File size: 214,947 Bytes
dbfbfc3 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 2058 2059 2060 2061 2062 2063 2064 2065 2066 2067 2068 2069 2070 2071 2072 2073 2074 2075 2076 2077 2078 2079 2080 2081 2082 2083 2084 2085 2086 2087 2088 2089 2090 2091 2092 2093 2094 2095 2096 2097 2098 2099 2100 2101 2102 2103 2104 2105 2106 2107 2108 2109 2110 2111 2112 2113 2114 2115 2116 2117 2118 2119 2120 2121 2122 2123 2124 2125 2126 2127 2128 2129 2130 2131 2132 2133 2134 2135 2136 2137 2138 2139 2140 2141 2142 2143 2144 2145 2146 2147 2148 2149 2150 2151 2152 2153 2154 2155 2156 2157 2158 2159 2160 2161 2162 2163 2164 2165 2166 2167 2168 2169 2170 2171 2172 2173 2174 2175 2176 2177 2178 2179 2180 2181 2182 2183 2184 2185 2186 2187 2188 2189 2190 2191 2192 2193 2194 2195 2196 2197 2198 2199 2200 2201 2202 2203 2204 2205 2206 2207 2208 2209 2210 2211 2212 2213 2214 2215 2216 2217 2218 2219 2220 2221 2222 2223 2224 2225 2226 2227 2228 2229 2230 2231 2232 2233 2234 2235 2236 2237 2238 2239 2240 2241 2242 2243 2244 2245 2246 2247 2248 2249 2250 2251 2252 2253 2254 2255 2256 2257 2258 2259 2260 2261 2262 2263 2264 2265 2266 2267 2268 2269 2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280 2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291 2292 2293 2294 2295 2296 2297 2298 2299 2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317 2318 2319 2320 2321 2322 2323 2324 2325 2326 2327 2328 2329 2330 2331 2332 2333 2334 2335 2336 2337 2338 2339 2340 2341 2342 2343 2344 2345 2346 2347 2348 2349 2350 2351 2352 2353 2354 2355 2356 2357 2358 2359 2360 2361 2362 2363 2364 2365 2366 2367 2368 2369 2370 2371 2372 2373 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2395 2396 2397 2398 2399 2400 2401 2402 2403 2404 2405 2406 2407 2408 2409 2410 2411 2412 2413 2414 2415 2416 2417 2418 2419 2420 2421 2422 2423 2424 2425 2426 2427 2428 2429 2430 2431 2432 2433 2434 2435 2436 2437 2438 2439 2440 2441 2442 2443 2444 2445 2446 2447 2448 2449 2450 2451 2452 2453 2454 2455 2456 2457 2458 2459 2460 2461 2462 2463 2464 2465 2466 2467 2468 2469 2470 2471 2472 2473 2474 2475 2476 2477 2478 2479 2480 2481 2482 2483 2484 2485 2486 2487 2488 2489 2490 2491 2492 2493 2494 2495 2496 2497 2498 2499 2500 2501 2502 2503 2504 2505 2506 2507 2508 2509 2510 2511 2512 2513 2514 2515 2516 2517 2518 2519 2520 2521 2522 2523 2524 2525 2526 2527 2528 2529 2530 2531 2532 2533 2534 2535 2536 2537 2538 2539 2540 2541 2542 2543 2544 2545 2546 2547 2548 2549 2550 2551 2552 2553 2554 2555 2556 2557 2558 2559 2560 2561 2562 2563 2564 2565 2566 2567 2568 2569 2570 2571 2572 2573 2574 2575 2576 2577 2578 2579 2580 2581 2582 2583 2584 2585 2586 2587 2588 2589 2590 2591 2592 2593 2594 2595 2596 2597 2598 2599 2600 2601 2602 2603 2604 2605 2606 2607 2608 2609 2610 2611 2612 2613 2614 2615 2616 2617 2618 2619 2620 2621 2622 2623 2624 2625 2626 2627 2628 2629 2630 2631 2632 2633 2634 2635 2636 2637 2638 2639 2640 2641 2642 2643 2644 2645 2646 2647 2648 2649 2650 2651 2652 2653 2654 2655 2656 2657 2658 2659 2660 2661 2662 2663 2664 2665 2666 2667 2668 2669 2670 2671 2672 2673 2674 2675 2676 2677 2678 2679 2680 2681 2682 2683 2684 2685 2686 2687 2688 2689 2690 2691 2692 2693 2694 2695 2696 2697 2698 2699 2700 2701 2702 2703 2704 2705 2706 2707 2708 2709 2710 2711 2712 2713 2714 2715 2716 2717 2718 2719 2720 2721 2722 2723 2724 2725 2726 2727 2728 2729 2730 2731 2732 2733 2734 2735 2736 2737 2738 2739 2740 2741 2742 2743 2744 2745 2746 2747 2748 2749 2750 2751 2752 2753 2754 2755 2756 2757 2758 2759 2760 2761 2762 2763 2764 2765 2766 2767 2768 2769 2770 2771 2772 2773 2774 2775 2776 2777 2778 2779 2780 2781 2782 2783 2784 2785 2786 2787 2788 2789 2790 2791 2792 2793 2794 2795 2796 2797 2798 2799 2800 2801 2802 2803 2804 2805 2806 2807 2808 2809 2810 2811 2812 2813 2814 2815 2816 2817 2818 2819 2820 2821 2822 2823 2824 2825 2826 2827 2828 2829 2830 2831 2832 2833 2834 2835 2836 2837 2838 2839 2840 2841 2842 2843 2844 2845 2846 2847 2848 2849 2850 2851 2852 2853 2854 2855 2856 2857 2858 2859 2860 2861 2862 2863 2864 2865 2866 2867 2868 2869 2870 2871 2872 2873 2874 2875 2876 2877 2878 2879 2880 2881 2882 2883 2884 2885 2886 2887 2888 2889 2890 2891 2892 2893 2894 2895 2896 2897 2898 2899 2900 2901 2902 2903 2904 2905 2906 2907 2908 2909 2910 2911 2912 2913 2914 2915 2916 2917 2918 2919 2920 2921 2922 2923 2924 2925 2926 2927 2928 2929 2930 2931 2932 2933 2934 2935 2936 2937 2938 2939 2940 2941 2942 2943 2944 2945 2946 2947 2948 2949 2950 2951 2952 2953 2954 2955 2956 2957 2958 2959 2960 2961 2962 2963 2964 2965 2966 2967 2968 2969 2970 2971 2972 2973 2974 2975 2976 2977 2978 2979 2980 2981 2982 2983 2984 2985 2986 2987 2988 2989 2990 2991 2992 2993 2994 2995 2996 2997 2998 2999 3000 3001 3002 3003 3004 3005 3006 3007 3008 3009 3010 3011 3012 3013 3014 3015 3016 3017 3018 3019 3020 3021 3022 3023 3024 3025 3026 3027 3028 3029 3030 3031 3032 3033 3034 3035 3036 3037 3038 3039 3040 3041 3042 3043 3044 3045 3046 3047 3048 3049 3050 3051 3052 3053 3054 3055 3056 3057 3058 3059 3060 3061 3062 3063 3064 3065 3066 3067 3068 3069 3070 3071 3072 3073 3074 3075 3076 3077 3078 3079 3080 3081 3082 3083 3084 3085 3086 3087 3088 3089 3090 3091 3092 3093 3094 3095 3096 3097 3098 3099 3100 3101 3102 3103 3104 3105 3106 3107 3108 3109 3110 3111 3112 3113 3114 3115 3116 3117 3118 3119 3120 3121 3122 3123 3124 3125 3126 3127 3128 3129 3130 3131 3132 3133 3134 3135 3136 3137 3138 3139 3140 3141 3142 3143 3144 3145 3146 3147 3148 3149 3150 3151 3152 3153 3154 3155 3156 3157 3158 3159 3160 3161 3162 3163 3164 3165 3166 3167 3168 3169 3170 3171 3172 3173 3174 3175 3176 3177 3178 3179 3180 3181 3182 3183 3184 3185 3186 3187 3188 3189 3190 3191 3192 3193 3194 3195 3196 3197 3198 3199 3200 3201 3202 3203 3204 3205 3206 3207 3208 3209 3210 3211 3212 3213 3214 3215 3216 3217 3218 3219 3220 3221 3222 3223 3224 3225 3226 3227 3228 3229 3230 3231 3232 3233 3234 3235 3236 3237 3238 3239 3240 3241 3242 3243 3244 3245 3246 3247 3248 3249 3250 3251 3252 3253 3254 3255 3256 3257 3258 3259 3260 3261 3262 3263 3264 3265 3266 3267 3268 3269 3270 3271 3272 3273 3274 3275 3276 3277 3278 3279 3280 3281 3282 3283 3284 3285 3286 3287 3288 3289 3290 3291 3292 3293 3294 3295 3296 3297 3298 3299 3300 3301 3302 3303 3304 3305 3306 3307 3308 3309 3310 3311 3312 3313 3314 3315 3316 3317 3318 3319 3320 3321 3322 3323 3324 3325 3326 3327 3328 3329 3330 3331 3332 3333 3334 3335 3336 3337 3338 3339 3340 3341 3342 3343 3344 3345 3346 3347 3348 3349 3350 3351 3352 3353 3354 3355 3356 3357 3358 3359 3360 3361 3362 3363 3364 3365 3366 3367 3368 3369 3370 3371 3372 3373 3374 3375 3376 3377 3378 3379 3380 3381 3382 3383 3384 3385 3386 3387 3388 3389 3390 3391 3392 3393 3394 3395 3396 3397 3398 3399 3400 3401 3402 3403 3404 3405 3406 3407 3408 3409 3410 3411 3412 3413 3414 3415 3416 3417 3418 3419 3420 3421 3422 3423 3424 3425 3426 3427 3428 3429 3430 3431 3432 3433 3434 3435 3436 3437 3438 3439 3440 3441 3442 3443 3444 3445 3446 3447 3448 3449 3450 3451 3452 3453 3454 3455 3456 3457 3458 3459 3460 3461 3462 3463 3464 3465 3466 3467 3468 3469 3470 3471 3472 3473 3474 3475 3476 3477 3478 3479 3480 3481 3482 3483 3484 3485 3486 3487 3488 3489 3490 3491 3492 3493 3494 3495 3496 3497 3498 3499 3500 3501 3502 3503 3504 3505 3506 3507 3508 3509 3510 3511 3512 3513 3514 3515 3516 3517 3518 3519 3520 3521 3522 3523 3524 3525 3526 3527 3528 3529 3530 3531 3532 3533 3534 3535 3536 3537 3538 3539 3540 3541 3542 3543 3544 3545 3546 3547 3548 3549 3550 3551 3552 3553 3554 3555 3556 3557 3558 3559 3560 3561 3562 3563 3564 3565 3566 3567 3568 3569 3570 3571 3572 3573 3574 3575 3576 3577 3578 3579 3580 3581 3582 3583 3584 3585 3586 3587 3588 3589 3590 3591 3592 3593 3594 3595 3596 3597 3598 3599 3600 3601 3602 3603 3604 3605 3606 3607 3608 3609 3610 3611 3612 3613 3614 3615 3616 3617 3618 3619 3620 3621 3622 3623 3624 3625 3626 3627 3628 3629 3630 3631 3632 3633 3634 3635 3636 3637 3638 3639 3640 3641 3642 3643 3644 3645 3646 3647 3648 3649 3650 3651 3652 3653 3654 3655 3656 3657 3658 3659 3660 3661 3662 3663 3664 3665 3666 3667 3668 3669 3670 3671 3672 3673 3674 3675 3676 3677 3678 3679 3680 3681 3682 3683 3684 3685 3686 3687 3688 3689 3690 3691 3692 3693 3694 3695 3696 3697 3698 3699 3700 3701 3702 3703 3704 3705 3706 3707 3708 3709 3710 3711 3712 3713 3714 3715 3716 3717 3718 3719 3720 3721 3722 3723 3724 3725 3726 3727 3728 3729 3730 3731 3732 3733 3734 3735 3736 3737 3738 3739 3740 3741 3742 3743 3744 3745 3746 3747 3748 3749 3750 3751 3752 3753 3754 3755 3756 3757 3758 3759 3760 3761 3762 3763 3764 3765 3766 3767 3768 3769 3770 3771 3772 3773 3774 3775 3776 3777 3778 3779 3780 3781 3782 3783 3784 3785 3786 3787 3788 3789 3790 3791 3792 3793 3794 3795 3796 3797 3798 3799 3800 3801 3802 3803 3804 3805 3806 3807 3808 3809 3810 3811 3812 3813 3814 3815 3816 3817 3818 3819 3820 3821 3822 3823 3824 3825 3826 3827 3828 3829 3830 3831 3832 3833 3834 3835 3836 3837 3838 3839 3840 3841 3842 3843 3844 3845 3846 3847 3848 3849 3850 3851 3852 3853 3854 3855 3856 3857 3858 3859 3860 3861 3862 3863 3864 3865 3866 3867 3868 3869 3870 3871 3872 3873 3874 3875 3876 3877 3878 3879 3880 3881 3882 3883 3884 3885 3886 3887 3888 3889 3890 3891 3892 3893 3894 3895 3896 3897 3898 3899 3900 3901 3902 3903 3904 3905 3906 3907 3908 3909 3910 3911 3912 3913 3914 3915 3916 3917 3918 3919 3920 3921 3922 3923 3924 3925 3926 3927 3928 3929 3930 3931 3932 3933 3934 3935 3936 3937 3938 3939 3940 3941 3942 3943 3944 3945 3946 3947 3948 3949 3950 3951 3952 3953 3954 3955 3956 3957 3958 3959 3960 3961 3962 3963 3964 3965 3966 3967 3968 3969 3970 3971 3972 3973 3974 3975 3976 3977 3978 3979 3980 3981 3982 3983 3984 3985 3986 3987 3988 3989 3990 3991 3992 3993 3994 3995 3996 3997 3998 3999 4000 4001 4002 4003 4004 4005 4006 4007 4008 4009 4010 4011 4012 4013 4014 4015 4016 4017 4018 4019 4020 4021 4022 4023 4024 4025 4026 4027 4028 4029 4030 4031 4032 4033 4034 4035 4036 4037 4038 4039 4040 4041 4042 4043 4044 4045 4046 4047 4048 4049 4050 4051 4052 4053 4054 4055 4056 4057 4058 4059 4060 4061 4062 4063 4064 4065 4066 4067 4068 4069 4070 4071 4072 4073 4074 4075 4076 4077 4078 4079 4080 4081 4082 4083 4084 4085 4086 4087 4088 4089 4090 4091 4092 4093 4094 4095 4096 4097 4098 4099 4100 4101 4102 4103 4104 4105 4106 4107 4108 4109 4110 4111 4112 4113 4114 4115 4116 4117 4118 4119 4120 4121 4122 4123 4124 4125 4126 4127 4128 4129 4130 4131 4132 4133 4134 4135 4136 4137 4138 4139 4140 4141 4142 4143 4144 4145 4146 4147 4148 4149 4150 4151 4152 4153 4154 4155 4156 4157 4158 4159 4160 4161 4162 4163 4164 4165 4166 4167 4168 4169 4170 4171 4172 4173 4174 4175 4176 4177 4178 4179 4180 4181 4182 4183 4184 4185 4186 4187 4188 4189 4190 4191 4192 4193 4194 4195 4196 4197 4198 4199 4200 4201 4202 4203 4204 4205 4206 4207 4208 4209 4210 4211 4212 4213 4214 4215 4216 4217 4218 4219 4220 4221 4222 4223 4224 4225 4226 4227 4228 4229 4230 4231 4232 4233 4234 4235 4236 4237 4238 4239 4240 4241 4242 4243 4244 4245 4246 4247 4248 4249 4250 4251 4252 4253 4254 4255 4256 4257 4258 4259 4260 4261 4262 4263 4264 4265 4266 4267 4268 4269 4270 4271 4272 4273 4274 4275 4276 4277 4278 4279 4280 4281 4282 4283 4284 4285 4286 4287 4288 4289 4290 4291 4292 4293 4294 4295 4296 4297 4298 4299 4300 4301 4302 4303 4304 4305 4306 4307 4308 4309 4310 4311 4312 4313 4314 4315 4316 4317 4318 4319 4320 4321 4322 4323 4324 4325 4326 4327 4328 4329 4330 4331 4332 4333 4334 4335 4336 4337 4338 4339 4340 4341 4342 4343 4344 4345 4346 4347 4348 4349 4350 4351 4352 4353 4354 4355 4356 4357 4358 4359 4360 4361 4362 4363 4364 4365 4366 4367 4368 4369 4370 4371 4372 4373 4374 4375 4376 4377 4378 4379 4380 4381 4382 4383 4384 4385 4386 4387 4388 4389 4390 4391 4392 4393 4394 4395 4396 4397 4398 4399 4400 4401 4402 4403 4404 4405 4406 4407 4408 4409 4410 4411 4412 4413 4414 4415 4416 4417 4418 4419 4420 4421 4422 4423 4424 4425 4426 4427 4428 4429 4430 4431 4432 4433 4434 4435 4436 4437 4438 4439 4440 4441 4442 4443 4444 4445 4446 4447 4448 4449 4450 4451 4452 4453 4454 4455 4456 4457 4458 4459 4460 4461 4462 4463 4464 4465 4466 4467 4468 4469 4470 4471 4472 4473 4474 4475 4476 4477 4478 4479 4480 4481 4482 4483 4484 4485 4486 4487 4488 4489 4490 4491 4492 4493 4494 4495 4496 4497 4498 4499 4500 4501 4502 4503 4504 4505 4506 4507 4508 4509 4510 4511 4512 4513 4514 4515 4516 4517 4518 4519 4520 4521 4522 4523 4524 4525 4526 4527 4528 4529 4530 4531 4532 4533 4534 4535 4536 4537 4538 4539 4540 4541 4542 4543 4544 4545 4546 4547 4548 4549 4550 4551 4552 4553 4554 4555 4556 4557 4558 4559 4560 4561 4562 4563 4564 4565 4566 4567 4568 4569 4570 4571 4572 4573 4574 4575 4576 4577 4578 4579 4580 4581 4582 4583 4584 4585 4586 4587 4588 4589 4590 4591 4592 4593 4594 4595 4596 4597 4598 4599 4600 4601 4602 4603 4604 4605 4606 4607 4608 4609 4610 4611 4612 4613 4614 4615 4616 4617 4618 4619 4620 4621 4622 4623 4624 4625 4626 4627 4628 4629 4630 4631 4632 4633 4634 4635 4636 4637 4638 4639 4640 4641 4642 4643 4644 4645 4646 4647 4648 4649 4650 4651 4652 4653 4654 4655 4656 4657 4658 4659 4660 4661 4662 4663 4664 4665 4666 4667 4668 4669 4670 4671 4672 4673 4674 4675 4676 4677 4678 4679 4680 4681 4682 4683 4684 4685 4686 4687 4688 4689 4690 4691 4692 4693 4694 4695 4696 4697 4698 4699 4700 4701 4702 4703 4704 4705 4706 4707 4708 4709 4710 4711 4712 4713 4714 4715 4716 4717 4718 4719 4720 4721 4722 4723 4724 4725 4726 4727 4728 4729 4730 4731 4732 4733 4734 4735 4736 4737 4738 4739 4740 4741 4742 4743 4744 4745 4746 4747 4748 4749 4750 4751 4752 4753 4754 4755 4756 4757 4758 4759 4760 4761 4762 4763 4764 4765 4766 4767 4768 4769 4770 4771 4772 4773 4774 4775 4776 4777 4778 4779 4780 4781 4782 4783 4784 4785 4786 4787 4788 4789 4790 4791 4792 4793 4794 4795 4796 4797 4798 4799 4800 4801 4802 4803 4804 4805 4806 4807 4808 4809 4810 4811 4812 4813 4814 4815 4816 4817 4818 4819 4820 4821 4822 4823 4824 4825 4826 4827 4828 4829 4830 4831 4832 4833 4834 4835 4836 4837 4838 4839 4840 4841 4842 4843 4844 4845 4846 4847 4848 4849 4850 4851 4852 4853 4854 4855 4856 4857 4858 4859 4860 4861 4862 4863 4864 4865 4866 4867 4868 4869 4870 4871 4872 4873 4874 4875 4876 4877 4878 4879 4880 4881 4882 4883 4884 4885 4886 4887 4888 4889 4890 4891 4892 4893 4894 4895 4896 4897 4898 4899 4900 4901 4902 4903 4904 4905 4906 4907 4908 4909 4910 4911 4912 4913 4914 4915 4916 4917 4918 4919 4920 4921 4922 4923 4924 4925 4926 4927 4928 4929 4930 4931 4932 4933 4934 4935 4936 4937 4938 4939 4940 4941 4942 4943 4944 4945 4946 4947 4948 4949 4950 4951 4952 4953 4954 4955 4956 4957 4958 4959 4960 4961 4962 4963 4964 4965 4966 4967 4968 4969 4970 4971 4972 4973 4974 4975 4976 4977 4978 4979 4980 4981 4982 4983 4984 4985 4986 4987 4988 4989 4990 4991 4992 4993 4994 4995 4996 4997 4998 4999 5000 5001 5002 5003 5004 5005 5006 5007 5008 5009 5010 5011 5012 5013 5014 5015 5016 5017 5018 5019 5020 5021 5022 5023 5024 5025 5026 5027 5028 5029 5030 5031 5032 5033 5034 5035 5036 5037 5038 5039 5040 5041 5042 5043 5044 5045 5046 5047 5048 5049 5050 5051 5052 5053 5054 5055 5056 5057 5058 5059 5060 5061 5062 5063 5064 5065 5066 5067 5068 5069 5070 5071 5072 5073 5074 5075 5076 5077 5078 5079 5080 5081 5082 5083 5084 5085 5086 5087 5088 5089 5090 5091 5092 5093 5094 5095 5096 5097 5098 5099 5100 5101 5102 5103 5104 5105 5106 5107 5108 5109 5110 5111 5112 5113 5114 5115 5116 5117 5118 5119 5120 5121 5122 5123 5124 5125 5126 5127 5128 5129 5130 5131 5132 5133 5134 5135 5136 5137 5138 5139 5140 5141 5142 5143 5144 5145 5146 5147 5148 5149 5150 5151 5152 5153 5154 5155 5156 5157 5158 5159 5160 5161 5162 5163 5164 5165 5166 5167 5168 5169 5170 5171 5172 5173 5174 5175 5176 5177 5178 5179 5180 5181 5182 5183 5184 5185 5186 5187 5188 5189 5190 5191 5192 5193 5194 5195 5196 5197 5198 5199 5200 5201 5202 5203 5204 5205 5206 5207 5208 5209 5210 5211 5212 5213 5214 5215 5216 5217 5218 5219 5220 5221 5222 5223 5224 5225 5226 5227 5228 5229 5230 5231 5232 5233 5234 5235 5236 5237 5238 5239 5240 5241 5242 5243 5244 5245 5246 5247 5248 5249 5250 5251 5252 5253 5254 5255 5256 5257 5258 5259 5260 5261 5262 5263 5264 5265 5266 5267 5268 5269 5270 5271 5272 5273 5274 5275 5276 5277 5278 5279 5280 5281 5282 5283 5284 5285 5286 5287 5288 5289 5290 5291 5292 5293 5294 5295 5296 5297 5298 5299 5300 5301 5302 5303 5304 5305 5306 5307 5308 5309 5310 5311 5312 5313 5314 5315 5316 5317 5318 5319 5320 5321 5322 5323 5324 5325 5326 5327 5328 5329 5330 5331 5332 5333 5334 5335 5336 5337 5338 5339 5340 5341 5342 5343 5344 5345 5346 5347 5348 5349 5350 5351 5352 5353 5354 5355 5356 5357 5358 5359 5360 5361 5362 5363 5364 5365 5366 5367 5368 5369 5370 5371 5372 5373 5374 5375 5376 5377 5378 5379 5380 5381 5382 5383 5384 5385 5386 5387 5388 5389 5390 5391 5392 5393 5394 5395 5396 5397 5398 5399 5400 5401 5402 5403 5404 5405 5406 5407 5408 5409 5410 5411 5412 5413 5414 5415 5416 5417 5418 5419 5420 5421 5422 5423 5424 5425 5426 5427 5428 5429 5430 5431 5432 5433 5434 5435 5436 5437 5438 5439 5440 5441 5442 5443 5444 5445 5446 5447 5448 5449 5450 5451 5452 5453 5454 5455 5456 5457 5458 5459 5460 5461 5462 5463 5464 5465 5466 5467 5468 5469 5470 5471 5472 5473 5474 5475 5476 5477 5478 5479 5480 5481 5482 5483 5484 5485 5486 5487 5488 5489 5490 5491 5492 5493 5494 5495 5496 5497 5498 5499 5500 5501 5502 5503 5504 5505 5506 5507 5508 5509 5510 5511 5512 5513 5514 5515 5516 5517 5518 5519 5520 5521 5522 5523 5524 5525 5526 5527 5528 5529 5530 5531 5532 5533 5534 5535 5536 5537 5538 5539 5540 5541 5542 5543 5544 5545 5546 5547 5548 5549 5550 5551 5552 5553 5554 5555 5556 5557 5558 5559 5560 5561 5562 5563 5564 5565 5566 5567 5568 5569 5570 5571 5572 5573 5574 5575 5576 5577 5578 5579 5580 5581 5582 5583 5584 5585 5586 5587 5588 5589 5590 5591 5592 5593 5594 5595 5596 5597 5598 5599 5600 5601 5602 5603 5604 5605 5606 5607 5608 5609 5610 5611 5612 5613 5614 5615 5616 5617 5618 5619 5620 5621 5622 5623 5624 5625 5626 5627 5628 5629 5630 5631 5632 5633 5634 5635 5636 5637 5638 5639 5640 5641 5642 5643 5644 5645 5646 5647 5648 5649 5650 5651 5652 5653 5654 5655 5656 5657 5658 5659 5660 5661 5662 5663 5664 5665 5666 5667 5668 5669 5670 5671 5672 5673 5674 5675 5676 5677 5678 5679 5680 5681 5682 5683 5684 5685 5686 5687 5688 5689 5690 5691 5692 5693 5694 5695 5696 5697 5698 5699 5700 5701 5702 5703 5704 5705 5706 5707 5708 5709 5710 5711 5712 5713 5714 5715 5716 5717 5718 5719 5720 5721 5722 5723 5724 5725 5726 5727 5728 5729 5730 5731 5732 5733 5734 5735 5736 5737 5738 5739 5740 5741 5742 5743 5744 5745 5746 5747 5748 5749 5750 5751 5752 5753 5754 5755 5756 5757 5758 5759 5760 5761 5762 5763 5764 5765 5766 5767 5768 5769 5770 5771 5772 5773 5774 5775 5776 5777 5778 5779 5780 5781 5782 5783 5784 5785 5786 5787 5788 5789 5790 5791 5792 5793 5794 5795 5796 5797 5798 5799 5800 5801 5802 5803 5804 5805 5806 5807 5808 5809 5810 5811 5812 5813 5814 5815 5816 5817 5818 5819 5820 5821 5822 5823 5824 5825 5826 5827 5828 5829 5830 5831 5832 5833 5834 5835 5836 5837 5838 5839 5840 5841 5842 5843 5844 5845 5846 5847 5848 5849 5850 5851 5852 5853 5854 5855 5856 5857 5858 5859 5860 5861 5862 5863 5864 5865 5866 5867 5868 5869 5870 5871 5872 5873 5874 5875 5876 5877 5878 5879 5880 5881 5882 5883 5884 5885 5886 5887 5888 5889 5890 5891 5892 5893 5894 5895 5896 5897 5898 5899 5900 5901 5902 5903 5904 5905 5906 5907 5908 5909 5910 5911 5912 5913 5914 5915 5916 5917 5918 5919 5920 5921 5922 5923 5924 5925 5926 5927 5928 5929 5930 5931 5932 5933 5934 5935 5936 5937 5938 5939 5940 5941 5942 5943 5944 5945 5946 5947 5948 5949 5950 5951 5952 5953 5954 5955 5956 5957 5958 5959 5960 5961 5962 5963 5964 5965 5966 5967 5968 5969 5970 5971 5972 5973 5974 5975 5976 5977 5978 5979 5980 5981 5982 5983 5984 5985 5986 5987 5988 5989 5990 5991 5992 5993 5994 5995 5996 5997 5998 5999 6000 6001 6002 6003 6004 6005 6006 6007 6008 6009 6010 6011 6012 6013 6014 6015 6016 6017 6018 6019 6020 6021 6022 6023 6024 6025 6026 6027 6028 6029 6030 6031 6032 6033 6034 6035 6036 6037 6038 6039 6040 6041 6042 6043 6044 6045 6046 6047 6048 6049 6050 6051 6052 6053 6054 6055 6056 6057 6058 6059 6060 6061 6062 6063 6064 6065 6066 6067 6068 6069 6070 6071 6072 6073 6074 6075 6076 6077 6078 6079 6080 6081 6082 6083 6084 6085 6086 6087 6088 6089 6090 6091 6092 6093 6094 6095 6096 6097 6098 6099 6100 6101 6102 6103 6104 6105 6106 6107 6108 6109 6110 6111 6112 6113 6114 6115 6116 6117 6118 6119 6120 6121 6122 6123 6124 6125 6126 6127 6128 6129 6130 6131 6132 6133 6134 6135 6136 6137 6138 6139 6140 6141 6142 6143 6144 6145 6146 6147 6148 6149 6150 6151 6152 6153 6154 6155 6156 6157 6158 6159 6160 6161 6162 6163 6164 6165 6166 6167 6168 6169 6170 6171 6172 6173 6174 6175 6176 6177 6178 6179 6180 6181 6182 6183 6184 6185 6186 6187 6188 6189 6190 6191 6192 6193 6194 6195 6196 6197 6198 6199 6200 6201 6202 6203 6204 6205 6206 6207 6208 6209 6210 6211 6212 6213 6214 6215 6216 6217 6218 6219 6220 6221 6222 6223 6224 6225 6226 6227 6228 6229 6230 6231 6232 6233 6234 6235 6236 6237 6238 6239 6240 6241 6242 6243 6244 6245 6246 6247 6248 6249 6250 6251 6252 6253 6254 6255 6256 6257 6258 6259 6260 6261 6262 6263 6264 6265 6266 6267 6268 6269 6270 6271 6272 6273 6274 6275 6276 6277 6278 6279 6280 6281 6282 6283 6284 6285 6286 6287 6288 6289 6290 6291 6292 6293 6294 6295 6296 6297 6298 6299 6300 6301 6302 6303 6304 6305 6306 6307 6308 6309 6310 6311 6312 6313 6314 6315 6316 6317 6318 6319 6320 6321 6322 6323 6324 6325 6326 6327 6328 6329 6330 6331 6332 6333 6334 6335 6336 6337 6338 6339 6340 6341 6342 6343 6344 6345 6346 6347 6348 6349 6350 6351 6352 6353 6354 6355 6356 6357 6358 6359 6360 6361 6362 6363 6364 6365 6366 6367 6368 6369 6370 6371 6372 6373 6374 6375 6376 6377 6378 6379 6380 6381 6382 6383 6384 6385 6386 6387 6388 6389 6390 6391 6392 6393 6394 6395 6396 6397 6398 6399 6400 6401 6402 6403 6404 6405 6406 6407 6408 6409 6410 6411 6412 6413 6414 6415 6416 6417 6418 6419 6420 6421 6422 6423 6424 6425 6426 6427 6428 6429 6430 6431 6432 6433 6434 6435 6436 6437 6438 6439 6440 6441 6442 6443 6444 6445 6446 6447 6448 6449 6450 6451 6452 6453 6454 6455 6456 6457 6458 6459 6460 6461 6462 6463 6464 6465 6466 6467 6468 6469 6470 6471 6472 6473 6474 6475 6476 6477 6478 6479 6480 6481 6482 6483 6484 6485 6486 6487 6488 6489 6490 6491 6492 6493 6494 6495 6496 6497 6498 6499 6500 6501 6502 6503 6504 6505 6506 6507 6508 6509 6510 6511 6512 6513 6514 6515 6516 6517 6518 6519 6520 6521 6522 6523 6524 6525 6526 6527 6528 6529 6530 6531 6532 6533 6534 6535 6536 6537 6538 6539 6540 6541 6542 6543 6544 6545 6546 6547 6548 6549 6550 6551 6552 6553 6554 6555 6556 6557 6558 6559 6560 6561 6562 6563 6564 6565 6566 6567 6568 6569 6570 6571 6572 6573 6574 6575 6576 6577 6578 6579 6580 6581 6582 6583 6584 6585 6586 6587 6588 6589 6590 6591 6592 6593 6594 6595 6596 6597 6598 6599 6600 6601 6602 6603 6604 6605 6606 6607 6608 6609 6610 6611 6612 6613 6614 6615 6616 6617 6618 6619 6620 6621 6622 6623 6624 6625 6626 6627 6628 6629 6630 6631 6632 6633 6634 6635 6636 6637 6638 6639 6640 6641 6642 6643 6644 6645 6646 6647 6648 6649 6650 6651 6652 6653 6654 6655 6656 6657 6658 6659 6660 6661 6662 6663 6664 6665 6666 6667 6668 6669 6670 6671 6672 6673 6674 6675 6676 6677 6678 6679 6680 6681 6682 6683 6684 6685 6686 6687 6688 6689 6690 6691 6692 6693 6694 6695 6696 6697 6698 6699 6700 6701 6702 6703 6704 6705 6706 6707 6708 6709 6710 6711 6712 6713 6714 6715 6716 6717 6718 6719 6720 6721 6722 6723 6724 6725 6726 6727 6728 6729 6730 6731 6732 6733 6734 6735 6736 6737 6738 6739 6740 6741 6742 6743 6744 6745 6746 6747 6748 6749 6750 6751 6752 6753 6754 6755 6756 6757 6758 6759 6760 6761 6762 6763 6764 6765 6766 6767 6768 6769 6770 6771 6772 6773 6774 6775 6776 6777 6778 6779 6780 6781 6782 6783 6784 6785 6786 6787 6788 6789 6790 6791 6792 6793 6794 6795 6796 6797 6798 6799 6800 6801 6802 6803 6804 6805 6806 6807 6808 6809 6810 6811 6812 6813 6814 6815 6816 6817 6818 6819 6820 6821 6822 6823 6824 6825 6826 6827 6828 6829 6830 6831 6832 6833 6834 6835 6836 6837 6838 6839 6840 6841 6842 6843 6844 6845 6846 6847 6848 6849 6850 6851 6852 6853 6854 6855 6856 6857 6858 6859 6860 6861 6862 6863 6864 6865 6866 6867 6868 6869 6870 6871 6872 6873 6874 6875 6876 6877 6878 6879 6880 6881 6882 6883 6884 6885 6886 6887 6888 6889 6890 6891 6892 6893 6894 6895 6896 6897 6898 6899 6900 6901 6902 6903 6904 6905 6906 6907 6908 6909 6910 6911 6912 6913 6914 6915 6916 6917 6918 6919 6920 6921 6922 6923 6924 6925 6926 6927 6928 6929 6930 6931 6932 6933 6934 6935 6936 6937 6938 6939 6940 6941 6942 6943 6944 6945 6946 6947 6948 6949 6950 6951 6952 6953 6954 6955 6956 6957 6958 6959 6960 6961 6962 6963 6964 6965 6966 6967 6968 6969 6970 6971 6972 6973 6974 6975 6976 6977 6978 6979 6980 6981 6982 6983 6984 6985 6986 6987 6988 6989 6990 6991 6992 6993 6994 6995 6996 6997 6998 6999 7000 7001 7002 7003 7004 7005 7006 7007 7008 7009 7010 7011 7012 7013 7014 7015 7016 7017 7018 7019 7020 7021 7022 7023 7024 7025 7026 7027 7028 7029 7030 7031 7032 7033 7034 7035 7036 7037 7038 7039 7040 7041 7042 7043 7044 7045 7046 7047 7048 7049 7050 7051 7052 7053 7054 7055 7056 7057 7058 7059 7060 7061 7062 7063 7064 7065 7066 7067 7068 7069 7070 7071 7072 7073 7074 7075 7076 7077 7078 7079 7080 7081 7082 7083 7084 7085 7086 7087 7088 7089 7090 7091 7092 7093 7094 7095 7096 7097 7098 7099 7100 7101 7102 7103 7104 7105 7106 7107 7108 7109 7110 7111 7112 7113 7114 7115 7116 7117 7118 7119 7120 7121 7122 7123 7124 7125 7126 7127 7128 7129 7130 7131 7132 7133 7134 7135 7136 7137 7138 7139 7140 7141 7142 7143 7144 7145 7146 7147 7148 7149 7150 7151 7152 7153 7154 7155 7156 7157 7158 7159 7160 7161 7162 7163 7164 7165 7166 7167 7168 7169 7170 7171 7172 7173 7174 7175 7176 7177 7178 7179 7180 7181 7182 7183 7184 7185 7186 7187 7188 7189 7190 7191 7192 7193 7194 7195 7196 7197 7198 7199 7200 7201 7202 7203 7204 7205 7206 7207 7208 7209 7210 7211 7212 7213 7214 7215 7216 7217 7218 7219 7220 7221 7222 7223 7224 7225 7226 7227 7228 7229 7230 7231 7232 7233 7234 7235 7236 7237 7238 7239 7240 7241 7242 7243 7244 7245 7246 7247 7248 7249 7250 7251 7252 7253 7254 7255 7256 7257 7258 7259 7260 7261 7262 7263 7264 7265 7266 7267 7268 7269 7270 7271 7272 7273 7274 7275 7276 7277 7278 7279 7280 7281 7282 7283 7284 7285 7286 7287 7288 7289 7290 7291 7292 7293 7294 7295 7296 7297 7298 7299 7300 7301 7302 7303 7304 7305 7306 7307 7308 7309 7310 7311 7312 7313 7314 7315 7316 7317 7318 7319 7320 7321 7322 7323 7324 7325 7326 7327 7328 7329 7330 7331 7332 7333 7334 7335 7336 7337 7338 7339 7340 7341 7342 7343 7344 7345 7346 7347 7348 7349 7350 7351 7352 7353 7354 7355 7356 7357 7358 7359 7360 7361 7362 7363 7364 7365 7366 7367 7368 7369 7370 7371 7372 7373 7374 7375 7376 7377 7378 7379 7380 7381 7382 7383 7384 7385 7386 7387 7388 7389 7390 7391 7392 7393 7394 7395 7396 7397 7398 7399 7400 7401 7402 7403 7404 7405 7406 7407 7408 7409 7410 7411 7412 7413 7414 7415 7416 7417 7418 7419 7420 7421 7422 7423 7424 7425 7426 7427 7428 7429 7430 7431 7432 7433 7434 7435 7436 7437 7438 7439 7440 7441 7442 7443 7444 7445 7446 7447 7448 7449 7450 7451 7452 7453 7454 7455 7456 7457 7458 7459 7460 7461 7462 7463 7464 7465 7466 7467 7468 7469 7470 7471 7472 7473 7474 7475 7476 7477 7478 7479 7480 7481 7482 7483 7484 7485 7486 7487 7488 7489 7490 7491 7492 7493 7494 7495 7496 7497 7498 7499 7500 7501 7502 7503 7504 7505 7506 7507 7508 7509 7510 7511 7512 7513 7514 7515 7516 7517 7518 7519 7520 7521 7522 7523 7524 7525 7526 7527 7528 7529 7530 7531 7532 7533 7534 7535 7536 7537 7538 7539 7540 7541 7542 7543 7544 7545 7546 7547 7548 7549 7550 7551 7552 7553 7554 7555 7556 7557 7558 7559 7560 7561 7562 7563 7564 7565 7566 7567 7568 7569 7570 7571 7572 7573 7574 7575 7576 7577 7578 7579 7580 7581 7582 7583 7584 7585 7586 7587 7588 7589 7590 7591 7592 7593 7594 7595 7596 7597 7598 7599 7600 7601 7602 7603 7604 7605 7606 7607 7608 7609 7610 7611 7612 7613 7614 7615 7616 7617 7618 7619 7620 7621 7622 7623 7624 7625 7626 7627 7628 7629 7630 7631 7632 7633 7634 7635 7636 7637 7638 7639 7640 7641 7642 7643 7644 7645 7646 7647 7648 7649 7650 7651 7652 7653 7654 7655 7656 7657 7658 7659 7660 7661 7662 7663 7664 7665 7666 7667 7668 7669 7670 7671 7672 7673 7674 7675 7676 7677 7678 7679 7680 7681 7682 7683 7684 7685 7686 7687 7688 7689 7690 7691 7692 7693 7694 7695 7696 7697 7698 7699 7700 7701 7702 7703 7704 7705 7706 7707 7708 7709 7710 7711 7712 7713 7714 7715 7716 7717 7718 7719 7720 7721 7722 7723 7724 7725 7726 7727 7728 7729 7730 7731 7732 7733 7734 7735 7736 7737 7738 7739 7740 7741 7742 7743 7744 7745 7746 7747 7748 7749 7750 7751 7752 7753 7754 7755 7756 7757 7758 7759 7760 7761 7762 7763 7764 7765 7766 7767 7768 7769 7770 7771 7772 7773 7774 7775 7776 7777 7778 7779 7780 7781 7782 7783 7784 7785 7786 7787 7788 7789 7790 7791 7792 7793 7794 7795 7796 7797 7798 7799 7800 7801 7802 7803 7804 7805 7806 7807 7808 7809 7810 7811 7812 7813 7814 7815 7816 7817 7818 7819 7820 7821 7822 7823 7824 7825 7826 7827 7828 7829 7830 7831 7832 7833 7834 7835 7836 7837 7838 7839 7840 7841 7842 7843 7844 7845 7846 7847 7848 7849 7850 7851 7852 7853 7854 7855 7856 7857 7858 7859 7860 7861 7862 7863 7864 7865 7866 7867 7868 7869 7870 7871 7872 7873 7874 7875 7876 7877 7878 7879 7880 7881 7882 7883 7884 7885 7886 7887 7888 7889 7890 7891 7892 7893 7894 7895 7896 7897 7898 7899 7900 7901 7902 7903 7904 7905 7906 7907 7908 7909 7910 7911 7912 7913 7914 7915 7916 7917 7918 7919 7920 7921 7922 7923 7924 7925 7926 7927 7928 7929 7930 7931 7932 7933 7934 7935 7936 7937 7938 7939 7940 7941 7942 7943 7944 7945 7946 7947 7948 7949 7950 7951 7952 7953 7954 7955 7956 7957 7958 7959 7960 7961 7962 7963 7964 7965 7966 7967 7968 7969 7970 7971 7972 7973 7974 7975 7976 7977 7978 7979 7980 7981 7982 7983 7984 7985 7986 7987 7988 7989 7990 7991 7992 7993 7994 7995 7996 7997 7998 7999 8000 8001 8002 8003 8004 8005 8006 8007 8008 8009 8010 8011 8012 8013 8014 8015 8016 8017 8018 8019 8020 8021 8022 8023 8024 8025 8026 8027 8028 8029 8030 8031 8032 8033 8034 8035 8036 8037 8038 8039 8040 8041 8042 8043 8044 8045 8046 8047 8048 8049 8050 8051 8052 8053 8054 8055 8056 8057 8058 8059 8060 8061 8062 8063 8064 8065 8066 8067 8068 8069 8070 8071 8072 8073 8074 8075 8076 8077 8078 8079 8080 8081 8082 8083 8084 8085 8086 8087 8088 8089 8090 8091 8092 8093 8094 8095 8096 8097 8098 8099 8100 8101 8102 8103 8104 8105 8106 8107 8108 8109 8110 8111 8112 8113 8114 8115 8116 8117 8118 8119 8120 8121 8122 8123 8124 8125 8126 8127 8128 8129 8130 8131 8132 8133 8134 8135 8136 8137 8138 8139 8140 8141 8142 8143 8144 8145 8146 8147 8148 8149 8150 8151 8152 8153 8154 8155 8156 8157 8158 8159 8160 8161 8162 8163 8164 8165 8166 8167 8168 8169 8170 8171 8172 8173 8174 8175 8176 8177 8178 8179 8180 8181 8182 8183 8184 8185 8186 8187 8188 8189 8190 8191 8192 8193 8194 8195 8196 8197 8198 8199 8200 8201 8202 8203 8204 8205 8206 8207 8208 8209 8210 8211 8212 8213 8214 8215 8216 8217 8218 8219 8220 8221 8222 8223 8224 8225 8226 8227 8228 8229 8230 8231 8232 8233 8234 8235 8236 8237 8238 8239 8240 8241 8242 8243 8244 8245 8246 8247 8248 8249 8250 8251 8252 8253 8254 8255 8256 8257 8258 8259 8260 8261 8262 8263 8264 8265 8266 8267 8268 8269 8270 8271 8272 8273 8274 8275 8276 8277 8278 8279 8280 8281 8282 8283 8284 8285 8286 8287 8288 8289 8290 8291 8292 8293 8294 8295 8296 8297 8298 8299 8300 8301 8302 8303 8304 8305 8306 8307 8308 8309 8310 8311 8312 8313 8314 8315 8316 8317 8318 8319 8320 8321 8322 8323 8324 8325 8326 8327 8328 8329 8330 8331 8332 8333 8334 8335 8336 8337 8338 8339 8340 8341 8342 8343 8344 8345 8346 8347 8348 8349 8350 8351 8352 8353 8354 8355 8356 8357 8358 8359 8360 8361 8362 8363 8364 8365 8366 8367 8368 8369 8370 8371 8372 8373 8374 8375 8376 8377 8378 8379 8380 8381 8382 8383 8384 8385 8386 8387 8388 8389 8390 8391 8392 8393 8394 8395 8396 8397 8398 8399 8400 8401 8402 8403 8404 8405 8406 8407 8408 8409 8410 8411 8412 8413 8414 8415 8416 8417 8418 8419 8420 8421 8422 8423 8424 8425 8426 8427 8428 8429 8430 8431 8432 8433 8434 8435 8436 8437 8438 8439 8440 8441 8442 8443 8444 8445 8446 8447 8448 8449 8450 8451 8452 8453 8454 8455 8456 8457 8458 8459 8460 8461 8462 8463 8464 8465 8466 8467 8468 8469 8470 8471 8472 8473 8474 8475 8476 8477 8478 8479 8480 8481 8482 8483 8484 8485 8486 8487 8488 8489 8490 8491 8492 8493 8494 8495 8496 8497 8498 8499 8500 8501 8502 8503 8504 8505 8506 8507 8508 8509 8510 8511 8512 8513 8514 8515 8516 8517 8518 8519 8520 8521 8522 8523 8524 8525 8526 8527 8528 8529 8530 8531 8532 8533 8534 8535 8536 8537 8538 8539 8540 8541 8542 8543 8544 8545 8546 8547 8548 8549 8550 8551 8552 8553 8554 8555 8556 8557 8558 8559 8560 8561 8562 8563 8564 8565 8566 8567 8568 8569 8570 8571 8572 8573 8574 8575 8576 8577 8578 8579 8580 8581 8582 8583 8584 8585 8586 8587 8588 8589 8590 8591 8592 8593 8594 8595 8596 8597 8598 8599 8600 8601 8602 8603 8604 8605 8606 8607 8608 8609 8610 8611 8612 8613 8614 8615 8616 8617 8618 8619 8620 8621 8622 8623 8624 8625 8626 8627 8628 8629 8630 8631 8632 8633 8634 8635 8636 8637 8638 8639 8640 8641 8642 8643 8644 8645 8646 8647 8648 8649 8650 8651 8652 8653 8654 8655 8656 8657 8658 8659 8660 8661 8662 8663 8664 8665 8666 8667 8668 8669 8670 8671 8672 8673 8674 8675 8676 8677 8678 8679 8680 8681 8682 8683 8684 8685 8686 8687 8688 8689 8690 8691 8692 8693 8694 8695 8696 8697 8698 8699 8700 8701 8702 8703 8704 8705 8706 8707 8708 8709 8710 8711 8712 8713 8714 8715 8716 8717 8718 8719 8720 8721 8722 8723 8724 8725 8726 8727 8728 8729 8730 8731 8732 8733 8734 8735 8736 8737 8738 8739 8740 8741 8742 8743 8744 8745 8746 8747 8748 8749 8750 8751 8752 8753 8754 8755 8756 8757 8758 8759 8760 8761 8762 8763 8764 8765 8766 8767 8768 8769 8770 8771 8772 8773 8774 8775 8776 8777 8778 8779 8780 8781 8782 8783 8784 8785 8786 8787 8788 8789 8790 8791 8792 8793 8794 8795 8796 8797 8798 8799 8800 8801 8802 8803 8804 8805 8806 8807 8808 8809 8810 8811 8812 8813 8814 8815 8816 8817 8818 8819 8820 8821 8822 8823 8824 8825 8826 8827 8828 8829 8830 8831 8832 8833 8834 8835 8836 8837 8838 8839 8840 8841 8842 8843 8844 8845 8846 8847 8848 8849 8850 8851 8852 8853 8854 8855 8856 8857 8858 8859 8860 8861 8862 8863 8864 8865 8866 8867 8868 8869 8870 8871 8872 8873 8874 8875 8876 8877 8878 8879 8880 8881 8882 8883 8884 8885 8886 8887 8888 8889 8890 8891 8892 8893 8894 8895 8896 8897 8898 8899 8900 8901 8902 8903 8904 8905 8906 8907 8908 8909 8910 8911 8912 8913 8914 8915 8916 8917 8918 8919 8920 8921 8922 8923 8924 8925 8926 8927 8928 8929 8930 8931 8932 8933 8934 8935 8936 8937 8938 8939 8940 8941 8942 8943 8944 8945 8946 8947 8948 8949 8950 8951 8952 8953 8954 8955 8956 8957 8958 8959 8960 8961 8962 8963 8964 8965 8966 8967 8968 8969 8970 8971 8972 8973 8974 8975 8976 8977 8978 8979 8980 8981 8982 8983 8984 8985 8986 8987 8988 8989 8990 8991 8992 8993 8994 8995 8996 8997 8998 8999 9000 9001 9002 9003 9004 9005 9006 9007 9008 9009 9010 9011 9012 9013 9014 9015 9016 9017 9018 9019 9020 9021 9022 9023 9024 9025 9026 9027 9028 9029 9030 9031 9032 9033 9034 9035 9036 9037 9038 9039 9040 9041 9042 9043 9044 9045 9046 9047 9048 9049 9050 9051 9052 9053 9054 9055 9056 9057 9058 9059 9060 9061 9062 9063 9064 9065 9066 9067 9068 9069 9070 9071 9072 9073 9074 9075 9076 9077 9078 9079 9080 9081 9082 9083 9084 9085 9086 9087 9088 9089 9090 9091 9092 9093 9094 9095 9096 9097 9098 9099 9100 9101 9102 9103 9104 9105 9106 9107 9108 9109 9110 9111 9112 9113 9114 9115 9116 9117 9118 9119 9120 9121 9122 9123 9124 9125 9126 9127 9128 9129 9130 9131 9132 9133 9134 9135 9136 9137 9138 9139 9140 9141 9142 9143 9144 9145 9146 9147 9148 9149 9150 9151 9152 9153 9154 9155 9156 9157 9158 9159 9160 9161 9162 9163 9164 9165 9166 9167 9168 9169 9170 9171 9172 9173 9174 9175 9176 9177 9178 9179 9180 9181 9182 9183 9184 9185 9186 9187 9188 9189 9190 9191 9192 9193 9194 9195 9196 9197 9198 9199 9200 9201 9202 9203 9204 9205 9206 9207 9208 9209 9210 9211 9212 9213 9214 9215 9216 9217 9218 9219 9220 9221 9222 9223 9224 9225 9226 9227 9228 9229 9230 9231 9232 9233 9234 9235 9236 9237 9238 9239 9240 9241 9242 9243 9244 9245 9246 9247 9248 9249 9250 9251 9252 9253 9254 9255 9256 9257 9258 9259 9260 9261 9262 9263 9264 9265 9266 9267 9268 9269 9270 9271 9272 9273 9274 9275 9276 9277 9278 9279 9280 9281 9282 9283 9284 9285 9286 9287 9288 9289 9290 9291 9292 9293 9294 9295 9296 9297 9298 9299 9300 9301 9302 9303 9304 9305 9306 9307 9308 9309 9310 9311 9312 9313 9314 9315 9316 9317 9318 9319 9320 9321 9322 9323 9324 9325 9326 9327 9328 9329 9330 9331 9332 9333 9334 9335 9336 9337 9338 9339 9340 9341 9342 9343 9344 9345 9346 9347 9348 9349 9350 9351 9352 9353 9354 9355 9356 9357 9358 9359 9360 9361 9362 9363 9364 9365 9366 9367 9368 9369 9370 9371 9372 9373 9374 9375 9376 9377 9378 9379 9380 9381 9382 9383 9384 9385 9386 9387 9388 9389 9390 9391 9392 9393 9394 9395 9396 9397 9398 9399 9400 9401 9402 9403 9404 9405 9406 9407 9408 9409 9410 9411 9412 9413 9414 9415 9416 9417 9418 9419 9420 9421 9422 9423 9424 9425 9426 9427 9428 9429 9430 9431 9432 9433 9434 9435 9436 9437 9438 9439 9440 9441 9442 9443 9444 9445 9446 9447 9448 9449 9450 9451 9452 9453 9454 9455 9456 9457 9458 9459 9460 9461 9462 9463 9464 9465 9466 9467 9468 9469 9470 9471 9472 9473 9474 9475 9476 9477 9478 9479 9480 9481 9482 9483 9484 9485 9486 9487 9488 9489 9490 9491 9492 9493 9494 9495 9496 9497 9498 9499 9500 9501 9502 9503 9504 9505 9506 9507 9508 9509 9510 9511 9512 9513 9514 9515 9516 9517 9518 9519 9520 9521 9522 9523 9524 9525 9526 9527 9528 9529 9530 9531 9532 9533 9534 9535 9536 9537 9538 9539 9540 9541 9542 9543 9544 9545 9546 9547 9548 9549 9550 9551 9552 9553 9554 9555 9556 9557 9558 9559 9560 9561 9562 9563 9564 9565 9566 9567 9568 9569 9570 9571 9572 9573 9574 9575 9576 9577 9578 9579 9580 9581 9582 9583 9584 9585 9586 9587 9588 9589 9590 9591 9592 9593 9594 9595 9596 9597 9598 9599 9600 9601 9602 9603 9604 9605 9606 9607 9608 9609 9610 9611 9612 9613 9614 9615 9616 9617 9618 9619 9620 9621 9622 9623 9624 9625 9626 9627 9628 9629 9630 9631 9632 9633 9634 9635 9636 9637 9638 9639 9640 9641 9642 9643 9644 9645 9646 9647 9648 9649 9650 9651 9652 9653 9654 9655 9656 9657 9658 9659 9660 9661 9662 9663 9664 9665 9666 9667 9668 9669 9670 9671 9672 9673 9674 9675 9676 9677 9678 9679 9680 9681 9682 9683 9684 9685 9686 9687 9688 9689 9690 9691 9692 9693 9694 9695 9696 9697 9698 9699 9700 9701 9702 9703 9704 9705 9706 9707 9708 9709 9710 9711 9712 9713 9714 9715 9716 9717 9718 9719 9720 9721 9722 9723 9724 9725 9726 9727 9728 9729 9730 9731 9732 9733 9734 9735 9736 9737 9738 9739 9740 9741 9742 9743 9744 9745 9746 9747 9748 9749 9750 9751 9752 9753 9754 9755 9756 9757 9758 9759 9760 9761 9762 9763 9764 9765 9766 9767 9768 9769 9770 9771 9772 9773 9774 9775 9776 9777 9778 9779 9780 9781 9782 9783 9784 9785 9786 9787 9788 9789 9790 9791 9792 9793 9794 9795 9796 9797 9798 9799 9800 9801 9802 9803 9804 9805 9806 9807 9808 9809 9810 9811 9812 9813 9814 9815 9816 9817 9818 9819 9820 9821 9822 9823 9824 9825 9826 9827 9828 9829 9830 9831 9832 9833 9834 9835 9836 9837 9838 9839 9840 9841 9842 9843 9844 9845 9846 9847 9848 9849 9850 9851 9852 9853 9854 9855 9856 9857 9858 9859 9860 9861 9862 9863 9864 9865 9866 9867 9868 9869 9870 9871 9872 9873 9874 9875 9876 9877 9878 9879 9880 9881 9882 9883 9884 9885 9886 9887 9888 9889 9890 9891 9892 9893 9894 9895 9896 9897 9898 9899 9900 9901 9902 9903 9904 9905 9906 9907 9908 9909 9910 9911 9912 9913 9914 9915 9916 9917 9918 9919 9920 9921 9922 9923 9924 9925 9926 9927 9928 9929 9930 9931 9932 9933 9934 9935 9936 9937 9938 9939 9940 9941 9942 9943 9944 9945 9946 9947 9948 9949 9950 9951 9952 9953 9954 9955 9956 9957 9958 9959 9960 9961 9962 9963 9964 9965 9966 9967 9968 9969 9970 9971 9972 9973 9974 9975 9976 9977 9978 9979 9980 9981 9982 9983 9984 9985 9986 9987 9988 9989 9990 9991 9992 9993 9994 9995 9996 9997 9998 9999 10000 10001 10002 10003 10004 10005 10006 10007 10008 10009 10010 10011 10012 10013 10014 10015 10016 10017 10018 10019 10020 10021 10022 10023 10024 10025 10026 10027 10028 10029 10030 10031 10032 10033 10034 10035 10036 10037 10038 10039 10040 10041 10042 10043 10044 10045 10046 10047 10048 10049 10050 10051 10052 10053 10054 10055 10056 10057 10058 10059 10060 10061 10062 10063 10064 10065 10066 10067 10068 10069 10070 10071 10072 10073 10074 10075 10076 10077 10078 10079 10080 10081 10082 10083 10084 10085 10086 10087 10088 10089 10090 10091 10092 10093 10094 10095 10096 10097 10098 10099 10100 10101 10102 10103 10104 10105 10106 10107 10108 10109 10110 10111 10112 10113 10114 10115 10116 10117 10118 10119 10120 10121 10122 10123 10124 10125 10126 10127 10128 10129 10130 10131 10132 10133 10134 10135 10136 10137 10138 10139 10140 10141 10142 10143 10144 10145 10146 10147 10148 10149 10150 10151 10152 10153 10154 10155 10156 10157 10158 10159 10160 10161 10162 10163 10164 10165 10166 10167 10168 10169 10170 10171 10172 10173 10174 10175 10176 10177 10178 10179 10180 10181 10182 10183 10184 10185 10186 10187 10188 10189 10190 10191 10192 10193 10194 10195 10196 10197 10198 10199 10200 10201 10202 10203 10204 10205 10206 10207 10208 10209 10210 10211 10212 10213 10214 10215 10216 10217 10218 10219 10220 10221 10222 10223 10224 10225 10226 10227 10228 10229 10230 10231 10232 10233 10234 10235 10236 10237 10238 10239 10240 10241 10242 10243 10244 10245 10246 10247 10248 10249 10250 10251 10252 10253 10254 10255 10256 10257 10258 10259 10260 10261 10262 10263 10264 10265 10266 10267 10268 10269 10270 10271 10272 10273 10274 10275 10276 10277 10278 10279 10280 10281 10282 10283 10284 10285 10286 10287 10288 10289 10290 10291 10292 10293 10294 10295 10296 10297 10298 10299 10300 10301 10302 10303 10304 10305 10306 10307 10308 10309 10310 10311 10312 10313 10314 10315 10316 10317 10318 10319 10320 10321 10322 10323 10324 10325 10326 10327 10328 10329 10330 10331 10332 10333 10334 10335 10336 10337 10338 10339 10340 10341 10342 10343 10344 10345 10346 10347 10348 10349 10350 10351 10352 10353 10354 10355 10356 10357 10358 10359 10360 10361 10362 10363 10364 10365 10366 10367 10368 10369 10370 10371 10372 10373 10374 10375 10376 10377 10378 10379 10380 10381 10382 10383 10384 10385 10386 10387 10388 10389 10390 10391 10392 10393 10394 10395 10396 10397 10398 10399 10400 10401 10402 10403 10404 10405 10406 10407 10408 10409 10410 10411 10412 10413 10414 10415 10416 10417 10418 10419 10420 10421 10422 10423 10424 10425 10426 10427 10428 10429 10430 10431 10432 10433 10434 10435 10436 10437 10438 10439 10440 10441 10442 10443 10444 10445 10446 10447 10448 10449 10450 10451 10452 10453 10454 10455 10456 10457 10458 10459 10460 10461 10462 10463 10464 10465 10466 10467 10468 10469 10470 10471 10472 10473 10474 10475 10476 10477 10478 10479 10480 10481 10482 10483 10484 10485 10486 10487 10488 10489 10490 10491 10492 10493 10494 10495 10496 10497 10498 10499 10500 10501 10502 10503 10504 10505 10506 10507 10508 10509 10510 10511 10512 10513 10514 10515 10516 10517 10518 10519 10520 10521 10522 10523 10524 10525 10526 10527 10528 10529 10530 10531 10532 10533 10534 10535 10536 10537 10538 10539 10540 10541 10542 10543 10544 10545 10546 10547 10548 10549 10550 10551 10552 10553 10554 10555 10556 10557 10558 10559 10560 10561 10562 10563 10564 10565 10566 10567 10568 10569 10570 10571 10572 10573 10574 10575 10576 10577 10578 10579 10580 10581 10582 10583 10584 10585 10586 10587 10588 10589 10590 10591 10592 10593 10594 10595 10596 10597 10598 10599 10600 10601 10602 10603 10604 10605 10606 10607 10608 10609 10610 10611 10612 10613 10614 10615 10616 10617 10618 10619 10620 10621 10622 10623 10624 10625 10626 10627 10628 10629 10630 10631 10632 10633 10634 10635 10636 10637 10638 10639 10640 10641 10642 10643 10644 10645 10646 10647 10648 10649 10650 10651 10652 10653 10654 10655 10656 10657 10658 10659 10660 10661 10662 10663 10664 10665 10666 10667 10668 10669 10670 10671 10672 10673 10674 10675 10676 10677 10678 10679 10680 10681 10682 10683 10684 10685 10686 10687 10688 10689 10690 10691 10692 10693 10694 10695 10696 10697 10698 10699 10700 10701 10702 10703 10704 10705 10706 10707 10708 10709 10710 10711 10712 10713 10714 10715 10716 10717 10718 10719 10720 10721 10722 10723 10724 10725 10726 10727 10728 10729 10730 10731 10732 10733 10734 10735 10736 10737 10738 10739 10740 10741 10742 10743 10744 10745 10746 10747 10748 10749 10750 10751 10752 10753 10754 10755 10756 10757 10758 10759 10760 10761 10762 10763 10764 10765 10766 10767 10768 10769 10770 10771 10772 10773 10774 10775 10776 10777 10778 10779 10780 10781 10782 10783 10784 10785 10786 10787 10788 10789 10790 10791 10792 10793 10794 10795 10796 10797 10798 10799 10800 10801 10802 10803 10804 10805 10806 10807 10808 10809 10810 10811 10812 10813 10814 10815 10816 10817 10818 10819 10820 10821 10822 10823 10824 10825 10826 10827 10828 10829 10830 10831 10832 10833 10834 10835 10836 10837 10838 10839 10840 10841 10842 10843 10844 10845 10846 10847 10848 10849 10850 10851 10852 10853 10854 10855 10856 10857 10858 10859 10860 10861 10862 10863 10864 10865 10866 10867 10868 10869 10870 10871 10872 10873 10874 10875 10876 10877 10878 10879 10880 10881 10882 10883 10884 10885 10886 10887 10888 10889 10890 10891 10892 10893 10894 10895 10896 10897 10898 10899 10900 10901 10902 10903 10904 10905 10906 10907 10908 10909 10910 10911 10912 10913 10914 10915 10916 10917 10918 10919 10920 10921 10922 10923 10924 10925 10926 10927 10928 10929 10930 10931 10932 10933 10934 10935 10936 10937 10938 10939 10940 10941 10942 10943 10944 10945 10946 10947 10948 10949 10950 10951 10952 10953 10954 10955 10956 10957 10958 10959 10960 10961 10962 10963 10964 10965 10966 10967 10968 10969 10970 10971 10972 10973 10974 10975 10976 10977 10978 10979 10980 10981 10982 10983 10984 10985 10986 10987 10988 10989 10990 10991 10992 10993 10994 10995 10996 10997 10998 10999 11000 11001 11002 11003 11004 11005 11006 11007 11008 11009 11010 11011 11012 11013 11014 11015 11016 11017 11018 11019 11020 11021 11022 11023 11024 11025 11026 11027 11028 11029 11030 11031 11032 11033 11034 11035 11036 11037 11038 11039 11040 11041 11042 11043 11044 11045 11046 11047 11048 11049 11050 11051 11052 11053 11054 11055 11056 11057 11058 11059 11060 11061 11062 11063 11064 11065 11066 11067 11068 11069 11070 11071 11072 11073 11074 11075 11076 11077 11078 11079 11080 11081 11082 11083 11084 11085 11086 11087 11088 11089 11090 11091 11092 11093 11094 11095 11096 11097 11098 11099 11100 11101 11102 11103 11104 11105 11106 11107 11108 11109 11110 11111 11112 11113 11114 11115 11116 11117 11118 11119 11120 11121 11122 11123 11124 11125 11126 11127 11128 11129 11130 11131 11132 11133 11134 11135 11136 11137 11138 11139 11140 11141 11142 11143 11144 11145 11146 11147 11148 11149 11150 11151 11152 11153 11154 11155 11156 11157 11158 11159 11160 11161 11162 11163 11164 11165 11166 11167 11168 11169 11170 11171 11172 11173 11174 11175 11176 11177 11178 11179 11180 11181 11182 11183 11184 11185 11186 11187 11188 11189 11190 11191 11192 11193 11194 11195 11196 11197 11198 11199 11200 11201 11202 11203 11204 11205 11206 11207 11208 11209 11210 11211 11212 11213 11214 11215 11216 11217 11218 11219 11220 11221 11222 11223 11224 11225 11226 11227 11228 11229 11230 11231 11232 11233 11234 11235 11236 11237 11238 11239 11240 11241 11242 11243 11244 11245 11246 11247 11248 11249 11250 11251 11252 11253 11254 11255 11256 11257 11258 11259 11260 11261 11262 11263 11264 11265 11266 11267 11268 11269 11270 11271 11272 11273 11274 11275 11276 11277 11278 11279 11280 11281 11282 11283 11284 11285 11286 11287 11288 11289 11290 11291 11292 11293 11294 11295 11296 11297 11298 11299 11300 11301 11302 11303 11304 11305 11306 11307 11308 11309 11310 11311 11312 11313 11314 11315 11316 11317 11318 11319 11320 11321 11322 11323 11324 11325 11326 11327 11328 11329 11330 11331 11332 11333 11334 11335 11336 11337 11338 11339 11340 11341 11342 11343 11344 11345 11346 11347 11348 11349 11350 11351 11352 11353 11354 11355 11356 11357 11358 11359 11360 11361 11362 11363 11364 11365 11366 11367 11368 11369 11370 11371 11372 11373 11374 11375 11376 11377 11378 11379 11380 11381 11382 11383 11384 11385 11386 11387 11388 11389 11390 11391 11392 11393 11394 11395 11396 11397 11398 11399 11400 11401 11402 11403 11404 11405 11406 11407 11408 11409 11410 11411 11412 11413 11414 11415 11416 11417 11418 11419 11420 11421 11422 11423 11424 11425 11426 11427 11428 11429 11430 11431 11432 11433 11434 11435 11436 11437 11438 11439 11440 11441 11442 11443 11444 11445 11446 11447 11448 11449 11450 11451 11452 11453 11454 11455 11456 11457 11458 11459 11460 11461 11462 11463 11464 11465 11466 11467 11468 11469 11470 11471 11472 11473 11474 11475 11476 11477 11478 11479 11480 11481 11482 11483 11484 11485 11486 11487 11488 11489 11490 11491 11492 11493 11494 11495 11496 11497 11498 11499 11500 11501 11502 11503 11504 11505 11506 11507 11508 11509 11510 11511 11512 11513 11514 11515 11516 11517 11518 11519 11520 11521 11522 11523 11524 11525 11526 11527 11528 11529 11530 11531 11532 11533 11534 11535 11536 11537 11538 11539 11540 11541 11542 11543 11544 11545 11546 11547 11548 11549 11550 11551 11552 11553 11554 11555 11556 11557 11558 11559 11560 11561 11562 11563 11564 11565 11566 11567 11568 11569 11570 11571 11572 11573 11574 11575 11576 11577 11578 11579 11580 11581 11582 11583 11584 11585 11586 11587 11588 11589 11590 11591 11592 11593 11594 11595 11596 11597 11598 11599 11600 11601 11602 11603 11604 11605 11606 11607 11608 11609 11610 11611 11612 11613 11614 11615 11616 11617 11618 11619 11620 11621 11622 11623 11624 11625 11626 11627 11628 11629 11630 11631 11632 11633 11634 11635 11636 11637 11638 11639 11640 11641 11642 11643 11644 11645 11646 11647 11648 11649 11650 11651 11652 11653 11654 11655 11656 11657 11658 11659 11660 11661 11662 11663 11664 11665 11666 11667 11668 11669 11670 11671 11672 11673 11674 11675 11676 11677 11678 11679 11680 11681 11682 11683 11684 11685 11686 11687 11688 11689 11690 11691 11692 11693 11694 11695 11696 11697 11698 11699 11700 11701 11702 11703 11704 11705 11706 11707 11708 11709 11710 11711 11712 11713 11714 11715 11716 11717 11718 11719 11720 11721 11722 11723 11724 11725 11726 11727 11728 11729 11730 11731 11732 11733 11734 11735 11736 11737 11738 11739 11740 11741 11742 11743 11744 11745 11746 11747 11748 11749 11750 11751 11752 11753 11754 11755 11756 11757 11758 11759 11760 11761 11762 11763 11764 11765 11766 11767 11768 11769 11770 11771 11772 11773 11774 11775 11776 11777 11778 11779 11780 11781 11782 11783 11784 11785 11786 11787 11788 11789 11790 11791 11792 11793 11794 11795 11796 11797 11798 11799 11800 11801 11802 11803 11804 11805 11806 11807 11808 11809 11810 11811 11812 11813 11814 11815 11816 11817 11818 11819 11820 11821 11822 11823 11824 11825 11826 11827 11828 11829 11830 11831 11832 11833 11834 11835 11836 11837 11838 11839 11840 11841 11842 11843 11844 11845 11846 11847 11848 11849 11850 11851 11852 11853 11854 11855 11856 11857 11858 11859 11860 11861 11862 11863 11864 11865 11866 11867 11868 11869 11870 11871 11872 11873 11874 11875 11876 11877 11878 11879 11880 11881 11882 11883 11884 11885 11886 11887 11888 11889 11890 11891 11892 11893 11894 11895 11896 11897 11898 11899 11900 11901 11902 11903 11904 11905 11906 11907 11908 11909 11910 11911 11912 11913 11914 11915 11916 11917 11918 11919 11920 11921 11922 11923 11924 11925 11926 11927 11928 11929 11930 11931 11932 11933 11934 11935 11936 11937 11938 11939 11940 11941 11942 11943 11944 11945 11946 11947 11948 11949 11950 11951 11952 11953 11954 11955 11956 11957 11958 11959 11960 11961 11962 11963 11964 11965 11966 11967 11968 11969 11970 11971 11972 11973 11974 11975 11976 11977 11978 11979 11980 11981 11982 11983 11984 11985 11986 11987 11988 11989 11990 11991 11992 11993 11994 11995 11996 11997 11998 11999 12000 12001 12002 12003 12004 12005 12006 12007 12008 12009 12010 12011 12012 12013 12014 12015 12016 12017 12018 12019 12020 12021 12022 12023 12024 12025 12026 12027 12028 12029 12030 12031 12032 12033 12034 12035 12036 12037 12038 12039 12040 12041 12042 12043 12044 12045 12046 12047 12048 12049 12050 12051 12052 12053 12054 12055 12056 12057 12058 12059 12060 12061 12062 12063 12064 12065 12066 12067 12068 12069 12070 12071 12072 12073 12074 12075 12076 12077 12078 12079 12080 12081 12082 12083 12084 12085 12086 12087 12088 12089 12090 12091 12092 12093 12094 12095 12096 12097 12098 12099 12100 12101 12102 12103 12104 12105 12106 12107 12108 12109 12110 12111 12112 12113 12114 12115 12116 12117 12118 12119 12120 12121 12122 12123 12124 12125 12126 12127 12128 12129 12130 12131 12132 12133 12134 12135 12136 12137 12138 12139 12140 12141 12142 12143 12144 12145 12146 12147 12148 12149 12150 12151 12152 12153 12154 12155 12156 12157 12158 12159 12160 12161 12162 12163 12164 12165 12166 12167 12168 12169 12170 12171 12172 12173 12174 12175 12176 12177 12178 12179 12180 12181 12182 12183 12184 12185 12186 12187 12188 12189 12190 12191 12192 12193 12194 12195 12196 12197 12198 12199 12200 12201 12202 12203 12204 12205 12206 12207 12208 12209 12210 12211 12212 12213 12214 12215 12216 12217 12218 12219 12220 12221 12222 12223 12224 12225 12226 12227 12228 12229 12230 12231 12232 12233 12234 12235 12236 12237 12238 12239 12240 12241 12242 12243 12244 12245 12246 12247 12248 12249 12250 12251 12252 12253 12254 12255 12256 12257 12258 12259 12260 12261 12262 12263 12264 12265 12266 12267 12268 12269 12270 12271 12272 12273 12274 12275 12276 12277 12278 12279 12280 12281 12282 12283 12284 12285 12286 12287 12288 12289 12290 12291 12292 12293 12294 12295 12296 12297 12298 12299 12300 12301 12302 12303 12304 12305 12306 12307 12308 12309 12310 12311 12312 12313 12314 12315 12316 12317 12318 12319 12320 12321 12322 12323 12324 12325 12326 12327 12328 12329 12330 12331 12332 12333 12334 12335 12336 12337 12338 12339 12340 12341 12342 12343 12344 12345 12346 12347 12348 12349 12350 12351 12352 12353 12354 12355 12356 12357 12358 12359 12360 12361 12362 12363 12364 12365 12366 12367 12368 12369 12370 12371 12372 12373 12374 12375 12376 12377 12378 12379 12380 12381 12382 12383 12384 12385 12386 12387 12388 12389 12390 12391 12392 12393 12394 12395 12396 12397 12398 12399 12400 12401 12402 12403 12404 12405 12406 12407 12408 12409 12410 12411 12412 12413 12414 12415 12416 12417 12418 12419 12420 12421 12422 12423 12424 12425 12426 12427 12428 12429 12430 12431 12432 12433 12434 12435 12436 12437 12438 12439 12440 12441 12442 12443 12444 12445 12446 12447 12448 12449 12450 12451 12452 12453 12454 12455 12456 12457 12458 12459 12460 12461 12462 12463 12464 12465 12466 12467 12468 12469 12470 12471 12472 12473 12474 12475 12476 12477 12478 12479 12480 12481 12482 12483 12484 12485 12486 12487 12488 12489 12490 12491 12492 12493 12494 12495 12496 12497 12498 12499 12500 12501 12502 12503 12504 12505 12506 12507 12508 12509 12510 12511 12512 12513 12514 12515 12516 12517 12518 12519 12520 12521 12522 12523 12524 12525 12526 12527 12528 12529 12530 12531 12532 12533 12534 12535 12536 12537 12538 12539 12540 12541 12542 12543 12544 12545 12546 12547 12548 12549 12550 12551 12552 12553 12554 12555 12556 12557 12558 12559 12560 12561 12562 12563 12564 12565 12566 12567 12568 12569 12570 12571 12572 12573 12574 12575 12576 12577 12578 12579 12580 12581 12582 12583 12584 12585 12586 12587 12588 12589 12590 12591 12592 12593 12594 12595 12596 12597 12598 12599 12600 12601 12602 12603 12604 12605 12606 12607 12608 12609 12610 12611 12612 12613 12614 12615 12616 12617 12618 12619 12620 12621 12622 12623 12624 12625 12626 12627 12628 12629 12630 12631 12632 12633 12634 12635 12636 12637 12638 12639 12640 12641 12642 12643 12644 12645 12646 12647 12648 12649 12650 12651 12652 12653 12654 12655 12656 12657 12658 12659 12660 12661 12662 12663 12664 12665 12666 12667 12668 12669 12670 12671 12672 12673 12674 12675 12676 12677 12678 12679 12680 12681 12682 12683 12684 12685 12686 12687 12688 12689 12690 12691 12692 12693 12694 12695 12696 12697 12698 12699 12700 12701 12702 12703 12704 12705 12706 12707 12708 12709 12710 12711 12712 12713 12714 12715 12716 12717 12718 12719 12720 12721 12722 12723 12724 12725 12726 12727 12728 12729 12730 12731 12732 12733 12734 12735 12736 12737 12738 12739 12740 12741 12742 12743 12744 12745 12746 12747 12748 12749 12750 12751 12752 12753 12754 12755 12756 12757 12758 12759 12760 12761 12762 12763 12764 12765 12766 12767 12768 12769 12770 12771 12772 12773 12774 12775 12776 12777 12778 12779 12780 12781 12782 12783 12784 12785 12786 12787 12788 12789 12790 12791 12792 12793 12794 12795 12796 12797 12798 12799 12800 12801 12802 12803 12804 12805 12806 12807 12808 12809 12810 12811 12812 12813 12814 12815 12816 12817 12818 12819 12820 12821 12822 12823 12824 12825 12826 12827 12828 12829 12830 12831 12832 12833 12834 12835 12836 12837 12838 12839 12840 12841 12842 12843 12844 12845 12846 12847 12848 12849 12850 12851 12852 12853 12854 12855 12856 12857 12858 12859 12860 12861 12862 12863 12864 12865 12866 12867 12868 12869 12870 12871 12872 12873 12874 12875 12876 12877 12878 12879 12880 12881 12882 12883 12884 12885 12886 12887 12888 12889 12890 12891 12892 12893 12894 12895 12896 12897 12898 12899 12900 12901 12902 12903 12904 12905 12906 12907 12908 12909 12910 12911 12912 12913 12914 12915 12916 12917 12918 12919 12920 12921 12922 12923 12924 12925 12926 12927 12928 12929 12930 12931 12932 12933 12934 12935 12936 12937 12938 12939 12940 12941 12942 12943 12944 12945 12946 12947 12948 12949 12950 12951 12952 12953 12954 12955 12956 12957 12958 12959 12960 12961 12962 12963 12964 12965 12966 12967 12968 12969 12970 12971 12972 12973 12974 12975 12976 12977 12978 12979 12980 12981 12982 12983 12984 12985 12986 12987 12988 12989 12990 12991 12992 12993 12994 12995 12996 12997 12998 12999 13000 13001 13002 13003 13004 13005 13006 13007 13008 13009 13010 13011 13012 13013 13014 13015 13016 13017 13018 13019 13020 13021 13022 13023 13024 13025 13026 13027 13028 13029 13030 13031 13032 13033 13034 13035 13036 13037 13038 13039 13040 13041 13042 13043 13044 13045 13046 13047 13048 13049 13050 13051 13052 13053 13054 13055 13056 13057 13058 13059 13060 13061 13062 13063 13064 13065 13066 13067 13068 13069 13070 13071 13072 13073 13074 13075 13076 13077 13078 13079 13080 13081 13082 13083 13084 13085 13086 13087 13088 13089 13090 13091 13092 13093 13094 13095 13096 13097 13098 13099 13100 13101 13102 13103 13104 13105 13106 13107 13108 13109 13110 13111 13112 13113 13114 13115 13116 13117 13118 13119 13120 13121 13122 13123 13124 13125 13126 13127 13128 13129 13130 13131 13132 13133 13134 13135 13136 13137 13138 13139 13140 13141 13142 13143 13144 13145 13146 13147 13148 13149 13150 13151 13152 13153 13154 13155 13156 13157 13158 13159 13160 13161 13162 13163 13164 13165 13166 13167 13168 13169 13170 13171 13172 13173 13174 13175 13176 13177 13178 13179 13180 13181 13182 13183 13184 13185 13186 13187 13188 13189 13190 13191 13192 13193 13194 13195 13196 13197 13198 13199 13200 13201 13202 13203 13204 13205 13206 13207 13208 13209 13210 13211 13212 13213 13214 13215 13216 13217 13218 13219 13220 13221 13222 13223 13224 13225 13226 13227 13228 13229 13230 13231 13232 13233 13234 13235 13236 13237 13238 13239 13240 13241 13242 13243 13244 13245 13246 13247 13248 13249 13250 13251 13252 13253 13254 13255 13256 13257 13258 13259 13260 13261 13262 13263 13264 13265 13266 13267 13268 13269 13270 13271 13272 13273 13274 13275 13276 13277 13278 13279 13280 13281 13282 13283 13284 13285 13286 13287 13288 13289 13290 13291 13292 13293 13294 13295 13296 13297 13298 13299 13300 13301 13302 13303 13304 13305 13306 13307 13308 13309 13310 13311 13312 13313 13314 13315 13316 13317 13318 13319 13320 13321 13322 13323 13324 13325 13326 13327 13328 13329 13330 13331 13332 13333 13334 13335 13336 13337 13338 13339 13340 13341 13342 13343 13344 13345 13346 13347 13348 13349 13350 13351 13352 13353 13354 13355 13356 13357 13358 13359 13360 13361 13362 13363 13364 13365 13366 13367 13368 13369 13370 13371 13372 13373 13374 13375 13376 13377 13378 13379 13380 13381 13382 13383 13384 13385 13386 13387 13388 13389 13390 13391 13392 13393 13394 13395 13396 13397 13398 13399 13400 13401 13402 13403 13404 13405 13406 13407 13408 13409 13410 13411 13412 13413 13414 13415 13416 13417 13418 13419 13420 13421 13422 13423 13424 13425 13426 13427 13428 13429 13430 13431 13432 13433 13434 13435 13436 13437 13438 13439 13440 13441 13442 13443 13444 13445 13446 13447 13448 13449 13450 13451 13452 13453 13454 13455 13456 13457 13458 13459 13460 13461 13462 13463 13464 13465 13466 13467 13468 13469 13470 13471 13472 13473 13474 13475 13476 13477 13478 13479 13480 13481 13482 13483 13484 13485 13486 13487 13488 13489 13490 13491 13492 13493 13494 13495 13496 13497 13498 13499 13500 13501 13502 13503 13504 13505 13506 13507 13508 13509 13510 13511 13512 13513 13514 13515 13516 13517 13518 13519 13520 13521 13522 13523 13524 13525 13526 13527 13528 13529 13530 13531 13532 13533 13534 13535 13536 13537 13538 13539 13540 13541 13542 13543 13544 13545 13546 13547 13548 13549 13550 13551 13552 13553 13554 13555 13556 13557 13558 13559 13560 13561 13562 13563 13564 13565 13566 13567 13568 13569 13570 13571 13572 13573 13574 13575 13576 13577 13578 13579 13580 13581 13582 13583 13584 13585 13586 13587 13588 13589 13590 13591 13592 13593 13594 13595 13596 13597 13598 13599 13600 13601 13602 13603 13604 13605 13606 13607 13608 13609 13610 13611 13612 13613 13614 13615 13616 13617 13618 13619 13620 13621 13622 13623 13624 13625 13626 13627 13628 13629 13630 13631 13632 13633 13634 13635 13636 13637 13638 13639 13640 13641 13642 13643 13644 13645 13646 13647 13648 13649 13650 13651 13652 13653 13654 13655 13656 13657 13658 13659 13660 13661 13662 13663 13664 13665 13666 13667 13668 13669 13670 13671 13672 13673 13674 13675 13676 13677 13678 13679 13680 13681 13682 13683 13684 13685 13686 13687 13688 13689 13690 13691 13692 13693 13694 13695 13696 13697 13698 13699 13700 13701 13702 13703 13704 13705 13706 13707 13708 13709 13710 13711 13712 13713 13714 13715 13716 13717 13718 13719 13720 13721 13722 13723 13724 13725 13726 13727 13728 13729 13730 13731 13732 13733 13734 13735 13736 13737 13738 13739 13740 13741 13742 13743 13744 13745 13746 13747 13748 13749 13750 13751 13752 13753 13754 13755 13756 13757 13758 13759 13760 13761 13762 13763 13764 13765 13766 13767 13768 13769 13770 13771 13772 13773 13774 13775 13776 13777 13778 13779 13780 13781 13782 13783 13784 13785 13786 13787 13788 13789 13790 13791 13792 13793 13794 13795 13796 13797 13798 13799 13800 13801 13802 13803 13804 13805 13806 13807 13808 13809 13810 13811 13812 13813 13814 13815 13816 13817 13818 13819 13820 13821 13822 13823 13824 13825 13826 13827 13828 13829 13830 13831 13832 13833 13834 13835 13836 13837 13838 13839 13840 13841 13842 13843 13844 13845 13846 13847 13848 13849 13850 13851 13852 13853 13854 13855 13856 13857 13858 13859 13860 13861 13862 13863 13864 13865 13866 13867 13868 13869 13870 13871 13872 13873 13874 13875 13876 13877 13878 13879 13880 13881 13882 13883 13884 13885 13886 13887 13888 13889 13890 13891 13892 13893 13894 13895 13896 13897 13898 13899 13900 13901 13902 13903 13904 13905 13906 13907 13908 13909 13910 13911 13912 13913 13914 13915 13916 13917 13918 13919 13920 13921 13922 13923 13924 13925 13926 13927 13928 13929 13930 13931 13932 13933 13934 13935 13936 13937 13938 13939 13940 13941 13942 13943 13944 13945 13946 13947 13948 13949 13950 13951 13952 13953 13954 13955 13956 13957 13958 13959 13960 13961 13962 13963 13964 13965 13966 13967 13968 13969 13970 13971 13972 13973 13974 13975 13976 13977 13978 13979 13980 13981 13982 13983 13984 13985 13986 13987 13988 13989 13990 13991 13992 13993 13994 13995 13996 13997 13998 13999 14000 14001 14002 14003 14004 14005 14006 14007 14008 14009 14010 14011 14012 14013 14014 14015 14016 14017 14018 14019 14020 14021 14022 14023 14024 14025 14026 14027 14028 14029 14030 14031 14032 14033 14034 14035 14036 14037 14038 14039 14040 14041 14042 14043 14044 14045 14046 14047 14048 14049 14050 14051 14052 14053 14054 14055 14056 14057 14058 14059 14060 14061 14062 14063 14064 14065 14066 14067 14068 14069 14070 14071 14072 14073 14074 14075 14076 14077 14078 14079 14080 14081 14082 14083 14084 14085 14086 14087 14088 14089 14090 14091 14092 14093 14094 14095 14096 14097 14098 14099 14100 14101 14102 14103 14104 14105 14106 14107 14108 14109 14110 14111 14112 14113 14114 14115 14116 14117 14118 14119 14120 14121 14122 14123 14124 14125 14126 14127 14128 14129 14130 14131 14132 14133 14134 14135 14136 14137 14138 14139 14140 14141 14142 14143 14144 14145 14146 14147 14148 14149 14150 14151 14152 14153 14154 14155 14156 14157 14158 14159 14160 14161 14162 14163 14164 14165 14166 14167 14168 14169 14170 14171 14172 14173 14174 14175 14176 14177 14178 14179 14180 14181 14182 14183 14184 14185 14186 14187 14188 14189 14190 14191 14192 14193 14194 14195 14196 14197 14198 14199 14200 14201 14202 14203 14204 14205 14206 14207 14208 14209 14210 14211 14212 14213 14214 14215 14216 14217 14218 14219 14220 14221 14222 14223 14224 14225 14226 14227 14228 14229 14230 14231 14232 14233 14234 14235 14236 14237 14238 14239 14240 14241 14242 14243 14244 14245 14246 14247 14248 14249 14250 14251 14252 14253 14254 14255 14256 14257 14258 14259 14260 14261 14262 14263 14264 14265 14266 14267 14268 14269 14270 14271 14272 14273 14274 14275 14276 14277 14278 14279 14280 14281 14282 14283 14284 14285 14286 14287 14288 14289 14290 14291 14292 14293 14294 14295 14296 14297 14298 14299 14300 14301 14302 14303 14304 14305 14306 14307 14308 14309 14310 14311 14312 14313 14314 14315 14316 14317 14318 14319 14320 14321 14322 14323 14324 14325 14326 14327 14328 14329 14330 14331 14332 14333 14334 14335 14336 14337 14338 14339 14340 14341 14342 14343 14344 14345 14346 14347 14348 14349 14350 14351 14352 14353 14354 14355 14356 14357 14358 14359 14360 14361 14362 14363 14364 14365 14366 14367 14368 14369 14370 14371 14372 14373 14374 14375 14376 14377 14378 14379 14380 14381 14382 14383 14384 14385 14386 14387 14388 14389 14390 14391 14392 14393 14394 14395 14396 14397 14398 14399 14400 14401 14402 14403 14404 14405 14406 14407 14408 14409 14410 14411 14412 14413 14414 14415 14416 14417 14418 14419 14420 14421 14422 14423 14424 14425 14426 14427 14428 14429 14430 14431 14432 14433 14434 14435 14436 14437 14438 14439 14440 14441 14442 14443 14444 14445 14446 14447 14448 14449 14450 14451 14452 14453 14454 14455 14456 14457 14458 14459 14460 14461 14462 14463 14464 14465 14466 14467 14468 14469 14470 14471 14472 14473 14474 14475 14476 14477 14478 14479 14480 14481 14482 14483 14484 14485 14486 14487 14488 14489 14490 14491 14492 14493 14494 14495 14496 14497 14498 14499 14500 14501 14502 14503 14504 14505 14506 14507 14508 14509 14510 14511 14512 14513 14514 14515 14516 14517 14518 14519 14520 14521 14522 14523 14524 14525 14526 14527 14528 14529 14530 14531 14532 14533 14534 14535 14536 14537 14538 14539 14540 14541 14542 14543 14544 14545 14546 14547 14548 14549 14550 14551 14552 14553 14554 14555 14556 14557 14558 14559 14560 14561 14562 14563 14564 14565 14566 14567 14568 14569 14570 14571 14572 14573 14574 14575 14576 14577 14578 14579 14580 14581 14582 14583 14584 14585 14586 14587 14588 14589 14590 14591 14592 14593 14594 14595 14596 14597 14598 14599 14600 14601 14602 14603 14604 14605 14606 14607 14608 14609 14610 14611 14612 14613 14614 14615 14616 14617 14618 14619 14620 14621 14622 14623 14624 14625 14626 14627 14628 14629 14630 14631 14632 14633 14634 14635 14636 14637 14638 14639 14640 14641 14642 14643 14644 14645 14646 14647 14648 14649 14650 14651 14652 14653 14654 14655 14656 14657 14658 14659 14660 14661 14662 14663 14664 14665 14666 14667 14668 14669 14670 14671 14672 14673 14674 14675 14676 14677 14678 14679 14680 14681 14682 14683 14684 14685 14686 14687 14688 14689 14690 14691 14692 14693 14694 14695 14696 14697 14698 14699 14700 14701 14702 14703 14704 14705 14706 14707 14708 14709 14710 14711 14712 14713 14714 14715 14716 14717 14718 14719 14720 14721 14722 14723 14724 14725 14726 14727 14728 14729 14730 14731 14732 14733 14734 14735 14736 14737 14738 14739 14740 14741 14742 14743 14744 14745 14746 14747 14748 14749 14750 14751 14752 14753 14754 14755 14756 14757 14758 14759 14760 14761 14762 14763 14764 14765 14766 14767 14768 14769 14770 14771 14772 14773 14774 14775 14776 14777 14778 14779 14780 14781 14782 14783 14784 14785 14786 14787 14788 14789 14790 14791 14792 14793 14794 14795 14796 14797 14798 14799 14800 14801 14802 14803 14804 14805 14806 14807 14808 14809 14810 14811 14812 14813 14814 14815 14816 14817 14818 14819 14820 14821 14822 14823 14824 14825 14826 14827 14828 14829 14830 14831 14832 14833 14834 14835 14836 14837 14838 14839 14840 14841 14842 14843 14844 14845 14846 14847 14848 14849 14850 14851 14852 14853 14854 14855 14856 14857 14858 14859 14860 14861 14862 14863 14864 14865 14866 14867 14868 14869 14870 14871 14872 14873 14874 14875 14876 14877 14878 14879 14880 14881 14882 14883 14884 14885 14886 14887 14888 14889 14890 14891 14892 14893 14894 14895 14896 14897 14898 14899 14900 14901 14902 14903 14904 14905 14906 14907 14908 14909 14910 14911 14912 14913 14914 14915 14916 14917 14918 14919 14920 14921 14922 14923 14924 14925 14926 14927 14928 14929 14930 14931 14932 14933 14934 14935 14936 14937 14938 14939 14940 14941 14942 14943 14944 14945 14946 14947 14948 14949 14950 14951 14952 14953 14954 14955 14956 14957 14958 14959 14960 14961 14962 14963 14964 14965 14966 14967 14968 14969 14970 14971 14972 14973 14974 14975 14976 14977 14978 14979 14980 14981 14982 14983 14984 14985 14986 14987 14988 14989 14990 14991 14992 14993 14994 14995 14996 14997 14998 14999 15000 15001 15002 15003 15004 15005 15006 15007 15008 15009 15010 15011 15012 15013 15014 15015 15016 15017 15018 15019 15020 15021 15022 15023 15024 15025 15026 15027 15028 15029 15030 15031 15032 15033 15034 15035 15036 15037 15038 15039 15040 15041 15042 15043 15044 15045 15046 15047 15048 15049 15050 15051 15052 15053 15054 15055 15056 15057 15058 15059 15060 15061 15062 15063 15064 15065 15066 15067 15068 15069 15070 15071 15072 15073 15074 15075 15076 15077 15078 15079 15080 15081 15082 15083 15084 15085 15086 15087 15088 15089 15090 15091 15092 15093 15094 15095 15096 15097 15098 15099 15100 15101 15102 15103 15104 15105 15106 15107 15108 15109 15110 15111 15112 15113 15114 15115 15116 15117 15118 15119 15120 15121 15122 15123 15124 15125 15126 15127 15128 15129 15130 15131 15132 15133 15134 15135 15136 15137 15138 15139 15140 15141 15142 15143 15144 15145 15146 15147 15148 15149 15150 15151 15152 15153 15154 15155 15156 15157 15158 15159 15160 15161 15162 15163 15164 15165 15166 15167 15168 15169 15170 15171 15172 15173 15174 15175 15176 15177 15178 15179 15180 15181 15182 15183 15184 15185 15186 15187 15188 15189 15190 15191 15192 15193 15194 15195 15196 15197 15198 15199 15200 15201 15202 15203 15204 15205 15206 15207 15208 15209 15210 15211 15212 15213 15214 15215 15216 15217 15218 15219 15220 15221 15222 15223 15224 15225 15226 15227 15228 15229 15230 15231 15232 15233 15234 15235 15236 15237 15238 15239 15240 15241 15242 15243 15244 15245 15246 15247 15248 15249 15250 15251 15252 15253 15254 15255 15256 15257 15258 15259 15260 15261 15262 15263 15264 15265 15266 15267 15268 15269 15270 15271 15272 15273 15274 15275 15276 15277 15278 15279 15280 15281 15282 15283 15284 15285 15286 15287 15288 15289 15290 15291 15292 15293 15294 15295 15296 15297 15298 15299 15300 15301 15302 15303 15304 15305 15306 15307 15308 15309 15310 15311 15312 15313 15314 15315 15316 15317 15318 15319 15320 15321 15322 15323 15324 15325 15326 15327 15328 15329 15330 15331 15332 15333 15334 15335 15336 15337 15338 15339 15340 15341 15342 15343 15344 15345 15346 15347 15348 15349 15350 15351 15352 15353 15354 15355 15356 15357 15358 15359 15360 15361 15362 15363 15364 15365 15366 15367 15368 15369 15370 15371 15372 15373 15374 15375 15376 15377 15378 15379 15380 15381 15382 15383 15384 15385 15386 15387 15388 15389 15390 15391 15392 15393 15394 15395 15396 15397 15398 15399 15400 15401 15402 15403 15404 15405 15406 15407 15408 15409 15410 15411 15412 15413 15414 15415 15416 15417 15418 15419 15420 15421 15422 15423 15424 15425 15426 15427 15428 15429 15430 15431 15432 15433 15434 15435 15436 15437 15438 15439 15440 15441 15442 15443 15444 15445 15446 15447 15448 15449 15450 15451 15452 15453 15454 15455 15456 15457 15458 15459 15460 15461 15462 15463 15464 15465 15466 15467 15468 15469 15470 15471 15472 15473 15474 15475 15476 15477 15478 15479 15480 15481 15482 15483 15484 15485 15486 15487 15488 15489 15490 15491 15492 15493 15494 15495 15496 15497 15498 15499 15500 15501 15502 15503 15504 15505 15506 15507 15508 15509 15510 15511 15512 15513 15514 15515 15516 15517 15518 15519 15520 15521 15522 15523 15524 15525 15526 15527 15528 15529 15530 15531 15532 15533 15534 15535 15536 15537 15538 15539 15540 15541 15542 15543 15544 15545 15546 15547 15548 15549 15550 15551 15552 15553 15554 15555 15556 15557 15558 15559 15560 15561 15562 15563 15564 15565 15566 15567 15568 15569 15570 15571 15572 15573 15574 15575 15576 15577 15578 15579 15580 15581 15582 15583 15584 15585 15586 15587 15588 15589 15590 15591 15592 15593 15594 15595 15596 15597 15598 15599 15600 15601 15602 15603 15604 15605 15606 15607 15608 15609 15610 15611 15612 15613 15614 15615 15616 15617 15618 15619 15620 15621 15622 15623 15624 15625 15626 15627 15628 15629 15630 15631 15632 15633 15634 15635 15636 15637 15638 15639 15640 15641 15642 15643 15644 15645 15646 15647 15648 15649 15650 15651 15652 15653 15654 15655 15656 15657 15658 15659 15660 15661 15662 15663 15664 15665 15666 15667 15668 15669 15670 15671 15672 15673 15674 15675 15676 15677 15678 15679 15680 15681 15682 15683 15684 15685 15686 15687 15688 15689 15690 15691 15692 15693 15694 15695 15696 15697 15698 15699 15700 15701 15702 15703 15704 15705 15706 15707 15708 15709 15710 15711 15712 15713 15714 15715 15716 15717 15718 15719 15720 15721 15722 15723 15724 15725 15726 15727 15728 15729 15730 15731 15732 15733 15734 15735 15736 15737 15738 15739 15740 15741 15742 15743 15744 15745 15746 15747 15748 15749 15750 15751 15752 15753 15754 15755 15756 15757 15758 15759 15760 15761 15762 15763 15764 15765 15766 15767 15768 15769 15770 15771 15772 15773 15774 15775 15776 15777 15778 15779 15780 15781 15782 15783 15784 15785 15786 15787 15788 15789 15790 15791 15792 15793 15794 15795 15796 15797 15798 15799 15800 15801 15802 15803 15804 15805 15806 15807 15808 15809 15810 15811 15812 15813 15814 15815 15816 15817 15818 15819 15820 15821 15822 15823 15824 15825 15826 15827 15828 15829 15830 15831 15832 15833 15834 15835 15836 15837 15838 15839 15840 15841 15842 15843 15844 15845 15846 15847 15848 15849 15850 15851 15852 15853 15854 15855 15856 15857 15858 15859 15860 15861 15862 15863 15864 15865 15866 15867 15868 15869 15870 15871 15872 15873 15874 15875 15876 15877 15878 15879 15880 15881 15882 15883 15884 15885 15886 15887 15888 15889 15890 15891 15892 15893 15894 15895 15896 15897 15898 15899 15900 15901 15902 15903 15904 15905 15906 15907 15908 15909 15910 15911 15912 15913 15914 15915 15916 15917 15918 15919 15920 15921 15922 15923 15924 15925 15926 15927 15928 15929 15930 15931 15932 15933 15934 15935 15936 15937 15938 15939 15940 15941 15942 15943 15944 15945 15946 15947 15948 15949 15950 15951 15952 15953 15954 15955 15956 15957 15958 15959 15960 15961 15962 15963 15964 15965 15966 15967 15968 15969 15970 15971 15972 15973 15974 15975 15976 15977 15978 15979 15980 15981 15982 15983 15984 15985 15986 15987 15988 15989 15990 15991 15992 15993 15994 15995 15996 15997 15998 15999 16000 16001 16002 16003 16004 16005 16006 16007 16008 16009 16010 16011 16012 16013 16014 16015 16016 16017 16018 16019 16020 16021 16022 16023 16024 16025 16026 16027 16028 16029 16030 16031 16032 16033 16034 16035 16036 16037 16038 16039 16040 16041 16042 16043 16044 16045 16046 16047 16048 16049 16050 16051 16052 16053 16054 16055 16056 16057 16058 16059 16060 16061 16062 16063 16064 16065 16066 16067 16068 16069 16070 16071 16072 16073 16074 16075 16076 16077 16078 16079 16080 16081 16082 16083 16084 16085 16086 16087 16088 16089 16090 16091 16092 16093 16094 16095 16096 16097 16098 16099 16100 16101 16102 16103 16104 16105 16106 16107 16108 16109 16110 16111 16112 16113 16114 16115 16116 16117 16118 16119 16120 16121 16122 16123 16124 16125 16126 16127 16128 16129 16130 16131 16132 16133 16134 16135 16136 16137 16138 16139 16140 16141 16142 16143 16144 16145 16146 16147 16148 16149 16150 16151 16152 16153 16154 16155 16156 16157 16158 16159 16160 16161 16162 16163 16164 16165 16166 16167 16168 16169 16170 16171 16172 16173 16174 16175 16176 16177 16178 16179 16180 16181 16182 16183 16184 16185 16186 16187 16188 16189 16190 16191 16192 16193 16194 16195 16196 16197 16198 16199 16200 16201 16202 16203 16204 16205 16206 16207 16208 16209 16210 16211 16212 16213 16214 16215 16216 16217 16218 16219 16220 16221 16222 16223 16224 16225 16226 16227 16228 16229 16230 16231 16232 16233 16234 16235 16236 16237 16238 16239 16240 16241 16242 16243 16244 16245 16246 16247 16248 16249 16250 16251 16252 16253 16254 16255 16256 16257 16258 16259 16260 16261 16262 16263 16264 16265 16266 16267 16268 16269 16270 16271 16272 16273 16274 16275 16276 16277 16278 16279 16280 16281 16282 16283 16284 16285 16286 16287 16288 16289 16290 16291 16292 16293 16294 16295 16296 16297 16298 16299 16300 16301 16302 16303 16304 16305 16306 16307 16308 16309 16310 16311 16312 16313 16314 16315 16316 16317 16318 16319 16320 16321 16322 16323 16324 16325 16326 16327 16328 16329 16330 16331 16332 16333 16334 16335 16336 16337 16338 16339 16340 16341 16342 16343 16344 16345 16346 16347 16348 16349 16350 16351 16352 16353 16354 16355 16356 16357 16358 16359 16360 16361 16362 16363 16364 16365 16366 16367 16368 16369 16370 16371 16372 16373 16374 16375 16376 16377 16378 16379 16380 16381 16382 16383 16384 16385 16386 16387 16388 16389 16390 16391 16392 16393 16394 16395 16396 16397 16398 16399 16400 16401 16402 16403 16404 16405 16406 16407 16408 16409 16410 16411 16412 16413 16414 16415 16416 16417 16418 16419 16420 16421 16422 16423 16424 16425 16426 16427 16428 16429 16430 16431 16432 16433 16434 16435 16436 16437 16438 16439 16440 16441 16442 16443 16444 16445 16446 16447 16448 16449 16450 16451 16452 16453 16454 16455 16456 16457 16458 16459 16460 16461 16462 16463 16464 16465 16466 16467 16468 16469 16470 16471 16472 16473 16474 16475 16476 16477 16478 16479 16480 16481 16482 16483 16484 16485 16486 16487 16488 16489 16490 16491 16492 16493 16494 16495 16496 16497 16498 16499 16500 16501 16502 16503 16504 16505 16506 16507 16508 16509 16510 16511 16512 16513 16514 16515 16516 16517 16518 16519 16520 16521 16522 16523 16524 16525 16526 16527 16528 16529 16530 16531 16532 16533 16534 16535 16536 16537 16538 16539 16540 16541 16542 16543 16544 16545 16546 16547 16548 16549 16550 16551 16552 16553 16554 16555 16556 16557 16558 16559 16560 16561 16562 16563 16564 16565 16566 16567 16568 16569 16570 16571 16572 16573 16574 16575 16576 16577 16578 16579 16580 16581 16582 16583 16584 16585 16586 16587 16588 16589 16590 16591 16592 16593 16594 16595 16596 16597 16598 16599 16600 16601 16602 16603 16604 16605 16606 16607 16608 16609 16610 16611 16612 16613 16614 16615 16616 16617 16618 16619 16620 16621 16622 16623 16624 16625 16626 16627 16628 16629 16630 16631 16632 16633 16634 16635 16636 16637 16638 16639 16640 16641 16642 16643 16644 16645 16646 16647 16648 16649 16650 16651 16652 16653 16654 16655 16656 16657 16658 16659 16660 16661 16662 16663 16664 16665 16666 16667 16668 16669 16670 16671 16672 16673 16674 16675 16676 16677 16678 16679 16680 16681 16682 16683 16684 16685 16686 16687 16688 16689 16690 16691 16692 16693 16694 16695 16696 16697 16698 16699 16700 16701 16702 16703 16704 16705 16706 16707 16708 16709 16710 16711 16712 16713 16714 16715 16716 16717 16718 16719 16720 16721 16722 16723 16724 16725 16726 16727 16728 16729 16730 16731 16732 16733 16734 16735 16736 16737 16738 16739 16740 16741 16742 16743 16744 16745 16746 16747 16748 16749 16750 16751 16752 16753 16754 16755 16756 16757 16758 16759 16760 16761 16762 16763 16764 16765 16766 16767 16768 16769 16770 16771 16772 16773 16774 16775 16776 16777 16778 16779 16780 16781 16782 16783 16784 16785 16786 16787 16788 16789 16790 16791 16792 16793 16794 16795 16796 16797 16798 16799 16800 16801 16802 16803 16804 16805 16806 16807 16808 16809 16810 16811 16812 16813 16814 16815 16816 16817 16818 16819 16820 16821 16822 16823 16824 16825 16826 16827 16828 16829 16830 16831 16832 16833 16834 16835 16836 16837 16838 16839 16840 16841 16842 16843 16844 16845 16846 16847 16848 16849 16850 16851 16852 16853 16854 16855 16856 16857 16858 16859 16860 16861 16862 16863 16864 16865 16866 16867 16868 16869 16870 16871 16872 16873 16874 16875 16876 16877 16878 16879 16880 16881 16882 16883 16884 16885 16886 16887 16888 16889 16890 16891 16892 16893 16894 16895 16896 16897 16898 16899 16900 16901 16902 16903 16904 16905 16906 16907 16908 16909 16910 16911 16912 16913 16914 16915 16916 16917 16918 16919 16920 16921 16922 16923 16924 16925 16926 16927 16928 16929 16930 16931 16932 16933 16934 16935 16936 16937 16938 16939 16940 16941 16942 16943 16944 16945 16946 16947 16948 16949 16950 16951 16952 16953 16954 16955 16956 16957 16958 16959 16960 16961 16962 16963 16964 16965 16966 16967 16968 16969 16970 16971 16972 16973 16974 16975 16976 16977 16978 16979 16980 16981 16982 16983 16984 16985 16986 16987 16988 16989 16990 16991 16992 16993 16994 16995 16996 16997 16998 16999 17000 17001 17002 17003 17004 17005 17006 17007 17008 17009 17010 17011 17012 17013 17014 17015 17016 17017 17018 17019 17020 17021 17022 17023 17024 17025 17026 17027 17028 17029 17030 17031 17032 17033 17034 17035 17036 17037 17038 17039 17040 17041 17042 17043 17044 17045 17046 17047 17048 17049 17050 17051 17052 17053 17054 17055 17056 17057 17058 17059 17060 17061 17062 17063 17064 17065 17066 17067 17068 17069 17070 17071 17072 17073 17074 17075 17076 17077 17078 17079 17080 17081 17082 17083 17084 17085 17086 17087 17088 17089 17090 17091 17092 17093 17094 17095 17096 17097 17098 17099 17100 17101 17102 17103 17104 17105 17106 17107 17108 17109 17110 17111 17112 17113 17114 17115 17116 17117 17118 17119 17120 17121 17122 17123 17124 17125 17126 17127 17128 17129 17130 17131 17132 17133 17134 17135 17136 17137 17138 17139 17140 17141 17142 17143 17144 17145 17146 17147 17148 17149 17150 17151 17152 17153 17154 17155 17156 17157 17158 17159 17160 17161 17162 17163 17164 17165 17166 17167 17168 17169 17170 17171 17172 17173 17174 17175 17176 17177 17178 17179 17180 17181 17182 17183 17184 17185 17186 17187 17188 17189 17190 17191 17192 17193 17194 17195 17196 17197 17198 17199 17200 17201 17202 17203 17204 17205 17206 17207 17208 17209 17210 17211 17212 17213 17214 17215 17216 17217 17218 17219 17220 17221 17222 17223 17224 17225 17226 17227 17228 17229 17230 17231 17232 17233 17234 17235 17236 17237 17238 17239 17240 17241 17242 17243 17244 17245 17246 17247 17248 17249 17250 17251 17252 17253 17254 17255 17256 17257 17258 17259 17260 17261 17262 17263 17264 17265 17266 17267 17268 17269 17270 17271 17272 17273 17274 17275 17276 17277 17278 17279 17280 17281 17282 17283 17284 17285 17286 17287 17288 17289 17290 17291 17292 17293 17294 17295 17296 17297 17298 17299 17300 17301 17302 17303 17304 17305 17306 17307 17308 17309 17310 17311 17312 17313 17314 17315 17316 17317 17318 17319 17320 17321 17322 17323 17324 17325 17326 17327 17328 17329 17330 17331 17332 17333 17334 17335 17336 17337 17338 17339 17340 17341 17342 17343 17344 17345 17346 17347 17348 17349 17350 17351 17352 17353 17354 17355 17356 17357 17358 17359 17360 17361 17362 17363 17364 17365 17366 17367 17368 17369 17370 17371 17372 17373 17374 17375 17376 17377 17378 17379 17380 17381 17382 17383 17384 17385 17386 17387 17388 17389 17390 17391 17392 17393 17394 17395 17396 17397 17398 17399 17400 17401 17402 17403 17404 17405 17406 17407 17408 17409 17410 17411 17412 17413 17414 17415 17416 17417 17418 17419 17420 17421 17422 17423 17424 17425 17426 17427 17428 17429 17430 17431 17432 17433 17434 17435 17436 17437 17438 17439 17440 17441 17442 17443 17444 17445 17446 17447 17448 17449 17450 17451 17452 17453 17454 17455 17456 17457 17458 17459 17460 17461 17462 17463 17464 17465 17466 17467 17468 17469 17470 17471 17472 17473 17474 17475 17476 17477 17478 17479 17480 17481 17482 17483 17484 17485 17486 17487 17488 17489 17490 17491 17492 17493 17494 17495 17496 17497 17498 17499 17500 17501 17502 17503 17504 17505 17506 17507 17508 17509 17510 17511 17512 17513 17514 17515 17516 17517 17518 17519 17520 17521 17522 17523 17524 17525 17526 17527 17528 17529 17530 17531 17532 17533 17534 17535 17536 17537 17538 17539 17540 17541 17542 17543 17544 17545 17546 17547 17548 17549 17550 17551 17552 17553 17554 17555 17556 17557 17558 17559 17560 17561 17562 17563 17564 17565 17566 17567 17568 17569 17570 17571 17572 17573 17574 17575 17576 17577 17578 17579 17580 17581 17582 17583 17584 17585 17586 17587 17588 17589 17590 17591 17592 17593 17594 17595 17596 17597 17598 17599 17600 17601 17602 17603 17604 17605 17606 17607 17608 17609 17610 17611 17612 17613 17614 17615 17616 17617 17618 17619 17620 17621 17622 17623 17624 17625 17626 17627 17628 17629 17630 17631 17632 17633 17634 17635 17636 17637 17638 17639 17640 17641 17642 17643 17644 17645 17646 17647 17648 17649 17650 17651 17652 17653 17654 17655 17656 17657 17658 17659 17660 17661 17662 17663 17664 17665 17666 17667 17668 17669 17670 17671 17672 17673 17674 17675 17676 17677 17678 17679 17680 17681 17682 17683 17684 17685 17686 17687 17688 17689 17690 17691 17692 17693 17694 17695 17696 17697 17698 17699 17700 17701 17702 17703 17704 17705 17706 17707 17708 17709 17710 17711 17712 17713 17714 17715 17716 17717 17718 17719 17720 17721 17722 17723 17724 17725 17726 17727 17728 17729 17730 17731 17732 17733 17734 17735 17736 17737 17738 17739 17740 17741 17742 17743 17744 17745 17746 17747 17748 17749 17750 17751 17752 17753 17754 17755 17756 17757 17758 17759 17760 17761 17762 17763 17764 17765 17766 17767 17768 17769 17770 17771 17772 17773 17774 17775 17776 17777 17778 17779 17780 17781 17782 17783 17784 17785 17786 17787 17788 17789 17790 17791 17792 17793 17794 17795 17796 17797 17798 17799 17800 17801 17802 17803 17804 17805 17806 17807 17808 17809 17810 17811 17812 17813 17814 17815 17816 17817 17818 17819 17820 17821 17822 17823 17824 17825 17826 17827 17828 17829 17830 17831 17832 17833 17834 17835 17836 17837 17838 17839 17840 17841 17842 17843 17844 17845 17846 17847 17848 17849 17850 17851 17852 17853 17854 17855 17856 17857 17858 17859 17860 17861 17862 17863 17864 17865 17866 17867 17868 17869 17870 17871 17872 17873 17874 17875 17876 17877 17878 17879 17880 17881 17882 17883 17884 17885 17886 17887 17888 17889 17890 17891 17892 17893 17894 17895 17896 17897 17898 17899 17900 17901 17902 17903 17904 17905 17906 17907 17908 17909 17910 17911 17912 17913 17914 17915 17916 17917 17918 17919 17920 17921 17922 17923 17924 17925 17926 17927 17928 17929 17930 17931 17932 17933 17934 17935 17936 17937 17938 17939 17940 17941 17942 17943 17944 17945 17946 17947 17948 17949 17950 17951 17952 17953 17954 17955 17956 17957 17958 17959 17960 17961 17962 17963 17964 17965 17966 17967 17968 17969 17970 17971 17972 17973 17974 17975 17976 17977 17978 17979 17980 17981 17982 17983 17984 17985 17986 17987 17988 17989 17990 17991 17992 17993 17994 17995 17996 17997 17998 17999 18000 18001 18002 18003 18004 18005 18006 18007 18008 18009 18010 18011 18012 18013 18014 18015 18016 18017 18018 18019 18020 18021 18022 18023 18024 18025 18026 18027 18028 18029 18030 18031 18032 18033 18034 18035 18036 18037 18038 18039 18040 18041 18042 18043 18044 18045 18046 18047 18048 18049 18050 18051 18052 18053 18054 18055 18056 18057 18058 18059 18060 18061 18062 18063 18064 18065 18066 18067 18068 18069 18070 18071 18072 18073 18074 18075 18076 18077 18078 18079 18080 18081 18082 18083 18084 18085 18086 18087 18088 18089 18090 18091 18092 18093 18094 18095 18096 18097 18098 18099 18100 18101 18102 18103 18104 18105 18106 18107 18108 18109 18110 18111 18112 18113 18114 18115 18116 18117 18118 18119 18120 18121 18122 18123 18124 18125 18126 18127 18128 18129 18130 18131 18132 18133 18134 18135 18136 18137 18138 18139 18140 18141 18142 18143 18144 18145 18146 18147 18148 18149 18150 18151 18152 18153 18154 18155 18156 18157 18158 18159 18160 18161 18162 18163 18164 18165 18166 18167 18168 18169 18170 18171 18172 18173 18174 18175 18176 18177 18178 18179 18180 18181 18182 18183 18184 18185 18186 18187 18188 18189 18190 18191 18192 18193 18194 18195 18196 18197 18198 18199 18200 18201 18202 18203 18204 18205 18206 18207 18208 18209 18210 18211 18212 18213 18214 18215 18216 18217 18218 18219 18220 18221 18222 18223 18224 18225 18226 18227 18228 18229 18230 18231 18232 18233 18234 18235 18236 18237 18238 18239 18240 18241 18242 18243 18244 18245 18246 18247 18248 18249 18250 18251 18252 18253 18254 18255 18256 18257 18258 18259 18260 18261 18262 18263 18264 18265 18266 18267 18268 18269 18270 18271 18272 18273 18274 18275 18276 18277 18278 18279 18280 18281 18282 18283 18284 18285 18286 18287 18288 18289 18290 18291 18292 18293 18294 18295 18296 18297 18298 18299 18300 18301 18302 18303 18304 18305 18306 18307 18308 18309 18310 18311 18312 18313 18314 18315 18316 18317 18318 18319 18320 18321 18322 18323 18324 18325 18326 18327 18328 18329 18330 18331 18332 18333 18334 18335 18336 18337 18338 18339 18340 18341 18342 18343 18344 18345 18346 18347 18348 18349 18350 18351 18352 18353 18354 18355 18356 18357 18358 18359 18360 18361 18362 18363 18364 18365 18366 18367 18368 18369 18370 18371 18372 18373 18374 18375 18376 18377 18378 18379 18380 18381 18382 18383 18384 18385 18386 18387 18388 18389 18390 18391 18392 18393 18394 18395 18396 18397 18398 18399 18400 18401 18402 18403 18404 18405 18406 18407 18408 18409 18410 18411 18412 18413 18414 18415 18416 18417 18418 18419 18420 18421 18422 18423 18424 18425 18426 18427 18428 18429 18430 18431 18432 18433 18434 18435 18436 18437 18438 18439 18440 18441 18442 18443 18444 18445 18446 18447 18448 18449 18450 18451 18452 18453 18454 18455 18456 18457 18458 18459 18460 18461 18462 18463 18464 18465 18466 18467 18468 18469 18470 18471 18472 18473 18474 18475 18476 18477 18478 18479 18480 18481 18482 18483 18484 18485 18486 18487 18488 18489 18490 18491 18492 18493 18494 18495 18496 18497 18498 18499 18500 18501 18502 18503 18504 18505 18506 18507 18508 18509 18510 18511 18512 18513 18514 18515 18516 18517 18518 18519 18520 18521 18522 18523 18524 18525 18526 18527 18528 18529 18530 18531 18532 18533 18534 18535 18536 18537 18538 18539 18540 18541 18542 18543 18544 18545 18546 18547 18548 18549 18550 18551 18552 18553 18554 18555 18556 18557 18558 18559 18560 18561 18562 18563 18564 18565 18566 18567 18568 18569 18570 18571 18572 18573 18574 18575 18576 18577 18578 18579 18580 18581 18582 18583 18584 18585 18586 18587 18588 18589 18590 18591 18592 18593 18594 18595 18596 18597 18598 18599 18600 18601 18602 18603 18604 18605 18606 18607 18608 18609 18610 18611 18612 18613 18614 18615 18616 18617 18618 18619 18620 18621 18622 18623 18624 18625 18626 18627 18628 18629 18630 18631 18632 18633 18634 18635 18636 18637 18638 18639 18640 18641 18642 18643 18644 18645 18646 18647 18648 18649 18650 18651 18652 18653 18654 18655 18656 18657 18658 18659 18660 18661 18662 18663 18664 18665 18666 18667 18668 18669 18670 18671 18672 18673 18674 18675 18676 18677 18678 18679 18680 18681 18682 18683 18684 18685 18686 18687 18688 18689 18690 18691 18692 18693 18694 18695 18696 18697 18698 18699 18700 18701 18702 18703 18704 18705 18706 18707 18708 18709 18710 18711 18712 18713 18714 18715 18716 18717 18718 18719 18720 18721 18722 18723 18724 18725 18726 18727 18728 18729 18730 18731 18732 18733 18734 18735 18736 18737 18738 18739 18740 18741 18742 18743 18744 18745 18746 18747 18748 18749 18750 18751 18752 18753 18754 18755 18756 18757 18758 18759 18760 18761 18762 18763 18764 18765 18766 18767 18768 18769 18770 18771 18772 18773 18774 18775 18776 18777 18778 18779 18780 18781 18782 18783 18784 18785 18786 18787 18788 18789 18790 18791 18792 18793 18794 18795 18796 18797 18798 18799 18800 18801 18802 18803 18804 18805 18806 18807 18808 18809 18810 18811 18812 18813 18814 18815 18816 18817 18818 18819 18820 18821 18822 18823 18824 18825 18826 18827 18828 18829 18830 18831 18832 18833 18834 18835 18836 18837 18838 18839 18840 18841 18842 18843 18844 18845 18846 18847 18848 18849 18850 18851 18852 18853 18854 18855 18856 18857 18858 18859 18860 18861 18862 18863 18864 18865 18866 18867 18868 18869 18870 18871 18872 18873 18874 18875 18876 18877 18878 18879 18880 18881 18882 18883 18884 18885 18886 18887 18888 18889 18890 18891 18892 18893 18894 18895 18896 18897 18898 18899 18900 18901 18902 18903 18904 18905 18906 18907 18908 18909 18910 18911 18912 18913 18914 18915 18916 18917 18918 18919 18920 18921 18922 18923 18924 18925 18926 18927 18928 18929 18930 18931 18932 18933 18934 18935 18936 18937 18938 18939 18940 18941 18942 18943 18944 18945 18946 18947 18948 18949 18950 18951 18952 18953 18954 18955 18956 18957 18958 18959 18960 18961 18962 18963 18964 18965 18966 18967 18968 18969 18970 18971 18972 18973 18974 18975 18976 18977 18978 18979 18980 18981 18982 18983 18984 18985 18986 18987 18988 18989 18990 18991 18992 18993 18994 18995 18996 18997 18998 18999 19000 19001 19002 19003 19004 19005 19006 19007 19008 19009 19010 19011 19012 19013 19014 19015 19016 19017 19018 19019 19020 19021 19022 19023 19024 19025 19026 19027 19028 19029 19030 19031 19032 19033 19034 19035 19036 19037 19038 19039 19040 19041 19042 19043 19044 19045 19046 19047 19048 19049 19050 19051 19052 19053 19054 19055 19056 19057 19058 19059 19060 19061 19062 19063 19064 19065 19066 19067 19068 19069 19070 19071 19072 19073 19074 19075 19076 19077 19078 19079 19080 19081 19082 19083 19084 19085 19086 19087 19088 19089 19090 19091 19092 19093 19094 19095 19096 19097 19098 19099 19100 19101 19102 19103 19104 19105 19106 19107 19108 19109 19110 19111 19112 19113 19114 19115 19116 19117 19118 19119 19120 19121 19122 19123 19124 19125 19126 19127 19128 19129 19130 19131 19132 19133 19134 19135 19136 19137 19138 19139 19140 19141 19142 19143 19144 19145 19146 19147 19148 19149 19150 19151 19152 19153 19154 19155 19156 19157 19158 19159 19160 19161 19162 19163 19164 19165 19166 19167 19168 19169 19170 19171 19172 19173 19174 19175 19176 19177 19178 19179 19180 19181 19182 19183 19184 19185 19186 19187 19188 19189 19190 19191 19192 19193 19194 19195 19196 19197 19198 19199 19200 19201 19202 19203 19204 19205 19206 19207 19208 19209 19210 19211 19212 19213 19214 19215 19216 19217 19218 19219 19220 19221 19222 19223 19224 19225 19226 19227 19228 19229 19230 19231 19232 19233 19234 19235 19236 19237 19238 19239 19240 19241 19242 19243 19244 19245 19246 19247 19248 19249 19250 19251 19252 19253 19254 19255 19256 19257 19258 19259 19260 19261 19262 19263 19264 19265 19266 19267 19268 19269 19270 19271 19272 19273 19274 19275 19276 19277 19278 19279 19280 19281 19282 19283 19284 19285 19286 19287 19288 19289 19290 19291 19292 19293 19294 19295 19296 19297 19298 19299 19300 19301 19302 19303 19304 19305 19306 19307 19308 19309 19310 19311 19312 19313 19314 19315 19316 19317 19318 19319 19320 19321 19322 19323 19324 19325 19326 19327 19328 19329 19330 19331 19332 19333 19334 19335 19336 19337 19338 19339 19340 19341 19342 19343 19344 19345 19346 19347 19348 19349 19350 19351 19352 19353 19354 19355 19356 19357 19358 19359 19360 19361 19362 19363 19364 19365 19366 19367 19368 19369 19370 19371 19372 19373 19374 19375 19376 19377 19378 19379 19380 19381 19382 19383 19384 19385 19386 19387 19388 19389 19390 19391 19392 19393 19394 19395 19396 19397 19398 19399 19400 19401 19402 19403 19404 19405 19406 19407 19408 19409 19410 19411 19412 19413 19414 19415 19416 19417 19418 19419 19420 19421 19422 19423 19424 19425 19426 19427 19428 19429 19430 19431 19432 19433 19434 19435 19436 19437 19438 19439 19440 19441 19442 19443 19444 19445 19446 19447 19448 19449 19450 19451 19452 19453 19454 19455 19456 19457 19458 19459 19460 19461 19462 19463 19464 19465 19466 19467 19468 19469 19470 19471 19472 19473 19474 19475 19476 19477 19478 19479 19480 19481 19482 19483 19484 19485 19486 19487 19488 19489 19490 19491 19492 19493 19494 19495 19496 19497 19498 19499 19500 19501 19502 19503 19504 19505 19506 19507 19508 19509 19510 19511 19512 19513 19514 19515 19516 19517 19518 19519 19520 19521 19522 19523 19524 19525 19526 19527 19528 19529 19530 19531 19532 19533 19534 19535 19536 19537 19538 19539 19540 19541 19542 19543 19544 19545 19546 19547 19548 19549 19550 19551 19552 19553 19554 19555 19556 19557 19558 19559 19560 19561 19562 19563 19564 19565 19566 19567 19568 19569 19570 19571 19572 19573 19574 19575 19576 19577 19578 19579 19580 19581 19582 19583 19584 19585 19586 19587 19588 19589 19590 19591 19592 19593 19594 19595 19596 19597 19598 19599 19600 19601 19602 19603 19604 19605 19606 19607 19608 19609 19610 19611 19612 19613 19614 19615 19616 19617 19618 19619 19620 19621 19622 19623 19624 19625 19626 19627 19628 19629 19630 19631 19632 19633 19634 19635 19636 19637 19638 19639 19640 19641 19642 19643 19644 19645 19646 19647 19648 19649 19650 19651 19652 19653 19654 19655 19656 19657 19658 19659 19660 19661 19662 19663 19664 19665 19666 19667 19668 19669 19670 19671 19672 19673 19674 19675 19676 19677 19678 19679 19680 19681 19682 19683 19684 19685 19686 19687 19688 19689 19690 19691 19692 19693 19694 19695 19696 19697 19698 19699 19700 19701 19702 19703 19704 19705 19706 19707 19708 19709 19710 19711 19712 19713 19714 19715 19716 19717 19718 19719 19720 19721 19722 19723 19724 19725 19726 19727 19728 19729 19730 19731 19732 19733 19734 19735 19736 19737 19738 19739 19740 19741 19742 19743 19744 19745 19746 19747 19748 19749 19750 19751 19752 19753 19754 19755 19756 19757 19758 19759 19760 19761 19762 19763 19764 19765 19766 19767 19768 19769 19770 19771 19772 19773 19774 19775 19776 19777 19778 19779 19780 19781 19782 19783 19784 19785 19786 19787 19788 19789 19790 19791 19792 19793 19794 19795 19796 19797 19798 19799 19800 19801 19802 19803 19804 19805 19806 19807 19808 19809 19810 19811 19812 19813 19814 19815 19816 19817 19818 19819 19820 19821 19822 19823 19824 19825 19826 19827 19828 19829 19830 19831 19832 19833 19834 19835 19836 19837 19838 19839 19840 19841 19842 19843 19844 19845 19846 19847 19848 19849 19850 19851 19852 19853 19854 19855 19856 19857 19858 19859 19860 19861 19862 19863 19864 19865 19866 19867 19868 19869 19870 19871 19872 19873 19874 19875 19876 19877 19878 19879 19880 19881 19882 19883 19884 19885 19886 19887 19888 19889 19890 19891 19892 19893 19894 19895 19896 19897 19898 19899 19900 19901 19902 19903 19904 19905 19906 19907 19908 19909 19910 19911 19912 19913 19914 19915 19916 19917 19918 19919 19920 19921 19922 19923 19924 19925 19926 19927 19928 19929 19930 19931 19932 19933 19934 19935 19936 19937 19938 19939 19940 19941 19942 19943 19944 19945 19946 19947 19948 19949 19950 19951 19952 19953 19954 19955 19956 19957 19958 19959 19960 19961 19962 19963 19964 19965 19966 19967 19968 19969 19970 19971 19972 19973 19974 19975 19976 19977 19978 19979 19980 19981 19982 19983 19984 19985 19986 19987 19988 19989 19990 19991 19992 19993 19994 19995 19996 19997 19998 19999 20000 20001 20002 20003 20004 20005 20006 20007 20008 20009 20010 20011 20012 20013 20014 20015 20016 20017 20018 20019 20020 20021 20022 20023 20024 20025 20026 20027 20028 20029 20030 20031 20032 20033 20034 20035 20036 20037 20038 20039 20040 20041 20042 20043 20044 20045 20046 20047 20048 20049 20050 20051 20052 20053 20054 20055 20056 20057 20058 20059 20060 20061 20062 20063 20064 20065 20066 20067 20068 20069 20070 20071 20072 20073 20074 20075 20076 20077 20078 20079 20080 20081 20082 20083 20084 20085 20086 20087 20088 20089 20090 20091 20092 20093 20094 20095 20096 20097 20098 20099 20100 20101 20102 20103 20104 20105 20106 20107 20108 20109 20110 20111 20112 20113 20114 20115 20116 20117 20118 20119 20120 20121 20122 20123 20124 20125 20126 20127 20128 20129 20130 20131 20132 20133 20134 20135 20136 20137 20138 20139 20140 20141 20142 20143 20144 20145 20146 20147 20148 20149 20150 20151 20152 20153 20154 20155 20156 20157 20158 20159 20160 20161 20162 20163 20164 20165 20166 20167 20168 20169 20170 20171 20172 20173 20174 20175 20176 20177 20178 20179 20180 20181 20182 20183 20184 20185 20186 20187 20188 20189 20190 20191 20192 20193 20194 20195 20196 20197 20198 20199 20200 20201 20202 20203 20204 20205 20206 20207 20208 20209 20210 20211 20212 20213 20214 20215 20216 20217 20218 20219 20220 20221 20222 20223 20224 20225 20226 20227 20228 20229 20230 20231 20232 20233 20234 20235 20236 20237 20238 20239 20240 20241 20242 20243 20244 20245 20246 20247 20248 20249 20250 20251 20252 20253 20254 20255 20256 20257 20258 20259 20260 20261 20262 20263 20264 20265 20266 20267 20268 20269 20270 20271 20272 20273 20274 20275 20276 20277 20278 20279 20280 20281 20282 20283 20284 20285 20286 20287 20288 20289 20290 20291 20292 20293 20294 20295 20296 20297 20298 20299 20300 20301 20302 20303 20304 20305 20306 20307 20308 20309 20310 20311 20312 20313 20314 20315 20316 20317 20318 20319 20320 20321 20322 20323 20324 20325 20326 20327 20328 20329 20330 20331 20332 20333 20334 20335 20336 20337 20338 20339 20340 20341 20342 20343 20344 20345 20346 20347 20348 20349 20350 20351 20352 20353 20354 20355 20356 20357 20358 20359 20360 20361 20362 20363 20364 20365 20366 20367 20368 20369 20370 20371 20372 20373 20374 20375 20376 20377 20378 20379 20380 20381 20382 20383 20384 20385 20386 20387 20388 20389 20390 20391 20392 20393 20394 20395 20396 20397 20398 20399 20400 20401 20402 20403 20404 20405 20406 20407 20408 20409 20410 20411 20412 20413 20414 20415 20416 20417 20418 20419 20420 20421 20422 20423 20424 20425 20426 20427 20428 20429 20430 20431 20432 20433 20434 20435 20436 20437 20438 20439 20440 20441 20442 20443 20444 20445 20446 20447 20448 20449 20450 20451 20452 20453 20454 20455 20456 20457 20458 20459 20460 20461 20462 20463 20464 20465 20466 20467 20468 20469 20470 20471 20472 20473 20474 20475 20476 20477 20478 20479 20480 20481 20482 20483 20484 20485 20486 20487 20488 20489 20490 20491 20492 20493 20494 20495 20496 20497 20498 20499 20500 20501 20502 20503 20504 20505 20506 20507 20508 20509 20510 20511 20512 20513 20514 20515 20516 20517 20518 20519 20520 20521 20522 20523 20524 20525 20526 20527 20528 20529 20530 20531 20532 20533 20534 20535 20536 20537 20538 20539 20540 20541 20542 20543 20544 20545 20546 20547 20548 20549 20550 20551 20552 20553 20554 20555 20556 20557 20558 20559 20560 20561 20562 20563 20564 20565 20566 20567 20568 20569 20570 20571 20572 20573 20574 20575 20576 20577 20578 20579 20580 20581 20582 20583 20584 20585 20586 20587 20588 20589 20590 20591 20592 20593 20594 20595 20596 20597 20598 20599 20600 20601 20602 20603 20604 20605 20606 20607 20608 20609 20610 20611 20612 20613 20614 20615 20616 20617 20618 20619 20620 20621 20622 20623 20624 20625 20626 20627 20628 20629 20630 20631 20632 20633 20634 20635 20636 20637 20638 20639 20640 20641 20642 20643 20644 20645 20646 20647 20648 20649 20650 20651 20652 20653 20654 20655 20656 20657 20658 20659 20660 20661 20662 20663 20664 20665 20666 20667 20668 20669 20670 20671 20672 20673 20674 20675 20676 20677 20678 20679 20680 20681 20682 20683 20684 20685 20686 20687 20688 20689 20690 20691 20692 20693 20694 20695 20696 20697 20698 20699 20700 20701 20702 20703 20704 20705 20706 20707 20708 20709 20710 20711 20712 20713 20714 20715 20716 20717 20718 20719 20720 20721 20722 20723 20724 20725 20726 20727 20728 20729 20730 20731 20732 20733 20734 20735 20736 20737 20738 20739 20740 20741 20742 20743 20744 20745 20746 20747 20748 20749 20750 20751 20752 20753 20754 20755 20756 20757 20758 20759 20760 20761 20762 20763 20764 20765 20766 20767 20768 20769 20770 20771 20772 20773 20774 20775 20776 20777 20778 20779 20780 20781 20782 20783 20784 20785 20786 20787 20788 20789 20790 20791 20792 20793 20794 20795 20796 20797 20798 20799 20800 20801 20802 20803 20804 20805 20806 20807 20808 20809 20810 20811 20812 20813 20814 20815 20816 20817 20818 20819 20820 20821 20822 20823 20824 20825 20826 20827 20828 20829 20830 20831 20832 20833 20834 20835 20836 20837 20838 20839 20840 20841 20842 20843 20844 20845 20846 20847 20848 20849 20850 20851 20852 20853 20854 20855 20856 20857 20858 20859 20860 20861 20862 20863 20864 20865 20866 20867 20868 20869 20870 20871 20872 20873 20874 20875 20876 20877 20878 20879 20880 20881 20882 20883 20884 20885 20886 20887 20888 20889 20890 20891 20892 20893 20894 20895 20896 20897 20898 20899 20900 20901 20902 20903 20904 20905 20906 20907 20908 20909 20910 20911 20912 20913 20914 20915 20916 20917 20918 20919 20920 20921 20922 20923 20924 20925 20926 20927 20928 20929 20930 20931 20932 20933 20934 20935 20936 20937 20938 20939 20940 20941 20942 20943 20944 20945 20946 20947 20948 20949 20950 20951 20952 20953 20954 20955 20956 20957 20958 20959 20960 20961 20962 20963 20964 20965 20966 20967 20968 20969 20970 20971 20972 20973 20974 20975 20976 20977 20978 20979 20980 20981 20982 20983 20984 20985 20986 20987 20988 20989 20990 20991 20992 20993 20994 20995 20996 20997 20998 20999 21000 21001 21002 21003 21004 21005 21006 21007 21008 21009 21010 21011 21012 21013 21014 21015 21016 21017 21018 21019 21020 21021 21022 21023 21024 21025 21026 21027 21028 21029 21030 21031 21032 21033 21034 21035 21036 21037 21038 21039 21040 21041 21042 21043 21044 21045 21046 21047 21048 21049 21050 21051 21052 21053 21054 21055 21056 21057 21058 21059 21060 21061 21062 21063 21064 21065 21066 21067 21068 21069 21070 21071 21072 21073 21074 21075 21076 21077 21078 21079 21080 21081 21082 21083 21084 21085 21086 21087 21088 21089 21090 21091 21092 21093 21094 21095 21096 21097 21098 21099 21100 21101 21102 21103 21104 21105 21106 21107 21108 21109 21110 21111 21112 21113 21114 21115 21116 21117 21118 21119 21120 21121 21122 21123 21124 21125 21126 21127 21128 21129 21130 21131 21132 21133 21134 21135 21136 21137 21138 21139 21140 21141 21142 21143 21144 21145 21146 21147 21148 21149 21150 21151 21152 21153 21154 21155 21156 21157 21158 21159 21160 21161 21162 21163 21164 21165 21166 21167 21168 21169 21170 21171 21172 21173 21174 21175 21176 21177 21178 21179 21180 21181 21182 21183 21184 21185 21186 21187 21188 21189 21190 21191 21192 21193 21194 21195 21196 21197 21198 21199 21200 21201 21202 21203 21204 21205 21206 21207 21208 21209 21210 21211 21212 21213 21214 21215 21216 21217 21218 21219 21220 21221 21222 21223 21224 21225 21226 21227 21228 21229 21230 21231 21232 21233 21234 21235 21236 21237 21238 21239 21240 21241 21242 21243 21244 21245 21246 21247 21248 21249 21250 21251 21252 21253 21254 21255 21256 21257 21258 21259 21260 21261 21262 21263 21264 21265 21266 21267 21268 21269 21270 21271 21272 21273 21274 21275 21276 21277 21278 21279 21280 21281 21282 21283 21284 21285 21286 21287 21288 21289 21290 21291 21292 21293 21294 21295 21296 21297 21298 21299 21300 21301 21302 21303 21304 21305 21306 21307 21308 21309 21310 21311 21312 21313 21314 21315 21316 21317 21318 21319 21320 21321 21322 21323 21324 21325 21326 21327 21328 21329 21330 21331 21332 21333 21334 21335 21336 21337 21338 21339 21340 21341 21342 21343 21344 21345 21346 21347 21348 21349 21350 21351 21352 21353 21354 21355 21356 21357 21358 21359 21360 21361 21362 21363 21364 21365 21366 21367 21368 21369 21370 21371 21372 21373 21374 21375 21376 21377 21378 21379 21380 21381 21382 21383 21384 21385 21386 21387 21388 21389 21390 21391 21392 21393 21394 21395 21396 21397 21398 21399 21400 21401 21402 21403 21404 21405 21406 21407 21408 21409 21410 21411 21412 21413 21414 21415 21416 21417 21418 21419 21420 21421 21422 21423 21424 21425 21426 21427 21428 21429 21430 21431 21432 21433 21434 21435 21436 21437 21438 21439 21440 21441 21442 21443 21444 21445 21446 21447 21448 21449 21450 21451 21452 21453 21454 21455 21456 21457 21458 21459 21460 21461 21462 21463 21464 21465 21466 21467 21468 21469 21470 21471 21472 21473 21474 21475 21476 21477 21478 21479 21480 21481 21482 21483 21484 21485 21486 21487 21488 21489 21490 21491 21492 21493 21494 21495 21496 21497 21498 21499 21500 21501 21502 21503 21504 21505 21506 21507 21508 21509 21510 21511 21512 21513 21514 21515 21516 21517 21518 21519 21520 21521 21522 21523 21524 21525 21526 21527 21528 21529 21530 21531 21532 21533 21534 21535 21536 21537 21538 21539 21540 21541 21542 21543 21544 21545 21546 21547 21548 21549 21550 21551 21552 21553 21554 21555 21556 21557 21558 21559 21560 21561 21562 21563 21564 21565 21566 21567 21568 21569 21570 21571 21572 21573 21574 21575 21576 21577 21578 21579 21580 21581 21582 21583 21584 21585 21586 21587 21588 21589 21590 21591 21592 21593 21594 21595 21596 21597 21598 21599 21600 21601 21602 21603 21604 21605 21606 21607 21608 21609 21610 21611 21612 21613 21614 21615 21616 21617 21618 21619 21620 21621 21622 21623 21624 21625 21626 21627 21628 21629 21630 21631 21632 21633 21634 21635 21636 21637 21638 21639 21640 21641 21642 21643 21644 21645 21646 21647 21648 21649 21650 21651 21652 21653 21654 21655 21656 21657 21658 21659 21660 21661 21662 21663 21664 21665 21666 21667 21668 21669 21670 21671 21672 21673 21674 21675 21676 21677 21678 21679 21680 21681 21682 21683 21684 21685 21686 21687 21688 21689 21690 21691 21692 21693 21694 21695 21696 21697 21698 21699 21700 21701 21702 21703 21704 21705 21706 21707 21708 21709 21710 21711 21712 21713 21714 21715 21716 21717 21718 21719 21720 21721 21722 21723 21724 21725 21726 21727 21728 21729 21730 21731 21732 21733 21734 21735 21736 21737 21738 21739 21740 21741 21742 21743 21744 21745 21746 21747 21748 21749 21750 21751 21752 21753 21754 21755 21756 21757 21758 21759 21760 21761 21762 21763 21764 21765 21766 21767 21768 21769 21770 21771 21772 21773 21774 21775 21776 21777 21778 21779 21780 21781 21782 21783 21784 21785 21786 21787 21788 21789 21790 21791 21792 21793 21794 21795 21796 21797 21798 21799 21800 21801 21802 21803 21804 21805 21806 21807 21808 21809 21810 21811 21812 21813 21814 21815 21816 21817 21818 21819 21820 21821 21822 21823 21824 21825 21826 21827 21828 21829 21830 21831 21832 21833 21834 21835 21836 21837 21838 21839 21840 21841 21842 21843 21844 21845 21846 21847 21848 21849 21850 21851 21852 21853 21854 21855 21856 21857 21858 21859 21860 21861 21862 21863 21864 21865 21866 21867 21868 21869 21870 21871 21872 21873 21874 21875 21876 21877 21878 21879 21880 21881 21882 21883 21884 21885 21886 21887 21888 21889 21890 21891 21892 21893 21894 21895 21896 21897 21898 21899 21900 21901 21902 21903 21904 21905 21906 21907 21908 21909 21910 21911 21912 21913 21914 21915 21916 21917 21918 21919 21920 21921 21922 21923 21924 21925 21926 21927 21928 21929 21930 21931 21932 21933 21934 21935 21936 21937 21938 21939 21940 21941 21942 21943 21944 21945 21946 21947 21948 21949 21950 21951 21952 21953 21954 21955 21956 21957 21958 21959 21960 21961 21962 21963 21964 21965 21966 21967 21968 21969 21970 21971 21972 21973 21974 21975 21976 21977 21978 21979 21980 21981 21982 21983 21984 21985 21986 21987 21988 21989 21990 21991 21992 21993 21994 21995 21996 21997 21998 21999 22000 22001 22002 22003 22004 22005 22006 22007 22008 22009 22010 22011 22012 22013 22014 22015 22016 22017 22018 22019 22020 22021 22022 22023 22024 22025 22026 22027 22028 22029 22030 22031 22032 22033 22034 22035 22036 22037 22038 22039 22040 22041 22042 22043 22044 22045 22046 22047 22048 22049 22050 22051 22052 22053 22054 22055 22056 22057 22058 22059 22060 22061 22062 22063 22064 22065 22066 22067 22068 22069 22070 22071 22072 22073 22074 22075 22076 22077 22078 22079 22080 22081 22082 22083 22084 22085 22086 22087 22088 22089 22090 22091 22092 22093 22094 22095 22096 22097 22098 22099 22100 22101 22102 22103 22104 22105 22106 22107 22108 22109 22110 22111 22112 22113 22114 22115 22116 22117 22118 22119 22120 22121 22122 22123 22124 22125 22126 22127 22128 22129 22130 22131 22132 22133 22134 22135 22136 22137 22138 22139 22140 22141 22142 22143 22144 22145 22146 22147 22148 22149 22150 22151 22152 22153 22154 22155 22156 22157 22158 22159 22160 22161 22162 22163 22164 22165 22166 22167 22168 22169 22170 22171 22172 22173 22174 22175 22176 22177 22178 22179 22180 22181 22182 22183 22184 22185 22186 22187 22188 22189 22190 22191 22192 22193 22194 22195 22196 22197 22198 22199 22200 22201 22202 22203 22204 22205 22206 22207 22208 22209 22210 22211 22212 22213 22214 22215 22216 22217 22218 22219 22220 22221 22222 22223 22224 22225 22226 22227 22228 22229 22230 22231 22232 22233 22234 22235 22236 22237 22238 22239 22240 22241 22242 22243 22244 22245 22246 22247 22248 22249 22250 22251 22252 22253 22254 22255 22256 22257 22258 22259 22260 22261 22262 22263 22264 22265 22266 22267 22268 22269 22270 22271 22272 22273 22274 22275 22276 22277 22278 22279 22280 22281 22282 22283 22284 22285 22286 22287 22288 22289 22290 22291 22292 22293 22294 22295 22296 22297 22298 22299 22300 22301 22302 22303 22304 22305 22306 22307 22308 22309 22310 22311 22312 22313 22314 22315 22316 22317 22318 22319 22320 22321 22322 22323 22324 22325 22326 22327 22328 22329 22330 22331 22332 22333 22334 22335 22336 22337 22338 22339 22340 22341 22342 22343 22344 22345 22346 22347 22348 22349 22350 22351 22352 22353 22354 22355 22356 22357 22358 22359 22360 22361 22362 22363 22364 22365 22366 22367 22368 22369 22370 22371 22372 22373 22374 22375 22376 22377 22378 22379 22380 22381 22382 22383 22384 22385 22386 22387 22388 22389 22390 22391 22392 22393 22394 22395 22396 22397 22398 22399 22400 22401 22402 22403 22404 22405 22406 22407 22408 22409 22410 22411 22412 22413 22414 22415 22416 22417 22418 22419 22420 22421 22422 22423 22424 22425 22426 22427 22428 22429 22430 22431 22432 22433 22434 22435 22436 22437 22438 22439 22440 22441 22442 22443 22444 22445 22446 22447 22448 22449 22450 22451 22452 22453 22454 22455 22456 22457 22458 22459 22460 22461 22462 22463 22464 22465 22466 22467 22468 22469 22470 22471 22472 22473 22474 22475 22476 22477 22478 22479 22480 22481 22482 22483 22484 22485 22486 22487 22488 22489 22490 22491 22492 22493 22494 22495 22496 22497 22498 22499 22500 22501 22502 22503 22504 22505 22506 22507 22508 22509 22510 22511 22512 22513 22514 22515 22516 22517 22518 22519 22520 22521 22522 22523 22524 22525 22526 22527 22528 22529 22530 22531 22532 22533 22534 22535 22536 22537 22538 22539 22540 22541 22542 22543 22544 22545 22546 22547 22548 22549 22550 22551 22552 22553 22554 22555 22556 22557 22558 22559 22560 22561 22562 22563 22564 22565 22566 22567 22568 22569 22570 22571 22572 22573 22574 22575 22576 22577 22578 22579 22580 22581 22582 22583 22584 22585 22586 22587 22588 22589 22590 22591 22592 22593 22594 22595 22596 22597 22598 22599 22600 22601 22602 22603 22604 22605 22606 22607 22608 22609 22610 22611 22612 22613 22614 22615 22616 22617 22618 22619 22620 22621 22622 22623 22624 22625 22626 22627 22628 22629 22630 22631 22632 22633 22634 22635 22636 22637 22638 22639 22640 22641 22642 22643 22644 22645 22646 22647 22648 22649 22650 22651 22652 22653 22654 22655 22656 22657 22658 22659 22660 22661 22662 22663 22664 22665 22666 22667 22668 22669 22670 22671 22672 22673 22674 22675 22676 22677 22678 22679 22680 22681 22682 22683 22684 22685 22686 22687 22688 22689 22690 22691 22692 22693 22694 22695 22696 22697 22698 22699 22700 22701 22702 22703 22704 22705 22706 22707 22708 22709 22710 22711 22712 22713 22714 22715 22716 22717 22718 22719 22720 22721 22722 22723 22724 22725 22726 22727 22728 22729 22730 22731 22732 22733 22734 22735 22736 22737 22738 22739 22740 22741 22742 22743 22744 22745 22746 22747 22748 22749 22750 22751 22752 22753 22754 22755 22756 22757 22758 22759 22760 22761 22762 22763 22764 22765 22766 22767 22768 22769 22770 22771 22772 22773 22774 22775 22776 22777 22778 22779 22780 22781 22782 22783 22784 22785 22786 22787 22788 22789 22790 22791 22792 22793 22794 22795 22796 22797 22798 22799 22800 22801 22802 22803 22804 22805 22806 22807 22808 22809 22810 22811 22812 22813 22814 22815 22816 22817 22818 22819 22820 22821 22822 22823 22824 22825 22826 22827 22828 22829 22830 22831 22832 22833 22834 22835 22836 22837 22838 22839 22840 22841 22842 22843 22844 22845 22846 22847 22848 22849 22850 22851 22852 22853 22854 22855 22856 22857 22858 22859 22860 22861 22862 22863 22864 22865 22866 22867 22868 22869 22870 22871 22872 22873 22874 22875 22876 22877 22878 22879 22880 22881 22882 22883 22884 22885 22886 22887 22888 22889 22890 22891 22892 22893 22894 22895 22896 22897 22898 22899 22900 22901 22902 22903 22904 22905 22906 22907 22908 22909 22910 22911 22912 22913 22914 22915 22916 22917 22918 22919 22920 22921 22922 22923 22924 22925 22926 22927 22928 22929 22930 22931 22932 22933 22934 22935 22936 22937 22938 22939 22940 22941 22942 22943 22944 22945 22946 22947 22948 22949 22950 22951 22952 22953 22954 22955 22956 22957 22958 22959 22960 22961 22962 22963 22964 22965 22966 22967 22968 22969 22970 22971 22972 22973 22974 22975 22976 22977 22978 22979 22980 22981 22982 22983 22984 22985 22986 22987 22988 22989 22990 22991 22992 22993 22994 22995 22996 22997 22998 22999 23000 23001 23002 23003 23004 23005 23006 23007 23008 23009 23010 23011 23012 23013 23014 23015 23016 23017 23018 23019 23020 23021 23022 23023 23024 23025 23026 23027 23028 23029 23030 23031 23032 23033 23034 23035 23036 23037 23038 23039 23040 23041 23042 23043 23044 23045 23046 23047 23048 23049 23050 23051 23052 23053 23054 23055 23056 23057 23058 23059 23060 23061 23062 23063 23064 23065 23066 23067 23068 23069 23070 23071 23072 23073 23074 23075 23076 23077 23078 23079 23080 23081 23082 23083 23084 23085 23086 23087 23088 23089 23090 23091 23092 23093 23094 23095 23096 23097 23098 23099 23100 23101 23102 23103 23104 23105 23106 23107 23108 23109 23110 23111 23112 23113 23114 23115 23116 23117 23118 23119 23120 23121 23122 23123 23124 23125 23126 23127 23128 23129 23130 23131 23132 23133 23134 23135 23136 23137 23138 23139 23140 23141 23142 23143 23144 23145 23146 23147 23148 23149 23150 23151 23152 23153 23154 23155 23156 23157 23158 23159 23160 23161 23162 23163 23164 23165 23166 23167 23168 23169 23170 23171 23172 23173 23174 23175 23176 23177 23178 23179 23180 23181 23182 23183 23184 23185 23186 23187 23188 23189 23190 23191 23192 23193 23194 23195 23196 23197 23198 23199 23200 23201 23202 23203 23204 23205 23206 23207 23208 23209 23210 23211 23212 23213 23214 23215 23216 23217 23218 23219 23220 23221 23222 23223 23224 23225 23226 23227 23228 23229 23230 23231 23232 23233 23234 23235 23236 23237 23238 23239 23240 23241 23242 23243 23244 23245 23246 23247 23248 23249 23250 23251 23252 23253 23254 23255 23256 23257 23258 23259 23260 23261 23262 23263 23264 23265 23266 23267 23268 23269 23270 23271 23272 23273 23274 23275 23276 23277 23278 23279 23280 23281 23282 23283 23284 23285 23286 23287 23288 23289 23290 23291 23292 23293 23294 23295 23296 23297 23298 23299 23300 23301 23302 23303 23304 23305 23306 23307 23308 23309 23310 23311 23312 23313 23314 23315 23316 23317 23318 23319 23320 23321 23322 23323 23324 23325 23326 23327 23328 23329 23330 23331 23332 23333 23334 23335 23336 23337 23338 23339 23340 |
#version: 0.2
á »
á º
Ġ t
n g
Ġ c
Ġ Ä
ĠÄ ij
Ġ Ġ
à ł
n h
Ġt h
Ġ v
à ¡
Ġ h
Ġ l
Æ °
Ġ s
i á»
Ġ m
Ġ b
Ġt r
Ġ d
Ġc h
Ġ k
Ạ¡
á c
à ³
Ạ£
Æ° á»
ĠÄij á»
Ġ nh
Ġ n
Ġ p
Ạ¿
Ġv Ãł
Ġth á»
Ġ g
Ġp h
Ġk h
Ġc á»
iá» ĩ
à ´
à ª
ĠĠ ĠĠ
Ġs á»
Ġc ác
Ġd á»
á» Ļ
à Ń
Ạ¥
§ a
Ġc ó
o n
Ġcá» §a
Ġ ng
à ¢
à ¬
ẠŃ
Ġt á»
ê n
i n
Ġv á»
Æ ¡
ạ n
Æ°á» £
Ġ r
Ġg i
Ġthá» ĥ
Ạ§
e r
q u
ĠĠ Ġ
a n
Ġl Ãł
Ġh á»
á»Ļ t
o ng
o r
ô ng
Ġdá» ¥
c h
a t
Ġ qu
i ế
` `
Ġ x
e n
Ġm á»Ļt
Ġ T
ì nh
Ạ·
Ġb ạn
Ġ =
Ľ i
ượ c
à º
u y
Ãł y
à £
Ġtr ong
Ġ C
ĠÄij ược
iá» ĥ
Ġdụ ng
Ä ĥ
Æ°á» Ŀ
ĠÄijá» ĥ
Ġsá» Ń
s t
ấ t
Ġ `
Ġn Ãły
Ġl á»
l e
Ġch á»
a r
Ċ ĠĠĠĠ
iá» ģ
Ġ "
iá»ĩ n
á» ij
Ġch o
iá»ĩ u
Ạ±
Ġtr á»
Ċ ĠĠĠ
ầ n
Ġh o
ĠÄ IJ
t h
Ġsá» ij
â n
Ġ 1
a l
ằ ng
Ġt ÃŃ
Ġm á»
ĠÄijá» Ļ
i ên
Ạ¯
e s
iá»ģ u
á» ¯
a m
ả i
ạ i
e t
Ġ N
à ¹
Ġ (
Ġ S
e l
Ġvá» Ľi
± c
Äĥ ng
a u
áºŃ p
© c
`` `
Ġcác h
t i
Ġtá» «
ặ c
ả n
Ġth e
Æ° Æ¡
â y
Æ°Æ¡ ng
Ġnh Æ°
Ġ B
ầ u
Ġh Ãł
a s
Æ¡ n
a o
Ġkh ông
i t
Ġ -
Ġt ạ
Ġl iá»ĩu
áºŃ t
a i
u ng
Ġng h
i m
Ġ P
Æ°á» Ľ
Ġ 2
u r
Æ°á»Ŀ ng
Ạ½
ế t
Ġ M
ú ng
Ġhá» į
a ng
a y
ĠÄijá» ĭ
i c
Ġvá» ģ
Ġb ằng
a nh
Ġ '
en t
Ãł i
Æ°á»Ŀ i
Ġho ặc
à ½
- -
ữ ng
iế t
Ġtạ o
Ġkh ác
Ġdá» ¯
ế n
Ġph á
ĊĠĠĠĠ ĠĠĠ
Ġs ẽ
ô i
Ġt o
Ġth u
ĠÄijá»ĭ nh
e c
Ġ á»
© ng
Ġ f
ĠvÃł o
Ġb á»
r o
ĠtÃŃ nh
y th
Ġ |
à ²
Ġn Äĥng
yth on
ĠÄij ó
Ãł nh
i nh
( )
ả m
á» ĥ
Ġnh ững
Ġg iá»
ù ng
£ p
Ġng Æ°á»Ŀi
Ŀ i
Ġh Æ¡n
Ġtr ình
iế n
Ġhá» £p
Ġ D
Ġr a
Ġn ó
Ġch úng
e m
Ġ H
Ġ 3
Æ°á»Ľ c
iá»ĩ c
á n
e x
i ng
ấ p
á»ij i
u t
e d
a c
u m
Ġh iá»ĩn
ượ ng
áºŃ n
iá»ĥ n
ÃŃ ch
Ġh ình
ĠT r
Ġsá» ±
in t
Ġ {
Ġthá» ±c
Ĺ i
ĠÄijá»Ļ ng
ĠÄij ến
ij i
Ạ«
Ġv iá»ĩc
Ġ V
ặ t
Ġ y
iá»ĥ m
ê u
0 0
ĠÄij ầu
l o
ó a
Ġ ```
u n
Ġ A
â u
iá»ĥ u
Ġtr ên
Ġqu an
Ġm ã
Ġkh i
á» ĵ
à ©
¥ c
Ġgi á
Ġph ân
Ġc ông
ĠÄij ã
r e
ķ i
Ġl o
ả ng
ĠtÃŃ ch
Ġth Ãłnh
i s
ế u
a d
i on
ÃŃ nh
i d
Ạ©
Ġchá» ī
Ġph ần
ạ ng
á» ĩ
o d
Ġb ản
ĠT h
Ġqu y
s e
Ġ L
Ġ K
o m
Ġ in
a g
Ġ w
ĠÄijá» ģ
Ġk ết
at e
ả o
Ġthe o
Ġm Ãł
ĠÄij iá»ģu
ĊĠĠĠĠ ĠĠĠĠ
Ġh óa
Ġk á»
ĠlÃł m
u ất
ti on
Ġl ý
t r
Ġx ác
i f
Ġc ần
Ġnh au
" ,
ĠÄijá» iji
Ġhá»į c
u s
ác h
Ġc ả
Ġthá» ©c
a b
Ġ 4
Ġdá» ±
Ġt ôi
o l
á» Ń
ạ t
Ġph á»
Ġm ô
ắ c
am e
Ġch uy
) ;
Ġc ấp
Ġt iế
ĠC h
á» ģ
Ġth ông
Ġ o
or t
ĠhÃł ng
Ġ 5
Ġlá» Ľ
Ġl ại
ij ng
Ġc on
Ġ G
Ġthá» Ŀi
' ,
á ng
an d
ẫ n
a p
Ä ©
Ġ <
Ġch ÃŃnh
á nh
Ġ }
ĠÄijá» ķi
ấ y
u á»ij
Ãł n
Ġd o
Ġqu ả
Ċ Ġ
Ġtá» ij
Ġ *
Ġtr Æ°á»Ŀng
á»Ļ c
ấ n
ú c
at a
ĭ ch
Ġnh iá»ģu
c e
ĠÄijá» ĵ
Æ° u
Ġph ải
ấ u
Ġtrá» ĭ
Ġgi ải
Ġt áºŃp
iá»ĩ m
ĠP ython
Ġnh ất
uy ên
i êu
Äĥ n
Ġl ượng
at ion
Ġc ung
Ġb á»Ļ
Ġtá» ±
á i
á»ģ n
Ġ /
Ġ 0
Ġh iá»ĩu
Ġtr iá»ĥn
Ġm ình
Ġ R
Ġphá t
Ġthu áºŃt
p ort
Ġnh ân
Ġph Æ°Æ¡ng
i g
r int
u l
Ġlá» ĩ
Ġt ác
Ġth iết
ê m
-- --
Ġc âu
h i
Ġtiế p
ĠÄIJ ây
Ġá» Ł
ag e
Ġch u
á»Ļ i
Ġr ằng
ĠhÃł m
Ġ #
Ġs au
ex t
ĠÄij iá»ĥm
Ãł o
Ġch i
Ġcá» ¥
į ng
Ġá» ©ng
p ython
Ġt Æ°Æ¡ng
ĠÄIJ á»ĥ
ĠTr ong
Ġc Æ¡
ec t
â Ģ
Ġt a
ắ t
) ,
Ġgi an
e st
á» į
Ġto án
Ġnh iên
ò ng
u b
Ġb ao
iá»ĩ t
Ġ +
Ġtr uy
Ġnh á»
i p
Ġmá» ¥c
Ġd ẫn
Ġhá» ĩ
im port
ĠÄIJ iá»ģu
Ġphá p
ĠÄij ây
Ġlo ại
á»ĥ n
ú p
ã y
a v
ô n
ì m
Ġthá» ijng
Ġx uất
Ġ [
á o
Ġd ùng
Ġb ảo
i st
Ġt ượng
á»ĵ m
Æ°á» Ľi
Ġc u
Ġc ùng
i z
Ġg á»ĵm
Ġgi úp
Ġc ầu
or d
u e
ạ nh
o t
Ġb iến
Å ©ng
as s
( "
( '
Ġ a
Ġt ìm
Ġd ạng
ả nh
Ġnh áºŃn
Ġc ao
Ġh ạn
Ġth ay
Ġv ÃŃ
e f
ĠÄij ặt
Ġth Æ°
" :
Ġh ai
Ġthá» ĭ
ĠN h
Ġt in
Ạ»
Ġd anh
in e
Ġbá» ĭ
Ġc ảm
Ġkh á»
en d
Ġf or
Ġs t
Ġc Å©ng
_ _
Ġkh ả
es s
Ġchuy á»ĥn
á» Ĺi
Æ¡ i
Ġth ế
Ġv áºŃt
â m
) .
ặ p
Ġt iêu
) :
ĊĠĠĠĠĠĠĠĠ ĠĠĠ
Ãł ng
Ġb iá»ĥu
ĠN g
ĠB ạn
t er
Ġ J
ķ ng
Ġs ách
Ġ ảnh
Ġng uyên
Äĥ m
i l
é p
Ġho ạt
m ent
Ạ³
` .
Ġl iên
Ġng ữ
ẳ ng
a in
á t
Ġngh Ä©
Ġv ì
Æ°á» Ł
p l
Ġth ÃŃch
Ġm ặt
Ġ F
Ġ I
Ġ $
Ġmá» Ĺi
ĠlỼ p
Ġtr Æ°á»Ľc
Ġtá» Ń
Æ°á»Ł ng
ĠP h
p ut
Ġv Äĥn
o w
á y
Ġkh o
e w
: :
Ġ E
Ġtá» ĩ
e v
o p
Ġnh Ãł
Ġth Æ°á»Ŀng
Ġvá» ĭ
Ġtrá» įng
Ġth am
Ġ ý
c on
Ġv ấn
Ġtá»ĩ p
Ġ 6
Ġmá» Ľi
ĠÄij o
ĠÄij ang
Ġgiá» ¯
Ġquy ết
į n
Æ°á»Ľ ng
uá»ij n
Ġth êm
Ġvá» ¥
Ġgi a
Ġlá»ĩ nh
ĠhÃł nh
Ġká» ¹
p y
Ġt iên
ắ n
ĠnghÄ© a
o c
ẩ m
Æ° a
Ġtừ ng
Ġt ên
Ġs inh
Ġx á»Ń
Ġchá» įn
i le
Ġn Ãło
Ġph ép
o s
Ġl áºŃp
Ġqu a
ẫ u
ĠÄij Æ¡n
l ass
Ġgi ảm
Ġy êu
Ġh á»Ļi
" )
à µ
Ġm áy
Ġgiá» Ŀ
Ġc áºŃp
Ġl Æ°u
Ġch ất
er s
iz e
Ġph ÃŃ
o ur
p rint
Ġt Äĥng
Ġtr a
Ġm uá»ijn
h t
Ġn ếu
Ġ X
á p
Ġthá» ©
Ġdá» ĭch
' )
Ġk iá»ĥm
Ġo f
Ġv iá»ĩn
Ġchu á»Ĺi
Ġtr ung
in d
Ġ 7
Ġb ảng
ĠnhÆ° ng
Ġtr ả
Ġcá» Ļ
Ġqu á
Ġk ế
Ġkhác h
n ame
£ i
Ġth ấy
Ġchá»ī nh
Ġdá»± a
g et
Ġng Ãły
ĊĠĠĠĠ Ġ
ur n
ı i
e b
Ġ an
Ġgiá» Ľi
p e
Ġ1 0
et urn
f or
i r
t ext
ĠÄij Æ°á»Ŀng
ĠN ếu
ab le
Ġnh áºŃp
âĢ ĭ
ĠC ác
ĠlỼ n
Ġ if
Ġx em
Ġh iá»ĥu
Ġb ất
Ġtrá» £
ĠÄijá»ĵ ng
Ġt ại
Ġngh iá»ĩm
Ġ/ /
. .
h e
i v
Ġs áng
Ġph ẩm
ạ ch
Ġtá» ķng
o un
Ġt Ãłi
Ġh ãy
Ġtr ò
Ġn ên
ro m
ĠÄij ảm
Ġk inh
Ġ and
Ġs o
Ġká» ³
Ġchá» §
áºŃ y
st r
Ġt ất
iá»ĩ p
ẩ n
' ]
el f
Ġh Æ°á»Ľng
Ġb iá»ĩt
Ġkh ai
Ġr eturn
ĠS au
Ġm ạnh
Ġb iết
Ġsá» Ł
Ġhá» ĵ
Ġgiữ a
Ġthu á»Ļc
á»ĩ n
Ġto Ãłn
ó m
Ġg á»į
u á»ĵ
or e
at h
() `
en ce
Ġth iá»ĩn
á m
Ġt ế
Ġg ó
) )
Ġtr ang
ĠT uy
od el
o o
Ġch ẳng
/ /
iế u
ĠM á»Ļt
d ata
p ro
Ġ W
Ł i
Ġb ắt
ù y
u d
Ġb Æ°á»Ľc
Ġn Äĥm
Ġcá» ij
ac k
Ġ U
Ġv iên
Ġs uất
= "
Ġngh á»ĩ
Ġhá» Ĺ
av a
© a
Ġ O
Ġc ải
i th
Ġ \
Ġnhá» Ľ
ạ c
c r
Ġs ản
i b
t o
Ġc á
Ġb ình
Ġtr ÃŃ
` ,
u p
ạ y
ĊĠĠĠĠĠĠĠĠ ĠĠĠĠ
Ġb Ãłi
Ġph ù
Ġl ên
é t
i ê
ĥ n
ĠÄ ĥn
iá»ģ n
uá»ĵ n
á» ķi
Ġtá» iji
Ġmá» ©c
Ġtạ p
iê ng
Ġc ô
Ġd iá»ĩn
Ġcu á»Ļc
á»ij c
Ġ as
Ġchá» ¯
à ¨
Ġ 8
Ġc ấu
Ġb áo
Ġd uy
Ġsá»Ń a
Ġy ếu
' :
Ġn um
o ut
Ġt u
Ġm ẫu
ic e
ĠÄij ặc
Ġng ôn
ú t
Ċ ĊĠĠĠ
Ġt ùy
ĠV ÃŃ
Ġ is
į c
Ġtrá» ±c
al l
Ġphá» ©c
< /
a x
Ġx ã
ĠN ó
Ġl ặp
Ġch ế
á» ±
Ġch Æ¡i
á»Ļ ng
uy ến
Ġchá» ©a
Ġchi a
y pe
Ä ij
00 0
[ '
Ġt Æ°
ó ng
Ġtruy á»ģn
o st
Ġgá»į i
---- ----
Ạ¹
Ġm ảng
Ġtrá» Ł
cr ip
Ġt ình
Ġng uá»ĵn
Ġgi ao
s et
Ġm ôi
Ġr iêng
od e
n um
iá» ħ
tr ing
Ġc Ãłi
ò n
ĠÄij i
Ġph ản
Ġhá»ĵ i
M L
Ġk ÃŃch
Ġngh iá»ĩp
Ġkh ÃŃ
ĠD Æ°á»Ľi
o Ãłi
Ġnh u
Ġsá» ©c
iá»ģ m
Ġsá»ij ng
ur r
Ġtá»ij t
w ord
Ġchá» ©c
it y
ĠG i
Ġv i
Ġlá» Ŀi
Ġlá» Ĺi
ắ ng
ĠK h
ĠK hi
e le
Ġtr úc
Ġph iên
Ġlá» ĭch
Ġst d
Ġd Ãłi
ạ o
Ġthá» Ń
as e
ĠmÃł u
Ġ Q
á» «
Ġt iết
Ġth ần
Ġnh áºŃt
Ġcu á»iji
an ce
Ġhá» ıi
Ġlá» ±c
Ġt iến
Ġt âm
ĠÄij ánh
Ġp ro
Ġv áºŃy
Ġm inh
Ġb ên
Ġd ata
Ġch ạy
iế m
Ġw eb
m l
v al
Ġ .
ĠÄij ại
ĠÄij Æ°a
Ġkh u
ti v
v er
Ġ int
ắ p
ĠS á»Ń
Ġ2 0
ad d
s v
Ġd ấu
Ġ ar
Ġcả nh
c t
r or
Ġc òn
Ġh iá»ĥn
Ġd Æ°á»Ľi
Ġgi ả
Ġho Ãłn
it em
ac t
Ġ i
á» §
Ġn á»iji
Ġdá» ħ
ic t
e g
e y
f rom
o b
Ġv iết
c om
r es
Ġch iến
urr ent
= '
T r
Ġc áºŃn
Ġs ắc
c l
j ect
ti c
uá»ij ng
ĠÄijo ạn
p le
Ġ import
Ġ âm
Ġm ạng
ả y
Ġvá» ±c
I n
Ġv u
ar t
Ġ :
Ġ us
Ġc ây
ĠB ằng
lo g
Ġp rint
Ġr á»Ļng
Ġtrá» ¯
ul t
Ġ 9
Ġth ì
im e
a ch
Ċ ĉ
Ġ %
ģ m
Ġk ý
Ġmá» ģm
2 0
u st
Ġtr ải
Ġn Æ°á»Ľc
ĠÄij áng
ằ m
c tion
c ol
ĠÄij iá»ĥn
Ġnh iá»ĩm
Ġcá» ©
s ize
Ġ j
Ġs âu
Ġm á»iji
Ġcá» ķ
an s
ữ a
ĠÄijá»ģ u
for m
p r
Ġk iá»ĩn
ang e
lo t
Ãł m
Ġd i
Ġn á»Ļi
ĠĠĠĠ ĠĠĠĠ
Ġgi ản
Ġbá» Łi
ĠJ ava
õ i
() ;
Ġgó i
iá»ħ n
c el
ĠÄij ạt
Ġl u
Ġn á»ģn
Ġkh ó
en c
u á»iji
Ġch ắn
Ġmá» Ł
l ic
Ċ ĠĠ
Ġ anh
Ġl ần
Ġnh óm
Ġkh ám
Ġr ất
Ġ= =
ĠÄijá»ĭ a
ab el
Ġphá» ¥
Ġcá»Ļ t
crip t
f ile
Ġ Æ°u
Ġtrá» Ŀi
oc k
âĢĭ âĢĭ
] ,
r it
ĠÄij a
Ġth Æ°á»Ľc
Ġm ang
ế p
Ġkh óa
Ġqu ản
Ġnhá» ı
i a
m e
p ath
Ġh ay
Ġk á»ĥ
Ġg ặp
Ġ Ã
Ġs elf
Ġch Æ°Æ¡ng
â ng
Ġx úc
ar y
] )
e p
o ại
Ġd òng
Ġk iếm
Ġn p
ĠH T
ĠH ãy
d f
Ġt inh
Ġth áºŃp
Ġh ấp
id e
f f
Ġ em
Ġ áp
ĠÄij iá»ĩn
ầ m
Ġx ét
ĠM ã
Ġbá» ķ
Ġcá»Ļ ng
str ing
Ġcứ u
O N
b er
Ġth ân
Ġgi ác
en er
en ti
s er
Ġnh iá»ĩt
Ġn ew
Ġg hi
um ent
Ġkho ảng
Äij un
d ef
Ġt ải
Ġb an
Ġd õi
ĠTh á»
Ġ* *
ı e
Ġc ái
Ġth anh
en s
Ġlá» £i
Ġkhá» ıe
a k
Å ©
Ġt y
on e
Ġmá» į
ub lic
Ġ e
Ġcá» ±c
Ġx ếp
ĠÄijá»Ļ c
Ġmá»į i
* *
l i
l y
y st
ĠÄij úng
Ġm áºŃt
Ġbá» ı
ud e
m y
p s
Ġ âĢĭâĢĭ
Ġc lass
Ġth ách
Ġch ung
Ġ< <
s h
Ġr e
Ġw ith
ĠCh úng
p on
r ay
Ġl ấy
Ġd ung
Ġr õ
Ġho ạch
Ġtiế ng
P I
r ame
µ n
Ạµn
Ġgiá» ijng
Ġdá»± ng
Ä© nh
ĠHT ML
A T
m odel
p h
Ġ ÃŃch
Ġl òng
Æ° ng
Ġs ao
Ġm ong
Ġg et
Ġbá» ģ
Ġquy á»ģn
c ore
Ġ ánh
and om
. "
1 0
Ġd ef
as k
re ate
Ġdo anh
Ġt ả
Ġt uyến
Ġp r
ì n
ac e
ap p
Ġ ấy
Ġv al
ĠNh ững
yst em
e ar
« a
Ġ án
Ġs ẵn
uy á»ĩn
ĠC on
Ġ1 2
ĠV ì
tion s
ĠE x
f it
Ġl ược
Ġb a
ạ m
ĠC uá»iji
Ġnó i
lo c
ĠA I
ẩ y
Ġh Æ°á»Łng
Ġtr ì
Ġg ì
Ġtá» ·
ent ence
ect or
oun t
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ
+ +
Ġt ảng
Ġk iến
Ġr es
Ġlo Ãłi
á»ĩ t
Ġchuy á»ĩn
ig ht
ĠQ u
c lass
p ar
u es
Ġtr ái
ầ y
ĠT ôi
ar b
ur e
d ate
Ġ im
Æ°á» ¡
ĠÄijá» įc
or m
ar i
ĠS á»±
ĠÄijó ng
cl ude
L A
a st
s o
Ġd at
áºŃ u
an t
ai l
Ġchu ẩn
C on
c ul
s on
y n
ĠÄijá» ij
Ġn Æ¡i
Ġg ây
Ġtá» ¥c
Ġdụ c
ĠNg Æ°á»Ŀi
ĠI n
1 2
s elf
t e
Ġv ẫn
Ġd iá»ħn
ó n
ÃŃ t
al cul
o ol
p t
p lot
á» ©c
Ġm ẽ
Ġn âng
Ġkh iến
ĠC ó
im al
Ġ el
Ġt iá»ģn
ĠÄij ầy
Ġv ai
Ġb u
in clude
Ġx uyên
Ġtá»ij c
ĠJ S
pon se
d u
d ict
i um
m ap
p er
¯ u
Ġ âĢ
Ġl uyá»ĩn
Ġm u
Ġtr anh
Ġnh ắc
Ġr á»ĵ
Ġlo g
Ġphá» ķ
ĠCh ắc
S t
c ess
c sv
Ġc urrent
Ġs ánh
Ġch iếu
Ġnh ạc
ec tion
ĠA PI
" .
C h
y m
Ġc ạnh
or k
ĠH á»į
Ġchuy ên
ĠÄijo án
Ġt ay
ĠÄij ất
Ġchá» ©ng
ar g
ĠÄIJ á»iji
ub le
ev ice
L P
± a
Ġc ân
or y
ĠT á»
ưỡ ng
Q L
Ġ on
Ġv òng
Ġd ù
Ġd Ãłnh
Ġch iá»ģu
on d
Ġngh iên
ừ ng
ĠJS ON
b ack
Ġ Y
Ġ ÃŃt
Ġth úc
Ġtr Æ°á»Łng
ượ t
Ġx ây
Ġphá» ¥c
E R
c ur
i al
n ew
Ġth Æ°Æ¡ng
ĠS t
id th
enti ment
: //
Ġ ẩn
Ġs át
Ġs ắp
in put
uy ết
ar a
ar d
Ġ1 00
as h
arb on
j ang
l t
o id
Ġth áng
Ġthá» §
Ġkh á»iji
Ġgi ai
er n
ti me
é o
tr ain
Ġ} ,
ht ml
ĠâĢ ľ
" );
D ata
Ġk iá»ĥu
Ġg á»ijc
ấ m
âĢ Ŀ
ĠX ác
Ġ ac
Ġt Æ°á»Łng
Ġth i
ĠB ây
ut put
ĠV iá»ĩc
alcul ate
t on
Ġt iá»ģm
Ġnh anh
Ġhá» ¯u
at er
ĠH Ãłm
Ġy our
Ġgiá o
ĠNg oÃłi
jang o
l ine
Ġ ô
Ġt iá»ĩn
ĠÄij êm
Ġv ùng
Ġl Ä©nh
Ġlá» ±a
al y
Ġvu i
e ed
o v
á» ¹
Ġm ê
Ġng oÃłi
Ġr ow
ĠS ông
ĠS ystem
ĠD o
d er
r i
t est
Ãł u
Ġh ết
Ġs ung
Ġm ặc
Ġng ủ
er ror
lo w
un ction
Ġw ord
us er
av e
Ġrá»ĵ i
S cript
\ _
c i
r el
ĵ n
Ġc ol
Ġl inh
Ġtr ạng
E r
e o
l ist
ĭ u
ı ng
á» ī
á» ĭ
ĠÄij áo
Ġth ao
Ġg ần
Ġph á»ij
ĠT ạo
re am
ĠTh u
Tr ue
Ġbá»ģ n
¯ ng
Ġt ắc
ĠÄij áp
Ġs et
Ġs ang
Ġtr ẻ
Ġk ê
Ġvá» įng
Ġ1 5
ĠH o
Ġ3 0
ad er
ĠL Æ°u
ĠEx cel
l abel
s um
Ġv ẻ
Ġd Ãłng
Ġr Ãłng
ĊĠĠĠĠ ĊĠĠĠ
om m
ind ex
iv e
Ġel se
a w
f t
l ib
t le
Ċ ĊĠĠĠĠĠĠĠ
Ġ ex
Ġ id
Ġh á»Ļ
Ġm ất
Ġch ÃŃ
Ġng Ãłnh
Ġvá» ¯ng
le ment
ắ m
el l
est ion
loc k
1 9
e qu
i o
n er
o u
p tion
ĠÄij ẩy
Ġth ấp
Ġv áºŃn
Ġtr ÃŃch
Ġd ân
ĠÄijá» §
er e
il ter
val ue
ĠJava Script
Er ror
S D
b ers
t ps
u ấn
Ġth ái
Ġl ạc
Ġch ú
Ġnh ằm
Ġn á»ķi
Ġn ữa
Ġthá» ¥
ĠC S
T he
l n
p en
t d
Ġt ắt
ĠÄij Äĥng
Ġl ai
Ġm odel
Ġtr Äĥng
Ġp ublic
Ġph im
Ġkh ÃŃch
Ġtá» Ľi
Ġtá» ĵn
ã n
Ġ1 9
oc ument
tiv ation
AT LA
ATLA B
L ist
Ġ or
ĩ nh
Ġn iá»ģm
Ġkh ẩ
Ġx u
ĠC l
è o
rit er
Ġkhẩ u
" >
E lement
T ype
p x
v ector
ĠÄij ình
Ġkh ung
um n
if ic
2 5
f ig
g e
Ġth ẻ
Ġh ạt
Ġs ẻ
ó c
Ġnh ìn
Ġph ạm
Ġng ẫu
er t
it e
Ġf ile
Ġkhá» ıi
ev el
Ċĉ ĉ
Ġmu a
ng th
Ġth ảo
Ġs Æ¡
Ġph òng
Ġtá» ķ
Ġr á»
ã i
ĠÄIJ ầu
al se
ro w
con st
pro fit
ĠU SD
" ;
g y
o i
Ġs h
Ġb óng
Ġn ằm
Ġthá» «a
Ġg á»
Ġkh ắc
Ġ= >
Ġtrá» «
Ġhá»į a
if i
Ġ5 0
Ġnum py
ele ment
app end
ĠTá» ķng
Ġt uy
Ġb iên
Ġch Æ°a
ĠÄijá» ĩ
Ġn ữ
at ch
ĠC ô
ĠC ông
ar n
am ple
ò a
ation s
ĠPh ân
Ġvu ông
col or
' ),
S T
S tring
m ax
o ot
Ġc ú
Ġc arbon
ĠÄij iá»ĩu
Ġth iên
Ġth ải
Ġh uấn
Ġn á»
áºŃ m
at ter
Ġx uá»ijng
ặ ng
Ġ1 1
ù a
as et
ĠM ATLAB
Ġ[ '
.. .
ẹ p
" ]
` :
e th
l d
o g
t ype
á» ³
Ġc Æ°á»Ŀng
Ġm ón
Ġlá» įc
ĠS á»ij
lo at
if f
ig h
Ġkho a
oun d
T h
n ection
Ń a
Ġs tring
Ġb y
Ġb á»ij
at or
Ġx ảy
ĠS QL
ĠD jango
ap e
ig in
ens or
N ame
Ġ __
Ľ p
ĠÄij ÃŃch
Ġth oại
ĠÄijá» £i
se qu
Ġin put
ub y
Ġtu á»ķi
Ġlu áºŃn
ĠCl ara
b ject
d at
k ey
t able
Ġ it
ĵ ng
Ġt ái
Ġl âu
Ġs Ä©
Ġm ắt
Ġd ưỡng
Ġph ong
ĠT ÃŃnh
st all
Ġ` .
im age
ĠL á»
uá»ij t
Ġus er
ern el
' );
3 0
d ex
q l
t al
v el
w idth
Ġth ú
Ġth iếu
iế c
Ġx anh
Ġ1 8
ec imal
if t
ĠPh Æ°Æ¡ng
he ad
'] ,
rel u
m in
n an
s ub
w e
ĠÄij Ãło
Ġb ầu
Ġkh uyến
á»Ļ n
Ġng ắn
Ġr ec
Ġr ừng
er as
ĠC ách
Ġchá» ĭu
Ġngh i
ĠD ef
ĠA d
ad e
ess age
oo k
Ġkhu ôn
( [
N N
R L
l ay
Ġth iá»ĥu
Ġs ai
Ġs entence
Ġs uá»ijt
Ġn ame
Ġg á»Ń
in k
Ġr andom
le arn
ur l
Ġbá» ĩnh
re ad
Ġso át
enc es
rit e
du ct
Ġgá»Ń i
' .
5 0
A n
N A
d i
j son
x y
} ,
Ä IJ
Ġ end
Ġth ẳng
Ġl á
Ġl ine
Ġd Æ°Æ¡ng
Ġch Äĥm
ch ange
Ġqu á»ijc
ĠM ặt
ò i
Ġká» ·
il l
Ġus age
Ġtuy á»ĩt
R es
T o
g r
l l
o int
p os
u le
x t
Ġt able
Ġr ange
en se
ĠT óm
ĠC âu
Ġho a
et ime
ti ng
ĠK ỳ
Ġ[ "
Ġtu ần
ifi er
ĠDef ine
C lass
U s
e ch
u se
Ġ un
ĠÄij am
Ġth iá»ĩu
Ġs uy
Ġm ain
Ġb án
Ġk iá»ĩm
Ġqu anh
Ġto tal
() )
lo ad
Ġkhá» Łi
Ġst at
Ġtrò n
Ġgó p
ari able
so le
eed back
ĠHo a
F rame
i ti
n ext
s c
Ġ &
Ġt ext
Ġv oid
Ġs tr
Ġb Ãły
Ġch iếc
Ġn iá»ĩm
Ġn ot
Ġp d
Ġkh án
Ġx ung
á»ij ng
Ġf unction
Ġbá» ©c
ut ton
un c
ĠA n
re f
is s
ĠK iá»ĥm
Ġj ava
ĠCon v
' s
1 1
b ash
c ost
l en
t op
Ġt f
Ġt im
Ġv Å©
Ġv ượt
Ġh ạng
Ġh òa
Ġch ấp
ĠĠĠĠ ĠĠĠ
st d
ic k
ĠV Ãł
ĠTh ay
us age
ab ase
Ġ< /
pl t
ow n
-------- --------
ĠKh ông
Ġar ray
S E
] ;
o x
s core
z ip
Ġ >
Ġ at
Ġ al
Ġc an
Ġc áo
ĠÄij ẹp
Ġm y
Ġtr Æ°ng
Ġg ắn
Ġph iếu
on t
Ġng ược
in it
er y
ĠC reate
ĠS tring
au r
Ġ- >
ic es
() ,
Ġdo uble
ess ion
á»± a
Ġlog ic
sequ ence
( $
C T
F orm
] .
c le
i el
m on
y our
Ġv ô
ấ c
le t
le ngth
ĠD ata
ĠH á»ĩ
od ule
Ġcụ m
á»į n
ht tps
word s
Ġem ail
ener ate
Ġhá»Ļ p
ĠÄijá»ĩ m
N LP
P h
e at
n ot
x ml
á» ĭch
ĠÄij òi
Ġh y
Ġl et
Ġl ist
Ġtr ánh
ar k
ar r
ĠÄIJ ảm
Ġ2 5
() .
ut e
od y
ag es
Ġphá» ıng
print ln
Ġgá»į n
ĠThá» ±c
Ġval ue
4 0
I d
c out
i es
o h
p p
s s
t ent
Ġc alculate
Ġh t
Ġh uá»ijng
Ġl abel
Ġs óc
Ġd f
Ġnh ãn
Ġng ay
iế p
ar e
ĠM ặc
Ġf rom
val ues
tiv e
Ġres ult
iel d
1 00
T ext
b r
i e
u g
w it
w ift
Ġ ,
Ġ au
Ġ ...
Ġt ầm
Ġc Äĥng
Ġl a
Ġb ữa
Ġtr áºŃn
Ġnh ấp
Ġp ip
Ġg ắng
Ġph ê
Ġcá» ¥c
on ac
Ġvá» ĩ
Ġqu ang
ú i
ĠB á»Ļ
ĠTr ue
lo b
Ġo bject
and as
Ġnhá» ĭ
con v
ĠphÃŃ a
ib onac
ob ot
** :
Us age
ibonac ci
T able
c urrent
d iv
p ublic
p ool
á» Ľi
á» ¥c
Ġc Ãł
Ġb iá»ĩn
Ġch ắc
ó i
Ġn é
Ġcá» Ńa
le vel
ĠÄIJ ó
Ġ1 4
es crip
au lt
Ġ- --
Ġthu áºŃn
Ġnum ber
form at
ĠCS V
3 2
d ir
g ro
i an
p ip
v ÃŃ
y l
§ ng
ng ine
Ġc Ãłng
Ġth Æ°á»Łng
Ġv ẽ
Ġl ã
Ġl úc
Ġs c
Ġs p
Ġb e
Ġph á»iji
ĠB r
ec ond
ĠV Ỽi
ĠTh iết
Ġdo c
hi le
ir st
.. ..
è n
res ult
Ġword s
E T
E x
a N
a f
f ord
i k
n et
r an
s entence
t xt
w w
Ġ !
ı a
Ġh út
Ġh áºŃu
Ġs iêu
Ġtr ắng
Ġd inh
Ġng ại
Ġgi ấc
Ġtrá» ¥c
am es
ĠN LP
ur al
ĠTr ung
ĠV á»ģ
Ġin stall
ĠR e
Ġ+ =
ow s
ĠE m
ĠU RL
Ġlu ôn
8 0
L E
b ody
r ust
w ork
ī nh
Ġs core
Ġm ax
Ġb lock
Ġd ần
Ġph i
Ġkh ảo
Ġng oại
qu est
at plot
at ive
Ġlá» ģ
Ġ1 6
ti tle
ent s
Ġá» ķ
Ġmã i
ĠK ết
ate g
ect Æ¡
ist ance
ord er
Ġkhá» Ľp
ĠI m
ĠO utput
Ġar g
In put
Ġe ach
orm al
igin al
atplot lib
) );
D evice
R O
f rame
i ew
t em
t ain
u c
w ith
Ġ ảo
á» ¥
Ġt ype
ĠÄij u
ĠÄij ôi
Ġv ectÆ¡
Ġh uy
Ġl Æ°á»Ľi
Ġs k
Ġs ạch
Ġtr ùng
Ġch ân
Ġn út
le ction
ar ray
ĠS h
el lo
ĠB ản
Ġhá»į p
ac y
ĠTr Æ°á»Ľc
ĠG iá»
ig n
Ġa x
pl ay
Ġ6 0
Ġduy á»ĩt
Ġnhu áºŃn
ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ
ide o
ym s
omm end
: **
a z
e e
f ind
f unc
i x
r ic
r aw
v ar
Ġ ông
Ġ en
Ġ ap
Ġ ẩm
Ġt án
Ġc oi
ĠÄij ấu
Ġs Ãłng
Ġm a
Ġb á»iji
Ġk m
Ġp ar
Ġkh iá»ĥn
Ġtá» ©c
Ġr obot
an ford
ã o
Ġ` __
Ġlá» ħ
Ġtrá» ¥
th er
Ġ2 4
ang le
ĠTh eo
Ġo utput
ĠR uby
Ġ# #
iz ation
ĠX ML
add ing
ener gy
ĠData Frame
wit ter
) `
0 1
1 6
D ocument
E n
I N
L evel
P ro
a le
r andom
u ff
y s
Ġ uá»ijng
ĠÄij ạo
Ġl ắng
Ġs ub
Ġs entiment
Ġm eth
Ġnh ấn
Ġnh ẹ
Ġkh Äĥn
Ġng Äĥn
Ġr ác
or r
Ġx óa
ặ m
ặ n
st at
ar m
ĠB Æ°á»Ľc
Ġngh á»ī
Ġgiá» įng
Ġ{ "
Ġy ou
ĠA c
re v
ĊĠĠĠĠĠĠĠĠ Ġ
tr ans
Ġcon st
ass word
ĠNg Ãły
pl ace
ĠPh át
Ġcá»ij c
ver t
col umn
ock et
Ġdat etime
Ġac tivation
ific ation
C ount
b in
d o
d own
f ul
g le
l ue
m it
s p
s ql
t p
« ng
Ġ ấm
Ġt ô
Ġt áºŃn
Ġh át
Ġl i
Ġs um
Ġm ùa
Ġtr ao
Ġtr á»ijng
ạ p
Ġp l
Ġp adding
in f
qu e
Ġqu án
le d
Ġho Ãłng
Ġ1 3
ĠhÃł i
ĠD iá»ĩn
ac tion
ĠA l
re e
is play
om e
Ġin dex
á»Ń a
end er
eg in
Ġbu á»Ļc
ater Usage
Ġstat ic
oh n
Ġné n
Ġdoc ument
2 4
> >
] `
b f
e ach
j ec
u ess
} ;
Ġt Ãłu
ĠÄij ảo
Ġth uyết
Ġm ì
Ġn ay
Ġg r
Ġg án
Ġph óng
Ġng ôi
Ġhá» ©ng
or ch
at ed
ĠT iếp
ĠtÃŃ n
Ġ( `
ro p
un d
se p
ĠmÃł n
Ġo pen
ce pt
__ __
ĠNg h
pro cess
Ġtu á»ĩ
num bers
ob ject
tic es
ert ex
1 5
2 3
F act
P ar
[ "
\ "
b y
f ic
m er
m at
n o
n s
r ed
s ol
Ġ @
Ġ add
Ġh ảo
Ġs Æ°
Ġm èo
Ġb iá»ĥn
Ġd e
Ġd u
Ġch óng
Ġn Æ°á»Ľng
Ġp ython
Ġph út
Ġng uy
Ġr o
Ġr au
ầ ng
or g
Ġx e
th ức
ĠÄijá»Ļ t
as ed
() `.
ĠD NA
Ġphá» §
ot al
il d
ind ows
iv er
oo gle
ĠGi ải
lay ers
Ġau to
G r
P ython
i tion
n e
r ec
s or
Ġt áo
Ġc om
Ġth at
Ġs equ
Ġb áºŃt
Ġd ặm
Ġk ÃŃnh
Ġnh iá»ħ
Ġp os
Ġqu ay
Ġqu ỹ
ĠC alculate
Ġtrá» ĵng
Ġ- -
Ġngh á»ģ
ĠM á»Ĺi
ec k
ex ec
ĠTr ái
tr y
ap pl
Ġ< -
ul ti
ĠNh áºŃt
__ (
os aur
ĠÃ ģ
ak e
ĠHá»į c
arg s
aly z
estion s
Ġgá» £i
Ġsk learn
6 0
D A
H P
I D
P U
R E
b egin
s cript
y ear
Ġ use
Ġt ime
ĠÄij en
Ġth o
Ġh e
Ġh ạnh
Ġtr ain
Ġnh ảy
Ġkh ái
el p
() :
ĠTh ông
av g
Ġ[ ]
ĠNh ìn
num ber
Ġar e
yn on
Ġbu á»ķi
Ġcol or
ĠAd d
Ġ! =
Ġá»ķ n
' ).
2 00
= (
E N
Q u
T P
a h
c ud
i osaur
j s
l ight
n p
n ect
p ack
p oint
t ask
Ġ ai
Ġ up
Ġt ur
Ġt óm
Ġc ắt
Ġc ase
Ġc reate
ĠÄij Ãłn
Ġv ideo
Ġb it
Ġb ánh
Ġtr ách
Ġtr Äĥm
Ġtr ans
Ġd ây
Ġch ay
Ġch ảy
Ġk ey
Ġk ernel
ĠÄijá» Ŀi
Ġn ông
Ġn ặng
Ġg h
Ġsá» ķ
or ld
le ct
ar get
am b
im g
ut es
Ġgiá m
re ak
ĠL ist
us h
us ing
ĠCh u
Ġcon nection
ist ic
iz er
Ġkhá» ©
text bf
'] )
Ġgó c
Ġnum bers
ele ct
item s
item ize
ach iosaur
ĠÃ Ŀ
Ġim age
so ft
Ġdat abase
ĠBr achiosaur
cud a
" ).
7 0
C ol
I m
M odel
W h
[ ]
c ode
d a
f oo
m art
n a
o in
o ặc
r on
r un
w ik
Ġ element
Ġt ách
Ġc v
Ġth ất
Ġth is
Ġl Æ°Æ¡ng
Ġm in
Ġm ại
Ġm et
Ġm ạch
Ġb ay
Ġr ủ
Ġgi ấy
Ġgi Ãłu
ch o
ch ain
ĠC U
ĠP HP
ĠV áºŃy
re g
Ġlo ạn
ĠL o
Ġw hile
Ġmô n
Ġo s
Ġkho ản
he et
Ġtu ân
ĠKh o
Ġint er
sv g
tic le
ĠThá» ©
ĠThá» Ŀi
Res ponse
Form atter
ĠBrachiosaur us
Ġrủ i
3 3
6 4
: ,
A r
C V
P rint
P os
S S
f ilter
t y
Ċ ĊĠ
Ġ )
Ġt ầng
Ġc a
Ġc am
Ġc Äĥn
ĠÄij ẳng
Ġv en
á u
Ġch ặt
Ġch éo
Ġp ath
Ġg en
Ġgi ó
er b
an c
an y
an ag
at ing
ĠC ả
ĠS wift
Æ°Æ¡ i
ĠP y
ĠM y
Ġf loat
ĠD á»±a
ĠA r
ĠA nh
tr úc
ap h
__ `
pl it
log g
pr ed
sh ape
Ġres ponse
te in
Ġthụ t
iti al
escrip tion
ateg ory
2 1
7 5
A R
B y
C C
K h
O f
R e
S QL
T O
U ser
a it
b ol
f act
i or
k h
m essage
n ode
o f
p lo
r and
s ave
v e
Ġh Æ°Æ¡ng
Ġh Æ¡i
Ġl iá»ģn
Ġs ong
Ġs ize
Ġch im
Ġn ắm
Ġtá» Ŀ
Ġx a
st ance
st art
Ġchá» ijng
th e
ĠN aN
ĠS V
ti l
ĠB ảo
it er
Ġf act
Ġnó ng
ĠTr á»
Ġquy á»ĥn
Ġchuy ến
ort ed
Ġ5 00
Ġchu a
ĠNh Ãł
ĠNh ân
ĠF alse
ĠW indows
ĠQu á
Ġdat aset
ri x
á»ĭ nh
mon th
ormal ization
4 5
: }
N ode
O S
b utton
d b
f ly
f eat
k ernel
s ame
t ed
u x
Ġ â
Ġ Æ¡n
Ġ energy
ij n
Ġt am
Ġt est
Ġt Æ°Æ¡i
Ġth Æ¡
Ġl ẻ
Ġb reak
Ġd iff
Ġnh Ãłng
Ġvá» ı
Ġvá» «a
Ġvá» ijn
Ġr anh
ĠT o
ĠT ừ
ĠC ol
st ream
th rust
ĠÄijá»Ļ i
ti m
ĠM ỹ
ic al
Ġto p
Ġá» ŀ
Ġf eedback
em ent
ĠH á»
ĠH Æ¡n
ex ample
ut ter
ĠTr uy
Ġ{ '
ĠL Ãłm
Ġw ork
ĠG oogle
pl ant
iv ate
ore NLP
oo st
ẹ n
num py
eg r
res ent
res ponse
In t
sh ow
cur acy
sum ption
ĠCS S
Ġná» Ĺ
LE CT
Ġtur tle
plo y
utter fly
1 8
> <
C hi
D ense
N h
T ime
b ook
c ent
g i
l ast
m t
s is
w riter
± ng
Ġ ad
ĵ i
Ġt d
Ġc Æ°á»Ŀi
Ġc ặp
ĠÄij áºŃu
Ġl uá»ĵ
Ġm ây
Ġm ét
Ġm ẹ
Ġb ÃŃ
Ġb Ãłn
Ġch ép
Ġch áºŃm
Ġk é
Ġn e
Ġn am
Ġp er
Ġr un
an k
ĠlÃł nh
ch ar
ĠT áºŃp
Æ°á»Ŀ n
st ate
le an
á»ij t
al ue
am in
et ch
ĠN am
ĠB atch
ur v
ro ot
ĠTr ình
is ion
ĠTh e
ĠL a
ĠL Ãł
Ġ4 0
Ġ} );
uá»ij c
') (
ĠÃ Ķ
aly sis
ov e
ĠThu áºŃt
igh b
RO M
exec ute
ĠLo ad
Ġluá»ĵ ng
- |
9 0
A d
E ner
G i
H ER
N ormalization
U n
c m
d ec
d is
e ngine
i ent
j oin
l at
m ary
n ing
p ace
r y
s á»ij
w er
Ġ ?
ĠÄij ô
ĠÄij ông
Ġth ác
Ġth áºŃt
Ġv ar
Ġv it
Ġh iá»ĥm
Ġl e
Ġl en
Ġs ông
Ġs Äĥn
Ġm át
Ġm atplotlib
Ġb Äĥng
Ġb Ãło
Ġtr y
Ġd istance
Ġch ặn
ó t
Ġn á»Ńa
Ġp lt
Ġp andas
Ġph ấn
Ġr ãi
or s
Ġqu ân
Ġchá» Ĺ
Ġtrá» ı
ĠN one
Ġ2 00
ĠM ạng
ĠD Ãłnh
Ġ3 2
int er
lo se
á»ĩ nh
od es
ĠL á»ĩnh
Ġká» ĭch
ĠG et
ect angle
ĠPh ần
ĠPh áp
ev ices
ĠX á»Ń
up er
è m
ĠQ uá»ijc
Ġpro tein
Ġ: =
Ġus ing
Ġ% }
ust om
enc y
Ġcol umn
ST M
Device Type
ĠAc tivation
ĠCU DA
anag er
ior ity
Ġké m
ĠBatch Normalization
Ener gy
HER E
" ],
- >
: \
F alse
H ello
N one
P r
b it
c ount
d oc
d evice
d ocument
i que
o us
p ig
p ush
t ÃŃnh
u til
w rite
Ġ Æ°á»Ľc
Ġt ask
Ġc ản
Ġc ánh
ĠÄij Æ°Æ¡ng
ĠÄij iá»ĩp
Ġh ere
Ġh igh
Ġl ong
Ġl ao
Ġs econd
Ġb ased
Ġk èm
Ġnh ắn
Ġn ext
Ġph iêu
Ġng á»į
Ġvá» Ŀi
Ġr Äĥng
Ġgi ấu
Ġqu en
Ġx ạ
Ġtrá» ©ng
ĠN ew
Ġ( $
el s
ic ation
ed u
ac ity
ĠTr iá»ĥn
Ġlo ạt
is e
tr act
ĠCh ủ
ĠR es
Ġlá»ĩ ch
ĠI D
Ġhá»Ĺ n
ock er
ser t
arg in
label s
Ġsh ell
we et
Ġrec ommend
Ġnhá»ĭ p
do uble
Ġvit amin
. ")
: </
I A
I tem
U M
b lock
c oun
d ecimal
f loat
h ape
i om
l p
m et
m odule
o od
o ul
r c
t a
u tion
y cle
¯ a
Ġc áºŃy
Ġc ost
Ġc sv
ĠÄij ế
Ġth ầm
Ġh ôn
Ġl ặng
Ġs ân
Ġm e
Ġm iá»ĩ
Ġtr ue
Ġd evices
Ġk eras
ĠÄijá» ©ng
ĠÄijá» īnh
Ġnh át
Ġcá» Ŀ
Ġng á»
er ences
er tices
ĠT ùy
ĠT ensor
ĠC Ãłi
ĠC ảm
Ġchá» Ŀ
ar ch
Ġngh èo
ĠP ar
ic ult
Ġphá n
ĠD ữ
á»ĵ ng
re quest
Ġo p
ĠG PU
ap top
ap acity
Ġthá»ĭ t
ter net
pl ate
ers on
ud o
ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ġ
ost ream
ĠkhÃŃ a
eg ative
Ġj son
li ent
Ġval ues
ear ch
par k
par am
du c
ym bol
cur sor
oot print
ariable s
Ġht tps
Ġlã ng
Ġmeth yl
orr ect
Ġnhiá»ħ m
Ġmin utes
Ġven ues
pig ment
Ġmiá»ĩ ng
icult y
) ]
4 4
9 9
> </
F ile
F ilter
F ield
L ine
M em
R ow
V B
V ID
c c
c at
g re
k y
k en
l s
l in
l ink
o ạn
r iver
s entiment
s plit
t f
w ing
¨ ng
Ĩ Ĵ
Ġt ôn
Ġt Ä©nh
Ġc ount
ĠÄij ám
ĠÄij iá»ģn
Ġl iá»ĩt
Ġm on
Ġm anh
Ġb á»Ļt
Ġtr iá»ĩu
Ġtr Ãłn
Ġd et
Ġd ãy
Ġk éo
ĠÄijá» ķ
Ġn ão
ĠvÃł ng
Ġthá» ıa
Ġg enerate
Ġph ông
Ġkh ấu
Ġkh ắp
Ġcá» ©ng
Ġng ân
Ġng ừng
Ġqu ên
ĠT witter
Ġchá» ©
Ġ1 7
al a
ĠN um
Ġ( '
ĠP rint
ĠM áy
Ġá» ¨ng
Ġf ont
ut s
is h
ĠTh Æ°
tr ib
ab s
ol d
ĠCh âu
ĠCh á»įn
Ġo xy
ig m
ĠPh ó
ĠGi ả
ver b
Ġclass ifier
." );
Con sumption
12 8
pt y
gro und
object s
Ġâ ĨĴ
Chi ld
ighb our
dis p
oul d
) ),
2 7
5 5
= ['
J ohn
M T
P ool
S c
T C
W aterUsage
` )
b ar
b ot
b ox
c reate
c ustom
g en
i ch
i ostream
k it
p op
p act
t ên
t ÃŃch
t tp
t otal
v ent
v ice
{ %
{ '
Ġ _
Ġ ấn
Ġt iá»ĥu
Ġc omm
Ġth ám
Ġth áºŃm
Ġl ẫn
Ġl ạnh
Ġs óng
Ġb ack
Ġch ó
ĠÄijá» ı
Ġnh ạy
Ġthá» Ł
Ġkh uyên
Ġkh uyết
Ġsá» £
Ġsá» ¯a
á»Ļ p
Ġr ev
Ġgi ây
at es
en u
ĠT Äĥng
ĠT ây
ĠC Æ¡
ĠC ụ
le x
Ġho ang
ĠÄIJ ánh
al le
ĠS et
el ic
el ta
it le
Ġngh e
ĠP ro
ur s
ĠM ón
ic ro
Ġthu ần
ac ter
Ġy ên
Ġw idth
ol der
ef fic
ĠNh Æ°ng
Ġst art
Ġst ock
il y
Ġkho ảnh
op en
ind ent
pro duct
ĠO pen
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ
out put
Ġint o
tic k
Ġthì a
pr ice
ĠÃ Ĥ
AT H
Ġpr ivate
St ock
ater ial
Ġit er
SE LECT
Ġht ml
gro up
Ġblock chain
tain er
Ġ## #
En ter
Ġsub ject
ynon yms
igm oid
( (
, "
4 2
6 5
6 6
A ver
C A
F ootprint
L in
O r
S er
S entiment
T est
] ]
d ev
f unction
f irst
h en
j ava
k w
k eras
m a
m ain
o ch
u it
y d
} ")
¥ p
§ y
Ġ ``
Ġ error
Ġ url
Ľ t
Ġt ần
Ġt ấn
Ġt Æ°á»Ľi
Ġth áºŃn
Ġl ay
Ġl evel
Ġl ink
Ġs er
Ġd Ãły
Ġd áºŃy
Ġk ẻ
Ġp assword
ĠvÃł i
Ġph ẩy
Ġkh úc
Ġdá» ĭu
er ence
qu ery
ã ng
Ġ` '
Ġchá» ¥p
ĠÄIJ iá»ĥm
al s
al ind
ĠS ao
ĠB ắt
ĠP hi
ur ation
ic tion
ĠD á»ĭch
em ove
ac tions
id d
ĠTh êm
ĠCh i
Ġcon sole
ap er
Ä© a
Ġ# {
end l
ĠF ibonacci
ĠF ROM
Ġ7 0
ĠW eb
ĠGi á
ele te
tiv es
ple ment
sh ar
Ġre qu
Ġre ad
Ġim g
ĠSt anford
user name
Ġgá» ¡
Ġby te
Ġlã nh
ww w
ĠGiá» Ľi
stat us
Fact ory
sol ar
ĠChu á»Ĺi
Ġngá»į t
icro soft
Aver age
( ['
. )
2 2
C H
F oo
L U
P y
R U
R egr
V alue
c py
e k
f ibonacci
i tive
j ust
l ide
p i
q r
r ation
r ary
r uby
s pe
s heet
t om
u i
v ec
į a
Ġt ây
Ġc at
Ġv Æ°á»Ŀn
Ġh Æ°ng
Ġl á»Ļ
Ġl ông
Ġl Æ°á»Ŀng
Ġs al
Ġm ai
Ġm ay
Ġm Å©
Ġtr á»Ļn
Ġd iv
Ġd ict
Ġch a
Ġk im
Ġnh ắm
Ġn êu
Ġn ấu
Ġng ạc
Ġtá» ı
in ner
Ġr oot
er min
an imal
or ical
en ame
ĠT ên
ú a
ĠC ung
ĠC oreNLP
Ġlá» ¥c
Ġ" ;
ĠÄIJ ông
am ond
ĠN VID
ĠS ara
el ine
ĠB e
ĠB iến
ĠB ắc
Ġ2 3
ĠM icrosoft
Ġ' ,
-- |
ĠH Ãłnh
ed ian
ĠA NN
ĠTh áng
se q
Ġw ill
tr ong
ĠG enerate
Ġtá»ij n
ĠR est
ul l
Ġkhá» §ng
Ġst ore
il der
pl y
ĠI N
op tion
con fig
con nection
Ġ6 4
py c
our ce
get Element
'] .
oo lean
ĠW ord
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
-------- ----
ĠGi ảm
Ġ. =
me an
class ifier
par se
Ġthủ y
Ġkê nh
Ġor g
dat aset
Class ification
lob al
inf o
jec tives
appl ication
pack age
gi á
Mem cpy
aterial s
alind rom
amond s
ĠNVID IA
' `
1 4
5 00
D ef
D ecimal
E O
E S
F low
P ref
T H
T ôi
b utterfly
d escription
f low
g iá»
i ed
j a
l ut
n lp
o T
o ard
s ing
s udo
u th
u ôi
v ers
w ard
y le
} );
á» ©
á» Ł
á» Łi
Ġt ensor
Ġc Æ¡n
Ġc uá»ijn
ĠÄij á
ĠÄij è
ĠÄij eo
Ġth ảm
Ġv ang
Ġv Ä©
Ġh ạ
Ġh ại
Ġh as
Ġh ùng
Ġl ạ
Ġs ql
Ġs mart
Ġm ar
Ġm Æ°a
Ġm iá»ħn
Ġm essage
Ġm enu
Ġb áºŃ
Ġb in
Ġb ắp
Ġd Æ°
Ġd ầu
Ġd ec
Ġd ate
Ġch ar
Ġch út
Ġn on
Ġn oun
Ġp lot
Ġph úc
Ġtá» ¥
Ġr á»iji
Ġgi ãn
an u
or n
at rix
Ġqu estions
Ġx Æ¡
ĠT Æ°Æ¡ng
ĠC om
Ġchá» ĵng
ĠÄIJ á»Ļ
ĠS c
ĠB ảng
Ġngh á»ĭ
Ġngh á»ĭch
im es
im ple
ĠP ost
ur es
ĠM ục
ĠD ocker
ĠH iá»ĩu
ing s
ed ia
re en
ĠTh Ãłnh
ĠTh is
ĠCh Æ°Æ¡ng
and er
ĠJ ack
ĠF elic
ĠPh ục
op h
op t
con text
con sole
con nect
Ġ7 2
he ight
ĠTuy ết
ĠW orld
ud ent
up le
val id
com p
In dex
log y
form ation
Ġlu áºŃt
enc od
ff e
Ġre quest
model s
ph a
Ġpr iority
++ )
yn c
ĠIn ternet
St ream
ĠY ork
Ġor iginal
Ġtá»ķ n
ĠLá» £i
Ġnghi êm
gr am
ech o
Ġlabel s
ĠIm plement
Ġsequ ence
alyz e
cuda Memcpy
ĠÄijế m
ĠTensor Flow
Pool ing
ĠCụ m
lex ander
alle ng
ĠÃĤ u
ĠSara h
ĠbáºŃ c
ĠFelic ity
) [
. ",
7 2
? "
A N
D B
F F
H EN
I O
O U
O ST
R ate
S h
` ).
a S
a aS
c v
c lose
d iff
f l
f r
h our
h ost
i us
m s
p re
p ost
p rev
p assword
r ad
r ase
r ange
s m
s econd
t ag
t ức
t orch
t arget
u ilder
v iew
Ġ et
Ġ ass
Ġ ir
Ġ zip
Ľ m
Ġt em
Ġt Ãłng
Ġc ong
Ġc ar
Ġc ur
Ġth Äĥm
Ġh ằng
Ġh è
Ġh iếm
Ġh uyết
Ġh ave
Ġs log
Ġm ắc
Ġm iá»ģn
Ġb Æ¡
Ġb ang
Ġb è
Ġb oolean
Ġd ã
Ġd Æ°á»Ŀng
Ġch Ãło
Ġch âm
ĠÄijá» ±ng
Ġnh iêu
Ġn inh
Ġn ét
Ġn úi
Ġn uôi
Ġg o
Ġsá» Ľm
Ġng ưỡng
Ġng á»įn
Ġng oặc
Ġvá» ¡
er r
er se
er form
or iginal
ch em
Ġqu ần
Ġqu ý
Ġx o
uy á»ģn
Ġlá» Ńa
Ġ" )
ĠÄIJ á»ĭnh
Ġ1 000
ĠS S
Ġthe ir
ĠB ạch
as es
ai led
ĠP andas
Ġ2 2
ĠM ẫu
ĠM iss
ent er
-- -|
ec r
() );
ĠH ai
ĠH ttp
Ġ3 00
ac OS
Ġ{ }
ĠV ui
Ġy ear
un it
ĠA lexander
Ġmã n
re qu
Ġin d
Ġw as
Ġw ing
us r
ĠCh iá»ģu
ĠCh eck
', '
ce ption
ĠR ust
ul ar
Ġnhá» Ŀ
Ġkhá» ķ
Ġst ate
il ename
ĠF it
ow er
Ġkho án
con tent
oc ity
print f
') )
Ġcá»ij t
ĠU se
ĠU ser
up date
ele m
eg er
Tr ans
ant s
12 3
ern et
ton yms
ĠThu á»Ļc
lib rary
Ġtrừ u
ĠLá» Ľp
ox ide
Ġarg s
ĠÄiju á»ķi
trans form
Ġsum mary
jec tive
By Id
Re ader
Ġfact s
urv ey
Energy Consumption
custom er
shar p
qr t
getElement ById
lut en
" $
' ;
( :,
) ",
- %
1 3
B uilder
C arbon
E d
G uess
I F
K ey
N ew
P E
R equ
S ub
S ER
T ên
T ÃŃnh
W riter
c ar
c od
c ategory
c sharp
f mt
g o
h ere
i re
i ency
l ần
l ab
m m
r ig
r ight
s ystem
u al
u á»Ļc
w o
z ure
Ġ áº
Ġt itle
Ġh ẹn
Ġl ang
Ġs áp
Ġs ide
Ġs ót
Ġm ạo
Ġm úi
Ġm úa
Ġb log
Ġtr Ãł
Ġtr ông
Ġtr Ãło
Ġtr ượt
Ġd a
Ġd b
Ġd evice
Ġch ạm
Ġk iêng
ĠÄijá» Ľi
Ġnh úng
Ġp oint
Ġg ấu
Ġng áºŃp
in stall
in ja
Ġr út
Ġgi án
er ic
an i
at aset
Ġqu ét
Ġx in
Ġx Æ°a
ĠT ÃŃch
uy á»ĥn
ĠC áºŃp
ĠC ây
st anford
Ġ` -
Ġ` [
Ġ` _
ĊĠĠĠĠ ĠĠ
ĠÄIJ ặt
ĠÄIJ oạn
th áng
al th
ĠN á»ģn
ĠB iá»ĥu
ai ly
ic o
ex as
ex ico
ĠTr ên
ĠTh am
ĠL u
ĠK ế
ĠK ỹ
ĠCh á»ī
Ġcon tent
ĠG o
ĠG r
and ard
Ġbá»Ļ i
á»į c
ip le
ist r
ot o
ment al
ĠF l
ĠI oT
ĠE T
ev e
oc ial
our se
ir on
ir ed
he ader
str ip
Ġhá»ĵ n
()` ,
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ
ax Pooling
ĠGi ai
ance Level
item sep
tic iple
pr ime
ep och
Ġpr ice
ĠIn t
Ġel if
per im
Ch ar
cur l
âĢĿ .
Ġrá» ±c
dat abase
.... ....
ĠIm age
no itemsep
Ġsequ ences
alyz er
amb da
wik i
Ġtop sep
ĠHá» £p
writer ow
Ġmon th
Requ est
% .
1 7
: %
D O
D o
I M
M odule
M anager
S ize
S ymbol
V ertex
W ith
c es
d istance
e et
f ont
g er
j av
k e
m ut
o k
r eturn
s l
s ort
s ys
s wer
t in
u el
v iron
Ġ Z
Ġ ev
Ġ all
Ġt arget
Ġt weet
Ġc Æ°
ĠÄij au
Ġth ùng
Ġth ắng
Ġh ầu
Ġh iến
Ġh ãi
Ġl ấp
Ġl Å©
Ġs e
Ġs ạn
Ġs ave
Ġs ocket
Ġs orted
Ġs uper
Ġb ông
Ġb ão
Ġd ao
Ġch âu
Ġch ấm
Ġch èn
Ġk iên
Ġk em
Ġnh út
Ġnh ầm
Ġph ú
Ġkh á
Ġkh ô
Ġdá» įc
ì a
Ġtá» ıa
in i
an e
an ner
or ad
Ġqu ảng
ĠT ác
ĠT ại
ĠT iêu
ĠT exas
ĠC ải
Ġlá» iji
le ft
ĠÄIJ iá»ĩn
ĠÄIJ á»Ļng
Ġ1 20
am a
am ic
ù i
ù n
au ti
ĠB a
ĠB ức
as cript
ĠM ô
ĠM ark
ĠM exico
Ġf ilter
Ġf irst
ĠÄijó n
Ġ3 5
ĠTr ie
ĠV in
ĠA s
se lect
ĠL at
ĠL áºŃp
ĠL á»Ĺi
ĠL oại
Ġw riter
Ġcon n
Ġcon text
Ġ< =
ĠR ob
Ġtruy á»ĩn
ip ient
ip edia
iz ed
ĠNh Æ°
ĠJ ohn
con vert
our ces
Ġan tonyms
ath er
ĠKh ả
ừ a
Ġpro duct
res hape
tic s
Ġ% >
Ġdi oxide
cel l
ep end
Ġe cho
Ġdef ault
ĠCon sole
ĠQu ả
yn amic
Ġrá»ĵ ng
train set
Ġrow s
ci kit
Ġid iom
25 6
Ġrá» ¡
Ġbá»ij n
ĠSQL ite
Ġ& &
iss ing
escrip tions
uc cess
Pro duct
Ġmeth od
Ġpl an
ĠNgh iên
no logy
appl y
Qu estion
Im port
Ġmet ric
Print ln
feat ure
ĠTo án
ĠCol orad
Ġsecond s
block s
duc ed
Ġback ground
Regr ession
Def ault
Pref erences
Carbon Footprint
istr ib
jav ascript
auti ful
ĠColorad o
" "
" },
$ {
( {
. /
9 5
= \"
A c
B oard
E X
F r
K E
N aN
O P
O R
P OST
R est
S o
S ph
T ag
V ertices
W ord
Y PE
[ :,
b e
b lue
c op
c all
c pp
d rop
h oặc
l a
l ar
l ambda
m od
o se
r ate
s qu
s wift
u a
v id
w r
{ }
© t
Ġ ]
ĩ t
Ġt áºŃt
Ġt Æ°á»Ŀng
Ġc m
Ġc or
Ġc al
Ġc ẩn
Ġc Å©
ĠÄij ằng
ĠÄij Ãłi
ĠÄij Ãłm
nh Æ°
Ġth an
Ġth ói
Ġv ết
Ġv erb
Ġh ô
Ġh ist
Ġh ref
Ġs u
Ġs elect
Ġs ources
Ġm ái
Ġb é
Ġb éo
Ġd ạy
Ġd ll
Ġch áºŃp
Ġch ôn
Ġp y
Ġp ass
Ġp op
Ġp resent
Ġp uts
Ġg am
Ġg luten
Ġcá» Ń
Ġdá» ĭ
on s
in o
ượ u
er g
an a
an o
an th
an ti
Ġhá» §y
or th
or est
ch or
ch ild
at is
Ġqu estion
Ġqu ãng
en e
ĠT ext
ĠT est
Ġ` =
ar ed
ar ticle
Ġho w
Ġmá» Ŀ
Ġmá» ĩnh
Ġmá» «ng
Ġmá» ĵi
et a
ĠS e
ĠS o
el se
el low
as c
im il
ĠM ôi
ĠM ag
ĠM ulti
ĠM axPooling
ic a
ic ode
ec ess
Ġf ig
Ġf rame
Ġbá» Ľt
ro up
ĠH am
ed D
ac curacy
ĠTr ain
ĠV ấn
ĠV âng
un ique
ĠA m
re ase
re ader
ĠTh ế
ĠTh áºŃt
ĠL iên
ĠL og
ĠK ov
ĠK eras
ol s
Ġo ut
Ġo ver
Ġo ption
Ġo ther
Ġ} ;
ĠR ed
ig en
ul ation
Ġchu á»Ļt
Ġnhá» Ł
iz z
ev en
op enc
ht tp
ĠX in
Ġan swer
pro x
set ting
ĠGi ao
Ġvi ew
ĠQ uy
Ġpro cess
ult ural
20 21
ĠHT TP
enti al
Ġre place
ph p
loc al
LA G
ast Par
Con tent
du ction
ov ie
Ġ15 0
Ġex ample
Ġrá» Ŀi
we ek
lay er
To Symbol
ech nology
are a
ran ch
Ġax is
ĠNgh á»ĩ
ne ighbour
istic s
Col lection
wik ipedia
reg ex
logg ing
Kh ông
fact ur
dec ision
Ġle ngth
Ġme an
ĠNum Py
iction ary
Ġsql ite
Ġsmart ph
anu factur
ffe ine
ĠlÅ© y
Sph ere
atis f
imil ar
ĠKov u
openc v
astPar ticiple
' }
( -
) "
. ,
. __
0 5
3 4
A p
A ge
C om
F eedback
G B
H e
L L
L STM
M y
M atrix
N G
O ption
S et
S earch
W rite
W HERE
b ine
c ap
d el
f ir
f etch
f ilename
g ói
h ai
k o
l ank
m á»Ļt
m ode
m argin
n ow
n ey
o th
o tion
p et
p ol
r ender
s ide
s ky
t ro
u z
u ct
w k
w ind
w eb
w hile
y t
£ t
Æ ¯u
Ġ z
Ġ am
Ġ ung
ĭ p
Ġt ai
Ġt ấm
Ġc áºŃu
ĠÄij e
ĠÄij áºŃm
Ġth ang
Ġth iá»ĩp
Ġth row
Ġs Æ°u
Ġm ảnh
Ġm á»ijc
Ġm acOS
Ġm issing
Ġtr i
Ġtr ôi
Ġd án
Ġd jango
Ġd raw
Ġd isplay
Ġch ẽ
Ġch Æ°á»Ľng
Ġn iên
Ġn ạp
Ġp erson
Ġg uess
Ġdá» įa
on es
Ġng ang
Ġr ound
Ġr ượu
er m
ĠlÃł ng
ch alleng
at ure
Ġqu e
st yle
le s
ar it
ĠÄIJ Æ°á»Ŀng
Ġmá» ±c
et we
Ġ( "
ti es
ĠB Ãłi
im ation
Ġá» §ng
Ġf ound
Ġf unc
ro ss
ĠD ense
em ain
em ail
ĠH á»ĵ
Ġ3 6
ex perim
ut f
ĠV iết
ĠA S
ĠA zure
re q
re place
od d
ĠTh á»Ń
ĠL ặp
ĠL STM
om ic
Ġin itial
ag in
Ġw e
Ġw ater
Ġká» ĭp
tr l
Ġ4 8
ĠCh art
Ġcon tin
ap i
hi st
(" /
Ġst udent
ess ages
ĠNg ược
ĠNg ôn
ĠNg uá»ĵn
ĠF oo
ĠPh ản
ĠE n
ĠE r
py plot
") `
') ))
Ġso ft
ĠW HERE
ĠU n
Ġas ync
ĠNó i
ĠKh uyến
ĠKh ợi
ver tices
ach e
Ġj an
pr ess
ff in
def ault
app er
Ġmu ffin
Ġlog arit
ĠSt ep
aly tics
user Id
Ġmodel s
25 5
Ġná» ¥
An not
iti es
---------------- ----------------
CT YPE
cle an
Ġcalculate Average
Ex ception
column s
Ġare a
Ġinter actions
Ġca ffeine
logg er
fact or
Ġdiff iculty
doc s
Ġngá» Ŀ
ls x
ĠOpen CV
tick s
Lin ux
Ġlay er
cudaMemcpy ToSymbol
ĠFit Sphere
rig ation
DO CTYPE
Do uble
viron mental
ĠHam let
fir m
etwe en
emain ing
Ġsoft max
6 9
7 8
8 5
9 7
: ',
= [
> &
A t
C lient
E vent
G R
I I
L T
L i
N o
N et
N um
N ot
O T
P S
P ATH
S A
S p
S elect
S pace
U P
U p
[ $
` );
c ó
d om
e as
e it
f y
f time
f ill
g or
g if
h at
m ar
m ay
n ames
o ver
p g
s orted
u ate
w ay
x lsx
} "
Ċ ĊĠĠĠĠĠĠĠĠĠĠĠ
Ġ ~
Ġ ed
Ġ age
Ġ ),
Ġ Æ°a
Ġ á»ijc
Ġ Ưu
á» ķ
á» Ĺ
á» ķng
Ġt Ãłn
Ġt ermin
Ġc out
ĠÄij áºŃp
ĠÄij Ä©a
Ġv ector
Ġv ariable
Ġh iá»ĩp
Ġl âm
Ġl õi
Ġl ưỡng
Ġs ame
Ġs ort
Ġs lide
Ġs uccess
Ġm iêu
Ġm argin
Ġb ấy
Ġtr áng
Ġd ecimal
Ġch e
Ġch ết
Ġch iết
Ġn Æ¡
Ġn á»Ĺi
Ġn á»ĵng
Ġn ull
Ġp ost
Ġph ó
Ġph áºŃn
Ġkh ao
Ġkh Æ¡i
Ġcá» ı
ô m
Ġsá» £i
ÃŃ n
Ġng on
in stance
Ġr est
Ġr Æ¡i
Ġr ùa
Ġr ectangle
er d
er ate
Ġhá» ıng
or es
at ural
iế ng
Ġx Æ°Æ¡ng
Ġx Ãło
ĠC ùng
ĠC omm
st op
Ġ" ,
al ar
am p
ĠN ode
ĠS ữa
ĠS igmoid
ĠB an
ur op
ĠM ong
ĠM ợ
Ġá» ©c
Ġf ind
ĠD N
ĠD anh
ĠD evice
ĠD Matrix
em ents
ex cel
ed elta
um erate
ĠV Äĥn
ĠV ertex
ĠA g
ĠA pp
á»ĵ i
is c
á»ĩ p
od ym
Ġw rite
if y
us s
ĠCh uyá»ĥn
ĠG it
ĠR h
ĠR andom
hi p
av el
(" \
Ġfor mat
): **
ĠJ inja
ĠI P
Ġ$ {
ĠÄijo Ãłn
ind ices
Ġan alysis
for each
for ward
he alth
ĠU p
to ken
': '
Ġar ticle
com mon
Ġem pty
ser vice
ask a
Ġ12 00
ector y
ari ance
yn ess
per ties
Ch arm
ĠY êu
low er
Ġex cel
ifi ed
Ġ__ ____
sub mit
An alyzer
ÄIJ en
Class ifier
Ġtim edelta
dir name
ĠRe ad
ĠEm ploy
Ġap t
Ġpar am
uff le
ful l
Ġgr ade
mer ge
Ġauto encod
Ġcom ple
ĠÃģ p
ynon ym
Ġup date
Ġtrans form
soft max
Ġelement s
Ar ray
ĠPy Charm
ĠMy SQL
ĠTrá» £
feat ures
Ġhigh est
edu ce
Ġrecommend ed
Item s
gre SQL
bot tom
effic iency
Ġstock s
kw args
Ġlink ed
idd en
ĠBe autiful
giá» Ŀ
vers ion
ĠPost greSQL
ecr et
ĠẠ¤
ĊĠĠĠĠĠĠ ĊĠĠĠĠĠ
So up
ecess ary
imilar ity
uz z
gor ith
odym ium
Ġ______ ____
Ġautoencod er
ĠBeautiful Soup
# ,
( `
0 3
4 00
5 12
A l
B utton
C urrent
C trl
G et
N D
N T
S UM
V ar
V ER
Y ear
[ -
] (
] [
a C
b a
c rease
d d
d um
d escriptions
f id
f ib
f ace
f older
l er
l ate
m ond
m essages
o DB
p k
s ite
s qrt
s hip
t ensor
u py
v ì
v en
v ariable
x l
x x
Ġ ác
Ġ item
Ġ avg
Ġ items
á» §a
Ġt iá»ĩc
Ġt ab
Ġt uyên
Ġt ám
Ġt echnology
Ġc o
Ġc r
Ġc ôn
Ġc all
Ġc orrect
ĠÄij ong
ĠÄij èn
Ġth ô
Ġth ù
Ġth ạo
Ġth oi
Ġv é
Ġv ariables
Ġh elp
Ġl ô
Ġl ượt
Ġl ãi
Ġl aptop
Ġs ing
Ġs ắm
Ġs ys
Ġs ome
Ġs heet
Ġs áu
Ġs ocial
Ġm ore
Ġm aterials
Ġb Ãł
Ġb ây
Ġb á»ijc
Ġb ếp
Ġtr ấn
Ġtr ầm
Ġd river
Ġch áy
Ġn Ãłnh
Ġn ode
Ġn ắng
Ġn eed
Ġp ool
Ġg Ãł
Ġg re
Ġg ame
Ġkh át
Ġng u
Ġng Å©
Ġng uyá»ĩn
in es
Ġr ate
Ġr Ãło
Ġr educe
an not
Ġx Ãł
ĠT ất
ĠT á»±
ĠC an
ĠC am
ĠC uá»Ļc
st om
Ġ` "
le ep
Ġ" \
Ġ" ))
ĠÄIJ Æ¡n
al ity
al anc
Ġmá» Ŀi
Ġmá» ıi
am ily
ĠN Äĥm
ĠS al
ĠS ản
ĠS equ
ĠS UM
el y
ĠhÃł o
it s
it ude
Ġtạ m
im ages
Ġ2 9
ur ch
ĠM á»iji
ĠM ain
ĠM ich
ĠM eta
Ġ' #
Ġthu ê
ec ific
Ġf n
Ġf eb
Ġf eet
ĠÄijó i
ĠD òng
ĠD isplay
Ġ3 1
ex e
ed List
um b
ĠV Æ°Æ¡ng
ĠV á»ĭ
lo ur
un k
Ġlo ad
ad a
ad ata
se arch
ĠL in
om a
Ġw he
", "
Ġ4 5
Ġ4 7
ĠCh ất
ĠCh ia
Ġcon nect
Ġcon tainer
Ġ} )
hi bit
est im
Ġcu stom
ot a
ĠNh áºŃp
ĠNh iá»ĩt
Ġkhá» ķng
Ġfor each
Ġst op
ess on
il k
ĠI t
con n
os h
") )
ers ed
ĠX em
Ġan y
ir d
ir th
ir cle
ĠW al
ĠW aterUsage
ĠO N
ĠO r
ĠO xy
ib le
ax is
ẹ o
num eric
ĠGi áng
Ġpro xy
Ġpro duced
tiv ity
Ġint ernet
Ġi o
com mit
cl ick
Ġ9 0
pr ing
ĠÃ Ĺ
my dict
ear ning
ĠQu ản
Ġim ages
ưỡ i
ari es
ĠÄijá»ij c
ĠÄijá»ij t
ĠIn itial
per ty
Ch art
ĠTá» ·
html top
Ġac tion
Ġac curacy
line ar
der edD
Ġset ting
sequ ences
dat etime
Ġrec ipient
di amonds
Res ult
gr id
use package
Ġjava x
Ph ân
ug h
32 000
Ġsp acy
ĠEm ily
frame work
ix ed
ale s
rop down
mat rix
Gr aph
Ġnhiá»ħ u
Ġtho ải
Ġhe ight
Ġtrain ing
pack ages
task s
Ġgh ép
anc es
ĠSV M
Ġwork sheet
ĠGet Classification
Pr ice
tract ed
coun try
ĠPar is
Ġop tions
Ġdet ect
Ġrequ ired
just ment
ration al
alindrom e
uth or
Ġdate Formatter
Ġslog an
Ġgo al
ĠHttp Response
Ed ge
Ġdevice Type
ĠTrie Node
ĠVin cent
EX T
ĠMulti Index
Ġframe work
week ly
ranch Level
wk htmltop
Ġcontin ue
ĠComm and
ĠMong oDB
ĠẤ n
uzz le
Current Time
fid ence
upy ter
hibit ed
ĠInitial ize
deredD ict
wkhtmltop df
! ,
" }
' '
' t
( ?
) ',
) ):
/ :
0 2
0 4
0 9
2 9
6 8
7 7
: ",
< !
A ll
B M
B ook
B lue
C R
C ore
D E
D P
D S
D iff
D SS
D ataset
E SS
F loat
I r
K EN
L og
M E
M essage
N ET
R ec
S core
S ign
V ec
V iew
\ \
` ),
c ác
c or
c orr
c ise
c ủa
d ay
d isplay
d elete
d aily
f an
f amily
g ing
h pp
i ents
i LSTM
j un
l st
l and
l iver
m al
m ath
n oun
n ormal
p es
p ed
p resent
q id
r en
s ection
s ynonyms
u á»ķi
v ance
w b
x it
y cl
y cop
} }
Ġ êm
Ġ edu
į t
Ġt k
Ġt orch
Ġc ycle
Ġc apacity
Ġc lient
ĠÄij iêu
nh eit
Ġth on
Ġth rust
Ġv ế
Ġv iá»ħn
Ġv oi
Ġv ertex
Ġv ẹn
Ġv ertices
Ġl Æ¡
Ġl am
Ġl eo
Ġl ùn
Ġs pe
Ġs ns
Ġs cikit
Ġm n
Ġm á»Ļ
Ġm ẻ
Ġm uá»iji
Ġm ask
Ġm ake
Ġb á
Ġb Æ°á»Ľ
Ġb ạch
Ġb ạo
Ġb utterfly
Ġtr ại
Ġtr ai
Ġtr ee
Ġd Ãłn
Ġch ải
Ġch ang
Ġch eck
Ġk iá»ĩt
ĠÄijá» Ĺ
Ġnh á»Ļn
Ġn ạn
Ġn ames
Ġp re
Ġp ack
Ġg roup
Ġph a
Ġkh ẩn
Ġcá» ķng
Ġcá» §ng
ê nh
Ġng o
Ġng ặt
Ġng ừa
Ġng á»ĵi
Ġvá» ±ng
Ġr ef
Ġgi Ãł
er o
qu id
an n
ch i
ch ẳng
at bot
Ġqu át
ĠT á»iji
ĠC al
ĠC art
Ġ` /
Ġlá» ĵ
Ġlá» «a
Ġ" #
Ġ" %
á»ij m
th es
al id
et y
et er
et ary
ĠN ow
ĠN OT
ĠS Q
ĠS m
ĠS am
ĠS ort
ĠS ắp
ĠB Y
ĠB Æ¡
ĠB lock
it Æ¡
ai r
ĠP re
ĠP ATH
ĠP erform
Ġ2 8
ĠM atplotlib
Ġ' /
ent ro
ec tions
Ġf alse
Ġf mt
ro und
ro ugh
Ġ| |
() ))
ĠD et
ĠD ãy
em ploy
em pty
ĠH ình
ĠH om
Ġ3 4
ac c
ĠTr ả
int eger
ĠV á»ĭnh
Ġy og
lo or
ĠA p
ĠA mer
re pe
re nheit
ad am
ĠTh ẻ
ĠL ý
om sky
Ġw orld
Ġw hen
ĊĠĠĠĠĠĠĠĠ ĠĠ
ab c
Ġ4 2
ol ution
ol lar
ĠCh iến
ĠG RU
Ġ} }
ord s
ef f
ĠNh ấp
ĠNh iá»ĩm
il le
ĠE ngine
op tions
") !,
our i
ht ag
Ġ7 5
eb r
eb ook
Ġan alyze
pe g
text area
Ġso ạn
Ġchủ ng
str ftime
pro file
ĠO liver
Ġ\ (
to ols
Ġ8 0
all erg
-------- --|
ĠGi ám
Ġpro duction
Ġ20 23
eg s
eg an
ob j
com ment
Tr ait
Ġ9 9
ans as
lic k
ber ri
enti fy
ser ial
ak es
ak ing
Ġe igen
Ġclass ification
AT E
Ġpr imes
ĠEx ample
ĠIn put
ĠâĢ ĵ
input s
Ġ100 00
aw k
ou se
List ener
ific ance
fig ure
atch es
Ġcarbon D
Ġná» Ł
Ġuser name
vel ocity
sub ject
di us
di etary
Ġend l
pos ition
sc atter
sc ala
ick s
Ġal pha
aur ant
Ph rase
af ting
uc k
ĠGiá» ijng
ric tions
uff er
stat s
sp an
Ġtho át
ah renheit
point s
istic Regression
pred ict
Of Type
month ly
Ad d
Un it
met adata
Ġdevices OfType
param s
trib ute
abs path
spe ed
spe ech
Ġsal ad
inner Text
comp ile
chem y
Ġxo ay
ĠSS L
SER T
ĠAs sum
Import anceLevel
KE Y
Rest rictions
vid ia
wr ap
ĠRed is
izz a
Write Line
pet ition
Ġtermin al
urop e
ĠDN MT
ĠAg ile
gorith m
aC y
ycl ing
ycop g
ĠBlock chain
entro py
allerg ens
berri es
dietary Restrictions
" `
( _
) `,
1 80
2 8
2 000
3 5
3 7
4 9
8 6
A I
B ase
C ON
C oreNLP
D D
E qu
F ailed
F LAG
F lour
G MT
H iá»ĩu
H elp
M Wh
M ilk
N O
O IN
P ath
S á»ij
S ort
S ession
T e
T ensor
T ree
T orch
U N
U RL
W idth
Y A
Y OU
] );
a int
a ff
b u
c d
c ateg
d e
d et
d ig
d jango
d raw
e ng
f x
f eedback
f ession
f ield
f stream
g ith
h au
h ash
h old
h ouse
i op
l ing
l ack
m k
m ail
m ulti
m peg
n n
n on
n ch
n é
n vidia
p ower
r us
r ess
r emove
r emaining
s a
s ed
s log
s ocket
t s
u age
v egan
y om
{ {
} ')
Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
Ġ ế
Ġ ab
Ġ av
Ġ áo
Ġ ],
Ġ append
á» ı
á» £i
Ġt úi
Ġc ạn
Ġc át
Ġc ell
Ġc riter
Ġc enter
Ġc ultural
ĠÄij âu
Ġth ánh
Ġth ắt
Ġth ạch
Ġv ú
Ġh u
Ġh ải
Ġh ash
Ġl ánh
Ġl ạm
Ġl á»Ļn
Ġs Ãłn
Ġs ection
Ġm ạn
Ġm ade
Ġm ulti
Ġm áu
Ġm any
Ġm anager
Ġm edian
Ġb ại
Ġb ò
Ġb utton
Ġb order
Ġb lue
Ġb etween
Ġb alanc
Ġd is
Ġd iá»ĩt
Ġd ir
Ġd elete
Ġch ẩn
Ġch ìa
Ġch unk
Ġch atbot
Ġk êu
Ġk ÃŃn
Ġn o
Ġn á»Ļp
Ġp e
Ġp ix
Ġp rev
Ġthá» Ŀ
Ġg e
Ġg ái
Ġg Ãłng
Ġg õ
Ġg ạch
Ġg á»ijm
Ġph ẳng
Ġkh á»Ń
Ġkh iếm
Ġcá» §
Ġcá» Łi
ĠĠĠĠ ĠĠ
Ġdá» «ng
on a
on omic
Ġng Æ¡i
Ġtá» īnh
ượ n
Ġr el
Ġr eg
er ent
er ry
qu estions
an el
an chor
Ġhá» ©a
ch á»ī
at tr
at Flour
Ġx ứ
ĠT Æ°
ĠT in
ĠT ur
ĠT iến
ĠT ìm
ĠT HEN
ĠC ap
ĠC uá»ijn
ĠC all
ĠC á»Ļng
ĠC DSS
st ock
st ants
Ġ` $
Ġlá» Ĺ
le ase
Ġ" .
Ġ" );
ằ n
Ġho án
ĠÄIJ ại
ĠÄIJ áºŃu
Ġsá»ij t
Ġmá» įng
Ġmá» ıng
es h
am s
am pl
am mal
ĠN ile
ĠS inh
au nch
ĠB ình
ĠB ất
ĠB ar
ĠB ánh
ĠB iLSTM
as ur
im m
im ations
ĠP aper
Ġ2 1
ĠM ap
ĠM ont
ay es
ec onomic
Ġá» §
Ġf ib
Ġf eat
Ġf ailed
Ġf req
Ġbá» Ŀ
ĠD ùng
ĠD ocument
ĠD ynamic
em on
em plate
ĠH y
ĠH uấn
Ġ3 7
ex ist
ac ement
ĠTr ans
un t
ion s
id iom
od a
ĠTh ái
Ġin stance
if orn
ab orn
Ġ4 9
ĠCh ÃŃnh
Ġ5 9
Ġcon v
ĠG hi
ĠG DP
Ġ< %
ĠR F
ĠR un
Ġchu á»iji
ip lot
ip pi
iz es
ot s
(" %
ĠNh áºŃn
end s
__ .
il led
pl acement
ĠF ile
ĠF ran
ĠI ron
:: -
ev al
py test
py xl
os s
ĠphÃŃ m
ĠX ây
ir is
'] );
()` :
)) )
pro p
ĠW HEN
ĠW yom
Ġchữ a
ừ u
Ġpro gram
add Document
com ple
Ġimport ance
In stance
Ġ: ,
pr ession
Ġdi amonds
file s
ON E
Ġpr ed
ĠCon vert
ĠEx tract
Ġim pact
Con nection
yn thes
alcul ator
Ġbu ông
St ep
arg v
ĠY ou
Data Frame
error filter
error console
Ġcol lection
á»ĭ a
Ġset up
ert Equ
Ġrá» ħ
row s
Ġsh ould
Ġgá» Ĺ
gr ess
pos itive
load s
ĠAn alytics
iss ippi
Ġjava fx
11 11
SE CR
Ġ> =
ĠData Fr
Ġ25 5
Ġsp aCy
result s
ĠEm otion
tem plate
ĠÄiju a
ommend ations
az on
var List
Ġen umerate
Ġap prox
Count s
bin ary
sp ect
sql ite
Gr id
Gr ade
RE E
run time
ĠKho a
33 3
ĠPy Torch
CC ESS
TO KEN
kh ông
iter ator
ĠCol umb
tim izer
ĠHá» Ĺ
Ġwork book
Nh ân
Ġne ighbour
char acter
ĠLa Te
Gi ao
Ġhigh er
ĠRes ponse
Ġrecommend ations
VB N
Ġcomm it
urs ive
yd ro
idd le
Ġrequ ire
animal s
alindrom es
TH REE
Ġtensor flow
Ġchar acter
Ġrequest s
fr uit
rad ius
Ġcur sor
ĠMiss ouri
ĠMiss issippi
Sub Element
mut ated
Tag s
squ ared
anth a
ĠMag na
ĠLog isticRegression
lank Int
ross entropy
firm ation
LT K
Li quid
ĠRh ine
yness Trait
SUM ER
mond Milk
Ġngu á»Ļi
ĠMich el
estim ator
Ġspe ed
ĠCart a
ĠSam antha
ĠAmer ica
repe ating
Help Formatter
YOU R
gith ub
hau st
Ġế ch
Ġpix el
asur ements
ĠWyom ing
ynthes is
ertEqu als
SECR ET
ĠDataFr ames
ĠEmotion Counts
ĠColumb ia
ĠLaTe X
! "
% =
( ",
) (
) }
, %
. *
/ %
/ .
0 7
3 00
7 00
: $
: ]
= =
A B
A PI
A lt
A pp
B ack
B ob
B lob
C RE
C apacity
D NA
D raw
E CV
F ound
G ener
H T
H Ã
I T
I t
J S
K iá»ĥm
M A
M D
M ath
M ode
M ATLAB
N S
N g
O ver
O bject
P P
P R
P erform
S V
S ocket
T ừ
T otal
T emplate
U LL
V e
V ector
V ariable
[ ['
a ft
b á»Ļ
b le
b ind
b ase
b lob
c in
c orrect
c rossentropy
d istrib
e es
e urope
f ac
g es
g res
g uess
g estions
g ba
h ic
h ello
i od
i êm
i eve
k ansas
l Ãłm
m p
m ig
m ass
m ak
m ask
m ake
m edian
o ice
p u
p time
p air
r ize
s ess
s ns
s mart
s park
s ynonym
s imilarity
s ycopg
t en
t ab
t ree
t wo
u um
w are
x e
x i
y text
} )
¥ ng
Ġ ul
Ġ one
Ġ epoch
Ļ i
á» ·
Ġt an
Ġt ag
Ġt uyết
ng Ãły
ng Æ°á»Ŀi
Ġc ay
Ġc ầm
Ġc Æ°ng
Ġc url
Ġc ategory
Ġc lean
ĠÄij ai
ĠÄij ắn
ĠÄij ạp
nh anh
Ġth ả
Ġv inh
Ġh Æ°
Ġh Æ°á»Ľc
Ġh Æ°u
Ġh ót
Ġl y
Ġl an
Ġl ân
Ġl áºŃn
Ġl ib
Ġl ầm
Ġl éo
Ġl earning
Ġs ô
Ġs qu
Ġs ur
Ġs ôi
Ġs om
Ġs úp
Ġs ystem
Ġs ample
Ġs rc
Ġs ynonyms
Ġs atisf
Ġs oda
Ġs izes
Ġm ut
Ġm ath
Ġm ark
Ġm ùi
Ġb uá»ĵn
Ġb ase
Ġb ảy
Ġb ook
Ġb lob
Ġd ược
Ġd es
Ġd Å©ng
Ġd elta
Ġd ictionary
Ġd ropdown
Ġch ánh
Ġch ấn
Ġch áºŃu
Ġk n
Ġk ì
Ġk ia
ĠÄijá» ©c
Ġnh ạt
Ġn ạ
Ġn Æ°á»Ľ
Ġn ecessary
Ġp ound
Ġp astParticiple
Ġp izza
Ġp sycopg
Ġg ender
Ġg lobal
Ġkh en
Ġkh ôi
Ġkh éo
Ġdá» Ļi
Ġng Æ°ng
Ġtá» ıi
in ed
in ce
in ct
in sert
Ġr ele
Ġr èn
er os
er cur
er ial
qu et
qu anti
an ia
at ost
Ġx á»ij
Ġx ticks
en n
ĠT ải
ĠT iết
ĠT inh
ĠT EXT
ĠC Ãł
ĠC ú
ĠC ấu
st andard
Ġ` (
Ġlá» ıng
Ġchá» iji
Ġ" /
Ġ" ";
Ġtrá» ħ
Ġtrá» įn
ĠÄIJ ã
ĠÄIJ ặc
ĠÄIJ iá»ĩp
th od
al i
al k
al ia
al ign
ĠtÃŃ m
Ġmá» ī
Ġmá» ĩt
et ri
ĠN A
ĠN a
ĠN e
ĠN o
ĠN á»Ļi
Ġ( \
ĠS p
ĠS py
ĠS entiment
ĠS EO
ĠS urvey
el o
ti x
Ġthe y
ĠB ữa
ĠB oost
ĠP lot
Ġ2 6
ĠM ar
ĠM Ãłu
ĠM Wh
ĠM YA
ang uage
ang elo
ic tions
Ġ' '
Ġ' -
Ġto ken
Ġthu ế
Ġthu á»ijc
Ġf oss
Ġbá» įc
ro le
ĠD Æ°Æ¡ng
ĠD ate
ĠH ar
ĠH á»Ļi
ĠH á»Ļp
ĠH ydro
ex port
ex haust
ed i
ac tic
ac uum
ĠTr ang
ĠV Ãło
00 1
ĠA R
ĠA MD
re st
re al
Ġlo ss
is ual
id er
id end
ĠTh ao
ĠTh Æ°á»Ŀng
ĠTh áp
ĠL ên
ĠL ou
ĠK ÃŃch
Ġin st
ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ
tr ung
tr ies
Ġxác h
us ers
ab oost
Ġ4 00
ĠCh o
ĠCh ó
ĠCh ế
ĠCh ạy
Ġo z
Ġo per
ort c
Ġcon cept
ce an
ĠÄijá»ĵ i
ĠR oth
ig Decimal
ul a
Ġchu ông
Ġ# [
est amp
á»į i
Ġ[ [
Ġ[ ],
ist inct
Ġthá»ĭ nh
ĠNh a
Ġst ack
ter n
pl ied
ĠF ind
ĠI f
ĠI Classification
ĠPh iên
ĠPh im
put s
Ġkho ai
ĠE th
ĠE iff
ĠE ND
ev ent
op y
op ing
Ġvụ n
os ine
') [
Ġ7 3
Ġan imal
Ġ10 9
oun try
)) (
ĠU b
ĠO R
ĠGi áo
Ġpro perties
Ġ20 15
add Child
Ġar r
act ual
com e
cl f
In valid
Ġprint s
20 22
col lect
pr iority
enc ies
ff f
ens ity
ak a
ĠâĢĭâĢĭ âĢĭâĢĭ
Ġre ply
10 1
Ġ12 3
++ ,
par ser
ari o
Con stants
Ġlog istic
St ate
Ch omsky
ĠY ếu
ĠSt ock
rel ation
aw ait
ell ant
io us
"> </
fig uration
element s
append Child
eth od
ỳ nh
Th is
sub plot
Ġrec ent
ĠAd aboost
NN P
An d
Ġusage Data
gr ade
Ġun n
Ġun der
Ġstat us
sc ale
sc ores
ĠAn imal
arr is
Ġresult s
ug gestions
Ġau th
Ġ14 7
dir ectory
ĠBr az
Ex cel
af ety
ik e
ĠRe place
order ed
ĠOutput s
Input Stream
Ġax it
Ġpar se
IN SERT
Pro perty
vert ex
Count Array
mit o
ĠAl aska
>> >
Fact or
rec ursive
Ġpos ition
ĠÃģ nh
Ġhe ad
Ġhe ap
TP H
Ġtrans action
Ġgh é
amb i
Col or
Im pact
Wh at
ĠKho ảng
Pos itive
ĠMy Model
ĠAr kansas
kh ách
ĠSV G
ĠthÆ¡ m
Ġdiff erent
char CountArray
ĠÃĶ ng
document Id
coun ter
met a
lin es
Ġcount s
verb s
Sc alar
Ġrev iew
indent ation
tick labels
Stock s
Stock Data
hen es
Ġcat s
Ġsal ary
ĠIN TO
------------ --|
Ġbin a
imple json
oph y
Ġpriority Filter
IO Error
OU NT
diff iculty
Ġir rigation
ĠSS I
ĠLu ôn
ĠFl ask
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ
Ġev ent
ĠLat inh
ĠRob o
ĠRob ert
Ġplan et
Ġmetric s
mod ified
Ġcal o
orest ation
child ren
asc ade
ĠAm azon
local host
decision s
Ġsmartph one
anufactur er
del iv
yt osine
challeng es
experim ents
agin ation
No am
Sp ecific
eas y
ĠEmploy ees
dum ps
ĠLin ux
Ġwhe els
ĠOr deredDict
Ġsetting s
ĠbÆ°á»Ľ m
ĠCal iforn
employ ment
Ġyog a
ĠAp ple
Tensor Board
bu ild
Ġcriter ia
Ġhu ỳnh
ĠCap tain
ĠDynamic Row
emon ic
unt u
ĠRF ECV
ĠMichel angelo
Perform ance
Vector izer
smart indent
ĠnÆ°á»Ľ u
atost henes
Ġxá»ij p
ĠSpy der
Ġfoss il
ĠRoth ko
ĠEiff el
! ");
" ])
" };
) *
) ])
) ];
+ ----------------
. _
. ).
/ `
2 80
2 24
4 7
5 3
5 000
6 7
7 9
8 9
= $
A G
A L
A M
A U
A s
A LU
A CCESS
B ạn
B ar
C O
C r
C ode
C ategory
C ycle
D T
D ER
D escription
D river
E D
E LECT
F ROM
F uel
G ET
H ạn
I P
I ST
I TC
J OIN
L S
L o
L en
L abel
M ax
M ade
M AR
N e
N egative
O ther
P Y
P oint
P TO
P alindrome
Q ue
R B
R ep
R aw
S al
S á»±
U S
V P
V erb
V ariables
Y ield
] :
_ `
b ao
c ô
c er
c ùng
c ase
c ycle
d im
d ro
d ocker
d ytext
e get
f h
g g
g ed
g ame
g end
g ray
g lobal
h Ãłnh
h ite
h idden
i ation
i tions
i xt
j it
j ax
j unit
k in
l ated
m n
m ạnh
m ark
m ovie
m anufacturer
n one
n pos
n egative
o e
o y
o ist
o ther
p d
p o
p ng
p us
p ens
r m
r is
r ations
r ectangle
r ases
r apper
s w
s es
s ers
s ci
s ecret
s ynthesis
t ail
t witter
t uple
t á»ķng
u tions
v as
v est
v ariables
v ille
v ania
v acuum
w n
w ood
w here
x ide
y y
y label
z y
 °
à ģ
Ġ ag
Ġ app
Ġ óc
Ġ actual
ij t
á» £
á» ©ng
Ġt ò
Ġt á»Ļc
Ġt ia
Ġt óc
Ġt ons
Ġc l
Ġc anh
Ġc lo
Ġc ap
Ġc ode
Ġc ấm
Ġc lose
ĠÄij ắm
Ġth ÃŃ
Ġv a
Ġv Æ°Æ¡ng
Ġv õ
Ġv ạch
Ġv iá»ģn
Ġv ous
Ġh am
Ġh ang
Ġl ò
Ġl át
Ġl ắp
Ġl ast
Ġl ưỡi
Ġs m
Ġs ên
Ġs ay
Ġs ol
Ġs urv
Ġs qrt
Ġm Æ¡
Ġm ò
Ġm âu
Ġm óng
Ġm ode
Ġm óc
Ġm anufactur
Ġb ác
Ġb el
Ġb ot
Ġb ãi
Ġb irth
Ġtr iết
Ġtr ắc
Ġd iá»ĩp
Ġd âng
Ġd ẹp
Ġd type
Ġd uration
Ġch úc
Ġch ẵn
Ġch ói
Ġk ẹo
ĠÄijá» «ng
ĠÄijá» £t
Ġnh á»įn
Ġnh iếp
Ġn âu
Ġn ảy
Ġn ous
Ġn egative
Ġn itÆ¡
Ġp atches
Ġg ener
Ġph oto
Ġkh ôn
Ġkh iếu
Ġkh á»ijc
Ġcá» ¡
ê t
Ġdá» įn
Ġdá» ĵi
Ġdá» ĩt
ÃŃ a
Ġtá» įa
in s
in ity
in itial
Ġvá» Ĺ
Ġvá» £t
Ġr á»ijt
Ġgi ảng
er l
er age
qu estion
or ing
ch eck
at us
Ġx ÃŃch
Ġx ấu
Ġx ạc
en ance
en ium
en ns
ĠT ình
ĠT am
ĠT Ãłi
ĠT om
ĠT uyên
ĠT á»ijc
ĠT ạp
ĠT otal
ĠT á»ĩp
ã nh
ĠC A
ĠC á
ĠC arbon
ĠC ycling
st ore
Ġ` {
Ġlá» ĵng
le gend
Ġcho ice
Ġho ãn
ĠÄIJ i
ĠÄIJ á»ģ
ĠÄIJ Æ°a
ĠÄIJ á»ķi
ĠÄIJ á»ĵng
th is
al pha
al chemy
am ount
et c
et ings
ĠN i
ĠN Æ°á»Ľc
ĠN ature
ĠN LTK
ĠN ULL
Ġ( !
Ġ( (
ĠS er
ĠS an
ĠS elect
ĠS yd
ĠS aaS
ĠS ELECT
el ium
au t
ti f
ti an
ti dytext
ĠB á»Ļt
ĠB ao
ĠB ayes
ĠB igDecimal
as ma
it c
it ory
ai m
ai ve
im it
im um
ĠP l
ĠP aaS
ĠM a
ĠM in
ĠM an
ĠM odel
ĠM èo
ĠM ercur
ay point
ent in
ent Class
Ġthu ẫn
ec ure
Ġá» ĵn
Ġf l
Ġf t
Ġf un
Ġf oot
Ġf ibonacci
Ġf loor
ĠD at
ĠD ec
ĠD ak
ĠD rop
ĠD ictionary
Ġra dius
em ber
ĠH e
ĠH ải
ĠH Ãłng
ĠH Æ°á»Ľng
ĠH arris
ex cept
ut or
ed ge
ed Reader
ac cess
um ber
ĠTr ân
ĠTr Æ°á»Ŀng
Ġ{ %
ẫ y
ĠV áºŃt
ĠV id
ĠV òng
lo ud
lo ader
lo ss
ĠA t
ĠA vent
Ġkhi êm
re w
ad or
id es
id get
ĠTh á»ĥ
se a
se lection
ĠL e
ĠL ấy
ĠK iến
ĠK ub
tr ue
ab in
ab ama
Ġ4 1
Ġ4 3
Ġ4 80
ol in
ame thod
ĠCh ild
Ġo b
Ġcon fidence
ĠR au
ĠR obot
ĠR oma
Ġchi p
Ġ+ +
Ġnhá» ±a
av or
Ġ[ {
ist akes
Ġcu á»Ļn
Ġcu da
(" |
(' /
ĠNh iá»ģu
ĠNh úng
ẻ o
end ing
Ġfor m
ĠNg ôi
ĠF rame
ĠF unction
ĠF arm
Ġ$ ('
Ġkho áng
op er
con cent
Ġ6 1
oc io
os itory
") );
ĠX uất
ĠX GB
') `
get line
get opt
eb ug
Ġan om
str action
str uct
str ptime
'] ),
Ġreturn s
ath on
pro ps
ĠW il
ĠW rite
ĠU sing
ĠO k
ĠO bject
ĠO ne
ĠO cean
Ġ\ *
Äij Æ¡n
ĠGi ấc
ĠKh ó
ĠKh ám
Ġpro ject
Ġpro ton
Ġpro hibited
Ġpro fession
tiv ities
Ġ20 21
add Event
Ġar ma
ct or
tic al
In sert
ach ine
Ġ% ></
form atter
pr imes
ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ
Ġ== =
me asurements
enti fic
Ġnew Document
ument s
li ke
Ġbá»ı ng
my data
sh uffle
Ġre ader
Ġdef orestation
Ġpr ec
Ġval id
++ .
++ ;
Ġres pon
Ġres hape
par sers
ari an
Con text
Con tro
Ġlog ging
St age
back s
ĠY elp
new s
new line
Data Lo
Ġô m
ov ariance
ĠHo ạt
sum er
sum mary
Ġex ist
io xide
Ġchú a
The o
vector s
Ġfile s
color s
Ġná» ©t
eth ing
Th u
Th ông
key word
table s
ĠLá» ħ
ĠLá» Ŀi
ĠLá» ĭch
head ers
sub str
sub process
([ [
ink edList
learn ing
An alysis
NA P
di ag
gr aph
Ġtotal ImportanceLevel
sc ene
zip ped
Ġ> >
Ġat tribute
Ġal t
Ġal gorithm
not es
Ġhy dro
Ġpip eline
pip eline
yl vania
ĠRe LU
Ġarg uments
ụ ng
az z
ric s
Ġen vironmental
Ġap r
Document Builder
arm a
down load
ĠAl abama
Ġgr id
Ġopen pyxl
mat lab
Ġ-- >
Ġtho ảng
Qu ery
Ġgh ế
Im age
Ġmet a
Print f
ty pes
AR CH
CC CC
Ġdataset s
tim estamp
ĠTruy á»ģn
>< %=
book s
Ġad jective
Ġad justment
Ġmẹ o
Ġne odymium
char set
Gi á
dec ode
inter cept
Pr ess
document s
met rics
arch ive
link s
ĠNum ber
gen ome
Ġcomm and
Ġrev ersed
Ġiter able
group by
CA SE
Or igin
Ser ver
Ser vice
Ġser ver
query set
ermin er
ĠIN T
ĠWord Press
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
TH ON
Ġmar athon
Ġbin s
Ġchar set
ĠSc anner
encod ing
Sh ift
fl avor
pre process
Ġtem p
Ġslog ans
requ ire
ĠUser Guess
Trans action
ernet es
SER VER
Ġpoint s
anceLevel s
Char s
ke ep
Ġse aborn
ĠLat ex
convert ed
Ġ%> %
Ġdefault dict
Ġmethod s
istrib ut
Ġcor relation
Ġhist ory
Ġhist orical
Ġpop ulation
Ġpresent ation
Ġfig ure
Collection s
Ġsmartph ones
Search CV
Annot ations
vironmental Impact
Not Found
mar tian
uss ell
Ġparam eter
Ġcomple tion
Ġlaptop s
Ġsing ular
Ġneed ed
ĠCan ada
ĠSequ ential
urch ases
ĠMeta Data
ĠWal rus
ĠOxy gen
Core Annotations
Log ger
Sign ificance
Ġchang es
Ġnames pace
Ġref erence
ann els
ĠSQ A
ĠSm ith
ĠPre process
ĠHom o
ĠcarbonD ioxide
uffer edReader
speech Text
ĠAssum ing
CON SUMER
categ orical
dig its
né e
Ġav erage
Ġbalanc ing
Ġpe ak
ampl ing
ĠBar cel
ĠPaper Made
ĠRun ning
ĠFran c
prop ellant
Ġcollection s
Ġapprox imations
distrib ution
fac es
mig rations
Ġsom ething
idend Yield
ĠUb untu
TPH ONE
ambi ance
ophy ll
deliv ery
Specific Category
ĠCaliforn ia
Description HelpFormatter
MAR TPHONE
PTO P
Que ue
Rep ository
Raw DescriptionHelpFormatter
gg plot
ixt ure
oist ure
pens es
enns ylvania
ĠSyd ney
Ġfun ctor
ĠDak ota
ĠVid alia
ĠAvent ador
ĠKub ernetes
concent ration
ocio economic
ĠXGB oost
addEvent Listener
DataLo ader
vironmentalImpact Analyzer
NotFound Error
ĠPaperMade Item
! /
! --
% '
% (
% )
' "
( &
( __
( {'
) `.
* \
. ),
0 8
2 25
2 70
3 9
3 65
6 3
8 7
8 00
9 55
: .
= \
> (
> ,
> ()
? ",
A b
A x
A uthor
B ranchLevel
B lack
C G
C ác
C ải
C all
C ourse
D ish
D ots
D istribut
E P
E ach
G A
G en
H R
H and
H ãy
I S
I ter
I di
J ob
J oe
L M
L e
L at
L á»Ĺi
M on
M ap
M iá»ģn
M uff
M ethod
O O
O ne
O atFlour
P al
P ay
R un
R ect
R andom
R ank
S ản
S ection
S ampling
S MARTPHONE
T F
T iêu
T ub
T witter
T weet
U TF
V alid
W OR
W idget
Y Y
Y our
[ #
[ (
[ ::-
] `.
] ))
] ])
_ ,
_ ['
a ar
b w
b all
b oost
b box
c a
c an
c ircle
c loud
d anh
d Æ°á»Ľi
d yn
d evel
d ee
d Of
d uration
e q
e an
e ep
f n
f ter
f ree
g am
g ument
g enerate
h ình
h om
h igh
h older
l Ãł
l ong
l ad
l ator
m us
m atch
m aterials
m iddle
m istakes
n x
n ai
n av
n ess
n eed
n odes
n atural
o z
p m
p ad
p age
p print
p pt
p ose
r al
r am
r ide
r strip
s i
s in
s end
s á»±
s ức
s ound
s igmoid
s ource
s chem
s leep
s ible
s ider
s aka
s uggestions
t oc
t á»ijt
t utor
u k
v Ãł
v im
v oid
x ticks
y ellow
z e
{ \
} /
} \
} `
} {
¥ i
Ċ Ċ
Ġ ;
Ġ u
Ġ ĊĠĠĠĠ
Ġ ext
Ġ ..
Ġ á»ijng
Ġ ];
ĭ n
Ĺ ng
Ł m
á» ±c
á» Ŀi
Ġt e
Ġt i
Ġt ân
Ġt á»Ļi
Ġt ẩy
Ġt òa
Ġt ặng
Ġt witter
Ġt uple
Ġt wo
Ġc ity
Ġc arb
Ġc alcul
Ġc ắm
Ġc atch
Ġc ourse
Ġc ircle
ĠÄij an
ĠÄij úc
ĠÄij áy
ĠÄij ùa
nh ững
Ġth Äĥng
Ġth ai
Ġth ere
Ġth uyá»ģn
Ġth rough
Ġv ay
Ġv ec
Ġv ượng
Ġv ắng
Ġv Ä©nh
Ġh i
Ġh áo
Ġh âm
Ġl esson
Ġs a
Ġs ent
Ġs port
Ġs ắt
Ġs ét
Ġs cript
Ġs udo
Ġs earch
Ġs ections
Ġm im
Ġm od
Ġm us
Ġm ap
Ġm á»Ļc
Ġm òn
Ġm ượt
Ġm odule
Ġm ặn
Ġm atrix
Ġm ovie
Ġm achine
Ġb r
Ġb ó
Ġb ar
Ġb Äĥm
Ġb ool
Ġb ody
Ġb oth
Ġb ranchLevel
Ġtr ần
Ġtr ạm
Ġtr avel
Ġd ải
Ġd ai
Ġd em
Ġd est
Ġd Æ°a
Ġd escription
Ġd aily
Ġd ollar
Ġch ai
Ġch anh
Ġch ìm
Ġch alleng
Ġch ênh
Ġk il
Ġk ép
Ġnh ược
Ġnh ánh
Ġn ại
Ġn á»į
Ġn Ãłng
Ġn át
Ġn ow
Ġn lt
Ġn odes
Ġp age
Ġp ot
Ġp ast
Ġp atter
Ġp alindromes
Ġthá» į
Ġthá» Ľt
Ġg Æ°Æ¡ng
Ġg om
Ġph o
Ġph ác
Ġph ô
Ġkh uất
ô gam
Ġsá» ©
Ġsá» §a
Ġng ẫ
Ġng Ãło
Ġng á»±a
Ġng ụ
Ġr ai
Ġr ung
Ġr and
Ġr á»Ńa
Ġr ender
Ġr emove
an et
an um
an na
an alysis
Ġhá» ©c
or igin
or ies
ch es
ch ed
at o
Ġqu Ãł
Ġx en
en ate
en ue
en oid
ĠT iá»ĥu
ĠT âm
ĠT iá»ģn
ĠT uá»ķi
ĠT AB
ĠC O
ĠC ar
ĠC ái
ĠC ảnh
ĠC ount
ĠC arg
ĠC PU
ĠC á»ķ
st one
Ġ` !
Ġ` +
Ġ` ~
Ġlá» ij
Ġlá» ©a
le vance
Ġchá» ijt
ar th
ar ange
Ġ" $
Ġ" :
á»ij n
Ġho st
Ġho ảng
Ġho urs
ĠÄIJ a
ĠÄIJ ến
ĠÄIJ ức
al ph
al ies
al ized
Ġmá» ¡
Ġmá» ĭn
es erial
et work
et rize
ĠN P
ĠN ữ
ĠN Äĥng
ĠN ob
ĠN âng
ĠN eed
ĠN aive
ù m
ĠS ai
ĠS tr
ĠS ol
ĠS he
ĠS elf
ĠS ức
ĠS ave
ĠS áu
ĠS pace
ĠS park
ĠS imple
el ocity
el enium
ti êu
ti ce
ti fic
Ġthe ano
ĠB ên
ĠB ãi
ĠB ợi
ĠB itc
as htag
it o
it r
it at
Ġ- --------------------------------
Ġngh iá»ĩt
Ġngh iá»ģn
im ary
ĠP r
ĠP an
ĠP ark
ĠP CA
ĠP lease
ĠP erl
ĠP ennsylvania
ĠP EP
Ġ2 7
Ġ2 50
Ġ2 24
ĠM ức
ĠM ario
-- -
Ġthu a
Ġá» §y
Ġf r
Ġf ill
Ġf etch
Ġf ixed
Ġbá» ī
Ġbá» ¥i
Ġ| ----------|
ĠnÄĥng TÃŃnh
Ġgiá» įt
ĠD ecimal
ĠH iá»ĥu
ĠH ạt
ex tr
ing le
ac ond
ac ecr
ac tice
um e
ĠTr ÃŃ
ĠTr ải
Ġ{ {
ĠV e
ĠV ùng
ĠV ượt
ĠV ARCH
00 000
un wrap
ĠA i
ĠA ng
ĠA uthor
ĠA xit
Ġkhi êu
re ed
re levance
Ġlo c
is m
is instance
is Palindrome
od b
ĠTh ượng
ĠTh ủ
ĠTh á»ijng
ĠTh uyá»ģn
Ġquy á»ĩn
ĠL et
ĠL ine
ĠL ast
ĠL aw
ĠL á»±a
ĠK inh
ĠK á»ĥ
ĠK us
Ġin crease
Ġw ant
us ion
ab a
ab r
ab v
ab il
ab itat
ol a
Ġphá» ķi
ĠCh uá»iji
Ġ5 5
Ġcon tain
Ġcon vert
Ġcon cat
ĠG reen
ĠG ather
Ġ< !--
ĠR emove
ĠR UN
ĠR ussell
---- ---|
hi o
hi ch
Ġchi ld
ĠcÆ¡ m
âĢ Ķ
av erse
Ġ[ ];
ot enoid
ass ertEquals
ef ined
ĠthÆ° a
ĠNh á»ĭ
). __
ĠNg ân
ĠNg á»±a
ter s
ter ate
ĠJ son
ĠJ upyter
Æ°á»Ł i
pl ash
pl ication
pl anet
pl abv
ĠF ast
ĠF ilter
ĠF LAG
ĠI d
ĠI Python
ĠI BM
ĠI terate
:: {
ĠE lement
ev er
ĠÄijo an
Ġxá»Ń a
") =
Ġan not
Ġan imation
for Each
rom e
'] }
'] }")
Ġhá»ĵ ng
ĠU t
=" /
ĠO ut
ĠO hio
Ġ\ \
Ġ8 1
Ġ8 4
Ġ8 00
Ġnum s
out er
Ġtu abin
Äij á»Ļng
set O
set Request
urr ed
Ġvi êm
ĠKh ai
ele s
ele ted
Ġpro t
Ġpro fit
Ġdata frame
Ġint eger
Ġ20 18
sv m
res net
Tr ắng
Tr ừu
Ġimport anceLevels
In ternet
In formation
In crease
log in
Ġ% (
ans wer
cel ls
Ġlu á»Ļc
Ġkhó i
ĊĠĠ ĊĠĠĠ
ep i
df kit
ser if
ens ion
Ġe ngine
yst al
my string
my Var
Ġre placement
Ġwith in
pon der
ph ần
Ġpr imary
ace holder
Ġ12 8
ĠQu estion
Ġim pro
LA PTOP
Con tainer
yn t
12 5
Ġmu á»Ĺ
Ch úng
ĠTá» ª
ond on
ĠY ah
âĢĿ ,
ĠDo e
ĠDo anh
ĠDo uble
rel ations
Ġex cept
ĠchÃŃ n
19 50
Ġ19 60
Ġor igin
Ċĉĉ Ċĉ
Ġrá» ¥ng
Ġrá» Ĺng
Ġsh ow
Ġtuy á»ĥn
Ġit s
Ġuser Preferences
Ġ18 0
Ġrec ord
ĠAd just
([ ('
lay out
ÄIJ á»Ļng
To String
Us ers
next Double
Ġstr uct
ĠAn d
ref ix
ick en
ox es
Ġat tr
Ġcan xi
Ġmy sql
Ġmy Var
($ "
let ter
Ph oto
br br
wit ch
div is
Ġsc anner
Ġsp ent
Ġsp acecr
Ġbe en
Ex penses
af e
ran k
Input Size
RO UP
tem p
tain s
uc umber
ee k
Ġen zy
En dOf
IN G
ys ical
Ġsub set
ĠAc tix
do anh
sp ec
sp ace
Ġpl ural
Ġpl asma
Ġpl aceholder
mer ged
red ict
red ients
sol d
sol ute
Ġpos Tags
try Insert
Ġcolor s
EN T
np m
Ġtrans port
Ġkey word
Ġkey words
ĠChu ẩn
Ġmet an
ĠCU RL
Ġinter est
Ġinter pol
Ar ticle
Ar gument
ĠAr ial
kh u
rand int
ĠSV C
iter items
45 6
response Option
ploy ee
Nh áºŃn
Time Distribut
cent er
gi ả
Ġad jectives
Ġrun es
Gi ảm
lat itude
odes ic
util s
Ġtask s
Ġlong est
ĠRes ponder
coun tries
param etrize
44 955
VB Z
cc c
ky o
trib ution
create Element
pop o
pop ulation
Ġcomm on
Ġrev erse
effic ient
CA P
Or iginal
kw im
query Select
Ġ#{ @
ĠWeb Socket
ĠStanford CoreNLP
------------ -|
Ġdec ision
ĠSc ala
ĠPost gres
oph one
72 6
AN D
AN F
diff erence
rad io
tag s
Ġet c
Ġgo es
---| ---|
unit s
Ġind ices
ĠGr id
ĠGr aph
With Pos
sl ice
ĠMark down
Default Name
Ġselect ed
ĠText Blob
icode Scalar
setting s
Ġprocess ed
Com petition
My Product
cap tion
fetch all
ko kwim
Ġam ount
erm an
challeng e
experim ent
ĠUn icode
Ġed ge
Ġsuccess ful
isc o
ĠUp date
token ize
submit Button
Al mondMilk
Ġ45 6
Ġcustom ers
Book s
Blue berries
Ir rational
Ġtk inter
Ġmn emonic
Ġngo an
round ed
Ġ}} </
eff ort
Ġeigen vectors
KEY WOR
iop ia
mk dir
multi ply
Ġhash lib
questions Table
ĠMont ana
Ġủ i
exist ing
eval uate
ĠYou Tub
character istics
Gener ic
Over ride
pair plot
Ġepoch s
etri eve
ĠEth iopia
subplot s
Ġheap q
Positive Feedback
ĠpriorityFilter Value
OUNT IF
ALU ES
Cr ystal
Other Service
sci entific
Ġcl f
Ġsol id
ĠTam popo
ĠMercur ial
Ġfl ask
ĠHarris on
Ġ$(' #
Ġrespon ses
THON PATH
ĠFranc isco
Ax es
Hand ler
Idi om
Muff ins
Valid ation
dee plabv
long itude
nai re
tutor ial
vim rc
Ġmus ique
Ġkil ôgam
Ġnlt k
Ġngẫ m
ĠTAB LE
ĠCarg o
ĠBitc oin
Ġ--------------------------------- ----------------
acond a
ĠVARCH AR
ĠLine ar
ĠLaw r
ĠKus kokwim
Ġcontain ing
Ġconcat enate
otenoid s
ĠNhá»ĭ p
Information Unit
Ġmuá»Ĺ ng
ĠYah oo
Ġspacecr aft
Ġenzy me
EndOf Word
TimeDistribut ed
44955 726
querySelect or
KEYWOR DS
ĠYouTub e
! ")
! ";
" ):
" `.
# :
' `,
' },
( *
( \
) ^
) ).
) ").
* )
+ )
. </
. âĢĿ
/ {
/ ',
0 6
1 000
1 10
1 50
1 40
2 6
4 32
6 1
9 4
: /
: ");
< <
= {'
> ::
> ();
? ('
? ");
A A
A m
A uth
B U
B ird
B lankInt
C Æ¡
C ông
C at
C reate
C NN
C orrect
C uá»Ļc
C annot
C OUNTIF
D anh
D isplay
D TC
D Trans
D ATE
E F
E G
E m
F P
F i
F irst
F orest
F mpeg
G ROUP
H A
H á»
H Æ°á»Ľng
H ttp
H á»Ĺ
I C
I KE
J J
L oc
L aptop
L esson
L egs
L anguage
L inkedList
M M
M ặt
M ass
M atplotlib
M any
M ammal
M oisture
M ENT
N P
N oun
N odes
N ING
O p
O per
P G
P l
P aper
R ed
R ap
R ef
R ace
R NN
S I
S ai
S ur
S om
S á»Ń
S ystem
S uper
S ynonyms
S ource
S urvey
S ecret
S pring
T k
T op
T itle
T á»ķng
U C
V ery
W AR
W rapper
X Y
X ác
X in
Y THONPATH
\ ./
] "
] ):
] `,
a ffe
b o
b ằng
b ur
b order
b etween
b irth
b sa
c k
c âu
c ream
c std
c ss
c apacity
c ourse
c ultural
c pu
c ascade
c ytosine
c ending
d ed
d ense
d ynamic
d ollar
e in
e igen
f alse
f oot
f lat
f ish
f requ
f req
f ixture
g d
g n
g hi
g ender
g oogle
h or
h á»ĩ
h and
h elp
i ó
i ence
j pg
j upyter
l on
l ation
l ific
l ug
l az
l aptop
m as
m se
m ag
m acOS
m aries
n d
n y
n th
n es
n il
n ium
n Question
p ile
p ast
p astParticiple
p agin
p urchases
q a
r d
r anh
r id
r ist
r date
r aph
r ates
r avel
r aries
r gba
s k
s ẽ
s ect
s ample
s Formatter
s ymbol
s lide
s elenium
s afe
t x
t or
t ừ
t á»ĩp
t DNA
u á»Ĺi
u ard
v g
v Äĥn
w as
w args
w ait
w ise
w alk
w hite
x ticklabels
z eros
} '
¹ ģ
à Ģ
à Ĭ
Å ©a
Ï Ģ
á ¹ģ
ð Ł
Ġ q
Ġ Ċ
Ġ ong
Ġ uy
Ġ ĊĠĠĠ
Ġ ân
Ġ ao
Ġ ion
Ġ om
Ġ uá»ijn
Ġ enc
Ġ ign
Ġ enter
Ġ ........
Ġ qid
Ġ encoding
Į N
Ķ NG
Ń ng
á» ¡
á» ħ
Ạ¢
Ġt ông
Ġt ấu
Ġt ẩm
Ġt ense
ng oại
Ġc Ãłnh
Ġc map
Ġc ountry
Ġc ovariance
Ġc types
ĠÄij Ãł
ĠÄij un
ĠÄij ÃŃnh
Ġth a
Ġth en
Ġv ong
Ġv ải
Ġv ariance
Ġv elocity
Ġh ao
Ġh ôi
Ġh ạch
Ġh ẹp
Ġh ula
Ġl b
Ġl at
Ġl Äĥng
Ġl it
Ġl áºŃt
Ġl ẽ
Ġl Æ°á»Ŀi
Ġl and
Ġl ái
Ġl iá»ģm
Ġl Æ°ng
Ġl ike
Ġs in
Ġs ti
Ġs ed
Ġs av
Ġs áo
Ġs end
Ġs ess
Ġs ans
Ġs park
Ġs ymbol
Ġs ource
Ġs urvey
Ġs ynonym
Ġs imilarity
Ġs leep
Ġs implejson
Ġs ocioeconomic
Ġs Æ°á»Łi
Ġs witch
Ġm an
Ġm áºŃp
Ġm ến
Ġm ắn
Ġm ym
Ġm atch
Ġm odes
Ġm tDNA
Ġb ù
Ġb ec
Ġb inh
Ġb est
Ġb ef
Ġb Æ¡i
Ġb ón
Ġb atch
Ġb áu
Ġb aking
Ġb ẫy
Ġtr e
Ġtr iá»ģu
Ġtr ặc
Ġtr Æ°a
Ġd el
Ġd ÃŃnh
Ġd áng
Ġd Ãło
Ġd ắt
Ġd ue
Ġd ạo
Ġd epend
Ġd escriptions
Ġd ẻo
Ġch Æ°á»Ľc
Ġch Äĥn
Ġch iếm
Ġch ange
Ġk g
Ġk iá»ģm
Ġk ali
Ġk wargs
ĠÄijá» ¡
ĠÄijá» ijng
Ġnh Æ°á»Ŀng
Ġnh ặt
Ġnh Å©ng
Ġn á»ģ
Ġn ắp
Ġn atural
Ġn etwork
Ġp b
Ġp le
Ġp our
Ġp art
Ġp pt
Ġp aper
Ġp ower
Ġp uzzle
Ġthá» £
Ġthá» ķ
Ġg ấp
Ġg all
Ġg á»Ļp
Ġph ạt
Ġph iá»ģn
Ġph rases
Ġkh ẳng
Ġcá» ijng
Ġsá» ĵi
Ġdá» «a
on ey
on ard
Ġng ắt
Ġng ón
Ġng oạn
Ġtá» §
Ġtá» ī
Ġtá» ĭ
Ġtá» ĭch
in ess
in ance
in formation
Ġvá» Ł
Ġr am
Ġr ải
Ġr ed
Ġr òng
Ġr áp
Ġr Å©
Ġr ẩy
Ġr á»ĩt
Ġr ule
Ġr ating
Ġr emaining
Ġgi Ãły
Ġgi ết
Ġgi Ãłnh
Ġgi Å©a
qu af
ĠlÃł n
Ġhá» ķ
Ġhá» ķng
or ig
or age
or ium
ch as
ch annels
at p
at iv
at ri
Ġqu ery
Ġx ả
Ġx er
Ġx ong
Ġx ml
Ġx á»Ļn
en v
en um
ĠT H
ĠT R
ĠT a
ĠT e
ĠT ần
ĠT es
ĠT áºŃn
ĠT áo
ĠT able
ĠT ask
ĠT ầng
ĠT iếng
ĠC V
ĠC at
ĠC á»ij
ĠC Äĥng
ĠC Æ°á»Ŀng
ĠC ấp
ĠC Å©ng
ĠC NN
ĠC ục
ĠC EO
ĠC ME
ĠC alculator
st ack
st ep
st erd
st aff
Ġ` |
Ġ` {%
Ġlá» Ńng
le ar
Ġchá» £
ar ri
Ġ" "
Ġ" [
Ġ" ${
Ġho an
Ġho Ãłi
Ġho using
ĠÄIJ úng
ĠÄIJ á»ĵ
ĠÄIJ óng
ĠÄIJ á»ĭa
th áºŃp
th ers
th ick
Ġ1 10
Ġ1 32
al al
al us
al ile
es e
et i
et ic
et ype
ĠN ên
ĠN á»iji
ĠN ame
ĠN egative
Ġ( )
Ġ( *)
ĠS M
ĠS us
ĠS core
ĠS ET
ĠS IM
ĠS aint
ĠS NAP
el v
el come
au d
ti t
ti le
ti tions
ti mer
ti ty
ĠB iên
ĠB á»iji
ĠB Ãłn
ĠB ri
ĠB eat
ĠB lue
ĠB TC
ĠB lankInt
ĠB ufferedReader
as on
it a
it ted
Ġ- --------
Ġngh ẽ
Ġngh ìn
im ate
im show
ĠP R
ĠP ic
ĠP ec
ĠP ort
ĠP rom
ĠP lat
ĠP ower
ĠP redict
ĠP YTHONPATH
Æ°á»Ľ t
Ġ2 000
Ġ2 40
ur a
ur ing
ĠM us
ĠM á»Ļc
ĠM ath
ĠM ust
ĠM uá»iji
ĠM eet
ic on
ic iency
Ġ' %
Ġ' )
Ġ' .
Ġ' {
Ġ' __
ent ation
ent ry
ec s
Ġf in
Ġf oo
Ġf ield
Ġf arm
Ġf ull
Ġf ilename
Ġf uel
ro ute
ĠD is
ĠD á»±
ĠD ES
ĠD iêm
Ġra w
em ble
ĠH iá»ĥn
ĠH av
ĠH ow
ĠH ello
Ġ3 9
Ġ3 60
Ġ3 65
ex pr
ex pen
ex tracted
ing ton
ing redients
ut tle
ut ral
ed Up
ac s
ac tivation
ac ific
ac tive
ĠTr Äĥng
ĠTr ò
ĠTr ừ
int ers
int enance
ĠV i
ĠV Ãłnh
ĠV alue
ĠV alid
ĠV isual
ĠV ALUES
00 00
lo op
lo ok
lo Ve
un ion
un ordered
ĠA b
ĠA ust
ĠA TP
Ġmã nh
re ased
re ating
is sub
is ian
is inf
id a
od ing
ĠTh iên
ĠTh úc
ĠTh iếu
Ġquy ên
Ġquy ến
ĠL an
ĠL ông
ĠL ao
ĠL os
ĠL ib
ĠL ạp
ĠL amb
ĠL aptop
ĠL á»įc
ĠL aunch
ĠL ondon
ĠK ý
ĠK em
ĠK iá»ĥu
ĠK HÃ
ĠK á»·
Ġin f
Ġin it
Ġin cr
Ġin sert
Ġin formation
Ġin spect
Ġw aterUsage
Ġw hich
Ġw eek
ĠmÃł ng
Ġká» ģ
Ġká» īnh
tr i
tr im
tr ái
tr ait
if e
if orm
if stream
ab out
ab solute
Ġ4 4
ol f
ol ate
ĠCh im
ĠCh ẳng
ĠCh rist
Ġo ur
Ġo cc
Ġ5 3
Ġ5 4
Ġ5 000
Ġcon fig
Ġcon di
Ġcon sumption
Ġcon cise
ĠG Ãł
ĠG ener
ĠG og
ĠG ói
ĠG ran
ĠG rand
ĠG old
ĠG ini
ĠG PS
ĠG á»įi
ĠG alile
ĠG loVe
Ġdo g
Ġdo wn
ation al
Ġtá»± u
Ġ0 9
ĠR a
ĠR á»iji
ĠR and
ĠR ev
ĠR eturn
ĠR út
ĠR io
ĠR DD
Ġsau rop
ip y
iz on
ord ers
ass o
(" #
(' <
Ġa quaf
ef ul
ĠNh út
end point
Ġfor est
Ġfor ms
Ġst ep
Ġst yle
__ ()
ess or
ess ment
ĠNg uyên
ĠNg ủ
ter ms
ĠJ LM
il Moisture
ain able
ĠF r
ĠF or
ĠF ound
ĠF eedback
ĠF irst
ĠF etch
ĠF ahrenheit
ĠF usion
ĠF Fmpeg
ĠI O
ĠI ll
ĠI aaS
Ġ$ .
ew hat
ĠE d
ĠE val
ĠE ff
ĠE ITC
ĠE HR
ĠE arth
op timizer
con da
con cise
con firmation
con sumer
con tains
Ġ6 9
py serial
") ]
ers ion
ers ine
ize Mode
our age
ĠX e
ĠX anh
Ġ7 1
get Text
get At
get arian
get Logger
eb ian
eb rew
Ġ10 5
Ġ10 69
ir i
ir us
text s
text comp
.. /
he app
iv or
iv en
'] :
'] [
'] ]
ore ign
// \./
pro c
pro xy
pro gram
pro duced
pro duction
pro hibited
ĠW at
ĠW riter
ĠW hat
ud io
ĠU s
ĠU ns
=" #
ĠO OP
cr afting
to ol
Ġcá u
up lot
out a
Ġis instance
Äij á»Ļ
Äij ại
ẹ t
set p
set up
set Level
set Section
ity Error
ĠGi a
Ġvi olin
ĠKh u
ĠQ t
ĠQ uyết
Ġpro vid
Ġ. /
Ġkhu ẩn
Ġ20 16
Ġ20 24
Ġi Python
res ize
res hold
Tr ong
Tr ình
cl ient
cl aim
ject ory
log s
Ġprint f
Ġ% -
20 19
20 40
20 16
ust ainable
Ġj ob
form s
pr ivate
Ġlu i
me al
]) ).
ep ar
ep tion
ff mpeg
string s
enti als
ser ver
ens sl
my frame
my db
Ġre port
AT CH
ph one
." ;
Ġpr ime
Ġpr ince
Ġres olution
ĠQu entin
class es
par e
par quet
date Formatter
Ġim pl
so up
ail s
Con figuration
ĠIn ter
ĠIn sert
ĠIn ches
te am
Ġbu ôn
Ġbu á»ĵm
Ġbu ild
map Par
per ience
Ġlog in
St ack
ĠTá» ķ
back ground
ĠY ellow
ER S
ĠSt ark
ard s
Ġac tivities
Er atosthenes
Ġset s
ĠHo Ãłn
ĠExcel Writer
Ġex it
Ġex cess
Ġex tract
Ġex pression
Ġid entify
19 2
19 95
equ ation
Element s
vector izer
const ant
Ġsh ape
Ġsh uffle
Ġsh ortc
arn ings
ST ERS
Ġcarbon Footprint
Ġná» £
eth yl
og n
og iri
Th iết
Name Error
dat ed
ĠLá» ±c
min utes
ĠAd jective
([ ])
Ġname Element
An imal
ÄIJ ây
Ġend if
Ġend for
Ġline ar
ill age
Res izeMode
To Double
Ġun e
Ġtotal Capacity
Ġtotal Negative
Ġtotal PositiveFeedback
Ġstat ement
next Int
next Line
Ġ& \
Ġtext Field
Ġstr ides
Ġfunction s
ĠAn alyze
ref lection
iss ions
bash rc
ick le
SE T
Form at
mon y
Ph ần
eat ure
Ġlist ener
40 6
Ġresult Set
100 00
Text Rank
ug ust
Ġobject s
Table Model
Ġsc ale
Ġsc ala
Ġsc reen
Ġsc ores
Ġsc oring
Ġsc ipy
ĠRe ality
ĠEm ail
ĠEm acs
work book
Ġmax Muffins
ĠIm port
RO P
Ġhuy á»ģn
ĠSh ad
ĠSh ell
ĠSh ould
ĠSh ynessTrait
ĠSh uttle
ĠGiá» Ŀ
Pro fit
arm ing
rev iew
trans lated
down case
Ġli u
action Rate
ome OtherService
>> )
Fact ors
Par ser
ne ural
rec ommend
rec ipient
rec ords
rec ommendations
Ġcom petition
Ġtrain loader
Ġai d
Ġai r
lect ors
cuda Printf
Col umn
Col lectors
Wh ite
reg ion
Pos itions
anag ement
ĠPy game
pred ictions
pred efined
AR Y
Kh ả
Of Legs
Of Eratosthenes
User Input
User Guess
ve getarian
ĠSV N
Ġfact or
ĠTrá» ±c
ĠTrá» ©ng
ĠTrá» įng
Ġ500 00
Ġenergy Consumption
Ġdiff erences
Ġfeedback Items
egr ityError
Ġtd New
Ġne ut
ĠÃĶ i
ĠÃĶ m
Ad jectives
Ad justment
inter val
Ġcolumn s
Ġngá»į c
els ius
ĠRes ult
ĠID E
Ġrecommend ation
Ġngá» £i
ĠTensor Board
Ġop timizer
duc tivity
File NotFoundError
Row Sort
gre p
Ġfont size
trib utes
verb ose
ĠPro cess
ĠPro gram
effic ients
open qa
product s
Ġiter ator
group s
Lin q
dev iation
uit ar
Ġlevel s
Ġ70 75
Foo Factory
Regr essor
tom l
ĠmÅ© i
Ġdiv idendYield
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ
ward s
Ġhas htag
Ġsql alchemy
Ġsmart indent
Ġnoun s
Ġquestions Table
IO Exception
post s
Ġass ert
Ġir is
Ġtem plate
Ġcar Node
Ġcar otenoids
err ari
Ġ{} ",
Ġyear s
ĠUser Preferences
car at
go al
strip es
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ
Char acter
Request Factory
Module X
Module Y
Vertex Positions
Ġev al
Ġsorted Elements
ĠVin ci
select ed
Ġidiom s
Import Error
squ are
wr apper
Ġcal led
Ġverb s
Ġpy test
ino a
ino is
anth ophyll
Ġquestion Row
Ġfig size
atisf ied
Ap prox
He ader
Ġtri angle
erm ine
ĠAS C
hist orical
Ġstudent Name
Ġstudent Grade
ĠEn vironmentalImpactAnalyzer
clean edList
ĠcalculateAverage WaterUsage
ĠcalculateAverage EnergyConsumption
ĠcalculateAverage CarbonFootprint
rigation Rate
firm ed
GR ect
Space X
UP DATE
Ġ~ /.
Ġed ges
ĠRandom Forest
ĠEmploy ee
full Name
Ġgrade Adjectives
Ġcomple te
ven ues
Ġcr afting
Ġsing le
ĠSal ad
ĠSal ary
Ġfn l
Ġcontainer Queue
osh er
Ġdetect ed
Rec ommendations
cor relations
present ation
Ġmn ist
Ġpack age
comment Input
det ect
slog an
slog ans
Ġab out
Ġappend Dots
Ġmulti plied
Ġprev Price
Ġge odesic
Ġreg ion
Ġreg ular
ĠTur ing
Ġ". \
Ġfeat ures
ĠDocument Builder
Ġcharacter s
CRE ATE
HT ML
JS ON
PR P
hic le
ieve OfEratosthenes
sess ive
Ġlib raries
Ġsatisf actionRate
Ġmut ation
Ġmark et
Ġrele vance
ĠHar mony
ĠHydro gen
rest aurant
ĠLou isian
Ġoper ator
tern ativ
priority Filter
State Code
Ġunn ecessary
ĠAnimal s
ĠBraz il
Performance Data
Ġfossil Fuel
)* (
CO L
Max Len
dim expr
kin Type
Ġag ain
Ġmanufactur ers
aut os
ĠMin nes
ĠDrop out
ĠLe onard
ĠChild Class
Ġconfidence Score
ĠWil li
Ġprec ode
Ġhydro xit
Origin Significance
ĠBarcel ona
Ab straction
Course Year
Le ngth
Mon th
Pay Pal
can vas
hom ophone
schem a
Ġte am
Ġsport s
Ġpot ential
Ġrai se
ĠCount Vectorizer
eserial ize
ĠNP V
ĠNob el
ĠPan ama
ĠAng eles
ĠLast Name
abr icks
ĠId entify
ĠUt ah
setO Auth
setRequest Property
Ġprimary Stage
ynt actic
ĠGrid SearchCV
Ġsuccessful ly
Ġ------------------------------------------------- -
ĠLinear Regression
ĠLawr ence
BU G
Display ing
DTrans pose
EG ER
Laptop s
Oper ating
Sur face
Som ewhat
Super Foo
WAR NING
XY Z
bur g
cstd lib
foot er
Ġenc ourage
Ġ........ ........
Ġmym odule
Ġbef ore
Ġgall on
ĠTes la
sterd am
Ġhousing Expenses
ĠSIM D
ĠBeat les
Ġnghẽ n
ĠPic asso
ĠPec os
ĠMust ache
ĠDis ney
ĠDES C
ĠHav ersine
expen se
ĠValid ate
ĠAust en
issub class
ĠKHÃ ĶNG
Ġincr ement
ĠChrist mas
Ġocc urred
ĠGog h
ĠGrand e
ĠGold en
ĠRev erse
Ġsaurop od
Ġaquaf aba
ilMoisture Level
ĠFound ation
ĠIll inois
ĠEval uate
oreign Key
ĠUns plash
setSection ResizeMode
mapPar titions
ĠYellow stone
Ġshortc ut
ĠtotalNegative Feedback
Adjustment s
RowSort er
anthophyll s
ĠRandomForest Classifier
ĠLouisian a
ĠMinnes ota
ĠLeonard o
! ("
! `);
" {
" ),
# !/
' re
' ):
' `.
( ',
) /
) ')
* ,
* .
+ ----
, ))
, âĢĿ
. ^
/ )
/ <
1 20
2 30
3 1
3 75
4 3
4 6
4 16
5 432
6 280
7 1
7 3
9 3
: "
: -
: ")
: ')[
< ?
= `
= {
= {}
> ";
> ').
? >
A S
A g
A zure
B V
B r
B á»Ļ
B Ãłi
B oot
C D
C ó
C ô
C alculate
C ustom
C ache
C lick
C PP
D e
D ay
D ec
D epend
D ropdown
D Regressor
E Y
E ST
E ngine
F I
F rom
F ree
F older
F PS
F AI
G E
G reen
G DRegressor
H C
H ow
H igh
H idden
I con
J ap
J son
L C
L O
L a
L and
L oÃłi
L oại
L OS
L ợi
L á»Ŀi
M R
M x
M ô
M á»Ļt
M at
M ây
M ón
M ulti
M edian
M aterials
M ean
N am
N ow
N ER
N IST
O D
O k
O ut
O utput
O pen
P er
P ost
P erson
P ane
P ROP
Q Header
R el
R ew
S au
S ol
S he
S entence
S equ
S plit
S lide
S printf
S afety
T A
T ình
T Ãłi
T ìm
T óm
T ask
T uple
T EXT
U I
U K
U SD
U TO
U SA
V G
V ideo
V illage
W ind
W eb
W indows
W elcome
X ML
Y êu
Y ou
\ (
\ .
\ ":
] }
] ').
_ ="
a ell
a ebr
a jax
b g
b on
b ạn
b an
b ay
b án
b ánh
b atch
b á»ijt
b lank
b osh
b uffer
b abil
c o
c ue
c uá»iji
c ov
c ased
c err
c ache
c ucumber
d Æ°Æ¡ng
d ai
d ing
d ot
d up
d ance
d ia
d ep
d type
d na
d ply
d epend
d istinct
d ebug
d ụng
d eleted
e el
e ux
f er
f ur
f ec
f ect
f loor
g s
g it
g ir
g iti
g ini
g event
g pus
h ay
h ow
h ome
h Ä©a
h ini
h anna
h ashtag
i h
i ens
j k
j an
j ob
j ection
k z
k ết
k now
l or
l ý
l é
l á»Ĺi
l ers
l strip
l chemy
l ợi
m ô
m an
m em
m un
m ium
m ov
m ua
m edi
n f
n ếu
n Äĥm
n text
n eg
n uplot
o le
o el
o ảng
o ff
p or
p th
p ing
p art
p atter
p ie
p andas
p erson
p uzzle
p dfkit
p refix
r a
r ap
r up
r fec
s at
s ung
s im
s un
s om
s ession
s with
s ome
s By
s rc
s ocial
s cikit
s uccess
s regex
s pring
s implejson
t z
t ất
t Ãłi
t ôi
t ex
t á»iji
t re
t body
u lo
u art
u ction
u istics
v m
v ed
v re
v ices
w s
w t
w he
w orld
x ity
x path
x label
x ln
z o
z el
z one
} `.
} </
} ");
} '.
} !`);
¥ t
® ner
± u
à §a
à ®ner
ã Ĥ
Ċ ĊĠĠĠĠĠ
Ġ Ãł
Ġ ấu
Ġ est
Ġ ).
Ġ ám
Ġ efficiency
Ġ êt
Ġ ÏĢ
Ġ ingredients
ļ t
á» Ľ
Ạ¬
Ġt en
Ġt ùng
Ġt Äĥm
Ġt xt
Ġt icks
ng ers
ng hĩa
Ġc b
Ġc ất
Ġc ai
Ġc úng
Ġc Æ°á»Ľi
Ġc urr
Ġc ãi
Ġc ake
Ġc ases
Ġc pu
Ġc ytosine
Ġc nx
Ġc tx
ĠÄij ung
ĠÄij iá»ģm
ĠÄij ắp
ĠÄij ặn
nh ìn
Ġth ÃŃnh
Ġth áp
Ġth iá»ģn
Ġth iêng
Ġth ree
Ġth ings
Ġth reshold
Ġv an
Ġv ần
Ġv Æ°Æ¡
Ġv end
Ġv âng
Ġv òi
Ġv ượn
Ġv eget
Ġv irus
Ġh er
Ġh is
Ġh ect
Ġh orm
Ġh ÃŃt
Ġh ãnh
Ġh elium
Ġl ê
Ġl st
Ġl anh
Ġl ÃŃnh
Ġl ab
Ġl á»Ļi
Ġl õ
Ġl arg
Ġl ặn
Ġl ines
Ġl ằn
Ġl aunch
Ġl actic
Ġl Æ°á»Ľt
Ġs it
Ġs ò
Ġs ảng
Ġs uá»iji
Ġs ell
Ġs igmoid
Ġs ecure
Ġs ched
Ġs lug
Ġm ù
Ġm ent
Ġm Æ°á»Ŀi
Ġm ag
Ġm úc
Ġm ạc
Ġm ost
Ġm ust
Ġm ầm
Ġm iếng
Ġm esh
Ġb i
Ġb ã
Ġb áºŃn
Ġb ÃŃch
Ġb ách
Ġb ass
Ġb át
Ġb ám
Ġb all
Ġb ấm
Ġb ound
Ġb rev
Ġb egin
Ġtr ú
Ġtr Æ°Æ¡ng
Ġtr èo
Ġtr á»ijn
Ġtr ùm
Ġd iá»ĩu
Ġd ò
Ġd id
Ġd uyên
Ġd ẳng
Ġd ans
Ġd ish
Ġd nf
Ġch Äĥng
Ġch án
Ġch art
Ġch ặng
Ġk ẹt
ĠÄijá» ±c
ĠÄijá» ©t
Ġnh ấm
Ġnh òa
Ġnh ôm
Ġn ung
Ġn eg
Ġn ormalization
Ġn lp
Ġp in
Ġp as
Ġp ort
Ġp and
Ġp urs
Ġp anel
Ġp agination
Ġp ickle
ế m
Ġthá» īnh
Ġg ai
Ġg ừng
Ġg ood
Ġg cd
Ġg uitar
Ġph ì
Ġph ai
Ġph ượng
Ġph ot
Ġph rase
Ġph ysical
Ġkh uy
Ġcá» «
ô cô
ĠĠĠĠ Ġ
on oun
on ium
on née
Ġng ô
Ġtá» ħ
in a
in st
in as
in ser
in cess
in ition
in spect
in come
Ġvá» įt
Ġr u
Ġr ô
Ġr ạn
Ġr ang
Ġr ùng
Ġr ắn
Ġr ock
Ġr á»Ļn
Ġr ìa
Ġr gba
Ġr ãnh
Ġgi t
Ġgi ông
Ġgi eo
Ġgi ven
er a
er re
er tr
an tic
an uts
an alyze
an alytics
Ġhá» ij
or ed
or ct
or ia
ch at
ch it
ch ÃŃnh
at ement
Ġqu ế
Ġqu ái
Ġx iên
Ġx ay
Ġx ôi
Ġx inh
Ġx áo
Ġx Æ°á»Ľng
Ġx ám
Ġx á»ī
Ġx ói
Ġx ứng
Ġx anthophylls
en on
en umerate
ĠT u
ĠT ái
ĠT ắt
ĠT iá»ģm
ĠT ime
ĠT ầm
ĠT ool
ĠT á»ijt
ĠT RU
ĠT ANF
ĠC á»Ļt
ĠC ân
ĠC ầu
ĠC Æ¡n
ĠC ac
ĠC ôn
ĠC lass
ĠC ore
ĠC ity
ĠC ON
ĠC arb
ĠC á»Ńa
ĠC lick
st er
st and
st ory
st udent
st orage
Ġ` @
Ġ` \
Ġ` {'
Ġ` {}
le y
le ather
ar c
ar es
Ġ" '
Ġ" -
Ġ" <
Ġ" ?
Ġ" |
Ġ" __
Ġ" ""
Ġ" ðŁ
Ġtrá» Ĺi
Ġho Ãłnh
Ġho ld
Ġho oping
ĠÄIJ o
ĠÄIJ á»Ļt
ĠÄIJ ược
ĠÄIJ Ãłi
ĠÄIJ Ãło
ĠÄIJ ám
ĠÄIJ ừng
ĠÄIJ èn
ĠÄIJ á»ı
th en
th ân
th Æ°á»Ŀng
th ay
th ere
th ird
Ġsá»ij c
Ġ1 12
Ġ1 30
Ġ1 70
al f
al t
al con
al enc
al led
al gorithm
al Server
al ternativ
es oz
am en
am use
ĠN Æ¡i
ĠN oun
ĠN ok
ĠN itÆ¡
ĠN ebr
Ġ( %
Ġ( -
Ġ( ?
ĠS i
ĠS ch
ĠS ub
ĠS úp
ĠS il
ĠS entence
ĠS ci
ĠS ocket
ĠS plit
ĠS uper
ĠS pring
ĠS HA
ĠS ôcô
el if
au th
au dius
ti s
ti al
ti tion
ti sh
ti kz
Ġthe m
Ġthe module
ĠB l
ĠB en
ĠB ầu
ĠB ro
ĠB ò
ĠB iá»ĥn
ĠB át
ĠB óng
ĠB ase
ĠB log
ĠB io
ĠB ook
ĠB utton
ĠB aking
it on
it ed
it ler
Ġ- ------------
Ġngh ênh
im b
im i
im er
im ile
ĠP u
ĠP it
ĠP age
ĠP op
ĠP RE
ĠP OS
ĠP OST
ĠP OP
ĠP anel
ĠP LOS
Ġ2 10
ur i
ur t
ĠM c
ĠM el
ĠM ang
ĠM ac
ĠM ảng
ĠM ad
ĠM á»ģ
ĠM ob
ĠM iá»ħn
ĠM ary
ĠM ail
ĠM arch
ĠM ua
ĠM ammal
ĠM á»įi
ĠM ito
ĠM ATCH
ĠM NIST
ĠM esoz
ang lad
ic ator
Ġ' --
Ġ' ',
Ġ' //
Ġ' '),
Ġ' '}
ec ord
ec tive
Ġá» ļt
Ġf ast
Ġf og
Ġf ech
Ġf ran
Ġf ootprint
Ġf illed
Ġf reed
Ġf oxes
Ġf eel
Ġbá» «ng
ro g
ro of
ro ck
Ġ| ")
Ġ| ---|---|
ĠnÄĥng Th
ĠnÄĥng Theo
() (
Ġhợp S
Ġhợp PayPal
ĠD i
ĠD on
ĠD uy
ĠD ân
ĠD ấu
ĠD ict
ĠD ep
ĠD ave
ĠD ataset
ĠD uck
ĠD ụng
ĠD á»ħ
ĠD eserialize
em it
em ic
ĠH iá»ĩn
ĠH Æ°Æ¡ng
ĠH ầu
ĠH iến
ĠH Ãłn
ĠH ey
ĠH òa
ĠH á»ĵng
ĠH awk
ĠH aar
ĠH abitat
ĠH itler
Ġ3 3
Ġ3 50
ex clude
ex cess
ex press
ut er
ut ure
ut ri
ac cept
ac eful
ac claim
ĠTr Ãł
ĠTr ì
ĠTr ạng
ĠTr ánh
ĠTr ẻ
ĠTr ust
ĠTr ừu
ĠTr inity
ĠTr iton
int o
int s
ĠV an
ĠV im
ĠV ẽ
ĠV iá»ĩt
ĠV Ãłng
ĠV ideo
ĠV Æ°á»Ŀn
ĠV ous
ĠV II
ĠV alenc
Ġy y
Ġy ield
lo s
un e
un zip
un employment
un iform
un zel
ĠA D
ĠA u
ĠA ge
ĠA ll
ĠA ss
ĠA ve
ĠA ND
ĠA NS
ĠA vg
ĠA ugust
ĠA UTO
ĠA VG
á»ĵ n
é n
ĠÄijã i
re a
re lease
Ġlo ve
Ġlo wer
is nan
is EndOfWord
ad il
ad ium
ad jectives
id ge
od ec
ĠTh ì
ĠTh ùng
ĠTh om
ĠTh ám
ĠTh ings
se ek
ĠL or
ĠL ượng
ĠL ab
ĠL ạc
ĠL ắp
ĠL ink
ĠL ED
ĠL IKE
ĠK ÃŃnh
ĠK á»ĭch
ĠK ane
ĠK EY
Ġin c
Ġin ch
Ġin com
ag ric
Ġw b
Ġw ent
Ġw aypoint
tr a
tr ang
tr averse
if etime
us iness
ol low
ĠCh ú
ĠCh ai
ĠCh úc
ĠCh iếc
ĠCh icken
Ġo ù
Ġo atFlour
Ġ5 2
Ġ5 72
Ġcon chas
ĠG I
ĠG e
ĠG u
ĠG and
ĠG ắn
ĠG ET
ĠG IA
ĠG lobal
ĠG mail
ĠG erman
ĠG FP
ĠG PG
ĠG ỡ
ĠG CD
ĠG nuplot
', ],
ap t
Ġ} ]
Ġ} ],
ce il
ĠPython ic
ĠR ate
ĠR ắn
ĠR os
ĠR ock
ĠR ừng
ĠR ocket
ĠR ome
ĠR etrieve
ĠR amen
ul fur
hi a
hi ps
ect ed
est er
á»į t
Ġhá»ĩ t
import ances
Ġ[ -
Ġ[ .
Ġ[ ['
ist er
Ġcu ps
(" ""
(" +----
(' .
(' //
(' ''
(' :')[
Ġa fter
Ġa wait
ĠvÃŃ t
ĠNh ắc
ĠNh óm
ĠNh ẹ
ĠNh ôm
Ġkhá» ī
Ġfor êt
Ġst ud
Ġst ory
Ġst uff
Ġst andard
Ġst ored
__ )
__ ':
ĠNg Ãłnh
ĠNg Äĥn
ĠNg á»įt
ter m
ĠJ J
ĠJ ude
ĠJ ames
ĠJ ane
ĠJ Unit
ép ce
ain s
pl ural
ĠF our
ĠF red
ĠF errari
ĠI MA
ĠI ris
Ġ$ _
ĠPh á
ĠPh iếu
ĠPh ạm
ĠPh á»ijt
put er
Ġkho ái
ĠE l
ĠE ri
ĠE ll
ev alue
op Iter
con cat
con tainer
con tro
Ġ6 3
Ġ6 7
oc i
oc olate
ile d
ile s
ers k
our née
print Stack
Ġtra jectory
ĠX ét
') ])
') }!`);
Ġ7 7
Ġ7 8
Ġ7 00
get Table
get DeviceType
get Context
eb reak
eb ank
Ġan i
Ġan alyzer
Ġan other
pe at
pe are
Ġ10 1
Ġ10 24
able s
iv ed
iv ide
iv ely
Ġso up
Ġso uff
str ong
str uction
'] ].
pro gress
ĠW is
ĠW ork
ĠW ash
ĠW ill
ĠU y
ĠU ri
ĠU SA
=" ")
ĠO S
ĠO n
ĠO ff
ĠO per
ĠO reg
ĠO saka
ith e
cr y
cr um
to List
to Double
up port
up per
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ
Ġas cending
Ġ8 5
Ġnum Items
Ġis prime
all y
ax box
á»± u
Äij ã
Äij ầu
Äij iá»ĥm
Äij áng
set opt
set Property
set Column
num s
num List
urr i
word cloud
ity Container
ĠKh ÃŃ
ĠKh ách
ele c
ele v
ele ph
ĠQ A
ĠQ uyá»ģn
Ġpro ps
Ġpro babil
Ġdata List
ĠSá»Ń a
Ġ20 20
Ġ20 19
Ġ20 17
add ress
ct x
act us
ict oria
ob an
res h
res pon
Tr ang
Tr ừ
Tr ace
Tr uyá»ģn
cl imate
Ġimport ant
Ġimport ances
In tern
art ment
Ġus ers
ult ure
Ġ9 5
Ġ9 6
Ġ9 8
20 20
20 10
20 11
20 15
20 35
Ġj inja
Ġj Query
Ġj ournée
form er
pr ise
me th
]) }
Ġem ployee
ber g
ĠThá» ĭ
ens im
Ġe qu
my Chart
my timer
Ġclass es
sh ell
sh ortc
pon ents
PI O
ph ân
ph út
ph ủ
ph erd
Ġmong odb
Ġget opt
Ġget Idiom
." ]
reate st
Ġpr actice
Ġpr onoun
ace aebr
ĠCon nect
ĠCon sider
Ġ12 34
++ :
ĠQu ang
ĠQu ý
ĠQu ảng
ĠQu ery
ĠQu inoa
class ify
par ent
par tial
arb uck
ari um
LA lchemy
ast a
ast er
ast ed
ast ype
ant on
ail and
ail able
Con firmation
Con firmed
ĠIn dex
ĠIn di
ĠIn formation
Ġmẽ Hiá»ĩu
map ToDouble
per ature
per iod
Ġmu á»Ļn
Ġlog s
St ore
St anford
St ates
St andard
St atus
csv file
Ch iến
Ch uyá»ĥn
Ch oice
Ch uá»Ĺi
arg ument
arg parse
ĠTá» ıi
Ġon ly
ĠY our
ĠY uk
ĠY eti
ER B
ial izer
ĠSt ates
ĠSt udio
ĠSt uart
ĠSt arbuck
Ġ100 000
Ġac c
Ġyour self
line Items
error Count
list en
á»ī nh
ĠHo ặc
ĠHo Ãłng
ĠHo oping
sum maries
Ġex perim
Ġex press
Ġex tracted
19 80
19 60
19 70
equ als
ou g
The ater
pen n
Ġ19 00
Ġ19 70
Ġ19 90
Ġor th
ĠCl audius
"> {{
25 0
fig caption
Ġsh ar
ations hips
max size
oot ball
Ġcarbon Content
Ġná» ķ
"] ;
Th êm
Th ứ
key s
Ġ18 30
Ġrec urs
Ġrandom ly
read link
NA ME
ÄIJ iá»ĩn
ÄIJ Æ°á»Ŀng
Res et
To Dish
To One
ll er
pos Tags
pos sessive
Ġun it
Ġun til
Ġun ordered
sc reen
Ġstr ong
Ġstr len
ĠAn alysis
ĠAn yt
ĠAn aconda
ref lect
std out
---------------- ---|
Ġat omic
Ġal mondMilk
Ġmy db
($ (
($ ('<
Ġ25 6
oh yd
br and
br idge
ug s
pool s
level s
Ġ14 5
format ted
ian o
yl cytosine
Ġsc atter
Ġsc ales
Ġsp an
Ġsp ace
Ġbe ing
.... ..
Ġwords WithPos
af é
af nium
work sheet
Ġmax ImportanceLevel
Ġmax imum
Ġmax BranchLevel
Ġblock s
Ġ16 0
ormal ize
Ġhuy nh
Ġsk ill
ĠSh akes
ĠSh oel
ĠGiá» įng
ign ificance
find all
find Element
find All
var char
Ġap i
Ġap k
Ġpar ent
Ġpar sing
Ġpar sed
Ġoutput s
Document s
Document Event
En tity
IN CRE
Pro ject
Pro gress
ys pro
Ġsub mit
Ġsub process
Ġsentiment Value
Ġsentiment Analysis
Ġnhẹ n
rev enue
trans fer
Ġli êm
Ġpl ant
inf lation
que hanna
Ġgr am
Ġgr and
ated Space
cept s
process or
process Form
Par is
Par entClass
org hini
Gr imm
Gr illed
rec eption
Ġcom put
Ġcom pare
Ġcom ponents
Ġpos itive
Ġpos sible
args ort
Ġtho ái
Ġhe ader
Ġare as
ĠAdd ax
Qu ần
point Form
Ġup on
Ġtur bine
Ġbit wise
Ġkey s
Ġgh ét
ĠList en
ron s
run ning
Ġmet ers
cho ice
ĠLo op
ĠKho ai
Ġinter p
Ġinter face
SS L
filter s
ĠMy Class
ĠAr m
ĠAr tis
Ġresponse Input
Kh ó
Re ad
bol ded
kh oảng
start swith
the ad
Ġfact ory
ĠTrá» Ł
db c
Ġtest ing
Ġdiff erence
ĠTo kyo
tim es
tim ize
tim ization
response Input
Int n
Int egrityError
Nh Ãł
Nh ững
Nh út
Ġne on
Ġne ural
Ġper form
Ġper iod
Ad verb
Ad jective
Un ion
Un icodeScalar
lat ten
Ġle af
inter est
Ġ%} `
:\ \
Pr ime
write header
Ġcost s
Ġngá» ±c
ĠPar entClass
request s
Ġop enssl
Ġvenues Table
)] ),
Mem ber
Row Filter
gre etings
Ġmon ey
Ġdet A
Ġdet ermine
Child Class
Pool Manager
Sc anner
ich urri
elic ious
ĠPro tein
ĠPro perties
Ġwidth s
ĠOpen NLP
ĠÃĤ m
Lin es
Or deredDict
Ġlay ers
Ġser vers
ĠWeb Element
ĠWeb site
shar ed
LU RE
inner HTML
ĠRest aurant
ource W
dataset s
Def inition
Pref ix
Ġbin ary
Ġdec rease
Ġdec reased
anu ary
ĠCom ing
ĠCom bine
oph ones
connect ed
comp any
Stream Handler
)[ ::-
Sh ynessTrait
diff erences
fl ag
fr am
fr ac
ms k
sm ith
sm all
second s
torch script
view port
Ġass ertEquals
Ġass ume
Ġir rational
requ ency
Ġind icator
ular ly
Ġstate Dropdown
content s
Trans former
library Depend
Sub ject
Sub mit
car s
car et
cod ecs
rig id
eric s
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ
Char Field
ĠImage Net
ĠImage Draw
Ġmonth s
IM IT
IM ARY
mut t
Ġse a
Ġconn ections
Ġidiom OriginSignificance
Default TableModel
Ac cess
Ac tivation
Ac cept
Ac curacy
EX IT
Fr ance
OP T
Word s
be ing
call backs
drop down
lar ative
Ġcor respon
Ġsu ch
Ġselect or
Ġpop ul
Ġgam ification
erg ing
chor us
ĠSe q
edD ataset
ĠAm sterdam
Ġover all
Ġprocess es
Ġprocess ing
'} )
Ap ple
Com ple
He ight
My Store
fetch one
fetch StockData
Ġz eros
Ġwe ight
ĠEn ter
ĠEr r
ĠEr atosthenes
ĠUn ityContainer
default dict
Ġmuffin OatFlour
Ġmuffin AlmondMilk
Ġmuffin Blueberries
Annot ator
factor ial
78 9
85 9
GR DB
Num ber
Num bers
Not ebook
Select CourseYear
Up date
Up Sampling
may jun
way s
way pointForm
Ġsort er
Ġsort Table
Ġpost s
ĠDevice Type
Ġtransform ed
Ġstocks Data
(` -
Al b
NT T
dd l
dum p
late st
Ġco efficients
Ġcr rdate
Ġcall backs
Ġsome one
Ġgre at
annot ate
Ġwhe ther
conn ector
ĠWal mart
ĠON E
ible by
(? =\
DE F
DE BUG
Diff iculty
Sign ature
day s
noun s
Ġbutterfly Surface
Ġpre position
Ġpack ages
Ġgroup s
Ġngo ặt
Ġ"% ,
ĠSQ LAlchemy
Ġ'/ '
ĠDet erminer
ĠHom ebrew
Ġeigen values
ĠcarbonD ensity
Add Edge
ĠAssum e
(_ .
Base Repository
eng ines
house hold
iop po
mk String
multi plied
Ġab il
Ġcell s
Ġsection Width
Ġsection Height
Ġmulti ple
Ġblue berries
Ġdis rup
Ġdir ectory
Ġprev ious
Ġge om
Ġrel ative
ĠTur bine
imm ers
Ġfeat ure
exist s
ĠTrans lator
Ġpred iction
Ġpred ictions
fruit s
Back ground
Ng Æ°á»Ŀi
correct ed
guess es
mak er
synonym Nodes
Ġsqu are
Ġsqu ared
Ġsur prise
Ġsatisf ied
Ġkn ight
quanti le
quanti ty
Ġ"/ "
Ġmá»ī a
ĠNe odymium
ĠNo SQL
ĠSurvey Response
ĠMar vel
edi eval
real path
ĠLou vre
Ġinst ances
Ġinst alled
Ġconcept s
ĠOR M
State Name
Ġunn est
Ġauth ors
ĠBraz os
Ġparse Float
+---------------- +
+---------------- +----------------+
=$ (
AL SE
Ne utral
Sal ary
eget ic
mark down
sw immers
Ġclo sed
Ġsm all
Ġbirth Year
ĠNi épce
ĠSelect From
ĠPl an
ĠMa ersk
ĠDec ision
ĠFrame work
Ġanom aly
Ġanom alies
ĠOne ToOne
Ġprofession s
Ġdeforestation Rate
Ġvalid ation
Contro l
Contro ller
Ġexist ing
CCCC CC
ĠNumber OfLegs
ĠINT EGER
Transaction Count
Author Manager
Gen ius
Lat ex
Tweet s
Widget s
devel oper
ppt x
Ġext ends
Ġti ebreak
Ġtuple s
Ġcarb s
Ġmim etype
Ġmod ulo
Ġdem ethyl
Ġchalleng es
Ġpatter ns
Ġ`! `
Ġ`+ `.
Ġlá»ij p
alph anum
ĠSol utions
ĠShe pherd
tific ation
Ġfr uit
extr action
ĠVe hicle
ĠThủ y
ĠFast API
ĠFilter edDataset
rome Driver
ĠOut look
layout s
ĠAnd alus
ĠmyVar Value
Photo Image
divis ibleby
rank ing
ĠCURL OPT
Ġinterpol ated
Argument Parser
querySelector All
+) \
Correct ly
Http Response
Loc ation
Matplotlib TensorBoard
Rap unzel
Ref lection
Survey Response
Top Words
birth Month
eigen values
frequ encies
gd p
gn ore
hor izon
hand lers
laz y
nd array
pagin ate
ÃĬ N
Ġign ore
Ġlit ers
Ġsti ll
Ġple in
ĠTR ÃĬN
step s
ĠSM TP
ĠSus quehanna
ĠBri tish
ĠPR IMARY
ĠPlat te
ĠPower Point
ĠMeet s
Ġfield s
Ġfarm s
edUp String
ĠValue Error
ĠLamb orghini
Ġinf inity
Ġweek ly
tri angle
trait s
ĠChim ichurri
Ġcondi tions
ĠIO Error
ĠEd ge
getAt tribution
ĠWat t
ĠUs age
="# ">
ĠQt Widgets
Ġprovid ed
eature Union
ĠShad ows
review s
neural net
recommend ation
Ġneut ron
ĠResult s
ĠASC II
ĠDocumentBuilder Factory
ĠHarmony ville
COL OR
autos ave
WARNING S
ĠReverse String
*, \
Boot Test
De Fi
FAI LURE
Hidden Size
Jap an
Output Stream
QHeader View
Rew ards
Sequ ential
\": \"
aell a
dai ry
dply r
gir affe
giti gnore
mem ory
patter n
rfec v
som evalue
spring framework
tex tit
xln t
Ġêt es
Ġcurr Price
ĠvÆ°Æ¡ n
Ġvend ió
Ġveget ables
Ġhorm one
Ġlõ ng
Ġment al
Ġbrev ity
Ġneg ation
Ġpand emic
inser ted
erre str
ĠCac ioppo
ĠCarb ohyd
student Grade
alServer Error
alternativ es
ĠNok ogiri
ĠNebr aska
ĠSôcô la
ĠPage Reader
ĠPRE G
ĠMá»ģ m
ĠMob ile
ĠMarch é
ĠMesoz oi
anglad esh
Ġfech a
Ġfran ça
Ġfreed om
rock et
ĠnÄĥngTh anh
ĠDep artment
utri tion
ĠAve ngers
ĠANS I
ĠAUTO INCRE
adil lo
Ġincom ing
agric ulture
ĠGand hi
("+---- +----------------+----------------+
ĠIMA P
opIter ation
contro l
printStack Trace
Ġsouff lé
struction s
ĠWash ington
ĠOper a
ĠOreg on
setColumn Width
eleph ant
Ġprobabil ity
Intern alServerError
shortc uts
aceaebr Chi
ĠYuk on
ĠStarbuck s
lineItems Table
Ġexperim ents
ĠAnyt own
ĠShakes peare
ĠShoel ace
Ġparsed Response
Progress Bar
libraryDepend encies
Ġcorrespon ding
Notebook App
mayjun df
Ġdisrup ted
ĠSelectFrom Model
ĠAndalus ia
horizon tal
ĠCarbohyd rate
ĠAUTOINCRE MENT
! \
! ',
! ')
! ');
" '
$ ':
% /
% ;
' \
' ll
' ve
' ""
( **
) +
) -
) ?
) {
) |
) ")
) </
) ['
) **
) ].
* }
* ))
+ $
+ \
, '
- ${
. %
. `
. //
. }"
/ "
/ #
/ ",
/ __
/ \(
2 12
2 65
2 85
3 8
3 000
3 40
4 8
4 40
4 60
4 75
4 85
4 86
4 365
4 2040
5 2
5 6
5 8
5 77
6 50
7 80
7 70
8 3
8 18
8 700
8 192
9 1
9 000
9 89
9 87
: #
: '
: ')
: ....
: )`
: (?
; `.
< =\
= /
= ',
> .
> ');
> ${
A E
A F
A X
A Y
A nh
A ut
A ction
A pr
A ss
A mer
A ES
A VER
A ero
A DER
A rea
B D
B e
B an
B en
B as
B arb
B LA
B ox
B order
B ranch
B GR
B ayes
B ufferedReader
B orders
B angladesh
C K
C L
C N
C or
C ar
C Ãłi
C ấp
C art
C LA
C omm
C SS
C ould
C ann
C alculator
C ountry
C ascade
C GRect
C afé
D F
D I
D at
D uy
D es
D ấu
D oc
D yst
D og
D á»±a
D á»ĭch
D ie
D uck
D ebug
D eleted
D ebian
D LC
D ivide
E E
E L
E ff
E ast
E xt
E duc
E mail
E ITC
F X
F it
F ind
F ont
F CC
F ish
F ates
F ixed
F ebr
F ahrenheit
F OO
F oreignKey
F resh
F ALSE
G H
G M
G o
G CT
G enerate
G RU
G lobal
G roup
G Float
G erman
G iven
H o
H iá»ĥn
H á»ĩ
H our
H ave
H ere
H ashtag
H asta
I X
I ce
I BM
I FooFactory
J ava
J aw
J ames
J JS
J une
J anuary
K ết
K ý
K ÃŃch
K iêu
L G
L I
L es
L Æ°u
L Ãłm
L ast
L á»ĭch
L ifetime
M Q
M er
M an
M ay
M age
M áy
M ẫu
M iá»ħn
M ak
M app
M ov
M ech
M ET
M ale
M arch
M axPooling
M NO
M iddle
M opy
N ur
N á»ģn
N ames
N OP
N ano
N LTK
O I
O K
O M
O b
O c
O n
O ff
O FF
O saka
O IC
P L
P e
P ai
P ort
P hi
P age
P art
P ublic
P ri
P SS
P CA
P astParticiple
P urch
P agination
P ending
P acific
Q U
R I
R S
R ắc
R ev
R eg
R ust
R ight
R uby
R ows
R ating
R ates
R GB
R DS
R AND
R GE
S O
S ent
S um
S tr
S ách
S yn
S eed
S orr
S park
S ứ
S atisf
S ales
S MA
S LS
S ợ
S NAP
S eq
S ingle
S kinType
S yntactic
T L
T M
T U
T W
T ác
T á»iji
T ùy
T ool
T each
T ANF
T errestr
V I
V M
V s
V en
V Äĥn
V á»ĭ
W P
W S
W in
W ork
W ater
W arri
X X
X á»Ń
X IST
Z ero
[ :
[ @
[ ~
[ .//
\ /
\ ",
] *
] ),
] ')
] ++;
_ %
_ .
_ [
` !
a j
a el
b t
b ất
b et
b iến
b ed
b um
b iá»ĥu
b ảng
b á»ģn
b est
b ass
b óng
b ool
b ium
b oot
b ased
b oard
b ugs
c u
c al
c ao
c Æ°á»Ŀi
c Å©ng
c os
c òn
c urr
c ity
c ast
c map
c time
c ert
c are
c ents
c az
c ous
c pi
c ycling
c ovariance
c actus
c oban
d t
d ân
d est
d òng
d jang
d ặm
d anc
d evices
d river
d elta
d types
d entation
e ig
e ight
e ebank
e ived
f m
f o
f ar
f lo
f il
f our
f eb
f ax
f line
f ound
f ood
f lex
f uel
f ellow
g p
g on
g el
g ener
g row
g ood
g luten
g ather
g ano
g pg
g ca
g reatest
h y
h am
h el
h Æ¡n
h ang
h ex
h ore
h ard
h di
h over
h rough
h ula
h aar
h alf
i q
i python
i loc
i lob
i tivity
j u
j w
j et
j ac
j our
j ack
k i
k s
k ens
k inter
k aim
l ên
l iên
l áºŃp
l im
l ent
l Æ°u
l ative
l ah
l ish
l ampl
l anguage
l mn
l ithe
m C
m g
m o
m Ãł
m ong
m ing
m and
m ul
m os
m ón
m á»ī
m ùa
m ục
m atplotlib
m ove
m anager
m enu
m aterial
m edia
m ùi
m issing
m otion
m apper
m atches
m ember
m anagement
m ophones
n am
n Äĥng
n ed
n á»Ļi
n est
n data
n ight
n orm
o at
o en
o et
o ti
o ic
o our
p a
p om
p ine
p end
p ict
p atch
p adding
p img
p reg
p alindrome
p anel
p alindromes
p Constants
p dbc
r b
r ô
r ect
r út
r ace
r ial
r ùa
r ating
r ename
r ather
r dd
r vest
r props
s le
s au
s ent
s á»Ń
s ist
s oc
s abel
s ock
s Data
s uper
s weet
s imple
s HelpFormatter
s afety
s ecure
s ieveOfEratosthenes
s bt
s fm
t m
t ác
t ế
t iá»ĩn
t Æ°Æ¡ng
t ur
t ol
t ìm
t ùy
t á»±
t uyến
t ạo
t act
t weet
t iếng
t á»·
t Color
u v
u is
u ary
u cle
v ig
v ant
v ideo
v ision
v oice
v oic
w im
w om
w ater
w ell
w ner
w xy
w ill
w ss
w indows
w hat
w arnings
x Æ¡
x ã
x uất
x ford
y a
y u
y te
y oto
y ticklabels
z Æ¡
z en
z he
{ {}
| (
| \.
} :
} `,
} .");
} ${
} `);
} \\
¥ y
¨ n
¿ ½
 ¡
à ±a
Æ ¯
ç Ħ
ï ¿½
Ċ ĊĠĠ
Ġ á»ij
Ġ áºŃp
Ġ Æ°Æ¡ng
Ġ ay
Ġ ĊĠĠĠĠĠĠĠ
Ġ ut
Ġ ĊĠ
Ġ Ãło
Ġ úp
Ġ il
Ġ ép
Ġ ::
Ġ ore
Ġ óng
Ġ ầm
Ġ amin
Ġ abs
Ġ old
Ġ err
Ġ ords
Ġ economic
Ġ iplot
Ġ amethod
Ġ ambiance
Ġ á¹ģ
Ġ icon
Ġ entry
Ġ elec
Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
Ġ ¡
ī Ī
į CH
ı m
ij c
Ŀ m
á» Ŀ
á» ©a
á» ıng
á» ıa
á» ĮN
Ạ¤
Ạł
Ġt ê
Ġt ú
Ġt ù
Ġt ặc
Ġt ao
Ġt ép
Ġt iá»ħn
Ġt ick
Ġt iêm
Ġt enn
ng uá»ĵn
Ġc ut
Ġc oun
Ġc ắp
Ġc ạm
Ġc ast
Ġc ool
Ġc ents
Ġc ateg
Ġc orr
Ġc red
Ġc ould
Ġc ities
Ġc ưỡi
Ġc lick
Ġc ằn
Ġc alculator
Ġc lear
Ġc reating
Ġc elsius
ĠÄij iên
ĠÄij ẽ
ĠÄij ấy
ĠÄij ắt
ĠÄij ắng
nh ẹ
nh ảy
Ġth ình
Ġth ầu
Ġth ung
Ġth án
Ġth ượng
Ġth ôn
Ġth ẳ
Ġth ẩm
Ġth ầy
Ġth ird
Ġth ese
Ġth oug
Ġv o
Ġv in
Ġv ạn
Ġv ân
Ġv ây
Ġv ấp
Ġv ạng
Ġv iá»ĩt
Ġv áy
Ġv uá»ijt
Ġv ani
Ġv ersion
Ġh h
Ġh or
Ġh el
Ġh Äĥng
Ġh án
Ġh um
Ġh ab
Ġh ue
Ġh ack
Ġh ét
Ġh iá»ģn
Ġh òn
Ġh eat
Ġh ãng
Ġh idden
Ġh ẻo
Ġh oney
Ġh alal
Ġl on
Ġl ây
Ġl ung
Ġl ắc
Ġl ìm
Ġl ue
Ġl Å©ng
Ġl ef
Ġl iêng
Ġl ạp
Ġl bf
Ġl ambda
Ġl ùi
Ġl egs
Ġl ượn
Ġl imit
Ġs an
Ġs am
Ġs Æ°Æ¡ng
Ġs ầu
Ġs Æ¡n
Ġs úng
Ġs Ãłnh
Ġs em
Ġs un
Ġs ạc
Ġs pr
Ġs eed
Ġs list
Ġs ession
Ġs uc
Ġs split
Ġs imple
Ġs api
Ġs ales
Ġs ynthesis
Ġs ince
Ġs afety
Ġs ustainable
Ġs epar
Ġs ieveOfEratosthenes
Ġs upport
Ġs wim
Ġm g
Ġm Äĥng
Ġm it
Ġm è
Ġm á»Ļng
Ġm yst
Ġm ph
Ġm ov
Ġm ove
Ġm essages
Ġm oy
Ġm ÃŃa
Ġm oisture
Ġm erging
Ġm pimg
Ġb l
Ġb s
Ġb ì
Ġb ong
Ġb uy
Ġb ùng
Ġb á»Ļc
Ġb ắn
Ġb ẩm
Ġb ind
Ġb urn
Ġb ẩn
Ġb ạc
Ġb út
Ġb ia
Ġb ầy
Ġb ell
Ġb row
Ġb old
Ġb ùn
Ġb iếng
Ġb osh
Ġb oxes
Ġtr á»Ļ
Ġtr ân
Ġtr au
Ġtr Ä©
Ġtr ust
Ġtr ói
Ġtr ùn
Ġtr ends
Ġd ạ
Ġd ÃŃ
Ġd ay
Ġd ol
Ġd ấn
Ġd ist
Ġd ám
Ġd iá»ħ
Ġd ep
Ġd iss
Ġd ark
Ġd na
Ġd isc
Ġd uring
Ġd îner
Ġch Ãły
Ġch iên
Ġch ạng
Ġch ain
Ġch ằm
Ġch ans
Ġch annels
Ġch icken
Ġk ing
Ġk eo
Ġk eep
Ġk osher
Ġk ilob
ĠÄijá» ©a
Ġnh a
Ġnh é
Ġn a
Ġn á»Ļ
Ġn an
Ġn ản
Ġn ang
Ġn ấp
Ġn ạc
Ġn one
Ġn á»ijt
Ġn Ä©a
Ġn ecess
Ġn primes
Ġn atri
Ġn ếm
Ġn ormalize
Ġp o
Ġp or
Ġp et
Ġp ut
Ġp rom
Ġp ref
Ġp ys
Ġp reg
Ġp alindrome
Ġp Constants
Ġp urchases
Ġp dfkit
Ġp refix
Ġp iano
Ġthá» ı
Ġthá» iji
Ġthá» ¥c
Ġthá» ķi
Ġthá» ĭch
Ġg c
Ġg áºŃt
Ġg ro
Ġg ánh
Ġg òn
Ġg ạo
Ġg ầm
Ġg ly
Ġg ray
Ġg ear
Ġg ặm
Ġg oogle
Ġg uard
Ġg ensim
Ġph u
Ġph os
Ġph Ãłm
Ġph one
Ġkh áºŃp
Ġkh inh
Ġkh ảm
Ġkh áng
Ġkh iá»ħ
Ġkh iếp
Ġcá» iji
ê ng
Ġsá» į
Ġsá» ¯ng
Ġsá» §ng
Ġsá» «ng
Ġdá» ©a
Ġdá» ©t
Ġdá» ım
Ġdá» ijc
ÃŃ u
on al
on ly
on te
on eta
on ots
on Character
Ġng ần
Ġng ách
Ġng Ãłn
Ġng âm
Ġng ừ
Ġng òi
Ġng á»Ńa
Ġtá» ĵi
in al
in ium
Ġvá» «ng
Ġr er
Ġr en
Ġr ình
Ġr et
Ġr áºŃp
Ġr em
Ġr âu
Ġr ạng
Ġr om
Ġr ách
Ġr ắc
Ġr ame
Ġr ep
Ġr oi
Ġr ug
Ġr ạp
Ġr ank
Ġr ót
Ġr ates
Ġr vest
Ġr etrieve
Ġr yu
Ġgi f
Ġgi am
Ġgi áºŃt
Ġgi áºŃn
Ġgi ặt
Ġgi un
Ġgi òn
er ce
er ons
er ecord
er fram
qu y
qu á
qu ick
qu are
an ay
an ic
an om
an us
an ame
an ban
Ġhá» ģ
Ġhá» ıa
or a
or ence
or ity
or ge
or vig
ch a
ch ú
ch iá»ģu
ch ung
ch úng
ch Æ¡i
ch ia
ch ron
ch mod
ch rome
ch lor
ch ester
ch ocolate
at en
at ic
at ma
at lab
at ross
at tributes
Ġqu ất
Ġqu ạt
Ġqu est
Ġx âu
Ġx óm
Ġx ẹp
en a
en o
en z
en ch
en os
en lp
ĠT ạ
ĠT iá»ĩn
ĠT it
ĠT em
ĠT our
ĠT ype
ĠT ấm
ĠT Ãłu
ĠT úi
ĠT wo
ĠT echnology
ĠT ôm
ĠT ÃŃn
ĠT HÃ
ĠT enn
ĠC H
ĠC a
ĠC r
ĠC or
ĠC ần
ĠC el
ĠC ur
ĠC lo
ĠC ad
ĠC ắt
ĠC op
ĠC os
ĠC our
ĠC up
ĠC ost
ĠC ode
ĠC òn
ĠC ep
ĠC PI
ĠC ard
ĠC apacity
ĠC lient
ĠC RU
ĠC ứ
ĠC enter
ĠC trl
ĠC PP
ĠC OUNT
ĠC ucumber
ĠC Ả
ĠC GRect
ĠC BV
ĠC á»±u
ĠC NTT
ĠC GFloat
st ac
st ag
st der
st uff
st hrough
st uv
Ġ` ;
Ġ` --
Ġlá» ¡
Ġlá» į
Ġlá» Łm
Ġlá» ±u
le ge
Ġchá» ĭ
Ġchá» Łm
ar s
ar on
ar in
ar du
ar ship
ar ters
iá»ģ ng
Ġ" {
Ġ" ).
Ġ" ."
Ġho á
Ġho me
Ġho mophones
ĠÄIJ ôi
ĠÄIJ un
ĠÄIJ Ãłn
ĠÄIJ á»Ļc
ĠÄIJ á»Ļi
ĠÄIJ áp
ĠÄIJ á»įc
ĠÄIJ á»ķ
th u
th Æ°
th Æ¡
th ông
th ic
th em
th ấp
th read
th ứ
th rough
th á»±c
Ġ1 19
al g
al er
al is
al ag
al go
al pdbc
Ġmá» §
Ġmá» ĵ
es i
es se
am i
am ang
am ine
am il
am ification
et z
et ing
et ric
et ree
et uple
et erminer
et Br
ĠN N
ĠN ông
ĠN et
ĠN ic
ĠN int
ĠN ot
ĠN á»Ĺi
ĠN Æ°á»Ľng
ĠN ep
ĠN ấm
ĠN ov
ĠN ắm
ĠN ere
ĠN úi
ĠN atural
ĠN atri
ĠN utrition
ĠN orvig
Ġ( ;
Ġ( %)
Ġ( _,
ĠS k
ĠS ê
ĠS Æ¡
ĠS uy
ĠS ur
ĠS ẽ
ĠS un
ĠS ag
ĠS ách
ĠS áng
ĠS Ä©
ĠS ắt
ĠS end
ĠS Ãłng
ĠS ev
ĠS óng
ĠS SE
ĠS ah
ĠS orted
ĠS Æ°á»Ŀn
ĠS urv
ĠS ource
ĠS ợ
ĠS ocial
ĠS cikit
ĠS erd
ĠS ustainable
ĠS kinType
ĠS AS
ĠS GDRegressor
ĠS DLC
ĠS PSS
ĠS TL
el py
el les
au x
au se
au to
ti st
ti um
Ġthe ms
ĠB Ãł
ĠB ÃŃ
ĠB er
ĠB ông
ĠB as
ĠB iết
ĠB án
ĠB ed
ĠB is
ĠB á»ģ
ĠB áo
ĠB ot
ĠB il
ĠB ảy
ĠB ash
ĠB lob
ĠB ão
ĠB ull
ĠB oolean
ĠB alanc
ĠB uá»ķi
ĠB á»ı
ĠB Ả
as is
as se
as hi
as ure
as mus
it or
it al
it ric
it oT
it ational
it amang
Ġ- ----------------
Ġtạ ng
ai d
ai s
Ġngh iêng
im read
im iter
im etric
ĠP o
ĠP yth
ĠP ab
ĠP ol
ĠP ip
ĠP ass
ĠP ublic
ĠP ix
ĠP resent
ĠP erson
ĠP late
ĠP eter
ĠP rize
ĠP enn
ĠP acific
ĠP aella
ĠP DF
Ġ2 12
Ġ2 16
Ġ2 27
ẽ m
ĠM L
ĠM o
ĠM ì
ĠM áºŃt
ĠM anh
ĠM ed
ĠM ess
ĠM art
ĠM á»ijng
ĠM ah
ĠM IM
ĠM clean
ĠM aint
ĠM ethod
ĠM SI
ĠM anagement
ĠM AX
ĠM RI
ĠM onte
ĠM atlab
ĠM alag
ĠM itoT
ĠÄijá»ĭ ch
ic s
ic ium
ic ense
Ġ' !
Ġ' "
Ġ' \
Ġ' _
Ġ' '.
Ġ' '`
Ġ' {}
Ġ' {{
ent uc
-- {}
Ġto e
Ġto ut
Ġto ét
Ġto ols
ec ol
ec ols
ec ify
Ġá» Ķ
Ġf it
Ġf ace
Ġf ail
Ġf low
Ġf stream
Ġf older
Ġf ahrenheit
Ġf ixture
Ġf rog
Ġbá» ĥ
Ġbá» ±c
Ġbá» ¥ng
ro om
ro pe
ro sa
ro zen
yth ing
Ġ| -------|
() ).
() ="
Ġgiá» ı
Ġgiá» ¥c
Ġhợp G
ĠD B
ĠD E
ĠD S
ĠD a
ĠD r
ĠD u
ĠD ược
ĠD ù
ĠD Æ°á»Ŀng
ĠD av
ĠD ir
ĠD iá»ħn
ĠD ark
ĠD raw
ĠD river
ĠD LL
ĠD isc
ĠD EF
ĠD ebian
ĠD eux
ĠD yspro
ĠD elicious
ĠD OM
Ġra d
em ask
em otion
em ely
ĠH Ãł
ĠH er
ĠH ằng
ĠH el
ĠH ang
ĠH um
ĠH ol
ĠH ard
ĠH az
ĠH II
ĠH IP
ĠH ola
ĠH oney
ĠH afnium
ĠH DI
Ġ3 000
Ġ3 40
ex p
ex it
ex ception
ex perience
ing er
ing Ap
ing uistics
ut om
ed ict
ed ium
ed uc
ed ges
ed Chars
ed Correctly
ed ora
ac ul
ac tiv
ac tivity
ac ebook
um ps
ĠTr iết
ĠTr ÃŃch
ĠTr ách
ĠTr ắng
ĠTr á»Ļn
ĠTr ies
ĠTr eebank
int ens
Ġ{ };
ĠÄijá»Ļng Theo
ĠV ai
ĠV Å©
ĠV ant
ĠV ie
ĠV ÃĢ
ĠV ersion
ĠV ictoria
ĠV itamang
Ġy ến
Ġy ellow
Ġy Axes
00 7
un iv
un ich
un icodeScalar
un iq
ĠA K
ĠA ir
ĠA lt
ĠA pol
ĠA CCESS
ĠA aron
ĠA utom
re at
re et
re port
re ver
re ality
re placement
Ġlo on
Ġlo op
is a
is p
is Irrational
is Comple
ad y
ad jective
ad verbs
ion né
ĠTh ai
ĠTh ÃŃch
ĠTh ách
ĠTh ánh
ĠTh Æ°á»Łng
ĠTh iá»ģn
ĠTh ằn
ĠTh orium
ĠL A
ĠL i
ĠL á
ĠL ò
ĠL Ãłn
ĠL òng
ĠL iá»ĩt
ĠL ev
ĠL oÃłi
ĠL õi
ĠL abel
ĠL one
ĠL Ä©nh
ĠL evel
ĠL ừa
ĠL earning
ĠL ưỡi
ĠL imit
ĠL inkedList
ĠL EF
ĠL IMIT
ĠL inguistics
ĠK im
ĠK ab
ĠK éo
ĠK NN
ĠK ansas
ĠK eep
ĠK night
ĠK anban
ĠK ẽm
ĠK entuc
om itted
Ġin structions
Ġin secure
ag ate
ag ore
ag raph
Ġw s
Ġw iz
Ġw ere
Ġw ww
Ġw ood
Ġw here
Ġw alk
Ġw hite
Ġw rapper
Ġw rap
ĠÄijá»ģ m
ĠÄijá»ģ n
tr on
tr uy
tr avel
if then
", "$
us ed
us hi
us ern
ab eth
ab straction
ol y
ol ve
Ġtiế c
ĠCh ữ
ĠCh iết
ĠCh ức
ĠCh ụ
ĠCh úa
ĠCh omsky
ĠCh ợ
ĠCh romeDriver
Ġo ise
Ġo wn
Ġo wner
Ġ5 7
Ġ5 250
Ġcon duct
Ġcon da
Ġcon sider
Ġcon cert
Ġcon sist
ĠG ần
ĠG ro
ĠG ame
ĠG ain
ĠG õ
ĠG ib
ĠG len
ĠG ood
ĠG MT
ĠG AN
ĠG roup
ĠG ợi
ĠG iven
ĠG ertr
ĠG AE
ĠG amification
ap es
ap ed
Ġ< (
Ġdo es
Ġdo ing
Ġ* (
ce ed
Ġ/ =
Ġ/ ></
Ġ0 8
ĠR u
ĠR as
ĠR ec
ĠR em
ĠR ub
ĠR ùa
ĠR ound
ĠR NN
ĠR ET
ĠR ender
ĠR ated
ĠR TC
ĠR ich
ĠR ails
ĠR EST
ĠR TA
ĠR OI
ul y
ul er
ul ate
ul let
---- --|
Ġ# ..
Ġchi êm
python X
est o
ub ly
ub ble
av en
av ing
av itational
Ġ[ %
Ġ[ (
Ġ[ ])
Ġ[ ...
ist ot
Ġcu á»ĵn
iz abeth
ot er
ot os
ot ype
(" -
(' %
(' -
(' --
(' ')
Ġa es
Ġa wk
Ġa ware
": [
": {
ĠNh u
ĠNh ược
ĠNh ấn
ĠNh Ỽ
end o
Ġfor loop
Ġst aff
__ ",
__ ":
__ ()`
__ `,
__ "`.
): \
ĠNg a
ĠNg ữ
ĠNg Å©
ĠNg á»įn
ĠNg á»įc
ĠJ T
ĠJ Ã
ĠJ erse
ĠJ OIN
ĠJ ura
ĠJ etBr
il t
il ver
ép hore
ain ting
pl ore
pl ish
ĠF ood
ĠF IF
ĠF inance
ĠF oreignKey
ĠF alcon
ĠF uture
ĠF ootball
ĠF latten
ĠF eatureUnion
ĠF CN
ĠF amil
ĠF edora
ĠF acebook
ĠI F
ĠI I
ĠI r
ĠI ow
ĠI FooFactory
ĠI sabel
Ġ$ $
ĠPh ác
ĠPh ô
ĠPh ÃŃ
ĠPh ong
ĠPh á»ij
ĠPh ải
ĠPh ép
ĠPh ụ
ĠPh rase
ĠPh oen
ĠPh á»ıng
put e
ow ired
Ġkho an
Ġkho ang
ew able
ĠE s
ĠE u
ĠE ng
ĠE st
ĠE ver
ĠE ns
ĠE cho
ĠE vent
ĠE urope
ĠE inst
ĠE XIST
ev ed
ev iation
op e
op ian
op qr
op ify
op ping
ĠnhÃł m
con sin
Ġ6 5
Ġ6 8
Ġ6 00
py d
py o
py torch
os hi
os records
") ',
ht s
ht ein
ĠX P
ĠX u
ĠX er
ĠX áo
ĠX enon
Ġof f
ind epend
Ġ7 6
Ġ7 9
Ġ7 20
Ġ7 10
Ġ7 44
name Input
get ter
get text
get String
get Node
get outer
get Users
get First
get Lines
Ġan aly
pe h
pe q
pe ar
pe ps
Ġ10 2
Ġ10 19
Ġ10 33
Ġ10 13
Ġ10 97
Ġ10 49
Ġ10 39
Ġ10 63
Ġ10 87
Ġ10 61
Ġ10 31
ir rigationRate
text up
text box
able d
Ġif stream
.. <
.. ."
he ap
iv al
iv ors
rom ed
rom ium
Ġso il
str al
str List
str Num
str aint
elf are
)) ]
)) ).
)) ")
)) ))
ĠTuy ến
oo f
pro ject
pro per
pro perty
pro fession
pro lific
pro ductivity
ĠW W
ĠW h
ĠW ar
ĠW ait
ĠW aypoint
ĠW arri
ĠW inters
ĠW arming
ud an
ud el
ack Data
ack Pane
ĠU TC
ĠO K
ĠO g
ĠO s
ĠO t
ĠO xford
ith er
cr it
cr ed
to án
to Ãłn
to string
to String
to Seq
to kens
up dated
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ
è re
Ġ8 6
Ġ8 8
Ġ8 500
': "
': {'
Ġnum List
Ġtu a
Ġis Irrational
Ġis EndOfWord
all ium
ax es
Äij iá»ģu
Äij á»ĥ
Äij á»iji
Äij êm
Äij á»ĭa
000 11
000 42
-------- |
set s
set counter
set RowFilter
set Pagination
num el
urr y
ĠGi ó
ĠGi úp
ĠKh ung
ĠKh á»ī
ele d
ĠQ Table
Ġpro ud
Ġpro gress
Ġpro lific
Ġpro ductivity
Ġweb app
Ġweb site
ver tical
Ġint eg
Ġ20 10
Ġ20 50
Ġ20 22
Ġ20 14
Ġ20 13
add r
sv c
item getter
Ġi ostream
eg g
eg ame
eg osaur
from URL
ob jectives
ob stac
com par
com press
com mand
com plish
res et
res cue
=' ;
Tr iá»ĥn
cl s
cl ust
ple xity
In One
In sect
In dentation
In fo
Ġ: ]
log reg
Ġprint ln
Ġ9 00
ach ed
Ġ% %
20 25
20 30
20 50
20 45
20 14
20 13
col n
col s
col lection
col ons
Ġj s
Ġj un
Ġj ust
Ġj acc
Ġj azz
Ġdi ag
Ġdi êm
Ġdi egetic
ĠJava FX
Ġkhó c
ĊĠĠ ĊĠ
file Name
file system
], [
path s
ĠÃ ©c
Ġnp m
ff i
ff s
ff ff
string ify
ber t
ber ry
ser ies
Ġnew s
def ined
def ghi
ĠThá» ķ
ĠThá» ©c
ĠThá» īnh
ĠThá» ¥y
ens emble
ens htein
Ġe o
Ġe aten
Ġe ither
** $
my file
my sql
my module
my username
my password
my Tuple
my csvfile
ps ycopg
Ġclass ific
sh a
sh ould
sh apes
sh opping
Ġre al
Ġre ach
AT US
AT CG
ph òng
ph ory
ph oto
Ġget text
Ġget Table
Ġget Sentiment
Ġget Size
Ġget Total
Ġget Twitter
Ġget Synonyms
Ġget Median
Ġget Tweets
Ġget PastParticiple
Ġget Ven
10 11
10 24
Ġdef ine
ask et
Ġpr incess
ear est
ear ly
ĠCon nection
ĠCon tainer
ĠCon figuration
Ġ12 1
Ġ12 6
Ġ12 7
ĠEx pl
ĠEx ception
ĠEx press
ĠEx tra
Ġba zÆ¡
loc ation
Ġres p
Ġres earch
ĠQu an
ĠQu ần
ĠQu áºŃn
ĠQu ỹ
ĠQu ick
ĠQu ãng
ĠQu ality
class ification
par agraph
date format
Ġim read
Ġim plement
ari us
LA RGE
so ilMoistureLevel
Con v
Con trib
Con fidence
Con sumer
Con cepts
ĠÄijá»ij m
ĠIn d
ĠIn voice
12 7
te ams
pt s
pt ree
plot ly
Ġel ip
Ġbu ilder
Ġbu ilt
per l
per t
Ġlog ger
St ories
St atement
ĠAPI View
ĠAPI RequestFactory
Ch Æ°Æ¡ng
Ch ức
Ch èn
Ch erry
Ch á»īnh
Ġon click
ond rial
ĠY t
ĠY oshi
cur dir
cur frame
new Document
new Instance
new counter
new DocumentBuilder
ĠSt udent
ĠSt andard
ĠSt opIteration
ĠSt reet
ĠSt ackPane
:// <
:// /:
ard en
Ġ100 9
ash imi
ash board
train ing
train ed
train loader
Data Table
Ġac cess
Ġac tive
Ġac ross
Ġac complish
ĠDo g
ĠDo ubly
der stand
ri ting
Ġword cloud
user Preferences
Script s
rel ax
rel ative
ĠThu ế
ĠThu ê
ĠThu ần
Ġtrẻ o
Ġ15 00
ĠExcel lent
label pad
Ġex p
ell ig
19 75
19 90
19 55
19 65
19 78
19 85
ere um
value Of
Error Filter
ln a
pen up
Ġ19 2
Ġ19 6
Ġ19 80
Ġ19 75
Element Tree
Type Error
fig size
ert s
Ġfile Name
Ġrá» ķ
Ġsh ift
Ġsh aped
Ġgá» Ŀm
arn ing
ST ATUS
max BranchLevel
Ġ11 5
Ġ11 8
"] .
"] ),
"] [.//
"] ]')
og raph
Th ÃŃ
Th at
Th en
Th ẻ
Th ủ
Th rust
Th ank
ator s
ator Wrapper
Ġinput File
dat abricks
dat amuse
Ġit self
Ġ18 60
Ġ18 55
min imum
sub Folder
we ight
Ġrec ogn
Ġrec eived
ĠDef ault
ĠAd olf
([ ]
([ ],
NN S
NN PS
Ġsai d
Ġrandom izer
read y
read Line
An tonyms
json Result
ÄIJ úng
ÄIJ êm
ÄIJ á»ĭnh
ÄIJ oạn
ÄIJ á»ĭa
Ġend point
ill a
Ġusage By
Res ourceW
Res olve
To ken
To Array
To Origin
To kyo
gr aceful
ll vm
etime Index
Us ed
Ġun able
Ġun ique
Ġun install
Ġtotal WaterUsage
Ġtotal EnergyConsumption
Ġtotal CarbonFootprint
load u
Ġstat es
Ġstat istics
iti ze
sc alar
sc ope
Ġ& =
Ġstr ftime
Ġstr dup
Ġnot re
Ġnot ebook
ref erence
iss ors
ĠConv olution
11 770
Ġtim eline
Ġarray s
Ġat p
Ġat tributes
Ġal one
Ġal gorith
Ġal iens
Ġal ways
Ġcan vas
Ġmy dict
Ġmy list
Ġmy frame
Ġmy env
ery l
ĠCreate Foo
ĠString Builder
aur us
aur ants
words WithPos
Ph á»ij
Ph ản
Ph ượng
Ph rases
Ph ysical
40 4
40 95
oh o
Ġht tp
Ġlabel ing
Ġlabel pad
Text Field
br Trong
br LoÃłi
ug al
Ġ... ]
Table RowSorter
current frame
div idendYield
public ation
Ġné m
level name
Ġ14 4
yl int
Ġsc ene
Ġsc alar
Ġsp am
Ġsp ecific
Ġbe ers
Ġbe autiful
Ġbe aut
Ex e
Ex ec
Ex pression
Ex plore
Ex pert
af ade
ĠRe ader
ĠRe peat
80 80
LE AN
work ers
Ġscore Adjustments
Ġmax size
Ġmax Level
ĠIm pact
Ġarg c
Ġarg parse
Device Syn
Ġsk y
ĠSh ared
ĠGiá» ¯
ign ed
Ġax es
ommend er
az ure
ix Nano
Ġen v
Ġen cry
Ġap pr
Ġma intenance
Ġpar ticiple
Ġpar quet
16 24
En viron
En vironmentalImpactAnalyzer
IN T
IN ET
Ġsub str
stat es
stat ic
Ġ{" _
ĠAc tivity
rev ersed
trans action
trans actions
Ġconst ants
down loads
sp ent
sql alchemy
Ġtô m
Ġli Khả
que ue
led Lifetime
ĠAl an
ĠAl pha
ĠAl ba
ĠAl caz
ĠAl pine
ĠAl zhe
ĠAl bert
ree ze
Ġindex of
24 7
Ġgr aph
Ġgr avitational
Ġ(` \
Ġ(` (?=\
sep al
Ġopen ing
ĠNgh á»ģ
process ed
15 00
23 4
23 45
Fact s
Par am
Par se
by e
red it
sol id
Ġadd Prefix
Ġde ep
Ġde uter
Ġro le
Ġro asted
Ġauto load
ne ighb
rec urrent
Ġcom pile
Ġpos Tag
Ġpos itions
Ġpos itivity
ĠÃģ o
ID E
RE M
year s
Ġtime zone
Ġtho áng
Ġhe art
elp hia
Ġcolor Background
ĠAdd Edge
ĠAdd ress
200 5
200 8
200 9
200 68
Qu ả
Qu anti
Ġup dated
Ġtrans actions
Ġtrans late
Ġtrans lator
Ġgh en
ĠList Status
70 94
Im g
Model Form
Wh en
mart re
run es
Ġmin or
cho ices
reg ularly
ĠKho ản
33 17
64 97
Ar tist
Print ed
Print Graph
Pos ition
SS I
filter warnings
ty ped
Ġven v
Ġven ue
Ġgen ome
erb et
ĠSwift Excel
ĠPy Spark
ĠMy Call
ĠAr ray
ĠAr istot
logg ers
pred iction
Ġresponse Option
Ġresponse Entity
Kh ung
Kh ách
Of Fuel
Re place
User Preferences
fact ory
ior itize
kh iếm
rand i
ve hic
start row
the ir
iter ations
Ġfact ors
45 3
Ġâ Ī
Ġâ īĪ
Ġtest Draw
ĠCol ab
ĠCol lege
Ġfeedback Item
ĠHá» ıi
example Text
plant s
egr ession
Int eger
Int ensity
show legend
Time Line
cent y
gi ây
last L
Ġad just
Ġad verbs
Ġtd B
Ġnam ed
Ġrun ning
ision s
ĠThe ory
ighb ors
Gi ải
Gi ai
Un derstand
Un ixNano
cm p
cm ath
cm peq
dec oding
dis connect
Ġ? "
inter pol
inter medi
Pr actice
document class
ous cous
Ġnext Approx
ĠRes Net
Ġshell s
double Value
float format
module x
module y
Ġcsv reader
Ġme al
Ġme asurements
Ġop timize
plate Request
Ġjson String
Ġjson Result
duc k
)] );
44 6280
44 4095
99 5
99 99
File OutputStream
VB D
VB G
VB P
gre en
lin ux
lin space
lin alg
sentiment Score
sentiment ToString
tf oot
Ġcount Comm
Ġmon oxide
Ġdet ails
ĠTwitter Factory
ĠNum py
ĠPrint Graph
27 2
55 5
Sc ale
Sc ene
Sc issors
custom ers
Ġrev enue
alle st
ĠPro ject
Ġstart s
Ġstart ed
Ġstart col
open pyxl
ĠOpen CL
price OfFuel
Ġiter ation
Ġiter ations
Ġiter tools
42 11770
42 20068
42 6497
66 6
66 7
66 00
66 66
Or der
Ser ial
Ser vers
Sentiment CoreAnnotations
]] ]]
function s
kw h
ma intenance
och ondrial
}") ]
Ġurl String
Ġlay out
Ġser ies
Ġser vice
Ġser ved
Ġser ializer
Ġpassword Input
Ġ`' /
Ġ`' '`
ĠWeb App
Ġread RDS
Average Pooling
22 9
CH OIC
CH á»ĮN
RU STERS
Ġdiv is
Ġroot Element
ĠGenerate Recommendations
ĠIN SERT
option b
option c
getElement sBy
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ
14 3317
EO F
EO L
TH RUSTERS
giá» Ľi
giá» ijng
sing le
Ġdec oding
Ġdec larative
Ġplot ly
Ġtụ ng
ĠCom ment
ĠCom pile
ĠCom plexity
ĠSc ene
ĠDocker file
opt parse
Ġpriority A
Ġpriority B
Ġoriginal Word
FF D
FF F
Sh yness
cv tColor
fl ip
fr ames
post gres
prev iew
rad a
sm iled
tag ger
view s
Ġass oci
Ġir regularly
Ġzip file
Ġtem ps
Ġtem perature
Ġtem peh
Ġcar Element
Ġcur se
original Phrase
Ġxo Äĥn
Ġxo áy
Ġxo ắn
ĠHttp Client
ĠHttp Server
Ġ{} `
requ ired
Ġind epend
Ġind entation
'; `
Ed s
Ed itor
Key s
car Node
ĠẠ¢
ĠẠ¨n
stanford nlp
ĠLu ther
ĠChá»ī nh
ĠGo thic
ĠFl orence
Ġprice Diff
Ġprice Increase
Char sets
ĠImage Font
Ġmonth ly
Request Param
17 1624
DO M
With out
With Hashtag
font size
mut ations
sl ender
Ġev ery
Ġtweet s
Ġse ason
Ġfilter edChars
Ġfirst Name
ĠAs k
ĠJohn son
Ġproduct s
Ġidiom ToOrigin
Ġplan ned
Ġplan imetric
Question naire
Ġbackground Color
Default sFormatter
Default sHelpFormatter
"" ):
95 6
Fr ench
OR DER
Rest Classifier
Rest Template
Tag Name
be en
be ans
cop y
drop out
drop Right
Ġcor pus
Ġcal frame
Ġhô m
Ġsu ôn
Ġbé n
Ġpy game
Ġpy project
Ġpass ions
Ġgam ma
ano ther
anti que
orest framework
Ġquestion Text
Ġquestion Pri
ĠText Field
Ġ`= =`
Ġhow Many
ĠSe ab
ĠSe ine
ĠSe uss
ĠSe aborn
asc time
ĠMag iê
ĠMulti ple
ĠLog ic
izz led
ĠHTTP Exception
., }${
05 72
Ap plication
Com puter
He alth
My Class
cap ita
hai ry
margin alpdbc
pet al
sky blue
tro py
Ġthrow n
Ġthrow s
Ġperson al
Ġperson alized
Ġround ed
Ġque ue
Ġcontin ent
ĠFoo Factory
ĠEn tropy
ĠEr asmus
ĠUn ited
Ġmuffin s
ĠStep s
ĠStep hen
Annot ation
clean ed
78 90
At wood
At Zero
GR AY
fy Variables
over all
over view
pg fline
Ġvector izer
Ġsuccess Rate
Ġsuccess Rates
Ġrest aurant
Ġrest Template
Ġrest aurants
Ġrectangle s
ĠDN S
excel Writer
uss ion
Ġformat ted
ĠUp Sampling
Ġarticle s
common Chars
lower cased
Ġexcel Table
Ġtransform s
Array List
Ġrecommended Stocks
Year ly
pk l
ven ue
xl im
xx x
Ġcall back
Ġcall erfram
Ġcorrect ed
Ġlaptop EnergyConsumption
Ġgre p
Ġgre ens
Ġgre etings
annot ation
ĠCam bridge
Ġ`" %
Ġ`" __
ĠSequ ence
ĠSequ ences
ĠMain Page
ĠDisplay Recommendations
search Input
ĠLin coln
estim ate
Ġcustom er
Ġstop words
ĠOr igin
grid data
Ġdetect Cat
ĠVincent y
'' ')
(? :(?
Float Field
Ir rigationRate
Log ging
Rec ent
cor enlp
present Per
ĠbÆ°á»Ľ u
Ġcheck ing
Ġcheck ed
Ġref lection
ety pes
ĠSm all
ĠDet ect
employ ee
Ġyog urt
abc defghi
eff ect
Ġanalyze WaterUsage
----------| -------------|
Ġproduction Data
Ġproduction Graph
serial ized
ĠInput Size
Ġusername Input
URL Connection
cd n
categ ories
det ached
dig est
feedback Item
ts burg
Ġav ailable
Ġcultural Factor
Ġcultural Factors
Ġmedian Usage
Ġborder Width
Ġborder Color
Ġbalanc ed
Ġno tification
Ġpe anuts
stock sData
ĠBar to
ĠPaper back
ĠMap le
ĠMont martre
ĠTrans port
ĠTrans late
ends with
ĠFile InputStream
ĠFile NotFoundError
ĠFran k
ĠIron Python
prop agate
comple x
comple tion
comple ted
Ġsetup tools
1111 000
1111 1111
Ġapprox imation
Ġcharacter istics
(", "));
.* ;
AB C
Back s
Gener ator
HT TP
Ng oại
Over view
Object Id
PR IC
SV J
SV M
SV N
blob s
blob store
blob fish
synonym List
Ġtag s
Ġclean edUpString
Ġsur face
Ġsystem s
Ġmut ations
Ġmark er
Ġbase Score
Ġbase Salary
Ġblob store
Ġkn own
ĠpastParticiple Cache
Ġrele vant
align ed
Ġmá»ī m
ĠNA SA
ĠNo am
ĠSp ain
ĠSp ecify
ĠSentiment Intensity
ĠPlot ly
ĠMar ia
ĠDate Time
Ġoper ating
Ġconcept List
Ġconcept Icon
Ġstack ed
ĠEth ereum
')[ :
Ġanimal s
Ġ109 1
Ġ109 3
ĠOR DER
101 00011
ĠStock Data
Ġrecent ly
And Significance
And Synonyms
And Antonyms
Ġunder estimate
Ġauth or
Ġauth Key
Excel Writer
Stocks Data
Ġsalary Adjustments
Ġirrigation Rate
ĠRobo tics
Ġsmartphone WaterUsage
Ġsmartphone EnergyConsumption
Ġsmartphone CarbonFootprint
47 37
AG E
AU LT
As sert
As ync
RB R
RB S
cer ies
mn emonic
rm dir
ris k
sw orth
yy yy
Ġclo sing
Ġsm allest
Ġsurv ive
Ġsurv ivor
Ġsurv ivors
Ġmanufactur ing
Ġbel ong
Ġbel ieve
Ġgener ation
Ġgener ator
Ġgener ated
initial izer
check ed
check box
ĠCA D
ĠCA SE
ĠSer vices
Ġfoot er
Ġfoot age
ĠDat abricks
ĠDat etimeIndex
access or
Ġob j
Ġob jectives
Ġcuda Printf
oper ator
ĠOk lah
ĠObject Id
ĠOne Vs
Ġprec odec
Ġexist s
DocumentBuilder Factory
Ġgrid spec
Ġadjustment s
Ġreversed String
Ġserver EnergyConsumption
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ
preprocess ing
preprocess ed
Ġtemp or
Logger Filter
Ġpeak Usage
ĠBarcel oneta
(& :
*\ *
225 143317
CG Float
Call back
GA CT
Gen etic
IS omeOtherService
Iter atorWrapper
Lat ino
OO LEAN
Run ner
Run With
dyn e
high est
lad elphia
middle ware
need le
need ed
send Keys
}/ ",
}` ;
}{ #
Ġcalcul atedSpace
Ġsent ences
Ġsearch ed
Ġmim etypes
ĠbranchLevel Length
Ġdem o
Ġdaily Usage
Ġchalleng ing
Ġpage Title
Ġpatter n
ĠCO VID
ĠCar fax
Ġ`+ `,
Ġ`~ `
alph as
alized Confirmation
ĠNeed ed
ĠSpark Session
ĠSimple XML
tific ial
ĠPr ivate
Ġfr ont
Ġ|----------| -------------------|
ĠAuthor Manager
Ġloc al
ĠGreen Genius
ĠGather UserInput
ĠJson Response
ĠFast Text
ĠElement Tree
Ġannot ator
Ġprot ective
Ġprot otype
epi log
ĠQuestion naire
Ġimpro v
Ġimpro ve
Container Size
Ġorigin X
Ġorigin Y
divis or
spec ies
Ġinterest s
Argument DefaultsHelpFormatter
ployee PerformanceData
tribution Error
population Data
CAP TU
110 1011
<< <
Am ount
Em ployeePerformanceData
Há» £p
JJ R
Op tions
Op timization
Pl us
Red is
Secret Ext
Spring BootTest
Spring Runner
jupyter lab
rd s
sk image
sk learn
uard ian
Ġom itted
Ġcountry ToDish
Ġsav ing
Ġsav ed
Ġsynonym List
Ġsocioeconomic Factor
Ġsocioeconomic Factors
Ġbec ause
Ġdel imiter
Ġpour rons
Ġppt x
information unit
information units
Ġred uc
Ġrule d
Ġrating s
Ġxer ograph
ĠTH EO
ĠTH AM
Ġ`| `
ĠName Error
elv a
elv es
ĠBlue print
Ġ--------- ---
ĠPort ugal
ĠProm oter
iciency Rating
Ġ') }"
Ġ'. '
ĠHow onots
inters ection
ĠLib rosa
Ġinsert Update
Ġ44 66
ĠGran ada
ĠGalile i
ĠGalile o
Ġdown load
ĠRand String
ĠRand onnée
ĠReturn s
ĠFeedback Analyzer
ĠFirst Name
ĠFetch StocksData
ĠEff ort
ĠEff iciency
confirmation Phrase
confirmation Len
Ġ105 1
../ ../
heapp op
heapp ush
//\./ .}"
//\./ .,}${
production Graph
Ġreport ed
ĠInter actions
ĠInter pol
Ġlogin Button
ĠAnalyze Stocks
cudaPrintf Error
cudaPrintf Format
Character Set
Ġeval uate
Approx imations
ĠEmployee Id
ĠEmployee PerformanceData
commentInput Wrapper
ĠappendDots Count
Ġagain st
ĠWilli am
Ġteam Names
setOAuth Access
setOAuth Consumer
Ġ................ ......
expense Diff
expense Increase
ĠValidate UserInput
230 416
43 171624
Calculate Average
Custom er
Dec isions
Engine er
FI LE
HC UP
Multi Scale
Out line
Open ed
Rel ationships
Sol ar
Video Writer
dia lect
hay stack
jk lmn
mun ashi
mov emask
off line
sat ya
tre es
whe els
zo om
Ậ T
Ġten xÆ¡
Ġhect ares
Ġlarg e
Ġsit com
Ġsched uler
Ġmag ic
Ġbegin AtZero
Ġpurs uit
Ġphot on
Ġkhuy a
Ġcừ u
Ġru á»Ļt
chit ect
ĠTime Line
ĠTRU E
ĠClass ify
ĠCON SUMER
Ġ`{} `
Ġ"| ",
ĠSch ool
ĠSub version
ĠSil icon
ĠSci ence
auth or
tikz pict
ĠBro thers
ĠBio Ruby
ĠPit tsburg
ĠPop ulation
ĠMang an
ĠMad rid
ĠMary land
ĠMito Fates
Ġ'// '
Ġ|---|---| ---|
ĠhợpS á»įc
ĠDict Vectorizer
ĠDuck Duck
ĠHawk ing
ĠValenc ia
ĠAss ign
ĠAugust ine
ĠThom as
ĠLor enz
Ġwaypoint Form
ĠGlobal AveragePooling
ĠGPG PU
ĠRock y
ĠRocket dyne
ister Type
('. ')
Ġstud ents
ĠFour cc
ĠEl izabeth
ĠEri k
ĠEll a
Ġ78 4
ĠWis consin
ĠWork book
ĠOS X
ĠOff ice
elev ation
ĠQA Expert
meth ylcytosine
Ġemployee Data
Ġequ al
anton yms
ĠIndi ana
penn Print
Ġshar ey
Ġrecurs ively
Ġstrong TÃŃnh
Ġatomic Numbers
Ġspace Count
Ġapi Key
Ġplant a
Ġgram mar
Ġgrand child
Ġcomput ation
ĠArm adillo
interest s
company name
Ġpopul ations
Alb atross
Signature Dish
Ġabil ities
Ġconcepts InOne
ĠDecision Mak
Control ledLifetime
Ġdemethyl ase
alphanum erics
Ġfrança is
("+----+----------------+----------------+ ");
'"" ")
285 225143317
440 818
4365 7094
42040 255
8700 00
Aut owired
Apr il
Ass essment
AVER AGE
Aero jet
Ban ana
Bas ic
Barb arian
BLA STERS
Border Country
Bayes Classifier
Cascade Classifier
Dat abase
Doc tor
Dyst opian
Eff iciencyRating
East ern
Educ ation
Febr uary
GH I
Ho Ãłn
Jaw s
Mer lin
Man chester
Mapp ing
Mov es
Mech anic
Middle ware
Nur se
Ob jectives
Off setPagination
OFF SET
Pai red
Port o
Purch ase
Rev ersed
Reg isterType
Sent ences
Sum mary
Str etch
Sorr y
Satisf action
SMA LL
TW O
Tool s
Teach er
Terrestr ial
Work out
Warri or
\", \"
flo ors
fil lna
fuel EfficiencyRating
gel ato
grow th
hex digest
jac ency
jack son
kaim ing
lim its
lampl ight
mong odb
má»ī m
oti de
oour s
pend own
sle ek
soc cer
sock addr
super lative
sweet s
tur bine
tol ist
ucle otide
voic ingAp
wom an
wxy z
{{} --{}
çĦ ¡
Ġore gano
Ġelec tron
Ġtenn is
Ġcoun tries
Ġcool ing
Ġcred entials
Ġthẳ m
Ġthoug hts
Ġhum ans
Ġhab eas
Ġheat map
Ġlue go
Ġlef t
Ġsam arium
Ġsem antic
Ġspr ite
Ġsession maker
Ġsuc ceed
Ġsapi ens
Ġmit ochondrial
Ġmoy en
Ġbell s
Ġtrá»Ļ m
ĠtrÄ© u
Ġdiá»ħ u
Ġdiss atisfied
Ġkilob yte
Ġnecess ity
Ġprom pts
Ġpys park
Ġgro ceries
Ġgoogle trans
Ġphos phory
Ġkhiá»ħ ng
onCharacter s
Ġrer un
Ġren ewable
Ġrom antique
Ġrame kin
anay ama
chron ize
chlor ophyll
atic ally
ĠTit an
ĠTour ism
ĠType Error
ĠTHÃ įCH
ĠCop ern
ĠCos mos
ĠCost a
ĠCep stral
ĠCRU D
stag ram
stder r
stuv wxyz
ardu ino
ĠNic éphore
ĠNint endo
ĠNov a
ĠNere id
ĠNutrition es
ĠSag rada
ĠSev ille
ĠSah ara
ĠSorted AuthorManager
ĠSurv ivor
ĠSerd e
Ġthems elves
ĠBas que
ĠBed egame
ĠBlob store
ĠBalanc ing
ĠBẢ NG
ĠPyth agore
ĠPab lo
ĠPip eline
ĠPass ionné
ĠPix ar
ĠPresent ation
ĠPerson alizedConfirmation
Ġ227 9000
ĠMed al
ĠMess i
ĠMart in
ĠMah atma
ĠMIM E
ĠMaint enance
ĠMitoT IP
room s
Ġ|-------| --------------|
ĠDav id
ĠDisc ussion
ĠDEF AULT
ĠDyspro si
ĠHaz el
ĠHII T
ĠHIP AA
educ ation
activ ate
intens ive
ĠVant age
ĠVitamang o
univ ocity
unicodeScalar s
ĠAutom atically
rever se
isComple ted
ĠLev enshtein
ĠLimit OffsetPagination
ĠLEF T
ĠKNN Basic
ĠKentuc ky
Ġwiz ard
Ġwood s
Ġwalk ed
usern ames
ĠChụ p
Ġoise aux
Ġconduct ed
ĠGlen n
ĠGood fellow
ĠGertr ude
ĠRich ard
ĠREST ful
ĠJerse y
ĠJetBr ains
ĠFIF A
ĠFamil ia
ĠIow a
ĠPhoen ix
ĠEinst ein
ĠEXIST S
opqr stuvwxyz
independ ence
getouter frames
getFirst Child
Ġanaly tical
straint s
ĠWarri ors
ĠQTable Widget
Ġinteg ers
obstac le
compar ative
clust er
Indentation Error
Ġjacc ard
Ġclassific ations
ĠgetTotal Capacity
ĠgetTwitter Instance
ĠgetSynonyms AndAntonyms
ĠgetTweets WithHashtag
ĠgetVen ues
ĠContainer ControlledLifetime
ĠConfiguration Builder
Ġimplement ation
Contrib utions
ĠDoubly LinkedList
Ġ1855 000
Ġrecogn ized
ĠDefault sFormatter
ĠusageBy Day
ResourceW arning
Ġnotebook s
Ġalgorith ms
Ġbeaut é
ĠImpact s
DeviceSyn chronize
Environ ment
ĠAlzhe imer
Ġdeuter ium
neighb oours
ĠposTag Map
Quanti ty
typed ef
ĠMyCall Backs
ioritize Variables
vehic les
ĠCollege Board
Integer Field
interpol ate
intermedi ate
ĠnextApprox imation
ĠjsonResult Element
446280 34
444095 73
ĠcountComm onCharacters
4211770 4
4220068 4
426497 44
CHOIC ES
getElementsBy TagName
postgres ql
Ġindepend ent
ĠidiomToOrigin AndSignificance
ĠquestionPri ority
ĠhowMany Concepts
pgfline width
Ġcallerfram erecord
ĠdetectCat s
Logging ErrorFilter
presentPer fect
abcdefghi jklmn
----------|-------------| ------------
PRIC E
ĠSentimentIntensity Analyzer
ĠconceptIcon s
10100011 1101011
ĠOklah oma
ĠOneVs RestClassifier
ĠSimpleXML Element
CAPTU RE
SecretExt ension
setOAuthAccess Token
230416 7
tikzpict ure
ĠPittsburg h
ĠDuckDuck Go
ĠconceptsInOne Branch
ĠDecisionMak er
440818 8
voicingAp ps
Ġphosphory l
ĠPersonalizedConfirmation Phrase
ĠContainerControlledLifetime Manager
abcdefghijklmn opqrstuvwxyz
101000111101011 10000
! )
! </
! {%
! }}
" \
" |
" ',
" `,
" ...
" /',
# .
$ "
$ (
$ .
$ //
$ {'
% %
% ,
% ."
% ">
% `)
% %=
& ]
& `
& `,
' !
' >
' m
' {
' ")
' ".
' `:
' };
' ></
' });
' %(
' (\
( @
( |
( ++
( %(
) !
) '
) =
) ->
) ''')
* '
* (
* /
* ;
* ]
* ")
* )`
* )(
+ '
+ :
+ '.
+ `)
+ )(
, '}
, )))
, */
- "
- $
. '
. **
. ';
. ''
. '})
/ $
/ '
/ (
/ ?
/ _
/ ")
/ ".
/ ";
/ `:
/ ](
/ }}
/ )).
/ >');
0 20
0 12
0 100
0 24
0 70
0 21
0 42
0 123
0 78
1 12
1 30
1 70
2 20
2 10
2 27
2 97
2 67
3 6
3 20
3 50
3 68
4 1
4 10
4 12
4 19
4 50
4 23
4 18
4 99
4 69
5 4
5 7
5 19
5 30
5 50
5 40
5 23
5 60
5 78
5 49
5 280
5 61
6 40
6 24
6 0000
7 20
7 25
7 50
7 18
7 65
7 66
7 22
7 34
7 39
7 432
8 2
8 20
8 19
8 16
8 23
8 300
8 365
8 859
8 82
9 30
9 80
9 60
9 45
9 86
9 265
: *
: `
: ])
: ";
: ($
: ]`
: `).
: `);
: /`
; '
; `
; ')[
; %%=
< _
< --
< ()
< >(
< >();
= %
= <
= `.
= ="
= ':
= ["
= '])
= []
= `).
= ')[
> "
> )
> *
> `
> ')
> //
> {{
> .*
? (
? )
? ;
? ]
? ).
? ')
A D
A i
A u
A v
A st
A le
A il
A ir
A iv
A NN
A RE
A tom
A lexander
A lab
A LL
A LT
A chi
A ED
A jax
A CG
A fter
A vg
A ura
A ugust
A wards
A WS
B A
B C
B F
B N
B P
B R
B Z
B l
B ên
B er
B ình
B ản
B ay
B iết
B iến
B ac
B iá»ĥu
B ảng
B ảo
B ắc
B Ãłn
B ắt
B est
B ạch
B óng
B ond
B ER
B io
B ody
B ee
B orn
B iLSTM
B igDecimal
B Ne
B LO
B OD
B usiness
B reat
B asket
B OOLEAN
C S
C e
C o
C á
C er
C ân
C al
C el
C ầu
C Æ¡n
C ao
C ung
C ent
C ảm
C âu
C re
C ad
C ách
C á»Ń
C ort
C ap
C uá»ijn
C oun
C ẩn
C ost
C òn
C ase
C ri
C ateg
C PU
C lose
C IM
C DSS
C ME
C rossentropy
C NS
C reating
C elsius
C BV
C MR
C Ậ
C apt
C actus
C NTT
C XX
C uis
C Ấ
C urry
C redit
D N
D ược
D iá»ĩn
D ân
D ù
D el
D as
D Ãłnh
D id
D ate
D ẫn
D Æ°á»Ľi
D oo
D ele
D ict
D evel
D own
D LE
D istance
D elete
D aily
D ynamic
D Matrix
D istinct
D IST
D eep
D eserialize
D eterminer
D ashboard
E M
E U
E W
E p
E st
E le
E ag
E LP
E ll
E ss
E LE
E DA
E AL
E HR
E ADER
F C
F K
F S
F T
F c
F x
F all
F ace
F ant
F ran
F lat
F ES
F OR
F iddle
F inance
F eature
F errari
F lor
F alcon
F ollow
F ootball
F latten
F requency
F eatureUnion
F orge
F rozen
G I
G d
G l
G iá»
G er
G ấu
G ot
G lue
G IA
G ood
G AN
G luten
G PS
G IS
G FP
G ỡ
G UI
G reat
G arden
H B
H i
H z
H áº
H on
H ình
H ar
H Ãłnh
H um
H om
H á»Ļi
H ub
H ist
H Ãłng
H òa
H ark
H ome
H DA
H amb
H ẹn
H á»įc
H eve
H ôm
H awk
H NO
H arris
H GA
H abitat
H alal
H OD
H afnium
H EL
H aj
H ẬT
I Y
I tal
I LE
I ÃĬ
J K
J b
J u
J ag
J ust
J ane
J azz
J ingle
J uly
J FK
K B
K ế
K in
K ung
K em
K hi
K ub
K èm
K aka
K osher
K yoto
L Ãł
L ong
L or
L ần
L áºŃp
L is
L ab
L ấy
L ow
L Ä©nh
L ight
L ite
L atter
L ink
L SE
L á»±a
L ET
L ux
L Tag
L earning
L oss
L ondon
L IKE
L IMIT
L VM
L ady
L BP
M B
M S
M W
M ê
M al
M ôi
M ut
M ac
M ad
M ạng
M od
M us
M ary
M ầm
M AT
M ức
M Ãłu
M eo
M èo
M ùa
M eth
M ục
M IN
M ild
M DA
M ID
M ợ
M exico
M ua
M ovie
M ixed
M YA
M ona
M erry
M ike
M anufacturer
M oz
M ingle
M OD
M edieval
M FCC
M aj
M arin
M asse
M edium
M unich
N H
N or
N au
N é
N ext
N Æ°á»Ľng
N út
N âng
N ov
N TP
N LU
N ES
N ULL
N aive
N ational
N ormalize
N IX
N LG
N esse
N earest
N EW
O H
O X
O OP
O nn
O cean
O LO
O áºł
P A
P C
P T
P a
P an
P ad
P ig
P ub
P ot
P ass
P lot
P ark
P assword
P red
P ron
P OS
P resent
P OR
P erm
P izza
P alindromes
P NS
P DT
P erl
P ennsylvania
P GA
P redict
P ATCH
P aella
P FS
Q A
Q R
Q uy
R P
R o
R ất
R é
R ice
R ick
R ectangle
R TC
R ich
R emove
R AN
R DB
R AM
R abin
R ussell
R TA
S L
S U
S an
S or
S ao
S ed
S âu
S iêu
S port
S hi
S úp
S py
S oc
S print
S áp
S ir
S cr
S ib
S ữa
S ep
S te
S ara
S ave
S ou
S utton
S SE
S wift
S econd
S ender
S heet
S igmoid
S parse
S imple
S ync
S chem
S eas
S leep
S UN
S uggestions
S ocioeconomic
S lug
S epar
S team
S omeOtherService
S atisfied
S GDRegressor
S imile
S ulfur
S crum
S Number
S CSS
S PL
S quare
S ushi
S ilver
S NES
S QA
T S
T in
T Äĥng
T ây
T Æ°Æ¡ng
T ur
T ac
T ÃŃch
T un
T is
T us
T ap
T uyến
T iá»ģm
T ạo
T cl
T ạm
T ech
T iếp
T ET
T ạp
T ake
T exas
T YPE
T echnology
T ÃŃn
T á»ĩp
T uá»ķi
T UN
T á»·
T AG
T LS
T ENT
T uring
T imer
T áºł
U H
U V
U Y
U se
U ns
U AG
U GA
V A
V E
V ì
V al
V ai
V ẽ
V iá»ĩc
V á»ģ
V ib
V âng
V oi
V Æ°á»Ŀn
V ua
V egan
V isual
V AL
V ING
V ALUES
V CS
W e
W or
W al
W ai
W ear
W arm
W orld
W aypoint
W nd
W XYZ
W oof
W ARE
X anh
X ấp
X ếp
X Data
X VID
X ero
X AI
X enon
Y H
Y M
Y ork
Y Data
Y MM
Z ip
Z Data
Z oho
[ [
[ `
[ ],
[ ])
[ ...
[ :]
[ :-
\ }
\ //
\ *\*
\ *]
] '
] \
] {
] ).
] //
] ],
] `:
] },
] ];
^ (
^ -
^ {
^ \*]
_ "
_ '
_ )
_ :
_ ",
_ `.
_ `,
_ ."
_ `:
_ )[::-
a e
a Latex
a ña
b b
b l
b ên
b á»Ļt
b ình
b as
b ai
b Ãłi
b ig
b python
b ắt
b iz
b ow
b út
b log
b ust
b li
b ear
b á»ĭ
b io
b row
b ound
b arr
b net
b bf
b org
b ush
b ous
b ls
b uilder
b isc
b version
b lack
b á»ı
b oring
b rew
b reed
b usiness
b ullet
b ubble
c b
c p
c w
c Ãł
c á
c ả
c ông
c am
c ây
c ec
c ấp
c um
c ad
c us
c ái
c ip
c áo
c ạnh
c our
c arb
c alcul
c ool
c arbon
c ape
c ick
c any
c á»ijt
c ould
c uá»Ļc
c asc
c á»ķ
c aC
c nx
c ogn
c á»±u
c Aiv
d g
d r
d s
d w
d iá»ĩn
d es
d ầu
d ung
d inh
d od
d ấu
d ist
d Å©ng
d ine
d ess
d á»±
d ime
d og
d á»±a
d ark
d lat
d acity
d inner
d ances
d eserial
d lon
d á»ħ
d ashboard
e j
e en
e im
e ad
e ol
e ine
e pl
e iss
e iver
e VM
f C
f e
f s
f u
f le
f em
f um
f name
f ail
f ive
f ade
f ox
f ron
f ait
f ied
f printf
f ants
f ixed
f air
f ahrenheit
f usion
f inance
f rog
f uture
f asta
f aster
f inal
f urry
g b
g c
g t
g u
g in
g ar
g ần
g áºŃt
g ment
g ow
g ard
g ov
g low
g len
g ian
g org
g cc
g old
g á»Ļp
g ui
g uel
g ebr
g mail
g entin
g boost
g ecol
h a
h c
h d
h o
h á»
h ạ
h iá»ĩn
h iá»ĩu
h as
h em
h ol
h á»Ļi
h ub
h ãy
h ef
h ép
h Ãłm
h ide
h áºŃu
h òa
h ref
h ale
h erb
h yd
h ui
h á»įc
h á»Ĺ
h ines
h ydro
h ito
h ension
h alal
h ole
h onium
h mC
i w
i qu
i as
i ate
i ef
i ant
i tives
i tical
j d
j i
j o
j or
j as
j ew
j unction
j ohn
j inja
j peg
j edi
j era
j dbc
j umps
j cick
k k
k n
k ar
k es
k ÃŃch
k ers
k ind
k eb
k éo
k String
k ok
k elium
k proc
k ogn
k ogiri
k osher
l m
l Ã
l ang
l Æ°á»Ŀi
l lo
l âu
l ize
l arg
l ond
l ater
l atter
l xml
l á»ĭch
l are
l uc
l abs
l ừa
l aunch
l imit
l cytosine
l ife
l ifetime
l xxx
m K
m d
m i
m v
m en
m ã
m es
m ặt
m ảng
m ắt
m ine
m ẫu
m ud
m ost
m ight
m ức
m Ãłu
m ade
m Ỽi
m ale
m icrosoft
m filename
m ilk
m esh
m orium
m issions
m iles
m aster
m edium
m hol
n t
n ó
n ô
n at
n Ãły
n ar
n im
n Æ°á»Ľc
n âu
n ap
n Ãło
n ip
n ine
n út
n óng
n ector
n io
n iff
n An
n ói
n ative
n á»Ńa
n ique
n uts
n ull
n What
n primes
n ever
n Open
n utrition
n Action
n Thank
n Customer
n Summary
o es
o ải
o ung
o ent
o is
o os
o tiv
o tic
o ust
o tions
o xy
o ting
o jcick
p G
p as
p em
p ass
p il
p ers
p to
p ach
p df
p tions
p ting
p ref
p az
p ix
p any
p ellant
p agination
p plication
p ura
p ickle
p timize
p amine
p ainting
p ère
p berry
p bpython
q b
q k
r U
r n
r ng
r Ãł
r á
r in
r at
r ain
r text
r á»ijc
r log
r one
r ant
r ium
r ard
r ug
r ah
r ise
r ino
r nn
r illed
r ider
r ides
r Wind
r part
r ina
r norm
r ival
r arius
r gb
r hines
s Æ¡
s en
s ar
s al
s ản
s ai
s ay
s é
s if
s ce
s ig
s ul
s av
s ue
s ore
s crip
s ans
s ữa
s lic
s ia
s yn
s ium
s low
s ie
s ign
s ix
s ior
s Item
s parse
s printf
s urvey
s ources
s imilar
s Items
s ales
s uck
s izes
s ampling
s ocioeconomic
s plash
s witch
s gd
s emble
s upport
s ignificance
s niff
t ần
t ân
t ại
t áºŃp
t ang
t anh
t iến
t un
t ảng
t od
t ái
t ect
t end
t our
t óm
t oo
t ener
t one
t len
t own
t ầng
t ake
t ta
t tf
t uá»ķi
t mp
t ania
t ario
t Factor
t ension
t uring
t une
t ected
t kinter
t á»ıa
u on
u er
u an
u ar
u ed
u int
u ce
u ation
u ip
u able
u ẩn
u enc
u ite
u we
u vers
u eta
u Get
u ched
u etype
u issions
u hito
u ji
v a
v c
v d
v i
v s
v u
v ô
v in
v or
v áºŃn
v ion
v ence
v ượt
v ader
v ender
v anc
v OS
v Æ°á»Ŀn
v á»Ĺ
v ariance
v á»ı
v ượn
v isual
v ẫy
v jw
v bnet
v tFactor
w C
w c
w v
w on
w es
w ur
w av
w il
w get
w ant
w ere
w arm
w aterUsage
w ild
w ould
w right
w hich
w space
w arming
w isp
w osrecords
w elfare
w riting
w Fx
w pem
x in
x em
x id
x ảy
x html
x code
x FF
x Run
x anthophylls
x gboost
y i
y z
y am
y lo
y ag
y ou
y og
y ield
y elp
y ush
y cho
y box
y Get
y All
y scale
y ra
y beans
y borg
y finance
z u
z ô
z on
z ac
z Äij
z sh
z ym
z ero
z uk
z dw
z wil
{ #
{ &
| |
| ')
| ----------------
| --------------------------------
| ----------|-------------|------------
} %
} +
} .
} [
} ",
} };
} .")
} '`
} ?"
} )',
} !")
} :")
} ${'
} ]\
~ `)
¢ ,
£ n
¥ a
¦ N
¦ Į
¦ tta
« ä
® A
® T
¯ c
¯ ")
¶ T
¸ ı
¸ ãĤ
¸ rn
º ķ
» zô
¼ ell
¾ U
 ²
à Ĥ
à Ī
à ī
à Ŀ
à ©c
à ĮN
à ¯c
à ¼ell
Å ĵ
Ì £
Î ¼
Î Ķ
â Ŀ
ã ģ
å Ī
æ Ī
æ İ
ï Ĥ
ï ¸ı
Ċ ĊĠĠĠĠĊĠĠĠ
Ġ er
Ġ Æ°á»Ľ
Ġ ur
Ġ ent
Ġ ấp
Ġ âu
Ġ );
Ġ ip
Ġ ôn
Ġ ord
Ġ Æ¡i
Ġ ĊĠĠĠĠĠĠĠĠĠĠĠ
Ġ ice
Ġ ĊĊĠĠĠ
Ġ 000
Ġ ey
Ġ ])
Ġ enti
Ġ ens
Ġ ave
Ġ ....
Ġ order
Ġ uyá»ĥn
Ġ utf
Ġ á»ijm
Ġ ĊĠĠĠĠĠĠĠĠĠĠ
Ġ eff
Ġ entropy
Ġ estimator
Ġ effort
Ġ Æ°á»Ľt
Ġ orders
Ġ uri
Ġ ......
Ġ epilog
Ġ Åĵ
Ġ ÎĶ
Ġ ïĤ
Ģ N
ģ ãģ
Ĥ n
Ħ ",
Ħ ¢,
Ħ ï¸ı
ħ u
ħ ",
ĩ ch
ī a
İ Ħ",
İ ħ",
IJ ng
Ĵ ¯")
Ĵ æİ
ĵ M
ĺ NG
ĺ ãĤ
ļ [(
Ľ n
Ŀ ãĤ
á» µ
á» Ĭ
á» ®A
á» ĢN
á» ĺNG
Ạ©ng
Ạ®T
Ạ¶T
Ạ¾U
Ġt z
Ġt á
Ġt on
Ġt er
Ġt á»Ļt
Ġt it
Ġt ung
Ġt ết
Ġt úng
Ġt ang
Ġt Æ°á»Ľc
Ġt id
Ġt ấy
Ġt úc
Ġt Æ°á»Ľng
Ġt ens
Ġt ail
Ġt ắm
Ġt ell
Ġt òi
Ġt ech
Ġt wit
Ġt body
Ġt ee
Ġt eng
Ġt ambi
Ġt errestr
Ġt vOS
ng Äĥn
ng hi
ng ưỡng
ng io
ng ines
ng redients
Ġc p
Ġc ược
Ġc Æ°Æ¡ng
Ġc ython
Ġc ac
Ġc od
Ġc ấy
Ġc úc
Ġc ub
Ġc ắn
Ġc Æ°a
Ġc os
Ġc áp
Ġc rom
Ġc ám
Ġc ạo
Ġc ach
Ġc õi
Ġc ock
Ġc rit
Ġc ưỡng
Ġc ri
Ġc ream
Ġc ert
Ġc arn
Ġc og
Ġc urv
Ġc ls
Ġc err
Ġc sharp
Ġc ache
Ġc opy
Ġc ascade
Ġc odec
Ġc ouscous
Ġc yborg
ĠÄ Ĥn
ĠÄij iá»ĥu
ĠÄij om
ĠÄij ắc
ĠÄij ẻ
ĠÄij Äĥm
ĠÄij ạc
ĠÄij òn
ĠÄij Ä©nh
ĠÄij ấm
ĠÄij ùi
nh Ãł
nh ân
nh áºŃp
nh ằm
nh Æ°ng
nh eim
Ġth au
Ġth ản
Ġth ôi
Ġth ắc
Ġth ấu
Ġth iêu
Ġth iá»ĩt
Ġth ép
Ġth ắp
Ġth Tên
Ġth Dân
Ġth rone
Ġv d
Ġv e
Ġv ác
Ġv ó
Ġv ả
Ġv on
Ġv ược
Ġv ất
Ġv Äĥng
Ġv ặt
Ġv áng
Ġv á»Ļi
Ġv ot
Ġv Å©ng
Ġv át
Ġv Æ°á»Ľng
Ġv ers
Ġv ảy
Ġv ạm
Ġv ast
Ġv ive
Ġv ặn
Ġv ùi
Ġv ẹo
Ġv hic
Ġv oice
Ġv isual
Ġv illage
Ġv ictoria
Ġv vjw
Ġh a
Ġh ong
Ġh ân
Ġh Æ°Æ¡
Ġh ung
Ġh im
Ġh úng
Ġh un
Ġh ad
Ġh and
Ġh ap
Ġh ấn
Ġh ấu
Ġh ẻ
Ġh ẳ
Ġh ẹ
Ġh ầm
Ġh Å©
Ġh ast
Ġh ard
Ġh ill
Ġh ói
Ġh èn
Ġh ello
Ġh az
Ġh umb
Ġh ùm
Ġh abil
Ġh abitat
Ġh alf
Ġl m
Ġl ng
Ġl Æ°
Ġl es
Ġl úng
Ġl ôi
Ġl em
Ġl ate
Ġl ip
Ġl ord
Ġl ess
Ġl eg
Ġl ÃŃt
Ġl ater
Ġl ắm
Ġl igh
Ġl ift
Ġl ik
Ġl ake
Ġl amb
Ġl abs
Ġl ife
Ġl imb
Ġl ived
Ġl ively
Ġl ÃŃu
Ġl icense
Ġs á
Ġs on
Ġs at
Ġs en
Ġs le
Ġs iết
Ġs ùng
Ġs ảo
Ġs ấy
Ġs âm
Ġs Æ°a
Ġs he
Ġs pro
Ġs cr
Ġs ảy
Ġs ia
Ġs ep
Ġs Æ°ng
Ġs ci
Ġs ite
Ġs ound
Ġs ensor
Ġs ense
Ġs pp
Ġs wift
Ġs ran
Ġs ign
Ġs ee
Ġs En
Ġs ender
Ġs und
Ġs ake
Ġs plit
Ġs rand
Ġs chem
Ġs printf
Ġs uel
Ġs imilar
Ġs way
Ġs ecret
Ġs oma
Ġs ẹo
Ġs uggestions
Ġs eek
Ġs yntactic
Ġs vm
Ġs imb
Ġs imile
Ġs ulfur
Ġs crum
Ġs elec
Ġs ignificance
Ġs ushi
Ġs ashimi
Ġs elva
Ġs fum
Ġs nip
Ġs vc
Ġm m
Ġm á
Ġm ạ
Ġm ác
Ġm er
Ġm en
Ġm el
Ġm ic
Ġm Ãłi
Ġm ed
Ġm ac
Ġm int
Ġm un
Ġm se
Ġm ẫn
Ġm Æ°u
Ġm òng
Ġm ist
Ġm il
Ġm ép
Ġm ir
Ġm ount
Ġm ight
Ġm ash
Ġm éo
Ġm eo
Ġm sc
Ġm ạp
Ġm Æ°Æ¡i
Ġm icro
Ġm ane
Ġm ixed
Ġm adam
Ġm atches
Ġm ượn
Ġm ammal
Ġm ercur
Ġm istakes
Ġm ito
Ġm iles
Ġm edieval
Ġm kString
Ġm otiv
Ġb c
Ġb g
Ġb al
Ġb ến
Ġb ut
Ġb re
Ġb id
Ġb ắc
Ġb Ãłng
Ġb ust
Ġb ẩy
Ġb son
Ġb ash
Ġb ùa
Ġb iếc
Ġb read
Ġb ox
Ġb rand
Ġb oost
Ġb box
Ġb oard
Ġb right
Ġb ranch
Ġb logging
Ġb lank
Ġb logger
Ġb ird
Ġb wb
Ġb lack
Ġb reed
Ġb asis
Ġb ullet
Ġb ubble
Ġb reeze
Ġb risk
Ġtr o
Ġtr ù
Ġtr Æ¡n
Ġtr áºŃt
Ġtr inh
Ġtr án
Ġtr êu
Ġtr ảng
Ġtr á»Ļi
Ġtr av
Ġtr op
Ġtr ack
Ġtr eat
Ġtr averse
Ġd s
Ġd on
Ġd ì
Ġd in
Ġd ại
Ġd im
Ġd ang
Ġd ro
Ġd âu
Ġd Ä©
Ġd ig
Ġd ip
Ġd Æ¡i
Ġd át
Ġd ime
Ġd ust
Ġd jang
Ġd eed
Ġd ense
Ġd iếp
Ġd anc
Ġd lat
Ġd iction
Ġd inner
Ġd istr
Ġd ynamic
Ġd istrib
Ġd ress
Ġd ams
Ġd emon
Ġd istinct
Ġd ensity
Ġd ebug
Ġd lon
Ġd ẹt
Ġd yspro
Ġd elicious
Ġd eviation
Ġd romed
Ġd rug
Ġch Ãł
Ġch ì
Ġch er
Ġch iá»ĩn
Ġch inh
Ġch ảo
Ġch iêu
Ġch Ãłng
Ġch át
Ġch iá»ģn
Ġch ắp
Ġch ant
Ġch ãi
Ġch uá»ijt
Ġch ôm
Ġch amp
Ġch ùm
Ġch én
Ġk ẽ
Ġk ay
Ġk iêu
Ġk ẹp
Ġk iss
Ġk èn
Ġk ìa
Ġk eng
Ġk Hz
ó p
ó xid
ĠÄijá» ¥c
ĠÄijá» Ľn
Ġnh ô
Ġnh ÃŃ
Ġnh ai
Ġnh ung
Ġnh Ãłi
Ġnh ẫn
Ġnh Ãłn
Ġnh áy
Ġnh õ
Ġnh áp
Ġnh ám
Ġnh á»įc
Ġnh á»ĵi
Ġn i
Ġn ặc
Ġn as
Ġn ic
Ġn anh
Ġn án
Ġn ạt
Ġn Ãłn
Ġn áo
Ġn ob
Ġn col
Ġn ep
Ġn ight
Ġn ức
Ġn ấm
Ġn ov
Ġn ood
Ġn ose
Ġn á»ĵi
Ġn vidia
Ġn ational
Ġn itric
Ġn earest
Ġn ucleotide
Ġp k
Ġp an
Ġp anh
Ġp ent
Ġp lo
Ġp é
Ġp il
Ġp ow
Ġp print
Ġp ob
Ġp ep
Ġp df
Ġp ear
Ġp ara
Ġp ert
Ġp atch
Ġp ÄIJ
Ġp ense
Ġp ark
Ġp ie
Ġp anc
Ġp John
Ġp yd
Ġp ied
Ġp agin
Ġp eas
Ġp ike
Ġp Lá»Ĺi
Ġp ita
Ġp XYZ
Ġp NhÃł
Ġp oly
Ġp ainting
Ġp ylint
Ġp Cuá»ijn
Ġp Ocean
Ġp uissions
Ġthá» ±
Ġthá» ijt
Ġg ác
Ġg ên
Ġg or
Ġg ar
Ġg ân
Ġg ent
Ġg em
Ġg á»iji
Ġg ãy
Ġg ôn
Ġg for
Ġg áºŃy
Ġg ừ
Ġg ảy
Ġg ìn
Ġg ầy
Ġg low
Ġg eo
Ġg ran
Ġg uá»ijc
Ġg cc
Ġg old
Ġg reen
Ġg ather
Ġg event
Ġg reatest
Ġg aler
Ġg arden
Ġg luc
Ġph en
Ġph ết
Ġph un
Ġph ách
Ġph ẫn
Ġph iá»ĩt
Ġph ẫu
Ġph á»Ļng
Ġph á»ĵng
Ġkh an
Ġkh iên
Ġkh ải
Ġkh ay
Ġkh iết
Ġkh âu
Ġcá» ±
Ġcá» į
Ġcá» Ĺi
Ġcá» įc
Ġcá» ±a
Ġcá» ĵn
Ġcá» ĵng
Ġcá» ±u
ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
Ġsá» ©a
Ġsá» ¥t
Ġdá» Ĺ
Ġdá» Ŀi
Ġdá» iji
ÃŃ z
ÃŃ vor
on y
on in
on ew
on ia
on na
on message
on be
on nx
on fram
on jour
on tium
on kers
on zu
Ġng a
Ġng Ãł
Ġng á»Ļ
Ġng ã
Ġng ai
Ġng ò
Ġng Æ°á»Ľc
Ġng Äĥm
Ġng áp
Ġng á»ijc
Ġng ạo
Ġng ầm
Ġng óc
Ġng ục
Ġng Æ°Æ¡i
Ġng ẩng
Ġtá» §y
Ġtá» Łm
in ing
in um
in ata
in ation
in op
in ary
in son
in ara
in vert
in vest
in Transaction
in ally
in Controller
in structions
in scope
in voicingApps
in cip
Ġvá» £
Ġvá» ĵ
Ġvá» Ŀ
Ġvá» ©t
Ġvá» īa
Ġr i
Ġr ng
Ġr á»Ļ
Ġr on
Ġr an
Ġr ong
Ġr Æ°Æ¡ng
Ġr ay
Ġr ò
Ġr Ãłnh
Ġr á»ĥ
Ġr is
Ġr ation
Ġr áo
Ġr ot
Ġr ẻ
Ġr á»Ĺi
Ġr át
Ġr eb
Ġr ạch
Ġr ib
Ġr ob
Ġr ia
Ġr ÃŃt
Ġr á»ī
Ġr óc
Ġr ocket
Ġr dd
Ġr oma
Ġr etri
Ġr ider
Ġr á»ijn
Ġr epar
Ġr ÃŃu
Ġr egression
Ġgi Æ°Æ¡ng
Ġgi ẻ
Ġgi Å©
Ġgi ấm
er u
er al
er to
er ia
er ov
er ge
er ick
er red
er izer
er ala
er cise
er land
er ious
er vices
er inas
er ything
qu ả
qu it
qu ang
qu é
qu ẳng
qu ỹ
qu ares
qu arters
qu oting
an st
an ln
an iel
an ello
an ish
an imation
an esson
an aconda
Ġhá» iji
Ġhá» Ľp
Ġhá» ¥t
or on
or er
or us
or ation
or ph
or lib
or ie
ch r
ch ó
ch ữ
ch ải
ch iến
ch uyên
ch ạy
ch ủ
ch art
ch uá»iji
ch ive
ch áºŃm
ch iếc
ch èn
ch ants
ch nology
ch unk
ch uá»Ĺi
ch arming
ch romed
ch uẩn
at ar
at form
at map
at erson
at omic
at ely
at tracted
at tribute
at rina
at yag
Ġqu ê
Ġqu ặc
Ġqu ot
Ġqu áºŃy
Ġqu ẩn
Ġqu ick
Ġqu ality
Ġqu inoa
Ġqu arters
Ġqu ỵ
Ġx x
Ġx Äĥng
Ġx iết
Ġx ò
Ġx ấp
Ġx âm
Ġx Æ°á»Łng
Ġx path
Ġx li
Ġx Æ°ng
Ġx ÃŃt
Ġx range
Ġx lsx
Ġx Axes
Ġx én
Ġx iá»ģng
Ġx itric
Ġx ylo
en en
en ol
en ner
en ade
en ames
en ry
en ada
en berg
ĠT F
ĠT V
ĠT b
ĠT c
ĠT i
ĠT l
ĠT m
ĠT s
ĠT y
ĠT ế
ĠT ân
ĠT iên
ĠT im
ĠT ạng
ĠT ag
ĠT us
ĠT ách
ĠT ab
ĠT á»Ń
ĠT ap
ĠT á»į
ĠT ass
ĠT iv
ĠT ủ
ĠT ener
ĠT ẩy
ĠT ant
ĠT ức
ĠT ory
ĠT ell
ĠT og
ĠT ech
ĠT orch
ĠT erb
ĠT of
ĠT imes
ĠT ua
ĠT yt
ĠT emplate
ĠT iêm
ĠT LS
ĠT ÃŃa
ĠT utor
ĠT á»ĵn
ĠT kinter
ĠT Ư
ĠT Ấ
ĠT axes
ĠT ẮT
ĠT ony
ú n
uy p
ĠC C
ĠC d
ĠC e
ĠC f
ĠC m
ĠC n
ĠC o
ĠC s
ĠC u
ĠC as
ĠC ao
ĠC it
ĠC um
ĠC un
ĠC úc
ĠC Äĥn
ĠC av
ĠC ot
ĠC ặp
ĠC ev
ĠC able
ĠC iv
ĠC rom
ĠC ủ
ĠC áºŃu
ĠC ov
ĠC ream
ĠC atch
ĠC arn
ĠC oh
ĠC ran
ĠC ello
ĠC ake
ĠC lose
ĠC ustom
ĠC ycle
ĠC orrect
ĠC ala
ĠC ourse
ĠC asc
ĠC ultural
ĠC ities
ĠC ủa
ĠC NS
ĠC opy
ĠC ountry
ĠC Ãģ
ĠC umber
ĠC loud
ĠC afe
ĠC OUNTIF
ĠC Há»
ĠC affe
ĠC lear
ĠC reating
ĠC elsius
ĠC MR
ĠC off
ĠC oban
ĠC afé
ĠC LI
ĠC XX
ĠC uis
ĠC á»Ŀ
ĠC redit
ĠC ouscous
ĠC pG
ĠC uyp
Ġdụng Qu
Ġdụng TÃŃnh
Ġdụng Sách
Ġdụng Xero
Ġdụng Zoho
st ar
st ad
st od
st age
st ant
st ool
st arr
st fl
st anti
st ones
st icks
Ġ` <
Ġ` ()`
Ġ` ['
Ġ` &`
Ġlá» įn
Ġlá» ©t
Ġlá» ¥t
Ġlá» £n
Ġlá» ¥a
le ti
le igh
le ss
le af
le uc
le ster
le woman
Ġchá» Ľp
Ġchá» «ng
Ġchá» ĩch
ar as
ar ic
ar ro
ar ing
ar tr
ar ter
ar os
ar ity
ar me
ar Regressor
ar anus
ar uhito
ar qué
Ġ" (
Ġ" +
Ġ" _
Ġ" `
Ġ" ",
Ġ" ("
Ġ" ")
Ġ" ----------------
Ġ" \"
Ġ" :\
Ġ" ?"
Ġ" }"
Ġ" '"
Ġ" ../../
Ġ" âĿ
Ġcho is
Ġcho áng
Ġcho Ãłng
Ġcho col
Ġcho ps
Ġcho lester
Ġtrá» ĩ
Ġho i
Ġho ại
Ġho ur
Ġho jas
ĠÄIJ en
ĠÄIJ ất
ĠÄIJ Äĥng
ĠÄIJ áºŃp
ĠÄIJ ÃŃnh
ĠÄIJ á»ĩ
ĠÄIJ áng
ĠÄIJ úc
ĠÄIJ á»ģn
ĠÄIJ êm
ĠÄIJ ôn
ĠÄIJ ẩy
ĠÄIJ á»ijt
ĠÄIJ Ä©a
ĠÄIJ ếm
ĠÄIJ Oáºł
ĠÄIJ ÃĤ
ĠÄIJ á»ĺNG
ĠÄIJ ẶT
th ô
th ì
th an
th ú
th ất
th th
th am
th Æ°Æ¡ng
th anh
th Ãłnh
th á»ĥ
th us
th ol
th eg
th ey
th eo
th á»ĭ
th row
th ree
th umb
th ằn
th á»Ŀi
th reshold
th ailand
th oug
th rilled
Ġ1 75
Ġ1 123
al S
al d
al o
al um
al ap
al ine
al ance
al ive
al ert
al og
al ick
al da
al tim
al ife
al ways
al onia
Ġmá» ¹
Ġmá» ı
es ape
es ian
es IO
es cap
es cape
es père
am u
am ame
am enc
am ps
am ous
am sm
am eter
am ole
am orph
et ur
et iz
et ers
et up
et ele
et ium
et yl
et itle
et imes
et ts
et eVM
ĠN b
ĠN d
ĠN p
ĠN it
ĠN âu
ĠN est
ĠN ev
ĠN ath
ĠN oo
ĠN út
ĠN ắng
ĠN eth
ĠN ick
ĠN iel
ĠN ik
ĠN ụ
ĠN ous
ĠN UM
ĠN Ä©a
ĠN LU
ĠN uôi
ĠN OU
ĠN HÃ
ĠN etwork
ĠN ever
ĠN Há»
ĠN imb
ĠN LG
ĠN REM
ĠN BA
ĠN HẬT
ĠN LTag
ĠN SNumber
ĠN uGet
ĠN ẾU
ĠN aruhito
Ġ( .
Ġ( _
Ġ( --
Ġ( ).
Ġ( ):
Ġ( `.
Ġ( `:
Ġ( ""
Ġ( °
Ġ( �
ĠS H
ĠS b
ĠS g
ĠS n
ĠS r
ĠS ÃŃ
ĠS ân
ĠS im
ĠS ec
ĠS ing
ĠS ed
ĠS um
ĠS ắc
ĠS and
ĠS iêu
ĠS hi
ĠS age
ĠS áo
ĠS ist
ĠS op
ĠS print
ĠS áp
ĠS eb
ĠS ax
ĠS ection
ĠS ER
ĠS eed
ĠS SD
ĠS ample
ĠS utton
ĠS ession
ĠS af
ĠS ake
ĠS of
ĠS earch
ĠS ky
ĠS igm
ĠS als
ĠS ync
ĠS á»įc
ĠS anti
ĠS á»ķ
ĠS ales
ĠS uzzle
ĠS olution
ĠS CON
ĠS ieve
ĠS erial
ĠS AM
ĠS ợ
ĠS ecure
ĠS MARTPHONE
ĠS elenium
ĠS ynt
ĠS omeOtherService
ĠS yntactic
ĠS imile
ĠS ulfur
ĠS crum
ĠS aving
ĠS udan
ĠS ashimi
ĠS elva
ĠS UGA
ĠS YM
ĠS quares
ĠS atyag
el ac
el us
el ist
el li
el ly
el te
el ative
el park
el imit
el ters
au ss
ti nh
ti êm
ti ment
ti str
ti mon
ti sol
ti fyVariables
Ġthe ad
ĠB I
ĠB N
ĠB h
ĠB i
ĠB k
ĠB á»ij
ĠB áºŃt
ĠB ôi
ĠB á»ĥ
ĠB ut
ĠB un
ĠB á»ĵ
ĠB re
ĠB ol
ĠB á»ģn
ĠB ass
ĠB ow
ĠB rom
ĠB ore
ĠB ack
ĠB ạc
ĠB uá»ĵn
ĠB urr
ĠB rit
ĠB ear
ĠB arb
ĠB ari
ĠB ast
ĠB ÃŃt
ĠB ool
ĠB ond
ĠB ER
ĠB ern
ĠB éo
ĠB á»ĭ
ĠB arr
ĠB oh
ĠB ụ
ĠB ale
ĠB uff
ĠB reak
ĠB ank
ĠB box
ĠB oard
ĠB ìa
ĠB ùn
ĠB yt
ĠB á»ķ
ĠB uzz
ĠB urch
ĠB lack
ĠB erry
ĠB LS
ĠB oy
ĠB Ãģ
ĠB ẫy
ĠB ism
ĠB Æ°á»Łi
ĠB orders
ĠB LO
ĠB MR
ĠB ertr
ĠB usiness
ĠB ugs
ĠB angladesh
ĠB oat
ĠB etz
ĠB asket
ĠB eryl
ĠB OOLEAN
ĠB ẬT
ĠB uon
ĠB yz
ĠB ÃĮN
ĠB onjour
ĠB oron
ĠB ún
ĠB alance
ĠB etele
ĠhÃł n
ĠhÃł u
as er
as ab
as il
as ia
as ync
as ana
as adam
as mag
as XML
as gow
ao far
it ô
it ab
it ation
it ary
it ert
it ron
it ney
Ġ- =
Ġ- ----
Ġ- |----------|-------------|------------
ai c
ai do
ai mer
ai lear
ai thers
Ġngh iá»ĩn
im us
im pl
im ét
im per
im ated
im mer
im pact
im edia
ĠP I
ĠP a
ĠP b
ĠP d
ĠP m
ĠP t
ĠP ao
ĠP ut
ĠP ad
ĠP ap
ĠP ers
ĠP ath
ĠP ack
ĠP all
ĠP art
ĠP ach
ĠP ool
ĠP lay
ĠP IN
ĠP ale
ĠP uff
ĠP lut
ĠP rad
ĠP rase
ĠP asc
ĠP izz
ĠP uzzle
ĠP izza
ĠP UN
ĠP ress
ĠP NS
ĠP agination
ĠP oe
ĠP ROP
ĠP iano
ĠP esto
ĠP ylint
ĠP Háº
ĠP PC
ĠP eine
ĠP wC
ĠP onzu
ĠP eru
ĠP aterson
Ġ2 20
Ġ2 25
Ġ2 60
Ġ2 200
Ġ2 70
Ġ2 65
Ġ2 22
Ġ2 72
Ġ2 13
Ġ2 17
ur lo
ur ity
ur ance
ur ep
ur ium
ur ky
ur ger
ĠM B
ĠM S
ĠM d
ĠM g
ĠM n
ĠM t
ĠM en
ĠM Äĥng
ĠM ay
ĠM ic
ĠM ent
ĠM inh
ĠM ut
ĠM is
ĠM ắc
ĠM ort
ĠM Ãłn
ĠM ấu
ĠM ạnh
ĠM end
ĠM Ãłng
ĠM os
ĠM ore
ĠM ax
ĠM ẹ
ĠM ON
ĠM á»ĩt
ĠM ari
ĠM atch
ĠM ùa
ĠM ỳ
ĠM essage
ĠM ill
ĠM acy
ĠM IN
ĠM orr
ĠM ake
ĠM áu
ĠM ove
ĠM oul
ĠM ates
ĠM enu
ĠM anu
ĠM ùi
ĠM ovie
ĠM eit
ĠM ilk
ĠM ẹo
ĠM uzzle
ĠM ouse
ĠM erry
ĠM esh
ĠM opy
ĠM oy
ĠM achine
ĠM oz
ĠM á»Ŀi
ĠM alus
ĠM edieval
ĠM FCC
ĠM GM
ĠM unich
ĠM oly
ĠM ELP
ĠM Pa
ĠM YH
ĠM erge
Ġhá»į ng
ay a
ay er
ay leigh
ic x
ic an
ic us
ic ase
ic GUI
Ġ' &
Ġ' :
Ġ' ;
Ġ' <
Ġ' [
Ġ' ))
Ġ' ="
Ġ' ').
Ġ' '])
Ġ' });
Ġ' )[
Ġ' ';
Ġ' ''
Ġ' %(
Ġ' *.
Ġ' <<<
Ġ' ../../
Ġ' +'
Ġ' ?')
ent o
ent on
ent re
ent own
ent Default
ý t
-- $
-- ;
Ġphá i
Ġphá o
Ġto o
Ġto ol
Ġto pp
Ġto mat
Ġto ward
Ġto ler
Ġto day
Ġto upper
Ġto fu
Ġto uched
Ġthu á»ķng
ec us
ec ting
ec ified
ec iate
Ġá» ¦
Ġá» ª
Ġá» Ĵ
Ġá» Ľt
Ġá» IJng
Ġf ar
Ġf ur
Ġf ol
Ġf ul
Ġf av
Ġf il
Ġf our
Ġf all
Ġf ly
Ġf ox
Ġf ree
Ġf light
Ġf anc
Ġf lat
Ġf ood
Ġf lex
Ġf lower
Ġf amily
Ġf lour
Ġf idget
Ġf olate
Ġf ollow
Ġf requency
Ġf otos
Ġf amous
Ġbá» ķng
Ġbá» įt
ro d
ro i
ro t
ro ject
ro ber
ro ix
ro trans
ro tein
ro gen
ro ts
ro bust
ro llo
ro yAll
ro stfl
ro aring
Ġ| \
Ġ| ");
Ġ| --------------|
Ġ| -------------|
Ġ| -------------------|
Ġ| ------|
Ġ| --------|
ĠnÄĥng tÃŃnh
ĠnÄĥng Kế
ĠÄijó m
inh ub
() '
() *
() +
() [
() ]
() {
() ],
() ])
() ">
() ([
() '.
() },
() ->
() [::-
Ġgiá» Ł
Ġgiá» ıi
Ġhợp Sh
ĠD T
ĠD b
ĠD s
ĠD y
ĠD Ãły
ĠD ầu
ĠD Ãłi
ĠD inh
ĠD em
ĠD á»iji
ĠD ion
ĠD om
ĠD us
ĠD ẫn
ĠD ul
ĠD ub
ĠD ip
ĠD Å©ng
ĠD oc
ĠD Æ°a
ĠD iv
ĠD ans
ĠD one
ĠD ial
ĠD ream
ĠD evel
ĠD ick
ĠD own
ĠD ET
ĠD arm
ĠD TC
ĠD elete
ĠD ATE
ĠD aff
ĠD istinct
ĠD azz
ĠD îner
ĠD arc
ĠD alt
ĠD ivide
ĠD VI
ĠD ứa
ĠD eviation
ĠD IY
ĠD elac
Ġra ce
Ġra cec
Ġra vi
Ġra ÃŃz
Ġnó n
em y
em ing
em ium
em place
em ming
ĠH H
ĠH f
ĠH g
ĠH i
ĠH s
ĠH at
ĠH uy
ĠH óa
ĠH é
ĠH and
ĠH ạnh
ĠH ass
ĠH Æ¡i
ĠH ath
ĠH art
ĠH ide
ĠH ầm
ĠH áºŃu
ĠH ÃŃt
ĠH uyết
ĠH Ãłu
ĠH uff
ĠH ome
ĠH ẹn
ĠH erd
ĠH elium
ĠH anna
ĠH ÃĢ
ĠH enry
ĠH eming
Ġ3 8
Ġ3 30
Ġ3 16
Ġ3 75
ex change
ex cell
ex pression
ex penses
ut c
ut ers
ut able
ut aceaebrChi
ut enberg
ut etium
ed am
ed ir
ed In
ed Class
ed rec
ed Stocks
ed tuple
ed states
ed rá
ed itary
ac es
ac ion
ac ey
ac count
ac tix
ac tivities
ac ias
ac amole
ac etyl
um inata
ĠTr y
ĠTr iá»ģu
ĠTr ao
ĠTr inh
ĠTr Äĥn
ĠTr òn
ĠTr ầm
ĠTr uyá»ĩn
ĠTr á»ĭ
ĠTr á»ijng
ĠTr ee
ĠTr uffle
ĠTr averse
ĠTr uly
ĠTr ackData
int on
int é
int ech
int ensity
int rin
int stones
Ġ{ __
Ġ{ **
Ġ{ ...
Ġ{ },
Ġ{ });
ĠV I
ĠV ô
ĠV ân
ĠV ết
ĠV Ãłi
ĠV ững
ĠV ec
ĠV áºŃn
ĠV is
ĠV á»ĩ
ĠV ue
ĠV il
ĠV õ
ĠV ers
ĠV ir
ĠV ond
ĠV oid
ĠV ectÆ¡
ĠV ụ
ĠV erb
ĠV ient
ĠV ừa
ĠV ua
ĠV ượn
ĠV oice
ĠV acuum
ĠV IP
ĠV elocity
ĠV ADER
ĠV BZ
ĠV onfram
ĠV aranus
ĠV edrá
Ġy a
Ġy et
Ġy oung
00 5
00 16
00 44
00 404
lo ại
lo vel
lo doc
un def
un der
un icode
un zipped
un elles
un used
un splash
ĠA L
ĠA P
ĠA re
ĠA ct
ĠA ction
ĠA St
ĠA ri
ĠA equ
ĠA br
ĠA stat
ĠA ux
ĠA LU
ĠA ES
ĠA way
ĠA DP
ĠA DD
ĠA NO
ĠA spect
ĠA jax
ĠA fter
ĠA UC
ĠA udio
ĠA wards
ĠA jw
ĠA Forge
Ġquan tity
Ġquan tifyVariables
Ġkhi êng
é e
é u
é sie
é vu
Ġgiá p
re p
re y
re ject
re ps
re gr
re ases
Ġlo a
Ġlo s
Ġlo ãng
Ġlo ok
Ġlo oping
is n
is ô
is on
is el
is per
is Em
is Deleted
is ks
ad i
ad on
ad es
ad ing
ad ap
ad ow
ad ers
ad ise
ad just
ad ville
ad olin
ad enos
ad jacency
ad uwe
ad stool
ad emy
ion el
ion ine
ion ship
id ed
id id
id ium
id ual
id entify
á»ĩ ch
od er
od or
od ium
ĠTh i
ĠTh ÃŃ
ĠTh an
ĠTh ất
ĠTh ần
ĠTh Äĥng
ĠTh anh
ĠTh ảo
ĠTh ấy
ĠTh ul
ĠTh áo
ĠTh Æ°a
ĠTh áºŃm
ĠTh iếc
ĠTh rust
ĠTh ree
ĠTh ừa
ĠTh ailand
ĠTh allium
ĠTh Maj
ĠTh oải
se y
se ed
se um
se par
se go
se ven
ĠL C
ĠL D
ĠL G
ĠL r
ĠL v
ĠL á»Ļ
ĠL iá»ĩu
ĠL ần
ĠL es
ĠL as
ĠL áºŃt
ĠL Ãłnh
ĠL inh
ĠL ex
ĠL âu
ĠL ate
ĠL and
ĠL úc
ĠL á»į
ĠL ow
ĠL ith
ĠL ost
ĠL lot
ĠL ear
ĠL ạm
ĠL ight
ĠL ive
ĠL ook
ĠL az
ĠL ee
ĠL iver
ĠL anc
ĠL AR
ĠL ãng
ĠL anth
ĠL ESS
ĠL anguage
ĠL icense
ĠL isa
ĠL ady
ĠL LVM
ĠL TS
ĠL yra
ĠL ayer
ĠL utetium
ĠL ionel
ĠK r
ĠK iá»ĩn
ĠK iên
ĠK ing
ĠK iêu
ĠK iá»ĩt
ĠK ind
ĠK iá»ģm
ĠK PI
ĠK ry
ĠK ẹo
ĠK erry
ĠK ali
ĠK aka
ĠK yoto
ĠK epl
ĠK iw
ĠK lond
ĠK uip
ĠK won
ĠK yush
ĠK erala
ĠK atrina
ĠK elly
ĠK itô
om es
om as
om ie
om alies
om acul
om eters
Ġin cl
Ġin line
Ġin place
Ġin fl
Ġin correct
Ġin voicingApps
Ġin painting
ag g
ag o
ag ain
ag ile
Ġw o
Ġw on
Ġw it
Ġw ay
Ġw av
Ġw ind
Ġw get
Ġw rit
Ġw ear
Ġw ast
Ġw ell
Ġw atch
Ġw arm
Ġw indows
Ġw ise
Ġw ould
Ġw orth
Ġw arnings
Ġw osrecords
Ġw elfare
Ġw riting
Ġw hole
ĠmÃł o
tr ả
tr ên
tr an
tr ình
tr Æ°á»Ŀng
tr Æ°á»Ľc
tr ánh
tr ack
tr ừ
tr ast
tr á»Ļn
tr ợ
tr á»±c
tr emely
tr uetype
if ilter
if ting
us able
us oid
us ecols
us labs
us etts
Ġcả PayPal
ab ay
ab log
ab bit
ab éu
Ġ4 6
Ġ4 50
Ġ4 11
Ġ4 90
Ġ4 44
ol is
ol ly
Ġphá» ħu
); `
); ''')
ĠCh ì
ĠCh ải
ĠCh ấp
ĠCh uyên
ĠCh Äĥn
ĠCh Ãło
ĠCh ip
ĠCh op
ĠCh ile
ĠCh uyến
ĠCh ase
ĠCh ange
ĠCh áºŃm
ĠCh á»ijng
ĠCh èn
ĠCh ìa
ĠCh ôm
ĠCh urch
ĠCh ênh
ĠCh atbot
ĠCh arc
ĠCh ocolate
ĠCh ứa
ĠCh romium
ĠCh artr
ĠCh esape
ĠCh amps
Ġo id
Ġo thers
Ġ5 1
Ġ5 6
Ġ5 8
Ġ5 10
Ġ5 12
Ġ5 11
Ġ5 23
Ġ5 70
Ġ5 55
Ġ5 13
Ġ5 700
Ġ5 280
Ġ5 5000
Ġcon ver
Ġcon tro
Ġcon firmation
Ġcon figuration
Ġcon sect
Ġcon straints
Ġcon junction
ĠG a
ĠG d
ĠG án
ĠG á»iji
ĠG ánh
ĠG ir
ĠG ạo
ĠG ray
ĠG ừng
ĠG low
ĠG ift
ĠG ug
ĠG az
ĠG IN
ĠG ala
ĠG erm
ĠG BM
ĠG erry
ĠG ROUP
ĠG laz
ĠG uitar
ĠG UI
ĠG ensim
ĠG inger
ĠG allium
ĠG uardian
ĠG RDB
ĠG hép
ĠG üell
ĠG óp
ĠG auss
ĠG aithers
ĠG utenberg
ĠG adolin
and ium
and tab
and ra
ap r
ap ter
ap pro
ap ple
ap tive
ap prox
Ġ} '
Ġ} {
Ġ} ).
Ġ} `,
Ġ} };
Ġ} \\
Ġdo pamine
Ġ* :
Ġ* `
ce ster
ce ptions
ation Test
Ġtá»± a
Ġ/ )
Ġ/ ,
Ġ/ >
Ġ0 7
ĠR b
ĠR f
ĠR g
ĠR n
ĠR ằng
ĠR áºŃp
ĠR ap
ĠR ip
ĠR ef
ĠR õ
ĠR he
ĠR ud
ĠR ep
ĠR aw
ĠR ou
ĠR og
ĠR ade
ĠR af
ĠR egin
ĠR amb
ĠR aph
ĠR ectangle
ĠR hen
ĠR och
ĠR uth
ĠR ượu
ĠR ica
ĠR SA
ĠR educe
ĠR DS
ĠR fac
ĠR AM
ĠR ED
ĠR oy
ĠR á»ijn
ĠR PG
ĠR eti
ĠR ecord
ĠR adium
ĠR eno
ĠR iá»ģng
ĠR aven
ĠR egression
ĠR BF
ĠR EAL
ĠR HEL
ĠR IÃĬ
ĠR PA
ĠR oent
ĠR elative
ĠR ayleigh
ĠR utaceaebrChi
ĠR adon
ĠR abbit
ig a
ig i
ig an
ig re
ig erons
ig ami
ul us
ul ting
---- -
---- --
Ġợ Expenses
age Element
Ġchu á»Ļng
Ġ# ...
Ġsau ce
ext ension
Ġchi ps
Ġchi vs
python ic
ect s
ect us
âĢ ĵ
Ġta xi
Ġta kes
est ar
est ica
ub ations
ub untu
ip isc
ip po
import lib
import anceLevels
av i
av y
av ro
av ailable
av eral
Ġ[ {'
Ġ[ &]
ist a
ist scope
Ġcu p
Ġcu á»ĵng
Ġcu cum
iz ar
iz ona
ord an
ot e
ot le
ot to
ot land
ot onin
ass ment
ass emble
ass essment
(" .
(" ."
(" (?
(" ðŁ
(" __",
(" *")
(" <--
(" _",
(' "
(' _
(' ',
(' '.
(' %.
(' ${
(' ./
(' %(
(' ;')[
(' =')[
Ġa a
Ġa chi
Ġa jax
Ġa ster
Ġa fade
Ġa wes
Ġa zac
Ġa star
ef b
ef ile
Ġhai r
ĠNh ả
ĠNh iá»ħ
ĠNh á»Ŀ
ine a
Ġbá»ĭ a
end e
end ar
end ish
end ars
Ġfor th
Ġfor get
Ġfor ward
Ġfor wards
Ġst ay
Ġst ream
Ġst orage
Ġst ole
Ġst egosaur
Ġst emming
Ġst reps
__ ),
__ `.
__ ))
__ `:
__ ())
__ }")
__ .__
__ _."
ess ine
ess ica
ĠNg ô
ĠNg on
ĠNg ay
ĠNg ò
ĠNg he
ĠNg oại
ĠNg ưỡng
ter bium
ĠJ e
ĠJ r
ĠJ en
ĠJ un
ĠJ ain
ĠJ ob
ĠJ oh
ĠJ ose
ĠJ eff
ĠJ erry
ĠJ azz
ĠJ ingle
ĠJ soup
ĠJ Free
ĠJ anuary
ĠJ uan
ĠJ vion
ĠJ ordan
ĠJ essica
il tin
il ippo
ment Method
ain String
pl ie
pl ates
pl ane
pl ica
ĠF T
ĠF e
ĠF m
ĠF lo
ĠF act
ĠF orm
ĠF low
ĠF erm
ĠF PS
ĠF lour
ĠF ouri
ĠF lick
ĠF ollow
ĠF resh
ĠF requency
ĠF ALSE
ĠF VI
ĠF inal
ĠF rozen
ĠF inger
ĠF esto
ĠF izzled
ĠF ILE
ĠF OX
ĠF PGA
ĠF uji
ĠF inally
ĠF rostfl
ĠF inhub
ĠF intech
ĠF ilippo
ĠI V
ĠI X
ĠI an
ĠI ce
ĠI rel
ĠI á»ijt
ĠI wer
ĠI II
ĠI SI
ĠI rid
ĠI EE
ĠI SomeOtherService
ĠI biz
ĠI guel
ĠI keb
ĠI ngredients
Ġ$ (
Ġ$ ;
Ġ$ ("
Ġ$ \(
ĠPh áºŃt
ĠPh òng
ĠPh áo
ĠPh ys
ĠPh ry
ĠPh ÃŃa
ĠPh aser
ow ner
Ġkho e
Ġkho át
:: %(
ĠE gy
ĠE ug
ĠE sp
ĠE last
ĠE urop
ĠE LSE
ĠE VE
ĠE bb
ĠE paz
ev ing
op enssl
op ère
op fe
op roject
con f
con i
con duct
con sumption
con trib
con fidence
con chas
con firmed
con cepts
con straints
con tour
con trast
Ġ6 2
Ġ6 6
Ġ6 000
Ġ6 50
Ġ6 0000
py data
py lab
py images
py spark
py tor
py pa
oc t
oc opy
os Pub
") '
") ?
") ),
") `.
") `,
") ])
") ));
") ["
ers ity
ers ions
ers po
our eux
ht aking
ĠX a
ĠX i
ĠX ã
ĠX ung
ĠX ấp
ĠX óa
ĠX úc
ĠX uyên
ĠX oÃłi
ĠX code
ĠX box
ĠX ero
ĠX AI
ĠX Path
ĠX LS
ĠX ena
ĠX esi
') ]
') ),
') ).
') ):
') ".
Ġof ten
ind a
Ġ7 4
Ġ7 30
Ġ7 50
Ġ7 416
Ġ7 453
Ġcá»Ļ i
name Element
get item
get frame
get Document
get Model
get Response
get Int
get root
get Child
get WaterUsage
get Or
get EnergyConsumption
get CarbonFootprint
get Instance
get Connection
get InputStream
get Title
get env
get Length
get Tweets
get Body
get Next
get Predict
get cw
eb an
Ġan ti
Ġan ame
Ġan ime
Ġan chor
Ġan sw
Ġan aconda
pe a
pe p
pe ak
pe anuts
Ġ10 3
Ġ10 4
Ġ10 6
Ġ10 7
Ġ10 8
Ġ10 23
Ġ10 21
Ġ10 2000
for ce
for est
for ting
for loop
ir ect
ir ection
ir ement
ir ements
ir rational
ir ited
ir rhines
ir coni
text size
text info
text font
text position
text wrap
Ġif rame
he y
he atmap
iv ersity
Ġso i
Ġso us
Ġso ilMoistureLevel
Ġso ybeans
str a
str ate
str ap
str act
str pos
str alia
'] `.
'] ],
'] ]`
'] [-
ĠSau di
Ġmạnh TÃŃnh
ore a
ath ons
()` ).
Ġgó t
)) /
)) `
)) );
)) ),
)) ):
)) `.
)) `,
)) },
)) };
)) ]);
)) )))
ĠTuy á»ĩt
oo C
oo th
oo by
data frame
data Task
pro jection
pro tected
ĠW i
ĠW ind
ĠW ith
ĠW ave
ĠW ik
ĠW inf
ĠW elcome
ĠW olf
ĠW inst
ĠW eiss
ĠW ojcick
ĠW enner
ĠW asab
ĠW ooC
ud ing
ud arme
ĠU X
ĠU ran
ĠU NIX
ĠU dacity
Ġviên Name
Ġviên Grade
Ġviên Database
=" ${
ĠO at
ĠO val
ĠO pr
ĠO ption
ĠO sc
ĠO ther
ĠO FF
ĠO sm
ĠO asis
ĠO ptimize
ith ecus
Ġ\ ;
Ġ\ ""
cr ib
cr iter
cr rdate
cr isp
ib a
to ber
to logy
to lower
to ugh
to Pl
up load
up iter
up enn
up grade
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ
ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ
Ġas k
Ġas ana
Ġas oci
Ġ8 2
Ġ8 3
Ġ8 7
Ġ8 9
Ġ8 000
Ġ8 16
Ġ8 45
': '.
Ġnum el
Ġnum eric
Ġnum erizer
out ine
out stand
Ġtu ôn
Ġis nan
Ġis Palindrome
Ġis Prime
Ġis Deleted
Ġis sue
all us
ax ing
ax ton
ax inscope
Äij ược
Äij Äĥng
Äij ảm
Äij ặt
Äij á»ĵ
Äij ạt
Äij ánh
Äij á»Ļi
Äij iá»ģn
Äij á»ķi
Äij óng
Äij ạo
Äij ầy
Äij á»įc
Äij ứng
000 4
000 10
000 227
ost on
-------- -"
set Text
set Count
set Formatter
set check
set Title
set RowSorter
set Debug
set Scene
set IrrigationRate
set Stretch
num ate
urr izar
word Node
ĠKh á
ĠKh ác
ĠKh an
ĠKh en
ĠKh ôi
ĠKh á»iji
ĠKh óa
ĠKh ái
ĠKh Æ¡i
ĠKh át
ĠKh iếm
ĠKh ÃŃa
ĠQ uyên
ĠQ UY
ance Test
Ġpro p
Ġpro ve
Ġpro perty
Ġpro jection
Ġpro por
Ġdata Type
Ġweb page
Ġweb cam
Ġ. ,
Ġ. ")
Ġ. ))
Ġ. ]]
Ġ. /.
Ġkhu ấy
tiv ated
ver y
ver ters
ver glen
Ġint ense
Ġint ellig
Ġ20 12
Ġ20 25
Ġ20 11
Ġ20 29
Ġ20 47
add i
add path
add Filter
add Row
add At
add All
add Handler
add Prefix
add Rows
add Sheet
sv elte
Ġar t
Ġar ound
Ġar tificial
Ġar chitect
Ġar chive
ror igin
act ly
Ġi j
Ġi ch
Ġi python
Ġi Ph
Ġi OS
eg a
from Json
from buffer
ob e
ob ia
ob ium
ob io
ob ello
ob js
com en
com es
com pact
com mun
com pute
res e
res olution
res ume
=' %
=' ')
=' ./
=' |')
Tr ÃŃ
Tr ên
Tr ung
Tr ò
Tr ÃŃch
Tr ánh
Tr ies
Tr ợ
Tr á»±c
Tr ackData
Tr yGet
Tr enton
cl ide
cl one
tic a
tic as
tic lass
tic ism
tic ularly
ple ts
In line
In stall
In fl
In correct
In ches
In dia
In stagram
Ġvu a
Ġ: -
Ġ: ['
Ġus es
Ġus ed
Ġus ecols
log ic
log ical
log its
Ġ9 1
Ġ9 2
Ġ9 3
Ġ9 4
Ġ9 7
Ġ9 45
Ġ9 90
Ġ9 34
Ġ9 26
ach usetts
Ġ% {&
20 12
20 32
20 18
20 17
ust o
size of
Ġj d
Ġj e
Ġj ar
Ġj ack
Ġj do
Ġj ane
Ġj upyter
Ġj ean
Ġj umps
Ġj alap
Ġj olly
Ġj upiter
form ylcytosine
pr ices
pr ince
pr imate
pr anayama
pr ioritizeVariables
Ġdi e
Ġdi ale
Ġdi jk
Ġdi óxid
ĠĠĠĠĠĠĠĠ ĠĠ
ĠĠĠĠĠĠĠĠ ĠĠĠ
cel ona
Ġlu ân
Ġlu ẩn
enc ode
enc ia
enc ium
cript or
file InputStream
file part
me thod
me eting
ĠÃ ¦
ĠÃ Ģ
]) "
]) ]
]) `.
]) `,
]) `:
]) },
ep ad
ide Rectangle
Ġem ploy
Ġem issions
Ġem bed
Ġem barr
ĠMã i
ber a
enti fied
ser a
ser de
Ġnew data
Ġnew line
Ġnew Word
Ġnew Phrase
def ine
def ects
ĠThá» Ł
ens is
ens ions
ak ely
ak istscope
Ġty pes
Ġmá»į t
Ġe z
Ġe ase
Ġe ius
Ġe arth
Ġe ars
Ġe ngines
** ,
** .";
li am
li um
ly wood
ly sé
my list
my List
my product
ps ql
ps ycho
ĠâĢĭâĢĭ '
ĠâĢĭâĢĭ =
ĠâĢĭâĢĭ `
Ġclass ified
sh u
sh ine
sh ift
sh are
sh ines
sh mal
sh aking
sh ynessTrait
sh erbet
Ġre using
Ġre install
Ġre alized
Ġre ason
Ġre plica
PI L
AT GCT
ph as
ph im
ph ấn
ph ép
ph áp
ph ức
ph rase
ph ones
ph á»ķ
ph otos
ph enol
Ġget DeviceType
Ġget WaterUsage
Ġget EnergyConsumption
Ġget CarbonFootprint
Ġget Users
Ġget Icon
." ""
10 15
10 418
10 8300
Ġtuyến tên
Ġpr ices
Ġpr anayama
Ġpr ioritizeVariables
Ġpr incip
Ġpr asadam
Ġpr évu
Ġpr axinscope
app Name
app etiz
Ġval ley
Ġval iant
Ġval uable
ĠCon tin
ĠCon fidence
ĠCon stants
ĠCon cha
ĠCon nector
ĠCon sul
ĠCon stant
Ġ12 5
Ġ12 15
Ġ12 17
ĠEx pression
ĠEx amine
ĠEx otic
ĠEx tension
fit er
fit ness
loc ate
loc ale
Ġres ize
Ġres cue
Ġres idual
Ġres ulting
ight ness
ĠQu a
ĠQu ế
ĠQu ân
ĠQu ad
ĠQu ạt
ĠQu ét
ĠQu icks
ĠQu arter
ĠQu imper
par is
par alle
par sing
date Format
Ġim plo
Ġim medi
Ġim por
LA NG
ast ian
ast asia
so y
so on
Ġdat es
Ġdat ecol
ant u
ant ine
ail les
Con fig
Con duct
Con vert
Con tains
Con tact
Con verters
cul ar
son r
ĠIn c
ĠIn clude
ĠIn iti
ĠIn valid
ĠIn cor
ĠIn correct
ĠIn ca
ĠIn sect
ĠIn stagram
ĠIn jera
ĠIn stanti
12 2
12 2035
te R
te ens
te chnology
pt on
pt ed
plot s
imal ist
Ġel it
Ġel py
Ġel sif
Ġbu ýt
dict Config
map s
map Val
per p
per form
per ref
per bol
per cent
per missions
Ġmu ch
Ġmu seum
Ġlog o
Ġlog scale
Ġlog ged
St ay
St art
St ory
St yle
St eve
St opIteration
St arship
cess ing
Ġcurrent ly
Ch o
Ch Ãł
Ch ó
Ch ế
Ch im
Ch âu
Ch uyên
Ch iếu
Ch ạy
Ch ủ
Ch uá»iji
Ch ick
Ch á»įn
Ch úa
Ch ris
Ch ina
Ch romeDriver
Ch romium
arg c
ĠTá» ©
ĠTá» Ŀ
Ġon to
Ġon ca
ĠJSON Serial
ĠY b
ĠY ield
ĠY ok
ĠY osh
ĠY YY
ĠY early
ĠY OLO
ĠY YMM
ĠY onkers
ER RO
ER VAL
cur o
cur se
new Word
new Phrase
new page
ĠSt ate
ĠSt ore
ĠSt art
ĠSt ory
ĠSt ard
ĠSt eve
ĠSt atus
ĠSt atement
ĠSt adium
ĠSt arship
ĠSt egosaur
ĠSt onew
ĠSt acey
input enc
input File
Ġ100 10100011110101110000
ash ore
ern al
time zone
Data Row
Data Scr
âĢĿ :
Ġac tions
Ġac cept
Ġac ry
Ġac tix
Ġac claim
Ġac oust
Ġac uer
Ġac uminata
ton y
Ġyour file
ov en
ov ing
ĠDo le
ĠDo ña
der ive
ri an
ri re
test Img
low y
low wisp
Ġword Node
user content
ci ent
ci ón
ci ties
Ġcol span
eo us
ĠThu áºŃn
Ġ15 4
Ġ15 000
Ġ15 64
Ġ15 17
Ġ15 43
ĠHo use
ĠHo kk
Ġ30 8
Ġ30 40
Ġ30 13
ĠExcel sior
sum otto
index ed
aw e
aw ake
aw ny
ft ware
lib ffi
Ġex clude
Ġex ped
Ġex perience
Ġex ercise
Ġex tremely
Ġex ceptions
Ġex actly
Ġid o
Ġid entified
ĠchÃŃ p
19 0
19 5
19 20
19 30
19 66
19 69
19 97
19 68
19 28
19 37
19 86
19 07
19 08
19 63
19 91
equ al
ner ium
SD LC
The odor
Ġ19 0
Ġ19 20
Ġ19 50
Ġ19 40
Ġ19 72
Ġ19 95
Ġ19 05
Ġ19 69
Ġ19 28
Ġ19 47
Ġ19 00000
Ġ19 06
Ġ19 52
Ġxu ân
Ġxu ôi
ĠCl ive
ĠCl arin
ĠCl asse
ĠCl inton
ĠCl axton
"> <
"> ${
Type Ref
ĠÄijình Thu
25 001
ge ist
ge ther
ge odesic
ge nheim
ert a
ert es
Ġfile InputStream
Ċĉĉ ĉ
Ġrá» £
"; `
Ġsh a
Ġsh ot
Ġsh og
Ġsh own
Ġsh elters
Ġsh adow
Ġsh ifting
Ġgá» ¥c
Ġ50 4
Ġ50 5
Ġ50 40
Ġ50 34
append Dots
ations hip
color Text
color ful
color Outline
ST L
ST RE
ST FT
ST UV
String Async
max Muffins
Ġcú m
Ġcarbon o
Ġ11 1
Ġ11 3
Ġ11 4
Ġ11 6
Ġ11 7
Ġ11 50
Ġ11 72
Ġ11 17
Ġ11 53
Ġ11 63
Ġ11 87
Ġ11 71
Ġ[' *.
... >
... ')
... ")`,
"] :
"] );
"] ))
eth ium
eth oven
og flow
og rÃł
ĠSá»ij t
ound aries
Th Æ°
Th ân
Th am
Th Ãłnh
Th ấp
Th áng
Th read
Th á»±c
Th orium
Th ailand
Th á»īnh
Th á»ıa
Ġstring s
Name Object
Ġ__ _
Ġinput s
dat ing
dat ablog
dat osPub
key words
key Phrases
table of
Ġit r
Ġit ali
Ġ`. /`
ĠLá» ¥c
Ġuser Service
30 97
tal face
Ġ18 00
Ġ18 99
Ġ18 27
Ġ18 13
Ġ18 63
Ġ18 58
head phone
head phones
sub caption
we ave
we alth
Ġrec ycling
Ġrec eption
ĠDef orestation
ĠAd ams
ĠAd ej
ĠAd aptive
ĠAd obe
ĠAd rian
([ "
([ -
([ ^\*]
ink lamplight
Ġrandom Index
Ġrandom ized
Ġrandom Num
Ġrandom ness
learn opencv
read r
read lines
An t
An alyze
An chor
An imation
An alytics
An nap
An omalies
An cient
NA V
di e
di ence
di egetic
json Data
json Object
json pickle
xy methylcytosine
}, `
ÄIJ i
ÄIJ ó
ÄIJ ông
ÄIJ ã
ÄIJ iá»ģu
ÄIJ ầu
ÄIJ ảm
ÄIJ á»ĥ
ÄIJ á»iji
ÄIJ iá»ĥm
ÄIJ áng
ÄIJ ánh
ÄIJ iá»ĩp
ÄIJ óng
ÄIJ á»ı
Ġend gettext
ill share
Res hape
To y
To List
To File
To Many
ll l
pos on
pos ix
ule s
ech ar
Ġun a
Ġun zip
Ġun icode
Ġun employment
Ġun zipped
Ġun iform
Ġun want
()) ]
()) `
()) );
()) ),
load File
iti ous
iti dine
next ContainerSize
sc ary
sc ape
Ġtext s
Ġtext box
Ġtext wrap
Ġtext blob
Ġstr ess
Ġstr ict
Ġstr ug
Ġstr etch
Ġstr ptime
Ġstr udel
Ġstr cmp
Ġstr rep
ĠAn y
ĠAn not
ĠAn ne
ĠAn na
ĠAn alyzer
ĠAn imation
ĠAn other
ĠAn nat
ĠAn timon
ĠAn astasia
iss a
len ame
top N
top ics
Ġtim estamp
ĠĠĠĠĠĠĠ ĊĠĠĠ
std io
ick et
ick Books
usage Data
---------------- |----------------
zip file
zip With
Ġat op
Ġat tracted
Ġat isô
Ġal ert
Ġal ign
Ġal ta
Ġal go
Ġal mond
Ġal los
Ġal bum
Ġal ready
Ġal gebr
Ġal iqu
Ġal thoug
Ġal locate
Ġcan al
Ġcan not
Ġcan cer
Ġmy string
Ġmy script
Ġmy Chart
Ġmy Tuple
init s
ĠString s
ĠString Content
aur id
aur aofar
Ġlogic al
CT A
CT GACT
your file
let te
Ph iên
Ph ù
Ph Æ°Æ¡ng
Ph im
Ph át
Ph ÃŃa
xml ns
Ġhy pom
Ġhy perbol
Ġlet ter
Ġlist s
Ġ25 1
(). _
(). __
40 5
oh ama
pp m
pp ing
ss l
ss w
Ġlabel String
100 1
100 300
100 10100011110101110000
100 00010
Text Node
Text File
Text Mode
Text Analytics
br a
br ush
br ightness
br awny
ie z
Ġau jour
Ġau gment
Ġau dience
Ġ... )
Ġ... ).
Ġ... ")`
Ġla zy
Ġpip e
ĠTrue ba
conv s
conv ersions
Table Level
div erging
Ġ14 40
Ġ14 75
Ġ14 85
Ġ14 53
Ġ--- -|
Ġnumber BD
dir path
dir ection
pip e
yl im
yl meth
Ġsc vtFactor
Ġsc rollo
Ġsp read
Ġsp inner
Ġsp ecified
Ġbe an
Ġbe au
Ġbe im
ĠBr ing
ĠBr uss
ĠBr unelles
econd s
èn e
result Set
Ex pr
Ex cess
Ex ample
Ex tracted
Ex haust
Ex perience
af oet
ford ium
ik i
net ium
ran n
Ġ! /
Ġ! ')
Ġinstall ation
ĠRe act
ĠRe ich
ĠRe ese
ĠRe ason
ĠRe ina
ĠRe usable
ĠEm ile
ĠEm berg
ĠEm otions
ĠURL s
ĠURL Session
80 1
LE O
work ing
Ġmax imus
Ġ16 21
Ġ16 09
ĠIm itation
Ġarg v
Ġarg max
RO C
RO W
RO OT
tem ber
tem pt
tem plates
tain ment
with Column
ĠÄiju ôi
Ġsk image
ĠSh ot
ĠSh ow
ĠSh ift
ĠSh ade
ĠSh orth
ĠSh yness
ĠSh opify
ĠSh eryl
ĠSh ining
ĠSh immer
ĠGiá» ¯a
ign on
ign ore
Ġax etic
ommend ed
az a
az is
ee Script
ee ze
raw Value
Ġen um
Ġen abled
Ġen zym
Ġap ple
Ġap art
Ġap plication
Ġap pear
Ġma jor
Ġpar ser
Ġpar tition
Ġpar mes
Ġpar ticularly
ther a
ther fordium
Ġ24 4
Ġoutput Stream
ĠXML Example
energy Consumption
)` )
01 5
01 7
01 8
16 2
16 8
16 75
16 99
Document Type
Document Client
Document Listener
En code
En abled
En semble
IN CT
Pro perties
Pro pellant
Pro tect
Pro vence
Pro cessing
ale Middleware
random Index
random Num
ys us
Ġsub tract
Ġsub Folder
stat istics
stat ista
arm adillo
Ġ{" $
ĠAc cess
ĠAc count
ĠAc tif
ĠAc ademy
trans Data
trans ition
trans late
trans pose
trans Axes
Count y
Count Vectorizer
bin es
bin ation
sp am
sp end
sp acy
sp aper
sp aces
Ġli Tiêu
Ġli Há»Ĺ
Ġli Xác
Ġli Triá»ĥn
Ġli Hợp
Ġli Cung
Ġli Quy
Ġli Tham
Ġli Phát
Ġsum maries
Ġpl us
Ġpl ais
Ġpl atform
inf inits
Ġ13 3
Ġ13 37
ĠAl low
ĠAl mond
ĠAl ternativ
ĠAl los
ĠAl bum
ĠAl ham
ĠAl bai
Ġindex es
Ġdocument Path
24 3
24 859
>> ()
Ġgr ab
Ġgr ass
Ġgr ise
Ġgr aff
Ġgr illed
Ġgr aceful
Ġgr izzled
ated Tree
Ġ(` /
Ġ(` %`)
Ġ(` &`,
Ġ(` ||
Ġ(` ~`)
rop ies
und hat
ĠNgh Ä©
ĠNgh á»ī
ĠNgh èo
ĠNgh á»ĭch
ĠNgh Ä©a
process ing
15 3
15 725
15 9265
23 12
23 37
Par ams
Par rot
\" }");
by te
fic a
mat ization
mat rope
no Access
no kogiri
red is
red uce
red irect
sol ara
Ġ@ ).
Ġadd ed
Ġadd ress
Ġde als
Ġde acetyl
Ġdu á»ĩ
Ġnguy á»ģn
org ium
ild a
ne utral
rec ent
sor bet
sor ción
Ġcom pact
Ġcom pre
Ġcom pil
Ġcom forting
Ġcom bination
Ġpos sess
Ġpos itron
ĠCalculate Average
eck s
exec utable
try Table
__( *
60 3
60 93
60 91
60 423
DA W
ID F
PU T
RE ST
RE QU
RE AD
year ly
Ġtime out
Ġtho ai
Ġhe alth
Ġtrain ed
Ġtrain Net
number BD
Ġcolor Text
Ġcolor links
Ġcolor Outline
ĠAdd ing
Ġ!= =
200 1
200 3
Qu ản
Qu entin
ah o
ah am
ah aya
js deliv
Ġup per
Ġup grade
Ġtur bines
Ġbit s
Ġtrans lated
Ġkey Phrases
Ġgh ê
Ġgh im
amb oat
img proc
ĠChu ông
Ġkhứ u
']) ),
']) })
Ġdatabase Name
ĠBrachiosaur ida
cuda Free
cuda DeviceSynchronize
cuda Mal
Col lab
Wh ere
[] []
na ean
run e
run ner
run Optimization
wik imedia
Ġmin Ne
Ġmet adata
reg ister
ĠKho áng
Ġinter jection
33 97
33 10418
64 8
Ar ial
Ar ts
Ar tificial
Ar chitect
Ar rival
Pos sible
Pos sessive
Ġ) ^(
Ġcam era
Ġven us
Ġpath s
anc ial
ĠPy PI
ĠPy tag
ĠPy Module
ĠMy Product
ĠMy OtherService
ĠMy Fit
ĠAr gon
ĠAr gentin
ĠAr izona
ĠAr tology
ĠAr undhat
logg ed
Ġresponse Text
75 9
Kh Ãłn
Kh uyến
Kh á»ī
Of Day
Re al
Re port
Re placement
Re peat
Re kogn
Re uters
SQL ite
TO TUN
User Repository
User Controller
bol dt
kh ung
kh á»ī
save As
Ġsize of
start Index
start OfDay
the ailear
ĠSV J
til us
iter able
iter tools
iter rows
ĠTrá» Ŀi
Ġ500 000
ĠWindows Base
month s
45 486
45 550
:} \\
Node List
Ġâ Ħ¢,
Ġtest Get
Ġtest Add
Ġtest Img
Ġlẻ o
Ġbreak s
ĠTo Ãłn
ĠTo ken
ĠTo adstool
ĠTo gether
tim eline
tim etuple
ĠHá» ıa
Ġwork s
Ġwork ing
Ġwork hor
egr ate
egr ationTest
resent ed
response Text
Int el
Int egrationTest
Nh áºŃp
Nh ắc
Nh óm
cent age
mt DNA
writer ows
Ġad verb
Ġad jacency
Ġad vanc
Ġad ipisc
Ġtd Mass
Ġtd Alb
Ġtd Phi
Ġtd Harris
Ġtd Mary
Ġtd Pennsylvania
Ġtd Wor
Ġtd Trenton
Ġtd Annap
Ġké n
Ġnam etuple
Ġper ched
Ġper forms
Ġper fect
Ġper centage
Ġrun Optimization
root Element
ĠThe ano
ĠLa ertes
Ġ40 8
execute Query
-| ")
90 2
Ad apter
Gi ó
Un ique
Un icode
Un kn
Un confirmed
Un iversity
cm d
dec larative
dec oration
dis able
lat rarius
ning ham
ry pting
Ġ? ,
Ġ? .
Ġ? ?
Ġ? ',
Ġ? )",
Ġvar List
Ġvit ality
Ġle ng
Ġle ur
Ġle ast
Ġle ather
Ġle aving
Ġle ading
Ġtry Table
Ġtry Insert
ĠGet ting
ĠGet SignatureDish
Ġ%} `.
Ġ%} ">
-> ())
:\ `
Pr etz
Pr emium
bit wise
count s
device Type
document Path
pig men
write ToFile
Ġlong er
Ġnext ContainerSize
Ġnext TableLevel
ĠNew sItem
ĠNew comen
Ġ($ _
Ġ($ )')
ĠRes hape
ĠRes earch
ĠRes ume
ĠRes ourceW
UM N
block proc
module s
rc Params
ution Mode
Ġcost Diff
Ġcost Increase
Ġcsv file
Ġme ans
Ġme ant
Ġme etings
Ġme asure
Ġnhát Trait
Ġngá» ı
Ġngá» £p
Ġngá» Ŀi
ĠTensor Variable
ĠPar ent
ĠPar se
ĠPar que
ĠPar ana
ĠPar quet
ĠPar tition
ĠPar fait
ĠPar ameter
ĠPar adise
Ġop ens
Ġop press
Ġop timization
Ġjson Data
park ing
Ġmethyl transfer
pigment s
44 3
44 2312
99 780
File Reader
File Writer
File InputStream
Field s
Line arRegressor
cat t
cat alog
gre at
lin are
lin eno
sentiment Analysis
sentiment Annotator
Ġdet ermin
Ġdet erminer
Ġgenerate JSON
ĠTwitter Sentiment
ĠTwitter Exception
Ġ17 80
Ġ(' /',
ĠPrint s
Ġfont name
Ġfont Color
27 017
55 6
55 55
Sc atter
Sc aler
Sc anln
Sc ooby
create Collection
create Connection
create Server
create Statement
create TextNode
gen path
gen ium
gen etic
ich e
total Capacity
total PositiveFeedback
vent us
Ġ_ ,
Ġ_ ('
Ġcomm a
Ġback link
Ġback space
Ġback wards
Ġchó p
ĠCÆ¡ m
ĠSet up
ĠPro duct
ĠPro tact
ĠPro fiter
open Connection
ĠOpen SSL
output Stream
tick et
Ġiter ate
group ing
group ed
group By
(( __
65 4
65 66
66 67
CA GCT
Or say
Or igami
Ser ies
Ser ene
Ser ializer
Sentiment Annot
Sentiment Analysis
Sentiment Annotator
Test ing
Test RestTemplate
]] ]
]] ))
]] ++;
]] --;
dev gu
function al
java x
kw s
main Template
main loop
uit s
Ġerror s
Ġerror Count
Ġurl lib
Ġurl color
Ġurl fetch
Ġlink s
Ġlink color
Ġser de
Ġser otonin
Ġ`' '`,
Ġ`' '`.
ĠPhi los
ĠPhi ladelphia
Ġ70 2
ĠWeb Reader
ĠWeb Search
ĠWeb Driver
Ġrequ irement
Ġread So
Ġread only
status es
22 2
CH ÃĪ
Foo bar
Py PI
Py Module
Py Import
Py Image
ration ale
tom an
vec S
Ġsal t
Ġsal mon
Ġdiv ided
Ġdiv ideRectangle
Ġcha que
inner hula
animal rescue
animal welfare
orical Crossentropy
ĠBe ngio
ĠBe anst
ĠBe ethoven
Ġ', '
Ġ', '`
ĠRest ant
config ure
config uration
pyc ache
ĠWord Net
ĠWord sworth
------------ -
parse Configuration
Memcpy ToSymbol
14 159265
butterfly Surface
butterfly Animation
flow er
giá» ¯
giá» ¯a
sing ing
sing ular
Ġmar s
Ġmar inas
Ġdec itab
Ġdec rypting
Ġplot s
Ġtụ t
ĠCom te
ĠCom pare
ĠCom puter
ĠCom pute
ĠCom pany
ĠSc reen
ĠSc andium
ĠSc otland
ĠJack son
oph allus
oph obia
opt Error
Ġ72 10
ĠWorld ometers
uple s
comp ound
logy tod
formation al
Stream Reader
Stream Result
Ġoriginal Phrase
)[ :
)[ ~
FF A
FF E
Sh ell
Sh are
Sh ake
Sh erbet
cv s
close st
diff erent
fl ask
fl ush
prev Price
prev entDefault
sm i
sm en
sm iles
sm ooth
tag Schem
torch vision
view Box
Ġass ist
Ġass ign
Ġass essment
Ġass igned
Ġcar eful
Ġcar rots
Ġcur frame
Ġcur ve
err no
original Word
Ġquý t
Ġxo a
Ġ") \\
ĠHttp Method
ĠHttp URLConnection
Ġ300 00
Ġ{} '.
unit edstates
requ irements
Ġind ent
Ġind istinct
ĠFit Nesse
ĠFit zwil
ĠUser Repository
ĠUser Controller
Trans actions
Trans lated
Trans lation
"$ {
Ed amame
Key Error
New sItems
New spaper
PE P
PE MDA
Sub scrip
car Element
car otenoids
cod er
go ed
wo ah
Ġtitle Công
Ġtitle Tóm
Ġlang uage
Ġpoint er
Ġ`[ ]`
Ġ`[ [`
Ġ`_ `
ĠLu ân
ĠLu áºŃt
ĠLu isa
ĠLu aLatex
ĠLu igi
Ġcontent s
ĠGr ace
ĠGr imm
ĠGr ains
ĠGr enada
ĠGr acias
ĠFl ore
ĠFl ash
ĠFl erov
ĠFl amenc
ĠFl intstones
iron python
ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ
epoch s
Ġprice TÄĥng
ĠInt egrityError
ĠInt ellig
ĠInt egrate
ĠImage Tk
Request He
Request Handler
:% (
Do e
IM READ
Module Object
font name
ger und
mut ex
ok a
sl im
sl ug
sl ides
sort er
ĠZ a
ĠZ n
ĠZ r
ĠZ eit
ĠZ ero
ĠZ IP
ĠZ hang
ĠZ oho
ĠZ irconi
Ġev erything
Ġse q
Ġse ize
Ġse ashore
ĠMark eting
ĠMark Down
Ġfilter Job
ĠAs en
ĠAs afoet
select Expr
ĠLat in
Ġconn ecting
ized SearchCV
ized TypeRef
Product Inline
Default RequestHe
({ "
95 4
=\" \/
Ac tivities
POST FI
So ftware
be ers
be autiful
be hold
cop rotein
cop ithecus
call cc
drop na
squ eeze
Ġcm d
Ġcm p
Ġcm ake
Ġcor relations
Ġcor tisol
Ġverb ose
Ġhist one
Ġsu is
Ġpy plot
Ġpy torch
Ġpy serial
Ġpass ive
Ġcá»Ń u
erg encia
ano leuc
Ġquestion naire
ĠText Rank
ĠTest NG
ĠTest RestTemplate
ĠTest Case
Ġ`= `
article s
ĠSe a
ĠSo are
asc a
ĠMag i
ĠMag ots
ĠMag ento
ĠMulti Box
ĠHam lin
ĠAm ount
ĠAm orus
ĠLog o
ĠLog istic
ĠLog inController
Ġout line
Ġout comes
Ġover view
Ġover look
Ġover throw
ĠRed istribut
izz ard
Ġview s
ĠHTTP S
Ġexample s
Ġexample Text
week s
week day
regex Filter
decision tree
'} ],
'} `:
05 8
34 1
34 340
Ap im
Com ment
Com bine
GB M
My Model
Set String
cap ital
cap turing
cap tivated
pol arity
uct ures
web app
web driver
web Environment
Ġz order
Ġz ero
Ġz oet
Ġam i
Ġam et
Ġam iga
Ġam oureux
Ġdraw now
Ġperson ification
Ġguess es
Ġguess Correctly
Ġguess edCorrectly
ones ia
style sheet
les son
Ġ(" /")
Ġ(" _"
ĠHá»ĵ i
Ġ36 00
Ġinitial ize
Ġ48 60
ĠChart s
hist ory
ĠFoo Form
ĠEn zo
ĠEn fants
ĠEn coder
ĠEr ror
ĠEr bium
ĠEr nest
'))) );
ĠUn ix
ĠUn ique
-------------------------------- ----------|
clean up
clean edUpString
69 3
78 1
78 4
97 9
At tributionError
At tend
Client Name
Client Options
No tification
Num erics
Not es
OT E
SA M
SA SS
Sp ec
Sp ain
Sp anish
Sp irited
Up dating
fill ing
mar ck
mar shmal
may be
names pace
over lay
over write
over rides
pg dg
way points
xlsx writer
}" `);
Ġ~ `
Ġed X
Ġed gecol
Ġage Element
Ġtermin er
Ġtermin erons
Ġvector s
Ġche aper
Ġpost ing
erd innerhula
ĠComm erce
stop words
Ġ", ".
urop oda
ĠGit Hub
ĠRh odes
ĠRh odium
ĠRandom Sentence
ĠRandom izedSearchCV
("\ \
Ġformat ting
ĠIP v
ĠUp loadFile
common s
Ġexcel Writer
Ġexcel sa
ĠRead ing
Ġparam s
full path
Ġcomple x
ĠMySQL db
version Id
ĠẤ m
Ġ__________ ___."
(` #
Al aska
Al igre
Get Classification
Get SignatureDish
Get Mapping
Get NameObject
Get optError
VER SI
][ :
][ :-
dd d
tensor flow
xx xx
Ġtab la
Ġtab stop
Ġco efficient
Ġco opère
Ġcr aft
Ġcr icket
Ġlaptop WaterUsage
Ġlaptop CarbonFootprint
Ġneed s
Ġgre ater
Ġngu á»ĩch
annot ators
ĠCan al
ĠCan ary
ĠCan xi
ĠCam era
ĠCam aras
ĠCam elus
Ġ"\ {
ĠSal mon
ĠSal inas
ĠMich ael
ĠMich igan
ecific LoggerFilter
ĠDisplay ing
unk t
Ġload ing
Ġload ed
ĠLin naean
Ġ47 12
Ġ47 70
Ġconnect ed
Ġstop s
Ġstop ping
ĠIt aly
ĠIt ami
ĠIt urrizar
ĠIt asca
conn ections
ĠWal t
ĠOr iginal
ĠOxy Plot
Result Set
grid spec
ales ce
country ToDish
ĠParis Activities
Ġdetect MultiScale
rational Numbers
ĠHttpResponse Message
'' '
(? <=\
29 8
29 38
68 122035
68 781
77 49
<! --
BM R
CR M
Core Map
DE CLA
DE LET
Diff erence
Ir is
Ir rigation
Log isticRegression
Rec ommender
Rec eiver
Rec ommended
cor an
cor pus
delete Task
normal ize
normal ized
}} $
}} {\
}} }'
Ġtorch vision
Ġspe ech
Ġchang ing
Ġchang ed
Ġchang edUp
Ġpre processed
Ġpre processing
Ġpack en
Ġgroup ed
Ġngo ạc
Ġref er
ann es
chi aros
ĠCal o
ĠCal endar
ĠCart esian
Ġ"# {
Ġ"% "
Ġ"% ");
thes econds
ĠSam arium
ĠPre position
Ġ28 4
ĠMatplotlib TensorBoard
Ġ'/ '.
round ings
())) )
())) ),
())) ).
ĠDet ector
ĠDet ail
ĠDet ection
ĠDet ermine
Ġ34 7
Ġ34 60
Ġ34 89
ĠAp ply
ĠAp plication
ĠAmer icium
repe at
Ġwhen ever
Ġ42 64
olution al
Ġ}} ',
Ġ}} ">{{
Ġ75 4
Ġ75 18
----------| --------
egs leather
obj detect
Ġeigen vector
ĠInput StreamReader
Unit ed
28 28
35 9
86 902
Base Model
CON TENT
FLAG S
NO W
NO DE
NO AA
Session Middleware
Tensor Dataset
URL Field
URL Session
bu iltin
eng lish
field s
ling uistics
non local
power ful
power point
rus brLoÃłi
remove Child
ts ignificance
ts Shyness
}') ">
Ġab sorción
Ġappend ing
Ġcriter ion
Ġhu á»ĩ
Ġmulti ply
Ġdis k
Ġdis p
Ġdis able
Ġdis order
Ġdis connected
Ġdir s
Ġdir ect
Ġdir name
Ġdir names
Ġdir igerons
Ġchunk size
Ġno tif
Ġge opy
Ġrel ationships
Ġrel ief
Ġrel axing
Ġrel ationship
ĠTur ia
ĠCap rese
Ġ`$ _
imm intrin
ĠMap s
ĠMont ju
ĠDocument Client
ĠDocument Listener
Ġ37 9
ĠTrans formational
idiom s
idiom OriginSignificance
iforn ia
Ġ49 170
Ġconv olutional
ĠGhi bli
ĠGhi rard
ĠRF ID
ĠFile Reader
ĠFile OutputStream
Ġprogram ming
addDocument Listener
comple te
comple xity
Ġpred ict
Ġpred efined
Ġcollection Name
azon ian
Grid SearchCV
Grid Spec
333 3097
Ġneighbour s
character s
ĠResponse Entity
estimator s
Ġspeed y
github usercontent
(", ")
)} %
)} {\
.* `.
.* >//
700 3
700 100300
API View
API RequestFactory
Blob Info
HT TPH
It aly
MA S
MA X
Math Context
Ng ôn
Ng òi
SV C
Total Cost
Template View
Ve hicle
bind ing
distrib ute
guess edCorrectly
mig ration
mak etitle
mak edir
mak efile
mak erdinnerhula
spark les
spark Context
tab lename
Ġtag ger
Ġtag ging
Ġclean ing
Ġclean ed
Ġlib rary
Ġlib ffi
Ġlib ssl
Ġsqu ire
Ġsur f
Ġsur roundings
Ġsom etimes
Ġmut t
Ġmark ers
Ġbook s
Ġdes ired
Ġdes erial
Ġdes cending
Ġdes igned
Ġkn ock
Ġkn ows
Ġrele ased
quanti fyVariables
ali as
etri ch
ĠNA V
ĠNe on
ĠNe il
ĠNe ighbors
ĠNo el
ĠSp aCy
ĠSp oof
ĠSp ecificLoggerFilter
ĠSentiment Annotator
ĠSurvey Mon
ĠBoost ing
ĠMar inara
ĠMar anello
Ġtoken ization
ĠDate Formatter
ĠHar per
ĠHar alick
ĠHar issa
export s
ĠAR HGA
real python
Ġinst ead
Ġoz one
Ġoper ation
Ġ73 97
actual package
Ġ123 45
Ġ123 980
Chomsky Facts
ĠStock Recommender
Ġstatus line
InputStream Reader
Ġparse Int
>>> ();
recursive Multi
Ġhead ers
ĠMyModel Form
Ġreview s
--------------| --------------|
--------------| -------------
Noam ChomskyFacts
Specific LoggerFilter
ĠCaliforn ium
TensorBoard Callback
build in
53 6
79 406
79 60423
79 45486
AG C
AG CTGACT
AU TOTUN
As StringAsync
Bar celona
Bar bera
CO OH
Cr afting
Code ModuleObject
Driver Manager
ED DB
Max Index
Max imum
Ne odymium
PY THON
PY THONPATH
Sal ad
Sal mon
Sal ted
cer in
mn r
mn ist
pd en
vest er
Ãģ o
Ãģ p
Ãģ nh
Ġag ile
Ġag ua
Ġcl ang
Ġclo hyd
Ġcap able
Ġcap abil
Ġcap ita
Ġcap ital
Ġclose st
Ġlast status
Ġsm iled
Ġsol ve
Ġbel le
Ġbel ow
Ġbot tom
Ġbot tlen
Ġbirth Month
Ġphoto Choice
ĠCA FES
Ġ`{ **
ĠNi honium
ĠNi obium
ĠSer ver
ĠSer vice
ĠSer ena
ĠSer enade
ĠSelect CourseYear
itc ard
ĠPl ural
ĠPl asma
ĠPl aza
ĠMin or
ĠMin imalist
ĠMercur y
Ġfl ag
Ġfoot ball
ĠDat abase
ĠDat amuse
ĠDec ember
ĠDec lare
ĠDec oder
ĠDrop box
ĠHe ight
ĠHe aven
ĠHe avy
loss es
ĠAt ari
ĠAt lin
ĠAt wood
ĠAt tributionError
ĠAt tempt
ĠLe igh
ĠLe adville
ĠChild ren
Ġob jective
Ġob tener
Ġ++ =
Ġcuda DeviceSynchronize
Ġcuda MemcpyToSymbol
("| ",
("| -------|
('/ "
('/ \*\*
Ġform an
Ġform ula
ĠFunction s
Ġ$(' <
ĠWil hel
ĠWil lowwisp
ĠOcean ic
ĠOcean ogrÃł
formatter s
Ġrespon sible
Thu ế
graph y
graph icx
Ġgrid Lines
Query Result
Image Tk
ARCH FLAGS
Ġserver WaterUsage
Ġserver CarbonFootprint
ĠINT J
ĠINT ERVAL
Ġpopulation Data
Ġpopulation Chart
ĠFranc ium
%' `.
%' `)
({' \
39 1
Ab out
Author ization
IS O
IS P
LM NOP
Pay mentMethod
Twitter Factory
Twitter Exception
YY YY
ca ffeine
fn l
generate JSON
hom ophones
high gui
mus cular
ness Pal
need s
ral far
send Notification
schem aname
uk i
}{ },
Ġext ent
Ġext ernal
Ġte ams
Ġti enen
Ġcalcul ations
Ġcalcul ated
Ġcalcul ating
Ġcircle s
Ġvec S
Ġsearch Input
Ġmod ified
Ġbr ave
Ġbr asil
Ġbó p
Ġdest ination
Ġpot ato
Ġrai sed
Ġrand i
Ġrand onnée
Ġremove Update
Ġxen ophobia
ĠCar lo
Ġ`! =`
Ġ`! =`.
Ġ`~ `),
Ġ`~ /.
Ġlá»ij c
Ġlá»ij m
Ġ"$ (
ĠNob elium
ĠStr ange
ĠStr atus
ĠStr udel
ĠStr ontium
ĠStr uctures
ĠSol ar
ĠSelf Reflection
ĠPr ice
ĠPr incess
ĠPark inson
Ġ27 37
--- ")
Ġfetch ed
Ġfetch StockData
Ġ|----------| -------|
Ġ|----------| ------|
Ġ|----------| ----------|-------------|------------
extr a
extr emely
Ġ{{ >
00000 1
ĠAng ular
Ġloc ation
Ġloc ale
ĠLast Pass
abr LoÃłi
Ġ55 22
-------| ----------------|----------------
ĠJson Convert
ĠJupyter Lab
ĠId aho
Ġanimation Frame
ĠUt zon
="/ {{
ĠOut ro
setO nAction
setRequest Method
Ġprot ected
Ġprofit s
myVar Value
Ġ128 460
Ġimpro ved
Ġstruct ures
ĠAnd es
ĠAnd rew
($" {
ĠCURL code
Ġinterpol ate
Ġinterpol ation
456 789
population Chart
ĠWebSocket s
Ġdecision s
ĠGrid Map
ĠGraph ics
ĠUnicode Encode
evaluate Relationships
Axes Grid
Idiom s
tutorial s
ĠLawr encium
(* '
)^ (
)^ -
150 3
150 6
26 2938
94 8
AA PL
Am sterdam
Am azonian
Em issions
HA VING
Http URLConnection
Loc aleMiddleware
Language Processing
Many ToMany
Pl ants
Rap tor
RNN CoreAnnotations
birth Year
cultural Factor
ded ent
eigen vectors
flat ten
frequ ency
gn uplot
google trans
hand le
ió ticas
laptop WaterUsage
laptop CarbonFootprint
ny times
pastParticiple Cache
pagin ated
rd ida
wait Key
ÃĢ h
ÏĢ r
Ġom ega
Ġign oring
Ġenter ed
Ġlb m
Ġlb s
Ġlit tle
Ġland forms
Ġsin usoid
Ġsin ensis
Ġsti rtext
Ġsynonym Nodes
Ġsleep ing
Ġswitch ing
Ġbec ome
Ġbec omes
Ġdepend s
Ġdepend ent
Ġdepend ency
Ġdepend encies
Ġnatural LanguageProcessing
Ġple asure
Ġpart s
Ġpower ful
Ġtá»ĭ nh
Ġram en
Ġrule s
Ġxer us
Ġxer ox
Ġxml read
enum item
ĠTR á»Ĭ
ĠTe ide
ĠTe ams
ĠTe zuk
ĠTable au
ĠTable RowSorter
ĠTask s
ĠCat alonia
ĠCalculator Test
Ġ`| `,
Ġ"" ",
Ġ110 3
Ġ110 9
Ġ110 540
ĠSM S
ĠSus an
tit ans
ĠBri e
ĠBlue berries
Ġ--------- |
Ġ--------- --
ĠPR ON
ĠPort er
ĠPort obello
ĠProm pt
ĠProm ethium
ĠPlat inum
ĠMus aceaebrChi
ĠMus icGUI
ĠMus ée
ĠMus abrLoÃłi
ĠMath Net
ĠMath Context
Ġ'{ "
Ġ'{ :.
Ġfin al
Ġfin ite
Ġfin ish
Ġfin ancial
Ġfarm ers
ĠHow ever
Ġ39 200
Ġ39 61
activation s
ĠVi olin
ĠVi ola
ĠVisual ize
ĠAb solute
ĠAb sar
ĠAb stract
ĠAb antu
ĠLib rary
ĠLib eria
ĠLaunch pad
Ġinf o
Ġweek ends
Ġká»ģ nh
Ġ44 1
Ġcondi tion
ĠGener ator
ĠGener ative
ĠGener ates
ĠGener alife
ĠGran ola
ĠGran ny
Ġstep s
__() '
ĠFr ance
ĠFr uit
ĠFr aud
ĠIO Exception
ĠEd gar
ĠEarth tone
Ġ69 2
Ġ69 60
Ġ69 70
ĠXe Latex
getText Content
getAt tribute
ĠWat ers
ĠUs ain
="# "
tool kit
Ġprovid er
resize Event
Ġ%- *
2019 05
Ġjob s
Ġjob lib
server EnergyConsumption
Configuration Builder
Configuration Exception
team Name
Stack Pane
Ġexcess OatFlour
Ġexcess AlmondMilk
Ġexcess Blueberries
Ġexpression s
Ġidentify Variables
ethyl ation
([]) `
([]) `,
Ġscale Label
ĠImport Error
ĠShad ow
Parser ConfigurationException
recommend edStocks
region props
ĠtdNew ark
Ġneut rino
ĠResult Set
Ġeval ai
Ġeval uation
detect MultiScale
Ġregion props
Ġregular ization
COL UMN
autos ize
ĠWilli e
ĠWilli ams
Ġprecode animals
Ġteam Name
Ġ................ ...
Ġ................ ....
ĠChristmas Idioms
ĠGolden berry
ĠGolden rod
(', ');
.^ (
/< \/
/< .*>//
46 72
6280 6566
73 16
={ "
={} ):
={} '.
Ag ent
Br ush
Custom PoolManager
Dec ember
Green Genius
HC l
Land scape
Out ro
Per iod
Post ed
Post Async
Post Mapping
Person ification
Rel ative
Sol utions
Task s
Video Capt
Village A
Village B
Village C
Web Element
Web Driver
Web Environment
co efficients
co erce
co alesce
cov ium
cased Chars
dot net
depend ent
depend ency
how ever
iens is
job s
job search
mov ies
por ate
rap id
sun shine
session s
sBy Person
success Rate
tre ebank
whe at
world wild
Ġest oy
Ġest omas
Ỽ c
Ġthreshold s
Ġvan illa
Ġhect are
Ġlab ore
Ġlab eled
Ġlarg est
Ġsched ules
Ġmag na
Ġmust ard
Ġball erinas
Ġbound s
Ġbound ing
Ġbound ary
Ġbegin ning
Ġdid n
Ġpas sthrough
Ġpurs ued
Ġgood will
Ġphot ocopy
Ġkhuy nh
Ġru á»Ļng
Ġrang es
analyze WaterUsage
chat Id
chit z
ĠTu ần
ĠTool box
ĠTRU NG
ĠClass ifier
ĠCore Document
ĠCore Map
ĠCON J
Ġ`{} `.
arc sin
Ġ"' ".
Ġ"- "
Ġ"| ")
Ġ"ðŁ ¦Į
Ġ"ðŁ İħ",
Ġ"ðŁ Ĵ¯")
Ġ112 9
Ġ112 780
Ġ130 700
Ġ(? ,
Ġ(? )',
ĠSi am
ĠSch opfe
ĠSub mit
ĠSil ver
ĠSci Py
ĠSpring field
ĠSpring BootTest
ĠBl vd
ĠBl akely
ĠBl izzard
ĠBen net
ĠBen edict
ĠBro s
ĠBase Model
ĠBase Repository
Ġ------------- -
Ġ------------- --
Ġ------------- |--------------------------------
ĠPu erto
ĠPu erta
ĠPit ahaya
ĠPop ulate
ĠPOS IX
Ġ210 7
ĠMc Cart
ĠMc Kin
ĠMel inda
ĠMang a
ĠMad onna
ĠMito Cart
Ġ'// '.
Ġ''} ><
Ġ''} ">${
Ġfast api
Ġfeel ing
ĠhợpS quare
ĠDi etrich
ĠDuy á»ĩt
ĠDict Writer
ĠHawk ley
excess OatFlour
excess AlmondMilk
excess Blueberries
uter ie
ĠVan adi
ĠVim L
ĠVideo Writer
ĠVII I
ĠValenc ian
ĠAD J
ĠAD N
ĠAD V
ĠAu stralia
ĠAll en
ĠAll entown
ĠAll ende
ĠAss urance
ĠAugust us
Ġlower case
Ġlower casedChars
ĠThom son
ĠLor o
ĠLink Find
ĠLink Har
ĠLink edIn
Ġinc reased
Ġinc reases
Ġinc idid
tra jectory
ĠGI L
ĠGI Ãģ
ĠGI á»®A
ĠGe orge
ĠGe isel
ĠGu ell
ĠGu acamole
ĠGu inea
ĠGIA I
ĠGlobal Cuis
ĠGerman ium
ĠRos alind
ĠRos ario
ĠRos aceaebrChi
ĠRock ville
('// ',
(''' \
Ġstud ies
ĠFour square
ĠFred erick
ĠFred die
ĠEl bridge
ĠEri e
ĠEll sworth
Ġ63 97
Ġ67 956
Ġ77 11
ĠWis py
ĠWork space
ĠOS Error
ĠOn ly
ĠOn line
ĠOn tario
cry pto
elev ium
Ġ98 1
ĠThá»ĭ t
Ġequ ival
ĠgetIdiom Table
ĠQuery Set
ĠQuery Result
parent Node
anton ym
ĠIndex Error
Stanford CoreNLP
Standard Charsets
Choice Field
Ġ100000 10
listen ing
Ġshar ex
Ġrecurs ing
Ġstrong Phi
Ġscatter plot
ĠwordsWithPos AndSynonyms
Ġsubmit ted
Ġsubmit Button
Ġcomput ations
ĠArm strong
Read Line
Read DataTable
Read AsStringAsync
Ġperform ance
Ġperiod s
UnicodeScalar View
Ġleaf y
Ġdetermine IrrigationRate
Ġindicator s
Transformer Factory
Transformer Exception
caret Ensemble
Accept anceTest
Ġpopul ated
Comple te
Ġweight s
Ġweight ed
ĠEnter tainment
Number OfLegs
DEF GHI
Ġabil ity
Ġprevious ly
=$( .
Ġsmall er
ĠDecision Tree
alphanum eric
+)\ *\*
Japan ese
Ġfrança ise
("+----+----------------+----------------+ ")
horizontal Header
)? .
)? ;
)| (?=\
)| (?<=\
*)) '
*)) `
48 23
:' +
:.... "
=', ',
Action Event
Amer ica
Amer ican
Be jew
Ben edict
Ben fica
Cor relation
Cor aline
CLA SSE
Cann y
Cann ed
Duy á»ĩt
Des ign
Des crib
EL DS
Fit Sphere
GM PFS
Java Script
Java Converters
LI BR
Last Section
MET A
MET HOD
NOP S
Oc p
Oc tober
On ce
Pe ak
Pe ace
QU OTE
Rust ic
SO CK
WS GIA
[~ ,
bed rooms
boot strap
cal oos
cal endars
cast si
care er
dest royAll
djang orestframework
djang oproject
danc ing
danc ed
eight een
four cc
flex ible
gon um
gener ic
gener ation
good bye
gather ing
gpg key
hy pers
hy perref
hel d
haar cascade
haar casc
ju ice
mo ons
mul ticlass
nam elist
nam edtuple
pa lette
video io
well ness
|\. ?
Ư Ỽc
Ġay udan
Ġay udarme
Ġut c
Ġ:: |
Ġtú y
Ġtick er
Ġtick et
Ġcast le
Ġcast ing
Ġcateg orical
Ġcateg ories
Ġclear ing
Ġvin yl
Ġvin centy
Ġhor u
Ġhor izon
Ġhel i
Ġhel ps
Ġhack athons
Ġsun rise
Ġsepar ate
Ġsepar ated
Ġmyst ery
Ġmyst erious
Ġmov ies
Ġmov ement
Ġbl ame
Ġbl urred
Ġburn ing
Ġburn ed
Ġbrow n
Ġbrow ser
Ġdol or
Ġdol ore
Ġdep th
Ġchans on
Ġchans ons
Ġking dom
Ġpo ésie
Ġpor trait
Ġpet ite
Ġpet als
Ġpref erences
Ġpref erred
Ġgly coprotein
Ġgly cerin
Ġret rotrans
Ġrem arqué
Ġrem plie
Ġrep mat
Ġrep resented
quy ết
quy á»ģn
anom aly
anom alies
ĠTem perature
ĠTem pura
ĠTenn esse
ĠTenn essine
ĠCH O
ĠCH NOPS
ĠCr uz
ĠCor ona
ĠCor coran
ĠCel tic
ĠCel tx
ĠCur ium
ĠCur ie
ĠClo verglen
ĠCad mium
ĠCad imi
ĠCour ville
ĠCour sera
ĠClient Options
ĠCẢ NH
Ġ"{ $
Ġ"{ \"
thu áºŃt
them odule
thread Id
Ġ119 3
Ġ119 500
ĠNot ebook
ĠNot epad
ĠNep al
ĠNep tun
ĠNatural Language
Ġ(; )
Ġ(; ),
ĠSk ip
ĠSk illshare
ĠSur ge
ĠSun stone
auto load
ĠBer ing
ĠBer kelium
ĠBis que
ĠBis marck
ĠBot press
ĠBil bao
ĠBil lowy
Ġ----------------- --------|
Ġ----------------- -----
ĠPo lo
ĠPol onium
ĠPol itical
ĠMo onbe
ĠMalag a
ĠMalag ueta
Ġ'! '
Ġ'" ';
Ġ'{} '
Ġ'{} ')".
Ġ'{{ {%
Ġá»Ķ n
Ġfit ting
Ġfail ing
Ġflow ers
ĠhợpG oogle
ĠhợpG usto
ĠDE BUG
ĠDE CIM
ĠDS P
ĠDr ive
ĠDr aft
ĠDir ect
ĠDir ectory
ĠDraw ing
ĠDriver Manager
Ġrad ar
Ġrad io
ĠHer on
ĠHer editary
ĠHel i
ĠHel mhol
ĠHum mus
ĠHum boldt
ĠHol mium
ĠHol lywood
ĠHoney suck
ĠHoney crisp
acul in
ĠVie ja
ĠVie jo
ĠVÃĢ O
007 69
ĠAK S
ĠAir lines
ĠAir plane
ĠApol lo
ĠApol linare
ĠLA PTOP
ĠLi quid
ĠLevel s
ĠKab addi
ĠKab uki
ifthen else
Ġconsider ed
Ġconsist s
Ġconsist ency
ĠGro s
ĠGro ove
ĠGib bous
ĠGib ralfar
Ġdoes n
ĠRu therfordium
ĠRas a
ĠRas pberry
ĠRec ursive
ĠRec ommender
ĠRem ember
ĠRem oving
ĠRub io
ĠRub idium
ĠRNN CoreAnnotations
("- ",
ĠJÃ ¸rn
ĠJà »zô
ĠIr rationalNumbers
ĠIsabel la
ĠEu clide
ĠEng land
ĠEng lish
ĠEst eban
ĠEver ything
ĠEns ure
ĠEns uite
ĠEvent NewsItems
ĠXer i
ĠXer us
Ġoff set
Ġ744 8
getNode Type
getNode Value
pear son
..." >
)))) )))))
ĠWW F
ĠWW II
ĠWh itney
ĠWh isper
ĠWar ner
ĠOg anesson
ĠOs amu
ĠOt sego
ĠOt toman
cred entials
cred itcard
Ġprogress bar
='; ')
='; '`.
Info Mingle
Ġ%% &
Ġdiag onal
fileName Path
Ġéc rit
Ġéc rire
ffff ff
ATCG TAG
ATCG ATGCT
photo Choice
Ġ126 220
ĠExpl ain
ĠExpl orer
ĠQuick Select
ĠQuick Books
ĠInd ra
ĠInd onesia
127 648
ĠYt tri
ĠYt terbium
ĠYoshi hide
ĠStandard Charsets
ĠStandard Scaler
Ġaccess es
Ġaccomplish ed
Ġaccomplish ment
Ġexp ected
Ġexp andtab
erts Shyness
ĠfileName Path
Ġshift width
Ġ115 1
Ġ118 1
minimum Age
ĠConvolution al
wordsWithPos AndSynonyms
Ġbeautiful soup
Exec utionMode
Exec CodeModuleObject
Ġsky line
Ġencry ption
Ġencry pted
Ġappr éc
Ġappr eciate
INT EGER
ĠAlcaz ar
ĠAlcaz aba
Ġheart warming
ĠArray s
ĠArray List
ĠAristot le
ĠAristot eles
ĠâĪ Ī
ĠâĪ ļ[(
lastL ithe
ĠtdB altim
ĠtdB oston
9999 99780
linux ize
Ġstarted rons
6666 6667
Order By
Serial ize
]]]] ]]]
Ġservice Instance
ĠWebApp IntegrationTest
ĠWebApp AcceptanceTest
Ġdivis or
Ġdivis ible
FFD C
Ġassoci ate
Ġassoci ative
ĠẢ nh
DOM Source
Ġevery one
Ġseason al
ĠSeab reeze
ĠSeab orgium
Health care
lowercased Chars
(?:(? =
(?:(? <=\
employee Data
ĠFrank lin
ABC DEFGHI
HTTP Adapter
risk Regression
ĠcudaPrintf Error
ĠcudaPrintf Format
Ġprecodec lass
Ġprecodec urs
Ġtempor ary
GACT CAGCT
Ġfront page
Ġ|----------|-------------------| ----------|--------
Ġimprov ement
Ġimprov ements
Ġreduc ing
Ġreduc ed
Ġxerograph y
ĠFeedbackAnalyzer Visual
Ġevaluate Relationships
setOAuthConsumer Key
setOAuthConsumer Secret
CalculateAverage WaterUsage
CalculateAverage EnergyConsumption
HCUP net
Sentences Annotation
{{}--{} }{},
çĦ¡ çĦ¡
ĠCopern icium
ĠCopern icus
Ġ|-------|--------------| --------
ĠEinstein ium
cluster map
setOAuthAccessToken Secret
!}} {}
"... )
%% )]
*)` ).
+)( \.
,*/ *;
.'' '))
/_ /
0100 3333097
070 519
0123 456789
297 7003
267 127648
419 4
499 6091
624 00
734 820
7432 368
8365 29
930 45550
986 0044
<_ >
<() >
=': ')
=[] ):
>` ;
>.* $//
Av ignon
Ast ro
Ale cAiv
Ail uropoda
Atom ic
Alab ama
ALT ER
Achi eving
ACG ATCGATGCT
Bl ues
Ber thol
Bay ern
Bac on
Bio conduct
BNe awe
BLO CK
BOD MAS
Breat htaking
Basket ball
Ce iba
Co uper
Cer copithecus
Cal ifornia
Cel tic
Cent OS
Cre ated
Cad mium
Cort ar
Cap R
Coun ter
Cri ticism
Categ oricalCrossentropy
CẬ P
CẤ P
DN MT
Del iver
Dele ting
Dict Writer
Devel op
DLE WARE
Dynamic Row
DIST INCT
Deserialize Object
EM PT
Ep och
Est imated
Ele phas
Eag le
Ell a
Ess entials
ELE MENT
Fc n
Fant asmag
Fran cus
Flat File
FOR MAT
Fiddle sticks
Flor ida
GI L
Gl asgow
Giá» ijng
Ger main
Got sumotto
Good bye
Hon shu
Hum mus
Hom ebrew
Hist ory
HDA C
Hamb urger
Heve a
Hawk ley
Haj ime
Ital ian
JK LMNOP
Ju ventus
Jag uar
Jazz Core
Kub o
Lor em
Lis bon
Lux o
MS ME
Mut ations
Mac Book
Mad rid
Mod ified
Mus a
Meth ane
MID DLEWARE
Moz illa
Marin ated
Masse y
Nor way
Nau tilus
Nov ember
Onn xRun
Pan thera
Pig ment
Pot ato
Pred eterminer
Pron oun
POR T
Perm ute
QR STUV
Ro asted
Ré my
RAN DOM
SU B
Sor bet
Sport s
Shi pping
Soc rea
Sib ling
Sep tember
Ste amboat
Sou th
Swift Excel
Sparse CategoricalCrossentropy
Sync fusion
Seas onal
SUN KEN
Slug Field
Separ ator
Steam ed
SPL IT
Tur in
Tac os
Tun a
Tus caloos
Tap irus
Tcl Error
Tech Solutions
Timer Fcn
Táºł O
Uns atisfied
UAG ES
Vib rant
Wal rus
Wai ting
Zip File
[... ,
\} ").
\// /
^{ -
bl kproc
bas eline
bear s
brow n
bbf bf
bisc uits
business es
cp is
cour ses
carb oxy
calcul atedSpace
cool warm
carbon Footprint
cogn itives
dr ink
des criptor
dod ge
dess erts
deserial ized
fs SL
fle w
fem ale
fron talface
faster xml
gin ia
gard in
glow s
gorg eous
ho using
há» £p
hef ty
herb e
há»Ĺ n
hydro xymethylcytosine
kar uslabs
kok u
là ¦tta
larg e
mv rnorm
mesh grid
nar row
nim ble
nAn swer
nOpen CV
ois elles
pas sthrough
pach o
pref etch
pix abay
rat elimit
rain bow
rah a
sal ary
sce aduwe
sav edrec
sore ad
slic es
sign als
socioeconomic Factor
sniff ing
town s
uenc ed
vin centy
wur d
wFx E
wpem ergencia
yam l
yog urt
zÄij á»ģ
zsh rc
zdw qk
}${' *'
«ä ºķ
¸ãĤ Ĵæİ
Ãī lysé
åĪ ĿãĤ
æĪ ¸ãĤĴæİ
Ġer ectus
ĠÆ°á»Ľ p
Ġur anus
Ġent ropies
Ġip sum
Ġey es
Ġenti re
Ġens urep
Ġave zÄijá»ģ
Ġeff ective
Ġeffort s
ĠÎĶ v
ĠïĤ ¸
ģãģ «äºķ
Ħï¸ı ",
ĺãĤ ĭ
Ġter ms
Ġtit anum
Ġtid ytext
Ġtech nique
Ġtwit teR
Ġteng o
Ġtambi én
Ġterrestr is
nghi êng
Ġcac bon
Ġcod ecs
Ġcub ed
Ġcach ing
Ġcock tail
Ġcri tical
Ġcert ain
Ġcarn ÃŃvor
Ġcog sci
Ġcurv es
Ġthau matrope
Ġvot es
Ġvhic s
Ġvisual ize
Ġvvjw Jb
Ġhong os
ĠhÆ°Æ¡ u
Ġhand ling
Ġhap py
Ġhẻ m
Ġhẳ n
Ġhast y
Ġhard working
Ġhaz ards
Ġhumb le
Ġhabil is
Ġlem matization
Ġlate st
Ġlip um
Ġleg end
Ġligh ting
Ġlift ed
Ġlik ely
Ġlimb ic
Ġsat urn
Ġsle pt
Ġspro uts
Ġscr ape
Ġsci entific
Ġsran mo
ĠsEn timent
Ġsund ae
Ġschem e
Ġsuel os
Ġsway ing
Ġseek s
Ġsimb ióticas
Ġsulfur ic
Ġselec ting
Ġsfum ato
Ġsnip pet
Ġmer chants
Ġmel anoleuc
Ġmic rô
Ġmed ical
Ġmist ake
Ġmil imét
Ġmir aculin
Ġmount ain
Ġmash ed
Ġmsc orlib
Ġmane uvers
Ġmercur y
Ġmotiv ating
Ġbal let
Ġbre ast
Ġbid irection
Ġbust ling
Ġbox width
Ġbwb oundaries
Ġblack smith
Ġtrav els
Ġtrop ical
Ġtreat ing
Ġdì u
Ġdin ucleotide
Ġdim ensions
Ġdang er
Ġdro plets
Ġdjang orestframework
Ġdanc ed
Ġdiction aries
Ġdistr ess
Ġdistrib ution
Ġdress ing
Ġdams el
Ġdemon strate
Ġdyspro sium
Ġdromed arius
Ġchant ent
Ġchamp ionship
Ġkay ak
ĠnhÃŃ m
Ġnhõ m
Ġnas omacul
Ġnic titans
Ġnob lewoman
Ġnep tune
Ġnov o
Ġnood les
Ġpan els
Ġpent andra
Ġplo esi
Ġpé rdida
Ġpil ates
Ġpob res
Ġpdf Latex
Ġpear sonr
Ġpert ubations
ĠpÄIJ ại
Ġpanc ake
Ġpyd antic
Ġpagin ated
Ġpeas ants
Ġpoly phenol
Ġgên e
Ġgor outine
Ġgar lic
Ġgent le
Ġgfor tran
Ġgeo logical
Ġgran ola
Ġgaler ie
Ġgluc ose
Ġphen akistscope
inop le
invert ed
invest ment
Ġris k
Ġration ale
Ġrot or
Ġreb el
Ġrib bon
Ġrob ertsShyness
Ġrocket s
Ġroma ine
Ġretri eved
Ġrepar tition
erland s
animation Frame
chunk size
chromed river
Ġquot echar
Ġxò e
Ġxli x
Ġxylo phone
ĠTag ine
ĠTus cany
ĠTab ata
ĠTap ir
ĠTá»į a
ĠTass inary
ĠTiv i
ĠTener ife
ĠTant alum
ĠTell urium
ĠTog gle
ĠTech netium
ĠTorch Script
ĠTerb ium
ĠTof urky
ĠTyt ler
ĠTemplate View
ĠTẤ T
ĠCas ilda
ĠCit rusbrLoÃłi
ĠCum ulus
ĠCun ningham
ĠCav endish
ĠCot tony
ĠCev iche
ĠCiv il
ĠCủ ng
ĠCov id
ĠCarn ap
ĠCoh l
ĠCran e
ĠCustom PoolManager
ĠCasc o
ĠCÃģ C
ĠCumber batch
ĠCHá» ĮN
ĠClear ing
ĠCoff eeScript
ĠCuis ine
ĠdụngQu ickBooks
stad tium
starr ed
leti a
leaf y
arro ti
Ġ"---------------- ---------"
Ġ"\" ";
Ġ"âĿ Ħï¸ı",
Ġchois i
Ġchocol ate
Ġcholester ol
ĠÄIJOáºł N
ĠÄIJÃĤ U
thth Diá»ĩn
theg uardian
Ġ175 000
escap ing
amsm ath
amorph ophallus
eteVM s
ĠNit rogen
ĠNest le
ĠNev ada
ĠNath aniel
ĠNoo yi
ĠNeth erlands
ĠNiel sen
ĠNik en
ĠNOU N
ĠNHÃ ĵM
ĠNHá» İ
ĠNimb us
ĠNLTag ger
Ġ(`: =`).
Ġ(� �
ĠSim ulate
ĠSec urity
ĠSing ular
ĠSed a
ĠSum ac
ĠSand berg
ĠShi koku
ĠSage brush
ĠSist ine
ĠSop hia
ĠSeb astian
ĠSax ophone
ĠSER VER
ĠSaf ely
ĠSof ia
ĠSky dance
ĠSigm und
ĠSals a
ĠSanti ago
ĠSales force
ĠSCON J
ĠSerial ize
ĠSynt ax
ĠSquares pace
ĠSatyag raha
tistr y
ĠBun ny
ĠBre wer
ĠBol t
ĠBow ser
ĠBore alis
ĠBrit tania
ĠBear er
ĠBarb ara
ĠBast ille
ĠBER T
ĠBern abéu
ĠBarr a
ĠBoh rium
ĠBụ i
ĠBale aric
ĠBuff alo
ĠBank ing
ĠBbox Base
ĠByt esIO
ĠBuzz ing
ĠBlack ton
ĠBLS DataScr
ĠBÃģ O
ĠBism uth
ĠBLO B
ĠBertr and
ĠBeryl lium
ĠBuon arroti
ĠByz antine
ĠBÃĮN H
ĠBetele hem
itert uples
Ġ----- -|
Ġ-|----------|-------------|------------ ---
aimer ais
ĠPap ua
ĠPers ian
ĠPack age
ĠPall adium
ĠPart e
ĠPach a
ĠPool Manager
ĠPale obio
ĠPuff y
ĠPlut onium
ĠPrad o
ĠPrase odymium
ĠPasc al
ĠPizz azz
ĠPUN CT
ĠPROP N
ĠPHẠ¦N
Ġ2200 000
Ġ265 68
Ġ213 5
Ġ217 000
urlo pen
ĠMay o
ĠMic key
ĠMent or
ĠMut ation
ĠMort y
ĠMend elevium
ĠMos covium
ĠMON TH
ĠMari e
ĠMill er
ĠMorr ison
ĠMoul ins
ĠMates chitz
ĠManu al
ĠMeit nerium
ĠMoy er
ĠMoz art
ĠMalus brLoÃłi
ĠMoly pden
ĠMELP A
Ġ'=" '
Ġ'<<< ')
entre es
Ġtool box
Ġtopp ed
Ġtomat oes
Ġtoler ance
Ġfol k
Ġful filling
Ġfil enames
Ġfall s
Ġfanc ybox
Ġfollow ing
Ġfotos inté
rober tsShyness
Ġ|--------------| ------------------------------------------|
Ġ|-------------| -------------|
Ġ|-------------------| --------------|-------------
Ġ|------| --------------|--------------|
Ġ|--------| --------------|
ĠhợpSh opify
ĠDem oiselles
ĠDion ysus
ĠDom estica
ĠDus k
ĠDul uth
ĠDub nium
ĠDip lodoc
ĠDiv idend
ĠDial ogflow
ĠDream weave
ĠDevel oper
ĠDick ens
ĠDown load
ĠDarm stadtium
ĠDaff y
ĠDazz ling
ĠDarc y
ĠDelac roix
Ġrace es
Ġracec ar
ĠHand le
ĠHass ium
ĠHath or
ĠHart man
ĠHuff ington
ĠHÃĢ NG
ĠHeming way
Ġ316 0
excell ent
acion es
Ġ{... },
ĠVis ite
ĠVue JS
ĠVil a
ĠVers ailles
ĠVir ginia
ĠVond elpark
ĠVient o
0016 66666667
lovel y
ĠAct inium
ĠASt ar
ĠAri anna
ĠAequ orea
ĠAbr aham
ĠAstat ine
ĠANO VA
ĠAspect s
ĠAjw ain
regr ession
Ġlook ing
isEm pty
adap ters
adenos ylmeth
identify Variables
ĠThul ium
ĠThMaj or
separ ators
ĠLand sat
ĠLow ell
ĠLith ium
ĠLlot ja
ĠLear nOpenCV
ĠLight ning
ĠLook up
ĠLaz y
ĠLiver morium
ĠLanc aster
ĠLAR GE
ĠLanth anum
ĠKry pton
ĠKerry gold
ĠKepl er
ĠKiw i
ĠKlond ike
ĠKuip er
ĠKyush u
Ġincl uding
Ġinfl ation
Ġwind ow
Ġwrit ten
Ġwear ing
Ġwast e
Ġworth iness
track ing
ĠChip otle
ĠChop s
ĠChurch ill
ĠChatbot s
ĠCharc uterie
ĠChartr es
ĠChesape ake
Ġ510 6
Ġ513 9
Ġconver ting
Ġcontro lar
Ġconsect etur
ĠGir alda
ĠGray son
ĠGug genheim
ĠGaz pacho
ĠGIN I
ĠGerm any
ĠGlaz ed
ĠGinger root
ĠGauss ian
ĠGaithers burg
ĠGadolin ium
appro ach
ĠRip ple
ĠRef erence
ĠRhe e
ĠRud olf
ĠRep tile
ĠRaw ls
ĠRou ges
ĠRog ers
ĠRade on
ĠRaf iki
ĠRegin ald
ĠRamb la
ĠRaph ael
ĠRhen ium
ĠRoch ester
ĠRuth enium
ĠRfac ebook
ĠRED CapR
ĠReti ro
ĠRaven na
ĠRIÃĬ NG
ĠRoent genium
ĠRabbit MQ
extension Template
Ġ[&] ()
Ġcucum bers
("." ):
("ðŁ İĦ",
("*") ).
("<-- ");
Ġachi eved
Ġaster isks
Ġawes ome
Ġazac itidine
ĠNhiá»ħ m
Ġstegosaur id
Ġstreps irrhines
ĠJob s
ĠJoh annes
ĠJose ph
ĠJeff erson
ĠJazz ed
ĠJFree Chart
ĠFact or
ĠForm s
ĠFerm ium
ĠFouri er
ĠFlick er
ĠFollow ed
ĠFresh Books
ĠFrozen List
ĠFILE NAME
ĠFOX P
ĠFrostfl ame
ĠIrel and
ĠIwer ks
ĠIrid ium
ĠIEE E
ĠIbiz a
ĠIguel do
ĠIkeb ana
ĠPhys alis
ĠPhry gian
ĠEgy pt
ĠEug ène
ĠEsp aña
ĠElast ic
ĠEurop ium
ĠEpaz ote
confidence Score
contour f
pyimages earch
pytor c
erspo on
ĠXLS X
getframe info
getResponse Code
getChild ren
getOr Create
getNext Sibling
getPredict edClass
getcw d
Ġansw ers
ĠWith erspoon
ĠWik ipedia
ĠWinf rey
ĠWolf e
ĠWinst on
ĠWojcick i
ĠWasab i
ĠUran ium
ĠviênDatabase App
ĠOpr ah
ĠOsc ar
ĠOsm ium
criter ia
toPl ainString
Ġasoci aciones
Ġ845 000
':'. ,'}
outstand ing
setcheck interval
setDebug Enabled
setStretch LastSection
ĠQUY á»ĢN
Ġpropor tion
Ġintellig ent
addAt tribute
Ġarchitect ure
ĠiPh one
commun ity
TryGet Value
Install ing
Infl uenced
Ġ945 24
Ġ934 000
Ġjdo e
Ġjupyter lab
Ġjalap enos
Ġdiale ct
Ġdijk stra
Ġdióxid o
filepart s
Ġemploy ment
Ġembarr assment
Ġeius mod
psycho logytod
shynessTrait s
ĠgetIcon Name
1015 700100300
Ġprincip al
appetiz ers
ĠContin ue
ĠConstant inople
Ġ1217 40
ĠExpression ism
ĠQuicks ilver
paralle lize
Ġimplo de
Ġimmedi ately
Ġimpor ting
LANG UAGES
Ġdatecol umn
ĠIniti ate
ĠIncor porate
ĠInstanti ate
mapVal ues
Chick pea
ĠJSONSerial ization
ĠYok ohama
ĠYosh ua
ĠYYY Y
ĠYYMM DD
ERRO R
ĠStard ust
ĠStegosaur us
ĠStonew all
Ġaccept able
Ġacry lic
Ġacoust ic
Ġacuer do
ĠHokk aido
Ġexped itious
ĠClarin et
25001 442312
Ġshog un
appendDots Count
STRE AM
Ġ1150 20
Ġ1172 60
Thread ing
tableof contents
Ġitali en
ĠAdej e
([^\*] +)\*\*
Anchor age
Ġunwant ed
Ġstrug gle
ĠAnnot ator
ĠAnnat to
zipWith Index
Ġallos aurid
Ġalgebr aic
Ġaliqu a
Ġalthoug h
auraofar tistry
Ġhypom ethylation
TextAnalytics DB
Ġaujour d
Ġaugment ation
Ġscrollo ff
ĠBruss els
ĠBrunelles chi
ĠReich held
ĠReason er
ĠEmberg low
ĠShorth air
Ġparmes an
1675 3310418
1699 25001442312
Ġplais ir
ĠAlternativ ely
ĠAllos aurus
ĠAlham bra
ĠAlbai cin
Ġgrise us
Ġgraff iti
Ġ(`|| `)
15725 16753310418
2337 4823
noAccess Control
Ġdeacetyl ase
Ġcompre hension
Ġcompil ing
ĠCalculateAverage CarbonFootprint
6093 44
REQU EST
ĠtrainNet work
jsdeliv r
ĠBrachiosaurida e
cudaMal loc
ĠminNe ighbors
3397 32
ĠPytag o
ĠMyOtherService Method
ĠMyFit nessPal
ĠArgentin a
ĠArundhat i
Rekogn ition
saveAs TextFile
theailear ner
ĠtestGet Users
ĠToken ize
Ġworkhor se
Ġadvanc ements
Ġadipisc ing
ĠtdMass achusetts
ĠtdAlb any
ĠtdPhi ladelphia
ĠtdHarris burg
ĠtdMary land
ĠtdWor cester
ĠtdAnnap olis
Unique ID
Unkn own
Pretz els
ĠNewsItem Serializer
ĠResourceW arnings
ĠnhátTrait s
ĠParameter izedTypeRef
Ġoppress ive
Ġmethyltransfer ase
Ġdetermin ed
ĠTwitterSentiment Analyzer
ĠProtact inium
SentimentAnnot atedTree
SentimentAnalysis Collection
devgu ide
ĠPhilos ophy
ĠreadSo ilMoistureLevel
CHÃĪ N
PyImage Search
ĠBeanst alk
14159265 359
Ġdecitab ine
ĠScreen play
tagSchem es
Ġcareful ly
ĠFitzwil liam
PEMDA S
Subscrip tion
ĠFlerov ium
ĠFlamenc o
ĠIntellig ence
ĠZeit geist
ĠZero MQ
ĠfilterJob sByPerson
ĠAsafoet ida
DefaultRequestHe aders
POSTFI ELDS
ĠAmorus o
Ġoverlook ing
ĠRedistribut able
capital ize
Ġzoet rope
marshmal low
Ġedgecol ors
ĠRandomSentence Generator
VERSI ON
Ġcraft smen
ĠCamaras aurus
ĠParisActivities Generator
68122035 7960423
DECLA RE
DELET E
ĠchangedUp date
chiaros curo
2828 37
Ġnotif ied
ĠMontju ïc
ĠGhirard elli
HTTPH EADER
makedir s
Ġdeserial ization
ĠSurveyMon key
ĠARHGA P
recursiveMulti ply
79406 2
AGCTGACT AGC
AUTOTUN E
Ġclohyd ric
Ġcapabil ities
Ġcapital ization
Ġbottlen ecks
ĠHeaven ly
("|-------| -------|----------------|----------------
('/\*\* ([^\*]+)\*\*
ĠWilhel m
ĠOceanogrÃł fic
Ġbrasil iensis
Ġpotato es
ĠSelfReflection App
ĠPrincess Story
Ġ|----------|-------| -------------|
Ġ|----------|----------|-------------|------------ --
ĠGraphics path
ĠUnicodeEncode Error
ManyToMany Field
Ġsinusoid al
ĠTezuk a
ĠAbsar oka
62806566 23374823
VideoCapt ure
worldwild life
Ġ"ðŁ¦Į ",
Ġ-------------|-------------------------------- ------
ĠMcCart ney
ĠMcKin sey
ĠMitoCart a
ĠAssurance pip
ĠLinkFind er
ĠLinkHar vester
Ġincidid unt
ĠGlobalCuis ines
crypto graphy
Ġequival ent
Bejew eled
CLASSE S
Describ e
LIBR ARY
WSGIA pplication
destroyAll Windows
hypers etup
haarcasc ades
Ġretrotrans poson
ĠTennesse e
ĠNeptun ium
ĠMoonbe am
ĠDECIM AL
ĠHelmhol tz
ĠHoneysuck le
ĠGibralfar o
ĠRaspberry roof
ATCGTAG GACTCAGCT
Ġappréc iez
ĠtdBaltim ore
999999780 1
ABCDEFGHI JKLMNOP
ĠFeedbackAnalyzerVisual izer
070519 9999997801
734820 93045550
9860044 18
AlecAiv azis
ACGATCGATGCT AGCTGACTAGC
Berthol letia
Bioconduct or
EMPT Y
Estimated Arrival
Fantasmag orie
OnnxRun time
QRSTUV WXYZ
Tuscaloos a
carboxy lcytosine
cognitives ervices
savedrec s
Ãīlysé es
åĪĿãĤ ģãģ«äºķ
æĪ¸ãĤĴæİ ĺãĤĭ
Ġensurep ip
ĠcarnÃŃvor o
Ġmelanoleuc a
Ġbidirection alS
Ġnasomacul atus
ĠBLSDataScr aper
ĠPaleobio logy
Ġfotosinté tica
Ġ|--------------|------------------------------------------| ---
ĠDiplodoc us
adenosylmeth ionine
psychologytod ay
1015700100300 739
ĠParameterizedTypeRef erence
681220357960423 8
("|-------|-------|----------------|---------------- -|")
('/\*\*([^\*]+)\*\* /',
ATCGTAGGACTCAGCT ACGATCGATGCTAGCTGACTAGC
ABCDEFGHIJKLMNOP QRSTUVWXYZ
73482093045550 86
åĪĿãĤģãģ«äºķ æĪ¸ãĤĴæİĺãĤĭ
|