#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| human_label
int64 0
1
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 121
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 2,036,320 | 0 | TATTATTCCACTTTGGGATTATGTTCGTAATGGGCGGTCATGTTATGGGGATATTAATTCCAGAAGCTGTATACCGTTCCATAGGTATTTCTGAGCATATGTATCATGTAGTAGCAATTAGTTTTGGTCTTCCGGCAGGTATTGCTTCTA | 118[Bacillus thuringiensis] serovar konkukian str. 97-27
|
G000009905 | ASM990v1 | GCF_000009905.1 | PRJNA224116 | SAMD00061067 | null | 2004/09/02 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/905/GCF_000009905.1_ASM990v1 | 637,000,306 | RS_GCF_000009905.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 292,459 | 2,734 | Symbiobacterium thermophilum IAM 14863 | strain=IAM14863 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Symbiobacteriaceae | Symbiobacterium | Symbiobacterium thermophilum | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 3,566,135 | 1 | 68.67 | 3,566,135 | 1 | 3,297 | 1,051,001 | 86.832243 | 98.02 | 0.03 | 0 | 347 | yes | yes | yes | 20 | high | 2,042,170 | 0 | GGAACCAAACCCAGCGCAGCGGAGACGGCGCCGAGCAAGCCGGCCACCGCCATCTTACGGACCGACATATTCATGGTGCATCCCTCTCCCTTAGAAGTGGTGACGCCCATATGGGTTTGGTAACAGTATAAACACTCTTCCACCGGTTGT | 99Symbiobacterium thermophilum IAM 14863 IAM14863
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,282,300 | 1 | CAAGGGCTCCATGGCACAAAAAAGGGCTTAAAACCCCAGGTCTGAGCCAGGCGCAGTGGCTCATGCCTGTAATCCCAGTACTTTAGGAGGCTGAGGTGGGAGGATCTCTTGAGCCCAGGAGTTTGAGATCAGCCTGGGCAACACAGTGAG | 120homo sapiens
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 1,172,730 | 0 | GGTGGGGTGTTCTGGGTAATGGCATTAATCGTGATCCCAGCGTTATTTATTCGCCCTCGGGTGGTGGCAAACCCGGAAGATCTCGCCGGTTAGGGCAAATCCAACAGGTGACGTAACCGCTTGTTTTGTTGTTCAGTTATGGGCAATAAC | 115Yersinia enterocolitica subsp. enterocolitica 8081
|
G000010785 | ASM1078v1 | GCF_000010785.1 | PRJNA224116 | SAMD00060961 | null | 2010/02/11 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/785/GCF_000010785.1_ASM1078v1 | 646,311,936 | RS_GCF_000010785.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 608,538 | 940 | Hydrogenobacter thermophilus TK-6 | strain=TK-6 | null | Bacteria | Aquificae | Aquificae | Aquificales | Aquificaceae | Hydrogenobacter | Hydrogenobacter thermophilus | true | Eubacteria | Bacteria | 1 | 1 | 0.8 | 1 | 1,743,135 | 1 | 44 | 1,743,135 | 1 | 1,905 | 573,308 | 96.888881 | 98.78 | 0.51 | 0 | 310 | yes | yes | yes | 20 | high | 1,040,520 | 0 | CATCCGCTGTGGAGGCTATGAGCCATCCATACTTCTTTTCTGGACTTATAAGGCGTGAGCTTGAGGACTTTTTCTGTCAAAAAACTGGTAGAAGATACGCTTTAGCGGTAAAAGAGTTTATAACGCCCTTGCTAGAAGTGCTTGACTATA | 49Hydrogenobacter thermophilus TK-6 ASM1078v1
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 1,600,170 | 0 | GGCGCCGACCTTGGAGGTCTTGCGCTGGAGGAGGTGGACCGTGCGCGGCGGGGCGGGCCGCTCGGGTGCGCCGAGGCCGCCGGGTGCGCGGTAGTCCATGTCGACGCCCCAGCTGCGGAAGTACGTCGCCGGGTCCTCGCTCGCCTTGTC | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 2,852,330 | 0 | GATTATATAGCTTAACAATACCGGACTTTGACTATACTGGACTCTGACAGTATCACGCTCTGATAGTTTTTAATGCTGATAATTTTTCAAATGTCCGCGGATTTTAATAGAAAACAATTTGTAACTGTTTGCCTTTGTAAGCCAGATCCG | 61Methanosarcina acetivorans C2A
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,115,100 | 1 | CTGCAGGACTTCACTACCATGAACCGTCCTCACCCCCAGCATCCCTGTCCCCACAGCTCCAAGGCCGCAGGAGGAGGCGATATCTAATCTTCCCCCCACGTAAACACCTGTCCCTGCGTAAATGCCTGAGGCTGGCTGCTTATTCTTTTT | 120homo sapiens
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 2,888,340 | 0 | AGCCCAGTTTGCCCATATAGTGATCCCCCGTGAACACCTGAGCAGGTTTATCCAAAACCTTCGGGCCGAATGTGCGAAAAGGGATAATCTGGCCGTTGCACTCTGCGCCGATGGTGTCAAGAAAACGCATCGTGACTTCGCTGGTCCGCT | 87Sodalis glossinidius str. 'morsitans' morsitans
|
G000009205 | ASM920v1 | GCF_000009205.1 | PRJNA57679 | SAMEA1705932 | null | 2006/09/20 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/205/GCF_000009205.1_ASM920v1 | 640,069,308 | RS_GCF_000009205.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,563 | 1,496 | Clostridioides difficile 630 | strain=630 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptostreptococcaceae | Clostridioides | Clostridioides difficile | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.9 | 1 | 4,298,133 | 2 | 29.06 | 4,290,252 | 1 | 3,829 | 1,209,268 | 82.891874 | 99.51 | 0.37 | 0 | 340 | yes | yes | yes | 20 | high | 3,787,030 | 0 | ACAATCTGTAATAACATTAAATTGGTCAACTATTATTATCTTGTTGAACTGATTATCATCAAATGGTAGAAACTCTAACTTACCTTTAACTACATTGCAATTTTCATTATACACTAGAGAATAACAGACATCTTCATAATTACTATTCTC | 28Clostridioides difficile 630 ASM920v1
|
G000009925 | ASM992v1 | GCF_000009925.1 | PRJNA58195 | SAMD00061068 | null | 2004/09/16 | Kitasato Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/925/GCF_000009925.1_ASM992v1 | 637,000,025 | RS_GCF_000009925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 295,405 | 817 | Bacteroides fragilis YCH46 | strain=YCH46 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides fragilis | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.9 | 1 | 5,310,990 | 2 | 43.2 | 5,277,274 | 1 | 4,416 | 1,603,639 | 88.979964 | 99.26 | 0 | 0 | 347 | yes | yes | yes | 20 | high | 32,890 | 0 | AAGATAGAGATGTACGCATTACGTGTAAAGTCGCCCGAACCGCCGATACCGTTCATCATTTTGGTTCCGCCAATGTGGGTAGAGTTTACATTACCATAGATATCCGCTTCAATGGCTGTATTGATAGAGATGATGCCTAAACGGCGAACT | 10Bacteroides fragilis YCH46
|
G000007625 | ASM762v1 | GCF_000007625.1 | PRJNA224116 | SAMN02603289 | null | 2003/02/05 | Gottingen Genomics Laboratory | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/625/GCF_000007625.1_ASM762v1 | 637,000,080 | RS_GCF_000007625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 212,717 | 1,513 | Clostridium tetani E88 | strain=Massachusetts substr. E88 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium tetani | true | Eubacteria | Firmicutes | 1 | 0.997 | 1 | 1 | 2,873,333 | 2 | 28.64 | 2,799,251 | 1 | 2,799 | 856,294 | 87.797934 | 98.28 | 0.14 | 0 | 315 | yes | yes | yes | 20 | high | 1,995,500 | 0 | TTATCACTTAGATAATTAAGTATGTCAGGATCCGTTGCAGGAGTAAGTTTTAGCAAAAAAATATTAGTACATAAAGTTTTATAAAAAACAAGTTCTTTCTTTTTTTTACAAATTGAAATTTTATCATTATATTTAATTCTATTTCCTTCA | 30Clostridium tetani E88 Massachusetts substr. E88
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 1,320,930 | 0 | CGCCAGGTCCTGATCTGACCACCAAAGGCACCACGGCACCGGCCATTCCACGCCACACCGCCTCGGCGTGGGTGGATTACACGGTTCATGACGGGCAGTTGAAAGGTGCTGGTGTGGGTGGCGGCGCACGTTATGTGGGCGCGAGTTGGG | 119[Pseudomonas syringae] pv. tomato str. DC3000
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 5,367,050 | 0 | ACTTCCCTTTTTTTCATCTTAACGTTTACTATCCTTCATTGTTTGAATGTGCAAGATATTTTGTAAAATAGTACAGGATGGCTATGAAGAATAAGTAAACCTAAAAAGCCTTCTTCGTGAGAAGAGGCTTTTTTGTTTTTGGAACTTTTT | 11Bacteroides thetaiotaomicron VPI-5482
|
G000007185 | ASM718v1 | GCA_000007185.1 | PRJNA294 | SAMN02603235 | null | 2002/04/03 | Fidelity Systems | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/007/185/GCA_000007185.1_ASM718v1 | 638,154,507 | GB_GCA_000007185.1 | Monoisolate | Complete Genome | Full | na | Major | 190,192 | 2,320 | Methanopyrus kandleri AV19 | strain=AV19 | null | Archaea | Euryarchaeota | Methanopyri | Methanopyrales | Methanopyraceae | Methanopyrus | Methanopyrus kandleri | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 1 | 1,694,969 | 1 | 61.16 | 1,694,969 | 1 | 1,814 | 523,004 | 90.896353 | 96.74 | 1.6 | 0 | 146 | yes | yes | yes | 15 | medium | 1,126,580 | 0 | TCGTCATCGACATGGTGGGAAGGTGGGTTCTGTACGAGGATTGGCTAGGTTACGCGCTGGGGGAGGTTACGACTTCGGGGTTACGTGAGCTGGTGAGATTACCCGGGCCAGCGCATCGCGTGACCGTATGGTCGACGGGTGGGGATGCCT | 60Methanopyrus kandleri AV19
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 3,416,010 | 0 | CCGTGTGTTCATTGAGGTGCTGCATCATCAATTGCAGGTGTCCAGCCAGCGCCTCTCGTAACTGAGCCAAGTGCTTGTCCAAACGGCCGCTGCTGCACAAGCGGGCGATGGCTCGCTGACGAGTGGGCGGCAGTTCAAAGGCGCGCAGCA | 119[Pseudomonas syringae] pv. tomato str. DC3000
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 2,158,130 | 0 | GGGATTGGCCATGATGGAGTGCAACAACGACGTATCTGAATTAGAGATCGGTGACTACATCAAACAAGTGAATAACTACCCGAAGCGTGCCGAGTTGGAACGATTGCGCGATGAGCAGCGGAGCTTACACCTCCAAGCGGCCGCAGCGGA | 15Brevibacillus brevis NBRC 100599
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,900,450 | 1 | TGCTGGTTGTTTGTGGGCACTCTTTGTTATTCTTTGGCTTGTAGAGGCATCACCCTGATCTCTATTTTATCTTCAAATGGTGTTCTCCCTGTGTGTCTTTGTGTGTGTGTATACGTCCAAATGTCTTCTTTTTATAATGACAGGAGTCAC | 120homo sapiens
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 4,019,080 | 0 | TTTTTTAGTAAACTGTTCACTCTTTTGCCAGTCTTTTAAATTCTCGTCTATTTTATTCTTTGATACCTGTTCATACATCGACCGAACTCCAAGTTCGGTTTCAGTCGCAGGTTTGTCTTGCACCTCTTCAAGGGTGTATGCATCTACAAA | 61Methanosarcina acetivorans C2A
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 1,509,040 | 0 | CTTTACCACCGGGTGCTCTACCCTGATCTTGCCGAGTTTGAGATATGTGTCTTCAATGTCGGTTTCTATAATCTTCTGTTCATCAATGATCTTTTGCAGCCCGTAATCTATAAACTTGTTAAATGAGTCTATATGGTGCTGCACTATCTT | 61Methanosarcina acetivorans C2A
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,811,950 | 1 | AATCTGAGTCTTGGTGACCTCTCTGGCCACTCCTTCTGGATCTAAAGCTCTAGAAGGACTCCACGTGAAGGCTGAGTAAAGAAGGATATGCCAGAAAGGAGAGTTGGGGCTGCCCTCCCTCAGGGAGCCTGCAGTGAGGGAGGGAAATAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,242,150 | 1 | GTGGCGCCATCTCGGCTCACTGCAAGCTCCGCCTCCGGGGTTCATGCCATTCTCCTGCCCCAGTCTCCCGAGTAGCTGGGACTACAGGCGCCCACCATCACGCCCAGCTAATTCTTTTTGTATTTTTAGCAGAGACAGGGTCTCACCATG | 120homo sapiens
|
G000009925 | ASM992v1 | GCF_000009925.1 | PRJNA58195 | SAMD00061068 | null | 2004/09/16 | Kitasato Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/925/GCF_000009925.1_ASM992v1 | 637,000,025 | RS_GCF_000009925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 295,405 | 817 | Bacteroides fragilis YCH46 | strain=YCH46 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides fragilis | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.9 | 1 | 5,310,990 | 2 | 43.2 | 5,277,274 | 1 | 4,416 | 1,603,639 | 88.979964 | 99.26 | 0 | 0 | 347 | yes | yes | yes | 20 | high | 449,150 | 0 | TCTGTTTAGAACTTTCTTTTCAGATGGAATAGAGGGCGTGTGTCGAAACTCACCACAGAGGACACTGAGTAACACAAAATGAGTTCTAAGTCATTGATTATCCATGTTGATAATCTGTGATAATCCGTGTAATCTGTGGTGAAAAGAGTT | 10Bacteroides fragilis YCH46
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 252,460 | 0 | CTGGGTAAGGCTTCAGGAACGGCTAATCAGCCATCTCGGGATAGATCGCTTGCTCGCCGTGGCAGGGGGCTCCCTGGGCGGTCAACAGGCCCTGGAGTGGGCGCTGGCCTACCCCGATCGCGTAGAATCAGCCATTATTATTGCTTCCGC | 73Pelotomaculum thermopropionicum SI
|
G000008725 | ASM872v1 | GCF_000008725.1 | PRJNA57637 | SAMN02603114 | null | 2001/01/09 | ChGP | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/725/GCF_000008725.1_ASM872v1 | 637,000,064 | RS_GCF_000008725.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,561 | 813 | Chlamydia trachomatis D/UW-3/CX | strain=D/UW-3/CX | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia trachomatis | true | Eubacteria | Chlamydiae | 1 | 1 | 0.9 | 1 | 1,042,519 | 1 | 41.31 | 1,042,519 | 1 | 897 | 318,650 | 90.069725 | 98.92 | 0 | 0 | 215 | yes | yes | yes | 20 | high | 885,430 | 0 | GTTAATGCTGCTGTTGCGATTTGATATCCCCCTTCTGGATGTAAGTCTATAATATGAAAGCGTGCATTTGAGGGAAGTGTTAGTGAGCCGCTATTCACTACCAGAGGAGGGAGATGATCGAGTTCTACATAATGATCATGTCCATGTAGA | 22Chlamydia trachomatis D/UW-3/CX
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 1,295,580 | 0 | AAGCGATGACCATTAAAAATGGCGTGCTTTCCTCGATACAATTAAATGAAGCTTGTTCTTCTGGGTGCGGTTCCTTTATCGAAACCTTTGCGCAATCTTTAAAATATAATGTGAAGGATTTTGCTTTGGCGGCTTTAGAATCGCAAGCGC | 37Enterococcus faecalis V583 ASM778v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,370,150 | 1 | AGGAAGTGGCAGTTACATTGCTCGGAGCCATCGAGCAGGGCAGAAGGGGGCTTCAAGCTGCCCCCAGCTAGAGCCTGACCACCTGCATCCGGGCCCCCAGTGAGTGTCAAATAAGGTCCTGGACCGCACGGCACCTGCCTCATGCTCGGG | 120homo sapiens
|
G000010145 | ASM1014v1 | GCF_000010145.1 | PRJNA224116 | SAMD00060917 | null | 2008/04/15 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/145/GCF_000010145.1_ASM1014v1 | 641,522,633 | RS_GCF_000010145.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,390 | 1,613 | Lactobacillus fermentum IFO 3956 | strain=IFO 3956 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Lactobacillaceae | Lactobacillus | Lactobacillus fermentum | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,098,685 | 1 | 51.47 | 2,098,685 | 1 | 2,094 | 609,422 | 85.544424 | 99.18 | 0.82 | 50 | 290 | yes | yes | yes | 20 | high | 1,644,110 | 0 | TCGCTAAGGAAATCGAACACCCAACCGGCACTAACCGCCTTTTCCAACGCCTCAGCGGGCTGGGAATTAAGGCTTCGATGCGGTCGGCCCTGATCGTGACCGGCGTCGTCTTAGTTGGGGCGTCCCTATACATTTTTGGTGGCATTTAAA | 52Lactobacillus fermentum IFO 3956
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,799,450 | 1 | CGCCCACTCTTTTGCTAGTGAAATTCTCTGGGAGTAGGTGCGGCCCCTCCCTGCCAGCAGGAGCCTGTGGCAACGGGGTGTCTAGGATGTCGAGGCAGCAGAGACCCTAGGGCCCTGCCCCGTGACAAAGGCCCCACGTGGGGACCTCTT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,427,300 | 1 | AATCCCAAGTGTGGGGTGAGGAATTCCACAGGACTCTCAGCCTGCTGGAGTTCCCAGGCGAGGCGTGCTGACTCGGGGCCAGGCCTGAGCCACTGCTCCCAGGGGACTCCGGAGGTGGCCAAGGAAGCCGGGCTCGAAGGCCCTTGAAGC | 120homo sapiens
|
G000006865 | ASM686v1 | GCF_000006865.1 | PRJNA57671 | SAMN02603339 | null | 2001/03/21 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/865/GCF_000006865.1_ASM686v1 | 637,000,144 | RS_GCF_000006865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,623 | 1,358 | Lactococcus lactis subsp. lactis Il1403 | strain=IL1403 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Lactococcus | Lactococcus lactis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,365,589 | 1 | 35.33 | 2,365,589 | 1 | 2,383 | 693,662 | 86.378488 | 100 | 0 | 0 | 310 | yes | yes | yes | 20 | high | 1,009,190 | 0 | ATGGGGCGGACTTGGGATTTGAAGCGATGATAATTGAAGACGCCTGTGCTGACAGAAAGTTAAAAAACTTCCAGAAAACAAAAACTGACGAAATACCAAAATTTGGGAAATTAATTAAAACAAAAGAAATTATCGAGGAACTGAATAAAA | 54Lactococcus lactis subsp. lactis Il1403 IL1403
|
G000007105 | ASM710v1 | GCF_000007105.1 | PRJNA224116 | SAMN02603579 | null | 2010/01/12 | Macrogen Inc. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/105/GCF_000007105.1_ASM710v1 | 637,000,356 | RS_GCF_000007105.1 | Monoisolate | Complete Genome | Full | na | Major | 264,203 | 542 | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 | strain=ZM4 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | Zymomonas | Zymomonas mobilis | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,056,363 | 1 | 46.33 | 2,056,363 | 1 | 1,753 | 604,103 | 86.562441 | 100 | 0 | 0 | 320 | yes | yes | yes | 20 | high | 1,002,950 | 0 | GATATCCTTTTTCTTTTGGCAATAGATTAAGGATATTGCCATAATCAAAAGTGGCTATTTCCGTAAAGGTAAAAGACGGGCGGGGTTGACCGCTTTCAAGCCATGCCTGATTTCAAAATGAAGTTGGGGGCGGGGGGTGTTGCCGCTTTC | 117Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 ZM4
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 2,400,060 | 0 | GCGATTATCGCGTAACAAACGCTCAGTTAAATGGTTCCCAATGAAGCCATTTACGCCCAAGATTAATACGCGTGTGCGCCTTTTCAATTTCTGACTTGGTTTATTGCCTAGACGGATACCAGTGACAATTCCCATCTCTTGTGCCAGGCG | 115Yersinia enterocolitica subsp. enterocolitica 8081
|
G000007865 | ASM786v1 | GCF_000007865.1 | PRJNA224116 | SAMN02604086 | null | 2004/01/30 | Univ. Minnesota | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/865/GCF_000007865.1_ASM786v1 | 637,000,168 | RS_GCF_000007865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,316 | 1,764 | Mycobacterium avium subsp. paratuberculosis K-10 | strain=K-10 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Mycobacteriaceae | Mycobacterium | Mycobacterium avium | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 4,829,781 | 1 | 69.3 | 4,829,781 | 1 | 4,544 | 1,497,326 | 91.345322 | 99.28 | 0.33 | 0 | 336 | yes | yes | yes | 20 | high | 1,346,800 | 0 | ACCAGTTCGTCGACGGTGCCGCGGTGCGGCGGGCCGGTGACCTGACCTACGCCGCGCTGGCGGCCGCCGGCGACATGGTGTCGATCACCACGGTCGACGAGGGCGCGGTCTGCACCGCGATGCTCGACCTCTACCAGAACGAGGGCATCA | 65Mycobacterium avium subsp. paratuberculosis K-10
|
G000007645 | ASM764v1 | GCF_000007645.1 | PRJNA57861 | SAMN02603126 | null | 2002/12/20 | Chinese National HGC, Shanghai | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/645/GCF_000007645.1_ASM764v1 | 637,000,281 | RS_GCF_000007645.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 176,280 | 1,282 | Staphylococcus epidermidis ATCC 12228 | strain=ATCC 12228 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus epidermidis | true | Eubacteria | Firmicutes | 1 | 0.977 | 0.9 | 1 | 2,564,615 | 7 | 32.05 | 2,499,279 | 1 | 2,354 | 721,937 | 82.93198 | 99.81 | 0 | 0 | 345 | yes | yes | yes | 20 | high | 808,600 | 0 | GCCACTTATCTTACCGTTATGGTATTTTGAGTGGCGTGTTTCTTTTTAATTGTTATAAATTTATAGAAAAATATATTATTTTAGACTTCTCGTCGTTCTTAACATTAGTAAAATAAAATAAGCAATCATTCCGAATAAGTAAGTGATAAA | 88Staphylococcus epidermidis ATCC 12228 ASM764v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,266,700 | 1 | AGGCGGAGCTGCAAAATGGTATGGCCATGCTTTTTAATCTTCCCCACCCAGGGAGGCCCTGGATCGAGCCATTGAGGAGTTCACCCTCTCCTGTGCTGGCTATTGTGTGGCCACATATGTGCTGGGCATTGGCGATCGGCACAGCGACAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,568,400 | 1 | ATATAAGAAGGCAGGAATGTCAGGCCTCTGAGCCCAAGCCAAGCCATCGCATCCCCTGTGACCTGCACATATACGCCCAGATGGCCTGAAGTAACTGAAGAATCACAAAAGAAGTGAATACGCCCTGCTCCACCTTAACTGATGACATTC | 120homo sapiens
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 4,810,520 | 0 | GCGTCATCAGGAATCCGCCGCCGACTCCGAACAGGCCCGACATGAACCCCACCCCGCCACCCAGGCCCAGGATAACGAAGACATTCACCGACATCTCGGCGATGGGAAGGTAGATCTGCATTCCTTCCGCCCCCTCTGCCCCATGCACTC | 56Magnetospirillum magneticum AMB-1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,275,850 | 1 | TCATGGGAAATCTCAAGAAGCCCCAGAGGCATTAACTGCCACTTGCTCTTTGTCACCTCCCTGCAAAGTTCCTTAGGCTCCAACTCAGGCTGAGGCAGCCAGGGAAAGGGGAGCACCCCCCACCCCAGCTCACCCCAAACACAACTTGTC | 120homo sapiens
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 2,070,900 | 0 | TGAAAACAATTTTCCATTTCTTCCATCCGATTAACAGTCCACGGCCGCAGCGGTTTGCCAATTGTGATAAGTTCTTTTTCATGAGCCAACACCCAAGACATTTTTGGATGTAAACTATCGACAAGCGCGAATGCCGGTCCCGCTTGACTT | 37Enterococcus faecalis V583 ASM778v1
|
G000008885 | ASM888v1 | GCF_000008885.1 | PRJNA224116 | SAMD00061100 | null | 2004/05/11 | Yale Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/885/GCF_000008885.1_ASM888v1 | 637,000,338 | RS_GCF_000008885.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 36,870 | 51,229 | Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Erwiniaceae | Wigglesworthia | Wigglesworthia glossinidia | true | Eubacteria | Proteobacteria | 0.99 | 0.986 | 1 | 1 | 703,004 | 2 | 22.48 | 697,724 | 1 | 646 | 209,912 | 87.974606 | 100 | 0 | 0 | 207 | yes | yes | yes | 20 | high | 7,540 | 0 | GAAGGAAATGATGTATTATTTTTTGTTGATAATATTTATAGATATACTTTAGCTGGAACAGAAGTATCTGCTCTTCTAGGAAGAATTCCTTCTGCAGTGGGTTATCAGCCTACTCTTTCTGAAGAAATGGGTATTTTACAAGAAAGAATT | 109Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,177,350 | 1 | CCATGAGTGTGGATGAGGGTCTCGGCTCAACTGGCCCCAGACGGTCTTTGTATTCAGCTGCCAAGTTGTTAGCTGGTGTCGGGAGCAGAGACTGCCCAGACCTAGGGGTGGGGAAAAGATCTCAACTCTTGCAACCGGTGTGGACTCTTC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,291,300 | 1 | TCCCAAGCAGAGGCGTCTGGTCCACTCCTGGGGCTCCACCTGCCTGTCACTGCAGCACCAGCGTGCACACGATGGAAACCCCACCGATGCCGCTCTCCTCCGCTTGGCCCCGCTGAGCCAGGGTGAGGTGCTGCCACTGCCTTCAGCCTA | 120homo sapiens
|
G000007305 | ASM730v1 | GCF_000007305.1 | PRJNA224116 | SAMN02604284 | null | 2002/02/27 | Utah Genome Center | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/305/GCF_000007305.1_ASM730v1 | 638,154,515 | RS_GCF_000007305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 186,497 | 2,261 | Pyrococcus furiosus DSM 3638 | strain=DSM 3638 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Pyrococcus | Pyrococcus furiosus | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 1,908,256 | 1 | 40.77 | 1,908,256 | 1 | 2,102 | 594,193 | 91.722127 | 99.5 | 0 | 0 | 195 | yes | yes | yes | 19 | high | 1,242,280 | 0 | TATGCTGTCAAGGGCAGAGGAAGGTTGAGGGTTTAGGTGTATGAGGTTGATAAGGAAACATTCGAGGAAATCAATCGCATGGAAGTAAATGCCGGCTACAAGCTAGTTGAAACGGATACAAAGTTCGGAAAGGCTATTCTTTGGGAGTGG | 80Pyrococcus furiosus DSM 3638
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,404,400 | 1 | GATCAGGGCCCGGGTCTAGACACACACACGGGTGGGAGGGTGCTAGGATCAGGGCCCGGGTCTAGACACACACACGGGTGGGCGGGTGCTAGGATCAGGGCCCGGGTCTAGACACACACACGGGTGGGCGGGTGCTAGGATCAGAGCCCG | 120homo sapiens
|
G000007485 | ASM748v1 | GCF_000007485.1 | PRJNA224116 | SAMN02603248 | null | 2003/02/24 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/485/GCF_000007485.1_ASM748v1 | 637,000,331 | RS_GCF_000007485.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 203,267 | 2,039 | Tropheryma whipplei str. Twist | strain=Twist | null | Bacteria | Actinobacteria | Actinobacteria | Micrococcales | null | Tropheryma | Tropheryma whipplei | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 927,303 | 1 | 46.33 | 927,303 | 1 | 934 | 278,179 | 88.37435 | 76.27 | 0 | 0 | 224 | yes | yes | yes | 20 | medium | 843,700 | 0 | GTTACCCCCCGGACTTTGAGCATACCGGCAATTTCGCGCGCCCATTGCCCGCCTCGGGTAATCCATACATGGTGGCAAGAGTGTCTCATTGTTTCAAGATTTCTCGTGCATTTTTTGACAAAAGTTCGTCAACAACGGTCTTTGCAAGAG | 106Tropheryma whipplei str. Twist
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,798,650 | 0 | TGCAACCGGCTTGGCGGGCTGGGTTGCAACAGGCTTGGGCGCAGGCGCAACCGACTGCACGGGCTGGGCAGGCGCAGGCGCCGGGCCAGCCGGCACACCTTGTGGCGGAGCGATGGTGGTCACGGTGGGTGGCGGGTTGCCAGGCTGCAG | 78Pseudomonas putida KT2440
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,189,290 | 0 | TTCACAATCTCCCCCAAAATATTTGTACTATAAAGTCACCTCAACCTCGCCCATCCAATAACGCCAAGCTACTAAATAATCTTCTAAATCTTTCGGGTGATGTCTTAAACACGTATCTATACGCAAATATAAGCCTATGACTATTTCTTC | 6Bacillus anthracis str. Sterne ASM816v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,987,950 | 1 | CCCCAGAGAGCTCAGGTGCCAGGACGTCAGCAGCCCTCAGACAGCAGAGCCAGGAGGGACACGGGGCAGTGGTGACGAAGCTGTTCAGGGCAACTCTGGGCATCCTCCTATTTTCAGAATAACAATCTTCCTGGTGTTCTTAGCAGCATG | 120homo sapiens
|
G000009725 | ASM972v1 | GCF_000009725.1 | PRJNA224116 | SAMD00061113 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/725/GCF_000009725.1_ASM972v1 | 2,514,885,032 | RS_GCF_000009725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 1,148 | 1,148 | Synechocystis sp. PCC 6803 | strain=PCC 6803 | null | Bacteria | Cyanobacteria | null | Synechococcales | Merismopediaceae | Synechocystis | Synechocystis sp. PCC 6803 | true | Eubacteria | Cyanobacteria | 1 | 0.99 | 0.9 | 1 | 3,947,019 | 5 | 47.37 | 3,573,470 | 1 | 3,713 | 1,164,101 | 86.890968 | 99.78 | 0 | 0 | 349 | yes | yes | yes | 20 | high | 105,040 | 0 | CATCAGGTTCAGATTTAATACCTACAAAGTCTGAGTTTGTTTTTAGATTAAGTTGCGAAAAGTTCCACATAATATGTAAATAAAACTATTCAATGAAAAGAAAACTTAGATTATTTTGATTGATAATTTATGAGATTCATTACAAAAGCT | 101Synechocystis sp. PCC 6803 ASM972v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,576,300 | 1 | CATCTTGTCCTGACTAAAGGTTCAGGAGGATAGATTTTCTCCCTTCGGTGAGAAGGAGGGTACTCCACAGACAAGGTTACACTTCAGCACAGTCTTAAATCAGGACTCTGCATTCTCTAGATGCAGGAGGGGATAAGGGAATTCCAGATG | 120homo sapiens
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 3,707,730 | 0 | CAACGTGGCAATGCGTGACACGCGCATTTCCTCTTGCTCGGTCGCCTTGCCTTTGCGCATCACGCAGGCATACAGGTCGTGGGACACCGCCGATGCGCCGGACAGCGCCAGGCCAGCGACCACAGCCAGAATGGTGGCGAAGGCCACGGC | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,653,650 | 1 | AGTGGAAGGCGTGGACACAGTGGGGGGCGGGGCTGCGGATGGAGGGCGGGGCTGCGGATGGAGGGCGGGCCGGGGACCTTACCACGCCGTCCTCCTCGCGCACCACGTACTGCGCCACCTTGAAGGAGCTCAGGTACTCGTTCATGTTCT | 120homo sapiens
|
G000009825 | ASM982v1 | GCF_000009825.1 | PRJNA224116 | SAMD00061074 | null | 2004/12/30 | Kao Corporation, Biological Science Laboratories, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/825/GCF_000009825.1_ASM982v1 | 637,000,019 | RS_GCF_000009825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 66,692 | 79,880 | Bacillus clausii KSM-K16 | strain=KSM-K16 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus clausii | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 4,303,871 | 1 | 44.75 | 4,303,871 | 1 | 4,304 | 1,270,194 | 86.940919 | 98.67 | 0.33 | 0 | 373 | yes | yes | yes | 20 | high | 3,991,000 | 0 | CAATTGTAGCCGGTTTAGTTTAAGTTGCTCAAAGGCAAACCGAAGTGCTAATTGGATTGCTTCTGTTCCGTACCCTTTATTTAAAACATGTTGATGATGCAAGGCAATTCTAAACCCGGCTTTTTGGTTGGTCTCGTCGATTTCTAAAAT | 8Bacillus clausii KSM-K16
|
G000010065 | ASM1006v1 | GCF_000010065.1 | PRJNA224116 | SAMD00061073 | null | 2004/12/16 | Nagoya University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/065/GCF_000010065.1_ASM1006v1 | 637,000,307 | RS_GCF_000010065.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 269,084 | 32,046 | Synechococcus elongatus PCC 6301 | strain=PCC 6301 | null | Bacteria | Cyanobacteria | null | Synechococcales | Synechococcaceae | Synechococcus | Synechococcus elongatus | true | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 2,696,255 | 1 | 55.48 | 2,696,255 | 1 | 2,691 | 815,460 | 89.10092 | 99.73 | 0 | 0 | 342 | yes | yes | yes | 20 | high | 298,870 | 0 | ACAGCAAGCGGGAACCAAGTATCAATGGGCATCGATTACGGCTGTGAAGAGTCTTTCGATACCCTACTCCACTCGTTATAACTAGCCGAAATAGCCAGAGATTGTTGTCAGCAAGGGCCACAATAGGGGGCACCGTGGCCTTTCTTGGCG | 100Synechococcus elongatus PCC 6301
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,235,400 | 1 | AGGGCAGAGTAGATTTACTTCATTCTTTTCTCTTTGAGACGGAGTCTCACTCTGTTACCCAGGCTGGAGGTGCAGTGGCGTGATCTCAGCTCACTGCAACCTCCGCTTCAGTTCAAGTAATTCTCCTGCTTCAGCCTCCTGAGCAGCTGG | 120homo sapiens
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 3,253,120 | 0 | TATCAAAATCCGTAACGATAAACACTGGCTCTGATGCATCAAGATTTTTCTTTAGAAATTTCTTGATGGTTTCTGGACTCTTATCTTTGAAAAGTTCATCTGCTATCGTTCTTTGAGCTTTTGCATCCAGTAAAGTTAAACGGTATTTCT | 61Methanosarcina acetivorans C2A
|
G000008465 | ASM846v1 | GCF_000008465.1 | PRJNA224116 | SAMN02604184 | null | 2004/12/02 | University of Hawaii at Manoa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/465/GCF_000008465.1_ASM846v1 | 637,000,136 | RS_GCF_000008465.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 283,942 | 135,577 | Idiomarina loihiensis L2TR | strain=L2TR | null | Bacteria | Proteobacteria | Gammaproteobacteria | Alteromonadales | Idiomarinaceae | Idiomarina | Idiomarina loihiensis | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,839,318 | 1 | 47.04 | 2,839,318 | 1 | 2,658 | 892,961 | 92.667007 | 100 | 0.17 | 0 | 344 | yes | yes | yes | 20 | high | 2,378,610 | 0 | AGCCACCTGAACCGGCAATTTCAGAACCGCACAACCCGTAAAAGGTATATTGCACAAGTTTGGGGCAAGCCACCCGCTCTGCAAGGAGAAATAGAGTTGCCGTTGTCCTGCGACTGGCCCAATCGCCCGCGCCAGCACATGGATTTTTTC | 50Idiomarina loihiensis L2TR
|
G000009745 | ASM974v1 | GCF_000009745.1 | PRJNA224116 | SAMD00061075 | null | 2003/10/03 | NHRI, Taiwan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/745/GCF_000009745.1_ASM974v1 | 637,000,337 | RS_GCF_000009745.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 196,600 | 672 | Vibrio vulnificus YJ016 | strain=YJ016 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio vulnificus | true | Eubacteria | Proteobacteria | 1 | 0.996 | 1 | 1 | 5,260,086 | 3 | 46.68 | 3,354,505 | 1 | 4,639 | 1,553,759 | 87.03525 | 100 | 0.14 | 0 | 369 | yes | yes | yes | 20 | high | 5,221,450 | 0 | GCCTTACTTTTTGGTAACTTGATTGCACAGCTCGCTTGTGTTCCAGAAGCCATGCTCACCTCGACGAACCTTGTCCTCCCTATCGATGCGCTCTTTTGGTGCTTGGGCTCACAAGGCAGTGCCTATCCCCTGACGGGCACAACAAACTAT | 108Vibrio vulnificus YJ016
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,403,000 | 1 | ATGCCTCCACCTCGCCCCTCGCCAAGATAACCCTCCTAAGCCCTGGAGCCCTGATAGTTACCTGATACTGTGAGGTCCACGCAGGGGTGATAATGTGCAGGATCCTGAGATGGGGGGATATCTGGACGACCCTGGAGGGCTCTAAATTCC | 120homo sapiens
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 237,900 | 0 | CAGCGTACTCGCCCTGCGCGTAGAAGCCCTCGCCCGCCTCACGGATGCTGGCAAAGACCGTGCCGGGTACCTGTTGCCGAATGGCTTCCGCCAGCGCCCGCTGCATTTCCGGCGCGAGATGACGCTCGAACAGCACCTCGCCGGTCGTCA | 35Deinococcus radiodurans R1 ASM856v1
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 1,386,450 | 0 | CTAGTTCCCCGTCTTTCAATAAAATCCACAATAGGCTTTAAAAGGTAGTAAAGTAAGGCTGAAATTACCAAAGGTAACATGATAACAGCTAAAAAAGAAAGAAGAGGTTTAAAAATAGAACTAATCTTGGTAAAAACAAGAATATCCAAA | 92Streptococcus mutans UA159
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,143,300 | 1 | TAAAAGGTCAGACTAGACCTTGGAATCTAGAAATCATTATTCGGAGTTTCTGAACAGATTAGGAGATGGGTATCATTCATTCATTCATTCATTCATTGCAACACATTTTGTGCAAGGCACAGGTTGAAGCAAAGCAGAGTTGGCGCCTGC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,226,800 | 1 | TCCCGGAGGCTCTGCCTGCAATTTCTGGACATCGGGTCCAGGGGAATGAAAGAGGGCATGAGACGCGTGCCTCTGAGGCTGGACCCACTTCAGAGGCAGAGCGTCCCCACGAAAGACTCGGGAACCGGAAAAAGCCCTAAGGACGTTCCC | 120homo sapiens
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 2,267,850 | 0 | GGCAGGAAGCACCGGTCTCGCATCACCCGCGCCCACGCTGCGGCGCCTCGCCGCCGGATTTCTGATCTTCGCCGCAGGCGCGCTCGCCGGCGCCTACGCACGCGATCTCATCGTCCCGCAATCGCAATTGGCCGCCGCGGCCTCCGAGGC | 86Sinorhizobium meliloti 1021
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,565,200 | 1 | TTCTAAAAAATAAATTGGAGGATATCTAGTGAATTTTTATGACAGAAAATACGATTGGTTGGCACGCAGGTTTTTATTAGATTATCCTCTATAGGTTTTGGAAAGCTTGAAGTCTTCCATAATCATCATCATCATCACTGAGAAATAGAG | 120homo sapiens
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 1,945,710 | 0 | AAAAAATCCCCGACTGGTTCGGGGATTTTTTTGCGTTGAATTCAGGCTGGCGGCTGGGGTGTCAGTCGAACCGATAGATGTCCATGCCCAGTGCGCCCATGGTAAAGCCCTGATAAGCGATGCTGAACGCACCGCCTGCGCCGCGTGCGA | 119[Pseudomonas syringae] pv. tomato str. DC3000
|
G000009745 | ASM974v1 | GCF_000009745.1 | PRJNA224116 | SAMD00061075 | null | 2003/10/03 | NHRI, Taiwan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/745/GCF_000009745.1_ASM974v1 | 637,000,337 | RS_GCF_000009745.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 196,600 | 672 | Vibrio vulnificus YJ016 | strain=YJ016 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio vulnificus | true | Eubacteria | Proteobacteria | 1 | 0.996 | 1 | 1 | 5,260,086 | 3 | 46.68 | 3,354,505 | 1 | 4,639 | 1,553,759 | 87.03525 | 100 | 0.14 | 0 | 369 | yes | yes | yes | 20 | high | 378,300 | 0 | GCTAGTTGTCTCAATGTCAGCCTTGCAACAGTCTCAGAGCTTGTCGCTCGCTTTAAGCAAAGTCAGATAGGCTGGCCTATCCCAGAAGGTTGCAGTGATACAGACCTTACCAAAGCCCTATATCATTCGAAGCAAGCCAGTCGAGACAAG | 108Vibrio vulnificus YJ016
|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 4,551,560 | 0 | AGGAAGCTTTCATCTTATTATTGGATTATGCATTTTTAGAATTAAATTTACATCGCCTTTCTTTACGAGTATTTTCTTTTAACGATAGAGCAATTAAATTATATAAATCGCTCGGTTTTCAACATGAAGGAACTTGTAAAGAAGCTATAT | 118[Bacillus thuringiensis] serovar konkukian str. 97-27
|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 5,200 | 0 | ATTAAATTGACGATTGAAGATAAACGTGAACATAAGCAAAAGAAAGAATTCCATTATGAAGGTGGAATTAAATCATATGTTGAGCATTTAAACCGTTCGAAACAACCAATCCATGAAGAGCCTGTATATGTAGAAGGATCAAAAGATGGT | 118[Bacillus thuringiensis] serovar konkukian str. 97-27
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,952,350 | 1 | ATTTCAAAAAGCTTTGCTTAAACTCATTAGGCCTGGGAAGACTATTAGAATATCCCCATCATGTAATCTCTGTTTTACAGCTCAGAGAGATCAGATAACTGCTCACCATAGAGAAGCTCCTCGAGAGACTAAGCCTGGATACAAATGTTG | 120homo sapiens
|
G000010185 | ASM1018v1 | GCF_000010185.1 | PRJNA224116 | SAMD00060918 | null | 2008/02/14 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/185/GCF_000010185.1_ASM1018v1 | 641,522,627 | RS_GCF_000010185.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,413 | 1,260 | Finegoldia magna ATCC 29328 | strain=ATCC 29328 | null | Bacteria | Firmicutes | Tissierellia | Tissierellales | Peptoniphilaceae | Finegoldia | Finegoldia magna | true | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 1,986,740 | 2 | 32.07 | 1,797,577 | 1 | 1,846 | 611,719 | 90.720879 | 99.39 | 0 | 0 | 282 | yes | yes | yes | 20 | high | 1,430,130 | 0 | CTACAGTTATATTTTGGTCCAATTCGTGTGCATTTTCATACAACCAGAATGTTTGTGGACTAAGTCCTGGCGCAACACGTGGAACAATCGTGCCTTTCTTTTCTTCAAGGAAGTATCTGCTCATTACTGGATCCACTGCTGCAGTTGTCC | 39Finegoldia magna ATCC 29328
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,652,850 | 1 | GCCAACATGGTGAAACCCCGTCTCTGCTAAAAATACAATAATTAGTTGGGCATGGTGGCATGTGCCTGTAATCCCAGCTATTACGGAGGCTTAGGCACGAGAATTGCTTGAACCCTGGAGGCGGAGGTTGCAGTGAGCCAAAATCGCACC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,210,400 | 1 | CCCCCAGGCGAGCATCTGAACTCATGGAGCAGCACCCACACCCCCAGGCGAGCATCTGACCGAACGGAGCAGCACCCACAACCCCAGGCGAGCATCTGACAGCATGAAACAGCACCCAGAACTCCAGGTGAGCATCTGACAGCCCGCAGT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,446,350 | 1 | AGGGATCACGCCACACCATTTACTGACTGCTACTCCTTGCGGTAAGCGGAGTAACTGCTGCCACCCCAGAGATACCCACGTCCTAACCCCAGAACCTATACATATGTTCAATGCCAAGGGACTAAGGTGCTCATCAGCTGACCCTGAGAT | 120homo sapiens
|
G000007025 | ASM702v1 | GCF_000007025.1 | PRJNA224116 | SAMN02603141 | null | 2002/11/25 | CNRS | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/025/GCF_000007025.1_ASM702v1 | 637,000,243 | RS_GCF_000007025.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 272,944 | 781 | Rickettsia conorii str. Malish 7 | strain=Malish 7 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Rickettsiaceae | Rickettsia | Rickettsia conorii | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,268,755 | 1 | 32.44 | 1,268,755 | 1 | 1,435 | 347,621 | 80.686027 | 99.46 | 0.33 | 0 | 218 | yes | yes | yes | 20 | high | 608,920 | 0 | GATTCCGGTTATCTTGAAATGCTTCAAGAAGAAAAAACCGAAGAAGCATTCGGTAGAATCGAAAATATTAACGAAATGCTTAGAGCTATTGCTGAATTTAACGATGTTCATGATTTTATCGAACATTCAAGCTTAGTTATGGAAAATGAA | 82Rickettsia conorii str. Malish 7
|
G000009025 | ASM902v1 | GCF_000009025.1 | PRJNA224116 | SAMEA3138187 | null | 2005/08/19 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/025/GCF_000009025.1_ASM902v1 | 637,000,090 | RS_GCF_000009025.1 | Monoisolate | Complete Genome | Full | na | Major | 255,470 | 61,435 | Dehalococcoides mccartyi CBDB1 | strain=CBDB1 | null | Bacteria | Chloroflexi | Dehalococcoidia | Dehalococcoidales | Dehalococcoidaceae | Dehalococcoides | Dehalococcoides mccartyi | true | Eubacteria | Chloroflexi | 0.97 | 1 | 1 | 1 | 1,395,502 | 1 | 47.03 | 1,395,502 | 1 | 1,437 | 426,285 | 89.985038 | 99.01 | 0 | 0 | 259 | yes | yes | yes | 20 | high | 977,340 | 0 | CAAAGACGGGGGTTCATCCCCACTACCTATAAAACGGTTTACCCTGTCCATCTGGTCTGCGGGTACATAGAGTTTGTCGCCGCCGGCATACTGGAGTATCAGGTATTCTTTATCCATGCCGTCACGGTTCATATGGCTGACCCCGCTGAA | 34Dehalococcoides mccartyi CBDB1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,247,100 | 1 | AACAGGGTCTCACTCTGTTGCCCGGGCTGGAGTGCAGCAGCATGATTGAAGCTCACTGTGGCCTCCACCTTCTGGGCTCACGTGATCCCCCCATCTCAGCCTCCAGAGTAGCTGGGACTACAGGCTCATGCCACCGTGCCCAGCTAATTT | 120homo sapiens
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 2,022,800 | 0 | CGCCTGTAGAGGGGTTCGCGCCGTGCCCAGTCGAGCCGCAAGCCGGGGTTGCCTGCGAGGTCCTGCAGATCCCGGGCCGTCTTACGTTCCAGGCCGTGCTGGATCTTCTGCAGCTGCTCGTCCAGGCGCTCGGGCTGCACGGACGGTTCC | 81Ralstonia solanacearum GMI1000
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 6,658,730 | 0 | TAGAACTTGTTCTCGTGCACGGCCATCAGGGACGCGTCCACATGCGCGACCCCCTCCGCGCCCAGCAGCCGCCCGCTCCACTCGGCGAGCAGCGCCGCCTTCTCCTCGTCCGGGACGGAGAAGGGGTCGACGTCGTACGCCGACACCCAG | 96Streptomyces griseus subsp. griseus NBRC 13350
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 4,673,110 | 0 | CAAAATTAATTTCCTAGTCGAGACAGGAGACTCCGAGACGGGAGACTCCGAGACGGGAGACGGGAGACAGCTATTAGGGATCGGATTTGAGTTTTCAGTTCACTGTTTCCTCACACCAGAAGTCTGACGGAGTAGTGGCTTAGATGTGTA | 64Microcystis aeruginosa NIES-843
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,082,200 | 1 | GGGCAGCATTGAAAGGCAGTGGGGAGGGCCGCTTCCTCTCCATTAATCAATGGTCCCAGTTTAGAAACAGTCGCCCTGAGCCAACGCCAAGGGCTAAACGGGCTCAGGACACCACCCAGTCCTAGCCACCCAACCTTCTCCAAGGCTCTG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,270,350 | 1 | GGTCAGCATATCTTGGGAGAGGCCTGATTTCTGAGCCATTCCTGCTCATTGCATCCCAGGGACCCCTTCATGCCAGCCCTCTGCTGTTTGCAGAGGATGAGAAAGAAGCTTGCATGCTCACCAATGTGTTCCCATTTCTGGGGAGTTGCC | 120homo sapiens
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 6,047,990 | 0 | CAAGGCGTCCAAGTGTTCCCAAAGGCTGTTCGAATCCGATTGGCGGATCGATACCGCATAAGCTGAGGAAGGACGTAAACGGATGGAGTGACCCGGGGAGACCCCGGGAAGCCGCCGGAGAGACATGCCGGAACTTGCGGCGACGTGGCA | 96Streptomyces griseus subsp. griseus NBRC 13350
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,346,450 | 1 | TTTGGGAGGCCGAGGTGGGTGAGTCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCAGGTGTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGA | 120homo sapiens
|
G000011025 | ASM1102v1 | GCF_000011025.1 | PRJNA224116 | SAMD00060968 | null | 2010/01/05 | Department of Bacteriology, Osaka Dental University | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/025/GCF_000011025.1_ASM1102v1 | 646,311,951 | RS_GCF_000011025.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 680,646 | 43,675 | Rothia mucilaginosa DY-18 | strain=DY-18 | null | Bacteria | Actinobacteria | Actinobacteria | Micrococcales | Micrococcaceae | Rothia | Rothia mucilaginosa | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,264,603 | 1 | 59.62 | 2,264,603 | 1 | 1,722 | 637,843 | 83.000906 | 99.33 | 0 | 0 | 293 | yes | yes | yes | 20 | high | 2,084,160 | 0 | TCAGCGAATCCCAGGGGGTCTCGACGAACTCGGCGGTCACGCCCAGGTCCTTGGCAATCAGGTCGGCGATTTCCTTCTCGAAGCCGACCAGGGTGCCGTTGGACTCGTGGAAGGAGAAGGGGCGGTAGGTACCCTCCAGGCCCACACGAA | 84Rothia mucilaginosa DY-18
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,803,450 | 1 | TAAGGGCAGTTACTAGGGATAAAGAAAGTAATTTCACAGTGATAAGGGATCAACTGATTAAACTACATAAAAATCCTAAATGTGTATGCCCCCAATAACAGAGCCCCAAAATACATGAACCAAAAATTGAAAGAAAGAAAAGCAGAACAT | 120homo sapiens
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 6,343,090 | 0 | GTAGTTATCAAATTCAGTATCTCTATAGTCGGCAGCAAACTCTTCTAGTTTGTATAAAGCCATGTTATTCTTCCTCCGAGAGCTATATTTACGATCCTAAAGACTTATCTTTCTACTTCTTCTTCCTGAAGGCTGAGATAATAGCAATCT | 70Nostoc sp. PCC 7120 ASM970v1
|
G000007945 | ASM794v1 | GCF_000007945.1 | PRJNA224116 | SAMN02604087 | null | 2003/07/23 | Univ. Ohio | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/945/GCF_000007945.1_ASM794v1 | 637,000,124 | RS_GCF_000007945.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 233,412 | 730 | Haemophilus ducreyi 35000HP | strain=35000HP | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pasteurellales | Pasteurellaceae | Haemophilus | [Haemophilus] ducreyi | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,698,955 | 1 | 38.22 | 1,698,955 | 1 | 1,689 | 506,660 | 87.856241 | 99.43 | 0.02 | 0 | 277 | yes | yes | yes | 20 | high | 717,600 | 0 | GATTTATTGAGGTGGATTATTTAGAAAGTTTGGCACGGGATTAACCCTAAAAGATGAGGCGTATAATACTGTAAATTATCGCTGATTGCAAATCATTTGCAAAAATAGACCACTTATCCTTATATAAGGATCGCAAAAAGCAAAATGTCA | 44Haemophilus ducreyi 35000HP
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,093,950 | 1 | ACTCTGAACCTTACTCAGAAACAGGGCAGGGAGAGCTCTTACGATGTGATTTTATTTTATTTATTCATGTATTTACTTTTGAGTCGGAGCCTTGCTCTGCCGCCCAGGTTGGAGTGCAGTGGCGTGGTCTTGGCTCACTGCAGCCTCCTC | 120homo sapiens
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 2,972,970 | 0 | GCCGCGGATCCATCGTCGTCTCTGCCAGCTGGTCCGCGTCCATCTCGCCCAGACCCTTGTACCGCTGGATCGAGTCCTTGTAGCGCACATTCTTGCGCTGCAACTCCAGCAGCGTCTCCCGCAGCTCCCGGTCCGAGTACGTGTAGACGT | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,901,800 | 1 | AAAATTTCCTTTGTGTTAACCAGGTTTCTGCAAGTGAAATTTTCTCTTTATGTTAAGTGAAAGCTTAGCCTGAAAACAGAAATGTGAAGAGGCTTTTTTAGACAAGTTCAAAACATTTGCCTCAGTTGAAAGAGTCAGTGTCATGAAACC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,906,800 | 1 | TAATCCCTAAAGGAGCCTGGCACTGTCAGCGGGCTCTGCTGCTAATCGTTAAATATCACCTCTGTGGTCTCTGAGTGCAGCAGGGAGAATGATGATCTGCTTGAAGGCACACGCAGAGAAGTGGAATTCTGAAATCTCAGCCTCCTACGT | 120homo sapiens
|
G000008925 | ASM892v1 | GCF_000008925.1 | PRJNA58233 | SAMN02604111 | null | 2006/03/30 | University College Cork | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/925/GCF_000008925.1_ASM892v1 | 637,000,143 | RS_GCF_000008925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 362,948 | 1,624 | Lactobacillus salivarius UCC118 | strain=UCC118 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Lactobacillaceae | Lactobacillus | Lactobacillus salivarius | true | Eubacteria | Firmicutes | 1 | 0.986 | 1 | 1 | 2,133,977 | 4 | 33.04 | 1,827,111 | 1 | 2,106 | 630,045 | 86.976336 | 99.48 | 0.52 | 0 | 292 | yes | yes | yes | 20 | high | 1,999,790 | 0 | ACCGATTGTTAGACCGGAATTCATCATTCCCATTGCCCAGTCGATCTTGGAATCCCTTTGTAAGTATCCACGACGATTCATATAAGCAGTTGTGTTCTTACTTAAATTATCTACACTAGCAAAGTGAATTCGACTTCCATCACCAGCAAT | 53Lactobacillus salivarius UCC118
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,440,700 | 1 | CACTTGTGATGTGCCTGGATCTGCTGGCCTCAGAGGTGCCTGGACAGGGACGCCCATCGCCGGCCCTCCCCAGCCCCTGCTCTGCTAGACCTCCAGATGCACCCAGGAAGAGCCGTCTGTGTCCTAAAAACTGTACGCAGGACTGGTACA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,429,200 | 1 | TATATTTTAGTGTGTCTCTGCCATAGGGGAAGATGTATATGACATGCTATTAAGTGAAAAATGCTGACTACGAAATTATTGATGGTATAAATGGAAGGATGGGTGTTTGTATTTGTGTGTGAATATATGTGAGTTATGCATGGCTGTATA | 120homo sapiens
|
G000008545 | ASM854v1 | GCF_000008545.1 | PRJNA57723 | SAMN02603986 | null | 2001/01/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/545/GCF_000008545.1_ASM854v1 | 637,000,321 | RS_GCF_000008545.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,274 | 2,336 | Thermotoga maritima MSB8 | strain=MSB8 | null | Bacteria | Thermotogae | Thermotogae | Thermotogales | Thermotogaceae | Thermotoga | Thermotoga maritima | true | Eubacteria | Bacteria | 1 | 1 | 0.9 | 1 | 1,860,725 | 1 | 46.25 | 1,860,725 | 1 | 1,866 | 602,696 | 95.430706 | 100 | 1.79 | 100 | 312 | yes | yes | yes | 20 | high | 189,150 | 0 | CCATCAACGCAAGTTGGTGGAGGAAAGGGGCGTTTGCCCCGCCGGAGGAGGGGCCCGCGGCCCATCAGGTAGTTGGTGGGGTAACGGCCCACCAAGCCGACGACGGGTAGCCGGCCTGAGAGGGTGGTCGGCCACAGGGGCACTGAGACA | 103Thermotoga maritima MSB8 ASM854v1
|
G000005825 | ASM582v2 | GCF_000005825.2 | PRJNA224116 | SAMN02603086 | null | 2010/12/15 | Center for Genomic Sciences, Allegheny-Singer Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/825/GCF_000005825.2_ASM582v2 | 646,311,908 | RS_GCF_000005825.2 | Monoisolate | Complete Genome | Full | representative genome | Major | 398,511 | 79,885 | Bacillus pseudofirmus OF4 | strain=OF4 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus pseudofirmus | true | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 4,249,248 | 3 | 39.86 | 3,858,997 | 1 | 4,260 | 1,228,222 | 85.144124 | 98.68 | 1.32 | 0 | 377 | yes | yes | yes | 20 | high | 3,042,390 | 0 | TGTTGGTTATGTTACATTTGTTTACCCTGACCCGATGGAACGTTGGTCAGAAGGAAAGATGGAAAATTTAATTGAACTTGGAGCTATTGAAATTGCTCCAAAATACCGTGGTGCACAAGTCGGAAAAAACCTGCTGCGCCTTTCTATGAT | 9Bacillus pseudofirmus OF4
|
G000008325 | ASM832v1 | GCF_000008325.1 | PRJNA224116 | SAMN02603968 | null | 2005/05/18 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/325/GCF_000008325.1_ASM832v1 | 637,000,166 | RS_GCF_000008325.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,233 | 414 | Methylococcus capsulatus str. Bath | strain=Bath | null | Bacteria | Proteobacteria | Gammaproteobacteria | Methylococcales | Methylococcaceae | Methylococcus | Methylococcus capsulatus | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,304,561 | 1 | 63.58 | 3,304,561 | 1 | 3,046 | 1,020,877 | 91.024466 | 99.2 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 1,487,590 | 0 | GGCCCTCATGACTCGAGCATCCGCCCGGCCTCCAGCCGGAGCAGGCGATCACAACGCGAAGCGAGACGGGCATCGTGCGTCACCAGGACCAGCGTGGTGCGATGCTCGCGGTTGAGGTCGAACAGCATATCGATGATGGTCTGGCTGGTA | 63Methylococcus capsulatus str. Bath
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 2,513,160 | 0 | AGTATTGAAACAGCTGGGCATTTTGATTTAGACGCTGAACTGAAAATTTGGGTATCTAGTTTGAGCACGCCAATTGCGAAAGAATTTAAAGGTGACGATAGTGTTTTAAGCATTCAAAAAGCGTTGGTAACATATACGACGAAATAGTTG | 6Bacillus anthracis str. Sterne ASM816v1
|