .
dermal sinus in mid - dorsal spine associated with a large intramedullary dermoid cyst presenting only with intermittent fever , sinus discharge and subtle neurological deficit are rare .
patient with dermal sinus should be evaluated early with spinal imaging preferably by mri of spine to rule out underlying spinal cord lesion which will facilitate better treatment at the early stage of disease , thus preventing development of neurological deficit . | intramedullary dermoid cyst is a rare entity .
it is usually associated with spinal dysraphism and dermal sinus .
our case is an 18-months - old female child who presented with history of fever and mild difficulty in moving left leg .
she had a sinus in mid dorsal spine since birth with history of intermittent discharge from it . on magnetic resonance imaging of spine
she was diagnosed to have large intramedullary epidermoid / dermoid cyst in the d2 - 7 vertebral level with a sinus tract . a dermoid cyst along with the sinus tract was excised .
post - operative follow up period was uneventful with full recovery . |
pain is the main symptom of hip joint diseases such as osteoarthritis ( oa ) and
osteonecrosis .
clinical presentation is dominated by pain during rest and joint motion ,
which results in loss of motion function and limitation in activities of daily living ( adl ) .
a previous study reported that physical therapy as a conservative therapy reduced pain in oa
patients1 .
in contrast , in end - stage oa , total hip arthroplasty
( tha ) is considered to be one of the most successful joint surgeries for the alleviation of
prolonged pain in patients with hip disease .
in fact , kawada et al.2 reported that pain in the hip joint provided motivation for
patients with hip disease to undergo arthroplasty . moreover ,
preoperative pain in resting
and motion are factors largely influencing the occurrence of pain following total knee
arthroplasty3 .
therefore , for a physical
therapist managing pain , it is important to correctly perceive the reality of pain in
patients with hip disease . in clinical settings ,
patients with hip joint disease sometimes present with complaints of
pain around not only the hip joint but also the thigh , knee , and lower leg . in the
literature ,
the groin , thigh , and knee are reported as the reference regions of patients
with hip disease4 , 5 .
hip joint pain in oa has been classically described as presenting
in the groin , with reference to the area below the knee .
khan et al.4 reported that 47% of patients with hip oa had pain below the
knee .
morimoto et al.6 reported that 34.6%
of patients awaiting arthroplasty have pain below the knee , even though they did not have
lower limb or lumbar diseases .
ruch7 hypothesized that referred pain originates from convergence and
projection ; somatic and visceral bers from each of the primary neurons converging upon one
dorsal horn neuron in the spinal cord .
sinclair et al.8 proposed that referred pain is caused by primary afferent bers
bifurcating into somatic and visceral structures .
these hypotheses mean that primary sensory
neurons relate to the occurrence of referred pain . in earlier literatures ,
the source of pain radiating from the hip to below the knee was
considered to be related to the femoral and obturator nerves , which supply articular
branches to the hip joint and cutaneous branches to the thigh and around the knee9 , 10 .
khan and woolson9 reported that referred
pain in hip oa was transported along the saphenous branch of the femoral nerve , which is
responsible for the sensory innervation of the anterior and anterolateral regions of the hip
joint capsule .
the saphenous nerve , a branch of the femoral nerve , innervates the cutaneous
anterior and medial knee joints .
therefore , the femoral nerve is believed to contribute to
the referred pain originating from the hip joint .
the obturator nerves supply the articular
branches to the anteromedial section of the hip joint capsule .
in addition , these nerves
innervate the anterior and medial aspects of the thigh and knee .
a previous study reported
that blockade of these nerves by intra - articular injection reduced hip referral pain in
patients with hip oa11 , indicating that
referred pain to the knee of patients with hip disease is transmitted by the femoral and
obturator nerve , which innervates the anterior medial and lateral aspects of the hip joint .
in our clinical experience ,
pain along the region of the femoral and obturator nerves is
often preoperatively found in patients with hip disease , especially in motion , e.g. ,
standing up or walking , rather than in resting
we believe that most cases of referred pain , especially
anterior knee pain , are referred from the hip joint , with the articular branches of the
femoral and obturator nerves being related to the pain .
in addition , only a few early reports have described the
involvement of the articular branches of these nerves in hip and knee pain . in this study
, we investigated the frequency of regional and referred pain patterns in
patients with hip disease at pre- and post - arthroplasty .
in addition , we observed two adult
cadavers to analyze the nerve supply of the hip and knee joints from the femoral and
obturator nerves .
ethical approval for this investigation was granted by the nagasaki university hospital
ethics board ( no . 13040158 ) .
the medical records of patients with hip joint disease who
underwent total hip arthroplasty at nagasaki university hospital between april 2008 and
november 2011 were retrospectively reviewed .
patients with dementia , diseases of the lower
limbs , and lumbar disease were excluded .
summary of the subjects background dataage ( years)63.2 11.4sexfemale92male21height ( cm)154.7 7.9weight ( kg)56.8 10.5bmi ( kg / m)23.8 3.8diagnosiship oa100osteonecrosis13operationtha107bha5bhr1duration of pain ( years)6.9 8.2the data are expressed as mean sd , unless otherwise specified . of the patients , 92 were women and 21 were men , with a mean age of 63.2
11.4 years ( range , 3984 years ) .
the subjects mean height , weight , and body mass index were
154.7 7.9 cm , 56.8 10.5 kg , and 23.8 3.8 kg / m , respectively .
the
documented diagnoses were as follows : hip oa ( n = 100 ) and osteonecrosis of the femoral head
( n = 13 ) .
the scheduled arthroplastic procedures were tha ( n = 107 ) , bipolar hip
arthroplasty ( bha , n = 5 ) , and birmingham hip resurfacing ( bhr , n = 1 ) . furthermore , the
mean duration of continuing pain was 6.9 8.2 years .
the data are expressed as mean sd , unless otherwise specified for regional pain assessment , based on a previous study2 , we referred to a body chart that was used as part of physical
therapy evaluation . on the body chart , which depicted the area from the lower limb to the
foot ,
all the patients were asked to mark the areas of the limb that experienced pain in
resting and motion .
the evaluation
was conducted before ( 1.4 0.9 days ) and after the operation ( 15.0 5.0 days ) . for
analysis of regional pain frequency and pain patterns ,
the pain region was divided into the
groin , greater trochanter , glutealis , thigh ( anterior , posterior , lateral , and medial ) , knee
( anterior and posterior ) , and below the leg .
all the cadavers were supplied by body donation , and consent for their use for education and
research had been given . given that no data allowing the identification of the individuals
were presented , the publication of this study does not pose any ethical problems .
the
femoral and obturator nerves and their branches were exposed , and the articular branches
were studied macroscopically .
the incidence of regional pain in the 113 patients is summarized in table 2table 2 .
the incidence of the regional pain patternsgroingreatertrochanterglutealisthigh(anterior)thigh(posterior)thigh(lateral)thigh(medial)knee(anterior)knee(posterior)belowthe legrestpre38 ( 33.6)21 ( 18.6)21 ( 18.6)12 ( 10.6)4 ( 3.5)13 ( 11.5)5 ( 4.4)15 ( 13.3)1 ( 0.9)9 ( 8.0)post17 ( 15.0)13 ( 11.5)13 ( 11.5)5 ( 4.4)4 ( 3.5)5 ( 4.4)6 ( 5.3)7 ( 6.2)5 ( 4.4)6 ( 5.3)motionpre71 ( 62.8)39 ( 34.5)42 ( 37.2)22 ( 19.5)11 ( 9.7)21 ( 18.6)4 ( 3.5)38 ( 33.6)10 ( 8.8)14 ( 12.4 ) post37 ( 32.7)38 ( 33.6)23 ( 20.4)22 ( 19.5)10 ( 8.8)20 ( 17.7)15 ( 13.3)19 ( 16.8)8 ( 7.1)8 ( 7.1)the data are expressed as number of cases ( % ) .
we found that 38 patients ( 33.6% ) in resting and 71 patients ( 62.8% ) in
motion preoperatively complained of groin pain , which had the highest incidence rate . in
order of decrease
, it was followed by pain in the greater trochanter ( 21 patients [ 18.6% ] in
resting and 39 patients [ 34.5% ] in motion ) and glutealis ( 21 patients [ 18.6% ] in resting and
42 [ 37.2% ] in motion ) .
anterior and lateral thigh pains occurred in 12 ( 10.6% ) and 13
patients ( 11.5% ) in resting , and 22 ( 19.5% ) and 21 patients ( 18.6% ) in motion , respectively .
anterior knee pain was preoperatively experienced by 15 patients ( 13.3% ) in resting and 38
patients ( 33.6% ) in motion . at postoperation
groin pain had the highest incidence in resting ( 17 cases , 15.0% ) and
second highest in motion ( 37 cases , 32.7% ) .
greater trochanter and glutealis pains occurred
in 13 cases ( 11.5% ) in resting and 38 ( 33.6% ) and 23 cases ( 20.4% ) in motion , respectively .
the postoperative thigh pain frequency was comparable with or better than that before the
operation .
anterior knee pain was recorded for 7 cases ( 6.2% ) in resting and 19 cases
( 16.8% ) in motion .
changes in the incidence of knee pain from preoperation to postoperationrestingmotionprepostprepostanterior1513812posterior1182pre , preoperative ; post , postoperative presents the changes in the incidence of knee pain from before to after the
operation .
fifteen patients ( 13.3% ) in resting and 42 patients ( 37.2% ) in motion
preoperatively complained of knee pain . at postoperation ,
anterior knee pain disappeared in
14 patients in resting and 26 patients in motion .
pre , preoperative ; post , postoperative twelve pain referred patterns are presented in table
4table 4 .
the incidence of the 12 observed patterns of painpain patternsrestmotionprepostprepostgroin alone12 ( 10.6)6 ( 5.3)17 ( 15.0)9 ( 8.0)greater trochanter alone1 ( 0.9)4 ( 3.5)2 ( 1.8)3 ( 2.7)groin + greater trochanter3 ( 2.7)3 ( 2.7)2 ( 1.8)4 ( 3.5)groin + glutealis7 ( 6.2)1 ( 0.9)9 ( 8.0)4 ( 3.5)groin + thigh ( anterior and medial)11 ( 9.7)7 ( 6.2)18 ( 15.9)17 ( 15.0)groin + thigh ( anterior and medial ) + knee
( anterior)6 ( 5.3)1 ( 0.9)12 ( 10.6)7 ( 6.2)groin + knee ( anterior)6 ( 5.3)2 ( 1.8)21 ( 18.5)8 ( 7.1)glutealis alone5 ( 4.4)3 ( 2.7)8 ( 7.1)11 ( 9.7)glutealis + thigh ( posterior)2 ( 1.8)1 ( 0.9)4 ( 3.5)2 ( 1.8)glutealis + thigh ( posterior ) + knee ( posterior)1 ( 0.9)0 ( 0.0)1 ( 0.9)0 ( 0.0)glutealis + knee ( posterior)0 ( 0.0)2 ( 1.8)3 ( 2.7)3 ( 2.7)thigh and/or knee5 ( 4.4)7 ( 6.2)9 ( 8.0)20 ( 17.7)the data are expressed as number of cases ( % ) .
most of the referred pain patterns were observed in the ventral aspect of the
lower limb . at preoperation ,
the highest incidence of referred pain pattern in resting was
observed in the groin alone ( 12 cases , 10.6% ) , followed by groin pain referred to the thigh
and knee ( 11 cases , 9.7% ) . in motion , however , the incidence of groin pain referred to the
thigh and knee increased compared with that in resting . at postoperation , the referred pain
patterns in resting and motion decreased compared with those at preoperation .
pre , preoperative ; post ,
postoperative we observed two adult cadavers to analyze the nerve supply to the hip and knee joints . in
one case , a small branch ascended vertically from the branch of the femoral nerve to the
pectineal muscle and entered to the anteromedial side of the iliofemoral ligament ( fig .
( a , b ) the
anteromedial aspect of the right hip joint . ( c , d ) the medial aspect of the right knee
joint . 1 : femoral artery .
4 : vastus medialis .
5 : patella . in one cadaver , a small branch ( arrow ) that entered the anterior side of
the iliofemoral ligament originated from the femoral nerve ( a , b ) . in the same
cadaver , one minor muscular branch that pierced the vastus medialis entered the joint
capsule from the superior medial aspect of the patella ( c , d ) .
it seems that each
branch is an articular branch of the femoral nerve innervating the hip and knee
joints . ) . in the same case ,
other minor branches of the femoral nerve that pierced the vastus
medialis entered the joint capsule from the superior medial aspect of the patella ( fig .
a small branch from
the posterior branch of the obturator nerve entered the anteromedial aspect of the
pubofemoral ligament ( fig .
small branches of the obturator nerve in the hip and knee joint ( a , b ) the
anteromedial aspect of the left hip joint .
( d ) the medial aspect of the distal left thigh ( around the adductor
canal ) .
( e ) the medial aspect of the left knee joint . 1 : obturator foramen . 2 :
anterior branch of the obturator nerve .
3 : posterior branch of the obturator nerve . 4 :
adductor longus . 5 : gracilis . in the other cadaver ,
a small branch ( arrow ) originated
from the posterior branch of the obturator nerve .
a branch
( arrow ) of the posterior branch of the obturator nerve ran down along the adductor
longus ( c ) , converging with the saphena nerve ( arrow in e ) .
the small branch ( arrow )
entered the knee joint from the medial aspect of the patella ( e ) . ) .
in addition , the branch derived from the posterior branch of the obturator nerve
ran down along the adductor longus , following convergence with the saphena nerve ( fig . 2c ,
d ) . the small branch entered the knee joint
from the medial aspect of the patella ( fig .
( a , b ) the
anteromedial aspect of the right hip joint . ( c , d ) the medial aspect of the right knee
joint . 1 : femoral artery .
4 : vastus medialis .
5 : patella . in one cadaver , a small branch ( arrow ) that entered the anterior side of
the iliofemoral ligament originated from the femoral nerve ( a ,
the vastus medialis entered the joint
capsule from the superior medial aspect of the patella ( c , d ) .
it seems that each
branch is an articular branch of the femoral nerve innervating the hip and knee
joints .
small branches of the obturator nerve in the hip and knee joint ( a , b ) the
anteromedial aspect of the left hip joint .
( d ) the medial aspect of the distal left thigh ( around the adductor
canal ) .
( e ) the medial aspect of the left knee joint . 1 : obturator foramen . 2 :
anterior branch of the obturator nerve .
3 : posterior branch of the obturator nerve . 4 :
adductor longus . 5 : gracilis . in the other cadaver ,
a small branch ( arrow ) originated
from the posterior branch of the obturator nerve .
a branch
( arrow ) of the posterior branch of the obturator nerve ran down along the adductor
longus ( c ) , converging with the saphena nerve ( arrow in e ) .
the small branch ( arrow )
entered the knee joint from the medial aspect of the patella ( e ) .
several studies have reported that pain originating from the hip joint referred to the
thigh , knee , and the below lower leg in patients with hip disease4,5,6 , 9 . among these regions ,
the
anterior knee is the most common pain location to which hip joint and anterior thigh pain
radiate .
the saphenous branch of the femoral nerves that supply articular branches to the
hip joint has been considered to be a source of referred pain originating from the hip
joint .
however , only a few previous research studies have reported the occurrence patterns
of referred pain with consideration of the neuroanatomical aspect of the lower limb . in this
study
, we retrospectively investigated the preoperative and postoperative incidences of
regional pain , and occurrence patterns of referred pain .
in addition , we observed the
sensory nerve innervation of the hip and knee joints in two cadavers , using a macroscopic
approach . at preoperation ,
the most common pain locations in the patients with hip disease were the
groin , greater trochanter , glutealis , anterior thigh , and anterior knee .
the incidence rates
of these regional pains in motion were markedly increased compared with those in resting .
the incidence of anterior knee pain was comparable with that of greater trochanter pain .
khan and woolson9 reported that 65% of
patients with primary hip disease had pain in the knee area , 88% of whom had anterior knee
pain .
hsieh et al.5 noted that anterior
knee pain occurred in 35.4% of patients with end - stage hip disease before tha .
our findings
regarding the incidence of anterior knee pain support those of previous studies .
in contrast
to our findings , , lesher et al.12
reported that only 2% of the patients who underwent diagnostic and potentially therapeutic
uoroscopically guided intra - articular hip injections had knee pain .
the difference in the
incidence of knee pain may arise from the disease stage of subjects .
our subjects were
patients with end - stage hip joint disease who underwent arthroplasty as were the subjects of
study by khan and woolson9 .
there is a
possibility that stage of hip joint disease may affect the incidence of regional pain . at
postoperation
, the incidence rates of almost all regional pain patterns in resting and
motion were reduced compared with those at preoperation .
we speculate that these referred
pains originated in hip joint , considering that the patients with lower limb and lumbar
diseases were excluded from this study .
therefore , if referred pain from the hip joint
induces preoperative anterior knee pain , we can infer that arthroplasty , which removes
pain - causing tissues , reduces the anterior knee pain . of our cases , 15 had anterior knee
pain in resting at preoperation , which disappeared in 14 patients ( 93.3% ) at postoperation .
moreover , in 26 ( 68.4% ) of 38 patients , anterior knee pain in motion disappeared
postoperatively .
these results suggest that most referred pain radiate from the hip joint to
the knee in the patients with hip disease before hip joint arthroplasty .
the incidence of regional pain among our patients indicated that the most common pain
locations were the groin , anterior knee , and ventral lower limb .
these areas are innervated
by the femoral and obturator nerves that supply articular branches to the hip joint .
we
speculated that the referred pain pattern in hip joint disease occurs along areas innervated
by these nerves .
we identified 12 referral pain patterns based on body image maps . in the
preoperative period , in referred pain pattern in resting
was observed most commonly in the
groin alone , and groin pain with an anterior thigh referral had an incidence rate of
approximately 10% .
meanwhile , the pain pattern in motion was observed to be in the groin ,
with thigh and/or anterior knee referral .
these referred pain patterns decreased
postoperatively , except in the groin with a thigh pain pattern in motion .
birnbaum et
al.10 suggested that the anterior
section of the hip joint capsule is supplied by the articular branches of the femoral and
obturator nerves .
moreover , the cutaneous branches of these nerves innervate the anterior
and medial aspects of the thigh .
therefore , it is likely that the femoral and obturator
nerves are the source of the referred pain pattern observed in the ventral lower limb . in
addition , hirasawa et al.13 reported that
the branches of these nerves enter the anterosuperior or medial aspect of the knee joint ,
which is thought to be the causative factor of knee pain originating from the hip joint .
the femoral and obturator nerves , derived from lumbar nerve roots 2 to 4 , have great
influence on the hip joint capsule , including the sensory dermatomes of the groin , medial
and anterior thigh , anterior knee , and medial leg . to our knowledge , this is the first
investigation to observe the branches entering the hip and knee joints at the same time . in
one cadaver ,
the femoral nerve supplied a small branch to the anterior side of the
iliofemoral ligament and superior medial aspect of the patella penetrating the vastus
medialis . in the other cadaver ,
the obturator nerve supplied a small branch to the
anteromedial aspect of the pubofemoral ligament and the medial aspect of the patella .
based
on the studies of birnbaum et al.10 and
hirasawa et al.13 , these small branches
seemed to be articular branches of the femoral and obturator nerves .
in addition , hirasawa
et al.13 found the branches , divided from
the nerves innervated to the joint capsule , were distributed to the anterior and posterior
cruciate ligaments .
moreover , miura et al.14 reported that approximately 1.6% of all drg neurons innervating the
hip joints had dichotomizing axons that extended to the medial portion of knee skin , which
may play some role in the occurrence of referred pain . in this
regard , our findings suggest
that the articular branches of the femoral and obturator nerves contributed to the referred
pain in the patients with hip joint disease . it should be noted that anterior knee pain postoperatively remained in 12 patients ,
contradicting our aforementioned opinion .
kawada et al.2 reported that a few patients with hip joint disease were
successfully treated with nerve root block therapy to reduce the referred pain , although an
intra - articular block injection therapy failed to reduce the pain .
this finding suggests
that the sensitization of spinal cord neurons caused by a prolonged noxious stimulus
occurred in the patients with hip disease .
in general , patients with hip oa have chronic
pain derived from degenerative changes caused by bone deformation and synovial inflammation .
therefore , the sensitization of spinal cord neurons caused by a noxious stimulus may be
considered as a mechanism underlying the persistence of referred pain after arthroplasty .
however , a recent study indicated that immobilization of the hind limbs of rats induced
chronic pain15 . a previous study
assessing pain after tha reported that poor preoperative function might affect recovery
unfavorably , which might in turn lead to chronic pain16 .
therefore , chronic pain in oa patients leads to a reduction in the amount of physical
activity , which may lead to another chronic pain pattern .
the present study was unable to
clarify the details of the pain origin in the cases presented .
first , the postoperative evaluation was initiated
approximately 2 weeks after arthroplasty ; thus , post surgical pain may have influenced the
incidence of regional pain and pain patterns , particularly , pain in the glutealis , the
greater trochanter and the lateral thigh in motion .
therefore , we think that more observation is
necessary to clarify the relation between referred pain in patients with hip disease and the
articular branches of the femoral and obturator nerves . | [ purpose ] the aim of this study was to examine the incidence and patterns of referred
pain in patients with hip disease , as well as the nerve distribution in the hip and knee
joints of 2 cadavers . [ subjects and methods ] a total of 113 patients with hip joint
disease were included in the investigation .
the incidence of regional pain and referred
pain patterns were evaluated before and after arthroplasty .
two cadavers were
macroscopically observed to verify the nerve innervation of the hip and knee joints .
[ results ] anterior knee pain was observed preoperatively in 13.3% ( in resting ) and 33.6%
( in motion ) of the patients , which was comparable with the incidence of greater trochanter
pain .
in addition , the preoperative incidence rates of knee pain in resting and motion
markedly decreased postoperatively .
of note is the remarkable incidence of pain radiating
to the ventral lower limb .
an anteromedial innervation was determined in the cadavers by
the articular branches of the obturator and femoral nerve , which supply small branches to
the knee joints .
[ conclusion ] our results suggest that the distribution of the incidence
of pain among the patients with hip disease is diverse owing to the sensory distribution
of the femoral and obturator nerves . |