Datasets:

tsharish

/

pubmed-summarization-1k

like 0

[ { "content": "You are a medical writer. Summarize the following article: imatinib mesylate is a small molecule inhibitor of multiple tyrosine kinases and selectively prevents phosphorylation of bcr - abl and inhibits downstream signaling and growth of bcr - abl positive cells . \n it was first approved for the treatment of chronic myeloid leukemia ( cml ) in 2001 and for the treatment of gastrointestinal stromal tumor ( gist ) in 2003 . \n this revolutionized the treatment of cml with more than 90% patients remaining stable in the past 5 years . \n imatinib is associated with various adverse effects which include cardiovascular side effects such as edema , anasarca , pericardial , or pleural effusion and rarely cardiac failure . \n although pleural effusions have been reported with imatinib , it is a rare side effect . \n we present a case of imatinib - associated pleural effusion for its rarity and its potential to be overlooked by physicians . \n an 88-year - old man presented with a 2-week history of gradually progressive breathlessness and dry cough . \n his history was remarkable for hypertension and coronary artery bypass grafting done 8 years ago . \n he was diagnosed with gist 4 months ago when he presented with gastric discomfort and a computed tomography ( ct ) scan of the abdomen showed a 12 cm 11 cm 8.5 cm posterior mediastinal mass . \n a subsequent endoscopic ultrasound - guided biopsy showed tumor cells positive for c - kit and dog-1 . \n he was commenced on tablet imatinib 400 mg / day for his gist , but after 1 month of the treatment , he began to complain of breathlessness on exertion . \n there was no history of tuberculosis or tuberculosis contact . on examination , he was mildly tachycardic with a pulse rate of 90/min . \n he had no pallor , icterus , cyanosis , clubbing , lymphadenopathy , or pedal edema . \n his respiratory system examination revealed diminished breath sounds in the right infrascapular and infraaxillary area . \n his complete blood count , renal function tests , and liver function tests were all normal . \n his transthoracic two - dimensional echocardiogram showed normal left ventricular ( lv ) ejection fraction of 55% . \n a chest radiograph [ figure 1 ] showed a right pleural effusion and high - resolution ct chest [ figure 2 ] showed a large right - sided pleural effusion and unchanged posterior mediastinal mass with no consolidation or lymphadenopathy . \n chest x - ray showing a right - sided pleural effusion high - resolution computed tomography chest showing right - sided pleural effusion with no parenchymal abnormality he underwent a thoracentesis of the pleural fluid ; 1100 ml was aspirated . \n results of pleural fluid aspiration were : protein : 3.3 g / dl ( total serum protein : 5.4 g / dl ) ; lactate dehydrogenase ( ldh ) : 223 iu / l ( serum ldh : 280 \n iu / l ) ; white blood cell count : 1040/mm ( 50% lymphocytic ) ; adenosine deaminase ( ada ) : 4.1 ( normal : 040 \n pleural fluid aerobic and tuberculosis cultures and genexpert were all negative . he was diagnosed to have an exudative effusion with a low ada . \n an oncologist 's opinion was sought who ruled out metastasis as a cause of the effusion . in the absence of other causes of pleural effusion , a diagnosis of imatinib - induced pleural effusion \n imatinib was withdrawn ; the patient gradually improved and a repeat chest x - ray at 3 months poststoppage of drug showed complete resolution and no refilling of the fluid [ figure 3 ] . \n the patient declined any further treatment for his gist and was not put on any other medication . \n he remains under regular chest radiograph and sonography follow - up over 1 year and has no recurrence of his effusion . \n drug - related pleural disease is rare although many commonly used drugs are known to affect the pleura . \n imatinib - induced fluid retention is a common adverse effect and one of the important dose - limiting toxicities . \n specifically , fluid retention manifests as edema in periorbital regions , lower extremities , and/or body in approximately 80% patients which is usually mild and manageable . \n severe fluid retention resulting in generalized edema ( anasarca ) , ascites , pleural , or pericardial effusions is rare and seen in around 2% of gist patients and hence poorly studied . \n two distinct types or courses of pleural effusion are seen : ( 1 ) acute / progressive fluid formation that occurs early after drug initiation or dose escalation and ( 2 ) intermittent / steady fluid formation with mild , occasional , or persistent fluid formation . \n imatinib - induced pleural effusion appears to be dose dependent , with higher incidence in patients treated with 400 mg twice a day . \n the suggested mechanism is probably related to kinase inhibition : imatinib potently inhibits platelet - derived growth factor receptor - b which is expressed in pericytes and is involved in the regulation of angiogenesis . \n imatinib can also induce cardiotoxicity which can range from asymptomatic lv dysfunction to congestive heart failure . \n hence , it should be ruled out in any patient who presents with breathlessness on imatinib therapy . \n while pleural effusion due to imatinib therapy is rare , it is commonly seen in patients treated with dasatinib which is a potent oral second - line bcr / abl tyrosine kinase inhibitor . in a review of 915 chronic phase , \n cml patients previously treated with imatinib or dasatinib or both , 30% of patients treated with dasatinib had a history of pleural or pericardial effusions , whereas only 2% of patients treated with imatinib developed effusions . \n treatment of tyrosine kinases induced pleural effusion includes therapy interruption , drug dose reduction , steroids , and diuretics and only in a few severe instances , therapeutic thoracentesis . with adequate management and monitoring of patients with predisposing factors \n , the majority of them can continue therapy with the drug , even if this complication occurs . \n thus , in conclusion , any new pleural effusion should not be mistakenly interpreted as a sign of metastases or worsening tumor , especially when the primary malignancy is stable . \n for best patient care in the era of molecular - targeted therapeutic agents , a multidisciplinary approach with close collaboration between oncologists and radiologists is essential to assess treatment response as well as toxicity of tyrosine kinase inhibitors . \n \n ", "role": "user" }, { "content": "imatinib is a tyrosine kinase inhibitor and has rarely been reported to cause pleural effusion . \n we report the case of an 88-year - old male , known case of gastrointestinal stromal tumor on treatment with imatinib , who presented with a 2-week history of cough and dyspnea . \n he was diagnosed to have a right - sided pleural effusion and thoracentesis of the fluid revealed an exudate with low adenosine deaminase and negative cytology . \n withdrawal of the drug lead to resolution of symptoms . \n we report this case to highlight the side effect profile of imatinib and warn physicians regarding this potential adverse effect which may be mistaken for metastasis or infection .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: soft - tissue defects around the knees are common problems in the victims of trauma , post - operative wound or after arthroplasty and excision of various lesions , which is usually associated with bone and implant exposure . \n currently , various reconstructive options available are gastrocnemius flap , sural fasciocutaneous flap , and saphenous flap . \n these flaps are harvested from the leg , which is usually involved in traumatized lower limb . in this series , therefore , inferiorly based thigh flap has been used , including anteromedial thigh fasciocutaneous flap and anterolateral thigh ( alt ) fasciocutaneous flap in 16 patients having soft - tissue defects around the knee joint for the coverage . \n lu et al . first confirmed the presence of at least one supragenicular fasciocutaneous perforator within 3 cm above the adductor tubercle . \n this perforator arises from the saphenous branch of the descending genicular artery , which accompanies two venae comitantes . \n inferiorly based anteromedial thigh fasciocutaneus flap can be taken from anteromedial aspect of thigh , which survives on supragenicular fasciocutaneous perforator . in 1990 , \n hayashi and maruyama have reported the inferiorly based alt fasciocutaneous flap based on the perforators of the lateral superior genicular artery ( lsga ) for reconstruction of defects around the knee , popliteal region , lower third of the thigh , and upper one - third of the leg . due to variable pathway of its pedicle , this flap was not used widely at that time . since its description , \n it was found in these publications that this flap can be very useful for soft - tissue coverage around knee joints . to the best of our knowledge \n , no publications are found that focus on simultaneous use of both inferiorly based anteromedial and anterolateral thigh flap for the reconstruction of defects around the knee joint . \n this leads to a more versatile use of inferiorly based thigh flap . in this series \n , we present our clinical experience with the use of inferiorly based thigh fasciocutaneous flap for the reconstruction of defects around the knee joint in 16 patients . \n these flaps have been potentially useful and advantageous for the coverage of these difficult regions . \n the sites of the soft - tissue defects included patellar region , infrapatellar region , upper one - third of leg , lower thigh , and over the knee joint [ table 1 ] . \n the aetiology of the defects were trauma ( n = 10 ) , burn ( n = 2 ) , infections ( n = 2 ) , tumour excision ( n = 1 ) , and post - arthroplasty wound dehiscence ( n = 1 ) [ table 2 ] . pre \n distribution of wound aetiology of soft - tissue defect the largest size of the defect was 28 cm 10 cm , whereas the smallest size was 17 cm 8 cm . \n the inferiorly based anteromedial thigh fasciocutaneous flap [ figures 1 and 2 ] was performed on 12 patients and inferiorly based alt fasciocutaneous flap on four patients [ table 3 and figure 3 ] . \n the size of the flaps ranged from 32 cm 11 cm to 20 cm 9 cm depending on the size of the defect . \n ( a ) soft - tissue defect over the knee with exposed joint after debridement . ( b ) inferiorly based anteromedial fasciocutaneous flap with supragenicular perforators identified . ( c ) follow - up photograph ( a ) soft - tissue defect over infrapatellar region before debridement . ( b ) intra - operative photograph after inferiorly based anteromedial thigh fasciocutaneous flap was raised . \n ( c ) long term follow - up photograph types and sizes of flap used ( a ) unstable scar lateral part of right knee with involved leg . \n ( b ) soft - tissue defect after debridement and arc of rotation of the inferiorly based anterolateral thigh fasciocutaneous flap . \n ( c ) post - operative photograph showing well set flap and skin grafted donor site \n the saphenous artery originates from the descending genicular artery at 9.16 1.36 cm proximal to the adductor tubercle , and it travels distally towards the knee joint within the adductor canal . \n saphenous artery and its venae comitantes give off supragenicular fasciocutaneous perforator and its venae comitantes , which supply the inferiorly based anteromedial thigh flap . \n the saphenous artery with its venae comitantes penetrates the adductor aponeurotic plate into a space formed by the sartorius anteriorly and adductor magnus posteriorly at the distal part of the adductor canal . \n the saphenous artery travels distally into the subcutaneous tissue between the sartorius and gracilis . in this course , saphenous artery is accompanied by the saphenous nerve and gives off 2 - 5 direct fasciocutaneous perforators and 2 - 6 musculocutaneous perforators . \n at least one supragenicular fasciocutaneous perforator always arises from the saphenous artery within 3 cm proximal to the adductor tubercle and it accompanies two venae comitantes . \n supragenicular fasciocutaneous perforator passes through the anterior margin of sartorius in 90% of cases and in remaining cases , it passes through the posterior margin of the sartorius . \n the ascending branch anastomoses with subcutaneous branches arising from other perforators of the saphenous artery , thus , forms a subcutaneous vascular plexus to supply the skin overlying inferiorly based anteromedial thigh flap . \n it travels superolaterally and gives branches to the knee joint , vastus lateralis , and biceps femoris . \n then , it penetrates through the deep fascia proximal to the knee joint just above the lateral condyle of the femur and terminates as a skin perforator in this region . \n the cutaneous perforators of lsga penetrate through the deep fascia 5 cm proximal to the femoral condyle . \n the terminal branches of these perforators anastomose with musculocutaneous / septocutaneous perforators of the lateral circumflex femoral artery and perforator of profunda femoris and popliteal artery . \n the saphenous artery originates from the descending genicular artery at 9.16 1.36 cm proximal to the adductor tubercle , and it travels distally towards the knee joint within the adductor canal . \n saphenous artery and its venae comitantes give off supragenicular fasciocutaneous perforator and its venae comitantes , which supply the inferiorly based anteromedial thigh flap . \n the saphenous artery with its venae comitantes penetrates the adductor aponeurotic plate into a space formed by the sartorius anteriorly and adductor magnus posteriorly at the distal part of the adductor canal . \n the saphenous artery travels distally into the subcutaneous tissue between the sartorius and gracilis . in this course , saphenous artery is accompanied by the saphenous nerve and gives off 2 - 5 direct fasciocutaneous perforators and 2 - 6 musculocutaneous perforators . \n at least one supragenicular fasciocutaneous perforator always arises from the saphenous artery within 3 cm proximal to the adductor tubercle and it accompanies two venae comitantes . \n supragenicular fasciocutaneous perforator passes through the anterior margin of sartorius in 90% of cases and in remaining cases , it passes through the posterior margin of the sartorius . \n the ascending branch anastomoses with subcutaneous branches arising from other perforators of the saphenous artery , thus , forms a subcutaneous vascular plexus to supply the skin overlying inferiorly based anteromedial thigh flap . \n it travels superolaterally and gives branches to the knee joint , vastus lateralis , and biceps femoris . \n then , it penetrates through the deep fascia proximal to the knee joint just above the lateral condyle of the femur and terminates as a skin perforator in this region . \n the cutaneous perforators of lsga penetrate through the deep fascia 5 cm proximal to the femoral condyle . \n the terminal branches of these perforators anastomose with musculocutaneous / septocutaneous perforators of the lateral circumflex femoral artery and perforator of profunda femoris and popliteal artery . \n the axis of the flap is delineated by drawing a line between the medial femoral epicondyle and midpoint of the inguinal ligament on the anteromedial aspect of the thigh . \n supragenicular fasciocutaneous perforator arises from the saphenous artery within 3 cm above the adductor tubercle , which is the pivot point of the flap . \n pre - operatively , location of these perforators is confirmed using hand - held doppler , recipient site is prepared , and the size of the defect is measured . \n the size and location of the flaps were designed by following basic principle of the plastic surgery of planning in reverse . \n first of all , the lateral border of the flap was incised and dissection was performed in the subfascial plane towards the medial side . during this process , intermuscular septum between vastus medialis and sartorius was identified and incised . \n after visualisation of perforator , superior and medial borders of flap were incised and dissection continued proximodistally . \n first of all , a line was drawn on the anterolateral aspect of thigh between the anterior superior iliac spine and the lateral border of the patella . using hand - held doppler , \n again , similar to anteromedial thigh flap , by following the principle of planning in reverse , flap was designed . \n dissection was performed proximodistally in the subfascial plane and intermuscular septum between rectus femoris and the vastus lateralis muscle was incised . during the process of dissection , perforators were identified at the pre - operatively marked sites in the space between vastus lateralis and biceps femoris just proximal to the lateral condyle of femur . \n after identification of the perforators , flap was rotated about 5 cm above the patella and transferred at the recipient site . \n the axis of the flap is delineated by drawing a line between the medial femoral epicondyle and midpoint of the inguinal ligament on the anteromedial aspect of the thigh . \n supragenicular fasciocutaneous perforator arises from the saphenous artery within 3 cm above the adductor tubercle , which is the pivot point of the flap . \n pre - operatively , location of these perforators is confirmed using hand - held doppler , recipient site is prepared , and the size of the defect is measured . \n the size and location of the flaps were designed by following basic principle of the plastic surgery of planning in reverse . \n first of all , the lateral border of the flap was incised and dissection was performed in the subfascial plane towards the medial side . during this process , intermuscular septum between vastus medialis and sartorius was identified and incised . \n after visualisation of perforator , superior and medial borders of flap were incised and dissection continued proximodistally . \n first of all , a line was drawn on the anterolateral aspect of thigh between the anterior superior iliac spine and the lateral border of the patella . using hand - held doppler , \n again , similar to anteromedial thigh flap , by following the principle of planning in reverse , flap was designed . \n dissection was performed proximodistally in the subfascial plane and intermuscular septum between rectus femoris and the vastus lateralis muscle was incised . during the process of dissection , perforators were identified at the pre - operatively marked sites in the space between vastus lateralis and biceps femoris just proximal to the lateral condyle of femur . \n after identification of the perforators , flap was rotated about 5 cm above the patella and transferred at the recipient site . \n all the patients were evaluated post - operatively in terms of viability of flap , the matching of flap with the recipient site and donor site morbidity . all flaps survived completely except one \n in which distal flap loss was noted and three in which minor complications occurred , including mild venous congestion in two patients and wound dehiscence in one patient [ table 4 ] . \n one patient with alt flap with suture line dehiscence achieved healing by regular dressings and antibiotics . \n the donor site healed well without major complications in all patients except acceptable minimal scar line and donor site skin graft . \n skin colour and texture of the flap matching well with the recipient site was also observed . \n majority of the patients ( 38% ) were in the age group of 20 - 30 years and male : female ratio was 4:1 [ table 5 ] . \n the aim of coverage of soft - tissue defect around the knee joint is to provide aesthetically acceptable appearance and maintain the function of joint . \n the gastrocnemius flap is one of the good alternatives , but the low volume of the distal part of the muscle is a disadvantage , which is incapable of providing good coverage in large defect in suprapatellar region . the sural artery flap can also be used due to its thin and pliable nature , but its size is limited . \n free flap is one of the good options that provide good coverage in one stage , but its use is difficult as it requires expertise , long operating time , and deep location of recipient vessels in this region . local advancement or rotation flaps is useful only for very small defects around the knee joint . \n used skin islands from the distal anteromedial aspect of the thighs of six patients as local perforator flaps in order to reconstruct the peripatellar region and upper leg soft - tissue defects . \n they concluded that the propeller distal anteromedial thigh perforator flap can reliably be transferred based on the only one adequate perforator vessel , but the disadvantage is that it becomes a microsurgical technique where the dissection of the pedicle is performed by using binocular magnifying glasses . \n since thigh is usually spared in the traumatised limb , and due to pliable and relatively lax skin , it is convenient to harvest flap from this region . depending upon the location of the defect around the knee joint \n performed their study on cadavers and confirmed the presence of supragenicular fasciocutaneous perforator within 3 cm above the adductor tubercle . \n they performed their study on 11 patients with skin defects over the popliteal fossa , proximal 1/3 leg , and amputation stump below knee . using distally based anteromedial thigh flaps , they successfully covered these defects and showed acceptable functional and cosmetic results in terms of movement at the knee joint and matching of skin paddle with the recipient site respectively . \n chou et al . described the distally based anteromedial thigh fasciocutaneous island flap for patellar soft - tissue reconstruction in seven patients . \n these island flaps were based on cutaneous feeders vessels and perforator vessels in the muscle septum and deep fascia of the saphenous artery . in their series , all flaps survived uneventfully with only one having venous congestion . in our series , we performed inferiorly based anteromedial thigh flap on 12 patients with a size ranging from 32 cm 11 cm to 24 cm 8 cm ( length to width ratio 2.9:1 - 3:1 ) . \n all the flaps survived well except two , out of which , one developed mild venous congestion , which subsided after removing compressive dressings , whereas other developed distal flap marginal necrosis which , required debridement and skin grafting . \n venous congestion is one of the common complications in distally based flaps . in the chou et al . \n study , only one patients developed venous congestion which , subsided after removal of single stitch and compressive dressing . \n lin et al . found that venous drainage is not liable to danger in distally based flap despite the presence of valves . \n compression of pedicle , infection , and poor general condition of the patient could be one of the reasons . \n performed an anatomical and histomorphometrical study of the lateral genicular artery flap in 18 fresh cadavers and clinical results of knee reconstruction were demonstrated in four patients . \n they identified cutaneous perforator of the lsga in all specimens at a mean distance up to the lateral condyle of the femur of 7.40 2.77 cm and thus , they confirmed the constant location of the vascular pedicle . it was concluded that inferiorly based thigh fasciocutaneous flap on the perforators of lsga is a useful option in the reconstruction of the defects around the knee joint . \n performed inferiorly based thigh flap on 15 patients on the perforators of lsga for the reconstruction of defects around the knee joint . \n they had excellent outcome in all cases except one in which distal marginal flap necrosis was noticed that healed by debridement and dressings . \n the inferiorly based thigh perforator flap ( lsgap flap ) is closer than the distally based reverse flow alt flap to the knee or popliteal region , making it more versatile for coverage of defects of these regions . in our series \n , all the alt flap survived well except one in which suture line dehiscence was observed that achieved healing by regular dressings and antibiotics . \n thin tissue , adequate length of vascular pedicle with flexible arc of rotation , early ambulation , cosmetically acceptable appearance and minimal donor site morbidity makes the inferiorly based alt flap , one of the good alternatives for soft - tissue reconstruction around the knee joint . \n this helped in narrowing the base and increasing the length to breadth ratio of the flap . narrowing the base also helped in increased rotation of the flap , and to some extent reducing the dog ear . regarding the donor site closure , various authors suggest closure in case the size is < 8 cm . \n donor defect more than 8 cm has to be skin grafted . in our series , a donor defect of up to 9 cm was primarily closed , which depends upon laxity of the skin . since \n anteromedial thigh skin is more lax as compared with anterolateral thigh , donor site closure in former one was comparatively easier than the later . \n one of the advantages of this flap , especially in the indian scenario , is that the donor site is hidden as compared with the donor sites of the proximally based sural or the gastrocnemius flaps , where the donor site is on the calf , and more prone to visibility as compared to the donor site on the thigh . \n the inferiorly based thigh flap is a reliable flap to cover the defect over proximal one - third of the leg , patellar region , knee , and lower thigh . \n the main advantages of this flap are its ability to cover a large area with a hidden donor site .", "role": "user" }, { "content": "background : soft - tissue defects around the knees are common in injured limbs and in the same injury the leg is often involved and the thigh is spared . furthermore due to pliable and relatively lax skin , we have used inferiorly based thigh flap to reconstruct defects around knee joint.aims and objectives : the aim of this study is to evaluate the use of inferiorly based thigh flap to cover soft - tissue defects over the proximal one - third of the leg , patellar region , knee , and lower thigh.materials and methods : this study was conducted during the period between october 2011 and february 2013 . \n inferiorly based anteromedial thigh fasciocutaneous flap was performed on 12 patients and inferiorly based anterolateral thigh fasciocutaneous flap on four patients . \n the sites of the soft - tissue defects included patellar regions , infrapatellar region , upper one - third of leg , lower thigh , and over the knee joint.results:patients were evaluated post - operatively in terms of viability of flap , the matching of the flap with the recipient site , and donor site morbidity . \n all the flaps survived well except one which developed distal marginal flap loss , one in which wound dehiscence was noticed , and two in which mild venous congestion was observed . \n venous congestion in two patients subsided on its own within 3 days . \n one patient with wound dehiscence achieved complete healing by secondary intention . \n patient who developed distal flap loss required debridement and skin grafting . \n no appreciable donor site morbidity was encountered . \n skin colour and texture of the flap matched well with the recipient site.conclusions:the inferiorly based thigh flap is a reliable flap to cover the defect over proximal one - third of the leg , patellar region , knee , and lower thigh .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: gout is a disease characterized by joint and kidney inflammation caused by high levels of uric acid in the bloodstream and tissues . \n uric acid is water soluble and is normally eliminated by the kidneys in quantities between 600 and 700 mg / day when the organism receives a normal diet . \n plasma concentrations of uric acid higher than 6 mg / dl and 7 mg / dl in women and men , respectively , cause hyperuricemia . \n this medical condition may be caused by a diet rich in proteins , fat , and alcohol as well as hereditary factors ( inborn errors of purine - pyrimidine metabolism ) . \n there are other diseases associated to hyperuricemia such as type 2 diabetes which , in the presence of higher levels of uric acid , causes insulin absorption resistance in tissues , increase of nephropathy progression , and tumor lysis syndrome ( tls ) [ 24 ] . \n urate oxidase ( uricase , ec 1.7.3.4 ) is an enzyme with copper bonds that catalyze the oxidative opening of the purine ring of uric acid to form allantoin which is 510 times more soluble than uric acid [ 5 , 6 ] . \n rasburicase ( fasturtec / elitek ) is a market name given to the aspergillus flavus urate oxidase expressed in saccharomyces cerevisiae which has been approved for clinical use . \n studies showed that rasburicase is more effective than other drugs in the treatment of hyperuricemia due to low incidence of hypersensibility reaction [ 7 , 8 ] . \n urate oxidase is also used as a reagent in clinical diagnostic kits for enzymatic determination of uric acid . \n native enzyme may be obtained from several microorganisms of the genus micrococcus , brevibacterium , streptomyces , candida , bacillus , pseudomonas , arthrobacter , and aspergillus [ 915 ] . \n urate oxidase from thermophilic bacillus sp . tb-90 has been extensively studied for diagnostic purposes since it exhibits high activity and thermostability in a wide range of phs . \n purified recombinant bacillus subtilis urate oxidase has been tested with success in a biochip system for diagnostic purposes . in this case , the puclm gene was cloned in - frame with the maltose - binding protein ( mpb ) coding sequence resulting in a large protein fusion ( ~98 kda ) which was not significantly overexpressed in escherichia coli . \n this result prompted us to employ a different approach to improve the expression of b. subtilis urate oxidase in e. coli by using a smaller 6x his tag which would also enable simple and fast purification of the recombinant enzyme for further biochemical characterization and large - scale production . \n bacillus subtilis subtilis \n\t\t\t\t\t lmd 69.3 was used as a source of the urate oxidase gene . for heterologous expression , e. coli bl21 ( de3 ) plyss and the expression vector pet21a ( novagen ) \n ni sepharose 6 fast flow ( ge healthcare ) resin was used to purify recombinant urate oxidase . \n plasmid extraction was performed by the use of qiaprep spin mini kit ( qiagen ) . \n b. subtilis chromosomal dna was extracted as described elsewhere . the urate oxidase coding sequence ( 1485 pb ) was obtained by pcr using primers pucl5 ( 5-cggatccatgttcacaatggatgacctg -3 ) and pucl3 ( 5-gctcgagggctttcaggctccgacat-3 ) which were designed based on the b. subtilis puclm gene sequence ( genebank gi : 32468813 ) . \n primer pucl5 contained a bamhi site ( underlined ) and the translation initiation codon ( bold ) , whereas pucl3 incorporated an engineered xhoi site ( underlined ) . \n amplification was performed using the following conditions : 30 cycles of 1 minute at 94c , 45 seconds at 50c , and 1.5 minutes at 72c . \n the sequence of the cloned gene was verified by automated dna sequencing on the genetic analyzer mega bace 1000 ( ge healthcare ) using the mega bace dye terminator kit . \n plasmid pgemuri was digested with bamhi and xhoi and the puclm gene was ligated into pet21a digested with the same enzymes . because primer pucl3 lacks a stop codon , \n the urate oxidase gene was cloned in - frame with the 6x his tag coding sequence present in pet21a . \n the resulting plasmid , peturi , was used to transform e. coli bl21 ( de3 ) plyss . a single e. coli colony transformed with peturi \n was inoculated in 6 ml luria - bertolin ( lb ) medium containing 100 g / ml ampicillin and incubated at 37c with shaking ( 200300 rpm ) overnight . \n five milliliters of this preculture were transferred to 50 ml of lb medium in a 250 ml shake flask . \n the culture was grown under the same condition until od600 reached 0.6 when iptg was added to a final concentration of 1 mm . \n one milliliter samples were collected at different intervals and cell pellet was resuspended in 50 l of sds - page sample buffer and boiled for 5 minutes prior to gel electrophoresis analysis . \n protein samples were separated on 12% sds - page gels and electroblotted onto pvdf membrane . \n the membrane was blocked with 5% milk in 10 mm tris - hcl with 150 mm nacl ( ph 8.0 ) and 0.1% tween 20 ( tbst ) for 2 hours at room temperature . \n the membrane was then incubated for 2 hours at room temperature with monoclonal mouse antipoly histidine ap antibody diluted 1 : 1000 in tbst . after three washes with tbst , bands were visualized by using the nbt / bcip detection method . in order to purify and analyze the recombinant protein , \n one bacterial clone was induced with 1 mm iptg in 100 ml lb during 3 hours . \n the cells were harvested by centrifugation at 5000 rpm for 20 minutes at 4c . \n cell pellet ( 1.5 g ) was resuspended in 2 ml lysis buffer ( 10 mm imidazole , 50 mm nah2po4 [ ph 8.0 ] , 300 mm nacl ) and lysed by sonication ( 6 cycles of 10 seconds of pulses at 45% amplitude59w ) . \n the suspension was centrifuged at 13000 rpm for 10 minutes and the supernatant loaded into an ni - nta column with a volume of 1 ml resin preequilibrated in lysis buffer . \n the column was washed 8 times with 1 ml wash buffer ( 20 mm imidazole , 50 mm nah2po4 [ ph 8.0 ] , 300 mm nacl ) and 4 times with 500 l elution buffer ( 200 mm imidazole , 50 mm nah2po4 [ ph 8.0 ] , 300 mm nacl ) . \n molecular mass determinations were performed on an ultraflex ii spectrometer ( bruker daltonics ) using lyophilized sample dissolved in milli - q water and mixed separately with two different saturated matrices solutions , -cyano-4-hydroxycinnanic acid , and 3,5-dimethoxy-4-hydroxycinnamic acid ( sinapinic acid ) . \n hydrogen peroxide reacts with 4-aminoantipyrine and 3,5-dichloro-2-hydroxybenzenesulfonic acid and forms quinoneimine , a red compound that is detected by an increase in absorbance at 555 nm . \n the enzymatic reaction was carried out at 37c and contained 200 l uric acid solution ( 10 mg in 100 ml of 10 mm tris - hcl , ph 8.0 ) , 50 l distilled water , and 50 l enzyme samples . \n after 15-minute reaction , the reagent solution ( 4 mm 4-aminoantipyrine , 2 mm 3,5-dichloro-2-hydroxybenzenesulfonic acid , 2 mm horseradish peroxidase , and 10 mm tris - hcl buffer ) was added , incubated at room temperature for 5 minutes , and measured at 555 nm . \n one unit of urate oxidase activity was defined as the amount of enzyme that catalyzes the transformation of 1 mol of urate per minute at 37c ( ph 8.0 ) . \n urate oxidase activity was calculated using the math formula found at the kikkoman biochemicals website \n\t\t\t\t\t\t\t ( http://www.kikkoman.co.jp/bio/e/common/rinsyou.html ) . \n enzyme activity as a function of ph was tested with 50 mm sodium citrate for the followings values of ph : 2.5 , 3.0 , 4.5 , 5.0 ; 50 mm sodium phosphate for ph values 6.0 and 7.0 ; 50 mm tris - hcl for ph values 8.0 , 9.0 and 10.0 . \n the optimum temperature was evaluated by measuring urate oxidase activity for 30 minutes at different temperatures : 25 , 37 , 40 , 60 , and 80c . \n the effect of temperature on enzyme stability was determined by measuring the residual activity after 0 , 12 , 24 , 48 and 72 hours of preincubation in 10 mm tris - hcl ( ph 8.0 ) at 20 , 4 and 37c . \n a ~1.5 kb amplicon corresponding to the b. subtilis puclm gene was successfully cloned , sequenced and transferred to the bacterial expression vector pet21a ( data not shown ) . in order to analyze the kinetics of urate oxidase expression , a colony of e. coli cells harbouring peturi \n was grown to mid - log and induced with iptg for 0 , 15 , 30 , 60 , 90 , and 120 minutes . \n samples analyzed by sds - page revealed a ~60 kda induction band ( figure 1(a ) ) . \n the size of this band was consistent with the predicted mass of the recombinant enzyme . \n western blot analysis showed that the induction band represented a protein which contained a 6x his tag ( figure 1(b ) ) . \n two smaller ( < 50 kda ) and less abundant bands were also observed in the western blot ( figure 1(b ) ) . \n induction profile showed a progressive accumulation of the enzyme starting 15 minutes after addition of iptg and reaching the highest peak 90 minutes later . \n after induction in 100 ml , the cleared cell lysate was chromatographed in a ni - nta resin column in order to purify recombinant urate oxidase in a single - step . \n fractions collected in different steps of purification were analyzed by sds - page ( figure 2 ) . in order to optimize the purification procedure of the enzyme different elution buffers containing increasing concentrations of imidazole ( 50 , 100 , 150 , 200 mm ) \n after elution with 200 mm imidazole , a predominant band with an apparent molecular mass of ~60 kda was observed ( figure 2 , lane 6 ) . \n the data presented in table 1 shows that the enzyme was purified with a 2.1 fold increase in specific activity with a yield of ~58% as compared to the crude extract . \n maldi - tof / ms analysis of the purified enzyme fraction revealed two major ions m+h = 58675 da and its double charged m+2h = 29338.1 da ( figure 3 ) . \n the effects of ph and temperature on enzyme activity are shown in figures 4(a ) and 4(b ) , respectively . \n purified urate oxidase showed maximum activity at ph 8.0 and 37c ( figure 4(b ) ) . \n as shown in figure 5 , the residual activity was practically constant at 20c and 4c after a 72 hours incubation period but was significantly affected by incubation at 37c . \n urate oxidase is a enzyme conserved in many species ranging from microorganisms to mammals ; however , primates have lost this activity as consequence of evolutionary gene mutations [ 20 , 21 ] . \n this enzyme catalyzes the oxidative reaction that converts urate to allantoin , a more soluble and easily excreted compound . due to this property urate oxidase \n many sources of urate oxidase are available , but commercial production may be hampered by low productivity and difficulties in protein purification for clinical applications [ 22 , 23 ] . \n dna technology has been employed to overcome these difficulties by expressing urate oxidase genes in heterologous systems . in b. \n subtilis the genes for purine degradation are clustered at positions 284 to 285 in the genome map [ 25 , 26 ] . \n mutational analysis of this region showed that inactivation of puclm resulted in a defect in the utilization of guanosine , hypoxanthine , and uric acid and was thus proposed to code for urate oxidase . \n although the protein coded from the pulm gene shows amino acid identity to other urate oxidases , this similarity is restricted to the c - terminal domain ( amino acids 171494 ) with the highest identities being with bacillus sp . tb-90 ( 66% ) , bacillus clausii ( 63% ) , and bacillus fastidiosus ( 55% ) . \n it has been proposed that the first 170 amino acids correspond to a peroxide reductase domain that could be involved in the removal of hydrogen peroxide , a product of the oxidation of uric acid to allantoin catalyzed by urate oxidase . unlike eukaryotic urate oxidases and similar to bacillus sp . \n tb-90 , the b. subtilis enzyme does not have the typical type 2 copper binding motif h - x - h - x - f . \n in this work , the puclm was successfully expressed in e. coli in a soluble and active form . \n this result is particular important for the commercial production of this enzyme since it eliminates the laborious denaturing / refolding steps often necessary to solubilize proteins present as inclusion bodies . furthermore , the strategy used in this work involved the fusion of b. subtilis urate oxidase to a 6x his tag in order to allow simple one - step purification using ni - nta column . a derivation of this method using ni \n ion - chelating magnetic beads to increase yield was reported for the purification of recombinant bacillus sp . \n the results presented in table 1 show that the recombinant enzyme was purified almost to homogeneity and the yield was about 58% as compared to the crude extract . \n this yield was close to that reported for commercial rasburicase ( 61% ) and native b. subtilis urate oxidase ( 67% ) [ 28 , 29 ] . \n the smaller protein contaminants that copurified with the recombinant enzyme represent minor breakdown products because they were recognized by the antipoly histidine antibody ( figure 1(b ) ) . \n the recombinant enzyme was submitted to biochemical characterization ( molecular mass determination , thermostability , optimum temperature and ph ) and in vitro enzymatic activity . \n the experimental molecular mass value of 58675 da obtained by maldi - tof / ms for the recombinant enzyme is close to the theoretical values calculated for the predicted recombinant protein ( 58.9 kda ) . \n the optimum temperature ( 37c ) and ph ( 8.0 ) were similar to that observed with a. flavus urate oxidase produced in e. coli and the b. subtilis mpb - uricase fusion protein . in enzymatic assays \n the b. subtilis urate oxidase exhibited a specific activity of 39 iu / mg protein , a value higher than those observed for other urate oxidase described in the literature under optimal conditions . \n for example , native b. subtilis urate oxidase specific activity was 5.29 iu / mg protein , the specific activity for the a. flavus urate oxidase expressed in e. coli was 26.96 iu / mg and the commercial rasburicase was 26.98 iu / mg protein . \n the stability of the recombinant enzyme at the temperatures used to store commercial enzymatic diagnostic kits ( 20c and 4c ) was evaluated and the enzyme kept 80% of its residual activity after 72 hours of pre - incubation . however , at 37c , 50% of the residual activity was lost after 12 hours which is in agreement with the rasburicase half life of 19 hours reported in humans [ 30 , 31 ] . \n it has been proposed that the human body temperature is responsible for the shorter circulating half - time exhibited by recombinant urate oxidase [ 30 , 31 ] . \n the results presented in this work showed the feasibility of producing soluble recombinant urate oxidase at high levels . \n the purity of the enzyme together with its high activity and thermostability shows that the production of the b. subtilis urate oxidase in e. coli should be considered for the development of diagnostic kits and for clinical purposes .", "role": "user" }, { "content": "urate oxidase ( ec 1.7.3.3 ) is an enzyme involved in purine metabolism which is used in the treatment of gout and as diagnostic reagent for detection of uric acid . in order to produce this enzyme in large quantities for biotechnological purposes , \n the gene coding for the bacillus subtilis urate oxidase was cloned and heterologously expressed in escherichia coli . \n time course induction in e. coli showed an induced protein with an apparent molecular mass of 60 kda . \n soluble recombinant enzyme was purified in a single - step procedure using ni - nta column . \n the enzyme was purified 2.1-fold with a yield of 56% compared to the crude extract . \n maldi - tof analysis revealed an ion with a mass of 58675 da which is in agreement with the expected mass of the recombinant protein . \n the purified enzyme showed an optimal ph and temperature of 8.0 and 37c , respectively , and retained 90% of its activity after 72 hours of incubation at 20c and 4c .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: with rapid economic development and industrialization , the construction industry continues to rank among the most hazardous industries in the world ( 1 ) . within the construction industry , \n the risk of a fatality is five times more than in manufacturing , whilst the risk of a major injury is two and a half times higher ( 2 ) . \n construction safety is always a significant concern for both practitioners and researchers ( 3 ) . \n one reason may be that the project management does not know how to evaluate the safety performance of a construction project . it is imperative that in order to effectively manage the safety management system , a composite performance evaluation system consisting of measurable and achievable indicators in many facets of safety management is required ( 4 ) . according to previous studies ( 57 ) , safety performance indicators can be divided into two types : passive indicators and active indicators . \n passive indicators refer to both before - the - accident and after - the - accident indicators . before - the - accident indictors include unsafe behaviors and unsafe conditions . \n after - the - accident indicators refer to historical parameters such as near - miss rate , accident rate , and number of lost days . \n there are some limitations and shortcomings of passive performance measurements when used in occupational safety and health management , such as insufficient descriptive data about injuries ( 5 ) . \n active safety performance involves implementing proactive practices ranging from safety inspections and safety trainings , to implementation of effective safety supervision and management . \n in addition , review of the construction safety performance literature introduces many different constructs compromising a variety of the contributing factors that affect the construction safety performance . among these , for example , previous studies focused on safety climate and its dimensions ( 812 ) . while the safety climate - safety performance relationship is well documented ( 1315 ) , the mechanism of this relationship is not clearly understood , especially in construction projects . \n 2008 ) stated that although many studies reported that the higher the score of a safety climate , the better the safety performance , there has not been much discussion about the causality of safety climates ( 16 ) . today \n , further research is necessary to develop new applied theories , and make stronger recommendations ( 1 ) . \n in addition , more work is needed to integrate different safety constructs and contributing components in a holistic framework . only through such integrated framework \n considering all these components , the goal of this study was the structural modeling of components affecting safety performance on construction projects . \n we conducted a questionnaire study based on a previous extracted structure ( 17 ) . in total , 230 participants with a mean age of 48.4 years ( sd=9.5 ) took part in the survey . \n the participants were a random sample from different jobs , work sites , and projects in different geographical and cultural areas in iran . \n as shown in table 1 , the observed variables were interpreted according to the findings of our previous qualitative research ( 17 ) , as follows : ( a ) general safety climate ( scfs ) ; ( b ) individual features ( ifs ) ; ( c ) and general safety performance ( sps ) . in this study , we suggested the following hypotheses to represent the relations between these components : descriptions of the latent and observed components adopted from khosravi et al . \n the ifs have a significant effect on the sps . these hypotheses in the form of the proposed structural model represent relations between latent variables , as illustrated in fig \n . 1 . proposed structural model structural equation modeling ( sem ) is a comprehensive statistical approach to testing hypotheses about relations between observed and latent variables . \n the sem is more flexible and comprehensive than any other approaches ( such as correlation , multiple regression , and anova ) , providing means of controlling not only for extraneous or confounding variables but for measurement errors as well ( 18 ) . \n we followed a two - stage sem according to anderson and gerbing ( 1988 ) to test the hypotheses ( 19 ) . \n first , we conducted the sem on the proposed model to test the validity of the observed variables of each latent variable . in the next stage \n the model modification follows the estimation of a model that resulted in unfavorable indices of fit ( 18 ) . to apply the sem , the lisrel 8.8 software was used to conduct the analysis of structural model ( 20 ) . in order to assess the fit of the models , \n the following common goodness - of - fit indices were used : goodness of fit index ( gfi ) , adjusted goodness of fit index ( agfi ) , parsimony goodness of fit index ( pgfi ) , root mean square residual ( srmr ) , root mean square error of approximation ( rmsea ) , comparative fit index ( cfi ) , incremental fit index ( ifi ) , relative fit index ( rfi ) , normalized fit index ( nfi ) , non - normalized fit index ( nnfi ) , parsimony normalized fit index ( pnfi ) , and /df ( 21 ) . \n we conducted a questionnaire study based on a previous extracted structure ( 17 ) . in total , 230 participants with a mean age of 48.4 years ( sd=9.5 ) took part in the survey . \n the participants were a random sample from different jobs , work sites , and projects in different geographical and cultural areas in iran . \n as shown in table 1 , the observed variables were interpreted according to the findings of our previous qualitative research ( 17 ) , as follows : ( a ) general safety climate ( scfs ) ; ( b ) individual features ( ifs ) ; ( c ) and general safety performance ( sps ) . in this study , we suggested the following hypotheses to represent the relations between these components : descriptions of the latent and observed components adopted from khosravi et al . \n these hypotheses in the form of the proposed structural model represent relations between latent variables , as illustrated in fig \n structural equation modeling ( sem ) is a comprehensive statistical approach to testing hypotheses about relations between observed and latent variables . \n the sem is more flexible and comprehensive than any other approaches ( such as correlation , multiple regression , and anova ) , providing means of controlling not only for extraneous or confounding variables but for measurement errors as well ( 18 ) . \n we followed a two - stage sem according to anderson and gerbing ( 1988 ) to test the hypotheses ( 19 ) . \n first , we conducted the sem on the proposed model to test the validity of the observed variables of each latent variable . in the next stage \n the model modification follows the estimation of a model that resulted in unfavorable indices of fit ( 18 ) . to apply the sem , the lisrel 8.8 software was used to conduct the analysis of structural model ( 20 ) . in order to assess the fit of the models , the following common \n goodness - of - fit indices were used : goodness of fit index ( gfi ) , adjusted goodness of fit index ( agfi ) , parsimony goodness of fit index ( pgfi ) , root mean square residual ( srmr ) , root mean square error of approximation ( rmsea ) , comparative fit index ( cfi ) , incremental fit index ( ifi ) , relative fit index ( rfi ) , normalized fit index ( nfi ) , non - normalized fit index ( nnfi ) , parsimony normalized fit index ( pnfi ) , and /df ( 21 ) . \n table 2 compares the goodness - of - fit indices of the alternative models with recommended values . the proposed structural model a1 ( fig . \n 2 ) indicates a good fit ( gfi=0.94 ; srmr=0.05 ; rmsea=0.06 ; cfi=0.98 ; nfi=0.96 ; =1.85 ) . \n however , a two - stage modification was conducted on the proposed structural model to obtain a better goodness - of - fit . as shown in table 2 , \n 3 ) indicated a better fit to the data ( gfi=0.92 ; srmr=0.04 ; rmsea=0.04 ; cfi=0.98 ; nfi=0.96 ; =1.78 ) . \n hypothesis test , as illustrated in figure 2 , indicated that the scfs predict the ifs ( standardized path coefficient=0.71 ; t - value=8.53 ) and the sps ( standardized path coefficient=0.84 ; t - value=5.30 ) , which support both hypotheses 1 and 2 . \n however , the ifs did not exhibit to have a significant effect on the sps ( standardized path coefficient=-0.07 ; t - value=-0.63 ) , and therefore , hypothesis 3 is rejected . \n comparison of the goodness - of - fit indices of alternative structural models based on the modified model in figure 3 , it appears that the client safety climate ( scf1 ) has the highest association ( standardized path coefficient=0.82 ) with the general safety climate ( scfs ) . among the main individual features , the safety motivation and prohibition ( if1 ) and safety attitude and belief ( if2 ) \n had the greatest association ( standardized path coefficient=0.83 ) with the individual features ( ifs ) . while psychological condition ( sp1 ) has the highest association ( standardized path coefficient=0.73 ) with the general safety performance ( sps ) , the accident and near - miss engagement ( sp4 ) has a week but significant association ( standardized path coefficient=0.20 ) with the general safety performance ( sps ) . \n proposed structural model ( a1 ) with standardized path coefficients ( t - value in parentheses : t - value above 1.96 shows significant at 95% confidence level ) modified structural model ( a2 ) with standardized path coefficients ( t - value in parentheses : t - value above 1.96 shows significant at 95% confidence level ) \n based on the presented study , some social and organizational constructs share their influence on safety performance via the general component of safety climate . \n the new structural model shows that the general safety climate predicts individual features and general safety performance . \n a theoretical implication of this finding is the integration of the indicators and the contributing com ponents that influence safety performance , into a holistic model . \n this finding is partially in line with previous findings that safety climate is one of the most important component affecting safety performance and accident ( 11 , 14 , 15 , 22 - 24 ) . \n results of this work also confirmed the findings of previous studies that highlighted the importance of distal factors such as organization , economic , social , and political pressures that may contribute to reducing unsafe behaviors and accidents through improving construction operations , site conditions , and individual features as proximal factors ( 1 , 25 ) . in this study , it was found that the association among the general safety performance with the unsafe behavior and psychological condition tended to be higher than that with the near - miss or accident engagement . \n a number of studies have found that the historical or retrospective safety indicators such as the injury or accident rate are generally regarded as less reliable to measure workplace safety in the construction industry ( 26 ) . \n most practitioners and researchers in this field have only focused on accident records as data source . \n contrary to expectations , the most interesting finding of this study was that the unsafe behavior had more association with unsafe condition than individual safety features . \n this finding alters the widely accepted view that in construction projects , an individual s characteristics are key components in accident causation and control ( 2729 ) . in order to implement effective interventions , more focus on psychological and physical conditions \n unsafe physical conditions include the lack of appropriate safety equipment , insufficient lighting , poor housekeeping , and working in bad weather conditions . \n unsafe psychological conditions include the lack of welfare facilities and work group interaction , work pressure , and mental workload ( 17 ) . the findings of this research seem to be consistent with previous work which found that unsafe behaviors are conflicting stimuli due to the conflict between immediate benefits and future potential costs ( 30 ) . \n physical or psychological conditions can weigh on one side of the conflict and lighten the other , thereby reducing or increasing the rate of safety violations . \n if the unsafe conditions are not known or not properly perceived , workers may engage in human error , another type of unsafe behavior . \n this study provided a new good fit structural model that suggests that some social and organizational components share their influence on safety performance via the general component of safety climate . \n the new structural model , which integrated the pervious constructs , can be used to provide better understanding of the links between safety performance indicators and contributing components , and make stronger recommendations for effective intervention in construction projects . \n ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy ) have been completely observed by the authors .", "role": "user" }, { "content": "abstractbackgroundwith rapid economic development and industrialization , the construction industry continues to rank among the most hazardous industries in the world . \n therefore , construction safety is always a significant concern for both practitioners and researchers . \n the objective of this study was to create a structural modeling of components that influence the safety performance in construction projects.methodswe followed a two - stage structural equation model based on a questionnaire study ( n=230 ) . in the first stage , we applied the structural equation model to the proposed model to test the validity of the observed variables of each latent variable . in the next stage , we modified the proposed model . \n the lisrel 8.8 software was used to conduct the analysis of the structural model.resultsa good - fit structural model ( goodness of fit index=0.92 ; root mean square residual=0.04 ; root mean square error of approximation=0.04 ; comparative fit index=0.98 ; normalized fit index=0.96 ) indicated that social and organizational constructs influence safety performance via the general component of the safety climate.conclusionthe new structural model can be used to provide better understanding of the links between safety performance indicators and contributing components , and make stronger recommendations for effective intervention in construction projects .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a giant cell tumor of the soft tissue ( gct - st ) is a rare tumor that was first described in 1972 by salm and sissons , followed shortly by guccion and enginger . \n this tumor has been considered to be synonymous with the giant cell variant of malignant sarcoma , and is reported to have frequent local recurrence and metastasis . \n gct - sts represent the soft tissue analog of giant cell tumors of the bone because of their histological and immunohistochemical similarities . \n most of the reported tumors have been in the extremities with the thigh being the most commonly affected site . \n these tumors show unpredictable behavior - some patients are cured by simple surgical excision whereas others develop metastasis . \n a primary giant cell tumor of soft tissue of low malignant potential should be considered in the differential diagnosis of bland - looking , giant cell - rich lesions . \n a 30 year - old male presented with a superficial , tender mass of three months duration , around 2.5 1.5 cm in size , and involving the lower part of the thigh . \n fine needle aspiration cytology ( fnac ) was done and slides stained with giemsa stain . microscopic examination showed numerous , elongated stromal cells , singly and in clusters , along with numerous , large , osteoclastic giant cells . \n diagnosis of a giant cell tumor of the soft tissue was made based on fnac . \n it showed multiple , grey - brown fragment of soft tissue altogether measuring 2.5 cm in diameter . \n microscopic findings were of a cellular tumor composed of spindle to oval cells admixed with numerous , multinucleated giant cells . \n these giant cells were scattered uniformly and appeared to have a similar nucleus as that of the surrounding spindle cells . \n as before , pleomorphism , cytological atypia , and mitotic activity were absent [ figure 2 ] . \n thus , the diagnosis of a giant cell tumor of soft tissue was confirmed histologically . \n photomicrographs showing multinucleated giant cells shown by arrow , large number of elongated cells lying singly and clusters ( giemsa , 400 ) histology photomicrographs showing multiple giant cells mixed with spindle cell stroma ( h and e , 400 ) \n a giant cell tumor of the soft tissue is a tumor whose cytomorphology closely resembles that of a giant cell tumor of the bone . \n many consider malignant giant cell tumors of the soft parts as histological variants of malignant fibrous histiocytomas . \n these gct - sts occur in patients in all age groups ranging from one to 87 years . \n our patient was a young adult male aged 30 years having a soft tissue mass in the lower thigh . \n other tumor locations include the face , abdominal wall , shoulders , neck , and retroperitoneum . \n the histogenesis is unclear and the behavior is dependent upon the location , size , and microscopic appearance . \n low- and high - grade forms have been separated from each other on the basis of the atypia , pleomorphism , and mitotic activity of the mononuclear neoplastic component . \n malignant forms of giant cell tumors of soft tissue show a mixture of osteoclast - like , multinucleated giant cells , cytoplasm - rich histiocytes , and fibroblasts . \n the latter two cell types exhibit varying degrees of cellular and nuclear pleomorphism . hemorrhage and necrosis are frequent findings ; fibroblasts show varying degrees of atypia with fibrosarcoma - like areas . \n the mitotic activity of mononuclear histiocytes and fibroblast - like cells has been found to be high , with up to ten mitotic figures per high power field ( hpf ) . \n differential diagnoses of gct - st includes soft tissue mesenchymal tumors that are rich in giant cells , especially nodular tenosynovitis , which is encapsulated , shows characteristic , nodular growth patterns , lacks the typical spindle stromal cells of a conventional giant cell tumor , and contains scattered giant cells , lymphocytes , foamy macrophages , and large amount of fibrous tissue . \n other benign tumors include pigmented , villonodular synovitis , which affects synovial lined joints , bursae , and tendon sheaths . \n nodular fasciitis with osteoclast - like giant cells are composed of immature fibroblasts in sheets and irregular bundles . \n giant cell malignant fibrous histiocytoma , osteoclast - like , giant cell - rich leiomyosarcoma , and extraskeletal osteosarcoma are usually large , deep - seated lesions with obvious cellular atypia . in contrast , gct - st is frequently superficial and devoid of significant pleomorphism and atypical mitosis . \n teiera et al . described primary giant cell tumor of soft tissue in a 54 year - old man that appeared histologically identical to a giant cell tumor of the bone . \n kim et al . described cytological features of giant cell tumor of soft tissue in a 58 year - old woman with a well demarcated dermal tumor . \n histopathological examination showed numerous , osteoclast - like giant cells and mononuclear cells with a bland nucleus . \n the authors concluded that a primary giant cell tumor of soft tissue should be considered in the differential diagnosis of bland - looking , giant cell - rich lesions . in our case \n , the tumor did not show any pleomorphism , cellular atypia , or mitotic figures , and the patient remained well and asymptomatic after tumor removal . in conclusion \n , gst - st occurs as a primary , soft tissue neoplasm and it is identical clinically and morphologically to giant cell tumor of the bone . \n complete excision of the gct - st results in a benign clinical course because episodes of distant metastasis and tumor - associated death seem to be exceedingly rare .", "role": "user" }, { "content": "giant cell tumors of soft tissue ( gct - sts ) are rare neoplasms and are mainly seen in adults and in the elderly population , usually in the extremities . when evaluated along with clinical features , \n the cytological features are sufficient to distinguish gct - sts from other more common tumors with giant cell morphology . \n we report here a case of a giant cell tumor of soft tissue diagnosed on the basis of fine needle aspiration cytology and confirmed after histopathology .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: patients with chronic heart failure ( chf ) are characterized by systemic inflammation , as evidenced by raised circulating levels of several inflammatory cytokines such as tumor necrosis factor- ( tnf- ) , interleukin- ( il- ) 1 , and il-6 as well as chemokines , for example , monocyte chemoattractant peptide- ( mcp- ) 1 , il-8 , and macrophage inflammatory protein- ( mip- ) 1 [ 16 ] , which were associated with high plasma levels of brain natriuretic peptide ( bnp ) . \n complex interplays between t helper ( th ) 1 and th2 lymphocytes are reported contributing to the pathophysiology of chf . \n in addition to th1 and th2 cells , there is accumulating evidence for a critical role for treg and th17 cell subsets in charge of the immune response and regulation . \n the proinflammatory cytokine il-17 , which is produced by th17 cells and other innate immune cells , has been implicated in many inflammatory conditions . \n conversely , treg cells help repress inflammation through modulating t cell responses and can be distinguished from cd4 t cell by foxp3 expression [ 12 , 13 ] . \n it has also been proposed that increased th17 cell levels correlated with decreased treg cell levels in patients with chf , suggesting that the imbalance between these two subsets may contribute to the pathogenesis of chf , which consisted with n - terminal pro - brain natriuretic peptide ( nt - probnp ) . \n most peripheral blood tregs appear as activated phenotype ( cd45ra ) ; however , a subset of nave regulatory t cells ( cd45ra ) has been detected as well . \n previous studies carried out in peripheral blood lymphocytes ( pbl ) of normal healthy individuals demonstrated three subpopulations ( fractions ( fr . ) \n i iii ) that expressed foxp3 and cd45ra protein at different amounts showed distinct phenotype and function . \n it may explain the reason why human foxp3treg cells failed to display homogenous function in previous reports in contrast to murine foxp3treg cells [ 1619 ] . \n the proportion of the three subpopulations differed between normal and pathological conditions [ 15 , 20 ] . \n activated tregs are highly susceptible to apoptosis and have critically short telomeres , so the peripheral homeostatic mechanisms are very important in charge of treg diversity and numbers in the maintenance of immune response . despite the reports of impaired treg / th17 balancing , \n the variation of treg cell subpopulations in chf remains to be elucidated . in recent years \n , vitamin d was highlighted as an important player in numerous diseases including cardiovascular disorders [ 2224 ] . \n vitamin d deficiency may be caused by multiple factors associating with the development and progression of chf [ 2528 ] . \n although vitamin d is a unique nutrition covering a range of pleiotropic effects contributing to the bone and calcium metabolism , its immune modulatory properties are outstanding both in vivo and in vitro [ 2933 ] . \n variation of vitamin d status in vivo is associated with the changes of t cell compartment in the human pbl . \n t cells are known targets for 1,25-dihydroxyvitamin d ( 1,25(oh)2d ) , the biological active metabolite of vitamin d , since they express vitamin d receptor ( vdr ) [ 35 , 36 ] . upon t cell activation , \n the expression of vitamin d receptor is upregulated , suggesting an important functional role for vitamin d in adaptive immunity . \n both human in vitro and animal models experiments revealed that vitamin d can suppress proinflammatory th1 and th17 cytokine responses [ 37 , 38 ] . \n how vitamin d works on t cell subsets in chf is worthy of further exploration . \n herein , we demonstrate the underlying imbalance of th17 and treg cell populations in patients with chf . \n reduced serum / plasma concentration of 25(oh)d level , together with elevated nt - probnp , was associated with the decreased treg in chf . \n in particular , we assessed variations of treg subpopulations in chf and healthy or aged individuals and found that nave ( cd4cd45rafoxp3 ) treg subset , rather than whole treg cells , contributes to the reduced treg in chf . \n taken together , these results indicated 1,25(oh)2d may be involved in the interaction between treg and th17 compartment , skewing t cells into anti - inflammatory and regulatory state in chf . \n between august 2012 and january 2013 , in this study , we included 84 patients with chf , diagnosed by clinical history , physical examination , electrocardiography , echocardiography , chest x - ray , and nt - probnp , and 18 patients with acute myocardial infarction ( ami ) as other cardiovascular diseases ( refer to acute hf ) from the department of internal cardiology and emergency of xinhua hospital , shanghai jiaotong university school of medicine . \n 35 healthy donors ( hd ) and 15 age- and sex - matched older donors ( between 79 and 90 years old ) serving as controls were obtained from the medical examination center of xinhua hospital . \n according to new york heart association ( nyha ) functional classification , patients were divided into 3 subgroups : nyha ii , nyha iii , and nyha iv ( for detailed information , refer to table 1 ) . \n exclusion criteria included inflammatory disease , allergic disease , collagen disease , malignant disease , advanced liver disease , renal failure , steroid therapy , and recent myocardial infarction or unstable angina ( within 3 months ) . \n written informed consent was obtained from each patient , and the study conformed to the declaration of helsinki principles . \n the study was approved by the ethical committee of xinhua hospital affiliated to shanghai jiaotong university school of medicine . \n blood samples used for this study were collected at the time of admission to the emergency department or internal cardiology department ( < 24 h from symptom onset ) . \n plasma 25(oh)d and nt - probnp levels , together with hscrp , ldl , lp(a ) , and hcy , were instantly measured by electrochemiluminescence immunoassay on automated immunoanalyzer ( cobas e601 , roche diagnostics , indianapolis , in ) according to the manufacturer 's instructions in the clinical chemistry laboratory of xinhua hospital . \n pbl in the 4 ml heparinized blood were freshly isolated by ficoll density gradient centrifugation . \n lymphocytes were resuspended in pbs supplemented with 2% bovine serum albumin at a concentration of 1 10 cells / ml . \n cell surface marker analysis was performed using four- or five - color flow cytometric analysis . cd3 \n eflour 450 ( ucht1 , ebioscience , ca , usa ) , cd4-pc5 ( 13b8.2 , beckman coulter , ca ) , cd45ra - cy7 ( hi100 , biolegend , san diego , ca , usa ) , il-17a - pe ( bl168 , biolegend ) , cd25-apc ( bc96 , ebioscience ) , foxp3-ax488 ( pch101 , ebioscience ) , vdr ( 9a7 , abcam ) , and the secondary antibody were used , together with appropriate isotype controls , to allow identification of positive and negative cell populations . for double staining of il-17 and foxp3 , \n pbl were isolated using ficoll density gradient separation , stimulated with pma ( 50 ng / ml ) and ionomycin ( 1 g / ml ) ( sigma - aldrich ) , and operated using the cytofix / cytoperm kit from bd biosciences ( san diego , ca , usa ) according to the instructions . to analyze the levels of vdr , \n cells were fixed with 16% formaldehyde ( final concentration of approximately 1.5% ) for 30 min , permeabilized with 1 ml of ice - cold methanol for 30 min on ice , and stained with rat anti - human vdr monoclonal antibodies and goat anti - human igg ( h+l ) secondary antibody dylight 488 . \n multiple - color facs analysis was performed using a bd facscanto ii flow cytometer ( bd ) . \n approximately 1 10 to 1 10 cells were analyzed ; the gating strategy for the identification of t subsets was performed as described previously ( supporting information , figure s1a in supplementary material available online at http://dx.doi.org/10.1155/2015/547697 ) . \n then , first - strand cdna was subsequently synthesized using sensiscript rt kit ( takara ) according to the manufacturer 's instructions . \n the following primers were used to assess gene expression : foxp3 , 5-ctacgccacgctcatccgctgg-3 ( forward ) and 5-gtagggttggaacacctgctggg-3 ( reverse ) ; il-17a , 5-agagatcctggtcctgcgca-3 ( forward ) and 5-gtgacacaggtgcagcccac-3 ( reverse ) ; rort , 5-accaccccctgctgagaaggac-3 ( forward ) and 5-tgcacccctcacaggtgataaccc-3 ( reverse ) ; vdr , 5-atctgcatcgtctccccagat-3 ( forward ) and 5-agcggatgtacgtctgcagtg-3 ( reverse ) ; gapdh , 5-attccacccatggcaaattc-3 ( forward ) and 5-gcatcgccccacttgatt-3 ( reverse ) . for cell sorting , \n 10 ml of peripheral blood was collected from either hds or patients , and cd4 t , cd4cd45rat , cd4cd45rat , or cd4cd25 t cells were obtained from pbl using the human cd4 t cell isolation kit ii and cd45ra beads ( miltenyi biotec ) . \n typically , the cells were incubated with 1,25(oh)2d at final concentration 20 nm or dmso as control under the stimulation with precoated 5 g / ml cd3 , soluble 5 g / ml cd28 , and 200 u / ml rhil-2 at 1 10 per well in 96-well u - bottom plates , and three replicate wells were set up . \n the cells were cultured in a humidified co2-containing atmosphere at 37c for 5~7 days in complete rpmi-10 medium supplemented with 100 u / ml penicillin , 100 g / ml streptomycin , 0.5 mm sodium pyruvate , 0.05 mm nonessential amino acids , 2 mm l - glutamine , and 10 mm hepes ( all from gibco ) . for cell proliferation , purified t cell was stained with cfse and detected cell division by flow cytometry after 5 days of incubation . \n cells were collected after 5 days induced by 1,25(oh)2d or controls for vdr analysis by wb . for cytokine measurements , \n cell culture supernatants were collected from 24 h to 7 d and diluted for the measurement of cytokines il-10 , il-17 , and ifn- quantitatively using enzyme - linked immunosorbent assay ( elisa ) kits ( multisciences biotech ) , according to the manufacturer 's instructions . \n the detection limit of il-10 , il-17 , and ifn- was 0.7 pg / ml , 15 pg / ml , and 15 pg / ml , respectively . \n the statistical evaluation was performed with graphpad prism ( version 5.0 , graphpad software , ca ) . \n values are shown throughout the paper as mean sem except for the patients and hd age , which is shown as mean sd . \n a student t - test was used to analyze the differences between the groups and one - way anova was initially performed to determine whether an overall statistically significant change existed before using the two - tailed paired or unpaired student t - test for normal distributed data . in the case of significant differences between subgroups , \n post hoc analyses were based on the tukey test ( normal distributed data ) or on the mann / whitney u test . \n pearson 's correlation coefficient ( normal distributed data ) and spearman 's rank correlation coefficient ( nonnormal data ) were used to assess interrelationships \n to determine whether treg and th17 cells are involved in the development of chronic heart failure , we measured the number of circulating treg and th17 cells in pbl by flow cytometry . \n we defined the phenotype of treg cells as cd4cd25foxp3 . as shown in figures 1(a ) and 1(b ) , the proportion of tregs of hds ranged from 3.1% to 11.9% , compared with 1.0% to 10.5% in the patients with chf . \n the frequencies of treg cells were significantly reduced in patients with chf ( nyha ii 5.63 0.30% , nyha iii 5.43 0.40% , and \n nhya iv 4.95 0.38% ) compared to healthy donors ( 7.08 0.37% ) and elder donors ( 6.85 0.64% ) ( p < 0.05 ) . \n the proportion of th17 cells in the total cd4 t cells in hds ranged from 0.6% to 1.8% , while the percentages in patients with chf were from 0.7% to 7.2% . \n the frequencies of th17 cells were markedly higher in patients associated with clinical stage ( nyha ii 1.98 0.24% , nyha iii 2.29 0.28% , and nhya iv 1.68 0.29% ) compared with the healthy donors ( 0.99 0.07% ) and elder donors ( 0.95 0.09% ) ( p < 0.05 , figures 1(a ) and 1(b ) ) . \n overall , the data showed a decrease in treg cells and an increase in th17 cells in chf . \n an imbalance was observed in patients with chf and ami ( acute hf ) ( p < 0.01 ) , which was characterized by lower frequencies of tregs and higher frequencies of th17 cells in cd4 t cells , as shown by the ratio of treg / th17 cells ( figure 1(c ) ) . \n there were equivalent numbers of frequencies of treg and th17 cells observed in hd controls and elder donors . \n further , there was no significant difference between percentages of treg and th17 cells in the chf patients and ami as ahf controls ( p > 0.05 ) . \n similar to cytometry results , foxp3 and tgf- mrna expressions of pbl were reduced in three nyha groups , while rort and il-17a mrna levels were significantly higher in chf patients compared with hds ( figure 1(d ) ) . \n multicolor flow cytometry showed cd4cd45rat cell producing il-17 mostly ( supporting information , figure s1b ) . accumulating evidence suggests that vitamin d deficiency is associated with cardiovascular disease ( cvd ) and excess mortality . to assess whether 1,25(oh)2d status correlated with treg and/or th17 , we first assessed concentration of plasma 25(oh)d and plasma nt - probnp from chf patients classified into three nyha groups , ami ( refer to acute hf ) controls , and aged donors \n . nt - probnp is a sensitive marker for cardiac dysfunction , elevated nt - probnp levels indicated patients with ventricular dysfunction , and levels correlate directly with the severity of heart failure . compared to ami and aged donor , levels of 25(oh)d were lower in all groups of chf patients ( figure 1(e ) ) . \n moreover , lower 25(oh)d and higher nt - probnp were consistent with increased clinical severity . \n nt - probnp , which is associated with ventricular dysfunction , was inversely correlated with 25(oh)d ( r = 0.3544 , p = 0.0044 ) ( figure 2(a ) ) . \n given our findings of reduced ratio of treg / th17 cell populations in patients with chf , it was correlated with plasma level of 25(oh)d as well ( r = 0.3393 , p = 0.0057 ) ( figure 2(b ) ) . \n we also found that the frequency of treg was negatively correlated with nt - probnp ( r = 0.3262 , p = 0.0071 ) and positively correlated with 25(oh)d ( r = 0.3617 , p = 0.0045 ) ( figure 2(c ) ) . \n meanwhile , the frequency of th17 was positively correlated with nt - probnp ( r = 0.2793 , p = 0.022 ) but not significantly correlated with 25(oh)d ( r = 0.121 , p = 0.312 ) ( figure 2(d ) ) . \n the combination of foxp3 and cd45ra staining of cd4 t cells in pbl of healthy individuals revealed three subsets , that is , foxp3cd45ra cells ( fr . \n i ) , foxp3cd45ra cells ( fr . ii ) , and foxp3cd45ra cells ( fr . \n i ) among cd4 t cells was decreased in chf ( 0.50% 0.41% , n = 84 versus 2.86% 0.99% in healthy donors , n = 24 ; p < \n ii ) was increased ( 0.84% 1.21% versus 0.48% 0.77% ; p = 0.0011 ; figures 3(b ) and 3(c ) ) . \n we also applied the new definition of foxp3 t cell subsets to the analysis of aging condition . \n in older people , nave treg was lower than normal individuals but higher than patients with chf ( 1.25% 0.69% , n = 15 versus 0.50% 0.41% , n = 84 ; p < 0.0001 ) , and cd45rafoxp3 non - treg cell fraction ( fr . \n iii ) increased compared to chf ( 5.44% 1.25% versus 4.27% 1.62% ; p = 0.0166 ) and healthy donors . \n according to the analysis of t cell population , we assumed cd45ra as a marker for the functional t cells on 1,25(oh)2d activity . to assess the effects of high dose vitamin d3 supplementation on t cell \n , we treated the cells with a series of concentrations of 1,25(oh)2d and detected the cell apoptosis . \n t cells from hd cultured with cd3/cd28 and 20 nm 1,25(oh)2d for 5 days showed similar apoptosis compared with dmso ( figure 4(a ) ) . \n high dose 1,25(oh)2d ( 50 or 100 nm ) increased t cells apoptosis slightly on day 3 ( figure 4(b ) ) . \n cd45ra expression on t cells from hd cultured with 20 nm 1,25(oh)2d was significantly higher than dmso control after cd3/cd28 activation on day 3 and day 5 ( p < 0.05 , figure 4(c ) ) . \n high dose 1,25(oh)2d had a significant role on cd45ra expression ( p < 0.05 , figure 4(d ) ) . \n previous results showed dramatically decreased nave treg cell in chf . to confirm the function of 1,25(oh)2d on t cells , cd4 t cells were first purified from hd and chf and were cultured with 20 nm 1,25(oh)2d or dmso in the presence of -cd3 , -cd28 , and rhil-2 . \n results showed that the percentage of cd45rafoxp3 nave treg cells was higher after 1,25(oh)2d treatment for 3 days in pbmcs from hd ( p < 0.05 , figure 4(e ) ) . \n chf cd4 t cell with 1,25(oh)2d treatment expressed less il-17 and ifn- ( figure 5(a ) top ) and more foxp3 than hd ( figure 5(a ) bottom ) . \n we further found that cd4cd45rat cells were the major population reacting to the 1,25(oh)2d in hd , as 1,25(oh)2d significantly inhibited il-17 and promoted foxp3 expression on cd4cd45rat cells than cd4cd45rat cells ( figure 5(b ) ) . the same response and mrna expression pattern of cd4cd45rat cells in chf compared with hd . \n it showed lower il-17 and higher foxp3 expression ( figure 5(c ) ) and lower il-17 and rort mrna and higher foxp3 mrna expression in cd4cd45rat cells ( figure 5(d ) ) . \n elevated il-10 and decreased il-17 and ifn- were found in the supernatants of hd cd4cd45rat cells cultured with 1,25(oh)2d in 7 days in series ( figure 5(e ) ) . \n cytokine profile of cd4cd45rat cells culture supernatants in chf was the same as in hd ( figure 5(f ) ) . \n no obvious changes in anti - inflammatory cytokine tgf- were observed ( data not shown ) . above all , results showed that 1,25(oh)2d induced cd4cd45rat cells convert to foxp3itreg , produce more il-10 , and inhibit il-17 secreting . \n 1,25(oh)2d exerts its biological function depending on the vdr , and we found there was no difference of vdr expression on cd4 t cell between hd and chf ( figure 6(a ) ) . \n further analysis showed that cd4cd45rat cells expressed more vdr than cd4cd45rat cells in hd , while it was not found in chf ( figure 6(b ) ) . \n cd4 t cells were isolated and incubated with 1,25(oh)2d or dmso for 5 days ; vdr and foxp3 expression was upregulated in a dose dependent manner ( figure 6(c ) ) . \n purified cd4cd45rat cells expressed higher level of vdr when cultured with 1,25(oh)2d than those with dmso both in chf and hd ( figure 6(d ) ) . \n cd4cd45rat cells from hd and chf were labeled with cfse and incubated with 1,25(oh)2d or dmso for 5 days and we analyzed their proliferation index . \n we found that cd4cd45rat cells treated with 1,25(oh)2d expanded at slightly slower pace ( for chf p = 0.098 ; for hd p = 0.002 ) ( figure 7(a ) ) . \n il-17 expression dropped sharply in cd4 t cells , especially in cd4cd45rat cells when cocultured with 1,25(oh)2d . \n the transwell coculture system was used to show the suppression of 1,25(oh)2d induced cd4cd45rat cells on cd4cd25 t effector cells ( teff ) . \n it is noteworthy that cd4cd45rat cells apart from hd exhibited a certain degree of suppression , but it would be reinforced in the presence of 1,25(oh)2d ( p = 0.016 ) ( figure 7(b ) upper ) . \n cd4cd45rat cells induced by 1,25(oh)2d or dmso did not show any suppression on teff ( figure 7(b ) upper ) . \n cd4cd45rat cells apart from chf had little suppressive function , while in the presence of 1,25(oh)2d these cells could restore their inhibition on teff ( p = 0.012 ) ( figure 7(b ) lower ) . \n also , increased il-10 and decreased il-17 were detected in the 1,25(oh)2d culture supernatant compared with dmso ( p < 0.05 ) ( figure 7(c ) ) . \n vitamin d status has been linked to chronic heart failure ( chf ) either in large clinical trial studies or in experimental in vitro and animal studies . \n however , the potential role of vitamin d in immunological deregulation in cardiac dysfunction is not well understood and remains to be elucidated . \n this is the first study to investigate the correlation between vitamin d status and the composition of t cell compartment and subpopulations of foxp3treg in vivo in chf patients . \n chf is considered to be a complex multistep disorder in which a number of physiologic systems participate in its pathogenesis . \n recent studies have provided strong lines of evidence implicating that the activation of the immune system and the prevalence of inflammation contribute to the progression of chf . increased plasma / serum inflammatory cytokines and chemokines \n are significantly correlated with deterioration of cardiac function ( i.e. , new york heart association classification ) and performance ( e.g. , left ventricular ejection fraction ( lvef ) ) [ 25 ] . moreover , these inflammatory mediators may also provide important prognostic information to chf . \n although the mechanisms for the inflammation are unknown , a growing body of evidence suggests that treg and th17 cells may play a role in the inflammation . \n the initial aim of this study was to determine whether an imbalance between th17 and treg cell populations is characteristic of chf , as previously suggested . \n we confirmed that increased th17 and decreased treg cell population frequencies correlated with the development of clinical stages . \n besides , we also showed reduced foxp3 and tgf- expression and elevated rort and il-17a expression accordingly . \n these results suggested that treg / th17 imbalance may participate in the development and progression of chf . \n previous evidence demonstrated impaired th1/th2 balance in patients with chf despite various etiologies [ 8 , 46 ] . \n with further understanding of immune activation and modulation , the treg / th17 cell balance seems to be more notable and convertible due to immunoregulatory therapy . \n as reported , human cd4foxp3 t cells can be separated into three phenotypically and functionally distinct subpopulations : cd45rafoxp3 nave treg cells ( fr . i ) , cd45rafoxp3 activated treg cells ( fr . ii ) , and cd45rafoxp3 nonsuppressive t cells ( fr . iii ) . in chf patients \n i t cells ( nave treg ) was decreased as compared to normal individuals , resulting in relatively elevated fr . \n taking into account the influence of age , we also analyzed three foxp3 t cell subsets in aged healthy subjects . \n i was lower than that of normal individuals , aged individuals still had higher frequency of fr . \n the variations in human treg cell populations under chf conditions may be highly informative in assessing the severity of disease . \n foxp3 activated treg appears to be terminally differentiated treg cells ; it may be converted from nave treg or cd4 foxp3 t cell and rapidly die in vitro . \n thus , the sharp drop of nave treg in chf may explain their subdued immunomodulation . \n future research needs to determine underlying mechanism of how vitamin d gives rise to nave treg cells persistence in vivo constantly in adults . \n studies have linked vitamin d deficiency to the development and progression of chf [ 2428 ] . \n vitamin d undergoes two hydroxylations to form the active metabolite , 1,25-dihydroxyvitamin d , termed calcitriol , and acts as a modulator of calcium homeostasis and the immune response [ 4749 ] . \n vitamin d treatment in chf decreased serum concentrations of tnf- , an inflammatory cytokine ; in contrast , increased concentrations of il-10 , an anti - inflammatory cytokine , suggested that vitamin d has protective effects on the heart itself [ 26 , 27 ] . \n however , clinical trial on vitamin d treatment showed no effect on left ventricular function compared to placebo treatment in men with chf . \n thus , the effect of vitamin d pertinent to cardiovascular health is the shift toward an anti - inflammatory response . as reported , high prevalence of vitamin d insufficiency ( < 30 ng / ml ) was found in 84% males and 89% females in china . \n the overall median ( interquartile range ) serum concentration of 25(oh)d was 20.9 ( 16.925.0 ) ng / ml , which consisted with plasma 25(oh)d concentration in this study . \n technically , it does not verify whether this criterion applied to asians to assess vitamin d levels is practical . \n we found levels of plasma 25(oh)d were lower in all groups of chf patients compared to ami , aged , and healthy donors . in our study , 25(oh)d was inversely correlated with nt - probnp , which was associated with ventricular dysfunction and consisted with increased clinical severity . \n additionally , we showed declined ratio of treg / th17 cell populations in patients with chf ; 25(oh)d was positively correlated with the frequency of treg , whereas it was not significantly correlated with the frequency of th17 . \n further results showed that cd4cd45rat cell was the population that better responded to 1,25(oh)2d treatment , which partially restored its suppressive function against inflammation in chf . \n nave treg cells ( cd4cd45rafoxp3 t ) manifested equivalent suppressive activity to activated tregs ( cd4cd45rafoxp3 t ) in vitro . targeting nave tregs in adults may offer new means of preventing and treating immune - related disease . \n herein , we employed cd4cd45rat instead of cd4cd25cd45rat cell , which was considered equal to cd4cd45rafoxp3 t cell , as a marker to illustrate the effect of vitamin d on t cells [ 15 , 39 ] . besides the fact that not enough cd4cd45rafoxp3 cell was available for harvesting from chf , the other major reason was that we considered cd45ra as a more practical marker to investigate the role of vitamin d on t cell subsets as inducible foxp3 expression after 1,25(oh)2d treatment . \n as reported , nave t ( mostly cd45rat ) cell could express foxp3 in the presence of 1,25(oh)d ; herein , we also found that cd4cd45rat cell expressed more foxp3 and less il-17 after 1,25(oh)d treatment . \n vitamin d supplementation increased nave cd4 t cells preferentially and induced a significant increase of regulatory t cells . \n results from cd4 t cell experiment showed cd45rafoxp3 t cell elevated as well . besides the role of 1,25(oh)2d on foxp3 expression , the consequent drop of cd45ra expression , after activation , in t cell with 1,25(oh)2d was less considerable on the detecting time point , leading to the percentage of foxp3treg in cd45rat probably being relatively higher . \n the cd3/cd28 stimulation is artificial and gives a very strong response , so cd45rafoxp3 t cell will be the dominant population at last . \n vd - itreg would be more appropriate to decribe the foxp3treg induced by 1,25(oh)2d . through vitamin d receptor ( vdr ) , 1,25(oh)2d inhibits proliferation of t effector cells , reduces the production of il-2 and ifn- and cytotoxicity [ 56 , 57 ] , and decreases the synthesis of il-6 , il-12 , il-17 , and il-23 [ 5860 ] . \n hence , it seems likely that 1,25(oh)2d suppresses the generation of th1 and th17 cells and probably induces the development of foxp3treg cells . \n due to vitamin d supplements being not practicing in clinical treatment of chf or other cardiovascular diseases as an adjuvant therapy in china , it was difficult to assess vitamin d status and t cell subpopulations in vivo for following up or achieve conclusion whether the change in the density of cd4cd45rafoxp3 t cells in chf patients is the cause or consequence of low 25(oh)d concentration . \n vdr is preferentially ligated with retinoid x receptor ( rxr ) to form heterodimers to bind dr3-type sequences or bind genomic dna first and then forms complexes with corepressor proteins and histone deacetylases to mediate gene transcription . \n the presence of vd response elements ( vdres ) in the intronic conserved noncoding sequence region of the human foxp3 gene ( + 1714 to + 2554 ) and the enhancement of the foxp3 promoter activity by such vdres in response to 1,25(oh)2vd were reported . \n more vdr chip - seq data , especially in primary cd4 t cell , provide interesting and helpful information . our findings addressed reduced vdr expression in cd4cd45rat cells in chf ; however , the role of vitamin d on cd45ra expression through vdr or other mechanisms needs further study . \n taken together , this work demonstrates that decreased vitamin d is correlated with decreased treg and increased th17 cells in chf . \n there are also variations of foxp3treg subpopulations with remarkably declined cd4cd45rafoxp3 nave treg cells and arisen cd4cd45rafoxp3 activated treg cells in chf . \n more importantly , 1,25(oh)2d has the ability to ameliorate the impaired immunomodulation of cd4cd45rat cell on teff in chf through vdr . \n our findings provide tangible evidence to vitamin d supplementation , as a nonpharmacologic strategy , which may help prevent the development and progression of chf through immunoregulation .", "role": "user" }, { "content": "the effect of vitamin d pertinent to cardiovascular health on the heart itself is considered to shift toward an anti - inflammatory response in chronic heart failure ( chf ) ; however , its underlying mechanism is not completely understood . in this study , we demonstrated that plasma 25(oh)d level , negatively associated with nt - probnp , correlated with the decreased treg in chf compared to the patients with other cardiovascular diseases and healthy and older donors . \n nave treg cell ( cd4+cd45ra+foxp3lot ) subset , rather than whole treg cells , contributes to the reduction of treg in chf . \n 1,25(oh)2d treatment maintained partial expression of cd45ra on cd4+t cell after cd3/cd28 monoclonal antibodies activation and ameliorated the impaired cd4+cd45ra+t cell function from chf patients through upregulating foxp3 expression and il-10 secretion in vitro . \n low level of vitamin d receptor ( vdr ) was detected in cd4+cd45ra+t cell of chf than control , while 1,25(oh)2d treatment increased the vdr expression to exert its immunosuppression on t cell . \n the results of this study might provide tangible evidence to our knowledge of the impact of vitamin d supplementation on nave tregs , which may offer new means of preventing and treating chf .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: children with acute diarrhea who came to 2 public hospitals ( joao alves filho and municipal da zona norte ) and 3 health centers that provided health services to a population ( santa maria ) in aracaju , brazil , were enrolled from november 2006 to february 2007 . children who came to the hospitals were enrolled consecutively on specific days of the week by study health workers , and children who came to the health centers were visited at home after we checked the daily attendance lists of the centers . \n acute diarrhea was defined as any episode < 14 days duration with > 3 watery stools per day . \n background and clinical information were collected after obtaining parental consent , and stool samples were stored frozen in duplicate at 80c until analyzed in liverpool , uk . \n information on rotavirus vaccination was obtained from parents and cross - checked against vaccination record cards . \n a child was considered vaccinated if 2 doses of the vaccine had been recorded on the vaccination card . \n rotavirus detection , genotyping , electropherotyping , isolation of strains in cell culture , and sequencing were performed as described ( 7 ) . \n data were analyzed by using descriptive statistics in epi - info 2002 ( centers for disease control and prevention , atlanta , ga , usa ) . \n the study protocol was reviewed and approved by the ethics committees of the liverpool school of tropical medicine and the federal university of sergipe . \n a total of 129 patients with a median age of 12 months ( range 1 month12 years ) were enrolled . \n of these , 63 ( 49% ) were < 1 year of age , 39 ( 30% ) were 12 years of age , and 27 ( 21% ) were > 2 years of age . \n of these children , 20 were identified among 89 children enrolled in the hospital and 1 was identified among 40 children enrolled in the health centers ( p = 0.002 ) . \n the frequency of rotavirus infection by vaccination status and age is shown in the table . among children \n < 1 year of age , 3 ( 7% ) of the 44 vaccinated children were infected with rotavirus compared with 5 ( 26% ) of 19 children who did not receive the vaccine ( p<0.05 ) . among children \n 12 years of age , 4 had received the vaccine and 1 ( 25% ) of them was infected with rotavirus compared with 8 ( 23% ) of the 35 children who did not receive the vaccine ( p not significant ) . \n the median ( range ) diarrhea severity scores of children with and without rotavirus infection were 12.9 ( 1015.8 ) and 9.4 ( 5.313.5 ) , respectively ( p<0.001 ) . \n although numbers are small , vaccinated children had a median ( range ) diarrhea severity scores of 12.5 ( 715 ) if they were infected with rotavirus and 7 ( 317 ) if they were not infected . similarly , the median ( range ) severity scores for unvaccinated children were 13 ( 815 ) and 11 ( 414 ) for children with and without rotavirus infections , respectively ( p not significant ) . \n nineteen specimens had short electropherotype strains , 1 was positive but with an undefined pattern , and 1 had insufficient rna to produce a pattern . \n sergipe has achieved relatively high rotavirus vaccine coverage ( 54% ) since introduction of the vaccine in 2006 , with 48,165 doses provided in aracaju . \n the vaccine was well received by the local population , and as new eligible children continue to be vaccinated , it is likely that vaccination levels will reach the high coverage currently attained for oral polio vaccine ( 100% ) ( http://tabnet.datasus.gov.br/cgi/tabcgi.exe?idb2005/f13.def ) . to our knowledge , this is the first report from brazil of 1 rotavirus genotype predominating in a population after introduction of a vaccine . \n the pg2 strain is a genotype for which effectiveness of the vaccine appears to be lower . \n this genotype has been previously reported in brazil but represents only 6.1% of all the genotypes published since 2000 . \n the proportions of strains with pg2 has ranged from 0% to 27% in various studies , and no study reported that this was the predominant strain . \n limited evidence of the effectiveness of rotarix vaccine against the pg2 strain has been reported ( 9,10 ) because the vp4 and vp7 proteins are not found in the pg1 strain that is included in this vaccine . \n although our numbers are small , a lower proportion of vaccinated children had rotavirus - associated diarrhea , which likely reflects the protective effect of the vaccine . \n four children were infected despite having been vaccinated and their infections were as severe as those in children who had not received the vaccine . \n although predominance of the pg2 strain in this population could be due to random preponderance of this genotype and is unrelated to vaccine use , this epidemiologic finding highlights the need for postlicensure surveillance of the vaccinated population .", "role": "user" }, { "content": "we identified 21 rotaviruses in 129 patients with diarrhea in a brazilian city with high rotavirus vaccine coverage . \n all rotaviruses were genotype p[4]g2 with 1 mixed infection with p[nt]g9 . although virus predominance could have occurred randomly , the vaccine may be less protective against p[4]g2 . \n prospective surveillance is urgently needed .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: compared to the invasive type electromyogram ( emg ) for measuring each motor unit action potential ( muap ) on muscle fiber in a small area , surface emg signals can be recorded from the human body non - invasively and easily over wide skin areas . to extract the motion information , \n surface emg signal processing has been studied , especially focusing on controlling electronic devices such as a human supporting prosthetic arms and smart interface ( sornmo and laguna , 2005 ) . since \n motor commands are transmitted through internal nerve tissues or muscles , inferring such commands only from the surface emg signals is not an easy task . \n ( 2001 ) used wavelet analysis and pca analysis to classify two arm motions and two wrist motions . \n also , englehart and hudgins ( 2003 ) used the absolute mean value , the zero crossing rate , and the wavelength to classify four arm and wrist motions . \n ( 1993 ) obtained an ensemble average of emg signals , and used a neural networks ( nn ) to classify four arm motions . while the surface emg - based motion inference has been focused on upper limb or hand motions , studies on inferring dexterous finger motions \n ( 1999 ) used the gabor transform and absolute mean value to extract the features and classify four wrist motions and six finger motions in real - time learning based on nn . \n nagata et al . ( 2007 ) used absolute sum analysis , canonical component analysis , and minimum euclidean distance to classify four wrist motions and five finger motions . \n chen et al . ( 2007 ) used mean absolute values ( mav ) , the ratio of the mavs , autoregressive ( ar ) model , and linear bayesian classifier to classify 5~16 finger motions . \n however , nn classifiers ( hudgins et al . , 1993 ; chen et al . , 2007 ; nagata et al . , 2007 ) \n linear classifiers ( uchida et al . , 1992 ; englehart et al . , 2001 \n ; englehart and hudgins , 2003 ; momen et al . , 2007 ; nagata et al \n . , 2007 ) are simple but show low accuracy compared with nonlinear classifiers . in this paper , we propose a novel method to infer the finger motions using surface emg signals . \n experimentally we demonstrated that the proposed method could infer the finger flexing motions including multi - fingers as high as 97.75% . \n in addition , we examined the influence of inference accuracies with various arm postures . a signal acquisition device ( poly - g - a , laxtha inc . , korea ) , bi - polar ag - agcl electrodes ( dual electrode # 272 , noraxon u.s.a . inc . ) , and snap electrodes ( secs-4 , laxtha inc . \n the emg signal was observed at the sampling frequency of 512 hz and was filtered to reduce power line noise . \n two able - bodied subjects without any upper limb deficiencies participated in performing motions for this study and was trained before signal recording . \n the emg signal was acquired with four channels on the left forearm ( around the wrist ) for 3.0 seconds . \n , the subject did not perform any motion - termed ' relaxation ' - and waited for an acoustic alarm . after 1.5 seconds \n the subject took a long and sufficient rest between recording procedures to avoid muscle fatigue or cramp . \n , korea ) , bi - polar ag - agcl electrodes ( dual electrode # 272 , noraxon u.s.a . inc . ) , and snap electrodes ( secs-4 , laxtha inc . \n the emg signal was observed at the sampling frequency of 512 hz and was filtered to reduce power line noise . \n two able - bodied subjects without any upper limb deficiencies participated in performing motions for this study and was trained before signal recording . \n the emg signal was acquired with four channels on the left forearm ( around the wrist ) for 3.0 seconds . \n , the subject did not perform any motion - termed ' relaxation ' - and waited for an acoustic alarm . after 1.5 seconds \n the subject took a long and sufficient rest between recording procedures to avoid muscle fatigue or cramp . \n then during fk motion , the recorded raw emg from the c channel can be denoted by rkc[n ] where n is a discrete time index . \n since the emg signal has both positive and negative levels , we take an absolute of rkc[n ] . for example , fig . \n 3 shows the surface emg signal of the 2 channel during the f3 motions , r32[n ] and 32[n ] . \n the amplitude of the emg signal is a fundamental quantity which increases monotonically with the force developed in the muscle ( sornmo and laguna , 2005 ) . \n moreover , the emg signal represents a stochastic signal ( sornmo and laguna , 2005 ) . \n the entropy ( information entropy , h ) was used to represent the characteristics of each emg signal activity during finger flexing motions . \n the entropy is a measure that can reveal how much dynamical nature and the information ( shannon and weaver , 1963 ) which the signal contains . \n shin et al . 2006 ; sabeti et al . , 2009 ) although the amplitude range or the spectral bandwidth of emg and eeg signal are remarkably different , but they have a non- stationary stochastic property in common . conventionally the entropy is calculated as follows : where x denotes discrete random variable , p(m ) means the probability of the random variable x when x equals m and m=1p(m)=1 . for c channel and fk motion , we define the probability pkc(m ) as where m determines the number of total bins and max indicates the largest magnitude of the signal acquisition device . \n this value is set as max = 1,050v in the study but can be adjusted to correspond to the subject 's emg characteristics . \n then , the information entropy of the emg signal is given by after accumulating the entropy in eq . \n ( 4 ) , we build the probability density function of the entropy based on the gaussian model : here fkc(h ) is the probabilistic model based on the entropy of emg signals . \n 4 . then we can get the probability density functions fkc on each channel for 8 different finger motions . \n 5 shows the resulting models of 8 finger motions and 4 channels . assuming the statistical independence in each channel 's emg signal , the likelihood function l(k ) becomes then \n , we find k which maximizes l(k ) such that where k means the estimated motion . \n then during fk motion , the recorded raw emg from the c channel can be denoted by rkc[n ] where n is a discrete time index . \n since the emg signal has both positive and negative levels , we take an absolute of rkc[n ] . for example , fig . \n 3 shows the surface emg signal of the 2 channel during the f3 motions , r32[n ] and 32[n ] . \n the amplitude of the emg signal is a fundamental quantity which increases monotonically with the force developed in the muscle ( sornmo and laguna , 2005 ) . \n moreover , the emg signal represents a stochastic signal ( sornmo and laguna , 2005 ) . \n the entropy ( information entropy , h ) was used to represent the characteristics of each emg signal activity during finger flexing motions . \n the entropy is a measure that can reveal how much dynamical nature and the information ( shannon and weaver , 1963 ) which the signal contains . \n shin et al . 2006 ; sabeti et al . , 2009 ) although the amplitude range or the spectral bandwidth of emg and eeg signal are remarkably different , but they have a non- stationary stochastic property in common . conventionally the entropy is calculated as follows : where x denotes discrete random variable , p(m ) means the probability of the random variable x when x equals m and m=1p(m)=1 . for c channel and fk motion \n , we define the probability pkc(m ) as where m determines the number of total bins and max indicates the largest magnitude of the signal acquisition device . \n this value is set as max = 1,050v in the study but can be adjusted to correspond to the subject 's emg characteristics . \n then , the information entropy of the emg signal is given by after accumulating the entropy in eq . \n ( 4 ) , we build the probability density function of the entropy based on the gaussian model : here fkc(h ) is the probabilistic model based on the entropy of emg signals . \n 4 . then we can get the probability density functions fkc on each channel for 8 different finger motions . \n 5 shows the resulting models of 8 finger motions and 4 channels . assuming the statistical independence in each channel 's emg signal , the likelihood function l(k ) becomes then , we find k which maximizes l(k ) such that where k means the estimated motion . \n the number of training data is 25 and that of the test data is 25 . \n the accuracy for six motions ( f1 , f2 , f3 , f4 , and f8 ) using the proposed method was 100.00% without any confusions as shown in table 1 . the proposed method can infer the motions more accurately than the studies of uchida et al . \n shows likelihood for various candidates of finger motions ( each value is normalized so that the maximum was equal to one . k and k \n ( a ) k = f1 , k = f1 ( b ) k = f2 , k = f2 ( c ) k = f3 , k = f3 ( d ) k = f4 , k = f4 ( e ) k = f5 , k = f5 ( f ) k = f6 , k = f6 ( g ) k = f7 , k = f7 ( h ) k = f8 , k = f8 the average inference accuracy for four motions ( flexion of thumb , flexion of index finger , flexion of middle finger , flexion of all fingers ) in a study ( uchida et al . , 1992 ) was 86% and the accuracy for six motions ( extension of thumb , extension of index finger , extension of middle finger , extension of ring finger , extension of little finger , and ' hook ' gesture ) was 96.83% ( chen et al . , 2007 ) . \n the inference results for eight motions ( f1~f8 ) are summarized in table 2 showing the high inference accuracy . \n the inference accuracies on f1 , f4 , f5 , and f8 are 100% but the slight decreases on f2 , f3 , f6 , and f7 arise from false inference . fig . \n 7 shows the confusion matrix which visualizes the false inference among the performed motions and table 3 shows the false inference rate which indicates the rate when performed motion is inferred incorrectly . \n the false inference rate on f3 confused with f6 is 5.002.20% while that on f6 confused with f3 is 8.002.74% . \n we set nine arm postures to find out how much accuracies hold down when human changes arm posture . \n 9 show inference accuracies for five single - finger flexion motions of each posture ; the number of training data was 25 and that of test data was equal . \n the average inference accuracies are 74.72% , 83.78% , 76.22% , 81.15% , 83.60% , 62.62% , 63.07% , 76.83% , and 77.55% , respectively . \n the shaded cells indicate the maximum average accuracy in the same row and these match the diagonal cells . \n accordingly , the data of an posture is not appropriate to the reference of other postures . \n this fact indicates that a robust finger motion decoding method can not be implemented without a scheme detects changes of arm 's posture . \n we set nine arm postures to find out how much accuracies hold down when human changes arm posture . \n 9 show inference accuracies for five single - finger flexion motions of each posture ; the number of training data was 25 and that of test data was equal . \n the average inference accuracies are 74.72% , 83.78% , 76.22% , 81.15% , 83.60% , 62.62% , 63.07% , 76.83% , and 77.55% , respectively . \n the shaded cells indicate the maximum average accuracy in the same row and these match the diagonal cells . \n accordingly , the data of an posture is not appropriate to the reference of other postures . \n this fact indicates that a robust finger motion decoding method can not be implemented without a scheme detects changes of arm 's posture . \n we have proposed a new method to infer finger flexing motions based on the entropy and the maximum likelihood estimation . the average recognition accuracy for six finger motions was \n also we have shown the quantitative interpretation of the need of avoidance of use of reference dataset cross arm posture because that influences the correlations between the emg signals and the performed finger flexing motions . \n this study may trigger a new type of human - computer interface with user 's intuitive hand motions which could control electronic devices .", "role": "user" }, { "content": "we provide a novel method to infer finger flexing motions using a four - channel surface electromyogram ( emg ) . \n surface emg signals can be recorded from the human body non - invasively and easily . \n surface emg signals in this study were obtained from four channel electrodes placed around the forearm . the motions consist of the flexion of five single fingers ( thumb , index finger , middle finger , ring finger , and little finger ) and three multi.finger motions . \n the maximum likelihood estimation was used to infer the finger motions . \n experimental results have shown that this method can successfully infer the finger flexing motions . \n the average accuracy was as high as 97.75% . \n in addition , we examined the influence of inference accuracies with the various arm postures .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the neurovascular unit is comprised of the endothelial cells which make up the vessels as well as several other associated cell - types including astrocytes and perivascular cells such as pericytes and smooth muscle cells . \n pericytes wrap around vessels and are in direct contact with endothelial cells via gap junctions ( figure 1b ; reviewed in bergers and song , 2005 ) . \n these cells provide structural support for vessels and also participate in vasomotion ( vaso - constriction and dilation ) thereby affecting cerebral blood flow . \n pinocytosis and phagocytosis have been observed in pericytes , suggesting that these cells also play macrophagic roles . \n blood vessels in the brain are also surrounded by the endfeet of astrocytes ( figure 1 ) . \n astrocyte endfeet located on vessels interact directly with endothelial cells and are capable of up - take and/or release of a number of molecules ( e.g. amino acids , growth factors ; reviewed in abbott , 2002 ; abbot et al . , 2006 ) . \n astrocytes are then able to release lactate into the extracellular milieu , providing neurons with the lactate necessary for energy production via glucose metabolism ( reviewed in tsacopoulos and magistretti , 1996 ) . \n there are a number of reasons why we have included instruction and demonstration of the cerebral vasculature and the neurovascular unit in undergraduate neuroscience lecture and lab - based courses . \n the first and most obvious is that the brain ( neurons , glia , etc . ) \n natural extensions of this fact include the neural and functional consequences of ischemia ( e.g. stroke ) or decreased oxygen content ( e.g. due to high altitude ) . \n second , neuronal activity ( action potential generation ) comes at a high metabolic cost , requiring glucose metabolism . \n this fact relates to the hemodynamic correlates of neural activity which is measured by blood - oxygen - level dependent function magnetic resonance imaging ( bold - fmri ; thompson et al . \n finally , changes in vascularity ( e.g. vessel loss , angiogenesis ) have been associated with disease such as brain tumors ( jain et al . , 2007 ) , \n alzheimer s disease ( iadecola , 2004 ; girouard and iadecola , 2006 ) and epilepsy ( schwartz , 2007 ) . \n our goal was to create a collection of histological material demonstrating cerebral vasculature and cell - vascular interactions for use in a laboratory - based class for undergraduate neuroscience majors . in the process \n , we identified a number of different methods / preparations which varied in time and resource investment as well as in the fine anatomical details that were demonstrated . \n a natural extension of this work was evaluating which methods were suitable for student participation with the goal of incorporating one or more of these methods into lab exercises . \n rat and mouse brains were used for all of the preparations described below . in some cases brains \n were removed following deep anesthesia and cardiac perfusion with phosphate - buffered saline ( pbs ) followed by 4% paraformaldehyde in pb . in other cases \n brain sections of varying thickness ( 40200m ) were prepared on a vibratome or freezing - stage sliding microtome . \n we adapted methods described in zheng et al . , ( 1991 ) for visualizing vessels in unstained sections . \n perfused and unperfused sections were mounted and coverslipped in 2% gelatin in order to prevent dehydration and preserve vessel structure . with the microscope condenser at its lowest position , providing sufficient contrast , vessels can be readily identified . \n figure 2 contains photomicrographs of unstained sections with visible blood vessels in neocortex ( figure 2a ) and hippocampus ( figure 2b ) . \n an obvious advantage to using this method is that no additional reagents are required in order to demonstrate cerebral vasculature . \n students can mount and coverslip the tissue themselves and can view structures at relatively high magnification . \n cell somata are visible in addition to vessels making it possible to link the association of vascular networks embedded within the parenchyma . \n thus , this method is ideally suited for laboratory classes with access to rat / mouse brains but with limited budgets for additional reagents . \n this simple stain allows for visualization of cell somata with the ability to distinguish neurons from glia based on soma size and color . \n following nissl staining , dehydration , and coverslipping , visualization of vessels using the method described for unstained tissue is not possible . \n however , in addition to staining of neurons and glia , perivascular cells are stained , allowing for visualization of many vessels . in particular , vessels cut along the transverse axis are especially demonstrative since putative pericytes can be seen in close contact with vessels . \n figure 3 contains representative photomicrographs of nissl - stained sections where vessels found in the hippocampal fissure can be seen ( arrowheads in a ) . \n an advantage of the above method is that demonstrations can be done on tissue that was already intended to be stained as part of the planned course exercise . \n additionally , this type of demonstration can be done on archival tissue which has previously been stained . \n given the minimal additional expense required to illustrate the relationship between pericytes and blood vessels ( i.e. the cost of staining materials ) this method is advantageous for use in courses with limited budgets . \n we adapted methods described by sherman and paull ( 1985 ) for use with unperfused tissue sections . \n sections from unperfused brains are placed in a solution of 1% dab ( fluka ) in pbs for 35 mins . \n next 30% h2o2 ( fisher scientific ) is added to the dab solution to a final concentration of 0.06% h2o2 . within seconds of adding the h2o2 \n sections are left in this solution for 35 mins . and subsequently washed three times in pbs for 10 mins . \n sections are mounted on gelatin - coated slides in pbs and coverslipped after drying with permount ( fisher scientific ; cat . \n staining with dab resulted in dark brown staining of rbcs found in blood vessels with little background staining . \n visualization of vessels with this technique varied depending on section thickness , with thicker sections ( 80200m ) revealing greater detail of individual vessels and branches as well as vessels from the pial surface which penetrate into neocortex all the way to deep layers . some dab stained sections were also nissl counter - stained . \n this material provided visualization of stained vessels as well as stained somata of neurons and glia ( figure 4c , e , f ) . \n high magnification of double - stained sections allowed for clear identification of labeled vessels with stained pericytes and nearby neurons ( figure 4f ) . \n dab staining of unperfused sections is a simple method for fine visualization of cerebrovascular networks . \n when combined with nissl counter - staining , several components of the neurovascular unit can be visualized , making the additional reagents ( and the cost of those reagents ) and preparation time ( only about 45 mins . \n . nevertheless , there are two important factors to consider when deciding to use dab stained sections in the teaching laboratory . \n first , all histochemical steps requiring dab must be done wearing gloves and safety goggles while under a fume hood , making this preparation useful only when a fume hood is available . \n second , dab waste including the tissue washes in pbs must be disposed of according to institutional guidelines for hazardous waste . \n these issues might prohibit student participation in the staining process ; however , once slides are stained and prepared they can be used repeatedly over many years . \n immunocytochemical ( icc ) methods constitute the most targeted method for labeling the cerebral vasculature as well as one or more components of the neurovascular unit . \n this approach is based on the principal that unique components of the neurovascular unit show molecular specificity and that there exist primary antibodies to those molecules . \n thus , antibodies that label molecules found only in endothelial cells will exclusively label cerebral blood vessels while antibodies against molecules found only in astrocytes will only label astrocytes . \n fortunately , such antibodies exist and are available for all components of the neurovascular unit . a list of commercially - available antibodies we have used in the past for research purposes can be found in croll et al . \n , we used a commercial primary antibody against an unknown antigen found only in rat endothelial cells ( rat endothelial cell antigen , reca ; serotec ; raised in mouse ; dilution 1:1000 ) . \n immunocytochemistry performed with the anti - reca antibody resulted in the labeling of the cerebral vasculature with no background . \n figure 5 contains representative photomicrographs of stained sections containing the neocortex ( a , b ) and hippocampus ( c , d ) . unlike dab staining of unperfused tissue , \n icc with anti - reca resulted in clear labeling of the vascular tube formed by endothelial cells . \n counterstaining with nissl revealed labeled endothelial cells as well as stained pericytes ( figure 5f ) . \n we also used icc against the astrocyte - specific molecule glial fibrillary acidic protein ( gfap ; dako ; raised in rabbit ; dilution 1:10,000 ) . \n icc with a primary antibody against gfap resulted in excellent visualization of astrocytes and astrocytic processes ( figure 6 ) . \n blood vessels were evident due to the dense surrounding plexus formed by the labeled astrocytic processes . \n we next used double - icc with anti - reca and anti - gfap antibodies in order to determine whether greater visualization of these components of the neurovascular unit would be possible . \n examination of this tissue at high magnification revealed putative contacts made by astrocytes directly onto vessels ( figure 7b , d ) . \n there are a number of advantages to using icc for demonstration of cerebral vascular networks and the neurovascular unit . \n first , discrete cellular elements of the neurovascular unit can be directly targeted with antibodies to cell - specific molecules . using this approach \n , we were able to specifically label endothelial cells ( anti - reca ) and astrocytes ( anti - gfap ) . \n second , using double icc ( or triple icc ) multiple cellular elements can be revealed . using this approach \n first , primary and secondary antibodies come at a financial cost that can be prohibitive for use in many courses . \n second , icc is time consuming , and in our experience requires at least two days . \n it may be difficult to incorporate icc into student exercises in the teaching lab , as most courses generally meet only one day a week for several hours . \n therefore , in some cases , the financial expense and time requirements of icc might outweigh the increased resolution provided by icc . \n this might especially be true when comparing dab staining of unperfused tissue with the results obtained following icc for endothelial cells with anti - reca . \n both methods are valuable in demonstrating cerebral vasculature but the former can be performed with substantially less time and resources . \n third , because icc for conventional light microscopy uses dab as a chromagen , concerns related to access to a fume hood and hazardous waste disposal also apply as described above for dab staining of unperfused tissue . finally , single and especially double \n previously we demonstrated the versatility of the allen brain atlas ( aba ; www.brain-map.org ) for use in the teaching lab and lecture hall as a tool for demonstrating cerebral cytoarchitecture , cellular diversity , and area - specific gene expression ( ramos et al . , 2007 ) . \n we extended this approach and made an extensive database search for genes with expression in components of the neurovascular unit . \n endothel , and angio results in an output of 5 , 48 , and 35 genes , respectively . \n we reviewed micrographs ( > 200 ) from each of these genes but did not identify staining profiles which revealed the cerebral vasculature . \n note that for many genes , micrographs from more than one brain / case were available . for reasons that are not known , perhaps due to the methods used for in situ hybridization ( lein et al . , 2007 ) \n we next searched for other anatomical / genetic databases and identified the gensat database ( http://gensat.org/index.html ) as a useful tool for demonstrating cerebral vasculature and the neurovascular unit in silico ( gong et al . \n the gensat database contains photomicrographic atlases of brain sections taken from green fluorescent protein ( gfp ) transgenic mice which have been stained using icc ( anti - gfp antibody ) . \n moreover , histological data can be found from animals of various ages ( embryonic day 15.5 , postnatal day 7 , adult ) . \n thus , micrographs found in this database reveal the expression profile in those cells / tissues where gfp expression is driven by transgene insertion . \n for example , the gensat database contains photomicrographs from transgenic mice where gfp is driven via insertion into the gfap gene . \n as expected , gfp expression is found exclusively in astrocytes , making these micrographs useful teaching tools for demonstrating the distribution and morphology of astrocytes in the brain . \n we used the search tools of the gensat database and searched for vascular which resulted in links to histological photomicrographs from 131 transgenic mice lines where gfp immunostaining is observed in the cerebral vasculature . \n we present photomicrographs taken from the gensat database for three such mouse lines where gfp expression is clearly visible in the cerebral vasculature in figure 8 . \n an additional resource of the gensat database is the ability to zoom - in on photomicrographs and view different structures at higher magnification . \n figure 8 also contains higher magnification micrographs of vasculature in hippocampus , neocortex , and cerebellum ( right panels in a \n we also performed a gensat database search for vascular neuron , vascular glial , and vascular neuron glial which resulted in links to photomicrographs from 88 , 59 , and 39 ( respectively ) transgenic mouse lines where gfp is found in these multiple cell - types . \n representative micrographs from the id3-gfp transgenic mouse line where gfp expression can be found in endothelial cells as well as astrocytes are found in figure 9 . \n there are only advantages to using the gensat database for demonstrating the cellular components of the neurovascular unit . \n first , because the gensat database is publicly available , there is no financial commitment necessary , making its use possible at any institution . \n the option to use the gensat database is , therefore , ideally suited for use in laboratory classes with no budget available for the additional resources required for the histological demonstrations we have described above . \n moreover , histological material from the gensat database can be used in the lecture hall where it is becoming more common to have available internet access and associated lcd projectors . \n thus , demonstrating the cerebral vasculature and the cellular components of the neurovascular unit in the lecture hall requires only internet access and a video projector . \n the anatomy of the cerebral vasculature and the relationship between cells in the brain and blood vessels are very important topics in neuroscience . despite its importance in brain function \n recognizing this deficit , we evaluated several methods for use in the preparation of histological material detailing the cerebral vasculature and the neurovascular unit , which we have used in a laboratory - based course ( part of our neuroscience curriculum ) . in the present report \n , we detail histological methods which reveal the cerebral vasculature and one or more cellular components of the neurovascular unit . \n based on these details , we believe that there exist one or more preparations which can be used in most laboratory - based courses . in instances \n where there is no budget for the resources required for the preparations described , we detail how the gensat database can be used . \n finally , identification of the gensat database as a means for demonstrating the cerebral vasculature has also introduced a novel teaching tool for use in the lecture hall . \n the present report describes our efforts to prepare histological material for students to examine with conventional compound microscopes . \n this material expands our collection of materials for demonstration and instruction of neuroanatomy , which also includes whole brains from various mammalian species , models of human brains , and computer software . \n an additional goal of assessing these various methods was to determine which could be incorporated into a lab exercise , where students participate in tissue preparation and staining . \n individual instructors and departments wishing to develop lab exercises for students using one of the methods described above will have to determine which preparation will be most suitable for their respective course . moreover , to what extent students participate in the histology should be carefully determined . \n mounting and visualizing unstained tissue as well as nissl staining are two preparations ideally suited for hands - on student participation . \n in contrast , dab - staining and icc are preparations requiring significant supervision and training . \n in addition to having students participate in the histology , there are exercises that can be implemented where students analyze several features of the neurovascular unit . \n tata and anderson ( 2002 ) provide both methods and examples of several important features of the neurovasculature that can be quantified . \n these measures include vessel diameter , capillary segment length , branch point number , and capillary tortuosity . in their report , \n tata and anderson ( 2002 ) use computer - assisted camera lucida where many measures are automatically calculated by the computer . equipped with microscopes with drawing tubes in our teaching lab ( olympus bx41 \n ; 4x , 10x , 40x objectives ) , we wondered whether one or more of the measurements described by these authors could be determined using conventional camera lucida . \n figure 10 , contains a representative camera - lucida drawing of a neocortical blood vessel . as can be seen , branches of multiple order ( e.g. 2 , 3 , etc . ) \n more sophisticated measurements such as vessel tortuosity and diameter prove difficult to accurately measure using this technique . \n however , drawings can be scanned with conventional flatbed scanners and digitally imported into the free image analysis software imagej which is distributed by the nih ( http://rsb.info.nih.gov/ij/ ) . using this software package , \n a number of measures can be obtained including total area , length , and volume of the drawn vessels . \n one challenge for neuroscience educators is to make as many aspects of neuroanatomy and neurophysiology accessible to students . \n we hope that the present description of methods for demonstrating cerebral vasculature and its relationship to glia and neurons will inspire greater discussion of the neurovascular unit and brain hemodynamics ( moore and cao , 2008 ) . \n although there are additional methods for revealing the cerebral vascular which are not described here ( fonta and imbert , 2002 ; bovetti et al . , 2007 ; \n chuquet et al . , 2007 ) , the methods described above represent realistic preparations that can be incorporated for use in laboratory courses . \n we adapted methods described in zheng et al . , ( 1991 ) for visualizing vessels in unstained sections . \n perfused and unperfused sections were mounted and coverslipped in 2% gelatin in order to prevent dehydration and preserve vessel structure . with the microscope condenser at its lowest position , providing sufficient contrast , vessels can be readily identified . \n figure 2 contains photomicrographs of unstained sections with visible blood vessels in neocortex ( figure 2a ) and hippocampus ( figure 2b ) . \n an obvious advantage to using this method is that no additional reagents are required in order to demonstrate cerebral vasculature . \n students can mount and coverslip the tissue themselves and can view structures at relatively high magnification . \n cell somata are visible in addition to vessels making it possible to link the association of vascular networks embedded within the parenchyma . \n thus , this method is ideally suited for laboratory classes with access to rat / mouse brains but with limited budgets for additional reagents . \n this simple stain allows for visualization of cell somata with the ability to distinguish neurons from glia based on soma size and color . \n following nissl staining , dehydration , and coverslipping , visualization of vessels using the method described for unstained tissue is not possible . \n however , in addition to staining of neurons and glia , perivascular cells are stained , allowing for visualization of many vessels . in particular , vessels cut along the transverse axis are especially demonstrative since putative pericytes can be seen in close contact with vessels . \n figure 3 contains representative photomicrographs of nissl - stained sections where vessels found in the hippocampal fissure can be seen ( arrowheads in a ) . \n an advantage of the above method is that demonstrations can be done on tissue that was already intended to be stained as part of the planned course exercise . \n additionally , this type of demonstration can be done on archival tissue which has previously been stained . \n given the minimal additional expense required to illustrate the relationship between pericytes and blood vessels ( i.e. the cost of staining materials ) this method is advantageous for use in courses with limited budgets . \n we adapted methods described by sherman and paull ( 1985 ) for use with unperfused tissue sections . \n sections from unperfused brains are placed in a solution of 1% dab ( fluka ) in pbs for 35 mins . \n next 30% h2o2 ( fisher scientific ) is added to the dab solution to a final concentration of 0.06% h2o2 . within seconds of adding the h2o2 \n sections are left in this solution for 35 mins . and subsequently washed three times in pbs for 10 mins . \n sections are mounted on gelatin - coated slides in pbs and coverslipped after drying with permount ( fisher scientific ; cat . \n staining with dab resulted in dark brown staining of rbcs found in blood vessels with little background staining . \n visualization of vessels with this technique varied depending on section thickness , with thicker sections ( 80200m ) revealing greater detail of individual vessels and branches as well as vessels from the pial surface which penetrate into neocortex all the way to deep layers . some dab stained sections were also nissl counter - stained . \n this material provided visualization of stained vessels as well as stained somata of neurons and glia ( figure 4c , e , f ) . \n high magnification of double - stained sections allowed for clear identification of labeled vessels with stained pericytes and nearby neurons ( figure 4f ) . \n dab staining of unperfused sections is a simple method for fine visualization of cerebrovascular networks . when combined with nissl counter - staining \n , several components of the neurovascular unit can be visualized , making the additional reagents ( and the cost of those reagents ) and preparation time ( only about 45 mins . \n . nevertheless , there are two important factors to consider when deciding to use dab stained sections in the teaching laboratory . \n first , all histochemical steps requiring dab must be done wearing gloves and safety goggles while under a fume hood , making this preparation useful only when a fume hood is available . \n second , dab waste including the tissue washes in pbs must be disposed of according to institutional guidelines for hazardous waste . \n these issues might prohibit student participation in the staining process ; however , once slides are stained and prepared they can be used repeatedly over many years . \n immunocytochemical ( icc ) methods constitute the most targeted method for labeling the cerebral vasculature as well as one or more components of the neurovascular unit . \n this approach is based on the principal that unique components of the neurovascular unit show molecular specificity and that there exist primary antibodies to those molecules . \n thus , antibodies that label molecules found only in endothelial cells will exclusively label cerebral blood vessels while antibodies against molecules found only in astrocytes will only label astrocytes . fortunately , \n a list of commercially - available antibodies we have used in the past for research purposes can be found in croll et al . \n ( 2004 ; see also kasselman et al . , 2007 ) . with this in mind \n , we used a commercial primary antibody against an unknown antigen found only in rat endothelial cells ( rat endothelial cell antigen , reca ; serotec ; raised in mouse ; dilution 1:1000 ) . \n immunocytochemistry performed with the anti - reca antibody resulted in the labeling of the cerebral vasculature with no background . \n figure 5 contains representative photomicrographs of stained sections containing the neocortex ( a , b ) and hippocampus ( c , d ) . unlike dab staining of unperfused tissue , icc with anti - reca resulted in clear labeling of the vascular tube formed by endothelial cells . \n counterstaining with nissl revealed labeled endothelial cells as well as stained pericytes ( figure 5f ) . \n we also used icc against the astrocyte - specific molecule glial fibrillary acidic protein ( gfap ; dako ; raised in rabbit ; dilution 1:10,000 ) . \n icc with a primary antibody against gfap resulted in excellent visualization of astrocytes and astrocytic processes ( figure 6 ) . \n blood vessels were evident due to the dense surrounding plexus formed by the labeled astrocytic processes . \n we next used double - icc with anti - reca and anti - gfap antibodies in order to determine whether greater visualization of these components of the neurovascular unit would be possible . \n examination of this tissue at high magnification revealed putative contacts made by astrocytes directly onto vessels ( figure 7b , d ) . \n there are a number of advantages to using icc for demonstration of cerebral vascular networks and the neurovascular unit . \n first , discrete cellular elements of the neurovascular unit can be directly targeted with antibodies to cell - specific molecules . \n using this approach , we were able to specifically label endothelial cells ( anti - reca ) and astrocytes ( anti - gfap ) . \n second , using double icc ( or triple icc ) multiple cellular elements can be revealed . using this approach \n first , primary and secondary antibodies come at a financial cost that can be prohibitive for use in many courses . \n second , icc is time consuming , and in our experience requires at least two days \n . it may be difficult to incorporate icc into student exercises in the teaching lab , as most courses generally meet only one day a week for several hours . \n therefore , in some cases , the financial expense and time requirements of icc might outweigh the increased resolution provided by icc . \n this might especially be true when comparing dab staining of unperfused tissue with the results obtained following icc for endothelial cells with anti - reca . \n both methods are valuable in demonstrating cerebral vasculature but the former can be performed with substantially less time and resources . \n third , because icc for conventional light microscopy uses dab as a chromagen , concerns related to access to a fume hood and hazardous waste disposal also apply as described above for dab staining of unperfused tissue . \n previously we demonstrated the versatility of the allen brain atlas ( aba ; www.brain-map.org ) for use in the teaching lab and lecture hall as a tool for demonstrating cerebral cytoarchitecture , cellular diversity , and area - specific gene expression ( ramos et al . , 2007 ) . \n we extended this approach and made an extensive database search for genes with expression in components of the neurovascular unit . \n endothel , and angio results in an output of 5 , 48 , and 35 genes , respectively . \n we reviewed micrographs ( > 200 ) from each of these genes but did not identify staining profiles which revealed the cerebral vasculature . \n note that for many genes , micrographs from more than one brain / case were available . for reasons that are not known , perhaps due to the methods used for in situ hybridization ( lein et al \n . , 2007 ) , the aba is not well - suited for demonstrating the cerebral vasculature . \n we next searched for other anatomical / genetic databases and identified the gensat database ( http://gensat.org/index.html ) as a useful tool for demonstrating cerebral vasculature and the neurovascular unit in silico ( gong et al . \n the gensat database contains photomicrographic atlases of brain sections taken from green fluorescent protein ( gfp ) transgenic mice which have been stained using icc ( anti - gfp antibody ) . \n moreover , histological data can be found from animals of various ages ( embryonic day 15.5 , postnatal day 7 , adult ) . \n thus , micrographs found in this database reveal the expression profile in those cells / tissues where gfp expression is driven by transgene insertion . \n for example , the gensat database contains photomicrographs from transgenic mice where gfp is driven via insertion into the gfap gene . \n as expected , gfp expression is found exclusively in astrocytes , making these micrographs useful teaching tools for demonstrating the distribution and morphology of astrocytes in the brain . \n we used the search tools of the gensat database and searched for vascular which resulted in links to histological photomicrographs from 131 transgenic mice lines where gfp immunostaining is observed in the cerebral vasculature . \n we present photomicrographs taken from the gensat database for three such mouse lines where gfp expression is clearly visible in the cerebral vasculature in figure 8 . \n an additional resource of the gensat database is the ability to zoom - in on photomicrographs and view different structures at higher magnification . \n figure 8 also contains higher magnification micrographs of vasculature in hippocampus , neocortex , and cerebellum ( right panels in a c , respectively ) . \n we also performed a gensat database search for vascular neuron , vascular glial , and vascular neuron glial which resulted in links to photomicrographs from 88 , 59 , and 39 ( respectively ) transgenic mouse lines where gfp is found in these multiple cell - types . \n representative micrographs from the id3-gfp transgenic mouse line where gfp expression can be found in endothelial cells as well as astrocytes are found in figure 9 . \n there are only advantages to using the gensat database for demonstrating the cellular components of the neurovascular unit . \n first , because the gensat database is publicly available , there is no financial commitment necessary , making its use possible at any institution . \n the option to use the gensat database is , therefore , ideally suited for use in laboratory classes with no budget available for the additional resources required for the histological demonstrations we have described above . \n moreover , histological material from the gensat database can be used in the lecture hall where it is becoming more common to have available internet access and associated lcd projectors . \n thus , demonstrating the cerebral vasculature and the cellular components of the neurovascular unit in the lecture hall requires only internet access and a video projector . \n the anatomy of the cerebral vasculature and the relationship between cells in the brain and blood vessels are very important topics in neuroscience . despite its importance in brain function , \n recognizing this deficit , we evaluated several methods for use in the preparation of histological material detailing the cerebral vasculature and the neurovascular unit , which we have used in a laboratory - based course ( part of our neuroscience curriculum ) . \n in the present report , we detail histological methods which reveal the cerebral vasculature and one or more cellular components of the neurovascular unit . \n based on these details , we believe that there exist one or more preparations which can be used in most laboratory - based courses . in instances where there is no budget for the resources required for the preparations described , we detail how the gensat database can be used . \n finally , identification of the gensat database as a means for demonstrating the cerebral vasculature has also introduced a novel teaching tool for use in the lecture hall . \n the present report describes our efforts to prepare histological material for students to examine with conventional compound microscopes . \n this material expands our collection of materials for demonstration and instruction of neuroanatomy , which also includes whole brains from various mammalian species , models of human brains , and computer software . \n an additional goal of assessing these various methods was to determine which could be incorporated into a lab exercise , where students participate in tissue preparation and staining . \n individual instructors and departments wishing to develop lab exercises for students using one of the methods described above will have to determine which preparation will be most suitable for their respective course . moreover , to what extent students participate in the histology should be carefully determined . \n mounting and visualizing unstained tissue as well as nissl staining are two preparations ideally suited for hands - on student participation . \n in contrast , dab - staining and icc are preparations requiring significant supervision and training . \n in addition to having students participate in the histology , there are exercises that can be implemented where students analyze several features of the neurovascular unit . \n tata and anderson ( 2002 ) provide both methods and examples of several important features of the neurovasculature that can be quantified . \n these measures include vessel diameter , capillary segment length , branch point number , and capillary tortuosity . in their report , \n tata and anderson ( 2002 ) use computer - assisted camera lucida where many measures are automatically calculated by the computer . equipped with microscopes with drawing tubes in our teaching lab ( olympus bx41 \n ; 4x , 10x , 40x objectives ) , we wondered whether one or more of the measurements described by these authors could be determined using conventional camera lucida . \n figure 10 , contains a representative camera - lucida drawing of a neocortical blood vessel . as can be seen , branches of multiple order ( e.g. 2 , 3 , etc . ) \n more sophisticated measurements such as vessel tortuosity and diameter prove difficult to accurately measure using this technique . \n however , drawings can be scanned with conventional flatbed scanners and digitally imported into the free image analysis software imagej which is distributed by the nih ( http://rsb.info.nih.gov/ij/ ) . using this software package , \n a number of measures can be obtained including total area , length , and volume of the drawn vessels . \n one challenge for neuroscience educators is to make as many aspects of neuroanatomy and neurophysiology accessible to students . \n we hope that the present description of methods for demonstrating cerebral vasculature and its relationship to glia and neurons will inspire greater discussion of the neurovascular unit and brain hemodynamics ( moore and cao , 2008 ) . \n although there are additional methods for revealing the cerebral vascular which are not described here ( fonta and imbert , 2002 ; bovetti et al . \n , 2007 ) , the methods described above represent realistic preparations that can be incorporated for use in laboratory courses . \n previously we demonstrated the versatility of the allen brain atlas ( aba ; www.brain-map.org ) for use in the teaching lab and lecture hall as a tool for demonstrating cerebral cytoarchitecture , cellular diversity , and area - specific gene expression ( ramos et al . , 2007 ) . \n we extended this approach and made an extensive database search for genes with expression in components of the neurovascular unit . \n endothel , and angio results in an output of 5 , 48 , and 35 genes , respectively . \n we reviewed micrographs ( > 200 ) from each of these genes but did not identify staining profiles which revealed the cerebral vasculature . \n note that for many genes , micrographs from more than one brain / case were available . for reasons that are not known , perhaps due to the methods used for in situ hybridization ( lein et al . , 2007 ) \n we next searched for other anatomical / genetic databases and identified the gensat database ( http://gensat.org/index.html ) as a useful tool for demonstrating cerebral vasculature and the neurovascular unit in silico ( gong et al . \n the gensat database contains photomicrographic atlases of brain sections taken from green fluorescent protein ( gfp ) transgenic mice which have been stained using icc ( anti - gfp antibody ) \n . moreover , histological data can be found from animals of various ages ( embryonic day 15.5 , postnatal day 7 , adult ) . \n thus , micrographs found in this database reveal the expression profile in those cells / tissues where gfp expression is driven by transgene insertion . \n for example , the gensat database contains photomicrographs from transgenic mice where gfp is driven via insertion into the gfap gene . \n as expected , gfp expression is found exclusively in astrocytes , making these micrographs useful teaching tools for demonstrating the distribution and morphology of astrocytes in the brain . \n we used the search tools of the gensat database and searched for vascular which resulted in links to histological photomicrographs from 131 transgenic mice lines where gfp immunostaining is observed in the cerebral vasculature . \n we present photomicrographs taken from the gensat database for three such mouse lines where gfp expression is clearly visible in the cerebral vasculature in figure 8 . \n an additional resource of the gensat database is the ability to zoom - in on photomicrographs and view different structures at higher magnification . \n figure 8 also contains higher magnification micrographs of vasculature in hippocampus , neocortex , and cerebellum ( right panels in a \n we also performed a gensat database search for vascular neuron , vascular glial , and vascular neuron glial which resulted in links to photomicrographs from 88 , 59 , and 39 ( respectively ) transgenic mouse lines where gfp is found in these multiple cell - types . \n representative micrographs from the id3-gfp transgenic mouse line where gfp expression can be found in endothelial cells as well as astrocytes are found in figure 9 . \n there are only advantages to using the gensat database for demonstrating the cellular components of the neurovascular unit . \n first , because the gensat database is publicly available , there is no financial commitment necessary , making its use possible at any institution . \n the option to use the gensat database is , therefore , ideally suited for use in laboratory classes with no budget available for the additional resources required for the histological demonstrations we have described above . \n moreover , histological material from the gensat database can be used in the lecture hall where it is becoming more common to have available internet access and associated lcd projectors . \n thus , demonstrating the cerebral vasculature and the cellular components of the neurovascular unit in the lecture hall requires only internet access and a video projector . \n the anatomy of the cerebral vasculature and the relationship between cells in the brain and blood vessels are very important topics in neuroscience . despite its importance in brain function \n recognizing this deficit , we evaluated several methods for use in the preparation of histological material detailing the cerebral vasculature and the neurovascular unit , which we have used in a laboratory - based course ( part of our neuroscience curriculum ) . in the present report \n , we detail histological methods which reveal the cerebral vasculature and one or more cellular components of the neurovascular unit . \n moreover we have identified the strengths and limitations of each preparation . based on these details , \n we believe that there exist one or more preparations which can be used in most laboratory - based courses . in instances where there is no budget for the resources required for the preparations described , we detail how the gensat database can be used . \n finally , identification of the gensat database as a means for demonstrating the cerebral vasculature has also introduced a novel teaching tool for use in the lecture hall . \n the present report describes our efforts to prepare histological material for students to examine with conventional compound microscopes . \n this material expands our collection of materials for demonstration and instruction of neuroanatomy , which also includes whole brains from various mammalian species , models of human brains , and computer software . \n an additional goal of assessing these various methods was to determine which could be incorporated into a lab exercise , where students participate in tissue preparation and staining . \n individual instructors and departments wishing to develop lab exercises for students using one of the methods described above will have to determine which preparation will be most suitable for their respective course . \n mounting and visualizing unstained tissue as well as nissl staining are two preparations ideally suited for hands - on student participation . \n in contrast , dab - staining and icc are preparations requiring significant supervision and training . \n in addition to having students participate in the histology , there are exercises that can be implemented where students analyze several features of the neurovascular unit . \n tata and anderson ( 2002 ) provide both methods and examples of several important features of the neurovasculature that can be quantified . \n these measures include vessel diameter , capillary segment length , branch point number , and capillary tortuosity . in their report , \n tata and anderson ( 2002 ) use computer - assisted camera lucida where many measures are automatically calculated by the computer . equipped with microscopes with drawing tubes in our teaching lab ( olympus bx41 ; 4x , 10x , 40x objectives ) , we wondered whether one or more of the measurements described by these authors could be determined using conventional camera lucida . \n figure 10 , contains a representative camera - lucida drawing of a neocortical blood vessel . as can be seen , branches of multiple order ( e.g. 2 , 3 , etc . ) \n more sophisticated measurements such as vessel tortuosity and diameter prove difficult to accurately measure using this technique . \n however , drawings can be scanned with conventional flatbed scanners and digitally imported into the free image analysis software imagej which is distributed by the nih ( http://rsb.info.nih.gov/ij/ ) . using this software package , \n a number of measures can be obtained including total area , length , and volume of the drawn vessels . \n one challenge for neuroscience educators is to make as many aspects of neuroanatomy and neurophysiology accessible to students . \n we hope that the present description of methods for demonstrating cerebral vasculature and its relationship to glia and neurons will inspire greater discussion of the neurovascular unit and brain hemodynamics ( moore and cao , 2008 ) . \n although there are additional methods for revealing the cerebral vascular which are not described here ( fonta and imbert , 2002 ; bovetti et al . , 2007 \n , the methods described above represent realistic preparations that can be incorporated for use in laboratory courses .", "role": "user" }, { "content": "one challenge of neuroscience educators is to make accessible to students as many aspects of brain structure and function as possible . \n the anatomy and function of the cerebrovasculature is among many topics of neuroscience that are underrepresented in undergraduate neuroscience education . recognizing this deficit , we evaluated methods to produce archival tissue specimens of the cerebrovasculature and the neurovascular unit for instruction and demonstration in the teaching lab . \n an additional goal of this project was to identify the costs of each method as well as to determine which method(s ) could be adapted into lab exercises , where students participate in the tissue preparation , staining , etc . in the present report , we detail several methods for demonstrating the cerebrovasculature and suggest that including this material can be a valuable addition to more traditional anatomy / physiology demonstrations and exercises .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: muscle fibres are nearly incompressible and so must increase in girth as they shorten . \n this transverse expansion requires that the fibres in pennate muscle rotate to greater pennation angles during shortening to ensure they still pack together in close proximity [ 2 , 3 ] . due to these fibre rotations , \n the fibres shorten at a lower velocity than the muscle belly in a process known as muscle belly gearing [ 46 ] , promoting a greater force and power production from the muscle . understanding how muscle fibres change shape during contraction \n it is commonly assumed that whole muscles maintain a constant volume during contraction , in a similar manner to their constituent fibres . \n many muscle models are one - dimensional and thus assume constant thickness of the muscle belly [ 3 , 710 ] . \n some studies have modelled muscle as 2d structures but have implemented a constant area assumption [ 6 , 1113 ] , and other studies of 3d properties implement constant or nearly incompressible volumes [ 1417 ] . however , whole muscle may change volume to a greater extent than fibres , due to a variable amount of blood that may pool and be pumped out from the muscle , through the action of the muscle contraction . \n additionally , recent imaging studies have shown that muscle varies in thickness in a complex and muscle - specific manner . \n muscle thickness is not constant during contraction and can vary for both isometric and dynamic [ 5 , 6 , 19 ] contractions . \n the belly gearing within a muscle can vary according to the mechanical demands of the contraction [ 5 , 6 , 19 ] , and so the fibres may exist at a range of different pennation angles for a given fibre length : it has been suggested that this variability is related to the load and stretch of connective tissue such as aponeurosis [ 6 , 15 , 19 ] . \n currently we do not know how the changes in transverse fibre dimensions relate to dynamic changes in fibre geometry , belly gearing , and thus the functional output of the muscle . \n recent developments in muscle imaging have allowed the longitudinal properties of muscle fibres to be determined . \n diffusion - tensor mri can identify the longitudinal direction of muscle fibres [ 2024 ] allowing fibres to be tracked and their length calculated . however , mri imaging necessitates prolonged , isometric contractions and thus is not suitable for dynamic studies of gearing . \n b - mode ultrasound imaging of muscle allows the fascicles to be imaged at faster rates , and a range of automated approaches have been used to quantify the fascicle lengths and even curvatures during dynamic contractions [ 2528 ] . \n neither these mri nor ultrasound techniques have allowed the width of the fascicles , or a measure of their transverse expansion , to be quantified . \n however , muscle fascicles appear as nearly parallel , repeating bands within b - mode ultrasound images and the width of these bands can potentially be extracted by frequency decomposition of the images . \n the purpose of this study was to develop a method to extract information on the spatial frequencies of the fascicular structure within the muscle belly from b - mode ultrasound images and to relate this information to the fascicle size , shape , and orientations during muscle contraction . \n six male subjects took part in this study ( age 28.8 5.5 years ; mass 78.3 6.2 kg ; height 178 2.3 cm ; mean sd ) . \n all subjects provided informed consent in accordance with requirements from the university office of research ethics . \n images were acquired from the medial gastrocnemius ( mg ) and lateral gastrocnemius ( lg ) of the right leg during ankle plantarflexion contractions . \n subjects were seated on a dynamometer ( system 3 , biodex , new york , usa ) with their knee held at 135 , their shank horizontal , and their foot secured to a footplate on the dynamometer . \n the central axis of the dynamometer was aligned to meet the axis through the medial and lateral maleoli . \n subjects performed cyclic ankle extensions against isotonic loads , in time to the beat of a metronome . \n the dorsiflexion torque was limited to 0.5 n m , and three plantarflexion conditions were presented ( 5@0.42 , 25@0.35 , and 5@16 : torque [ n m ] @ cycle frequency [ hz ] ) ; each condition had a 15 range of motion from 5 to 20 plantarflexion . \n each trial consisted of 10 cycles of contraction , from which the middle 5 were analyzed . \n the mg and lg muscle bellies were imaged using 128-element ( 60 mm width ) linear array b - mode ultrasound probes ( echoblaster 128 , telemed , lithuania ) , scanning at 40 hz . the probes were aligned to the fascicle planes to obtain nearly continuous lines for the fascicles in each image . \n the probes were secured to the leg using custom mounts with adhesive and elasticized bandages . \n the probes were measured from the mg and lg simultaneously , and were synchronized to the position p and torque data t from the dynamometer ( recorded at 1000 hz : usb-6229 , national instruments , austin , tx , usa ) . \n each ultrasound frame formed a square image f(x , y ) of n = 512 pixels per side with each greyscale pixel indexed by its x- and y - coordinate ( figure 1 ) . \n images were manually digitized ( imagej software , nih , maryland , usa ) to identify three coordinates on the superficial aponeurosis , three coordinates on the deep aponeurosis , and two coordinates on a representative fascicle . \n aponeuroses were described using second - order polynomials that were fit to both the superficial and the deep coordinates using least - squares minimization , and the muscle belly thickness ly was calculated as the mean distance between the aponeuroses . \n the fascicle inclination d within the fascicle plane was given by the angle between the x - axis and the vector between the two digitized fascicle points . \n the fascicle length lf was given by the length of the linear line passing through the fascicle coordinates that intersected the best - fit linear lines through the superficial and deep aponeuroses . \n this method enhances the tubular structures in the image that are formed by the fascicles and is capable of resolving tubular structures of different radii and has previously been applied to b - mode ultrasound images [ 25 , 26 , 30 ] . \n here we followed rana and coworkers by using scales of 1.5 , 2 , 2.5 , and 3 . \n the region of interest was taken as the area of muscle tissue within the filtered image that was bounded by the aponeuroses , and a strip , 10 pixels wide , was removed inside the aponeuroses to ensure that the region of interest contained no features that were aligned with the aponeuroses . \n muscle fascicles appear as dark lines in the image and connective tissue between the fascicles appears as bright structures that parallel the fascicles . \n the striped nature of the fascicles is enhanced and retained within the filtered image and is characterized by the spatial frequency of the stripes . \n the spatial frequencies f(u , v ) of the filtered image f(x , y ) were determined by a 2d discrete fourier analysis of the region of interest , where \n ( 1)f(u , v ) = 1nx=0n1y=0n1f(x , y ) [cos(2(ux+vy)n)+jsin(2(ux+vy)n)],j=1 . \n the amplitude spectra for the region of interest describe the amplitudes of the pixel intensities across a range of frequencies : \n ( 2)|f(u , v)|=re2(u , v)+im2(u , v ) . \n this is reduced to a single frequency value for each direction ( u and v ) using the mth moment of frequency : \n ( 3)u=u = b1b2v = b1b2[|f(u , v)|mu]u = b1b2v = b1b2|f(u , v)|m , v=v = b1b2u = b1b2[|f(u , v)|mv]v = b1b2u = b1b2|f(u , v)|m . \n the moments of frequency were calculated across the frequency range of b1 = 4 to b2 = 120 , and this contained more than 99% of the power of the amplitude spectra . \n the wavelengths for the fascicle stripes x and y were given by \n ( 4)x=1u , y=1v. \n the dominant repeating structure within the region of interest is given by the muscle fascicles . for large inclinations ( 90 ) x would be small and y would be large ; conversely , for small inclinations ( 0 ) x would be large and y would be small . \n the fascicle inclination f ( relative to the x - direction ) can be determined from the fourier analysis as follows : \n ( 5)f = arctan(yx ) . \n the best value for m was determined by comparing d and f for 1 m 8 ( see statistics section below ) . \n the wavelengths x and y reflect the dominant characteristics of the repeated fascicles in the region of interest . \n they provide information not only on the fascicle inclination , but also on the wavelength of the fascicle stripes f , that is , the wavelength of the stripes in a transverse direction across the fascicles : \n ( 6)f=xsinf . \n the muscle belly thickness ly , fascicle length lf , and the wavelength f were normalized by their respective means that occurred throughout the five contraction cycles to yield normalized terms l^y , l^f , and ^f , respectively . pixel brightnesses in each ultrasound image are a measure of the echogenicity of the material being scanned . \n it is possible that , as the muscle expands in a transverse direction , there is an uneven expansion of fascicular and connective tissue . \n this would result in a change in the distribution of pixel brightness within the region of interest . \n this possibility was examined by quantifying the mean pixel brightness bp within the region of interest . \n the best value for m was determined from the correlation coefficient r and the root - mean - square error ( rmse ) between d and f for each contraction sequence . \n the effect of m on r and rmse was determined with anova with subject ( random ) , muscle , and condition as factors ( minitab v16 , minitab inc . , state college , pa , usa ) . for each condition \n the time was normalized to each contraction ( 0 to 360 ) , with 0 occurring at the midpoint of each dorsiflexion movement . \n the parameters p , t , l^f , l^y , d , f , ^f , and bp were each described by a fourier series of the form \n ( 7)c1+a1sin(1+)+a2sin(2 + 2 ) , \n where the coefficients c1 , a1 , and 1 describe the mean value , the amplitude , and the phase for the first harmonic . \n the effect of subject ( random ) , muscle , condition , parameter , and muscle - by - parameter interaction on these fourier coefficients was determined using anova . \n subjects performed a series of isotonic plantarflexions ( figure 2 ) , with the ankle plantarflexor torque increasing during each plantarflexion . the fascicle length within the medial and lateral gastrocnemius shortened during each plantarflexion , and this coincided with an increase in the inclination angle of the fascicles . \n during fascicle shortening the thickness of both the fascicles and muscle belly increased , with the relative increases in the muscle belly thickness being greater than those for the fascicles . during each contraction cycle , the pixel intensity within the region of interest varied , with the lowest intensities occurring when the fascicles were shortest but thickest . \n the estimates of the inclination angle based on the fourier transform were dependent on the moment of frequency , m , selected . \n there was no significant effect of m on the correlation between the inclination angle determined by manual digitization , d , and the inclination angle determined from the discrete fourier transform , f ; however , there was a significant effect of m on the root - mean - square error between these values ( figure 3 ) . \n a value of m = 5 resulted to be close to the greatest correlation and the lowest rmse and so was selected for further analysis . \n when considered across all subjects , muscles , and contraction conditions , the rmse for m = 5 was 3.4. the error between the two measures of inclination was partly due to the smaller amplitude of change in inclination for the f than for d . \n the anova showed there was a significant effect of the muscle , subject , parameter , and muscle - by - parameter interaction on the amplitude of the cyclic changes , a1 . \n the main effects from the anova ( figure 4 ) showed that the a1 for mg was 0.41 greater than for lg . \n the interaction effect showed that a1 for d for the mg was greater than for the lg ; however , this effect was not seen for f . \n the magnitude of the parameter effects on a1 can be seen in tables 1 and 2 . \n the anova showed there was a significant effect of the subject , parameter , and muscle - by - parameter interaction on the phase of the cyclic changes , o1 . \n the interaction effect showed that o1 for ^f was slightly smaller and for l^y was slightly larger for the mg than for the lg : in other words , there was a greater phase difference between the cycles of fascicle thickness and muscle belly thickness for the mg than for the lg . \n the magnitude of the parameter effects on a1 can be seen in tables 1 and 2 : there was no significant difference in the phase difference between l^y , d , and f . \n + 180 ) there was no significant difference between its phase and those for l^y , d , and f , and so the timing of fascicle length shortening exactly matches the increases in fascicle thickness . \n this study shows that there is information within b - mode images of the muscle bellies that has spatial frequencies that change in a cyclical manner during repeated contractions . \n these spatial frequencies are due to the fascicular ( or vessel - like ) structures within the muscle that were resolved by the multiscale vessel enhancement filtering . \n 2d information from the images was retained by the 2d discrete fourier transform of the images and allowed the inclination angle of the muscle fascicles to be determined , f : this is a feature of the fascicles that could be validated against the manually determined inclination angles , d ( figure 3 ) . \n when ultrasound images are manually digitized , the inclination angles tend to reflect the dominant fascicle features within the image . however , there is variation of fascicle orientations across each image and sometimes nonfascicular features that may also occur in the image , and these features would influence the spatial frequencies determined by automated methods that consider the whole region of interest such as the discrete fourier transform as used in this study . the accuracy in these automated approaches can be maximized by careful selection of images that contain minimal nonfascicular structures or by masking the undesired features within the region of interest . the inclinations d and f in this study measured the angles between the fascicles and the x - axis of the ultrasound images . \n by contrast , pennation angles measured in previous ultrasound studies are defined in different ways , for example , the angle between the fascicle and the superficial aponeurosis , or the deep aponeurosis or the mean direction of the superficial and deep aponeuroses [ 3 , 3133 ] . in this study , \n the f was approximately 13 and 8 for the mg and lg , respectively , for an ankle plantarflexion angle of 5 ( calculated from data in tables 1 and 2 ) , and these are approximately 5 smaller than the pennations reported for seated subjects in the same dynamometer . \n the transverse wavelength of the fascicle strains ^f changed in a cyclical manner , in time with the fascicle shortening ( tables 1 and 2 ; figure 4 ) . as the fascicles shorten their transverse strain increased . \n the mean pixel brightness also decreased as the transverse strain increased ( tables 1 and 2 ; figures 2 and 4 ) , indicating a greater proportion of darker elements in the image for higher ^f . within the muscle bellies , \n it is possible that the increase in bp with increased ^f indicates that the transverse strain in the muscle fascicles is underestimated by ^f ( that includes elements from both fascicles and connective tissue ) . \n the transverse strain was calculated by resolving x and y into the transverse direction . in theory , these values could be resolved into the longitudinal direction to provide a measure of longitudinal fascicle strain ; however , this is practically not possible . in an ideal ultrasound image \n , all the fascicles would appear as continuous lines between the two aponeuroses : these would have a longitudinal spatial frequency of less than 1/512 pixels and therefore would be beyond the resolution of the technique . \n in reality , fascicles appear as partial lines between the aponeuroses , and the exact length of each line segment is very sensitive to the exact orientation of the fascicles relative to the scanning plane . during contraction \n the fascicles can change their orientation relative to the scanning plane , and thus fluctuations in line - length would reflect their 3d orientation as well as the fascicle length and therefore preclude measurements of fascicle length using these methods . assuming that the muscle fibres ( and presumably the fascicles ) maintain a constant volume during contraction , then they must increase in girth as they shorten . if an additional assumption is made that the increase in girth for the muscle fascicles is radially symmetrical then the muscle fascicles should have a poisson ratio of 0.43 for a longitudinal strain of 0.2 , where the poisson ratio is the ratio of the transverse strain / longitudinal strain . \n the poisson ratio can be calculated from this study as the ratio of ( a1 for ^f)/(a1 for l^f ) . \n the mean from this study was 0.09 0.01 and was thus much smaller than expected . \n as discussed above , it is possible that ^f is an underestimate , leading to low . an alternative estimate for the transverse strain for the fascicles can be calculated from the manually digitized parameters . if it is assumed that the entire muscle belly consists of fascicles that are parallel to each other , then the distance between the aponeuroses must equal the width of the fascicles acting in parallel , adjusted by their inclination ; thus the normalized fascicle thickness will equal l^y / cosd . \n this alternative estimate of fascicle thickness yields a mean of 0.20 0.02 that is still less than expected . \n data from this study thus indicate that the increase in the transverse width of the fascicles does not meet that expected for isovolumetric muscle fibres that show radial symmetry in their expansion in girth . \n it will be necessary to investigate the fascicular expansion in the direction perpendicular to the scanning plane to identify the reasons for this discrepancy . \n changes to muscle belly thickness occur with changes in both fascicle thickness and fascicle rotations to different pennation angles , with the fascicle thickness and pennation angle being related to each other via intramuscular pressure , transverse forces , and compliance in connective tissues such as aponeuroses and intramuscular connective tissue . \n it is possible that the differences in whole - muscle bulging between mg and lg that have been reported in previous studies [ 3 , 5 , 6 , 19 , 32 ] may reflect differences in the direction of the transverse or perpendicular ( out of plane ) bulging of the fascicles , or due to differences in connective tissue properties and the tendency for the fascicles to rotate . in this study \n we found similar transverse expansion and poisson ratio of the fascicles occurring in both the mg and lg ( tables 1 and 2 ) , thus indicating that differences in the bulging of the muscle belly are caused more by differences in connective tissue properties and the tendency for the fascicles to rotate than by differences in the fascicle bulging per se . \n this study describes a method to determine the transverse strain in the muscle fascicles during contraction and is the first study to describe these strains during dynamic and voluntary contractions . \n however , it should be noted that this methodological study has been constrained to a small set of contractions performed by male subjects : it will be important to understand how transverse bulging of the fascicles changes with both age and gender . \n nonetheless , the results show that increases in transverse width are exactly timed with the reductions in the longitudinal length of the fascicles . \n surprisingly , the magnitude of the transverse strains , as imaged within the ultrasound scanning planes , appears smaller than expected . however , the imaging methods preclude the measurement of strains perpendicular to the ultrasound scans . \n fully 3d studies are needed to explore the exact nature of shape changes to the fascicles during contraction and to relate these to the mechanisms of muscle contraction .", "role": "user" }, { "content": "when skeletal muscle fibres shorten , they must increase in their transverse dimensions in order to maintain a constant volume . in pennate muscle , this transverse expansion results in the fibres rotating to greater pennation angle , with a consequent reduction in their contractile velocity in a process known as gearing . understanding the nature and extent of this transverse expansion is necessary to understand the mechanisms driving the changes in internal geometry of whole muscles during contraction . \n current methodologies allow the fascicle lengths , orientations , and curvatures to be quantified , but not the transverse expansion . \n the purpose of this study was to develop and validate techniques for quantifying transverse strain in skeletal muscle fascicles during contraction from b - mode ultrasound images . \n images were acquired from the medial and lateral gastrocnemii during cyclic contractions , enhanced using multiscale vessel enhancement filtering and the spatial frequencies resolved using 2d discrete fourier transforms . \n the frequency information was resolved into the fascicle orientations that were validated against manually digitized values . \n the transverse fascicle strains were calculated from their wavelengths within the images . \n these methods showed that the transverse strain increases while the longitudinal fascicle length decreases ; however , the extent of these strains was smaller than expected .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: by using site - directed mutagenesis and reverse genetics as described ( 9 ) , we generated recombinant viruses with na from the pandemic ( h1n1 ) 2009 virus a / auckland/1/2009 and the remaining genes from a / pr/8/34 . \n recombinant viruses were constructed with no na mutations , with single i117v or i117 m na mutations , and with dual i117v + h275y or i117 m + h275y na mutations . \n nai sensitivity analysis with a fluorescence - based na inhibition assay ( 10 ) found that compared with a recombinant with no mutations , the i117v mutation conferred a 5-fold increase in the oseltamivir concentration required to inhibit 50% ( ic50 ) of the na activity , a 2-fold increase in zanamivir ic50 , and no change in peramivir ic50 . in comparison , the i117 m mutation had no effect on sensitivity to any of the nai drugs ( table 1 ) . * \n nai , neuraminidase inhibitor ; ic50 , 50% inhibitory concentration ; , not applicable . \n -fold differences compared with ic50 value of rg - wt , except for a / perth/504/2010 , which was calculated for on the basis of comparison to the mean ic50 of circulating pandemic ( h1n1 ) 2009 viruses . \n n = 3,334 , obtained through world health organization global influenza surveillance and response system , april 2009june 2011 . \n mean and sd of peramivir ic50 values were based on analysis of 273 isolates . \n mean ic50 sd values of the a / perth/504/2010 virus and the rg strains were calculated on the basis of values derived from 3 independent assays . the dual i117v + h275y variant had oseltamivir and peramivir ic50 values that were 3 and 2 higher , respectively , than the ic50 of a virus with the h275y mutation alone . \n in contrast , the ic50 of the i117 m + h275y variant was not substantially different from that of the h275y mutant for all of the nais , further demonstrating the lack of effect of the i117 m mutation on nai sensitivity . \n analysis of 3,334 pandemic ( h1n1 ) 2009 strains received at the world health organization ( who ) collaborating centre , melbourne , victoria , australia , through the who global influenza surveillance and response system from april 2009 through june 2011 , showed that 1 isolate had a i117v na mutation , but no i117 m variants were detected . the i117v variant , a / perth/504/2010 ( genbank accession nos . \n ha : epi279165 and na:279164 ; www.gisaid.com ) , was isolated from a 5-year - old boy and had a 4-fold and 3-fold reduction in sensitivity to oseltamivir and zanamivir , respectively , similar to that of the rg - i117v strain ( table 1 ) . neither the patient nor his family members or siblings were undergoing any nai treatment . apart from the a / perth/504/2010 strain , no other pandemic ( h1n1 ) 2009 strains with an i117v na mutation were reported on genbank or public sequence databases , demonstrating the high degree of conservation at this residue . \n however , 45 na sequences from highly pathogenic influenza a ( h5n1 ) strains in the public sequence databases contained the i117v mutation . \n the i117v mutation in highly pathogenic influenza a ( h5n1 ) viruses has previously been reported to confer a 5- to 16-fold reduction in oseltamivir sensitivity and up to a 4-fold reduction in zanamivir sensitivity ( 6,7 ) . \n residue i117 is not in direct structural contact with oseltamivir , although it has neighboring residues that are known to affect drug susceptibility such as e119 , r118 , and v116 . by using the predictive computational force field foldx ( 11 ) in yasara ( 12 ) \n , we modeled the effects on structural stability of i117v , i117 m , h275y , i117v + h275y , and i117 m + h275y mutations in the pandemic ( h1n1 ) 2009 na crystal structure ( protein data bank no . \n the model estimated local destabilization effects for the known oseltamivir - resistance mutation h275y , which served as a control for the approach , whereas substantially smaller effects for i117v were observed , and almost no stability change was predicted for the i117 m mutation ( table 2 ) . \n + i117 m and h275y + i117v were not substantially different from that predicted for the h275y mutation alone . when the na inhibition assay ic50 data ( table 1 ) were compared with the estimated local destabilization effects of the mutants ( table 2 ) , a good correlation was demonstrated between the 2 methods , although functional testing showed a larger difference between the h275y and the h275y + i117v variants than that estimated in the computational model . \n the destabilization effect of i117v appears to be mainly caused by the increase in an internal cavity ( figure 1 ) , which could increase flexibility of neighboring residues that form part of the drug - binding framework . \n the h275y and i117v mutations are at opposite sides of the binding pocket ( figure 2 ) and , although they are not expected to affect each other s side - chain environment directly , the simultaneous changes on both sides of the drug show more effects on oseltamivir binding than the single mutations alone . structural details of neuraminidase mutations from pandemic ( h1n1 ) 2009 viruses . \n all were modeled with foldx ( 11 ) in yasara ( 12 ) in the context of the pandemic ( h1n1 ) 2009 virus neuraminidase crystal structure ( protein data bank : 3nss ) . \n cavities within the structure ( 1.4 radius water probe ) are shown in magenta . \n comparison of wildtype i117 mutation from pandemic ( h1n1 ) 2009 viruses ( green residues ; protein data bank : 3nss ) with foldx / yasara model of i117v + h275y double mutant ( red residues ) ( 11,12 ) . \n oseltamivir is added as reference ( protein data bank : 3clo ) and shown in magenta . \n although the i117v mutation was detected in 1 isolate from australia , analysis of sequences from public databases shows that it is extremely rare in pandemic ( h1n1 ) 2009 viruses to date . \n although the i117v mutation causes a mild reduction in oseltamivir sensitivity , on the basis of pharmacokinetic data , we expect that a variant carrying this mutation would not be clinically resistant ( 14,15 ) . \n however , in combination with h275y , the i117v mutation has a synergistic effect on oseltamivir resistance , raising the oseltamivir ic50 to 3 that caused by the h275y mutation alone and to a level that is likely to be clinically important . \n previous studies have reported that the i117 m mutation may confer oseltamivir resistance ( 4,5 ) , although in this study we have demonstrated that this is not the case . \n these results therefore highlight the importance of assaying functional drug resistance when reporting novel mutations because resistance can not be assumed on the basis of data from other amino acid substitutions at the same residue .", "role": "user" }, { "content": "analysis of mutations i117v and i117 m in the neuraminidase of influenza a pandemic ( h1n1 ) 2009 viruses showed that i117v confers a mild reduction in oseltamivir sensitivity and has a synergistic effect of further increasing resistance when combined with h275y . \n contrary to recent reports , the i117 m mutation does not alter oseltamivir sensitivity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: home care instructions provided to patients after insertion of complete dentures are important in maintaining oral mucosal health and the longevity of the prostheses . beyond the concern for esthetics , poor oral hygiene can lead to biofilm formation and oral infections , especially in elderly patients.1 the most commonly used method for cleaning denture \n is mechanical cleaning using detergent , soap , or toothpaste.2 older patients often face a difficulty in mechanical removal of plaque because of reduced manual dexterity or impaired vision or physical limitations.3 chemical cleansers are alternatives to mechanical cleaning . for cleaning \n , dentures should be immersed in the chemical solutions for a certain period of time . \n these solutions may include one or a combination of various active agents , such as sodium hypochlorite ( naocl ) , chlorhexidine , alkaline peroxides , enzymes , and diluted acids.4 an ideal denture cleanser should reduce biofilm accumulation and be antibacterial , antifungal , non - toxic , short - acting , easy to use , and cost - effective.145 also , an ideal denture cleanser should not have any detrimental effect on the denture materials.4 however , long - term immersion or incorrect use of chemical denture cleansers may adversely alter the physical and mechanical properties of the artificial denture teeth and base materials.5 artificial teeth are an important component of conventional complete denture and play a significant role in the esthetics and functional treatment outcomes.6 currently , there are different types of artificial teeth available on the market . \n porcelain teeth have been used because of their superior esthetics , resistance to wear and discoloration properties.7 however , acrylic resin teeth are more beneficial because of their natural texture , high resiliency , adequate mechanical strength , ease of occlusal adjustment , and high bond strength to the denture base.8 conventional acrylic resin denture teeth are primarily composed of polymethylmethacrylate ( pmma ) polymers . to improve mechanical properties , highly cross - linked acrylic resin and microfilled composite resin ( isosit ) \n teeth have been developed.9 a newer generation of composite resin teeth has been introduced , consisting of a nanohybrid composite ( nhc ) material on a urethane dimethacrylate ( udma ) matrix , which includes various types and sizes of fillers as well as pmma clusters . \n the nhc material comprises a variety of fillers , including highly cross - linked inorganic macrofillers , highly densified inorganic microfillers , and silanized nanoscale fillers based on silicon dioxide.10 artificial denture teeth usually consist of enamel and dentin layers , and some composite resin teeth may also have intermediate layers . \n the enamel layer is often removed due to masticatory wear or chairside occlusal or laboratory adjustments , leading to exposure of the subenamel layers.6 it has been reported that the different layers of denture teeth are affected differently by denture cleansers.11 studies have shown that dental materials differ in their susceptibility to oral bacteria , which has most commonly been attributed to differences in their surface roughnesses.121314 surface roughness is of a particular clinical relevance for artificial teeth as it can cause staining , biofilm retention , or difficult biofilm removal.515 hardness , which is defined as resistance of a material to plastic deformation measured as a force per unit area under indentation , has been used to assess the mechanical properties of materials , ease of finishing and polishing , resistance to scratching , and wear resistance of many restorative materials , including artificial denture teeth.612 the immersion of a denture fabricated using these new generation artificial teeth to achieve disinfection or sterilization is important . \n however , chemical denture cleansers may have negative effects on the physical and mechanical properties of the artificial denture teeth.3161718 therefore , the findings of this study will enable dental practitioners to select the most appropriate artificial denture tooth materials and/or cleansers for their patients . \n there are numerous studies that report the changes in the mechanical and physical properties of artificial teeth exposed to sodium hypochlorite16171920 and sodium perborate.20 however , to our knowledge , there has been no study evaluating the effects of cleansers on new generation artificial denture teeth . \n hence , this study aims to compare the effect of naocl and alkaline peroxide solutions on the surface roughness and hardness of different types of artificial teeth with various compositions . \n the hypothesis tested was that immersion in naocl and effervescent alkaline peroxide tablets would influence the surface roughness and microhardness of all artificial teeth tested . \n four types of artificial molar denture teeth were used in this study ( table 1 ) . \n all teeth were sectioned with a low - speed cutting machine ( isomet 1000 , buehler ltd . , lake bluff , il , usa ) to obtain bucco - lingual slices of 2.3 0.1 mm thickness . \n forty - two specimens were prepared for each artificial tooth group as described in table 1 . \n the slice at the each end of mesial and lingual sides that was thinner than 2.3 mm was not used . \n each specimen was embedded in autopolymerizing acrylic resin ( steady resin scheu - dental gmbh , iserlohn , germany ) using a rectangular plastic mold . \n a custom - made surveyor was used to ensure the specimen surfaces were parallel to the workbench . \n the specimen surfaces were ground flat and finished with silicon carbide abrasive paper ( english abrasives & chemicals , stafford , england ) in the order of 200- , 400- , 600- , 800- , and 1200-grit , and then polished using an aluminum oxide paste ( universal polishing paste , ivoclar vivadent , schaan frstentum , liechtenstein ) . \n the specimens were then stored in distilled water at room temperature ( 23 2 ) for 7 days before the immersion procedures . according to the manufacturer , the denture teeth involved two to four layering schemes ( cervical - dentine - enamel - pearl effect layers ) . \n hence , surface roughness and microhardness tests were carried out on the dentine layer of each specimen to simulate clinical conditions . \n the artificial teeth specimens were randomly divided into three subgroups according to the denture cleanser types ( n = 14 ) ( table 1 ) : \n corega tabsnaocldistilled water ( control ) \n distilled water ( control ) corega tabs ( effervescent denture cleanser ) were prepared according to the manufacturer 's instructions , by adding one tablet to 200 ml of warm water ( 40 ) . \n after each cycle of 5 minutes , the soaking solution was discarded and the specimens were rinsed thoroughly under running water . between the soaking procedures , \n immersion procedures were repeated 180 times to simulate 180-day of use . for the group immersed in naocl , \n the total immersion period was 15 hours to simulate 5 minutes of daily immersion.21 for the control group , the specimens were kept in distilled water at room temperature for 15 hours . \n distilled water was preferred because of its uniformity and purity.21 following immersion procedures , all specimens were subjected to surface roughness measurement tests . \n prior to the surface roughness analysis , all specimens were cleaned in an ultrasonic bath and dried . \n the surface roughness ( ra in m ) was measured on each specimen surface using the mitutoyo surftest-402 surface roughness tester ( mitutoyo corporation , tokyo , japan ) with a standard cut - off value of 0.8 mm . prior to measuring \n , the profilometer was calibrated against a reference block , whose the ra value was 3.05 m . \n three tracings at randomly selected locations on each specimen were made at a distance of 4 mm apart , and the mean value was calculated . after surface cleaning using a steam cleaner , the vickers hardness number ( vhn ) measurement was performed on all specimens with a microindentation system ( hmv micro hardness tester , shimadzu corporation , tokyo , japan ) using the vickers diamond indenter with a 0.5 n load for a dwell time of 15 seconds . \n three indentations per specimen were made with a spacing of at least 50 m between each indentation . \n data analysis was performed using spss for windows , version 11.5 ( spss inc . , chicago , il , usa ) . \n data were shown as mean standard deviation or median ( min max ) , where applicable . \n the statistical analyses were performed using kruskal - wallis test , conover 's nonparametric multiple comparison test , and spearman 's rank correlation analysis . \n a p value less than .05 was considered statistically significant . however , for all possible multiple comparisons , the bonferrroni correction was applied to control type i error . \n the data obtained after surface roughness and microhardness tests were determined by comparing each specimen value after immersion in distilled water and denture cleansers . \n table 2 demonstrates the surface roughness values ( ra in m ) of the different artificial teeth groups subjected to various denture cleansers . while orthotyp pe and postaris dlc showed no significant difference ( p > .005 ) , the roughness values decreased in the control group in the order of sr phonares ii , sr orthosit pe , and orthotyp pe ( p < .005 ) . \n when comparing denture cleanser groups , naocl caused significantly higher roughness values on orthotyp pe group ( p < .001 ) . \n however , there was no statistically significant difference between denture cleansers for the other groups ( p > .005 ) . \n microhardness values for the different types of artificial teeth subjected to the various denture cleansers are shown in table 3 . \n orthosit pe had significantly higher microhardness values after immersion in distilled water when compared with the other groups ( p < .001 ) . \n for sr orthotyp pe , corega tabs caused higher microhardness values than distilled water and naocl ( p < .005 ) . \n microhardness values decreased significantly for the sr orthosit pe group in the order of immersion in distilled water , naocl , and corega tabs ( p < .001 ) . \n sr postaris dlc specimens showed higher microhardness when immersed in distilled water or naocl compared with immersion in corega tabs ( p < .003 ) . \n there was no statistically significant correlation between roughness and microhardness values ( r = 0.104 , p = .178 ) . \n the present study evaluated the effect of various denture cleansers on surface roughness and microhardness of different types of artificial denture teeth . \n the null hypothesis tested was partially accepted ; naocl and effervescent alkaline peroxide tablets changed the surface roughness and/or hardness of only some of the artificial teeth tested . \n the sr phonares ii specimen surfaces showed no difference after immersion in any of the mediums . \n there are controversial opinions in the literature related to the effects of denture cleansers on surface roughness and hardness of denture materials.171822 differing compositions of cleansing solutions and materials , and different testing methods may be responsible for the controversy . \n the surface roughness of dental materials has been shown to be of particular importance for adhesion of oral bacteria;121314 hence , smoother surfaces will result in denture longevity.18 profilometry and its numerical data has been shown to be useful in the evaluation of the roughness of dental materials.18 bollen et al.13 found a threshold value of 0.2 m , suggesting that low roughness levels do not influence adhesion . in the present study , although naocl caused significantly higher roughness values on orthotyp pe group specimens , the surface roughness values were lower than the threshold for all tested specimens ; therefore , adverse effects of denture cleansers on surface roughness may be neglected . \n a valid tool for determining the hardness of rigid polymers is the vickers microhardness test , which is based upon the ability of the surface of a material to resist point penetration under a certain load.23 hence , this test has been used in many studies,1920 including the present study , to evaluate the hardness of denture base acrylic resin and artificial denture teeth . \n cross - linkage is a descriptive term for the composition of artificial denture teeth , and the manufacturers do not indicate the number or exact type of covalent links present in the polymeric structure.17 it is possible that different cleansing solutions have variable influences on commercial teeth . \n this suggests that the number of pressing during the tooth 's manufacturing process is equally as important as cross - linkage , mainly because of the residual monomer absence . in the present study , \n this result may be explained by the fact that these artificial teeth are less resistant to the loss of plasticizers and do not have cross - linking chains , which reduce their resistance . \n this is also in accordance with the results of pisani et al.16 however , a decrease in hardness was noted in sr orthosit pe and sr postaris dcl group specimens immersed in corega tabs . in agreement with the results of previous studies,1620 \n the absorption of aqueous cleansing solutions may have caused a decrease in hardness because these solutions may have acted as plasticizers . \n small molecules of water diffuse into the polymer mass and cause relaxation of polymer chains , consequently reducing the hardness of the artificial teeth , which is similar to the process that occurs in acrylic resin.24 grinding the tooth surfaces may have formed microcracks , leading to infiltration of the solutions and accelerating the process of pmma plasticization . \n denture cleaning by immersion in a chemical solution should not involve any physical , mechanical , or chemical change in the artificial teeth . \n no significant effect on surface roughness or microhardness of the new generation nanohybrid artificial teeth was found after immersion in any of the cleansing mediums used in the present study , which reflected a promising future preference . \n however , in vivo and further in vitro research should be carried out to clarify the mechanical , physical , and optical properties of this new material . \n examination of the artificial teeth surfaces using scanning electron microscopy could have been carried out after immersion in the various cleansers for visual comparison . \n furthermore , several types of artificial teeth of different compositions of only one brand have been evaluated in this study , and in vitro , not clinical , tests were performed . in future studies , other oral environment conditions , such as continuous cyclic loading and the use of artificial saliva , could be evaluated . \n furthermore , chemical denture cleansers could be accompanied by mechanical brushing to determine the association related to changes in surface properties . \n within the limitations of the present in vitro study , the following conclusions may be drawn : naocl caused significantly higher roughness values on orthotyp pe group specimens ( p < .001 ) . \n corega tabs caused higher microhardness values than distilled water and naocl for sr orthotyp pe specimens ( p < .005 ) . \n microhardness values decreased significantly for the sr orthosit pe ( p < .005 ) and sr postaris dcl groups \n there was no statistically significant correlation between roughness and microhardness values ( r = 0.104 , p = .178 ) . \n immersion in any of the tested cleansing solutions did not cause a significant change in the surface roughness or microhardness of the new generation sr phonares ii artificial teeth .", "role": "user" }, { "content": "purposethe aim of this study was to compare the effects of different denture cleansers on the surface roughness and microhardness of various types of posterior denture teeth.materials and methods168 artificial tooth specimens were divided into the following four subgroups ( n=42 ) : sr orthotyp pe ( polymethylmethacrylate ) ; sr orthosit pe ( isosit ) ; sr postaris dcl ( double cross - linked ) ; and sr phonares ii ( nanohybrid composite ) . \n the specimens were further divided according to the type of the denture cleanser ( corega tabs ( sodium perborate ) , sodium hypochlorite ( naocl ) , and distilled water ( control ) ( n=14 ) ) and immersed in the cleanser to simulate a 180-day immersion period , after which the surface roughness and microhardness were tested . \n the data were analyzed using the kruskal \n wallis test , conover 's nonparametric multiple comparison test , and spearman 's rank correlation analysis ( p<.05).resultsa comparison among the denture cleanser groups showed that naocl caused significantly higher roughness values on sr orthotyp pe specimens when compared with the other artificial teeth ( p<.001 ) . furthermore , corega tabs resulted in higher microhardness values in sr orthotyp pe specimens than distilled water and naocl ( p<.005 ) . \n the microhardness values decreased significantly from distilled water , naocl , to corega tabs for sr orthosit pe specimens ( p<.001 ) . \n sr postaris dlc specimens showed increased microhardness when immersed in distilled water or naocl when compared with immersion in corega tabs ( p<.003 ) . \n no correlation was found between surface roughness and microhardness ( r=0.104 , p=.178).conclusionnaocl and corega tabs affected the surface roughness and microhardness of all artificial denture teeth except for the new generation nanohybrid composite teeth .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: over the last decade , numerous nonskeletal disease associations have been reported with vitamin d deficiency , including type 2 diabetes mellitus ( t2 dm ) . circulating 25-hydroxyvitamin d ( 25(oh)d ) concentrations \n compared to healthy controls , subjects with t2 dm have been observed to have significantly lower circulating 25(oh)d concentrations [ 35 ] . \n perhaps not coincidently , both vitamin d deficiency and t2 dm share the same risk factors , including african - american , asian , or hispanic ethnicity , increased adiposity , age , and physical inactivity ( which may translate to decreased time spent outdoors or reduced sun exposure ) [ 6 , 7 ] . \n seasonal variations in glucose and insulin concentrations have been reported , which may correlate with seasonal variations in 25(oh)d concentrations . \n although not within the scope of this review , vitamin d has likewise been implicated in the development of type 1 diabetes mellitus due to its modulation of the immune system . \n t2 dm is considered a state of insulin resistance ( beta cell compensation ) and insulinopenia ( beta cell decompensation ) and is characterized by progressive deterioration in beta cell function and eventual loss of beta cell mass . \n the mechanism by which vitamin d deficiency and t2 dm are related is not well known . \n we performed a computerized pubmed search of english language original and review articles through march 2009 using the terms vitamin d , insulin , insulin sensitivity , insulin resistance , insulin secretion , and other related terms . \n this review provides a comprehensive summary of the literature available relating vitamin d to insulin secretion and sensitivity , including the potential mechanisms mediating the vitamin d - glucose homeostasis relationship ; supportive or contradictory cross - sectional , prospective , and intervention studies ; as well as potential interactions of vitamin d with the insulin like growth factor ( igf ) system and influences of vitamin d receptor ( vdr ) gene polymorphisms . \n pittas et al . have summarized the biological evidence implicating a potential influence of vitamin d on glucose homeostasis . \n the inferences for the manifold roles of vitamin d include the presence of specific vitamin d receptors ( vdrs ) on pancreatic -cells , the expression of 1--hydroxylase enzyme in pancreatic -cells which catalyzes the conversion of 25(oh)d to 1 , 25-dihydroxyvitamin d ( 1,25(oh)2d ) , the presence of a vitamin d response element in the human insulin gene promoter , and the presence of vdr in skeletal muscle . \n in addition , 1,25(oh)2ddirectly activates transcription of the human insulin receptor gene , activates peroxisome proliferator activator receptor- , stimulates the expression of insulin receptor , and enhances insulin - mediated glucose transport in vitro . \n animal and in vitro studies provide compelling evidence that vitamin d may play a functional role in the preservation of glucose tolerance through its effects on insulin secretion and insulin sensitivity . \n vitamin d deficient rabbits and mice present with impaired insulin secretion , and supplementation with vitamin d corrects the defect [ 1922 ] . \n mice with mutations in the vdr have impaired insulin secretion and lower glucose tolerance than those with functional receptors . in vitro \n , 1,25(oh)2d induces the biosynthesis of insulin in rat pancreatic islet cells , and in another study , inhibited free fatty acid - induced insulin resistance ( i.e. , improved glucose uptake ) in cultured myocytes in a dose - dependent manner . \n although the skeletal effects of vitamin d occur via an endocrine mechanism , there may be an autocrine / paracrine role of vitamin d in insulin target tissues . \n pancreatic -cells express the vitamin d receptor ( vdr ) as well as the pivotal enzyme 1-hydroxylase [ 12 , 13 ] . \n vdr is also expressed by both human skeletal muscle and adipose tissue [ 26 , 27 ] , which are the main determinants of peripheral insulin sensitivity . \n notably , skeletal muscle expression of vdr declines with age , as does insulin sensitivity . \n vitamin d deficiency may influence its effects on insulin secretion and sensitivity via its effects on intracellular calcium . elevated intracellular calcium impairs postreceptor binding insulin action , such as the dephosphorylation of glycogen synthase and of insulin regulatable glucose transporter ( glut-4 ) [ 30 , 31 ] . \n vitamin d deficiency results in elevated parathyroid hormone ( pth ) , which in turn is known to elevate intracellular calcium . sustained \n elevations of intracellular calcium may inhibit insulin - target cells from sensing the brisk intracellular calcium fluxes necessary for insulin action , such as glucose transport . \n pancreatic -cells also depend on an acute intracellular calcium increase for insulin secretion , which may also be attenuated with elevated cytosolic calcium . \n another possible mechanism is that elevated intracellular calcium enhances calmodulin binding to insulin receptor substrate-1 ( irs-1 ) , which interferes with insulin - stimulated tyrosine phosphorylation and pi3-kinase activation [ 3537 ] . \n indeed , pth has been shown to be inversely associated with insulin sensitivity [ 38 , 39 ] . on the other hand , kamycheva et al . \n did not find significant differences in insulin or glucose metabolism in subjects with secondary hyperparathyroidism versus controls . \n nevertheless , dichotomization based on serum 25(oh)d concentrations appeared to determine differences in insulin sensitivity . \n it is arguable that the insulin resistance seen in vitamin d deficient subjects is not fully explained by these aforementioned molecular mechanisms alone . \n reports on associations between insulin secretion and 25(oh)d have been inconsistent ( table 1(a ) ) . \n the differences in this relationship are likely due to differences in subject populations and disparate methods to determine insulin secretion . \n boucher et al . reported a significant positive association between 25(oh)d and oral glucose tolerance test- ( ogtt- ) induced insulin secretion in east london asians at risk for t2 dm , although orwoll et al . reported no association between 25(oh)d and meal - induced insulin secretion in men with t2 dm ( mean glycosylated hemoglobin , hba1c : 11.5 3.5% ) \n it is possible that vitamin d is unable to augment insulin secretion in uncontrolled t2 dm subjects who have already exhausted their insulin secretory capacity . \n analyses of the national health and nutrition examination survey 19891994 ( nhanes iii ) disclosed that serum 25(oh)d was inversely associated with diabetes risk and measures of insulin resistance despite there is no association between 25(oh)d concentrations and the homeostasis model assessment of -cell function ( homa- , an index of -cell function derived from fasting insulin and glucose concentrations ) . \n significant inverse associations have been reported between 25(oh)d and ogtt - induced insulin secretion in elderly dutch men , hyperglycemic clamp - induced insulin response in glucose tolerant subjects of various ethnic backgrounds , and hyperglycemic clamp - induced insulin response in norwegian subjects with secondary hyperparathyroidism . \n although an inverse association between 25(oh)d and insulin secretion may seem contradictory to the hypothesis that vitamin d is necessary for -cell synthesis of insulin , subjects with insulin resistance , but not t2 dm , often experience compensatory hyperinsulinemia . \n thus , inverse statistical associations of vitamin d with insulin secretion may be mediated through vitamin d influences on insulin sensitivity , as shown by chiu et al . . \n in general , cross - sectional studies , including large - scale population studies such as nhanes iii [ 5 , 45 ] , have shown a significant positive relationship between serum 25(oh)d and measures of insulin sensitivity [ 4 , 5 , 40 , 43 , 4548 ] ( table 1(b ) ) . \n this relationship has been corroborated in a variety of populations including pregnant and pediatric populations [ 49 , 50 ] . \n a limitation to the available cross - sectional data is that , with the exception of few studies [ 40 , 43 , 51 , 52 ] , many studies investigating relationships between 25(oh)d and insulin secretion and sensitivity have used indirect proxy measures , such as fasting insulin , fasting or postchallenge glucose , the homeostasis model assessment of insulin resistance ( homa - ir ) , homa- , the quantitative insulin - sensitivity index ( quicki ) , postchallenge insulin , or hba1c [ 4 , 5 , 42 , 4649 , 53 ] , instead of the paragon investigation and the hyperglycemic clamp . \n the accuracy of proxy measures of insulin sensitivity may vary depending on obesity status or ethnicity . \n in addition , the majority of studies investigating the association between 25(oh)d and insulin metabolism have used bmi , rather than a direct measure of adiposity as a covariate in analyses [ 4 , 5 , 40 , 41 , 43 , 51 , 53 , 55 ] . \n the accuracy of bmi in reflecting adiposity has been questioned , and when studies have used both dual energy x - ray absorptiometry-(dxa- ) derived total body fat and bmi in models to predict 25(oh)d , only total body fat emerged as an independent predictor [ 5658 ] . \n also , many studies have not accounted for confounders that may be mediating associations between 25(oh)d and insulin sensitivity , such as physical activity and calcium intake , each of which has been shown to be significantly associated with insulin sensitivity and may , thus , corrupt data analysis . \n furthermore , inherent to the nature of the cross - sectional study design , studies using this design are limited in their ability to infer causation . \n investigated the associations of 25(oh)d with insulin sensitivity ( determined with a euglycemic - hyperinsulinemic clamp ) in morbidly obese caucasian women . \n serum 25(oh)d was not associated with insulin sensitivity in these subjects either before bariatric surgery or 5 and 10 years post - surgery . suggesting that the often found low serum 25(oh)d concentrations before and after bariatric surgery do not negatively affect insulin sensitivity . \n other anthropometric factors , such as the extreme adiposity prior to surgery and the improved metabolic and lipid profile postsurgery , likely had a greater impact than 25(oh)d on insulin sensitivity . \n nhanes iii data did not show a significant relationship between 25(oh)d and homa - ir in african americans despite there are significant results in caucasian and mexican americans , and alemzadeh et al . reported a significant relationship between serum 25(oh)d and hba1c in caucasian but not in african americans . \n similarly , in a meta - analysis of the association between 25(oh)d and t2 dm prevalence , pittas et al . found an or of 0.36 ( 95% ci : 0.160.08 ) for the highest concentrations of 25(oh)d compared to the lowest , although this significant or only appeared after african americans were excluded from analyses . \n it is unclear whether disparate ethnicities have different optimal serum concentrations of 25(oh)d , and the relationships of serum 25(oh)d with glucose homeostasis should be examined in african americans using direct measures of insulin sensitivity and secretion to confirm a nugatory effect of 25(oh)d . \n few studies have examined the predictive value of 25(oh)d on future risk of t2 dm [ 6062 ] . \n forouhi et al . found baseline 25(oh)d to be inversely associated with fasting glucose , fasting insulin , and homa - ir at the 10-year follow - up of the medical research council ely prospective study ( european - origin adults ) , independent of baseline outcome values . \n similarly , in the mini - finland health study , the relative risk for t2 dm was 0.60 in subjects with the highest 25(oh)d quartiles ( mean 70.9 nmol / l ) compared to those in the lowest quartile ( mean 22.4 nmol / l , p = .01 ) , after adjustment for age , sex , and month of blood draw . \n this observation , however , was subsequently negated to nonsignificance ( p = .05.07 ) after further adjustments for confounders such as bmi and leisure - time exercise . a pooled , nested case - control analysis of the mini - finland health study and the finnish mobile clinic health examination survey revealed an 82% reduced risk of t2 dm incidence in men with the highest 25(oh)d quartiles ( mean 69.11 \n nmol / l ) versus those with the lowest quartiles ( mean 22.3 nmol / l , p < \n intermediate markers of t2 dm risk , such as insulin resistance , were not reported in the latter studies . \n the role of serum 25(oh)d in predicting the risk for t2 dm and insulin resistance in non - caucasian ethnic populations , such as those with african , asian , and indian - descent is worth investigating , as these populations are at high risk for t2 dm and low 25(oh)d concentrations . \n table 2(a ) summarizes results of available vitamin d intervention studies on insulin secretion . \n gedik and akalin first reported impairment in insulin secretion in 4 relatively healthy subjects presenting with vitamin d deficiency , and their insulin secretion was normalized after 6 months of vitamin d supplementation . \n other studies have reported significant improvement in insulin secretion after variable doses and lengths of vitamin d3 supplementation in subjects with or at risk for t2 dm [ 41 , 66 ] , as did a study using alphacalcidiol as the intervention . \n antithetically , studies that have used 1 , 25(oh)2dto supplement have not shown significant improvement in insulin secretion [ 42 , 68 ] . \n insofar as the pancreatic -cell is endowed with the ability to produce 1 , 25(oh)2d by an autocrine mechanism , supplementation with vitamin d3 or d2 to produce a rise in circulating 25(oh)d may be superior as 25(oh)d serves as the necessary substrate for extra - renal 1--hydroxylase [ 90 , 91 ] . of note \n , there was a tendency toward a better insulin secretory response in recently diagnosed ( within 3 years ) t2 dm subjects supplemented with 1 , 25(oh)2d , supporting the previous notion that vitamin d supplementation may not be useful once -cells are exhausted . \n studies using homa- , an indirect index of -cell function derived from fasting values of glucose and insulin , as the insulin secretory outcome , have likewise not shown significant changes in insulin secretion [ 69 , 70 ] . \n the majority of available studies , regardless of a positive or negative outcome , are limited by their lack of a randomized , placebo - controlled design [ 41 , 65 , 66 , 68 ] , and/or nonreporting of serum 25(oh)d to ensure attainment of sufficient vitamin d concentrations [ 42 , 65 , 67 , 68 ] . with regards to insulin sensitivity , \n studies in subjects with chronic renal disease have shown intravenous vitamin d administration to improve insulin sensitivity [ 92 , 93 ] . \n human studies in relatively healthy populations without renal disease have been inconsistent , particularly those using indirect indices of insulin sensitivity ( table 2(b ) ) . \n studies using fasting values of glucose and insulin ( e.g. , homa - ir ) , which primarily reflect hepatic insulin sensitivity , have generally not shown significant improvements in insulin sensitivity after vitamin d intervention [ 66 , 69 , 71 , 72 ] . \n posthoc analyses , however , from a randomized placebo - controlled trial revealed improved homa - ir after 3 years of 700 iu vitamin d3 plus 500 mg calcium citrate daily supplementation in caucasian subjects with impaired fasting glucose , but not normal fasting glucose . \n vitamin d supplementation is more likely to influence peripheral insulin sensitivity , as shown by nagpal et al . \n , whereby 3 doses of 120000 iu vitamin d3 fortnightly versus placebo showed significant improvements in a 3-hour ogtt - derived insulin sensitivity index , but not indices derived from fasting values , in asian - indian men . \n additional studies that have used ogtt - derived indices are limited by relatively small sample sizes , lack of randomized placebo - controlled design , and short - term supplementation [ 74 , 75 ] . \n the few studies investigating vitamin d effects on directly measured insulin sensitivity using the euglycemic clamp technique or intravenous glucose tolerance testing ( ivgtt ) have not shown improvements in insulin sensitivity with supplementation [ 52 , 76 , 77 ] ( table 2(b ) ) . \n the null effects in 2 studies [ 52 , 76 ] may , at least in part , be explained by the vitamin d sufficiency of the subject populations . \n as suggested by jorde and figenschau , supplementation of vitamin d - sufficient populations may not incur additional glucose regulating effects . \n in addition , all studies used the active form of vitamin d ( 1 , 25(oh)2d ) or an analog of this hormone to supplement , and the increase in 25(oh)d was minimal in one study and unable to be evaluated in the others [ 52 , 77 ] . \n it is plausible that results would have differed in vitamin d deficient subjects supplemented with cholecalciferol or ergocalciferol to produce a rise in serum 25(oh)d . \n there is no universally accepted definition for the optimal serum concentration of 25(oh ) d , thus complicating vitamin d supplementation trials . for prevention of rickets or osteomalacia , a serum 25(oh)d concentration of 25 mmol / l ( 10 ng / ml ) is considered sufficient ; yet to prevent osteoporosis and maximize calcium absorption a concentration of 75 nmol / l ( 30 ng / ml ) is suggested . \n vitamin d deficiency is defined as serum 25(oh)d < 50 nmol / l ( < 20 ng / ml ) . as summarized by pepper et al . \n , there is also no universally accepted standard regimen for the correction of vitamin d deficiency . \n it is also unknown what length of intervention or duration of follow - up once vitamin d is replete is required to appreciate the effects of vitamin d on insulin sensitivity and secretion . further confounding conclusions are that the reported vitamin d intervention studies are heterogeneous in their research design and length , form , and dosage of vitamin d supplementation \n many also lack the demonstration of achieving a therapeutic level of vitamin d. additionally , the majority of intervention trials have been performed in caucasian subjects . \n there is a need for more intervention studies in subjects of non - caucasian descent . \n polymorphisms in the vdr gene , namely , taqi , bsmi , apai , and foki , have been identified and may influence insulin secretion and sensitivity , although relatively few studies have been conducted and , results have varied ( table 3 ) . among a cohort of bangladeshi asians , \n the apai vdr gene polymorphism was associated with insulin secretion index ; however reanalysis of this cohort revealed taqi to be the independent predictor of the insulin secretion index . \n in contrast , the bsmi vdr gene polymorphism was associated with postprandial c - peptide concentrations among caucasian hungarians . \n the apai and bsmi vdr gene polymorphisms were also shown to be associated with fasting glucose and homa - ir , respectively , among a large cohort of caucasian americans , and bsmi was associated with fasting glucose in a large cohort of germans . the linkage disequilibrium that exists between the taqi , bsmi and apai polymorphisms \n the foki vdr polymorphism was also associated with indices of insulin resistance among polish men and among caucasian americans , although the studies contradicted each other regarding the specific genotype associated with insulin resistance ( ff versus ff ) . despite the support for a vdr gene polymorphism influencing insulin secretion and resistance , case - control studies , in general , \n have not found statistical differences in vdr gene polymorphism frequencies among subjects with t2 dm versus controls [ 8689 ] . \n did , however , report a higher prevalence of t2 dm among german subjects with the bb genotype of the bsmi vdr gene polymorphism compared to those with the bb genotype . \n the association between vdr gene polymorphisms and insulin secretion and sensitivity should be confirmed using direct methods , such as ivgtt or clamp studies . \n in addition , these associations should be investigated in african americans and other non - caucasian ethnicities . \n there is some evidence to suggest that vitamin d status may interact with the igf system to influence glucose homeostasis [ 61 , 64 ] . \n analysis of the 1958 british birth cohort revealed a lower risk for metabolic syndrome in subjects with the highest tertiles of both serum 25(oh)d and igf-1 concentrations , although there was no statistical interaction between 25(oh)d and igf-1 in any of the individual components of the metabolic syndrome and hba1c . in a prospective study , \n forouhi et al . found an inverse relationship between baseline 25(oh)d and 10-year follow - up fasting and 2-hour glucose only in subjects with baseline igf binding protein-1 ( igfbp-1 ) concentrations below the median . \n an interaction between vitamin d and the igf axis to influence glucose homeostasis seems conceivable as each has been shown to directly enhance the other [ 95 , 96 ] . \n there is mechanistic support that vitamin d may influence both insulin secretion and insulin sensitivity and subsequently t2 dm incidence . in general , \n cross - sectional and prospective studies support the role of vitamin d in the prevention of t2 dm . despite the inherent limitations of cross - sectional and prospective study designs , these types of study designs are useful for preliminary research to suggest which specific populations may respond to vitamin d interventions . \n future cross - sectional and prospective studies should focus on non - caucasian ethnicities with a high risk of both t2 dm and vitamin d deficiency . \n cross - sectional and prospective studies should account for potential confounders of the vitamin d - t2 dm relationship , including age , ethnicity , obesity , physical activity , and diet , as well as use direct measures of adiposity , insulin sensitivity , and insulin secretion . \n results of vitamin d intervention studies are equivocal ; yet many studies are flawed by lack of randomized , placebo - controlled design , use of indirect measures of insulin secretion and sensitivity , small sample size , and inability to show relevant increases in serum 25(oh)d . \n the lack of protocol for optimal dosing of vitamin d and lack of definition for optimal therapeutic concentrations of serum 25(oh)d further inhibit the application of vitamin d intervention trials . \n one could also postulate that interactions with the igf system , vdr gene polymorphisms , or other individual genotypes of subjects might becloud the conflicting conclusions . \n it is plausible that vitamin d has a role in improving insulin secretion and sensitivity , but may not be effective in insulinopenic situations , or that beyond a certain concentration of vitamin d level , further supplementation of vitamin d sufficient subjects may not be of value in improving glucose homeostasis . \n based on a review of literature , a true , direct link between vitamin d and risk for t2 dm has not yet been conclusively established , although several unknowns remain . \n it is not known what the optimal concentration of vitamin d for glucose homeostasis should be and what duration of follow - up is necessary to appreciate the effects of vitamin d on insulin secretion and sensitivity . \n it is also unclear if a serum 25(oh)d threshold exists for which vitamin d does not incur additional benefits for glucose homeostasis , if vitamin d influences are ethnic - specific , or if there are different optimal thresholds for different ethnic groups . \n large , well - controlled , randomized studies are required to clarify these important unknowns and define the relationship between vitamin d status and glucose homeostasis .", "role": "user" }, { "content": "vitamin d functions are not limited to skeletal health benefits and may extend to preservation of insulin secretion and insulin sensitivity . \n this review summarizes the literature related to potential vitamin d influences on glucose homeostasis and insulin sensitivity . \n cross - sectional data provide some evidence that circulating 25-hydroxyvitamin d ( 25(oh)d ) is inversely associated with insulin resistance , although direct measurements of insulin sensitivity are required for confirmation . reported associations with insulin secretion , however , are contradictory . \n available prospective studies support a protective influence of high 25(oh)d concentrations on type 2 diabetes mellitus risk . \n there is a general lack of consistency in vitamin d intervention outcomes on insulin secretion and sensitivity , likely due to differences in subject populations , length of interventions , and forms of vitamin d supplementation . \n vitamin d receptor gene polymorphisms and vitamin d interactions with the insulin like growth factor system may further influence glucose homeostasis . \n the ambiguity of optimal vitamin d dosing regimens and optimal therapeutic concentrations of serum 25(oh)d limit available intervention studies . future studies , including cross - sectional and prospective , should be performed in populations at high risk for both vitamin d deficiency and type 2 diabetes mellitus . \n well - designed , placebo - controlled , randomized intervention studies are required to establish a true protective influence of vitamin d on glucose homeostasis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: epidemiological studies concerning the incidence of type 1 and type 2 diabetes worldwide show a continuous increase in the number of cases [ 1 - 4 ] . \n it is believed that the number of diabetic patients will double in europe and worldwide in the nearest future [ 1 - 6 ] . \n changes in the retina developing in the course of diabetes are defined as diabetic retinopathy and considered the most threatening eye complication of the disease . \n diabetic retinopathy is referred to as the main cause of blindness in industrialized and middle income countries . according to the world health organization in the year 2002 as many as 37 million of the world population \n since it is a major socioeconomic issue , it is important to determine all mechanisms that may lead to its development [ 4 , 8 ] . \n diabetic retinopathy has been clinically divided into non - proliferative and proliferative types . the time from a mild stage to advanced changes varies among individuals . \n hyperglycemia , especially chronic long term hyperglycemia , plays a key role in the pathomechanism of dr . \n epidemiological studies indicate that tight glucose control for type 1 patients as well as type 2 patients is recessing micro vascular diabetes complication including diabetic retinopathy . on the other hand , although hyperglycemia is the main mechanism for the changes in the pathomechanism of diabetic retinopathy , recent evidence found out that moderate to severe hypo- glycemia , especially in type 1 diabetes , may contribute to development of neuroretinal apoptosis . \n demand for oxygen and nutrients is so high that they are delivered to the retina via double vasculature , through the choroid , supplying blood to the outer layers and primary vasculature of the retina which supplies its inner layers . \n the imbalance between oxygen demand and supply leads to the risk of ischemic injury in the retina . \n the outer layer of the retina is more resistant to hypoxia in contrast to the inner layers . \n the blood - retina barrier plays a protective role for the neural layer of the retina . the internal blood - retina barrier is formed by vascular endothelial cells . \n tight connections between adjacent endothelial cells and epithelial cells are necessary to control the passage of the fluid and soluble substances through the blood - retina barrier and to block permeation of toxic particles and plasma components to the retina . \n vascular changes in diabetes affect small vessels ( microangiopathy ) , including precapillary arterioles , capillaries and venules . in the vessels , pericytes become lost , basement membrane is thickened , endothelial cells are damaged and proliferated [ 14 , 15 ] . as a result of these processes , \n the ischemic retina may produce the hypoxia - inducible factor ( hif ) that can release vascular endothelial growth factor ( vegf ) to vascularize again the hypoxic areas . \n then , vegf binds vegf receptors on vascular cells of the retina causing angiogenesis . in this way \n , new vessels appear on the retina and optic nerve disc ( proliferative retinopathy ) . \n additionally , in diabetic patients were observed the higher levels of pro - inflammatory cytokines , such as interleukin-6 , 7 and 8 in the aqueous humor and vitreous humor , which increase adherence of leukocytes to vascular endothelial cells [ 18 , 19 ] . \n it is believed that chronic inflammation in the vascular walls additionally promotes vessel occlusion and enhances retinal hypoxia [ 20 - 22 ] . \n found out that advanced glycation end products ( ages ) have a key role in the development of dr . \n ages exert deleterious effects inducing vascular changes and cause oxidative stress , influencing crucial pro - inflammatory and pro - sclerotic cytokines . \n in addition , the receptor for ages ( rage ) can be expressed in cells of retina causing inflammatory process . \n in addition , the age - rage axis has important role in the neurodegeneration and microvascular changes in dr . \n the changes occurring in the retina in the course of diabetes have been well known . \n the majority of the available studies have focused on the vascular retinal lesions , assuming that they are the cause of altered neuronal function . \n this may result from the fact that vascular changes are visible in ophthalmoscopy , whereas the neural retina is transparent . \n recently , some authors have suggested that the functional neuronal changes and neuronal viability may contribute to the pathogenic mechanisms of diabetic retinopathy that begin soon after diabetes onset [ 23 - 28 ] . \n these suggestions seem to be confirmed by abnormal results of electrophysiological examination of the retina in diabetic patients , who also show vascular changes in the eye fundus that exacerbate with the disease progression [ 13 , 30 - 34 ] . \n thus , neurodegenerative lesions and accelerated apoptosis of retinal neurons are likely to precede vascular changes in the fundus of the eye [ 27 - 29 ] . \n the layer of the nerve fibers is made up of ganglion cell processes that run along the inner retina and converge at the posterior eyeball to form the optic nerve . \n the inner limiting membrane is composed of mller cell basements and joins the vitreous humor basement . \n round connections between photoreceptors and mller glial cells permeate almost the whole thickness of the retina . \n mller cells coordinate vascular responses to meet the metabolic demand of neurons , metabolites , neurotransmitters , and help to establish the extracellular environments for membrane potentials and electrical activity . \n it has been proven that these cells possess properties of stem cells and are capable of developing into many various cells of the retina . \n scientists managed to transform these cells in vitro into all types of retinal neurons [ 36 , 37 ] . \n changes in the ganglion cells of the retina have been found the earliest in diabetic patients [ 13 , 38 ] . \n their loss caused a decreasing thickness of the retinal nerve fibers layer and was observed in rats with streptozotocin ( stz ) - induced diabetes and in diabetic patients with minimal dr [ 13 , 39 , 40 ] . \n hyperglycemia and inflammatory processes activate glial cells in the inner retina and cause their migration to the subretinal spaces and the release cytokines , thus leading to the death of neurons [ 13 , 22 , 41 - 44 ] . \n these activated cells adhere to the vessels and can damage vascular wall [ 13 , 45 ] . \n schellini et al . , studied the structure and ultrastructure of retinal mller cells of healthy wistar rats , rats with untreated diabetes and those with diabetes treated 1 and 12 months after diabetes induction and observed that the nuclei of the mller cells were changed in shape and had greater density than other nuclei . in diabetic rats , \n these changes were more frequent in the perivascular region and increased with time . in treated diabetic rats the changes were less pronounced than in the untreated group . \n additionally , mller cells in diabetic patients have been found to show overexpression of glial acidic fibrillar protein ( gfap ) [ 13 , 47 , 48 ] . \n the mller cells produce agents able to modulate blood flow and vascular permeability and have crucial role in the pathomechanism of diabetic micro- angiopathy in the retina [ 13 , 48 ] . \n it is believed that the major mechanisms involved in the process of neuroretinal injury in diabetic retinopathy include oxidative stress , glutamate accumulation , and decreased retinal production of neuroprotective factors [ 13 , 22 ] . \n glutamate is the primary retinal neurotransmitter and its level is increased in the extracellular space , both in the aqueous and vitreous humor . \n the accumulation of glutamate can lead to hyperactivation of its ionotropic receptors , such as alpha - amino-3-hydroxy-5-methyl-4-isoxazole propionate ( ampa ) and n - methyl - d - aspartic acid ( nmda ) , that pass calcium ions to the intracellular space of postsynaptic neurons in an uncontrolled way , causing cells death . \n the glutamate excess in the extracellular space in diabetes is caused mainly by its reduced absorption by glial cells , a decrease in the activity of glutamine synthetase , and inhibition in the ability of the retina to convert glutamate to ketoglutarate [ 13 , 49 - 55 ] . in the cells , glucose is converted via a few metabolic pathways ( glycolytic , pentose , hexosamine and polyol ) . in hyperglycemia , increased glucose metabolism in endothelial cells , monocytes and blood platelets is accompanied by the production of free oxygen radicals . \n physiologically , the respiratory chain of the mitochondria is the site where reactive oxygen species ( ros ) are produced in small amounts . the reactive oxygen and nitrogen species ( rons ) released in physiological amounts have a role of mediators and regulators , ensuring normal cell function . \n however , the effect of the reactive rons depends largely on their concentration and time of action . \n for instance , nitric oxide ( no ) produced in small amounts by constitutive no synthases in endothelial cells of blood vessels plays a major role of a signaling molecule engaged in the regulation of vascular wall tension . \n however , no produced in macro- phages in high concentrations by inducible synthase shows destructive properties against other cells . \n the production of free oxygen and nitrogen radicals is under a strict control of the enzymatic and non - enzymatic antioxidant system . \n if this system fails and/or there is overproduction of rons , the balance between pro - and anti - oxidative processes can be impaired , which is defined as oxidative stress [ 57 , 58 ] . damage induced by rons within mtdna \n abnormal production of the mitochondria , being responsible for the generation of the majority of endogenous ros , exerts a negative effect on the surrounding structures and on the mitochondria themselves . \n this leads to a drop in energy production below the required level needed for tissue functioning , and in consequence to functional impairment and premature death also of retinal neurons . in order to minimize the harmful effects of ros , \n the most important antioxidants are : glutathione ( gsh ) , vitamins a , c , and e , and the enzymes glutathione peroxidase ( gpx ) , catalase ( cat ) , superoxide dismutase ( sod ) , and glutathione reductase ( grx ) . \n the retina is the only neural tissue that is directly exposed to light , leading to the photo - oxidation of lipids . \n these lipids are toxic to the cells of the retina [ 13 , 60 ] . \n then , the activity of l - glutamate / l - aspartate transporter ( glast ) is decreased and the accumulation of glutamate increases through ca2 + channels and ischemia . \n the production by the retina of the neuroprotective factors such as somatostatin ( sst ) , pigment epithelial - derived factor ( pedf ) and interstitial retinol - binding protein ( irbp ) is lower in patients with diabetes . \n pedf inhibits angio- genesis and neurodegeneration in diabetes by reducing oxidative stress in the retina [ 60 , 62 ] or by increasing the expression of glutamine synthase and the protection against glutamate excitotoxicity . \n pedf peptide eye drops have been recently observed to decrease microglial activation , ganglion cell death in diabetic rats , and suggest that exogenous pedf may be a potential option for treatment early stage of dr [ 22 , 64 ] . \n additionally , pedf and sst play an important role in homeostasis of the retina because of its anti - angiogenicity and neuroprotection . \n pedf downregulation mediates the early vascular changes and favours neurodegeneration . at early dr a lower retinal production of sst and neurodegeneration \n apart from downregulation of natural neuroprotective factors produced by the retina , an upregulation also occurs . in the diabetic retina \n increased levels of neurotrophic and survival factors such as vegf and erythropoietin ( epo ) were detected , especially in the early stages of dr where ischemia is not the most important event . \n it is believed that the major mechanisms involved in the process of neuroretinal injury in diabetic retinopathy include oxidative stress , glutamate accumulation , and decreased retinal production of neuroprotective factors [ 13 , 22 ] . \n glutamate is the primary retinal neurotransmitter and its level is increased in the extracellular space , both in the aqueous and vitreous humor . \n the accumulation of glutamate can lead to hyperactivation of its ionotropic receptors , such as alpha - amino-3-hydroxy-5-methyl-4-isoxazole propionate ( ampa ) and n - methyl - d - aspartic acid ( nmda ) , that pass calcium ions to the intracellular space of postsynaptic neurons in an uncontrolled way , causing cells death . \n the glutamate excess in the extracellular space in diabetes is caused mainly by its reduced absorption by glial cells , a decrease in the activity of glutamine synthetase , and inhibition in the ability of the retina to convert glutamate to ketoglutarate [ 13 , 49 - 55 ] . in the cells , glucose is converted via a few metabolic pathways ( glycolytic , pentose , hexosamine and polyol ) . in hyperglycemia , increased glucose metabolism in endothelial cells , monocytes and blood platelets is accompanied by the production of free oxygen radicals . \n physiologically , the respiratory chain of the mitochondria is the site where reactive oxygen species ( ros ) are produced in small amounts . the reactive oxygen and nitrogen species ( rons ) released in physiological amounts have a role of mediators and regulators , ensuring normal cell function . \n however , the effect of the reactive rons depends largely on their concentration and time of action . \n for instance , nitric oxide ( no ) produced in small amounts by constitutive no synthases in endothelial cells of blood vessels plays a major role of a signaling molecule engaged in the regulation of vascular wall tension . \n however , no produced in macro- phages in high concentrations by inducible synthase shows destructive properties against other cells . \n the production of free oxygen and nitrogen radicals is under a strict control of the enzymatic and non - enzymatic antioxidant system . \n if this system fails and/or there is overproduction of rons , the balance between pro - and anti - oxidative processes can be impaired , which is defined as oxidative stress [ 57 , 58 ] . \n abnormal production of the mitochondria , being responsible for the generation of the majority of endogenous ros , exerts a negative effect on the surrounding structures and on the mitochondria themselves . \n this leads to a drop in energy production below the required level needed for tissue functioning , and in consequence to functional impairment and premature death also of retinal neurons . in order to minimize the harmful effects of ros , \n the most important antioxidants are : glutathione ( gsh ) , vitamins a , c , and e , and the enzymes glutathione peroxidase ( gpx ) , catalase ( cat ) , superoxide dismutase ( sod ) , and glutathione reductase ( grx ) . \n the retina is the only neural tissue that is directly exposed to light , leading to the photo - oxidation of lipids . \n these lipids are toxic to the cells of the retina [ 13 , 60 ] . \n then , the activity of l - glutamate / l - aspartate transporter ( glast ) is decreased and the accumulation of glutamate increases through ca2 + channels and ischemia . \n the production by the retina of the neuroprotective factors such as somatostatin ( sst ) , pigment epithelial - derived factor ( pedf ) and interstitial retinol - binding protein ( irbp ) is lower in patients with diabetes . decreased expression of the neuroprotective factors compromises neuroprotection against neurotoxic factors connected with neurodegeneration . \n pedf inhibits angio- genesis and neurodegeneration in diabetes by reducing oxidative stress in the retina [ 60 , 62 ] or by increasing the expression of glutamine synthase and the protection against glutamate excitotoxicity . \n pedf peptide eye drops have been recently observed to decrease microglial activation , ganglion cell death in diabetic rats , and suggest that exogenous pedf may be a potential option for treatment early stage of dr [ 22 , 64 ] . \n additionally , pedf and sst play an important role in homeostasis of the retina because of its anti - angiogenicity and neuroprotection . \n pedf downregulation mediates the early vascular changes and favours neurodegeneration . at early dr a lower retinal production of sst and neurodegeneration \n apart from downregulation of natural neuroprotective factors produced by the retina , an upregulation also occurs . in the diabetic retina \n increased levels of neurotrophic and survival factors such as vegf and erythropoietin ( epo ) were detected , especially in the early stages of dr where ischemia is not the most important event . \n glutamate is the primary retinal neurotransmitter and its level is increased in the extracellular space , both in the aqueous and vitreous humor . \n the accumulation of glutamate can lead to hyperactivation of its ionotropic receptors , such as alpha - amino-3-hydroxy-5-methyl-4-isoxazole propionate ( ampa ) and n - methyl - d - aspartic acid ( nmda ) , that pass calcium ions to the intracellular space of postsynaptic neurons in an uncontrolled way , causing cells death . \n the glutamate excess in the extracellular space in diabetes is caused mainly by its reduced absorption by glial cells , a decrease in the activity of glutamine synthetase , and inhibition in the ability of the retina to convert glutamate to ketoglutarate [ 13 , 49 - 55 ] . \n in the cells , glucose is converted via a few metabolic pathways ( glycolytic , pentose , hexosamine and polyol ) . in hyperglycemia , increased glucose metabolism in endothelial cells , monocytes and blood platelets is accompanied by the production of free oxygen radicals . \n physiologically , the respiratory chain of the mitochondria is the site where reactive oxygen species ( ros ) are produced in small amounts . the reactive oxygen and nitrogen species ( rons ) released in physiological amounts have a role of mediators and regulators , ensuring normal cell function . \n however , the effect of the reactive rons depends largely on their concentration and time of action . \n for instance , nitric oxide ( no ) produced in small amounts by constitutive no synthases in endothelial cells of blood vessels plays a major role of a signaling molecule engaged in the regulation of vascular wall tension . \n however , no produced in macro- phages in high concentrations by inducible synthase shows destructive properties against other cells . \n the production of free oxygen and nitrogen radicals is under a strict control of the enzymatic and non - enzymatic antioxidant system . \n if this system fails and/or there is overproduction of rons , the balance between pro - and anti - oxidative processes can be impaired , which is defined as oxidative stress [ 57 , 58 ] . \n abnormal production of the mitochondria , being responsible for the generation of the majority of endogenous ros , exerts a negative effect on the surrounding structures and on the mitochondria themselves . \n this leads to a drop in energy production below the required level needed for tissue functioning , and in consequence to functional impairment and premature death also of retinal neurons . in order to minimize the harmful effects of ros , \n the most important antioxidants are : glutathione ( gsh ) , vitamins a , c , and e , and the enzymes glutathione peroxidase ( gpx ) , catalase ( cat ) , superoxide dismutase ( sod ) , and glutathione reductase ( grx ) . \n the retina is the only neural tissue that is directly exposed to light , leading to the photo - oxidation of lipids . \n these lipids are toxic to the cells of the retina [ 13 , 60 ] . \n then , the activity of l - glutamate / l - aspartate transporter ( glast ) is decreased and the accumulation of glutamate increases through ca2 + channels and ischemia . \n the production by the retina of the neuroprotective factors such as somatostatin ( sst ) , pigment epithelial - derived factor ( pedf ) and interstitial retinol - binding protein ( irbp ) is lower in patients with diabetes . decreased expression of the neuroprotective factors compromises neuroprotection against neurotoxic factors connected with neurodegeneration . \n pedf inhibits angio- genesis and neurodegeneration in diabetes by reducing oxidative stress in the retina [ 60 , 62 ] or by increasing the expression of glutamine synthase and the protection against glutamate excitotoxicity . \n pedf peptide eye drops have been recently observed to decrease microglial activation , ganglion cell death in diabetic rats , and suggest that exogenous pedf may be a potential option for treatment early stage of dr [ 22 , 64 ] . \n additionally , pedf and sst play an important role in homeostasis of the retina because of its anti - angiogenicity and neuroprotection . \n , pedf downregulation mediates the early vascular changes and favours neurodegeneration . at early dr a lower retinal production of sst and neurodegeneration \n apart from downregulation of natural neuroprotective factors produced by the retina , an upregulation also occurs . in the diabetic retina \n increased levels of neurotrophic and survival factors such as vegf and erythropoietin ( epo ) were detected , especially in the early stages of dr where ischemia is not the most important event . \n the relationship between the toxicity processes involving glutamate and vegf - induced damage to the blood - retina barrier makes a crucial aspect relating neurodegeneration with vascular disorders . \n hyperglycemia is known to induce an increased level in glutamate and then hyperactivity of nmda receptors , which accelerates death of neurons . \n it is likely that the hypoxic retina , in order to spare the neurons , initiates the production of the hif that stimulates the release of vegf . \n this factor as a neuroprotector aims to protect the nerve cell through angiogenesis initiation , but increasing vascular permeability damages the blood - retina barrier . not without significance is the role of the glial cells whose enhanced activity in early stages of diabetes may contribute to nerve cell injury . \n additionally , a decrease in the neuroprotective factors , including pedf and sst may damage the blood - retina barrier through or directly vegf overexpression . at the current stage of knowledge \n is important to thoroughly elucidate the mechanisms of apoptosis and degeneration of retinal neurons causing diabetic retinopathy . \n perhaps the treatment of diabetic changes of the retina could be based largely on neuroprotective agents . \n ", "role": "user" }, { "content": "backgrounddiabetic retinopathy ( dr ) is an important complication of diabetes and is considered one of the main causes of blindness in moderate - income and highly - developed countries . as it is \n a major socioeconomic problem , defining all mechanisms that may lead to dr development is of great importance . in the 21st century \n diabetic lesions occurring in the retina are well known . \n however what kind of retinal neuronal damage occurs in the course of diabetes remains unclear.resultsin this manuscript we present the most recent knowledge about suggested mechanisms of diabetic retinopathy , including neuroretinal apoptosis . getting a deep insight into the role of apoptosis and degeneration of retinal neurons leading to dr will have vital consequences.conclusionthe findings of this review confirm that it is very likely that in the nearest future diabetic retinopathy treatment will be based on administration of neuroprotective agents . \n the implementation of neuroprotective drugs may slow down retinopathy progression , making it possible to avoid the currently used therapeutic procedures , such as laser photocoagulation , intravitreous injections or posterior vitrectomy , which are not only risky for the healthy part of the retina but also relatively expensive .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: \n surface - sterilized seeds ( 20 seeds / plate ) of a. thaliana wt ( columbia-0 ) were placed on petri dishes with ms medium using a 1 ml micropipette , and kept at 4 c for 48 h. plates were kept at 22 c under continuous illumination ( 65 mol m s ) from the side ( distance from light source = 30 cm ) for 10 days . \n aspergillus - minimal medium was used to propagate p. indica for 3 weeks , ( section a ) at 22 c in the dark . \n an aspergillus - minimal medium plaque of 5 mm diameter with fungal hyphae ( or without fungal hyphae ; control ) was used as inoculum . \n three seedlings ( equal in size and number of leaves ) from twelve days - old plants ( described above ) were picked from the ms plates and their roots were laid onto the surface of a nylon membrane in a distance of 3 cm from the plaques . \n all plates were transferred to 22 c under continuous illumination ( 80 5 mol m s ) from the top ( distance from light source = 30 cm ) for 2 or 6 days . \n while no physical contact has been established after 2 days of co - cultivation , microscopic staining and pcr analyses confirmed the presence of fungal mycelium in and around the roots after 6 days of co - cultivation ( fig . 1 , fig . \n total rna was isolated from the roots co - cultivated with the fungus ( or mock - treated ) after 2 and 6 days of co - cultivation using the rneasy plant mini kit ( qiagen ) . \n after reverse transcription , 1 g of total rna was used for cdna synthesis by the omniscript rt kit ( qiagen ) and oligo ( dt)20 in 20 l reaction volume . to confirm the absence of any mycelium in the 2 day sample , or the presence of fungal mycelium in the 6 day sample , rt - pcr was conducted with the primer pairs for arabidopsis gapdh ( forward : gagctgactacgttgttgag and reverse : ggagacaatgtcaaggtcgg ) and p. indica its ( forward : caacacatgtgcacgtcgat and reverse : ccaatgtgcattcagaacga ) as housekeeping genes for the two organisms . \n cfx connect real - time system and the cfx manager software version 3.1 ( bio - rad ) were used for quantitative pcr . for the amplification of the pcr products , iq sybr supermix ( bio - rad ) \n was used according to the manufacturer 's instructions in a final volume of 20 l . \n the icycler was programmed to 95 c 2 min , 35 ( 95 c 30 s , 55 c 40 s , 72 c 45 s ) , 72 c 10 min followed by a melting curve ( 5595 c in increasing steps of 0.5 c ) . \n rna was extracted from root samples of 3 biological independent experiments , and hybridized to the arabidopsis genome array ath1 ( affymetrix , usa ) at the kompetenzzentrum fr fluoreszente bioanalytik , regensburg , germany . \n robin ( http://mapman.gabipd.org/web/ guest / robin - download ) and mapman programs were used for analysis of hybridization signal data followed by statistical analysis with the t - test ( fig . \n the raw and normalized data have been submitted to geo ( http://www.ncbi.nlm.nih.gov/geo , submission number gse58771 ) . to investigate whether a physical contact exists between the roots and the p. indica mycelium , \n the roots were stained with trypan blue / fuchsin acid and the colonization was analyzed by light and fluorescent microscopy as described in vahabi et al . . \n surface - sterilized seeds ( 20 seeds / plate ) of a. thaliana wt ( columbia-0 ) were placed on petri dishes with ms medium using a 1 ml micropipette , and kept at 4 c for 48 h. plates were kept at 22 c under continuous illumination ( 65 mol m s ) from the side ( distance from light source = 30 cm ) for 10 days . \n aspergillus - minimal medium was used to propagate p. indica for 3 weeks , ( section a ) at 22 c in the dark . \n an aspergillus - minimal medium plaque of 5 mm diameter with fungal hyphae ( or without fungal hyphae ; control ) was used as inoculum . \n three seedlings ( equal in size and number of leaves ) from twelve days - old plants ( described above ) were picked from the ms plates and their roots were laid onto the surface of a nylon membrane in a distance of 3 cm from the plaques . \n all plates were transferred to 22 c under continuous illumination ( 80 5 mol m s ) from the top ( distance from light source = 30 cm ) for 2 or 6 days . while no physical contact has been established after 2 days of co - cultivation , microscopic staining and pcr analyses confirmed the presence of fungal mycelium in and around the roots after 6 days of co - cultivation ( fig . 1 , fig . \n total rna was isolated from the roots co - cultivated with the fungus ( or mock - treated ) after 2 and 6 days of co - cultivation using the rneasy plant mini kit ( qiagen ) . \n after reverse transcription , 1 g of total rna was used for cdna synthesis by the omniscript rt kit ( qiagen ) and oligo ( dt)20 in 20 l reaction volume . to confirm the absence of any mycelium in the 2 day sample , or the presence of fungal mycelium in the 6 day sample , rt - pcr was conducted with the primer pairs for arabidopsis gapdh ( forward : gagctgactacgttgttgag and reverse : ggagacaatgtcaaggtcgg ) and p. indica its ( forward : caacacatgtgcacgtcgat and reverse : ccaatgtgcattcagaacga ) as housekeeping genes for the two organisms . \n cfx connect real - time system and the cfx manager software version 3.1 ( bio - rad ) were used for quantitative pcr . for the amplification of the pcr products , iq sybr supermix ( bio - rad ) \n was used according to the manufacturer 's instructions in a final volume of 20 l . the icycler was programmed to 95 c 2 min , 35 ( 95 c 30 s , 55 c 40 s , 72 c 45 s ) , 72 c 10 min followed by a melting curve ( 5595 c in increasing steps of 0.5 c ) . \n rna was extracted from root samples of 3 biological independent experiments , and hybridized to the arabidopsis genome array ath1 ( affymetrix , usa ) at the kompetenzzentrum fr fluoreszente bioanalytik , regensburg , germany . \n robin ( http://mapman.gabipd.org/web/ guest / robin - download ) and mapman programs were used for analysis of hybridization signal data followed by statistical analysis with the t - test ( fig . \n the raw and normalized data have been submitted to geo ( http://www.ncbi.nlm.nih.gov/geo , submission number gse58771 ) . \n to investigate whether a physical contact exists between the roots and the p. indica mycelium , the roots were stained with trypan blue / fuchsin acid and the colonization was analyzed by light and fluorescent microscopy as described in vahabi et al . .", "role": "user" }, { "content": "colonization of the roots of different plant species by piriformospora indica results in better plant performance and biotic and abiotic stress tolerance . \n an increase of the biomass and seed yield is other beneficial effect of p. indica for the host plants . \n the interaction of p. indica with arabidopsis thaliana roots is a unique model system to study symbiotic relationships . \n we describe a co - cultivation system which allows us to investigate the effects of fungal exudates on the root transcriptome before and after the establishment of a physical contact , and during early phases of root colonization . \n we present a detailed protocol which facilitates easy reproduction of the results ( ncbi geo accession number gse58771 ) published by vahabi et al . \n ( 2015 ) in bmc plant biology [ 1 ] .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the main determinants of adhesion energy at the cell contact are the adhesion molecules . for cell \n cell adhesion , the force required to separate contacting cells has been shown to linearly depend on the squared total number of e - cadherin molecules in the cells and the amount of e - cadherin at the plasma membrane . \n this suggests that the number of classical cadherins is likely to play a key role in controlling adhesion energy . \n however , cadherins are known to undergo dynamic changes in their localization at the plasma membrane through various processes such as cadherin clustering , endocytosis and recycling [ 2628 ] . moreover , in epithelial cells of the drosophila germ band , several distinct plasma membrane pools of e - cadherin have been identified , each of which bind different populations of actin . \n this suggests that the ability of cadherins to control adhesion energy not only depends on the total amount of cadherins at the contact , but also on the dynamic spatiotemporal distribution of these molecules and their association with distinct components of the adhesion complex . \n cadherins bind with their extracellular domain to other cadherins and with their intracellular domain to molecules linking them to the cytoskeleton . \n notably , separating cadherin - mediated cell cell contacts or directly pulling on cadherins can lead to the extrusion of plasma membrane tubes or tethers both in vitro and in vivo , suggesting that extracellular cadherin cadherin binding can be stronger than the intracellular binding of cadherins to the cytoskeleton . \n consequently , the energy of de - adhesion during contact separation might , at least partly , be determined by the strength of intracellular binding of cadherins to the cytoskeleton . \n therefore , in that case , the energy of de - adhesion would be different from the adhesion energy , which is determined by the binding strength of the adhesion molecules at the contact . \n it is important to keep this in mind when interpreting results obtained using experimental techniques that probe cell adhesion through de - adhesion measurements ( see below ) . \n the intracellular adhesion complex not only modulates adhesion energy by coupling cadherins to the cytoskeleton , but also through its mechanosensing activity . \n cadherins at cell cell contacts show enhanced clustering in response to increased stiffness of the substrate to which the contacting cells bind . moreover , directly pulling on cadherin - mediated cell cell contacts using a micropipette enlarges the cell cell contact area , suggesting that the cadherin adhesion complex is mechanosensitive . \n however , the observation that increased cell contractility and consequently tugging on cell cell contacts not only promotes cadherin clustering and anchoring to the actin cytoskeleton , but also leads to disassembly of cadherin - mediated cell cell contacts , indicates that the mechanosensitive response of the cadherin adhesion complex to contraction varies . while the basis of this variation is still unclear , the association of different actin networks and isoforms of myosin motors with the adhesion complex are likely to play an important role therein . to better understand how the cadherin adhesion complexes react to mechanical force , it will be essential to identify the specific mechanosensitive molecules mediating these effects . \n -catenin plays a crucial role in connecting cadherins to the actin cytoskeleton by recruiting actin and/or actin binding molecules to the adhesion complex . \n interestingly , stress - induced conformational changes of -catenin have been shown to modulate its ability to recruit actin , suggesting that -catenin is a crucial component of the cadherin adhesion complex for sensing and transducing contact stress . \n whether other molecules of the cadherin adhesion complex are also involved in these processes remains to be established . \n the development of fluorescent probes that can report the stress applied to specific molecules of the adhesion complex , such as recently reported for vinculin , will be a pivotal tool for constructing a detailed molecular force / stress map of individual adhesion complexes and identify potential candidates involved in mechanotransduction . \n one way is to calculate the energy of adhesion during contact formation on the basis of the binding affinity of the adhesion molecules involved . \n this , however , requires prior knowledge about the binding affinities of all adhesion molecules present , and the spatial ( parallel , serial ) arrangements of the bonds formed by these molecules . because the complete molecular machinery mediating many situations of cell cell contact are not known , this method is restricted to reduced / artificial systems of cell adhesion where the number and spatial configuration of adhesion molecules at the contact site are predetermined . \n another way to determine adhesion energy is to deduce it from the morphology and interfacial tensions of the contacting cells . generally , the size of the cell cell contact results from the minimization of the total surface energy . \n in order to increase the size of cell cell contacts , contacting cells must consume energy ( adhesion energy ) that allows them to deviate from their preferential spherical shape owing to their surface ( interfacial ) tension . \n the adhesion energy can thus be obtained on the basis of the geometry of the contacting cells and the interfacial tensions at the cell cell and cell extracellular medium interfaces ( box 1 ) . \n this method of calculation assumes mechanical steady state of the adhering cells and therefore does not capture dynamic changes in adhesion energy during contact formation and maturation . a key determinant of interfacial tensions is the contractility of the acto - myosin cortex , giving rise to cortex tension . \n indeed , the balance between cell contractility and adhesion has been proposed to determine the cell cell contact size . in a recent study , the relationship between cell cell contact size \n , cell contractility and adhesion has been investigated . by measuring the traction exerted by contacting cells on their substrate , \n the tugging force between these cells was deduced assuming a force balance between tugging and traction forces ( box 2 ) . \n the relation between the contact size and tugging force gives the contact stress , which is the property of the cell cell contact to withstand tensile or compressive forces . \n contact stress in turn should correspond to the adhesion energy , and thus knowing about contact stress will provide information about adhesion energy . \n however , a direct correlation between traction force and tugging force , and between tugging force and contact size has been disputed [ 40,4850 ] and it therefore remains unclear how accurately adhesion energy can be deduced from those experiments . \n an alternative approach to obtaining insight into the adhesion energy is to pull apart the cell cell contact . when the chemical bonds engaged in the contact are separated , adhesion energy is released , producing a force that opposes the separation . in the case of passive elastic materials , \n the relationship between the separation or de - adhesion force and the adhesion energy is less clear . \n the interfacial tension at the cell cell contact is determined by the combinatorial activities of adhesion energy and cortex tension , which both are likely to undergo dynamic change during contact formation and maturation . in order to understand the relationship between de - adhesion force and adhesion energy , different experimental methods \n have been developed that allow measuring the force that is needed to mechanically separate contacting cells ( box 2 ) . \n de - adhesion force measurements can be done both on a molecular and cellular level . on a molecular level , atomic force microscopy ( afm ) and bioforce probe ( bfp ) \n experiments with classical cadherins revealed that e - cadherin has a higher de - adhesion force than n - cadherin . \n moreover , single molecule studies demonstrated that the de - adhesion force of adhesion molecules strongly depends on the applied separation speed , or loading rate . \n therefore , the pulling speed determines the probability for the paired molecules to be separated in a specific conformation , making it impossible to obtain one single value for the de - adhesion force of two molecules from such experiments . despite this difficulty \n , separations performed with similar loading rates can be used to determine relative differences in de - adhesion forces for different molecules . on a cellular level , afm and the dual pipette assay ( dpa ) \n have been used to analyze the function of cadherins in regulating the de - adhesion force at cell cell contacts . with afm \n , the amount of e - cadherin at the plasma membrane has been shown to linearly scale with corresponding de - adhesion force at cell cell contacts . moreover , \n dpa measurements showed that cell cell contacts expressing e - cadherin exhibit a higher de - adhesion force than contacts expressing equal amounts of n - cadherin . \n this is consistent with the observation that cadherins are crucial for determining the adhesion energy at cell cell contacts , and that e - cadherin molecules exhibit a higher de - adhesion force than n - cadherin molecules . how to deduce the adhesion energy from the measured de - adhesion forces is still a matter of debate . \n one approach has been to model cells that contact each other via polysaccharides as elastic solids in which cortical tension is uniform ( independent of the specific interfaces ) . \n however , the observation of interface - specific regulation of cortical tension in cells binding via cadherins suggests that this approach might not be generally applicable to all cell cell contacts . \n another caveat when using de - adhesion forces to determine adhesion energy is that the molecules involved in contact formation might differ from the molecules involved in contact separation , and that thus the energy of adhesion might be different from the energy of de - adhesion ( see above ) . \n the measurement of separation forces will therefore provide information about the energy of de - adhesion , but not necessarily about the energy of adhesion . \n future studies identifying the molecules involved in cell cell contact formation and separation will be needed to interpret the outcome separation measurements in relation to the adhesion energy . \n methods to measure separation force of cell cell contacts are currently limited to cultured cells outside of their endogenous environment ( ex vivo ) . however , the separation force critically depends on the specific cell environment such as calcium concentration or substrate attachment . \n thus it is impossible to extrapolate the actual forces expected in vivo from the separation force values obtained ex vivo as long as the culture conditions do not precisely correspond to the in vivo situation . \n although none of the methods currently available can directly measure cell cell separation forces in vivo , various micromanipulation techniques allow indirectly determining the adhesive properties of tissues and their constituent cells in their organismal context . by deforming tissues , for example , through micropipette aspiration , several mechanical properties of the tissue , such as surface tension , viscosity , elasticity and compliance can be measured . \n these measurements can be done in control and experimental cells / tissues where the function of certain adhesion molecules is impaired to obtain insight into the role of these molecules , and consequently of adhesion itself , in controlling tissue mechanics . \n adhesion energy of cell cell contacts in vivo can also be determined by imaging cell cell contact dynamics in vivo . \n while recent advances in image analysis of 2-dimensional time - lapse movies of contacting cells in vivo allow automatic tracking of cell cell contact dynamics in high spatiotemporal resolution , methods for automatic 3-dimensional tracking are less advanced . \n moreover , theoretical models used to determine adhesion energy on the basis of cell cell contact dynamics either still lack experimental confirmation or rather provide information about cell cell interfacial tension which is only partially determined by adhesion energy . \n combining the observation of contact size in vivo with direct measurements of mechanical tissue properties might be a good approach to more precisely analyze adhesion energy at cell cell contacts in vivo . \n we would like to argue that in order to understand cell adhesion , insight into the adhesion energy is required , as adhesion energy , together with cortical tension , are the key physical properties determining how cells adhere to each other . \n there are different ways by which the adhesion energy at cell cell contacts can be determined : experimentally , it can be obtained on the basis of the cell cell contact size , the spatiotemporal distribution of adhesion molecules at the contact , and/or the force needed to separate the contact . \n while these experimental approaches in principle are suitable for determining adhesion energy , questions remain as to the precise spatiotemporal distribution of adhesion molecules at cell contacts and the proper interpretation of cell separation experiments . \n currently the most promising approach is therefore to deduce the adhesion energy from the geometry of the contacting cells and their interfacial tensions ( box 1 ) . with the adhesion energy in hand \n , it is then possible to go back to the corresponding de - adhesion force and adhesion molecule distribution , thereby obtaining insight into the relationship between these variables . \n in particular , the relationship between adhesion energy and de - adhesion forces will be interesting to explore as the process of adhesion and separation probably involves different molecular bonds with different binding affinities . \n new methods , such as the recently developed molecular force sensors , will be highly useful for gaining mechanistic insight into force transduction at adhesion sites and the generation of adhesion energy . eventually , a better understanding of adhesion energy will help in unraveling the molecular and cellular mechanisms underlying cell \n papers of particular interest , published within the annual period of review , have been highlighted as: of special interest of outstanding interest of special interest of outstanding interest", "role": "user" }, { "content": "highlights in this review , we describe the role of adhesion energy in cell cell adhesion . \n we review recent advances in elucidating the molecular and cellular basis of adhesion energy . \n we propose both experimental and theoretical strategies to determine adhesion energy between cells in vitro and in vivo .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: among those who visited our clinic ( chung - ang university hospital ) , patients with pingueculae who displayed af without any ocular surface disorders were included in this study . \n 2008 - 023 - 07 ) . we examined af using a cobalt blue filter with an additional yellow filter on a slit lamp biomicroscope . \n forty pingueculae that exhibited af were excised from 30 patients and 10 pingueculae without af were excised from 10 patients . in each case , all specimens were formalin - fixed and paraffin - embedded . in order to observe the general composition and topohistological characteristics of the pingueculae \n , 3 - 5-micron - thick samples were stained by classic histochemical methods : hematoxylin - eosin , alcian blue , periodic acid - schiff ( pas , for carbohydrates ) , oil red o ( for lipids ) , masson 's trichrome ( for connective tissue ) , and congo red ( for amyloid ) . human monoclonal antibodies cd29 and cd34 were used to identify mesenchymal stem cells by immunohistochemical staining . \n transglutaminase-2 ( tg-2 ) is known to play a crucial role in wound healing , cell migration , apoptosis , and maintenance of the ocular surface . \n based on staining patterns , we graded each slide according to the intensity of staining : negative ( - ) , weak ( ) , or positive ( + ) . \n among those who visited our clinic ( chung - ang university hospital ) , patients with pingueculae who displayed af without any ocular surface disorders were included in this study . \n 2008 - 023 - 07 ) . we examined af using a cobalt blue filter with an additional yellow filter on a slit lamp biomicroscope . \n forty pingueculae that exhibited af were excised from 30 patients and 10 pingueculae without af were excised from 10 patients . \n in each case , all specimens were formalin - fixed and paraffin - embedded . in order to observe the general composition and topohistological characteristics of the pingueculae \n , 3 - 5-micron - thick samples were stained by classic histochemical methods : hematoxylin - eosin , alcian blue , periodic acid - schiff ( pas , for carbohydrates ) , oil red o ( for lipids ) , masson 's trichrome ( for connective tissue ) , and congo red ( for amyloid ) . \n human monoclonal antibodies cd29 and cd34 were used to identify mesenchymal stem cells by immunohistochemical staining . \n transglutaminase-2 ( tg-2 ) is known to play a crucial role in wound healing , cell migration , apoptosis , and maintenance of the ocular surface . \n therefore , we performed tg-2 immunohistochemical staining for assessing the wound healing process . based on staining patterns \n , we graded each slide according to the intensity of staining : negative ( - ) , weak ( ) , or positive ( + ) . \n the mean age of the patients was 63.5 7.2 years ( range , 45 to 78 years ) . on slit - lamp examination , \n one pattern was a round and elevated lesion , and the other pattern was flat with bizarre , irregular margins . \n round and elevated pingueculae have stronger af intensity , dilated tortuous vessels , no vessel invasion and focal erosions . \n bizarre and flat pingueculae have a scattered af shape , multiple vessel invasion and diffuse erosions ( fig . \n deposition of eosinophilic and amorphous materials in the subepithelial layer of the conjunctiva and degeneration of the collagen fibers of the conjunctival stroma with thinning of the overlying epithelium and calcification were observed ( fig . \n 2 ) . positive immunoreactivity to tg-2 , integrin ( cd29 ) , and cd34 was detected in the subepithelial layer in 17 of 40 pingueculae with af , but no immunoreactivity was detected in the pingueculae without af . by contrast , no immunoreactivity to pas , masson 's trichrome , congo red , or oil red o was detected in any pinguecula ( fig . \n in this study , we imaged the af of pingueculae using a cobalt blue filter with an additional yellow filter on a slit lamp biomicroscope . recently , \n utine et al . demonstrated that hyper - af originates from pingueculae using confocal scanning laser ophthalmoscopy . \n the authors proposed that either lipofuscin may be associated with the subconjunctival degenerative process of pingueculae , or that the hyper - af of pingueculae may be related to an undetermined fluorophore . in fundus \n af ( faf ) imaging , various tools including color fundus photographs and angiography were used . with the advent of confocal scanning laser ophthalmoscopy , \n it is possible to visualize faf and its spatial distribution [ 11 - 13 ] . using spectrophotometric investigations , delori et al \n . showed that lipofuscin granules in the rpe cell monolayer contain the dominant fluorophores responsible for faf imaging . \n however , our system is based on slit lamp examination , a new , easy , fast , low - cost method of examining patients with pinguecula on af imaging . \n the main part ( mass ) of the pterygium is composed of connective tissue that , over the course of pterygium evolution , undergoes pathological changes that are accompanied by an increase of the mass of the pterygium itself . \n the newly formed structure in the pinguecular part of the pterygium is located subepithelially and progresses towards the cornea . \n we suggest that the flat , bizarrely shaped pingueculae had characteristics of slow progressive pterygium . \n however , all of the analyzed pingueculae on af images could be defined as elastotic degenerations . \n hogan and alvarado found that elastotic material within the pterygium is formed in four ways : 1 ) by degenerated collagen , 2 ) by degeneration of pre - existing elastic fibers , 3 ) by abnormal fibroblastic activity , and 4 ) by ground substance disorder . \n . reported elastotic degeneration only under abnormal fibroblastic activity with the production of abnormal maturational forms of elastic fibers . \n in addition , they found that the pinguecular fibroblasts might have a role in formation of abnormal elastic fibers . \n raizada and bhatnagar suggested that pinguecula was a precursor of pterygium on the evidence of the histopathology of pinguecula . \n they suggested that histopathological findings of pingueculae resembled in many respects the late fibrotic or early atrophic sclerotic phase of pterygium . \n zhang et al . reported that tg-2 plays a crucial role in wound healing , cell migration , apoptosis , and maintenance of the ocular surface . \n our results showed that tg-2 immunoreactivity was positive in pingueculae with af , but negative in pingueculae without af . \n additionally , the cd29 and cd34 immunoreactivity in pingueculae with af suggests the possibility that fibroblasts are involved . \n therefore , we suggest that pingueculae with af have a different , more aggressive pathogenesis than those without af . \n the present study has a limitation in that the percentage of positive reactivity to tg-2 , cd29 , and cd34 was 47.5% in the samples of pingueculae with af .", "role": "user" }, { "content": "purposeto analyze the autofluorescence ( af ) properties of pinguecula using cobalt - blue and yellow filters and to investigate the nature and pathogenesis of pingueculae using histochemical and immunohistochemical staining.methodsfifty pingueculae in 40 patients were included in this study . \n af of the pingueculae was observed and analyzed using a cobalt - blue filter with an additional yellow filter on a slit - lamp . \n hematoxylin - eosin and immunohistochemical stainings were performed on surgical specimens of pingueculae that were prepared from each patient . \n immunohistochemical staining included congo red , oil red o , periodic acid - schiff ( pas ) , masson 's trichrome , transglutaminase-2 ( tg-2 ) , mesenchymal stem cell markers cd29 ( -1-integrin ) , and cd34.resultsaf images revealed hyper - af in the pinguecula area . \n the af lesions of pingueculae showed superficial punctuate erosions and avascular lesions . \n deposition of eosinophilic and amorphous materials in the subepithelial layer of the pinguecula were observed on hematoxylin - eosin staining . \n historeactivities to congo red , pas , oil red o , alcian blue , and masson 's trichrome were not detected , but immunoreactivities to cd29 , cd34 , and tg-2 were detected in the pingueculae with af . \n however , cd29 , cd34 , and tg-2 were not detected in the pingueculae without af.conclusionsthe af of pingueculae may be related to cd29 , cd34 , and tg-2 . \n we suggest that pingueculae with af have a different pathogenesis compared to pingueculae without af .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: chronic rhinosinusitis with nasal polyps ( crswnp ) is a chronic inflammatory disease of the upper airways . \n it is defined as the presence of two or more symptoms that persist for more than 12 weeks . \n symptoms include facial pain / pressure , purulent nasal discharge , nasal obstruction , and decreased sense of smell during chronic inflammation and confirmed the presence of nasal polyps through endoscopy.1 on the other hand , asthma is a chronic inflammation of the lower airways involving episodic breathlessness and wheezing , with airway hyperresponsiveness to environmental stimuli , with a prevalence of 5%10% in the general population.2 asthmatic patients have a higher rhinosinusitis severity score than nonasthmatic patients , and more presence of nasal polyps regardless of atopic status , indicative of a strong relationship between crswnp severity and chronic airway inflammatory diseases.3 since the introduction of the united airway disease concept,4 a large body of evidence from clinical epidemiology , pathophysiology , histology , and treatment outcomes has correlated asthma and crswnp . \n this association has been supported by numerous observations of similar histopathological changes5 and common inflammatory mediator infiltration.6 typical histopathological findings of asthma , including airway remodeling ( epithelial shedding and basement membrane thickening ) , eosinophilic infiltration , t - helper cell involvement , and il-5 production are present in both asthma and crswnp , suggesting similar physiopathological processes.7,8 although the argument for the existence of a link between upper and lower airway diseases is strong , the mechanism that underlies this connection remains under investigation . in this review \n , we will analyze the prevalence and the impact of management challenges regarding both asthma and crswnp . \n crswnp is an inflammatory condition of the nose and paranasal sinuses of unknown cause , which is present in 2%4% of the adult population.1,9 crswnp is often associated with other respiratory diseases such as asthma,10 aspirin sensitivity,11,12 and idiopathic bronchiectasis.13 it has been reported that 20%60% of patients with crswnp have asthma.1416 the association between crswnp and asthma patients can be considered from two different perspectives : percentage of asthmatic patients developing crswnp and patients diagnosed with crswnp and with asthma . \n bronchial asthma is more prevalent in patients suffering from crs.1,9,17 on the other hand , patients with asthma have a greater prevalence of crs than patients without asthma.18 jarvis et al9 included over 52,000 adults , aged 1875 years , recruited in 19 centers from 12 european countries . in all centers and at all ages , \n a strong association between asthma and crs ( adjusted or : 3.47 ; 95% ci : 3.203.76 ) was observed . \n the association with asthma was stronger in patients reporting both crs and allergic rhinitis ( adjusted or : 11.85 ; 95% ci : 10.5713.17 ) . \n dixon et al19 included 2,031 asthmatic patients and demonstrated that the association with crs was related to severe asthma , poorly controlled asthma , and asthma exacerbations , but not to decreased lung function . \n interestingly , most patients with crs without clinical asthma showed bronchial hyperresponsiveness when a methacholine challenge test was performed . furthermore , up to 45% of crswnp patients have or will develop asthma.1,9,20 the prevalence of crswnp is higher in asthmatics ( 7% ) compared to the general population ( 4%),21 and females present a greater proportion of crswnp in combination with asthma.19 in addition , caucasian patients have shown a greater prevalence of crswnp and asthma than asiatic patients,22,23 while the severity of crs is higher when concomitant asthma exists.3,2426 in non - atopic asthma and late - onset asthma , crswnp was found even more frequently , from 15% to 26% depending on the study,27,28 while more than 60% of crswnp patients have some level of lower airway involvement.29 aspirin - exacerbated respiratory disease ( aerd ) , a syndrome characterized by the presence of aspirin sensitivity / intolerance , asthma , and crswnp , has an estimated prevalence of 1% in the general population and 10%20% among asthmatics.1,12,30 during the natural evolution of the disease , a clinical history of rhinitis or crs usually precedes asthma and the development of aspirin hypersensitivity . in the european network on aspirin - induced asthma cohort study , the disease followed a typical pattern : persistent rhinitis / rhinosinusitis appeared first ( mean age 30 years ) , being associated to a flulike infection in half of the patients . \n this was followed by asthma after 2 years ( mean age 32 years ) , and aspirin - induced respiratory reactions and nasal polyposis after 4 years ( mean age 34 years).11 the clinical presentation in the different european countries was remarkably similar . in women , who outnumbered men by a ratio of 2.3:1 , the onset of symptoms occurred significantly earlier , and the disease was more severe than in men . \n once developed , crswnp and asthma evolution is usually independent of the aspirin and nonsteroidal anti - inflammatory drug avoidance.31 the typical clinical picture of patients with crswnp and asthma has been characterized by older age , longer duration of nasal symptoms , higher incidence of allergic rhinitis , bronchial obstruction , higher computed tomography ( ct ) and endoscopy scores , and higher number of sinonasal surgeries.3,32,33 bilodeau et al34 showed that , among asthmatic subjects , those with crswnp presented more poorly controlled asthma , increased airway obstruction , and more marked lower airway inflammation than those without crswnp . \n the same authors have suggested that a subgroup of asthmatic patients may have a more intense lower airway inflammation in relation to the presence of crswnp . \n they observed that asthmatic subjects using intranasal corticosteroids ( ics ) to treat nasal polyps had a more intense inflammation and a poorer asthma control compared to patients with chronic rhinosinusitis without nasal polyps , reflecting a more severe subset of asthma . \n asthma and crswnp have been also linked with an impaired quality of life ( qol ) ; patients suffering from asthma and crs reporting a poorer quality qol.32 alobid et al35 reported 109 patients with crswnp who were randomized to either receive oral prednisone for 2 weeks or to undergo endoscopic sinus surgery , all patients being treated with intranasal budesonide for 12 months . \n they observed a considerable impact of crswnp on patients qol , this being even worse in patients with concomitant asthma mainly on physical functioning , body pain , and vitality ( p<0.05 ) . \n the same group10 evaluated different outcomes of patients with crswnp and found that asthma and especially persistent asthma have an accumulative impact on the loss of smell , proposing the loss of smell as a predictive symptom to identify severe asthma . \n other authors have also found lower olfactory outcomes in patients who have associated crswnp and asthma36 or aerd.37 \n the european position paper on rhinosinusitis and nasal polyps provides a specific treatment guideline for patients with crswnp with and without asthma.1 on the basis of available evidence , medical therapy for crswnp should begin with daily application of a topical ics in conjunction with high - volume saline irrigation , and subsequent therapies are based on the patient s polyp status , severity of symptoms , and/or qol impairment . regarding the question about how sinus surgery and medical crswnp treatment may modify the course of bronchial asthma \n a recent systematic review40 analyzed the effect of upper airway intervention in the subpopulation of patients with coexisting crswnp and asthma and did not find marked differences between outcomes after endoscopic sinus surgery ( ess ) or medical treatment with montelukast , omalizumab , or erythromycin . \n when analyzing the evidence of medical treatment specifically for patients with crswnp and coexisting asthma , there are a few randomized controlled trials and uncontrolled prospective interventional studies that evaluated the efficacy of different treatments . \n they observed that patients with crswnp have a significantly worse qol than the general population and that steroid treatment and ess lead to similar qol improvement in crswnp , either with or without asthma ; both steroid and ess treatments improve nasal symptoms in patients with crswnp . \n two montelukast trials with follow - up times of 10 weeks and 13 weeks were done . \n schper et al41 investigated the effect of montelukast ( 10 mg / d ) in a double - blinded , placebo - controlled crossover trial ( 6 weeks of intervention , 4 weeks of placebo ) in 24 patients . \n ragab et al42 studied 44 patients with montelukast ( 10 mg / d ) treatment for 3 months as an add - on therapy to inhaled steroids and intranasal steroids ( incs ) in an uncontrolled prospective trial . \n significant improvements in nasal and pulmonary symptoms , results of endoscopy and ct scanning of the paranasal sinuses , and asthma medication intake were reported in both trials . nevertheless , no significant improvements were found in nasal and pulmonary function test results ; however , schper et al41 found montelukast to increase peak expiratory flow significantly ( p<0.05 ) . \n immunoglobulin e ( ige ) activates mast cells , and its levels are elevated in people with allergic diseases.1 the monoclonal antibody omalizumab lowers the level of ige through selective binding , and anti - ige is used in the treatment of uncontrolled allergic asthma . \n omalizumab significantly improved nasal outcomes ( symptoms , nasal endoscopy , and ct results ) and qol but did not significantly improve pulmonary outcomes ( symptoms and pulmonary function test results ) . \n gevaert et al43 studied 24 patients with and without allergy in a 16-week double - blinded , placebo - controlled trial . \n standardized asthma treatment , and during the trial oral steroids and antibiotics were prohibited . \n they observed significant improvements in nasal symptoms , endoscopy results , and opacification on ct scans in the omalizumab group over those in the placebo group , irrespective of allergy status . \n vague results in the omalizumab group were seen in relation to the lower airways ; significant improvements were found in two of three pulmonary symptoms , but no significant changes were found in pulmonary function test results . \n the same group,44 in a randomized , double - blind , placebo - controlled trial of 30 patients with severe nasal polyposis , observed in 12 patients who received mepolizumab ( two doses ) radiographic and endoscopic improvement in nasal polyp burden compared to patients in the placebo arm , after 8 weeks of treatment . \n although mepolizumab led to a reduction in loss of smell , postnasal drip , and nasal congestion , these results did not reach statistical significance , and the benefit in nasal symptoms normalized after a period of time , except for improvement in olfaction . \n gevaert et al45 showed that a single injection of reslizumab , another anti - il-5 monoclonal antibody , improved nasal polyp scores in 50% of patients with crswnp , and nasal il-5 levels predicted the response to treatment . \n these studies support that a select population of patients with severe nasal polyposis may benefit from anti - il-5 therapy , although , once again , larger studies are needed to corroborate these findings . \n finally , in addition to the known antimicrobial effects , long - term low - dose treatment with a macrolide such as erythromycin is believed to have immunomodulatory effects . \n erythromycin improved nasal symptoms and was superior to ess in improving pulmonary outcomes ( symptoms and pulmonary function test results).40 ragab et al46 randomized a heterogeneous group of chronic rhinosinusitis without nasal polyps and crswnp patients with asthma who failed initial medical therapy with incs and nasal lavage to continued medical therapy or surgery . \n patients randomized to continued medical therapy received erythromycin for 12 weeks , nasal lavage , and fluticasone drops , and some patients with crswnp received oral steroids . \n both the medical and the surgery groups had improved asthma at 12-month follow - up ; evermore the continued medical therapy group ( erythromycin group ) had greater improvement in objective pulmonary function tests . \n when analyzing treatments used in both crswnp and asthma , the most used treatments are leukotriene antagonists , monoclonal antibodies , and macrolide antibiotics . \n the surgical treatment of nasal polyps by means of ess leads to a subjective improvement of asthma symptoms and a decrease in hospital admissions , emergency department visits , asthma exacerbations , and the need of medication for disease control . there is also growing evidence supporting that aggressive surgical management of crswnp can consequently lead to a greater improvement of asthma severity.4749 palmer et al50 retrospectively re - evaluated the clinical histories of 15 subjects who had both crs and steroid - dependent asthma , investigating the asthma relapse days and total dose of oral corticosteroid or antibiotics needed before and after ess . \n they observed that 93% of patients significantly reduced their postoperative prednisone or antibiotic needs by total number of days . \n senior et al51 reported that 90% of asthmatic patients ( n=30 ) who underwent ess for crs reduced the number of asthma exacerbations and need for medication after a follow - up period of 6.5 years . in the same line of research , manning et al52 found that children with crs and asthma ( n=14 ) who underwent ess had a decreased number of asthma hospitalizations and missed schooldays . \n other authors36,53 have observed that asthma patients undergoing ess for crswnp had a significant improvement in pulmonary function and a reduction of systemic medication , respectively , but they failed to show improvement in aerd patients . \n recently , leung et al54 simulated an evidence - based risk analysis using literature - reported complication rates , qol changes , and medicare costs to identify the threshold at which the risks of repeated courses of corticosteroid exceeded the risks of surgery . \n they found that the risks of oral corticosteroid exceed the risks of ess when patients exceed 0.20 ( crswnp ) , 0.53 ( crswnp / asthma ) , or 1.81 ( samter s triad ) courses of oral corticosteroids per year or need oral corticosteroid more frequently than every 5 years , 2 years , or 6 months , respectively . in ess trials , all nasal outcomes ( symptoms , nasal endoscopy , and pulmonary function test results ) and \n qol improved significantly although ambiguous results were reported for pulmonary outcomes ( symptoms , pulmonary function test results , and asthma medication intake ) . \n a systematic review has found that ess improves asthma control while decreasing asthma exacerbations , hospitalizations , and use of systemic and inhaled corticosteroids , pulmonary function being however unchanged.55 according to these findings , the current widespread belief is that comorbid asthmatic conditions of crswnp patients improve after ess . on the other hand , \n some authors have reported that asthma does not represent a predictor of poor symptomatic outcome after primary56,57 or revision58 ess . \n concomitant asthma was associated with worse postoperative endoscopic findings in two retrospective analyses , but had no significant weight on other objective outcomes . \n symptoms improved significantly in both asthmatics and nonasthmatics postoperatively , but asthmatics exhibited worse postoperative endoscopic outcomes.59,60 in a series of 120 patients undergoing ess , kennedy26 reported that asthma did not affect the surgical outcomes when comparing patients with similar sinonasal disease severity , excluding the worst patients in whom asthma negatively affected the outcome . \n seybt et al61 did not find differences in crs patients with or without asthma in terms of the need for primary sinonasal surgery , but they observed that asthmatics had a significantly increased number of secondary surgeries . \n uri et al62 reported that in patients with crswnp and asthma , ess did not affect the asthma status . \n lin et al,24 in a prospective trial including 224 crs patients , could not confirm the beneficial effect of ess on modifying the severity of asthma measured by objective lung function . \n these findings suggest a benefit of early therapy for crs in asthmatics if crs is considered a reason for poor asthma control . \n similarly , asthmatics with difficult - to - control illness should be assessed for unsuspected crs , with ct scanning or nasal endoscopy , since crs signs and symptoms may be subtle and overlooked if not specifically sought . \n we have highlighted that there exist only a few good quality studies of the treatment for crswnp with coexisting asthma , which underlines the need for further research in terms of both quality and quantity of the studies . \n we found low evidence to support a positive effect of both ess and medical intervention on pulmonary function tests and asthma medication intake . \n rix et al40 and vashishta et al55 observed that patients who underwent ess had an improvement in clinical asthma outcomes , but no significant change in pulmonary function test results . \n the effect of montelukast and other leukotriene antagonists on crswnp was evaluated in a recent systematic review and meta - analysis;63 improvements in symptoms and clinical outcomes were described by all 12 included studies after leukotriene antagonist treatment , but pulmonary function test results were sparse . \n ragab et al64 published a randomized , prospective trial on patients with chronic rhinosinusitis without nasal polyps or crswnp and asthma comparing surgical versus medical treatment . \n they found that medical as well as surgical treatments for crs showed improvements in asthma status with a good correlation to the improvement achieved in upper airway symptoms . \n exhaled nitric oxide levels and forced expiratory volume in 1 second ( fev1 ) improved in both groups with predominance in the medical treatment group of patients with crswnp . \n when analyzing the evidence of medical treatment specifically for patients with crswnp and coexisting asthma , there are a few randomized controlled trials and uncontrolled prospective interventional studies that evaluated the efficacy of different treatments . \n they observed that patients with crswnp have a significantly worse qol than the general population and that steroid treatment and ess lead to similar qol improvement in crswnp , either with or without asthma ; both steroid and ess treatments improve nasal symptoms in patients with crswnp . \n two montelukast trials with follow - up times of 10 weeks and 13 weeks were done . \n schper et al41 investigated the effect of montelukast ( 10 mg / d ) in a double - blinded , placebo - controlled crossover trial ( 6 weeks of intervention , 4 weeks of placebo ) in 24 patients . \n ragab et al42 studied 44 patients with montelukast ( 10 mg / d ) treatment for 3 months as an add - on therapy to inhaled steroids and intranasal steroids ( incs ) in an uncontrolled prospective trial . \n significant improvements in nasal and pulmonary symptoms , results of endoscopy and ct scanning of the paranasal sinuses , and asthma medication intake were reported in both trials . nevertheless , no significant improvements were found in nasal and pulmonary function test results ; however , schper et al41 found montelukast to increase peak expiratory flow significantly ( p<0.05 ) . \n immunoglobulin e ( ige ) activates mast cells , and its levels are elevated in people with allergic diseases.1 the monoclonal antibody omalizumab lowers the level of ige through selective binding , and anti - ige is used in the treatment of uncontrolled allergic asthma . \n omalizumab significantly improved nasal outcomes ( symptoms , nasal endoscopy , and ct results ) and qol but did not significantly improve pulmonary outcomes ( symptoms and pulmonary function test results ) . \n gevaert et al43 studied 24 patients with and without allergy in a 16-week double - blinded , placebo - controlled trial . \n standardized asthma treatment , and during the trial oral steroids and antibiotics were prohibited . \n they observed significant improvements in nasal symptoms , endoscopy results , and opacification on ct scans in the omalizumab group over those in the placebo group , irrespective of allergy status . \n vague results in the omalizumab group were seen in relation to the lower airways ; significant improvements were found in two of three pulmonary symptoms , but no significant changes were found in pulmonary function test results . \n the same group,44 in a randomized , double - blind , placebo - controlled trial of 30 patients with severe nasal polyposis , observed in 12 patients who received mepolizumab ( two doses ) radiographic and endoscopic improvement in nasal polyp burden compared to patients in the placebo arm , after 8 weeks of treatment . \n although mepolizumab led to a reduction in loss of smell , postnasal drip , and nasal congestion , these results did not reach statistical significance , and the benefit in nasal symptoms normalized after a period of time , except for improvement in olfaction . \n gevaert et al45 showed that a single injection of reslizumab , another anti - il-5 monoclonal antibody , improved nasal polyp scores in 50% of patients with crswnp , and nasal il-5 levels predicted the response to treatment . \n these studies support that a select population of patients with severe nasal polyposis may benefit from anti - il-5 therapy , although , once again , larger studies are needed to corroborate these findings . \n finally , in addition to the known antimicrobial effects , long - term low - dose treatment with a macrolide such as erythromycin is believed to have immunomodulatory effects . \n erythromycin improved nasal symptoms and was superior to ess in improving pulmonary outcomes ( symptoms and pulmonary function test results).40 ragab et al46 randomized a heterogeneous group of chronic rhinosinusitis without nasal polyps and crswnp patients with asthma who failed initial medical therapy with incs and nasal lavage to continued medical therapy or surgery . \n patients randomized to continued medical therapy received erythromycin for 12 weeks , nasal lavage , and fluticasone drops , and some patients with crswnp received oral steroids . \n both the medical and the surgery groups had improved asthma at 12-month follow - up ; evermore the continued medical therapy group ( erythromycin group ) had greater improvement in objective pulmonary function tests . \n when analyzing treatments used in both crswnp and asthma , the most used treatments are leukotriene antagonists , monoclonal antibodies , and macrolide antibiotics . \n the surgical treatment of nasal polyps by means of ess leads to a subjective improvement of asthma symptoms and a decrease in hospital admissions , emergency department visits , asthma exacerbations , and the need of medication for disease control . there is also growing evidence supporting that aggressive surgical management of crswnp can consequently lead to a greater improvement of asthma severity.4749 palmer et al50 retrospectively re - evaluated the clinical histories of 15 subjects who had both crs and steroid - dependent asthma , investigating the asthma relapse days and total dose of oral corticosteroid or antibiotics needed before and after ess . \n they observed that 93% of patients significantly reduced their postoperative prednisone or antibiotic needs by total number of days . \n senior et al51 reported that 90% of asthmatic patients ( n=30 ) who underwent ess for crs reduced the number of asthma exacerbations and need for medication after a follow - up period of 6.5 years . \n in the same line of research , manning et al52 found that children with crs and asthma ( n=14 ) who underwent ess had a decreased number of asthma hospitalizations and missed schooldays . \n other authors36,53 have observed that asthma patients undergoing ess for crswnp had a significant improvement in pulmonary function and a reduction of systemic medication , respectively , but they failed to show improvement in aerd patients . \n recently , leung et al54 simulated an evidence - based risk analysis using literature - reported complication rates , qol changes , and medicare costs to identify the threshold at which the risks of repeated courses of corticosteroid exceeded the risks of surgery . \n they found that the risks of oral corticosteroid exceed the risks of ess when patients exceed 0.20 ( crswnp ) , 0.53 ( crswnp / asthma ) , or 1.81 ( samter s triad ) courses of oral corticosteroids per year or need oral corticosteroid more frequently than every 5 years , 2 years , or 6 months , respectively . in ess trials , all nasal outcomes ( symptoms , nasal endoscopy , and pulmonary function test results ) and qol improved significantly although ambiguous results were reported for pulmonary outcomes ( symptoms , pulmonary function test results , and asthma medication intake ) . \n a systematic review has found that ess improves asthma control while decreasing asthma exacerbations , hospitalizations , and use of systemic and inhaled corticosteroids , pulmonary function being however unchanged.55 according to these findings , the current widespread belief is that comorbid asthmatic conditions of crswnp patients improve after ess . on the other hand , \n some authors have reported that asthma does not represent a predictor of poor symptomatic outcome after primary56,57 or revision58 ess . \n concomitant asthma was associated with worse postoperative endoscopic findings in two retrospective analyses , but had no significant weight on other objective outcomes . \n symptoms improved significantly in both asthmatics and nonasthmatics postoperatively , but asthmatics exhibited worse postoperative endoscopic outcomes.59,60 in a series of 120 patients undergoing ess , kennedy26 reported that asthma did not affect the surgical outcomes when comparing patients with similar sinonasal disease severity , excluding the worst patients in whom asthma negatively affected the outcome . \n seybt et al61 did not find differences in crs patients with or without asthma in terms of the need for primary sinonasal surgery , but they observed that asthmatics had a significantly increased number of secondary surgeries . \n uri et al62 reported that in patients with crswnp and asthma , ess did not affect the asthma status . \n lin et al,24 in a prospective trial including 224 crs patients , could not confirm the beneficial effect of ess on modifying the severity of asthma measured by objective lung function . \n these findings suggest a benefit of early therapy for crs in asthmatics if crs is considered a reason for poor asthma control . \n similarly , asthmatics with difficult - to - control illness should be assessed for unsuspected crs , with ct scanning or nasal endoscopy , since crs signs and symptoms may be subtle and overlooked if not specifically sought . \n we have highlighted that there exist only a few good quality studies of the treatment for crswnp with coexisting asthma , which underlines the need for further research in terms of both quality and quantity of the studies . \n we found low evidence to support a positive effect of both ess and medical intervention on pulmonary function tests and asthma medication intake . \n rix et al40 and vashishta et al55 observed that patients who underwent ess had an improvement in clinical asthma outcomes , but no significant change in pulmonary function test results . \n the effect of montelukast and other leukotriene antagonists on crswnp was evaluated in a recent systematic review and meta - analysis;63 improvements in symptoms and clinical outcomes were described by all 12 included studies after leukotriene antagonist treatment , but pulmonary function test results were sparse . \n ragab et al64 published a randomized , prospective trial on patients with chronic rhinosinusitis without nasal polyps or crswnp and asthma comparing surgical versus medical treatment . \n they found that medical as well as surgical treatments for crs showed improvements in asthma status with a good correlation to the improvement achieved in upper airway symptoms . \n exhaled nitric oxide levels and forced expiratory volume in 1 second ( fev1 ) improved in both groups with predominance in the medical treatment group of patients with crswnp . \n although there has been major advances in this field , there is still a lack of consistent evidence to reach firm conclusions about the relationship between upper and lower airway inflammatory diseases , their natural history , pathophysiology , and medical / surgical management . \n research on the basic pathophysiology of the nose and demonstration of the unified airway concept are mandatory . \n clarification is also required concerning whether crs management affects other comorbid lower airway diseases such as asthma , chronic obstructive respiratory disease , and bronchiectasis . \n randomized clinical trials with a good level of scientific evidence need to be performed to better understand the available treatments for comorbid upper and lower inflammatory diseases .", "role": "user" }, { "content": "patients with chronic rhinosinusitis with nasal polyps ( crswnp ) often have coexisting asthma under the concept of united airway disease , being the combination of both diseases , which is one of the most challenging phenotypes to treat . \n although clinicians have recognized this difficult - to - treat phenotype for many years , it remained poorly characterized . \n there is increasing epidemiological evidence linking chronic rhinosinusitis and asthma , but a good understanding of the pathophysiology and the combined management is still lacking . bronchial asthma is more prevalent in patients who suffer chronic rhinosinusitis , while asthmatic patients have a greater prevalence of crswnp than patients without asthma . the effect of crswnp treatment , whether medical or surgical , in asthma is today less controversial after some studies have shown improvement of asthma after medical and/or surgical treatment of crswnp . \n however , direct comparisons between surgical and medical treatments are limited . \n further randomized clinical trials are , however , still needed to better understand the management when both asthma and crswnp occur together . \n this review aims at summarizing the prevalence , impact , and management challenges regarding both asthma and crswnp .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 91-year - old female patient with a chief complaint of a mild febrile sensation and general weakness that lasted for two days was admitted to the emergency room at another hospital . \n the patient had hypertension controlled by the beta blocker bevantolol , and dementia controlled by donepezil and risperidone . \n she was able to ambulate and communicate without assistance , although she had limited ambulation after a short - leg splint was placed in order to treat undisplaced fractures of the 4th and 5th metatarsal bones of the right foot two weeks before her emergency room visit . \n she complained of watery diarrhea starting a week before her emergency room visit , and she started to produce small amounts of sputum over the last two days . the abdominal computed tomography ( ct ) scan taken in a previous hospital before referral to our hospital revealed fluid retention and a gas shadow in the right gluteal area and around the greater trochanter of the femur . \n she was transferred to our hospital for intensive care , as sepsis following soft tissue infection was suspected . at the time of the transfer , she had a systolic blood pressure ( sbp)/diastolic bp of 149/64 mmhg , a pulse rate of 74 beats / minute , a respiratory rate of 17 breaths / minute , and a body temperature of 36.5. physical examination revealed no evidence of skin necrosis or fluctuation ; generation of a mild level of heat was the only finding around the hip and thigh . \n her bp subsequently dropped to 81/38 mmhg , her body temperature increased to 38.5 , and she complained of a chilling sensation . \n laboratory findings included a white blood cell ( wbc ) count of 14,300/mm ( normal range : 4,000 - 10,000/mm , neutrophils 95% ) , an erythrocyte sedimentation rate ( esr ) of 41 mm / hour ( normal range : < 20 mm / hour ) , and a c - reactive protein ( crp ) level of 17.46 mg / dl ( normal range : < 0.5 mg / dl ) . under a diagnosis of sepsis \n gas was observed on the right gluteal area on plain radiographs of the pelvis ( fig . \n additionally , increased signal intensity was observed along the gluteus fascia to the greater trochanteric area on magnetic resonance imaging ( mri ) , and abscess formation was identified between the right gluteus maximus and medius ( fig . \n air formation was identified , indicating invaded inflammatory lesions on both sides of the hips . \n although cystic shadows in the posterosuperior surface of the uterus were detected , radiographic findings were insufficient to determine a connection to the hip lesions . based on the aforementioned findings , \n bilateral nf was confirmed around both hips and hip joints , along with the fascia and muscles , occurring in layers deeper than the skin and the subcutaneous layer . \n after her bp was stabilized , prompt incisions and thorough debridements were performed on the following day . \n taking the patient 's comorbid conditions into account , surgery was conducted only on the right side ( the side with clear abscess and gas formation ) in order to minimize operating time . \n bacterial cultures and subsequent identifications were performed on a gray - colored abscess discharged at the time of incision . \n abscess and necrotic tissues were observed along the gluteus medius and greater trochanter of the femur . \n after sufficient debridement and lavage , the patient underwent a right hip joint puncture for culture tests . a drainage catheter was inserted and the surgical site was sutured . \n the patient was referred to a gynecologist due to cystic lesions along the superior surface of the uterus , which were considered to be a possible cause of infection . \n transvaginal sonography was conducted by switching the patient to the lithotomy position , and puncture and aspiration were performed . \n the aspirated fluid was clear and lesions were clinically judged to be non - inflammatory . \n postoperatively , she was under intensive care for two days with a sbp of 132 mmhg and a body temperature of 36.2. she had a wbc count of 9,400/mm ( neutrophil 95% ) , esr of 16 mm / hour , and a crp level of 3.77 mg / dl . \n escherichia coli was detected by culture tests conducted intraoperatively , and treated with sustained - release ciprofloxacin . \n the drainage catheter , which had been in place for a week , was removed after tip culture . after managing surgical wounds for two weeks \n subsequently , her ambulation was limited by a combination of sepsis and the trauma of an operation following a rapidly progressive infection . additionally , a pressure ulcer that occurred on the ischial areas was detected and considered to require management . \n general symptoms , high fever , and other findings were not identified after the initial operation . \n on postoperative day 14 , the patient 's crp level was elevated to 8.37 mg / dl with a raised body temperature of 38.5. taking into account possible symptoms caused by her pressure ulcer infection , the patient was followed - up with antibiotic administration . however , a follow - up mri was performed due to persistently increased body temperature and crp levels . \n an increase in the size of the abscess was found between the left greater trochanter and the gluteus medius ( fig . \n bacterial cultures and subsequent identifications were performed on drained serosanguinous fluid , and the surgical site was sutured after inserting a drainage catheter . \n additionally , her body temperature did not exceed 36.7. further deterioration of the ischial pressure ulcer required wound dressing and care . \n nf is a rare infection and an orthopedic emergency that requires discrimination from severe cellulitis or abscess . \n type i is characterized by synergistic polymicrobial infections caused by non - group a streptococci , as well as aerobic and anaerobic organisms . \n type iii is caused by marine vibrio species after exposure to raw seafood or seawater and marine animals , and is lethal in 30 - 40% of all cases6 ) . \n type i nf , which accounts for more than 70% of all nf infections , is more likely to occur in immune compromised patients , has various prognoses according to patients ' underlying diseases , and progresses slower than other types3,4 ) . \n the elderly patient in the present case report developed type i nf that had progressed over 3 days after abdominal symptoms ( diarrhea ) , and the causative pathogen was identified as e. coli . although only a single strain was identified due to the administration of antibiotics before performing the surgery and culture test , gas formation on plain radiographs and broad necrosis found in the operating room indicated that the infection was caused by multiple microorganisms acting synergistically . \n gas tracking and necrotic tissues that spread along the fascial planes on ct imaging are typical clinical features of nf7 ) . \n gas was observed only on the right gluteal area on plain radiographs , and the degree of tissue invasion was less severe on the left side as compared to the right on the ct image . \n however , the patient was diagnosed with bilateral nf around both hips , as a gas shadow and a progressive infection spreading along the fascial planes were observed . \n although not all cases of nf show gas formation on plain radiographs , gas is only seen in 3% of non - nf cases as opposed to 32% of nf cases . \n thus , detection of gas formation may aid in the early diagnosis of this infection8 ) . to determine whether the uterine cystic lesions observed during the preoperative evaluation were causing the infection , the patient was referred for assessment by a gynecologist . \n fournier gangrene , a form of nf of the perineal region , commonly requires care and treatment in gynecology , urology , and general surgery departments . in some cases \n , colostomy can be performed concurrently with surgical debridement to prevent fecal contamination of the surgical wound9 ) . in the present case report \n , the possibility of fournier gangrene was excluded after preoperative exams . however , clinical symptoms ( a febrile sensation in the hip ) were insufficient to discriminate nf from fournier gangrene . in the case of fournier gangrene , gynecologist or general surgeon \n although the authors intended to conduct a colonoscopy and examinations of additional organs to clarify the exact cause of the infection , the patient and her family members rejected the procedures . \n the causes of the serious infection were therefore assessed by evaluating her intraperitoneal organs on the preoperative abdominal ct and mri , and confirmed intraoperatively . in a case report described by kim et al . \n ( 2013)5 ) , rectal cancer was confirmed through additional examinations after managing nf around the unilateral thigh . \n however , unsatisfactory results were obtained due to the refusal of the patient and the patient 's family members to undergo aggressive treatment . for patients with nf of the thigh with no exact cause , they suggest a heightened level of clinical suspicion pertaining to abdominal or intestinal causes , and recommend ct scanning . unlike the case report by kim et al.5 ) , the rare condition observed in the present case report , bilateral nf affecting the thigh and hip , has not yet been reported in the literature . \n because older patients have a poorer prognosis relative to younger patients , the decision to perform any aggressive treatment in an elderly patient is made more difficult and complicated . \n due to the patient 's unstable condition at the time of the initial operation in the present case , thorough surgical debridement to shorten the operating time could not be performed . \n based on further deterioration of symptoms detected during a follow - up examination , and additional debridement was done on the left aspect . \n prompt diagnosis , thorough debridement , and the use of adequate antibiotics are critical in the treatment of type i nf . because this infection is assumed to be polymicrobial , the use of adequate antibiotics is essential for treatment3 ) . \n the prognosis may be unfavorable in patients 60 years of age with diabetes , hypotension , renal failure , and other conditions . \n nevertheless , the patient in this case report was able to recover from nf due to prompt surgical management and an interdisciplinary approach to the underlying diseases . \n the results of a previous study suggested that aggressive surgical intervention reduced a mortality rate of 35% to 4.2%10 ) , and complete debridement is mow recommended instead of removing only nonviable tissues . \n although 1 - 2 sessions of surgery can achieve good results1,4 ) , 3 - 4 operations are carried out on average6 ) . \n the elderly patient in the present case report had nf around both hips , and it was difficult to discriminate this patient 's signs and symptoms from those of fournier gangrene , a form of nf of the perineal region near the hip . \n prompt radiologic evaluation and systematic management in several departments resulted in favorable outcomes . despite the necessity of performing debridement separately on each side of the hip , \n early and aggressive treatment led to recovery from nf , despite the risk imposed by the patient 's older age . \n a better prognosis is expected with thorough debridement of all lesions associated with bilateral nf .", "role": "user" }, { "content": "as an emergency encountered in orthopedic practice requiring prompt diagnosis and aggressive treatment , necrotizing fasciitis around the hip must be discriminated from fournier gangrene . \n the current case report describes a patient who suffered from bilateral type i necrotizing fasciitis around the hips , which was alleviated by prompt surgical debridement and intensive postoperative care .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a pcr master mix from promega corporation ( madison , wi , usa ) was applied in all pcr assays . \n asymmetric pcr was performed with a reaction mixture containing 2.5 u taq dna polymerase , a 200-mol / l concentration of each deoxynucleoside triphosphate ( datp , dgtp , dctp , and dttp ) , 1.5 mmol / l mgcl2 in 1 reaction buffer , 500 nmol / l cy3 modified reverse primer , 50 nmol / l forward primer , and 10 l dna template from the autoclaved bacterial cultures . \n the amplification profile included an initial step at 95c for 5 min , followed by 5 cycles of 95c for 1 min , 56c for 1 min , and 72c for 1 min ; 30 cycles of 95c for 1 min , 54c for 1 min , and 72c for 1 min ; and a final extension step at 72c for 7 min . \n pcr controls were run with the reaction containing all the reagents for pcr amplification except template dna . \n primer pool i contained 7 primer pairs , ba2 , btk1 , ft1 , yp1 , cb1 , va1 , and bm1 . \n primer pool ii contained ba4 , btk2 , ft2 , yp2 , cb2 , va2 , and bm2 . \n multiplex pcr was run as follows : an initial step at 95c for 5 min , followed by 5 cycles of 95c for 1 min , 56c for 1 min , and 72c for 1 min ; 40 cycles of 95c for 1 min , 54c for 1 min , and 72c for 1 min ; and a final extension step at 72c for 7 min . \n pcr products were analyzed on 4% precast agarose gels ( invitrogen corporation , carlsbad , ca , usa ) and visualized on gel doc xr system ( bio - rad laboratories , hercules , ca , usa ) . \n the denatured pcr products ( 25 l ) were combined with 10 l hybridization buffer ( 2 mol / l nacl and 0.2 mol / l phosphate - buffered saline [ pbs ] ) and hybridized to the multiplexed array for 30 min at room temperature . \n tris - edta ( te ) buffer was used to wash the array after hybridization to remove the unbound target dna , and 20% formamide in pbs ( 50c ) was applied for 1 min to minimize nonspecific binding of target dna to probes followed by washing with te buffer for another 1 min . \n a pcr master mix from promega corporation ( madison , wi , usa ) was applied in all pcr assays . \n asymmetric pcr was performed with a reaction mixture containing 2.5 u taq dna polymerase , a 200-mol / l concentration of each deoxynucleoside triphosphate ( datp , dgtp , dctp , and dttp ) , 1.5 mmol / l mgcl2 in 1 reaction buffer , 500 nmol / l cy3 modified reverse primer , 50 nmol / l forward primer , and 10 l dna template from the autoclaved bacterial cultures . \n the amplification profile included an initial step at 95c for 5 min , followed by 5 cycles of 95c for 1 min , 56c for 1 min , and 72c for 1 min ; 30 cycles of 95c for 1 min , 54c for 1 min , and 72c for 1 min ; and a final extension step at 72c for 7 min . \n pcr controls were run with the reaction containing all the reagents for pcr amplification except template dna . \n primer pool i contained 7 primer pairs , ba2 , btk1 , ft1 , yp1 , cb1 , va1 , and bm1 . \n primer pool ii contained ba4 , btk2 , ft2 , yp2 , cb2 , va2 , and bm2 . \n multiplex pcr was run as follows : an initial step at 95c for 5 min , followed by 5 cycles of 95c for 1 min , 56c for 1 min , and 72c for 1 min ; 40 cycles of 95c for 1 min , 54c for 1 min , and 72c for 1 min ; and a final extension step at 72c for 7 min . \n pcr products were analyzed on 4% precast agarose gels ( invitrogen corporation , carlsbad , ca , usa ) and visualized on gel doc xr system ( bio - rad laboratories , hercules , ca , usa ) . \n the denatured pcr products ( 25 l ) were combined with 10 l hybridization buffer ( 2 mol / l nacl and 0.2 mol / l phosphate - buffered saline [ pbs ] ) and hybridized to the multiplexed array for 30 min at room temperature . \n tris - edta ( te ) buffer was used to wash the array after hybridization to remove the unbound target dna , and 20% formamide in pbs ( 50c ) was applied for 1 min to minimize nonspecific binding of target dna to probes followed by washing with te buffer for another 1 min . \n a pcr master mix from promega corporation ( madison , wi , usa ) was applied in all pcr assays . \n asymmetric pcr was performed with a reaction mixture containing 2.5 u taq dna polymerase , a 200-mol / l concentration of each deoxynucleoside triphosphate ( datp , dgtp , dctp , and dttp ) , 1.5 mmol / l mgcl2 in 1 reaction buffer , 500 nmol / l cy3 modified reverse primer , 50 nmol / l forward primer , and 10 l dna template from the autoclaved bacterial cultures . \n the amplification profile included an initial step at 95c for 5 min , followed by 5 cycles of 95c for 1 min , 56c for 1 min , and 72c for 1 min ; 30 cycles of 95c for 1 min , 54c for 1 min , and 72c for 1 min ; and a final extension step at 72c for 7 min . \n pcr controls were run with the reaction containing all the reagents for pcr amplification except template dna . \n primer pool i contained 7 primer pairs , ba2 , btk1 , ft1 , yp1 , cb1 , va1 , and bm1 . \n primer pool ii contained ba4 , btk2 , ft2 , yp2 , cb2 , va2 , and bm2 . \n multiplex pcr was run as follows : an initial step at 95c for 5 min , followed by 5 cycles of 95c for 1 min , 56c for 1 min , and 72c for 1 min ; 40 cycles of 95c for 1 min , 54c for 1 min , and 72c for 1 min ; and a final extension step at 72c for 7 min . \n pcr products were analyzed on 4% precast agarose gels ( invitrogen corporation , carlsbad , ca , usa ) and visualized on gel doc xr system ( bio - rad laboratories , hercules , ca , usa ) . \n the denatured pcr products ( 25 l ) were combined with 10 l hybridization buffer ( 2 mol / l nacl and 0.2 mol / l phosphate - buffered saline [ pbs ] ) and hybridized to the multiplexed array for 30 min at room temperature . \n tris - edta ( te ) buffer was used to wash the array after hybridization to remove the unbound target dna , and 20% formamide in pbs ( 50c ) was applied for 1 min to minimize nonspecific binding of target dna to probes followed by washing with te buffer for another 1 min .", "role": "user" }, { "content": "we developed a fiber - optic , microsphere - based , high - density array composed of 18 species - specific probe microsensors to identify biological warfare agents . \n we simultaneously identified multiple biological warfare agents in environmental samples by looking at specific probe responses after hybridization and response patterns of the multiplexed array .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ischemia reperfusion injury ( iri ) occurs when blood supply to a tissue is temporarily interrupted . \n when blood flow is restored reperfusion paradoxically induces more severe tissue injury [ 1 , 2 ] . \n renal warm - iri occurs in clinical practice and is a consequence of systemic hypoperfusion with subsequent circulatory resuscitation . \n local nephritic hypoperfusion after aortic cross - clamping or renal transplantation also causes iri to the kidney . \n several recent trials have shown that remote ischemic conditioning ( ric ) has a powerful protective effect in limiting nephritic iri . \n ric is accomplished with brief nonlethal cycles of ischemia and reperfusion of an arm or leg . \n these cycles may be applied before ( preconditioning ) , during ( perconditioning ) , or after ( postconditioning ) prolonged ischemia of a distant organ [ 6 , 7 ] . \n some studies have found that ric is a straightforward , inexpensive , non - invasive , and powerful means of preventing nephritic iri during surgery or organ transplantation [ 3 , 8 , 9 ] . in previous studies , remote ischemic postconditioning ( ripostc ) and perconditioning ( riperc ) \n have provided practical methods for protecting the kidneys against iri , but their combined effects and mechanism have not been studied in detail . in the present study , we conducted a randomized trial on rats in which we induced iri . to augment the protective effect of ric \n , ric was induced through lower limb ischemia , rather than upper limb ischemia , and riperc was combined with ripostc ( riperc + ripostc ) . \n renal iri was assessed by measuring levels of serum creatinine ( scr ) and blood urea nitrogen ( bun ) . \n we also histologically assessed the degree of renal tubular injury , and measured myeloperoxidase ( mpo ) activity superoxide dismutase ( sod ) activity and malondialdehyde ( mda ) content . \n eighteen - week - old male sprague dawley rats , weighing between 200 and 250 g ( experimental animal center , xuzhou medical college , xuzhou , jiangsu province , china ) were studied . \n the animal research study protocol was in compliance with the guide for the care and use of laboratory animals published by the national institutes of health ( nih pub . \n 8523 , revised 1996 ) and approved by the animal care committee of the affiliated hospital of xuzhou medical college , xuzhou medical college . \n all rats were acclimatized with free access to food and water in a 2227 c environment for 2 weeks prior to the experiments . \n surgical procedures were performed with the rats under sodium pentobarbital anaesthesia ( 40 mg / kg ; i.p . ) . \n the ric stimulus was delivered via tourniquet blockage of blood flow to the right hind limb for cycles of 5-min occlusion followed by 5-min resumption of blood flow . \n fifty rats were randomly allocated to each of five experimental groups ; three rats were excluded because of anaesthetic or surgical complications . \n ( n = 10 ) , the left renal artery was occluded for 60 min with a nontraumatic vascular clip , followed by 24 h of reperfusion . in the sham group ( n = 10 ) , all the above surgical procedures were performed , except that iri was not induced . in the riperc group \n ( n = 8) , four cycles of 5 min of ischemia followed by 5 min of reperfusion were performed on the right hind limb during renal ischemia and before renal reperfusion . in the ripostc group \n ( n = 9 ) , four cycles of ischemia / reperfusion of the right lower limb were performed immediately after restoring blood flow to the kidney . in the riperc + ripostc group ( n = 10 ) , \n two cycles of ischemia / reperfusion were performed during renal ischemia before renal reperfusion , and two similar cycles were performed immediately upon restoring blood flow to the kidney ( fig . \n 1experimental protocols and grouping of the animals experimental protocols and grouping of the animals at the end of the 24-h reperfusion period , plasma samples were collected , and scr and bun levels were determined using commercially available colorimetric methods , according to the manufacturer s instructions . \n mpo activity , mda content , and sod activity were measured in the 10 % homogenates by colorimetric methods using commercially available kits , according to the manufacturer s instructions . in each rat , the left kidney was removed under fully maintained anaesthesia . \n after removal , the kidney was bisected along the non - hilar axis and was fixed in 10 % phosphate - buffered formalin . \n the tissues were subsequently embedded in paraffin , sectioned , stained with hematoxylin and eosin , and were analyzed . \n renal damaged was histologically graded using the established by accepted grading system described by jablonski et al . . \n kidney injury was scored by a single pathologist ( x.l.s . ) as the percentage of damaged tubules in the corticomedullary junction . \n criteria for kidney injury included tubular necrosis , cast formation , loss of the brush border , tubular dilatation and immune cell infiltration . \n scoring for each category was as follows : 0 for no change ; 1 for < 10 % ; 2 for 1020 % ; 3 for 2130 % ; 4 for > 30 % area change . \n graph pad prism 5 ( graph pad inc . , la jolla , ca ) was used to analyze and present data . \n differences between groups were analyzed using a paired parametric t test or a one - way anova test . \n eighteen - week - old male sprague dawley rats , weighing between 200 and 250 g ( experimental animal center , xuzhou medical college , xuzhou , jiangsu province , china ) were studied . \n the animal research study protocol was in compliance with the guide for the care and use of laboratory animals published by the national institutes of health ( nih pub . \n 8523 , revised 1996 ) and approved by the animal care committee of the affiliated hospital of xuzhou medical college , xuzhou medical college . \n all rats were acclimatized with free access to food and water in a 2227 c environment for 2 weeks prior to the experiments . \n surgical procedures were performed with the rats under sodium pentobarbital anaesthesia ( 40 mg / kg ; i.p . ) . \n the ric stimulus was delivered via tourniquet blockage of blood flow to the right hind limb for cycles of 5-min occlusion followed by 5-min resumption of blood flow . \n fifty rats were randomly allocated to each of five experimental groups ; three rats were excluded because of anaesthetic or surgical complications . \n ( n = 10 ) , the left renal artery was occluded for 60 min with a nontraumatic vascular clip , followed by 24 h of reperfusion . in the sham group ( n = 10 ) , all the above surgical procedures were performed , except that iri was not induced . in the riperc group \n ( n = 8) , four cycles of 5 min of ischemia followed by 5 min of reperfusion were performed on the right hind limb during renal ischemia and before renal reperfusion . in the ripostc group \n ( n = 9 ) , four cycles of ischemia / reperfusion of the right lower limb were performed immediately after restoring blood flow to the kidney . in the riperc + ripostc group \n ( n = 10 ) , two cycles of ischemia / reperfusion were performed during renal ischemia before renal reperfusion , and two similar cycles were performed immediately upon restoring blood flow to the kidney ( fig . 1).fig . \n at the end of the 24-h reperfusion period , plasma samples were collected , and scr and bun levels were determined using commercially available colorimetric methods , according to the manufacturer s instructions . \n mpo activity , mda content , and sod activity were measured in the 10 % homogenates by colorimetric methods using commercially available kits , according to the manufacturer s instructions . \n after removal , the kidney was bisected along the non - hilar axis and was fixed in 10 % phosphate - buffered formalin . \n the tissues were subsequently embedded in paraffin , sectioned , stained with hematoxylin and eosin , and were analyzed . \n renal damaged was histologically graded using the established by accepted grading system described by jablonski et al . . \n kidney injury was scored by a single pathologist ( x.l.s . ) as the percentage of damaged tubules in the corticomedullary junction . \n criteria for kidney injury included tubular necrosis , cast formation , loss of the brush border , tubular dilatation and immune cell infiltration . \n scoring for each category was as follows : 0 for no change ; 1 for < 10 % ; 2 for 1020 % ; 3 for 2130 % ; 4 for > 30 % area change . \n graph pad prism 5 ( graph pad inc . , la jolla , ca ) was used to analyze and present data . \n differences between groups were analyzed using a paired parametric t test or a one - way anova test . \n 2a , b , the levels of scr and bun in the iri , riperc , ripostc and riperc + ripostc groups were significantly higher than seen in the sham group ( p < 0.001 ) . \n in addition , the iri group showed higher levels of scr and bun than the riperc , ripostc , and riperc + ripostc groups . \n there was no significant difference in scr and bun levels among the riperc , ripostc , and riperc + ripostc groups at 24 h after reperfusion ( p > 0.05 ) . \n these results indicate that the renal iri induced by a 60-min period of ischemia can be limited to some degree using ric.fig . 2 \n a and b \n , respectively demonstrate that scr and bun concentrations in the iri , riperc , ripostc , and riperc + ripostc groups are significantly higher than those in the sham group . \n in addition , the iri group shows higher scr and bun concentrations than the riperc , ripostc , and riperc + ripostc groups . \n < 0.01 , * p < 0.05 vs. iri group ) \n a and b , respectively demonstrate that scr and bun concentrations in the iri , riperc , ripostc , and riperc + ripostc groups are significantly higher than those in the sham group . \n in addition , the iri group shows higher scr and bun concentrations than the riperc , ripostc , and riperc + ripostc groups . \n ( * * * p < 0.001 , * * p < 0.01 , * p < 0.05 vs. iri group ) mpo activity and mda content levels were significantly elevated in the iri group compared to the sham group . \n all of the ric groups ( riperc , ripostc , and riperc + ripostc ) had a less remarkable elevation of mpo activity and mda content ( p < 0.05 , fig . 3a , c ) . \n sod activity significantly decreased in the iri group compared to that in the sham group , but did not significantly decrease in the ric groups ( p < 0.05 , fig . \n sod activity , mpo activity , and mda content were not significantly different between the riperc , ripostc and riperc + ripostc groups . \n . 3).fig . 3 \n a and c , respectively , demonstrate that mpo activity and mda content levels are significantly elevated in the iri group compared to those in the sham group . \n all of the ric groups ( riperc , ripostc , and riperc + ripostc ) had a lesser elevation of mpo activity and mda content . \n c demonstrates that sod activity significantly decreased in the iri group compared to that in the sham group , but did not significantly decrease in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) . \n d shows that the tubular damage score significantly decreased in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) compared to that the iri group . \n ( * * * p < 0.001 , * * p < 0.01 , * p < 0.05 vs. iri group ) \n a and c , respectively , demonstrate that mpo activity and mda content levels are significantly elevated in the iri group compared to those in the sham group . \n all of the ric groups ( riperc , ripostc , and riperc + ripostc ) had a lesser elevation of mpo activity and mda content . \n c demonstrates that sod activity significantly decreased in the iri group compared to that in the sham group , but did not significantly decrease in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) . \n d shows that the tubular damage score significantly decreased in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) compared to that the iri group . \n ( * * * p < 0.001 , * * p < 0.01 , * p < 0.05 vs. iri group ) according to the well - known grading system established by jablonski et al . the extent of renal tubular damage in the study groups is described in detail in table 1 . \n + ripostc groups showed ischemic tubulointerstitial abnormalities , that were clearly less prominent than those seen in the iri group , which displayed moderate - to - severe ischemic - characteristic tubulointerstitial lesions ( p < 0.05 , figs . 3d , 4 ) . \n a significant difference was not seen among the riperc , ripostc , and riperc + ripostc groups at 24 h after kidney reperfusion.table 1renal tubular damage scores in the five groupsgroupsdegree of damageno change ( n)minimal ( < 10 % ) ( n)mild ( 1120 % ) ( n)moderate ( 2130 % ) ( n)severe ( > 30 % ) ( n)sham ( n = 10)37000iri ( n = 10)01630riperc ( n = 8)06200ripostc ( n = 9)06300riperc + ripostc ( n = 10)08200fig . \n 4tissue sections stained with hematoxylin and eosin ( h&e ) 40 . a sham operation ( sham \n group ) : no abnormalities ; b untreated iri ( iri group ) : moderate - to - severe tubular cell necrosis , tubular dilation , intratubular cell detachment , interstitial oedema , and interstitial cellular infiltration ; c , d , e riperc , ripostc , and riperc + ripostc treatment ( riperc , ripostc , and riperc + ripostc groups ) : the degree of renal graft injury clearly less severe than that in the iri group ( b ) renal tubular damage scores in the five groups tissue sections stained with hematoxylin and eosin ( h&e ) 40 . a sham operation ( sham group ) : no abnormalities ; b untreated iri ( iri group ) : moderate - to - severe tubular cell necrosis , tubular dilation , intratubular cell detachment , interstitial oedema , and interstitial cellular infiltration ; c , d , e riperc , ripostc , and riperc + ripostc treatment ( riperc , ripostc , and riperc + ripostc groups ) : the degree of renal graft injury clearly less severe than that in the iri group ( b ) \n 2a , b , the levels of scr and bun in the iri , riperc , ripostc and riperc + ripostc groups were significantly higher than seen in the sham group ( p < 0.001 ) . \n in addition , the iri group showed higher levels of scr and bun than the riperc , ripostc , and riperc + ripostc groups . \n there was no significant difference in scr and bun levels among the riperc , ripostc , and riperc + ripostc groups at 24 h after reperfusion ( p > 0.05 ) . \n these results indicate that the renal iri induced by a 60-min period of ischemia can be limited to some degree using ric.fig . 2 \n a and b \n , respectively demonstrate that scr and bun concentrations in the iri , riperc , ripostc , and riperc + ripostc groups are significantly higher than those in the sham group . \n in addition , the iri group shows higher scr and bun concentrations than the riperc , ripostc , and riperc + ripostc groups . \n < 0.01 , * p < 0.05 vs. iri group ) \n a and b , respectively demonstrate that scr and bun concentrations in the iri , riperc , ripostc , and riperc + ripostc groups are significantly higher than those in the sham group . \n in addition , the iri group shows higher scr and bun concentrations than the riperc , ripostc , and riperc + ripostc groups . \n ( * * * p < 0.001 , * * p < 0.01 , * p < 0.05 vs. iri group ) \n mpo activity and mda content levels were significantly elevated in the iri group compared to the sham group . \n all of the ric groups ( riperc , ripostc , and riperc + ripostc ) had a less remarkable elevation of mpo activity and mda content ( p < 0.05 , fig . 3a , c ) . \n sod activity significantly decreased in the iri group compared to that in the sham group , but did not significantly decrease in the ric groups ( p < 0.05 , fig . 3b ) . \n sod activity , mpo activity , and mda content were not significantly different between the riperc , ripostc and riperc + ripostc groups . \n a and c , respectively , demonstrate that mpo activity and mda content levels are significantly elevated in the iri group compared to those in the sham group . \n all of the ric groups ( riperc , ripostc , and riperc + ripostc ) had a lesser elevation of mpo activity and mda content . \n c demonstrates that sod activity significantly decreased in the iri group compared to that in the sham group , but did not significantly decrease in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) . \n d shows that the tubular damage score significantly decreased in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) compared to that the iri group . \n < 0.01 , * p < 0.05 vs. iri group ) \n a and c , respectively , demonstrate that mpo activity and mda content levels are significantly elevated in the iri group compared to those in the sham group . \n all of the ric groups ( riperc , ripostc , and riperc + ripostc ) had a lesser elevation of mpo activity and mda content . \n c demonstrates that sod activity significantly decreased in the iri group compared to that in the sham group , but did not significantly decrease in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) . \n d shows that the tubular damage score significantly decreased in the ric groups ( riperc , ripostc , and riperc + ripostc groups ) compared to that the iri group . \n the extent of renal tubular damage in the study groups is described in detail in table 1 . \n the riperc , ripostc , and riperc + ripostc groups showed ischemic tubulointerstitial abnormalities , that were clearly less prominent than those seen in the iri group , which displayed moderate - to - severe ischemic - characteristic tubulointerstitial lesions ( p < 0.05 , figs . \n was not seen among the riperc , ripostc , and riperc + ripostc groups at 24 h after kidney reperfusion.table 1renal tubular damage scores in the five groupsgroupsdegree of damageno change ( n)minimal ( < 10 % ) ( n)mild ( 1120 % ) ( n)moderate ( 2130 % ) ( n)severe ( > 30 % ) ( n)sham ( n = 10)37000iri ( n = 10)01630riperc ( n = 8)06200ripostc ( n = 9)06300riperc + ripostc ( n = 10)08200fig . \n 4tissue sections stained with hematoxylin and eosin ( h&e ) 40 . a sham operation ( sham group ) : no abnormalities ; b untreated iri ( iri group ) : moderate - to - severe tubular cell necrosis , tubular dilation , intratubular cell detachment , interstitial oedema , and interstitial cellular infiltration ; c , d , e riperc , ripostc , and riperc + ripostc treatment ( riperc , ripostc , and riperc + ripostc groups ) : the degree of renal graft injury clearly less severe than that in the iri group ( b ) renal tubular damage scores in the five groups tissue sections stained with hematoxylin and eosin ( h&e ) 40 . a sham operation ( sham group ) : no abnormalities ; b untreated iri ( iri group ) : moderate - to - severe tubular cell necrosis , tubular dilation , intratubular cell detachment , interstitial oedema , and interstitial cellular infiltration ; c , d , e riperc , ripostc , and riperc + ripostc treatment ( riperc , ripostc , and riperc + ripostc groups ) : the degree of renal graft injury clearly less severe than that in the iri group ( b ) \n the present study shows that riperc + ripostc was as effective as riperc or ripostc in decreasing renal reperfusion injury in a rat model of iri . \n however , the riperc + ripostc combination did not result in superior outcomes to either riperc or ripostc alone . \n the renal iri protective effect of riperc and ripostc was first reported by kadkhodaee et al . in 2011 . in a rat model of nephritic iri , \n four episodes of 5-min ischemia followed by 5-min reperfusion of the left femoral artery were applied during renal ischemia before reperfusion , or after ischemia at the time of restoration of blood flow to the kidney . \n we included five experimental groups to investigate whether ric could protect the kidney from ischemic injury . \n indeed , the iri group demonstrated significantly more serologic and histological evidence of renal damage than the sham group , verifying the induction of ischemia / reperfusion injury . \n additionally , scr and bun levels in the riperc , ripostc and riperc + ripostc groups were significantly lower than those in the iri group ( p < 0.05 ) , demonstrating the protective effect of ric . \n there was no significant difference in scr or bun levels between the three ric groups ( p > 0.05 ) . \n the level of mpo activity in renal tissue represents the quantitative expression of neutrophil activity and infiltration into the kidneys . \n demonstrated that the release of proteinase 3 ( pr3 ) and elastase by activated neutrophils during acute inflammation , may result in vascular damage by causing endothelial cell apoptosis [ 10 , 11 ] . \n in other words , mpo activity may indirectly reflect the extent of renal tubular epithelial cell apoptosis . \n the iri , riperc , ripostc , and riperc + ripostc groups all showed significantly higher mpo activity than the sham group ( p < 0.05 ) . \n this indicates that after ischemia reperfusion , a large number of neutrophils are activated , and these infiltrate into the local ischemic tissues . \n mpo activities in the riperc , ripostc , and riperc + ripostc groups were lower than those in the iri group ( p < 0.05 ) , once again supporting the protective effect of ric . \n the degree of nephritic tubular injury in the riperc , ripostc , and riperc + ripostc groups was less prominent than that seen in the iri group ( p < 0.05 ) . \n these results suggest that the riperc , ripostc , and riperc + ripostc groups experienced less renal tubular damage through a reduction of neutrophil accumulation and renal tubular epithelial cell apoptosis in ischemic renal ischemic tissue . \n mda is the main metabolite of lipid peroxidation within the body , and elevated levels indirectly reflect a higher degree of cell damage in the body . \n sod plays a key role in the body s oxidation and antioxidative balance ; this enzyme protects cells from damage by scavenging the superoxide anion radical ( o2- ) . \n sod activity indirectly reflects the level of free radical scavenging activity within the body , and the level of mda indirectly reflects the severity of cellular injury from free radical attack . \n the iri , riperc , ripostc , and riperc + ripostc groups all demonstrated higher renal tissue mda content than the sham surgery group . \n sod activity was significantly lower in the iri group than sod activities in the riperc , ripostc , and riperc + ripostc treatment groups ( p < 0.05 ) . \n the riperc , ripostc , and riperc + ripostc groups were able to maintain a higher sod activity than the iri group . \n this enables the destruction of more oxygen - free radicals , and reduces oxygen - free radical - mediated lipid peroxidation . \n the higher sod activity in the ric groups leads to a reduction in the degree of renal iri and may account for a significant portion of ric s protective effect . \n our results indicated that ric reduced the intensity of renal inflammation intensity , protecting the kidneys from iri to some extent . \n these three different approaches likely function via the same mechanism of action to reduce renal iri . in clinical studies , \n ravlo et al . , wu et al . and sndergaard et al . \n huang et al . also observed similar protective effects in kidney resection , but chen et al . \n found no improvement in renal function when ric was used in living donor kidney transplantation . \n further studies are necessary to determine the optimal techniques and indications for ric in the future , especially with regard to clinical trials . \n we have demonstrated the protective effects of ric in limiting iri in the rat kidney . \n riperc , ripostc , and riperc + ripostc treatments were all equally beneficial , and possibly exerted their effects by enhancing antioxidant activity and decreasing inflammation in the injured renal tissues . \n the riperc + ripostc protocol did not show an additive effect from the combination of perconditioning and postconditioning . \n this may be because each protocol consisted of 4 remote i / r cycles , which in the riperc + ripostc protocol were split evenly between perconditioning and postconditioning .", "role": "user" }, { "content": "backgroundremote ischemic perconditioning ( riperc ) , remote ischemic postconditioning ( ripostc ) , and remote ischemic perconditioning + postconditioning ( riperc + ripostc ) protect against renal ischemia reperfusion injury ( iri ) . \n however , the most beneficial approach among these is not known.aimsto compare the protective effects and study the mechanisms of three different remote ischemic conditioning in preventing iri in the rat kidney.methodsfifty healthy adult male sprague dawley rats were randomly assigned to five groups : sham , iri , riperc , ripostc , and riperc + ripostc . \n right nephrectomy was performed initially in all rats . \n iri was induced by occluding the left renal artery for 60 min , followed by reperfusion for 24 h. riperc , ripostc , and riperc + ripostc were induced with 5-min ischemia / reperfusion ( i / r ) cycles using a tourniquet on the right hind limb.resultsthe iri group showed significant serologic evidence of renal injury compared to the sham group ( p < 0.05 ) . \n the riperc , ripostc , and riperc + ripostc groups displayed significantly lower levels of renal dysfunction than the iri group ( p < 0.05 ) . \n superoxide dismutase ( sod ) levels were significantly lower in the iri group than in the sham group ( p = 0.003 ) , but were significantly less depressed in the riperc , ripostc , and riperc + ripostc groups ( p < 0.05 ) . \n the iri group displayed more severe renal tubular injury than the riperc , ripostc , and riperc + ripostc groups \n ( p < 0.05).conclusionall three remote ischemic conditioning showed similar therapeutic potential for preventing renal iri . \n the riperc + ripostc protocol did not show an additive effect from the combination of preconditioning and postconditioning . \n the protective mechanism may be due to the stimulation of endogenous antioxidant activity by transient limb ischemia reperfusion .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: modern public health practice still lacks strong political support.1 neither managers nor public health professionals appear to be succeeding in their attempt to improve the health of the public . \n this is evidenced by the enormous waste of resources on downstream interventions because of the absence of work upstream . \n this is why not much has been achieved to raise the status of public health . \n considerably more is possible if there was a more dynamic application of public health knowledge and approach to the establishment of infrastructure.2 \n the difference between upstream and down stream investment is that with an injection of modest financial resource to deal with the risk factors , an extra decade of healthy life could be realized . \n the tendency in most countries is for people in authority to act only after the occurrence of a problem , yet investment in prevention , especially primary proactive prevention activities may be more cost - effective with greater long - lasting benefits . \n the who world report in 2002,3 identified top 10 risks that are often the actual causes of major diseases . their true impact and the means to reduce them are evident . \n the ten leading risk factors globally are : underweight , unsafe sex , high blood pressure , tobacco consumption , alcohol consumption , unsafe water , sanitation and hygiene , iron deficiency , indoor smoke from solid fuels , high cholesterol , and obesity . it is obvious that in some countries , fewer risks may cause a huge number of premature deaths . \n underweight alone accounts for over three million childhood deaths a year in developing countries , while in the more developed countries , tobacco , alcohol , hypertension , cholesterol and obesity are more important . \n what we need is an attempt to ensure that a balance is maintained between upstream and downstream determinants of health.46 \n the classic burdens presented by infectious diseases have shifted in some countries to non - communicable diseases .. by the year 2020 , their collective burden is expected to reach 60% globally . \n non - communicable diseases need a different long - term approach . by adopting cost - \n effective interventions applied in the industrialized countries , the burden of these diseases can be reduced . \n investing in intervention programs to deal with tobacco use , high blood pressure or high cholesterol can prevent more than three - quarters of cardiovascular diseases , the world 's leading cause of death . \n cost - effective interventions to counter some risk factors can , therefore , reverse their impact and save a considerable amount of money usually spent on treatment of the disease . \n risk reduction policy can save four million premature deaths a year as a result of high cholesterol , five million for tobacco use , and seven million for high blood pressure.3 needless to say , a change in health status through an upstream intervention is particularly difficult since any intervention meant to benefit the disadvantaged helps the better - off . \n consistent political commitment is necessary in order to ensure success and reduce the ever - widening disparities in health . \n there has been much improvement in the field of infectious diseases,811 but ncd poses a greater challenge . \n published data from saudi arabia indicate that interest in the preventive national strategies for ncd is still evolving.1214 failure to shift the policy debate from the bias towards a downstream agenda that focuses on treatment is still an important problem at the management level of national health . \n a change at the local or regional level is possible only if it forms a part of the national policy which assesses the magnitude of the risks and formulates a risk reduction policy , and provides the infrastructure that would make action on the policy feasible . \n risk factors can be assessed at the national level , but the fine details and modalities of operation must be assessed at the regional level . \n also , pilot projects can be started at the provincial level , and replicated elsewhere.1516 in al - gassim , prince sultan cardiac center ( pscc ) , a tertiary cardiac center , can be a model with two components : a clinical dimension to address the downstream problems and a broader prospective of public health that extends the investment upstream with planning and supervision of a risk reduction policy \n . a risk reduction policy should be part of the national policy but pscc can work as an infrastructure in the al - gassim region . \n pscc could be the focal point in gassim to plan and supervise risk assessment and reduction in the province . \n this can be done through the concept of public health management defined as the optimal use of the resources of society and its health services towards the improvement of the health experience of population.17 provision can be made in the early stages by including the epidemiology and public health departments within the pscc upgraded to the level where clinical services become population based , rather than institution based . at that stage \n , the outcome is measured not only as the number of interventional cardiology measures taken , but also in terms of the magnitude of risk reduction in the community . \n in order to transfer intervention schemes developed in industrialized countries to developing nations , it is important to assess the local risk factors and those interventions that are culturally relevant . \n detailed data at the provincial level is more convincing to the public and reflects local differences . \n studies have shown that obesity is on the increase in the al - qassim region.18 further studies to measure hypertension , cholesterol , smoking and physical activities are as important as risks of road traffic accidents . \n after measuring the risk factors , interventions can be planned and directed at the appropriate target groups . in general , behavior that affects health is acquired early in life . \n this means that children are the most suitable target group for a change in behavior . \n studies indicate that changes in cardiovascular risk factors including body mass index are possible after a health education program is introduced to children in primary schools.19 accordingly , long term investments and partnership between and across different sectors including cooperation between the ministries of health and education should be planned and implemented . in conclusion , it should be borne in mind that resources utilized on upstream investment on health can bring downstream results and save a huge amount of money , especially when non - communicable diseases are the focus . \n strengthening the infrastructure at the provincial level in this investment , is an important step that should be supported by the encouragement of local risk assessment studies and the adoption of the concept of public health management at all levels .", "role": "user" }, { "content": "since the burden of disease has shifted towards non - communicable diseases and public health management , there is a greater need to direct resources to address risk factors of the diseases rather than the diseases themselves . \n the downstream agenda focused on treatment services and is still an important problem at the level of national health management . \n much has been accomplished in preventive programs for infectious diseases in saudi arabia but a great deal more is needed to combat non - communicable diseases . while a national non - communicable diseases program is being established in the kingdom , \n more advanced pilot projects of ncd can be started in the regions . \n a model for cardiovascular diseases in qassim will be presented .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the oral squamous cell carcinoma ( oscc ) is the most frequent malignant tumour of the oral cavity , covering more than 80% of all oral cancer diagnoses . despite the progress in therapy , \n the mortality of patients with oscc has remained steadily high during the last 20 years as compared to other cancers . \n consequently , early diagnosis and treatment are still crucial to improve prognosis : if a correct diagnosis is made at the initial stage of the disease , the 5-year survival rate is higher than 90% . \n general practitioner and dental professionals must play an important role in secondary prevention of oscc , but poor practice of the oral mucosa routine examination during dental and medical recalls is reported by almost all patients whose oral cancer was diagnosed at a late stage . \n moreover , dentists should be responsible even for primary prevention of oral cancer , by giving advice on smoking cessation , alcohol diminution and sun protection . \n besides the responsibilities ascribable to the professional ( provider delay ' ) , another kind of liability has to be totally entrusted to the patient , which can be defined as patient delay ' , or alternatively as the period between the patient first noticing symptoms and their first consultation with a health care professional concerning those symptoms ' . \n as for other cancers , patient delay accounts for approximately 60% of the overall diagnostic delay and it seems to be mainly related to cognitive and psychosocial variables . in a review of 32 qualitative investigations on cancer patients ' experiences of help - seeking , smith and colleagues concluded that the most common causes of patient delay are fear and lack of symptom recognition . \n similar findings are reported in studies investigating the risk factors of the delay ascribable to the patients with head and neck / upper gastrointestinal cancers , with particular reference to cognitive and psychosocial variables , which are well known for being related to the detection of cancer symptoms and to seeking medical help . \n about 30% of oscc patients usually wait for more than 3 months before consulting medical / dental professional after self - discovery of signs and symptoms of oral cancer . \n this delay is related to the difficulty experienced by patient in perceiving such signs and symptoms as harmful , whereas they are usually dismissed as a minor oral disease , e.g. , trauma , infective process , disorders related to dentures or other generic , non - dangerous dental conditions . \n the understanding of the reasons that characterize the duration of this cognitive pathway is critical in order to design targeted intervention strategies . to the best of our knowledge , \n research on this topic , with specific reference to oral cancer , is scant , purely theoretical and qualitatively insufficient . \n the main aim of this retrospective study on oscc patients was to investigate the variables related to patient delay , with particular reference to cognitive and psychological factors . \n a total of 156 patients with histological diagnosis of scc of the oral cavity and awaiting treatment were consecutively and unselectively recruited at the department of surgical , oncological and oral sciences ( oral medicine unit ) , university of palermo , and at the department of head / neck surgery , oral cavity and audio / verbal communication , second university of naples , from january 2000 to december 2005 . \n all subjects were interviewed , by two of the authors ( vera panzarella and giuseppina campisi ) , using a structured , pre - tested questionnaire . \n sociodemographic variables recorded during the interview included age , gender , level of education , employment , marital status and place of residence . in order to assess health - related variables , \n the subjects were interviewed about their smoking / drinking habits and regularity of dental attendance . \n patients were divided into two groups according to their smoking / drinking status : smokers vs. non - smokers and non - drinkers vs. drinkers , respectively . \n patients claiming to have quit their smoking or drinking habits have been classified as former ' smokers or drinkers , respectively . \n finally , dental attendance was defined as regular when the subjects claimed to have undergone dental visit at least once a year . \n cognitive variables were also assessed , specifically including relatives ' and personal experience of cancer , knowledge of cancer ( either general or oral ) , experience of symptoms ( with reference to asymptomatic or symptomatic lesions , in terms of experienced pain , burning , bleeding / haemorrhage , swelling or irritation / tenderness ) , initial self - diagnosis ( cancer , non - threatening condition , unable to self - diagnose ) or complete unawareness ( patient unable to recognize symptoms as such ) . finally , the interview considered some common psychological variables related to possible emotional responses to the detection of potentially threatening oral symptoms ( denial , fear , carelessness , medical service mistrust ) . since interpretation of the symptoms could significantly differ depending on the considered district ( e.g. , oral vs. oropharyngeal ) , we exclusively recruited patients with scc of the oral cavity ( lip and oral sites : icd-9 140 , 141 , 143 - 5 ) in order to select a cohort as homogeneous as possible . \n the patients were specifically asked to provide their most reliable estimate about the date when they recalled to have experienced the first sign / symptom of oscc . \n patient delay was estimated by calculating the time interval between the provided information and the date when the first medical opinion for cancer - related sign / symptom was sought ( as established by a physician , a dentist or a staff member at the universities of palermo and naples ) . in accordance to this definition of delay \n , patients who did not notice any sign / symptom and did not seek medical consult ( i.e. , patients whose lesions were accidentally discovered ) have been excluded from the study . in order to reduce both the classification bias ' and the memory bias ' related to patient delay , we decided to use two arbitrary categorizations of this quantity by choosing two different time points to discriminate between delayed and non - delayed cases : 1 month vs. > 1 month for dichotomous delay ( using a cutoff of more than 30 days ) , and < 1 month , 13 months , > 3 months for polytomous delay . \n data were analysed by means of the computer package spss 15 ( spss , chicago , il , usa ) . \n the chi - square test was used to assess statistical differences among categorical variables , whereas fisher 's exact test was used when the observed frequency was less than 5 ; p values 0.05 were considered as statistically significant . in order to measure the association level , \n crude odds ratio ( or ) and the 95% corresponding test - based confidence interval ( ci ) were calculated . \n reference groups were chosen as follows : for ordinal variables , the first category was chosen as the reference one ; for other features , the category with the largest number was chosen as the reference one . \n a logistic / multinomial regression model was also built for dichotomous / polytomous measurements of patient delay , respectively . \n the maximum likelihood estimates and adjusted odds ratio were obtained on full models by using the iterative weighted least squares procedure . \n a total of 156 patients with histological diagnosis of scc of the oral cavity and awaiting treatment were consecutively and unselectively recruited at the department of surgical , oncological and oral sciences ( oral medicine unit ) , university of palermo , and at the department of head / neck surgery , oral cavity and audio / verbal communication , second university of naples , from january 2000 to december 2005 . \n all subjects were interviewed , by two of the authors ( vera panzarella and giuseppina campisi ) , using a structured , pre - tested questionnaire . \n sociodemographic variables recorded during the interview included age , gender , level of education , employment , marital status and place of residence . in order to assess health - related variables , \n the subjects were interviewed about their smoking / drinking habits and regularity of dental attendance . \n patients were divided into two groups according to their smoking / drinking status : smokers vs. non - smokers and non - drinkers vs. drinkers , respectively . \n patients claiming to have quit their smoking or drinking habits have been classified as former ' smokers or drinkers , respectively . \n finally , dental attendance was defined as regular when the subjects claimed to have undergone dental visit at least once a year . \n cognitive variables were also assessed , specifically including relatives ' and personal experience of cancer , knowledge of cancer ( either general or oral ) , experience of symptoms ( with reference to asymptomatic or symptomatic lesions , in terms of experienced pain , burning , bleeding / haemorrhage , swelling or irritation / tenderness ) , initial self - diagnosis ( cancer , non - threatening condition , unable to self - diagnose ) or complete unawareness ( patient unable to recognize symptoms as such ) . finally , the interview considered some common psychological variables related to possible emotional responses to the detection of potentially threatening oral symptoms ( denial , fear , carelessness , medical service mistrust ) . since interpretation of the symptoms could significantly differ depending on the considered district ( e.g. , oral vs. oropharyngeal ) , we exclusively recruited patients with scc of the oral cavity ( lip and oral sites : icd-9 140 , 141 , 143 - 5 ) in order to select a cohort as homogeneous as possible . \n the patients were specifically asked to provide their most reliable estimate about the date when they recalled to have experienced the first sign / symptom of oscc . \n patient delay was estimated by calculating the time interval between the provided information and the date when the first medical opinion for cancer - related sign / symptom was sought ( as established by a physician , a dentist or a staff member at the universities of palermo and naples ) . in accordance to this definition of delay \n , patients who did not notice any sign / symptom and did not seek medical consult ( i.e. , patients whose lesions were accidentally discovered ) have been excluded from the study . in order to reduce both the classification bias ' and the memory bias ' related to patient delay , we decided to use two arbitrary categorizations of this quantity by choosing two different time points to discriminate between delayed and non - delayed cases : 1 month vs. > 1 month for dichotomous delay ( using a cutoff of more than 30 days ) , and < 1 month , 13 months , > 3 months for polytomous delay . \n data were analysed by means of the computer package spss 15 ( spss , chicago , il , usa ) . \n the chi - square test was used to assess statistical differences among categorical variables , whereas fisher 's exact test was used when the observed frequency was less than 5 ; p values 0.05 were considered as statistically significant . in order to measure the association level , \n crude odds ratio ( or ) and the 95% corresponding test - based confidence interval ( ci ) were calculated . \n reference groups were chosen as follows : for ordinal variables , the first category was chosen as the reference one ; for other features , the category with the largest number was chosen as the reference one . \n a logistic / multinomial regression model was also built for dichotomous / polytomous measurements of patient delay , respectively . \n the maximum likelihood estimates and adjusted odds ratio were obtained on full models by using the iterative weighted least squares procedure . \n the male patients were 110 ( 70.5% ) , while the female ones were 46 ( 29.5% ) , with a male / female ratio equal to 2.391 . \n the mean age at detection of oral signs and symptoms was ( 6212.5 ) years ( age range : 3292 years ) . \n the patients were subdivided into four categories of age , according to 25th , 50th and 75th percentiles ( < 51 , < 64 , < 72 , 72 ) . no statistical significant association ( p>0.05 ) was found between sociodemographic / health - related variables and patient delay , with the exception of age in univariate analysis of polytomous measurement of delay ( p=0.001 ) . \n the patients characterized by delay 1 month were 55/156 ; those with delay > 1 month were 101/156 ( 35.3% vs. 64.7% ) . \n the most meaningful factors were : personal experience of cancer ' ( yes vs. none : or=0.30 , 95% ci=0.110.82 , p=0.02 ) , knowledge of cancer ' ( poor vs. basic : or=2.91 , 95% ci=1.256.76 , p=0.013 in univariate analysis ) , initial self - diagnosis ' ( cancer vs. unable to self - diagnose : or=0.22 , 95% ci=0.060.82 , p=0.02 ) , unawareness ' ( false vs. true : or=0.42 , 95% ci=0.210.81 , p=0.01 ) and denial ' ( true vs. false : or=2.38 , 95% ci=0.965.90 , p=0.06 ) . \n the logistic regression ( table 2 ) selected as most significant variables the following ones : personal experience of cancer ' ( yes vs. none : or=0.33 , 95% ci=0.110.99 , p=0.05 ) , unawareness ' ( true vs. false : or=4.96 , 95% ci=2.1611.37 , p<0.01 ) and denial ' ( true vs. false : or=6.84 , 95% ci=2.3120.24 , p<0.01 ) . \n the patients characterized by delay < 1 month were 55 ( 35.26% ) , the ones with delay ranging from 1 month to 3 months were 51 ( 32.69% ) , and finally , the ones with delay > 3 months were 50 ( 32.05% ) \n the most meaningful variables are : age ' ( chi - square=16.13 , p=0.01 ) , personal experience of cancer ' ( chi - square=6.79 , p=0.03 ) , knowledge of cancer ' ( chi - square=12.04 , p=0.02 ) and unawareness ' ( chi - square=7.57 , p=0.02 ) . as regards the results of multinomial regression ( table 4 ) , the most meaningful variables were : age ' ( chi - square=23.414 , p=0.001 ) , personal experience of cancer ' ( chi - square=10.224 , p=0.006 ) , knowledge of cancer ' ( chi - square=8.359 , p=0.079 ) and unawareness ' ( chi - square=4.877 , p=0.087 ) . \n the patients characterized by delay 1 month were 55/156 ; those with delay > 1 month were 101/156 ( 35.3% vs. 64.7% ) . \n the most meaningful factors were : personal experience of cancer ' ( yes vs. none : or=0.30 , 95% ci=0.110.82 , p=0.02 ) , knowledge of cancer ' ( poor vs. basic : or=2.91 , 95% ci=1.256.76 , p=0.013 in univariate analysis ) , initial self - diagnosis ' ( cancer vs. unable to self - diagnose : or=0.22 , 95% ci=0.060.82 , p=0.02 ) , unawareness ' ( false vs. true : or=0.42 , 95% ci=0.210.81 , p=0.01 ) and denial ' ( true vs. false : or=2.38 , 95% ci=0.965.90 , p=0.06 ) . \n the logistic regression ( table 2 ) selected as most significant variables the following ones : personal experience of cancer ' ( yes vs. none : or=0.33 , 95% ci=0.110.99 , p=0.05 ) , unawareness ' ( true vs. false : or=4.96 , 95% ci=2.1611.37 , p<0.01 ) and denial ' ( true vs. false : or=6.84 , 95% ci=2.3120.24 , p<0.01 ) . \n the patients characterized by delay < 1 month were 55 ( 35.26% ) , the ones with delay ranging from 1 month to 3 months were 51 ( 32.69% ) , and finally , the ones with delay > 3 months were 50 ( 32.05% ) \n the most meaningful variables are : age ' ( chi - square=16.13 , p=0.01 ) , personal experience of cancer ' ( chi - square=6.79 , p=0.03 ) , knowledge of cancer ' ( chi - square=12.04 , p=0.02 ) and unawareness ' ( chi - square=7.57 , p=0.02 ) . \n as regards the results of multinomial regression ( table 4 ) , the most meaningful variables were : age ' ( chi - square=23.414 , p=0.001 ) , personal experience of cancer ' ( chi - square=10.224 , p=0.006 ) , knowledge of cancer ' ( chi - square=8.359 , p=0.079 ) and unawareness ' ( chi - square=4.877 , p=0.087 ) . \n with almost 130 000 annual deaths worldwide , oscc is considered a public health problem . \n this type of cancer is relatively common in italy : in 2008 , the registered incidence was equivalent to 4 450 with an age - standardized rate per 100 000 population per year equal to 6.0 for male and 2.3 for female . in southern italy , \n the number of new cases , in the same period , was 509 and age - standardized rate was 4.3 for male and 1.2 for female . \n the data on oscc are still daunting : the majority of cases is identified late and in advanced clinical stage ( i.e. , iii or iv ) . moreover , after primary treatment , recidivists or metastases are found in more than half of the patients ( 80% of cases within the first two years ) and the 5-year survival rate is less than 50% . in these cases , \n the necessary surgical treatment and radio- and chemotherapy are so invasive , complex , weakening and disfiguring that they heavily compromise the quality of the remaining life . \n the great paradox of oscc is that , despite the easy access to oral district for medical examination and the improvements on therapeutic approaches to the disease , its death rate remains high ( approximately 46.5% ) and , even more unexpected , similar to that of cancers occurring in less accessible areas , such as colon , cervix and breast . \n oscc is almost always preceded by visible and symptomatic early changes of the mucosa ( such as ulcer , erithroplakia , leukoplakia ) , bleeding and pain . an adequate examination for the suspect of oral cancer consists of a simple , non - invasive , oral visual inspection that requires only 5 min during dental / medical recall . \n additionally , it seems that such oral examination is accepted by the patient with more hesitation than a pelvic exam and pap smear . \n this patient behaviour is due to the misunderstanding of initial signs for minor oral diseases , such as trauma , infective process , disorders related to dentures or other dental condition . as a consequence , self- and/or inappropriate medications are carried out , in the false opinion of improving the course of the disease , while substantially increasing the duration of diagnostic delay . \n hence , an effective strategy to improve oscc outcome and to reduce its morbidity seems to guide the patients towards an early diagnosis , by acting on those factors primarily involved in the initial stage of cognitive process . in the present study , we investigated diagnostic delay in oscc in two cohorts of patients living in southern italy and awaiting treatment for oscc . to the best of our knowledge , \n this is the first study conducted in the mediterranean area investigating the variables related to the patient delay , with particular reference to the cognitive and psychological ones . \n no statistical significant association was found between lesion symptoms , sociodemographic ( with the exception of age ) , health - related variables and patient delay . on the contrary , \n some of the cognitive and psychological variables investigated were found to be significantly associated with the diagnostic delay . as regards dichotomous delay ( 1 month vs. > 1 month ) , the logistic regression showed the importance of personal experience of cancer ' , unawareness ' and denial ' variables in terms of statistical significance . \n these results are similar to those obtained from the analysis conducted using a polytomous measurement of delay ( < 1 month , 13 months , > 3 months ) that highlighted the age ' , personal experience of cancer ' , knowledge of cancer ' and unawareness ' variables . \n our findings also suggest that older patients with knowledge of cancer ( through personal experience or referred ) showed a smaller delay with respect to younger patients , whereas emotional response , such as denial , related to difficulty in recognizing potential cancer symptoms , was found to be significantly related to the oscc delay . \n these results could be explained by the consideration that the majority of people , particularly young subjects , with no experience of cancer ( general or oral ) , very seldom consider the possibility to have a malignant disease . as a consequence , a wait and \n see ' behaviour is adopted , denying the usefulness of medical help and opting for a useless self - diagnosing and/or a self - medication for an indefinite time . \n non - recognition of the severity of symptoms , mainly related to lack of knowledge about the disease , was the predominant risk factor for patient delay across all cancer sites , including the oral cavity where malignant conditions are almost always preceded by symptomatic early signs that could easily be diagnosed . with the limitation related to the retrospective design of the present study ( that could be biased by patient difficulty to report specific time interval ) , the main results of the present investigation are in line with those of similar researches on other symptomatic cancers . \n our findings also support the belief that improving basic knowledge about cancer issue may increase people 's ability to identify cancer symptoms and to promote an appropriate life - saving help - seeking . for this purpose , as recently recommended by rogers et al . \n , increasing public awareness , both on oral cancer and general cancer , by media advertising such as tv / radio broadcasts / newspapers / publications , and by regular educational programs involving schools , should be promptly planned . \n the use of alert messages in dental / general practitioners and pharmacies may also be useful to increase the population awareness on the high variability of presentation of the oscc . \n these intervention strategies should be conducted by emphasizing the key role of the patient on the diagnostic pathway of oral cancer . \n , awareness interventions , knowledge of screening visits and their time interval ( 612 months in asymptomatic subjects ) , self - checking behaviour are considered important elements of cancer awareness . \n therefore , similarly to the promotion of breast self - examination or testicular checking , which are reported as helpful in the reduction of breast and testicular cancers , respectively , the self - examination of the oral cavity should be strongly encouraged , as this can enable the patient to detect early oscc signs . in conclusion \n , the findings of this study indicated that , in the investigated cohorts , the knowledge about cancer issues is strongly linked to the patient delay . \n educational interventions on the mediterranean population are necessary in order to increase the patient awareness and to emphasize his / her key role in early diagnosis of oscc .", "role": "user" }, { "content": "this retrospective study investigated , in two cohorts of subjects living in southern italy and awaiting treatment for oral squamous cell carcinoma ( oscc ) , the variables related to diagnostic delay ascribable to the patient , with particular reference to the cognitive and psychological ones . \n a total of 156 patients with oscc ( mean age : 62 years , m / f : 2.391 ) were recruited at the universities of palermo and naples . \n risk factors related to patient delay included : sociodemographic , health - related , cognitive and psychological variables . \n the analysis was conducted by considering two different delay ranges : dichotomous ( 1 month vs. > 1 month ) and polytomous ( < 1 month , 13 months , > 3 months ) delay . \n data were investigated by univariate and multivariate analyses and a p value 0.05 was considered statistically significant . for both delay measurements , \n the most relevant variables were : personal experience of cancer ' ( dichotomous delay : p=0.05 , odds ratio ( or)=0.33 , 95% confidence interval ( ci)=0.110.99 ; polytomous delay : p=0.006 , chi - square=10.224 ) and unawareness ' ( dichotomous delay : p<0.01 , or=4.96 , 95% ci=2.1611.37 ; polytomous delay : p=0.087 , chi - square=4.77 ) . \n also denial ' ( p<0.01 , or=6.84 , 95% ci=2.3120.24 ) and knowledge of cancer ' ( p=0.079 , chi - square=8.359 ) were found to be statistically significant both for dichotomous and for polytomous categorization of delay , respectively . \n the findings of this study indicated that , in the investigated cohorts , the knowledge about cancer issues is strongly linked to the patient delay . \n educational interventions on the mediterranean population are necessary in order to increase the patient awareness and to emphasize his / her key role in early diagnosis of oscc .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: sufficient healing after open or arthroscopic rotator cuff repair still remains one of the challenges in shoulder surgery . despite an improvement in the surgical technique , \n suggested that the repair should provide high initial fixation strength , allowing for only minimal gap formation between the tendon and its insertion site . \n in addition , it is postulated that re - establishing the anatomical footprint of the tendon \n bone insertion is a key factor to facilitate healing of the tendon to the bone . \n the integrity of the repair site , in particular , has been shown to correlate with clinical improvement , particularly the return of strength [ 4 , 13 ] . \n therefore , the goal is to reconstruct the footprint configuration accompanied by the restoration of its mechanical performance in order to establish an adequate environment for optimal healing of the tendon to the bone . \n the native footprint area could be recreated more accurately with the use of the double - row technique when compared to a single - row of anchors [ 3 , 26 , 29 ] . \n additionally , previous studies were able to demonstrate a higher initial mechanical strength of the double - row repair by means of isometric cyclic loading at time zero [ 2 , 18 , 21 , 22 ] . \n nonetheless , recent trials have not been able to confirm these results for clinical applications [ 10 , 12 , 16 ] . \n recently , the suture - bridge technique was introduced to maximise the utility of a single - row construct by using the suture limbs from the medial mattress sutures to bridge and compress the repaired tendon . \n the suture - bridge technique is postulated to restore the footprint contact area and unite the advantages of repair with those of suture anchor and transosseous repair [ 11 , 24 ] . \n thus , there is still no consensus as to which procedure , i.e. suture anchors or suture - bridge fixation , will provide the optimal conditions for cell biological tendon - to - bone healing . \n given this current situation in the treatment of rotator cuff injury , the purpose of this study was to determine the initial mechanical properties in cyclic loading and load - to - failure as well as the initial contact pressure over a defined rotator cuff footprint for a modified suture - bridge technique , using a titanium anchor screw . \n the study was conducted with the hypothesis that the presented technique exceeds the clinically relevant 250-n load threshold and would resist an isometric load of 3,000 cycles . \n thirty sheep shoulders ( specimen age , 2 years ) were harvested fresh , wrapped in saline - soaked gauze and stored frozen at 20c [ 2 , 3 , 31 ] . \n shoulders were dissected from all of the soft tissues except for the infraspinatus muscle and tendon . \n the infraspinatus tendon was sharply detached from its insertion site to mimic a standardised full - thickness tear . right and left shoulders were randomly assigned among three investigation groups that were based on the use of a special titanium anchor screw ( lasa - dr - screw , knigsee implantate , aschau , germany ) : ( 1 ) cyclic loading , ( 2 ) load - to - failure testing and ( 3 ) tendon bone interface contact pressure measurement . \n all of the repairs were coupled with braided nonabsorbable polyethylene suture sized usp no . 2 ( hifi ; conmed linvatec , largo , fl , usa ) . the lasa - dr - screw ( fig . 1 ) consists of a pinpoint to fix the medial row of sutures , a threaded rod to assure anchorage of the screw to the bone , a thread - free neck and a flat head . using a freehand technique , \n a medial bone channel is made with a punch at the medial footprint border , with a lateral tilt of 7080 inclination towards the footprint area ( fig . \n after that a punch is inserted through the cortex of the lesser tuberosity in parallel direction to the footprint surface ( fig . \n . then the length of the screw is determined , according to the length of the footprint between the tuberosity and the medial footprint border . \n two sutures are then inserted around the tip of the screw using a guiding device ( fig . \n after perforating the sutures medially through the tendon , they were secured by arthroscopic mason - allen stitches . \n the sutures were then tensioned , crossed over the tendon s footprint , tied around the screw neck and secured by the flat head ( fig . \n stitches were first tied with the use of a sliding double half - hitch knot , and then secured by a series of four reversing half hitches on alternative posts . to standardise tension for the repair , no less than 4 kg of tensile force \n dissections , preparations , repairs and experimental testing were performed by one single - experienced shoulder surgeon after thawing the shoulders for 24 h at room temperature.fig . 1lasa - dr - screw ( knigsee implantate , aschau , germany ) demonstrating the pinpoint to fix the medial row of sutures , the threaded rod to assure anchorage of the screw to the bone , the thread - free neck and the flat headfig . \n 2a medial bone channel is made with a punch ( * ) at the medial footprint border ( a ) . \n a suturing instrument is equipped with a shuttle suture and brought into this bone channel . a punch ( # ) \n then , the screw is placed in parallel to the footprint , with two sutures inserted around the screw pinpoint ( b ) . \n the tendon is medially fixed by arthroscopic mason - allen stitches ( c e ) . \n sutures were tensioned over the tendon s footprint , then tied around the screw neck , and secured by the flat head ( f h ) lasa - dr - screw ( knigsee implantate , aschau , germany ) demonstrating the pinpoint to fix the medial row of sutures , the threaded rod to assure anchorage of the screw to the bone , the thread - free neck and the flat head a medial bone channel is made with a punch ( * ) at the medial footprint border ( a ) . \n a suturing instrument is equipped with a shuttle suture and brought into this bone channel . a punch ( # ) \n then , the screw is placed in parallel to the footprint , with two sutures inserted around the screw pinpoint ( b ) . \n the tendon is medially fixed by arthroscopic mason - allen stitches ( c e ) . \n sutures were tensioned over the tendon s footprint , then tied around the screw neck , and secured by the flat head ( f h ) examinations were performed using a material - testing machine [ zwick 1445 , zwick - roell , ulm , germany ] . \n the data were recorded with the dedicated software [ testxpert 12 , zwick - roell , ulm , germany ] and a load displacement curve . \n the proximal end of the infraspinatus tendon was set in a tendon clamp , leaving approximately 6 cm between the clamp and the site of repair . \n to prevent it from slipping out of the clamp during testing , cryo - jaws for soft tissue fixation were used [ 2 , 19 ] . \n the humerus was fixed in a custom rig designed to evenly distribute loads across the tendon . to simulate postoperative conditions , a cyclic loading \n shoulders were loaded in the physiologic direction of the rotator cuff tendon , perpendicular to the longitudinal axis of the humerus , as previously described [ 2 , 19 , 27 ] . \n the loading force was applied with the humerus maintained at a constant angle relative to the tendon , resulting in simulated isometric muscle contraction . \n after pretension to 10 n for 1 min , each construct was cyclically loaded to 3,000 cycles from 10 to 180 n with a 5-s cycle [ 2 , 7 , 8 , 19 ] . \n these parameters have been reported as the physiologic loads and speeds that occur in normal daily activity and were therefore considered the best manner to simulate the postoperative condition [ 8 , 27 ] . \n the tests were stopped when complete failure ( e.g. repair site gap 10 mm , defect of the tendon bone construct ) or a total of 3,000 cycles was attained . \n the number of cycles creating a 5-mm and 10-mm gap was recorded along with the mechanism of failure [ 2 , 19 , 27 ] . \n with use of a material - testing machine [ zwick 1445 , zwick - roell , ulm , germany ] , a pretension of 10 n was applied and the clamp and custom rig were checked for tightness before beginning the load - to - failure testing . the load [ n ] and the displacement [ mm ] were digitally recorded by a deformation curve , and the mode of failure was documented . \n tests were stopped when complete failure was attained ( e.g. repair site gap of 10 mm , defect of the tendon bone construct ) . \n a load of 250 n was chosen as the minimum clinically relevant ultimate failure load , based on previous studies of rotator cuff fixation techniques [ 6 , 7 , 15 ] . a pressure - sensitive film ( prescale film , super low pressure type , fuji photo film co ltd , tokyo , japan ) was used to measure the interface contact pattern and pressure between the infraspinatus tendon and the insertion site [ 3 , 24 , 29 ] . \n the pressure - sensitive film was cut in a standardised fashion for all specimens to conform to the 1 2 cm footprint defect . \n then , the film was placed under a prepared template so that we were able to prepare holes on the film in a uniform pattern . \n bone interfaces after insertion of the screws and sutures , while great care was taken to keep the film dry by constantly using gauze to absorb the moisture from the tendon to the bone [ 3 , 24 , 29 ] . \n the sutures connecting the tendon to the bone were carefully passed through the prepared holes . \n these measures were conformed so as to attain the best possible panoramic view of the contact pressure and pressure pattern . after the repair , \n the film was left in place for 2 min , as recommended by the manufacturer . \n sutures were then cut , the film was scanned into a fuji film prescale pressure densitometer ( fdp-305e , fuji photo film co ltd , tokyo , japan ) , and the average contact pressure and pressure pattern were detected . \n examinations were performed using a material - testing machine [ zwick 1445 , zwick - roell , ulm , germany ] . \n the data were recorded with the dedicated software [ testxpert 12 , zwick - roell , ulm , germany ] and a load displacement curve . \n the proximal end of the infraspinatus tendon was set in a tendon clamp , leaving approximately 6 cm between the clamp and the site of repair . to prevent it from slipping out of the clamp during testing , cryo - jaws for soft tissue fixation \n the humerus was fixed in a custom rig designed to evenly distribute loads across the tendon . to simulate postoperative conditions , \n a cyclic loading was performed , similar to previous studies [ 2 , 8 , 27 ] . \n shoulders were loaded in the physiologic direction of the rotator cuff tendon , perpendicular to the longitudinal axis of the humerus , as previously described [ 2 , 19 , 27 ] . \n the loading force was applied with the humerus maintained at a constant angle relative to the tendon , resulting in simulated isometric muscle contraction . \n after pretension to 10 n for 1 min , each construct was cyclically loaded to 3,000 cycles from 10 to 180 n with a 5-s cycle [ 2 , 7 , 8 , 19 ] . \n these parameters have been reported as the physiologic loads and speeds that occur in normal daily activity and were therefore considered the best manner to simulate the postoperative condition [ 8 , 27 ] . \n the tests were stopped when complete failure ( e.g. repair site gap 10 mm , defect of the tendon bone construct ) or a total of 3,000 cycles was attained . \n the number of cycles creating a 5-mm and 10-mm gap was recorded along with the mechanism of failure [ 2 , 19 , 27 ] . \n with use of a material - testing machine [ zwick 1445 , zwick - roell , ulm , germany ] , a pretension of 10 n was applied and the clamp and custom rig were checked for tightness before beginning the load - to - failure testing . the load [ n ] and the displacement [ mm ] were digitally recorded by a deformation curve , and the mode of failure was documented . \n tests were stopped when complete failure was attained ( e.g. repair site gap of 10 mm , defect of the tendon bone construct ) . \n a load of 250 n was chosen as the minimum clinically relevant ultimate failure load , based on previous studies of rotator cuff fixation techniques [ 6 , 7 , 15 ] . \n a pressure - sensitive film ( prescale film , super low pressure type , fuji photo film co ltd , tokyo , japan ) was used to measure the interface contact pattern and pressure between the infraspinatus tendon and the insertion site [ 3 , 24 , 29 ] . \n the pressure - sensitive film was cut in a standardised fashion for all specimens to conform to the 1 2 cm footprint defect . \n then , the film was placed under a prepared template so that we were able to prepare holes on the film in a uniform pattern . \n bone interfaces after insertion of the screws and sutures , while great care was taken to keep the film dry by constantly using gauze to absorb the moisture from the tendon to the bone [ 3 , 24 , 29 ] . \n the sutures connecting the tendon to the bone were carefully passed through the prepared holes . \n these measures were conformed so as to attain the best possible panoramic view of the contact pressure and pressure pattern . \n after the repair , the film was left in place for 2 min , as recommended by the manufacturer . \n sutures were then cut , the film was scanned into a fuji film prescale pressure densitometer ( fdp-305e , fuji photo film co ltd , tokyo , japan ) , and the average contact pressure and pressure pattern were detected . \n the number of cycles to 5-mm gap formation was 2,884.5 96.8 cycles . \n the ultimate tensile strength of the suture - bridge technique was 565.8 17.8 n and stiffness was 173.7 9.9 n / mm . \n the entire specimen presented a previously described unique mode of failure as it is well known in using high strength sutures by pulling them through the tendon [ 2 , 5 , 20 ] . \n there was no screw - related failure during load - to - failure testing as well . \n we detected a mean contact pressure of 1.19 0.03 mpa applied on the footprint area . \n however , the pressure around the insertion of the knots was higher than in the area between the knots . \n the most important findings of the study are excellent biomechanical and tendon bone - pressure characteristics of the presented modified suture - bridge technique . we confirmed our hypothesis , with the principle that this technique exceeds the clinically relevant 250-n load threshold as well as resisted against an isometric load of 3,000 cycles . additionally , the contact pressure over a defined footprint area is comparable to the results of a double - row technique [ 3 , 24 , 29 ] . \n several studies have demonstrated the mechanical characteristics of different techniques for rotator cuff repair , mainly dealing with the use of suture anchor systems . \n these studies have reported excellent mechanical behaviour for the double - row repair [ 2 , 18 , 21 , 22 ] . \n the double- and single - row techniques provided comparable clinical and mri arthrography short - term outcomes , especially in patients with small and medium rotator cuff tears ( <3 cm ) . only charousset et al . \n demonstrated significantly better tendon healing results for the double - row technique , in a computed tomographic arthrography follow - up . despite its widespread use , our review of the literature revealed only a few papers examining clinical use of the suture - bridge technique , in basic trials [ 6 , 9 , 24 ] or presented as a technical note [ 11 , 25 ] . in a recent study , frank et al . confirmed a healing rate of 88% with mri studies , as well as excellent clinical function after a mean follow - up of 14.6 months \n the authors concluded that the suture - bridge technique could protect the biological environment of tendon - to - bone healing over a short - term period . \n simulated a suture - bridge technique repair with a combination of transosseous sutures and suture anchor systems in cadaver shoulder specimen . \n they used a monotonic loading regime and found a mean failure of the repair at 404 n. in comparison with transosseous and single - row techniques , the repair failed at 5567% higher loads , respectively . \n a cyclic loading test was not performed ( table 1 ) . comparing the mean load - to - failure result of 565.81 n to a recent study evaluating the differences between single- and double - row techniques \n , we were able to confirm higher failure loads , as shown by burkhead et al . . \n certainly , comparing these results to the mentioned study , it has to be considered that we used an animal model and the infraspinatus tendon instead of the human supraspinatus tendon.table 1summary of the results of current studies investigating the suture - bridge or suture - bridge - like repair techniquesexperimental settingtested techniquefixation materialresultburkhead et al . \n load - to - failuretos versus sr versus sbtos : 3 ethibond suturesr : 3 metallic anchor systemssb : panalok anchor systemsb > tos > srbusfield et al . \n cyclic loadingload - to - failuredrsb1 versus drsb2dr - sb1 : 2 metallic anchor systems medial , 2 pushlocks lateraldr - sb2 : 2 metallic anchor systems medial , 2 pushlocks lateraldrsb2 > \n contact pressurecontact areadr versus sb2 versus sb4dr : 4 bio - corkscrew anchor systemssb2 : 1 bio - tenodesis screwsb4 : 2 bio - tenodesis screwsb4 > sb2 > drdr double - row , drsb1 double - row - suture - bridge group 1 ( without medial row knots ) , drsb2 double - row - suture - bridge group 2 ( with medial row knots ) , tos transosseous , sr single - row , sb suture bridge , sb2 suture bridge ( 2 suture bridges ) , sb4 suture bridge ( 4 suture bridges ) summary of the results of current studies investigating the suture - bridge or suture - bridge - like repair techniques dr double - row , drsb1 double - row - suture - bridge group 1 ( without medial row knots ) , drsb2 double - row - suture - bridge group 2 ( with medial row knots ) , tos transosseous , sr single - row , sb suture bridge , sb2 suture bridge ( 2 suture bridges ) , sb4 suture bridge ( 4 suture bridges ) busfield et al . conducted a biomechanical comparison of two suture - bridge repair techniques with and without medial row knots using metallic suture anchors and pushlocks ( arthrex , naples , fl , usa ) . \n the authors confirmed the necessity of medial row knots , in order to preserve the integrity of the repair construct and reach higher ultimate failure loads of up to 352.9 n ( table 1 ) . \n the average number of cycles to 5-mm gap formation in the study at hand was 2,884.5 cycles . \n the entire specimen resisted 3,000 cycles . comparing these results to studies using an analogue experimental set - up \n , it seems that the suture - bridge technique provides strength superior to that of a single - row , double - row and transosseous techniques [ 2 , 19 ] . the contact pressure at the tendon \n bone interface was the same when comparing this technique to a double - row technique using a combination of arthroscopic mason - allen stitches and horizontal mattress stitches . when using a combination of simple and horizontal mattress stitches \n the use of a suture - bridge technique maintained a homogenous pressure pattern at the tendon bone interface , as supported by the results of park et al . . \n the entire tested specimen in the current study failed by pulling the suture through the tendon when the maximum load was reached , as noticed in former investigations [ 2 , 5 , 20 ] . nevertheless , the maximum load was significantly higher compared to a double - row repair that was tested in a prior study , with the use of braided polyblend polyethylene sutures as well as with braided polyester sutures . \n the problem of early suture breakage seems to be solved by the improved material properties of the new high - performance suture material . \n however , it has to be noted that the more rigid characteristics of the new braided polyblend polyethylene suture material [ 20 , 32 ] can more easily cut in a parallel direction through the defective tendon , when used in healthy rotator cuff specimens [ 2 , 5 , 20 ] . \n this aspect is particularly important , because most of the torn human rotator cuff tendons are degenerated . \n tendons that fail a single - row repair are typically grade iii degenerate tendons , according to the classification of goutallier et al . . \n in the recent study , failure of the repair is indeed due to suture pulling through the tendon , resulting in a considerably higher failure force when compared to double - row repair . \n we could assume that this phenomenon is due to a steady and homogenous pressure distribution of the tendon \n the contact pattern between the fixation points could be increased by the suture - bridge repair , resulting in more footprint coverage than is observed for single - row techniques . \n interconnected repair , in contrast to the double - row technique that is based on separate fixation points . \n additionally , the suture - bridge technique provides a better compression vector when compared with suture anchor techniques . \n analysed the contact area of two different suture - bridge techniques in which a 4-suture - bridge technique , similar to that used in our evaluation , yielded a significantly higher contact area and interface pressure than double - row and 2-suture - bridge techniques ( table 1 ) . \n the authors conclude that this technique may lead to further improvement in the repair of rotator cuff tears , thus optimising the chances of healing the tendon to the bone . in our study , \n the mean contact pressure was 1.19 mpa , which is comparable to the results of a double - row technique . \n the sheep infraspinatus tendon was chosen because it has previously been demonstrated to be similar in size , shape and microstructure to the human supraspinatus tendon . \n but it has to be stated that it is different from the degenerated and thinner supraspinatus tendons seen in human shoulders with chronic rotator cuff tears , as already mentioned earlier . consequently \n , it remains an approximation to the human condition and clinically used rotator cuff repair techniques . \n nevertheless , this animal model has been used extensively to evaluate rotator cuff tendon repairs in previous studies [ 2 , 3 , 15 , 19 ] and allows interstudy comparison . \n furthermore , although great care was taken to minimise interference when preparing holes in the film , with regard to the pressure measurements , this may have yielded some artefacts . however , it would be impossible to obtain the entire contact pressure distribution and pressure pattern of the investigated techniques if pressure - sensitive film was only inserted between the tendon bone interfaces . \n additionally , using pressure - sensitive film that detects a pressure range between 0.50 and 2.50 mpa may have underestimated the contact area . \n the results of the current study provide information on the footprint coverage and mechanical strength of a suture - bridge technique during the immediate postoperative clinical situation . by passing the sutures medially , \n the repair takes advantage of healthier tendon tissue to improve fixation strength . due to the interconnected repair , \n one is able to achieve a homogenous tendon - to - bone pressure that has been shown to influence healing . \n beyond these considerations , the optimal pressure range for the tendon to heal to the bone is not known . \n bone interface , whereas high pressure may affect the vascularisation of the tendon and result in impaired tissue healing . \n thus , it should be noted that our evaluation does not address the influence of healing and/or remodelling on the strengths and footprint coverage of the repair . after comparing our results with recent reports in the literature [ 2 , 3 , 19 , 21 , 22 , 24 , 26 , 29 ] \n , the suture - bridge technique seems to be a further improvement in rotator cuff surgery [ 13 , 2426 ] . \n therefore , the presented technique may lead to clinical results superior to several double - row fixations , because it offers biomechanical advantages with low gap formation in cyclic loading and a uniform tendon - bone - contact pressure . \n in conclusion , the fundamental results of our study ( i.e. high mechanical load resistance , high contact pressure and contact area ) support the use of a suture - bridge technique for reconstruction of a torn rotator cuff tendon . nevertheless , an individual estimation has to be done when using the suture - bridge technique clinically as suggested by park et al . . \n a biomechanical comparison of a double - row versus the presented suture - bridge technique may be helpful but finally , in vivo trials are necessary to gain information on the cell biological healing process of suture - bridge techniques , to emphasise potential biological advantages and to accomplish more sufficient advancements in rotator cuff repair .", "role": "user" }, { "content": "the aim of the study was to evaluate the time - zero mechanical and footprint properties of a suture - bridge technique for rotator cuff repair in an animal model . \n thirty fresh - frozen sheep shoulders were randomly assigned among three investigation groups : ( 1 ) cyclic loading , ( 2 ) load - to - failure testing , and ( 3 ) tendon bone interface contact pressure measurement . \n shoulders were cyclically loaded from 10 to 180 n and displacement to gap formation of 5- and 10-mm at the repair site . \n cycles to failure were determined . \n additionally , the ultimate tensile strength and stiffness were verified along with the mode of failure . \n the average contact pressure and pressure pattern were investigated using a pressure - sensitive film system . \n all of the specimens resisted against 3,000 cycles and none of them reached a gap formation of 10 mm . \n the number of cycles to 5-mm gap formation was 2,884.5 96.8 cycles . \n the ultimate tensile strength was 565.8 17.8 n and stiffness was 173.7 9.9 \n n / mm . \n the entire specimen presented a unique mode of failure as it is well known in using high strength sutures by pulling them through the tendon . \n we observed a mean contact pressure of 1.19 0.03 mpa , applied on the footprint area . \n the fundamental results of our study support the use of a suture - bridge technique for optimising the conditions of the healing biology of a reconstructed rotator cuff tendon . \n nevertheless , an individual estimation has to be done if using the suture - bridge technique clinically . \n further investigation is necessary to evaluate the cell biological healing process in order to achieve further sufficient advancements in rotator cuff repair .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the study was approved by the medical ethics committee of the stanford university medical center and the research committee at aravind eye hospital , and conducted according to the principles of the declaration of helsinki . \n this study was carried out from june to august 2012 at the aravind eye hospital , a private eye hospital in madurai , india , which provides low vision eye care to both paying and nonpaying patients . at the time of study design , the lvqol questionnaire , originally designed by wolffsohn and cochrane in 2000 , was selected as the main outcome measure for its simplicity and extensive previous validation . \n it consists of 25 questions to assess 4 areas of quality of life : ( 1 ) mobility , distance vision , and lighting ; ( 2 ) adjustment ; ( 3 ) reading and fine work ; and ( 4 ) activities of daily living . \n the questionnaire was translated into tamil and verified for clarity by 3 different bilingual members of the research team . \n a pilot study was done with 21 patients using the tamil questionnaire and question 16 ( how well was your eye condition explained to you ? \n ) was found to be confusing in its translated form , and the patients did not find it relevant to their quality of life . \n this question was omitted in the questionnaire administered to the patients in the final study . \n the remaining 24 questions were answered on a likert scale from 0 to 5 with 0 denoting the great difficulty due to vision and 5 denoting no problem due to vision ( appendix ) . \n this answer choice was not common ( 7.9% of all responses ) , but to adjust the total score for patients who found one question not applicable ( n = 1 question worth 5 points ) , their score would be multiplied by a factor of 120/(120 5n ) . \n in addition to the lvqol survey , patient demographic and clinical information ( including age , gender , literacy , education level , student status , income , diagnosis , va and visual field ) were collected at baseline for all patients . \n eligible patients were between 10 and 70 years old , fluent in english or tamil , with va < 20/70 to light perception in the better eye or visual fields < 10 from the point of fixation . \n patients were excluded if they were mentally disabled , had no way of being contacted later by phone , or had already received low vision services previously . after providing informed consent to participate in the study , patients were interviewed by a tamil - speaking researcher using the lvqol questionnaire in a private study room . in order to establish baseline lvqol scores of low vision versus normal vision patients , consecutive patients coming to the low vision clinic who met criteria were enrolled along with normal vision control patients who were recruited from the waiting room of the general clinic . \n normal vision was defined as best corrected va 20/30 in the better eye and visual fields 10 from the point of fixation . \n 30 low vision patients were compared to 30 normal vision controls matched for age , gender , and education level . \n an additional 25 low vision patients were added to the low vision group ( total n = 55 ) to achieve statistical power of 0.80 . \n all patients in the low vision group were assessed at baseline and called for a follow - up lvqol assessment over the telephone 30 days after their first visit . \n this 1-month follow - up time point was chosen as long enough so that patients would not be able to recall their initial responses , yet not too long that their eye disease might progress enough to affect their lvqol score . \n additionally , this time would allow patients to try their new lvas if they had received one . \n about 80% of the low vision group patients competed the follow - up survey over the phone . during the low vision visit , \n next , the low vision ophthalmologist specialist examined the patient , explained the prognosis , and prescribed an lva depending on disease type , acuity level , and mental capacity . \n lvas available included hand or stand magnifiers , spectacle magnifiers , telescopes , closed - circuit televisions , and tinted spectacles . \n if the patient could not afford to pay , these lvas were provided at low cost or free of charge using financial subsidies from the govel trust mahema devadoss endowment established in 2009 . \n some patients did not receive an lva because their vision did not improve with any aids , or they refused . \n a counselor also educated patients about their eye condition , and when appropriate , referred them to government benefits or services . \n the minimum change in the lvqol score found to be clinically significant was 510 points . \n this was established in a previously published study of 329 patients in the netherlands , who were assessed at baseline and 5 months follow - up with the lvqol and a general transition question . to find \n if this applied to the indian population , we conducted a pilot study ( n = 20 ) and found an average 10.0-point increase in score after 1-month ( baseline lvqol score 69 22 points , 30 days follow - up lvqol score 79 25 points ) . based on this pilot data \n , a sample size of 45 was calculated to be sufficient to detect an improvement of 10 points after 30 days from receiving services at the low vision clinic , using 80% power and 5% level of significance . \n the patients assessed in the pilot were not included in the final study . in the current study , \n we calculated the cronbach 's alpha score of the questionnaire to determine the internal consistency of the questionnaire and ensure that the items are inter - correlated , and scores are reliable . \n paired t - test was used to assess the difference between baseline and follow - up lvqol scores of low vision patients . \n there was a 20% loss to follow - up when low vision patients were called for a phone interview ( after 30 days , patients were called every day for 3 days at a time convenient for them ; if they were not able to be reached or if the phone number was incorrect , this was recorded as loss to follow - up ) . \n mann - whitney u parametric test was used to compare the difference between normal and low vision patient lvqol scores . \n two - tailed pearson 's product - moment correlation coefficient was used to correlate age and va with lvqol scores . \n effect size ( change in lvqol score ) was calculated with 95% confidence intervals ( 95% ci ) . \n the minimum change in the lvqol score found to be clinically significant was 510 points . \n this was established in a previously published study of 329 patients in the netherlands , who were assessed at baseline and 5 months follow - up with the lvqol and a general transition question . to find \n if this applied to the indian population , we conducted a pilot study ( n = 20 ) and found an average 10.0-point increase in score after 1-month ( baseline lvqol score 69 22 points , 30 days follow - up lvqol score 79 25 points ) . \n based on this pilot data , a sample size of 45 was calculated to be sufficient to detect an improvement of 10 points after 30 days from receiving services at the low vision clinic , using 80% power and 5% level of significance . \n the patients assessed in the pilot were not included in the final study . in the current study , 55 patients were chosen to account for the expected loss to follow - up . \n we calculated the cronbach 's alpha score of the questionnaire to determine the internal consistency of the questionnaire and ensure that the items are inter - correlated , and scores are reliable . \n paired t - test was used to assess the difference between baseline and follow - up lvqol scores of low vision patients . \n there was a 20% loss to follow - up when low vision patients were called for a phone interview ( after 30 days , patients were called every day for 3 days at a time convenient for them ; if they were not able to be reached or if the phone number was incorrect , this was recorded as loss to follow - up ) . \n mann - whitney u parametric test was used to compare the difference between normal and low vision patient lvqol scores . \n two - tailed pearson 's product - moment correlation coefficient was used to correlate age and va with lvqol scores . \n effect size ( change in lvqol score ) was calculated with 95% confidence intervals ( 95% ci ) . \n a total of 30 low vision patients had significantly lower lvqol scores ( 79.43 18.37 points ) compared to 30 normal vision controls ( 117.34 2.32 points ) matched for age , gender , and education level . on average low vision patient \n lvqol scores are 37.91 points ( 32.3% ) lower than normal vision patients ( mann - whitney u parametric test , n1 = n2 = 30 , p < 0.0001 , two - tailed ) . \n low vision patient scores ( 79.43 18.37 points ) were also more widely distributed than controls with normal vision ( 117.34 2.32 points ) [ fig . 1 ] . \n linear regression was run on 3 variables ( age , sex , education ) to ensure that they were not confounders , and this effect remained unaltered . \n the questionnaire provided good internal consistency ( cronbach 's alpha = 0.92 ) in lvqol scores for low vision patients and demonstrated good reliability . \n low vision versus normal vision low vision quality of life score a total of 44 patients ( 80% ) with low vision completed the 1-month follow - up . \n there was 20% loss to follow - up due to the difficulty reaching the patient by phone within a time window of 3033 days . \n patients who completed both baseline and follow - up surveys demonstrated an improvement in lvqol score of + 4.55 points on average ( paired t - test , p = 0.0013 , two - tailed ) , from a baseline of 77.77 19.04 to 82.33 22.52 [ table 1 ] . \n the measured effect size overall measured 4.55 points ( 95% ci 1.06 7.14 ) , with very few patients who had a significant decline in lvqol . \n patient scores showed significant improvement in 3 subcategories of the lvqol on average : mobility ( + 1.63 points , p = 0.01 , paired t - test , two - tailed ) , psychological adjustment ( + 0.84 , p = 0.01 , paired t - test , two - tailed ) , and reading ( + 1.91 , p = 0.001 , paired t - test , two - tailed ) . the last area of the lvqol , activities of daily life , improved in these patients as well , but the change was not significant ( + 0.18 , p = 0.543 , paired t - test , two - tailed ) [ table 1 ] . \n effect of low vision services on lvqol average va in the better eye of the patients was measured at baseline and was not significantly different between those who did or did not receive an lva . \n those who did not receive an lva had a mean va of 0.17 0.11 , and those who received an lva had a mean va of 0.16 0.16 . \n patients who received lvas ( n = 24 ) showed a significant improvement of 8.89 points in lvqol score after 30 days ( paired t - test , p < 0.001 , two - tailed ) , their average scores increased from 83.13 13.22 to 92.02 17.35 [ table 2 ] , an improvement of 8.97 points . \n 6 of these patients received lvas for free ; their lvqol score improvement of + 6 points was not significantly different from the improvement of + 5 points in those who paid for their lvas . \n patients who did not receive an lva ( n = 20 ) showed a decrease of 0.65 points in lvqol score ( paired t - test , p = 0.320 , two - tailed ) . \n effect of low vision aids on lvqol scores gender , literacy , student status , and va in the better eye at baseline were analyzed to identify predictors of benefit from low vision services . \n there was no correlation between the age and change in lvqol score ( r = 0.169 , n = 44 , p = 0.27 ) or between va and change in lvqol score ( r = 0.253 , n = 44 , p = 0.09 ) . \n similarly , there was no correlation between change in gender , literacy , student status , and change in lvqol score [ table 3 ] . \n this suggests that of these demographics , there are no significant trends providing a strong basis for predicting who will benefit most from low vision care . demographic predictors of lvqol improvement ( n=44 ) \n our study shows that low vision services can have a quantifiable positive impact on quality of life for many patients living in rural india . using the lvqol tool \n , we were able to measure the reduced quality of life that low vision imposes on patients and how well patients improve after receiving low vision services . \n patients showed significant gains in all four categories assessed by the lvqol except for activities of daily living . \n the population surveyed included many patients whose daily life involved manual labor , fieldwork , or work that requires both hands . \n lvas such as telescopes , magnifiers , and other devices are less useful for these activities of daily life . \n telescopes are often prescribed for far vision needs , but have a high cost - to - benefit ratio , and many patients find them cumbersome and thus , abandon them in frustration . receiving an lva was a predictor of significant improvement in vision - related quality of life . in this study , the 6 patients who received free lvas demonstrated an improvement of lvqol score similar to those who paid for lvas , and thus providing lvas for free did not introduce significant bias . \n therefore , if the patient is willing to explore low vision services and lvas , ophthalmologists should definitely refer them for low vision evaluation . \n it can be difficult to determine which low vision patients will benefit most from lvas . \n when deciding on whether to refer patients to low vision , physicians consider factors including patient - specific ocular disease processes , socioeconomic status , individual intrinsic motivation , education level , and activities of daily life . \n unfortunately , physician assessments are often limited by time constraints of a busy clinic ; in this setting , physicians can easily overlook a referral to low vision services . in this way \n , the lack of physician referrals can be a barrier for patients who could benefit from low vision services . \n an informal survey carried out among 60 ophthalmologists at aravind eye hospital on their views towards low vision services revealed that , in fact , many physicians are unsure which patients would benefit from a referral to low vision . \n common perceptions of why physicians do not refer included : the perception that the patient lacks motivation to use lvas , the patient can not afford lvas , or would not benefit from the lva given his / her education level . \n contrary to this , our results establish that indeed patients regardless of gender , literacy , and education level can have a significantly improved quality of life with the assistance from low vision services and lvas . \n functional improvement after low vision rehabilitation has been shown , but vision - related quality of life has not been well - studied and the data is less clear , particularly in the rural indian population . in more urban settings , \n low vision rehabilitation services have been shown to improve the clinical outcomes and functional ability outcomes of patients after a spectrum of follow - up surveys ranging from immediately afterwards to 5 years after receiving low vision services . in these studies , a variety of quality of life tools were used including the impact of vision impairment profile , national eye institute visual function questionnaire , visual function questionnaire , and the vision quality of life core measure . in india \n , one study compared different types of low vision rehabilitation by randomizing 436 low vision patients to receive center - based rehabilitation , home - based rehabilitation , a combination of home and center - based rehabilitation , or center - based rehabilitation with non interventional home visits by trained rehabilitation workers . \n the outcomes were measured after 9 months using questionnaires to assess adaptation to low vision , quality of life , and effectiveness of rehabilitation training using a newly developed 10-question survey , the effectiveness of low vision rehabilitation training . \n there was a lower dropout rate with home - based rehabilitation , suggesting a larger benefit with more convenient , individualized vision rehabilitation . \n however , home - based rehabilitation programs are challenging to implement widely in rural india given issues related to training , human resources , funding , and sustainability . \n in developing countries , in - home rehabilitation programs such as these may only be as effective as point - of - care rehabilitation at a vision center since many patients are unable to come back for follow - up . with this in mind \n , our study supports their conclusions and reinforces the importance of low vision referrals so that patients may tap into and benefit from these resources . in our study , \n one limitation was that there was no negative control group consisting of low vision patients who were not referred to low vision services . \n this was intentional , since it would have been unethical to identify and survey these patients at baseline and deny them available services that could potentially help them . \n the translated questionnaire was not formally validated previously in this population , however after the adjustments made with the pilot study ( eliminating question 16 ) , and based on the cronbach 's alpha reliability measures , we concluded the survey was relevant to this population and appropriate to use for the purpose of evaluating patient quality of life in this setting . \n eliminating one question from the questionnaire also lowered the effect size detectable , relative to the 25-item questionnaire . \n thus , our effect size of 4.55 improvement in lvqol is comparable to what has been reported as a clinically significant improvement in quality of life using the lvqol in the dutch population . \n the baseline and follow - up survey methods were administrated using different methods ( in person at baseline and via telephone at follow - up ) , to minimize loss to follow - up . \n however , telephone administration of the lvqol survey has been shown to be as reliable and consistent as in person interview for the lvqol . \n still , 11 patients ( 20% ) were lost to follow - up that may have introduced a response bias . \n the patients lost to follow - up were not significantly different from those who did follow - up in terms of age , gender , education , va , or baseline lvqol score . \n however , their baseline lvqol and va are not indicators of eye disease progression , and these patients may have had a progressively worse course than those who did follow - up and their loss to follow - up may have introduced a response bias . \n admittedly there is a relatively modest improvement overall , patients with severe visual impairments generally do not achieve much visual improvement , even with lvas . \n there is a large variability among low vision patients , as seen in our sample ; some patients do poorly regardless of rehabilitation efforts . a few patients in this study who experienced rapid decline in lvqol likely had progressive disease and declining va , which explains our large amount of variability in effect size . in general , people living with low vision tend to feel frustrated and sad ; it becomes difficult for their families and friends as well . \n staff members at low vision centers are trained to provide counseling and guidance for rehabilitation . \n these include practical tips for mobility and activities of daily living ( using canes and flashlights to help sense surroundings , enhancing edges of doorways and steps with high contrast tape , enhanced lighting , nonoptical aids such as cardboard notex cards for organizing currency by cut edges matching different sizes of currency notes ) ; vocational / educational rehabilitation ( career guidance on vocations that are more practical for people with low vision , advice on using audio books , braille schools ) ; and social rehabilitation ( help in gaining government disability financial assistance , subsidies for walking canes , education , travel expenses ) . with these types of services tailored to each patient 's age , level of vision loss and goals \n our results demonstrate an improvement in this population of rural india , including less educated , lower income patients - a population often forgotten when it comes to providing low vision services . \n many physicians think that low income , rural populations do not benefit from lvas ; however , this study reveals the opposite . \n low vision referrals , more specifically lvas , can help restore a patient 's vision - related quality of life even in rural india . \n thus , physicians should remember to refer patients who meet criteria for low vision evaluation . \n efforts should be made in other low resource areas to increase utilization of low vision services that are beneficial for quality of life in low vision patients .", "role": "user" }, { "content": "context : in india , where the heavy burden of visual impairment exists , low vision services are scarce and under-utilized.aims:our study was designed to survey the effectiveness of low vision exams and visual aids in improving patient quality of life in southern rural india.subjects and methods : the low vision quality of life ( lvqol ) questionnaire measures vision - related quality of life through 25 questions on a likert scale of 05 that pertain to ( 1 ) mobility , distance vision , and lighting ; ( 2 ) psychological adjustment ; ( 3 ) reading and fine work ; and ( 4 ) activities of daily living . this tool was translated into tamil and verbally administered to 55 new low vision referral patients before their first visit at the low vision clinic at aravind eye hospital . \n low vision aids ( lvas ) were prescribed at the discretion of the low vision specialist . \n 1-month later , the same questionnaire was administered over the phone.results:about 44 of 55 low vision patients completed baseline and follow - up lvqol surveys , and 30 normal vision controls matched for age , gender , and education were also surveyed ( average 117.34 points ) . \n after the low vision clinic visit , the low vision group demonstrated a 4.55-point improvement in quality of life ( from 77.77 to 82.33 points , p = 0.001 ) . adjusting for age , gender , and education , \n the low vision patients who also received lvas ( n = 24 ) experienced an even larger increase than those who did not ( n = 20 ) ( 8.89 points , p < 0.001).conclusion : low vision services and visual aids can improve the quality of life in south indian rural population regardless of age , gender , and education level . \n thus , all low vision patients who meet the criteria should be referred for evaluation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: seasonal sound production has been studied extensively in terrestrial animals , bird songs in particular ( catchpole and slater 2003 ) , but seasonal patterns in call production are also common among fishes and marine mammals . \n generally , seasonal sound production is related to biologically meaningful behaviors such as reproduction , mate attraction , and foraging . \n for example , sciaenid fishes produce more sounds during peak spawning season than at other times of the year ( aalbers 2008 ; locascio and mann 2011 ; ramcharitar et al . \n exhibit a seasonal cycle in their breeding calls ( thomas and demaster 1982 ; stirling et al . \n 1983 ) , and cetaceans such as humpback ( megaptera novaeangliae ) , blue ( balaenoptera musculus ) , and fin whale ( b. physalus ) males sing most commonly during and around their presumed breeding season in the winter ( winn and winn 1978 ; mattila et al . 1987 ; watkins et al . 1987 ; mcdonald et al . 2001 ; croll et al . \n on the other hand , both sexes of these species produce distinct sounds associated with feeding ( thompson et al . \n in addition to seasonal patterns , daily patterns in sound production have been documented for fishes and marine mammals , and they may inform on the behavioral context of each sound . \n night chorusing of sciaenids corresponds to the peak daily occurrence of spawning events ( holt et al . \n many odontocetes , such as dolphins and porpoises , produce a majority of their echolocation signals during the night , this sound production corresponding to periods of foraging on vertically migrating prey ( carlstrm 2005 ; johnston et al . \n blue whales , on the other hand , feed and produce foraging - associated calls mostly during the day , while their song has a crepuscular pattern ( stafford et al . \n thus , studying temporal patterns in sound production can provide insight into both the behavioral ecology of a species , and its seasonal distribution . \n fin whales produce a variety of low - frequency ( mostly < 100 hz ) , high - intensity ( up to 189 db re : 1 pa at 1 m ) , short - duration ( approximately 1 s ) , frequency - modulated sounds ( watkins 1981 ; watkins et al . 1987 ; \n the most often reported fin whale sound is the 20 hz pulse , a short - frequency downsweep mostly centered around 20 hz , which is produced by fin whales worldwide ( watkins 1981 ; edds 1988 ; thompson et al . \n 1992 ; clark and fristrup 1997 ; clark and charif 1998 ; watkins et al . \n this call is produced in regular sequences forming stereotyped songs , sometimes in a form of \n 1987 ; mcdonald and fox 1999 ) or as repeated individual pulses , with likely a reproductive function as they are produced only by males ( croll et al . \n 2002 ) . when produced in irregular sequences or as call - counter calls , 20-hz calls likely have a social purpose and may be used to maintain contact ( mcdonald et al . 1995 ; edds - walton 1997 ) . \n one higher frequency call type reported by watkins ( 1981 ) was also sweeping down in frequency , generally between 100 and 30 hz , but most often from 75 to 40 hz . \n this call was produced by fin whales mostly during the summer during deep dives , as individual or multiple calls , but never in a regular sequence ( watkins 1981 ) . \n the remaining fin whale signals are more variable in character , and their social context is more poorly understood ( watkins 1981 ; edds 1988 ) . \n the traditionally accepted and simplified view of baleen whale seasonal life history is that most species undergo a seasonal migration from higher latitude , summer feeding grounds to lower latitude winter calving grounds ( kellogg 1929 ) . \n based on a comprehensive analysis of historic whaling records , mark recovery tags , visual sightings , and acoustic recordings , mizroch et al . \n ( 2009 ) concluded that fin whale seasonal distribution in the eastern north pacific indicates a more complex movement pattern . \n at least some part of the population undergoes a seasonal migration between the gulf of alaska and us west coast feeding areas to the wintering areas off baja california ( rice 1998 ; mizroch et al . \n the bering sea generally has high concentrations of fin whales during the summer and may serve as a mixing ground for two distinct populations , eastern and western ( mizroch et al . \n consistent with a seasonal presence of fin whales in the bering sea , near the aleutian islands , 20-hz calls appear the most prevalent between may and august ( moore et al . \n offshore recordings , however , do not show this seasonal pattern and between 55n in the gulf of alaska to approximately 30n off california , 20-hz calls are detected most often between september and march ( moore et al . 1998 ; watkins et al . \n 2007 ) when the whales would be expected to be farther south based on the traditional migration theory . \n this may indicate that at least a part of the population remains year - round at productive higher latitudes locations , such as near kodiak island and in the gulf of alaska ( mizroch et al . \n in addition to the hypothesized ocean - basin - wide migrating populations , there is evidence of resident fin whale populations in peripheral seas such as the gulf of california , the east china sea , and the mediterranean ( tershy 1993 ; canese et al . \n 2009 ) , as well as off southern california ( forney and barlow 1998 ) . among these resident populations , \n fin whales are more abundant off southern california in the summer ( forney and barlow 1998 ) , while in canal de ballenas , the area with the highest fin whale abundance in the northern gulf of california , their peak presence is in the winter and spring , with fewer sightings during the summer ( tershy 1993 ) . \n it is interesting , however , that peak acoustic presence based on 20-hz calls off southern california lags the peak in presence from visual survey and occurs in the fall and winter ( clark and fristrup 1997 ; oleson 2005 ) . \n these inconsistencies between visual and acoustic data indicate that a more thorough inspection of fin whale calling repertoire is needed to fully describe their seasonal presence . in this paper \n , we describe the differences in seasonal and daily temporal patterns between the 20-hz call and a higher frequency sound we designated the 40-hz call after watkins ( 1981 ) , produced by fin whales at three locations across the eastern north pacific ocean : the bering sea , southern california , and the gulf of california ( canal de ballenas ) . \n we also discuss possible behavioral context of these calls and their importance for successful acoustic monitoring of fin whales across the eastern north pacific . \n passive acoustic data were collected using high - frequency acoustic recording packages , harps ( wiggins and hildebrand 2007 ) , at three locations across the eastern north pacific : the bering sea , off southern california , and in the northern gulf of california ( fig . 1 ) . \n the harps recorded at different sample rates and duty cycles , but all the recordings provided sufficient bandwidth for capturing the full bandwidth of both fin whale call types ( table 1 ) . \n nine months of data ( from april 2005 until january 2006 ) were available in the bering sea , a full year from january 2010 through january 2011 was available for southern california , and data were collected intermittently in the gulf of california from august 2008 until may 2010 . \n all recordings were decimated to reduce the data to 1 khz effective bandwidth and allow for computationally faster analysis.fig . \n 1map of the eastern north pacific ocean , with squares denoting locations where fin whale recordings were collected for this study : bering sea , southern california , and gulf of californiatable 1location , dates , and recording parameters for acoustic recordings at three locations across the eastern north pacificlocationlatitude ( n)longitude ( w)deployment perioddepth ( m)sample rate ( ksamples / s)duty cyclebering sea56 51.6164 03.524 apr 0516 \n jan 067040continuoussouthern california32 22.2118 33.831 jan 1026 mar 101280200continuous11 apr 1018 jul 1023 jul 108 nov 107 dec 1030 jan 11gulf of california29 01.6113 22.58 aug 0825 dec \n 086902005/2024 apr 0912 sep 095/157 dec 0918 may 105/15for duty cycle of the recording , the first number denotes the length of recording [ min ] during each cycle , and the second number is the total length [ min ] of each cycle map of the eastern north pacific ocean , with squares denoting locations where fin whale recordings were collected for this study : bering sea , southern california , and gulf of california location , dates , and recording parameters for acoustic recordings at three locations across the eastern north pacific for duty cycle of the recording , the first number denotes the length of recording [ min ] during each cycle , and the second number is the total length [ min ] of each cycle as there are no previous detailed characterizations of the 40-hz call type , we measured start and end frequency of 40-hz calls at all three location . \n we performed measurements of 20 calls at each location , with each call separated by at least 24 h to try to ensure calls from a single animal are not overrepresented in the data . \n we tested whether call frequency characteristics at different locations were similar enough to each other to be considered as coming from the same population using a one - way analysis of variance . \n the start and end frequency characteristics of the 40-hz calls did not vary among locations ( anova , f(2,57 ) = 0.04 , p = 0.964 and f(2,57 ) = 0.79 , p = 0.461 , respectively ) , so we pooled all the measurements for the calculation of overall average frequency characteristics . \n long - term spectral averages ( ltsas ) , with 5 s temporal and 1 hz frequency resolution , were calculated from the data using the custom matlab - based program triton ( wiggins and hildebrand 2007 ) . \n these long - term averages were manually scrutinized by trained analysts for the presence of 20- and 40-hz calls in each hour of data . \n if there was uncertainty regarding the call type based on the ltsa , the analysts would further examine the call with a shorter time scale ( 20 s to 2 min ) spectrogram with higher temporal resolution ( 0.1 s ) than the ltsas to verify the call type based on spectral characteristics and durations of individual calls . \n since hourly presence of calls was noted rather than the timing of individual calls , we did not further classify 20-hz calls into songs or call - counter call . \n fin whales are known to produce 20-hz calls in regular sequences , while 40-hz calls can be produced repetitively but generally not in a regular sequence ( watkins 1981 ) . \n thus , the presence of calls in an hour of data was used as a metric to remove some of the positive bias to the 20-hz calls that would result from their regular repetitiveness had we used individual call detections , although a bias remains in the increased likelihood of detection of long sequences of calls over individual or irregular calls . \n additionally , the gulf of california data were recorded using a duty cycle , making it more difficult to measure the repetitiveness of calls to further classify 20-hz calls . \n percent of hours with calls per week was plotted for each call type and each location . \n less than 100 % effort in data collection per week , either as a result of deployment or recovery of instruments or duty - cycled data , was plotted along with call data . \n the gulf of california data are presented on a 1-year timeline to facilitate observation of seasonal patterns even though the data were collected over the course of 3 years . to obtain a quasi - continuous year - long time series , we plotted the following sections of data from each deployment : september 1december 15 , 2008 , may 1august 31 , 2009 , and december 16 , 2009april 31 , 2010 . \n we calculated the yearly mean day of calling for each call type at each location using circular statistics toolbox for matlab ( berens 2009 ) . \n the measured variable in this analysis was the day when each hour with a call was recorded , and thus , each day was assigned an angular value based on its position on an imaginary annual circle . \n the mean day of calling , with its associated 95 % confidence interval , was calculated from the angular values . to test \n whether the mean days of calling for 40- and 20-hz calls differed significantly at each location , we performed a parametric watson \n this analysis was performed on the same data that were used for creating seasonal plots for each site . to test if calls were preferentially produced by fin whales at a certain time of the day , we divided the hours with detected calls into 4-day periods : dawn , day , dusk , and night . \n dawn was defined as the hours of nautical twilight ( defined by the passage of the center of the sun geometrically 12 below the horizon ) start and sunrise , as well as any hours between them . \n day was made up of hours after sunrise but before sunset , and night were hours after the end but before the start of nautical twilight . \n this method overestimates total period of dawn and dusk and underestimates day and night , because the entire hour at change of sun condition is considered as dawn or dusk , regardless of the exact time of change . \n sunrise , sunset , and twilight information were accessed from the us naval observatory sun and moon rise / set tables ( http://aa.usno.navy.mil/data/docs/rs_oneyear.php ) . \n the total number of hours with calls was summed up for each day period over the entire duration of the recordings . \n we used chi - square goodness of fit to test the hypothesis that the number of hourly detections of each call for each day period at each site ( observed value ) is proportional to the total effort hours for that day period ( expected value ) . \n we used = 0.05 to reject the null hypothesis that whales do not call preferentially during any day period . to graphically represent the variability in diel patterns \n , we plotted the values as a difference between the actual and expected call presence values , expressed as a fraction of total effort . \n two fin whale call types recorded in the eastern north pacific , the 20-hz and the 40-hz call , were both short - duration downsweeps , but with different frequency characteristics ( fig . 2 ) . \n the 40-hz calls downswept from 61.2 6.6 to 47.6 5.7 hz ( n = 60 ) over about 1 s. the calls were generally not produced in regularly repeated sequences.fig . 2 \n a long - term spectral average plot ( 2000-point fast fourier transform ( fft ) , 5 s time average and 2 khz sample rate ) recorded on june 16 , 2010 with 20-hz calls marked with ovals and 40-hz calls marked with a rectangle . \n spectrograms of fin whale ( b ) 20-hz calls ( 2000-point fft with 95 % overlap , band - pass filtered between 10 and 50 hz ; sample rate 2 khz ) recorded on june 9 , 2010 and c 40-hz calls ( 2000-point fft with 95 % overlap , band - pass filtered between 30 and 80 hz ; sample rate 2 khz ) recorded on april 18 , 2010 . \n all recordings were collected off southern california \n a long - term spectral average plot ( 2000-point fast fourier transform ( fft ) , 5 s time average and 2 khz sample rate ) recorded on june 16 , 2010 with 20-hz calls marked with ovals and 40-hz calls marked with a rectangle . \n spectrograms of fin whale ( b ) 20-hz calls ( 2000-point fft with 95 % overlap , band - pass filtered between 10 and 50 hz ; sample rate 2 khz ) recorded on june 9 , 2010 and c 40-hz calls ( 2000-point fft with 95 % overlap , band - pass filtered between 30 and 80 hz ; sample rate 2 khz ) recorded on april 18 , 2010 . \n all recordings were collected off southern california both the 20 and 40 hz fin whale calls were recorded at all three locations . additionally , they were present during all months with recordings although the relative occurrence of their weekly presence varied within and among sites ( fig . 3 ) . \n for example , the 40-hz call was least common in the gulf of california , where a maximum of 17 % of hours per week had calls . \n if corrected for the recording duty cycle , the rate was still the lowest at 51 % of hours per week with calls . off \n southern california and in the bering sea , on the other hand , a maximum of about 85 % of hours had 40-hz calls during times of peak presence . \n the peak in 40-hz calling occurred in june at all three locations , albeit the earliest in the gulf of california and the latest in the bering sea ( table 2 ) . \n the 20-hz call was the most common off southern california with nearly 100 % of hours with calls during large parts of the year , but with a notable decrease from may until july ( fig . 3 ) . \n the presence of this call was more seasonal in the bering sea and the gulf of california , with a high number of hours with calls occurring between july and december . \n the peak in 20-hz calling was more variable than the peak in 40-hz calls , and it occurred the earliest in the gulf of california and the latest off southern california ( table 2 ) . \n the difference between the yearly mean calling day between the two call types was significant in the bering sea and off southern california ( watson williams test , f = 27.1 , p < 0.001 and f = 936.3 , p < 0.001 , respectively ) , but the means were not significantly different in the gulf of california ( watson williams test , f = 0.42 , p = 0.516).fig . \n 3percent of hours per week with fin whale 20-hz ( light gray ) and 40-hz ( dark gray ) calls recorded a in the bering sea , b off southern california , and c in the gulf of california . \n right axes and black dots represent percentage of recording effort per week when effort was less than 100 % . \n note that in the gulf of california ( c ) , the scale of the right axes is different because the recordings were on a duty cycle . \n also note that the data in panel ( c ) are not continuous and vertical lines denote times when data from different deployments were used . \n stars at the top of each panel represent the mean day of calling presence for 20-hz ( light gray ) and 40-hz ( dark gray ) calls during the year . \n all panels are aligned by month , for easier seasonal comparisontable 2yearly mean day of calling presence ( and 95 % confidence interval ) for each call type at each of the three locations across the eastern north pacificgulf of californiasouthern californiabering sea40-hz call1 june ( 21 may13 june ) n = 16915 june ( 1318 june ) n = 1,90125 june ( 2329 june ) \n n = 1,13620-hz call23 september ( 2027 september ) n = 2,31921 november ( 25 october18 december ) n = 6,4368 october ( 611 october ) n = 2,037 \n n is sample size used for each calculation , representing the number of hours with detected calls for each call type at each location percent of hours per week with fin whale 20-hz ( light gray ) and 40-hz ( dark gray ) calls recorded a in the bering sea , b off southern california , and c in the gulf of california . \n right axes and black dots represent percentage of recording effort per week when effort was less than 100 % . \n note that in the gulf of california ( c ) , the scale of the right axes is different because the recordings were on a duty cycle . \n also note that the data in panel ( c ) are not continuous and vertical lines denote times when data from different deployments were used . \n stars at the top of each panel represent the mean day of calling presence for 20-hz ( light gray ) and 40-hz ( dark gray ) calls during the year . \n all panels are aligned by month , for easier seasonal comparison yearly mean day of calling presence ( and 95 % confidence interval ) for each call type at each of the three locations across the eastern north pacific \n n is sample size used for each calculation , representing the number of hours with detected calls for each call type at each location neither the 20- nor 40-hz calls were produced uniformly during the day across the eastern north pacific ( fig . \n the diel calling pattern was consistent for the two call types within the site in the bering sea and in the gulf of california , but the patterns between the calls differed off southern california . in the bering sea , \n both 20- and 40-hz calls were more common during day hours and less common during dusk and dawn ( chi - square test , 32 = 29.86 , p < 0.001 and 32 = 695.2 , p < 0.001 , respectively ) . \n this pattern was largely opposite in the gulf of california . while the diel pattern was also significantly different from our null hypothesis , more hours with 40 and 20-hz calls were detected during night and dawn ( chi - square test , 32 = 20.20 , p < 0.001 and 32 = 17.44 , p = 0.001 , respectively ) . \n off southern california hours with 40-hz calls were more common during the day and dusk ( chi - square test , 32 = 94.76 , p < 0.001 ) , while 20-hz calls occurred less commonly during day and dusk hours , although the trend was not significantly different from the null hypothesis ( chi - square test , 32 = 2.03 , p = 0.567).fig . \n 4difference between the actual and expected hourly call presence , in fractions of effort , for ( a ) 20-hz and ( b ) 40-hz call types during each of the 4 day periods : dawn , day , dusk , and night . \n black bars represent data from the bering sea , gray are southern california , and white are the gulf of california data difference between the actual and expected hourly call presence , in fractions of effort , for ( a ) 20-hz and ( b ) 40-hz call types during each of the 4 day periods : dawn , day , dusk , and night . \n black bars represent data from the bering sea , gray are southern california , and white are the gulf of california data \n both types of fin whale calls were detected at all three eastern north pacific locations during all the months of recording and , combined , they provide a more accurate insight into the seasonal presence of fin whales across the eastern north pacific than just a single call type . \n fin whale calls were detected in the bering sea during the entire deployment period including the early winter . as we did not have data from february to april , we can not conclude if fin whales are present in the bering sea during late winter . while there is a marked decrease in the number of hours with fin whale calls in december and january suggesting the whales may be leaving the area , \n fin whales have been recorded previously off aleutian islands in march and april ( moore et al . 1998 ) , and it is possible some fin whales remain at these high latitudes year - round . \n year - round presence of both fin whale call types off southern california and in the gulf of california is consistent with previous reports of likely resident populations in those areas ( tershy et al . \n 1990 ; forney and barlow 1998 ) . however , peak acoustic presence in the canal de ballenas was in the summer and fall , but fin whales are more commonly seen at this location during the winter and spring ( tershy et al . \n off southern california , on the other hand , overall calling presence was consistently high , while visual sightings peak occurs during the summer ( forney and barlow 1998 ) . \n these cases illustrate that visual and acoustic methods may result in different occurrence patterns ( irovi et al . \n 2006 ; gedamke and robinson 2010 ) since each method depends on a broader behavioral context ( e.g. , visible surface behavior or subsurface sound production ) and may change seasonally . \n production of 20 hz pulses has been consistently attributed to fin whales ( schevill et al . 1964 ; watkins and schevill 1972 ) , but the only published record attributing the 40-hz call to fin whales comes from watkins ( 1981 ) . \n the exact locations of watkins ( 1981 ) recordings were not noted though most of the recordings were made in the atlantic ocean . \n the frequency characteristics of 20-hz calls produced by fin whales in the atlantic and the pacific ocean are similar ( watkins 1981 ) , and it is reasonable to assume 40-hz calls recorded in the pacific , that match watkins ( 1981 ) description , are also produced by fin whales . \n in addition , the locations of our recordings offer further evidence that fin whales are the only species that is a likely source of this sound . \n we recorded these calls in the bering sea and the gulf of california , both areas where fin whales are the most commonly sighted baleen whales ( tershy et al . \n minke ( b. acutorostrata ) and humpback whales ( m. novaeangliae ) , the other two baleen whale species common in the bering sea ( moore et al . \n 2002 ) , are not commonly sighted in the northern gulf of california ( tershy et al . \n , the bering sea is well outside of the known range of bryde s whales ( b. edeni ) , a tropical and subtropical species also common in the gulf of california ( tershy et al . \n additionally , sei whales ( b. borealis ) are very rarely sighted in the bering sea ( moore et al . \n 2002 ) and the gulf of california ( mangels and gerrodette 1994 ) and would thus be an improbable source of these common calls . finally , ambiguity could arise in distinguishing blue whale d calls from fin whale 40-hz calls in an ltsa even though d calls have a distinctly broader bandwidth ( oleson et al . \n if bandwidth alone was not sufficient for classifying call type , a trained analyst would use a spectrogram with a higher time resolution and base classification on the different durations of the two call types ( oleson et al . \n since this additional step was conducted for hourly periods when there was ambiguity about the call type based on the ltsa , we conclude that the vast majority of hours with identified calls were indeed fin whale 40-hz calls . while both call types show consistent fin whale presence at these three eastern north pacific locations , there were clear seasonal differences in the relative persistence of each call type during the period of our recordings . \n fin whales produced 40-hz calls primarily during the summer , with a peak in june , while peak in 20-hz calling occurred in the fall ( between late september and november ) . \n this seasonal variation could be an indication of the difference in the behavioral context during which each call type is produced . \n watkins ( 1981 ) noted that higher frequency 40-hz calls were generally produced by animals in groups , apparently in feeding contexts , for example when the animals were seen surface feeding and during deep , likely foraging dives ( croll et al . \n fin whales are known to feed at all three sites ; thus , their presence at these locations could be associated with feeding . \n the bering sea is an important feeding habitat where fin whales have been linked with concentrations of zooplankton and fish during the summer ( moore et al . 2000 ) . \n in addition to the high latitude productive areas , fin whales in the eastern north pacific also feed in productive regions off southern california and in the gulf of california , particularly in the canal de ballenas ( tershy 1992 ; croll et al . \n the peak in calling presence of the 40-hz call occurred in early summer at all locations , a pattern similar to blue whale d calls off southern california ( oleson et al . \n the blue whale is the most closely related animal to fin whale , so it is possible that call production could be similar in the two species . \n based on the seasonal peak in the production of this call , its occurrence at locations known to be fin whale feeding areas , and association between behaviors associated with feeding and this call observed by watkins ( 1981 ) , we propose that the 40-hz call may be produced by whales that are primarily focused on feeding , analogous to the downswept d call in blue whales . \n there is wide agreement that 20-hz calls , when occurring in regular , songlike sequences , likely serve a mating function , either as advertisement of resources ( croll et al . 2002 ) or for mate attraction ( watkins 1981 ; watkins et al . \n call - counter calls and irregular 20-hz calls , on the other hand , likely serve social function and may be used for keeping contact with moving conspecifics ( edds 1988 ; mcdonald et al . \n 1995 ) , and , like 40-hz calls , are generally produced by animals in groups ( watkins 1981 ) . \n nearly year - round high levels ( > 80 % of hours with calls from august until april ) of 20-hz calls off southern california could be explained by the fact that we combined all variants of the 20-hz call ( song , counter call and irregular ) into one metric in this study . from earlier studies , \n we know that call - counter calls occur year - round off british columbia , but are seasonal off the us west coast ( moore et al . \n southern california , counter calls peak in the summer , while song phrases are only found in the winter ( oleson 2005 ) . \n the later seasonal peak in the 20 hz hourly call presence off southern california , relative to the other locations , is likely the result of an extended fin whale presence off southern california . \n the persistence of a high hourly rate of 20-hz calls for most of the year off southern california may be a recent development . during the early 2000s , a clear peak in fin whale call detections off \n southern california occurred in the fall with fewer 20-hz calls detected in the winter ( oleson 2005 ) . a possible explanation for this persistence of the 20-hz call could lie in the changing oceanographic conditions . over the last decade , there has been considerable fluctuation in the california current ecosystem , driving fluctuations in abundance and distribution of lower trophic levels ( bjorkstedt et al . \n 2010 ) . as a result of these oceanographic changes , postulated resident and migratory fin whale populations off southern california ( mizroch et al . \n 2009 ) may be using these areas differently , contributing to more constant use levels . \n we see the same prolonged use of the area by fin whales in our recordings from the same location in the southern california bight a year earlier ( february 2009january 2010 ) . \n the temporal separation of the two calls is maintained in the data , but there is a shift to earlier peaks , with the mean day of 40-hz calls in late spring ( 6 may , 95 % confidence interval 30 april12 may ) and the mean day of 20-hz calls in early winter ( 18 january , 95 % confidence 1224 january ) . \n however , considering the greatly varying oceanographic conditions between these 2 years , with 2009 a strong el nio and 2010 a moderate la nia years ( lee et al . \n a better understanding of fin whale population structure followed by a detailed investigation into the variation in seasonal use of the different parts of the north pacific by different fin whale stocks would be timely in the light of continued changes in the ocean environment driven by global climate change ( bakun 1990 ; hayward 1997 ; king et al . \n 20-hz calls in the bering sea and the gulf of california showed distinct seasonality , with peaks in the late summer and fall . \n these peaks are earlier than reported in most previous analysis of 20-hz calls in the northeastern pacific , where peaks were found to occur in the winter and early spring ( watkins et al . \n previous recordings in the gulf of california , on the other hand , yielded predominately 20-hz calls in march , some 20-hz calls in august , and neither 20- nor 40-hz calls in february or june ( cummings et al . \n these studies provided only brief glimpses into fin whale acoustics in the gulf of california , but we are not familiar with any year - round recordings from this area . while our data are non - contiguous and we may be confounding some intra - annual variability , we provide the first year - round acoustic look at fin whale presence in the gulf of california . some of the variability between our recordings and earlier reports could be due to the interannual variability inherent to the oceanographic environment as illustrated in our southern california recordings . \n additional complication to our interpretation stems from the fact that recordings from different basins are not temporally overlapping . \n however , we believe the overall seasonal pattern and separation of the two call types is likely to persist across years and regions ( moore et al . \n in addition to seasonal differences , we also found evidence of differences in daily calling patterns across the eastern north pacific for both call types . if calls are associated with different behaviors , a difference in diel patterns of calls is not surprising as daily patterns in fin whale behaviors \n feeding patterns vary between different oceans ; in the north atlantic fin whales feed during the night ( vkingsson 1997 ) , while in the southern california bight and the gulf of california they have been observed feeding during the day ( tershy 1992 ; acevedo - gutirrez et al . \n dominant production of the 40-hz call in the bering sea and off southern california occurred during the day with a decrease in the number of hours with calls at night . during the day , whales can forage more effectively on prey , such as euphausids , copepods , and schooling fishes ( kawamura 1980 ; tershy 1992 ) , which are aggregated at depth . \n this diurnal pattern supports our hypothesis that the whales may be producing these calls while foraging . \n the daily call production pattern is the opposite , however , in the gulf of california , with peaks at night and dawn . \n most observations of feeding in this area were from the winter and spring ( tershy 1992 ) , but most calls occurred during the summer and fall , when fin whales in other areas are known to forage at night ( vkingsson 1997 ) . \n it is possible that the whales change their feeding behavior during the year if the behavior of their prey or their prey preference changes . \n although direct observations of fin whales during the night are difficult , in the gulf of california , nighttime observations during the summer months would be needed to help explain the difference in the calling pattern . \n while overall daily patterns in sound production were largely similar among sites , variation from expected number of hours with call was much smaller for 20-hz calls , and in the case of southern california was not even significant . \n previous studies have found that a peak in 20-hz calls in southern california occurs after dusk ( oleson 2005 ) , but it is not surprising that we found no significant diel pattern in 20-hz calls off southern california considering calls were detected close to 100 % of the time during long periods of the year . \n additionally , a distinct diel pattern may exist in song and call - counter call , but combining the calls into one metric may obscure and confound any such patterns . by augmenting the seasonal record of fin whale acoustic presence in the eastern north pacific with the 40-hz call \n , we provide evidence of consistent levels of fin whale presence in higher and mid - latitudes . \n when a call is detected , we know a whale is present , but absence of a call does not mean that whales are not present ; they may be present but quiet . by combining multiple call types into the analyses of seasonal presence \n , we can diminish the bias of a quiet whale that may occur due to the behavioral constraints of calling and obtain seasonality information that more accurately reflects the animal s true presence . \n interestingly , the peak in 40-hz calls corresponds better to whale presence based on visual data off southern california , but neither call type offers good overlap with the peak abundance of whales based on visual data in the gulf of california ( tershy et al . \n 1990 ; breese and terhsy 1993 ; forney and barlow 1998 ) . in conclusion , we have confirmed year - round presence of calling fin whales in the northern gulf of california and off southern california , as well as their presence in the bering sea from may through january . we propose that estimates of seasonality of fin whales would benefit from inclusion of both 20- and 40-hz calls , as these calls are likely produced in distinct behavioral context , and thus , one may be favored over another during different times of the year . \n the 40-hz call , likely associated with foraging , peaks in late spring ( june ) across the eastern north pacific , while peaks in 20-hz calling occur 35 months later . \n direct studies of feeding and calling behaviors would help further explain factors driving the production of these calls , as well as their ultimate function .", "role": "user" }, { "content": "fin whales ( balaenoptera physalus ) produce a variety of low - frequency , short - duration , frequency - modulated calls . \n the differences in temporal patterns between two fin whale call types are described from long - term passive acoustic data collected intermittently between 2005 and 2011 at three locations across the eastern north pacific : the bering sea , off southern california , and in canal de ballenas in the northern gulf of california . \n fin whale calls were detected at all sites year - round , during all periods with recordings . at all three locations \n , 40-hz calls peaked in june , preceding a peak in 20-hz calls by 35 months . \n monitoring both call types may provide a more accurate insight into the seasonal presence of fin whales across the eastern north pacific than can be obtained from a single call type . \n the 40-hz call may be associated with a foraging function , and temporal separation between 40- and 20-hz calls may indicate the separation between predominately feeding behavior and other social interactions .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: alternative splicing ( as ) is an eukaryote - specific cellular mechanism of creating diverse mrna structures by differential use of splice sites ( 1 ) . \n we have seen substantial progress in understanding the significance and mechanism of as via both computational and experimental approaches . \n several studies have revealed the role of as in developmental regulation ( 2 ) , evolutionary processes ( 3 ) and even in psychological behavior ( 4 ) . \n proper functional annotation is an essential part in understanding the role of splice variants at the genome scale ( 7 ) . \n european community ( especially the ebi ) has made significant efforts to include splice variants as a part of their ensembl genome annotation project . \n tharanaj and coworkers have developed a series of databases ( asd , altsplice and alttrans ) by datamining genbank sequences and pubmed literatures ( 8,9 ) . \n aceview provides a comprehensive overview of functional and structural aspects of alternatively spliced genes for human , worm and arabidopsis genomes ( 10 ) . \n ( 11 ) developed algorithms and databases ( asap ; alternative splicing annotation project ) to analyze as at the genome - wide level . \n recently they developed an algorithm to predict the full - length mrna models which is critical in understanding the significance of a given as at the transcript level , not at the individual exon level ( 12 ) . at the time of writing , they updated the asap database to asap ii which covers 17 organisms and supports comparative analysis of splice variants ( ) . \n holste et al . ( 13 ) developed the hollywood database in which the conservation of as pattern in human and mouse can be examined . \n numerous other databases ( 14,15 ) are available either to model the diverse gene structures or to predict the splice variants ( e.g. see the website for the nar database issues ; ) . \n sage and est data have been successfully used to find differentially expressed genes ( deg ) in various organs and cancerous tissues ( 16,17 ) . \n lee and coworkers extended the bioinformatics search to find differentially expressed splice variants in various tissues and cancers ( 18,19 ) . \n 20 ) developed a database and a web server that display tissue - specific transcripts and genes using unigene est cluster . \n the algorithm introduced a novel combination of genome - based est clustering and graph - based transcript assembly procedures ( 21 ) . \n the database provided functional annotations for alternatively spliced genes that included the domain , gene ontology ( go ) and expression pattern analysis based on the est and sage data ( 22 ) . in this update , \n we have expanded the ecgene 's est clustering and mrna modeling to support nine organisms whose genome maps are available . \n the species thus included are human , mouse , rat , worm , fruit fly , zebrafish , dog , chicken and rhesus monkey . \n the genome - based version provides improved est clustering compared to the transcript - based clustering . \n we have also developed several new applications and utilities for functional annotation of alternatively spliced genes in the human genome . \n notably , a java - based viewer with several novel features visualizes as so that users can compare splice variants efficiently . \n the viewer combines the advantages of the genome browser and transcript viewer in a single user interface by supporting variable intron scaling . \n this is in contrast to the use of two separate windows in the intris program ( 23 ) . \n furthermore , functional domains of encoded proteins and splicing - regulatory elements are indicated in this new interface to facilitate understanding the functional significance and regulatory mechanism of as . \n we also added several new programs to identify deg and isoforms in various organs and/or cancer tissues . together with the new features \n the updated version consists of two main components expansion of ecgene clustering to various organisms and annotation of the human genome . \n new tools are added to examine differential expression pattern which may aid identifying tissue- and/or cancer - specific genes . \n links to applications are provided inside the picture as well as in the tab menu for user convenience . \n the ecgene algorithm was applied to nine organisms that include most of the important model organisms . \n this implies that we have the mrna model and the subcluster for each splice variant , in addition to the genome - based est clusters which are equivalent to the unigene clusters . \n the result is quite similar to the tigr gene indices that provides clustering and assembly for eukaryotic genomes ( 24 ) . \n however , the genome - based method is superior to the transcript - based method in terms of clustering accuracy with a limitation that it can be applied only to organisms with the genome map . \n we also provide the ecgene genome browser that shows the genomic alignment of mrna models and est sequences as custom tracks in the ucsc genome browser ( 25 ) . \n this allows users to access ample annotation tracks in the ucsc genome browser database , thereby facilitating the deduction of functional significance of each splice variant . \n table 1 compares the extent of as for the drosophila melanogaster genome in several databases including the flybase ( 26 ) , dedb ( 27 ) and asap ii . \n although the number of spliced genes is comparable between databases , ecgene shows that a significantly larger number of genes that are alternatively spliced . \n comparison of as statistics for the drosophila melanogaster genome current version of dedb is based on the flybase release 4.2.1 . \n genes and transcripts for the flybase were downloaded from the ucsc table browser for the dm2 genome . \n ecfunction was developed to effectively visualize the mrna structure and functional domains of alternatively spliced genes so that users can readily recognize any changes in the functional domains due to as . \n we improved the user interface by switching to java applets that allow both zooming and intron scaling in real time . \n variable intron scaling allows a seamless transition from the genome browser to the transcript or protein viewers . \n thus , the detailed gene structure as well as known functional features in the genomic , mrna and protein sequences can be readily visualized in a single user interface . importantly , \n candidate splicing - regulatory signals such as the ese ( exon splicing enhancer ) ( 5 ) and ess ( exon splicing silencer ) ( 6 ) can be visualized with the transcript structure , which would be valuable information in studying the mechanism of as . \n asviewer extends the features of ecfunction to support other gene models including refseq , ensembl and aceview . \n the transcript models can be readily compared using the detailed information for exons and introns available in the baloon help . \n we also provide a utility to print the genomic sequence in a similar way to the ucsc genome browser ( 25 ) \n . the character style and color can be specified for individual mrna models which would facilitate the detailed comparison of various predicted mrna models . \n we divided the previous version of ecexpression into two separate applications ( estexpress and sageexpress ) providing more specific and detailed information for each data type . \n estexpress analyzes 8600 human cdna libraries and illustrates the inferred gene expression in various tissues and cancers . \n an option of using non - normalized libraries is also available to obtain quantitative prediction ignoring ests from the normalized cdna libraries . \n sageexpress is substantially improved to provide diverse search options and detailed analysis on alternative tags . \n the search interface closely follows the widely used sagemap of ncbi and the sage genie at nci ( 28,29 ) . \n our tag - to - gene assignment is based on the mrna models of ecgene . \n we also provide information on alternative tags stemming from alternative polya tails , internal restriction sites and the single nucleotide polymorphisms ( snp ) . \n special efforts have been made to facilitate the examination of the differential expression which is an issue of major importance in the field of biomarker and drug target discovery . \n ecprofiler is a candidate gene search system that mines est clusters for genes with desired expression pattern and function . \n specifically , the expression ontology used for cdna library classification includes three categories organ / tissue / cell - type , pathology and developmental stage . both gene expression and function are implemented in ontology - based hierarchical structures . \n java implementation allows users to select any combination of nodes in all categories including choice of multiple nodes and subnode expansion . \n we also provide a powerful search engine and diverse filtering options such as motifs , number of ests and libraries and the specificities . \n degest is a database of deg , splice variants ( isoforms ) and as events covering 52 tissues and cancer types . \n chi - squared test was performed for est clusters and subclusters from ecgene clustering to identify deg and isoforms . \n . the background distribution of statistical test can be either the ests in the gene or the whole dbest . \n this allows users to obtain transcripts with specific expression at the isoform level even though the gene itself has no specificity at all . \n as events are classified into exon - skipping , alternative donor / acceptor sites and intron retention . \n since sage is inherently an mrna - based technique , a gene may have several tags or a tag may correspond to several splice variants . \n ecprofiler and degsage run as server - client applications in real time , and the response may be slow . \n it is thus strongly recommended to specify the genomic region of interest within a chromosome in running ecprofiler . \n although we support the genome - wide search , it should be noted that this may take over 30 min . \n degest is a simple query system to the database that stores all results in pre - computed form for fast response . \n the ecgene algorithm was applied to nine organisms that include most of the important model organisms . \n this implies that we have the mrna model and the subcluster for each splice variant , in addition to the genome - based est clusters which are equivalent to the unigene clusters . \n the result is quite similar to the tigr gene indices that provides clustering and assembly for eukaryotic genomes ( 24 ) . \n however , the genome - based method is superior to the transcript - based method in terms of clustering accuracy with a limitation that it can be applied only to organisms with the genome map . \n we also provide the ecgene genome browser that shows the genomic alignment of mrna models and est sequences as custom tracks in the ucsc genome browser ( 25 ) . \n this allows users to access ample annotation tracks in the ucsc genome browser database , thereby facilitating the deduction of functional significance of each splice variant . \n table 1 compares the extent of as for the drosophila melanogaster genome in several databases including the flybase ( 26 ) , dedb ( 27 ) and asap ii . \n although the number of spliced genes is comparable between databases , ecgene shows that a significantly larger number of genes that are alternatively spliced . \n comparison of as statistics for the drosophila melanogaster genome current version of dedb is based on the flybase release 4.2.1 . \n genes and transcripts for the flybase were downloaded from the ucsc table browser for the dm2 genome . \n ecfunction was developed to effectively visualize the mrna structure and functional domains of alternatively spliced genes so that users can readily recognize any changes in the functional domains due to as . \n we improved the user interface by switching to java applets that allow both zooming and intron scaling in real time . \n variable intron scaling allows a seamless transition from the genome browser to the transcript or protein viewers . \n thus , the detailed gene structure as well as known functional features in the genomic , mrna and protein sequences can be readily visualized in a single user interface . importantly , \n candidate splicing - regulatory signals such as the ese ( exon splicing enhancer ) ( 5 ) and ess ( exon splicing silencer ) ( 6 ) can be visualized with the transcript structure , which would be valuable information in studying the mechanism of as . \n asviewer extends the features of ecfunction to support other gene models including refseq , ensembl and aceview . \n the transcript models can be readily compared using the detailed information for exons and introns available in the baloon help . \n we also provide a utility to print the genomic sequence in a similar way to the ucsc genome browser ( 25 ) . \n the character style and color can be specified for individual mrna models which would facilitate the detailed comparison of various predicted mrna models . \n we divided the previous version of ecexpression into two separate applications ( estexpress and sageexpress ) providing more specific and detailed information for each data type . \n estexpress analyzes 8600 human cdna libraries and illustrates the inferred gene expression in various tissues and cancers . \n an option of using non - normalized libraries is also available to obtain quantitative prediction ignoring ests from the normalized cdna libraries . \n sageexpress is substantially improved to provide diverse search options and detailed analysis on alternative tags . \n the search interface closely follows the widely used sagemap of ncbi and the sage genie at nci ( 28,29 ) . \n our tag - to - gene assignment is based on the mrna models of ecgene . \n we also provide information on alternative tags stemming from alternative polya tails , internal restriction sites and the single nucleotide polymorphisms ( snp ) . \n special efforts have been made to facilitate the examination of the differential expression which is an issue of major importance in the field of biomarker and drug target discovery . \n ecprofiler is a candidate gene search system that mines est clusters for genes with desired expression pattern and function . \n specifically , the expression ontology used for cdna library classification includes three categories organ / tissue / cell - type , pathology and developmental stage . both gene expression and function are implemented in ontology - based hierarchical structures . \n java implementation allows users to select any combination of nodes in all categories including choice of multiple nodes and subnode expansion . \n we also provide a powerful search engine and diverse filtering options such as motifs , number of ests and libraries and the specificities . \n degest is a database of deg , splice variants ( isoforms ) and as events covering 52 tissues and cancer types . \n chi - squared test was performed for est clusters and subclusters from ecgene clustering to identify deg and isoforms . \n the background distribution of statistical test can be either the ests in the gene or the whole dbest . \n this allows users to obtain transcripts with specific expression at the isoform level even though the gene itself has no specificity at all . \n as events are classified into exon - skipping , alternative donor / acceptor sites and intron retention . \n since sage is inherently an mrna - based technique , a gene may have several tags or a tag may correspond to several splice variants . \n ecprofiler and degsage run as server - client applications in real time , and the response may be slow . \n it is thus strongly recommended to specify the genomic region of interest within a chromosome in running ecprofiler . \n although we support the genome - wide search , it should be noted that this may take over 30 min . \n degest is a simple query system to the database that stores all results in pre - computed form for fast response . \n ecgene is an ongoing project with a collection of diverse databases and applications focused on as . \n various utilities to explore differential expression are available only for the human genome at this point . \n ecgene clustering and gene modeling will be applied to other species with a completed genome map as well . \n frequent update is critical , and we plan to update ests on a bimonthly basis . \n whole genome re - calculation takes extensive computation and will thus be updated once or twice a year depending on the amount of additional sequence data .", "role": "user" }, { "content": "ecgene ( ) was developed to provide functional annotation for alternatively spliced genes . \n the applications encompass the genome - based transcript modeling for alternative splicing ( as ) , domain analysis with gene ontology ( go ) annotation and expression analysis based on the est and sage data . \n we have expanded the ecgene 's as modeling and est clustering to nine organisms for which sufficient est data are available in the genbank . as for the human genome , \n we have also introduced several new applications to analyze differential expression . \n ecprofiler is an ontology - based candidate gene search system that allows users to select an arbitrary combination of gene expression pattern and go functional categories . \n degest is a database of differentially expressed genes and isoforms based on the est information . \n importantly , gene expression is analyzed at three distinctive levels gene , isoform and exon levels . \n the user interfaces for functional and expression analyses have been substantially improved . \n asviewer is a dedicated java application that visualizes the transcript structure and functional features of alternatively spliced variants . \n the sage part of the expression module provides many additional features including snp , differential expression and alternative tag positions .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: long - term follow - up studies on prevalence and incidence of multiple sclerosis ( ms ) for more than five decades are rare and has previously only been conducted in a 95-year follow - up study in olmsted county , minnesota , usa,1 and a 50-year follow - up study from hordaland county , western norway.2 follow - up on the incidence and prevalence of ms are important to study time trends that can contribute to analyses of environmental risk factors for ms and evaluate long - term benefit from disease - modifying treatment of the disease . \n previously , studies have reported rising prevalence of ms in norway.26 we have reported more than a sevenfold increase of ms prevalence ( 20 to 150 per 100 000 ) in hordaland county during 1953 to 2003 and an increasing incidence until 19781982 , followed by a high but stable incidence during the past 30 years.2 \n 7 the cause for the rise in prevalence is not fully understood and further investigation of whether the prevalence is still rising despite a stabilising incidence rate may increase our understanding of the disease . we , therefore , present data on a 60-year follow - up of incidence and prevalence of ms in hordaland county , western norway . \n we aimed to investigate the incidence of ms during 60 years from 1953 to 2013 and to estimate the prevalence rate of ms on 1 january 2003 and 2013 in hordaland county , western norway . \n hordaland county is located in western norway , between 59 30and 61 north , and is characterised by a long coastal line and inland area with numerous fjords , mountains and valleys . \n the population is mainly occupied in industry , including oil and gas production , commerce and service , fisheries and agriculture . \n the population in hordaland county increased from 317 384 on 1 january 1953 to 441 660 on 1 january 2003 and to 490 570 on 1 january 2013 . \n nearly half of the population lives in the administrative centre in the city of bergen and half of the population lives in small villages and rural areas . \n the migration rate ranged between 3.6% and 4.7% during 19732007 , and between 8.7% and 9.7% during 20082012 . during 20012009 , \n data files from previous epidemiological studies conducted during 19532003 were available2 \n 811 and patients records were reassessed according to mortality and place of residence on the prevalence day , 1 january 2013 . \n additional patients diagnosed after 2003 were identified from the patient records at the department of neurology at haukeland university hospital , bergen . the department was established in 1953 and is responsible for the neurological health service to residents in central and northern regions of hordaland county . \n owing to administrative changes , patients living in the southern regions of hordaland county have been referred to haugesund hospital during the last decade . \n thus , a total of 37 patients were identified from patient records at the department of neurology at haugesund hospital . \n all patients with ms in hordaland county are referred to these two neurological departments for diagnostic cerebrospinal fluid ( csf ) analysis and disease - modifying treatment . \n thus all patients diagnosed with ms in hordaland county are therefore most likely included in the sample . \n all patients were referred from general practice and private neurological practices to the hospital for diagnostic evaluation , including mri and csf analysis . \n statistics norway ( http://www.ssb.no ) and the national population registry provided data on the patient s place of residence at the time of disease onset and on prevalence day , as well as the total population in the county . \n all patient records were reviewed and scrutinised for data on gender , age , place and year of birth , course of disease at onset , year of disease onset and year of diagnosis . \n the clinical course at onset was classified as relapsing remitting or primary progressive ms . \n onset from 1953 were classified according to the diagnostic criteria of poser12 and onset from 2003 onwards were classified according to the revised ( 2010 ) diagnostic criteria of mcdonald.13 patients initially diagnosed with ms who later received another diagnosis were excluded from the study . \n patients with onset of ms during 19532013 while living in the county of hordaland , who had moved out of the county prior to the prevalence day were included in the incidence analyses , but excluded from the prevalence analyses . \n patients still alive and living in the county with ms onset prior to 1953 were excluded from the incidence analyses , but included in the prevalence analyses . \n similarly , all patients with onset outside hordaland county and who later immigrated were excluded from the incidence analyses , but included in the prevalence rates . \n when calculating the prevalence in 2013 , patients who had emigrated or died between 2003 and 2013 were excluded . \n the study was approved by the regional committee for medical and health research ethics in western norway . \n the prevalence rate was defined as the total number of patients with ms with definite13 or probable ms12 per 100 000 inhabitants living in hordaland county on 1 january 2013 . \n the crude annual incidence rate of ms was defined as the number of patients with onset of disease per 100 000 inhabitants per year . \n calculation of ci for prevalence and incidence as well as the test for trend in incidence were based on the assumption that the number of cases each year follows a poisson distribution . \n given the heavily skewed distribution , the mann - whitney test was used to test for difference in time from onset of disease to diagnosis . in the other bivariate comparison , \n one way analysis of variance was used to test difference in age at onset between different diagnostic classifications . \n the statistical software packages ibm spss statistics v.21 and statxact 9 ( cytel software , cambridge , massachusetts , usa ) were used to perform the analysis . \n data files from previous epidemiological studies conducted during 19532003 were available2 \n 811 and patients records were reassessed according to mortality and place of residence on the prevalence day , 1 january 2013 . \n additional patients diagnosed after 2003 were identified from the patient records at the department of neurology at haukeland university hospital , bergen . the department was established in 1953 and is responsible for the neurological health service to residents in central and northern regions of hordaland county . \n owing to administrative changes , patients living in the southern regions of hordaland county have been referred to haugesund hospital during the last decade . \n thus , a total of 37 patients were identified from patient records at the department of neurology at haugesund hospital . \n all patients with ms in hordaland county are referred to these two neurological departments for diagnostic cerebrospinal fluid ( csf ) analysis and disease - modifying treatment . \n thus all patients diagnosed with ms in hordaland county are therefore most likely included in the sample . \n all patients were referred from general practice and private neurological practices to the hospital for diagnostic evaluation , including mri and csf analysis . \n statistics norway ( http://www.ssb.no ) and the national population registry provided data on the patient s place of residence at the time of disease onset and on prevalence day , as well as the total population in the county . \n all patient records were reviewed and scrutinised for data on gender , age , place and year of birth , course of disease at onset , year of disease onset and year of diagnosis . \n the clinical course at onset was classified as relapsing remitting or primary progressive ms . \n onset from 1953 were classified according to the diagnostic criteria of poser12 and onset from 2003 onwards were classified according to the revised ( 2010 ) diagnostic criteria of mcdonald.13 patients initially diagnosed with ms who later received another diagnosis were excluded from the study . \n patients with onset of ms during 19532013 while living in the county of hordaland , who had moved out of the county prior to the prevalence day were included in the incidence analyses , but excluded from the prevalence analyses . \n patients still alive and living in the county with ms onset prior to 1953 were excluded from the incidence analyses , but included in the prevalence analyses . \n similarly , all patients with onset outside hordaland county and who later immigrated were excluded from the incidence analyses , but included in the prevalence rates . when calculating the prevalence in 2013 , patients who had emigrated or died between 2003 and 2013 were excluded . \n the study was approved by the regional committee for medical and health research ethics in western norway . \n the prevalence rate was defined as the total number of patients with ms with definite13 or probable ms12 per 100 000 inhabitants living in hordaland county on 1 january 2013 . \n the crude annual incidence rate of ms was defined as the number of patients with onset of disease per 100 000 inhabitants per year . \n calculation of ci for prevalence and incidence as well as the test for trend in incidence were based on the assumption that the number of cases each year follows a poisson distribution . \n given the heavily skewed distribution , the mann - whitney test was used to test for difference in time from onset of disease to diagnosis . in the other bivariate comparison , \n one way analysis of variance was used to test difference in age at onset between different diagnostic classifications . \n the statistical software packages ibm spss statistics v.21 and statxact 9 ( cytel software , cambridge , massachusetts , usa ) were used to perform the analysis . \n a total of 1558 patients had received a diagnosis of ms during 19532013 at the departments of neurology at haukeland university hospital and haugesund hospital . on prevalence day , \n 1 january 2013 , a total of 393 were deceased and 130 were not resident in hordaland county , leaving 1035 still alive and living in the county . \n a total of 493 ( 46.7% ) were classified as definite ms and 112 ( 10.8% ) were classified as probable ms according to poser criteria , and 430 ( 41.5% ) were classified as definite ms according to mcdonald criteria ( table 1 ) . demographic and clinical data for patients with multiple sclerosis on prevalence day , 1 january 2013 ms , multiple sclerosis . relapsing \n remitting course at disease onset was detected in 950 ( 91.8% ) and primary progressive course was found in 85 ( 8.2% ) . \n the mean age at onset was 31.8 years ; 31.7 years for patients with definite ms , 33 years for patients with probable ms according to poser criteria12 and 31.5 years for patients diagnosed with ms according to mcdonald s criteria13 ( p=0.97 ) . \n the female proportion was 63.8% and the f / m ratio was 1.8:1 on prevalence day , 1 january 2013 . \n the average time interval between onset and diagnosis of ms declined from median 21 ( range 940 ) years during 19531957 to 1.3 ( range 09 ) years during 20032007 , ( p<0.0001 ) in the prevalence cohort ( figure 1 ) . \n time delay from onset of disease until diagnosis of multiple sclerosis , in 5-year periods 19532013 . since the last follow - up,2 \n a total of 135 patients were included with onset prior to 2003 and diagnosed with ms during 20032013 . by including these patients and patients from haugesund hospital \n a total of 142 patients immigrated to hordaland during 20032013 of whom 112 had disease onset prior to 2003 . \n a total of 179 patients emigrated , of whom 49 were deceased by 2013 and 140 had disease onset prior to 2003 . on 1 \n january 2013 , the crude prevalence rate was 211.4 ( 95% ci 198.3 to 224.2 ) per 100 000 inhabitants , 270.9 ( 95% ci 250.6 to 292.3 ) for women and 151.8 ( 95% ci 136.8 to 167.9 ) for men . \n the peak age - specific prevalence appeared highest in women aged 5559 years and in men aged 6064 years ( figure 2 ) . \n age - specific prevalence rates of multiple sclerosis ( ms ) by gender on 1 january 2013 . compared with the 2003 follow - up,2 \n the prevalence is higher in older ages , age 6064 , in 2013 ( figure 3 ) . since 1957 \n , the prevalence in hordaland county increased from about 207 to 60 in 19839 and to 211/100 000 in 2013 . \n the 2003 prevalence increased from 150 reported in the previous follow - up2 to 191 in the present study . \n age - specific prevalence rates of multiple sclerosis ( ms ) in 2003 and 2013 . \n the annual incidence rate increased significantly during the study period analysed by 5-year intervals ( p<0.0001 ) from 1.9/100 000 inhabitants during 19531957 to 8.2 during 20032007 , followed by a decline to 5.2/100 000 during 20072013 . \n the incidence increased during the first 25 years ( p=0.00019 ) , until stabilising at a high level , ranging from 7.2 to 8.5 since 1978 ( p=0.20 ; figure 4 ) . \n the incidence increased in both genders and the overall sex ratio at onset did not significantly change during the study period , ranging from 1.2:1 to 1.8:1 ( p=0.381 ) . \n total crude annual incidence rates per 100 000 populations of multiple sclerosis ( ms ) with onset 19532013 in 5-year periods by gender . \n on 1 january 2013 , the crude prevalence rate was 211.4 ( 95% ci 198.3 to 224.2 ) per 100 000 inhabitants , 270.9 ( 95% ci 250.6 to 292.3 ) for women and 151.8 ( 95% ci 136.8 to 167.9 ) for men . \n the peak age - specific prevalence appeared highest in women aged 5559 years and in men aged 6064 years ( figure 2 ) . \n age - specific prevalence rates of multiple sclerosis ( ms ) by gender on 1 january 2013 . compared with the 2003 follow - up,2 \n the prevalence is higher in older ages , age 6064 , in 2013 ( figure 3 ) . since 1957 \n , the prevalence in hordaland county increased from about 207 to 60 in 19839 and to 211/100 000 in 2013 . \n the 2003 prevalence increased from 150 reported in the previous follow - up2 to 191 in the present study . \n age - specific prevalence rates of multiple sclerosis ( ms ) in 2003 and 2013 . \n the annual incidence rate increased significantly during the study period analysed by 5-year intervals ( p<0.0001 ) from 1.9/100 000 inhabitants during 19531957 to 8.2 during 20032007 , followed by a decline to 5.2/100 000 during 20072013 . \n the incidence increased during the first 25 years ( p=0.00019 ) , until stabilising at a high level , ranging from 7.2 to 8.5 since 1978 ( p=0.20 ; figure 4 ) . \n the incidence increased in both genders and the overall sex ratio at onset did not significantly change during the study period , ranging from 1.2:1 to 1.8:1 ( p=0.381 ) . \n total crude annual incidence rates per 100 000 populations of multiple sclerosis ( ms ) with onset 19532013 in 5-year periods by gender . \n we provide a 60-year follow - up of incidence and prevalence of ms in hordaland county , western norway , showing an increasing prevalence over the total period , but a stabilising incidence since 1978 . \n the prevalence increased 10-fold from 20/100 000 in 1963 to 211 ( 95% ci 198.3 to 224.2 ) per 100 000 in 2013 . \n the prevalence rate of 211/100 000 inhabitants was higher than a recent prevalence report of 186/100 000 in western norway.3 these diverging results are most likely a result of the limitation of using data from the national patients registry included in this recent nationwide study.3 previous norwegian studies using hospital records ( as in our study ) have reported ms prevalence rates of 170/100 000 in the south - eastern county of oslo,5 180/100 000 in the southern county of vest - agder6 and 185.6/100 000 in the eastern county of oppland.14 the prevalence rate in hordaland was , thus , similar to the latest report from the uk,15 but higher than reported in denmark,16 sweden17 and south east wales,24 and lower than reports from orkney , shetland and aberdeen city,36 all geographical areas close to hordaland county . comparing ms prevalence in hordaland county on prevalence day 1 january 2003 calculated in 20032 at 150/100 000 with the present study including follow - up until 2013 giving 191/100 000 , highlights the importance of the sample collection termination day , in order to calculate the valid prevalence . \n thus , the follow - up identified undiagnosed patients who had symptom onset prior to 1 january 2003 and illustrates that the prevalence is rising and most interestingly , that the date for study termination has a major impact on prevalence . \n the rise in prevalence is a consequence of the underestimated prevalence reported previously2 due to the time delay between onset and diagnosis . \n however , the time delay between onset and diagnosis is decreasing and consequently , the methodological issue of underestimated prevalence will probably be reduced in future studies . \n the incidence of ms in hordaland county has in previous studies increased from 0.2/100 000 in 1935,10 to 0.67/100 000 in 195111 and to 4.7/100 000 in 19781982.9 however , in the present long - term follow - up study , we also identified patients with disease onset years prior and thus higher incidence rates of 1.8/100 000 during 19531957 , 6.9/100 000 during 19781982 followed by a stable high level of approximately 78/100 000 during later years . \n thus , this tendency towards increase in incidence rates and prevalence rates of ms , presented in the repeated studies we provide in this paper , demonstrates the necessity of repeated surveillance to study valid time trends of ms incidence rates.23 the incidence of 8.5/100 000 inhabitants during 20032007 was similar to reports from previous reports on ms frequency in the southern6 and eastern14 parts of norway , confirming norway as a high risk area of ms without any evidence of a latitude gradient.3 we showed relatively stable incidence rates during the past three decades . \n however , since we reported the year - of - onset incidence , we observed a drop in rate probably due to delayed diagnosed cases for the latest 5-year period . \n the stable incidence rate was consistent with reports from olmstead county , minnesota , usa,1 and canada,18 but was in contrast to a downward incidence trend in the orkney islands,21 the faroe islands19 and in gothenburg,22 and the increased incidence trends in denmark,23 south east - wales,24 northeast ireland25 and another canadian population.26 the rise in prevalence of ms could partly be explained by the historical large increase in incidence of the disease until 19781982 . \n the early increase in prevalence might be explained by the increase in incidence the first 34 decades . \n also , owing to the onset of disease approach to incidence and prevalence estimations , and the time delay between onset and diagnosis , the prevalence has a delay up to about mean 79 years until the 1990 s and hence , increase in incidence is followed by a parallel increase in prevalence after almost a decade . \n because of the retrospective year of onset approach to incidence , the prevalence is catching up later . \n however , the continued recent increase in prevalence was not associated with a parallel increase in incidence . thus some of the increase in prevalence in recent years may be explained by improved diagnostics especially with the introduction of mri in the 1990s and the ability to identify younger patients and more benign disease living longer with the disease . \n the diagnostic criteria which has evolved from the early clinically based criteria12 to mri - grounded criteria,27 recently revised,13 have improved case ascertainment throughout the study period . \n systematic use of the revised diagnostic criteria of mcdonald with frequent use of repeated mris may lead to an increased diagnosis of patients with vague symptoms due to a benign disease . \n however , the diagnosing of more benign cases had probably a limited impact on prevalence , leaving increased survival as the most likely explanation to our findings . \n improved survival in ms , possible due to more frequent use of advanced disease - modifying therapies,28 was probably the most important factor related to the observed increase in prevalence . \n the importance of improved survival on the observed increase in prevalence was also supported by the shift towards an older age distribution of the present 2013 prevalence cohort compared with the prevalence reported in the 2003 study.2 a change in age distribution has also previously been reported from canada and the uk.15 \n 18 given the stable incidence rate , the higher ages in the cohort probably relate to improved survival either due to disease - modifying therapies or attributed to a general increase in life expectancy during the last decades . to determine the impact of treatment on survival , \n standardised mortality ratio calculations comparing ms to the general population in norway are needed.29 in contrast to several reports of increasing female to male ratios in ms24 \n 30 \n 31 the overall rate has been stable in hordaland county throughout the past six decades . \n our follow - up data showed a stable sex - ratio throughout the period and does not indicate gender - specific environmental risk factors which affect women more than men . \n explaining the stable incidence rates by changes in environmental risk factors for ms seems challenging . \n epstein - barr virus20 infections are stable , but cigarette smoking32 has declined during the last decades ( https://www.ssb.no/statistikkbanken/selectvarval/saveselections.asp ) and may have reduced the risk of ms . \n however , both consumption of dietary salt intake33 through processed food and use of sun - protection products,34 which may lead to reduced serum levels of vitamin d35 has increased in the past three decades . \n these may be two other factors associated with increased risk of ms . improved case ascertainment during the past six decades \n this was indicated by the steady decline in time delay between onset and diagnosis of ms . \n revised diagnostic criteria,13 focusing on active use of mri to define disseminated disease in time and space , combined with improved disease - modifying treatments has increased the diagnostic awareness among physicians and patients , and have therefore , important impact on this time - delay . \n our study provides comprehensive data on ms prevalence and incidence during 60 years and confirms norway as a high risk area for ms . the steady increase in ms incidence from the 1950s followed by a stable high incidence during the past three decades , \n calls for further studies focusing on environmental factors to explain this pattern . the tendency to identify more ms cases at follow - up , demonstrated in this study , indicates that previous studies with data collection close to the prevalence day might have underestimated the prevalence of ms . thus future studies on prevalence of ms \n should explore the occurrence of disease with a prolonged follow - up of several years after prevalence day in order to estimate the true prevalence of disease .", "role": "user" }, { "content": "objectiveinvestigate the incidence of multiple sclerosis during 19532013 and estimate the prevalence rate of ms on 1 january 2003 and 2013 in hordaland county , western norway.methodsall patients with onset of disease in hordaland 19532013 were identified in files from previous studies until 2003 and from patient records at the departments of neurology , haukeland university hospital and haugesund hospital during 20032013 . \n 1558 patients were assessed and 1402 of these were included , of whom 1035 were alive and living in hordaland at prevalence day 1 january 2013 . \n annual incidence rates were calculated for 19532013.resultson 1 january 2003 , the crude prevalence rate was 191/100 000 population and on 1 january 2013 , the crude prevalence rate was 211.4 ( 95% ci 198.3 to 224.2 ) per 100 000 ; 270.9 ( 95% ci 250.6 to 292.3 ) for women and 151.8 ( 95% ci 136.8 to 167.9 ) for men . \n prevalence peaked at ages 5559 years for women and 6064 years for men . \n the annual incidence rate increased from 1.9 ( 95% ci 1.2 to 2.6 ) per 100 000 during 19531957 to 7.2 ( 95% ci 6.0 to 8.5 ) during 19781982 and to 8.5 ( 95% ci 7.3 to 9.7 ) during 20032007 , thus indicating a stabilising incidence over the past 35 years . the female / male ratio ranged from 1.2:1 to 1.8:1 ( p=0.381 ) during the period.conclusionsstabilising rather than increasing incidence combined with the stable female / male ratio are indicative of non - fluctuating environmental factors in a geographical area otherwise characterised by lack of vitamin d effective sun exposure . \n the rising prevalence of ms could result from improved survival and follow - up methodology .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: hypoxia is a common feature of pathological conditions such as tissue ischemia and inflammation , as well as of the microenvironment of solid tumors . \n many cellular responses to hypoxia are thought to be mediated through changes in targeted gene expression . \n one major mechanism mediating cellular responses to hypoxia is the pathway of hypoxia inducible factor-1 ( hif-1 ) . \n hif-1 is a member of the basic helix - loop - helix / per - arnt - sim ( bhlh - pas ) family of proteins and binds to hypoxia - response elements ( hre ) in the promoters of target genes . \n hif-1 consists of an alpha ( hif-1 ) and a beta ( hif-1 ) subunit and activates the expression of at least 150 genes , which encode proteins that regulate cell metabolism , cell cycle , proliferation , apoptosis , autophagy , erythropoiesis , immune reactions , cytokine production , and angiogenesis as well as many other functions . \n , hif-1 is overexpressed as a result of intratumoral hypoxia and of genetic alterations affecting crucial oncogenes and tumor suppressor genes . \n similarly , hif-1 overexpression has been reported at both the protein [ 5 , 6 ] and the mrna [ 7 , 8 ] level in non - small - cell lung cancer ( nsclc ) patients with poor prognosis . in preclinical studies , \n inhibition of hif-1 activity has marked effects on tumor growth ; inhibitors of hif-1 have therefore attracted much attention as new therapeutic agents for patients with advanced malignancies , and several clinical studies have been performed . \n research has shown that hif-1 antagonists , such as ezn-2968 and px-478 , inhibit tumor cell proliferation in vitro and in vivo [ 9 , 10 ] . \n mirnas have emerged as a new class of noncoding genes that are involved in the regulation of cell proliferation , differentiation , and viability . \n mirnas are single - stranded small rna molecules of approximately 22 nucleotides that silence the expression of target genes either through mrna degradation or suppression of transcription [ 1214 ] . \n the mirnas that are regulated by hypoxia were examined in a 2007 study in which mir-210 was identified as the most consistently and robustly induced mirna in hypoxic cells and tissues . \n mir-210 expression is frequently elevated in a variety of cancers , including lung cancer [ 1620 ] . \n mir-210 is regulated by both hif-1 [ 2123 ] and hif-2 , and a recent study demonstrated that hif-1 directly binds to an hre on the proximal mir-210 promoter . \n mir-210 plays numerous crucial roles in the cellular response to hypoxia , such as in apoptosis [ 15 , 25 ] , angiogenesis , cell cycle regulation [ 24 , 27 ] , dna damage repair , mitochondrial metabolism [ 28 , 29 ] , and tumor growth . \n thus , mir-210 is thought to have essential roles in tumorigenesis along with hif-1. it has been reported that mir-210 overexpression is correlated with poor prognosis in breast [ 21 , 31 ] , pancreatic , and head and neck cancer patients . \n recently , two systematic reviews and a meta - analysis confirmed that mir-210 is useful for prediction of the survival of patients with various tumors , especially breast cancers [ 33 , 34 ] . \n however , these two studies did not include the outcome of patients with lung cancer . \n therefore , the prognostic impact of mir-210 in patients with lung cancer remains unclear . within this context \n , we analyzed mir-210 expression in nsclc patient samples , and showed that it could be a prognostic biomarker , especially for patients with adenocarcinoma . \n in total , 80 snap - frozen nsclc and 30 matched normal adjacent lung tissue samples were evaluated for mir-210 expression . \n these consecutive samples were obtained from patients who underwent surgical resection at the department of regenerative surgery , fukushima medical university , fukushima , japan , from january 2004 to december 2007 . \n the clinical characteristics of the 80 patients included in this study were typical of the characteristics of resected nsclc reported by the japan lung cancer society ( 2004 ) with respect to age , sex , histology , and pathological stage . \n none of the patients had received any previous anticancer treatment . ethical approval for analysis of samples and patient notes \n tumor types and stages were determined according to the 7th edition of union for international cancer control tnm classification . at the time of surgery , \n all tissue samples were immediately frozen in liquid nitrogen and stored at 80c until assay . \n all samples were analyzed histologically to assess the amount of tumor component ( at least 70% tumor cells ) and the quality of the material ( i.e. , absence of necrosis ) . \n these 80 cases consisted of 34 female and 46 male patients with a median age of 69 years ( range : 5185 ) , of which 54 were stage i cases , 12 were stage ii , and 14 were stage iii . \n the median observation period was 74.5 months ( range : 5117 ) , and the five - year survival rate was 62.4% . \n taqman - based quantitative real - time polymerase chain reaction ( qrt - pcr ) was applied to assess mirna expression levels in tissue samples . \n rna was extracted from snap - frozen lung tumor samples or normal lung tissue using the mirvana mirna isolation kit ( ambion , austin tx , usa ) . \n the quantity and quality of the extracted rna were determined spectrophotometrically by measurement of absorbance at 260 and 280 nm using a du530 uv - vis spectrophotometer ( beckman coulter , fullerton , ca , usa ) . samples with a 260/280 ratio of 1.80 or greater were used for analysis . \n mirna - cdna was synthesized from 5 ng of total rna using microrna - specific primers and the taqman microrna reverse transcription kit ( applied biosystems , foster city , ca , usa ) . \n the taqman microrna assays for mir-210 ( i d : 000512 ) and rnu6b ( i d : 001093 ) were purchased from applied biosystems . \n real - time pcr was performed in triplicate using a steponeplus real - time pcr system ( applied biosystems ) . for mirna assays , \n each pcr reaction contained 1.33 l reverse transcription product , 2taqman universal master mix , and 1 l taqman microrna assay . \n the 20 l reactions were incubated in a 96-well optical plate at 95c for 10 minutes , followed by 40 cycles at 95c for 15 seconds , and 60c for 60 seconds . \n changes in mirna expression between treatment and controls were determined using the 2 method , and results were normalized against rnu6b expression levels . for lung cancer samples , the controls consisted of the median of 30 normal lung tissues . \n correlations between the status of mir-210 expression and clinical characteristics were assessed using student 's t - test , pearson and spearman 's rank test , or the mann - whitney u test . \n kaplan - meier survival analysis was performed by applying the long - rank test to mir-210 expression and was stratified by median values and quartiles . disease - specific overall survival ( referred to as overall survival hereafter ) \n was defined as the time from surgery to last follow - up or time of nsclc - specific death . \n disease - free survival was defined as the time from surgery to the time of first evidence of radiographic metastatic disease . \n chicago , il , usa ) , and p values of < 0.05 were considered significant . \n to examine whether mir-210 expression correlates with clinical characteristics in patients with nsclc , we analyzed mir-210 expression of nsclc samples using qrt - pcr . for each sample , the data were normalized using rnu6b as a reference . \n the fold - change in mir-210 expression for each nsclc sample was calculated by comparison with the median of 30 normal control samples . \n patients with higher than the median expression level of mir-210 were defined as the high group of mir-210 expression . \n no significant association between the status of mir-210 expression and clinical characteristics such as sex , age , tumor size , histology , t factor , lymph node status , pathological stage , ly factor , or v factor was observed . \n however , we found that the status of mir-210 expression was significantly correlated with disease relapse ( p = 0.007 , pearson and spearman 's rank test ; table 1 ) . to confirm the correlation between mir-210 and prognosis \n , we analyzed the relationship between mir-210 expression and patient survival by performing kaplan - meier survival analysis , applying the long - rank test to mir-210 expression . \n the mir-210-high group showed significantly shorter disease - free survival than the mir-210-low group ( log rank chi - square = 11.225 , p = 0.001 ; figure 1(a ) ) . \n five - year disease - free survival was 37.5% in the mir-210-high group and 70.0% in the mir-210-low group . \n five - year overall survival was 47.5% in the mir-210-high group and 77.5% in the mir-210-low group ( log rank chi - square = 8.448 , p = 0.004 ; figure 1(b ) ) . \n although we found that mir-210 expression is a prognostic factor for disease - free survival and overall survival in nsclc patient samples ; the status of mir-210 expression was not significantly correlated with important clinicopathological factors . \n we therefore analyzed the correlation of each histological type with mir-210 expression and clinical characteristics . in 62 patient samples with adenocarcinoma , mir-210 expression \n was significantly correlated with lymph node status , pathological stage , ly factor , v factor , and disease relapse ( p = 0.018 , p = 0.003 , p = 0.0009 , p = 0.044 , and p = 0.002 , resp . , mann - whitney u test ) , whereas , in 18 patient samples with squamous cell carcinoma , it was not significantly correlated with any clinical characteristic ( table 2 ) . because mir-210 expression in adenocarcinoma patient samples was correlated with many important clinicopathological factors , we hypothesized that mir-210 expression would be more closely correlated with prognosis in adenocarcinoma patient samples than in nsclc patient samples . to test this hypothesis , \n kaplan - meier survival analysis was performed by applying the log - rank test to mir-210 expression of 62 patient samples with adenocarcinoma . \n mir-210 expression was a strong adverse prognostic factor for disease - free and overall survival when considered as a binary variable divided by median value ( log rank chi - square = 12.205 , p < 0.001 ; figure 2(a ) , log rank chi - square = 12.595 , p < 0.001 ; figure 2(b ) , resp . ) \n . however , in the 18 patient samples with squamous cell carcinoma , no significant correlation between mir-210 expression and disease - free or overall survival was observed . in the 62 lung adenocarcinoma \n patient samples , these relationships were also statistically significant when the patients were divided into quartiles on the basis of mir-210 expression levels ; mir-210 expression was an adverse prognostic factor for disease - free and overall survival ( log rank chi - square = 17.540 , p < 0.001 ; figure 2(c ) , log rank chi - square = 16.651 , p = 0.001 ; figure 2(d ) , resp . ) . \n we performed further studies of diagnostic factors of disease - free survival and overall survival , specifically in adenocarcinoma patients , using univariate and multivariate analysis . \n analysis , sex , tumor size , t factor , lymph node metastases , p - stage , ly factor , v factor , and mir-210 expression were significantly correlated with disease - free survival ( p = 0.024 , p = 0.034 , p = 0.036 , p < 0.0001 , p < 0.0001 , p = 0.001 , p = 0.004 , and p = 0.001 , resp . ) , whereas only age was not correlated with disease - free survival . \n furthermore , a cox multivariate analysis defined sex , ly factor , and mir-210 expression as independent prognostic factors for disease - free survival ( p = 0.008 , p = 0.021 , and p = 0.020 , resp . ) . \n moreover , in a cox univariate analysis , sex , tumor size , t factor , lymph node metastases , p - stage , ly factor , v factor , and mir-210 expression were also significantly correlated with overall survival ( p = 0.005 , p = 0.044 , p = 0.018 , p = 0.001 , p < 0.0001 , p = 0.004 , p = 0.032 , and p = 0.001 , resp . ) . \n furthermore , cox multivariate analysis showed that the usefulness of mir-210 as a prognostic factor for overall survival was marginal ( p = 0.057 ) . \n by univariate and multivariate analyses our study provides clear evidence that upregulation of mir-210 is a prognostic factor in patients with lung adenocarcinoma and is correlated with important clinicopathological factors including nodal involvement , pathological stage , lymphatic vessel invasion , and cancer relapse . \n recently , a meta - analysis of human lung cancer microrna expression profiling studies that compared cancer tissues with normal tissues showed that the top two most consistently reported upregulated micrornas were mir-210 and mir-21 . \n in addition , systematic reviews and meta - analyses of two studies confirmed that upregulation of mir-210 is predictive of poor survival of patients with various tumors , especially breast cancers [ 33 , 34 ] . \n however , these two systematic reviews did not include the outcome of patients with lung cancer . \n recently , eilertsen et al . reported a large - scale study of the prognostic role of mir-210 in nsclc . in that study , \n upregulation of mir-210 expression was a positive prognostic factor for disease - free survival in 335 nsclc patients . \n one reason for the differences between these results might be the different methods used , since our study assessed mir-210 expression using qrt - pcr , whereas the previous study used in situ hybridization . \n however , other previous studies strongly suggest that high expression of mir-210 could be a biomarker of bad prognosis in lung cancer . \n reported that mir-210 was significantly elevated in patients with advanced disease such as stages ii - iii disease compared with stage i a disease ( n = 20 ) . \n reported that mir-210 was significantly elevated in patients with stages iii - iv disease compared with stages i - ii disease ( n = 60 ) . \n furthermore , in the majority of the previous studies , mir-210 upregulation was significantly correlated with poor prognosis in patients with various cancers such as breast cancer , pancreatic cancer , head and neck cancer , colorectal cancer , and glioblastoma , though not renal cancer . \n further study is still needed to clarify the clinical impact of mir-210 as a prognostic factor in patients with nsclc . \n in vitro functional studies regarding mir-210 \n for example , zhang et al . found that mir-210 inhibits mnt , an antagonist of c - myc , and promotes cell proliferation in transformed cells such as colon and cervical cancer cells . \n however , giannakakis et al . found that mir-210 acts as a tumor suppressor by inhibiting cell proliferation via e2f3 regulation in ovarian cancer cell lines . \n it is unclear how to reconcile these paradoxical findings that mir-210 acts primarily as a positive or a negative regulator of proliferation . to understand these conflicting findings \n , we hypothesized that mir-210 may play various roles depending on the cancer type or histological subtype in which it is expressed . in the present study \n , we first analyzed the correlation of mir-210 expression in nsclc patient samples with each histological subtype of nsclc and with the clinical characteristics of patients with each subtype . \n we then focused on mir-210 expression in samples with histology specific for adenocarcinoma . in patients with adenocarcinoma \n , we clearly showed that mir-210 expression was strongly associated with important clinical parameters such as age , lymph node metastasis , pathological stage , ly factor , v factor , and relapse , while , in patients with squamous cell carcinoma , mir-210 was not associated with any clinical characteristic . in our study , \n the uniformly high expression levels of mir-210 in most squamous cell carcinomas meant that a prognostic impact of mir-210 on squamous cell carcinoma could not be determined . \n however , mir-210 could be a biomarker of adenocarcinoma because adenocarcinomas showed varying levels of mir-210 expression . \n in conclusion , this study demonstrated for the first time that mir-210 was correlated with poor prognosis in patients with nsclc , especially in lung adenocarcinoma . \n this evidence could contribute to biomarker studies in patients with lung adenocarcinoma . because this was an exploratory study and the sample size was very small , our results warrant further investigation and require independent validation . \n in particular , mir-210 levels in the plasma may have special prognostic significance since mirna has been shown to circulate in various body fluids in remarkably stable forms , resulting in the identification of novel noninvasive biomarkers for the diagnosis and prognosis of various cancers and other diseases [ 44 , 45 ] . \n based on these evidences , the prognostic signature of mir-210 in the plasma of nsclc patients should be examined in future studies .", "role": "user" }, { "content": "objective . \n the aim of this study was to investigate the prognostic value of microrna-210 ( mir-210 ) expression in patients with non - small - cell lung cancer ( nsclc ) . \n methods . \n we examined the mir-210 expression of samples of 80 patients , who underwent surgical resection at fukushima medical university from 2004 to 2007 , by using quantitative rt - pcr . \n the relationship between mir-210 expression and clinicopathological factors as well as histological subtype was statistically analyzed . results . \n mir-210 expression showed an inverse correlation with disease - free and overall survival in patients with nsclc . \n significant correlations were found between mir-210 expression and lymph node metastasis , late disease stages , and poor prognosis in patients with adenocarcinoma . \n multivariate cox analysis indicated that mir-210 expression was an independent prognostic factor for disease - free survival in patients with adenocarcinoma . \n conclusions . \n we showed that mir-210 may be a prognostic biomarker for patients with nsclc , especially for those with lung adenocarcinoma .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pancreatic pseudocysts are a collection of pancreatic secretions enclosed in fibrous tissue layer without a lining of epithelium and are usually located in the peripancreatic region.1 they may also rarely occur at unexpected and atypical locations such as the spleen , liver , mediastinum , pelvis and kidney depending upon the path taken by the activated pancreatic enzymes.12 intramural pseudocysts or pseudocysts occurring in the gastrointestinal tract ( git ) wall are very rare . they have been reported in the stomach ; duodenum and colon as occasional case reports.345678910111213 the exact mechanism of the formation of the pseudocysts in the git wall are not known . \n the possible mechanisms are suggested for their formation includes rupture of a pancreatic pseudocyst into the git wall , presence of a fistula between the pancreas and the alimentary tract and inflammation of heterotopic pancreatic tissue within the git wall.345678910111213 due to their rarity there are no guidelines on their management and most of the described cases in the literature have been either treated surgically or have spontaneously decompressed by rupturing into the git lumen.345678910111213 in this study , we describe the clinical and radiological characteristics of intramural pseudocysts in nine patients as well as our experience with endoscopic drainage and clinical outcome in these patients . \n we performed a retrospective analysis of patients with intramural pseudocysts seen at our institution over the past 6 years . \n all patients were symptomatic and had intramural pseudocysts with a well - formed wall , as documented on contrast enhanced computed tomography ( cect ) scan . \n the eus examination was performed with either a radial scanning echoendoscope ( eg-3670 urk radial echoendoscope , pentax inc . , \n tokyo , japan ) or a linear scanning echoendoscope ( eg-3870 utk linear echoendoscope , pentax inc . , \n tokyo , japan ) at 7.5 mhz . depending upon the symptoms , their control with the conservative medical therapy and procedural consent \n , the patients underwent eus guided single time aspiration of the pseudocyst or transmural drainage or transpapillary drainage or surgery . \n all symptomatic patients with less than 3 cm size pseudocysts were initially treated by a single time eus guided aspiration . following this , \n if the symptoms persisted or the pseudocysts recurred , patients were treated endoscopically or by surgery . \n all patients provided procedural informed consent at the time of eus examination or the endoscopic treatment . for eus \n eus guided single time aspiration was performed using a 19 g ( in the stomach ) or 22 g ( in the duodenum ) needle . \n endoscopic retrograde pancreatography was performed by standard technique using a tjf 145 or tjf 160 ( olympus optical co. ltd . \n , tokyo , japan ) side - viewing duodenoscope under conscious sedation using intravenous midazolam . \n pancreatic duct ( pd ) disruption was defined by free extravasation of contrast outside the pd system as seen on fluoroscopy after retrograde contrast injection of the main pd or dorsal duct ( in patients with pancreatic divisum ) . \n pd disruption was defined as complete when the main duct upstream to the disruption was not visualized on fluoroscopy and as partial when the main duct was visualized upstream from the site of disruption . after confirming the ductal disruption , \n a 5-f stent was placed across the papilla into the pd by advancing it over a 0.025- or 0.035-inch hydrophilic guide wire ( jagwire ) ( microvasive endoscopy , boston scientific corp . , natick , ma ) . \n therapeutic success was defined as symptomatic improvement with radiological resolution of all pseudocysts on cect scan and therapeutic failure was defined as persistence of pseudocyst at 8 weeks after endoscopic therapy or need for surgical or radiological intervention . \n following resolution , the stent was removed and a repeat pancreatogram was obtained to document healing of ductal disruption . \n a total of 9 patients with intra mural pseudocysts ( male : n = 8 ; mean age sd : 39.3 8.0 years ; age range : 24 - 54 years ) were seen by us over past 6 years ( tab . \n five patients had chronic pancreatitis and four patients had pseudocysts as sequelae of acute pancreatitis . \n majority of the patients ( 8/9 ; 89% ) had alcoholic pancreatitis ( chronic five and acute three ) and one patient also had associated complete pancreas divisum . \n the only female patient developed intramural pseudocyst as a consequence of acute gall stone pancreatitis . \n the pseudocysts were located in the wall of the second part of the duodenum in five patients , in the gastric wall in three patients and in the lower esophageal wall in one patient . \n the size of the pseudocysts ranged from 8 mm to 8 cm and 3/9 ( 33% ) patients had associated extra mural pancreatic pseudocysts . \n the profile of nine patients with intra mural pseudocysts all patients had abdominal pain on presentation . along with pain \n the patients with duodenal intramural pseduocysts also had symptoms suggestive of gastric outlet obstruction ( 3 ) or jaundice ( 1 ) . \n 1 and 2 ) . the patient with esophageal pseudocyst had thickening of the lower esophageal wall demonstrated on cect , but no definite pseudocyst could be visualized . however , eus demonstrated small intramural pseudocyst with wall thickening and loss of wall stratification ( fig . \n eus was also done in other seven patients and it could clearly demonstrate intra mural pseudocyst in all these seven patients ( figs . \n 1 , 2 and 4 ) . one of these patients had significant necrotic debris within the pseudocyst . \n ( a ) contrast enhanced computed tomography : large gastric intramural pseudocyst ( arrows ) ; ( b ) endoscopic image : submucosal bulge in stomach ; ( c ) endoscopic ultrasound : intra mural pseudocyst adherent to the muscularis propria ( arrow ) of the gastric wall ( a ) contrast enhanced computed tomography : gastric intra mural pseudocyst ; ( b ) endoscopic image : nodularity just below gastro esophageal junction ( arrows ) ; ( c ) endoscopic ultrasound ( eus ) intramural pseudocyst with gastric wall thickening and loss of wall stratification ; ( d ) eus guided aspiration of intra mural pseudocyst esophageal intra mural pseudocyst with wall thickening ( arrows ) duodenal intramural pseudocyst . \n muscularis propria seen around the cyst ( arrows ) one patient with a large duodenal pseudocyst causing gastric outlet obstruction preferred surgery and was treated surgically . \n all the remaining patients with duodenal pseudocysts and gastric outlet obstruction ( n = 2 ) underwent eus guided aspiration of the cyst with a 22 g needle and it revealed hemorrhagic fluid with markedly elevated amylase and lipase and normal carcino embryonic antigen levels . the cyst was completely emptied and a nasojejunal tube was placed for enteral feeding . the oral feeding was gradually reintroduced and once patient tolerated oral feeds well the nasojeunal tube was removed . \n the patient with obstructive jaundice underwent single time eus guided aspiration of the pseudocyst along with an insertion of a biliary stent that was removed after 4 weeks . \n one patient with small duodenal pseudocyst and pain only was successfully treated by medical management of oral enzymes , anti - oxidants and non - steroidal anti - inflammatory drugs . \n one of patients with gastric pseudocyst was treated with a combination of a single time eus guided aspiration along with minor papillotomy . \n the patient with esophageal pseudocyst was successfully treated with endoscopic transpapillary drainage using a 5 fr stent . \n this patient had dilated main pd along with partial disruption in the body of the pancreas . \n no significant complication of the procedure was noted in any of the patients . in a follow - up period of 2 months to 6 years , there has been no recurrence of symptoms in these successfully treated patients . \n intramural pseudocysts of the git are very rare and have been reported in the stomach , duodenum and colon.345678910111213 the rarity of intramural pseudocysts suggests that the git wall seems to be a relatively strong barrier to proteolytic activity of pancreatic enzymes . \n however , once the barrier is broken , the expansion of the intramural pseudocyst can lead to obstruction of the lumen and pain as was seen in the majority of our patients.345678910111213 with accumulation of pancreatic secretions these pseudocysts may extend within the wall or may rupture into the bowel lumen . \n intramural gastric pseudocysts are very rare and a literature review in 2003 revealed seven published cases of gastric intramural pseudocysts.14 the exact mechanism of formation of gastric pseudocyst is not known and the suggested possibilities include rupture of pseudocyst into the wall of the stomach , presence of pancreaticogastric fistula and pancreatitis occurring in heterotopic pancreatic tissue within the gastric wall.14 the endoscopic appearance of gastric intra mural pseudocyst resembles any gastric submucosal lesion as was in our cases ( figs . 1 and 2 ) . \n the cect is an useful investigation for confirming the cystic lesion of the lesion as well detecting features of acute or chronic pancreatitis.10111214 however , eus is the most useful investigation for evaluating patients with intramural pseudocysts . it can help in evaluating the contents of the cyst in detail , excluding significant necrotic debris and ascertain the relationship of the cyst with the various layers of the git wall.1015 aspiration of fluid high in amylase and lipase content is also a reliable modality for confirming the diagnosis of intra mural pseudocyst as was done in one of our case.9 the duodenal intramural pseudocysts have also been rarely reported and they usually occur posteriorly with the second part of the duodenum.345 this is because the posterior surface of the duodenum is in direct contact with the head of the pancreas with no barrier to prevent the digestive effects of pancreatic secretions.34 depending on the depth of the penetration these duodenal pseudocysts may develop between the serosa and muscularis , or between muscularis and mucosa . \n the differential diagnosis for such duodenal lesions includes a duodenal duplication cyst and a choledochocoele . \n careful history and investigations such as cect and eus can help in accurately diagnosing intra mural pseudocyst . in patients with duodenal intra mural \n pseudocysts the symptoms of gastric outlet obstruction dominate the clinical feature as was also in the majority of our patients.345 the role of endoscopy in diagnosing intra mural pseudocyst is limited as its endoscopic appearance resembles any duodenal submucosal lesion . \n cect is an useful investigation for diagnosis of duodenal intra mural pseudocysts and the ct characteristics of intramural involvement are an extension of the pseudocyst along the course of the duodenum and flattening of the pseudocyst wall at the border of the git lumen.4 however , like for gastric intra mural pseudocysts , eus is the most useful investigation for evaluating patients with duodenal intramural pseudocysts.5 due to their rarity , there is no consensus on the best approach for their management . majority of published cases either have been diagnosed at laparotomy or treated by surgical decompression.3456789101112131415 however , as the intramural pseudocysts are immediately adjacent to the git lumen , they can be effectively treated by endoscopic aspiration / drainage as was done in the majority of our cases . \n based on the study it can be concluded that intramural pseudocysts of the upper git are very rare and eus is the most useful investigational modality for diagnosing and treating them . \n gastric intramural pseduocysts frequently present with abdominal pain and symptoms of gastric outlet obstruction dominate the clinical presentation of patients with duodenal intramural pseudocysts .", "role": "user" }, { "content": "background : intramural pseudocysts or pseudocysts occurring in the gastrointestinal tract ( git ) wall are rare and there is a paucity of data on their clinical features and management.patients and methods : we retrospectively evaluated patients with intramural pseudocysts seen at our institution over the past 6 years . intramural location was confirmed either on surgery or endoscopic ultrasound ( eus ) . \n depending upon the symptoms , their control with the conservative medical therapy and procedural consent , the patients underwent eus guided single time aspiration of the pseudocyst or transmural drainage or transpapillary drainage or surgery.results:a total of 9 patients with intra mural pseudocysts ( male : \n n = 8 ; mean age sd : 39.3 8.0 years ; age range : 24 - 54 years ; five patients having chronic and four patients having acute pancreatitis ) were studied . \n the pseudocysts were located in the wall of the second part of the duodenum in five patients , in the gastric wall in three patients and in the lower esophageal wall in one patient . \n the size of the pseudocysts ranged from 8 mm to 8 cm and 3/9 ( 33% ) patients had associated extra mural pancreatic pseudocysts . \n all patients had abdominal pain on presentation . \n along with pain the patients with duodenal intramural pseduocysts also had symptoms suggestive of gastric outlet obstruction ( 3 ) or jaundice ( 1 ) . \n the patient with esophageal intramural pseudocyst had dysphagia along with abdominal pain . \n majority of these patients could be successfully treated endoscopically with no significant complications.conclusions:intramural pseudocysts of the upper git are very rare and eus is a useful investigational modality for diagnosing and treating them .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the ubiquitin - proteasome system ( ups ) is the major pathway for protein degradation in eukaryotic cells , regulating most cellular processes , including cell division , signal transduction , and development ( finley , 2009 ) . before degradation \n , proteins are conjugated to ubiquitin chains that act as recognition signals for the 26s proteasome , a large proteolytic complex that degrades substrate proteins ( finley , 2009 ) . \n although proteasome function has been extensively studied , our knowledge of how this particle recognizes ubiquitylated substrates remains incomplete . since the identification of the first intrinsic proteasomal ubiquitin receptor , rpn10 , studies have identified a group of so - called ubl - uba domain proteins that act as transient , extrinsic proteasome substrate receptors ( deveraux et al . , 1994 ; \n seeger et al . , 2003 ; su and lau , 2009 ; wilkinson et al . , \n more recently , an additional novel intrinsic receptor , rpn13 , was identified ( husnjak et al . , 2008 ; \n however , budding yeast cells , deleted for the ubl - uba domain proteins and mutated in both the rpn10 and rpn13 ubiquitin - interacting regions , are still viable ( husnjak et al . , 2008 ) . \n moreover , ubiquitin conjugates still bind to 26s proteasomes lacking the ubiquitin - interacting regions of rpn10 and rpn13 ( peth et al . , 2010 ) . \n as proteasome function is essential , at least one additional ubiquitin receptor remains to be discovered ( saeki and tanaka , 2008 ) . \n here , we present structural , biochemical , and genetic data that the disordered and multifunctional protein dss1 ( known as sem1 in budding yeast ) , is another ubiquitin - binding subunit of the 26s proteasome . \n in fission yeast , substrate recognition by the 26s proteasome is accomplished by two intrinsic proteasome subunits , rpn10 and rpn13 , and two extrinsic ubl - uba domain proteasome cofactors , rhp23 and dph1 ( finley , 2009 ; hartmann - petersen et al . , 2003 ; sakata et al . , 2012 ; wilkinson et al . , 2001 ) \n studies have shown these receptors to be functionally redundant ( husnjak et al . , 2008 ; peth et al . , 2010 \n it was previously demonstrated , both in budding and fission yeast , that the gene for the ubl - uba domain protein rad23 ( rhp23 in fission yeast ) functionally overlapped with the gene encoding the 26s proteasome ubiquitin receptor subunit rpn10 . \n specifically , only a double deletion mutant ( rpn10rhp23 ) displayed severe growth defects ( wilkinson et al . \n in addition , rhp23 variants unable to bind ubiquitin or the proteasome could not rescue the growth defects of the double mutant , implying that substrate recognition was at least partly responsible for the observed phenotypes ( wilkinson et al . , 2001 ) . \n therefore , we asked whether lack of the ubiquitin- or proteasome - binding functions of rpn10 contribute to the severe phenotype of the rpn10rhp23 double mutant . to this end , we cloned constructs of rpn10 that lacked the ubiquitin interaction motif ( uim ) , rpn10uim , or the n - terminal proteasome - binding region , rpn1082 ( figure 1b ) ( seeger et al . , 2003 ) . \n these strains were then crossed , and the ability of the rpn10 constructs to rescue the growth defects of the rpn10rhp23 double mutant were assayed by plating and selecting for the relevant spores . \n surprisingly , this revealed that the rpn10uim construct rescued the growth defects as efficiently as the full - length construct ( figure 1c ; figure s1a available online ) , while the rpn1082 proteasome - binding mutant did not ( figure 1c ) . \n this implies that loss of rpn10 ubiquitin binding does not contribute to the severe phenotype of the rpn10rhp23 double mutant . the fact that the rhp23rpn10uim mutant is viable is consistent with previous work , suggesting that the vwa domain has some unknown facilitator function in the ups ( mayor et al . \n , 2007 ; peth et al . , 2010 ; verma et al . , \n 2004 ) and shows that other proteasomal substrate receptors functionally overlap with rpn10 and rhp23 . \n currently , the remaining known receptors and shuttle proteins are the ubl - uba protein dsk2 ( dph1 in fission yeast ) and rpn13 ( rpn13a and rpn13b in fission yeast ) that associate with both ubiquitin and the proteasome . to test these candidates genetically \n , null mutants were constructed for each and subsequently crossed to create the appropriate genetic backgrounds . \n we postulated that , if either of these receptors functionally overlapped with rpn10 and rad23 , then deletion of its gene in the rpn10rhp23 background should prevent rescue of the rpn10rhp23 phenotype by the rpn10uim construct . \n surprisingly , the rpn10uim construct once again rescued the dph1rpn10rhp23 triple ( figure s1b ) and rpn13arpn13brpn10rhp23 quadruple deletion mutants ( figure s1c ) . \n this implies that neither dph1 nor rpn13 were responsible for the rescue of the rpn10rhp23 growth defects by rpn10uim . \n such candidates should either be proteasome subunits or proteasome - associated proteins and would be expected to display synthetic phenotypes with mutants in rpn10 or rhp23 . \n when searching the saccharomyces genome database , we found that the proteasome subunit , called sem1 in budding yeast ( funakoshi et al . \n 2004 ) and dss1 in humans and fission yeast ( joss et al . , 2006 ) , fulfills these criteria . to assess if dss1 functions as a proteasomal ubiquitin receptor , we first tested its ability to interact directly with ubiquitin chains . \n we performed an in vitro ubiquitin - binding assay using glutathione s - transferase ( gst)-dss1 and k48- and k63-linked ubiquitin chains . \n indeed , under these conditions , gst - dss1 efficiently interacted with both k48 and k63 ubiquitin chains , while gst alone did not ( figure 2a ) . in general , \n ubiquitin receptors recognize ubiquitin via a conserved hydrophobic patch around ile44 ( husnjak et al . , 2008 ) . \n to test if dss1 also binds ubiquitin via this hydrophobic area , we assayed the ability of dss1 to interact with the i44a ubiquitin mutant . compared to wild - type ubiquitin that clearly interacted with dss1 , \n i44a ubiquitin did not efficiently associate with dss1 or rhp23 ( figure 2b ) . \n this suggests that the ubiquitin ile44 patch is important for efficient dss1 and rhp23 binding . scrutinizing \n the dss1 sequence left us unable to identify any resemblance to known ubiquitin - binding sites ( ubss ) or domains ( husnjak and dikic , 2012 ) . \n structural prediction analyses of dss1 suggested it to belong to the intrinsically disordered proteins ( idps ) ( figure 2c ) ( uversky , 2011 ) . \n pondr ( obradovic et al . , 2003 ) , but not iupred ( dosztnyi et al . , \n 2005 ) , predicted that a short stretch in the dss1 c terminus is structured ( figure 2c ) . to probe this further , we analyzed dss1 by heteronuclear nuclear magnetic resonance ( nmr ) spectroscopy . assigned c chemical shifts relative to random coil shifts ( figure 2d ) ( kjaergaard et al . , 2011 ) , combined with a low - dispersion n , h - heteronuclear single quantum correlation ( hsqc ) spectrum ( figure 2e ; figure s2a ) , conclusively identified dss1 as intrinsically disordered with a single , transiently populated helix from f55 through k66 . \n successive addition of excess ubiquitin and analysis by nmr uncovered two distinct ubss , identified from chemical shift perturbation analyses . \n titration analyses with increasing amounts of ubiquitin disclosed the strongest binding to ubiquitin by binding site i ( ubs - i ) , which is located at d38d49 ( dissociation constant , kd , = 50 30 m ) and disclosed the second and weakest site , ubs - ii , located at d16n25 ( apparent kd > 1 mm ) ( figure 2f ; figures s2b and s2c ) . \n these ubss are conserved and located in the disordered region of dss1 ( figure s3 ) . \n notably , both sites have a similar sequence , characterized by a series of hydrophobic residues flanked by acidic residues ( figure s3 ) . \n we subsequently mapped the corresponding interaction surface on ubiquitin by nmr , using c , n - labeled ubiquitin ( figure 3 ) . \n the perturbations of peak intensities of ubiquitin , imposed by addition of dss1 ( figure 3a ) , mapped consistently to the surface - exposed common hydrophobic binding surface of ubiquitin involving the sheet and the hydrophobic residues i13 , l69 , and i44 ( figures 3b3d ) but is also extended to the c terminus , resembling the binding site exploited by the e2 ubiquitin - conjugating enzyme cdc34 ( arrigoni et al . \n , 2012 ; choi et al . , 2010 ; spratt and shaw , 2011 ) . \n several positively charged residues located on the same surface were also significantly perturbed , whereas no perturbations were seen on the opposite face of ubiquitin ( figure 3c ) . \n a representation of the electrostatic surface of ubiquitin revealed a tripartite binding site of a hydrophobic patch flanked by two positively charged regions ( figures 3e and 3f ) . \n this directly mirrors the architecture of the ubss identified in dss1 ( figure s3 ) . \n moreover , the size of the interaction surface and the length of each ubs in dss1 strongly suggest that the two ubss bind independently to each their ubiquitin moiety . of note , we observe that , depending on the linkages , there are unequal distances from the dss1 binding site on ubiquitin to a second dss1 binding site on a linked ubiquitin , suggesting that dss1 may express a preference in the selection of different lysine - linked ubiquitin chains . as expected from the nmr data , mutation of either ubs - i ( l40a , w41a , w45a ) or ubs - ii ( f18a , f21a , \n w26a ) clearly reduced binding to ubiquitin , and no ubiquitin binding was observed for dss1 mutated at both sites ( figure 4a ) . \n consistent with ubs - i being the stronger of the two binding sites , mutation of this site also had a greater effect on ubiquitin binding ( figure 4a ) . for better understanding of the functional relevance of dss1 and the importance of its ubiquitin - binding activity , \n a range of yeast mutants was created and tested in growth assays under various conditions . \n expression of dss1 or any of the dss1 variants did not affect cell growth of wild - type cells ( figure s4a ) , whereas deletion of the dss1 gene resulted in a growth defect that was especially pronounced at higher temperatures ( figure 4b ) . \n when introducing the dss1 variants into the dss1 strain , we observed that cells expressing dss1 , mutated at both ubs - i and ubs - ii , displayed a significant growth defect ( figure 4b ) , while each of the single ubs mutants or wild - type human dss1 only partially restored growth ( figure 4b ) . \n similar effects were observed on media containing canavanine ( figure s4b ) , a drug that inhibits protein folding and induces cell stress . \n notably , these genetic effects correlated with the cellular accumulation of ubiquitin - protein conjugates . \n thus , ubiquitin - protein conjugates accumulated in the dss1 strain , and this accumulation was not affected by ectopic expression of dss1 mutated in both ubs - i and ubs - ii ( figure 4c ) . \n expression of either dss1 ubs - i or dss1 ubs - ii mutants partially reduced the level of ubiquitin conjugates in the dss1 strain , while expression of wild - type s. pombe dss1 or human dss1 fully reduced ubiquitin - protein conjugates to wild - type levels ( figure 4c ) . \n we next analyzed if any of the dss1 mutants were also compromised in proteasome binding . \n we found that wild - type dss1 , as well as individual dss1 ubs - i and dss1 ubs - ii mutants , all efficiently coprecipitated 26s proteasomes ( figure 4d ) . \n however , dss1 mutated in both ubs - i and ubs - ii failed to interact with 26s proteasomes ( figure 4d ) . \n hence , the strong phenotype of dss1 mutated in both ubs - i and ubs - ii is likely caused by both loss of ubiquitin binding and loss of proteasome binding . \n in contrast , the intermediate phenotypes of dss1 with single mutations in ubs - ii or , in particular , in ubs - i can likely be attributed to a reduced ubiquitin binding since they still bind to the proteasome . \n recently , dss1 was shown to function in proteasome assembly ( tomko and hochstrasser , 2014 ) . to assess the importance of dss1 on overall proteasome integrity , we isolated 26s proteasomes from a dss1 strain and analyzed them biochemically . \n we found that proteasomes lacking dss1 still efficiently interacted with polyubiquitylated proteins ( figure s4c ) and were proteolytically active ( figure s4d ) . \n this suggests that , structurally , 26s proteasomes are not strongly affected by loss of dss1 and that the contribution of dss1 to the proteasomal substrate binding capacity in vitro is lower compared to the already known substrate receptors . \n this agrees with previous in vitro activity studies of purified proteasomes , lacking all known ubss , which suggest the existence of an additional low - affinity substrate binding site ( peth et al . , \n 2010 ) . to further rule out that the observed phenotype of the dss1 null mutant was not caused by a general loss of 26s proteasome integrity \n , we performed label - free quantitative mass spectroscopy , comparing 26s proteasomes purified from wild - type , rpn10 , rpn10uim , and dss1 cells ( figures s4e and s4f ) . in agreement with data from budding yeast ( bohn et al . \n , 2013 ; tomko and hochstrasser , 2014 ) , loss of dss1 caused a modest reduction in 26s proteasome integrity ( figures s4e \n mutation of the dss1 ubs - i only slightly reduced the amount of rpn10 in the 26s proteasome ( figure s4h ) . \n loss of rpn10 was more disruptive , with the amounts of 26s proteasomes being reduced to around 10% of that found in wild - type cells ( figures s4e \n collectively , these data imply that ubiquitin binding is important for the function of dss1 in the 26s proteasome in vivo and that dss1 could be responsible for the viability of the rhp23rpn10uim strain ( figure 1c ) . \n this being the case , then loss of dss1 should impart growth defects in the rhp23rpn10uim strain . \n indeed , spore viability of the dss1rhp23rpn10uim strain was reduced compared to cells expressing the full - length rpn10 protein ( figures 4e and 4f ) . when introducing wild - type dss1 and the dss1 ubs - i and ubs - ii mutants in the dss1rhp23rpn10uim strain , we found that neither the dss1 ubs - i mutant nor the dss1 ubs - ii mutant was able to fully restore growth of the dss1rhp23rpn10uim strain ( figure 4f ) , suggesting that the ubiquitin - binding function of dss1 , described here , is important for proteasomal function and cell viability . \n in this article , we demonstrate that dss1 has a previously uncharactized function as a ubiquitin - binding protein of the 26s proteasome : unlike other receptors , dss1 interacts with ubiquitin via an unstructured ubs . \n given the highly conserved nature of the ups and the dss1 gene itself ( 47% identity between fission yeast and human dss1 ) , and given that human dss1 complements the phenotype of a fission yeast dss1 mutant , we propose that dss1 acts as a ubiquitin receptor in all eukaryotes . \n most ubiquitin - binding proteins have well - defined and structured ubiquitin - binding domains or small motifs ( husnjak and dikic , 2012 ) . \n this is in sharp contrast to proteins interacting with the ubiquitin - like modifier sumo that , in general , associate via short motifs located in intrinsically disordered regions ( vogt and hofmann , 2012 ) . \n we suspect that other ubiquitin - binding proteins may interact by a similar mechanism . in general , \n disordered proteins are not well conserved in sequence ( uversky , 2011 ) , and by homology searches , we have not been able to identify other proteins containing any dss1-like ubss . however , we did note some similarity between the sites in dss1 and the ubss found in the e2 - 3r family of e2 ubiquitin - conjugating enzymes ( arrigoni et al . , 2012 ) such as cdc34 ( choi et al . , 2010 ) . \n intriguingly , a recently described disordered region of cdc34 binds an area on ubiquitin similar to the area we identified for dss1 ( arrigoni et al . , 2012 ; \n , 2010 ; spratt and shaw , 2011 ) , suggesting that these binding regions are required to be unstructured . \n previous studies in budding yeast have shown that cells lacking all known proteasomal ubss still remain viable ( husnjak et al . , 2008 ) . \n the data presented here reveal that the same is true for fission yeast , but this viability , at least in part , depends on dss1 . \n what happens to ubiquitylated substrates after reaching the 26s proteasome , but prior to or during degradation , is still an open question . \n for instance , we know little about the events taking place during the initial substrate capture by rpn10 and rpn13 , localized at the tip of the regulatory particle , and the translocation to the central atpase ring . \n it is possible that substrates are handed over from the outer receptors to an inner receptor more proximal to the atpase ring . \n the localization of dss1 near the atpase pore and the deubiquitylating subunit rpn11 ( bohn et al . , 2013 ) \n the disordered and flexible nature of dss1 could then allow for interaction with substrates presented in various orientations . \n however , like most disordered proteins ( uversky , 2011 ) , dss1 is multifunctional , even within the 26s proteasome , where it appears to act both structurally and functionally . \n recently , budding yeast sem1 was shown to play an important role in proteasome assembly ( tomko and hochstrasser , 2014 ) . \n specifically , sem1 catalyzes incorporation of subunits rpn3 and rpn7 into the 19s regulatory complex through sites that overlap with ubs - i and ubs - ii in fission yeast dss1 . \n although our proteomic analyses of dss1 26s proteasomes do not indicate that the level of rpn3 or rpn7 is reduced compared to that of other subunits of the lid complex , we also noted that dss1 , mutated in both ubs - i and ubs - ii , is not incorporated into 26s proteasomes . \n notably , the dss1 mutant in ubs - i alone was still incorporated into 26s proteasomes but continued to display the temperature - dependent growth defect and ubiquitin - conjugate stabilization . \n this suggests that the phenotypes connected with the dss1 ubiquitin - binding activity is limited to that of the dss1 ubs - i , which has a much greater affinity for ubiquitin compared to ubs - ii . \n however , dss1 also has proteasome - independent functions , including associating with dna repair proteins ( yang et al . , 2002 ) and the transcription - export complex ( ellisdon et al . , 2012 ; faza et al . , \n we speculate that the ubiquitin - binding activity of dss1 may also play a functional role for these cellular processes . in conclusion , \n our studies suggest the intrinsically disordered protein dss1 as a ubiquitin receptor for the 26s proteasome in fission yeast . \n since dss1 is phylogenetically conserved , we propose that dss1 acts as a ubiquitin receptor in all eukaryotes . \n the strains were all derived from the s. pombe wild - type heterothallic 972h and 975h . \n standard genetic methods and media were used ( moreno et al . , 1991 ) . \n the plasmids used for expression of rpn10 and dss1 in fission yeast were prep41 carrying the budding yeast leu2 gene for selection and the nmt41 promoter or the pdual vector carrying ura4 for selection and the nmt1 promoter ( matsuyama et al . , 2004 ) . \n antibodies to mts4/rpn1 have been described elsewhere ( wilkinson et al . , 2001 ) . \n other antibodies were commercially available : flag ( sigma ) , green fluorescent protein ( gfp ; sigma ) , tubulin ( abcam ) , 20s proteasome mcp231 ( enzo ) , t7 ( bethyl ) , and ubiquitin ( dako ) . \n the 26s proteasomes , flag - tagged on mts4 ( rpn1 ) , were purified as described elsewhere ( verma et al . , 2002 ) . \n the proteolytic activity of affinity - purified 26s proteasomes with or without dss1 was measured in the presence or absence of 5 m of the proteasome inhibitor bortezomib ( lc laboratories ) using the suc - llvy - amc substrate ( enzo ) as described elsewhere ( groll et al . , 2006 ) . \n all dss1 proteins were expressed in escherichia coli bl21 ( de3 ) from the pgex6p1 or pdest15 vectors by standard methods . \n harvested cells were lysed by sonication in a buffer containing 12.5 mm tris - hcl , ph 7.5 , 37.5 mm nacl , 1 mm phenylmethylsulfonyl fluoride and complete mini protease inhibitor tablets ( roche ) . \n following centrifugation at 13,000 g , the cleared lysates were tumbled with glutathione - sepharose beads ( ge healthcare ) for 1 hr at 4c and extensively washed with the lysis buffer . \n coprecipitation assays were performed as described elsewhere ( wilkinson et al . , 2001 ) . for the ubiquitin precipitation studies , \n 3 g of k48- and k63-linked ubiquitin chains ( boston biochemicals ) were used per precipitation in 100 l buffer a , containing 12.5 mm tris - hcl , ph 7.5 , 37.5 mm nacl . \n the protein / bead ratio was adjusted to about 1 mg / ml , and 10 l of beads were used per assay . after 2 hr of tumbling at 4c , the beads were washed twice with 1 ml of buffer a with 0.5% triton x-100 and once with buffer a. bound protein was eluted by boiling with sds sample buffer . \n some ubiquitin blots were boiled for 30 min after transfer to enhance reactivity and blocked with 5% bsa in pbs . \n the t7-tagged sic1-py was purified and in vitro ubiquitylated as described elsewhere ( kriegenburg et al . , 2008 ) . \n k.p . performed the protein purification experiments in figures 2a , 2b , and s4 .", "role": "user" }, { "content": "summarythe ubiquitin - proteasome system is the major pathway for protein degradation in eukaryotic cells . \n proteins to be degraded are conjugated to ubiquitin chains that act as recognition signals for the 26s proteasome . \n the proteasome subunits rpn10 and rpn13 are known to bind ubiquitin , but genetic and biochemical data suggest the existence of at least one other substrate receptor . here \n , we show that the phylogenetically conserved proteasome subunit dss1 ( sem1 ) binds ubiquitin chains linked by k63 and k48 . \n atomic resolution data show that dss1 is disordered and binds ubiquitin by binding sites characterized by acidic and hydrophobic residues . \n the complementary binding region in ubiquitin is composed of a hydrophobic patch formed by i13 , i44 , and l69 flanked by two basic regions . \n mutations in the ubiquitin - binding site of dss1 cause growth defects and accumulation of ubiquitylated proteins .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acute uncomplicated cystitis ( auc ) is the most commonly encountered bacterial infections in healthy women . \n the current management of auc is usually a short course of empirical treatment with co - trimoxazole or fluoroquinolones in areas where resistance to co - trimoxazole is prevalent . \n this antibiotics are tried without performing a urine culture or susceptibility testing to guide therapy ( 1 ) . \n however , there has been a significant increase in resistance of escherichia coli strains to antimicrobials worldwide ( 2 - 8 ) . \n the adverse consequences of using antimicrobials to treat a strain that is resistant to these antimicrobials may be a delay in resolution of the infection and the consequently increased social costs such as days lost from work or school for some women ( 9 ) . \n fluoroquinolone or co - trimoxazole resistance by e. coli has been detected at a high rate in the asia - pacific region in recent years ( 2 - 5 ) . \n moreover , some countries in asia do not currently consider fluoroquinolone as a first line treatment for recurrent cystitis ( 3 , 6 ) . \n consequently , new therapeutic options in the setting of high resistance against fluroquinolone need to be found . \n therefore , the clinicians in local areas , before deciding on the best empirical regimen to use for auc in this era of increased drug resistance , they must know the patterns of drug resistance and assess the risk factors for drug resistance in their local area . however , there are not many studies on the drug resistance pattern of auc in korea ( 2 , 3 ) . \n the designs of the previously reported papers in korea were retrospective studies and they were regionally confined as well . \n additionally , the available studies were also a mix of data from patients with uncomplicated and complicated cystitis . \n further , much of the data about antimicrobial resistance has often have come from western countries . \n unfortunately , this western data may not accurately reflect the drug resistance patterns in asia because the patterns may be different among different countries ( 2 , 5 , 6 ) . \n in this study , we described the four key antimicrobials susceptibility patterns of the e. coli strains from auc patients who were prospectively collected from 22 different medical centers in korea . \n we also assessed the risk factors for antimicrobial - resistant uropathogenic e. coli , and particularly their associations with fluoroquinolone resistance . \n all the female patients between 18 and 65 yr old and who presented with symptoms of dysuria , urgency , frequency or a combination of these between may and october , 2006 were included in this study . \n the women who had received antimicrobial agents in the 4 weeks previous to the study and those who were hospitalized were also excluded . \n a clean - catch midstream urine sample was tested by microscopy for the presence of leukocytes , and then it was sent to a central laboratory for culture and sensitivity testing . only one specimen per patient \n the e. coli included in the study were from cultures yielding 10 colony forming units / ml and the urine displayed pyuria ( 2 ) . in total , 225 \n e. coli isolates were prospectively and consecutively collected from the urine samples of the female outpatients with uncomplicated cystitis in 22 hospitals of korea . in seoul , \n 102 samples were collected from 4 hospitals . in chungcheong - do and jeolla - do , \n the minimum inhibitory concentration ( mic ) of ciprofloxacin resistance was determined by the agar dilution method on mueller - hinton agar ( becton dickinson and company , franklin lakes , nj , usa ) , as recommended by the nccls ( 3 ) . \n the number of cystitis episodes was classified into none , one and two recurrences in the previous year ( 2 ) . \n for easily handling of the data , we placed the intermediate resistant e. coli isolates into the resistant categories of each antimicrobial . \n this study was approved by the institutional review board of the dankook university medical center ( approval number : 0911 - 078 ) . \n statistical analysis was performed by using fisher 's exact test , chi - square tests , student 's t - tests and the mann - whitney test . \n multiple variables were assessed as predictors of the categorical outcomes by multivariable logistic regression analysis . \n all the female patients between 18 and 65 yr old and who presented with symptoms of dysuria , urgency , frequency or a combination of these between may and october , 2006 were included in this study . \n the women who had received antimicrobial agents in the 4 weeks previous to the study and those who were hospitalized were also excluded . \n a clean - catch midstream urine sample was tested by microscopy for the presence of leukocytes , and then it was sent to a central laboratory for culture and sensitivity testing . only one specimen per patient \n the e. coli included in the study were from cultures yielding 10 colony forming units / ml and the urine displayed pyuria ( 2 ) . in total , 225 \n e. coli isolates were prospectively and consecutively collected from the urine samples of the female outpatients with uncomplicated cystitis in 22 hospitals of korea . in seoul , \n 102 samples were collected from 4 hospitals . in chungcheong - do and jeolla - do , \n the minimum inhibitory concentration ( mic ) of ciprofloxacin resistance was determined by the agar dilution method on mueller - hinton agar ( becton dickinson and company , franklin lakes , nj , usa ) , as recommended by the nccls ( 3 ) . \n the number of cystitis episodes was classified into none , one and two recurrences in the previous year ( 2 ) . \n for easily handling of the data , we placed the intermediate resistant e. coli isolates into the resistant categories of each antimicrobial . \n this study was approved by the institutional review board of the dankook university medical center ( approval number : 0911 - 078 ) . \n statistical analysis was performed by using fisher 's exact test , chi - square tests , student 's t - tests and the mann - whitney test . \n multiple variables were assessed as predictors of the categorical outcomes by multivariable logistic regression analysis . \n determination of antimicrobials resistance was possible for more than 96.9% of the isolates ( 220 isolates to ampicillin , 221 to co - trimoxazole and ciprofloxacin and 218 to cefazolin of the total 225 isolates ) . \n the e. coli isolates more commonly exhibited resistance to ampicillin ( 66.3% ) and co - trimoxazole ( 31.2% ) , followed by ciprofloxacin ( 26.7% ) and cefazolin ( 7.3% ) . \n the association studies of the risk factors for antimicrobials resistance are shown in table 1 . \n the mean ages of the patients with sensitive and resistant isolates to ampicillin were 45.0612.41 and 46.5412.41 yr , respectively ( p=0.40 ) , those for co - trimoxazole were 45.3012.38 and 47.3712.66 yr ( p=0.251 ) , those for ciprofloxacin were 45.4712.70 and 47.0311.94 yr ( p=0.42 ) and those for cefazolin were 45.8512.42 and 48.8713.14 yr ( p=0.353 ) , respectively . in the women aged older than 50 yr , the resistance rates to the four antimicrobials were not increased as compared to the women below that age ( table 1 ) . some regional differences in ciprofloxacin resistance \n isolates from gyeongsang - do , 38.7% were ciprofloxacin resistant strains , whereas 20.6% of the e. coli isolates from gyeonggi - do were ciprofloxacin resistant strains ( or : 2.43 , 95% ci : 1.02 - 5.8 , p=0.04 ) . \n however , there were no significant differences in ciprofloxacin resistance among seoul and the chungcheong - do & jeolla - do and gyeongsang - do . \n in addition , there were no statistical differences in co - trimoxazole , ampicillin and cefazolin resistance among the four regions . \n interestingly , two recurrences of acu in prior year was associated with ciprofloxacin ( or : 4.44 , 95% ci : 1.34 - 14.74 , p=0.01 ) and cefazolin resistance ( or : 5.33 , 95% ci : 1.24 - 22.84 , p=0.02 ) . \n we analyzed trends for the risk of resistance to the four antimicrobials by performing multivariate analysis ( table 2 ) . \n however , the samples from the south - west ( chungcheong - do & jeolla - do ; or : 3.04 , 95% ci : 1.19 - 7.80 , p=0.02 ) , and from the south - east ( gyeongsang - do ; or : 3.04 , 95% ci : 1.22 - 7.58 , p=0.017 ) showed a risk for ciprofloxacin resistance when compared with the samples from the north ( gyeonggi - do ) , whereas the other antimicrobials did not reveal differences according to the different region . \n in addition , the patients with ciprofloxacin or cefazolin resistant e. coli isolates were significantly more likely to have histories of cystitis ( two recurrences with ciprofloxacin resistant e. coli ; or : 6.71 , 95% ci : 1.86 - 24.11 , p=0.004 and two recurrences with cefazolin resistant e. coli ; or : 5.72 , 95% ci : 1.20 - 27.25 , p=0.028 ) in previous year as compared with the non - recurrent patients . resistance to one antimicrobial was usually associated with resistance to another antimicrobial ( table 3 ) . for example , the e. coli strains with ciprofloxacin resistance were significantly associated with resistance to ampicillin ( p<0.001 ) , co - trimoxazole ( p<0.001 ) and cefazolin ( p=0.002 ) . \n the korean association of urogenital tract infection and inflammation ( kautii ) reported previously that the resistance rates of e. coli from auc patients to ciprofloxacin , cefazolin , ampicillin and co - trimoxazole were 23.4% , 7.6% , 64.8 and 29.4% , respectively ( 2 ) . \n they also reported that gyeongsang - do showed a trend for a higher rate of resistance to ciprofloxacin as compared with other regions ( 2 ) . \n we have recently re - evaluated the raw data and re - analyzed the data together with the patient characteristics to investigate the overall patterns and risk factors for resistance to ciprofloxacin , cefazolin , ampicillin and co - trimoxazole in the e. coli isolates from patients with auc . \n interestingly , resistance to ampicillin , co - trimoxazole , cefazolin and ciprofloxacin did not significantly vary according to age group . \n however , it is a general rule that older aged patients are significantly associated with antimicrobial resistance . \n moreover , some studies have also reported that older women with auc show a higher chance for ciprofloxacin resistant e. coli than do the younger women ( 4 , 6 , 7 ) . \n however , the four key antimicrobials did not show any differences in their resistance by age group in our study . \n the exclusion criteria were patients with symptoms of or predisposing factors for complicated urinary tract infections , such as pregnancy , antimicrobial treatment within 2 weeks , symptoms lasting longer than 7 days , fever , known urological or nephrological problems and more than 3 recurrences in previous year ( 2 ) . \n in addition , all the female patients in our study were between 18 and 65 yr old ( meansd : 45.9312.47 yr ) . \n the patients whose ages were over 66 were not included because of the risk of complicated cystitis . \n we also dichotomized patient age into 18 - 49 yr olds and 50 - 65 yr old , and re - analyzed the data . clearly , the patient ages were not different in the dichotomized study . \n chungcheong and jeolla - do is in the south - west and gyeongsang - do is in the south - east . \n near all the hospitals included in this study are tertiary university hospitals , and the estimated populations around the hospitals are above a half million \n in addition , there was no statistical difference in ciprofloxacin resistance among 4 hospitals in gyeonggi - do ( p=0.2 ) . \n gyeongsang - do , chungcheong - do and jeolla - do revealed a significantly higher rate of ciprofloxacin resistance when compared with that of gyeonggi - do ( table 2 ) . \n although previous use of antimicrobials may be involved in the regional differences of antimicrobial resistance , we must consider other factors such as the patients ' characteristics or sampling bias and the social and geological factors that have not yet been defined . \n a history of auc in the previous 1 yr was the other independent variable for ciprofloxacin or cefazolin resistance . \n for the case of ciprofloxacin resistance , the results of our study were not surprising because fluoroquinolones has been prescribed empirically and habitually in this region over the past decade . \n in addition , an association between the increase in fluoroquinolones prescriptions and an increase in its resistance has been reported in several countries ( 8 , 10 , 11 ) . \n the risk of cefazolin resistance was also increased in e. coli isolates from patients with two bouts of recurrent auc in past year . \n although all the previous prescriptions for the patients were not analyzed , the first generation cephalosporins have rarely been used to empirically treat auc in korea . moreover , a small decrease in cefazolin resistance was recognized in 2006 ( 7.6% ) when compared with the same study in 2002 by kautii ( 7.8% ) ( 2 , 3 ) . \n if previous exposure to cefazolin was an important factor for resistance in our study , it is reasonable to consider that the prevalence of cefazolin resistance will increase year by year . \n the risk of cephalosporin resistance in the e. coli isolates from auc patients has not been well documented around the world . \n however , to the best of our knowledge , many doctors may consider that the risk of cephalosporin resistance in the e. coli isolates from auc patients is not high . \n the finding that the e. coli isolates from patients with recurrent auc have a trend for cefazolin resistance is clinically very important because cephalosporins are considered as an empirical treatment for urinary tract infections in countries with a high prevalence of fluoroquinolones resistance . \n e. coli strains with ciprofloxacin resistance were also significantly associated with resistance to ampicillin , co - trimoxazole , and cefazolin in our study . \n quinolone resistance is often associated with cross - resistance to many other structurally unrelated antimicrobials such as beta - lactams , puromycin , tetracyclines , nalidixic acid and chloramphenicol ( 12 , 14 ) . \n combinations of mutation in the topoisomerase - encoding genes , altered permeability and active efflux have been suggested as mechanisms . \n altered permeability and active efflux would also contribute to the decreased susceptibility to beta - lactams ( 15 ) . \n they are also convenient for oral intake and have few side effects . with these advantages , \n the empirical treatment with fluoroquinolones has been a standard treatment for urinary tract infections in korea . \n concurrently and perhaps consequently , urinary tract infections due to fluoroquinolones - resistant e. coli strains have continued to increase at an alarming rate \n . however , there are very few choices to replace fluoroquinolone for empirical auc treatment . \n clearly , we should make a plan to reduce the antimicrobials resistance and be more cautious in using antimicrobials for auc treatment in korea , especially fluoroquinolone . \n therefore , urine culture and antimicrobial susceptibility testing should be considered for the korean auc patients who have risk factors for antimicrobial resistance .", "role": "user" }, { "content": "we investigated the risk factors for resistance to ciprofloxacin , cefazolin , ampicillin and co - trimoxazole in escherichia coli isolates from urine of korean female patients with acute uncomplicated cystitis ( auc ) . \n a total of 225 patients and their e. coli isolates were prospectively and nationwidely enrolled between may and october , 2006 . \n all the antimicrobials did not show any differences according to the age group . a higher rate of ciprofloxacin resistance was observed in the south ( or : 3.04 , 95% ci : 1.19 - 7.80 for chungcheong - do & jeolla - do ; or : 3.04 , 95% ci : 1.22 - 7.58 for gyeongsang - do ) compared to gyeonggi - do . \n two recurrences of auc in the past year was an important risk factor for antimicrobial resistance ( ciprofloxacin ; or : 6.71 , 95% ci : 1.86 - 24.11 and cefazolin ; or : 5.72 , 95% ci : 1.20 - 27.25 ) . \n however , the resistance to co - trimoxazole and ampicillin was not associated with any of the risk factors . \n this study also revealed the pattern of multi - drugs resistance in ciprofloxacin resistant e. coli strains . in conclusion , for korean patients with two more recurrences of auc in the past year \n , it is strongly recommended to perform an antimicrobial sensitivity test with a urine sample before empirical treatment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: anomalous origin of the left main coronary artery from the pulmonary artery ( alcapa ) is a rare congenital anomaly that usually presents in childhood , also known as bland - white - garland syndrome , occurring in approximately 1 in 300,000 children or 0.5% of children with congenital heart disease \n . ninety percent of the patients with alcapa die within the first year of life without surgical intervention . \n the condition causes varying degrees of left ventricular ( lv ) ischemia with resulting lv dysfunction . \n the ischemia results from several factors including the retrograde flow in the anomalous vessel into the pulmonary artery ( pa ) which can act as a coronary steal . \n we here report a patient with alcapa in whom forward flow was observed preoperatively due to pulmonary hypertension ( phtn ) , secondary to severe mitral regurgitation , and discuss the implication and management plan . \n a 1.5-year - old male child presented with four months history of shortness of breath and dyspnea on exertion . \n two - dimensional color flow doppler echocardiography revealed the presence of an abnormal mitral valve ( figure 1 ) . \n the lv was dilated with an ejection fraction of 56% and left atrial ( la ) enlargement . \n the origin of the left main coronary artery ( lmca ) seemed to arise from the pulmonary artery ( pa ) , however there was antegrade flow in the coronaries ( figure 3 ) . \n multi - slice computed tomography ( msct ) angiography and selective coronary angiography confirmed the origin of lmca from pulmonary artery ( figures 46 ) . \n anatomic correction of alcapa was performed by coronary transfer to the aorta and mitral valve repair . \n the case presented here illustrates several important features regarding the diagnosis , pathophysiology and management of alcapa . \n clinical manifestations of alcapa are due to myocardial ischemia , secondary to low - pressure coronary perfusion and insufficient collateral flow from the right coronary artery and reversed flow in the left coronary vessels to the pulmonary artery , which can cause coronary steal . in the patient presented here the presence of alcapa with primary mitral valve abnormality resulted in several unusual features . \n severe mr with the pulmonary hypertension , caused the flow in the lmca to be antegrade . \n this prevented severe deterioration of lv function , in spite of the fact that part of the myocardium was perfused by deoxygenated blood . \n the diagnosis is usually made by the coexistence of lv dysfunction in early life with signs of ischemia and mitral regurgitation . \n echocardiographic findings include a dilated right coronary artery ( rca ) , detection of the coronary artery to pulmonary artery shunt by careful interrogation of the pulmonary trunk using color flow doppler imaging , and retrograde filling of the anomalous coronary artery by both pulsed wave and color flow doppler imaging . in our patient , \n the diagnosis was made preoperatively in spite of the absence of retrograde flow by multi modality imaging . \n similar cases were reported describing antegrade flow in lmct due to phtn in patients with pda , vsd or severe mr who also had alcapa . \n treatment of the cause of phtn in such cases , with failure to identify the diagnosis of alcapa , will unmask the alcapa and can lead to catastrophic consequences . \n the optimal management of alcapa repair aims at direct anatomic implantation of the left coronary ostium in the left sinus of valsalva at infancy . \n the correction should be done as early as possible to take advantage of fact that cardiomyocytes continue to self - proliferate for a short period after birth , as stated by hesham sadek and his group . \n it is hoped that the unusual features of alcapa presented here will help in the management of similar patients in the future .", "role": "user" }, { "content": "anomalous origin of the left main coronary artery from the pulmonary artery ( alcapa ) is a rare congenital anomaly that usually presents in childhood . \n it results in left ventricular ( lv ) ischemia with resulting lv dysfunction . \n this ischemia results from retrograde flow into the pulmonary artery which can act as a coronary steal . \n we here report antegrade flow detected in alcapa caused by severe pulmonary hypertension . \n anatomic correction of alcapa is the preferred surgical option and should be performed as early as possible .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mycoplasmas belong to the class mollicutes and number approximately 200 species , among which are obligate parasites of humans and commercially important mammals such as pigs . mycoplasmas are wall - less bacteria distinguished by small genomes of low g+c content . \n the parasitism , the reduced genome , and the close association of these bacteria with their hosts have contributed to the absence of enzymes involved in important biosynthetic pathways in mycoplasma . \n enzootic pneumonia caused by mycoplasma hyopneumoniae is a major constraint to efficient pork production worldwide . \n the m. hyopneumoniae genome contains 920,079 base pairs and 716 protein - coding genes , of which 418 encode proteins that are homologous to proteins with known functions . \n currently , there are nearly 1,500 complete genome sequences in genbank , and half of all of the predicted genes encode proteins having no inferable functions . \n similarly , almost 42 % of predicted m. hyopneumoniae genes correspond to proteins annotated as hypothetical . \n this lack of annotation is a particularly intriguing and unsolved issue because , as mentioned above , components of important and essential metabolic pathways present in other organisms have not been identified in mycoplasmas [ 4 , 5 ] . \n the blast program has contributed significantly to the analysis of nucleotide and amino acid sequences , allowing the prediction of biological functions and evolutionary relationships of genes and proteins . \n however , this tool can be used with a high degree of confidence only when the sequences are evolutionarily close to each other and the identity between them is over 50% . to overcome these limitations , alternative methodologies such as threading and homology modeling \n these methods are possible because biological processes such as gene duplication and evolutionary divergence occur in many distantly related organisms , giving rise to structurally and functionally similar families of proteins . \n when one or more proteins in a family have experimentally determined structures , it is feasible to model the structures of many other members with reasonable accuracy . \n this condition is particularly true when the sequence identity between protein domains is 30% and larger than 100 residues . \n threading and homology modeling can identify domains and active sites , aiding in placing their locations within a 3d structure ( i.e.,surface or buried ) . because the determination of a crystal structure is an arduous and sometimes impractical task for some proteins , the homology modeling methodology is a helpful approach that can guide further experimental assays to investigate protein function [ 911 ] . \n the rapid growth of structural genomics is producing a considerable number of templates that can be used for homology modeling . \n the availability of more templates increases the quality of new models , thereby diminishing the gap between computationally derived models and experimental outcomes . thus far , mycoplasma genome sequences have not been annotated for activities related to the utilization of atp , nad and nadh and amino acid synthesis derived from pyruvate . \n however , genes corresponding to these activities must exist , otherwise their enzymatic activities would not have been found . \n this discrepancy suggests that sequence - based methodologies for identifying protein function may not be suitable for mycoplasmas in some cases . in this study , using structure - based approaches , we were able to predict the function of seven proteins annotated as hypothetical in the m. hyopneumoniae genome . \n three of the proteins are involved in metabolic processes , a finding that may enhance further studies concerning the metabolism of this bacterium . \n another two proteins are involved in transcription , controlling gene expression based on cellular or environmental signals , an important characteristic of pathogenic bacteria such as m. hyopneumoniae . \n functions for the other two proteins could not be assigned , but their modeled structures suggest experimental designs , which will allow future investigation concerning their function . \n the sequences of 298 proteins belonging to m. hyopneumoniae strain 7448 , currently annotated as hypothetical in the genesul database ( http://www.genesul.lncc.br/finalmp/ ) , were submitted to two threading programs , genthreader and prospect - pspp . \n additionally , these data were analyzed by interproscan and cog , and the functional predictions of these four programs were compared . \n thirty - four sequences with the same functional predictions given by at least two of the mentioned programs were selected for manual analysis , resulting in the further selection of seven targets for structural investigation . \n firstly , the sequences of these seven proteins were submitted to a psi - blast search at http://blast.ncbi.nlm.nih.gov/blast.cgi against the protein data bank ( pdb ) . to guide the functional inference of uncharacterized proteins , \n these other tools suggested scans against sequence pattern , domain , and family classification databases , as well as structural family databases , to identify conserved , functional residues and to extract homologs for post - hoc comparative modeling . \n the local alignment between sequences of the seven selected proteins and their templates provided by threading results was performed using the embl / ebi software mafft with little manual editing . \n the blosum30 matrix was used with gap and extension penalties of 1.0 and 0.123 , respectively . \n afterward , the alignment was used to model the selected proteins with the modeller program ( version 9v8 ) . \n the overall geometric and stereochemical qualities of the structures were assessed using procheck through the pdbsum server and prosa - web and are listed in table 1.table 1sequence and structure information of the selected proteins and their templatesprotein idtemplateidentityevaluationproposed functionprosaramachandranyp_2878667.697.9 % nicotinic acid mononucleotide adenylyltransferase2h2935 % 8.662o0823 % 7.28putative metal - dependent phosphohydrolase ( hd domain)2ogi24 % 8.03yp_2877866.1797 % nicotinic acid phosphoribosyltransferase ( naprtase)1ytk25 % 8,93yp_2876757.2296.5 % flavin adenine dinucleotide ( fad ) synthetase1s4m20 % 8.68yp_2875594.5295.1 % participates in the antitermination process ( nusb)1ey121 % 4.592jr023 % 5.451tzt23 % 6.521q8c15 % 6.751eyv18 % 4.6yp_2880244.2296.2 % key regulator of bacterial transcription initiation ( sige , sigma-28)2z2s18 % 6.331rp320 % 7.73yp_2879715.92100 % unknown function . \n likely binds to nucleic acids ( yrdc)1hru18 % 7.4pdb idfavored and allowed regionsz- score templates sequence and structure information of the selected proteins and their templates favored and allowed regions \n the target sequence is threaded through each template present in databases that contain all known protein folds . \n threading is performed by using measures for fitness for each type of amino acid in local structural environments and defined in terms of solvent accessibility and protein secondary structure . \n if a sequence fits well with a given fold , conserved residues are likely shared suggesting similar functions . \n the prospect - pspp threading pipeline showed that 27 ( 9.06% ) of 298 target proteins gave psi - blast hits against the pdb with an e - value < 0.0001 , indicating the existence of homologs . \n additionally , 83 ( 27.85% ) of the proteins had hits against pdb with a z - score > 20 , indicating that the fold recognition confidence level was > 99% ; the remainder of the proteins had hits with confidence levels between 85 and 99% . \n the genthreader results had high confidence levels ( certain ) for 84 ( 32.43% ) of 259 proteins ( total number of hypothetical sequences available in 2005 ) . \n detailed information analysis obtained by threading provided interesting and consistent results , which helped us to select seven proteins having the same prediction by the both mentioned programs . \n in addition , we followed the protocol suggested by mazumder and vasudevan , as mentioned in materials and methods . \n the results proposed homologs with 3d structures available , thereby providing new knowledge to be applied for comparative modeling . in the following sections , we will discuss the 3d structures and functions predicted for the seven proteins ( yp_287866 , yp_287786 , yp_287675 , yp_287559 , yp_288024 , yp_287971 and yp_288034 ) . \n table 1 lists the templates used to obtain the 3d structures and information about the selected protein models . the 3d structure of hypothetical protein yp_287866 exhibits similarity to portions of two different proteins , i.e. , the n - terminal region of nicotinate - nucleotide adenylyltransferase ( nadd ) and the c - terminal region of an uncharacterized histidine - aspartate ( hd ) domain . \n although the steps in nad biosynthesis and recycling can vary between species , the enzymes involved in these pathways are generally the following : 1 ) nicotinate phosphoribosyltransferase ( naprtase ) ( ec 2.4.2.11 ) , 2 ) nicotinate mononucleotide adenylyltransferase ( namnat or nadd ) ( ec 2.7.7.1 ) , and 3 ) nad synthetase ( nade ) ( ec 6.3.1.5 ) ( fig . 1 ) . \n these enzymes are encoded by the conserved genes pncb , nadd and nade , respectively . \n enzymes involved in nad biosynthesis have been considered as promising drug targets because they are essential for the viability of most bacteria [ 23 , 24 ] ; however , only nade is annotated in m. hyopneumoniae . because nadd is likely essential , characterization of this enzyme using a structure - based approach for m. hyopneumoniae will improve its annotation and add this enzyme to the list of potential therapeutic targets.fig . \n are the ec numbers of the enzymes whose 3d structure was predicted in this study . \n yp_287866 ( n - terminal region ) is suggested to be a nicotinate - nucleotide adenylyltransferase , ec 2.7.7.18 . \n the 3d structures were obtained using comparative modeling methodology , and the structures were rendered with pymol ( www.pymol.org ) simplified nad biosynthesis pathway proposed for m. hyopneumoniae . highlighted in blue circles \n are the ec numbers of the enzymes whose 3d structure was predicted in this study . \n yp_287866 ( n - terminal region ) is suggested to be a nicotinate - nucleotide adenylyltransferase , ec 2.7.7.18 . \n the 3d structures were obtained using comparative modeling methodology , and the structures were rendered with pymol ( www.pymol.org ) the sequence similarity between the yp_287866 n - terminal region and other nicotinate - nucleotide adenylyltransferases is low ( approximately 30% ) ; however , the proteins share two highly conserved atp - binding motifs , gxxxpx(t / h)xx and sx(t / s)xxr . \n the crystal structures of many namnat proteins [ 2529 ] reveal the residues involved in their function , such as the following : 1 ) his20 , ser162 , arg167 and the essential his17 in the enzymes from pseudomonas aeruginosa , escherichia coli and b. subtilis , located in the atp binding site , 2 ) thr87 and trp117 that interact with the substrate nicotinic acidyl , and 3 ) arg134 that interacts with the adenosine . \n the template selected to obtain the 3d structure of the yp_287866 n - terminal region was the crystal structure of nicotinic acid mononucleotide adenylyltransferase from staphylococcus aureus ( pdb i d : 2h29 ) . \n the sequence identity between these two proteins is 35% ; however , they share similar topologies , being composed of eight -helices , a six - stranded parallel -sheet and an additional -strand . the model obtained for the yp_287866 c - terminal region adopted a similar conformation to proteins belonging to the metal - dependent phosphohydrolase superfamily . \n these proteins possess a variety of uncharacterized domains associated with nucleotidyltransferases from bacteria , archaea and eukaryotes ; yp_287866 also appears to possess one of these domain architectures . \n the limitation of low sequence identity ( 25% ) between yp_287866 and these proteins was circumvented by the presence of a metal - binding hd motif in yp_287866 . \n crystal structures of hd - domain proteins have been solved for bacillus halodurans ( pdb i d : 2o08 ) and streptococcus agalactiae ( pdb i d : 2ogi ) ; however , a large number of the hd - domain proteins remains uncharacterized . \n concerning the c - terminal region of yp_287866 ( yp_287866c ) , the template used was the crystal structure of the putative metal - dependent phosphohydrolase from s. agalactiae ( pdb i d : 2ogi ) . \n yp_287866 is encoded by only one gene ; however , it comprises two distinct domains with different functions . \n the complete model showed both domains linked by a disulfide bond between cys74 and cys275 within the n - terminal and c - terminal regions , respectively . \n this domain architecture was also found in another hd - domain protein fused to a nucleotidyltransferase domain . because the binding sites in both domains are not spatially superimposed , and the templates form dimers ( 2h29 and 2ogi ) \n moreover , the model has 97.9% of its residues in preferred and allowed regions of the ramachandran plot , indicating good stereochemical quality . as mentioned above , \n some enzymes of the nad biosynthetic and recycling pathways have not been identified in m. hyopneumoniae . \n however , based on structural information , we propose that one of the yp_287866 domains is nadd , and we also suggest that yp_287786 functions in this same metabolic pathway , thereby completing the nad biosynthetic pathway . \n the threading programs suggested the crystal structure of nicotinate phosphoribosyltransferase from thremoplasma acidophilum ( tmnaprtase ) ( pdb i d : 1ytk ) as the best hit for the yp_287786 sequence . \n further structural analysis suggested another homolog with a solved 3d structure , i.e. , naprtase ( ec 2.4.2.11 ) from enterococcus faecalis ( efnaprtase ) ( pdb i d : 2f7f ) . \n this enzyme catalyzes the synthesis of nicotinic acid mononucleotide ( namn ) from adenine and phosphoribosyl pyrophosphate ( prpp ) , regardless of the presence of atp . \n although the sequence similarities between yp_287786 and its structural homologs tmnaprtase and efnaprtase showed low overall identity ( 25% ) , many residues were found conserved , among which were tmnaprtase residues arg224 , asp226 , glu273 and glu292 involved in namn binding . \n two other residues also implicated in namn binding are found in tmnaprtase and substituted in yp_287786 , i.e. , thr179/ser166 and thr293/val294 \n . the first substitution , between amino acids having a similar physicochemical property , may not affect the function of yp_287786 because namn binds tmnaprtase through a hydroxyl group . to transfer the phosphoribosyl group , \n two conserved motifs , 275hsggh279 ( h stands for hydrophobic residue ) and 298gvg301 , are responsible for accommodating the phosphate group of prpp . \n both motifs are conserved in yp_287786 except for a glycine residue being replaced by a serine at position 277 . \n the stereochemical quality of the yp_287786 model was verified by the ramachandran plot calculated using procheck , which showed 97% of the residues in preferred or allowed positions . \n the biosynthesis of flavin adenine dinucleotide ( fad ) in prokaryotes involves bifunctional proteins belonging to the fad synthetase family that catalyze both riboflavin ( rf ) phosphorylation and flavin mononucleotide ( fmn ) adenylylation . in our study , \n the sequence of yp_287675 showed similarities to the crystal structure of fad synthetase ( tm379 ) from t. maritime ( pdb i d : 1s4 m ) and the in silico model of fad synthetase from corynebacterium ammoniagenes ( cafads ) ( pdb i d : 2x0k ) . using the comparative genome tool from genesul \n , we noticed that fad synthetase was annotated in other mycoplasma genomes and yp_287675 also belongs to this cluster . \n the 3d structure obtained for yp_287675 showed an overall topology similar to its template 1s4 m . \n the n - terminal domain contains the fmn adenylylation function , catalyzing the reaction between atp and fmn to form pyrophosphate and fad ( ec 2.7.7.2 ) . \n structurally , this domain consists of a typical nucleotide - binding fold ( rossmann fold ) containing an atp - binding site . the motif v / ixgx1 - 2gxxgxxxg / \n a associated with the rossmann fold and fmn binding is present in yp_287675 with a few amino acid substitutions , i.e. , vx3ggx2ax3gx7a . \n this motif was important in assigning biological function to proteins with unknown function from fully sequenced genomes . \n similarly , the residues believed to be involved in atp - binding are conserved between yp_287675 and its template , except for glu25 and phe100 ( replaced by aspartate and tyrosine , respectively , in 1s4 m and 2x0k ) . \n the second domain of yp_287675 , the c - terminal domain , folds into a six - stranded , antiparallel -barrel architecture , implicated in rf binding . \n with respect to sequence , none of these residues are at the same positions in yp_287675 ; however , the asparagine is maintained at the same structural location . despite lacking structural information for some regions , \n the 3d structure of yp_287675 revealed that 96.5% of the residues are in favored and allowed regions . \n our structure - based annotation of the proteins yp_287866 , yp_287786 involved in nad biosynthesis and yp_287675 implicated in fad biosynthesis fills gaps in this annotation . \n furthermore , proteins required in these biosynthetic pathways are being considered as antimicrobial drug targets . \n nusb participates in the antitermination process , in which rna polymerase is prevented from reading specific rna secondary structures that usually terminate transcription . in e. coli , \n antitermination involves at least three nus proteins : nusb , nuse ( identical to the ribosomal protein s10 ) , and nusg . \n nusb , in association with these other proteins , is believed to bind an rna motif , boxa , present in e. coli rrn operons . \n mutations in nusb lower growth rate , which is an evidence for its role in rrna synthesis . \n e. coli has seven rrn operons whereas m. tuberculosis and m. hyopneumoniae have only one such operon . \n therefore , an efficient antitermination mechanism is particularly important in these pathogenic bacteria to ensure the expression of the entire single rrn operon . \n except for nusb , all other proteins required for efficient antitermination , such as nusa , nusg and s10 , have been annotated in m. hyopneumoniae . \n yp_287559 has only 133 residues ( of 216 ) that align with the nusb sequence annotated in other bacterial genomes , including other species of mycoplasma . the remaining sequence ( residues 182 ) possesses similarities to a transposase . as no suitable template was found to build the 3d structure of this part of the protein , only its c - terminal region was modeled . \n the three dimensional structures of e. coli nusb ( pdb i d : 1ey1 ) and aquifex aeolicus nusb ( pbd i d : 2jr0 ) derived from nmr experiments and the crystal structures of nusb from thermotoga maritime ( pdb i d : 1tzt ) , m. genitalium ( pdb i d : 1q8c ) , and m. tuberculosis ( pdb i d : 1eyv ) were used as templates to model yp_287559 . \n the c - terminal portion of yp_287559 displays a topology composed of only alpha helices . \n its structure can be divided into two subdomains , 1-3 forming the n - terminal region and 4-7 encompassing the c - terminal subdomain . in the n - terminal region , yp_287559 contains the conserved , positively charged residues lys83 , arg84 , arg85 and arg88 , forming an arginine - rich motif with a high probability of being the rna binding site of this protein . also , interactions between nucleic acid bases and rna binding proteins often involve aromatic residues essential for stacking . as found in other nusb proteins , the yp_287559 sequence contains the following aromatic residues : tyr96 , trp98 , \n phe101 , tyr114 , phe115 , phe127 , tyr132 , phe134 , trp147 , trp149 , phe168 , phe169 , phe176 , phe186 , phe194 , phe196 , tyr207 , tyr208 , and phe214 ( fig . 2 ) . \n these amino acids located on the surface of the protein are believed to participate in recognition processes , whereas the remaining residues are probably involved in protein fold stabilization.fig . \n are -helices and loops ; sticks represent aromatic residues likely involved in substrate recognition the 3d structure of yp_287559 . highlighted in green are -helices and loops ; sticks represent aromatic residues likely involved in substrate recognition previous studies have determined that nusb exists as a homodimer in m. tuberculosis ( mtunusb ) , as a monomer in e. coli ( econusb ) , m. genitalium ( mgenusb ) , and a. aeolicus ( aqnub ) , and as a monomer / dimer equilibrium with a preference for the monomeric form in thermotoga maritima ( tmanusb ) . \n however , two key residues in mtunusb , alanine and phenylalanine , are replaced by serine and tyrosine , respectively , in both m. hyopneumoniae and e. coli . in mtunusb \n , the dimer interface overlaps the region involved in rna binding , which may allow mtunusb to remain inactive until needed for transcriptional regulation . \n we concluded that yp_287559 is composed of two domains , one similar to a transposase and the other to nusb . \n the ramachandran plot analysis of the model structure from this last region showed that 95.1% of the residues are in favored and allowed regions . \n the m. hyopneumoniae habitat is the porcine mucosal surface where amino acids , purines , and pyrimidines are acquired to compensate for the lack of important metabolic pathways . \n studies suggested that , in mycoplasmas , genes involved in replication , transcription and translation are constitutively expressed in constant environments , eliminating the need for sophisticated genetic control mechanisms . \n moreover , m. hyopneumoniae has only one annotated sigma factor , rpod , a key regulator of bacterial transcription initiation that is responsible for promoter recognition and melting . \n however , the 35 regions of m. hyopneumoniae promoters have low sequence conservation , suggesting the presence of more than one sigma factor to respond rapidly to environmental changes . in our structure - based analysis \n , we found similarities between the yp_288024 structure and the crystal structures of rhodobacter sphaeroides sige ( pdb i d : 2z2s ) and the flagellar sigma-28 of a. aeolicus ( pdb i d : 1rp3 ) . \n these similarities could indicate that mycoplasmas have a regulatory system not yet identified by traditional tools . \n although gene expression in mycoplasma is not well characterized , recent work investigating transcriptional changes has shown that m. hyopneumoniae regulates its genes in response to environmental changes [ 5154 ] , and 93% of its intergenic regions are transcribed . \n the sequence alignment of the sigma -70 family revealed the conservation of four regions , divided into subregions . \n highly conserved among all members of this family are subregions two and four that compose the sigma factor binding site for the 10 and 35 promoter elements . conserved only in a highly related sigma factor , subregion one is apparently involved in an antagonistic dna - binding activity . \n subregion three is absent from yp_288024 and from extracytoplasmic function sigma factors that allow bacteria to adapt rapidly to environmental changes . \n furthermore , subregion three of extracytoplasmic function sigma factors interacts with the 10 element of promoters lacking a 35 element . the structural alignment between these proteins showed the complete lack of -helices four and five and a portion of -helix six corresponding to the subregion three . \n all the other -helices are conserved in yp_288024 , suggesting their interaction with the 10 and 35 promoter elements . \n this functional prediction was based on a model where 96.2% of the residues lie in the most favorable and allowed regions . \n the hypothetical protein yp_287971 exhibited structural homology to ylxr from s. pneumoniae ( pdb i d : 1g2r ) , a small protein with unknown function , although the ylxr gene is probably in an operon with the other well - studied genes nusa , infb , and rbfa . \n the protein encoded by rbfa ( rbfa ) binds to the 30s ribosomal subunit , perhaps promoting subunit maturation . \n crucial for translation initiation , if2 ( the product of infb ) also functions by binding the 30s subunit . \n nusa is a highly conserved , essential elongation factor that binds rna polymerase as part of the transcriptional antitermination complex in many organisms . \n the ylxr - containing operon has also been studied in e. coli and b. subtilis . \n the latter presents two additional genes ( ylx - r and ylx - q ) between nusa and infb ; this order was not found in e. coli nor in m. hyopneumoniae wherein these genes are adjacent . \n the 3d structure of yp_287971 showed a similar topology to ylxr of s. pneumoniae . besides a short 310-helix \n the central core of the model was comprised of three antiparallel -strands followed by two -helices , one of which bends at lys61 . \n the yp_287971 sequence also possesses highly conserved residues , such as the grga(y / w ) motif present in the hydrophobic core together with val10 , leu20 , leu24 , ile32 , ile47 , phe63 and leu79 . at the protein surface \n several positively charged residues are conserved ( arg6 , arg22 , asp27 , arg43 , lys60 , lys61 and arg65 ) , forming a patch typical of nucleic acid - binding proteins , as shown in fig . \n this region is proposed to be related in ylxr function , which may involve an rna - binding activity found in proteins encoded by the genes in the nusa / infb operon .fig . \n the electrostatic potential surface distribution shows an extensive positively charged region ( blue ) typical of nucleic acid - binding proteins probable nucleotide binding site of yp_287971 . \n the electrostatic potential surface distribution shows an extensive positively charged region ( blue ) typical of nucleic acid - binding proteins yp_287971 is probably a member of a highly conserved family ( duf448 ) of unknown function , distributed in many organisms , including 14 species of mycoplasmas for which complete genome sequences are available . \n the stereochemical quality of yp_287971 was evaluated , resulting in 93.3% of the residues located in favored regions and 6.7% in additional allowed regions of the ramachandran plot . because it is of high quality and shows a significant structural resemblance to ylxr of s. pneumoniae \n , the model suggests the same function for yp_287971 and ylxr , and it will aid in the design of future experiments to verify the function . finally , the yp_288034 protein showed structural similarities to the crystal structure of yrdc from e. coli ( pdb i d : 1hru ) . \n members of the yrdc family code for proteins that fold into a single domain , as in the case of 1hru , or as a domain in proteins implicated in regulation process . \n yp_288034 is probably an example of the latter because its alignment with e. coli yrdc involves only 164 amino acids out of the yp_288034 total of 287 residues . \n searching for homologs within mycoplasmas , we observed that this protein clusters with a sua5-like translation factor found in six other species . \n thus , yp_288034 constitutes a two - domain protein containing a yrdc domain as found in e. coli and in sua5 members such as that from saccharomyces cerevisiae . \n the function of e. coli yrdc is unknown , but its crystal structure suggested that it possesses a double - stranded rna - binding capacity . the sua5 protein , containing an yrdc homolog domain in yeast , has been implicated in the re - initiation of translation . \n this function is consistent with the large concave surface of sua5 ; this surface has a positive electrostatic potential akin to that of the yrdc binding surface , which resembles other nucleic acid - binding proteins . \n the geometry of our model shows 96.6% of the residues in the most favored and additionally allowed regions of the ramachandran plot . \n the 3d structure of hypothetical protein yp_287866 exhibits similarity to portions of two different proteins , i.e. , the n - terminal region of nicotinate - nucleotide adenylyltransferase ( nadd ) and the c - terminal region of an uncharacterized histidine - aspartate ( hd ) domain . \n although the steps in nad biosynthesis and recycling can vary between species , the enzymes involved in these pathways are generally the following : 1 ) nicotinate phosphoribosyltransferase ( naprtase ) ( ec 2.4.2.11 ) , 2 ) nicotinate mononucleotide adenylyltransferase ( namnat or nadd ) ( ec 2.7.7.1 ) , and 3 ) nad synthetase ( nade ) ( ec 6.3.1.5 ) ( fig . 1 ) . \n these enzymes are encoded by the conserved genes pncb , nadd and nade , respectively . \n enzymes involved in nad biosynthesis have been considered as promising drug targets because they are essential for the viability of most bacteria [ 23 , 24 ] ; however , only nade is annotated in m. hyopneumoniae . because nadd is likely essential , characterization of this enzyme using a structure - based approach for m. hyopneumoniae will improve its annotation and add this enzyme to the list of potential therapeutic targets.fig . \n are the ec numbers of the enzymes whose 3d structure was predicted in this study . \n yp_287866 ( n - terminal region ) is suggested to be a nicotinate - nucleotide adenylyltransferase , ec 2.7.7.18 . \n the 3d structures were obtained using comparative modeling methodology , and the structures were rendered with pymol ( www.pymol.org ) simplified nad biosynthesis pathway proposed for m. hyopneumoniae . \n highlighted in blue circles are the ec numbers of the enzymes whose 3d structure was predicted in this study . \n yp_287866 ( n - terminal region ) is suggested to be a nicotinate - nucleotide adenylyltransferase , ec 2.7.7.18 . \n the 3d structures were obtained using comparative modeling methodology , and the structures were rendered with pymol ( www.pymol.org ) the sequence similarity between the yp_287866 n - terminal region and other nicotinate - nucleotide adenylyltransferases is low ( approximately 30% ) ; however , the proteins share two highly conserved atp - binding motifs , gxxxpx(t / h)xx and sx(t / s)xxr . \n the crystal structures of many namnat proteins [ 2529 ] reveal the residues involved in their function , such as the following : 1 ) his20 , ser162 , arg167 and the essential his17 in the enzymes from pseudomonas aeruginosa , escherichia coli and b. subtilis , located in the atp binding site , 2 ) thr87 and trp117 that interact with the substrate nicotinic acidyl , and 3 ) arg134 that interacts with the adenosine . \n the template selected to obtain the 3d structure of the yp_287866 n - terminal region was the crystal structure of nicotinic acid mononucleotide adenylyltransferase from staphylococcus aureus ( pdb i d : 2h29 ) . \n the sequence identity between these two proteins is 35% ; however , they share similar topologies , being composed of eight -helices , a six - stranded parallel -sheet and an additional -strand . the model obtained for the yp_287866 c - terminal region adopted a similar conformation to proteins belonging to the metal - dependent phosphohydrolase superfamily . \n these proteins possess a variety of uncharacterized domains associated with nucleotidyltransferases from bacteria , archaea and eukaryotes ; yp_287866 also appears to possess one of these domain architectures . \n the limitation of low sequence identity ( 25% ) between yp_287866 and these proteins was circumvented by the presence of a metal - binding hd motif in yp_287866 . \n crystal structures of hd - domain proteins have been solved for bacillus halodurans ( pdb i d : 2o08 ) and streptococcus agalactiae ( pdb i d : 2ogi ) ; however , a large number of the hd - domain proteins remains uncharacterized . \n concerning the c - terminal region of yp_287866 ( yp_287866c ) , the template used was the crystal structure of the putative metal - dependent phosphohydrolase from s. agalactiae ( pdb i d : 2ogi ) . \n yp_287866 is encoded by only one gene ; however , it comprises two distinct domains with different functions . \n the complete model showed both domains linked by a disulfide bond between cys74 and cys275 within the n - terminal and c - terminal regions , respectively . \n this domain architecture was also found in another hd - domain protein fused to a nucleotidyltransferase domain . because the binding sites in both domains are not spatially superimposed , and the templates form dimers ( 2h29 and 2ogi ) \n moreover , the model has 97.9% of its residues in preferred and allowed regions of the ramachandran plot , indicating good stereochemical quality . \n as mentioned above , some enzymes of the nad biosynthetic and recycling pathways have not been identified in m. hyopneumoniae . \n however , based on structural information , we propose that one of the yp_287866 domains is nadd , and we also suggest that yp_287786 functions in this same metabolic pathway , thereby completing the nad biosynthetic pathway . \n the threading programs suggested the crystal structure of nicotinate phosphoribosyltransferase from thremoplasma acidophilum ( tmnaprtase ) ( pdb i d : 1ytk ) as the best hit for the yp_287786 sequence . \n further structural analysis suggested another homolog with a solved 3d structure , i.e. , naprtase ( ec 2.4.2.11 ) from enterococcus faecalis ( efnaprtase ) ( pdb i d : 2f7f ) . \n this enzyme catalyzes the synthesis of nicotinic acid mononucleotide ( namn ) from adenine and phosphoribosyl pyrophosphate ( prpp ) , regardless of the presence of atp . \n although the sequence similarities between yp_287786 and its structural homologs tmnaprtase and efnaprtase showed low overall identity ( 25% ) , many residues were found conserved , among which were tmnaprtase residues arg224 , asp226 , glu273 and glu292 involved in namn binding . \n two other residues also implicated in namn binding are found in tmnaprtase and substituted in yp_287786 , i.e. , thr179/ser166 and thr293/val294 \n . the first substitution , between amino acids having a similar physicochemical property , may not affect the function of yp_287786 because namn binds tmnaprtase through a hydroxyl group . to transfer the phosphoribosyl group , \n two conserved motifs , 275hsggh279 ( h stands for hydrophobic residue ) and 298gvg301 , are responsible for accommodating the phosphate group of prpp . \n both motifs are conserved in yp_287786 except for a glycine residue being replaced by a serine at position 277 . \n the stereochemical quality of the yp_287786 model was verified by the ramachandran plot calculated using procheck , which showed 97% of the residues in preferred or allowed positions . \n the biosynthesis of flavin adenine dinucleotide ( fad ) in prokaryotes involves bifunctional proteins belonging to the fad synthetase family that catalyze both riboflavin ( rf ) phosphorylation and flavin mononucleotide ( fmn ) adenylylation . in our study , \n the sequence of yp_287675 showed similarities to the crystal structure of fad synthetase ( tm379 ) from t. maritime ( pdb i d : 1s4 m ) and the in silico model of fad synthetase from corynebacterium ammoniagenes ( cafads ) ( pdb i d : 2x0k ) . using the comparative genome tool from genesul \n , we noticed that fad synthetase was annotated in other mycoplasma genomes and yp_287675 also belongs to this cluster . \n the 3d structure obtained for yp_287675 showed an overall topology similar to its template 1s4 m . as expected , \n the n - terminal domain contains the fmn adenylylation function , catalyzing the reaction between atp and fmn to form pyrophosphate and fad ( ec 2.7.7.2 ) . \n structurally , this domain consists of a typical nucleotide - binding fold ( rossmann fold ) containing an atp - binding site \n . the motif v / ixgx1 - 2gxxgxxxg / a associated with the rossmann fold and fmn binding is present in yp_287675 with a few amino acid substitutions , i.e. , vx3ggx2ax3gx7a . \n this motif was important in assigning biological function to proteins with unknown function from fully sequenced genomes . \n similarly , the residues believed to be involved in atp - binding are conserved between yp_287675 and its template , except for glu25 and phe100 ( replaced by aspartate and tyrosine , respectively , in 1s4 m and 2x0k ) . \n the second domain of yp_287675 , the c - terminal domain , folds into a six - stranded , antiparallel -barrel architecture , implicated in rf binding . \n with respect to sequence , none of these residues are at the same positions in yp_287675 ; however , the asparagine is maintained at the same structural location . despite lacking structural information for some regions , \n the 3d structure of yp_287675 revealed that 96.5% of the residues are in favored and allowed regions . \n our structure - based annotation of the proteins yp_287866 , yp_287786 involved in nad biosynthesis and yp_287675 implicated in fad biosynthesis fills gaps in this annotation . \n furthermore , proteins required in these biosynthetic pathways are being considered as antimicrobial drug targets . \n nusb participates in the antitermination process , in which rna polymerase is prevented from reading specific rna secondary structures that usually terminate transcription . in e. coli , \n antitermination involves at least three nus proteins : nusb , nuse ( identical to the ribosomal protein s10 ) , and nusg . \n nusb , in association with these other proteins , is believed to bind an rna motif , boxa , present in e. coli rrn operons . \n mutations in nusb lower growth rate , which is an evidence for its role in rrna synthesis . \n e. coli has seven rrn operons whereas m. tuberculosis and m. hyopneumoniae have only one such operon . \n therefore , an efficient antitermination mechanism is particularly important in these pathogenic bacteria to ensure the expression of the entire single rrn operon . \n except for nusb , all other proteins required for efficient antitermination , such as nusa , nusg and s10 , have been annotated in m. hyopneumoniae . \n yp_287559 has only 133 residues ( of 216 ) that align with the nusb sequence annotated in other bacterial genomes , including other species of mycoplasma . the remaining sequence ( residues 182 ) possesses similarities to a transposase . \n as no suitable template was found to build the 3d structure of this part of the protein , only its c - terminal region was modeled . \n the three dimensional structures of e. coli nusb ( pdb i d : 1ey1 ) and aquifex aeolicus nusb ( pbd \n i d : 2jr0 ) derived from nmr experiments and the crystal structures of nusb from thermotoga maritime ( pdb i d : 1tzt ) , m. genitalium ( pdb i d : 1q8c ) , and m. tuberculosis ( pdb i d : 1eyv ) were used as templates to model yp_287559 . \n the c - terminal portion of yp_287559 displays a topology composed of only alpha helices . \n its structure can be divided into two subdomains , 1-3 forming the n - terminal region and 4-7 encompassing the c - terminal subdomain . \n in the n - terminal region , yp_287559 contains the conserved , positively charged residues lys83 , arg84 , arg85 and arg88 , forming an arginine - rich motif with a high probability of being the rna binding site of this protein . \n also , interactions between nucleic acid bases and rna binding proteins often involve aromatic residues essential for stacking . \n as found in other nusb proteins , the yp_287559 sequence contains the following aromatic residues : tyr96 , trp98 , phe101 , tyr114 , phe115 , phe127 , tyr132 , phe134 , trp147 , trp149 , phe168 , phe169 , phe176 , phe186 , phe194 , phe196 , tyr207 , tyr208 , and phe214 ( fig . 2 ) . \n these amino acids located on the surface of the protein are believed to participate in recognition processes , whereas the remaining residues are probably involved in protein fold stabilization.fig . \n are -helices and loops ; sticks represent aromatic residues likely involved in substrate recognition the 3d structure of yp_287559 . highlighted in green are -helices and loops ; sticks represent aromatic residues likely involved in substrate recognition previous studies have determined that nusb exists as a homodimer in m. tuberculosis ( mtunusb ) , as a monomer in e. coli ( econusb ) , m. genitalium ( mgenusb ) , and a. aeolicus ( aqnub ) , and as a monomer / dimer equilibrium with a preference for the monomeric form in thermotoga maritima ( tmanusb ) . \n however , two key residues in mtunusb , alanine and phenylalanine , are replaced by serine and tyrosine , respectively , in both m. hyopneumoniae and e. coli . in mtunusb \n , the dimer interface overlaps the region involved in rna binding , which may allow mtunusb to remain inactive until needed for transcriptional regulation . \n we concluded that yp_287559 is composed of two domains , one similar to a transposase and the other to nusb . \n the ramachandran plot analysis of the model structure from this last region showed that 95.1% of the residues are in favored and allowed regions . \n the m. hyopneumoniae habitat is the porcine mucosal surface where amino acids , purines , and pyrimidines are acquired to compensate for the lack of important metabolic pathways . \n studies suggested that , in mycoplasmas , genes involved in replication , transcription and translation are constitutively expressed in constant environments , eliminating the need for sophisticated genetic control mechanisms . \n moreover , m. hyopneumoniae has only one annotated sigma factor , rpod , a key regulator of bacterial transcription initiation that is responsible for promoter recognition and melting . \n however , the 35 regions of m. hyopneumoniae promoters have low sequence conservation , suggesting the presence of more than one sigma factor to respond rapidly to environmental changes . in our structure - based analysis \n , we found similarities between the yp_288024 structure and the crystal structures of rhodobacter sphaeroides sige ( pdb i d : 2z2s ) and the flagellar sigma-28 of a. aeolicus ( pdb i d : 1rp3 ) . \n these similarities could indicate that mycoplasmas have a regulatory system not yet identified by traditional tools . \n although gene expression in mycoplasma is not well characterized , recent work investigating transcriptional changes has shown that m. hyopneumoniae regulates its genes in response to environmental changes [ 5154 ] , and 93% of its intergenic regions are transcribed . \n the sequence alignment of the sigma -70 family revealed the conservation of four regions , divided into subregions . \n highly conserved among all members of this family are subregions two and four that compose the sigma factor binding site for the 10 and 35 promoter elements . \n conserved only in a highly related sigma factor , subregion one is apparently involved in an antagonistic dna - binding activity . \n subregion three is absent from yp_288024 and from extracytoplasmic function sigma factors that allow bacteria to adapt rapidly to environmental changes . \n furthermore , subregion three of extracytoplasmic function sigma factors interacts with the 10 element of promoters lacking a 35 element . \n the structural alignment between these proteins showed the complete lack of -helices four and five and a portion of -helix six corresponding to the subregion three . \n all the other -helices are conserved in yp_288024 , suggesting their interaction with the 10 and 35 promoter elements . \n this functional prediction was based on a model where 96.2% of the residues lie in the most favorable and allowed regions . \n the hypothetical protein yp_287971 exhibited structural homology to ylxr from s. pneumoniae ( pdb i d : 1g2r ) , a small protein with unknown function , although the ylxr gene is probably in an operon with the other well - studied genes nusa , infb , and rbfa . \n the protein encoded by rbfa ( rbfa ) binds to the 30s ribosomal subunit , perhaps promoting subunit maturation . \n crucial for translation initiation , if2 ( the product of infb ) also functions by binding the 30s subunit . \n nusa is a highly conserved , essential elongation factor that binds rna polymerase as part of the transcriptional antitermination complex in many organisms . \n the ylxr - containing operon has also been studied in e. coli and b. subtilis . \n the latter presents two additional genes ( ylx - r and ylx - q ) between nusa and infb ; this order was not found in e. coli nor in m. hyopneumoniae wherein these genes are adjacent . \n the 3d structure of yp_287971 showed a similar topology to ylxr of s. pneumoniae . besides a short 310-helix \n the central core of the model was comprised of three antiparallel -strands followed by two -helices , one of which bends at lys61 . \n the yp_287971 sequence also possesses highly conserved residues , such as the grga(y / w ) motif present in the hydrophobic core together with val10 , leu20 , leu24 , ile32 , ile47 , phe63 and leu79 . at the protein surface \n several positively charged residues are conserved ( arg6 , arg22 , asp27 , arg43 , lys60 , lys61 and arg65 ) , forming a patch typical of nucleic acid - binding proteins , as shown in fig . \n this region is proposed to be related in ylxr function , which may involve an rna - binding activity found in proteins encoded by the genes in the nusa / infb operon .fig . \n the electrostatic potential surface distribution shows an extensive positively charged region ( blue ) typical of nucleic acid - binding proteins probable nucleotide binding site of yp_287971 . \n the electrostatic potential surface distribution shows an extensive positively charged region ( blue ) typical of nucleic acid - binding proteins yp_287971 is probably a member of a highly conserved family ( duf448 ) of unknown function , distributed in many organisms , including 14 species of mycoplasmas for which complete genome sequences are available . \n the stereochemical quality of yp_287971 was evaluated , resulting in 93.3% of the residues located in favored regions and 6.7% in additional allowed regions of the ramachandran plot . because it is of high quality and shows a significant structural resemblance to ylxr of s. pneumoniae \n , the model suggests the same function for yp_287971 and ylxr , and it will aid in the design of future experiments to verify the function . finally , the yp_288034 protein showed structural similarities to the crystal structure of yrdc from e. coli ( pdb i d : 1hru ) . \n members of the yrdc family code for proteins that fold into a single domain , as in the case of 1hru , or as a domain in proteins implicated in regulation process . \n yp_288034 is probably an example of the latter because its alignment with e. coli yrdc involves only 164 amino acids out of the yp_288034 total of 287 residues . \n searching for homologs within mycoplasmas , we observed that this protein clusters with a sua5-like translation factor found in six other species . \n thus , yp_288034 constitutes a two - domain protein containing a yrdc domain as found in e. coli and in sua5 members such as that from saccharomyces cerevisiae . \n the function of e. coli yrdc is unknown , but its crystal structure suggested that it possesses a double - stranded rna - binding capacity . \n the sua5 protein , containing an yrdc homolog domain in yeast , has been implicated in the re - initiation of translation . \n this function is consistent with the large concave surface of sua5 ; this surface has a positive electrostatic potential akin to that of the yrdc binding surface , which resembles other nucleic acid - binding proteins . \n the geometry of our model shows 96.6% of the residues in the most favored and additionally allowed regions of the ramachandran plot . \n one of the key challenges in the post - genomic era is the prediction of function for proteins annotated as hypothetical proteins . \n a combination of bioinformatic tools , focused not only on sequence analysis but also on structural information , guided us to suggest functions for seven hypothetical proteins in the m. hyopneumoniae genome . \n nadd , naprtase and fad synthetase involved in metabolic processes ; nusb and sige in transcription ; and for yrdc and ylxr , no conclusive functions were assigned ; however , the results obtained helped us design rational experimental strategies for future works . \n our results suggest that this structure - based approach provides significant improvements to domain and function prediction , especially for minimal genomes having poorly annotated metabolic pathways . \n mycoplasma metabolism requires an adequate annotation of its proteome , and our results fill significant gaps in this annotation . each target protein used in this work \n was approached from a unique perspective , taking into account the genomic localization / organization of its open reading frame , its conserved structural features , and any biological evidence available in the literature , even if such evidence was for remote homologs .", "role": "user" }, { "content": "enzootic pneumonia caused by mycoplasma hyopneumoniae is a major constraint to efficient pork production throughout the world . \n this pathogen has a small genome with 716 coding sequences , of which 418 are homologous to proteins with known functions . \n however , almost 42% of the 716 coding sequences are annotated as hypothetical proteins . \n alternative methodologies such as threading and comparative modeling can be used to predict structures and functions of such hypothetical proteins . \n often , these alternative methods can answer questions about the properties of a model system faster than experiments . in this study \n , we predicted the structures of seven proteins annotated as hypothetical in m. hyopneumoniae , using the structure - based approaches mentioned above . \n three proteins were predicted to be involved in metabolic processes , two proteins in transcription and two proteins where no function could be assigned . \n however , the modeled structures of the last two proteins suggested experimental designs to identify their functions . \n our findings are important in diminishing the gap between the lack of annotation of important metabolic pathways and the great number of hypothetical proteins in the m. hyopneumoniae genome .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in a recent paper , gonano and coworkers reported the potential failure of antithrombin ( at ) therapy to modulate hypercoagulability , as evident from teg measurements . at \n constitutes the principal physiological inhibitor of thrombin and of other serine proteases of the clotting cascade , and has been shown to interfere with the clotting process at various sites . at activity is decreased in patients with trauma , shock and sepsis by virtue of its consumption during complex formation with clotting factors , and by degradation via granulocyte elastase . \n the first application of at in a patient with septic shock complicated by disseminated intravascular coagulation ( dic ) was described in 1978 . following this report \n , many intensive care specialists have also used this natural coagulation inhibitor over more than 25 years to treat coagulopathy in patients with sepsis complicated by dic . \n the kybersept trial investigated the effects of a four - day at therapy in 2,314 patients with severe sepsis . in this study , at treated patients did not benefit overall in terms of 28-day and 90-day mortality . in a recent subgroup analysis , \n however , concomitant heparin application was characterized as the major reason for the failure of the \n at treatment ; 28-day as well as 90-day mortality were improved in patients not receiving concomitant heparin during the treatment phase . given that at \n was clearly more effective in kybersept patients with dic than those without it , the characterization of at 's actions on hypercoagulability in sepsis clearly seems to be interesting and important . \n in a recent issue of critical care , gonano and co - workers analyzed hypercoagulability in a subset of patients in the kybersept trial by thrombelastography ( teg ) and routine coagulation tests . \n septic patients in both groups clearly showed hypercoagulability , as defined by five teg parameters , when compared to normal values . \n this information may be important given that the severity of coagulatory disorders has been clearly correlated with decreased survival , and because the international society of thrombosis and hemostasis score is a perfect predictor of mortality . \n characterization of septic coagulopathy by teg has not been published thus far , and the clinical relevance of these measurements has to be determined in further studies . \n coagulatory parameters during high dose at supplementation have already been extensively characterized in four - day studies as well as during long - term ( 14-day ) treatment . \n all studies clearly show a reduction in the severity of dic with the administration of at when measured with standard coagulation tests [ 9 - 11 ] . thus far \n , no studies looking at teg measurements in this scenario have been performed . at least for us , it remains unclear from the given data whether at therapy really is unable to influence hypercoagulability , as was indicated in the study by gonano and colleagues by teg measurements with high inter - individual variability . despite this variability , in this pilot trial with 33 patients , \n the group treated with at also showed an attenuation of hypercoagulability after an intravenous bolus of at , and no differences in the later time course when compared to controls without at . \n it could be speculated that this at effect will gain statistical significance in a better powered trial . \n one problem with the kybersept trial design in terms of efficacy in hypercoagulability could be the treatment period of only four days . \n in other studies , however , a four day treatment period has allowed at to become effective with regard to dic . \n there is some evidence from a small clinical pilot trial that prolonged at supplementation with adjusted activity ( > 120% activity ) can modify coagulatory parameters . \n however , the validity of this concept of prolonged , dose - adapted at support has not been further established by the literature . from the given data it seems to be debatable \n other key mechanisms could include the microhemodynamic and cellular actions of at during endotoxemia ; at was shown to effectively prevent endotoxin - induced leukocyte adhesion to the endothelium and to improve capillary performance , both of which are known to be crucial during the development of multiple organ dysfunction in sepsis . since teg has been shown to be a highly sensitive assay for hypercoagulability , teg measurements may indicate distinct changes in coagulation in septic patients that can not be measured by standard tests . \n after correlation of these laboratory findings with clinical data , teg may become important for future trials investigating pharmacological anticoagulation strategies in patients with severe sepsis . \n \n jnh has received honoraria for oral presentations from biotest , csl - behring , fresenius and octapharma .", "role": "user" }, { "content": "antithrombin ( at ) has been used for over 25 years to successfully treat disseminated intravascular coagulation ( dic ) . a four - day at therapy in patients with dic in the kybersept trial has been related to a clear survival benefit in patients not receiving concomitant heparin . \n gonano and coworkers performed thrombelastography ( teg ) measurements in patients with severe sepsis and clearly showed hypercoagulability , as defined by five teg parameters , compared to healthy controls . in the at group they found a trend towards normalization of teg parameters after treatment , although this did not reach statistical significance . \n this first clinical evaluation of hypercoagulability during at treatment could not provide evidence for an attenuation of coagulopathy , an effect that might be due to high inter - individual variability .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: neuroblastoma is a neoplasm comprising embryonic nerve cells and is most commonly diagnosed in lactating infants less than 1 year old . \n the varied behaviour of neuroblastoma , which is sometimes very aggressive , suggests that the malignant transformation in this disease is at least partially due to a failure to regulate cell differentiation and proliferation . \n neuroblastoma tumors sometimes exhibit relatively high benign differentiation rates with spontaneous regression , a phenomenon that may reflect alterations in cell differentiation programs and apoptotic cascades . \n neuroblastoma maturation is a well - known process and generally occurs in infants less than 1 year of age with a favourable histology . \n it is known to be highly dependent on the remodelling of the extracellular matrix ( i.e. , remodelling of the stroma in neuroblastomas ) , which evolves from a poorly differentiated neuropil to one that is rich in well - differentiated schwann cells . \n of high interest are those rare patients who , despite their favourable clinical and pathological profiles , exhibit early relapses and a very poor clinical course . \n identifying these patients at diagnosis enables more aggressive therapy to be undertaken , even when the good prognostic factors suggest that this course of action is not required , thus improving the chances of patient survival . \n the quiescin sulfhydryl oxidase ( qsox ) proteins are fad - dependent sulfhydryl oxidases that are found in the extracellular environment ( e.g. , seminal fluid , chicken egg white and supernatant of quiescent fibroblasts ) . \n the extracellular location of qsox proteins suggests that they may be involved in the remodelling of the extracellular matrix , particularly because qsox can catalyse the formation of disulphide bridges , which are needed for the appropriate folding and stability of various matrix proteins . \n qsox has been observed in the endoplasmic reticulum , golgi complex , secretory granules , mitochondria and other organelles . \n studies using a polyclonal antiqsox1 antibody in rats revealed the presence of this protein in all areas of the brain . \n in addition , qsox2 is reportedly involved in the sensitisation of neuroblastoma cells to apoptotic stimuli and may act as a regulatory factor in cell growth and adhesion . \n the hypothesis of this study is based on the observation that the expression of qsox1 in neuroblastoma tumors may influence its clinical course because this protein is involved in processes such as the maturation of the extracellular matrix and the induction of apoptosis in these tumors . \n these processes are responsible for the differentiation and maturation of these tumors and , consequently , their more benign behaviour . \n the aim of this study was to investigate the immunoexpression of qsox1 in human neuroblastoma tumors such that this protein could be used as a prognostic biomarker to help better discriminate among risk groups . \n this project was approved by the committee for ethics in research at the pontifical catholic university of paran ( pucpr ) and was conducted according to the principles of the declaration of helsinki . \n all male and female patients at the pequeno prncipe children s hospital with a diagnosis of neuroblastoma were selected for the study . in total , 23 paraffin - embedded neuroblastoma samples were obtained from patients who had not yet been treated . \n each sample was classified as follows : i ) gender of the child ; ii ) age range at diagnosis ( less than / equal to 18 months or older than 18 months ) ; iii ) location of lesions at diagnosis ( extra - abdominal or abdominal ) ; iv ) state of bone marrow ( presence or absence of neoplastic cell infiltration ) ; v ) histological differentiation of the tumor ( classified into 2 groups : a ) poorly differentiated or undifferentiated tumors ; and b ) well - differentiated or differentiating neuroblastomas and ganglioneuroblastomas ) ; vi ) clinical course of the disease ( patient was deceased or alive ; if alive , the presence or absence of relapses or residual disease ) ; vii ) type of extracellular matrix in the tumor ( schwannian - stroma rich or poor ) ; viii ) shimada classification ( favourable or unfavourable histology ) ; ix ) staging according to the international neuroblastoma staging system ( i , iia , iib , iii , iv or ivs ) ; and x ) amplification status of the mycn oncogene ( paraffin embedded - formalin fixed fish reactions were performed at diagnosis , and these data were obtained ) . \n two representative areas of the tumor were transferred from the histology block to a recipient tissue microarray ( tma ) block . \n next , two 4-m - thick paraffin - embedded sections of the tma blocks were transferred to electrically charged star frost ( braunschweig , germany ) slides and incubated with a primary anti - qsox1 recombinant mouse antibody produced at the federal university of paran for 12 h in a humidified chamber at a temperature between 2 and 8c . \n an advance dako ( carpinteria , ca , usa ) secondary antibody was incubated with the slides for 30 min at a temperature between 2 and 8c . \n the immune reactions were developed by adding dab chromogen - substrate solution ( dako ) to the slides . \n the slides were read using the image pro plus ( rockville , md , usa ) software with aid of a dino - eye ( taiwan ) camera and an olympus bx40 optical microscope ( japan ) ( 40x objective ) . \n the cytoplasm of neuroblastoma cells and extracellular matrix appeared brown when the anti - qsox1 reaction was positive ( figure 1 ) . \n a photomicrograph of a high power field ( hpf = 400x ) in a positive control slide ( human seminal vesicle ) was taken . \n a sample of the positive brown staining pattern from this photomicrograph was subsequently input into the program for the software to automatically identify all of the other positive areas of the photographed field . \n ten hpfs were photographed for each slide , and the previously prepared mask was superimposed on these photomicrographs . \n based on the mask , the program automatically measured the total immunopositive area for each hpf in m . \n the average of the 10 immunopositive areas corresponded to the mean immunopositivity ( per hpf ) for qsox1 for each neuroblastoma in the study . to compare the groups defined by the clinical and pathological variables and the clinical course of the disease in terms of the quantitative variables , student s t - test or a nonparametric mann - whitney test was used . \n fisher s exact test was used to compare the groups in terms of dichotomous nominal variables . \n patient survival was analysed using kaplan - meier curves , and the log - rank test was used to compare pairs of curves . \n the statistical analysis program used was spssv8 . to determine the cut - off points that best represented the correlation between the 2 groups , \n the cut - off points were determined using the groups with or without relapse / residual disease ; the value of the area immunopositive for qsox1 ( in m ) that best distinguished between the 2 groups was calculated , and the best product ( sensitivity x specificity ) was considered . \n after the roc curve was calculated , the patients were divided into 2 groups according to the immunopositivity results for qsox1 : ( a ) group with high immunopositivity ( greater than 65 m ) and ( b ) group with low immunopositivity ( less than or equal to 65 m ) . \n statistical analyses of prognosis ( relapses and/or residual disease ) and/or survival ( dead or alive ) using sensitivity , specificity , positive and negative predictive values for qsox1 expression , differentiation of the tumors , schwannianstroma and shimada classification were performed . \n the majority of the patients were diagnosed with neuroblastoma before the age of 18 months ( 60.8% ) . \n most of the lesions were located in the abdomen ( 60.8% ) and exhibited well - differentiated histology ( 60.8% ) . \n only 65% underwent a bone marrow biopsy , and in 26.6% of these cases , the bone marrow had been infiltrated by the tumor . at diagnosis , 5 patients were stage iia , 2 were stage iii and 16 were stage iv . \n in the shimada classification , 18 patients had favourable histologies , and 5 exhibited unfavourable histologies ; 14 patients had schwannian stroma - rich tumors , and 9 exhibited schwannian stroma - poor tumors . \n three years after diagnosis , 60% of the patients were still alive , although in 57% of these cases the disease remained active ( table 1 ) . \n the immunoexpression of qsox1 correlated with the type of tumor stroma ( figure 1 ) and was higher in schwannian stroma - rich tumors , with a tendency towards statistical significance ( p=0.054 ) ( table 1 ) . using the cutoff point established from the roc curve , \n new comparisons were made among the groups defined by the clinical , pathological and clinical - course variables ( table 2 ) . \n the data in table 2 exhibit a statistically significant correlation between qsox1 expression and well - differentiated neuroblastomas ( p=0.029 ) . \n table 2 also shows that there was a correlation between high immunohistochemical expression of qsox1 and stroma - rich samples ( p=0.029 ) . \n there was no statistically significant correlation between the number of deaths and the clinical and pathological variables or between the number of deaths and the expression of qsox1 . \n nine patients exhibited low immunopositivity ( 65 m ) , 3 of whom exhibited relapses / residual disease and 6 of whom did not show signs of relapse / residual disease ( table 3 ) . \n of the 5 who showed higher immunopositivity for qsox1 ( > 65 m ) , all of them exhibited relapses / residual disease p=0.031 ) . therefore , more instances of relapse / residual disease occurred among cases with immunopositive areas greater than 65 m ( i.e. , higher expression of qsox1 ) . there was no statistically significant correlation between the death rate and expression of qsox1 . \n a cox regression model was adjusted to analyse the relationship between survival time and clinical and pathological variables and the area that was immunopositive for qsox1 . \n the results indicated that there was no significant association between the variables included in the model and the patient survival curve . \n the correlation between prognosis ( relapses and/or residual disease ) and/or survival ( dead or alive ) with qsox1 expression demonstrated that a higher expression of qsox1 may be associated with increasingly poor prognoses and survival ( higher specificity and positive predictive value ) ( table 4 ) . \n qsox1 is an enzyme that is thought to promote the maturation of the extracellular matrix because it is involved in many extracellular processes , including the formation of disulphide bridges . \n it also participates in redox reactions and contributes to increased cellular oxidative stress and apoptosis induction , which has been observed in fibroblasts and progenitor cells isolated from the peripheral nervous system . \n qsox1 is also thought to play a role in neurodegenerative processes because it is associated with dysfunctions in neuronal cell growth and differentiation , maturation of glial cells and production of growth factors .. in human neuroblastoma , qsox2 appears to be involved in the apoptosis of tumor cells . \n we have found scarce evidence to support this claim in the literature , and we believe that qsox1 may play a role in both the apoptosis / proliferation of and extracellular matrix - cell adhesion / maturation in neuroblastomas . since qsox1 is involved in cell regeneration , maturation of the extracellular matrix ( especially the neural extracellular matrix ) and apoptosis , tumor samples that have histological patterns and/or clinical and pathological factors associated with a better prognosis should exhibit higher qsox1 immunopositivity due to the close relationship between neuroblastoma differentiation , changes in extracellular matrix maturation and increases in apoptotic rates . in our study population , there was a direct and statistically significant correlation between the higher immunoexpression of qsox1 and the presence of well - differentiated stroma - rich tumors . \n this protein could therefore act as a biomarker of differentiation and favourable evolution of the lesion . \n however , contrary to our expectations , most of the samples obtained from the group with relapses / residual neoplasms exhibited higher expression of this protein , whereas all of the samples from the group without relapses / residual neoplasms exhibited low expression ( table 3 ) . \n moreover , higher qsox1 expression ( > 65 m ) correlated with poor prognosis and/or low survival rates , and its expression was associated with high rates of specificity and positive predictive values ( table 4 ) . \n this finding can be explained by the observation that the vast majority of these patients did not have relapses but instead exhibited residual disease following chemotherapy . \n chemotherapy for neuroblastoma is generally more effective in less differentiated areas of the tumor and spares the more differentiated areas , which may subsequently appear as residual disease . \n therefore , it is likely that a greater prevalence of residual disease would be observed in patients with tumors that have large well - differentiated areas ; consequently , these patients would exhibit higher qsox1 expression . \n moreover , it should be noted that the number of cases studied in this report is small ; thus , the confidence intervals are quite large ( table 4 ) . \n however , we should consider that higher qsox1 expression may be related to poor prognosis , though we observed its correlation with good prognostic factors such as well - differentiated tumors and stroma - rich tumors in this study . \n the reason for this consideration is that these 2 factors are related to tumors with large amounts of stroma and therefore exhibit much higher qsox1 expression , independent of biological behaviour . \n however , these last 2 characteristics should be considered together because the samples that qualified as well - differentiated are the same samples that are defined as stroma - rich ( the p values for these 2 groups are the same ) . \n other authors have previously described the association of higher qsox1 expression with a higher risk of recurrence and poor prognosis in breast cancer . \n regardless of qsox1 s involvement in maturation of the neural extracellular matrix and apoptosis and given that neuroblastoma maturation / differentiation is well correlated with survival , this work suggests a lack of correlation between the qsox1 data and patient survival . \n this observation could be related to a delay in diagnosis because this is very common in brazil : alternatively , it could be related to very important differences among treatment protocols due to the presentation of these patients . \n another reason could be the very small sample number of cases used to obtain good survival curves , which is a limitation of this study . \n the higher immunohistochemical expression of qsox1 was more common in well - differentiated samples ( p=0.029 ) , in stro ma - rich samples ( p=0.029 ) and in samples from patients with a high prevalence of relapses / residual disease .", "role": "user" }, { "content": "neuroblastoma is the most common extracranial solid malignant tumor observed during childhood . \n although these tumors can sometimes regress spontaneously or respond well to treatment in infants , genetic alterations that influence apoptosis can , in some cases , confer resistance to chemotherapy or result in relapses and adversely affect prognosis for these patients . \n the aim of this study was to correlate immunohistochemical expression of the protein quiescin sulfhydryl oxidase 1 ( qsox1 ) in samples obtained from untreated neuroblastomas with the patients clinical and pathological prognostic factors and clinical course . \n neuroblastoma samples ( n=23 ) obtained from histology blocks were arrayed into tissue microarrays and analysed by immunohistochemistry . \n the cases were classified according to the following clinical and pathological prognostic factors : age at diagnosis greater or less than / equal to 18 months ; location of the lesion at diagnosis ( abdominal or extra - abdominal ) ; presence or absence of bone - marrow infiltration ; tumor differentiation ( well or poorly differentiated ) ; shimada histopathologic classification ( favourable or unfavourable ) ; state of the tumor extracellular matrix ( schwannian - stroma rich or poor ) ; amplification of the mycn oncogene ; and clinical course ( dead or alive with or without relapses / residual lesions ) . \n twelve of the cases were female , 9 children were over 18 months old , 9 cases presented with extra - abdominal tumors and 9 cases exhibited tumors with unfavourable histologies . \n fifteen patients underwent bone - marrow biopsy , and 4 of these were positive for metastasis . \n nine patients died . \n the higher immunohistochemical expression of qsox1 was more common in well - differentiated samples ( p=0.029 ) , in stroma - rich samples ( p=0.029 ) and in samples from patients with a high prevalence of relapses / residual disease . \n the functions of qsox1 include extracellular matrix maturation and the induction of apoptosis . \n therefore , qsox1 may be involved in neuroblastoma differentiation and regression and may thus function as a biomarker for identifying risk groups for this neoplasm .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: over the last decade , chronic exposure to ambient air pollution has become increasingly recognized as an important risk factor underlying adverse pregnancy outcomes ( apos ) [ 19 ] . in parallel , \n the associations between socioeconomic status ( ses ) and apos are among the most robust findings in perinatal research [ 1012 ] , which persist even in settings with universal access to health care [ 1316 ] . \n while interest in the intersection between health and the social environment is long standing [ 1719 ] , renewed attention has been propelled by two independent progressions in quantitative research . \n the first is the popularization of multilevel statistical models and the ability to separate the individual - level effects from those of their encompassing social and physical environments [ 2026 ] . \n the second is the emerging research on the biological effects of psychosocial stress on health and its modification by environmental factors . \n there is now mounting evidence that stress can interact with chemical exposures to exacerbate the toxic effect and the physiological response to a greater extent than either insult ( stress or chemical ) acting alone [ 2731 ] . \n furthermore , the accumulation of low - level exposures to multiple chemicals via multiple sources and pathways shows evidence of dose addition and synergism [ 3234 ] . \n for example , synergism was observed between aqueous cigarette tar and other respirable particles ( e.g. , asbestos fibers , particulate matter , and diesel exhaust ) . \n recognition of these interactions has been incorporated into several conceptual models and study designs of cumulative risk of chemical and nonchemical exposures [ 3639 ] with models recently developed to identify these potentially double - exposed populations [ 40 , 41 ] . \n two complimentary reviews of these models have been recently published [ 42 , 43 ] . \n although the causes of apos are multifactorial , the placenta plays the main intermediary role between the mother 's physical and social environment and the fetus [ 4450 ] . \n importantly , a perturbed intrauterine environment inhibiting the fetal growth trajectory may also have long - term adult health implications as suggested by the developmental origins of disease hypothesis [ 5153 ] . \n therefore efforts to understand the underlying mechanisms of the physical and social environment that contribute to the disproportionate risk of apos across the socioeconomic spectrum are required in order to target preventative and restorative interventions . \n this review will examine how the shared pathoetiological effects of exposure to particulate air pollution and ses act on the fetal - placental unit leading to adverse pregnancy outcomes . \n this will be accomplished by building on conceptual pathway models of air pollution and ses etiologic mechanisms on apos [ 54 , 55 ] . \n we review the role of the placenta in this context , describing its physiology and obstetrical pathologies followed by a description of particulate air pollution and its toxicokinetics in relation to placentation and how it can lead to apos . \n we highlight specific indicators of ses and their biological pathways that intersect with air pollution exposure and how this may contribute to increased susceptibility for apos . \n our aim is for this review to be a resource for researchers interested in environmental - perinatal epidemiology . understanding how correlated social and environmental exposures at times overlap to produce potentially synergistic and modifiable effects will help guide future research and intervention strategies with the aim to improve the overall health of the population [ 3640 ] . \n formed from two genetically distinct organisms , it is multifunctional and vital to fetal development yet situated outside the fetal body with a limited life span . \n notable characteristics unique to humans and the great apes include deep interstitial implantation and a highly invasive hemochorial phenotype thus allowing the direct interaction of maternal blood and fetal chorionic tissues . \n interestingly , this particular aspect of placental evolution has less to do with nutrient transfer efficiency than previously thought and more likely implicates the highly regulated maternal - fetal immunological relationship [ 5759 ] . \n the first trimester is a critical period in pregnancy involving implantation and initial placentation , two events highly susceptible to disturbance . \n the great obstetrical syndromes such as early / recurrent miscarriage , pregnancy induced hypertension and preeclampsia ( pih / pe ) , fetal growth restriction ( fgr ) , placental abruption , prelabour rupture of the fetal membranes ( prom ) , and spontaneous preterm labour may share common etiological mechanisms arising from defective deep placentation ( ddp ) [ 61 , 62 ] . together , these conditions may complicate between 17 and 29% of all pregnancies and are for the purpose of this review referred to collectively as apos . furthermore , these conditions may lead to epigenetic programming of adult disease susceptibility including obesity , diabetes , cardiovascular and reproductive diseases , all with their own substantial societal costs [ 52 , 6466 ] . \n ddp refers to the shallow invasion of the placental bed into the maternal decidua and myometrium including incomplete remodeling of the uterine spiral arteries [ 62 , 67 ] . \n the latter is a vital event during which under normal conditions the endothelial lining of the spiral artery walls is remodeled to accommodate the inundation of maternal blood flow starting in the second trimester . \n spiral arteries that fail to undergo this vascular remodeling are not only narrower in diameter but also remain responsive to vasoconstrictive compounds such as stress hormones . \n the etiological trigger(s ) leading to ddp are thought to involve either early placental oxidative stress which triggers an inflammatory response or , vice versa , an atypical inflammatory maternal immune response to the semi - allogenic fetal - placental unit leading to placental oxidative stress and further inflammation [ 69 , 70 ] . \n the difference between a normal and an affected pregnancy is a matter of degrees on a continuum with individual biological and behavioural variability nested within the social and physical environment [ 12 , 2426 , 68 , 69 , 7173 ] . \n air pollution is a general term used to describe the presence of agents ( particulates , biologicals , and chemicals ) in outdoor or indoor air that negatively impact human health . \n several common air pollutants have been associated with apos , including carbon monoxide ( co ) , nitrogen dioxide ( no2 ) , sulfur dioxide ( so2 ) , ozone , particulate matter ( pm ) , and polycyclic aromatic hydrocarbons ( pahs ) ; however , attention has focused on the latter two compounds showing strong molecular evidence of cytotoxicity , mutagenicity , dna damage , oxidative stress , and inflammation [ 55 , 7479 ] . \n while the observed risks of apos in relation to air pollution tend to be modest , the population attributable risk can be quite large due to the pervasiveness of exposure to the general population . \n significant risks have been observed even in settings with relatively low ambient air pollution exposure [ 80 , 81 ] . \n preterm birth ( ptb ) and fgr are major risk factors of perinatal mortality and serious infant morbidities contributing to increased health care and societal costs [ 8287 ] . particulate matter ( pm ) \n it is defined according to particle size into the inhalable coarse fraction ( pm10 , 2.510 m ) , the fine respirable fraction ( pm2.5 , 2.5 m ) , and the ultrafine fraction ( ufp , 0.1 m ) . \n their ubiquity and recognized human health risks have deemed them as toxic [ 88 , 89 ] . \n first , particle size dictates the location of deposition in the respiratory system [ 88 , 90 ] . \n for example , pm10 is mainly derived from mechanical processes such as windblown soil , pollen , minerals and dust from roads , farms , and industrial operations . \n conversely , pm2.5 is a primary by - product of combustion and atmospheric reactions with precursor gases such as so2 , nitrogen oxides , ammonia , and volatile organic compounds ( vocs ) . \n pm2.5 can remain suspended in air for days to weeks and are consequently more prone to long - range transport . \n derived mainly from the earth 's crust , pm10 typically contains oxides of iron , calcium , silicon , and aluminum , whereas pm2.5 mixtures derived from anthropogenic combustion sources are mainly composed of sulphates , nitrates , ammonium , trace metals , elemental carbon , and organic hydrocarbons ( e.g. , pahs ) . \n chemical differences and relative proportions also differ within the pm10 and pm2.5 mixtures with regional ( urban - to - rural ) and interurban ( urban - to - urban ) differences as well as intraurban spatial variation [ 88 , 9193 ] \n . therefore trimester and demographic differences in residential mobility and intraurban population differences are important study design issues to consider [ 94 , 95 ] . \n finally , pm10 , pm2.5 , and ufps differ by their toxicological mechanisms such as their oxidative potential , which may reflect their differences in size , surface area , and/or their chemical constituent compositions , although they tend to be correlated [ 76 , 92 , 96 , 97 ] . \n transition metals such as copper , nickel , lead , chromium , iron , vanadium , and cobalt among other metals are variably present in ambient air absorbed to pm2.5 [ 92 , 93 ] . their direct oxidative action or redox potential to create reactive oxidative species ( ros ) is one possible mechanism as to how pm2.5 induces oxidative dna and protein damage [ 78 , 97 ] . \n there is accumulating evidence that suggests ufps may be the fraction of pm responsible for many of the adverse health effects reported in air pollution studies [ 78 , 79 , 97 , 98 ] . \n ufps are a small proportion by mass but make up a large proportion in particle number and have gone either unmeasured or misclassified as pm2.5 [ 88 , 98 ] . \n their small size facilitates better tissue penetration deep into lung alveoli and into epithelial cells restricting their clearance via macrophage phagocytosis . \n animal studies have shown that ufps can translocate across the lung epithelium into blood circulation and accumulate in other organs , including the liver , spleen , kidneys , heart , brain , and reproductive organs . \n the high surface area of ufps favours the absorption of pahs and possibly transition metals which has shown to localize in the mitochondria inducing major structural damage . \n this could be a possible explanation to ufp 's exhibited higher oxidative potential compared to larger pm fractions of the same material . \n recent attention has been given to proinflammatory and endocrine - disrupting properties of diesel emissions , a major source of ufps in ambient air [ 31 , 99101 ] . \n polycyclic aromatic hydrocarbons ( pahs ) are organic substances that constitute a class of over 100 individual chemical compounds made up of carbon and hydrogen atoms formed into rings . while toxicological data exist for individual pahs ( benzo[a]pyrene being the most commonly used pah indicator ) , they almost always occur as complex mixtures ( e.g. , soot , tobacco smoke , creosote , and diesel exhaust ) . \n thus it is difficult and arguably futile to assess the toxicity of individual pah components only to be compounded by the likelihood of interactions [ 75 , 104 , 105 ] . \n combustion of organic matter and fossil fuels is the main source of atmospheric pahs with their distribution and magnitude concentrated along transportation corridors ( road and rail ) and land - use areas with heavy industrial activities . \n however , main stream and environmental tobacco smoke ( ets ) remain a leading source of pah exposure . \n pahs are generally nonvolatile ( i.e. , stable ) and have low water solubility . as a consequence \n residency times in the atmosphere depend on weather conditions , pah molecular weight , and the emission source ( e.g. , stack versus tailpipe ) with atmospheric deposition as the main source of pahs to soil , vegetation , and surface water . \n once in aquatic systems , pahs are often found absorbed to suspended particles or bound to sediments settled on the bottom where they persist or are slowly biodegraded by microorganisms . \n while pahs can bioaccumulate in some aquatic and terrestrial organisms , they tend to not biomagnify in food systems due to their metabolism in higher order species [ 102 , 106 ] . \n however , it is the inefficient clearance and action of the highly reactive pah metabolites that are suspected to cause cytotoxicity , mutagenicity , dna damage , oxidative stress , and tumorgenesis [ 75 , 106 ] . \n much of the work elucidating the mechanisms in which pm and pahs elicit adverse cellular effects have been conducted using cardiovascular disease ( cvd ) and lung cancer as models [ 7678 , 97 , 107109 ] . \n although seemingly different diseases , they share several similarities with ddp and apos with respect to associated risk factors . \n first , both apos and cvd related outcomes are associated with pm exposure levels which vary by ses [ 40 , 110 , 111 ] but are also associated with other socially patterned risk factors such as smoking , poor or inadequate diet , psychosocial stress , obesity , and diabetes [ 12 , 112114 ] . \n cvd and apos also share many other risk factors such as the presence of systemic inflammation and preexisting hypertension . \n interestingly , pih / pe is a risk factor for maternal cvd later in life and also in the offspring if affected by iugr [ 115117 ] . \n cvd and disorders of ddp have similarly affected cellular tissues in their respective target systems ( i.e. , endothelial cells of the cardiovascular system and in the highly vascularised placenta ) which are particularly susceptible to oxidative and inflammatory injury [ 97 , 118 ] . \n high plasma homocysteine concentrations are positively associated with vasculopathy and infarction in the placental - uterine and coronary systems increasing the risk of spontaneous ptb and cvd events , respectively [ 119 , 120 ] . \n fittingly , high density lipoprotein cholesterol may be protective against spontaneous ptb and cvd events [ 120 , 121 ] . \n finally , pm and pah - induced mutagenicity , cytotoxicity , dna damage , and oxidative stress linked to lung cancer have also been observed in the fetal - placental unit [ 122 , 123 ] , and exposure early in pregnancy may contribute to the risk of congenital anomalies and early ( subclinical ) pregnancy loss [ 124127 ] . \n the social environment plays a significant role in maternal and perinatal health with indicators of low socioeconomic status ( ses ) consistently among the strongest predictors of adverse pregnancy outcomes [ 1012 ] . \n the causal pathways in which ses contribute to apos and ill health in general can be conceptualized in terms of downstream or mediating exposures , stresses , and behaviours acting on the individual through upstream society - level determinants such as poverty , poor education , income inequality , and social discrimination / marginalization over the lifespan . indicators of low ses associated with ptb and fgr include maternal anthropometry ( prepregnancy bmi , height , and gestational weight gain ) , nutrition and micronutrient status , cigarette use , genital tract infections and inflammation , cocaine and other drug use , physically demanding work , quantity and quality of prenatal care , and psychosocial factors including anxiety , depression , and stress ( e.g. , lack of social , familial , and marital support , poverty or financial hardship , physical / verbal abuse , and neighbourhood crime ) [ 12 , 24 , 26 , 54 ] . for the purpose of this review , the focus here will be on three that engage with the oxidative stress and inflammation pathways to potentially interact with exposure to particulate air pollution . \n they include ( 1 ) a diet - micronutrient pathway [ 55 , 128131 ] , ( 2 ) cigarette smoke exposure [ 35 , 132135 ] , and ( 3 ) stress - mediated ( allostatic ) activation of the hpa - axis and corresponding glucocorticoid production [ 47 , 72 , 136138 ] . nutrition and diet can influence perinatal health in opposing directions . \n poor / under - nutrition such as high fat / calorie dense food and low micronutrient intake is more prevalent among women from low ses backgrounds which may partly explain higher rates of some apos [ 12 , 139142 ] . \n conversely , adequate diet and micronutrient status provides resilience against oxidative stress and inflammation caused by various exposures including air pollution , allostatic stress , infection , or smoking [ 55 , 118 , 128 , 129 , 131 , 143 ] . maternal exposure to mainstream or environmental cigarette smoke during pregnancy \n their exposure prevalence is associated with indicators of low ses as well as other socially patterned risk factors [ 147149 ] and remains one of the most modifiable risk factors with potential for beneficial intervention . \n other risk factors associated with low ses such as obesity , pre - existing and gestational diabetes , and hypertension [ 13 , 113 , 150 ] also engage the oxidative stress and inflammatory pathways and could therefore also potentially interact with pm exposure to increase susceptibility to adverse effects as evidenced in studies of cardiovascular health [ 114 , 151 , 152 ] . \n recent studies have observed increased risks of preeclampsia and gestational diabetes associated with measures of air pollution [ 153156 ] with one study showing positive effect modification by preexisting and gestational diabetes . \n evidence shows that chronic life stressors associated with low ses at multiple levels of organization ( individual , household , and community ) result in a cumulative biological toll on the body affecting multiple systems and increasing susceptibility to numerous ailments [ 21 , 157160 ] including apos [ 15 , 26 , 161 , 162 ] . \n the concept of allostasis and allostatic load / overload has been proposed to describe the individual stress response to an event as a necessary and adaptive process thereby removing the implicit negative connotation attached to the term stress . \n stress can be positive or tolerable when it improves function and performance and may have long - term adaptive benefits . \n however , this may depend on available coping resources such as one 's psychological resistance , resilience , and ability to recover . negative or toxic stress occurs when real or perceived environmental / social demands , or the anticipation of such , become too extreme or unpredictable thereby exceeding one 's ( perceived ) ability to cope ( e.g. , no sense of control , adverse childhood experiences , and other forms of trauma ) [ 164 , 165 ] . therefore , allostasis is the multisystem biological response that promotes adaptation using system mediators such as cortisol , ( nor)epinephrine , vasopressin , renin , and glucagon , whereas allostatic load and overload is the cumulative toll ( wear and tear ) on biological systems after prolonged or poorly regulated ( hyper / hypoactivated ) allostatic responses [ 165 , 166 ] . \n for example , the cardiovascular system is extremely sensitive to stress in terms of increased blood pressure ; however , metabolic disorders such as diabetes and obesity as well as immune function impairment are also linked to chronic stress . \n furthermore , lifestyle coping mechanisms as a response to chronic stress have the ability to either buffer or exasperate the effect ( e.g. , exercise , diet , sleep , and social interactions or lack thereof ) . \n therefore in light of the above , it is our belief that the fetal - placental unit is the site where the physical and social environments converge and interact to influence reproductive health which we describe further below . \n figure 1 illustrates the interconnectedness between particulate air pollution ( pm / pah ) and ses on how they may act discretely or in a combined manner to yield apos . \n using figure 1 as a guide , the following text will review the two major mechanisms ( oxidative stress and inflammation ) through which the physical and social environments are believed to negatively affect the fetal - placental unit and how they may combine / interact to lead to the multifactorial nature of apos . \n aptly known as the oxygen paradox , oxygen is both essential and toxic to the multicellular aerobic organisms whose very evolution was dependent on leveraging this anaerobic waste by - product into a higher energy producing advantage . \n observed in all mammals , a steep oxygen tension gradient from 20% in our atmosphere to 3 - 4% oxygen concentration in most internal tissues is the primary defense against oxidative damage . \n secondary and tertiary layers of protection include antioxidant defenses as well as damage removal , repair , and apoptotic response systems [ 168 , 169 ] . \n these genetically adaptive responses are upregulated in the presence of reactive oxygen species ( ros ) generated as natural by - products of cellular aerobic metabolism and exposure to various toxins . \n it is produced by the mitochondria as a metabolic by - product but also from the metabolism of various growth factors , drugs , and toxins by oxidizing enzymes such as nadph - oxidase and cytochrome p450 ( cyp450 ) . \n superoxide is reduced by superoxide dismutase ( sod ) into hydrogen peroxide ( h2o2 ) which is then further reduced into water by glutathione peroxidase ( gpx ) and catalase . under normal physiological conditions \n h2o2 acts as intracellular secondary messengers ; however , it 's accumulation along with superoxide can react with free iron ions or nitric oxide to form highly toxic hydroxyl ( oh ) or peroxynitrite ( onoo ) ions , respectively [ 70 , 168 ] . \n free iron is a common metal found absorbed to pm , and the antioxidant heme oxygenase-1 ( ho-1 ) facilitates its conjugation and removal through the increased availability of ferritin thereby preventing the formation of reactive hydroxyl molecules [ 92 , 170172 ] . \n deficiencies in ho-1 have been associated with several apos such as recurrent miscarriage , fgr , and preeclampsia [ 171 , 172 ] . \n common antioxidants include enzymatic ( e.g. , sod , gpx , catalase , and ho-1 ) and nonenzymatic compounds ( e.g. , vitamin c and e , glutathione , -carotene , and ubiquinone ) . genetic polymorphisms and/or micronutrient deficiencies in antioxidant enzymes precursors can impair antioxidant capacity , while chronic exposure to toxicants , psychosocial stress , bacteria , viruses , and other inducers of inflammation can foster prooxidant burden [ 70 , 77 , 118 , 172 ] . \n oxidative stress is unavoidable ; however , under optimal conditions the presence of ros leads to homeostatic adaptation and are safely removed . \n failure to effectively manage oxidative stress can result in altered cellular function as excess ros degrade lipids , proteins , and dna potentially initiating pathological processes . \n refer to for an extensive review on the role of cellular ros in pregnancy outcomes . \n it is well recognized that the maternal immune system plays a central role throughout the entire pregnancy , from preimplantation to parturition , and is influenced by the inflammatory response of the mother to her environment as well as to her partner . \n alternative to previously hypothesized , the maternal immune system is not passive or suppressed during implantation and development of the semiallogeneic placenta and fetus . \n rather , it exerts executive influence on the establishment and progression of the pregnancy as an immune - mediated quality control mechanism to maximize maternal and offspring health [ 44 , 173 ] . \n this is achieved by favouring pro- or anti - inflammatory environments at different times during pregnancy for different purposes . \n for instance , implantation , initial placentation , and parturition are characterized by a proinflammatory environment whereas an anti - inflammatory state prevails for most of midgestation . \n the favoured localized immunological response however is highly modified by the infectious , inflammatory , stress , nutritional , and metabolic status of the individual and thus can be influenced by environmental agents such as pm [ 175177 ] and/or available coping , social , and nutritional resources [ 44 , 128 , 164 , 178 ] . \n therefore , inflammation is believed to be one pathway involved in both pm and ses - mediated apos . \n chronic and acute inflammation is a complex response process mediated by a real or perceived attack from foreign substances . \n the innate immune response is the rapid automatic response to externally originating ( exogenous ) substances such as pathogens , but also from internal ( endogenous ) danger signals including products of trauma , ischemia , necrosis , or oxidative stress . \n the response includes the release of proinflammatory signaling cytokine proteins such as interleukins il-1 , il-6 , and tumour necrosis factor ( tnf- ) which serve to recruit neutrophils to affected tissues . \n however , the recruited neutrophils release ros and hydrolytic proinflammatory enzymes ( inducible nitric oxide synthase ( inos ) , cyclooxygenase ( cox-2 ) , and prostaglandins ( pg - e2 ) ) which disturb normal cells in addition to affected tissues \n . this in turn leads to increased ros and oxidative stress [ 180 , 181 ] . \n the placenta plays a role at the maternal - fetal interface as the main producer of endocrine steroid and protein hormones as well as the immunologic barrier between mother and fetus which positively interact for the success of the pregnancy [ 44 , 173 ] . \n this is achieved through a nonlinear series of positive and negative feedback pathways with the stimulation or suppression of molecules with pro- and anti - immunosuppressant properties ( interleukins , galectins , placental growth factor , and human chorionic gonadotropin ( hcg ) ) [ 182184 ] . \n the production of these cytokines , chemokines , and other immune - regulatory agents mediates the coordination , migration , and function of several maternal immune cells ( e.g. , uterine natural killer cells ( unk ) ) that participate in early pregnancy events such as endometrial receptivity of embryo implantation , tissue remodeling , immune tolerance , and vascular adaptation to invading placental trophoblast cells [ 44 , 182184 ] . \n interference or aberrant production / secretion of these substances by various stressors including infection , toxins , and those acting through the hpa - axis may result in the impaired maternal immune response leading to the hallmark ddp syndrome complications described above ( early pregnancy loss , pih / pe , prom , fgr , and premature labour , figure 2 ) [ 44 , 61 , 69 , 134 , 175 , 185187 ] . \n due to immortal time bias , miscarriage is not easily measured in population or cohort studies without careful design methodologies [ 188 , 189 ] ; however , associations between infertility and air pollution have been made [ 190 , 191 ] . \n for example , obese mice showed increased ros synthesis and oxidation in oocytes with a reduced ability of zygotes to develop to the blastocyst stage providing evidence that impaired cellular antioxidant capacity can limit successful ovulation and fertilization . dividing mitotic cells are particularly sensitive to oxidative damage and are shown to enter a transient growth - arrested state as a protective mechanism until the stress has passed . \n thus , severe or chronic oxidative stress may hamper cell division or cause cellular necrosis reducing or terminating embryo viability [ 72 , 169 ] . \n alternatively , an exaggerated inflammatory state via a viral , toxic , and/or allostatic load could lead to a maternal immune maladaptation to conception restricting trophoblast stem cell accumulation in the early embryo responsible for the production of hormones that enables successful implantation ( figure 2 ) [ 44 , 72 ] . \n oxidative stress is implicated in first trimester miscarriage from premature placental perfusion of maternal oxygenated blood and accompanying ros into the early embryonic environment . \n early embryo development occurs in a low oxygen state , and it is not until the tenth to twelfth week of gestation that maternal blood begins to gradually infiltrate the intervillous space of the yet fully developed placenta . \n the limited oxygen environment is thought to act as a protective mechanism against the deleterious and teratogenic effects of ros on early stem cells at a time of extensive cell division [ 64 , 138 ] . \n this early hypoxic environment also plays a vital physiological role in placental cell type differentiation switching from proliferative villous cytotrophoblasts into invasive extravillous trophoblasts ( evt ) important in spiral artery remodeling . at the end of the first trimester , \n oxygen tension rises sharply which coincides with the infusion of oxygenated maternal blood into the placenta and triggers an apoptotic cascade that serves to establish the definitive discoid placenta . \n evt invasion is insufficient allowing for the premature onset of maternal intraplacental circulation and its consequential burst of ros on the conceptus [ 70 , 192 ] . \n severe cases may result in pregnancy failure while more modest cases may initiate fetal - maternal adaption to impaired spiral artery remodeling leading to the ddp pathology and further complications later in pregnancy such as fgr and pih / pe ( figure 2 ) [ 69 , 70 , 193 ] . \n while oxidative stress and inflammation are conditions of normal pregnancy , they are consistently elevated in cases of pih / pe and central in its pathology . \n pih / pe stems from a defect in early trophoblast invasion insufficient to fully convert the spiral arteries into low - resistance channels [ 68 , 194 ] . \n the retention of smooth muscle cells remains active to circulating vasoconstricting agents such as stress hormones ( e.g. , glucocorticoids ) and other stimulants . \n the diminished and intermittent perfusion of maternal blood into the intravillous space produces transient hypoxia resulting in a chronic ischaemia - reperfusion ( i / r ) type injury . \n this further provokes ros synthesis and excess shedding of placental microvesicles which have proinflammatory , antiangiogenic , and procoagulant activity initiating endothelial dysfunction [ 6870 ] . \n elevated circulating levels of placental debris and ros biomarkers in the placental tissues of preeclamptic women are well documented [ 68 , 179 , 194 ] . \n similarly , prom can be considered part of the ddp syndrome but may represent a phenotype resulting from a less severe ddp pathophysiology compared to preeclampsia [ 61 , 62 ] . excess oxidative stress arising from multiple causes ( \n infection , inflammation , smoking , and cocaine use ) has been implicated in prom in addition to its role in ddp . \n both pih / pe and prom are leading causes of preterm birth , while pih / pe is a major risk factor for fgr ( figure 2 ) . \n deficiencies in ho-1 have been associated with preeclampsia as well as morphological changes in the placenta and elevations in maternal blood pressure . \n the bioactive ho-1 metabolites co and bilirubin may protect against preeclampsia through their vasodilatory properties and the suppression of the antiangiogenic factor sflt , respectively [ 171 , 172 ] . \n fgr has many causes however often arises from placental insufficiency due to compromised supply of oxygen and nutrients to the fetus which may have both short- and long - term health consequences on the offspring [ 51 , 82 , 195 ] . \n fgr is strongly associated with early onset or more severe cases of preeclampsia , and there is a clear etiological link between fgr and ddp as it involves abnormal placentation and reduced uteroplacental blood flow ( figure 2 ) [ 62 , 70 ] . \n alternatively , perturbed calcium homeostasis can induce chronic low - level stress within the endoplasmic reticulum leading to suppressed protein synthesis and a reduced growth trajectory of the placenta . \n cadmium , an environmental toxin and highly present in cigarette smoke , is a major antagonist of cellular calcium activities ( transport , uptake , and binding ) as well as in the transfer of other nutrients and zinc homeostasis within the placenta [ 134 , 185 , 196 ] . \n furthermore , cadmium is a known endocrine disruptor shown to impair hormone synthesis in the placenta including progesterone and leptin , important hormones in early pregnancy [ 49 , 175 , 186 ] . \n both smoking and air pollution exposure were associated with lower birth weights along with low blood progesterone levels and high placental cadmium concentrations compared to a non - exposed control group . \n inflammation is proposed as one potential mechanism leading to spontaneous preterm labour , both with intact membranes or prom . \n the classification of patients who deliver preterm can be categorized into two non - mutually exclusive clusters : those who present with inflammatory lesions ( e.g. , acute chorioamnionitis and funisitis ) and those with vascular lesions who tend to have longer gestational periods . the consequence of uteroplacental ischemia as a result of such lesions will depend on the severity , the timing , and duration of the insult . \n while a complete blockage of uterine arteries will lead to fetal death , less severe ischemia will result in different clinical phenotypes as a result of adaptive mechanisms for fetal survival . \n this may include fetal growth restriction if chronic underperfusion of oxygen and nutrients persists , the onset of maternal hypertension to sustain or increase uterine blood flow , and/or the initiation of preterm labour as a maternal / fetal adaptation to continued growth restriction in utero ( figure 2 ) [ 61 , 197 ] . \n cardiovascular lesions indicating thrombosis and atherosis are shown to be indirectly caused by exposure to pm2.5 and ufps via inflammatory and/or oxidative injury . \n exposure to pm2.5 and its constituents , including pahs and metals , induce oxidative stress and inflammation in many biological systems through various means ( figure 3 ) [ 48 , 7779 , 97 , 176 , 177 , 198 ] . \n one method is the direct generation of ros from free radicals and oxidants on particle surfaces including soluble transition metals such as iron , copper , chromium , and vanadium . as mentioned above \n , free iron can react with available superoxide or hydrogen peroxide to form highly reactive hydroxyl radicals [ 70 , 77 ] . \n pahs and other organic molecules absorbed to pm2.5 and ufps may account for a large proportion of their oxidative potential due to their ability to enter the cell and disrupt the mitochondria . \n altered function of mitochondria may produce excess quantities of nadph - oxidase which in turn generates large amounts of cellular superoxide , a process already in overdrive throughout pregnancy but particularly in the first trimester [ 70 , 77 ] . interpolated ambient pm10 exposure was shown to be negatively associated with the number of placental mitochondrial dna , a molecular marker of mitochondrial disruption and inflammation . \n this association was reversed with increasing distance from major roads , a proxy for traffic - related air pollution . \n alternatively , pm / pah mediated oxidative stress can be induced by the activation of the inflammation system . \n immunotoxic compounds can promote the release of proinflammatory cytokines , tnf- , and cox-2 , which in turn act in a positive feedback loop to generate more ros and oxidative stress . for example , modelled pm10 and pm2.5 exposure has been positively associated with elevated c - reactive protein ( crp ) levels , a biomarker of systemic inflammation , in both maternal first trimester blood and fetal cord blood in a dose - dependent manner [ 176 , 200 ] . \n crp is produced in the liver and part of the acute - phase response released during inflammatory reactions from cytokines produced in the lungs . \n raised crp is a risk factor for cardiovascular disease as a marker of unstable atheromatous plagues leading to thrombosis and ischemic events . \n exposure to diesel exhaust in healthy human volunteers resulted in pulmonary inflammation in addition to systemic inflammation , prothrombotic changes , and other cardiovascular effects consequent of proinflammatory events [ 99 , 201 ] . \n this hyper proinflammatory state , along with oxidative stress , is hypothesized to contribute to several apos [ 69 , 70 , 174 , 181 , 202 ] . \n indirectly , the cellular detoxification of pahs can induce oxidative stress and cytotoxicity by forming potent ros metabolite by - products . \n specifically , pahs and other organic xenobiotics ( notably pcbs and dioxins ) are detoxified by the cytochrome p-450 ( cyp ) superfamily of phase i and phase ii metabolizing enzymes . \n the expression of these enzymes is highly modulated by genetic polymorphisms , steroid / sex hormones such as glucocorticoids , insulin , estrogens , and progesterone , and micronutrient / dietary deficiencies [ 74 , 75 , 128 , 203 , 204 ] . \n furthermore , hypoxia , infection , and inflammation are shown , in general , to downregulate cyp enzymes which may affect the clearance and bioavailability of growth factors , hormones , drugs , and toxins [ 203 , 205 ] . \n cyp1a1 is the only isoform also significantly expressed in the placenta throughout pregnancy responsible for metabolizing steroid / sex hormones , growth factors , and fatty acids in addition to toxins . \n these exogenous and endogenous substances act as ligands to activate the aryl hydrocarbon receptor ( ahr ) , a transcription factor that mediates the biotransformation of such ligands ( pahs , estradiol , etc . ) into more polar and bioavailable metabolites by upregulating cyp enzymes \n . however , certain metabolites of pahs ( e.g. , o - quinones , arene oxide , and diol epoxide ) bind to dna , rna , and protein macromolecules to form toxic adducts that disrupt dna replication and are considered mutagenic [ 72 , 75 ] . \n such dna adducts have been found in newborn cord - blood positively correlated with maternal exposure to pahs . \n pahs have also shown to significantly decrease the accumulation of trophoblast stem cells in the early placenta thereby limiting their differentiation into other cell types vital for hormone synthesis and ongoing placental development , a process that could contribute to ddp . \n direct prenatal exposure to airborne pahs has been associated with fgr with an increased exposure - related risk in the first trimester [ 206 , 207 ] . \n secondary ( phase ii ) metabolizing enzymes are required to further detoxify reactive pah - metabolites in which their inefficient clearance results in prolonged exposure leading to sustained cytotoxicity and mutagenicity . \n phase ii enzymes include glutathione s - transferases ( gsts ) , udp - glucuronosyltransferases ( ugts ) , nad(p)h - dependent quinone oxidoreductase-1 ( nqo1 ) , and aldehyde dehydrogenase-3 ( aldh3 ) [ 75 , 205 ] . \n adequate diet and micronutrient status provides resilience against oxidative stress and inflammation caused by various exposures including air pollution , allostatic stress , infection , and smoking ( figure 4 ) [ 55 , 118 , 128 , 129 , 131 , 143 ] . \n many micronutrients such as essential trace metals are vital cofactors in several antioxidant enzyme systems . \n similarly , selenium and its incorporation into the amino acid selenocysteine are required for the functionality of all selenoenzymes , including gpx and gst . \n thus , selenium is essential in several aspects of human health , particularly conditions involving oxidative stress and inflammation such as cvd , immune function , cancer , and reproduction , but also thyroid regulation and brain diseases [ 208 , 209 ] . \n ros may have direct effects on oocyte quality and appears to be modulated by dietary antioxidant supplements . \n women who are obese tend to have higher rates of infertility that correlate with increased levels of oxidative stress biomarkers in their blood as excess glucose availability leads to higher mitochondrial ros synthesis [ 70 , 118 ] . selenium deficiency and corresponding reduced gpx activity has been documented in cases of recurrent miscarriage and spontaneous abortions [ 210212 ] and has also been associated with preeclampsia and preterm birth [ 213 , 214 ] . \n however , given the supposed role of oxidative stress in preeclampsia , treatment with certain antioxidants ( notably vitamins c and e ) has not produced reliable preventative results in experimental trials . \n one hypothesis is that inappropriate antioxidant regiment and/or administration too late in gestation are responsible and new therapeutic candidates include melatonin and selenium . \n interestingly , national programs in finland and new zealand fortifying food with selenium have been associated with a significant reduction in the rate of preeclampsia . \n furthermore , fatty acids and low density lipid ( ldl ) cholesterols necessary for the placental synthesis of oestrogens and progesterone are particularly vulnerable to oxidative injury . \n regulation of placental nutrient transport is controlled by several different mechanism , including imprinted genes , placental signaling pathways , various cytokines , and hormones such as insulin , leptin , glucocorticoids , and oestrogens ( for review see ) . \n the major placental transfer mechanisms include simple diffusion of lipophilic substances ( e.g. , oxygen , co2 , fatty acids , steroids , fat soluble vitamins , and anesthetic gases ) , restricted diffusion of hydrophilic substances , facilitated diffusion via a membrane bound carrier ( e.g. , glucose and other carbohydrates ) , and active transport which requires energy ( e.g. , amino acids , iron , calcium , and other divalent cations ) [ 45 , 217 ] . \n placental physiology , including spiral artery remodeling and placental villous surface area are major determinants dictating placental transport capacity , and the degree of placental developmental disruption correlates with the severity of obstetrical complications associated with ddp [ 51 , 62 ] . nutrition and diet can influence perinatal health in opposing directions ( i.e. , it can be an antagonist or agonist ) . \n poor / undernutrition such as high fat / calorie dense food and low micronutrient intake is more prevalent among women from low ses backgrounds which may partly explain higher rates of some apos [ 12 , 139142 ] . on the other hand , good nutrition and supplemental vitamin intake is capable of reducing the toxicity of everyday environmental stressors as well as preventing certain apos and congenital anomalies as shown with the successful reduction of neural tube defects with folic acid [ 128 , 143 , 218 ] . \n nutritional and/or genetically induced deficiencies in folate and vitamins b6 and b12 can disrupt the homocysteine - to - methionine pathway resulting in hyperhomocysteinemia ( hhc ) , a known risk factor of cardiovascular morbidities ( thrombosis , lesions , and infarcts ) and markers of oxidative stress [ 54 , 119 , 219 , 220 ] . \n hhc may similarly affect the highly vascularized placenta and has been associated with decidual vasculopathy and preterm birth [ 54 , 120 ] . \n omega-3 fatty acids abundant from eating salmon were shown to improve markers of oxidative stress , which may impart neurodevelopmental resilience against stressors [ 222 , 223 ] . \n dietary phytophenols from fruits , vegetables , herbs , and spices have shown to have antioxidant and anti - inflammatory properties capable of reducing infection - induced inflammatory and contractile pathways in human gestational tissues . \n significant differences in pregnancy outcomes between dominicans and african americans both exposed to similar levels of pahs in new york city neighbourhoods were thought to be due to healthful dietary / cultural practices in the dominican immigrant population . \n maternal smoking during pregnancy and exposure to ets remain to be two modifiable risk factors with the greatest potential for beneficial interventions ( figure 4 ) . \n their association with numerous apos including congenital anomalies is well documented [ 127 , 144146 ] , as have their associated prevalence with indicators of low ses and other socially patterned risk factors [ 147149 ] . \n the mechanisms involved leading to apos have been well reviewed [ 132 , 134 ] ; however , it is notable that the two main toxins present in tobacco smoke can also be absorbed to pm2.5 ( pahs more so than cadmium ) . \n cadmium ( cd ) exposure readily interferes with the active transport of essential minerals to the fetus , particularly zinc and calcium [ 46 , 135 , 196 , 226228 ] . \n cadmium and lead ( pb ) exposure has also been shown to reduce glycogen concentrations thereby potentially limiting available glucose to the fetus . \n cadmium has shown to disrupt placental leptin synthesis , a hormone with several vital functions including placental angiogenesis , immunomodulation , amino acid and fatty acid transport , as well as fetal pancreatic development important in the regulation of insulin - like growth factors and fetal body fat accumulation [ 49 , 51 ] . finally , synergistic effects in the generation of oxidative hydroxyl radicals have been observed between tobacco smoke and both ambient pm2.5 and diesel exhaust particles specifically . \n interestingly , the counterintuitive association between smoking and lower risk of preeclampsia was recently shown to vary according to the timing and intensity of smoking . \n it is possible that the increased exposure to co from smoking in late gestation acts as a vasodilator and at the same time inhibits the release of sflt-1 , a hallmark antiangiogenic factor implicated in the endothelial dysfunction present in preeclampsia [ 115 , 230 ] . reviewed elsewhere , the brain is the primary target and mediating organ through which ses - related stress pathways are translated to other body systems via the hypothalamic - pituitary - adrenal ( hpa ) axis . \n the hpa - axis is actively involved in several biological systems , including the cardiovascular , metabolic , immunological , and endocrinal effects in both mother and fetus to promote allostatic adaptation [ 165 , 231 ] . here , the neuroendocrine hormones of the hpa axis , corticotrophin releasing hormone ( crh ) , adrenocorticotropic hormone ( acth ) , and glucocorticoids ( gc ) , respectively , coordinate the biological response via feedback loops . \n the human placenta is also capable of releasing crh and other neuropeptides which interact with the hpa axis to regulate the maternal stress response as well as other normal pregnancy functions . \n proper levels of in utero glucocorticoids are essential for successful embryo implantation , fetal organ maturation , and the initiation of labour with glucocorticoid levels gradually increasing over the course of gestation . \n normally , levels of maternal cortisol rise sharply in the third trimester causing the release of placental crh in a positive adrenal - placental feedback loop . \n placental crh stimulates fetal cortisol secretion which in turn suppresses placental progesterone and activates the release of prostaglandins and oxytocin to promote uterine contractions [ 47 , 232 ] . \n however , early and increased levels of fetal glucocorticoids can impair growth and predispose to adult - onset diseases [ 136 , 233 , 234 ] . \n the placental enzyme 11-hydroxysteroid dehydrogenase type 2 ( 11-hsd2 ) protects the fetus from excess endogenous glucocorticoids by converting active cortisol into inactive cortisone . \n 11-hsd2 is hormonally regulated making it susceptible to endocrine disruption from chemical and nonchemical stressors such as maternal anxiety , inflammation , infection , cadmium exposure , and low caloric intake [ 136 , 138 , 224 , 235 , 236 ] . \n placental hypoxia associated with pih / pe has been shown to suppress 11-hsd2 activity which may be an adaptive response to counteract compromised fetal growth by allowing more cortisol to reach the fetus for organ development . \n low concentrations / activities of 11-hsd2 and high levels of cortisol have been associated with ptb and fgr [ 136 , 237 , 238 ] , two outcomes also associated with poor maternal psychosocial / mental health [ 233 , 234 , 239 ] . \n factors affecting 11-hsd2 activity that are associated with low ses include allostatic overload leading to the excess production of glucocorticoids that can overwhelm the fetal protective mechanism ( figure 4 ) [ 136 , 231 , 240 ] . \n indirectly , allostatic load is capable of disrupting the metabolic system leading to impaired glucose tolerance , insulin resistance , diabetes , and/or obesity , all of which are risk factors for various apos [ 138 , 165 , 231 ] . \n general maternal undernutrition and/or a low dietary protein intake has been shown to impair placental glucose transport and inhibit 11-hsd2 activity in pregnant rats leading to fgr , indicating a possible mechanism through poor diet [ 224 , 241 ] . \n additionally , cadmium has also shown to inhibit 11-hsd2 activity in both human and rodent placentas , and prenatal cadmium exposure has been shown to increase fetal corticosterone concentrations in rats which resulted in reduced birth weights . \n this suggests a possible mechanism from active or passive tobacco smoke exposure or ambient pm2.5 exposure [ 135 , 242 , 243 ] . \n collectively , it is possible for the cumulative exposures of pm2.5 , smoking , ets , poor dietary intake , and other ses - related factors to interact through the same 11-hsd2 mechanism to increase the risk of impaired fetal growth ( figure 4 ) . \n the ubiquitous exposure to particulate air pollution and its constituents ( e.g. , pahs and metals ) is but one class of environmental contaminants that can act through oxidative stress , inflammation , and/or endocrine disruption to promote developmental toxicity and adverse perinatal health [ 177 , 244 , 245 ] . summarized in figure 2 , a perturbed early in utero environment can lead to defective deep placentation resulting in a cascade of fetal - placental adaptive mechanisms contributing to a range of pregnancy complications and adverse outcomes . here \n the underlying biological , social , and physical risk factors likely intersect to produce excessive or atypical oxidative stress , inflammatory response , and biological antagonism to either initiate the defective deep placentation pathology and/or contribute to the severity of its phenotype . \n socioeconomic disparities are known to confound the environmental exposure effects ; however , they may also act as potential effect modifiers given their overlapping etiological mechanisms with pm2.5 exposure . \n while the traditional biomedical paradigm that views populations as a collection of independent individuals has yielded useful information regarding risk factors , elucidating the intersecting pathways involved in apos will require placing individual biologic and behavioural determinants within the social and spatial context [ 22 , 246 ] . \n it is now well recognized that ses operates at multiple levels of organization , and neighbourhood or community - level factors can work to either ameliorate or exacerbate certain risk factors [ 15 , 2426 ] . \n the healthy migrant paradox exemplifies these effects in which home country , education , and neighbourhood qualities combine to modify the expected perinatal outcomes often observed with low income households [ 161 , 247 ] . \n the ses risk factors that overlap or interact with the pm - mediated mechanisms include smoking , nutrition , and psychosocial stress acting through the hpa - axis and allostatic load . given \n this knowledge , interventions aimed at ameliorating these factors may be the best way to counteract the negative influences of low ses and air pollution exposure on fetal development . \n maternal smoking continues to be one of the most modifiable risk factors to lower the risk of apos [ 134 , 147 ] . \n furthermore , maternal smoking also tends to interact negatively with nutrient intake and status [ 133 , 248 ] . \n smokers in general have poorer nutritional profiles than nonsmokers with both behavioural and biological factors independently accounting for the differences in micronutrients such as folate and essential vitamins and minerals [ 133 , 248250 ] . while smokers tend to have lower dietary nutrient intakes , they also have an accelerated requirement for micronutrients due to increased inflammatory cell turnover caused by the oxidative stress of smoking , an effect more pronounced among heavy and long - time smokers . \n these interacting effects of smoking and nutrition are further compounded by their association with other indicators of low ses such as low education and income contributing to allostatic load [ 139 , 251 ] . \n nutrient intake may be ameliorative after an insult has occurred as shown in rat models of fetal alcohol syndrome where an omega-3 fatty acid enriched diet reversed the cellular effects of prenatal ethanol exposure on the fetal brain . \n therefore with respect to policy interventions , nutrition in the form of improved food security and micronutrient intake may serve to counteract the negative influences of both low ses and air pollution exposure [ 252257 ] . \n the complex mixture of particulate air pollution , especially pm2.5 and ufps which includes absorbed pahs and various metals , also emerges as an important target for risk reduction and management . \n the deserved scrutiny stems from their ubiquity in the environment , the myriad of emission sources , and their established association with apos [ 88 , 98 , 258 ] . \n the pervasiveness of pm2.5 and ufps in the environment means that a high proportion of people are exposed resulting in a high etiological fraction . \n therefore , even a modest reduction in exposure will have a large population effect with reduction of the societal costs of apos . \n notably , their sources are primarily local , such as vehicle emissions and industrial land - use . \n this makes them modifiable risk factors that can be addressed at the municipal and provincial / state level with better urban planning to reduce vehicle traffic , increasing access to green - space and enforcing air quality regulations [ 260263 ] . not unlike the accumulation of evidence on smoking and health outcomes or that of air pollution on cardiovascular and pulmonary health , the epidemiological and toxicological research \n over the past two decades has established a consistent dose - response association with high biological specificity , temporality , and plausibility [ 3 , 55 , 177 ] . \n taken in concert , these characteristics and further corroborating research should lend strength for evidence - based policy for intervention strategies targeting high risk areas in order to reduce the environmental burden of disease attributed to particulate air pollution [ 98 , 265 , 266 ] . \n adverse pregnancy outcomes such as fetal growth restriction and preterm birth are a public health priority of global importance . \n we have brought together the multidisciplinary literature on the current state of evidence linking the physical and social environment to specific adverse pregnancy outcomes . \n the evidence suggests that various exposures , whether socially or environmentally determined , may be interpreted by the fetoplacental unit in similar ways resulting in a common pathological foundation for adverse outcomes , namely , deficient deep placentation . given this background , \n well planned future epidemiology studies using multilevel models exploring various biological effects of the social and physical environment will have the potential to provide the evidence to establish crucial windows of fetal vulnerability with an aim to identify and mitigate modifiable risk factors .", "role": "user" }, { "content": "exposure to particulate air pollution and socioeconomic risk factors are shown to be independently associated with adverse pregnancy outcomes ; however , their confounding relationship is an epidemiological challenge that requires understanding of their shared etiologic pathways affecting fetal - placental development . \n the purpose of this paper is to explore the etiological mechanisms associated with exposure to particulate air pollution in contributing to adverse pregnancy outcomes and how these mechanisms intersect with those related to socioeconomic status . \n here we review the role of oxidative stress , inflammation and endocrine modification in the pathoetiology of deficient deep placentation and detail how the physical and social environments can act alone and collectively to mediate the established pathology linked to a spectrum of adverse pregnancy outcomes . \n we review the experimental and epidemiological literature showing that diet / nutrition , smoking , and psychosocial stress share similar pathways with that of particulate air pollution exposure to potentially exasperate the negative effects of either insult alone . \n therefore , socially patterned risk factors often treated as nuisance parameters should be explored as potential effect modifiers that may operate at multiple levels of social geography . \n the degree to which deleterious exposures can be ameliorated or exacerbated via community - level social and environmental characteristics needs further exploration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: pkc plays a requisite role in bcr abl - mediated resistance to chemotherapy - induced apoptosis ( murray and fields , 1997 ; jamieson et al . , 1999 ) , and is critical for epithelial cell polarity ( suzuki et al . , 2002 ) and cell survival ( murray and fields , 1997 ; jamieson et al . , 1999 \n the corresponding gene in rodents , which is 95% homologous to pkc at the amino acid level , is termed pkc. for clarity , we will refer to both the human and rodent genes and gene products as pkc. ) although pkc has also been implicated in ras - mediated signaling ( uberall et al . , 1999 ; coghlan et al . \n 2001 ) , nothing is known about its role in oncogenic ras - mediated transformation . \n activating ras mutations occur in 30% of all human cancers ( adjei , 2001 ) , and in 50% of human colon adenomas and carcinomas ( bos , 1989 ) . here , we investigate the role of pkc in ras - mediated oncogenic transformation . \n our data demonstrate that ras - mediated transformation , invasion , and anchorage - independent growth of intestinal epithelial cells requires pkc activity . \n furthermore , we demonstrate that pkc is critical for ras- and carcinogen - mediated colon carcinogenesis in vivo . \n as a first step in examining the role of pkc in colon carcinogenesis , we assessed the expression of pkc in normal mouse colonic epithelium and azoxymethane ( aom)-induced colon tumors . \n immunoblot analysis demonstrated that pkc is elevated in colon tumors compared with matched , uninvolved epithelium ( fig . \n rt - pcr analysis demonstrated a corresponding increase in pkc mrna in colon tumors ( fig . \n pkc was also elevated in human colon carcinoma specimens when compared with matched uninvolved colonic epithelium ( fig . \n 1 c ) , demonstrating that elevated pkc is a common feature of both mouse and human colon tumors . \n immunohistochemical staining confirmed the elevated expression of pkc in mouse colon tumors ( fig . 2 b ) compared with normal colonic epithelium ( fig . \n specificity of the immunostaining was confirmed by staining with antibody in the presence of a fivefold molar excess of the pkc peptide used to generate the pkc antibody ( fig . \n 2 , c and d ) . pkc is elevated mouse and human colon tumors . \n ( a ) total protein lysates and ( b ) total rna extracts were prepared from aom - induced mouse colon tumors and uninvolved colonic epithelium from the same animals as described previously ( gkmen - polar et al . , 2001 ) . \n ( c ) immunoblot analysis of lysates from colon tumor tissue and matched , uninvolved colonic epithelium from five patients with colon carcinoma . \n equal amounts of protein ( 50 g ) were subjected to immunoblot analysis for pkc and actin . \n lanes n1n5 indicate uninvolved human colonic epithelium ; lanes t1t5 indicate matched human colon tumors . \n immunohistochemical analysis of sections from ( a and c ) normal , uninvolved epithelium and ( b and d ) an aom - induced colon tumor from the same animal was performed using a specific pkc antibody in the ( a and b ) absence or ( c and d ) presence of competing pkc peptide as described in materials and methods . \n the elevated expression of pkc in colon tumors suggested that pkc may play an important role in colon carcinogenesis . to test this hypothesis \n , we generated transgenic mice that express either a constitutively active pkc ( capkc ) or kinase - deficient pkc ( kdpkc ) in the colonic epithelium . transgenic capkc and \n transgenic capkc mice exhibited high intrinsic pkc activity in the colonic epithelium when compared with nontransgenic littermates ( fig . \n , transgenic kdpkc mice exhibited decreased colonic pkc kinase activity when compared with nontransgenic littermates ( fig . \n neither transgenic capkc nor transgenic kdpkc mice exhibited demonstrable changes in proliferation or differentiation markers in the colonic epithelium ( unpublished data ) . \n next , we treated transgenic capkc , transgenic kdpkc , and nontransgenic mice with aom to induce colon carcinogenesis ( murray et al . \n , 1999 ; gkmen - polar et al . , 2001 ) and analyzed the mice for preneoplastic lesions , aberrant crypt foci ( acf ; fig . \n heterozygous transgenic capkc mice developed twice as many acf , and homozygous capkc mice developed three times as many acf , as nontransgenic littermates ( fig . 3 c ) . in contrast , homozygous transgenic kdpkc mice developed significantly fewer acf than nontransgenic mice . \n thus , pkc activity in the colonic epithelium correlates directly with susceptibility to aom - induced acf formation . \n ( a and b ) total protein lysates from scraped colonic epithelium from nontransgenic ( ntg ) and transgenic ( a ) capkc ( ca ) or ( b ) kdpkc ( kd ) mice were analyzed for pkc protein ( a and b , top ) and pkc activity by immunoprecipitation histone kinase assay ( a and b , bottom ) . \n ca / ca , homozygous capkc mice ; ca/+ , heterozygous capkc mice ; ntg , nontransgenic mice ; kd / kd , homozygous kdpkc. results represent the average acf / animal sem ( n = 49 ; * p = 0.05 vs. ntg ; * * p = 0.02 vs. ntg ) . \n ( d ) h&e - stained section of a tubular adenoma from a nontransgenic mouse . \n ( e ) h&e - stained section of a carcinoma in situ from a capkc mouse . \n transgenic capkc mice exhibited a threefold higher incidence of tumors than nontransgenic mice [ 63.6% ( 7/11 ) vs. 20% ( 2/10 ) tumor - bearing mice ] . \n in addition , transgenic capkc mice developed predominantly malignant intramucosal carcinomas ( 6/7 tumors ; fig \n . 3 e ) , whereas nontransgenic mice developed mainly benign tubular adenomas ( 2/3 tumors ; fig . 3 d ) . \n therefore , elevated colonic pkc activity increases the number of preneoplastic lesions and subsequent colon tumors , and promotes tumor progression from benign adenoma to malignant intramucosal carcinoma . due to the low tumor incidence in nontransgenic mice it was impractical to assess the effect of kdpkc on tumor formation . \n , 1999 ; coghlan et al . , 2000 ; kampfer et al . , 2001 ) \n , we assessed whether pkc is important for ras - mediated transformation of the intestinal epithelium . \n . , 2003 ) have used rat intestinal epithelial ( rie ) cells to study ras - mediated transformation , and elucidate the molecular mechanisms by which pkcii promotes carcinogenesis . \n ras - transformed rie ( rie / ras ) cells were transfected with flag - tagged , wild - type ( wt ) pkc or kdpkc. both rie / ras / wtpkc and rie / ras / kdpkc cells expressed elevated levels of pkc when compared with rie or rie / ras cells ( fig . \n immunoblot analysis using an antibody to oncogenic v12 ras demonstrated that rie / ras , rie / ras / wtpkc , and rie / ras / kdpkc cells express comparable levels of oncogenic ras ( fig . \n actin immunoblots confirmed that equal amounts of protein were loaded for each cell line ( fig . \n ( a ) rie cells were stably transfected with empty vector ( rie ) , ras ( rie / ras ) , ras and wtpkc ( rie / ras / wtpkc ) , or ras and dnpkc ( rie / ras / kdpkc ) . \n total cell lysates were subjected to immunoblot analysis for pkc ( top ) , oncogenic v12 ras ( second from top ) and -actin ( third from top ) . \n immunoprecipitates using a specific pkc antibody were analyzed for pkc expression ( fourth from top ) and pkc activity ( fifth from top ) . \n anti - flag immunoprecipitates were analyzed pkc expression ( second from bottom ) and pkc activity ( bottom ) . \n ( c ) active ( gtp bound ) rac1 was isolated from the indicated rie cell transfectants : control empty vector ; ras ; ras and racn17 ; ras and kdpkc ; and ras and kdpkc and racv12 . \n immunoblot analysis was performed for active rac1 ( top ) , total cellular rac1 ( middle ) , and actin ( bottom ) . \n data represent the average number of cells invading into the bottom chamber sd from three independent experiments . * p = 0.02 versus rie + control vector ; * * p < 0.02 versus rie / ras ; * * * p = 0.005 versus rie / ras / kdpkc. we next assayed rie , rie / ras , rie / ras / wtpkc , and rie / ras / kdpkc cells for total pkc activity ( jamieson et al . , 1999 ; fig . \n although rie and rie / ras cells expressed equivalent levels of endogenous pkc ( fig . \n 4 a , fourth from top ) , rie / ras cells exhibited elevated pkc activity ( fig . \n 4 a , fifth from top ) . thus , expression of oncogenic ras leads to activation of endogenous pkc while having no demonstrable effect on pkc expression . \n rie / ras / wtpkc cells expressed elevated pkc protein and activity when compared with rie or rie / ras cells , whereas rie / ras / kdpkc cells exhibited elevated pkc protein , but no increase in pkc activity when compared with rie / ras cells ( fig . \n immunoprecipitation with an anti - flag antibody followed by immunoblot analysis confirmed the expression of flag - wtpkc and flag - kdpkc in rie / ras / wtpkc and rie / ras / kdpkc cells , respectively ( fig . \n 4 a , second from bottom ) . assay of anti - flag immunoprecipitates for pkc activity confirmed that rie / ras / wtpkc cells express catalytically active flag - wtpkc , whereas rie / ras / kdpkc cells express catalytically inactive flag - kdpkc ( fig . \n these data demonstrate that oncogenic ras activates both endogenous and transfected pkc , and confirm that our kdpkc construct is deficient in kinase activity . \n rie / ras cells exhibited an increase in anchorage - dependent growth rate and saturation density compared with rie cells ( fig . \n expression of wtpkc or kdpkc had little effect on the ras - mediated increase in growth rate or saturation density ( fig . 4 b ) . \n rie cells expressing wtpkc or kdpkc in the absence of oncogenic ras exhibited no demonstrable change in growth rate compared with rie cells , and no signs of cellular transformation ( unpublished data ) . because ras transformation is dependent on activation of the small molecular weight gtpase , rac1 ( qiu et al . \n , 1995 ) , we measured rac1 activity in rie / ras cells ( fig . \n as expected , rie / ras cells exhibit elevated rac1 activity when compared with rie cells ( fig . 4 c ) . \n expression of either a dominant negative rac1 ( racn17 ) mutant ( qiu et al . , \n 1995 ) or kdpkc blocked ras - mediated rac1 activation . in contrast , expression of a constitutively active rac1 ( racv12 ) mutant ( qiu et al . , \n expression of wtpkc in the absence of oncogenic ras was not sufficient to induce rac1 activity ( unpublished data ) . \n both ras and rac1 have been implicated in cellular motility and invasion ( de corte et al . , 2002 ) and rie / ras cells exhibit an invasive phenotype ( fujimoto et al . , \n therefore , we assessed whether the invasive phenotype observed in rie / ras cells is dependent on rac1 and pkc. as expected , rie / ras cells are highly invasive , whereas rie cells are not ( fig . 4 \n expression of racn17 or kdpkc in rie / ras cells blocks ras - mediated invasion ( fig . \n however , expression of racv12 in rie / ras / kdpkc cells partially restores invasiveness . \n thus , oncogenic ras - mediated cellular invasion is dependent on both rac1 and pkc. interestingly , expression of either wtpkc or capkc in the absence of oncogenic ras failed to induce invasion , indicating that pkc is necessary for ras - mediated invasion , but is not sufficient to induce invasion in the absence of oncogenic ras ( unpublished data ) . \n rie / ras cells exhibit anchorage - independent growth in soft agar , whereas rie cells do not ( fig . 5 , a and b ) . \n expression of wtpkc significantly enhances , and expression of kdpkc blocks , soft agar growth of rie / ras cells ( fig . 5 , a and b ) . \n furthermore , expression of racv12 in rie / ras / kdpkc cells restores soft agar growth ( fig . \n expression of racv12 in rie cells in the absence of oncogenic ras does not induce soft agar growth , indicating that expression of active rac1 alone is not sufficient to cause cellular transformation ( fig . \n 5 c ) , which is consistent with previous reports that racv12 exhibits very weak transforming potential ( khosravi - far et al . , 1995 ) . \n these data demonstrate that pkc plays a critical role in ras - mediated transformation of rie cells because pkc is required for ras - mediated activation of rac1 , cellular invasion , and anchorage - independent growth . \n our data place pkc downstream of oncogenic ras and upstream of rac1 in a pathway that stimulates invasiveness and soft agar growth , two hallmarks of the transformed phenotype . \n next , we assessed the importance of pkc in ras - mediated colon carcinogenesis in vivo using transgenic mice expressing a latent oncogenic k - ras allele ( g12d ) that is activated by spontaneous recombination ( johnson et al . , 2001 ) . \n latent k - ras ( k - ras ) mice develop ras - dependent lung carcinomas and colonic acf ( johnson et al . , 2001 ) . \n we bred our transgenic kdpkc mice with k - ras mice to generate bitransgenic k - ras / kdpkc mice , and assessed them for spontaneous acf development ( fig . \n k - ras / kdpkc mice developed significantly fewer acf in the proximal colon than k - ras mice . \n these data are consistent with our results in rie / ras cells in vitro , and demonstrate that pkc is critical for oncogenic k - ras mediated colon carcinogenesis in vivo . \n expression of dnpkc blocks ras - mediated transformation of the intestinal epithelium in vitro and in vivo . \n ( a and b ) rie cells were stably transfected with control empty vector ( rie ) , ras ( rie / ras ) , ras and wtpkc ( rie / ras / wtpkc ) , or ras and kdpkc ( rie/ ras / kdpkc ) , and evaluated for growth in soft agar . \n ( c ) the indicated rie cell transfectants were analyzed as described in panel a. values represent the average of five determinations sem . \n * p = 0.008 versus rie / ras ; * * p = 0.0001 versus rie / ras / kdpkc. ( d ) 12-wk - old k - ras and k - ras / kd pkc mice were analyzed for acf in the proximal colon . \n average number of acf per mouse is plotted the sem ; n = 5 ; * p = 0.04 . \n our results provide direct evidence that pkc and rac1 are necessary for the transformed phenotype induced by oncogenic ras . \n rac1 has been shown to be required for transformation by both h - ras and k - ras , the two most commonly mutated forms of ras in human cancers . \n our data demonstrate that pkc is also required for both h - ras and k - ras mediated transformation . \n although h - ras and k - ras have both common and distinct effectors , both of these ras isoforms activate rac1 , though k - ras appears more effective than h - ras ( walsh and bar - sagi , 2001 ) . \n we have shown that h - ras induces rac1 activity through a pkc-dependent pathway and that pkc is required for k - ras mediated colon carcinogenesis . \n given the increased propensity of k - ras to activate rac1 , it is likely that the raspkcrac1 pathway we have elucidated in rie cells is also important for k - ras mediated colon carcinogenesis in vivo . \n interestingly , pkc and rac1 have also been implicated in epithelial cell polarity through formation of complexes containing pkc , par6 , and rac1 ( noda et al . , \n rac1 is thought to regulate pkc activity within these complexes to affect cell polarity ( noda et al . , 2001 ) . \n our data now implicate signaling through pkcpar6rac1 complexes in ras - mediated transformation . in this report , we present conclusive evidence that pkc is critical for colonic epithelial cell transformation both in vitro and in vivo . \n interestingly , disruption of pkc signaling by kdpkc has little effect on normal intestinal epithelial cell homeostasis in vitro and in vivo , suggesting that pkc may be an attractive target for development of novel therapeutics against colon cancer . \n aom - induced mouse colon tumors were produced in c57bl/6 mice as described previously ( gkmen - polar et al . , 2001 ) . \n fresh frozen tissue from human colon carcinomas and uninvolved colonic epithelium was obtained from surgical specimens . \n isolation of rna and protein for rt - pcr and immunoblot analysis , respectively , was performed as described previously ( gkmen - polar et al . , 2001 ) . \n immunoblot analysis for pkc and actin was conducted using isozyme - specific antibody against pkc and actin ( santa cruz biotechnology , inc . ) as described previously ( murray and fields , 1997 ; gkmen - polar et al . , 2001 ) . \n we determined previously that this pkc antibody recognizes pkc but not pkc ( murray and fields , 1997 ) . \n primers for rt - pcr analysis were as follows : pkc forward primer , 5-gcttatgtttgagatgatggcgg-3 , and pkc reverse primer , 5-gtgacaacccaatcgttccg-3 ; and actin forward primer , 5-gtgggccgctctaggcaccaa-3 , and actin reverse primer , 5-ctctttgatgtcacgcacgatttc-3. colon tumors and uninvolved colonic epithelium from aom - treated mice were fixed in 10% buffered formalin , sectioned , and subjected to antigen retrieval ( vector laboratories ) . \n immunohistochemical detection of pkc was performed using the specific pkc antibody ( santa cruz biotechnology , inc . ) and the dako lsab2 ( dab ) detection system ( dakocytomation ) . \n specificity of immunostaining for pkc was demonstrated by inclusion of a fivefold molar excess of the peptide used to generate the pkc antibody ( santa cruz biotechnology , inc . ) in the antibody dilution . \n digital images were acquired on a microscope ( model dx51 ; olympus ) equipped with a dp70 digital camera using a 20 objective lens . \n transgenic capkc and kdpkc mice were generated on a c57bl/6 background using the fabpl promoter ( simon et al . \n louis , mo ) to direct transgene expression to the colonic epithelium ( murray et al . , 1999 ) . \n isolation of colonic epithelium , immunoblot analysis for pkc , and immunoprecipitation histone kinase assays were described previously ( jamieson et al . , 1999 ; \n transgenic capkc , transgenic kdpkc , and nontransgenic mice were injected with either 10 mg / kg aom or saline as described previously ( gkmen - polar et al . , 2001 ) . \n acf analysis was performed 12 wk after the last aom injection ( murray et al . , \n 2002 ) using well - defined criteria ( mclellan et al . , 1991 ) . \n mice were analyzed at 40 wk for tumor number , size , location , and pathological grade as described previously ( gkmen - polar et al . , 2001 ) . \n all tumors were classified as either tubular adenomas or intramucosal carcinomas ( carcinoma in situ ) by z. gatalica , a board - certified pathologist . \n digital images of the tumors were captured on a microscope ( model eclipse e600 ; nikon ) equipped with a progres c14 camera ( jenoptik ) using a 20 objective lens . \n images were acquired using progres c14 software with microsoft photoeditor and processed with microsoft photoshop . \n transgenic k - ras mice ( johnson et al . , 2001 ; provided by t. jacks , massachusetts institute of technology , cambridge , ma ) were bred to transgenic kdpkc mice to obtain bitransgenic k - ras / kdpkc mice . at 12 wk old , transgenic k - ras and bitransgenic k - ras / kdpkc mice were assessed for spontaneous acf formation ( mclellan et al . , \n rie cells and derivatives were grown in dme containing 5% fbs as described previously ( ko et al . , 1998 ) . \n rie / ras cells were described elsewhere ( sheng et al . , 2000 ; provided by h.m . \n sheng , university of texas medical branch [ utmb ] , galveston , tx ) . \n microarray analysis of rie / ras cells demonstrated that these cells do not express pkc ( unpublished data ) . \n human wtpkc and kdpkc cdnas were cloned into the pbabe / flag / puro retroviral expression vector and virus stocks were produced using phoenix - e cells ( provided by g. nolan , stanford university , palo alto , ca ) . \n expression of flag - epitope tagged pkc was confirmed by immunoblot analysis using anti - flag antibody ( sigma - aldrich ) , and pkc kinase activity was determined by immunoprecipitation histone kinase assay as described previously ( jamieson et al . , 1999 ) . \n recombinant retroviruses containing myc - tagged racn17 or myc - tagged racv12 were generated by excising the myc - tagged rac1 constructs from pexv / rac vectors ( qiu et al . , 1995 ) with ecori and ligating them into the ecori site of the lzrs - gfp retrovirus . \n lzrs - gfp - rac1 retroviruses were used to infect rie cells and derivative cell lines using a protocol described previously ( ireton et al . , 2002 ) . \n rac1 activity was assessed by affinity isolation of gtp - bound rac1 using a protocol described previously ( sander et al . , 1998 ) . \n active gtp - bound rac1 and total rac1 were identified by immunoblot analysis using a rac1 mab ( bd biosciences ) and quantitated by densitometry . \n invasiveness of rie cell transfectants was assessed in transwell inserts precoated with matrigel ( 6.5-mm diam , 8-m pore size ; bd biosciences ) . \n dme containing 10% fbs was added to the bottom chamber and 5 10 cells were suspended in 500 l of serum - free dme and placed in the top chamber of the transwell insert . \n cells were incubated for 22 h at 37c in 5% co2 , at which time noninvading cells were removed from the top chamber . \n cells that had invaded through the matrigel - coated filter were fixed in 100% methanol , stained with crystal violet , and counted on a microscope ( nikon ) using a calibrated ocular grid . \n 15 representative areas of the bottom chamber were counted to determine the number of invasive cells in each well . to assess anchorage - independent growth , \n rie cell transfectants were suspended in dme supplemented with 10% fbs , 1.5% agarose , and a 1% insulin , transferrin , and selenium solution ( sigma - aldrich ) , and plated ( 300 cells/60-mm dish ) on a layer of 1.5% agar containing the same medium . \n cell colonies were fixed with 20% methanol and stained with giemsa after 714 d in culture and quantified under a dissecting microscope ( nikon ) . \n aom - induced mouse colon tumors were produced in c57bl/6 mice as described previously ( gkmen - polar et al . , 2001 ) . \n fresh frozen tissue from human colon carcinomas and uninvolved colonic epithelium was obtained from surgical specimens . \n isolation of rna and protein for rt - pcr and immunoblot analysis , respectively , was performed as described previously ( gkmen - polar et al . , 2001 ) . \n immunoblot analysis for pkc and actin was conducted using isozyme - specific antibody against pkc and actin ( santa cruz biotechnology , inc . ) as described previously ( murray and fields , 1997 ; gkmen - polar et al . , 2001 ) . \n we determined previously that this pkc antibody recognizes pkc but not pkc ( murray and fields , 1997 ) . \n primers for rt - pcr analysis were as follows : pkc forward primer , 5-gcttatgtttgagatgatggcgg-3 , and pkc reverse primer , 5-gtgacaacccaatcgttccg-3 ; and actin forward primer , 5-gtgggccgctctaggcaccaa-3 , and actin reverse primer , 5-ctctttgatgtcacgcacgatttc-3. colon tumors and uninvolved colonic epithelium from aom - treated mice were fixed in 10% buffered formalin , sectioned , and subjected to antigen retrieval ( vector laboratories ) . \n immunohistochemical detection of pkc was performed using the specific pkc antibody ( santa cruz biotechnology , inc . ) and the dako lsab2 ( dab ) detection system ( dakocytomation ) . \n specificity of immunostaining for pkc was demonstrated by inclusion of a fivefold molar excess of the peptide used to generate the pkc antibody ( santa cruz biotechnology , inc . ) in the antibody dilution . \n digital images were acquired on a microscope ( model dx51 ; olympus ) equipped with a dp70 digital camera using a 20 objective lens . \n human capkc and kdpkc cdnas were generated and characterized previously ( jamieson et al . , 1999 ; lu et al . , 2001 ) . \n transgenic capkc and kdpkc mice were generated on a c57bl/6 background using the fabpl promoter ( simon et al . \n louis , mo ) to direct transgene expression to the colonic epithelium ( murray et al . , 1999 ) . \n isolation of colonic epithelium , immunoblot analysis for pkc , and immunoprecipitation histone kinase assays were described previously ( jamieson et al . , 1999 ; \n transgenic capkc , transgenic kdpkc , and nontransgenic mice were injected with either 10 mg / kg aom or saline as described previously ( gkmen - polar et al . , 2001 ) . \n acf analysis was performed 12 wk after the last aom injection ( murray et al . , \n 2002 ) using well - defined criteria ( mclellan et al . , 1991 ) . \n mice were analyzed at 40 wk for tumor number , size , location , and pathological grade as described previously ( gkmen - polar et al . , 2001 ) . \n all tumors were classified as either tubular adenomas or intramucosal carcinomas ( carcinoma in situ ) by z. gatalica , a board - certified pathologist . \n digital images of the tumors were captured on a microscope ( model eclipse e600 ; nikon ) equipped with a progres c14 camera ( jenoptik ) using a 20 objective lens . \n images were acquired using progres c14 software with microsoft photoeditor and processed with microsoft photoshop . \n transgenic k - ras mice ( johnson et al . , 2001 ; provided by t. jacks , massachusetts institute of technology , cambridge , ma ) were bred to transgenic kdpkc mice to obtain bitransgenic k - ras / kdpkc mice . at 12 wk old , \n transgenic k - ras and bitransgenic k - ras / kdpkc mice were assessed for spontaneous acf formation ( mclellan et al . , 1991 ; murray et al . , 1999 ) . \n rie cells and derivatives were grown in dme containing 5% fbs as described previously ( ko et al . , 1998 ) . \n rie / ras cells were described elsewhere ( sheng et al . , 2000 ; provided by h.m . \n sheng , university of texas medical branch [ utmb ] , galveston , tx ) . \n microarray analysis of rie / ras cells demonstrated that these cells do not express pkc ( unpublished data ) . \n human wtpkc and kdpkc cdnas were cloned into the pbabe / flag / puro retroviral expression vector and virus stocks were produced using phoenix - e cells ( provided by g. nolan , stanford university , palo alto , ca ) . \n expression of flag - epitope tagged pkc was confirmed by immunoblot analysis using anti - flag antibody ( sigma - aldrich ) , and pkc kinase activity was determined by immunoprecipitation histone kinase assay as described previously ( jamieson et al . , 1999 ) . \n recombinant retroviruses containing myc - tagged racn17 or myc - tagged racv12 were generated by excising the myc - tagged rac1 constructs from pexv / rac vectors ( qiu et al . , 1995 ) with ecori and ligating them into the ecori site of the lzrs - gfp retrovirus . \n lzrs - gfp - rac1 retroviruses were used to infect rie cells and derivative cell lines using a protocol described previously ( ireton et al . , 2002 ) . \n rac1 activity was assessed by affinity isolation of gtp - bound rac1 using a protocol described previously ( sander et al . , \n active gtp - bound rac1 and total rac1 were identified by immunoblot analysis using a rac1 mab ( bd biosciences ) and quantitated by densitometry . \n invasiveness of rie cell transfectants was assessed in transwell inserts precoated with matrigel ( 6.5-mm diam , 8-m pore size ; bd biosciences ) . \n dme containing 10% fbs was added to the bottom chamber and 5 10 cells were suspended in 500 l of serum - free dme and placed in the top chamber of the transwell insert . \n cells were incubated for 22 h at 37c in 5% co2 , at which time noninvading cells were removed from the top chamber . \n cells that had invaded through the matrigel - coated filter were fixed in 100% methanol , stained with crystal violet , and counted on a microscope ( nikon ) using a calibrated ocular grid . \n 15 representative areas of the bottom chamber were counted to determine the number of invasive cells in each well . to assess anchorage - independent growth , \n rie cell transfectants were suspended in dme supplemented with 10% fbs , 1.5% agarose , and a 1% insulin , transferrin , and selenium solution ( sigma - aldrich ) , and plated ( 300 cells/60-mm dish ) on a layer of 1.5% agar containing the same medium . \n cell colonies were fixed with 20% methanol and stained with giemsa after 714 d in culture and quantified under a dissecting microscope ( nikon ) .", "role": "user" }, { "content": "protein kinase c ( pkc ) has been implicated in ras signaling , however , a role for pkc in oncogenic ras - mediated transformation has not been established . here , we show that pkc is a critical downstream effector of oncogenic ras in the colonic epithelium . \n transgenic mice expressing constitutively active pkc in the colon are highly susceptible to carcinogen - induced colon carcinogenesis , whereas mice expressing kinase - deficient pkc ( kdpkc ) are resistant to both carcinogen- and oncogenic ras - mediated carcinogenesis . \n expression of kdpkc in ras - transformed rat intestinal epithelial cells blocks oncogenic ras - mediated activation of rac1 , cellular invasion , and anchorage - independent growth . \n constitutively active rac1 ( racv12 ) restores invasiveness and anchorage - independent growth in ras - transformed rat intestinal epithelial cells expressing kdpkc. our data demonstrate that pkc is required for oncogenic ras- and carcinogen - mediated colon carcinogenesis in vivo and define a procarcinogenic signaling axis consisting of ras , pkc , and rac1 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in this issue of critical care , han and colleagues report that in a prospective , multicenter study of patients with severe sepsis - induced acute lung injury ( ali ) and acute respiratory distress syndrome ( ards ) , women were less likely than men to be treated with lung protective ventilation ( lpv ) during the first 48 hours of their illness . \n this gender disparity disappeared when the groups were adjusted for height and severity of illness . in a multivariate analysis , patient height and severity of illness remained significant predictors of receiving lpv during the first 48 hours of illness . \n while prior research has identified physician , respiratory therapist and nurse factors as potential barriers to implementation of lpv , this study identifies a population of patients who are especially vulnerable to receiving suboptimal ventilator management when being treated for ali / ards . \n this observation is an important contribution to our growing understanding of why implementation of lpv in patients with ali / ards is far from universal more than a decade after the ards network arma trial demonstrated an 8.8% absolute mortality reduction . \n the authors report that among all patients in their study , only half ( 53% ) received lpv . \n unfortunately , this proportion is similar to other reports in the post - arma era , reports published more than 5 years ago , suggesting the lasting impact of this advance may have been limited and has plateaued . \n this illustrates the difficulty of changing practice culture in the intensive care unit : despite the lpv protocol requiring no new equipment and minimal additional training , and despite unambiguous evidence of mortality benefit and a favorable cost - effectiveness profile , full adoption into clinical practice simply has not occurred . in the past 15 years , many of the greatest strides in intensive care have come not from the introduction of novel pharmaceuticals nor biomedical devices but instead from protocolized care delivery . \n interventions using protocols and checklists have shown clear benefit in the management of ali / ards , severe sepsis , sedation strategies , ventilator weaning and prevention of nosocomial infections . yet in most instances , incorporation into clinical practice has been slow and incomplete , with the persistence of , and considerable variance in , critical care practices and their attributable morbidity and mortality . \n a number of potential barriers to protocol implementation have been previously identified , including reluctance of providers to relinquish control , failure to recognize clinical contexts in which protocol initiation is indicated , a resistance to ' cookbook medicine ' in which clinical judgment is supplanted by algorithms , and ' clinical inertia ' . \n the association identified by han and colleagues between patient size and provider adherence with lpv is consistent with several identified by rubenfeld and colleagues , namely provider discomfort with low tidal volumes and the perception that ' my patient is an exception ' , for some reason outside of the population of patients who would benefit from strict lpv . \n the miscalculation of set tidal volume based on patients ' actual body weight rather than predicted body weight has been identified as a barrier to implementation of lpv , and was observed in 73% of patients in this current study . \n given that obesity is more common among women than men among us adults , use of actual body weight would tend to result in larger tidal volumes for women and may partly explain the disparity observed in the current study . \n but the significant association between patient height and adherence with lpv suggests that a more important cognitive barrier may be provider reliance on absolute tidal volumes rather than tidal volumes adjusted by patient 's predicted body weight , particularly when that calculation yields a seemingly too small tidal volume . \n short people with ali are not treated with the same reasoned judgment with regards to tidal volume as taller ones are . \n we surmise in most intensive care units tidal volumes are routinely reported in unadjusted , absolute terms ( milliliters per breath ) . here a simple lesson from human factors engineering is worthy of consideration : simply switching the reporting of tidal volumes from milliliters to milliliters per kilogram of predicted body weight could potentially alleviate provider discomfort with small absolute tidal volumes and make delivery of lpv more uniform and appropriate across a diverse patient population . \n gender disparities in intensive care outcomes have been increasingly recognized in recent years , and may reflect underlying physiological differences or discrepancies in treatment delivery . in this instance \n a significant gender disparity in the delivery of lpv disappeared when adjusted for patient height , suggesting at least some apparent gender disparities may instead reflect other underlying variance in patient factors . \n this mode of analysis is important in moving beyond the recognition of disparities in care by revealing and offering the opportunity to address patient and provider factors that drive them . \n ali : acute lung injury ; ards : acute respiratory distress syndrome ; lpv : lung protective ventilation . \n \n ", "role": "user" }, { "content": "though the benefits of lung protective ventilation ( lpv ) in acute lung injury / acute respiratory distress syndrome ( ali / ards ) have been known for more than a decade , widespread clinical adoption has been slow . \n han and colleagues demonstrate that women with ali / ards are less likely than men to receive lpv , though this disparity resolves when the analysis is adjusted for patient height . \n this analysis identifies patient height as a significant factor in predicting provider adherence with lpv guidelines , and illuminates why some disparities in intensive care exist and how they may be resolved via improved utilization of evidence - driven protocols .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: allergies represent one of the most prevalent chronic illnesses in the united states , affecting 4050 million individuals . \n although allergies are often viewed as non - life - threatening , they are increasingly recognized to have a significant negative impact on one 's social , emotional , occupational , and physical functioning [ 2 , 3 ] . \n much of the research regarding psychosocial adjustment to allergies focuses primarily on younger children and on specific subgroups of allergies ( i.e. , food - related allergies ) , rather than the broader disease itself . \n examinations of adults with allergies have demonstrated that adolescents and young adults ( ayas ) experience pejorative psychosocial outcomes compared to healthy peers [ 5 , 6 ] . \n relatively few studies have examined the impact of allergy symptom severity on these psychosocial outcomes ; however , kovcs and colleagues found that ayas and adults who reported more depressive symptoms also reported more severe allergic complaints . \n additionally , for ayas with asthma , greater asthma symptom severity was found to be significantly related to increased depressive and anxious symptoms \n . what has yet to be identified , however , are factors that potentially mediate or explain the precise relationship between allergy severity and negative psychosocial outcomes . \n importantly , researchers have demonstrated a strong relationship between attitude toward illness and anxious and depressive symptoms . \n lebovidge and colleagues found that children with arthritis who have a positive attitude toward their illness have lower levels of depressive and anxious symptoms . \n a similar relationship has been demonstrated in children with food allergies , such that a more negative attitude toward their allergies was associated with increased symptoms of anxiety and depression . to our knowledge , \n no researchers have examined the impact of attitude toward illness on psychosocial outcomes in ayas with allergies \n . it may be that ayas who view their illness negatively ( i.e. , evidence more negative attitudes ) are more likely to withdraw from others and allow their illness to impact their daily activities [ 9 , 11 ] . \n in contrast , those who have a more positive attitude toward their illness may be more resilient and open to new opportunities . to understand how illness attitudes may influence the relationship between illness severity and psychosocial functioning , lazarus and folkman 's stress , appraisal , and coping model \n this model suggests that the way an individual appraises or thinks about a stressor will predict how well he / she copes with that stressor . in the context of ayas with allergies , allergies serve as the stressor with which an individual must cope . \n greater allergy symptom severity may negatively impact an individual 's attitude toward his / her illness because symptoms interfere with daily tasks and , in turn , cause distress . from the extant research on attitude toward illness \n , we know that a young adult 's attitude toward his / her illness ostensibly determines psychological adjustment , including depressive and anxious symptomatology . using this model as a theoretical framework , it was hypothesized that attitude toward illness would mediate the relationship between allergy severity and depressive or anxious symptoms , such that , attitude toward illness would clarify and explain part of the relationship between allergy severity and depressive or anxious symptoms . \n the current study included 214 undergraduate students between the ages of 1725 years ( m = 19.52 , sd = 1.50 ) with self - reported allergies . \n the majority of the ayas were female ( 73.4% ) and most self - identified as caucasian ( 80.4% ) . \n the ethnic breakdown is consistent with the ethnic distribution of the university where the study was conducted ; demographic information can be found in table 1 . \n participants reported whether they experienced allergic reactions to environmental , food , animal , or other allergens . \n participants completed a demographic questionnaire where they provided information regarding their age , sex , ethnicity , education level . \n they also provided information about their allergies , including self - reported disease severity on a 5-point likert scale and types of allergies . \n the ces - d is a 20-item , self - report measure of depressive symptoms . for each item \n each of the items is ranked on a four - point likert scale , ranging from occurring rarely or none of the time to most or all of the time . \n responses were summed to calculate a total score , with greater scores representing higher levels of depressive symptomatology . \n good to excellent ( .85.90 ) internal consistency reliability has been demonstrated for the ces - d . \n cronbach 's alpha for the ces - d total score for the current sample was excellent at .90 . \n the sas is a 20-item , self - report measure of anxious symptoms . for each item , participants indicated the extent to which they had experienced each symptom within the last week . each of the items is ranked on a four - point likert scale , ranging from occurring none or a little of the time to most of the time . \n responses were summed to calculate a total score , with higher scores indicating greater levels of anxious symptomatology . \n cronbach 's alpha for the sas total score for the current sample was good at .86 . \n the catis is a 13-item , self - report measure of an individual 's feelings about having a chronic illness . \n each item is ranked on a five - point likert scale , ranging from very bad or never to very good or very often . a mean response for all items \n the catis was first validated with children aged 812 years with epilepsy and asthma and has been adapted for individuals with other chronic illnesses , including type 1 diabetes , juvenile rheumatic diseases , and allergies . \n the catis has also been validated in a sample of adolescents with epilepsy . for the current study , \n the catis was adapted from the original version for individuals with allergies by changing items to include allergies \n ( e.g. , how often do you feel different from others because of your allergies ? ) . \n good ( .87.89 ) internal consistency reliability has been demonstrated for the catis in an adolescent population . \n cronbach 's alpha for the catis total score for the current sample was good at .82 . \n participants were recruited from an online participant pool for undergraduate students at a large midwestern university . the participants self - identified having allergies and completed all measures online as part of a larger study examining psychosocial adjustment in college students with allergies . the study had approval from the university 's institutional review board , and all participants received research credit for an undergraduate class in exchange for their participation . \n a series of bivariate correlations was first conducted to determine if any demographic variables ( i.e. , age , gender , and ethnicity ) were related to any outcome variables ( i.e. , ces - d total score , sas total score , and catis total score ) . results revealed that gender was significantly related to ces - d total score , r = .15 , p = .02 , sas total score , r = .27 , p < .001 , and catis total score , r = .21 , p = .002 . specifically , female ayas reported higher levels of depressive and anxious symptoms and had more negative attitudes toward their illness than male ayas . \n the ranges , means , and standard deviations for the outcome variables can be found in table 3 . the sample was also examined to determine the number of ayas reporting clinically significant levels of depressive and anxious symptoms . using the clinical cutoff scores identified by the authors [ 13 , 14 ] , 43.5% of the sample were found to be experiencing clinically significant levels of depressive symptoms , and 22.4% were found to be experiencing clinically significant levels of anxious symptoms . \n analyses of the direct and indirect effects of allergy severity on anxious and depressive symptoms were conducted using the recommendations of preacher and hayes [ 18 , 19 ] , who recommend using bootstrapping to decrease type 1 error rates and increase power . \n the indirect macro developed for spss by preacher and hayes was utilized in the following analyses . \n a significant direct relationship was observed between subjective allergy symptom severity and catis total score , t(213 ) = 3.59 , p < .001 , indicating that ayas who reported more severe symptoms had more negative attitudes toward their illness . \n another significant direct relationship was observed between catis and ces - d total scores , t(213 ) = 6.44 , p < .001 , such that ayas with more negative attitudes toward their illness reported more depressive symptoms . \n a nonsignificant direct relationship was observed between disease severity and ces - d total score , t(213 ) = 1.70 , p = .09 . \n however , after controlling for catis total scores , the direct relationship between subjective allergy severity and depressive symptoms became less significant , and the overall model was significant , f(3 , 210 ) = 17.03 , p < .001 . \n the partial effect of gender was not significant , suggesting that gender did not impact the relationship between disease severity and depressive symptoms . \n as zero did not fall within the 95% confidence interval , post hoc bootstrapping results supported the mediation results ( 95% ci = .56 to 2.34 ) . \n for the anxious symptoms model , a significant direct relationship was observed between subjective allergy symptom severity and catis total score , t(213 ) = 3.59 , p < .001 , indicating that ayas who reported more severe symptoms had more negative illness attitudes . \n another significant direct relationship was observed between catis and sas total scores , t(213 ) = 6.70 , p < .001 , such that ayas with more negative attitudes toward their illness reported more anxious symptoms . \n also , a significant direct relationship was observed between subjective allergy symptom severity and sas total score , t(213 ) = 2.47 , p = .01 , such that individuals with more severe allergy symptoms reported more anxious symptoms . after controlling for catis total scores , \n the relationship between allergy severity and anxious symptoms was no longer significant , thus confirming that illness attitudes mediated the relation between allergy severity and anxious symptoms , f(3,210 ) = 24.36 , p < .001 . \n the partial effect of gender was significant , t(213 ) = 2.77 , p = .006 , suggesting that gender may impact the relationship between disease severity and anxious symptoms ; however , as zero did not fall within the 95% confidence interval , post hoc bootstrapping results supported the mediation results ( 95% ci = .52 to 2.23 ) . \n the results of the current investigation suggest that allergy symptom severity is significantly related to anxious symptoms and that attitude toward illness significantly mediates the relationship between allergy severity and both depressive and anxious symptoms in ayas , after controlling for gender . \n these results indeed suggest that illness attitudes can significantly impact psychological functioning in ayas with allergies . \n in contrast with previous research , we did not find that self - reported disease severity was significantly related to depressive symptoms , perhaps due to the exclusion of individuals with comorbid asthma in the current study . \n however , there was a significant relationship between self - reported allergy severity and anxious symptoms , such that the ayas with more severe allergy symptoms reported more anxious symptoms . \n for both models , attitude toward illness significantly mediated the relationship between disease severity and depressive and anxious symptoms . \n the results of this study confirm that attitudes impact an individual 's psychosocial functioning and reported disease severity , and these results are consistent with lazarus and folkman 's stress , appraisal , and coping model , which posits that feelings / attitudes are indeed related to illness severity and experiences of distress . \n our results would indicate that attitude toward illness is one pathway in which disease severity impacts depressive and anxious symptoms in ayas with allergies . \n it is important to note that high rates of ayas met the suggested clinical cutoffs based on their reported anxiety and depressive symptoms , as 43.5 and 22.4 percent met the cutoffs for depressive and anxiety symptoms , respectively . \n this suggests that although we utilized a nonclinical population , ayas are indeed having significant adjustment difficulties . as such , our study suggests that the psychosocial adjustment of ayas with allergies should be assessed periodically as they transition to adulthood . \n first , participants were recruited from a large midwestern university , and as a nonclinical population , they may not be representative of individuals with more severe symptoms . \n participants also self - reported their diagnosis and severity levels , and this was not confirmed with physician report . \n additionally , the psychosocial functioning was assessed using self - report measures , so the results may reflect shared method variance . \n overall , the current study builds upon past research examining the impact of severity on depressive and anxious symptoms and the role of attitude toward illness . \n the current study also adds to the literature examining psychosocial outcomes of ayas with allergies . \n such research is critical , as young adults remain an understudied population in chronic illness literature . \n clinically , our results would suggest that one 's attitude toward their illness is a potential target for intervention to reduce depression and anxiety in ayas with allergies .", "role": "user" }, { "content": "the current study examined the relationship between self - reported allergy severity , depressive and anxious symptoms , and attitude toward illness in adolescents and young adults ( ayas ) with allergies . \n participants were 214 undergraduate students between the ages of 1725 years with self - reported allergies . \n participants completed the center for epidemiological studies depression scale ( ces - d ) , the zung self - rating anxiety scale ( sas ) , and the child attitude toward illness scale ( catis ) as measures of depressive symptoms , anxious symptoms , and attitude toward illness , respectively . using the bootstrapping method , results revealed that attitude toward illness mediated the relationship between self - reported disease severity and depressive and anxious symptoms . \n results of the current study suggest that attitude toward illness is one pathway by which subjective disease severity impacts psychological functioning in ayas with allergies .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: disseminated intravascular coagulation ( dic ) is a life - threatening complication of several disease states including sepsis , cancer , obstetrical complications , trauma and aortic aneurysm , although dic associated with aortic aneurysm is rarely reported in korea . \n the definitive treatment for dic caused by an aortic dissecting aneurysm , involves lesion removal and the infusion of coagulation factors during the operation to minimize blood loss . \n we reported a case of dic caused by an aortic dissecting aneurysm , which was resolved by non - surgical therapy . \n a 55-year - old female patient was transferred from another hospital because of chest pain radiating to her back and thrombocytopenia . \n she had been diagnosed as having essential hypertension approximately 3 years earlier , but was not medicated . the chest pain developed upon exertion and radiated to her back the day prior to admission to a local hospital ; it persisted and became more severe after admission . on admission , \n her temperature was 36.8c , her pulse rate was 106 , her respiration was 20 , and her blood pressure was 190/100 mmhg . on physical examination , the patient appeared acutely ill , but her heart sounds were normal . \n urinalysis revealed many red blood cells and 05 white blood cells per high power field . \n chest radiographs revealed mediastinal widening , and a computer tomography ( ct ) scan of the thorax and abdomen revealed a dissecting aneurysm of the descending thoracic aorta , which descended inferiorly to the proximal abdominal aorta ( figure 1 ) . \n on the 2 day of admission , the patient reported an improvement in her chest pain , and she had a platelet count of 63,000/mm . \n on the 7 day , her platelet count was 377,000/mm , and her prothrombin and partial - thromboplastin times were normal . \n we followed up the aortic dissecting aneurysm by a thorax ct on the same day and disease progression was not observed . at 3 weeks after admission , her blood pressure and pulse rate had normalized and her chest pain had fully subsided . \n the dic profiles , including platelet count , prothrombin and partial - thromboplastin times , d - dimer , fdp , antithrombin iii , and fibrinogen , had normalized ( table 1 ) . \n outpatient follow - up by laboratory testing , thorax ct , and echocardiography have been performed at regular intervals over a period of 9 months , and the patient is doing well . \n disseminated intravascular coagulation ( dic ) is a rare complication of aortic dissecting aneurysm , but a well - recognized one . in the current series of patients with aortic aneurysm , 40% \n were found to have elevated levels of fibrinogen split products , but only 4% experienced significant bleeding and laboratory evidence of dic . \n the pathogenesis of coagulopathies , caused by aortic dissecting aneurysm , may be related to the release of endothelin , thromboplastin , and other attractants from the exposed subendothelial tissue and to the subsequent clot formation . \n dic implies the consumption of platelets , fibrinogen , and coagulation factors because of extensive in vivo coagulation . \n the mechanical destruction of platelets as the blood flows over the thrombus may also play a role there is no single laboratory test that can establish or rule out a diagnosis of dic . in clinical practice , \n a dic panel typically consists of a platelet count , a fibrinogen level , a prothrombin and a partial thromboplastin time , and a measurement of d - dimer ( or fdp ) level . \n tests for d - dimers may be helpful in the differentiation of dic from other conditions that are associated with a low platelet count or a prolonged clotting time . \n quantitations of selected coagulation inhibitors , including antithrombin iii and/or protein c , may provide useful prognostic information . a scoring system that uses simple laboratory tests \n has recently been published by the dic subcommittee of the international society on thrombosis and haemostasis . \n a score of 5 was deemed compatible with a diagnosis of dic , but the published scoring system has not yet been validated by prospective studies . in the present case , a low platelet count ( < 50,000/mm , scoring 2 ) , a moderately elevated fdp ( 20 g / ml , scoring 2 ) , and a low fibrinogen level ( < 1.0 \n g / l , scoring 1 ) were obtained , giving a total score of 5 . on admission , \n the patient s d - dimer level was elevated to 2.0 g / ml and her anti - thrombin iii level depressed to 19.7 mg / dl , which is compatible with overt dic . \n when these two conditions coexist , they create a difficult clinical problem that requires optimal medical and surgical care . \n bleeding diathesis must be corrected before surgery in order to prevent massive intraoperative bleeding . in this respect , \n if bleeding is brisk or surgery is contemplated , cryoprecipitate , platelet concentrates , and fresh - frozen plasma should be given ; anti - thrombin iii concentrate and gabexate may also be effective in some cases . \n we recommended surgical intervention in the present case , but the patient refused , so we treated her using intravenous antihypertensive agents and antithrombin iii replacement . \n she was discharged without any complication , and has remained symptom - free and well during the 9 months since discharge .", "role": "user" }, { "content": "disseminated intravascular coagulation ( dic ) is an acquired coagulation disorder that occurs when the normal hemostatic balance is disturbed , primarily by excessive thrombin formation . moreover , while dic is a rare complication of aortic dissecting aneurysm , it is also a well - recognized one . \n we reported a case of dic associated with aortic dissecting aneurysm in a 55-year - old woman who was transferred from another hospital because of chest pain radiating to her back and thrombocytopenia . \n laboratory findings showed dic with severe thrombocytopenia , and she was diagnosed as having an acute aortic dissection and dic . \n after medical treatment on the aortic dissecting aneurysm , her dic profile recovered .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: surface current balance condition yields a current system at astronomical bodiescurrent system possible for sharp ( airless ) objects of any sizecurrent system is thermoelectric and motion through the plasma nonessential surface current balance condition yields a current system at astronomical bodies current system possible for sharp ( airless ) objects of any size current system is thermoelectric and motion through the plasma nonessential \n nonconductive objects in equilibrium with space plasmas are subject to the requirement that time - averaged positive and negative currents into ( i.e. , normal to ) their surfaces , including ambient electrons and ions , and secondary and photoelectrons must balance at every point . a classic problem in spacecraft design and operation is determining the local conditions of this equilibrium , including local potential , sheath formation , and local surface charge [ garrett , 1981 ; wipple , 1981 ] . \n many studies have extended this physics to surfaces of planetary bodies [ roussos et al . , 2010 ; nordheim et al . , \n 2014 ] , e.g. , to the problem of solar wind charging of the lunar surface [ farrell et al . \n , 2010 ; freeman and ibrahim , 1975 ; manka , 1973 ; stubbs et al . , \n we consider the question of surface current balance in the presence of an ambient planetary magnetic field , as elucidated by cassini spacecraft measurements of saturn 's satellite rhea during two close encounters on 2 march 2010 and 11 january 2011 . as shown in figure1 , the flybys designated r2 and r3 , respectively passed directly through the rhea flux tube over the north and south poles , at 97 and 72 km altitude . as expected for a plasma - absorbing body , the cassini fluxgate magnetometer ( mag ) [ dougherty et al . \n , 2004 ] measured ( figure2 ) an augmentation of the southward ( z - directed ) magnetic field due to the diamagnetic current circulating rhea 's flux tube and equator orthogonal to the field , which serves to compensate the absorption of plasma pressure by the body . since rhea orbits within saturn 's inner magnetosphere at 8.75 saturn radii , it 's orbital motion is overtaken by the corotating ( collisionless ) plasma , forming a leading side plasma wake which also carries a portion of the diamagnetic current ( figure1 ) . \n rhea r2 and r3 north and south polar flyby configuration , showing the relation of the moon , the flux tube , the ambient saturn magnetic and corotation electric field directions , and the xyz coordinate system . x and o denote fields and flows into and out of the page , respectively . \n ( a ) north polar view showing ( green dashed line ) the expected diamagnetic current flow and the related magnetic field enhancement ( pink x ) which compensates pressure absorption by rhea . \n -parallel ion diffusion causes rapid wake infilling downstream of rhea , leading to diamagnetic current closure across the wake which may couple to alfvnic field - aligned currents due to ion gyroradius effects ( green x , o ) [ simon et al . , \n ( b ) equatorial view looking upstream , showing the observed -directed enhancement in the flux tube and orthogonal perturbations circling the flux tube edge ( dotted lines ) . \n cassini mag , , and measurements ( black ) versus spacecraft y coordinate for the ( top ) r2 and ( bottom ) r3 encounters , with the differential ( red , from simon et al . ) and integral ( blue , this work ) hybrid models also shown . \n the ihm assumes 4 ( r2 ) and 7 ( r3 ) cm densities and a blurred rhea resistivity profile to obtain approximate agreement with the dhm . \n the models reproduce the broad features of the data but not the sharp peaks aligned with the flux tube edge at y 1 ( dashed lines ) . however , mag also measured intense perturbations of the magnetic fields in the x and y directions ( figure2 ) , i.e. , orthogonal to the -directed ambient field , which is unusual . \n such orthogonal perturbations are reminiscent of the field - draping pattern associated with the pedersen current or pickup ions of a planetary atmosphere in relative motion to the ambient plasma , as seen , for example , at enceladus [ simon et al . \n , 2011 ] , io [ saur et al . , 2002 ] , and europa [ volwerk et al . , 2007 ] . \n in fact , cassini 's ion neutral mass spectrometer [ waite et al . , 2004 ] found an o2 and co2 atmosphere at rhea during the r2 and r3 flybys [ teolis et al . , 2010 ; teolis and waite , 2012 ] , but the molecular abundance ( 2.5 10 o2 ) yields conductivity values in the range 0.110.43 , roughly 2 orders of magnitude less than necessary to explain the orthogonal field perturbations [ simon et al . , \n we have also analyzed ( this work ) cassini plasma spectrometer ( caps ) [ young et al . , \n 2004 ] data from the downstream r1 2005 and r1.5 2007 rhea flybys and estimate rhea 's total pickup ion source to be 10 ions / s ( 1 g / s ) or 1.6 ka , still substantially less than the 14 ka ( see below ) required to explain the field perturbations . \n , who showed that the short length ( 4 rhea radii ) of rhea 's plasma wake results in a downstream diamagnetic current , orthogonal to the flow and parallel to the ambient corotation electric field , which has sufficient magnitude to account for the strength of the orthogonal perturbations . \n they propose that the current and associated electromagnetic disturbance is propagated against the plasma flow by a standing current - carrying alfvn wave , or \n wing , similar to the magnetospheric interaction of satellites possessing significant conductive atmospheres [ neubauer , 1998 ] , and rhea alfvn wings have been confirmed by downstream mag data from two distant ( 102 and 54 rhea radii ) cassini flybys [ khurana et al . , \n 2012 ] . using a standard differential - type hybrid modeling ( dhm ) code ( particle ions and magnetohydrodynamic ( mhd ) fluid electrons ) that solves a differential equation for the electron fluid , simon et al . have simulated the modification of rhea 's wake currents due to ion gyroradius effects and predict field perturbations generally resembling the measured signatures ( figure2 ) . \n however , here we focus on the abrupt changes of , measured coincidently with the flux tube boundary on both flybys , which the dhm fit did not capture ( figure2 ) . \n each change occurred over short distances of roughly 100 km much shorter than the plasma 's 500 km ion inertial length and therefore too short to be alfvnic . \n the abrupt magnetic perturbation is an unequivocal indication of a field - aligned current at the flux tube boundary intersecting cassini 's trajectory . \n this flux tube current appears to be a consistent feature of rhea 's plasma interaction , as implied by its presence on two cassini encounters in opposite hemispheres . \n current was discussed by santolik et al . and simon et al . , who noted that a current homogeneously distributed in the flux tube provides , at best , only a rough fit to the observed field perturbations . \n in figure3 we have applied the axially symmetric form of ampere 's law in cylindrical coordinates to estimate the required ( inhomogeneous ) current distribution in the flux tube . \n the currents are of the order 10 a / m , which is unfortunately below the 10 a / m discernible by caps , according to our analysis of the r2 and r3 ion and electron flux data acquired by the caps ion mass spectrometer and electron spectrometer . the total flux tube current is 7 ka in each hemisphere , i.e. , 14 ka in total assuming north / south symmetry . \n one can see that the field - aligned current , which flows out from rhea , is concentrated at the flux tube edges as noted by santolik et al . \n , with a return shielding current apparently just outside the flux tube ( figure3 ) . \n ( a ) from r2 data ( top ) : ampere 's law estimate of the -directed current versus radial distance from the flux tube ( black line ) , compared with the ihm prediction for a sharp rhea resistivity profile ( red line ) , and the analytical expression ( with for r > 1 ) for the electron current needed to balance uniform irradiation of a sphere by a 270 ev , 10 m ion plasma ( blue dashed line ) . \n note that the infinities of at r = 1 are artifacts owing to the neglect of the finite electron gyroradius . \n mag data ( bottom ) ( black ) and the expression ( or for r > 1 ) for the azimuthal wire field magnitude from ( blue dashed line ) . \n the broad hump in on r3 ( not captured by the analytic expression ) is a second - order effect due to the higher plasma ( 6 cm ) than r2 ( 3 cm ) ; see figure8 and text . \n both flybys show evidence for current peaks outflowing from rhea near the edge of the flux tube ( consistent with the analytical and ihm prediction ) and an oppositely directed shielding current just outside the tube ( not anticipated by the analytical expression but predicted by the ihm ) . \n we consider here the concept sketched in figure4 , invoking ( i ) the difference of average ion and electron gyroradii rgi and rge ( table 1 ) and ( ii ) the requirement for current balance on the sharp rhea surface to explain the observed current system . \n as shown the ions are absorbed into rhea from ( roughly ) all directions , discharging across magnetic field lines with ease due to the large gyroradius , while the electrons are constrained to flow north / south along the field lines . \n hence , the flux tube current is carried by the electrons , which flow most strongly along the tube rim , into rhea 's low - latitude surface to compensate ion deposition there . simply considering the electron flow necessary to balance ion flux onto the sphere ( assuming as an approximation uniform flux ) , we obtain to first - order for r 1 ( r > 1 ) , and a resultant -perturbation circular around the z axis of magnitude for r 1(r > 1 ) , with radial coordinate r in units of rhea radii r. as shown in figure3 \n , these simple expressions predict the basic shape and magnitude of the observed field perturbations and in particular the current and field perturbation maxima at the flux tube edges . \n ions discharge into the body approximately uniformly ( we neglect for simplicity the leading / trailing hemispherical difference due to corotation flow ) , while electrons are confined to flow along the field lines due to the smaller gyroradius . \n the requirement to balance ion and electron currents on the sharp surface yields a flux tube current flowing away from rhea . \n the current is maximum on the flux tube edge due to the oblique angle of the magnetic field to the planetary equator . \n field - guided wave emissions for flux tube thermoelectric current systems in different space plasma environmentsa there are four distinct regimes : < rgi < dse ( current carried by anisotropy ) , dse < rgi < dsi ( whistler ) , rge < dsi < rgi ( whistler + alfvn ) , rge > dsi ( alfvn ) , though as shown some environments are borderline between regimes . \n conditions highly variable along orbit . using average plasma properties . satisfying < rgi , = 1 cm . ion and electron \n mean free paths ( 0.1 and 10 km at 400 km ) > > gyroradii [ kelley and heelis , 1989 ] , but whistler excitation nevertheless inhibited by the strong terrestrial field ( average 35 t ) and cold ions ( 0.1 ev ) . \n whistler + partial alfvn refers to rgi dsi cases where spreading whistler wings may weakly excite alfvn wings at sufficient distances from the body . \n results are applicable to the flux tube current and do not preclude the possibility of secondary alfvnic disturbances from the wake or flux tube . \n crucially , this current system only exists if the plasma absorber 's surface is sharply defined , unlike , e.g. , an absorber surrounded by a significant thick atmosphere . \n the dhm has numerical difficulty in the case of the sharp absorber , which can account for the problems in resolving the flux tube current . \n we discuss this issue below , and using a solution algorithm adapted to the case of a sharp surface , we demonstrate the agreement of self - consistent simulations with the current system described above . \n differential - type hybrid models are discussed at length in literature [ lipat=\"jgra0119 - 8881-math-000ov , 2002 ; mller et al . , \n the dhm bins the rectangular simulation space into a hierarchical cartesian grid and randomly initializes a statistically large sample of ions with ( typically ) maxwellian - distributed speeds as individual particles upstream of the plasma - absorbing obstacle , advancing the ion positions and velocities in finite time steps t according to the equation of motion ( neglecting gravity ) : where , q , and m are the ion velocity , charge , and mass and and are the electric and magnetic fields at the position of ion i. ions striking the body are removed from the simulation , and the ion / electron density n is estimated from the number of simulated ions in each grid cell , with quasi - neutrality n = ni = ne assumed . \n the steady state electric field satisfies the force balance condition where denotes the resistivity due to ion - electron collisions , the flow velocity of the massless electron fluid , the electron pressure tensor divergence , and the definition of current is used to express the condition in terms of . \n the dhm solves the magnetic diffusion equation obtained from equation ( 2 ) using faraday 's law and ampere 's law without the ( assumed negligible ) displacement current term , which ensures continuity . \n typical boundary conditions are to fix to ( dirichlet condition ) at the upstream face of the simulation box ( with the ambient field measured far from the body ) , its spatial derivatives to zero ( neumann condition ) across the downstream face , and periodic conditions at the side faces [ bagdonat , 2005 ] . \n p this generalizes ( assuming a gyrotropic electron velocity distribution ) to containing magnetic mirror and curvature forces in the third and fourth terms [ hu and denton , 2009 ] . \n the dhm discretizes the spatial derivatives with finite cell widths x and iterates equation ( 3 ) over sufficient finite time steps to converge the field to steady state , i.e. , , setting and the ( diverging ) n term to zero within the body . \n the model is suitable for the study of the ion gyroradius effects at bodies , e.g. , comets [ bagdonat , 2005 ; mller et al . , \n 2011 ] , enceladus [ kriegel et al . , 2009 ] , and titan [ sillanp , 2008 ] , with conductive atmospheres possessing smoothly varying resistivity . \n airless objects like rhea present a dilemma for the dhm since , as evident on expansion to , the resistivity term in equation ( 3 ) explodes due to ( i ) large inside the body and ( ii ) the convergence of to a dirac delta function on the body surface , as x 0 . \n the catastrophe at the body surface will , in fact , give rise to numerical artifacts including false current systems . \n the standard preventative measure is to simply remove the surface resistivity step by smoothing , e.g. , through suppression of high spatial frequency components [ holmstrom , 2013 ] , or imposition of an arbitrary function [ mller et al . , 2011 ; vernisse et al . , \n 2013 ] that smears some resistivity into the space outside the body , with the required smoothing width a increasing with internal resistivity 0 . \n the implicit assumption is that the smoothed surface is sufficiently sharp to accurately render the physics of the plasma interaction . \n realistically , the smoothing imposes a possible limitation on the dhm 's applicability [ vernisse et al . , 2013 , \n ] , since insufficient internal resistance allows too much current to permeate the body , while excessive 0 may inhibit exterior currents by requiring too much surface smoothing . \n the t and x used ( which are limited by computing speed ) may in some cases not allow for any physically realistic combination of 0 and a to be simulated . \n other variations of the dhm encounter similar difficulties ; e.g. , holmstrom et al . \n neglect the resistivity terms in their study of the lunar solar wind interaction but must still smooth n at the object surface to avoid numerical differentiation of the surface step . \n the issue is not solvable , e.g. , by imposing a surface boundary condition , since the condition is already inherently satisfied by the dhm , in a rough sense , within the smeared surface [ simon et al . , \n 2012 ] , simply by way of the fact that in equation ( 3 ) . \n rather , the difficulty is numerical and lies in imposing a resistivity and/or density boundary onto the dhm with sufficient sharpness to model the relevant physics . \n though differential expressions like equation ( 3 ) are often preferred due to computational efficiency , integral equations tend to be better behaved numerically and may sometimes be necessary in special cases , e.g. , solutions involving large derivatives [ greengard and rokhlin , 1991 ; ledvina et al . , 2008 ] as at rhea . \n we have therefore implemented the physics of the electron fluid in the form of integral equations to treat rhea 's sharp surface an approach we designate here as the integral hybrid model ( ihm ) . \n we treat the ions as particles exactly as in the dhm but diverge from the dhm 's derivation by using to include ion and electron current explicitly in the force balance condition : where and . from equation \n ( 5 ) we solve for the -perpendicular electron current in terms of where , a = en , , and the p and h subscripts signify the alignment of the components with the pedersen and hall directions in the case . inside the body \n where , equations 6a , 6b , 6c yield , with k and n ( in the context of the solid ) the hall coefficient and charge carrier density ( i.e. , n = 1/ek ) , respectively . \n however , the hall terms are insignificant if is very large inside the body , i.e. , , with in the infinite resistivity limit . in the other extreme case of a = en 0 ( i.e. , low resistivity and/or density ) , equations 6a , 6b , 6c yield , i.e. , , far from the body ( where ion gyroradius effects on are negligible ) . with the parallel current components included ( below ) , \n these conditions generalize to in the limits of ( i ) low density ( few charge carriers ) , ( ii ) large resistivity ( high ion / electron collision rates ) , and ( iii ) , with some exceptions , low resistivity . \n therefore , equations ( 6a ) , ( 6b ) , and ( 6c ) anticipate , for example , that a thick planetary ionosphere with a gradient of versus altitude would ( as expected ) conduct most current in the altitudinal shell of intermediate resistivity . \n the exceptions to ( iii ) which allow for , i.e. , current flow even in the low - resistivity case , are ( 1 ) ion gyroradius effects acting on , ( 2 ) pressure gradients resulting in diamagnetic currents , and ( 3 ) sources or sinks along a field line which draw parallel electron current . \n whereas the dhm enforces continuity via ampere 's law , here we directly impose the condition , by requiring the parallel part of to satisfy , i.e. , . \n we integrate this expression along the field lines using the identity , valid for integration on paths along field lines connected to , to solve for : where , and and are the field line entry / exit points from the simulation space , assuming no closed field lines . \n the constant of integration m varies across field lines but is constant along a field line . \n this constant provides the unique for which the total parallel resistive force on the field line particles ( i.e. , the integral of from to ) is zero , as required in steady state . for the special case of zero field line resistance , m defaults to , resulting in equal and opposite parallel currents at each end of the field line . \n the role of m is to constrain the field line electron current drawn into or out of the simulation box to the ( unique ) solution which balances both currents and ( parallel ) forces . here \n we assume equal field line resistance beyond and , i.e. , in both directions outside the simulation box , such that the exterior regions make no net contribution to the force balance . we compute the steady state electric field as the negative gradient of the potential : where is the ambient corotation field and is the potential due to on the simulation box wall . here \n is the field line integral of the parallel ( ohmic ) electric field given ( from equation ( 5 ) ) by . \n finally , we evaluate from via the biot - savart law : where is the ambient ( saturnian ) magnetic field . shielding effects \n prevent the simulated field in the simulation box interior from seeing the exterior currents , and therefore , equation ( 9 ) is well approximated by evaluating the volume integral only over the simulation domain ( rather than all space ) . \n we minimize any errors near the boundaries by appending several external grid cell layers ( typically eight layers , 1000 km total thickness ) to the box faces . \n we continue ( along the field lines ) the currents and , as evaluated at the boundaries of the original box , into the new grid cells , and evaluate equation ( 9 ) in this extended box . \n these pseudo grid cells are only used for purposes of equation ( 9 ) and have no role in other steps of the ihm . \n writing equations 6a , 6b , 6c , 7a , 7b , 7c9 in shorthand ( excluding here fixed model inputs , e.g. , ) : , , , , with , we can construct the self - sufficient expression encapsulating all the physics in terms of the composite function : which we implement computationally in the form of nested subroutines . unlike the dhm which satisfies a condition ( equation ( 3 ) ) on , one can see in equation ( 10 ) that the ihm implements the same physics ( figure5 ) by satisfying a condition on , i.e. , . \n we bin the simulation space into a cartesian grid as in the dhm and approximate the field line and volume integrals in by the midpoint riemann summation method . \n 8) iteratively retraces the field lines intersecting every grid cell as they evolve throughout the simulation . \n we converge the ihm to the self - consistent steady state by iterating a two - step sequence : ( 1 ) evaluate equation ( 10 ) repeatedly as an iterated function sequence until relaxes to an attractive fixed point then ( 2 ) update n and by executing one or more time steps of ion motion ( equation ( 1 ) ) . \n since is nonlinear , we use damping ( relaxation ) parameters ( which weight the average of the current and prior iterations ) of 0.5 and 0.2 on and ( figure5 ) to establish convergence in step ( 1 ) . \n there is flexibility in the number of ion time steps in ( 2 ) : we find that propagating the ions for a gyroperiod ( tg = 2m / eb0 = 48 s ) , i.e. , sufficient for the ions to adjust to the updated fields from ( 1 ) , tends to minimize the ihm convergence computation time . \n hence , with a time step of 0.75 s , sufficiently small to resolve the gyromotion , we run each iteration of ( 2 ) for 64 time steps . after achieving 10% precision on the magnitudes of , , , , and n \n , we begin gradually increasing the number of time steps to 100 , while averaging results with previous steps to reduce statistical uncertainty in and n. the simulation is finally terminated upon achieving 1% precision . in accordance with equation \n ( 10 ) , , n , and fully describe the system state in the model , with , , and obtainable at any time via equations 7a , 7b , 7c9 . \n contrary to the dhm , the electron fluid portion of the ihm makes no attempt to evaluate the temporal evolution of as in equation ( 3 ) . accordingly , by solving directly for the steady state , the ihm bypasses another inherent dhm limitation which occurs in two of the cases mentioned above : ( i ) high resistivity ( e.g. , an insulator such as rhea ) and ( ii ) low density ( e.g. , vacuum ) . \n both cases lead to a divergence of terms ( i.e. , diverging magnetic diffusivity ) on the right - hand side of equation ( 3 ) . \n the difficulty has its origins in the dhm 's neglect of the displacement current , which ( by maxwell 's equations ) determines the field propagation versus time in regions of low current , i.e. , . \n numerical tricks are required by the dhm in these limits , such as setting n to zero at low density or assuming an arbitrary high ( but not too high ) resistivity in vacuum regions or within the insulating body [ holmstrom , 2013 ] . by contrast \n , the ihm has no difficulty in the low - current ( i.e. , high diffusivity ) regions , such as rhea 's interior , since the steady state magnetic fields are readily given at any point in space by the action at a distance principal embodied in equation ( 9 ) . \n we note also that the steady state displacement current is by definition zero and hence of no relevance to the time - independent ihm electron fluid algorithm . \n another benefit of integral equations is that the known constants of integration ( m , , and in the ihm ) are sufficient to establish a unique solution , thereby taking over the role of boundary conditions in a differential scheme . in this respect \n the ihm is more realistic , circumventing the requirement of the differential approach for assumptions , inherently somewhat arbitrary , about , e.g. , , , and ( in the dhm 's case ) at the simulation box walls . \n rather , the values everywhere in the domain are already given uniquely by the integral equations 7a , 7b , 7c9 as constrained by m , , and , respectively . \n considering as an example the upstream boundary , the ihm gives the unique realistic solution for , i.e. , very close to but spatially variable , rather than the exact equality typically enforced by the dhm . while not required for rhea , we note that the ihm is readily adaptable to bodies possessing a more significant neutral exosphere \n . together with an assumed exospheric density profile , the required modifications are ( i ) an extra electron - neutral collisional resistivity term in equation ( 5 ) and ( ii ) inclusion of ion - neutral collisions and a pickup ion source . \n first , the integration over in equation ( 8) mitigates the differentiation of the surface step by . similar reasoning applies to the discontinuity of and due to ion and electron deposition on the body surface , since the divergent derivatives , i.e. , ( for r = 1 ) as x 0 , are safely reintegrated by equations 7a , 7b , 7c . finally , while both the dhm and ihm exhibit a surface spike if , the issue is trivial in the ihm since the parallel component of the spike is integrated by equation 8 . \n the perpendicular component contributes to a surface spike of , but the effect is integrated out by equation ( 9 ) . \n these considerations are demonstrative of the advantageous numerical properties of integral equations in systems containing sharp discontinuities . \n we applied the ihm to rhea by setting the average ion mass to 16 amu [ wilson et al . , \n 2010 ] , the ambient ( upstream ) ion velocity distribution to a bidirectional maxwellian with ti = 65 ev and ti = 225 ev [ wilson et al . , 2010 ] , the rhea - referenced corotation speed v0 , and to 50 km / s and 22 nt southward [ khurana et al . , 2008 ; thomsen et al . , 2010 ; wilson et al . , \n we simulated a less dense plasma at r2 ( n = 3 cm ) than r3 ( n = 6 cm ) , in accordance with the cassini radio and plasma wave instrument ( rpws ) [ gurnett et al . , \n 2004 ] density measurements during these flybys [ roussos et al . , 2012 ] . \n we model rhea as a sharply defined sphere of infinite , which forces in the body . \n we typically add a small amount ( 10m ) of artificial ambient resistivity to ensure numerical stability as is also commonly done in differential - type codes [ ledvina et al . , 2008 ] . \n the simulation space was a 9r - sided cube , binned ( uniformly ) into 56 56 56 cells of width x = ( 9/56)r . \n we calculated from equation ( 4 ) using p = nte and p = nte and estimated the average ambient r2(r3 ) electron temperatures te 30(8)ev and te 60(16 ) ev from the caps els data , setting p = p = 0 inside rhea . \n additionally , we tracked b field lines intersecting rhea throughout the simulation and reduced te and te by 70% on these field lines to include the effect of high - energy electron absorption seen by els [ jones et al . , 2011 ] . \n as expected , we find that the resulting electron pressure loss enhances in the flux tube but does not contribute to the and components ( which exhibit a similar response even if constant is everywhere assumed ) . in figure6 \n we show the ihm plasma density n and and streamlines on the y = 0 ( xz ) and equatorial z = 0 ( xy ) planes . \n ion absorption yields a thin density cavity surrounding rhea and a downstream wake which expands more rapidly in z than y due to unrestrained -parallel ion diffusion . \n contrary to the equatorial electron streamlines which flow smoothly around rhea , figure6 reveals that the equatorial ion flow is more responsive to the obstacle , exhibiting more cross - field curvature into rhea and the wake than the electrons due to the larger ion gyroradius . \n this behavior is reversed in xz to satisfy on rhea 's surface , with the -parallel electron flow more responsive to the obstacle than the ions ( figure6 ) , converging more sharply into rhea and the wake to compensate the cross - field ion convergence . \n ihm rhea results showing plasma density xy and xz cross sections ( blue - to - green : increasing density , with low - density wake on right ) and the ion ( black solid streamlines ) and electron currents ( red dashed streamlines , shown ) . \n note that the orthogonal cross - section planes bisect rhea , and therefore , only the northern anti - saturn quadrant of the sphere is visible in the figure . \n ions curve more strongly into rhea on the equatorial plane due to the large gyroradius . in response , \n electrons curve more strongly into rhea in the vertical xz plane along the magnetic field to maintain surface current balance . \n the sum of and yields the expected flux tube current system , with a current converging toward rhea 's equator and a commensurate outgoing current concentrated on the tube rim . \n the visualization of figure7 shows how the field - aligned current flows north / south away from rhea , roughly compensating the convergence of perpendicular current in the equatorial plane ( see ring of negative around rhea 's equator in figure7 ) . \n the cylindrical shell wire generates a field circulating the flux tube , with the ihm correctly predicting the position ( and the magnitude ) of the peaks in on the flux tube edges during r2 and r3 ( figure8 ) . \n accordingly , the total field ( plus perturbation ) twists about the flux tube , and the field - aligned current is therefore somewhat helical . \n a shielding current of opposite helicity , directed toward rhea , also flows just outside the flux tube , not unlike that implied by ampere 's law from the mag data in figure3 . \n such flux rope topologies are characteristic of electron mhd disturbances , which exist on scales sharper than the ion inertial length dsi = c/pi ( 500 km or 0.65r at rhea ) , and tend to propagate in tandem with whistler mode disturbances [ stenzel et al . , 1999 ] as we discuss in the next section . \n the wire field also introduces a large - scale second - order perturbation to the ions , on mhd size scales ( i.e. , larger than dsi ) . \n the effect is insignificant at r2 but more substantial at r3 due to the higher plasma density , yielding a broad hump in the r3 component as also seen in the data ( figure8 ) . \n as can be seen in figure8 the dhm , as expected , has little difficulty capturing the large - scale ( alfvnic ) [ simon et al . , \n however , the ihm goes a step farther , by also succeeding to render the sharp small - scale features at the flux tube edge ( figure8 ) which are indicative of current balance on the sharp rhea surface . \n ihm prediction of the rhea current system showing the flux tube current flowing out from rhea and oppositely directed shielding currents outside the flux tube . \n equatorial cross section shows the diamagnetic current spiraling into rhea ( black streamlines ) and the divergence of the perpendicular current component ( color ) . \n one can see that the outgoing flux tube current compensates the ion convergence at rhea 's surface ( red ring around rhea ) . \n same as figure2 except that here we show the ihm results ( blue ) for a sharp rhea resistivity profile . \n the assumption of a higher density at r3 ( 6 cm ) than r2 ( 3 cm ) , in accordance with rpws data , reproduced the broad hump in on r3 . \n the hump results from the second - order alfvnic disturbance at scales larger than dsi ( 500 km ) , which is more significant at the higher r3 density . \n the ihm 's rendering of ultrasharp features is limited by ( i ) binning resolution ( currently 0.16r = 122 km ) and possibly ( ii ) the steady state approximation ( e.g. , oblique whistler wavefronts near the flux tube edge are not modeled since they are temporally variable ) . even with these constraints , \n the sharp rhea assumption enables the ihm to successfully predict the magnitude and alignment of the peaks with the edge of the flux tube at y 1 . \n the ihm gives a good approximation of the dhm fit ( figure2 ) after smoothing rhea 's surface resistivity step using ( as an example ) a (r ) = 0/(exp[(1 r)/w ] + 1 ) profile with 0 = 6 10m and a smoothing width w = 0.2 rhea radii . in this scenario ( figure9 ) \n the equatorial diamagnetic current is more circular around rhea , with the convergent component mostly cut off due to the extension of resistivity outside the body , enabling ions to frictionally drag electrons across field lines into the surface . by breaking the circuit , \n the external resistivity layer automatically balances the surface current and suppresses the flux tube current system . \n a dichotomy in equatorial develops on the saturn - facing and anti - saturn - facing flanks of rhea as seen in figure9 , yielding ingoing and outgoing field - aligned currents on these flanks , respectively . unlike the sharp resistivity case ( see next section ) , this dhm current system requires relative motion between the object and the plasma and depends on object size ( due to the ion gyroradius effect ) and plasma as noted by simon et al . . \n for example , the current system vanishes in simulation runs where we assume no bulk plasma flow past rhea and diminishes when we reduce , either by initializing a colder ion population or increasing the magnetic field . \n we concur in part with the explanation of simon et al . in terms of cross - flow diamagnetic currents in the infilling downstream wake but would add that the variation of ion flow speed around the obstacle ( a gyroradius effect ) [ see roussos et al . \n the fast ions concentrated on rhea 's saturn - facing flank couple to the electron fluid via the resistivity smeared outside the body , thereby forcing electrons anti - saturnward into rhea through induction and generating current divergence ( positive ) and a corresponding ingoing field - aligned current ( outgoing electrons ) on this flank ( figure9 ) . by contrast , the anti - saturn convergence ( negative ) results from deceleration of ions entering the wake across the field lines [ roussos et al . , 2008 , figure1-i ] , which produces an outgoing field - aligned current ( ingoing electrons ) from this flank . \n the divergence ( blue region ) and convergence ( red region ) of the equatorial currents on the saturn and anti - saturn flanks of rhea are compensated by a dichotomous current flowing vertically to / from rhea . \n this current system ( unlike figure7 ) increases in magnitude with ion gyroradius and plasma and requires relative motion between the object and the plasma . \n moreover , the diamagnetic current is more circular around the body , i.e. , prevented from spiraling directly into rhea 's surface by the extension of resistivity outside the body . \n as expected , the overall current system resembles that obtained in the dhm due to the smooth resistivity assumption . outside the flux tube the ihm and dhm yield similar results irrespective of the assumed sharpness of the body . \n for example , as shown in figure10 for the 26 november 2005 r1 cassini wake flyby ( figure1 ) , both the ihm and dhm succeed to fit the mag data , showing the expected intensification of in the wake . \n give many detailed plots of the estimated plasma moments and fields around rhea ; their simulations agree with our ihm results outside the flux tube . \n fit to the r1 wake flyby ( figure1 ) , with the dhm ( red , from roussos et al . ) and ihm results ( blue ) both showing the expected increase of in the wake ( see roussos et al . \n for a detailed analysis of the shapes in all components ) . the ihm assumes a sharp rhea , with = 25 nt and n = 6 cm . \n this example demonstrates the general agreement of the dhm and ihm on the plasma properties and fields outside the flux tube . \n in the simplest terms rhea 's flux tube current can be understood as a direct consequence of the surface potential , which charges negative to equalize the ion and electron fluxes everywhere on the surface [ roussos et al . , \n accordingly , the electron current distribution in the flux tube ( figure4 ) results from precipitation of electrons with sufficient energy to overcome the surface potential . \n however , we can gain additional perspective into the physics of rhea 's plasma interaction by also considering the wave modes excited by the body , their contribution to the currents and magnetic topology around rhea , and the implications of the sharp surface . \n a basic dilemma is that ( due to the surface step ) the flux tube perturbations are too short to be mhd , implying that the classic alfvn wing model traditionally applied to planetary satellites possessing significant exospheres / ionospheres [ neubauer , 1998 ] can not give a complete description of rhea 's flux tube current system . \n we start by comparing , in figures1 and 2 , the field perturbation produced by the sharp object and that of the smooth resistivity approximation . \n one can see in the smooth resistivity case ( figure11 ) a typical field - draping pattern , as would be expected for the figure9 dichotomous current system discussed above . \n we expect a smoothly resistive object to excite modes with wavelengths of similar size to the object [ neubauer , 1998 ] , which for bodies like rhea larger than the ion inertial length yields magnetosonic and shear alfvn waves characteristic of an mhd plasma . \n only the alfvn wing persists to large distances due to ( ideally ) perfect -parallel constructive interference of the alfvn waves [ gurnett and bhattacharjee , 2005 ] . \n one can see that the draped field pattern of figure11 tilts at roughly the alfvn angle = atan(v0/va ) = 23 , with v0 = 40 km / s and va = 89 km / s the plasma flow and alfvn speeds , respectively . \n blue streamlines : the ihm prediction of the magnetic field perturbation ( i.e. , total field minus constant background ) in the smooth resistivity ( r2 , n = 3 cm ) case . \n equatorial cross section shows the plasma density ( blue - to - red : increasing density ) and the diamagnetic current circling rhea and the wake ( black streamlines ) . \n the perturbation is entirely southward directed as expected to compensate pressure loss around rhea and the wake . \n one can see the field draping in the flow direction , as expected for an alfvnic current system . \n same as figure11 for the sharp resistivity case , with southward and northward perturbations colored blue and red . \n contrary to the alfvn disturbance from the wake , the flux tube feature has negligible draping angle to the ambient magnetic field , consistent with the high whistler group velocities of order 10 km / s . \n this result stands in stark contrast to the sharp surface case shown in figure12 , which exhibits ( in addition to some field draping in the wake ) the prominent flux tube helical perturbation discussed above . unlike the smoothly resistive object \n , we anticipate that the sharp object may also excite ( in addition to mhd waves ) short wavelength modes as the plasma responds to accommodate the surface step , with the near - parallel field alignment of the flux tube perturbation consistent with propagation of most of the excited wave energy along much faster than the alfvn speed . on plotting the different branches of the plasma dispersion relation out to large wave numbers ( figure13 ) , we find that the average wave numbers of the sharp flux tube perturbations ( 100 km , i.e. , centered at 6 10 m ) are well above the range of mhd waves \n . the spatial scale of the surface plasma absorption interaction is given by the topography ( 1 km ) [ nimmo et al . \n , 2010 ] on large scale and the debye length on small scale ( 0.05 km ) and therefore tends to excite modes in the 6300 10 m wave number range . \n the effect of plasma absorption at the sharp surface is twofold : ( 1 ) short wavelength ( i.e. , 0.051 km ) electrostatic wave excitation from the surface sheath and ( 2 ) anisotropization of the flux tube electron velocity distribution onto which the surface step is imprinted as a sharp flux tube boundary ( e.g. , as exhibited in the caps els spectra [ jones et al . , 2011 ; santolik et al . \n we briefly address the question of sheath waves , before discussing the generation of waves further up the flux tube by anisotropy - driven instabilities . \n ( top ) dispersion relations with rhea plasma parameters approximated by cold plasma equations [ gurnett and bhattacharjee , 2005 ; hollweg , 1999 ; stringer , 1963 ] . \n ( bottom ) group velocity versus wave number averaged over all wave vector angles . vertical dashed lines denote wave numbers for relevant length scales . \n black dashed : average for the perturbations on the flux tube edge ( figure8 ) . \n olive dashed : surface topography and electron gyroradius scale , which roughly define the lower limiting for surface electrostatic wave excitation . \n negatively sloped straight lines ( figure13 , top ) : inverse versus relationship of the limiting positive ( lower red ) and negative ( upper black ) surface sheath charging timescales . \n cross - hatched zone : approximate spatiotemporal scale of possible surface wave excitation , lying near or between the charging timescales and topographical and debye spatial scale , and near several slow - propagating resonances . \n nonlinear coupling via anisotropy - driven instabilities ( i ) at the surface and ( ii ) farther up the flux tube causes energy flow ( curved arrows ) into faster - propagating modes ( figure13 , bottom ) which travel large distances from rhea . \n sheath electrostatic waves may ( i ) acquire free energy from the electron / ion velocity distributions , which are highly anisotropic at the surface , and ( ii ) exchange thermal energy with the random component of the particle velocities [ gould , 2002 ] . \n the interaction frequencies are roughly speaking bounded by the limiting charging timescales , i.e. , ion(electron ) flux ratioed to the unit charge column density i , e = 0ti , e / e ( i.e. , surface charge plus sheath space charge ) to repel the particles ( where the i , e expression treats the plasma penetration distance of the surface electric field as equivalent to the wavelength = 2/k of the surface - coupled electrostatic wave ) . \n as shown in figure13 with limiting frequencies i , e = 2/charging = 2fi , e/i , e = ci , e / k ( where ) , the relevant spatiotemporal scales correspond closely with ( i ) electron plasma ( langmuir ) and upper hybrid waves near the plasma frequency ( fep15 khz ) , ( ii ) ion plasma waves ( fip80 hz ) , and ( iii ) electron cyclotron ( fce650 hz ) waves ( and , in a hot plasma , bernstein modes ) , i.e. , all slowly propagating resonance modes . \n the rpws indeed detected intensification of all of these resonances in rhea 's flux tube [ santolik et al . \n , 2011 ] , though we note that the electron plasma resonance undergoes additional anisotropy - driven amplification farther up the flux tube [ santolik et al . , 2011 ] . as the slowly propagating resonant waves accumulate energy near the sheath , some wave energy flows ( figure13 ) into fast - propagating off - resonance frequencies through nonlinear interactions \n the principal nonlinear interaction pathway is by way of electrostatic wave - particle interactions in the sheath , which contribute to the electron velocity anisotropy by scattering thermal electrons into the surface [ iess et al . , \n additionally , a major contribution to the anisotropy also comes from fast ambient electrons arriving with sufficient energy to overcome the sheath potential without significantly interacting with the sheath waves . \n the anisotropy and associated electron current is propagated up the flux tube [ santolik et al . , \n 2011 ] , where thermodynamic free energy is continuously exchanged between the electron velocity distribution and different wave modes ( and , likewise , between waves modes via the distribution ) . \n the current system dissipates ( i.e. , closes ) gradually up the flux tube as free energy escapes into fast - propagating wave modes not guided along the field lines , including high - frequency ( > 15 khz ) electron acoustic waves ( 4400 km / s ) shorter than the 0.05 km debye length and low - frequency ( < 80 hz ) ion acoustic waves ( 40 km / s ) above kilometer wavelengths . \n rpws , in fact , detected enhanced broadband excitation at rhea both above fpe ( presumably electron acoustic and/or doppler - shifted plasma waves ) in association with \n high - frequency emissions and at frequencies below 40 hz in the ion acoustic range [ santolik et al . , \n by contrast , free energy exchange with field - guided wave modes may facilitate the survival of the flux tube current system to large distances from rhea . \n current - carrying kinetic alfvn waves do have high field - aligned group velocities of order 10 km / s , but energy flow into this mode is likely minor since the waves only occur in a small sliver of phase space at oblique wave vector angles above 87 ( figure14 ) . \n ( right ) group velocity ( gv ) hodographs with direction ( arrows ) and magnitude ( color ) versus wave number ( logarithmic radial coordinate ) and propagation angle to , for the three low - frequency branches of the rhea ambient plasma corresponding to the fast ( bottom ) , slow ( middle ) , and shear alfvn ( top ) modes in the mhd limit . \n color : gv magnitude in the rhea frame , shown in linear scale to demonstrate the negligibility of the gv in all modes except kinetic alfvn ( top , oblique angles only ) and whistler ( bottom , colored stripe spanning all angles ) . \n ( left ) gv angular distributions ( white - to - black : low - to - high intensity , angle relative to in the rhea frame ) assuming isotropic wave vector excitation . \n surface waves excited at topographical and debye scales are far beyond the range of the alfvn and slow shocks ( top , middle ) but can nonlinearly couple to the fast - propagating whistlers ( bottom ) . note for whistlers that the gv arrows align nearly to at all propagation angles ( bottom ; see preponderance of vertical arrows in the whistler band ) , forming a fast - propagating ( mean gv of 6400 km / s ) field - aligned beam near 10 m with a small 1 spread . \n the measured perturbation ( black dashed line ) is centered at 10 m in the whistler regime , i.e. , well beyond mhd spatial scales . \n inset : rpws 17:41:26.39 utc r2 flyby measurement ( solid line ) of intense of whistler frequency excitation in the rhea flux tube from santolik et al . , \n compared to predicted spectra for the 10 m whistler beam ( black dashed line : assumes cosine distribution of wave vector propagation angles ; red dotted line : isotropic wave vectors ) . \n however , whistlers at wavelengths above the electron inertial length dse = c/pe 3 km are an obvious candidate to perpetuate the currents since they ( i ) are well focused along and ( ii ) have the highest average group speed ( peaking at 8000 km / s ) of any mode on the dispersion plot ( figure13 , bottom ) spanning all wave vector angles ( figure14 ) . \n physically , the whistlers are the continuation of the mhd fast waves to wavelengths shorter than dsi for which electron motion dominates the plasma wave response , which is consistent with our findings that the flux tube current is carried by the electrons . \n intense whistler activity inside the rhea flux tube was confirmed by rpws ( figure14 , inset ) , likely deriving energy from the electron cyclotron - resonant instability [ santolik et al . , \n the whistlers may be initiated in part at the surface itself and farther up the field lines due to cyclotron - resonant ( parallel energy 230 ev ) electrons reflected from negative surfaces [ jones et al . , \n similar processes are known to operate at the moon , where whistler emission is stimulated by solar wind electron interactions with crustal magnetic fields [ halekas et al . , \n 2006 ] and electron reflection from negatively charged surfaces [ halekas et al . , 2012 ] and lunar wake ambipolar electric fields [ farrell et al . \n , 1996 ; nakagawa et al . , 2003 ] . comparing the group velocity field of the three low - frequency dispersion surfaces , versus wave number and vector angle to ( figure14 ) , we can see that only the whistler group velocities exhibit alignment parallel to at all in rhea 's reference frame . the narrow group velocity cone angle of 1 for near 10 m ( figure14 , bottom left ) , or 23 km wavelength , is within the 100 km thickness of the measured field perturbations ( figure2 ) . \n the near - parallel whistler beam alignment is due to the high average group speed , 6400 km / s , i.e. , much faster than the alfvn and slow shocks ( 89 and 37 km / s ) which exist at much lower wave numbers below 10 m ( i.e. , wavelengths > dsi ) and at substantial angles to ( 23 and 44 ) in rhea 's reference frame . \n for this reason the whistler poynting flux is field aligned [ santolik et al . , \n slow - propagating oblique wavefronts at the flux tube edge may contribute to the sharpness of the magnetic perturbations sampled by mag , by analogy , e.g. , with oblique whistler wave fields near perpendicular shocks [ hellinger et al . \n for instance , the flux tube edge may contain wave components with temporal variability on small scale not considered by the ( steady state ) ihm . \n the lack of these wave components in the ihm may explain the model 's underestimation of the steepness of the perturbations ( figure8 ) . \n the phase speed approaches va = 89 km / s [ stringer , 1963 ] ( in the plasma rest frame ) for perpendicular whistler propagation at wavelengths the size of the flux tube perturbation ( 100 km ) , and the wave normals can pass through 90 to ( no resonance cone ) since the frequencies ( f va/ = 0.9 hz ) are below the lower hybrid frequency ( flh = 4.2 hz ) [ gurnett and bhattacharjee , 2005 ] . at shorter wavelengths ( f flh ) the perpendicular phase velocity slows further as the resonance cone regime \n is approached , with the waves becoming electrostatic lower hybrid oscillations [ bell and ngo , 1990 ] . \n however , wavefronts not oriented precisely perpendicular to also have significant transverse electron currents and magnetic degrees of freedom [ bellan , 2013 ] , and such waves directed near radially to the flux tube may contribute to the shielding current and fields near the tube rim ( figure3 ) . \n wavefronts drifting out of phase with the sharp flux tube boundary ( in the electron current and velocity distribution [ santolik et al . , 2011 ] ) may be rapidly landau damped [ zhang et al . , \n 1993 ] , thereby transferring energy back to the electrons [ cattell et al . , 2012 ] , analogous , for instance , to the damping of oblique precursor whistler waves observed drifting ahead of sharp planetary bow shocks [ gary and mellott , 1985 ; orlowski et al . , \n current - carrying whistler wings consisting of oblique wavefronts [ stenzel , 1999 ] have also been demonstrated in laboratory experiments in which the motion of a conducting electrode through a magnetized plasma was simulated by current pulse superposition [ stenzel and urrutia , 1990 , 1993 ] , and cerenkov whistler emissions are known to form from the motion of small ( < dsi ) magnetized asteroids through the solar wind [ baumgartel et al . , 1997 ; gurnett , 1995 ; omidi et al . , 2002 ; simon et al . , 2006 ; \n a noteworthy property of the flux tube current system is that motion of the body through the plasma is not required as for a ( smooth ) conductor , with the currents retained even in ihm runs with the plasma at rest relative to rhea . \n the reason is that the current system is thermodynamically , rather than inductively driven , being excited solely through plasma absorption , i.e. , by heat flow from the plasma into the body . \n the currents are therefore proportional to the ion implantation flux into the surface , i.e. , to the density times the ion thermal speed , as verified by our ihm runs \n . a related example of thermal field - aligned plasma currents may be the short - circuit effect first discussed by simon in magnetically confined laboratory plasmas , in which cross - field thermal ion diffusion , e.g. , to the axial walls of a conductive containment vessel [ zhilinskii and tsendin , 1980 ] , can induce field - aligned electron eddy currents which short across field lines at the end walls [ drentje et al . , \n the competition of these currents with electron ambipolar diffusion has been the focus of recent theoretical discussion [ fruchtman , 2009 ] and simulation studies [ lafleur and boswell , 2012 ] , and thermally driven electron shorting currents turn out to be a significant design consideration for electron cyclotron ion sources [ schachter et al . \n an interesting example is a thermoelectric circuit , with the difference of seebeck coefficients between two materials enabling temperature gradient - driven currents ( via the material 's different densities of electronic states ) , playing the same role as the difference of rgi and rge for a plasma - absorbing body ( via the different phase space densities of ion / electron trajectories intersecting the sharp absorber ) . \n the limiting lateral spatial scales of the current system about the flux tube are defined by rgi and rge . \n the current system may propagate in tandem with whistler waves as long as the spatial extent of the whistler characteristics are within the rgi - rge size range . \n current closure begins at the distance up the field lines for which the whistler beam spreads to become larger than rgi ( assuming rgi > rge ) , provided that rgi < dsi , with dsi the minimum spatial scale for mhd waves . taking 1 group velocity cone angle as a lower limit for rhea 's whistlers ( figure13 ) , we find that the rhea whistler wing may extend at most to 30,000 km up the field lines before current closure begins , i.e. , outside our simulation box , but well short of the 1.6 10 km distance to saturn . \n however , at rhea 's l shell rgi and dsi are similar ( table 1 ) , and therefore , the current system and associated magnetic anomaly may spread sufficiently to significantly perturb the ion trajectories prior to current closure , thereby weakly exciting alfvn wings which can propagate currents much further . \n beams and slower - propagating alfvn waves has also been found at io , with the observations of multiple jovian auroral spots in association with io 's alfvn wings [ bonfond et al . , 2008 ] . \n whistler wing spreading north / south of rhea might also scatter energetic electrons away from rhea , possibly explaining [ santolik et al . \n , 2011 ] the puzzling energetic electron depletion measured near rhea on several of the cassini flybys [ roussos et al . , 2012 ] . \n the depletion was at first interpreted as possible evidence of a rhea ring system [ jones et al . , 2007 ] , but nondetection of rings by cassini imaging appeared to rule out this explanation [ tiscareno et al . , \n strong magnetic fields and/or cold or tenuous plasma ( for which rgi is shorter than the electron inertial length dse = c/pe ) are at the limit of the whistler wing description , since whistlers transition into electron cyclotron oscillations for wavelengths below dse due to electron inertia . in this limit \n the current system closes at a distance up the flux tube sufficient for the dissipation of the electron velocity anisotropy , which may occur as free energy flows from the velocity distribution into nonfield - guided ( short wavelength ) waves , such as langmuir waves via landau damping . at more extreme ( and unlikely ) high field intensities and low densities for which rgi < , the current system is completely inhibited since the surface is , from the plasma perspective , only as sharp as its debye sheath . in the opposite ( also unlikely ) limit , \n i.e. , very weak fields and/or hot or dense plasma for which rge > dsi , the spatial scales are entirely in the mhd range , allowing for an entirely alfvnic current system . \n these criteria assume collisionless plasma : with collisions the current system propagation distance is also limited by the ion and electron mean free paths . \n note that the conditions for the existence of the current system depend only on plasma parameters , and not object size ( figure15 ) , e.g. , a spacecraft or a planet may generate a current , so long as the surface is sharp ( e.g. , a airless body , or one with an atmosphere much thinner than rgi ) . simply by absorbing plasma from its environment , \n even the cassini spacecraft should excite a weak whistler - generating current system with a total estimated current of 50 na , and minimum spatial scale ( given by rge ) about a kilometer at rhea , i.e. , much larger than the spacecraft . as shown in table 1 \n the conditions for thermoelectric whistler wing formation are satisfied in a wide range of space plasma environments . \n schematic of the flux tube current system for a small ( e.g. , spacecraft ) , medium , and large plasma absorber ( relative to the ion gyroradius ) . \n the current system exists for absorbers of any size , provided there is a difference of electron and ion gyroradii . \n we note that even large bodies on mhd size scales can excite the currents due to the surface step , which contains frequency components above the mhd range . \n cassini 's findings at rhea yield clues on the fundamental plasma process of surface current balance on a sharp - absorbing body and raise the fascinating question of how this balance is achieved in a magnetic field for which ions and electrons approach the body on different trajectories . in this paper we have demonstrated from first principles , and with self - consistent modeling , that the difference of ion and electron average gyroradii yields a current system in the flux tube with unique properties : ( 1 ) motion through the plasma is not required since the current is produced thermoelectrically through work done by heat flow into the object , ( 2 ) the current system can form with objects of any size ( e.g. , the relation of the object size to the ion gyroradius is not critical ) , and ( 3 ) an object with a sharp surface ( much sharper than rgi ) is necessary , i.e. , without a significant thick atmosphere . we demonstrate that standard modeling approaches employing differential equations encounter numerical problems with the sharp surface , and we therefore implement a so - called integral hybrid model to solve the physics with an integral equation approach better suited to cope with the surface step . we suggest that this type of approach can serve as a starting point for future treatments of a new class of modeling problems involving sharp - surface plasma absorbers , such as airless planetary bodies and spacecraft , immersed in magnetized space plasmas . \n finally , we show on the basis of the plasma dispersion relations and cassini rpws results at rhea that whistler waves stimulated by anisotropy - driven instabilities in the flux tube and interaction with surface sheath electrostatic waves on topographic scales may facilitate transmission of the current system up the flux tube . the discovery of a rhea flux tube current system addressed in this paper , and that of secondary alfvn wings [ khurana et al . , 2012 ] from the wake diamagnetic [ simon et al . , \n 2012 ] and flux tube currents ( figure8 , at r3 ) , paint a new and surprisingly complex picture of the general interaction of objects with space plasmas beyond the scope of cold plasma theory . \n four fundamental current systems can now be distinguished ( the first two familiar and the last two new ) : ( 1 ) alfvn wings from a conductive atmosphere in relative motion to the plasma , ( 2 ) the diamagnetic current ( figure1a ) , ( 3 ) the secondary alfvn wings , and ( 4 ) the flux tube current . only current system ( 1)that generated by a conductive atmosphere exists in the cold plasma limit but requires motion through the plasma ( the canonical pure induction case ) . \n the remaining three current systems require a warm plasma , and ( 2 ) and ( 4)the diamagnetic and flux tube currents , respectively can form in a stationary plasma ( the pure thermoelectric case ) . in a moving plasma ( 2 ) and \n ( 4 ) can give rise to secondary alfvn wings , i.e. , current system ( 3 ) . \n hence , ( 3 ) has a hybrid induction - thermoelectric character , with kinetic effects enabling pathways ( specifically , current systems ( 2 ) and ( 4 ) ) for momentum exchange ( via alfvn wings ) between the object and the moving plasma . \n a significant difference between ( 2 ) and ( 4 ) is the inverse b0 dependence of the diamagnetic current ( 2 ) , implying , e.g. , a negligible diamagnetic contribution to alfvn wings in low plasmas , as is common ( see , e.g. , the case of dione and tethys discussed by simon et al . ) . \n by contrast , the flux tube current ( 4 ) is proportional only to ion density and thermal speed as discussed above and is not quenched by strong magnetic fields alone ( except in the extreme rgi < limit mentioned above ) . \n flux tube current systems are therefore expected to form under quite general conditions , to satisfy surface current balance , e.g. , at the other saturnian ( or other planetary ) satellites , or objects in the solar wind such as asteroids and earth 's moon . \n this potential broad implication of cassini 's results at rhea starkly illustrates the necessity for new modeling approaches as discussed here and for future in situ measurements at solar system bodies to further elucidate the fundamentals of the plasma interaction and , in particular , the role of thermoelectric current systems and surface current balance .", "role": "user" }, { "content": "sharp magnetic perturbations found by the cassini spacecraft at the edge of the rhea flux tube are consistent with field - aligned flux tube currents . the current system results from the difference of ion and electron gyroradii and the requirement to balance currents on the sharp rhea surface . \n differential - type hybrid codes that solve for ion velocity and magnetic field have an intrinsic difficulty modeling the plasma absorber 's sharp surface . \n we overcome this problem by instead using integral equations to solve for ion and electron currents and obtain agreement with the magnetic perturbations at rhea 's flux tube edge . \n an analysis of the plasma dispersion relations and cassini data reveals that field - guided whistler waves initiated by ( 1 ) the electron velocity anisotropy in the flux tube and ( 2 ) interaction with surface sheath electrostatic waves on topographic scales may facilitate propagation of the current system to large distances from rhea . \n current systems like those at rhea should occur generally , for plasma absorbers of any size such as spacecraft or planetary bodies , in a wide range of space plasma environments . \n motion through the plasma is not essential since the current system is thermodynamic in origin , excited by heat flow into the object . \n the requirements are a difference of ion and electron gyroradii and a sharp surface , i.e. , without a significant thick atmosphere.key pointssurface current balance condition yields a current system at astronomical bodiescurrent system possible for sharp ( airless ) objects of any sizecurrent system is thermoelectric and motion through the plasma nonessential", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: . approximately 50% of benign cardiac tumors are myxomas and most of them are typically polypoid and located on the left atrium . \n the right atrium is an unusual localization , observed only in 1520% of myxoma cases . \n the villous right atrial myxoma is a very rare subtype in particular , and shows high tendency for pulmonary embolism . \n transthoracic echocardiography ( tte ) , transesophageal echocardiography ( tee ) , computed tomography scan and cardiac mignatic resonance imaging are the techniques being used for diagnosis . \n we report a giant right atrial villous myxoma with simultaneous pulmonary embolism in a 29 year - old male ( figs . \n a 29 year - old male admitted to our outpatient clinic with progressive exertional dyspnea , chest pain and intermittent feeling faint complaints . \n tte showed a villous mobile mass with a diastolic movement through the tricuspid valve toward the right ventricle . \n the patient underwent tee evaluation , which confirmed the findings of the tte and added anatomical detailing and its insertion in the interatrial septum . during the tee examination , \n after reconstruction , 3d tee showed the real shape , size and origin of the mass . for a possible pulmonary embolism , chest computed tomography ( ct ) scan \n the patient underwent surgery of the right atrial mass , which was a villous of elastic consistency and violet to grayish - yellow in color . \n the patient was discharged 4 days after surgery , and doing very well after 6 months . \n we present a rare clinical case of a giant villous ra myxoma with simultaneous pulmonary embolism which is an uncommon clinical apparition . \n a low incidence of ra myxoma has been reported in several series of autopsy cases . \n the mayo clinic series ( 19541979 ) included 23,673 patients and found 41 patients with primary heart tumors ( 0.17% ) . \n a myxoma was found in 28 patients and its location was the left atrium in 17 cases and the right atrium in 4 cases ( 14% ) . \n recently , in a surgical case series , yu et al . reviewed 33,108 patients submitted to cardiac surgery and found 234 cases with a confirmed diagnosis of primary heart tumor ( 0.71% ) . among 184 patients with myxoma \n the ra localization was observed in only 12 ( 6.5% ) of those cases . according to size , mobility , and location of the tumor as well as physical activity and body position , \n ra myxomas may remain asymptomatic or may appear with constitutional , obstructive or embolic symptoms . \n pulmonary embolism of tumor fragments or thrombus from the tumor surface may also occur , resulting in dyspnea , chest pain , haemoptysis , syncope , pulmonary hypertension and right sided heart failure or death . in this report , the patient complained of exertional dyspnea , atypical chest pain and intermittent feeling faint . \n tte showed a villous mobile mass with a diastolic movement through the tricuspid valve toward the right ventricle . \n the patient underwent 3d tee evaluation , which confirmed the findings of the tte and added anatomical detailing and its insertion in the interatrial septum . for a possible pulmonary embolism , chest ct scan \n in contrast to polypoid myxomas which are usually compact and show little tendency toward spontaneous fragmentation , the less common villous myxomas have a surface that consists of multiple fine or very fine villous extensions . \n these extensions are gelatinous and fragile and tend to break off or into pieces . once a cardiac myxoma is diagnosed , surgical excision should be performed without delay to minimize risk of embolic events . \n although tte and tee provided a good visualization of the mass with a sensitivity of 95% and 100% respectively , 3d tee may be helpful in surgery planning , allowing a better definition of the mass real shape , position and attachment in the interatrial septum . in this case , a ra mobile mass originating from the interatrial septum was detected by tte . \n mass size , boundaries and its relationship with the septum was assessed by 3d tee in detail . \n the patient was operated and the mass was totally resected as a result of a successful operation . \n ra villous myxoma is a rare subtype in an unusual location with high potential of pulmonary embolism . \n early surgery for villous myxoma has a great importance in order to reduce the risk of pulmonary embolism . \n 3d tee , should be a sufficient technique for diagnosis and evaluation of shape , size and origin of the cardiac masses and an adequate guide to surgical treatment . \n \n \n written informed consent was obtained from the patient for publication of this case report and accompanying images . \n a copy of the written consent is available for review by the editor - in - chief of this journal on request . \n ", "role": "user" }, { "content": "introductionprimary cardiac tumors are rare and approximately three quarters of them are benign and up to half of the benign tumors are myxomas . \n right atrial villous myxoma with pulmonary embolism is an unusual apparition.presentation of casea 29 year - old male was admitted to our outpatient clinic with progressive exertional dyspnea , chest pain and intermittent feeling faint . \n a giant right atrial villous mobile mass was detected by means of transthoracic echocardiography . to exclude possible pulmonary embolism , \n chest computed tomography scan was performed and showed filling defects in the branch of the pulmonary artery . \n the mass was totally resected.discussionra villous myxoma is a rare subtype in an unusual location with high potential of pulmonary embolism . \n early surgery for villous myxoma has a great importance in order to reduce the risk of pulmonary embolism.conclusion3d tee should be a sufficient technique for diagnosis and evoluation of shape , size and origin of the cardiac mass an adequate guide to surgical treatment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: surgical treatment of malignant glaucoma is based on interrupting the sequence of events lying at the foundation of its pathophysiological process . in the classical form of this complication , \n aqueous humor accumulates in the area of the vitreous cavity due to ciliary block , and , as a result of this , there is an increase in the vitreous pressure that is transferred to the structures of the anterior segment causing a forward movement of the lens - iris diaphragm . most often , malignant glaucoma develops quickly , within days after primary surgery with a clear cause - effect relationship with the performed procedure , although its occurrence can also be postponed [ 24 ] . \n recurrences of malignant glaucoma are observed both after ppv that was initially effective and after conservative treatment [ 58 ] . \n it seems that the characteristic clinical picture of malignant glaucoma with recurrences is caused by the preservation of the primary mechanism that is found at the basis of aqueous humor accumulation in the posterior segment of the eye . \n observations resulting from the application of ppv for the treatment of malignant glaucoma in pseudophakic eyes make it possible to state that elimination of adhesion of the vitreous body , lens capsule , and its zonula to the plane of the iris , pupil , and iridectomy restores normal aqueous humor flow from the posterior to the anterior segment of the eye [ 6 , 9 ] . while ppv unburdens the vitreous chamber and improves anatomical proportions in the anterior chamber , preservation of communication between the posterior and anterior segments of the eye is decisive to the stability of this procedure . surgical treatment in malignant glaucoma \n is usually applied when conservative and laser treatment do not have the intended effect [ 6 , 9 , 10 ] . on the other hand , \n the time that passes from diagnosis has an impact on the nature of complications and the effectiveness of surgical procedure . \n certain authors stress that the greatest chance for permanent success of ppv in the case of malignant glaucoma is related to quick implementation of surgical treatment . \n the goal of the study was to evaluate surgical treatment of malignant glaucoma in pseudophakic eyes by partial ppv extended by communication of the anterior chamber and vitreous cavity through removal of zonules and of the anterior and posterior capsule in the area of the iridectomy which was formed during primary glaucoma surgery . \n the following treatment schedule was applied when symptoms of malignant glaucoma occurred : mannitol 2 g per kg intravenously once or twice a day , acetazolamide 250 mg tid , and locally : atropine 1% qid , cosopt ( dorzolamide hydrochloride - timolol maleate ophthalmic solution ) bid , and 0.1% dexamethasone phosphate tid . \n sustainable improvement after medical and laser treatment was obtained in only 2 cases ( 9.1% ) . \n regardless of using all available methods most of malignant glaucoma cases ( 20 eyes ) needed to be treated surgically because of a weak effect of conservative treatment . \n the indication for surgical treatment was diagnosis of malignant glaucoma in eyes after cataract and glaucoma surgery or after glaucoma surgery in pseudophakic eyes based on symptoms such as progressive increase of iop together with axial shallowing of the anterior chamber in the presence of a patent iridotomy , despite the application of conservative and laser treatment [ 6 , 9 , 10 , 12 , 13 ] . \n all patients required iop reduction and restoration of anatomical relationships to prevent further progression of malignant glaucoma and its complications . \n exclusion criteria included suprachoroidal hemorrhage , pupillary block , hypotony progressing with shallowing of the anterior chamber or choroidal detachment , and inflammation in the anterior or posterior segment of the eyeball requiring conservative or surgical procedures of a different type . \n seventeen patients ( 20 eyes ) with symptoms of malignant glaucoma occurring at various time after primary surgery were recruited into the study . during qualification , medical history concerning prior procedures and applied treatments was taken . during baseline examination , \n iop , uncorrected distance visual acuity ( udva ) , and corrected distance visual acuity ( cdva ) were measured , the anterior segment was examined with consideration of anterior chamber depth , eye fundus examination along with evaluation of c / d and measurement of central corneal thickness and axial length ( axl ) was performed , and gonioscopic examination was conducted . \n the anterior and posterior segments were evaluated in terms of fulfillment of the inclusion criteria . \n all surgeries were performed with retrobulbar anesthesia ( 2% xylocaine and 0.5% bupivacaine ) by one surgeon ( m.r . ) . \n the anterior chamber was opened ( 1.2 mm ) at the 5:00 or 7:00 position depending on the eye that was being operated on . \n the anterior chamber was filled with viscoelastic ( viscoat , alcon laboratories , inc . ) . \n a trocar was inserted into the vitreous cavity through the pars plana at a distance of 3.5 mm from the corneal limbus , and after that 25-gauge ppv was performed , which included removal of the anterior part of the vitreous body . \n after the vitreous chamber was unburdened , the anterior chamber was filled using viscoat , adhesions around the present iridectomy , iris - lens adhesions , iridocorneal adhesions , and iris - capsule adhesions were released , and then the anterior chamber was opened in the projection of the iridectomy . a 25-gauge needle was inserted through this opening , puncturing the anterior and posterior capsule in the area of the iridectomy . \n there are few possible ways ( through the anterior chamber or from behind ) to clear the iridectomy and all of these methods can be used interchangeably . \n the iridectomy , posterior capsulotomy , and hyaloidotomy may be performed using a vitrectomy tip or using other surgical instruments . in this case \n series fragments of the circumferential capsule and zonula were removed with a 25-gauge vitrector , and communication was established between the anterior and posterior chamber and vitreous cavity . during the surgery we pay particular attention to performing vitrectomy in properly wide range in case \n the vitreous remnants do not disturb the flow through iridotomy and at the end of surgery we avoid leaving the vitreous in the sclerotomies . at the end of surgery , after the spontaneous deepening of anterior chamber was achieved , the site of the previously performed glaucoma surgery was revised , the anterior chamber was filled using viscoat , and wounds in the corneal limbus were sealed , sometimes with the application of single nylon 10/0 sutures . \n standard ophthalmological examination was performed on days 1 and 7 and 1 , 3 , 6 , and 12 months after surgery . \n iop , udva , and cdva ( snellen chart and logmar ) were determined , and the anterior and posterior segments of the eye were examined . \n postoperative course was analyzed , including the occurrence of complications and the number of applied antiglaucoma medications . \n complete surgical success was defined for two criteria : iop 18 mmhg and iop 21 mmhg without antiglaucoma medications , and satisfactory success was defined as iop at these two levels without and with a maximum of two antiglaucoma medications . \n ineffectiveness of the previous filtration procedure was identified when iop 21 mmhg was stated or when it was necessary to use antiglaucoma medications . \n early if they occurred in the first week after surgery ; other complications were qualified as late \n cystoid macular edema was stated based on deterioration of visual acuity and characteristic biomicroscopic image , and optical coherent tomography ( oct ) was performed in order to confirm the diagnosis . \n a recurrence of malignant glaucoma was considered to be shallowing of the anterior chamber with accompanying progressive iop increase after malignant glaucoma surgery . in the case of recurrence or suspected obstruction resulting from the formation of fibrin membranes in the area of iridectomy \n , unblocking of communication between the anterior and posterior segments was performed using nd : yag laser with energy 15 mj . \n statistical analysis of the investigated variables was performed with the shapiro - wilk and paired wilcoxon tests . \n friedman anova for matched groups and rank means and rank sums were also used for post hoc comparison . \n the kaplan - meier method was used to determine survival curves , and differences between them were tested by the log - rank test \n from january 2005 to march 2010 1689 eyes were treated with glaucoma surgery in single clinic ( military institute of medicine in warsaw ) , 960 ( 56.8% ) with penetrating surgery and 729 ( 43.2% ) with nonpenetrating surgery . \n 1417 ( 83.9% ) of conducted surgeries were combined with phacoemulsification , while 272 ( 16.1% ) were antiglaucoma surgeries without phacoemulsification . the decision to perform a combined procedure depended on vision loss connected with cataract development , \n subtype of the glaucoma surgery was chosen individually for each patient . in analyzed material malignant glaucoma occurred in 22 eyes ( 1.3% ) . among patients with penetrating surgery , \n malignant glaucoma occurred in 2.3% of patients , whereas after nonpenetrating surgery this complication was not found ( p = 0.00004 ) . \n the statement was made that penetrating surgery is the risk factor of malignant glaucoma occurrence . \n the risk of malignant glaucoma after phacotrabeculectomy and phacoiridencleisis was equivalent ( p = 0.058 ) . when the frequency of malignant glaucoma after trabeculectomy and iridencleisis was compared , the difference was not statistically significant ( p = 0.416 ) . in the group of patients with malignant glaucoma 40.9% \n eyes underwent surgical treatment with the method of phacoiridencleisis , 22.7% phacotrabeculectomy , 18.2% iridencleisis , 13.6% trabeculectomy , and 4.5% seton valve implantation before this complication occurred . \n the phakic eyes with malignant glaucoma and malignant glaucoma cases after cataract surgery were not analyzed for the study purpose . \n twenty eyes of 17 patients ( 15 women , 2 men ) with an average age of 62.9 13.3 ( sd ) years ( me 64 , range : 4385 years ) were recruited into the study . \n the mean time elapsed from primary glaucoma surgery was about two months but differed markedly equal to 61.4 190.5 ( sd ) days ( me 2.5 ; from 1 to 840 days ) . \n the mean time of observation was 405 366.1 ( sd ) days ( me 360 ; from 7 to 1440 days ) . \n significant variance of the iop value was stated ( anova = 38.73 ; p < 0.001 ) , which resulted from statistically significant iop reduction on day 1 after surgery ( rank means 3.72 , rank sum 67.0 , and p < 0.05 ) that was maintained until the end of observation ( anova = 2.51 ; p = 0.77462 ) ( figure 1 , table 2 ) . \n preoperative mean iop was 30.4 14.2 ( sd ) mmhg and decreased during the first day , on average , by 49.3% ( range : 11.880.8% ) to 13.4 4.4 ( sd ) mmhg ( rank means 3.72 , rank sum 67.0 , and p < 0.05 ) . \n after 12 months of follow - up , mean iop was 14.6 3.2 ( sd ) mmhg and was reduced , on average , by 43.0% ( range : 5.872.3% ) relative to initial values ( rank means 2.94 , rank sum 53.0 , and p < 0.05 ) ( table 2 ) . \n the mean number of antiglaucoma medications applied preoperatively was 3.3 1.1 ( sd ) ( me 3 ; range : 15 ) , and , at the end of follow - up , this number was significantly reduced to 1.2 1.1 ( sd ) ( me 1 ; range : 03 ) ( z = 3.059412 , p = 0.002218 ) ( table 2 ) . \n the complete success rate after 12 months of follow - up for the criteria 18 and 21 mmhg was , respectively , 46.0% and 49.0% , whereas the qualified success rate was , respectively , 76.2 and 85.7% ( figure 2 ) . \n it should be noted that a large drop of the percentage of patients fulfilling the complete success criterion is observed after the operation , which is related to the necessity of applying antiglaucoma medications for the purpose of iop control ( figure 2 ) . in 94.4% of cases , \n iop 18 mmhg was achieved after surgery , and a > 30.0% reduction of its value relative to initial values was achieved in 72.2% of cases during the same observation period . \n the mean logmar of cdva changed from 0.9 0.7 ( sd ) before surgery to 0.7 0.6 ( sd ) on day 1 after surgery ( rank means 0.50 , rank sum 6.50 , and p > 0.05 ) ; the cdva after 12 months was 0.3 0.5 ( sd ) ( rank means 2.92 , rank sum 38.0 , and p < 0.05 ) ( table 3 ) . \n the following early complications were observed : raised iop ( 5% ) , inflammatory exudate in the anterior chamber ( 5% ) , vitreous hemorrhage ( 10% ) , and posterior adhesions ( 5% ) . \n progressive shallowing of the anterior chamber without increase of iop was observed in the first week after surgery in 8 cases ( 40% ) . among the late complications , \n fibrosis was observed in 3 eyes ( 15.0% ) , recurrence of malignant glaucoma in 3 eyes ( 15% ) , cystoid macular edema in 2 eyes ( 10% ) , and retinal detachment in 1 eye ( 5% ) . \n despite well - established methods of conservative treatment and laser procedures to treat malignant glaucoma , it is documented that surgical management to release entrapped aqueous fluid remains the most efficacious . until chaundry and coworkers emphasized that establishing patent communication between the anterior chamber and vitreous cavity is the most important part of surgery in cases of malignant glaucoma , pars plana vitrectomy with or without lens extraction was applied to treat malignant glaucoma and was not successful in all cases [ 5 , 6 , 12 , 16 ] . \n evacuation of vitreous and aqueous humor from the vitreous cavity and establishment of communication with the anterior chamber help stop the vicious mechanism that eventually leads to increased iop . \n in postoperative follow - up , it is important to maintain patency of newly created passages by using an nd : yag laser , as this helps diminish the number of recurrences . \n the data presented here clearly demonstrates the significant decrease of iop on day 1 after surgery and at the end of follow - up . \n the efficacy of the surgery is further confirmed by the reduction of the number of antiglaucoma medications from about 3 before surgery to about 1 after the operation . \n the complete success rate in our whole group of patients for the two criteria of iop reduction , the iop 18 mmhg and iop 21 mmhg criteria , was 46% and 45% , respectively , whereas the qualified success rate was 76.2% and 85.7% , respectively . \n it is noteworthy that there is a great difference between complete and qualified success rates . \n this is related to the fact that ant - glaucoma drops were frequently necessary to control iop in our case series . \n the most typical and difficult complication of malignant glaucoma surgery is the recurrence of malignant glaucoma . \n tsai and coworkers described reoccurrence of symptoms in 33% of pseudophakic eyes treated with ppv and in 75% of phakic eyes after ppv . \n lois et al . did not observe recurrence of malignant glaucoma in 5 eyes treated surgically with zonulo - hyaloido - vitrectomy , but the follow - up was relatively short ( 19 months ) . \n sharma and coworkers also did not note return of malignant glaucoma symptoms in their study , but the procedure of vitrectomy - phacoemulsification - vitrectomy was performed only in 4 eyes . \n compared percentage of recurrence after conventional vitrectomy ( 75% ) and anterior vitrectomy with iridectomy and zonulectomy ( 66% ) , and they did not notice any after total ppv with iridectomy and zonulectomy \n . in our study , 11 eyes ( 55% ) exhibited isolated shallowing of the anterior chamber after surgical treatment of malignant glaucoma . in all cases , \n nd - yag capsulotomy was performed , and the laser beam was directed through a patent iridotomy / iridectomy or through the pupil . in eight eyes that did not show iop elevation , deepening of the anterior chamber was achieved . in three eyes with concomitant raised iop , frank recurrence was regarded ; however , only in one case reoperation was needed . \n failure of preceding glaucoma surgery was formerly described in the literature [ 5 , 6 , 9 , 12 ] . in our study \n it was observed in 11 eyes ( 55% ) , and this made administration of antiglaucoma drops necessary . at present , although new methods of treating malignant glaucoma are very promising , it is not possible to totally prevent complications . \n however , their occurrence can be limited by using new methods and making the decision to treat malignant glaucoma surgically as quickly as possible . \n posterior pars plana vitrectomy with concomitant zonulectomy and capsulectomy seems to be efficacious as far as iop control , post - op visual acuity , and reduction of medications are concerned . in general \n its pathomechanism is not fully understood , and the role of communication between the anterior chamber and posterior segment of the eye needs to be elucidated . the onset of malignant glaucoma differs , its frequency is low , and the application of various methods of treatment in groups of patients poses some ethical issues . \n it seems that further multicenter studies are needed to establish long - term success and optimal instrumentation in a larger group of patients . \n partial ppv with peripheral lens capsule excision communicating anterior chamber and vitreous cavity allows effective iop control in 12-month follow - up of 20 operated eyes , although in most cases there was a necessity of additional use of local antiglaucoma treatment in order to obtain the desired level of iop after operation . in case of recurrences connected with occlusion of created tunnel between anterior chamber and vitreous cavity nd - yag laser", "role": "user" }, { "content": "purpose . determination of partial posterior vitrectomy ( ppv ) in the proposed modification for treatment of malignant glaucoma . \n methods . the prospective , consecutive , single - center case series study involved patients in whom symptoms of malignant glaucoma occurred after combined cataract and glaucoma surgery or after glaucoma surgery in pseudophakic eye . when medical and laser treatment were not successful , partial ppv with establishment of communication between the anterior chamber and the vitreous cavity was performed . \n efficacy measures were intraocular pressure ( iop ) reduction , corrected distance visual acuity ( cdva ) , and the number of antiglaucoma medications . \n surgical success and occurring complications were also evaluated . \n results . \n the study enrolled 20 eyes of 17 patients . \n average iop was reduced from 30.4 14.2 ( sd ) mmhg to 14.6 3.2 ( sd ) mmhg one year after surgery ( p < 0.00001 ) . \n a statistically significant reduction of the number of antiglaucoma medications was obtained from 3.3 1.1 ( sd ) preoperatively to 1.2 1.1 ( sd ) at the end of follow - up . \n statistically significant improvement of cdva was observed 3 , 6 , and 12 months after surgery . \n conclusions . \n partial ppv with establishment of communication between the anterior chamber and the vitreous cavity enables effective iop control over a 12-month observation ; however , in most cases , it is necessary to use antiglaucoma medications for iop control .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: bromocriptine is an ergot derivative of ergoline and also an amide derivative of the d isomer of lysergic acid ; it is a white , crystalline almost odorless powder . \n bromocriptine is absorbed largely from the gastrointestinal tract , having a half life of about 3.3 hours and reaching peak plasma levels within 1 - 2 hours after oral administration . \n bromocriptine is a dopamine agonist that exerts its actions and properties at striatal d1 and d2 adenyl cyclase - linked dopamine receptors . \n bromocriptine inhibits prolactin secretion and also inhibits glutamate release by reversing the glutamate glt1 transporter . \n bromocriptine is used in the treatment of parkinson 's disease and has also been found valuable in the treatment of a number of endocrinologic and gynaecologic disorders [ 2 , 6 ] . \n it also induces behavioral and hormonal changes that could last several hours following a single systemic dose , such behavioral changes include motor hyperactivity in animals . in may 2009 , \n bromocriptine mesylate quick release was approved for the treatment of type 2 diabetes ; it is believed to exert its antidiuretic actions from its influence on hypothalamic circadian neuronal activities thus resetting abnormally elevated hypothalamic drive for an increase in plasma glucose , free fatty acids , and triglycerides in patients with type 2 diabetes . \n bromocriptine also has antioxidant properties ; a study evaluating its neuroprotective effects in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine ( mptp ) induces that toxicity concluded that bromocriptine blocked mptp - induced behavioral dysfunction and also reversed glutathione and dopamine depletion [ 9 , 10 ] . \n bromocriptine was mostly known for its use in the management of cns related disorders , with its increasing importance in the management of nonneurological conditions , its effects on neurobehaviour in the absence of brain pathology became important . \n a lot has been done studying the neurobehavioral effects of bromocriptine in rats or mice usually following single intraperitoneal injections [ 7 , 1113 ] . \n little data , if any on the behavioral effects of subchronic or chronic oral bromocriptine in mice , are available . \n electronic precision balance , plastic animal cages , sterile disposable syringes ( 1 , 5 , and 10 ml ) and needles , cotton wool , stop watch and open field box , and y - maze were used . \n normal saline , 5 mg bromocriptine tablets ( bromergon ) ( lek pharmaceutical and chemicals ) , was grounded into fine powder , weighed and dissolved in measured volume of isotonic saline solution to get the desired concentrations . \n bromocriptine at 2.5 and 5 mg / kg was administered orally using a cannula . \n healthy adult swiss albino mice purchased from the empire animal farms , osogbo , osun state , nigeria , with weights ranging from 20 to 25 g were used . \n the animals were housed in plastic cages measuring 16 12 10 ( 10 mice in each cage ) . \n they were maintained under standard laboratory conditions , that is , a well - aerated room with alternating light and dark cycles of 12 h each and at room temperature of 25c . the experimental protocol was approved by the ladoke akintola university animal ethics committee . \n a total of sixty animals were used for both studies , thirty animals for each of the experiments . \n the animals were randomly assigned into three groups a , b , and c. group a was the control and received normal saline . \n groups b and c received bromocriptine orally at 2.5 and 5 mg / kg daily , respectively , for a period of 21 days ; the animals were exposed to the open field and the y - maze thirty minutes after the first and last doses of either drug or vehicle . \n the behavioral tests were conducted in a large quite room between the hours of 8 am and 3 pm novelty - induced behaviors were evaluated using the open field box and spatial learning and memory using the y - maze . \n behaviors were scored by the authors using a stop watch ; all animals in a group were tested on the same day ( 10 animals per day ) . \n the open field box is a rectangular area composed of a hard floor measuring 36 36 26 cm and made of white painted wood . \n the floor was divided by permanent red markings into 16 equal squares at the bottom . \n generally , spontaneous motor activity was monitored for 30 min in the open field as described by ajayi and ukponmwan . \n after treatment as explained earlier , each mouse was introduced into the field and the total locomotion ( number of floor units entered with all paws ) , rearing frequency ( number of times the animal stood on its hind limbs or with its fore limbs against the walls of the observation box or free in the air ) , and frequency of grooming ( number of body cleaning with paws , picking of the body , and pubis with mouth and face - washing actions ) within each 10 min interval were recorded . \n the arena was cleaned with 5% alcohol to eliminate olfactory bias and the arena was allowed to dry before introducing a fresh animal . \n the y - maze can be used as a measure of short - term memory , general locomotor activity , and stereotypic behavior . \n therefore , spontaneous alternation was assessed using a y - maze composed of three equally spaced arms ( 120 , 41 cm long , and 15 cm high ) . \n the floor of each arm is made of pyrex and is 5 cm wide . \n each mouse was placed in one of the arm compartments and was allowed to move freely until its tail completely enters another arm . \n the sequence of arm entries is manually recorded , the arms being labeled a , b , or c. an alternation is defined as entry into all three arms consecutively , for instance , if the animal makes the following arm entries : acb , ca , b , c , a , cab , c , a , in this example , then the animal made 13 arm entries , 8 of which are correct alternations . \n the number of maximum spontaneous alternations is then the total number of arms entered minus two , and the percentage alternation is calculated as { ( actual alternations / maximum alternations ) 100}. for each animal , the y - maze testing was carried out for 5 minutes . \n the apparatus was cleaned with 5% alcohol and was allowed to dry between sessions . \n all data were analyzed using one way analysis of variance ( anova ) followed by a post hoc test ( student - newman - keuls ) test carried out to determine the source of a significant effect . \n figure 1 shows the acute and subchronic effects of bromocriptine on horizontal locomotion following thirty minutes of exposure in the open field . \n there was a significant increase in locomotor activity at 5 mg / kg on day 1 and at 2.5 and 5 mg / kg of bromocriptine compared to control on day 21 ( f = 11.94 , p < 0.05 , degree of freedom = 27 ) . \n figure 2 shows the acute and subchronic effects of bromocriptine on rearing activity following thirty minutes of exposure in the open field . on day 21 \n , there was a significant increase in rearing activity at 2.5 and 5 mg / kg compared to control ( f = 19.77 , p < 0.05 , degree of freedom = 27 ) . the response seen at 2.5 mg / kg was slightly higher than that seen at the 5 mg / kg dose , although the difference was only visual . \n figure 3 shows the effects of bromocriptine on grooming behavior following thirty minutes of exposure in the open field ; on both days 1 and 21 , there was significant increase in grooming behaviour at 2.5 and 5.0 mg / kg of bromocriptine compared to control ( f = 4.94 , p = 0.015 , degree of freedom = 27 ) . \n figure 4 shows effects of bromocriptine on locomotor activity following 5 mins exploration in the y - maze . on day 1 , \n locomotor activity increased significantly at 5 mg / kg , and on day 21 it showed significant increment in locomotor activity at 2.5 and 5.0 mg / kg of bromocriptine compared to control ( f = 32.68 , p = 0.00 , degree of freedom = 27 ) . \n figure 5 shows the effect of bromocriptine on spatial memory following 5 mins of exploration in the y - maze . \n there was a significant ( f = 4.15 , p = 0.027 , degree of freedom = 27 ) increase in percentage correct alternations ( spatial memory ) following administration of bromocriptine at 2.5 mg / kg of bromocriptine compared to control on day 21 , and comparing both doses of bromocriptine showed a more significantly increased alternation at 2.5 mg / kg than that seen at the 5 mg / kg dose . \n neurobehavioral effects of subchronic , oral bromocriptine in the open field , and y - maze in male swiss mice were studied . \n initial neurobehavioral assessments after the first dose showed no significant changes in locomotion and spatial memory with only grooming behavior showing significant increases . \n however , results at day 21 showed that at 2.5 and 5.0 mg / kg doses compared to control , bromocriptine significantly increased both horizontal and vertical locomotor activity , and this corroborates with findings from other studies that concluded that intraperitoneal injection of bromocriptine ( 520 mg / kg ) produced dose - dependent and long lasting locomotor stimulation in mice . \n another study reached almost the same conclusion , reporting that subcutaneous injection of bromocriptine at 3.0 mg / kg caused dose - specific elevation of locomotion in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine- ( mptp- ) treated neonatal mice ; suppression of activity was , however , seen at higher doses [ 9 , 10 ] . \n worthy of note is the fact that although almost similar conclusions were reached by these studies , different routes of administration were used , showing that either as an injection or daily oral bolus , bromocriptine increased locomotor activity . \n bromocriptine is known to produce a biphasic behavioral effect in mice , an early depression followed by stimulation [ 16 , 17 ] . in this study , \n day 1 tests showed no significant changes except for grooming , while day 21 tests showed major changes , and changes seen on day 21 are probably attributable to accumulation of bromocriptine following repeated doses , although we intend to evaluate this in subsequent studies . \n bromocriptine enhances locomotor activity by a complex involvement of both noradrenaline and dopamine pre- and postsynaptic neurons , possibly due to its partial agonist action or as a result of its active metabolite , these conclusions were deduced from an observation that the increased locomotor activity induced by bromocriptine was suppressed by drugs inhibiting both dopaminergic and noradrenergic pre- and post - synaptic actions . \n pelage cleaning in laboratory rodents can be seen following exposure to novelty . in the study , \n both acute and subchronic bromocriptine significantly increased novelty - induced grooming activity at 2.5 and 5 mg / kg \n . a higher intensity of grooming is , however , observed with chronic administration , further suggesting that bromocriptine effects on grooming tend to increase as cumulative doses are given . \n it is known that central dopaminergic activation induces intense grooming via d1 receptors and bromocriptine is a dopamine agonist at d1 receptors . since we now know from this study that both acute and subchronic doses affect grooming , a part of what we intend to continue to study is the differential modulatory effect of acute versus subchronic oral bromocriptine on d1 receptors . \n the y - maze is a behavioral model that can be used to investigate locomotor activity as well as learning and memory . in this study \n , it was observed that y - maze locomotor activities was significantly increased at 2.5 and 5.0 mg / kg of subchronic bromocriptine , and this is in accordance with bromocriptine ability to enhance locomotor activity as earlier observed . in the y - maze spatial memory task , \n a small nonsignificant decline was seen with acute dosing at 2.5 mg / kg but at 5 mg / kg ; it returned back to baseline , however , subchronic bromocriptine caused a dose - dependent change in spatial memory with peak ( significant ) value seen at 2.5 mg / kg and a decline at 5 mg / kg . \n the results we got from acute administration is consistent with previous studies reporting that bromocriptine causes dose - dependent differential effects on learning ; rats that received bromocriptine at 5 mg / kg intraperitoneal injection demonstrated impairment in learning , while bromocriptine at 10 mg / kg and vehicle - treated groups did not differ from normal controls . in subchronic doses , however , the ability of oral bromocriptine to enhance spatial memory at one of the doses administered is demonstrated . \n studies have shown that bromocriptine is a modulator of learning and memory , as it has been shown to cause a reduction in working memory errors in mice following exposure to the 12 arm radial maze , and this is also true in humans [ 22 , 23 ] . \n bromocriptine modulates learning and memory via its mixed agonist antagonist actions at dopamine receptors with the abilities to both increase and deplete dopamine levels as the case may be . \n this study demonstrates the ability of oral bromocriptine to affect neurobehavior in normal mice . \n it also suggests that there is a cumulative effect of oral bromocriptine on the behaviors studied with more changes being seen after subchronic administration rather than after a single oral dose .", "role": "user" }, { "content": "this study set out to assess the neurobehavioral effects of subchronic , oral bromocriptine methanesulfonate using the open field and the y - maze in healthy male mice . \n sixty adult swiss albino mice were assigned into three groups . \n controls received normal saline , while test groups received bromocriptine methanesulfonate at 2.5 and 5 mg / kg / day , respectively , for a period of 21 days . \n neurobehavioral tests were carried out on days 1 and 21 after administration . \n open field assessment on day 1 after administration revealed significant increase in grooming at 2.5 and 5 mg / kg , while horizontal and vertical locomotion showed no significant changes . day 1 also showed no significant changes in y - maze alternation . on day 21 , horizontal locomotion , rearing , and grooming were increased significantly at 2.5 and 5 mg / kg doses after administration ; also , spatial memory was significantly enhanced at 2.5 mg / kg . in conclusion , the study demonstrates the ability of oral bromocriptine to affect neurobehavior in normal mice . \n it also suggests that there is a cumulative effect of oral bromocriptine on the behaviors studied with more changes being seen after subchronic administration rather than after a single oral dose .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: valproic acid ( vpa ) is an antiepileptic drug for the treatment of epilepsy , absence seizures and lennox - gastaut syndrome . \n vpa has a negative effect on coagulation and may cause thrombocytopenia ( tcp ) , platelet abnormalities , alterations of concentrations of various coagulation factors . \n such hematological abnormalities may rarely lead to a large hemorrhage and may have a role in increased risk of bleeding after surgery . \n a 51-old - year female patient treated with vpa , at a dose of 1000 mg per day , for depressive and bipolar disorder , since 2008 , was admitted to our hospital with a diagnosis of hemoptysis . \n pulmonary bleeding was causing anemia ( up to four episodes of hemoptysis a day with the emission of bright red blood and fresh clots ) . \n blood tests showed mild anemia ( hemoglobin 9.6 g / dl ; hematocrit 28,2% ) . \n the bronchoalveolar lavage ( bal ) examination showed a proportion of hemosiderin - laden macrophage ( approximately 20% ) cultures for bacteria and fungi , mycobacteria , and the autoimmune tests were all negative . \n the ct scan of the chest showed ground - glass areas localized in the right upper lobe [ figure 1 ] . \n spirometry revealed restrictive abnormality , with diffusion capacity of the lung for carbon monoxide ( dlco ) being 70% of the predicted value . a ct scan repeated after six days showed a reduction of the lesions in the upper lobe and the appearance of bilateral ground - glass opacity , mainly in the middle lobe . \n vpa was suspended and the result was an immediate disappearance of hemoptysis , without recurrence . \n hematological dosage of vpa was 54.7 g / ml ( range 50 to 100 g / ml ) . \n after 20 days , the radiological and clinical follow - ups were normal [ figure 2 ] . \n ct scan of the thorax showing confluent nodular opacities and ground - glass areas follow - up chest x - ray \n valproic acid is used for the treatment of various forms of epilepsies and seizures , especially in the pediatric population . a variety of coagulation disorders , as side effects , have been demonstrated . \n some studies have showed a correlation between coagulation disorders and blood drug dosage , while others did not show any relation a significant reduction in platelet count and platelet dysfunction are the most common hematological adverse effects of vpa ( incidence range : 5 - 60% ) . \n tcp has been explained by the induction of an immune response against platelets or by the direct toxic effect on bone marrow . \n factor xiii - deficiency syndrome was related to the vpa treatment and associated with an increase in perioperative bleeding risk . acquired von willebrand disease \n vitamin k - dependent coagulopathies have been described , but the pathogenetic mechanisms have not been elucidated . \n the immediate improvement in prothrombin time ( pt ) after oral vitamin k administration , suggests an exogenous lack of vitamin k ; anyway , under normal nutritional conditions , the daily intake is much higher than the daily need of vitamin k , and vpa seems not to influence the intestinal uptake of vitamin k. a competitive rivalry for some metabolic steps seems to be more reliable . \n there are some reports about hematomas , epistaxis , and increased bleeding after neurosurgery . a review of the english - language medical literature revealed the description of only two other cases of vpa treatment related alveolar bleeding . \n diffuse alveolar hemorrhage ( dah ) is a life - threatening disorder characterized clinically by hemoptysis , in approximately one - third of the cases , falling hematocrit , diffuse pulmonary infiltrates , and hypoxemic respiratory failure . \n bleeding is caused mainly by injury , which causes alterations in the pulmonary microcirculation and subsequently increases permeability , similar to immune - mediated capillaritis and the treatment consists of supportive care , cessation of offending drugs , and if necessary , high - dose steroids , immunosuppressants , and plasmapheresis . \n one described case , reported a 15-year - old boy receiving vpa treatment since the age of 10 years for myoclonic epilepsy . \n he developed dyspnea and hemoptysis and radiological examinations revealed bilateral lung infiltrates , suggestive of dah . \n no alterations of coagulation were discovered , but the immediate disappearance of the symptoms and the sudden radiological improvement after two days and seven days , after discontinuation of the drug , were considered as a close association between bleeding and vpa . \n the second case is of a 30-year - old woman , who was receiving valproic acid since the age of 20 years for generalized seizure disorder , and was hospitalized for severe anemia . \n laboratory data showed hemoglobin of 4.9 g / dl , hematocrit of 15% , platelet count of 15,000/l , and a serum vpa level of 124 g / ml . the radiological reports showed that she had lower lobe infiltrates and a bone marrow aspirate , which were consistent with the myelodysplastic syndrome . \n unfortunately , the patient died because of respiratory failure due to the evolution of bilateral diffuse pulmonary infiltrates . in the reported case \n in fact the ct scan of the lung showed bilateral ground - glass infiltrates localized first in the right superior lobe and later in the middle lobe , with other diffuse ground - glass opacities bilaterally . \n bronchoscopic evaluation revealed the presence of blood in the middle lobe bronchus with a proportion of hemosiderin - laden macrophages ( approximately 20% ) and all bal specimens were negative for infection . \n autoimmune antibody tests were negative and the platelet count was always normal ( the lowest value recorded was 2,43,000/l ) . \n alterations or deficiency of coagulation factors were not found and a pre - existing disease , predisposing to dah , ( pulmonary or cardiac disorders , especially heart failure or interstitial lung diseases ) was not present . an increase in dlco is usually seen in cases with fresh dah . due to the increased availability of intra - alveolar hemoglobin that combines with carbon monoxide . \n this may be because the dlco measurements in our case were done more than 48 hours after admission . \n the association between bleeding and vpa treatment was diagnosed indirectly , because hemoptysis suddenly disappeared after cessation of vpa therapy and never recurred , with the radiological examinations normalizing after a week . \n the alterations of pulmonary microcirculation can cause dah , a life - threatening disease , which requires specific supportive treatment . in our case \n an association between vpa and dah was suspected and indirectly confirmed by the successful outcome , with no bleeding recurrence after cessation of the drug . \n vpa therapy is a common cause of various disorders of coagulation that is rarely associated with clinically significant spontaneous bleeding , but rather with an increased risk of postoperative bleeding . \n dah is one of the rare vpa - related complications , probably secondary to a combination of several hemostatic disorders .", "role": "user" }, { "content": "valproic acid ( vpa ) is one of the most frequently used antiepileptic drugs for the treatment of focal and generalized epilepsies , absence seizures , and lennox - gastaut syndrome ( lgs ) . \n vpa has been demonstrated to have a negative effect on both the intrinsic and extrinsic coagulation systems and controversy exists about the clinical relevance of such hematological abnormalities . \n we describe a case of reversible lung hemorrage due to vpa . in english - language literature only two other similar cases ( one of which fatal ) \n have been described so far .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: breast cancer remains the most common malignant tumor in women worldwide and one of the principal causes of cancer deaths . \n breast cancer cell growth is modulated by a composite network of growth factors , chemokines , and cytokines that induce rapid cell proliferation and metastasis . \n cytokines are important signaling molecules in the tumor microenvironment that regulate cancer cell growth through cancer cell progression and metastasis . \n murine breast cancer models revealed that interleukin ( il ) 4 and il-13 secretion and activation of il-4 receptor signaling facilitated tumor cell metastasis . \n both il-4 and il-13 are dependent on the interleukin-4 receptor ( il4r ) chain either for recognition and signaling ( i.e. , il-4 ) or signal transduction ( i.e. , il-13 ) . \n il-4 binds to the type i receptor , whereas both il-4 and il-13 bind to the il4r type ii receptor . \n in fact , an upregulation in the expression of il4r has not only been seen in breast cancer cells , but also in rhabdomyosarcoma , bladder cancer , and brain cancer . \n owing to the role of this receptor in regulation of cell division , it can be interpolated that the il4/il4r interaction and consequent signaling changes within cells can promote not only the proliferation , but also the survival of breast cancer cells . \n targeted delivery to specific cells through the use of nanoscale drug delivery systems ( ddss ) allows enhanced and selective accumulation of therapeutic agents in disease areas . \n in addition , nanocarriers can protect the drug / inhibitor against degradation and increase its half - life in the bloodstream , allowing better bio - pharmacokinetic control in host tissues . \n therefore , enhancing the ability of blocking antibodies to be administered directly to the cancerous tissue may improve treatment efficacy and decrease systemic side effects . \n recent advances in nanoscale dds allow specific delivery of various treatment options to the target tissue , ensuring improved efficacy , decreased side effects , and controlled release . among the different nanoparticles \n used , superparamagnetic iron oxide nanoparticles ( spion ) offers a novel theranostic approach enabling high detection sensitivity and selective targeting . \n biomedical interest in spions has increased considerably in the last few decades because of their potential for use as contrast agents in magnetic resonance imaging ( mri ) , in magnetic separation techniques , and hyperthermia . \n furthermore , spions have superior biocompatibility and ability to cross biological membranes in addition to providing the possibility of achieving high drug - loading capacity , sustained release , enhanced drug stability and absorption , as well as targeted deposition . doxorubicin ( dox ) , a member of the anthracycline class of chemotherapeutic agents , is commonly used to treat several common human cancers . therefore , targeting il4r using spion conjugated with anti - il4r blocking antibodies ( spion - il4r ) nanoparticles in combination with low doses of dox may help reduce toxicity and improve the clinical usefulness of cancer therapy . \n this study was conducted to assess the in vitro efficacy of il4r conjugated spion as theranostic nanoprobes for breast cancer by evaluating cell viability , reactive oxygen species generation , and apoptosis frequency in 4t1 breast cancer cells . \n in addition , the successful interaction and targeting of anti - il4r antibody conjugated spion with il4r receptors on 4t1 cancer cells was confirmed and the efficacy of combined treatment with spion - il4r and dox was reported . \n nanoferrite spions prepared via the core - shell method with a core of 75%-80% ( w / w ) magnetite and a shell of dextran ( micromod partikeltechnologie gmbh , rostock , germany ) were used in this study . \n spions were conjugated to polyethylene glycol ( peg ) polymer with a molecular weight of 2,000 g / mol as previously described . \n thiolated il4r monoclonal antibodies ( bd biosciences , san diego , ca ) , which specifically binds to cd124 ( also known as the subunit of mouse il4r ) , were conjugated to maleimide - functionalized spions as previously described . the anti \n spion - il4r were purified on magnetic - activated cell sorting columns ( miltenyi biotec , bergisch gladbach , germany ) . \n the hydrodynamic size and zeta potential ( i.e. , surface charge ) of nanoparticles before and after their conjugation with il4r antibodies were measured using zetasizer nano zs90 ( malvern instruments , malvern , uk ) . \n 4t1 murine breast cancer cells ( crl-2539 , american type culture collection [ atcc ] , manassas , va ) were cultured in complete roswell park memorial institute 1,640 medium containing 10% gamma - irradiated fetal bovine serum and 100 units / ml penicillin - streptomycin ( life technologies , carlsbad , ca ) at 37c in a humidified atmosphere containing 5% co2 . \n these cancer cells were chosen since their tumor growth in vivo and metastatic spread in mice closely mimics stage iv human breast cancer . \n spion - il4r and dox were applied at a concentration of 5 g / ml each based on our previous studies . \n cell viability was analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrasodium bromide ( mtt ) assay as per the manufacturer s protocol ( merck millipore , billerica , ma ) . upon completion of incubation of cultured 4t1 cells in complete medium with either anti - il4r antibodies , spion - igg1 ( nanoparticles with isotype antibodies ) , spion - il4r , dox , or combined spion - il4r+dox incubation for 24 , 48 , and 72 hours , 10 l of mtt reagent was added to each well and samples were incubated for 2 hours at 37c . \n the formazan crystals formed were dissolved in 100 l isopropanol with 0.04 n hcl and the absorbance was measured within an hour using an epoch biotek elisa plate reader ( biotek , winooski , vt ) with an absorbance wavelength of 570 nm and a reference wavelength of 630 nm . \n the percentage of cell viability under each condition was calculated relative to controls . a thiobarbituric acid reactive substances ( tbars ; r&d systems , minneapolis , mn ) \n parameter assay kit was used to measure the overall oxidative stress in 4t1 cells caused by either spion - il4r , dox , or combined spion - il4r+dox at different time intervals relative to controls . briefly , \n cultured 4t1 cells were equilibrated overnight , treated , washed and lysed using a cell lysis buffer . \n cells were incubated with an acid reagent for 15 minutes and centrifuged , after which supernatants were treated with thiobarbituric acid reagent for 2 - 3 hours at 45 - 50c . \n the absorbance of the samples was measured at 532 nm using a biotek enzyme - linked immunosorbent assay plate reader . \n the percentages of live , early apoptotic , late apoptotic , total apoptotic , and dead cells were quantitatively evaluated using muse annexin v and dead cell assay kit ( merck millipore ) before and after treatment of 4t1 tumor cells with either spion - il4r , dox , or combined spion - il4r+ dox . \n these experiments were conducted since apoptosis / programmed cell death is an important regulator of cell growth and proliferation . \n cells were mixed with the reagent , incubated for 20 minutes and analyzed using a muse cell analyzer ( merck millipore ) . to confirm specific targeting of spion - il4r to 4t1 cells , blocking of il4r receptors \n was performed for 4 hours with anti - mouse il4r antibody / isotype igg1 antibody in the presence or absence of il-4 . \n the specific targeting of anti - il4r conjugated spion was assessed in vitro using cultured 4t1 cells . \n nanoparticles were labeled with fluorescein isothiocyanate ( fitc ) using a pierce fitc labeling kit as per the manufacturer s protocols ( thermo fisher scientific , waltham , ma ) . \n cultured and trypsinized 4t1 cells were equilibrated overnight , fixed with 4% paraformaldehyde , washed with phosphate buffered saline ( pbs ) and blocked with anti - mouse il4r antibody or isotype igg1 antibody , respectively , for 30 minutes at room temperature on a shaker . \n the cells were washed with ice - cold pbs and stained with fitc labeled spion - il4r ( spion - il4rfitc ) for 30 minutes at room temperature on a shaker . \n the wells were washed again three times with ice - cold pbs , and mounted using ultracruz mounting medium ( santa cruz biotechnology inc . , \n all immunocytology slides were screened using an olympus bx53 fluorescent microscope ( olympus corporation , tokyo , japan ) . \n fluorimetry measurements were performed in 96 well black tissue culture plates under the same conditions . \n briefly , approximately 10 cells / well were equilibrated overnight , after which cells were blocked for 4 hours with either anti - il4r antibodies or isotype igg1 antibodies . \n fluorescence assessments were performed on an epoch biotek plate reader to determine differences in fluorescence intensity . \n in addition to the above , additional experiments were conducted to assess the viability and frequency of apoptosis following blocking of il4r receptors with anti - mouse il4r antibody or isotype igg1 antibody , respectively , for 2 hours at room temperature on a shaker . \n the cells were then washed with pbs and the cell viability and apoptosis frequency was analyzed as described above after 12 hours of incubation using either anti - il4r antibodies , spion - igg1 , spion - il4r , dox , or combined spion - il4r+dox . \n all experiments were performed in triplicate with exposure incubation times of 12 , 24 , 48 , and 72 hours as applicable and results were compared to untreated cells . \n nanoferrite spions prepared via the core - shell method with a core of 75%-80% ( w / w ) magnetite and a shell of dextran ( micromod partikeltechnologie gmbh , rostock , germany ) were used in this study . \n spions were conjugated to polyethylene glycol ( peg ) polymer with a molecular weight of 2,000 g / mol as previously described . \n thiolated il4r monoclonal antibodies ( bd biosciences , san diego , ca ) , which specifically binds to cd124 ( also known as the subunit of mouse il4r ) , were conjugated to maleimide - functionalized spions as previously described . the anti \n spion - il4r were purified on magnetic - activated cell sorting columns ( miltenyi biotec , bergisch gladbach , germany ) . \n the hydrodynamic size and zeta potential ( i.e. , surface charge ) of nanoparticles before and after their conjugation with il4r antibodies were measured using zetasizer nano zs90 ( malvern instruments , malvern , uk ) . \n 4t1 murine breast cancer cells ( crl-2539 , american type culture collection [ atcc ] , manassas , va ) were cultured in complete roswell park memorial institute 1,640 medium containing 10% gamma - irradiated fetal bovine serum and 100 units / ml penicillin - streptomycin ( life technologies , carlsbad , ca ) at 37c in a humidified atmosphere containing 5% co2 . \n these cancer cells were chosen since their tumor growth in vivo and metastatic spread in mice closely mimics stage iv human breast cancer . \n spion - il4r and dox were applied at a concentration of 5 g / ml each based on our previous studies . \n cell viability was analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrasodium bromide ( mtt ) assay as per the manufacturer s protocol ( merck millipore , billerica , ma ) . upon completion of incubation of cultured 4t1 cells in complete medium with either anti - il4r antibodies , spion - igg1 ( nanoparticles with isotype antibodies ) , spion - il4r , dox , or combined spion - il4r+dox incubation for 24 , 48 , and 72 hours , 10 l of mtt reagent was added to each well and samples were incubated for 2 hours at 37c . \n the formazan crystals formed were dissolved in 100 l isopropanol with 0.04 n hcl and the absorbance was measured within an hour using an epoch biotek elisa plate reader ( biotek , winooski , vt ) with an absorbance wavelength of 570 nm and a reference wavelength of 630 nm . \n a thiobarbituric acid reactive substances ( tbars ; r&d systems , minneapolis , mn ) parameter assay kit was used to measure the overall oxidative stress in 4t1 cells caused by either spion - il4r , dox , or combined spion - il4r+dox at different time intervals relative to controls . briefly , \n cultured 4t1 cells were equilibrated overnight , treated , washed and lysed using a cell lysis buffer . \n cells were incubated with an acid reagent for 15 minutes and centrifuged , after which supernatants were treated with thiobarbituric acid reagent for 2 - 3 hours at 45 - 50c . \n the absorbance of the samples was measured at 532 nm using a biotek enzyme - linked immunosorbent assay plate reader . \n the percentages of live , early apoptotic , late apoptotic , total apoptotic , and dead cells were quantitatively evaluated using muse annexin v and dead cell assay kit ( merck millipore ) before and after treatment of 4t1 tumor cells with either spion - il4r , dox , or combined spion - il4r+ dox . \n these experiments were conducted since apoptosis / programmed cell death is an important regulator of cell growth and proliferation . \n cells were mixed with the reagent , incubated for 20 minutes and analyzed using a muse cell analyzer ( merck millipore ) . \n to confirm specific targeting of spion - il4r to 4t1 cells , blocking of il4r receptors was performed for 4 hours with anti - mouse il4r antibody / isotype igg1 antibody in the presence or absence of il-4 . \n the specific targeting of anti - il4r conjugated spion was assessed in vitro using cultured 4t1 cells . \n nanoparticles were labeled with fluorescein isothiocyanate ( fitc ) using a pierce fitc labeling kit as per the manufacturer s protocols ( thermo fisher scientific , waltham , ma ) . \n cultured and trypsinized 4t1 cells were equilibrated overnight , fixed with 4% paraformaldehyde , washed with phosphate buffered saline ( pbs ) and blocked with anti - mouse il4r antibody or isotype igg1 antibody , respectively , for 30 minutes at room temperature on a shaker . \n the cells were washed with ice - cold pbs and stained with fitc labeled spion - il4r ( spion - il4rfitc ) for 30 minutes at room temperature on a shaker . \n the wells were washed again three times with ice - cold pbs , and mounted using ultracruz mounting medium ( santa cruz biotechnology inc . , \n all immunocytology slides were screened using an olympus bx53 fluorescent microscope ( olympus corporation , tokyo , japan ) . \n fluorimetry measurements were performed in 96 well black tissue culture plates under the same conditions . \n briefly , approximately 10 cells / well were equilibrated overnight , after which cells were blocked for 4 hours with either anti - il4r antibodies or isotype igg1 antibodies . \n fluorescence assessments were performed on an epoch biotek plate reader to determine differences in fluorescence intensity . \n in addition to the above , additional experiments were conducted to assess the viability and frequency of apoptosis following blocking of il4r receptors with anti - mouse il4r antibody or isotype igg1 antibody , respectively , for 2 hours at room temperature on a shaker . \n the cells were then washed with pbs and the cell viability and apoptosis frequency was analyzed as described above after 12 hours of incubation using either anti - il4r antibodies , spion - igg1 , spion - il4r , dox , or combined spion - il4r+dox . \n all experiments were performed in triplicate with exposure incubation times of 12 , 24 , 48 , and 72 hours as applicable and results were compared to untreated cells . \n peg - functionalized spions were conjugated to anti - il4r antibodies via a peg chain with a molecular weight of 2,000 g / mol . \n spions have a hydrodynamic size of 132.55.9 nm and a surface charge of 2.710.62 mv based on measurement of the zeta potential using a zetasizer nano zs90 . \n following conjugation with anti - il4r antibodies , no significant change in the size of spion - il4r nanocarriers ( i.e. , 133.15.7 nm ) was measured , although their surface charge decreased slightly to 1.050.46 mv . \n quantification by bicinchoninic acid protein assay revealed that the amount of conjugated il4r antibodies was approximately 13.7 g per milligram of spion . \n next , the ability of spion - il4r to induce tumor cell death and apoptosis was assessed and compared to the effect of dox or spion - il4r+dox . \n mtt cell proliferation assays and tbars assessments were conducted to determine if spion - il4r and/or dox can induce cytotoxicity and oxidative stress in cultured 4t1 cancer cells , respectively . \n a significant reduction in cell viability was observed after cell incubation with either spion - il4r or dox separately , while a more prominent effect was observed in response to combined treatment ( fig . \n similarly , while spion - il4r and dox caused comparable elevations in reactive oxygen species when administered alone , substantial increases in oxidative stress were observed in response to their combined administration . \n the apoptosis frequency induced by spion - igg1 , anti - il4r antibodies , spion - il4r , and dox in breast cancer murine 4t1 cells was also evaluated . to determine if apoptosis induced by spion - il4r is potentiated by the addition of dox , the effects of spion - il4r+dox were investigated . while anti - il4r antibodies , spion - il4r , dox , and spion - il4r+dox caused a significant increase in cell death at 24 hours , as expected , no significant increases in apoptosis were observed in response to spion - igg1 . \n spion - il4r and dox alone caused significant increases in programmed cell death from 48 hours onwards , while spion - il4r+dox induced more apoptosis than either compound alone ( fig . \n the higher levels of apoptosis induced by spion - il4r+dox after 24 hours indicated an additive effect of this combination compared to either treatment alone . to confirm whether the synthesized \n spion - il4r indeed bound to il4r receptors on 4t1 cells , cultured cells were blocked with anti - il4r/isotype igg1 antibody for 4 hours prior to exposure to spion - il4r-fitc conjugated nanocarriers . \n prior blocking of the il4r receptors with anti - il4r antibodies inhibited binding of spion - il4r-fitc and consequently caused a decrease in fluorescence intensity ( fig . \n 3 ) . in 4t1 cells , which have been treated with isotype igg1 antibody , \n this increased fluorescence intensity was also confirmed and quantified by fluorimetry assessments , which revealed a 68.7% fluorescence intensity without blocking , while the fluorescence intensity was estimated to be 19.8% following il4r blocking , confirming that the developed nanocarriers positively bound to il4r receptors on cultured 4t1 cells . \n interestingly , upon prior blocking of cells with anti - il4r antibodies , an increase in cell viability and decrease in apoptosis was observed in 4t1 cells treated with spion - il4r nanocarriers , providing additional confirmation of the specific targeting of the designed nanocarriers . \n these findings also indicate that prior blocking with anti - il4r antibodies blocked the il4r receptors , leaving no / minimal sites for the nanocarriers to bind . \n in contrast , 4t1 cells that were blocked with isotype igg1 antibodies showed significantly decreased cell viability and increased apoptosis ( fig . \n since dox acts independently of spion - il4r nanocarriers , it caused a significant decrease ( p < 0.05 ) in cell viability and increase in apoptosis ( as expected ) , regardless of whether the receptors were blocked with either anti - il4r antibodies or isotype igg1 antibodies . \n overall , these results conclusively confirmed that our developed nanoparticles did indeed bind to il4r receptors on cultured 4t1 cells . \n peg - functionalized spions were conjugated to anti - il4r antibodies via a peg chain with a molecular weight of 2,000 g / mol . \n spions have a hydrodynamic size of 132.55.9 nm and a surface charge of 2.710.62 mv based on measurement of the zeta potential using a zetasizer nano zs90 . \n following conjugation with anti - il4r antibodies , no significant change in the size of spion - il4r nanocarriers ( i.e. , 133.15.7 nm ) was measured , although their surface charge decreased slightly to 1.050.46 mv . \n quantification by bicinchoninic acid protein assay revealed that the amount of conjugated il4r antibodies was approximately 13.7 g per milligram of spion . \n next , the ability of spion - il4r to induce tumor cell death and apoptosis was assessed and compared to the effect of dox or spion - il4r+dox . \n mtt cell proliferation assays and tbars assessments were conducted to determine if spion - il4r and/or dox can induce cytotoxicity and oxidative stress in cultured 4t1 cancer cells , respectively . \n a significant reduction in cell viability was observed after cell incubation with either spion - il4r or dox separately , while a more prominent effect was observed in response to combined treatment ( fig . \n cell viability decreased to 48% . similarly , while spion - il4r and dox caused comparable elevations in reactive oxygen species when administered alone , substantial increases in oxidative stress were observed in response to their combined administration . \n the apoptosis frequency induced by spion - igg1 , anti - il4r antibodies , spion - il4r , and dox in breast cancer murine 4t1 cells was also evaluated . to determine if apoptosis induced by spion - il4r is potentiated by the addition of dox , the effects of spion - il4r+dox were investigated . while anti - il4r antibodies , spion - il4r , dox , and spion - il4r+dox caused a significant increase in cell death at 24 hours , as expected , no significant increases in apoptosis were observed in response to spion - igg1 . \n spion - il4r and dox alone caused significant increases in programmed cell death from 48 hours onwards , while spion - il4r+dox induced more apoptosis than either compound alone ( fig . \n the higher levels of apoptosis induced by spion - il4r+dox after 24 hours indicated an additive effect of this combination compared to either treatment alone . \n to confirm whether the synthesized spion - il4r indeed bound to il4r receptors on 4t1 cells , cultured cells were blocked with anti - il4r/isotype igg1 antibody for 4 hours prior to exposure to spion - il4r-fitc conjugated nanocarriers . \n prior blocking of the il4r receptors with anti - il4r antibodies inhibited binding of spion - il4r-fitc and consequently caused a decrease in fluorescence intensity ( fig . \n 3 ) . in 4t1 cells , which have been treated with isotype igg1 antibody , \n this increased fluorescence intensity was also confirmed and quantified by fluorimetry assessments , which revealed a 68.7% fluorescence intensity without blocking , while the fluorescence intensity was estimated to be 19.8% following il4r blocking , confirming that the developed nanocarriers positively bound to il4r receptors on cultured 4t1 cells . \n interestingly , upon prior blocking of cells with anti - il4r antibodies , an increase in cell viability and decrease in apoptosis was observed in 4t1 cells treated with spion - il4r nanocarriers , providing additional confirmation of the specific targeting of the designed nanocarriers . \n these findings also indicate that prior blocking with anti - il4r antibodies blocked the il4r receptors , leaving no / minimal sites for the nanocarriers to bind . \n in contrast , 4t1 cells that were blocked with isotype igg1 antibodies showed significantly decreased cell viability and increased apoptosis ( fig . \n since dox acts independently of spion - il4r nanocarriers , it caused a significant decrease ( p < 0.05 ) in cell viability and increase in apoptosis ( as expected ) , regardless of whether the receptors were blocked with either anti - il4r antibodies or isotype igg1 antibodies . \n overall , these results conclusively confirmed that our developed nanoparticles did indeed bind to il4r receptors on cultured 4t1 cells . \n the interaction of il4r receptor with the cytokine il-4 has been shown to be associated with proliferation of breast cancer cells , causing enhanced survival and metastases of cancer cells in vivo . \n il-13 , a cytokine related to il-4 , also uses il4r receptors for cell signaling . \n il4r receptors have been found to be expressed and activated in mouse models of breast cancer . \n the possibility that both il-4 and il-13 can be simultaneously targeted in breast cancer is based on the idea that they both play a role in cell proliferation and are dependent on the il4r chain , either for recognition or signal transduction . \n therefore , disruption of the interaction of il-4 with il4r receptors may help abrogate the proliferation and metastatic spread of cancer cells . in the present study , we assessed the effects of blocking il4r receptors in 4t1 breast cancer cells by specifically and actively targeting an antibody - conjugated spion nanocarrier and compared these effects with combined treatment with dox , a chemotherapeutic drug widely used in cancer therapy . with this novel approach \n , we aim to significantly improve both cancer diagnosis and therapy while minimizing the side effects of currently used chemotherapeutic agents . \n spions offer several advantages for prospective in vivo applications over competing nanocarriers by enabling both single cell tracking and imaging of diseased areas using noninvasive mri . \n additionally , spions have superior biocompatibility and ability to cross biological membranes in addition to a high drug - loading capacity and enabling sustained release , enhanced drug stability and absorption , as well as targeted deposition . \n the nanocarriers developed here have been previously validated to be highly safe and revealed excellent stability at neutral ph , while their stability decreased remarkably in acidic environments with the use of 2,000 g / mol peg chain linker ; thus , they can preferentially release conjugated blocking antibodies . \n this is the first study to evaluate the ability of spion - il4r alone or in combination with dox to induce cytotoxicity and increase reactive oxygen species generation and apoptosis frequency in breast cancer cells . \n one of the major hindrances to successful cancer treatment is the resistance of cancer cells to cell death , which primarily occurs because of drug resistance mechanisms , enhanced efflux of anti - cancer drugs or alterations in cell signaling - pathways enabling cancer cells to quickly undergo metastasis . \n therefore , induction of apoptosis plays a major role in limiting the spread of cancer cells . \n since il-4 plays a role in survival of cancer cells , we hypothesized that neutralization of the interaction of il4r receptors through the use of il4r antibodies conjugated to spion may limit cell proliferation and induce apoptosis in cancer cells . moreover , the main anticancer action of dox is thought to be a result of topoisomerase ii inhibition and free radical generation . in agreement with other studies \n , the current study demonstrated that blockade of il4r successfully induced apoptosis of 4t1 cancer cells . similarly and as expected , dox also induced apoptosis of 4t1 cells , confirming the results of other studies . \n it is important to note that potentiation of apoptosis was observed when a combination of spion - il4r and dox was used . \n this additive effect of il-4neutralizing antibody in spion - il4r when combined with chemotherapy may enable considerable reduction of tumor growth via increased apoptotic events , thus limiting metastasis and minimizing the required amount of chemotherapeutic drugs . \n advances in novel ddss to diagnose , target and treat local and metastatic tumor sites have provided many advantages in limiting tumor progression and metastases . in this study , the in vitro efficacy of a combination of spion - il4r and dox on 4t1 breast cancer cells that multiply and simulate stage iv human breast cancer was evaluated . \n spion - il4r was used because 4t1 cancer cells have been shown to overexpress il4r receptors , which in turn use il-4 and il-13 to mediate signal transduction events that modulate cell proliferation . \n therefore , simultaneous inhibition of the interaction of il-4 and il-13 by blocking il4r receptors using anti - il4r antibody nanocarriers may offer a promising therapeutic approach in breast cancer . \n a nanocarrier - based approach was used to enable improvement of treatment efficacy owing to specific targeting of cells while minimizing side effects . \n the specific targeting of designed spion - il4r nanocarriers was demonstrated through a combination of immunofluorescence , fluorimetry , cell viability and apoptosis assessments following prior blocking of il4r receptors on 4t1 cells with either anti - il4r antibody or isotype igg antibody ( i.e. , without blocking ) . additionally , a commonly used anti - cancer drug , dox , was used to investigate if the combination of spion - il4r and dox was able to achieve a higher treatment efficacy than either treatment alone . \n the current study conclusively confirmed that a combination of spion - il4r and dox induced better cytotoxicity , oxidative stress and apoptosis in breast cancer cells than either treatment alone . \n both spion - il4r and dox caused alterations in the levels of inflammatory mediators produced by 4t1 cancer cells . \n in addition , the synthesized spion - il4r successfully targeted the il4r receptors on 4t1 cancer cells . \n these positive study results are encouraging , and future studies will now focus on the in vivo efficacy of spion - il4r in the breast cancer mouse model .", "role": "user" }, { "content": "purposethe specific targeting of interleukin-4 receptor ( il4r ) receptor offers a promising therapeutic approach for inhibition of tumor cell progression in breast cancer patients . in the current study , the in vitro efficacy of superparamagnetic iron oxide nanoparticles conjugated with anti - il4r blocking antibodies ( spion - il4r ) via polyethylene glycol polymers was evaluated in 4t1 breast cancer cells.materials and methodscell viability , reactive oxygen species generation , and apoptosis frequency were assessed in vitro in 4t1 cancer cell lines following exposure to spion - il4r alone or combined with doxorubicin . \n in addition , immunofluorescence assessments and fluorimetrywere performed to confirm the specific targeting and interaction of the developed nanocarriers with il4r receptors in breast cancer cells.resultsblocking of il4r receptors caused a significant decrease in cell viability and induced apoptosis in 4t1 cells . \n in addition , combined treatment with spion - il4r+doxorubicin caused significant increases in cell death , apoptosis , and oxidative stress compared to either spion - il4r or doxorubicin alone , indicating the enhanced therapeutic efficacy of this combination . the decrease in fluorescence intensity upon immunofluorescence and fluorimetry assays combined with increased viability and decreased apoptosis following the blocking of il4r receptors confirmed the successful binding of the synthesized nanocarriers to the target sites on murine 4t1 breast cancerous cells.conclusionthese results suggest that spion - il4r nanocarriers might be used for successfulreduction of tumor growth and inhibition of progression of metastasis in vivo .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: non - melanoma skin cancer ( nmsc ) is the most commonly diagnosed type of cancer . \n over 2 million patients are treated for these cancers each year in the usa alone , resulting in nearly $ 1.5 billion total direct costs annually . \n unlike many other types of cancer , the rates of nmsc continue to rise , indicating the need to increase research and identify new , more effective therapies . \n nmscs are primarily caused by chronic exposure to ultraviolet ( uv ) light from the sun , although chemical exposure , chronic wounds , and viral infection can be risk factors as well [ 1 , 4 ] . \n there are two main types of nmsc : basal cell carcinoma ( bcc ) and squamous cell carcinoma ( scc ) . \n and although these tumors are rarely metastatic , patients have a high risk of developing additional tumors within 5 years of diagnosis . \n sccs make up roughly 16% of all skin cancers and are typically more aggressive than bccs , posing a higher risk for metastasis and leading to approximately 2,500 deaths annually . \n the risk of developing skin cancer is very high in the general population , as one in five people will develop skin cancer in their lifetimes ; however , certain populations such as transplant patients are at an even greater risk [ 7 , 8 ] . \n angiogenesis , the growth and expansion of the vasculature , is an important process in the growth and metastasis of many cancers , including nmsc . \n vascular endothelial growth factor ( vegf ) is a potent pro - angiogenic factor and several studies have established a critical role for vegf in skin cancer . \n vegf transgenic and conditional knockout mice subjected to skin carcinogenesis protocols , such as the well - established two - stage chemical carcinogenesis model [ 11 , 12 ] , have demonstrated that vegf promotes skin carcinogenesis through the induction of angiogenesis [ 13 , 14 ] . \n additionally , several recent studies have now uncovered direct effects of vegf on keratinocytes and skin tumor cells . \n these studies have suggested that in addition to enhancing angiogenesis , vegf may promote skin carcinogenesis by altering the survival , proliferation , or stemness of keratinocytes and tumor cells in an autocrine manner [ 1518 ] . \n furthermore , immune cells such as macrophages can respond to directly vegf [ 19 , 20 ] and recent studies indicate that vegf recruits macrophages to skin tumors \n . this review will highlight our current knowledge of the angiogenic and newly discovered non - angiogenic activities of vegf that contribute to non - melanoma skin cancer , which are summarized in figure 1 . \n angiogenesis is a key process in the growth and spread of many cancers , including skin cancer . \n typically , angiogenesis is required for tumors to grow beyond 1 - 2 mm in size and offers a route for tumor cells to disseminate to secondary sites . because of this \n , tumor angiogenesis has been an attractive and promising therapeutic target . to induce angiogenesis , tumor cells and cells within the tumor microenvironment \n must alter the balance of pro- and anti - angiogenic factors , favoring an angiogenic switch . \n when pro - angiogenic signals outweigh anti - angiogenic signals , it allows for capillary sprouting through the proliferation and migration of endothelial cells . eventually , the newly formed vessels supply the tumor with oxygen and nutrients required for continued growth . \n many pro - angiogenic factors have been identified and characterized , including basic fibroblast growth factor ( bfgf ) , interleukin-8 ( il-8 ) , platelet - derived growth factor ( pdgf ) , placental growth factor ( plgf ) , transforming growth factor- ( tgf- ) , and vascular endothelial growth factor ( vegf ) . \n vegf - a ( referred to as vegf throughout this article ) is a 45 kda heterodimeric heparin - binding protein belonging to the family of vascular endothelial growth factors . \n at least 5 splice variants of vegf have been identified in humans , including vegf121 , vegf145 , vegf165 , vegf189 , and vegf206 [ 25 , 26 ] . \n vegf binds to three known receptors : vegf receptor-1 ( vegfr-1 ) , vegf receptor-2 ( vegfr-2 ) , and neuropilin-1 ( nrp-1 ) [ 2729 ] . \n vegfr-1 and vegfr-2 are tyrosine kinase receptors characterized by a seven immunoglobulin - like extracellular domain , a single transmembrane region , and an intracellular tyrosine kinase domain . \n nrp-1 is a single pass transmembrane protein that binds semaphorins as well as some isoforms of vegf . \n nrp-1 functions as a coreceptor for the vegfrs , enhancing their activity ; however , nrp-1 may be able to signal independently of vegfrs in response to vegf , particularly in tumor cells . \n vegf is well characterized as a potent inducer of angiogenesis and functions as a survival factor and mitogen for endothelial cells [ 34 , 35 ] . in general , vegf is expressed at low levels by epidermal keratinocytes and is upregulated during many pathological processes such as wound healing , psoriasis , and skin carcinogenesis [ 3638 ] . \n vegf production by keratinocytes can be induced by many stimuli including hypoxia , transforming growth factor- , keratinocyte growth factor , uv radiation , and the tumor promoter 12-o - tetradecanoylphorbol-13 acetate ( tpa ) , while vegf production is inhibited by the transcription factor fra-1 [ 3946 ] . \n strong evidence has demonstrated that vegf plays an important role in skin carcinogenesis . in human skin , vegf is expressed at low levels in normal epidermis , with more differentiated epidermal cell layers generally expressing more vegf than less differentiated epidermal cells [ 4749 ] . \n several studies have confirmed that vegf levels are elevated in tumor cells compared to normal epidermal cells using immunohistochemistry and in situ hybridization techniques [ 4749 ] . \n tumor cells of human bccs tend to show weak vegf expression [ 47 , 48 , 50 ] with positive tumor cells predominantly localized to the invading margin . \n in contrast , sccs , which are typically more aggressive than bccs , display more intense and widespread staining , with higher expression in tumor cells localized near infiltrating inflammatory cells [ 47 , 50 ] . furthermore \n vessel density is also high in sccs , especially in late - stage sccs , compared to normal skin , actinic keratoses , bccs , or early - stage sccs [ 48 , 49 ] . in mice , acute exposure to tumor promoters such as tpa or uv light causes upregulation of vegf and induction of angiogenesis in the skin [ 38 , 5153 ] . \n vegf expression patterns in murine models of skin carcinogenesis mimic what is observed in human tumors . \n a functional role for vegf in skin tumor angiogenesis has been demonstrated through the use of transgenic and conditional knockout mice . \n both k6-vegf and k14-vegf transgenic mice which overexpress vegf in epidermal keratinocytes show elevated blood vessel density in the skin and in skin tumors compared to controls [ 13 , 14 , 54 ] . \n vegf transgenic mice are also more susceptible to two - step chemical carcinogenesis [ 13 , 14 ] . \n in addition to containing a larger number of blood and lymphatic vessels both within and surrounding skin tumors , k14-vegf mice develop chemically - induced tumors more rapidly and also have a dramatically higher incidence of metastasis than controls . \n conversely , conditional k14-vegf knockout mice have reduced blood vessel density in tumors and are much more resistant to chemical carcinogenesis \n in addition to inducing papillomas and sccs , uv exposure increases vegf levels and neovascularization in the skin [ 52 , 53 , 56 ] . \n inhibition of vegf in the skin with compounds such as epigallocatechin-3-gallate ( ecgc ) and myricetin leads to a decrease in angiogenesis and a reduction in the number of uv - induced skin tumors [ 5658 ] . \n evidence from orthotopic skin tumor models has also shown a link between vegf , angiogenesis , and tumor development [ 59 , 60 ] . \n scc-13 cells transfected with vegf form invasive , highly vascularized tumors when injected subcutaneously or intradermally into nude mice . \n similarly , tumors arising from a malignant hacat cell line , which produce large amounts of vegf , initiate angiogenesis more quickly and to a larger degree than hacat cell lines which form benign tumors . \n furthermore , treatment with vegfr-2 blocking antibodies reduces endothelial cell proliferation and vessel density in tumors derived from the malignant cell lines to levels comparable to benign cell lines . \n in addition , vegfr-2 antibody treatments reduce tumor growth and invasiveness , suggesting that vegf promotes tumor growth by inducing angiogenesis . taken together , \n the evidence from human tumors and animal models demonstrate that vegf is critical for the development , growth , and spread of skin tumors , and these findings have been largely attributed to the promotion of angiogenesis by vegf . \n although dermal cells such as macrophages , fibroblasts , and other cell types are known to produce vegf , epidermal keratinocytes are believed to be the principle source of vegf in the skin [ 36 , 45 , 55 , 61 ] . \n in addition to stimulating angiogenesis through its actions on endothelial cells , recent evidence has demonstrated that vegf can have direct effects on keratinocytes . \n several groups have now identified vegf receptors on keratinocytes , suggesting the possibility of autocrine vegf signaling . currently , there is some disparity in the exact receptor profiles that have been described . \n some studies have identified vegfr-1 , vegfr-2 , and nrp-1 on keratinocytes [ 18 , 62 ] ; however , others do not detect vegfr-2 [ 1517 ] . \n our lab has shown that vegf induces the proliferation of cultured primary human keratinocytes through vegfr-1 and this finding has been confirmed by others in murine keratinocytes . \n additionally , vegfr-1 is expressed in mouse and human skin tumor cells and in squamous cell carcinoma cell lines , suggesting that vegf could affect tumor cells directly . \n autocrine functions for vegf in keratinocytes and skin tumor cells have also been suggested by recent functional studies performed in vivo [ 16 , 17 ] . \n lichtenberger et al . utilized various conditional knockout mice to uncover a direct role of vegf in skin carcinogenesis using the k5-sos model , in which the ras activator son of sevenless is constitutively activated in the epidermis . in this model , \n k5-sos mice develop skin tumors spontaneously and tumors can be induced rapidly by wounding the skin [ 17 , 64 ] . \n keratinocytes were shown to overexpress vegf in the k5-sos model , and k5-specific deletion of vegf reduced tumor development in these mice . \n loss of keratinocyte vegf also lead to a decrease in vessel density and a decrease in tumor cell proliferation , and vegf was able to enhance keratinocyte proliferation in vitro . because vegfr-1 expression was detected in murine and human skin cells , epidermal vegfr-1 was deleted in k5-sos mice . a reduction in papilloma development and tumor cell proliferation \n was observed in conditional vegfr-1 knockout mice compared to controls , while blood vessel density was unaffected . \n together , these studies establish a direct role for vegf in skin carcinogenesis , wherein vegf stimulates tumor cell proliferation through vegfr-1 . \n interestingly , an autocrine loop between vegf and nrp-1 has also been discovered . using the two - stage chemical skin carcinogenesis model , beck et al . \n cd34 tumor cells were shown to express higher levels of vegf than cd34 tumor cells or normal keratinocytes . \n epidermal overexpression of vegf increased the pool of cd34 cscs , while inhibition of vegfr-2 activity with dc101 or conditional deletion of vegf in the epidermis reduced the csc pool and diminished csc proliferation , in addition to reducing the number of established tumors . \n conditional deletion of nrp-1 completely blocked tumor formation in the chemical carcinogenesis model compared to control mice which all developed papillomas . \n in addition , when conditional nrp-1 knockout mice were crossed with vegf transgenic mice , vegf was unable to promote tumor growth , even though efficient tumor angiogenesis was still observed . \n overall , the results suggest that epithelial cell - derived vegf regulates cscs in an autocrine manner . in addition to affecting epithelial cell proliferation and stemness , a recent study suggested that vegf may also directly affect keratinocyte survival in vitro.zhu et al . \n showed that exposure to uv light , the primary causative agent of nmsc , increased the expression of vegfr-1 , vegfr-2 , and nrp-1 in primary normal human keratinocytes in vitro and in human epidermis in vivo . \n interestingly , vegf was able to protect keratinocytes from apoptosis following exposure to moderate ( 300 j / m ) but not high ( 700 j / m ) doses of uv . \n activation of vegfr-2 , but not vegfr-1 , was responsible for the observed increase in keratinocyte survival . \n although these results will need to be confirmed in vivo , they suggest that vegf could function as a survival factor for keratinocytes following uv exposure . \n in addition to endothelial cells , some immune cells also express vegf receptors , supporting the idea that vegf can have paracrine effects that are not related to its pro - angiogenic activity . \n for example , monocytes and macrophages express vegfr-1 and vegf has been shown to be a chemoattractant for these cells [ 19 , 20 ] . \n tumor - associated macrophages , particularly m2 macrophages , are believed to promote tumor growth and invasion and well as angiogenesis [ 65 , 66 ] . \n recently , linde et al . used an orthotopic tumor model in which control or vegf - transfected hacat cells were injected subcutaneously into mice . \n vegf - driven hacat tumors were larger , more vascular , more invasive , and had higher numbers of infiltrating m2 macrophages compared to control tumors . \n depletion of macrophages reversed the effects of vegf overexpression , indicating that vegf was influencing tumor development by affecting macrophages . in this model , vegf stimulated the recruitment of macrophages to the tumors but was not sufficient to polarize them . \n these studies indicate that in addition to promoting angiogenesis , vegf can influence skin carcinogenesis by recruiting immune cells . \n strong evidence has established a critical role for vegf in the development of non - melanoma skin cancers . \n vegf is produced by the skin in response to tumor - promoting agents such as tpa and uv light , and skin tumors are known to express elevated levels of vegf . in mouse studies , vegf increases angiogenesis and tumor growth , while the loss of vegf inhibits skin carcinogenesis . to date , these findings have been primarily attributed to the potent pro - angiogenic effects of vegf . \n however , the presence of vegf receptors on non - endothelial cell types , such as keratinocytes and macrophages , has expanded our view of the potential functions of vegf . \n indeed , new evidence suggests that vegf can impact skin carcinogenesis by directly affecting keratinocytes , tumor cells , and immune cells . \n while there is no doubt that vegf plays an important role in skin carcinogenesis , more work is required to characterize the various mechanisms by which vegf contributes to this process and to understand the relative importance of each of these pathways . \n further studies will have to be carried out to determine whether these newly described alternative functions of vegf can be targeted to treat nmsc .", "role": "user" }, { "content": "vascular endothelial growth factor ( vegf ) is known to play a critical role in the development of non - melanoma skin cancers . \n vegf is a potent pro - angiogenic factor and it is elevated in mouse and human skin tumors . the use of transgenic and knockout mice has shown that vegf is essential for tumor development in multiple models of skin carcinogenesis and , until recently , the mechanism of action has been primarily attributed to the induction of angiogenesis . however , additional roles for vegf have now been discovered . \n keratinocytes can respond directly to vegf , which could influence skin carcinogenesis by altering proliferation , survival , and stemness . in vivo studies \n have shown that loss of epidermal vegfr-1 or neuropillin-1 inhibits carcinogenesis , indicating that vegf can directly affect tumor cells . \n additionally , vegf has been shown to promote tumor growth by recruiting macrophages to skin tumors , which likely occurs through vegfr-1 . \n overall , these new studies show that vegf carries out functions beyond its well - established effects on angiogenesis and highlight the need to consider these alternative activities when developing new treatments for non - melanoma skin cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the basic repeating unit of eukaryotic chromatin is the nucleosome , which contains a 145147 bp dna fragment wound around a histone core . \n the positioning of nucleosomes on a dna fragment is critical for gene expression . along with other factors such as dna methylation and histone modifications , \n dna sequence is one of the most important factors guiding nucleosome positioning in vitro and in vivo \n . \n unfortunately , micrococcal nuclease , which is commonly used for mapping nucleosome positions experimentally , exhibits high at - specificity and lacks the resolution to identify exact nucleosome positions , especially for nucleosomes with the gc - rich boundaries . \n therefore , prediction of nucleosome positioning on genomic sequence at high resolution is of great biological interest . \n nucleosome positioning is usually characterized by two parameters : rotational positioning , which describes the side of the dna helix that faces the histones , and translational positioning , which determines the nucleosome midpoint ( or dyad ) with regard to the dna sequence . \n we have developed two simple models , the yr scheme and w / s scheme , for the prediction of translational and rotational positioning of nucleosomes , respectively . \n both methods successfully predict 80% of nucleosome positions in vitro with 2-bp precision ( see supplementary materials at http://numap.rit.edu/app/dna/suppmaterial.xhtml ) . here \n , we present a web - based application that implements both models for prediction of nucleosome positioning patterns . \n both yr and w / s schemes are based on the sequence - dependent dna anisotropy , which dictates how dna is wrapped around a histone octamer . \n one of the best established sequence patterns consistent with this anisotropy is the periodic occurrence of at - containing dinucleotides ( ww ) and gc - containing dinucleotides ( ss ) in the nucleosomal locations where dna is bent in the minor and major grooves , respectively . \n the minor and major groove bending sites are defined by the base - pair step roll values observed in nucleosome crystal structures , in which a dna fragment of 147 bp or 146 bp in length is co - crystallized with histones . based on the roll values , 14 minor - groove dna bending sites and 12 major - groove dna bending sites \n were selected from the 147-bp or 146-bp nucleosomal dna template ; each site is 4 bp in length ( see the methods section on the server website for details ) . the w / s scheme implements the aforementioned periodic ww and ss patterns . the w / s score sw / s(n ) of the threaded sequence with the center at position n can be calculated as(1)sw / s(n)=minorsite=114cww+majorsite=112css-minorsite=114css-majorsite=112cwwwhere cww and css are the total occurrences of ww and ss dinucleotides at a given minor - groove or major - groove dna bending site . \n in addition to the ww and ss motifs , the yr scheme incorporates gc , pyrimidine purine ( yr ) , yyrr and ryry motifs to take into account their anisotropic bending into dna grooves ( see methods at the site for details ) . \n the yr score s(n ) of the threaded sequence with the center at position n can be calculated as(2)s(n)=pattern=128wxsite=112or14cxwhere cx is the occurrence of a designated motif x at a given site and wx is the weight of the motif at this site . \n if a motif occurs at the site where dna is severely bent , its occurrence is given a higher weight than at other sites ( see methods section on the website for details ) . \n the numap web application takes a dna sequence as input and returns both numeric scores and corresponding profiles . \n we use the model - view - controller ( mvc ) design , in which the communication between the client and the database is mediated by the web application server ( figure 1 ) . \n the server is implemented using a combination of extensible hypertext markup language pages ( xhtml ) , and javaserver faces ( jsf ) as a rich component - based user interface . \n nucleosome positioning scores can be computed by the yr and w / s schemes implemented at the backend of the server as perl scripts . \n an open - source reporting engine , jasperreports library , is used with the combination of java codes for reporting the results in graphical output in multiple formats including pdf , excel and csv ( see implementation notes at the server site for details ) . \n the single layout is used to generate single graph for each of the input sequences , whereas the superimpose layout \n the average layout ( asymmetric ) is used to calculate the average scores for multiple sequences , while the average layout ( symmetric ) produces a symmetrical graph by generating the reverse complement of all the input sequences and then calculating the average scores at each base pair position . \n the setting panel allows the user to choose from two prediction schemes , yr and w / s . by default , \n a chosen scheme will calculate a score for the first nucleosome starting at the position 1 of the input sequence , and assign that score to the dyad position 74 . \n the user can also give a specific value to the start of the input sequence ( if not 1 ) by changing the value in the starting position box . \n option is specific to the yr scheme , the user can choose from three different sets used initially to establish this scheme with each set evaluating the occurrence of specific pattern at specific site differently ( see table siii in ) . \n the numap provides numerous reporting formats such as pdf ( figure 3 ) , word and excel . \n moreover , the server offers many features that allow the user to interact with output data in different ways such as zooming in a large graph , which is useful to investigate a certain range of values , and exploring dynamic data features , which show the corresponding score / base pair position when a user places the mouse over any point in the graph ( figure 4 ) . \n other models work well in predicting nucleosome occupancy in vivo by introducing a position - independent component , pl , to represent sequences that are generally favored or disfavored regardless of their position within the nucleosome ( most notably , poly(da : dt ) tracts , which are strongly disfavored by nucleosomes ) . \n detailed comparisons in prediction accuracy between these models and ours have been made and will be published separately . \n the incorporation of this component into the yr or w / s scheme has a potential to improve both the rotational and translational positioning predictions of nucleosomes in vivo . \n various models have been developed for nucleosome positioning predictions [ 1519 ] and for gene regulatory analysis . \n nonetheless , one has to browse through different servers , which often have different formats and representations , making the comparison of the results extremely difficult . \n we will overcome this obstacle by reprogramming these methods , incorporating them into the numap server and presenting the results in the same format . \n comparison of all the methods in this way will allow detailed analyses of the strengths and weaknesses of each approach , facilitating our understanding of the biophysical principles of nucleosome positioning . \n \n ", "role": "user" }, { "content": "nucleosome positioning is critical for gene expression and of major biological interest . \n the high cost of experimentally mapping nucleosomal arrangement signifies the need for computational approaches to predict nucleosome positions at high resolution . here , we present a web - based application to fulfill this need by implementing two models , yr and w / s schemes , for the translational and rotational positioning of nucleosomes , respectively . \n our methods are based on sequence - dependent anisotropic bending that dictates how dna is wrapped around a histone octamer . \n this application allows users to specify a number of options such as schemes and parameters for threading calculation and provides multiple layout formats . \n the numap is implemented in java / perl / mysql and is freely available for public use at http://numap.rit.edu . \n the user manual , implementation notes , description of the methodology and examples are available at the site .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: bacteria of the genus staphylococcus are the principal causative agents of two major types of infection affecting bone septic arthritis and osteomyelitis , which involve the inflammatory destruction of joint and bone . \n these infections cause serious morbidity and are often difficult to manage ( berendt and byren , 2004 ) . \n the principal routes of infection for both osteomyelitis and septic arthritis are either haematogenous , resulting from bacteremia ; contiguous , when the infection is transmitted from local tissue ; or direct , resulting from infiltration of bone , often following injury , surgery or implantation of a foreign body , such as joint replacement ( berendt and byren , 2004 ; ciampolini and harding , 2000 ; goldenberg , 1998 ; lazzarini et al . \n infections may be acute or chronic and affect native joints , especially the hip and knee , or prosthetic joints , long bones , vertebrae and almost any other bone . \n osteomyelitis of the foot is particularly common in diabetic patients ( berendt and byren , 2004 ; nade , 2003 ) . \n septic arthritis is a joint disease typified by bacterial colonisation and rapid articular destruction ( levine and siegel , 2003 ) . \n infiltration and growth of bacteria within the synovium results in inflammation with infiltration of leukocytes into the joint fluid ( goldenberg , 1998 ; nade , 2003 ) . \n the production of reactive oxygen species and host matrix metalloproteinases ( mmps ) , lysosomal enzymes and bacterial toxins contribute to the destruction of cartilage . \n this starts with degradation of host proteoglycans followed by collagen breakdown within hours of infection , and is mediated by polymorphonuclear leukocytes ( goldenberg , 1998 ; nade , 2003 ; shirtliff and mader , 2002 ; stott , 2001 ) . \n the containment of the inflammatory process within the joint results in increasing pressure , which impedes blood and nutrient supply to the joint exacerbating joint damage and facilitating destruction of cartilage and the synovium . \n permanent destruction of articular cartilage and subchondral bone can occur rapidly , within just a few days ( shirtliff and mader , 2002 ) . \n osteomyelitis describes a range of infections in which bone is colonized with microorganisms , with associated inflammation and bone destruction . \n acute osteomyelitic foci are characterised by pus - forming inflammation at the site of microbial colonisation . \n damage to bone matrix and compression and destruction of vasculature is also observed as the infection spreads to surrounding soft tissues , which can further exacerbate bone necrosis ( lazzarini et al . , 2004 ; \n lew and waldvogel , 2004 ) sections of dead bone , known as sequestra , can form which may then detach to form separate infectious foci which , due to the lack of vasculature , are protected from immune cells and antibiotics ( lazzarini et al . , 2004 ; lew and waldvogel , 2004 ) . \n such areas of dead , infected tissues that are inaccessible to antimicrobials or the immune response can lead to chronic persistence of the infection ( lazzarini et al . , 2004 ) . \n the incidence of septic arthritis is between 2 and 10 in 100,000 in the general populace but may be as high as 3070 per 100,000 in rheumatoid arthritis sufferers or recipients of prosthetic joints ( goldenberg , 1998 ; nade , 2003 ; stott , 2001 ) and is more common in children than adults , and in males rather than females ( levine and siegel , 2003 ) . \n haematogenous osteomyelitis most frequently effects children and the elderly ( lew and waldvogel , 2004 ) and in children , the incidence is typically between 1 in 5000 and 1 in 10,000 ( weichert et al . , 2008 ) . \n it has been argued that the incidence of haematogenous osteomyelitis is decreasing with an annual fall in childhood cases of 0.185 per 100,000 people recorded in glasgow , scotland between 1970 and 1997 ( blyth et al . , 2001 ; \n conversely , osteomyelitis resulting from direct infection is reportedly on the increase ( gillespie , 1990 ; lazzarini et al . \n . local spread of infection from contiguous tissue to bone or direct infection can occur at any age , with foreign body implants a substantial risk factor ( lew and waldvogel , 2004 ) . \n the presence of an implant is particularly associated with chronic osteomyelitis , where antibiotic treatment is frequently ineffective , and removal of the implant and debridement are required ( ciampolini and harding , 2000 ) . \n relapsing cases of osteomyelitis with several decades between episodes have been documented , and there are records of reactivation fifty or even eighty years after the initial infection ( ciampolini and harding , 2000 ; gallie , 1951 ; greer and rosenberg , 1993 ; korovessis et al . , 1991 ) \n . a broad range of bacterial species have been isolated in cases of septic arthritis and osteomyelitis . \n pathogens cultured from septic joints include s. aureus , streptococcus pyogenes , streptococcus pneumoniae , escherichia coli , pseudomonas aeruginosa , serratia marcescens , as well as salmonella , neisseria , aerobacter , and bacteroides species ( nade , 2003 ; shirtliff and mader , 2002 ) . staphylococcus and streptococcus spp . , haemophilus influenzae , e. coli , p. aeruginosa , salmonella and mycobacterium spp . \n are all potential causes of osteomyelitis ( bennet and bennet , 2006 ; lazzarini et al . , 2004 ; lew and waldvogel , 1997 , 2004 ) . \n s. aureus is the most commonly identified pathogen in both conditions , by a substantial margin , regardless of type or route of infection ( ciampolini and harding , 2000 ; goldenberg , 1998 ; lew and waldvogel , 2004 ) . \n staphylococcus , principally s. aureus , accounts for between 37% and 67% of septic arthritis isolates in studies from a range of nations ( al arfaj , 2008 ; dubost et al . \n coagulase - negative staphylococci are less commonly isolated from arthritic joints , representing between 3% and 16% of staphylococcus cultures \n ( al arfaj , 2008 ; dubost et al . , 2002 ; ryan et al . , \n studies of osteomyelitis in several developed countries over the past decade have identified s. aureus in 38% to 67% of culture - positive cases . \n coagulase - negative staphylococci were identified in 5% to 15% of culture - positive patients ( arnold et al . , 2006 ; blyth et al . , 2001 ; grammatico et al . , 2008 ; karwowska et al . , 1998 \n surveillance data from the health protection agency on surgical site infections in the u.k . between 1997 and 2005 found s. aureus to be the causative agent in 41.4% of hip prosthesis , 33.5% of knee prosthesis , 53% of open reduction of bone fracture and 59.1% of hip hemiarthroplasty infections . \n coagulase - negative staphylococci accounted for 15.1% , 20.7% , 7.5% and 6.3% of these infections , respectively ( u.k . health protection agency , 2008 ) . \n s. epidermidis is the most common coagulase - negative staphylococcus species in many types of infection , including osteomyelitis and infection of prosthetic joints , but other species , including staphylococcus simulans , staphylococcus hominis , staphylococcus capitis , staphylococcus caprae and staphylococcus lugdunensis have all been reported ( greig and wood , 2003 ; lang et al . , 1999 \n ; murdoch et al . , 1996 ; vallianou et al . , 2008 ) . \n clearly s. aureus , and to a lesser extent other staphylococci , are pathogens of major importance in skeletal infections . \n the number of joint replacement procedures is increasing : 220,000 hip replacements were performed in the usa in 2003 , a 38% rise from 1996 , with numbers projected to rise to 572,000 by 2030 . \n total knee replacements reached 418,000 in 2003 and are expected to undergo a similar rise , especially in light of an aging population ( lee and goodman , 2008 ) . in cases of septic arthritis antibiotic therapy is frequently effective if applied rapidly , appropriately and in combination with joint drainage ( shirtliff and mader , 2002 ) . \n osteomyelitis is , however , often refractory to antibiotic treatment , a problem exacerbated by the increasing levels of antibiotic resistance amongst staphylococcus spp . \n this is complicated further by the emergence of particularly persistent , antibiotic - resistant small colony variant forms that may be selected for by certain current treatment regimens ( ciampolini and harding , 2000 ; henderson and nair , 2003 ; von eiff et al . , 1997a ) . \n staphylococcal bone infections are thus likely to be a continuing and probably increasing problem , and understanding of the interaction of these pathogens with bone is central to development of the novel therapeutic strategies required to treat increasingly antibiotic - resistant and persistent infections . \n a number of studies have attempted to identify an association between the possession of certain virulence genes by s. aureus and invasive disease . \n ( 2002 ) suggested that the possession of certain combinations of virulence factor genes is associated with invasive disease , and increased severity of infection following examination of a panel of 334 s. aureus isolates by pcr . \n the isolates comprised those from 179 healthy patients , 94 hospital - acquired isolates and 61 community - acquired isolates . \n seven putative virulence genes , including the adhesin genes fnba and cna , the toxin genes sej , eta and hlg , and icaa , which is involved in biofilm production , were found to be associated with invasive isolates . \n the association with specific types of invasive infection was not examined and indeed the small number of isolates examined in this study would have precluded such an analysis ( peacock et al . , 2002 ) . \n the genes for the fibronectin - binding proteins fnba and fnbb have been reported to be present in 98% and 99% of clinical isolates , respectively , from a range of orthopaedic associated infections , whereas the cna gene , encoding the collagen - binding protein was identified in just 46% of isolates ( arciola et al . , 2005 ) . \n ( 2000 ) found the prevalence of both fnba and fnbb genes , as opposed to just one of the two , to be significantly higher in invasive isolates than in carriage strains in a panel of 163 strains , which included septic arthritis and osteomyelitis isolates . \n genes encoding panton - valentine leukocidin were found to be present in 59 of 89 s. aureus isolates from cases of acute haematogenous osteomyelitis . \n the presence of pvl genes is associated with an increased risk of severe infection requiring intensive care , bacteremia and more severe systemic inflammation ( bocchini et al . , 2006 ; sdougkos et al . , 2007 \n ) . however , one of the problems with the above studies is that it is unclear how representative these strain collections are of those isolates carried in other establishments and regions across the world , since strain typing was not reported . \n strain typing studies of s. aureus , using multilocus sequence typing ( mlst ) and comparative genomic microarray hybridizations have so far failed to identify any specific clonal lineages associated with invasive disease ( feil et al . , 2003 ; lindsay et al . , 2006 ) . \n however , these studies did not use a collection of isolates from specific invasive diseases and therefore do not rule out the possibility that specific lineages or genes are associated with specific types of infection , such as osteomyelitis or septic arthritis . to date , the only genome comparison study relevant to s. aureus bone infections has been done using comparative genome microarray hybridisations of the s. aureus uams-1 strain , isolated from an osteomyelitis patient , with a range of genome sequenced strains ( cassat et al . , 2005 ) . \n these authors found variations in the complement of adhesin , toxin , exoenzyme and regulatory genes . \n although it is not possible to draw general conclusions about association with bone infection from characterisation of a single strain , the presence of fnba , but not fnbb or the bone sialoprotein - binding gene bbp , in uams-1 suggest that fnbb and bbp are dispensable for bone infection , at least in certain genetic backgrounds . thus at this juncture there is a lack of evidence to support or disprove an association between specific s. aureus lineages or specific genomic features and the pathogenesis of bone infections . \n in terrestrial vertebrates mature bone is made up of dense surface plates of bone , known as the cortices , and within these is a network of bone struts oriented to oppose loading forces , known as trabecular bone . \n trabecular bone is typically replaced every 34 years , with the denser cortical bone taking over a decade to replace in adults ( blair , 1998 ) . \n this process of continual remodelling is required to remove old bone and microfractures to ensure bone integrity and mineral homeostasis ( vaananen and laitala - leinonen , 2008 ) . \n the skeleton is a dynamic organ system , in a state of perpetual turnover which is continually remodelled by the actions of two cell types ( henderson and nair , 2003 ) . \n osteoblasts are responsible for the deposition of bone matrix ; they are found on bone surfaces and are derived from mesenchymal osteoprogenitor cells . \n these cells secrete osteoid , a mixture of bone matrix proteins primarily made up of type i collagen ( over 90% ) , proteoglycans such as decorin and biglycan , glycoproteins such as fibronectin , osteonectin and tenascin - c , osteopontin , osteocalcin and bone sialoprotein , oriented along stress lines ( blair , 1998 ; mackie , 2003 ) . \n osteoblasts are also thought to facilitate the mineralization of bone matrix , whereby hydroxyapatite , [ ca3(po4)2]3ca[oh]2 , crystals form , making up around 90% of bone matrix ( blair , 1998 ; mackie , 2003 ) . \n nucleators are required to instigate mineralisation , and phosphate - containing matrix proteins like bone sialoprotein and osteopontin are likely to play such a role ( henderson and nair , 2003 ; mackie , 2003 ; van de lest and vaandrager , 2007 ) . \n osteoblasts also produce tissue non - specific alkaline phosphatase ( tnap ) which cleaves phosphate esters to liberate free inorganic phosphate , which is key to the process of mineralisation ( van de lest and vaandrager , 2007 ) . \n osteoblasts are not terminally differentiated , and some may form osteocytes and become implanted in the bone matrix , eventually ceasing the secretion of osteoid , whilst others undergo apoptosis ( blair , 1998 ; mackie , 2003 ) . \n osteocytes are also involved in bone maintenance , detecting stress within the bone through mechanosensitive mechanisms located in extensive cellular projections , called canaliculi , that interconnect osteocytes ( van de lest and vaandrager , 2007 ) . \n osteocytes are thought to respond to mechanical stress by undergoing apoptosis , leading to osteoclast recruitment and differentiation , possibly by alterations in the levels of soluble factors produced by the osteocyte . \n candidates include transforming growth factor ( tgf- ) , which may suppress osteoclastogenesis when produced by healthy osteocytes ( henriksen et al . , 2009 ; matsuo and irie , 2008 ) . \n the opposing action of bone matrix removal is performed by osteoclasts , multinucleate cells that are derived from the macrophage - monocyte lineage . \n these cells express large quantities of a vacuolar - type h - atpase on their cell surface , along with chloride channel 7 ( clc 7 ) enabling localised hydrochloric acid secretion into a closed compartment , known as the resorption lacuna , and subsequent solubilisation of bone mineral ( blair et al . \n the cell is attached to the bone matrix by a sealing zone membrane to create this compartment , and fusion of acidified vesicles with the plasma membrane contributes further to acid release ( vaananen and laitala - leinonen , 2008 ) . \n cathepsin k is centrally involved in degradation of bone matrix , it is highly expressed by osteoclasts and digests substrates such as collagen and osteonectin ( bossard et al . , 1996 ; drake et al . , 1996 ) . \n evidence from knock - out mouse and selective inhibitor experiments indicates that cathepsin l , and mmps also play a role in degrading bone matrix ( everts et al . , 2006 ) . \n osteoclasts also secrete acid phosphatases , such as tartrate - resistant acid phosphatase ( tracp ) , which is used as an osteoclast marker and is activated by cathepsin k cleavage ( blair et al . , 1989 ; \n tracp is able to generate reactive oxygen species in addition to having phosphatase activity ( hayman and cox , 1994 ) . \n the exact cellular function of tracp in bone resorption is not well understood , but serum tracp levels correlate with bone - resorptive activity , and tracp - deficient mice exhibit reduced osteoclastic bone resorption and increased bone mineralization ( angel et al . \n the balance of activity between these two cell types is crucial to maintaining the proper homeostasis of bone turnover , and any shift in the relative levels of osteoblast and osteoclast activity can result in bone pathology ( henderson and nair , 2003 ) . \n infection with a pathogen such as s. aureus is capable of stimulating such a shift , mediated in part by induction of an inflammatory response . \n there is intimate interaction between the two cell types , with osteoblasts interpreting the majority of extracellular signals and subsequently modulating osteoclast differentiation and function ( henderson and nair , 2003 ; matsuo and irie , 2008 ) . \n interaction between the rank ( receptor activator for nuclear factor b ) receptor , expressed by osteoclast precursors , and its cognate ligand , rankl , expressed by osteoblasts is essential for osteoclastogenesis ( matsuo and irie , 2008 ) . \n rankl is a homotrimeric protein displayed on the membrane of osteoblasts , although it may be secreted following cleavage by mmps 7 or 14 , or adam ( a disintegrin and metalloprotease domain ) ( boyce and xing , 2008 ; hikita et al . \n suppression of mmp 14-mediated secretion enhances osteoclastogenesis ( boyce and xing , 2008 ; hikita et al . , 2006 ) . \n the rank receptor is a homotrimeric transmembrane protein belonging to the tumour necrosis factor ( tnf ) receptor superfamily . \n following binding of rankl to rank , traf ( tnf receptor - associated factor ) adaptor proteins are recruited , with binding sites for traf2 , traf5 and traf6 all present on rank ( kim et al . \n traf6 seems to play a central role in rank - mediated osteoclast formation , and mice deficient in traf6 are osteopetrotic ( lomaga et al . , 1999 ) whereas traf2 and traf5 are relatively marginal players in osteoclastogenesis ( kanazawa et al . \n , 2003 ; kanazawa and kudo , 2005 ) . signalling via rank , and these adaptor proteins , \n activates a number of transcription factors , including nfb ( nuclear factor b ) , ap-1 ( activator protein 1 ) and nfatc1 ( nuclear factor of activated t - cells , cytoplasmic , calcineurin - dependent 1 ) which drive osteoclast differentiation ( matsuo and irie , 2008 ; wada et al . , 2006 ) . \n osteoprotegrin ( opg ) is an endogenous inhibitor of rankl signalling , functioning as a decoy receptor that binds to rankl and prevents its association with rank ( wada et al . \n a number of host cytokines play a significant role in the pathogenesis of osteomyelitis , and there is strong evidence that production of these cytokines is induced by staphylococcal infection of bone , and that they directly contribute to bone destruction . \n in particular , the inflammatory cytokines tumour necrosis factor ( tnf ) , interleukin 1 ( il-1 ) and il-6 seem to be especially important in bone physiology and pathology ( kwan et al . , 2004 ) . in patients with acute \n osteomyelitis , plasma levels of tnf , il-1 ( the secreted form of il-1 ) and il-6 are all elevated ( evans et al . , 1998 ; klosterhalfen et al . , 1996 ) \n high levels of il-1 , il-6 and tnf are also found in the synovial fluid of patients with septic arthritis ( osiri et al . , 1998 ; saez - llorens et al . , \n interestingly , specific polymorphisms in the il-1 and il-6 genes have recently been found to be associated with an increased risk of osteomyelitis in the greek population ( tsezou et al . , 2008 ) . \n a number of animal models of s. aureus osteomyelitis reveal that bone infection can lead to elevated levels of these cytokines both locally and systemically . \n increased levels of il-1 have been measured in the tibiae of 22-month - old rats experimentally implanted with s. aureus - infected needles , and the same animals have increased circulating levels of il-6 ( garcia - alvarez et al . , 2009 ) . \n in a murine osteomyelitis model , bone levels of il-1 and il-6 are significantly increased in the early post - infection period , with tnf rising later during the infection ( yoshii et al . , 2002 ) . \n production of il-1 can be induced in human osteoblast - like cell lines by a variety of stimuli , including tnf ( pivirotto et al . , 1995 ) \n . however , infection of primary mouse osteoblasts with s. aureus results in increased transcription , but not increased protein synthesis or secretion of il-1 ( marriott et al . , \n tnf is detectable only at low levels in human osteoblasts derived from mesenchymal stem cells and the osteosarcoma cell line mg63 ( bu et al . , 2003 ) . \n infiltrating immune cells may therefore be a more likely source of il-1 and tnf in bone in response to infection ( bost et al . \n , 1999 ; ishimi et al . , 1990 ; marriott et al . , 2002 ; mundy , 1991 ; robinson et al . , 2007 ) . \n il-6 however , is produced by osteoblasts in response to a variety of signals , including infection with s. aureus ( bost et al . \n these cytokines have potent effects on the process of bone remodelling , and are strongly implicated in the pathology of osteomyelitis . \n cell culture models support the view that il-1 and tnf stimulate the proliferation and differentiation of osteoclast progenitors into mature osteoclasts in the presence of osteoblasts ( mundy , 1991 ; pfeilschifter et al . \n tnf and il-1 also stimulate osteoclast - mediated bone resorption , a process which may also require the presence of osteoblasts ( azuma et al . \n , 2000 ; taubman and kawai , 2001 ; thomson et al . , 1987 ) . \n similarly , il-6 increases bone resorption activity and osteoclast number in cultured mouse calvariae , and stimulates osteoclast differentiation in the presence of osteoblasts ( ishimi et al . , 1990 ; kotake et al . , 1996 ) . in vivo , local administration of il-1 and tnf antagonists in a non - human primate model of periodontitis results in significant reduction of osteoclast formation and bone destruction ( assuma et al . , 1998 ) . \n intravenous administration of tnf and il-1 in mice stimulates bone resorption in a dose - dependent fashion ( konig et al . , 1988 ) , and deletion of the murine il-1r , tnf - r1 and tnf - r2 receptors and of caspase-1 significantly decreases osteoclast number and the area of bone resorption in calvariae following lipopolysaccharide ( lps ) injection ( chiang et al . , 1999 ) . \n il-1 and tnf also inhibit the differentiation of mesenchymal stem cells into osteoblast - like cells , and suppress the accompanying mineralisation and increased expression of alkaline phosphatase and procollagen i genes , although only tnf inhibits osteonectin and osteopontin gene expression ( lacey et al . , 2008 ) . \n tnf also decreases production of type i collagen and osteocalcin , and of alkaline phosphatase in a variety of osteoblast cell culture and bone tissue explant models , thereby reducing matrix deposition and mineralisation ( canalis , 1987 ; centrella et al . , 1988 ; li and stashenko , 1992 ; nanes et al \n surface - associated material ( sam ) from s. aureus stimulates bone resorption and osteoclast formation , and blockade of il-1 or tnf signalling completely abolishes this bone resorption activity . \n neutralisation of tnf and il-6 fully abolishes sam - stimulated osteoclastogenesis , with antagonism of il-1 having only a partial effect ( meghji et al . \n the effect of this sam on osteoclast formation and stimulation of resorption does not require co - culture with osteoblasts , and does not require rankl signalling ( lau et al . \n s. epidermidis surface material can also induce bone resorption , by a mechanism that is strongly dependent on tnf and , to a lesser extent , il-1 ( meghji et al . , 1997 ) . \n induction and release of these cytokines in response to pathogen - associated molecules involves two main classes of pattern recognition receptors ( prrs ) , the toll - like receptors ( tlrs ) and nod - like receptors ( nlrs ) . \n the production of tnf and il-6 by murine macrophages in response to s. aureus cell wall preparations is dependent on tlr2 , and tlr2-deficient mice exhibit reduced survival of intravenous s. aureus infections compared to wild - type counterparts ( takeuchi et al . \n primes the cell for il-1 production by inducing expression of the inactive , pro - form of the cytokine ( creagh and o'neill , 2006 ; kahlenberg et al . , \n il-1 is synthesised as a 31-kda precursor molecule , and is processed to produce a 17-kda active molecule by caspase-1 . \n caspase-1 activation , and subsequent processing and release of active il-1 involves assembly of a multiprotein complex known as the inflammasome . \n this complex consists of caspase-1 , the adaptor protein asc ( apoptosis - associated speck - like protein containing a caspase recruitment domain ( card ) ) and one of several nlr proteins , of which four are known to associate with inflammasomes ( ting et al . , 2008 ) . \n each nlr responds to different activating signals , and although the exact recognition steps remain to be elucidated , reported stimuli include flagellin , anthrax lethal toxin , and muramyl dipeptide ( boyden and dietrich , 2006 ; faustin et al . \n , 2007 ; franchi et al . , 2006 ; miao et al . , 2006 ) . a broad range of stimuli for nlrp3 \n ( nlr family pyrin domain containing 3 ) have been reported , including s. aureus . \n although nlrp3 and asc are essential for il-1 secretion by murine macrophages in response to s. aureus , the stimulating signal is as yet unknown , and deletion of the - , - and -toxins does not perturb production of the cytokine ( mariathasan et al . , 2006 ; ting et al . , \n the inflammasome is involved in cell death in response to bacterial invasion ( marriott et al . , 2002 ; mccall et al . , 2008 \n ) and although invasion of murine osteoblasts by s. aureus induces apoptosis , it is not established whether the inflammasome is involved ( tucker et al . , 2000 ) . \n the major signal transduction events following binding of il-1 and tnf to their respective receptors are shown in fig . \n 1 . signalling in response to both cytokines leads to eventual activation of the nfb transcription factor and jnk ( c - jun n - terminal kinase ) and p38 mapk ( mitogen - activated protein kinase ) signalling ( arend et al . , 2008 ; dinarello , 2009 ) . \n studies with knockout mice have shown that at least one of the p50 or p52 nfb subunits is required for il-1-induced osteoclast formation and resorptive activity , indicating that much of the osteoclastogenic activity of il-1 is dependent on nfb ( xing et al . , 2003 ) . \n tnf binds to two receptors , tnf type i ( tnf - r1 ) and type ii ( tnf - r2 ) receptor which differ in their signalling mechanisms although there is substantial signalling crosstalk between the two receptors ( aggarwal , 2003 ; wajant et al . , 2003 ) . \n interestingly , the s. aureus virulence factor protein a , in addition to possession of immunoglobulin g - binding activity , is able to bind to the tnf - r1 receptor and stimulates downstream signalling and inflammation ( gomez et al . , 2004 ) . \n tnf production by osteoclast progenitors is induced by rankl and stimulates osteoclast differentiation in an autocrine manner ( zou et al . , 2001 ) . \n 2 shows an overview of the signal transduction events following il-6 binding to its receptor . \n signal transduction involves the activation of janus family ( jak ) tyrosine kinases and subsequent phosphorylation and activation of stat ( signal transducers and activators of transcription ) family transcription factors ( kwan et al . , 2004 ) . \n il-6 mediates bone resorption indirectly , and has no effect on isolated osteoclasts and il-6 induction of osteoclastogenesis is dependent on the expression of the il-6 receptor by osteoblasts , but not osteoclast progenitors ( hattersley et al . , 1988 ; kwan et al . , 2004 ; \n it is clear that these cytokines have a prominent role in modulating bone turnover , and perturbation of their levels can have profound effects on this process . \n although some mechanistic details are currently lacking , there is strong evidence that s. aureus infection of bone initiates local and systemic production of tnf , il-1 and il-6 via host prrs . \n elevated levels of these cytokines then shift the homeostatic balance of bone turnover , increasing osteoclast differentiation and bone resorption and diminishing osteoblast - mediated bone matrix production and mineralisation , thereby driving bone destruction . \n in addition to staphylococcal induction of inflammatory mediators that modulate the actions of osteoblasts and osteoclasts , bacteria of this genus are involved in more direct interactions with bone cells . \n invasion and persistence of s. aureus in non - professional phagocytic host cells in vitro has been described for many different cell types , including epithelial cells , endothelial cells and keratinocytes ( garzoni and kelley , 2009 ; kintarak et al . , 2004 ) . \n in cell culture systems , s. aureus is able to invade cultured osteoblasts from murine , human and embryonic chick sources , and s. epidermidis is also able to invade and grow within cultured osteoblasts ( ellington et al . \n , 1999 ; hudson et al . , 1995 ; jevon et al . , 1999 ; khalil et al . , 2007 ; reilly et al . , 2000 ) . \n electron microscopy has demonstrated the presence of bacteria within osteoblasts and osteocytes of embryonic chicks following injection with s. aureus , indicating that internalisation by bone cells also occurs in vivo ( reilly et al . , 2000 ) . \n intracellular bacteria inside osteoblasts and osteocytes in a patient with recurrent , long - term osteomyelitis of the fibula have been visualised by light and electron microscopy , although the species was unfortunately not determined ( bosse et al . , 2005 ) . \n more recently stoodley et al . ( 2008 ) , have demonstrated s. aureus biofilms in an infected total joint arthroplasty . \n although not reported in this paper the authors also identified s. aureus within host cells ( personal communications , stoodley ) . \n thus the suggestion that internalisation of s. aureus by bone cells in vivo provides a protective niche for the bacterium , where it is shielded from immune effector mechanisms and antibiotics , may help to explain persistent cases of osteomyelitis . \n however , the true importance of intracellular staphylococci in clinical osteomyelitis has yet to be established ( henderson and nair , 2003 ) . \n s. aureus requires fibronectin - binding proteins ( fnbps ) expressed on the surface of the bacterium to enable uptake by osteoblasts , and many other cell types ( ahmed et al . , 2001 ; \n these proteins belong to a group of adhesins known as mscramms ( microbial surface components recognising adhesive matrix molecules ) , which bind a range of extracellular matrix proteins including fibronectin , fibrinogen , collagen , elastin and bone sialoprotein ( hauck and ohlsen , 2006 ) . \n mutants deficient in the two fnbps , fnbpa and fnbpb invade host cells very poorly ( ahmed et al . , 2001 ; \n invasion is dependent on fibronectin binding by these proteins , and on the host cell integrin 51 receptor ( dziewanowska et al . , 1999 ; fowler et al . \n , 2000 ; sinha et al . , 1999 ) . s. aureus binds to fibronectin via fnbps displayed on the bacterial surface , and fibronectin serves as a bridging molecule to the integrin 51 which acts as a \n alternative uptake mechanisms do exist in certain cell types , however , as s. aureus is still able to invade primary keratinocytes in the absence of fnbps and uptake is not inhibited by blockade of integrin 51 binding to fibronectin ( kintarak et al . , 2004 ) . \n the mechanism of invasion also differs between s. aureus and s. epidermidis and the latter does not gain entry via the fibronectin - integrin 51 mechanism ( khalil et al . , 2007 ) . \n the level of expression of the alternative sigma factor , , affects fnba expression and the fibronectin binding ability of s. aureus strains and correlates with the level of internalisation of bacteria by osteoblasts suggesting that -mediated up - regulation of fnbp expression may facilitate invasion ( mitchell et al . , 2008 ; \n integrin 51-mediated uptake of s. aureus requires remodelling of the actin cytoskeleton ( agerer et al . , 2005 ) . \n the integrin - linked kinase , ilk , provides a link between 51 and the cytoskeleton , and interacts with the cytoplasmic domains of integrins and is subsequently activated . \n ilk activity is required for internalisation of s. aureus by epithelial cells ( wang et al . , 2006 ) . \n recruitment of focal adhesion proteins , including the adaptor protein paxillin and the focal adhesion kinase , fak , follows ( boulter and van obberghen - schilling , 2006 ) . upon infection of hek293 t cells with s. aureus \n there is also recruitment of focal adhesion proteins , such as tensin , zyxin and vinculin to the site of bacterial attachment . \n fak is recruited and tyrosine phosphorylated , and fak - deficient cells are able to internalise s. aureus much less efficiently . \n phosphorylation of downstream substrates of fak , including cortactin , which is involved in actin cytoskeletal organisation , occurs during invasion , and interference with cortactin also reduces internalisation . \n so , signalling downstream of the integrin 51 receptor , involving ilk and fak , is important for s. aureus invasion , at least in certain cell types ( agerer et al . , 2005 ; wang et al . , 2006 ) \n 3 shows an overview of some of the events involved in the internalisation of s. aureus by host cells . \n physical contact between s. aureus and osteoblasts induces host cell expression of tumour necrosis factor apoptosis inducing ligand ( trail ) ( alexander et al . , 2003 ) . \n trail is a member of the tnf cytokine family , and binds to two death domain - containing receptors , trail receptors 1 and 2 , which once activated recruit the fadd ( fas - associated protein with death domain ) adaptor protein which in turn activates caspases 8 and 10 and commits the cell to an apoptotic pathway ( mahalingam et al . , 2009 ) . \n trail produced by s. aureus - infected osteoblasts induces caspase-8 activation and apoptosis in cultured osteoblasts ( alexander et al . , 2003 ) . \n trail can induce apoptosis in human osteoclasts via trail receptor 2 , and also inhibits osteoclast differentiation ( colucci et al . \n it is therefore possible that apoptosis of bone cells infected with s. aureus , and potentially of neighbouring uninfected cells may contribute to bone loss in osteomyelitis ( henderson and nair , 2003 ) . \n growing experimental support indicates that staphylococcal invasion of osteoblasts , most likely via the fnbp - fibronectin - integrin 51 bridging mechanism in the case of s. aureus , may play a role in the pathogenesis of bone infections . \n this intracellular location may provide a protected environment for bacteria , aiding prolonged persistence by enabling evasion of antimicrobials and host immune mechanisms and possibly contributing to bone damage by inducing apoptosis of infected cells . \n a number of animal models of bone implant infection , osteomyelitis and septic arthritis have been developed which have enabled the role of specific virulence factors in infections to be determined . as mentioned at the outset \n there are a number of routes of bone infection , i.e. haematogenous , contiguous and direct infection of bone , and models have been developed to mimic each of these routes of infection . \n this is important since the range of environments experienced by the bacterium differs for each route and hence the virulence factors that are involved in pathology may be different for each route of infection . \n 2001 ) in conjunction with defined isogenic mutants deficient in one or more virulence determinants , or with neutralising antibodies to virulence factors has proven to be particularly useful in elucidating the role of specific virulence determinants and host factors in bone infections . \n this model has shown that there is a plethora of virulence determinants involved in s. aureus septic arthritis ( table 1 ) some of which are also involved in osteomyelitis ( table 1 ) . however , there is some controversy in this area because whilst the murine septic arthritis model is well established and standardised a number of different models have been developed for osteomyelitis and the relevance of specific virulence factors to bone implant infections or osteomyelitis appears to be dependent on the particular model used . for example \n the collagen adhesin cna has been shown to contribute to osteomyelitis by some workers ( elasri et al . , \n 2002 ) but not by others ( johansson et al . , 2001 ) and has been reported not to be important in orthopaedic device infections ( darouiche et al . , 1997 ) . \n the role of fnbps has not been directly assessed in a model of osteomyelitis , but comparison of s. aureus strains with and without fibronectin - binding activity in a mouse osteomyelitis model suggests that fibronectin - binding strains may give rise to more severe bone infections ( johansson et al . , 2001 ) . in the septic arthritis model , \n s. aureus fnba fnbb mutants show no reduction in severity of arthritis , in contrast with clfa clfb mutants lacking the fibrinogen - binding clumping factors . \n however , the presence of the fnb genes results in greater weight loss and mortality , as well as higher serum levels of il-6 , indicating a role for fnbps in the systemic inflammatory response ( palmqvist et al . , 2005 ) . \n one area of research that has received surprisingly little attention is that of the direct action of virulence factors on bone and bone cells . \n work in our own laboratory has shown that s. aureus and s. epidermidis produce surface - associated proteins that can stimulate bone breakdown in an in vitro assay ( meghji et al . \n these surface - associated proteins and capsular material appear to promote the formation and activation of the bone - resorbing osteoclast ( lau et al . \n interestingly , a proportion of the population have antibodies that can block the action of the s. aureus proteins and prevent bone breakdown ( nair et al . , 1997 ) . \n the identity of the protein(s ) in these mixtures which cause bone destruction has not been elucidated . \n variant forms of s. aureus , known as small colony variants ( scvs ) , are associated with infections of bone and joint that may be particularly persistent , recurrent and refractory to antibiotic treatment ( von eiff et al . , 2006 ) . \n these bacteria are mutant forms of staphylococcus that may have an adaptive advantage enabling persistent bone colonisation . \n scv forms of coagulase - negative staphylococci , including s. epidermidis , s. lugdunensis and s. capitis have also been isolated from a range of infections ( adler et al . , 2003 ; \n the scv phenotype is characterised by slow growth , with colonies around 10-fold smaller than wild - type forms , often with decreased pigmentation , increased aminoglycoside resistance and some reports of reduced haemolytic activity ( sendi and proctor , 2009 ) . \n the nature of these phenotypes can cause difficulty in detection and identification of the bacteria , and may contribute to an underestimation of the clinical prevalence of scvs ( von eiff , 2008 ) \n . these phenotypes usually result from auxotrophy for hemin , menadione or thymidine and can be reversed by supplementation with these molecules ( proctor et al . , 1995 , 2006 ) . \n mutations in the hemb and mend genes produce hemin and menadione auxotrophic strains with typical scv phenotypes , and give rise to disruption of electron transport which is the basis of the growth deficiency , increased aminoglycoside resistance and other phenotypes ( bates et al . , 2003 ; proctor et al . \n scvs can be selected for with gentamicin in vitro , and there is evidence that antibiotic therapy , in particular use of gentamicin beads , which are used in addition to debridement and systemic antibiotic therapy for osteomyelitis may select for scvs in clinical situations ( musher et al . , 1977 ; von eiff et al . , 1997a ) . in a cohort of fourteen patients with confirmed s. aureus osteomyelitis \n , scvs were isolated only from those four that had received gentamicin bead therapy , with the remaining ten patients harbouring normal s. aureus strains . \n of the four scvs , three were auxotrophic for hemin , and one for menadione . \n only the patients harbouring scvs had recurrent infections , although only patients whose gentamicin bead therapy had failed were included in the study ( von eiff et al . \n scvs have also been isolated from cases of infection of hip prostheses , and intracellular bacteria within host fibroblasts were identified in one of the five instances ( sendi et al . , 2006 ) . \n clinically isolated scvs with hemin auxotrophy , and defined hemb mutants , show enhanced intracellular persistence in a range of human cell types ( moisan et al . , 2006 ; \n the basis of this persistence is not established but may involve a number of possible mechanisms . \n s. aureus hemb mutants exhibit enhanced binding to fibrinogen and fibronectin , and transcribe and display more clfa and fnbp on their surface , which may increase attachment and uptake by host cells ( vaudaux et al . , 2002 ) . \n transcriptional profiling of clinical and defined mutant scvs reveals increased transcription of genes regulated by , including adhesin genes , and down - regulation of exoprotein and toxin genes ( moisan et al . , 2006 ) . \n the effect of increased activity on mscramm expression has been shown to correlate well with osteoblast invasion , adding weight to the argument that -mediated up - regulation of adhesins increases host cell invasion , at least in vitro , and that increased invasion by scvs may be partially dependent on this mechanism ( moisan et al . , 2006 ; \n it has been argued that reduced production of toxins , particularly haemolysins , by scvs also contributes to intracellular persistence by reducing the cytotoxic effect on host cells ( moisan et al . , 2006 ; sendi and proctor , 2009 ; von eiff et al . , 1997b ) . in a murine septic arthritis model , a defined stable hemb mutant , exhibiting the scv phenotype , elicited more frequent and severe arthritis than the parental strain despite a reduced bacterial load in the kidney and joints . \n it has been argued that scvs are therefore more virulent on a per organism basis and that enhanced protease production by hemb mutants may partially explain this ( jonsson et al . \n , 2003 ) . it may be that in clinical infections relatively small numbers of scvs with enhanced virulence survive within tissues , possibly intracellularly , for extended periods and cause persistent infections . \n clinically isolated scvs are able to revert to the parent phenotype , although to what extent this may play a role in infections , and whether s. aureus may switch between states in different in vivo situations is currently unclear . \n staphylococcus species are a major cause of debilitating bone disease globally , a situation that shows no sign of abating . the increasing antibiotic resistance of staphylococci , combined with the greater opportunity for infection afforded by escalating numbers of orthopaedic surgical procedures will only serve to exacerbate the problem . \n furthermore , evidence is now emerging that staphylococci are facultative intracellular pathogens , and are able to exploit this protected niche during bone infection to enhance persistence . spontaneously arising mutant forms , such as scvs , \n may be particularly adapted to this lifestyle , complicating the treatment of these infections further . \n although host factors involved in the inflammatory destruction of bone are increasingly well understood , the staphylococcal virulence determinants directly involved in skeletal colonisation and destruction are less well characterised . continued focus on elucidating the complex interactions between host and pathogen in these invasive skeletal infections \n enhanced understanding of these interactions will not only inform improved clinical management of bone disease , but may well open up new avenues for therapeutic development .", "role": "user" }, { "content": "staphylococci , in particular staphylococcus aureus , are the predominant cause of bone infections worldwide . \n these infections are painful , debilitating and with the rise in antibiotic - resistant forms , increasingly difficult to treat . \n the growth in the number of prosthetic joint replacement procedures also provides new opportunities for these infections to take hold . comprehending the mechanisms \n by which staphylococci interact with and damage bone is critical to the development of new approaches to meet this challenge . \n this review summarises current understanding of the mechanisms by which staphylococci infect and damage bone . \n we address the role of the inflammatory response to staphylococcal infection in disrupting the homeostatic balance of bone matrix deposition and resorption and thereby mediating bone destruction . \n a number of virulence factors that have been shown to contribute to bone infection and pathology are discussed , however no single factor has been defined as being specific to bone infections . although traditionally considered an extracellular pathogen , there is increasing evidence that staphylococci are able to invade host cells , and that an intracellular lifestyle may facilitate long - term persistence in bone tissue , enabling evasion of antimicrobials and host immune responses . small colony variant strains , with mutations disabling the electron transport pathway appear particularly adept at invading and persisting within host cells , and exhibit enhanced antimicrobial resistance , and may represent a further complication in the treatment and management of staphylococcal bone disease .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mental disorders cause a substantial proportion of the burden of disease in the general \n population . \n neuropsychiatric disorders rank second in the list of disability adjusted life \n years ( daly ) in europe , preceded only by cardio - vascular diseases . \n they are also responsible \n for the largest part of causes for years lived with disability ( yld ) , and account for 19.5% \n of dalys and 40% for yld , \n . \n an overview over 27 studies on the prevalence of mental disorders in europe yielded an \n estimate of 27% of the adult population between 18 and 65 years , who fulfilled criteria of \n at least one mental disorder . \n prevalence rates between studies ranged considerably , with highest prevalence rates for a ) \n affective disorders with a median ( md ) rate of 6.9% , b ) specific phobias , md = 6.4% , c ) \n somatoform disorders , md = 6.3% , d ) substance use disorders , md = 2.4% , and e ) social \n phobias , md = 2.3% . \n in germany point - prevalence ( four weeks ) is estimated with 20% , the 12-months - prevalence \n with 31% , and life - time prevalence with 43% . \n the most frequent disorders are affective , \n somatoform , substance - use and panic disorders . \n prevalence is estimated with 26% and increases with geographical agglomeration \n up to 35% in metropolitan areas . \n standardised diagnostic procedures distinguished themselves because of their high \n reliability in epidemiological studies as well as in clinical settings . on the other hand , \n clinical diagnoses without structuring are less reliable and valid . \n as basis for estimates on morbidity and ensuing \n planning of demand , clinical diagnoses have to be regarded with greater care . \n persons with mental disorders call on medical treatments more often and are more frequently \n on sick leave . \n however only \n one third of all persons concerned , has sought out psychotherapeutic treatments , or have \n received psychotherapy . \n these high demands on health care provision are met with a differentiated system of \n services . in international comparison \n , the wide range of differentiated services of \n inpatient psychotherapeutic care in germany takes a leading position . \n it encompasses a ) specialists in \n neurology / psychiatry who are contracted through a staturory health insurance ( shi ) , b ) shi \n psychotherapists , c ) shi psychotherapists for children and adolescents , d ) psychosomatic \n primary care through shi general practitioners , e ) outpatient care clinics , f ) psycho - social \n counselling centres , and g ) day care centres . \n waiting time \n for an intake interview lasts about two months , waiting time for psychotherapy to begin \n lasts about four and a half months . in the geographical region of the former gdr ( east - germany ) \n waiting times last about ten weeks and over three months respectively . comparing the mental health care provision by regional aspects , schulz and colleagues \n summarise : a comparison of density of supply in different regions within germany shows , \n with the exception of inpatient care for children and adolescents , a striking \n east - west - difference to the disadvantage of east - germany . \n the under - supply seems to be especially striking in the \n outpatient provision for children and adolescents . even in the otherwise well provisioned \n federal state of baden - wrttemberg , \n only between 4% and 35% of all children and adolescents \n concerned found a treatment place . \n the aim of this study is , with regard to a posited bottleneck in supply , to paint a more \n precise picture of the provision of care for persons with mental disorders within a rural \n area in east - germany . \n we do not only take data from the psychotherapeutic provision of care \n into account , but data from the whole statutory health insurance . \n we assume that by \n analysing reimbursement claims from shi physicians , we gain insights into areas where \n persons with mental disorders are cared for outside psychotherapeutic provision of care . \n this view creates an image of the real - life provision of in an economically underdeveloped \n region . \n this parallels \n a population density of 72 inhabitants per square kilometre ( in germany the population \n density is 231 inhabitants per square kilometre ) . \n about one third lives in cities with \n between 45,000 and 198,000 inhabitants , another third in communities with less than 2,000 \n inhabitants . only one \n mental disorders take middle and forward ranks in the burden of disease . with respect to \n their relative frequencies the following rank order results in mecklenburg - west \n pomerania : a ) 29.2% of all new entries into \n the statutory pension funds ( rank 1 ) , b ) 18.1% of all rehabilitative treatments ( rank 3 ) , c ) \n 8.1% of all sick certificates ( rank 4 ) , d ) 1.7% of mortality ( rank 7 ) , and e ) 6.1% of all \n hospitalisations ( rank 8) . \n the density of supply with psychotherapists varies between 5,000 \n and 120,000 inhabitants per psychotherapist ; in the very sparsely inhabited areas the supply \n density ranges between 15,000 and 150,000 . to address our research questions , we analysed the billing data of mecklenburg - west \n pomerania s association of shi physicians from the years 2006 / 2007 . \n the exception here is ambulatory health care centres ( mvz ) , where more than one \n specialised practice work as one treatment unit . \n they bill under one single billing account , \n so that the specialty of every single provider can not be identified . \n also the group of \n neurologists and psychiatrists bill their reimbursement claims under one single account so \n it s not possible to differentiate between neurological and psychiatric practices . and \n within the group of psychotherapists it s not possible to differentiate between medical and \n psychological psychotherapists . in analysing \n a treatment \n corresponds to a medical treatment or service that has been billed within one billing \n quarter ( three months ) . \n a case corresponds to a person ( patient ) , for whom one or more \n treatments may be billed within one quarter . following this logic \n this entails that with respect to cases the relative frequencies of diagnoses may vary . for \n example \n a patient with a depression , a phobic disorder and nicotine dependence would be \n counted with three diagnoses , when the distribution of diagnoses on the level of cases is \n considered . since no ordering according to importance of disorder ( primary diagnosis , \n secondary diagnosis etc . ) has been recorded within the data , we were unable to rank - order \n diagnoses accordingly for each case . \n therefore we investigated \n from the data from the last quarter of 2007 as a proxy for the whole period how many \n diagnoses and how many cases have been billed by how many treatment providers . \n for the last \n quarter in 2007 that corresponds to 564,279 treatments for 303,839 cases . \n the data have been provided by the association of shi physicians mecklenburg - west \n pomerania . \n ethical , legal or data - safety regards are warranted : anonymous data were \n provided , data can not be traced back to individuals and additional diagnostic or therapeutic \n means have not been taken . \n the basis for the relative frequencies for treatment cases it should be noted that more \n that one diagnosis may be valid for one case . accordingly single cases may weigh with \n more than single weight in the determination of relative frequencies . \n altogether data stem from 4,246,734 treatments from the years 2006 and \n 2007 , that have been billed to the association of shi physicians in mecklenburg - west \n pomerania for an icd-10 chapter v diagnosis . of these treatments , \n inaccurate means a diagnostic code \n has been billed that does not exist in icd-10 chapter v ( e.g. f45.51 , or f10.17 ) ; incomplete \n means the billed diagnostic code does nt allow for unambiguous allocation to one category \n ( e.g. f45 , or f10 ) . for our further analysis , we limit ourselves to the remaining 3,905,262 \n treatments . \n category encompasses medical treatment centres ( mvz ) , ophtalmotologists , \n surgeons , anaesthesiologists , pulmologists , emergency clinics , laboratory practices , \n radiologists , neurosurgeons , central emergency services , oral and facial surgery , \n nuclear physicians and other central services . \n the distributions of the relative frequencies of diagnoses according to icd-10 subchapters \n on the basis of treatments as well as on the basis of cases are given in table 1 . \n remarkable is that more than one third of all treatments \n billed for reimbursement are allocated to neurotic , stress - related and somatoform disorders \n ( f4x.xx ) , a little bit less than one quarter of all claims are allocated to mood ( affective ) \n disorders ( f3x.xx ) and a little more than one tenth of all claims are allocated to substance \n use disorders ( f1x.xx ) . \n here it is worth remarking that almost half of all claims were filed by general \n practitioners . \n psychotherapists ( medical and psychological psychotherapists combined ) claimed with only \n 3.1% a minor proportion of claims . \n for the 303,839 cases from the last quarter of 2007 , claims were billed in \n 193,717 cases ( 63.8% ) for a single diagnosis , in 63,941 cases ( 21.0% ) for two diagnosis , in \n 26,006 cases for ( 8.6% ) three diagnoses , and in 20,175 cases ( 6.6% ) for more than three \n different icd-10 chapter v diagnoses . \n these were billed in 244,070 cases ( 80.3% ) from one \n group of specialists , in 49,528 cases ( 16.3% ) from two different groups , in 8,757 cases \n ( 2.9% ) from three different groups , and in 1,484 cases ( 0.5% ) from more than three different \n groups of specialists . \n the significance of alcohol and tobacco related disorders , depression , anxiety and \n somatoform disorders , that has been reported in large epidemiological studies , also pictures \n in everyday health care provision . \n a broad spectrum of practitioners provides health care \n for the patients , with the stress on general practices and family doctors who bill about \n half of the claims . \n the group of neurologists / psychiatrists cares for about one seventh of \n all cases . \n opposed to that , psychotherapeutic practices ( medical as well as psychological ) \n bill claims for only about three percent of all cases . \n collaborative treatment of patients \n with mental disorders seems to be the exception rather than the rule ; treatments for four \n fifth of cases are claimed by one single practitioner . \n these results complement the image from other german studies on health care provision of \n patients with mental disorders . \n striking is the large proportion of treatments that are \n claimed by general practitioners . since 80% of all treatment claims \n are billed by one single \n practitioner , we may well assume that to a large degree , patients with mental disorders are \n cared for by general practitioners alone . \n taking into account the urban - rural - divide that \n schulz and colleagues \n observed in 2008 with regard to psychotherapeutic provision of care , and against the \n background of long waiting times as reported by zepf and colleagues and peikert and \n colleagues it may be \n assumed that the treatments of mental disordered patients provided by general practitioners \n owe to at least to a certain degree a bottleneck in the provision of care by \n neurologists / psychiatrists and psychotherapists ; and that this shows more pronounced in a \n rural and remote area as mecklenburg - west pomerania . that the outpatient provision of care \n in rural and remote areas lacks behind that in metropolitan areas \n is also shown in the study \n by peikert and colleagues ; about one fifth of the inhabitants in east - germany live in urban \n areas . \n accordingly the provision of care in urban areas is evaluated more favourably by \n psychotherapists and waiting times are much shorter in bigger cities than in the other \n regions . in sum , this study provides insight into the epidemiology of mental disorders in germany \n under the actual status quo with the regard to health care provision . and these reflect on \n the one hand the large proportion of substance use disorders , depression , anxiety , and \n somatoform disorders on the burden of disease due to mental disorders . on the other hand , \n the study supports the picture of a suboptimal provision of mental health care outside the \n metropolitan areas . in order to improve the provision of care especially in rural and remote \n areas , \n it could be considered to take aspects of population density into account , when \n practice settlements for psychotherapists and neurologists / psychiatrists are planned . \n it \n appears also worthwhile to think about a further accentuation in basic and continuing \n medical education in diagnostics and treatment of mental disorders of general practitioners . \n but also alternative concepts to secure service provision , such as the implementation of \n mobile treatment facilities or actively calling on patients in their homes , may cause some \n relief . additionally to these ramifications , in the face of the high prevalence of mental \n disorders , interventions to prevent mental disorders should also be kept in mind . \n the results of this investigation have to be put into perspective by a number of \n limitations . \n for instance it can not be safely assumed that all diagnoses have been secured \n by standardised and structured diagnostic interviews . \n it may well be that the frequency of \n certain diagnoses have been under- or overestimated . \n it has to be seen critically that \n almost ten percent of all billed claims base on incorrect or incomplete diagnostic codes and \n had to be discarded from our analyses . \n furthermore our study does not provide differential \n insight as to what kind of treatment has been provided for which kind of disorder . for future evaluations it may be advisable to be able to differentiate the treatments \n provided according to the kind of disorder . taking a future perspective , \n utilising modern \n methods of spatial statistics in combination with geographical information systems may serve \n as a basis for empirically and geographically based service provision planning . \n this may lead to demand - oriented \n plans for service provision that is more strongly oriented towards the demands of the \n population serviced .", "role": "user" }, { "content": "mental disorders cause a substantial amount of the burden of disease . \n although they are \n less frequent in rural areas , their provision of care is disproportionately lower . \n reimbursement claims in the federal state of mecklenburg - west pomerania of the years \n 2006/2007 serve as the basis for the descriptive distribution of subgroups on the total \n number of mental disorders and their outpatient care . of all claims , 35.3% were allotted \n to neurotic , stress - related and somatoform disorders , 24.2% to affective disorders and \n 12.5% to substance use disorders . \n claims for reimbursement were made for 44.7% by general \n practitioners , 15.1% by neurologists and psychiatrists , 12.6% by gynaecologists , and 8.1% \n by internists . \n psychotherapists claimed 3.1% . \n these results cause considerations regarding \n the establishment of psychotherapeutic and neurological / psychiatric practices as well as \n the significance of mental disorders in the training of general practitioners .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: with the rapid development of magnetic resonance imaging ( mri ) technology such as improved mri gradient performance , multichannel surface receiver coils , and parallel imaging techniques , functional mri technology has brought revolutionary progress in the diagnosis and study of diseases . \n diffusion - weight imaging ( dwi ) can reflect the pathological and physiological information of the lesion on the basis of the microscopic mobility of water , which is called the brownian movement in organisms with various diseases , and it also has an important role in the identification of hepatic tumors [ 29 ] . \n previous studies have suggested that the apparent diffusion coefficient ( adc ) of hepatic tumor lesions has distinct differences between benign and malignant tumors , which can distinguish the property of a tumor . \n however , inherent limitations exist in diagnosis based on a single exponential model , especially losing sight of the effect of the arteriole - capillary - venule microcirculation in living tissues on adc values . in 1986 , \n proposed the principles of intravoxel incoherent motion ( ivim ) and suggested that using a more sophisticated approach to describe the relationship between signal attenuation in tissues with increasing b value would enable quantitative parameters that separately reflect tissue diffusivity and tissue microcapillary perfusion to be estimated . in 1988 , \n le bihan et al . used a phantom that could show the effects of perfusion using dw imaging . \n initially applied ivim to the abdomen in 1999 to evaluate the diffusion coefficient of lesions in the abdominal viscera . \n ivim can provide quantitative parameters for the movement of water molecules in tissues and reflect the perfusion condition of the tissue . \n ivim - dwi can be obtained through multiple b values , and emphasizes the combined application of the low b value ( < 200 s / mm ) and high b value ( > 200 s / mm ) to accurately and effectively detect and measure the adc value of lesions . \n the ivim - dwi technique can be used to estimate the diffusion coefficient of slow or nonperfusion - related diffusion - based molecular diffusion ( d ) , the diffusion coefficient of fast or perfusion - related diffusion based diffusion ( d * ) , and the perfusion - related diffusion fraction ( f ) in the voxel . \n this research used the double exponential model to estimate the d value , d * value and f magnitude and compare the diagnostic performance of these parameters in hepatic tumors . \n this study was approved by the local ethics committee and written informed consent was obtained from each subject before the examination . from january 2014 to october 2014 , \n a total of 103 subjects with suspicious hepatic tumors underwent multiple - b - value ivim - dwi . \n a total of 123 focal hepatic lesions in 89 patients were included in this study after surgical pathologic confirmation . among the 89 patients , 52 patients were male and 37 patients were female . \n mean age was 69.7 years old with an age range of 39 to 85 years old . \n patients with definite diagnosis were divided into 2 groups according to the extent of tumor progress : benign tumor group ( 40 cases , 57 lesions ) and malignant tumor group ( 49 cases , 66 lesions ) . \n final diagnoses were as follows : hemangioma ( 47 lesions in 31 cases ) , liver abscess ( 5 lesions in 4 cases ) , focal nodular hyperplasia ( 4 lesions in 4 cases ) , liver hamartoma ( 1 lesion in 1 case ) , hepatocellular carcinoma ( 40 lesions in 30 cases ) , metastatic liver tumor ( 20 lesions in 13 cases ) , and cholangiocarcinoma ( 6 lesions in 6 cases , table 1 ) . \n primary tumors of the metastatic liver tumor were as follows : colorectal carcinoma ( 7 cases ) , pancreatic carcinoma ( 2 cases ) , gastric carcinoma ( 2 cases ) , breast cancer ( 1 case ) , and ampullary carcinoma ( 1 case ) . \n size ( given as meanstandard deviation and range ) of the hepatic carcinoma , cholangiocarcinoma , metastatic liver tumor , hepatocellular carcinoma , focal nodular hyperplasia , abscess and hamartoma were 3.111.92 cm ( 1.684.50 cm ) , 3.121.03 cm ( 1.956.43 cm ) , 1.721.35 cm ( 1.303.90 cm ) , 2.841.79 cm ( 1.507.50 cm ) , 3.171.74 cm ( 1.706.00 cm ) , 2.621.43 cm ( 1.605.00 cm ) , and 4.41 cm , respectively . \n inclusion criteria were as follows : ( 1 ) patients with focal liver lesions detected by computed tomography ( ct ) or ultrasound examination , ( 2 ) patients who were not contraindicated to the mr examination , ( 3 ) patients with focal hepatic lesion > 2 cm in diameter , and ( 4 ) conclusive diagnosis of the lesion using either pathologic or aspiration biopsy confirmation . \n exclusion criteria were as follows : ( 1 ) patients who were treated by transarterial chemoembolization or radiofrequency ablation , ( 2 ) patients whose images were of unacceptable quality for the evaluation of focal hepatic lesions on dwi , ( 3 ) patients who are unable to tolerate the examination , and ( 4 ) patients who did not achieve a definite diagnosis . \n mri was performed using a 3.0 t whole - body scanner ( discovery mr750 , ge healthcare systems ; milwaukee , wi , usa ) with a ge 8-channel phased - array coil . \n all subjects were subjected to limosis for 48 h before the examination and respiratory training to achieve consistency of breathing extent and frequency . \n routine mri protocols consisted of transverse t1-weighted imaging ( t1wi ) using 3d gradient - echo pulse lava ( liver acquisition with volume acceleration ) sequences , transverse breath - trigger fat suppressed fast recovery fast spin - echo ( frfse ) t2-weighted imaging ( t2wi ) , and coronal breath - trigger fat suppressed frfse t2wi . \n ivim - dwi with respiratory triggering was performed with the following scanning parameters : te=79 ms , tr=6000 ms , matrix size=128160 , fov from 3636 cm to 4040 cm , slice thickness=7 mm , gap=1 mm and scanning time=256 s. eleven b - values were used : 0 , 10 , 20 , 30 , 50 , 80 , 100 , 200 , 400 , 800 , and 1000 s / mm . for b values in ranges of 030 s / mm , 50200 s / mm and 4001000 s / mm , nex was 3 , 2 , and 6 , respectively . transverse and coronal contrast - enhanced dwi imaging was performed with a 3d t1-weighted gradient - echo pulse lava sequence after the administration of gadopentetate dimeglumine ( gd - dtpa ; beilu pharmaceutical , beijing , china ) into the elbow vein at a dose of 0.1 mmol / kg with a rate of 2.53 ml / s by high - pressure syringe . \n the contrast agent was followed by using an intravenous bolus administration of 20 ml of saline at the same rate . \n scanning parameters were as follows : matrix size=288192 , slice thickness=25 mm , and the layer number of scanning ranged from 70 to 100 . \n tr=3.7 ms , te=1.7 ms , rotation angle=12 and breath holding time=1217 s. the arterial , portal venous and delayed phase scans were performed 1820 s , 5560 s and 3 min after contrast injection , respectively . \n three diffusivity parameters were defined as follows : diffusion coefficient of slow or nonperfusion - related diffusion - based molecular diffusion ( d , 10 mm / s ) represents true molecular diffusion , diffusion coefficient of fast or perfusion - related diffusion based diffusion ( d * , 10 mm / s ) represents perfusion - related diffusion , and perfusion - related diffusion fraction ( f , % ) represents fractional volume occupied in the voxel by flowing spins . \n these diffusivity values were calculated using the ivim model equation described by le bihan et al . \n : sb is the signal intensity for a given b value and s0 is the signal intensity at b=0 s / mm . \n d was initially determined by the linear least square approach using dwi with a b - value > 200 s / mm . \n d * and f were calculated by the nonlinear least - squares approach using the nelder - mead method . \n / s0 ) of relative signal intensity vs. b values from cases of primary hepatocellular carcinoma . \n all acquired images were analyzed on a ge advantage workstation 4.6 using the local software of the machine functool ( ge healthcare , milwaukee , wi , usa ) prior to surgery and before pathologic results were known . \n two clinically experienced radiologists with more than five 5 years of experience in interpreting hepatic mr images , who were blinded to the final histology or biopsy , evaluated each of the mr images independently . \n routine t1wi , t2wi , and dynamic enhanced lava t1wi were provided to confirm the location and size of the lesion when ivim - dw images were evaluated ( figure 2a and figure 3a , 3b ) . \n rois were placed on an image with b=0 ( figure 2b and figure 3c ) . \n the software automatically copied the roi to each image ( b=101,000 s / mm ) and calculated the average of the signals within the roi for each image while simultaneously recording the d value , d * value and f value , respectively ( figure 2c2e and figure 3d3f ) . in focal hepatic lesions , \n rois were placed in order to avoid necrosis or hemorrhage , ; and rois were drawn as large as possible to cover the solid part of the lesions . \n data were analyzed using commercial software ( ibm spss v.19 , armonk , ny ; medcalc v.12 , mariakerke , belgium ) . \n diffusion parameters of benign and malignant tumors were compared by mann - whitney u test . \n diffusion parameter results between malignant tumor types were compared by kruskal - wallis test followed by bonferroni - corrected mann - whitney u test . \n receiver operating characteristic ( roc ) analysis was performed for lesion discriminability between malignant and benign hepatic lesions . \n this study was approved by the local ethics committee and written informed consent was obtained from each subject before the examination . from january 2014 to october 2014 , \n a total of 103 subjects with suspicious hepatic tumors underwent multiple - b - value ivim - dwi . \n a total of 123 focal hepatic lesions in 89 patients were included in this study after surgical pathologic confirmation . among the 89 patients , 52 patients were male and 37 patients were female . \n mean age was 69.7 years old with an age range of 39 to 85 years old . \n patients with definite diagnosis were divided into 2 groups according to the extent of tumor progress : benign tumor group ( 40 cases , 57 lesions ) and malignant tumor group ( 49 cases , 66 lesions ) . \n final diagnoses were as follows : hemangioma ( 47 lesions in 31 cases ) , liver abscess ( 5 lesions in 4 cases ) , focal nodular hyperplasia ( 4 lesions in 4 cases ) , liver hamartoma ( 1 lesion in 1 case ) , hepatocellular carcinoma ( 40 lesions in 30 cases ) , metastatic liver tumor ( 20 lesions in 13 cases ) , and cholangiocarcinoma ( 6 lesions in 6 cases , table 1 ) . \n primary tumors of the metastatic liver tumor were as follows : colorectal carcinoma ( 7 cases ) , pancreatic carcinoma ( 2 cases ) , gastric carcinoma ( 2 cases ) , breast cancer ( 1 case ) , and ampullary carcinoma ( 1 case ) . \n size ( given as meanstandard deviation and range ) of the hepatic carcinoma , cholangiocarcinoma , metastatic liver tumor , hepatocellular carcinoma , focal nodular hyperplasia , abscess and hamartoma were 3.111.92 cm ( 1.684.50 cm ) , 3.121.03 cm ( 1.956.43 cm ) , 1.721.35 cm ( 1.303.90 cm ) , 2.841.79 cm ( 1.507.50 cm ) , 3.171.74 cm ( 1.706.00 cm ) , 2.621.43 cm ( 1.605.00 cm ) , and 4.41 cm , respectively . \n inclusion criteria were as follows : ( 1 ) patients with focal liver lesions detected by computed tomography ( ct ) or ultrasound examination , ( 2 ) patients who were not contraindicated to the mr examination , ( 3 ) patients with focal hepatic lesion > 2 cm in diameter , and ( 4 ) conclusive diagnosis of the lesion using either pathologic or aspiration biopsy confirmation . \n exclusion criteria were as follows : ( 1 ) patients who were treated by transarterial chemoembolization or radiofrequency ablation , ( 2 ) patients whose images were of unacceptable quality for the evaluation of focal hepatic lesions on dwi , ( 3 ) patients who are unable to tolerate the examination , and ( 4 ) patients who did not achieve a definite diagnosis . \n mri was performed using a 3.0 t whole - body scanner ( discovery mr750 , ge healthcare systems ; milwaukee , wi , usa ) with a ge 8-channel phased - array coil . \n all subjects were subjected to limosis for 48 h before the examination and respiratory training to achieve consistency of breathing extent and frequency . \n routine mri protocols consisted of transverse t1-weighted imaging ( t1wi ) using 3d gradient - echo pulse lava ( liver acquisition with volume acceleration ) sequences , transverse breath - trigger fat suppressed fast recovery fast spin - echo ( frfse ) t2-weighted imaging ( t2wi ) , and coronal breath - trigger fat suppressed frfse t2wi . \n ivim - dwi with respiratory triggering was performed with the following scanning parameters : te=79 ms , tr=6000 ms , matrix size=128160 , fov from 3636 cm to 4040 cm , slice thickness=7 mm , gap=1 mm and scanning time=256 s. eleven b - values were used : 0 , 10 , 20 , 30 , 50 , 80 , 100 , 200 , 400 , 800 , and 1000 s / mm . for b values in ranges of 030 s / mm , 50200 s \n / mm and 4001000 s / mm , nex was 3 , 2 , and 6 , respectively . \n transverse and coronal contrast - enhanced dwi imaging was performed with a 3d t1-weighted gradient - echo pulse lava sequence after the administration of gadopentetate dimeglumine ( gd - dtpa ; beilu pharmaceutical , beijing , china ) into the elbow vein at a dose of 0.1 mmol / kg with a rate of 2.53 ml / s by high - pressure syringe . \n the contrast agent was followed by using an intravenous bolus administration of 20 ml of saline at the same rate . \n scanning parameters were as follows : matrix size=288192 , slice thickness=25 mm , and the layer number of scanning ranged from 70 to 100 . \n tr=3.7 ms , te=1.7 ms , rotation angle=12 and breath holding time=1217 s. the arterial , portal venous and delayed phase scans were performed 1820 s , 5560 s and 3 min after contrast injection , respectively . \n three diffusivity parameters were defined as follows : diffusion coefficient of slow or nonperfusion - related diffusion - based molecular diffusion ( d , 10 mm / s ) represents true molecular diffusion , diffusion coefficient of fast or perfusion - related diffusion based diffusion ( d * , 10 mm / s ) represents perfusion - related diffusion , and perfusion - related diffusion fraction ( f , % ) represents fractional volume occupied in the voxel by flowing spins . \n these diffusivity values were calculated using the ivim model equation described by le bihan et al . \n : sb is the signal intensity for a given b value and s0 is the signal intensity at b=0 s / mm . \n d was initially determined by the linear least square approach using dwi with a b - value > 200 s / mm . \n d * and f were calculated by the nonlinear least - squares approach using the nelder - mead method . \n / s0 ) of relative signal intensity vs. b values from cases of primary hepatocellular carcinoma . \n all acquired images were analyzed on a ge advantage workstation 4.6 using the local software of the machine functool ( ge healthcare , milwaukee , wi , usa ) prior to surgery and before pathologic results were known . \n two clinically experienced radiologists with more than five 5 years of experience in interpreting hepatic mr images , who were blinded to the final histology or biopsy , evaluated each of the mr images independently . \n routine t1wi , t2wi , and dynamic enhanced lava t1wi were provided to confirm the location and size of the lesion when ivim - dw images were evaluated ( figure 2a and figure 3a , 3b ) . \n rois were placed on an image with b=0 ( figure 2b and figure 3c ) . \n the software automatically copied the roi to each image ( b=101,000 s / mm ) and calculated the average of the signals within the roi for each image while simultaneously recording the d value , d * value and f value , respectively ( figure 2c2e and figure 3d3f ) . in focal hepatic lesions , \n rois were placed in order to avoid necrosis or hemorrhage , ; and rois were drawn as large as possible to cover the solid part of the lesions . \n data were analyzed using commercial software ( ibm spss v.19 , armonk , ny ; medcalc v.12 , mariakerke , belgium ) . \n diffusion parameters of benign and malignant tumors were compared by mann - whitney u test . \n diffusion parameter results between malignant tumor types were compared by kruskal - wallis test followed by bonferroni - corrected mann - whitney u test . \n receiver operating characteristic ( roc ) analysis was performed for lesion discriminability between malignant and benign hepatic lesions . \n both the d value ( [ 1.040.34]10 mm / s ) and d * value ( [ 16.57.7]10 mm / s ) in malignant lesions were significantly lower than in benign lesions ( d value [ 1.700.55]10 mm / s , p<0.01 ; d * value [ 21.79.9]10 mm / s , p<0.01 ) . \n there was no statistically significantly difference in f value between malignant ( 23.39.5 ) and benign ( 33.514.9 ) lesions ( p=0.13 , table 2 ) . \n results of diffusion and perfusion - related parameters by tumor type are shown in table 3 . \n cholangiocarcinoma presented significantly higher d values than metastatic liver tumor ( p=0.021 ) and hepatocellular carcinoma ( p=0.002 ) . \n similarly , metastatic liver tumor had significantly lower d * values than cholangiocarcinoma ( p=0.016 ) and hepatocellular carcinoma ( p=0.001 ) . according to roc analysis , the average area under the roc curve for predicting malignant lesions was 0.88 ( 0.810.91 ) for d * value and 0.98 ( 0.941.00 ) for d value ( p<0.05 , table 4 ) . \n optimal cutoff values calculated by roc analysis ( d , 1.29510 mm / s and d * , 21.8510 mm / s ) provided sufficiently high sensitivity and specificity for both d ( 96.2% and 91.4% , respectively ) and d * ( 90.6% and 82.9% , respectively ) values ( table 4 ) . \n functional mr images can reflect the random motion ( brownian movement ) of water molecules in living tissue . \n however , quantitative adc values can also be affected by physiological activity and the perfusion effect of the capillary network . \n the double exponential model with multi - b - values separates the diffusion and perfusion ( microcirculation ) of water molecules . \n it more closely approximates the real adc of the biological tissue , which reflects dwi better than the single exponential model . \n the ivim double exponential model assumes that tissue diffusion consists of 2 parts : brownian movement ( d ) due to molecular diffusion , and fast perfusion movement ( d * ) due to blood flow in smaller vessels . \n d is the static tissue molecular diffusion ( true diffusion coefficient ) , which is calculated by selecting the high b value ( > 200/mm ) and eliminating the perfusion component . \n d * denotes the perfusion - diffusion coefficient , which is the perfusion - related diffusion coefficient due to blood circulation . \n perfusion composition of tissue microcirculation is sensitive to mr signal attenuation with low b values ( < 200/mm ) . the perfusion fraction f represents the fractional volume occupied in the voxel by flowing spins linked to the intravascular component or to the microcirculation . \n d * is closely associated with blood vessel density in tumor tissues , and f value increases with the growth of the tissue perfusion component . in this study , d \n * values were much greater than the corresponding d values , which indicate that d * is sensitive to mr signal attenuation when b value is low . \n the d , d * , and f values in our study are similar to a previous study in hepatic adenoma , hepatic cavernous hemangioma , hepatocellular carcinoma , metastatic liver tumor , and cholangiocarcinoma patients . \n however , the study of ichikawa et al . reported higher d , d * , and f values than those in our study . \n these may be due to the difference on the manual roi drawing ( manual roi method ) and the number of patients or lesions . \n the attribute of the hypovascularity of metastatic liver tumors in this study may also affect these outcomes . in this study , we found both d and d * values in malignant lesions were significantly lower than in benign lesions , which is consistent with the findings of ichikawa et al . . \n in contrast to our findings , the study of doblas et al . reported that pure diffusion coefficients ( d ) were significantly lower in malignant tumors than in benign tumors , while perfusion - related diffusion parameters ( d * ) did not significantly differ between these 2 groups , which was due to the large number of benign hepatocellular lesions ( fnh and adenomas ) in their study . \n the d * value of metastatic liver tumors is lower than hepatocellular carcinoma and cholangiocarcinoma , which may be due to the hypovascular property of the metastatic liver tumor . \n our findings are consistent with those of a previous study , which reported that d * and f values can reflect the condition of the blood supply , and these values are higher in hypervascular hepatic tumors than in hypovascular hepatic tumors . \n this study also used the roc curve to evaluate the diagnostic efficiency of d , d * , and f. the roc curve presents the optimal threshold of d for the diagnosis of benign and malignant tumors is 1.29510 mm / s . sensitivity ( 91.4% ) and specificity ( 96.2% ) of the d value \n are both relatively high for identifying the maximum auc ( 0.976 ) , indicating the highest diagnostic efficiency of the d value . \n ( 1 ) the most obvious difference between benign and malignant tumors is the component of abnormal cell proliferation . \n altered nucleo - cytoplasmic ratio and nuclear atypia in malignant tumor cell induce the limited diffusion of water molecules and increase the true diffusion of the tissue . \n ( 2 ) the component separation of perfusion - diffusion and true molecular diffusion by the double exponential model resulted in the calculation , in which the d value is closer to the actual adc of the biological tissue . \n the perfusion - diffusion is due to the irregular perfusion of the microcirculation in the blood capillary . \n the relatively small sample size and the selection of lesion types in this study may have affected interpretation of results . \n more realistic d , d * , and f values can be obtained by using more dwi images of low b values and high b values during ivim imaging , contributing to the qualitative and quantitative identification of the diagnosis . \n d and d * are both valuable in the diagnosis of hepatic tumors , but d is more reliable in property identification . the diagnostic value of the perfusion parameter obtained by ivim may reduce the dependency for liver contrast medium clinically . \n ivim is an ideal examination method when dynamic enhanced scan period ( arterial phase ) fails or for contrast medium sensitivity , especially for senile patients and infants . \n thus , there is an overbalance in the distribution of tumor types , which is limited by the subjects in the hospital . \n second , using 3 parameters is unstable , in contrast to using a single parameter ; which can easily cause errors in the d * value . \n in particular , when the f value is small ( low perfusion proportion ) , the quality of the d * image decreases and the chance for more errors on the d * value is higher . \n third , the liver is a locomotive organ that can affect ivim parameters . finally , multi - b - value technology prolongs scanning time , which is onerous for patients . \n ivim dwi can provide more essential d , d * , and f values by using sufficiently low b values and high b values , which contributes to the qualitative and quantitative diagnosis of hepatic tumors . \n the d value was proven to be a more reliable parameter than the d * value for distinguishing between malignant and benign hepatic lesions .", "role": "user" }, { "content": "backgroundthis study aimed to evaluate the diagnostic value of the d value , d * value , and f magnitude for identifying benign and malignant hepatic tumors using intravoxel incoherent motion ( ivim ) diffusion - weighted imaging ( dwi).material / methodsdata of 89 cases ( 123 lesions ) with hepatic tumor confirmed by surgical pathology and postoperative follow - up were retrospectively collected . among these cases , 40 cases were benign hepatic tumors ( 57 lesions ) and 49 cases were malignant hepatic tumors ( 66 lesions ) . \n all subjects underwent conventional mri with t1wi , t2wi , multi - b - value dwi , and dynamic enhanced lava scan . \n diffusion - weighted images with 11 b values ( 0 , 10 , 20 , 30 , 50 , 80 , 100 , 200 , 400 , 800 , and 1000 s / mm2 ) were obtained to calculate true molecular diffusion ( d ) , perfusion - related diffusion coefficient ( d * ) , and perfusion fraction ( f ) . \n the diagnostic performance in differentiating between malignant and benign hepatic lesions was analyzed.resultsmalignant lesions had a significantly lower d value ( [ 1.040.34]103 mm2/s ) and d * value ( [ 16.57.7]103 mm2/s ) compared to benign lesions ( d value : [ 1.700.55]103 mm2/s , p<0.01 ; d * value : [ 21.79.9]103 mm2/s , p<0.01 ) . \n there was no statistically significant difference in f values between malignant ( 23.39.5 ) and benign lesions ( 33.514.9 , p=0.13 ) . \n in addition , d exhibited a better diagnostic performance than d * in terms of the area under the curve , sensitivity , and specificity when identifying malignancies from benign lesions.conclusionsd and d * are significant parameters for diagnosing hepatic tumors . \n moreover , the d value is a more reliable parameter in distinguishing benign and malignant hepatic tumors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: without effective tobacco control measures , it is estimated that by the year 2030 , the annual global death toll will reach 8 million . with current smoking patterns , approximately 500 million people alive today will eventually be killed by tobacco use . currently , there are an estimated 1.3 billion smokers in the world . \n most smokers indicate interest in quitting , three out of four smokers say they want to quit . \n one of the core responsibilities of the health system should be to treat tobacco dependence . \n this treatment includes different methods such as simple medical consultation , medication , and telephone counseling . \n the cost of these methods differs and would not have the same effect on different smokers . \n it should be noted that treatments need to be tailored and delivered appropriately for individuals according to their age , gender , interest , needs and also cultural and local conditions . \n this intervention is relatively cost - effective because it is a part of available services , which people rarely use . \n such interventions are very effective because they are provided by health care providers who are respected by most people and with whom smokers tend to have good interactions . \n in addition to medical advice and telephone consultation for quitting , an effective method can also include medication . \n medication includes various forms of nicotine replacement therapy ( nrt ) such as patches , gum , lozenges , and nasal spray and also prescription drugs such as bupropion and varenicline . \n after 10 years of the first educational intervention for quitting smoking and one or two complementary programs in the iran health system network , and in some attached centers ( including group therapy and free 15 mg nicotine patch ) the same interventions are still being implemented with little documentation of effectiveness . \n therefore , different treatments including more recent treatments need to be studied and assessed and the most appropriate ones selected and developed at the country health system level . \n this should include among other factors demands on human resources and availability and cost of medication services . \n it is important for us to know how these treatments were viewed by patients . in undertaking \n this assessment , it is important to include patient selection on the methods they have experienced . \n the aim was to study and assess patients selection of different quit smoking methods provided in tobacco cessation services centers in iran in order to identify those that could be as one of the most appropriate for the country health system . \n this cross - sectional and descriptive study was conducted in smoking cessation services centers in iran in 20122013 . in each iran 's province , there is a university under the supervision of ministry of health and medical education . \n therefore , primary health care services are provided by universities of medical sciences and national tobacco control programs provided by these universities , and there is a person to coordinate these activities in the affiliated centers all across the provinces . there were approximately 5060 smoking quit centers , which are working under the supervision of health centers in primary health care system , but many of these were not active in presenting tobacco cessation services . 13 active centers in 7 cities were selected ( whether public or private ) with the goal of obtaining a representative sample size of 1066 subjects by using the following formula : in a randomly selected day based on first - come , first - serve basis and agreement to join the study , smokers at all active quit centers throughout the country completed the questionnaire . \n the researchers visited the centers during june 2012 and asked a randomly selected sample of smokers ( minimum 10 from each center ) to complete an anonymous , self - administered questionnaire during their visit to the center . \n the contents of the primarily structured questionnaire were designed by the first author based on review of the relevant literature and the authors preliminary research . \n its psychometric properties were evaluated in terms of face and content validity through a panel discussion with seven tobacco control experts in iran who had experience in tobacco cessation programs . \n the reliability coefficient ( cronbach alpha ) for the questionnaire was assessed through test - retest on a sample of 15 patients ( = 0.88 ) . \n the questionnaire contained 10 questions ( 3 scores each ) regarding the quality , cost , effect , side - effects and the results of quitting methods using a 5-point liker - type scale from 1 to 3 to have maximum 30 for each . for maximum coverage \n the centers of seven cities in different geographic regions such as tehran , isfahan , shiraz , mashhad , tabriz , hamedan and sari were selected ( these centers were identified through necessary coordination with the deputy for health and curative affairs in each province ) . \n prior to distribution of the questionnaire , the purpose and nature of the study were explained to the relevant authorities in each center and also to the randomly selected participants and informed consent was obtained in order to inform the participants regarding the aim of study , feel free to join the study , and other ethical and confidential issues . \n all survey responses were entered into a data set and double keyed to ensure accurate data entry . \n percentages , frequencies , mean , t - test and variance analysis were computed for all study variables . \n analyses were conducted using spss 16.00 statistical software ( spss inc . , chicago , il , usa ) . \n in this study , a total of 1063 out of 1384 smokers returned completed the survey questionnaire ( response rate was 77% ) . \n most respondents were from tehran with 473 cases , using all methods , while in other cities some methods were not accessible or the patients did not use them . \n the most frequently used methods were nrt and combination methods ( nrt and counseling ) with 228 and 163 cases , respectively . \n the least used methods were hypnotism ( n = 8) and the quit and win method ( n = 17 ) [ table 1 ] . frequency distribution of study sample by methods and cities in iran in 2012 - 2013 the mean score of all used methods in our study was 16.8 4.6 ( minimum 10maximum 26 ) . \n the methods which received the maximum scores were combined methods , willpower and champix with means of 21.4 , 20.4 and 18.4 , respectively . \n the minimum scores were assigned to e - cigarettes , hypnotism and education with means of 12.8 , 11 and 10.8 , respectively [ table 2 ] . \n prevalence and score obtained for each quit smoking method based on patients ' opinion and according to their priority there were significant differences in mean scores based on different cities and in the mean scores of different methods [ table 3 ] . the cities of hamadan and sari gained the maximum scores ( p < 0.000 ) and combined methods , personal , champix and quitlines gained the maximum scores ( p < 0.000 ) . \n invariance analysis on mean scores of different methods , there were significant differences among methods , and combined treatment , personal , champix and telephone consultation gained the maximum scores ( p < 0.000 ) [ table 4 ] . \n analysis of variance of mean scores for patients opinions on quit smoking methods in different cities of iran , 2012 analysis of variance of mean score provided through patients opinion towards different methods of quit smoking in iran , 2012 there were no significant differences in patients mean scores of according to their gender ( p = 0.19 ) [ tables 5 and 6 ] . \n patients mean scores according to their gender in iran , 2012 t - test for equality of means score obtained from patients opinion regarding different quit methods according to their gender in iran , 2012 \n in this study , the selection and opinions of the smokers toward different quitting methods revealed that the combination therapy , personal , champix and telephone consultation were viewed as the most effective methods in the country . \n it is important to know the patients opinions in order to up to date our services at the country level for enhanced success . among these four preferred methods , \n the combination therapy treatment was the first priority , and we assume that this could be due to its availability free of charge and also its group therapy approach . \n this method also has been recommended in prior studies . for personal methods that were rated as a second priority \n , we considered that this may be due to the fact that the use of personal methods demonstrates the high motivation of smokers to quit smoking . \n other studies have not confirmed this idea , however , and it may be considered as a starting point for further complementary studies . \n use of champix has been implemented once ( free of charge ) and revealed a good result . \n telephone consultation was identified as a fourth priority , and this could also be due to its accessibility at the country level . \n these seventeen treatment methods for quit smoking can be divided into three groups as follows : \n group with high priority : combination therapy , willpower , champix , telephone consultation , nrt , nonnicotine medication.group with medium priority : acupuncture , zyban , some medications ( such as anti - depression drugs ) , some methods without medication ( for example counseling and watching movies ) , quit and win , behavioral treatment.group with low priority : learning material , interactive voice response , e - cigarettes , hypnotism , and education . \n group with high priority : combination therapy , willpower , champix , telephone consultation , nrt , nonnicotine medication . \n group with medium priority : acupuncture , zyban , some medications ( such as anti - depression drugs ) , some methods without medication ( for example counseling and watching movies ) , quit and win , behavioral treatment . \n group with low priority : learning material , interactive voice response , e - cigarettes , hypnotism , and education . \n it was observed that there are significant differences in mean scores for quitting methods among the seven cities [ table 3 ] . \n we had assumed that these methods would receive higher scores in tehran compared to other cities ( due to long - term experience and the availability of the centers ) . \n however , contrary to our expectations , the highest scores were reported in sari and hamadan city . \n further research should be done to investigate this result . according to the variance analysis conducted to compare methods ( and \n despite the fact that there were significant differences between the methods ) ; four quit methods , including combination therapy , willpower , and champix were identified as best . \n there were no significant differences among the remaining six quit methods [ table 4 ] . \n this table indicates that one appropriate method may be selected from among the methods in each group based on present conditions , including patients and physicians preference and satisfaction . \n there also was no significant difference between women and men in this study , in contrast to gilpin and pierce 's findings . \n this study demonstrated that patients prefer to use combination therapy individually ( not group therapy ) and this issue should be considered for the supplementary further study . \n the results of this study are important because few studies have assessed real world responses of patients who used different smoking treatment methods . \n thus , one potential follow - up from this study could be a training program for health care providers on effective methods to treat smokers . \n for example , acupuncture has not been proven effective as a tobacco treatment method , yet it was reported as a medium priority treatment by the participants . \n an important limitation of this study is the cross - sectional nature of the data . \n another important limitation was inability of health policy makers to make necessary final decision for tobacco control program based of the result of this study and future studies should focus on the quality , such as cost - effectiveness , time , and side effects of each cessation method . \n this study also reflects the international discussion that has occurred regarding the role of formal treatment relative to self - quitting since participants reported that both willpower and medications like varenicline were most effective for helping them quit smoking . \n willpower can be considered an indicator of motivation , and our experience is that those who are most motivated to quit might be the most successful ones . and \n when that motivation is coupled with an effective medication , the chances of being successful increase even more . \n thus , the results of this study reflect the wisdom our patients because they recognize that smoking treatment requires more than just taking a medication , but it also reflects the need to train more healthcare workers to assure they help their patients with the most effective methods . \n patients opinions revealed that combination therapy , willpower , champix and telephone consultation are the most effective quit methods in the country and that quit centers will have more patients successfully quit smoking using these methods .", "role": "user" }, { "content": "background : health systems play key roles in identifying tobacco users and providing evidence - based care to help them quit . \n this treatment includes different methods such as simple medical consultation , medication , and telephone counseling . to assess different quit smoking methods selected by patients in tobacco cessation centers in iran in order to identify those that are most appropriate for the country health system.methods:in this cross - sectional and descriptive study , \n a random sample of all quit centers at the country level was used to obtain a representative sample . \n patients completed the self - administered questionnaire which contained 10 questions regarding the quality , cost , effect , side effects and the results of quitting methods using a 5-point likert - type scale . \n percentages , frequencies , mean , t - test , and variance analyses were computed for all study variables.results:a total of 1063 smokers returned completed survey questionnaires . \n the most frequently used methods were nicotine replacement therapy ( nrt ) and combination therapy ( nrt and counseling ) with 228 and 163 individuals reporting these respectively . \n the least used methods were hypnotism ( n = 8) and the quit and win ( n = 17 ) . \n the methods which gained the maximum scores were respectively the combined method , personal and champix with means of 21.4 , 20.4 and 18.4 . \n the minimum scores were for e - cigarettes , hypnotism and education with means of 12.8 , 11 and 10.8 , respectively . \n there were significant differences in mean scores based on different cities and different methods.conclusions:according to smokers selection the combined therapy , personal methods and champix are the most effective methods for quit smoking and these methods could be much more considered in the country health system .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: leishmaniasis is one of the most neglected tropical diseases in terms of drug discovery and development . in over 88 countries \n , leishmania threatens millions of the poorest people , especially those living in rural areas . \n up to two million people are infected with leishmania each year , and 70% of those who die from leishmaniasis are children ( chappuis et al . , 2007 ) . \n leishmania donovani ( l. donovani ) causes visceral leishmaniasis ( vl ) , the most severe form of the disease in humans ( hotez et al . , 2007 ) . \n leishmania amazonensis ( l. amazonensis ) causes cutaneous leishmaniasis ( cl ) , the most common form of leishmaniasis in the new world ( guimaraes - costa et al . , 2009 ) . \n cl is endemic in 82 countries , with an incidence of approximately 1.5 million cases per year . \n available treatments for vl and cl include amphotericin b ( a toxin that forms pores in membranes with some preferences for ergosterol ( croft et al . , 2006 ) ) , with some success on the indian subcontinent ( chappuis et al . , 2007 ) . \n in contrast to india , the use of amphotericin b for vl in east africa generally results in less - effective responses ; thus , in this region , pentavalent antimonials , such as sodium stibogluconate ( mode of action is not clearly understood ( copeland and aronson , 2015 ) ) , are the first line of treatment . \n however , these drugs are highly toxic and cause serious side effects including hypotension , seizures , disturbances in cardiac conduction , and phlebotoxicity ( vein inflammation , which limits repeated dosing ( croft and coombs , 2003 ) ) . moreover , widespread resistance has developed to these drugs . in march 2014 , the fda approved miltefosine ( developed in the late 1980s for cancer treatment ( vincent et al . , 2014 ) ) for treatment of cl and vl caused by specific leishmania species . \n although initially miltefosine demonstrated high efficacy for vl in india , numerous clinical failures have since been reported . \n in addition , only moderate efficacy has been observed in east africa and the new world ( monge - maillo and lpez - vlez , 2015 ) . \n trypanosoma cruzi ( t. cruzi ) infection causes chagas disease , affecting 10 million people in the americas , and is responsible for 12,000 deaths yearly ( bonney , 2014 ) . moreover , increased migration has disseminated this disease worldwide ( bonney , 2014 ) , and about 70 million people , the majority of which are children , remain at high risk for contracting this disease ( hotez et al . , 2012 ) . during the acute phase after t. cruzi infection , clinical signs \n are usually quite minimal ; however , many years after the primary infection , about 3040% of infected individuals develop the symptomatic chronic phase of chagas disease , characterized by the presence of myocarditis and heart failure ( garcia et al . , 2005 ) . \n the drugs used to treat chagas disease , benznidazole ( which causes double - stranded breaks in dna ( viotti et al . , \n 2009 ) ) and nifurtimox ( mechanism of action is not yet fully elucidated ) , have limited use , as they have severe side effects and exhibit inadequate efficacy in the chronic stage ( maya et al . , 2007 ) . \n several clinical studies found that although benznidazole treatment is somewhat beneficial , its side effects are still an issue ( e.g. clinical study , nct01162967 , in which the treatment of 20% of the patients in the benznidazole group was discontinued because of severe cutaneous reactions ( molina et al . , 2014 ) ) . \n therefore , novel and simple strategies are needed for developing therapeutic agents that are effective and less toxic , do not trigger resistance , and are affordable for the infected populations in the developing world . here , we describe our effort to develop novel inhibitors for the parasites leishmania sp . and t. cruzi . \n we concentrated on generating inhibitors that are specific for the parasites by targeting unique domains of parasite scaffold proteins , lack ( leishmania 's receptor for activated c - kinase ) and track ( trypanosoma \n receptor for activated c - kinase ) . \n lack is a scaffold protein required for the viability of the parasite and for its establishment in the host ( gomez - arreaza et al . , 2011 ) . \n lack plays an important role in the early phase of leishmania infection ( mougneau et al . , 1995 ) \n ; lack - deficient parasites are not viable ( kelly et al . , 2003 ) , and parasites expressing lower levels of lack fail to parasitize even immune - compromised mice \n similarly , track in trypanosoma is an essential protein and its homologs are found in several trypanosomatids , including t. cruzi ( rothberg et al . , 2006 ) . \n although there is limited information about track 's functions in t. cruzi , in trypanosoma brucei ( t. brucei ) , track is expressed throughout the parasite 's life cycle and has a role in the final stages of mitosis ( rothberg et al . , 2006 ) . \n in addition , decreased track expression by rnai leads to incomplete cytokinesis in pro - cyclic blood stream trypanosomes and accelerates the elimination of parasites from peripheral blood ( rothberg et al . , 2006 ) . \n these data suggest that lack and track are involved in essential parasite processes and could be important anti - parasitic drug targets . \n previously we developed a rational approach to generate inhibitors of scaffold proteins , which interfere with normal and pathological signaling events in cells , in animal models , and in humans ( review ( churchill et al . \n , 2009 , mochly - rosen and qvit , 2010 , qvit and mochly - rosen , 2010 ) ) . \n relevant to this study , we have identified peptides that inhibit the function of rack ( receptor for activated c - kinase ) , the mammalian homolog of lack and track . \n rack is a ubiquitous and highly conserved scaffold protein ( mccahill et al . , 2002 ) that binds several signaling enzymes , all of which are critical for cell survival , growth , and differentiation ( schechtman and moshly - rosen , 2001 ) . \n we rationally designed peptides that interfere with rack function ; these peptides were found to be effective and selective in cells , in vivo ( in a variety of animal models of human diseases ( inagaki et al . , 2003 , kim et al . \n , 2008 ) ) , and in clinical trials ( bates et al . , 2008 ) . here \n we apply the same rational design for development of peptides that target leishmaniasis and chagas disease . \n we describe an inexpensive and fast approach that enabled the identification of novel peptides derived from the parasitic scaffold proteins , lack and track , as anti - parasitic therapeutic leads . these may ultimately provide the basis for a specific , less toxic , and more convenient treatment for people who suffer from these diseases . \n sequences from different species were aligned using the following proteins : human rack ( p63244 ) , l. donovani lack ( q76ls6 ) , leishmania braziliensis lack ( a4hgx7 ) , leishmania panamensis lack ( q9gub0 ) , leishmania major lack ( q253306 ) , leishmania turanica lack ( 496205235 ) , leishmania aethiopica lack ( 496205233 ) , leishmania tropica lack ( 404515577 ) , leishmania gerbilli lack ( 388850676 ) , leishmania infantum lack ( p62884 ) , leishmania chagasi lack ( p62884 ) , leishmania mexicana lack ( q7kfg4 ) , l. amazonensis lack ( q95nj3 ) , trypanosoma cruzi track ( q4dtn2 ) , trypanosoma brucei track ( p69103 ) , trypanosoma congolense track ( o96653 ) , trypanosoma carassii track ( a6zic2 ) and trypanosoma vivax track ( o96654 ) . \n the alignment was done using the fasta server of the university of virginia ( pearson and lipman , 1988 ) , where : ( :) represents identical amino acids , and ( . ) \n represents similar amino acids . in brief : peptides were synthesized on solid support using a fully automated microwave peptide synthesizer ( liberty , cem corporation ) . \n the peptides were synthesized by spps ( solid phase peptide synthesis ) methodology ( merrifield , 1963 ) with a fluorenylmethoxycarbonyl ( fmoc)/tert - butyl ( tbu ) protocol . \n the lysine side chain was protected with n - methyltrityl ( mtt ) , a protection group that can be deprotected selectively using acid labile conditions ( aletras et al . , 1995 ) . \n after completion of the synthesis of the linear peptide , an anhydride spacer was coupled to the n - terminal amino group and cyclization was performed using amide bonds between the moiety linker at the backbone n - terminus and an epsilon amino on the side chain of a c - terminal lys residue ( gilon et al . , 1991 , \n peptides were analyzed by analytical reverse - phase high - pressure liquid chromatography ( rp - hplc ) ( shimadzu , md , usa ) and matrix - assisted laser desorption / ionization ( maldi ) mass spectrometry ( ms ) and purified by preparative rp - hplc ( shimadzu , md , usa ) . \n dichloromethane ( dcm ) , n - methyl-2-pyrrolidone ( nmp ) , triisopropylsilane ( tis ) , n , n - diisopropylethylamine ( diea ) , o - benzotriazole - n , n , n,n-tetramethyl - uronium - hexafluoro - phosphate ( hbtu ) , 1-hydroxybenzotriazole ( hobt ) and trifluoroacetic acid ( tfa ) were purchased from sigma \n aldrich ( mo , usa ) ; dimethylformamide ( dmf ) was purchased from alfa aesar ( ma , usa ) ; piperidine was purchased from anaspec ( ca , usa ) ; rink amide am resin was purchased from cbl biopharma llc ( substitution 0.49 mmol / g , co , usa ) ; fmoc - protected amino acids were purchased from advanced chemtech and gl biochem ( ky , usa and shanghai , china ) . side chains of the amino acids used in the synthesis were protected as follows : boc ( lys / trp ) , but ( ser / thr / tyr ) , obut ( asp / glu ) , pbf ( arg ) , mtt ( lys ) and trt ( asn / cys / gln / his ) . \n peptides were chemically synthesized using liberty microwave peptide synthesizer ( cem corporation , matthews , nc , usa ) on solid support with an additional module of discover ( cem corporation , matthews , nc , usa ) equipped with fiber - optic temperature probe for controlling the microwave power delivery following the fluorenylmethoxycarbonyl ( fmoc)/tert - butyl ( tbu ) method in a 30 ml teflon reaction vessel . \n fmoc deprotection was performed in two steps : 30 s and 180 s , both at 45 w , 75 c using piperidine ( 20% ) in dmf with hobt ( 0.1 m ) solution . \n coupling reactions were performed by repetition of the following cycle conditions : 300 s , 25 w , 75 c , with hbtu ( 0.11 m ) in dmf , amino acids ( 0.12 m ) in dmf and diea ( 0.25 m ) in nmp solution . the coupling and fmoc deprotection steps were monitored using kaiser ( ninhydrin ) test ( kaiser et al . , 1970 ) and small cleavage . \n anhydride coupling was carried out as follows : 300 s , 25 w , 75 c , using 10:10:1 anhydride / di - isopropylethylamine ( diea)/4-dimethylaminopyridine ( dmap ) in nmp . \n cyclization was performed in dibromomethane ( dbm ) ( 300 s , 25 w , 75 c , using 5:10 benzotriazole-1-yl - oxy - tris - pyrrolidino - phosphonium hexafluorophosphate ( pybop)/di - isopropylethylamine ( diea ) ) . \n peptide cleavage from the resin and deprotection of the amino acid side chains were carried out with tfa / tis / h2o / phenol solution ( 90:2.5:2.5:5 v / v / v / w ) for 3 h at room temperature without microwave energy . \n the crude products were precipitated with diethyl ether , collected by centrifugation , dissolved in h2o / ch3cn and lyophilized . \n products were analyzed by analytical reverse - phase high - pressure liquid chromatography ( rp - hplc ) ( shimadzu lc-20 equipped with : cbm-20a system controller , spd-20a detector , cto-20a column oven , 2 lc-20ad solvent delivery unit , sil-20ac autosampler , dgu-20a5 degasser from shimadzu , md , usa ) using an ultra 120 5 m c18q ( 4.6 mm i d 150 mm ) column ( peeke scientific , ca , usa ) at 1 ml / min . \n the solvent systems used were a ( h2o with 0.1% tfa ) and b ( ch3cn with 0.1% tfa ) . \n a linear gradient of 550% b in 15 min was applied and the detection was at 215 nm . \n the synthesis products were purified by preparative rp - hplc ( shimadzu lc-20 equipped with : cbm-20a system controller , spd-20a detector , cto-20a column oven , 2 lc-6ad solvent delivery unit and frc-10a fraction collector from shimadzu , md , usa ) , using an xbridge prep obd c18 5 m ( 19 mm 150 mm ) column ( waters , ma , usa ) at 10 ml / min . \n the solvent systems used were a ( h2o with 0.1% tfa ) and b ( ch3cn with 0.1% tfa ) . for separation , a linear gradient of 550% b in 45 \n peptides were conjugated to tat47 - 57 ( ygrkkrrqrrr ) carrier peptide through an amide bond and with different spacers , as part of the solid phase peptide synthesis . \n note that tat47 - 57-based delivery of a variety of peptide cargoes into cells has been used now for over 25 years and delivery of the cargo across biological membranes and into subcellular organelles has been confirmed ( begley et al . \n , 2004 , lonn and dowdy , 2015 , rizzuti et al . , 2015 ) . furthermore , \n tat47 - 57 and other cell - penetrating peptides have also successfully been used to deliver cargos into several intracellular parasites ( corradin et al . , 2002 , \n the stability of the peptides was determined by hplc using trypsin , which cleaves peptide bonds after lysine and arginine . \n peptide ( 1 mg / ml , 400 l ) was dissolved in nh4hco3 buffer ( ph 8.0 , 200 mm ) , and was mixed with a trypsin solution ( 1 l , 1 mg / ml in nh4hco3 , ph 8.0 ) ( promega , wi , usa ) . \n the peptide was incubated at 37 c , and samples ( 100 l ) were taken after 20 min , and every hour . \n a solution of 2% tfa and 5% acn in water ( 100 l ) was added , and the samples were analyzed by hplc and ms ( pakkala et al . , 2007 ) . to evaluate the bioactivity of the peptides , logarithmic phase l. donovani promastigote forms ( aah/hgprt/xprt ) \n were seeded in 96-well microtiter plates at 20,000 cells/100 l in dulbecco 's modified eagle 's medium ( dmem , life technologies , ny , usa ) media . \n promastigotes parasites were incubated with or without peptides ( 1 , 5 , 10 , 25 , 50 , 75 and 100 m ) and the culture was incubated for 24 h at 26 c . \n the viability of parasites was assessed by adding 20 l of the vital dye alamar blue ( fisher scientific , ottawa , on ) to each well and cultures were incubated for an additional 24 h at 26 c ; the reduction of alamar blue was determined by measuring fluorescence at an excitation wavelength of 570 nm and an emission wavelength of 590 nm . all assays were performed in duplicate with the observer blinded to the experimental conditions . \n cytotoxicity was expressed as percent survival of control cultures incubated in the absence of peptide . \n cell viability was evaluated in vitro by cultivating l. amazonensis promastigotes ( 5 10 per well ) in m199 medium ( sigma , mo , usa ) , supplemented with 10% heat - inactivated fetal calf serum ( fcs ; invitrogen , ca , usa ) . \n parasites were incubated with or without peptides ( 1 , 5 , 10 , 25 , 50 , 75 and 100 m ) at 25 c for 24 h. quantification of viable cells was assessed either by cell counting or by measuring the cleavage of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide ( mtt ; sigma , mo , usa ) as previously described ( zauli - nascimento et al . , 2010 ) . \n mtt cleavage was assessed in a microplate reader ( polarstar omega , bmg labtech , ortenberg , germany ) with a reference wavelength of 690 nm and a test wavelength of 595 nm . \n cytotoxicity was expressed as percent survival of control cultures incubated in the absence of peptide . \n statistical analysis was assessed by unpaired student 's t - test . a value of p < 0.05 was considered significant . \n to validate the bioactivity of the peptides as anti - parasitic treatment , we used a trypomastigote y strain ( 2 10 ) that was obtained from the 5th or 6th day of infection of cultures of the rhesus monkey kidney epithelial line ( llc - mk2 , atcc , boulevard manassas , va , usa ) ( andrews and colli , 1982 ) . \n the assay was carried out in fresh modified eagle 's medium ( mem , life technologies , ny , usa ) phenol red - free with 2% fetal bovine serum ( fbs , wisent , montreal , qc ) with or without peptides ( 1 , 5 , 10 , 25 , 50 , 75 and 100 m ) for 24 h at 37 c and 5% co2 . parasite viability was measured by a colorimetric assay using 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2h - tetrazolium monosodium salt ( wst-1 ) reagent according to manufacturer 's instructions ( roche , in , usa ) and measured at 450 nm , and expressed as a percentage of control with no treatment . to corroborate the viability assay , \n a value of p < 0.05 was considered significant . to validate the potential bioactivity of the peptides on t. cruzi epimastigote forms , t. \n cruzi epimastigotes were axenically cultured in liver infusion tryptose ( lit ) media , supplemented with 10% fetal bovine serum ( fbs , wisent , montreal , qc ) . \n parasites were pelleted by centrifugation at 200 g for 10 min . \n epimastigotes were counted using a hemocytometer ( hausser scientific , horsham , pa , usa ) and seeded at a density of 1 10 parasites per well in lit media in sterile 96-well flat - bottom plates ( becton dickinson falcon , franklin lakes , nj , usa ) . peptides ( 1 , 5 , 10 , 25 , 50 , 75 and 100 m ) were added to each well . \n plates were incubated at 27 c for 24 h. live parasites were distinguished and counted using trypan blue ( sigma , mo , usa ) . \n percentage of inhibition is expressed as the number of live parasites / total parasites 100 . \n a value of p < 0.05 was considered significant . to evaluate the toxicity of the peptides , \n rhesus monkey kidney epithelial cells ( llc - mk2 , atcc , boulevard manassas , va , usa ) were seeded in 96-well plates at a density of 8,000 cells / well 24 h prior to treatments . \n all cell treatments were carried out in fresh modified eagle 's medium ( mem , life technologies , ny , usa ) medium phenol red - free supplemented with 2% fetal bovine serum ( fbs , wisent , montreal , qc ) . \n the cells received four doses of peptides ( 200 m each ) at time - points of 0 , 4 , 8 and 12 h. after 24 h cell infection was determined by the number of cells and parasites using 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2h - tetrazolium monosodium salt ( wst-1 ) reagent according to manufacturer 's instructions ( roche , in , usa ) measured at 450 nm , and expressed as a percentage of control with no treatment . \n balb / c mice were treated with different peptides ( or control , eight mice per group ) to assess their toxicity . \n all treatments were performed between 9:00 a.m. and 4:00 p.m. by an experimenter blinded to the treatment groups . \n balb / c female mice ( 2326 g , six to eight weeks old ) , were housed in a temperature- and light - controlled room for at least three days before use . \n all animals were randomized and assigned to testing groups to generate biological replicates for each group . \n osmotic pumps ( # 2002 , 0.5 l / h , alzet , ca , usa ) filled with the p4d ( 5 mg / kg / day ) or vehicle were implanted subcutaneously on the back of the mice following anesthesia using a standard surgical procedure as recommended by the manufacturer . \n the study objective tested whether the peptides regulated the level of parasitemia and survival in rodent models . \n balb / c mice were infected with t. cruzi and treated with different peptides ( or controls , five to eight mice per group ) , to assess their effect on t. cruzi infection in vivo . \n based on our experience , a minimum of five rodents per group is required to obtain statistically meaningful data . \n an experimental group size of five or more animals is necessary to achieve at least a 20% minimal difference in parasitemia and survival for a power of 95% with a < 0.05 and b < 20% . \n all treatments were performed between 9:00 a.m. and 4:00 p.m. by an experimenter blinded to the treatment groups . \n balb / c female mice ( 2326 g , six to eight weeks old ) , were housed in a temperature- and light - controlled room for at least three days before use . \n all animals were randomized and assigned to testing groups to generate biological replicates for each group . in the first study , \n balb / c mice ( five mice per group ) were treated with peptides by intraperitoneal ( ip ) injection for 7 consecutive days and after two days ( day 10 ) given an additional injection for a total of 8 injections of p4d ( 1.5 mg / kg / day ) or vehicle . \n one day before peptide treatment started , mice were infected with 500 bloodstream trypomastigotes ( strain h1 of t. cruzi ) via ip injection . in the second study osmotic pumps ( # 2002 , 0.5 l / h , alzet , \n ca , usa ) filled with p4d ( 1.5 mg / kg / day ) or vehicle were implanted subcutaneously on the backs of the mice under anesthesia using a standard surgical procedure as recommended by the manufacturer . \n one day following pump implantation , mice were infected with 500 bloodstream trypomastigotes ( strain h1 of t. cruzi ) via intraperitoneal injection . \n one group of control mice received benznidazole ( bz ) ( sigma , mo , usa , 100 mg / kg / day ) administered orally for 20 days starting on day 1 post - infection . \n parasitemia in the blood was measured every third day in infected mice by microscopic counting using a neubauer chamber , and survival was recorded daily for up to 24 days ( first study ) or 50 days ( second study ) post - infection ( limon - flores et al . , 2010 ) with \n parasite burden was determined by quantitative real - time pcr ( qpcr ) amplification of t. cruzi dna from cardiac biopsies ( quijano - hernandez et al . , \n , dna was purified from cardiac biopsies with qiaamp dna mini kit ( qiagen , limburg , netherland ) following the manufacturer 's instructions . \n a standard curve was generated using mouse dna spiked with known serial dilutions of t. cruzi dna . \n pcr reactions contained 50 ng of mouse dna , 0.5 m primers tcz - f 5-gctcttgcccacamgggtgc-3 and tcz - r 5-ccaagcagcggatagttcagg-3 , and 10 l of express sybr greener qpcr supermix ( invitrogene , ca , usa ) in a final volume of 20 l . reactions were run in triplicate on an eco real - time pcr system ( illumina , ca , usa ) as follows : 50 c for 2 min and 40 cycles of 95 c for 10 s , 55 c for 15 s and 72 c for 5 s. high - resolution melting curves were determined at the end of the amplification . \n the standard curve had a slope of 3.127 , r = 0.9932 and an efficiency of 109% . \n statistical analysis was assessed using the two tailed unpaired student t - test , one - way or two - way measures analysis of variance ( anova ) with post - hoc testing by tukey when appropriate . a value of p < 0.05 was considered significant . \n sample sizes for in culture experiments were estimated based on previous experience of similar assays and the effect size observed in preliminary experiments . \n all samples were identical prior to allocation of treatments and the observer was blinded to the experimental conditions . \n animal care and husbandry procedures were in accordance with established institutional and national institutes of health guidelines . \n the animal protocols were approved by the ethical committee of the universidad autnoma de yucatn , mexico , and by the stanford university institutional animal care and use committee . in the raman spectra , the shape of amide i and amide iii bands were analyzed to determine the secondary structure of the biomolecules . \n the shape of amide iii band was evaluated qualitatively , while the deconvolution of the amide i was performed as follows ( maiti et al . , 2004 ) : 5 lorentzian peaks for -helix ( 1651 cm ) , -sheet ( 1668 cm ) , random coil ( 1683 cm ) , tyrosine peak at 1620 cm and exponential baseline ( represented with a broad lorentzian peak centered at 1500 cm ) . \n raman experiments were performed with ntegra spectra raman spectrophotometer instrument , equipped with a peltier plate - cooled ccd camera in backscattering geometry . \n the illumination source was a 473 nm cobolt blues continuous wave diode - pumped solid state laser brought to the sample by a mitutoyo long working distance objective ( 100 , 0.7 na ) . \n laser power at sample was 2 mw , as measured by coherent lasercheck. samples were measured in dry state . \n spectra from dry samples were acquired in 1 min increments for 10 min total . \n the absence of sample degradation was confirmed by absence of any difference between the 1-min spectra , besides minimal changes in fluorescence baseline signal . \n we hypothesized that short sequences in the scaffold proteins lack and track that are conserved among parasite strains and species , but are not conserved in the mammalian rack , may mediate interactions important to the parasites but not to the mammalian host . \n we focused on lack in leishmania and compared it to rack , the ortholog in mammalian hosts ( fig . 1 ) . \n although lack is similar ( > 75% similar and 48% identical ) to rack , at least eight distinct regions in lack differ substantially ( 57% similarity and 30% identity to rack ; fig . 1a ; these regions are designated as l1 to l8 ) . \n importantly , these eight regions in lack are conserved between different species of leishmania ( supplementary figure 1 ) , suggesting that they may be functionally important for the parasite . \n most of the non - conserved regions between rack and lack are also less conserved between rack and track ( supplementary figure 2 ) and are conserved between different trypanosoma species ( supplementary figure 3 ) . \n we hypothesized that peptides derived from these parasite - unique regions may have anti - parasitic activity without affecting mammalian host signaling . \n we synthesized peptides ( p1-p8 ) derived from regions l1-l8 in lack ( supplementary figure 4 - 5 and table 1 ) and tested them for their bioactivity towards parasites . \n we also covalently linked the peptides to a cell - penetrating peptide ( cpp ) , which allows the peptides to cross cell membranes ( lonn and dowdy , 2015 ) . \n peptides conjugated to cpp have previously been delivered intracellularly to the parasites leishmania and plasmodium ( the parasite causing malaria ) , where they inhibit infections ( corradin et al . , 2002 , \n specifically , we used tat47 - 57 ( ygrkkrrqrrr , supplementary figure 4 ) , which has been shown to deliver macromolecules into cells in cell culture and in animal disease models in vivo , and which has been used in over 25 clinical trials ( lonn and dowdy , 2015 ) . \n treatment of l. donovani promastigotes with peptide p4a ( see supplemental table 1 for sequence information ) reduced the parasite viability in culture by 60% at 48 h ( fig \n 2b , dashed lines ) , and p3 treatment resulted in 50% reduction of parasite viability ( fig . \n 2a ) . none of the other targeted peptides had any effect on l. donovani promastigote viability . \n in addition , treatment with p4a reduced the viability of l. amazonensis promastigotes in culture by 100% after 24 h ( ic50 23 m , fig . 2b , solid lines ) . \n tat peptide alone and p4 , which lacks tat ( supplemental table 1 ) , showed no anti - parasitic activity ( fig . \n 2a b ) , demonstrating that tat is not cytotoxic and that intracellular delivery by tat is required for the anti - parasitic effect of the cargo . \n treatment of t. cruzi trypomastigotes in culture with the lack - derived peptide , p4a , reduced the viability of the parasites by 75% compared with control ( fig . 2a , right panel ; ic50 20 m , fig . \n again , the tat or p4 alone showed no anti - parasitic activity ( fig . \n we tested the effect of the relative positions of the cargo ( p4 ) and the carrier ( tat ) , and the effect of different linkers between the carrier and the cargo on the leishmanicidal ( l. donovani ) and trypanocidal ( t. cruzi epimastigotes ) activity ( fig . \n 3b and supplementary figure 5 show peptide structures ) . when the cargo was linked at the c - terminus of tat by a flexible gg linker ( p4b , supplemental table 1 and fig . \n 3b ) , the anti - parasitic effect was completely lost relative to a peptide with the same linker and the cargo at the n - terminus ( p4a vs. p4b ; fig . \n in contrast , when the cargo was linked at the tat c - terminus using a constrained gamma amino butyric acid ( gaba ; p4c ) linker , the anti - parasitic activity was comparable to that observed in the reverse order using the flexible gg linker ( p4a ; fig . \n conformational constraints such as cyclization usually decrease degradation and increase bioactivity of peptides , as compared with their linear counterparts ( qvit et al . \n , 2008 , qvit and crapster , 2014 , qvit and kornfeld , 2016 ) . \n therefore , we developed two cyclic peptides and tested their activity in the same assay . \n one of the two cyclic peptides , p4d , was more active than the linear peptide , p4a , reducing parasite viability to only 5% as compared with control ( fig . \n the ic50 of p4d was 45 fold lower than the ic50 of p4a ( ic50 6 m and ic50 3 m for l. donovani and t. cruzi epimastigotes , respectively , fig . \n 3c ; vs. ic50 of 20 m for both by p4a , fig . \n importantly , the peptides derived from the l4 region did not affect the viability of naive llc - mk2 , rhesus monkey kidney cells , confirming that the peptides are not toxic to the mammalian host cells ( fig . \n 3d ) . we tested the stability of the peptides to determine if the increased activity of the cyclic peptide is due to its improved resistance to degradation . \n the linear peptide p4a was less stable ( > 55% degradation by trypsin occurred in < 20 min , fig . \n 4a b ) than the cyclic peptide p4d ( < 20% trypsin cleavage in 6 h , fig . \n the increased stability may account for the superior anti - parasitic activity of the cyclic peptide compared to the linear peptide . \n importantly , despite the increased constraint in p4d relative to p4a , analysis of the secondary structure of these peptides using raman spectroscopy showed that their structures were very similar ( supplementary figure 6 ) . \n amide iii regions did not exhibit a pronounced peak , suggesting that the majority of the structure was disordered for all three molecules . \n the p4a and p4d molecules showed a higher percentage of ordered structure , mostly due to an increase in -helix content . in the figure , \n the height of the tyrosine peak is compared to the height of the amide i band ( pairs of horizontal dashed lines ) . \n it can also be seen that the ratio of the intensities of tyr and amide band slightly increases as follows : tat < p4a < p4d , which is due to an increase in the number of amide bonds per molecule . \n this proves that the measured conformations come mostly from the cargo amino acids and not solely the carrier . \n activity relationship ( sar ) studies on the cargo of the cyclic peptide helped determine which amino acids in the peptide are required for bioactivity . \n alanine scanning of the cyclic peptide p4d demonstrated that substitution of any of the amino acids from the n - terminal half ( r , n , g , or q ) with alanine ( a ) only slightly reduced the anti - parasitic activity of the peptide . \n however , substitution of any one of the amino acids in the c - terminal half ( c , q , r or k ) caused a reduction or a complete loss of anti - parasitic activity , indicating that the c - terminal half of the peptide is required for this activity ( fig . \n interestingly , the same c - terminal half is the most highly conserved in the l4 region between lack and track ( fig . \n 5b ) , which may explain why the l4 region - derived peptide ( from lack ) had both leishmanicidal and trypanocidal activity . \n we performed two preliminary studies to evaluate the effect of the peptides in mice infected with t. cruzi . \n balb / c mice ( five females per group ) were infected with trypomastigotes ( t. cruzi ) via intraperitoneal ( ip ) injection , and on the following day we began the peptide treatment . \n mice were treated with 8 ip injections of p4d ( 1.5 mg / kg / day ) or vehicle . \n treatment with p4d reduced the parasitemia by 85% ( day 7 ) and 80% of the mice survive compared to none of the vehicle treated mice ( day 24 ) ( supplementary figure 7 ) . \n next we performed a second study , using eight females per group , and followed the mice for 50 days . \n mice were infected with trypomastigotes ( t. cruzi ) via ip injection and were treated with p4d or vehicle for the first 14 days after infection at 1.5 \n mg / kg / day , using osmotic pumps , which provide slow and sustained delivery of the peptide . in this study , p4d decreased parasitemia by more than 75% ( days 3942 ) ( fig . \n 6b ) , and reduced parasite burden in cardiac tissue by three - fold ( fig . \n osmotic pumps were used to deliver p4d for 28 days at 5 mg / kg / day , a 3.3 fold higher dose than in the anti - parasitic study , above . \n the effect of the prolonged treatment on mice was compared to that of vehicle - treated mice ( eight balb / c females per group ) . \n the peptide did not show any toxic effects ( there was no weight difference , induction of seizures , strange behavioral or metabolic disorders in the p4d relative to vehicle - treated mice ) when the naive uninfected mice were treated with > 3 the dose for twice the duration as the infected mice . in conclusion , in both animal parasite models , p4d reduced the level of parasitemia by > 65% , increased the survival by at least three - fold , and decreased the parasite burden on the peak days . in the second study ( 50 days ) \n 6a ) for a longer duration than the peptide ( 21 days vs. 14 days , respectively ) and with much higher dose ( 100 mg / kg / day vs. 1.5 mg / kg / day , respectively ; moreover since the molecular weight of benznidazole is less than 10% of p4d ( 216.25 \n g / mol vs. 2854.32 g / mol , the mole ratio between benznidazole and p4d is 920:1 ( 0.46 mmol vs. 0.0005 mmol ) ) . in \n these combined data confirm the cell culture data and suggest that further optimization of peptide sequence , formulation , dose , and route of administration should achieve higher efficacy in vivo . \n neglected tropical diseases , endemic in developing regions of the world , are responsible for significant morbidity among low - income populations ( hotez et al . , 2007 ) . \n toxicity occurs because most drugs are relatively non - selective toxins with more generalized mechanisms of action affecting both parasite and host . \n many drugs are directed to the catalytic site of enzymes such as proteases , kinases , and metabolic enzymes ( ( olin - sandoval et al . , 2010 ) ; for review ( qvit and crapster , 2014 , renslo and mckerrow , 2006 ) ) . although there has been some success using this approach for the treatment of chagas ' disease , such as k777 ( an -ketone irreversible cruzipain inhibitor ) ( barr et al . , 2005 ) , these catalytic sites are usually highly conserved between the parasites and mammalian hosts , and therefore it is challenging to specifically target the parasite ( seebeck et al . , \n the other limitation of current treatments relates to drug resistance , which emerges in part because of lack of compliance ( i.e. , early or inconsistent treatment ) may enable development of mutations in the drug target . \n we have described here a simple and fast approach to identify an anti - parasitic peptide that may overcome the limitations of current treatments in the following ways : ( 1 ) our candidate should have less or no toxicity , because it specifically targets protein domains that are unique to the parasite , not the host ; ( 2 ) this approach reduces the probability that resistance will arise because substitution mutations in the parasites are much less likely to occur at evolutionarily conserved sites in proteins ( thomas et al . , 2003 ) . \n we focused our drug discovery efforts on the parasite - specific scaffold proteins , lack and track , which are essential for the survival and infectivity of both leishmania sp . and \n t. cruzi , respectively ( mougneau et al . , 1995 , rothberg et al . , 2006 , choudhury et al . , 2011 ) . \n our rational approach identified an inhibitor which inhibited parasites growth in culture and in vivo without exerting toxic effects . \n we show that peptides corresponding to the l4 region from lack , which is only 20% identical to mammalian rack ( fig . 1 ) , had anti - parasitic activity against both leishmania sp . and t. cruzi in culture and showed anti - trypanosomal activity in vivo . \n two different animal models were used in these latter studies : a short study ( 24 days ) in which the peptide was delivered by ip injection and a longer study ( 50 days ) , in which the peptide was delivered in a sustained fashion , using subcutaneous osmotic pumps . \n osmotic pumps permit continuous administration of short half - life molecules and are gaining widespread use for targeting parasites ( shibata et al . , 2011 ) . in both studies , \n the peptide treatment was for a short time ( only one - third of the study ) and in a low dose ( 1.5 mg / kg / day ) . \n the peptide was conjugated to tat , which is used to deliver large macromolecules and peptides into cells . \n furthermore , it was recently shown that when miltefosine , an oral anti - parasitic drug , was linked to tat , the resulting compound was efficiently internalized into a miltefosine - invulnerable leishmania strain , resulting in fast parasite killing , and successful avoidance of resistance ( de la torre et al . , 2014 ) . therefore , tat is a proven tool to improve drug intake and treatment efficacy in the parasite . \n optimized peptoid delivery using a subcutaneous deposit ( single injection ) or a sustained delivery employing a subcutaneous osmatic pump ( similar to that used for yearly contraceptive delivery in some developing countries ) could ensure effective delivery and compliance to drug treatment in humans , especially in rural areas , and therefore decrease the chance of resistance emerging . \n although the biology of t. cruzi and leishmania is significantly different , it has already been shown that targeting either unique parasite proteins or exclusive domains on scaffold proteins can be a successful approach for the development of anti - parasite agents ; inhibitors targeting several key proteins , such as polyamine biosynthetic enzymes ( heby et al . , 2007 ) , trypanothione reductase ( parveen et al . , 2005 ) , sterol 24-methyltransferase ( magaraci et al . , 2003 ) and \n others , affect both parasites . in support of our finding that peptides derived from the l4 region of rack exhibit both anti - leishmanial and anti - trypanosomal effects , sar studies demonstrated that amino acids found to be critical for the bioactivity were those conserved between lack and track . \n further studies exploring the bioactivity of l4 region - derived peptoids against leishmania amastigotes , as well as targeting t. cruzi with peptides derived from track , are now under evaluation . \n in addition , the cysteine from the l4 region of lack is conserved in most leishmania species as well as between lack and track . however , because it can be susceptible to rapid oxidation , the anti - parasitic activity of substituting the cysteine with serine , methionine , etc , will be valuable . \n moreover , additional considerations should be given to the difference in the biology of each parasite in future optimization studies of this lead peptide , p4d . \n while t. cruzi divides within the cytoplasm , leishmania divides within the phagolysosome , and therefore peptides targeting leishmania need to cross more membranes and act within the acidic environment of the phagolysosome . \n importantly , although peptides that work intracellularly are not traditionally considered to be suitable drugs , this notion is now being challenged in general ( fosgerau and hoffmann , 2015 ) and also for anti - parasite agents ( qvit and crapster , 2014 ) . \n for example , we have used peptide inhibitors of rack in animal models of heart failure ( mochly - rosen et al . , 2012 ) and myocardial infarction ( inagaki et al . , 2003 ) as well as in patients ( bates et al . , 2008 ) . \n although the optimal treatment regimen and dose have not yet been determined , our data suggest that peptoids ( modified peptides ) derived from the l4 region of lack , which will be highly specific and effective , will fulfill the target product profile published by dndi ( http://www.dndi.org/diseases-projects/diseases/chagas/target-product-profile.html and http://www.dndi.org/diseases-projects/diseases/vl/tpp/tpp-vl.html ) , and therefore will be promising candidates as anti - parasitic lead compounds . \n in addition , the possibility to combine the peptide lead compound that we identified with other chemotherapy is a valuable option \n . it may be most effective to try combination with current drugs that have different mechanisms of action , for example benznidazole ; such a combination may reduce the potential for resistance as well as decrease the required quantity of benznidazole , thereby reducing toxicity . \n moreover , topical formulations offer several advantages over systemic delivery , including easier administration , minimizing adverse effects and reducing cost ( garnier and croft , 2002 , moreno et al . , 2014 ) . \n the rational method that we used here to identify an effective drug lead is rapid , does not require high throughput screens or extensive medicinal chemistry efforts , and uses very limited capital . \n we suggest that this approach to generate inhibitors is likely generalizable and can be adapted for the design of other novel drugs .", "role": "user" }, { "content": "parasitic diseases cause 500,000 deaths annually and remain a major challenge for therapeutic development . using a rational design based approach , we developed peptide inhibitors with anti - parasitic activity that were derived from the sequences of parasite scaffold proteins lack ( leishmania 's receptor for activated c - kinase ) and track ( trypanosomareceptor for activated c - kinase ) . \n we hypothesized that sequences in lack and track that are conserved in the parasites , but not in the mammalian ortholog , rack ( receptor for activated c - kinase ) , may be interaction sites for signaling proteins that are critical for the parasites ' viability . \n one of these peptides exhibited leishmanicidal and trypanocidal activity in culture . \n moreover , in infected mice , this peptide was also effective in reducing parasitemia and increasing survival without toxic effects . \n the identified peptide is a promising new anti - parasitic drug lead , as its unique features may limit toxicity and drug - resistance , thus overcoming central limitations of most anti - parasitic drugs .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a previously healthy 4-year - old boy presented to the emergency department with fever and upper respiratory infection symptoms for 5 days . \n over 3 days , the child developed lethargy , dysphagia , sialorrhea , and ataxia and presented to the hospital . upon admission , he was febrile and lethargic , without meningeal signs . \n respiratory , cardiovascular , and abdominal examinations were unremarkable . laboratory evaluation is depicted in table 1 . \n abbreviations : l , lymphocytes ; n , neutrophils ; m , monocytes ; e , eosinophils ; b , basophils ; cmv , cytomegalovirus ; ebv , epstein - barr virus ; hsv , herpes simplex virus ; wbc , white blood cell ; hg , hemoglobin ; pt , prothrombin time ; ptt , partial thromboplastin time ; pcr , polymerase chain reaction ; alt , alanine transaminase ; ast , aspartate aminotransferase ; ig , immunoglobulin . history revealed normal development , unremarkable prenatal , birth , medical , and surgical history . \n he was up - to - date on vaccinations and had 3 siblings in good health . on day 9 of the illness \n , he developed a semicomatose state ( glasgow coma scale = 6/15 ) , quadriplegia , areflexia , and generalized tonic - clonic seizures . \n he was admitted to the pediatric intensive care unit , and his seizures were aborted by midazolam and phenobarbital . \n he required mechanical ventilation , and levetiracetam was added for maintenance . on day 11 of his illness , 1 \n two lumbar punctures showed lymphocytic pleocytosis and high cerebrospinal fluid protein ( table 2 ) , 1 on admission and the other done 1 week afterward . \n polymerase chain reaction ( pcr ) failed to evidence herpes simplex virus 1/2 or other viruses . \n imaging studies were done during the first week of admission , computed tomography ( ct ) scan was normal . \n magnetic resonance imaging , however , showed bilateral multifocal signal intensity of the cerebral cortex and basal ganglia with mild left diffuse meningeal enhancement ( figure 1 ) . \n abbreviations : wbc , white blood cell ; rbc , red blood cell ; csf , cerebrospinal fluid ; l , lymphocytes ; m , monocytes . \n unenhanced fluid - attenuated inversion recovery magnetic resonance imaging of the head ( all panels ) shows multifocal signal hyperintensities of the cerebral cortex ( all panels ) and basal ganglia ( panels a and b ) with mild left diffuse meningeal enhancement ( panel d ) . upon further investigations , \n nerve conduction studies / electromyography confirmed severe motor - axonal neuropathy with predominant lower extremity involvement , particularly the peroneal nerve . \n a repeat eeg showed moderate to severe encephalopathy changes with a slow background and without epileptiform discharges . \n a few days after intravenous immunoglobulin was infused , he improved remarkably and was weaned from the mechanical ventilator . although briefly manifesting aphasia , he was alert to surroundings and regained , and by day 14 , spontaneous movements were seen in the lower limbs . \n discontinuation of all medications except levetiracetam 50 mg / kg / day followed , and the boy was discharged home . \n he exhibited mild lower limb weakness on his last follow - up at the age of 5 years . \n this was a rare case of mycoplasma pneumoniae infection causing both central nervous system and peripheral nervous system disease . \n this patient presented with fever , upper respiratory infection symptoms , and positive mycoplasma serology and then rapidly developed encephalopathy with positive cerebrospinal fluid , magnetic resonance imaging , eeg , and nerve conduction studies findings . in daxboeck s review , \n flu - like or respiratory illness preceded the onset of the neurologic disease in 76% of patients . \n manifestations included meningeal signs , fever , nausea / vomiting , headache , fatigue , lethargy , and convulsions . \n this patient s clinical picture is consistent with findings reported in major studies focused on mycoplasma encephalitis . for the diagnosis of mycoplasma pneumoniae - associated encephalopathy , \n studies have suggested the sufficiency of immunoglobulin m in children . in comparison to adults , in childhood \n an immunoglobulin m study is efficient and shows consistency for titer changes during the acute phase . \n this diagnosis relies on consistent laboratory , clinical , and neuroimaging findings , accompanied by the absence of any features incriminating other etiologies . \n cerebrospinal fluid pcr and intrathecal antibodies testing for mycoplasma pneumoniae were not performed in this case due to the low yield of these studies . \n according to the california encephalitis project , magnetic resonance imaging abnormalities were \n up to 49% , eeg abnormalities were found in 79% of cases , while ct was often normal ( 82% ) . \n cerebrospinal fluid in mycoplasma pneumoniae meningitis or encephalitis usually contains a pleocytosis ( mostly mononuclear ) and elevated protein counts . in this patient , \n cerebrospinal fluid , eeg , and magnetic resonance imaging findings were consistent with those reported in literature . although evidence of antibiotics efficacy is still lacking , the authors started acyclovir , ceftriaxone , clarithromycin , and vancomycin as this patient s neurologic symptoms had emerged . \n antimicrobial agents have been reported to be effective in a few reports , however , they did nt achieve any therapeutic benefit in this case . \n this failure might be explained by insufficient penetration into the blood brain barrier , however , an immunologic etiology of the disease is another very important explanation as the exact etiology of the disease is still uncertain . \n as his condition deteriorated , despite administering antimicrobial agents , a trial of intravenous immunoglobulin ( 1 gram / kg / day for 2 days ) was tried . \n the treatment decision was made based on a presumptive diagnosis of mycoplasma encephalopathy and was based on anecdotal reports . \n brain barrier , but lymphocytic encephalitis may have increased permeability . although this patient has recovered after intravenous immunoglobulin , late effects of the antimicrobial agents \n another interesting issue is that some studies report spontaneous recovery which also can not be excluded . \n therefore , this case report does not give evidence for the proposed immune - mediated pathophysiology for mycoplasma pneumoniae encephalitis but rather demonstrates a significant improvement of symptoms after administering intravenous immunoglobulin . \n although mycoplasma pneumoniae neurologic disease is considered rare , and most cases run a benign course , significant morbidity and fatalities have occurred . \n prospective studies are needed to establish evidence for efficacy and appropriate dosing in intravenous immunoglobulin treatment .", "role": "user" }, { "content": "mycoplasma pneumoniae infection frequently presents as a self - limited process , however , severe cases and even fatalities have been reported . \n the authors present a case of mycoplasma pneumoniae infection associated with both encephalopathy and peripheral neuropathy that responded to intravenous immunoglobulin therapy . to our knowledge , this is the first documented case of mycoplasma pneumoniae related to encephalitis and peripheral axonal neuropathy . to date , there is insufficient data on the effect of intravenous immunoglobulin on the course of mycoplasma - associated central nervous system / peripheral nervous system disease . \n while intravenous immunoglobulin has aided in a variety of autoimmune - mediated disorders , its efficacy in mycoplasma - mediated encephalitis treatment remains unclear . in this patient case , reversal of both central and peripheral nervous system symptoms after treatment with intravenous immunoglobulin suggested a possible therapeutic benefit .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ocular dominance ( od ) plasticity is the preeminent model of experience - dependent plasticity in the mammalian nervous system . \n retinotopically matched inputs from both eyes converge on individual cortical neurons to produce binocular vision . \n the strength and persistence of these connections is highly susceptible to manipulations that asymmetrically degrade the quality of visual experience , such as monocular deprivation ( md , wiesel and hubel , 1963 ) . \n awake recordings in juvenile mice have shown that a brief period of monocular lid suture produces an od shift solely through the loss of responsiveness to the deprived eye ( frenkel and bear , 2004 ) . \n broadly speaking , there are two categories of changes that could account for the observed reduction in deprived - eye responses , which are not mutually exclusive . \n first , excitatory drive into the cortex from the deprived eye could become weakened , thereby decreasing responses driven by the deprived eye . \n second , intracortical inhibition of deprived - eye inputs could increase following md , thereby suppressing or masking visual responses evoked by the deprived eye . \n a large body of classic work in kittens has supported the former idea , demonstrating that md leads to a reduction in cortical innervation by excitatory thalamocortical axons subserving the deprived eye ( shatz and stryker , 1978 ) , which is accompanied physiologically by considerable weakening of deprived - eye inputs ( singer , 1977 ; tsumoto and suda , 1978 ; mitzdorf and singer , 1980 ) . \n the alternative hypothesis , that the od shift observed following md results from altered intracortical inhibition , was originally suggested over 30 years ago , again based on experiments in kittens ( duffy et al . , 1976 ; \n burchfiel and duffy , 1981 ) . local iontophoretic administration of bicuculline , a gabaa receptor antagonist , restores binocularity and deprived - eye responses in cortical neurons following md ( burchfiel and duffy , 1981 ) . \n however , attributing these results to md - induced plasticity of inhibitory networks is difficult , as blockade of gaba receptors in normal cats both broadens receptive field properties and unmasks previously subthreshold responses ( sillito , 1975 ) . \n a similar unmasking was also observed for responses evoked through either the deprived or non - deprived eye in md animals ( sillito et al . , 1981 ) . in recent years \n rodents have emerged as the preferred system for studies of visual cortical plasticity , and questions of the relative contribution of md - induced changes in excitation and inhibition have been readdressed with new approaches . \n several lines of evidence demonstrate that the mechanisms of long - term depression ( ltd ) of excitatory synapses play a central role in the weakening of visual responses ( reviewed in smith et al . , 2009 ) . \n brief md leads to reduced surface expression of ampa - type glutamate receptors and occludes subsequent induction of ltd ( heynen et al . , 2003 ; \n furthermore , molecular manipulations that block ampa receptor endocytosis exclusively in excitatory neurons completely prevent the loss of deprived - eye responses following md ( yoon et al . \n in addition , it has recently been shown that the full od shift in cortical layer 4 is expressed by modifications of excitatory thalamocortical synaptic currents ( khibnik et al . , 2010 ) . \n however , additional work has shown that cortical inhibitory networks can also be strongly affected by md . \n brief periods of deprivation induce potentiation of feedback inhibition involving fast - spiking ( fs ) basket cells in layer 4 of the monocular visual cortex in rats studied ex vivo ( maffei et al . , 2006 ) . \n additionally , two recent studies used calcium imaging in mice in vivo and found md - induced od shifts in both excitatory and inhibitory neurons ( gandhi et al . , 2008 ; kameyama et al . , 2010 ) . \n thus , both the inputs to and outputs from inhibitory neurons can be modified by deprivation . in a recently published report in the journal nature , \n ( 2009 ) take a direct approach to study plasticity of inhibitory interneurons and describe a novel and surprising response of these cells to md . \n the authors used technically demanding in vivo intracellular recordings in anesthetized mice to assay the od of individual cortical neurons . \n this approach enabled them to directly compare od and the consequences of md in pyramidal neurons and fs interneurons . \n in addition , by slowly infusing picrotoxin ( ptx ) into pyramidal neurons , they could examine the contribution of somatic inhibition to od and the expression of od plasticity . \n this approach enabled the investigators to address a number of interesting questions , discussed below . \n the aims and approaches used in the study by yazaki - sugiyama are truly laudable . \n as discussed below , some of their findings are not easily reconciled with other recent results . \n thus , the conclusions reached by yazaki - sugiyama , while interesting and provocative , will require confirmation using additional approaches . \n in pyramidal neurons recorded from control ( non - md ) mice , visually evoked spiking displays a biased response , with greater firing elicited by stimulation of the contralateral eye . \n the degree of contralateral bias observed with intracellular recordings ( roughly 2:1 ) is similar to what has been observed previously using either extracellular single - unit recordings or visually evoked potentials ( gordon and stryker , 1996 ; frenkel and bear , 2004 ) , and matches the relative anatomical density of projection neurons in the lgn ( coleman et al . , 2009 ) . \n interestingly , however , intracellular recordings from fs interneurons , putatively parvalbumin - positive large basket cells , exhibited strongly binocular responses , without bias toward either eye ( yazaki - sugiyama et al . , \n ( a ) schematic summary of od data for fs and pyramidal neurons reported by yazaki - sugiyama et al . \n black arrows indicate od bias under a given condition , ranging from purely contralateral - eye responses to purely ipsilateral - eye responses . \n small gray arrows indicate changes relative to control ( non - md or no ptx conditions ) . \n top row : in non - md mice , fs cells exhibit binocular responses , which first shift toward the deprived eye after 3 days md , then become biased to the open - eye after 14 days md . middle row : pyramidal neurons in non - md mice display contralaterally biased responses , which become binocular following either 3 or 14 days md . \n non - md mice , responses become binocular with intracellular ptx , whereas after 3 days md ptx leads to inversion of od biases . \n ( b ) schematic representation of the relative strengths of excitatory and inhibitory inputs which could potentially produce the observed data . \n numbers represent relative excitatory ( green ) and inhibitory ( red ) synaptic strengths of inputs driven by stimulation of the contralateral or ipsilateral eye . \n number in center of pyramidal neuron is the overall spike bias , and numbers to left and right represent the influences of contralateral and ipsilateral visual stimulation , respectively . \n left panel : in order to produce contralaterally biased responses in neurons receiving binocularly balanced excitation , ipsilaterally dominated inhibitory inputs ( and therefore ipsilaterally dominated inhibitory neurons ) are required . \n right panels : after md excitatory neurons are on average binocular , comprised of two populations showing a modest bias to either eye . \n these overall biases invert in the absence of inhibition , thus excitatory inputs have the opposite od bias from the neuron itself . \n the observed binocularity of fs cells is consistent with prior results from suspected interneurons recorded in awake rabbits ( swadlow , 1988 ) , however these results differ from two recent studies using in vivo calcium imaging in mice , which report strong contralateral biases in genetically labeled inhibitory cells . in gad67-gfp \n knock - in mice , both excitatory and inhibitory neurons display similar od distributions with contralateral biases ( gandhi et al . , 2008 ) . \n similarly , inhibitory cells in vgat - venus transgenic mice , which although more binocular than excitatory neurons , still on average exhibit a strong contralateral bias ( kameyama et al . , 2010 ) . additionally , in parvalbumin - positive interneurons from normally reared rats , visually evoked c - fos induction shows a 2:1 contralateral bias ( mainardi et al . , 2009 ) . \n the basis for the different results reported in these studies and by yazaki - sugiyama et al . remains to be determined . \n although gad67-gfp mice have reduced cortical gaba levels which may impact the normal development of od ( tamamaki et al . , 2003 \n ; hensch , 2005 ) , this is not the case in vgat - venus mice ( kameyama et al . , 2010 ) . \n is that the results of in vivo calcium imaging are misleading because these experiments are restricted to superficial layers of the cortex which contain fewer fs cells . \n however , given that all neurons recorded by yazaki - sugiyama et al . were also located in layer 2/3 , \n this is unlikely to account for the different results . to test the functional consequences of somatic inhibition on od of excitatory neurons , yazaki - sugiyama et al . performed technically challenging recordings from pyramidal neurons in which the gabaa antagonist ptx was slowly infused intracellularly through the recording pipette . \n this technique nominally allows the examination of od in the same neuron both prior to and following intracellular blockade of gabaa receptors , thereby isolating the response to excitatory inputs . in non - md control mice , \n ptx greatly increased the binocularity of visually driven responses ( figure 1 , left column ) . \n notably , binocularity was increased in both neurons with an initial contralateral bias ( the majority of cells ) and those with an initial ipsilateral bias . \n this surprising result suggests that excitation onto pyramidal cells is binocularly balanced , with the maintenance of od biases dependent on asymmetric inhibition . \n this interpretation requires the existence of biased inhibitory networks , which might be expected to include fs cells due to their apparently central role in od ( hensch , 2005 ; katagiri et al . , 2007 ) . \n the finding that fs cells lack such a bias and are in fact strikingly binocular ( yazaki - sugiyama et al . , 2009 ) \n suggests that monocularly biased inhibition relies on other interneuron subtypes and that these subtypes play a greater role in modulating pyramidal cell responses than previously thought . \n although more complex cortical circuits involving disinhibition could play a role in the observed results , such models also require the existence of monocularly biased inhibition . \n the findings are surprising because feed - forward ( excitatory ) projections from the lgn ( targeting layer 4 and deep layer 2/3 in mice ) show an anatomical bias favoring the contralateral eye by approximately a 2:1 ratio , equivalent to the physiological response ratio recorded in layer 4 ( frenkel and bear , 2004 ; coleman et al . , 2009 ) . \n thus , it has been assumed that the contralateral bias of cortical responses simply reflects excitatory innervation density , an idea well supported by recordings from species with anatomically defined od columns , such as the cat and monkey . \n the model of balanced od in excitatory neurons of mouse visual cortex requires new assumptions about how inputs from the two eyes target excitatory and inhibitory neurons , and how these cells interconnect . \n the possibility needs to be considered that the apparent loss of biased responses in pyramidal cells following ptx infusion is caused by saturation of pyramidal cell firing rates , which might clip the dominant contralateral eye response and obscure eye - specific differences in excitatory input . \n previous results have shown elevated spontaneous firing rates using this technique ( nelson et al . , 1994 ) , and there is a trend toward elevated firing rates following ptx in the current study ( though not statistically significant ) . perhaps this concern could be addressed in future studies by varying the contrast of the visual stimulus or by passing hyperpolarizing current into the neuron before and after ptx infusion . \n three days of contralateral eye md produces a shift in the od of visual cortical neurons , away from the previously dominant contralateral eye and toward the ipsilateral non - deprived eye ( gordon and stryker , 1996 ; frenkel and bear , 2004 ) . in measurements of spike bias from pyramidal neurons following md , yazaki - sugiyama et al \n . found a similar loss of contralateral bias , with the average response across neurons having become highly binocular . \n in contrast fs cells , which had binocular responses in control mice , were reported to acquire biased responses and shift toward the deprived ( contralateral ) eye following md ( figure 1 , middle column ) . on the surface \n ( 2008 ) who find that the od of inhibitory neurons in the gad67-gfp mice does not change from baseline after 3 days of md . however , recall that the inhibitory neurons studied by gandhi et al . in non - deprived mice were , like the excitatory neurons , initially biased toward the contralateral eye . thus , both studies are actually in agreement that inhibitory neurons show a contralateral - eye bias after 3 days of md . \n the question is whether this reflects a shift in od , or is rather the maintenance of the baseline , non - deprived state . \n an interesting clue to resolving the difference is the finding by yazaki - sugiyama et al . that spontaneous activity in fs neurons is dramatically ( > 5 ) reduced by md . \n it is possible that the high spontaneous firing rates in non - md animals obscure visually evoked responses and could potentially mask an underlying contralateral - eye bias in the inputs to fs cells . \n a reduction in spontaneous activity with md would then unmask biased responses , leading to a shift in spike output toward the deprived eye . \n if the spontaneous firing rate of fs cells is in fact a critical determinant of their od , then the varying reports of biased responses in interneurons may be due to differences in spontaneous firing rates across mouse lines and experimental preparations . \n the question of the response to brief md in inhibitory cells is complicated by the finding that in vgat - venus transgenic mice , inhibitory neurons lose their initial contralateral bias and become increasingly binocular following 2 days of md ( kameyama et al . , 2010 ) . \n this finding appears to disagree with the results of both yazaki - sugiyama et al . and \n gandhi et al . , who report contralaterally biased responses following brief deprivation . as discussed previously , unlike the gad67-gfp mice studied by gandhi et al . \n , cortical gaba levels are normal in vgat - venus animals , which may partly explain the contrasting results . \n additionally , differences in aesthesia and recording technique ( intracellular electrodes vs. calcium imaging ) may also contribute to the variety of results regarding the response of inhibitory cells to short ( 2- to 3-day ) periods of md . \n used intracellular ptx to block somatic inhibitory inputs and isolate excitatory drive onto pyramidal cells following brief md ( figure 1 , middle column ) . \n infusion of ptx did not change the overall degree of binocularity , suggesting that on a population level , changes in inhibition make a minor contribution to expression of the od shift . \n interestingly , however , ptx infusion produced an inversion of od for each individual neuron : those exhibiting a contralateral bias prior to gabaa blockade became dominated by the ipsilateral eye following intracellular ptx application , and vice versa . \n these results suggest that monocularly biased excitation , which was not observed in non - md control neurons with ptx , emerges following visual deprivation . \n in addition , the conversion of open - eye dominated responses to deprived - eye dominated responses following ptx suggests the presence of inhibitory networks biased to the open - eye after 3 days of md . \n given that open - eye dominated fs cells were not observed after short - term md , these results again require a key role for other inhibitory cell types in shaping od biases . \n ltmd did not produce any further change in od , largely consistent with prior results ( gordon and stryker , 1996 ; frenkel and bear , 2004 ) . \n ltmd led to responses dominated by the ipsilateral non - deprived eye , a reversal of the contralateral bias seen after 3 days md . \n describe a bidirectional response to md in fs cells : initially binocular neurons acquire contralateral ( deprived ) eye bias during the early phases of md , which reverses to ipsilateral ( non - deprived ) eye bias with longer periods of deprivation ( figure 1 , top row ) . \n a strong od shift away from the deprived eye in fs neurons following prolonged md is consistent with the observations of gandhi et al . in the gad67-gfp mice ( gandhi et al . , 2008 ) . \n in contrast , parvalbumin - positive cells failed to exhibit a shift in od following 120 days of md when assayed via visually evoked c - fos in rats ( mainardi et al . , 2009 ) . \n these discrepant findings may be the result of varying plasticity among interneuron subtypes or species - specific mechanisms . to investigate a possible mechanism behind the bidirectional response to md in fs cells , the authors present modeling data showing that a spike - timing - dependent plasticity ( stdp ) rule applied to excitatory inputs onto inhibitory neurons , if properly constructed , predicts a bidirectional od shift in accordance with the observed data . \n however , it is not clear whether this stdp rule has a physiological basis in layer 2/3 fs cells in mouse visual cortex . \n show that the stdp rule is by itself insufficient to account for the eventual loss of deprived - eye responses and reversal of spike bias observed with prolonged md because the rule favors elimination of active synapses over inactive ones . to compensate \n second , the shape of the stdp rule used in the model is based on recordings from rat somatosensory cortex and includes regions in which synaptic weights are potentiated , which were not observed in the experimental data ( lu et al . , 2007 ) . \n these caveats aside , the modeling exercise shows that the observed changes are feasible using mechanisms of long - term potentiation and ltd of excitatory connections onto inhibitory neurons . \n the most robust and unexpected finding by yazaki - sugiyama et al . is the apparent reversal of spike bias ( od ) when ptx is allowed to diffuse into pyramidal neurons following md in juvenile animals ( figure 1 ) . \n interestingly , this same effect was not observed when adult ( p60 ) neurons were infused with ptx . \n together , these findings imply that the effect of inhibition on expression of od is developmentally transient \n . early work in mice suggested that md also fails to shift od when it is initiated after about 5 weeks of age ( gordon and stryker , 1996 ) , consistent with the well established concept of a critical period for visual cortical plasticity . \n however there is now broad agreement from multiple labs utilizing multiple methods of analysis that adult ( p60 ) md produces a robust od shift in mouse visual cortex ( sawtell et al . , 2003 ; lickey et al . , 2004 ; \n pham et al . , 2004 ; tagawa et al . , 2005 ; frenkel et al . , 2006 ; hofer et al . , 2006 , 2009 ; fischer et al . \n , 2007 ; sato and stryker , 2008 ; kameyama et al . , 2010 ) . \n indeed , yazaki - sugiyama et al . also show that spike bias is shifted in adults after md . in non - md mice , neurons with ipsilaterally dominated responses were not observed , whereas md progressively increased the percentage of cells dominated by the non - deprived eye such that after ltmd , 50% of neurons exhibited an apparent od shift and were now dominated by the non - deprived ipsilateral eye ( figure 2 ) . \n summary histograms based on spike biases reported by yazaki - sugiyama et al . in adult mice . in non - md control animals , \n three days md leads to an apparent od shift , with some neurons now dominated by the ipsilateral non - deprived eye . following 14 days md , over 50% of neurons \n these data support previous findings that mice lack a critical period and exhibit robust od plasticity into adulthood . \n it is therefore puzzling that the authors appear to argue that the observed absence of changes in spike bias following ptx infusion in adults is evidence that inhibitory network changes are critical to od plasticity . \n the repeated finding that od plasticity is in fact induced by adult md suggests instead the opposite conclusion : reorganization of inhibitory function is not a necessary component of od shifts . \n a novel aspect of the study by yazaki - sugiyama et al . is the use of intracellular ptx infusion through sharp microelectrodes to block gabaa receptor conductances . to demonstrate the efficacy of intracellular ptx \n , the authors examined miniature inhibitory postsynaptic currents ( mipscs ) in slices of visual cortex using whole - cell patch recordings with internal solution containing ptx . \n while whole cell recordings make possible the resolution of mipscs using voltage clamp , they differ from sharp electrode recordings quite dramatically when it comes to the rate and extent of intracellular dialysis . demonstrating the time - course for the elimination of ipsps evoked through electrical stimulation or gaba iontophoresis by ptx delivered through sharp electrodes in slice would have better validated this approach in vivo . \n a related concern is that the use of a cesium acetate based internal solution in the ptx experiments as opposed to a potassium acetate solution for other experiments in which ptx was not applied . \n cesium is a well - known blocker of a variety of potassium channels , and as such will have effects on dendritic cable properties , membrane potential , and spike output , in addition to eliminating the effects of gabab receptors . \n this may account for the apparent low value of contralateral bias in non - md animals prior to ptx infusion ( average bias approximately 0.13 ) when compared to the average bias reported from experiments using potassium acetate filled electrodes ( average bias approximately 0.3 ) . \n lastly , it must be noted that the use of barbiturate anesthesia by yazaki - sugiyama et al . could potentially confound the results by binding gabaa receptors and accentuating inhibition within the cortex . \n previous work has shown that administration of barbiturates can in some circumstances alter od ( pham et al . , 2004 ) . \n in contrast , the in vivo calcium imaging studies discussed here used isoflurane ( gandhi et al . , \n 2008 ) or urethane ( kameyama et al . , 2010 ) , whereas anesthetic was absent during c - fos induction experiments ( mainardi et al . , 2009 ) . the choice of anesthetic used while measuring od may therefore contribute in part to the contrasting reports of od plasticity in inhibitory cells \n there is considerable evidence linking the developmental regulation of cortical plasticity to the maturation of inhibition , however the contribution of inhibitory neurons to od plasticity has been more difficult to determine . \n the recent studies discussed in this review have clearly demonstrated that inhibition is affected by md and may play a role in shaping the physiological response to sensory deprivation . \n however , the relative significance of inhibitory plasticity in maintaining an od shift after md remains uncertain , particularly in light of the recent finding that expression of an od shift can be accounted for solely through changes in the strength of excitatory thalamocortical transmission ( khibnik et al . , 2010 ) . \n provide novel insights into the effects of md on inhibition and raise several interesting questions about the role of inhibitory neurons in od that need to be addressed with future experiments . \n the initial binocularity of fs neurons and their paradoxical shift toward the deprived eye have not been observed previously ( e.g. , gandhi et al . , 2008 ; \n recent advances in extracellular recording techniques facilitate the distinction between excitatory and inhibitory neurons in mice ( niell and stryker , 2008 ) . applying this approach to od plasticity would allow both confirmation of the paradoxical shift in fs neurons and the extension of these results to deeper cortical layers . \n additionally , a recently generated parvalbumin - cre mouse ( hippenmeyer et al . , 2005 ) can be used to genetically label parvalbumin - positive neurons for in vivo calcium imaging experiments , thereby restricting analysis to a particular class of inhibitory cells while avoiding the confound of reduced gaba levels in gad67-gfp knock - in mice ( tamamaki et al . , 2003 ; gandhi et al . , 2008 ) . \n similar experiments examining od plasticity in other classes of genetically identified interneurons could determine the source of monocularly biased inhibition required to explain the loss of pyramidal cell bias following delivery of ptx . \n lastly , the discovery of genetic means to transiently silence populations of neurons ( e.g. , allatostatin receptors or halorhodopsin ; lechner et al . , 2002 ; zhang et al . , 2007 ) combined with advanced recording techniques ( niell and stryker , 2008 ) suggests that it is ultimately possible to determine the contribution of inhibitory inputs from specified cell types to the response properties of both excitatory and inhibitory neurons across cortical layers . \n applying occam 's razor the notion that the simplest solution is usually the correct one to the problem of od plasticity has always suggested that the initial contralateral bias and its subsequent loss after md could both be well explained by the relative strength and plasticity of eye - specific excitatory inputs to visual cortex . \n suggest the possibility that the maintenance and modification of od in visual cortex may be far more complex than assumed previously . \n although there is no reason to discard the well - supported and simple model of od plasticity via modifications of thalamocortical input , these and other recent studies suggest ways it might be amended in the future to include inhibitory influences . \n the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "monocular visual deprivation ( md ) produces profound changes in the ocular dominance ( od ) of neurons in the visual cortex . \n md shifts visually evoked responses away from the deprived eye and toward domination by the open - eye . over 30 years ago \n , two different theories were proposed to account for these changes : either through effects on excitatory visual drive , thereby shifting the balance of excitation in favor of the open - eye , or through effects on intracortical inhibition , thereby suppressing responses from the deprived eye . in the intervening years \n , a scientific consensus emerged that the major functional effects of md result from plasticity at excitatory connections in the visual cortex . \n a recent study by yazaki - sugiyama et al . \n ( 2009 ) in mouse visual cortex appears to re - open the debate . \n here we take a critical look at these intriguing new data in the context of other recent findings in rodent visual cortex .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: at present , hepatitis b virus ( hbv ) infection remains one of the major global public health problems . over \n one - third of the world s population ( about 2 billion people ) has been infected with hbv at some time in their life , and about 350 million of those remain infected . \n the distribution of hbv throughout the world shows that , unfortunately , china is an area where hbv infection is highly prevalent . according to a 2008 nationwide survey of china by the ministry of health ( moh ) \n , there were approximately 93 million chronic hbv carriers . to reduce morbidity and mortality from chronic hbv infection , \n current antiviral agents for the treatment of chb include interferon ( ifn ) and nucleoside analogues . as a kind of immunomodulator , \n ifn has been used since the early 1980s in attempts to suppress hbv replication . although treatment with ifn may lead to a durable response , its unpleasant adverse effects ( flu - like symptoms , fatigue , leucopoenia , hair loss , anorexia , etc . ) , and high cost limited its use . \n nucleoside analogues such as lamivudine ( lmv ) , adefovir , entecavir and telbivudine then became the most common drugs used for antiviral therapy . \n these chemically synthesized drugs can imitate natural nucleosides , and are integrated into newly synthesized hbv dna , causing chain termination or competitively inhibiting the reverse transcriptase ( rt ) activity of the viral polymerase to restraint viral replication . \n lmv is the first safe oral nucleoside analogue approved for the treatment of hbv by the fda ( december 1998 ) , and it has become the clinical drug of first choice because it is effective and well - tolerated , although it requires long - term therapy . \n however , long - term treatment may induce mutations . through the sequencing analysis of the hbv gene , a series of mutations associated with lmv at diverse positions in the rt domain \n have been identified , located in codon positions 180 , 204 , 173 [ 1315 ] , 213 and 207 , and others . \n the existence of those mutations may not only cause distinct virological responses in patients , but also cause drug resistance and eventually lead to treatment failure . \n the development of different drug resistance mutations was influenced by the characteristics of patients and the hbv itself . \n however , there have been few investigations on whether different hbv genotypes may affect the incidence of lmv resistance mutations . \n the aim of the present study was to investigate chb patients in southern china to determine the prevalence characteristics of hbv genotypes and lmv resistance mutations , the association of hbv genotypes / lmv resistance mutations with the age / sex characteristics of those patients , as well as the relationship between hbv genotypes and lmv resistance mutations . \n this study was approved by the ethics committee of west china hospital , sichuan university , and written informed consent was obtained from all participants . between august 2009 and july 2010 , \n 185 consecutive patients with chb were recruited from the hepatitis clinic of west china hospital of sichuan university . \n the patients were positive for hepatitis b surface antigen ( hbs ag ) , had hbv viral loads 3 log copies / ml , and did not have other infectious diseases such as human immunodeficiency virus , hepatitis c or hepatitis d. blood samples ( 510 ml ) were collected from all patients , using disposable syringes under aseptic conditions . \n sera were separated and stored in a freezer at 20c until the time of use . \n hbv dna was extracted from 200 l of serum using chelex 100 ( ke hua bio - engineering co. ltd . , \n hbsag was detected by enzyme - linked immunosorbent assay . to measure the quantity of hbv dna , the light cycler 480 system for real - time pcr ( roche diagnostics , shanghai , china ) \n the amplification conditions of pcr consisted of 42c for 5 min and 94c for 5 min , 40 cycles of 94c for 7 sec , and 60c for 50 sec , followed by a final primer extension at 72c for 5 min . \n sequencing was performed using an abi 3130 genetic analyzer ( applied biosystems , foster city , ca , usa ) . \n mutations were detected by using the hepatitis b virus drug resistance mutations and genotypes detection kit ( yuan qi bio - medicine co. ltd . , \n the hbv genotypes were determined by using a web - based genotyping tool for viral sequences from the national center for biotechnology information ( ncbi ) . \n the nucleotide sequences were compared with those of the hbv genotypes at ncbi ( nucleotide locus af286594 ) . \n data were analyzed using tests for categorical variables and t tests for continuous variables when appropriate . \n values were expressed as mean sd for normally distributed variables , and median for non - normally distributed variables . \n the effects of age , sex and hbv genotypes on lmv mutations were estimated as odds ratios ( ors ) and 95% confidence intervals ( 95% ci ) using binary logistic regression . \n all statistical analysis was performed using the statistical package for the social sciences ( spss 17.0 for windows ; spss inc , chicago , il , usa ) . \n this study was approved by the ethics committee of west china hospital , sichuan university , and written informed consent was obtained from all participants . between august 2009 and july 2010 , \n 185 consecutive patients with chb were recruited from the hepatitis clinic of west china hospital of sichuan university . \n the patients were positive for hepatitis b surface antigen ( hbs ag ) , had hbv viral loads 3 log copies / ml , and did not have other infectious diseases such as human immunodeficiency virus , hepatitis c or hepatitis d. \n blood samples ( 510 ml ) were collected from all patients , using disposable syringes under aseptic conditions . \n sera were separated and stored in a freezer at 20c until the time of use . \n hbv dna was extracted from 200 l of serum using chelex 100 ( ke hua bio - engineering co. ltd . , \n hbsag was detected by enzyme - linked immunosorbent assay . to measure the quantity of hbv dna , the light cycler 480 system for real - time pcr ( roche diagnostics , shanghai , china ) \n the amplification conditions of pcr consisted of 42c for 5 min and 94c for 5 min , 40 cycles of 94c for 7 sec , and 60c for 50 sec , followed by a final primer extension at 72c for 5 min . \n sequencing was performed using an abi 3130 genetic analyzer ( applied biosystems , foster city , ca , usa ) . \n mutations were detected by using the hepatitis b virus drug resistance mutations and genotypes detection kit ( yuan qi bio - medicine co. ltd . , \n the hbv genotypes were determined by using a web - based genotyping tool for viral sequences from the national center for biotechnology information ( ncbi ) . \n the nucleotide sequences were compared with those of the hbv genotypes at ncbi ( nucleotide locus af286594 ) . \n data were analyzed using tests for categorical variables and t tests for continuous variables when appropriate . \n values were expressed as mean sd for normally distributed variables , and median for non - normally distributed variables . \n the effects of age , sex and hbv genotypes on lmv mutations were estimated as odds ratios ( ors ) and 95% confidence intervals ( 95% ci ) using binary logistic regression . \n all statistical analysis was performed using the statistical package for the social sciences ( spss 17.0 for windows ; spss inc , chicago , il , usa ) . a p value of less than 0.05 was considered statistically significant . \n all 185 samples were successfully sequenced . in total , 91 ( 49.19% ) of these lmv resistance substitutions ( lmv resistance mutations group ) , 88 ( 47.57% ) were had no drug resistance mutations ( without mutations group ) , the remaining 6 ( 3.24% ) patients mutations were irrelevant to lmv . \n six lmv - related mutation sites were detected : rt204 , rt180 , rt207 , rt173 , rt213 , and rt181 . \n the vast majority of patients ( 78/91 , 85.71% ) had the mutations at site rt204 , and a compensatory mutation at position rt180 was detected in 35 ( 35/78 , 44.87% ) of these patients . \n rt180 mutation always existed along with abnormal rt204 ( 35/36 , 97.22% ) , and only 1 was accompanied with rt181 . \n it is obvious that the pattern of rtm204i alone was dominantly observed ( 36.26% ) , followed by rtm204v + rtl180 m ( 23.08% ) , while other mutation patterns were rare . \n age and sex characteristics between lmv - resistant patients and patients without any mutations are shown in table 2 . \n no significant difference was observed between the 2 groups ( age : t=0.434 , p>0.05 ; sex : =3.07 , p>0.05 ) . \n figure 1 shows the distribution and frequency of age between the 2 groups . there was no significant difference between 2 groups with various age ranges in both females and males . \n for the 91 lmv - resistant individuals , the isolates of genotypes b and c were 57 ( 62.64% ) and 34 ( 37.36% ) , respectively . \n table 2 shows the incidence rates of lmv resistance were not significantly different between hbv genotypes b and c ( =0.02 , p>0.05 ) . \n regression analysis showed that patient age , sex and hbv genotypes did not have significant effects on lmv mutation ( or : 1.01 , 95% ci : 0.981.04 , p=0.64 ; or : 0.51 , 95% ci : 0.241.08 , p=0.08 ; or : 0.91 , 95% ci : 0.491.68 , p=0.76 ) . \n the age and sex distribution of the 115 patients with genotype b hbv were 35.4610.73 years and the males / females ratio was 89/26 , similar to those of the 70 patients with genotype c , which were ( 34.949.48 ) years and a male / female ratio of 58/12 ( comparing mean age : t=0.332 , p>0.05 ; sex : =0.80 , p>0.05 ) . \n in the 91 patients with lmv resistance mutations , the mean age and sex ratio of patients infected with hbv genotype b were similar to those of patients infected with hbv genotype c. ( mean age : t=0.317 , p>0.05 ; sex : =1.67 , p>0.05 ) ( table 3 ) . \n the genotype distributions and frequencies of patients with various mutation patterns were counted , calculated and summarized in table 4 . \n rtm204i mutation in genotype b ( 45.61% ) was more frequent than that in genotype c ( 20.59% ) ( =5.77 , p<0.05 ) ; however , the incidence rates of other mutation patterns were not significantly different between genotypes b and c. \n all 185 samples were successfully sequenced . in total , 91 ( 49.19% ) of these lmv resistance substitutions ( lmv resistance mutations group ) , 88 ( 47.57% ) were had no drug resistance mutations ( without mutations group ) , the remaining 6 ( 3.24% ) patients mutations were irrelevant to lmv . \n six lmv - related mutation sites were detected : rt204 , rt180 , rt207 , rt173 , rt213 , and rt181 . \n the vast majority of patients ( 78/91 , 85.71% ) had the mutations at site rt204 , and a compensatory mutation at position rt180 was detected in 35 ( 35/78 , 44.87% ) of these patients . \n rt180 mutation always existed along with abnormal rt204 ( 35/36 , 97.22% ) , and only 1 was accompanied with rt181 . \n it is obvious that the pattern of rtm204i alone was dominantly observed ( 36.26% ) , followed by rtm204v + rtl180 m ( 23.08% ) , while other mutation patterns were rare . \n age and sex characteristics between lmv - resistant patients and patients without any mutations are shown in table 2 . \n no significant difference was observed between the 2 groups ( age : t=0.434 , p>0.05 ; sex : =3.07 , p>0.05 ) . \n there was no significant difference between 2 groups with various age ranges in both females and males . \n only 2 genotypes were identified in 185 patients b ( 115 , 62.16% ) and c ( 70 , 37.84% ) . \n for the 91 lmv - resistant individuals , the isolates of genotypes b and c were 57 ( 62.64% ) and 34 ( 37.36% ) , respectively . \n table 2 shows the incidence rates of lmv resistance were not significantly different between hbv genotypes b and c ( =0.02 , p>0.05 ) . \n regression analysis showed that patient age , sex and hbv genotypes did not have significant effects on lmv mutation ( or : 1.01 , 95% ci : 0.981.04 , p=0.64 ; or : 0.51 , 95% ci : 0.241.08 , p=0.08 ; or : 0.91 , 95% ci : 0.491.68 , p=0.76 ) . \n the age and sex distribution of the 115 patients with genotype b hbv were 35.4610.73 years and the males / females ratio was 89/26 , similar to those of the 70 patients with genotype c , which were ( 34.949.48 ) years and a male / female ratio of 58/12 ( comparing mean age : t=0.332 , p>0.05 ; sex : =0.80 , p>0.05 ) . in the 91 patients with lmv resistance mutations , the mean age and sex ratio of patients infected with hbv \n genotype b were similar to those of patients infected with hbv genotype c. ( mean age : t=0.317 , p>0.05 ; sex : =1.67 , p>0.05 ) ( table 3 ) . \n the genotype distributions and frequencies of patients with various mutation patterns were counted , calculated and summarized in table 4 . \n rtm204i mutation in genotype b ( 45.61% ) was more frequent than that in genotype c ( 20.59% ) ( =5.77 , p<0.05 ) ; however , the incidence rates of other mutation patterns were not significantly different between genotypes b and c. \n lmv , the major oral nucleoside analogue , was approved for the treatment of chronic hepatitis b in china in 1999 . \n however , it has the highest resistance rate in patients receiving long - term therapy . \n about 20% of patients taking lmv for 1 year develop resistance , and the resistance rate is 70% for patients who take lmv for 5 years . \n this study showed that the incidence rate of lmv resistance in southern china reached 49.19% , which was much higher than that of other nucleoside analogues ( 3.24% ) . to date , 8 genotypes ( a to h ) of hbv have been identified world - wide . \n it was previously reported that genotype c is predominant in the regions north of the yangtze river , while genotype b is more frequent in southern china , and genotypes e , f , g and h were not found in any of the patients studied . in this study we found genotypes b ( 62.16% ) and c ( 37.84% ) in 185 chb patients from sichuan province , which is considered to be part of southern china . \n studies have reported that in lmv treatment of chb , resistance primarily took place in hbv with genotypes b and c , whereas no difference in rates of resistance has been observed between the 2 genotypes . \n our results are consistent with these studies , indicating that there is nt a significant difference in the incidence of lmv resistance between genotypes b and genotype c. it was reported that in china chb patients with genotype b were younger in age and more likely to be males , compared to those of genotype c ( 31.412.3 vs. 33.312.2 , p=0.01 ; 16.9% vs. 22.4% , p=0.03 , for genotypes b and c , respectively ) . \n the mean age of lmv - resistant patients infected with hbv of genotype c ( 39.111.4 years old ) were significantly older than that of genotype b ( 33.79.7 years old ) ( t=6.55 , p<0.01 ) . \n however , in our study the mean ages of lmv - resistant patients were not significantly different between genotypes b and c. this discrepancy may be caused by the different sampling in our study , as we chose mainly southern chinese and the sample size of our study is relatively small . \n thus , further investigation is needed to shed light on the age and sex tendency in genotypes b and genotype c. as the reverse transcriptase lacks a proofreading function , hbv has a high mutation rate . \n our results show that lmv resistance may be highly related to mutations at site rt204 of the ymdd motif . and \n another mutation position , rt180 , which is also located in the ymdd motif and next to rt204 , always compensates for the mutation at rt204 . \n these findings agree with the hypothesis that the most frequent mutations are rtl180 m and rtm204i / v [ 2326 ] . \n otherwise , amino acid change at position rt181 in the rt domain could induce cross - resistance to lamivudine and adefovir , and rt173 , rt207 and rt213 sites were known as the common compensatory mutations to confer reduction in susceptibility to lamivudine . according to a previous study , about one - third of chb patients had rt204 mutation . \n the frequency of rt204 mutation in our study was 42.16% ( 78/185 ) ; 96.30% of the patients with rtm204v also had rtl180 m , while 93.48% of the patients with rtm204i did not . \n this verifies that the rtm204v mutations are always accompanied by rtl180 m , while rtm204i mutations are not . \n the pattern of rtm204i alone was predominantly observed ( 36.26% ) , followed by rtm204v + rtl180 m ( 23.08% ) . \n the rtm204i alone mutation in genotype b ( 45.61% ) was significantly more frequent than that in genotype c ( 20.59% ) ( =5.77 , p<0.05 ) . \n xu lj et al . reported the incidence rate of rta181v / t mutation in genotype c was significantly higher than that in genotype b. we also identified this mutation ; however , the frequencies are basically the same as in genotypes b and c. the clinical significance of this mutation requires further investigation . other mutations and mixed combinations were also observed ( rtm204i+rtv207m / l , rtm204i+rtv173l , rtm204i+rts213 t , rtm204v+rtl180m+rtv173l / m , rtm204v+rtl180m+rtv207 m , rtm204i / v+rtl180m+rts213 t ) , but with the relatively small sample size in this study , it would be inappropriate to draw strong conclusions on the distributions of those genotypes in southern china . \n we intend to expand the sample size to improve this part of the data in future research . \n our study concludes that lmv has very high resistance incidence , and hbv with genotypes b and c are the main prevalent strains among chb patients in southern china . \n there was no significant difference between genotype b and genotype c in the incidence of lmv resistance . \n the rtm204i pattern in lmv - resistant patients infected with genotype b hbv is much more common than that in patients infected with genotype c hbv . considering the general prevalence of lmv resistance in southern china , testing before treatment is a rational practice for optimal therapeutic decision - making .", "role": "user" }, { "content": "summarybackgroundlamivudine ( lmv ) , as the preferred oral drug for use in treatment of hbv , always results in development of resistance mutations after long - term treatment . in this study we investigated chronic hepatitis b ( chb ) patients in southern china to determine whether different hbv genotypes affect the incidence of lmv resistance mutations.material/methodsthe study recruited 185 chb patients living in southern china . \n enzyme - linked immunosorbent assay was used to test for hbv serological markers , and hbv dna was quantified by real - time pcr . \n sequencing was performed to detect hbv genotypes and mutations.resultsthere were 49.19% ( 91/185 ) chb patients with hbv resistant to lmv . \n only 2 genotypes were found : b and c ; 62.16% ( 115/185 ) of patients were infected with genotype b hbv and 37.84% ( 70/185 ) of patients were infected with genotype c hbv . \n the incidence rate of lmv resistance was not significantly different between genotype b and c ( 49.57% vs. 48.57% , p>0.05 ) . \n for the mean age and sex ratio , no significant difference was found . \n the pattern of rtm204i alone was predominantly observed ( 36.26% , 33/91 ) , followed by rtm204v+rtl180 m ( 23.08% , 21/91 ) . \n the overall incidence rate of rtm204i mutation in genotype b ( 45.61% , 26/57 ) was more frequent than that in genotype c ( 20.59% , 7/34 ) ( 45.61% vs. 20.59% , p<0.05 ) , but the incidence rate of other mutation patterns was not significantly different between genotypes b and c.conclusionsour results emphasize that a lmv resistance test before treatment is of great importance in rational and optimal chb therapy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 40-year - old male patient came with the complaint of pain and swelling in the anterior vestibular region for the past 2 weeks . \n history revealed recurrent episodes of pain and swelling and spontaneous remission following nasal discharge . on examination , \n the patient had a well - defined , fluctuant swelling obliterating the labial vestibule from 12 to 22 . \n the swelling also extended in the midpalatal region between two central incisors posteriorly up to the premolar level [ figure 1 ] . \n the central incisor exhibited mild grade 1 mobility buccopalatally without any movement in the corono - apical region . \n patient had poor oral hygiene and inflamed gingiva with 5 mm of gingival pocket in both central incisors . \n the periapical radiograph showed large triangular - shaped radiolucent lesion measuring about 2 cm diameter was present between the two maxillary central incisors [ figure 3 ] . \n the lesion had a thin radio - opaque margin with displacement of both the roots in a distal direction [ figure 4 ] . \n mild root resorption was observed in 21 root and the lesions also involved the periapical region of the two lateral incisors . \n the central incisors had bone only on the cervical region , and the remaining portion was completely in the radiolucent lesion . \n occlusal view radiograph revealed an oval radiolucent lesion from the central incisor to the 2 premolar region in the midpalatal region measuring about 3 cm 2 cm lesion . due to the proximity of the lesion to the nasal floor , \n cone - beam computed tomography ( cbct ) scan was taken to plan for the surgical procedure which clearly showed the complete breach of both the nasal floor and hard palate with hollowing in the anterior maxillary region [ figure 5 ] . \n based on the clinical and radiographic findings , provisional diagnosis of nasopalatine duct cyst was made . \n preoperative intraoral swelling preoperative ( a ) intraoral periapical radiograph , ( b ) occlusal radiographs orthopantamograph showing distal displacement roots of upper central incisors ( a and b ) cone beam computed tomography images of the lesion showing complete anterior palatine bone loss the patient was advised about the nature and severity of the lesion , and the complete bone loss of anterior palatine bone was explained . \n the significance of surgical enucleation of the lesion was explained to the patient and also advised for bone graft placement . \n the patient gave consent for the cyst enucleation but was not willing for bone grafting procedure . before the surgery \n , root canal treatment of the involved teeth was done , and complete scaling was done to improve the oral hygiene . before surgery , all preliminary investigations were done , and the results were within normal limit . due to the mild mobility of the central incisors , splinting of the teeth with arch bar \n the possibility of tooth avulsion or extractions of incisors were explained to the patient , and informed consent was obtained . as the cystic wall was found attached to the nasal mucosa and palatal mucosa , both labial and palatal approach \n were used [ figure 6 ] . the cyst was carefully dissected and enucleated , without breaching the nasal mucous membrane or the palatal mucosa . \n intraoperatively , the cyst was found to be a capsuled lesion which was adherent in the nasopalatine region of palatal mucosa but was not attached to the root or periodontal ligament . \n the flap was closed , and palatal acrylic plate was placed to support the palatal mucosa . \n histopathologically , it was found to have fibrous capsule with stratified squamous epithelial lining , and final diagnosis of nasopalatine duct cyst was confirmed [ figure 7 ] . \n intraoperative picture showing attachment of the cystic wall with ( a ) nasal mucosa , ( b ) palatal mucosa histopathological picture showing stratified squamous epithelium ( h and e , original magnification , 10 ) \n nasopalatine duct canal develops as a right and left side canal but generally fuses into single canal . \n however , three anatomical variations have been reported ; wherein , it sometimes appears as two parallel canals or single canal or a y - shaped canal . depending on the anatomical structure , the nasopalatine cyst appears as a midline cyst or paramedian cyst when it involves one side of the canal only . however , midline nasopalatine duct cyst is more common than the other types ( stafne 1969 ) . \n it has been postulated that localized trauma such as previous endodontic treatment , implant placement or infection or mucous retention may initiate the cellular proliferation and may give rise to nasopalatine duct cyst . \n it is not been associated with any habits such as smoking or alcoholism . in our study \n the cyst arises from the epithelial lining of nasopalatine duct or from the vomer nasal organ of jacobson or mucous glands present in the nasal mucosa . \n the epithelium close to the nasal floor has ciliated columnar epithelium , and the one closer to the oral cavity has squamous epithelium and the one in the middle has cuboidal epithelium . \n hence , the nasopalatine cyst also exhibits the mixed nature of the epithelial lining . in our case , \n it appears as either asymptomatic which is recognized on routine imaging or may present with pain or swelling or with other symptoms such as burning sensation , tooth displacement , nasal obstruction , or discharge into the nasal cavity or oral cavity . \n the size of the swelling is variable in size but most often it is < 2 cm in diameter . \n however , occasional cases of large and aggressive lesion up to 52 mm have been reported with complete destruction of labial and palatal bony plates . \n when the nasopalatine duct cyst present at higher level , there is not much effect over the tooth . \n the nasopalatine duct cyst when it is present at lower level always displaces the tooth and often considered characteristic of the lesion . \n however , it has been reported in association with nonvital tooth and periodontally compromised tooth . in our case , both the incisors were nonvital , and the patient had chronic periodontitis with poor oral hygiene . \n root resorption is uncommon ; however , shear and speight have reported cases with root resorption . \n radiographically , it appears as a round , ovoid , pear - shaped , or heart - shaped radiolucent lesion in the middle of the palate . \n bone expansion is uncommon , and usually , it causes resorption of bone . in our case , \n the cyst completely eroded the palatal bone and the nasal floor , and the swelling was fluctuant in nature . \n the average size of the normal nasopalatine fossa is 3 mm in anteroposterior , transverse , and in vertical direction . \n however , shear and speight have reported that the mean size of the nasopalatine fossa was as high as 10.19 + 3.24 mm anteroposteriorly and 4.79 + 1.33 mm in width . \n it is advised that if the radiographic size of nasopalatine fossa was < 10 mm without any signs and symptoms , it should be re - radiographed periodically . however , bodin , isaacson , and julin advised for surgical exploration if the size of the radiolucency exceeds 8 mm , or if it shows asymmetric bulging . aspiration of the radiolucent lesion will help to differentiate a normal nasopalatine fossa from the cyst . \n cbct is useful when planning for the surgical enucleation of the lesion as it clearly shows the proximity of the lesion with the nasal floor and the posterior extent in the hard palate . \n the differential diagnosis of the lesions includes odontogenic cysts and tumors such as dentigerous cyst , lateral periodontal cyst , cystic ameloblastoma , keratocystic odontogenic tumors , and periapical granuloma . \n however , marsupialization is considered in large lesions followed by second stage enucleation can be done . \n recurrence is uncommon following enucleation ; however , recurrence rate of 1130% has been reported in the literature . in our study , we used both palatal and vestibular approach as the cyst was large in size extending from nasal floor to palatal mucosa . \n paresthesia of the anterior palatal region has been reported in occasional cases following the surgery . \n apart from odontogenic cysts such as radicular cyst , dentigerous cyst , and odontogenic keratocyst , the nonodontogenic origin of cyst such as nasopalatine duct cyst also should be considered in the differential diagnosis of the radiolucent lesions in the anterior maxillary region . as per the literature review , nasopalatine duct cyst is considered a rare pathology , simple enucleation surgery is often considered curative . \n \n ", "role": "user" }, { "content": "nasopalatine duct cyst is the nonodontogenic developmental cyst , frequently occurring in the midline of the anterior maxillary region . \n the clinical presentation of the cyst is often varied and presents a diagnostic difficulty and frequently misdiagnosed as developmental or inflammatory odontogenic cystic lesion . \n this paper represents a large infected nasopalatine duct cyst presenting with complete destruction of anterior palate and pyriform rim .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: these mutations disrupt genes that regulate normal cellular processes , thereby providing growth advantages and metastatic capabilities to tumor cells . understanding how such changes lead to an oncogenic phenotype can provide a deeper understanding of the molecular nature of different cancers while also revealing novel therapeutic targets . \n there are a number of well - known somatic mutations ( 1 ) and germline mutations ( 2,3 ) that have been implicated in cancer progression \n . however , there are likely many more mutations that have not yet been found ( 4 ) . \n the identification and study of these additional mutations presents an important opportunity for further understanding of the biological processes and pathways underlying cancer . \n many large - scale screens have been initiated to identify novel cancer - causing mutations ( 47 ) ( http://cancergenome.nih.gov ) . \n these efforts have relied on sequence analysis of a few hundred to several thousand genes across multiple tumor and cell line samples . while these screens are extremely important for further understanding of tumorigenesis , the results are difficult to interpret because the majority of identified changes are not cancer - causing . \n in fact , a recent large - scale survey of mutations in breast and colon cancers indicates that causal mutations likely account for less than 1% of all observed non - synonymous changes ( 4 ) . \n the high level of background signal can be attributed in part to single nucleotide polymorphisms ( snps ) and passenger mutations . \n snps can be distinguished from true cancer mutation data by a variety of methods including identifying the same change in a matched normal tissue sample , or identifying the same , change in a database of known snps such as dbsnp . \n however , such approaches can be complicated by many factors including a lack of matched normal samples for re - sequencing putative cancer mutations . \n additionally , known snp databases are largely incomplete ( 8) and can contain unreliable records , making it difficult to positively identify a particular change as an snp . \n it is even more difficult to distinguish passenger mutations from true cancer mutations as this usually requires laboratory experimentation . \n recently , a method was developed by sjoblom and colleagues ( 4 ) to identify passenger mutations by uncovering those changes that occur at a higher than expected frequency in a set of tumor samples . \n but , since this method is highly dependant on large numbers of representative tumor samples , well - known oncogenes such as braf were not identified due to their low observed frequency in the sjoblom data . \n thus , without methods specifically designed to analyze the mutations generated from these genome - scale screens , it is likely that a large number of true causal mutations will be overlooked . \n different algorithms have been developed to measure the effect a particular mutation might have on protein function . \n these approaches include sorting intolerant from tolerant ( sift ) ( 9 ) , the pfam - based logr.e - value metric ( 10 ) , polyphen ( 11 ) , ls - snp ( 12 ) , statistical geometry methods ( 13 ) , support vector machine methods ( 14 ) , decision trees ( 15 ) and random forest classifiers ( 16 ) . \n additionally , methods based on the gene ontology such as the gene ontology similarity score ( goss ) ( 17 ) can also provide a measure as to how similar a gene of interest is to other known cancer - causing genes . \n while these algorithms may provide some indication about the nature of a particular mutation , it remains unclear whether by themselves such methods could be directly applicable in cancer mutation analysis . \n recently , using algorithms described earlier , we found that relevant somatic missense mutations behave differently from snps , and based on this distinction we developed a computational method to predict whether a variant is likely to be cancer - causing or not ( 17 ) . \n logr.e - value and goss metrics to generate a prediction to distinguish relevant mutations from other missense changes . \n we demonstrated that this approach could be potentially useful in distinguishing causal from passenger mutations ( 17 ) . \n while this method was described in detail , its implementation requires a thorough understanding of random forest algorithms and the r programming language , likely impeding a large number of experimental biologists from attempting to classify their mutations . here , we present a web application , canpredict , that provides a clean and straightforward interface to our algorithm . \n changes identified on a refseq protein sequence can be submitted and a prediction is generated as to whether the changes are cancer - associated or not . \n this application provides the first public interface to an important algorithm that can provide insight into the large amount of mutation data being generated from cancer re - sequencing projects . \n the algorithm supporting the canpredict application uses a random forest ( rf ) classifier to predict whether an amino acid change is likely to be cancer - causing or not . \n rf classifiers divide a large pool of data into smaller subsets based on characteristics of each datum ( 18 ) . for the canpredict application , the three characteristics used to describe each mutation are scores from sift , the pfam - based logr.e - value and the goss metrics . \n the sift algorithm uses similarity between closely related proteins to identify potentially deleterious changes ( 9 ) . \n sift scores < 0.05 are predicted to be deleterious ( 9 ) and only sift scores with a median information content score < 3.25 are included for predictions since higher values likely indicate unreliable sift scores ( 9 ) . \n also , because the computation time to generate alignments used by the sift algorithm is lengthy , the alignments for all refseq protein sequences have been pre - computed and are stored on the server . \n the pfam - based logr.e - value score predicts whether a change will alter protein function by determining the difference in fit of a wild - type version of the protein to a particular pfam model ( 10 ) . \n these scores were derived from values provided by the hmmer 2.3.2 software and the ls mode was used to search against the pfam protein family database . \n the logr.e - value score was calculated as : log10(e - valuevariant / e - valuecanonical ) . \n lastly , the goss metric uses the gene ontology to measure the similarity of the submitted refseq gene to other known cancer - causing genes ( 17 ) . \n the training data set used to construct the classifier is composed of 200 randomly selected known somatic cancer mutations and 800 non - cancer , non - synonymous variants . \n the cancer mutations were downloaded from data stored in the cosmic database ( 1 ) and the non - cancer variants were selected randomly from snps stored in dbsnp with a minor allele frequency > 20% . for each mutation in the training data , a score from the sift , \n these values were used to build the classifier using the package randomforest 4.5 - 16 ( http://stat-www.berkeley.edu/users/breiman/randomforests ) for the r statistical environment ( http://www.r-project.org ) . \n the out - of - bag error , an internal measure of the rate of misclassification of the classifier , was determined to be 3.19% suggesting that the classifier is very effective . \n 17 ) , data from three different experiments suggest that the predictor can function very well to highlight putative cancer mutations . \n first , in a cross - validation experiment , the classifier consistently revealed a very low false - positive rate of 1.7% for distinguishing relevant mutations from common snps ( 17 ) . \n second , an experiment was performed to distinguish recurrently identified mutations from mutations occurring only one time ; causal mutations are more likely than passenger changes to be seen in multiple different tumor samples because they are under positive selection in tumor samples . in this analysis , \n 58% of variants observed more than 10 times were predicted to be cancer - associated while only 43% of variants occurring only one time were predicted cancer - associated ( p - value 0.018 , two - tailed fisher exact test ) ( 17 ) . \n third , the classifier was used to analyze recent data from a large - scale screen for cancer mutations performed by sjoblom and colleagues ( 4 ) . in the paper by sjoblom \n , mutations were grouped into those genes likely to cause cancer and those genes unlikely to cause cancer , can genes and non - can genes , respectively . \n the canpredict classifier revealed that mutations in can genes were more likely to be predicted as cancer - associated than mutations in non - can genes ( 26.3% to 13.3% , respectively ; p - value 8.8e-6 ; two - tailed fisher exact test ) ( 17 ) . \n the user - supplied mutations and protein sequence data are validated via a server process , and the analysis status is instantly updated without the user leaving the input page . \n the results summary page is automatically loaded when the ajax call detects that the analysis is complete . \n the dojo library ( www.dojotoolkit.org ) implements ajax calls by providing support for the back and forward buttons , changing the url in the address bar to allow for bookmarking , and gracefully degrading when ajax or javascript are not fully supported on the client . \n the canpredict application can be used to submit a single full - length refseq protein sequence or accession and multiple associated changes ( figure 1 ) . \n additionally , from the batch submission page , the application will accept multiple refseq protein accessions and associated changes . \n there is no limit to the number of changes that can be analyzed from the batch submission page . \n changes are validated by the server to ensure that the amino acid specified in the change string occurs in the indicated sequence . for testing the application \n , users can either enter their own mutations or use the test - it link to submit example mutations . included in these examples \n results of the analysis are returned to the user in a summary page where they can also access all other submitted changes using links at the top of the summary ( figure 2 ) . \n there is also a link directing users to a detailed description of the scores produced from each metric . within the submission summary \n is a prediction from the classifier indicating likely cancer , likely non - cancer or not determined . \n the sequence flanking the change is included to allow the user to confirm the precise sequence used in the analysis . \n below the submission summary are data from the sift , logr.e - value and goss analyses . as alignment files used by the sift algorithm are time - consuming to produce , they are available for download using the provided link . \n sift scores and median information content are also presented and only scores with a median information content of < 3.25 are considered reliable ( 9 ) and will be used to generate a prediction from the classifier . \n if there are multiple domains covering the same mutation , the domain with the most deleterious ( largest ) logr.e - value score will be selected for display and will be used by the classifier . \n the goss score is indicated last , and will be present only if the submitted change resides in a gene with a gene ontology description . \n the result pages can be bookmarked , and the associated data are saved in the server for a week . finally , a link presented on the results summary page allows users to download their results in a tab - delimited format . \n results from the batch submission page will be returned in a similar tab - delimited format . \n the canpredict application provides an easily accessible interface for users to determine if an amino acid change is likely to be cancer - causing .", "role": "user" }, { "content": "various cancer genome projects are underway to identify novel mutations that drive tumorigenesis . \n while these screens will generate large data sets , the majority of identified missense changes are likely to be innocuous passenger mutations or polymorphisms . as a result \n , it has become increasingly important to develop computational methods for distinguishing functionally relevant mutations from other variations . \n we previously developed an algorithm , and now present the web application , canpredict ( http://www.canpredict.org/ or http://www.cgl.ucsf.edu/research/genentech/canpredict/ ) , to allow users to determine if particular changes are likely to be cancer - associated . \n the impact of each change is measured using two known methods : sorting intolerant from tolerant ( sift ) and the pfam - based logr.e - value metric . a third method \n , the gene ontology similarity score ( goss ) , provides an indication of how closely the gene in which the variant resides resembles other known cancer - causing genes . \n scores from these three algorithms are analyzed by a random forest classifier which then predicts whether a change is likely to be cancer - associated . \n canpredict fills an important need in cancer biology and will enable a large audience of biologists to determine which mutations are the most relevant for further study .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: saudi arabia is the second biggest arab country , with a surface area of 2,150 thousand sq km , and a population of 25.5 million , about 7 million of whom are non - saudis.[14 ] it is the leading muslim country , as two of the most holy sites for muslims ( makkah and madina ) where millions come to worship and work every year , are located here . \n compared to other countries in the eastern mediterranean region , it has one of the highest gross national incomes per capita and expenditure on health ( usd 22,300 and 6.4% ( as percentage of gross domestic product ( gdp ) ) , respectively . despite this relatively high expenditure on health ( 5% of gdp ) , \n most of the facilities in the healthcare system remain largely concentrated in the three main and most densely populated cities , namely : riyadh , the political capital with18% of the ministry of health ( moh ) hospitals and 18% of the primary health care centers ( phccs ) for 6.2 million people ; jeddah and makah with 9% of the moh hospitals and 7.5% of the phccs for a population of 4.9 million ; and the eastern region , including dammam and qasim , which has 15% of the moh hospitals , and 13.4% of the phccs for a population of 3.4 million . \n the development of the healthcare system in saudi arabia began in 1925 , when a public health department was established by a royal decree . \n the first school of nursing was opened in 1926 , followed by the school of heath and emergencies in 1927 . in 1951 , \n the ministry of health was established . since then , the health services have expanded immensely . from 1970 to 1980 , the health services were predominantly curative . however , the concept of primary health care ( phc ) became popular in the early 1980s ; when the world health organization ( who ) slogan \n health for all ( hfa ) gained recognition . by a ministerial decree in 1980 , the establishment of health centers was initiated . \n currently , the ministry of health has 1848 phc centers and 200 hospitals under its jurisdiction . \n there is growing international literature that discusses the ethical issues relating to healthcare systems in industrialized countries , although these generally deal with specific specialities or a given group of patients . a leading study done by jm breslin and colleagues identified the top ethical challenges that patients and their families in the healthcare system in toronto , canada , face . \n a modified delphi study was conducted and the top ten ethical challenges that canadians confronted within their healthcare were identified . \n the top three challenges in their study were : ( 1 ) disagreement between patients / families and healthcare professionals about treatment decisions ; ( 2 ) waiting lists ; and ( 3 ) access to needed resources for the aged , the chronically ill , and the mentally ill , respectively . likewise , other studies were carried out to identify the national ethical problems related to the healthcare system , the clinical situations doctors and nurses perceive as ethical problems , and to describe the ethical issues deemed as highly important to oncology nurses . \n the conclusions reached by these studies reflected the ethical issues close to those revealed by the canadian study as frequently encountered , such as problems in the healthcare reform process , professional interactions , and doctor - patient relationships . \n the top three priority ethical issues for oncology nurses were assisted suicide , end - of - life decisions , and pain management . however , the literature relating to medical / clinical ethics in saudi arabia remains limited in terms of volume and scope . \n most of these studies focus on the islamic perspective of some clinical practices such as organ donation , do - not - resuscitate ( dnr ) orders , and end - of - life issues , or other issues like patient satisfaction . a study that is worthy of note \n was conducted by kalid bin saeed , to compare the views of physician executives and clinicians on ethical issues in saudi arabian hospitals and the contributory factors leading to the presence of these ethical issues . \n however , the ethical issues that confront the saudi healthcare system and public were not adequately studied , nor was there any attempt to collate and prioritize them . \n this study is aimed at defining , collating , and ranking the major ethical challenges encountered in the healthcare system in saudi arabia , as perceived by the healthcare providers and the public . \n it also proposes an approach to the management of these ethical issues in line with other international studies , especially the canadian study by breslin and colleagues . \n the study area included the three main saudi cities of riyadh , jeddah , and dammam , as well as other smaller cities ( taif ( west ) and tabuk ( north ) ) . \n the study population included : members of the ethics committees in the major health institutions ( hospitals ) , who taught or had experience in medical ethics and medical administration , and academic staff from 10 hospitals in the selected areas [ table 1 ] . \n out of 110 participants , 90 replied in the study period , giving a response rate of 82% ; and 83 ( 75.5% ) provided their professional and contact information . \n the participants were male and female clinicians and medical doctors , 46 ( 55% ) and 12 ( 15% ) , respectively ; medical doctors in public health and community medicine 12 ( 14% ) ; eight ( 10% ) non - medical hospital staff ; and five ( 6% ) pharmacists and other paramedical technicians . hospitals included from each city and the sample size in each participants from military hospitals were civilian staff without rank in the armed forces . \n the justification for the use of a panel of clinicians and ethics committee members rather than community members was that it was expected that they would provide a better insight into the overall ethical challenges than community members , because of their work . \n , 110 participants were asked to write down a list of what they perceived as the top 10 medical ethical challenges to health care . \n they were asked to rank the items from that list again as the top 10 ethical issues facing healthcare providers and return them to the researchers . in the third round , after ranking the obtained ethical issues from all participants responses , the list was sent again to the participants to indicate their agreement or otherwise to the ranking . \n if they did not agree with what they were sent , the re - ranked responses were returned by the participants to the research team . on receipt of the participants re - ranked forms , \n a meeting of experts of a select group of health professionals was held , to choose the top 10 medical ethical problems facing the saudi population from the medical health professionals point of view . at the experts meeting , \n an open session was held to : ( 1 ) unify the definitions of the problems ; ( 2 ) select the top 10 ethical problems ; and ( 3 ) re - rank these problems using a scale that depended on the following four items : ( 1 ) size of the problem ; ( 2 ) seriousness of the problem ; ( 3 ) feasibility of solving it ; and ( 4 ) status of public awareness of it . \n each one of these items was put on a scale of one ( + ; the lowest score ) to 4 ( + s ) , the highest score . \n later , the experts were put into two groups and each group was given a list of the ranked items and asked to rank the top 10 ethical problems facing the saudi care providers . at the end of these sessions , the top 10 ethical problems that the saudi providers faced were formulated and approved . \n 110 participants were asked to write down a list of what they perceived as the top 10 medical ethical challenges to health care . \n they were asked to rank the items from that list again as the top 10 ethical issues facing healthcare providers and return them to the researchers . in the third round , after ranking the obtained ethical issues from all participants responses , the list was sent again to the participants to indicate their agreement or otherwise to the ranking . \n if they did not agree with what they were sent , the re - ranked responses were returned by the participants to the research team . on receipt of the participants re - ranked forms , \n a meeting of experts of a select group of health professionals was held , to choose the top 10 medical ethical problems facing the saudi population from the medical health professionals point of view . at the experts meeting , \n an open session was held to : ( 1 ) unify the definitions of the problems ; ( 2 ) select the top 10 ethical problems ; and ( 3 ) re - rank these problems using a scale that depended on the following four items : ( 1 ) size of the problem ; ( 2 ) seriousness of the problem ; ( 3 ) feasibility of solving it ; and ( 4 ) status of public awareness of it . \n each one of these items was put on a scale of one ( + ; the lowest score ) to 4 ( + s ) , the highest score . \n later , the experts were put into two groups and each group was given a list of the ranked items and asked to rank the top 10 ethical problems facing the saudi care providers . at the end of these sessions , the top 10 ethical problems that the saudi providers faced were formulated and approved . \n out of 110 participants , 90 replied in the study period giving a response rate of 82% . \n following the first round , 32 ethical issues were identified , the top three of which were : patients rights ( 55 ; 61% ) , confidentiality of patients information ( 41 ; 46% ) , and medical negligence / error ( 31 ; 34% ) . \n the least important were : language barrier , private sections in public hospitals , and nursing practices ( 2 , 2 , and 1% , respectively ) . \n patients rights , patient confidentiality , and medical negligence / error were ranked the highest of the ethical issues . \n the third round and the meeting of the panel of participants resulted in the underlisted top 10 medical ethics problems facing the saudi population , from the participants point of view [ table 2 ] . \n the presence of a centralized healthcare system in a culturally diverse population and healthcare providers may give rise to a set of ethical issues . \n for example , the ethical issues related to patients waiting time for medical attention , lack of comprehension resulting from cultural differences , the language barrier between the healthcare providers and the patients , and issues relating to eligibility to health care . for instance , saudi patients in many peripheral areas have to travel to one of the main cities to seek healthcare . \n therefore , the introduction of an organized approach to handle these ethical issues , among others , is needed . \n in addition to the results of rankings [ table 2 ] , the panel members comments during the meeting were taken as the basis for this discussion . \n the highest ranked medical ethical challenge within the public in the healthcare system was the issue of patients rights , whereas , in the canadian study , the first priority was the disagreement between patients / families and healthcare professionals on decisions of treatment . \n good treatment ; give consent for any medical intervention ; confidentiality of his / her medical information ; and the right to refuse treatment against medical advice . since it is only a document that \n guides , the onus has been on the main hospitals to develop their patients bill of rights . \n unfortunately , this is still in the process of being formulated , finalized , and endorsed . \n the second highest ranked ethical challenge facing the public in the healthcare system is equity of access to resources . \n the equity of distribution of health resources is a major issue in the saudi healthcare system , as most of the resources are primarily in the main cities . besides , there are inequities even within the cities and among saudis and non - saudis . \n few exceptions are made for patients with some serious diseases , such as , tuberculosis and dengue fever , who should have access to free management , regardless of their legal status . \n this is an issue that needs to be addressed , for it is unlikely that an illegal resident would dare seeking medical treatment in a governmental hospital . \n bin saeed also draws attention to the more sensitive issue of , favoring patients based on their race or gender , which is considered an important ethical issue by 83.6% of the clinicians in his study . \n the health resources are mainly distributed in favor of the specialist hospitals , that is , secondary and tertiary institutions , leaving the primary care and preventive care centers at a disadvantage . in the canadian study , this issue was ranked the third most important because it was found that a major part of the funds was directed toward acute , live saving care , while long - term , rehabilitation , and mental healthcare were grossly underfunded . the third highest ranked ethical challenge facing the saudi healthcare system was confidentiality of patient information . \n the panel underscored the importance of this issue , which had to be given serious attention . \n there are no clear policies on the management of patient information , specifically the medical records , in many hospitals . \n this includes decisions on sharing any information about the patient without the proper consent of the patient . \n unlike patients rights , not much effort is being made to develop policies on information security . \n this was also a finding made by kahlid bin saeed , who indicated that 80% of the clinicians in his study had stated that patient confidentiality was a major ethical issue in their hospitals . \n the most probable reason is that patients are unlikely to know that their confidential information has been shared , and therefore , are less likely to file a complaint against the treating doctor or the hospital . with an increasing number of patients suing their treating doctors in saudi arabia , \n the main hospitals have taken preventive measures , including the development of certain policies that mandate a physician to take an insurance policy against medical errors before registration in the saudi council for health specialties . \n the fourth ranked ethical challenge was patient safety ; this comprised their physical , emotional , and social safety . \n this issue was not considered one of the top 10 ethical challenges in the canadian health care . \n the problem could be linked to the previous one , in that , a physician 's feeling of insecurity made any potential source of doctor \n despite the danger to themselves the moral responsibility of the doctors to look after their patients safety , remains paramount . \n included were , the relationship between the healthcare team and the pharmaceutical , medical equipment , and companies that traded in medical supplies , especially during the conduct of research in which patients were participants . \n it also included ethical issues relating to privatization and doctors practicing in both public and private hospitals . \n no sustained effort has been made to formulate a clear policy on the conflict of interests within the main hospitals where the study took place . \n the sixth ranked ethical challenge facing the public in saudi arabia was the ethics of privatization . according to the panel members , \n this item comprised many important issues , especially as health insurance was going to be made obligatory in the next few years . \n the panel members also drew attention to the fact that some physicians worked in the private sector during their official working hours , when they were supposed to be at their posts in government hospitals . \n this necessarily affected the time they had to devote to their patients in governmental sectors . besides , their patients were sometimes advised to go to the private hospitals for their follow - up in order to avoid a long waiting list . \n other issues relating to the private sector included the concern that doctors were inclined to request more investigations for patients than was necessary , as also the problem of exorbitant fees charged by some private facilities . \n moreover , employment by some private facilities of poorly trained health professionals , could affect patient safety . \n this issue was not considered an important ethical issue in the canadian study , because of the nature of the canadian health system , which depended almost exclusively on public funds . \n the seventh challenge facing the public in saudi arabia was informed consent : there was a lengthy discussion on this matter for many reasons . the patient / family members tended to sign the form for informed consent hurriedly without carefully reading a document with many difficult medical expressions , which neither the patient nor his / her family member could comprehend . \n as many of the personnel working in the saudi health sector are foreign , and therefore , unable to speak arabic well , communication with a patient and / or his / her family member , who had to sign the consent form , became a problem . \n it is estimated that saudi nurses represent only 22% of the total working force of nurses in the country . \n the next ethical challenge in healthcare in saudi arabia is , how to deal with the opposite sex , that is , when male doctors have to examine female patients and vice versa . \n as the practices of the saudi community are based on islamic ethics and rules , this is a sensitive problem , especially when a male healthcare provider has to deal with a female patient . \n it is worth mentioning that this is permitted in islam only under special circumstances , for example , when no competent female doctor is available for a male doctor to examine a female patient . \n the ninth ethical challenge facing the public in saudi arabia was the matter of the beginning and end of life . \n this sensitive issue discussed by the panel has created much controversy between family members and the medical team . \n it has become more complicated because of the large amount of money used to purchase sophisticated equipment and supplies , which consequently have raised the expectations of patients and their families for a better quality of life as well as a longer life . although mentioned in the canadian study discussion , it was not one of their major ethical problems . \n the tenth ethical challenge facing the public in saudi arabia was : the ethics health care team . \n this refers to ethical issues relating to disagreements , disputes , or even conflicts among the healthcare team members . \n the problems vary according to the attitudes of physicians and their colleagues toward one another and other professionals . \n this situation gets complicated because of the lack of clearly defined job descriptions , which lead to disputes or even conflicts within the health facility . \n apart from the top ten ethical issues , other important issues were raised , although not listed . \n these related to the language barrier and relations within the healthcare team , islamic medicine , and ethics of muslim doctors . \n the last issue is important in saudi arabia , which is a symbol of the modern islamic state . \n discussions revealed differences between the historical islamic practice of medicine and western teaching , which most of the saudi doctors had undergone . \n moreover , the differences between the ethical and practice standards in the western hospitals where they were trained and what was obtained in this country aggravated this divergence . \n the major 10 ethical issues as perceived by the participants were : ( 1 ) patients rights , ( 2 ) equity of resource distribution , ( 3 ) confidentiality of patients , ( 4 ) patient safety , ( 5 ) conflict of interests , ( 6 ) ethics of privatization , ( 7 ) informed consent , ( 8) dealing with the opposite sex , ( 9 ) beginning and end of life , and ( 10 ) healthcare team ethics . however , this list was not exhaustive . \n the results of this study were intended for comparison with those of the canadian study . \n differences were indeed expected because of the differences in culture and healthcare systems of saudi arabia and canada . unlike the canadian study , this study included the opinions of administrators and legal representatives . \n although many of the challenges listed by the participants have received significant public and specialized attention worldwide , very little attention has been given to these top challenges in saudi arabia . \n the higher authorities in the health delivery system hierarchy have to initiate more in - depth discussions on the ethical issues , in order to ultimately bring about changes in policies , particularly on resource allocation . \n although a code of ethics need not lay down rules that are set in stone , it can provide guidance to deal with ethical issues as they arise . \n the top ethical issues reflected the national and cultural peculiarities of the saudi population and health system . \n however , one can reasonably assume that the issues discussed will be applicable to other countries of the region that share the arabic - islamic moral values . \n differences will , however , remain , as there will be issues that arise from different health delivery systems . \n the results were intended for comparison with those of the canadian study by breslin and colleagues . \n the main limitation relates to the ability to generalize the results within or outside saudi arabia . \n first , the study did not include the smaller underserved rural hospitals that could have revealed another set of ethical issues , although the issue of equity in access to resources was listed among the top five issues . \n second , although the study tried to involve non - clinicians , the dominance of saudi male clinicians in the selected sample could have given the results and conclusions a clinical bias . \n this also partly explains why no ethical issues dealing with paramedical staff and their relationship with doctors were mentioned . \n as the delphi process was not stratified , the peculiarities of the different settings were blurred . \n for instance , in this methodology , regional and gender differences and those related to the type of the health facility were indistinct . in addition , it appeared that there was no definite consensus on the meaning of some terms used . \n finally , there was also the fact that communication with the participants of the study was basically electronically supported by some phone calls and faxes . \n moreover , the modified delphi model , presented the possibility of some members dominating the discussions in the face - to - face expert meeting . \n the results were intended for comparison with those of the canadian study by breslin and colleagues . \n the main limitation relates to the ability to generalize the results within or outside saudi arabia . \n first , the study did not include the smaller underserved rural hospitals that could have revealed another set of ethical issues , although the issue of equity in access to resources was listed among the top five issues . \n second , although the study tried to involve non - clinicians , the dominance of saudi male clinicians in the selected sample could have given the results and conclusions a clinical bias . \n this also partly explains why no ethical issues dealing with paramedical staff and their relationship with doctors were mentioned . \n as the delphi process was not stratified , the peculiarities of the different settings were blurred . \n for instance , in this methodology , regional and gender differences and those related to the type of the health facility were indistinct . \n in addition , it appeared that there was no definite consensus on the meaning of some terms used . \n finally , there was also the fact that communication with the participants of the study was basically electronically supported by some phone calls and faxes . \n moreover , the modified delphi model , presented the possibility of some members dominating the discussions in the face - to - face expert meeting .", "role": "user" }, { "content": "background : despite the relatively high expenditure on healthcare in saudi arabia , its health system remains highly centralized in the main cities with its primary focus on secondary and tertiary care rather than primary care . \n this has led to numerous ethical challenges for the healthcare providers . \n this article reports the results of a study conducted with a panel of practitioners , and non - clinicians , in saudi arabia , in order to identify the top ten ethical challenges for healthcare providers , patients , and their families.materials and methods : the study design was a cross - sectional , descriptive , and qualitative one . \n the participants were asked the question : what top ten ethical challenges are saudis likely to face in health care ? the participants were asked to rank the top ten ethical challenges throughout a modified delphi process , using a ranking scale . \n a consensus was reached after three rounds of questions and an experts meeting.results:the major 10 ethical issues , as perceived by the participants in order of their importance , were : ( 1 ) patients rights , ( 2 ) equity of resources , ( 3 ) confidentiality of the patients , ( 4 ) patient safety , ( 5 ) conflict of interests , ( 6 ) ethics of privatization , ( 7 ) informed consent , ( 8) dealing with the opposite sex , ( 9 ) beginning and end of life , and ( 10 ) healthcare team ethics.conclusion:although many of the challenges listed by the participants have received significant public and specialized attention worldwide , scant attention has been paid to these top challenges in saudi arabia . \n we propose several possible steps to help address these key challenges .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: segregation distortion is a phenomenon that the genotypic frequency array of a locus does not follow a typical mendelian ratio . \n depending on the population under investigation , mendelian ratio of a locus varies from 1 : 1 for a backcross to 1 : 2 : 1 for an f2 and to 1 : 1 : 1 : 1 for a four - way cross . \n , the effects of distorted markers on the result of qtl mapping were not known . \n for the reason of precaution , people simply discarded all the distorted markers in qtl mapping . \n recently , we found that distorted markers can be safely used for qtl mapping with no detrimental effect on the result of qtl mapping . \n this finding can help qtl mappers save tremendous resources by using all available markers , regardless whether they are mendelian or not . \n we also found that if distorted markers are handled properly , they can be beneficial to qtl mapping . \n the reason behind the distortion is due to one or more segregation distortion loci ( sdl ) . \n these loci are subject to gametic selection , zygotic selection , or both and their ( unobservable ) distorted segregation causes the observed markers to deviate from the mendelian ratio . \n several investigators [ 411 ] have attempted to map these segregation distortion loci using molecular markers . \n agricultural scientists are interested in mapping qtl for economically important traits while evolutionary biologists are interested in mapping sdl that respond to natural selection . \n since the theory of segregation distortion has been introduced and discussed in previous studies [ 7 , 8 ] and our own research , this study only presents the em ( expectation - maximization ) implementation of the statistical method . \n the variance - covariance matrix of estimated parameters under the em algorithm is also derived and presented in appendix a for interested readers . \n we only investigate interval mapping where a model contains a single qtl at a time and the entire genome is scanned through repeated calling of the same program for different locations of the genome . the technical difference between the joint \n mapping and qtl mapping occurs only in one place . in the traditional interval mapping of qtl , \n the conditional probabilities of genotypes for a qtl are calculated using flanking marker genotypes with the prior probabilities of qtl genotypes being substituted by the mendelian ratio . for the joint mapping , the genotypic frequencies ( segregation ratios ) are treated as unknown parameters that are subject to estimation . \n let m and n be the left and right flanking markers bracketing the qtl ( denoted by g for short ) . \n the interval of the genome carrying the three loci is labeled by a segment mgn . \n the three genotypes of the qtl are denoted by g1g1 , g1g2 , and g2g2 , respectively . \n let r1 and r2 be the recombination fractions for segments mg and gn , respectively . \n the joint distribution of the marker genotypes conditional on the qtl genotype can be derived using the markov chain property under the assumption of no interference between consecutive loci in segregation . \n let us denote the three ordered genotypes , g1g1 , g1g2 , and g2g2 , by genotypes 1 , 2 , and 3 , respectively . \n if individual j takes the th genotype for the qtl , we denote the event by gj = , for all = 1 , 2 , 3 . \n the joint probability of the two markers conditional on the genotype of the qtl is \n\t\t\t\t\t\t\t\t ( 1)pr(mj=,nj= gj= ) = pr(mj= gj=)pr(nj= gj= ) \n\t\t\t\t\t\t\t for all , , = 1 , 2 , 3 , where pr(mj = gj = ) = 1( , ) and pr(nj = \n we use i( , ) to denote the th row and the th column of the following transition matrix : \n\t\t\t\t\t\t\t\t ( 2)i=[(1ri)22ri(1ri)ri2ri(1ri)(1ri)2+ri2ri(1ri)ri22ri(1ri)(1ri)2 ] , i=1,2 . \n for example , \n\t\t\t\t\t\t\t\t ( 3)pr(mj=1,nj=2 gj=3 ) = pr(mj=1 gj=3)pr(nj=2 gj=3 ) = 1(3,1)2(3,2)=2r12r2(1r2 ) . \n let = pr(g = ) , for all = 1 , 2 , 3 , be the probability that a randomly sampled individual from the f2 family has a genotype . we use a generic notation p for probability so that p(gj = ) represents pr(gj = ) and p(mj , nj gj = ) stands for pr(mj , nj gj = ) . \n the log likelihood function of the flanking marker genotypes in the f2 population is \n ( 4)l( m)=j=1nln [ =13p(gj=)p(mj , nj gj=)]=j=1nln [ =131(,mj)2(,nj ) ] , \n\t\t\t\t\t\t\t where = [ 1 2 3 ] is a vector of parameters with constraint =1 = 1 , where m in l( m ) stands for marker information . note that without any prior information , p(gj = ) = , for all j = 1 , , n. under the assumption of mendelian segregation , = where = [ 1 2 3 ] = [ 1/4 1/2 1/4 ] . \n because we are dealing with the genotypic frequencies , the segregation distortion is called zygotic distortion \n we postulate that deviation of from causes a marker linked to locus g to show distorted segregation . \n let yj be the phenotypic value of a quantitative trait measured from individual j. the probability density of yj conditional on the genotype of individual j is normal with mean \n ( 5)=xj+h \n\t\t\t\t\t\t\t and variance , that is , \n ( 6)p(yj gj=)=122exp [ 122(yjxjh)2 ] , \n\t\t\t\t\t\t\t where h is the th row of matrix h and \n ( 7)h=[+110111 ] . \n this h matrix can be defined in a different scale , for example , \n ( 8)h=[+100110 ] , \n\t\t\t\t\t\t\t which does not affect the significance test . \n the advantage of choosing the scale in ( 7 ) is that the expectation of the dominance indicator is zero . \n the design matrix xj and the regression coefficients capture non - qtl effects , for example , field location effects , year effects , and so on . \n the likelihood function of the phenotypic values in the f2 population is \n\t\t\t\t\t\t\t\t ( 9)l(,,2, y ) = j=1nln [ =13p(gj=)p(yj gj= ) ] = n2ln ( 2)+j=1nln { =13exp [ 122(yj)2 ] } , \n\t\t\t\t\t\t\t where letter y in l( , , , y ) stands for the phenotype . \n this likelihood function is the one used in segregation analysis of quantitative traits because no marker information is required . \n let = [ ] be a vector of all parameters in the joint analysis . \n the likelihood function is obtained by combining ( 4 ) and ( 9 ) : \n ( 10)l( m , y)=j=1nln [ =13p(gj=)p(yj gj=)p(mj , nj gj=)]=j=1nln { =13exp [ 122(yj)2]1(,mj)2(,nj ) } n2ln ( 2 ) . \n\t\t\t\t\t\t\t for qtl mapping under segregation distortion \n the previous two likelihood functions ( for markers and for phenotypes ) were presented as background information to introduce this joint log likelihood function . \n the mle ( maximum likelihood estimate ) of the parameters is solved via an em algorithm . \n let us define a delta function as \n ( 11)(gj,)={1if gj=,0if gj , \n\t\t\t\t\t\t\t if the genotypes of all individuals are known , that is , given (gj , ) for all j = 1 , , \n n and = 1 , 2 , 3 , the complete - data log likelihood is \n ( 12)l(,)=j=1nln [ p(yj gj)p(mj , nj gj)p(gj ) ] , \n\t\t\t\t\t\t\t where \n ( 13)p(yj gj)=122exp [ 122=13(gj,)(yj)2],p(mj , nj gj)=k=13p(mj , nj gj=)(gj,)=k=13[1(,mj)2(,nj)](gj,),p(gj)==13(gj, ) . \n therefore , we need to take expectation of the log likelihood with respect to . the expected complete - data log likelihood function is \n ( 14)l( (t))=e[l(, ) (t)]=0+1()+2( ) . \n note that e[l( , ) ] stands for the expectation of l( , ) with respect to conditional on parameters at the current state and the data ( the symbol for data is suppressed for simplicity ) . \n the three components of ( 14 ) are \n ( 15)0=j=1n =13e[(gj, ) (t ) ] [ln 1(,mj)+ln 2(,nj)],1()=n2ln ( 2 ) 122j=1n =13e[(gj, ) (t)](yj)2,2()=j=1n =13e[(gj, ) (t)]ln . \n\t\t\t\t\t\t\t the first component 0 is a function of but not a function of . therefore , it is considered as a constant . \n the expectation step of the em algorithm requires computing the expectation of conditional on the data and . because is a bernoulli variable , the expectation is simply the probability of = 1 , that is , \n ( 16)e[(gj, ) (t)]=pr[(gj,)=1 (t),m , y]=p(gj=)p(yj gj=)p(mj , nj gj=)=13p(gj=)p(yj gj=)p(mj , nj gj=)=exp [ (1/22)(yj)2]1(,mj)2(,nj)=13exp [ (1/22)(yj)2]1(,mj)2(,nj ) . \n the maximization step of the em algorithm requires taking the partial derivatives of l( ) with respect to , setting the partial derivatives equal to zero , and solving for the parameters : \n ( 17)l( (t))=1()+2()=0 . \n the solutions of the parameters are \n ( 18)=[j=1nxjtxj]1[j=1n=13e[(gj,)]xjt(yjh)],=[j=1n =13e[(gj,)](hth)]1 [j=1n =13e[(gj,)]ht(yjxj)],2=1nj=1n =13e[(gj,)](yjxjh)2,=1nj=1ne[(gj, ) ] , =1,2,3 . \n although the wald test can be performed for testing the presence of qtl , such a test is not justified for testing the null hypothesis of mendelian segregation . \n therefore , the likelihood ratio tests are more justifiable . regardless what hypothesis is tested , the full model joint log likelihood function given in ( 10 ) is required . \n let us reintroduce this joint log likelihood function using a different notation so that different likelihood ratio tests are easily interpreted . \n the joint likelihood is rewritten as \n ( 19)lqs(,)=n2log ( 2)+j=1nln { =13exp [ 122(yj)2]1(,mj)2(,nj ) } , \n\t\t\t\t\t\t\t where represents qtl effects and stands for non - mendelian segregation . \n the null hypothesis for qtl detection is hqtl : = 0 while the null hypothesis for detecting segregation distortion is hsdl : = . the null hypothesis is hqtl : = 0 . \n the likelihood ratio test statistic is \n ( 20)qtl=2[ls(0,^)lqs(^,^ ) ] , \n\t\t\t\t\t\t\t\t\t where ls(0,^ ) is the log likelihood value under the null model = 0 , which is \n ( 21)ls(0,^)=l(^,^2 y)+l(^ m ) , \n\t\t\t\t\t\t\t\t\t where \n ( 22)l(^,^2 y)=n2ln ( ^2)12^2j=1n(yjxj^)2,l(^ m)=j=1nln [ =13^1(,mj)2(,nj ) ] . \n\t\t\t\t\t\t\t\t\t the estimated parameters in ( 22 ) \n are obtained by maximizing the corresponding likelihood functions ( see appendix b for the estimation ) . \n the null hypothesis is hsdl : = . the likelihood ratio test statistic is \n ( 23)sdl=2[lq(^,)lqs(^,^ ) ] , \n\t\t\t\t\t\t\t\t\t where \n ( 24)lq(^,)=n2ln ( ^2)+j=1nln { =13exp [ 12^2(yj^)2]1(,mj)2(,nj)}. \n\t\t\t\t\t\t\t\t\t again , the mles of the parameters in ( 24 ) are obtained by maximizing this likelihood function ( see appendix b for the estimation of parameters under the null model ) . \n the null hypothesis is h0 : = 0 and = . the likelihood ratio test statistic is \n ( 25)qs=2[l(0,)lqs(^,^ ) ] , \n\t\t\t\t\t\t\t\t\t where \n ( 26)l(0,)=l(^,^2 y)+l( \n m ) . \n\t\t\t\t\t\t\t\t\t the two components of ( 26 ) are \n ( 27)l(^,^2 y)=n2ln ( ^2)12^2j=1n(yjxj^)2,l( m)=j=1nln [ =131(,mj)2(,nj ) ] . \n the parameters involved in these log likelihood functions are estimated using formulas given in appendix b. this hypothesis is rejected if either 0 or or both inequalities hold . \n suppose that , for some reason , we know for sure that the population from which the sample is drawn is a mendelian population . the sample drawn from this population is selected based on extreme phenotypes ( selective genotyping ) . \n the sample is then non - mendelian regarding the qtl that control the trait subject to phenotypic selection . \n the reason is that segregation distortion in the sample is solely caused by selective genotyping . \n this example demonstrates the application of the method to joint mapping of qtl and sdl in a wheat qtl mapping experiment . \n the experiment was conducted by dou et al . who made the data available to us for this analysis . \n a female sterile line xnd126 and an elite cultivar gaocheng 8901 with normal fertility were crossed for genetic analysis of female sterility measured as a ratio of the number of seeded spikelets to the total number of spikelets per plant . the parents and their f1 and f2 progeny \n were planted in the huaian experimental station in china for the 2006 - 2007 growing season under the normal autumn sowing condition . \n the sterility trait was transformed using the angular sine transformation , y = arcsin(x ) , where x is the phenotypic value expressed as ratio . \n these markers covered five chromosomes of the wheat genome with an average genome marker density of 15.5 cm per marker interval . \n the five chromosomes are only part of the wheat genome . the model for the female sterility is \n ( 28)yj = xj+zj11+zj22+j , \n\t\t\t\t\t where xj = 1 for all j , is the intercept , zj1 = { + 1,0 , 1 } is the genotype indicator variable for the additive effect 1 = a , and zj2 = { -1,1 , 1 } is the genotype indicator variable for the dominance effect 2 = d. we used an interval mapping approach to scanning the entire genome . \n therefore , the model contains one qtl at a time . with the interval mapping , zj = [ zj1 zj2 ] is missing and \n can take one of three values denoted by h for = 1 , 2 , 3 ( see definition of h ) in section 2 . \n the likelihood ratio test statistics were divided by 4.61 to obtain their corresponding lod scores . \n the top panel ( a ) shows the lod profile for qtl detection regardless whether there is segregation distortion or not . \n figure 3(b ) shows the lod profile for testing segregation distortion , regardless whether the qtl is present or absent . \n we used the quick method of piepho to calculate the genome wide critical value of the lod for significance test . \n we found that the genome wide critical value was slightly less than lod = 3 criterion ( data not shown ) . \n in addition to the two major loci , several other regions of the genome also showed significant peaks of the lod score profile . \n overall we detected eight loci , four qtls and four sdls . among the detected qtl , \n each explains from 10% to 47% of the phenotypic variance ( listed as heritability denoted by h in table 1 ) . among the four sdl detected , all showed bias in favor of the xnd126 parent , \n that is , the homozygote of xnd126 allele was over represented at the cost of low representation of the other parent . \n the frequency of the heterozygote was close to the mendelian frequency of 0.5 , but the homozygote of gaocheng 8901 allele was almost wiped out . \n the estimated genotypic frequencies are plotted against the genome location as shown in figure 2 . \n one of the major theoretical contributions of this study is the development of the variance - covariance matrix of the estimated qtl - sdl parameters . \n the covariances between pairs of estimated parameters are not of interest , but the variances of the estimated parameters are important . \n we reported the standard errors for two selected loci , locus 4 ( qtl ) and locus 7 ( sdl ) . \n the standard errors are the square roots of the variances obtained from the em algorithm . \n the variance - covariance matrix of the estimated parameters takes the inverse of the information matrix . as a result \n we also performed a bootstrap analysis ( 1000 bootstrap samples ) to provide more accurate estimation of the variance . \n the results of the bootstrap estimates of the standard errors for the two loci are also listed in table 2 for comparison . \n the approximate standard errors from the em algorithm are indeed biased downward , especially for locus 4 ( qtl ) . \n the bootstraps method is recommended for obtaining more accurate estimates of the standard errors if the sample size is small . \n methods also are available for mapping viability loci or segregation distortion loci when markers do not segregate in a typical mendelian ratio [ 46 , 911 ] . \n however , qtl mapping and sdl mapping have never been combined in a single analysis . \n this study is the first attempt to combine the two seemingly different analyses into a joint one . \n when qtl and sdl are loosely linked or not linked , the joint analysis does not offer much advantage over the separate analyses . \n when they do overlap , a phenomenon called pleiotropy , joint mapping does offer some advantage . \n unfortunately , the wheat experiment introduced here is not a good example to demonstrate the advantage of joint analysis because the qtl and sdl detected do not overlap . \n an obvious situation where the joint analysis can be more powerful is qtl mapping with selective genotyping . in most designed selective genotyping experiments , \n directional ( one - tailed ) selection is rarely used for selective genotyping because it artificially reduces the variation of the trait and thus reduces the statistical power of qtl detection . however , with the joint analysis , the power can increase under directional selection . \n we simulated 500 f2 individuals for a single chromosome of 300 cm long . \n we placed 16 markers evenly over the chromosome with 20 cm per marker interval . \n we selected 300 smallest individuals out of the 500 ( one - tailed selection ) for mapping . \n figure 3(a ) shows the test statistic for qtl regardless whether segregation is distorted or not . \n the panel in the middle ( b ) shows the lod test statistic for segregation distortion , regardless whether a qtl is present or not . \n the panel at the bottom ( c ) shows the lod score profile of the joint analysis where the null model is no qtl and no sdl . \n if lod = 3 is the threshold value , neither of the separate analyses is significant . \n however , the joint analysis has a lod score as high as 4.5 , indicating a significant qtl in the middle of the chromosome . \n our model was developed under zygotic selection because we are dealing with the genotypic frequencies . however , \n if the true cause of segregation is gametic selection , we can still detect segregation distortion as long as the gametic selection leads to the genotypic frequencies deviating from the expected mendelian ratio . \n a model particularly handling gametic selection has not been developed yet , but it is not difficult . \n let us take the f2 population as an example to show the gametic selection model . \n denote the frequencies of g1 and g2 alleles from the female parent by 1 and 2 , respectively , for 1 + 2 = 1 , and the corresponding allele frequencies from the male parent . \n when gametic selection occurs , we treat 1 and 1 as unknown parameters for estimation . \n the genotypic frequencies are simply functions of the two unknown parameters , as given by 1 = 11 , 2 = 12 + 21 and 3 = 22 . \n qtl parameters are estimated using the same algorithm as described in the zygotic selection model because they depend only on the genotypic frequencies . estimating parameters 1 and 1 requires a modified algorithm . under the gametic selection model \n , we can test whether the segregation distortion is caused by the distortion of female gametes , male gametes , or both . \n the joint analysis developed in this study only applies to line crossing data where the marker linkage phases are known . \n application of the method to pedigrees warrants further investigation and it is not obvious to us at this moment . \n we have already extended the method to bc ( backcrosses ) , ril ( recombinant inbred lines ) , dh ( double haploids ) , and fw ( four way crosses ) and incorporated them into our qtl mapping program that is described in the next paragraph . \n however , interval mapping is still the quickest method of qtl mapping , even though multiple qtl mapping programs are available . \n compared with traditional qtl interval mapping , this joint analysis involves one additional step of updating the genotypic frequencies . \n this additional step presents a complication where the conditional genotypic frequencies given flanking marker genotypes can not be calculated prior to qtl mapping . \n fortunately , we have incorporated the joint qtl / sdl mapping into our qtl mapping program . \n the method = ml option in the proc qtl statement must be turned on with an additional suboption /distortion to invoke the joint mapping procedure . without the /distortion option \n proc qtl is available on our website ( http://www.statgen.ucr.edu/software.html ) and users can download the program with no charge . the program is also accompanied with a detailed user manual . \n let us define the individual - wise complete - data log likelihood for plant j as \n ( a.1)lj(,)=[12ln ( 2)122=13(gj,)(yjxjh)2]+=13(gj,)[ln ( t1(,mj))+ln ( t2(,nj))]+=13(gj,)ln , \n\t\t\t\t\t\t\t where 3 = 1 1 2 so that 3 is excluded from the parameter vector . to derive the variance covariance matrix of the estimated parameters , we need to define the score vector sj( , ) and the hessian matrix hj( , ) for the individual - wise complete - data log likelihood function . \n the louis information matrix of the parameters under the em algorithm is \n ( a.2)i(^)=j=1ne[hj(^,)]j=1nvar[sj(^, ) ] , \n\t\t\t\t\t\t\t where the expectation and variance are taken with respect to the missing values . once the information matrix is define , the variance matrix of the estimated parameters simply takes \n ( a.3)var(^)i1(^ ) . \n\t\t\t\t\t\t\t the standard error of each parameter takes the square root of each diagonal element of the above matrix . the approximation performs better for large sample sizes . \n the score vector is denoted by sj( , ) = lj( , )/ , which consists of five blocks , as follows : \n ( a.4)sj(,)=lj(,)=12k=13(gj,)xjt(yjxjh),sj(,)=lj(,)=12=13(gj,)ht(yjxjh),sj(2,)=lj(,)2=122 + 124=13(gj,)(yjxjh)2,sj(1,)=lj(,)1=(gj,1)11(gj,3)1112,sj(2,)=lj(,)2=(gj,2)12(gj,3)1112 . \n\t\t\t\t\t\t\t concatenating the above five scores vertically \n the hessian matrix is denoted by hj( , ) = lj( , )/ , which is block diagonal with non - zero blocks given as follows : \n ( a.6)hj()=2lj(,)t=12xjtxj , hj()=2lj(,)t=12=13(gj,)xjth,hj(2)=2lj(,)2=14=13(gj,)xjt(yjxjh),hj()=2lj(,)t=12=13(gj,)hth,hj(2)=2lj(,)2=14=13(gj,)ht(yjxjh),hj(22)=2lj(,)22=12416=13(gj,)(yjxjh)2,hj(11)=2lj(,)11=(gj,1)112(gj,3)132,hj(12)=2lj(,)12=(gj,3)132,hj(22)=2lj(,)22=(gj,2)122(gj,3)132 . \n the expectation of the hessian matrix e[hj( , )]and the variance matrix of the score vector var[sj( , ) ] can be expressed explicitly because both the hessian matrix and the score vector are linear functions of the missing value \n ( a.8)j=[(gj,1)(gj,2)(gj,3)]t . \n therefore , e[hj( , ) ] and var[sj( , ) ] can eventually be expressed as functions of the expectation and variance of j , which have simple expressions because j is a multinomial variable . \n the hessian matrix hj( , ) is already expressed in linear function of j and thus the expectation can be obtained straightforwardly by replacing j by e(j ) . \n let us define the following matrices : \n ( a.9)cj()=[12xjt(yjxjh1)12xjt(yjxjh2)12xjt(yjxjh3)],cj()=[12h1t(yjxjh1)12h2t(yjxjh2)12h3t(yjxjh3)],cj(2)=[124(yjxjh1)2124(yjxjh2)2124(yjxjh3)2],cj(1)=[11013 ] , cj(2)=[01213 ] . \n the score vector in matrix notation is \n ( a.10)sj(,)=lj(,)=[cjt()cjt()cjt(2)cjt(1)cjt(2)]j+[0012200]=cjj+d . \n\t\t\t\t\t\t\t as a result , \n ( a.11)var[sj(,)]=cjvar(j)cjt , \n\t\t\t\t\t\t\t where \n ( a.12)var(j)=diag [ e(j)]e(j)e(jt ) \n\t\t\t\t\t\t\t is the variance - covariance matrix of the multinomial variable j . \n this appendix provides methods for estimating parameters under various null models that are required for constructing likelihood ratio test statistics . the log likelihood for the null model is \n ( b.1)ls(0,^)=l(^,^2 y)+l(^m ) , \n\t\t\t\t\t\t\t\t\t where \n ( b.2)l(^,^2 y)=n2ln ( ^2)12^2j=1n(yjxj^)2,l(^ m)=j=1nln [ =13^1(,mj)2(,nj ) ] . \n the mles of the population parameters are obtained explicitly without iteration : \n ( b.3)^=[j=1nxjtxj]1[j=1nxjtyj],^2=1nj=1n(yjxj^)2 . \n the estimated genotypic frequencies , however , require the following iterations : \n ( b.4)(t+1)=1nj=1ne[(gj, ) ] , =1,2,3 , \n\t\t\t\t\t\t\t\t\t where \n ( b.5)e[(gj,)]=(t)1(,mj)2(,nj)=13(t)1(,mj)2(,nj ) . \n the log likelihood function for the null model is \n ( b.6)lq(^,)=n2ln ( ^2)+j=1nln { =13exp [ 12^2(yj^)2]1(,mj)2(,nj)}. \n\t\t\t\t\t\t\t\t\t finding the solution of the parameters requires iterations as given as foolows : \n ( b.7)(t+1)=[j=1nxjtxj]1 [j=1n =13e[(gj,)]xjt(yjh(t))],(t+1)=[j=1n =13e[(gj,)](hth)]1 [j=1n =13e[(gj,)]ht(yjxj(t))],2(t+1)=1nj=1n =13e[(gj,)](yjxj(t)h(t))2 , \n\t\t\t\t\t\t\t\t\t where \n ( b.8)e[(gj,)]=exp [ (1/22)(yj)2]1(,mj)2(,nj)=13exp [ (1/22)(yj)2]1(,mj)2(,nj ) . \n the mendelian frequencies 's are constants , not parameters , as 1 = 3 = ( 1/2)2 = 1/4 . \n the log likelihood function for the null model is \n ( b.9)l(0,)=l(^,^2 y)+l( m ) , \n\t\t\t\t\t\t\t\t\t where \n ( b.10)l(^,^2 y)=n2ln ( ^2)12^2j=1n(yjxj^)2,l(m)=j=1nln [ =131(,mj)2(,nj ) ] .", "role": "user" }, { "content": "quantitative trait locus ( qtl ) mapping is usually performed using markers that follow a mendelian segregation ratio . \n we developed a new method of qtl mapping that can use markers with segregation distortion ( non - mendelian markers ) . \n an em ( expectation - maximization ) algorithm is used to estimate qtl and sdl ( segregation distortion loci ) parameters . \n the joint analysis of qtl and sdl is particularly useful for selective genotyping . \n application of the joint analysis is demonstrated using a real life data from a wheat qtl mapping experiment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: many computerized physician order entry systems ( cpoes ) generate drug safety alerts to remind physicians of potentially unsafe situations . \n drug safety alerts are frequently overridden , for example because the alert is not patient - tailored or because the disadvantages of the situation do not outweigh the advantages . \n a high number of low - specificity alerts may cause physicians to override important alerts along with unimportant ones , thereby decreasing safety . in the netherlands , \n all hospital cpoes make use of the national drug database , which is updated monthly . \n g standard contains safety information for all drugs licensed in the netherlands . the g standard introduced drug - drug interaction ( ddi ) alerting on qt prolongation in march 2005 . \n qt prolongation may predispose patients to developing torsades de pointes ( tdp ) and to sudden cardiac death . \n after many complaints about low - specificity alerts in the cpoes , several drugs were excluded from qt - alert generation in may 2007 [ 3 , 4 ] without any outcome measurements . \n the aim of this study was to compare the rules for qt alerting to see whether the 2007 rules would identify patients at risk of developing tdp better than the 2005 rules . \n the following questions were to be answered : \n in what percentage of patients at risk of developing tdp due to a combination of two qt - prolonging drugs is a qt - prolongation ddi alert generated ( sensitivity)?in what percentage of generated qt - prolongation ddi alerts is the patient really at risk of developing clinically significant qt prolongation ( positive predictive value of the qt alert ) ? \n in what percentage of patients at risk of developing tdp due to a combination of two qt - prolonging drugs is a qt - prolongation ddi alert generated ( sensitivity ) ? in what percentage of \n generated qt - prolongation ddi alerts is the patient really at risk of developing clinically significant qt prolongation ( positive predictive value of the qt alert ) ? \n many cardiac and noncardiac drugs can prolong the qt interval on the electrocardiogram ( ecg ) , thereby increasing the risk of serious ventricular arrhythmias ( e.g. , tdp ) and sudden cardiac death . \n tdp has a low incidence , and the prolongation of the absolute qtc interval beyond 500 ms and/or an increase of more than 60 ms are regarded as leading to an increased risk of tdp [ 57 ] . \n many risk factors may increase the risk of developing tdp such as gender , age , cardiovascular disease , and electrolyte disturbances ; elderly females are especially at risk . \n many drugs increase this risk to different extents , and higher doses and renal failure may add an additional risk . \n the dutch national drug database , the g standard , has included ddi alerts on qt prolongation since march 2005 . at first \n , drugs from lists d and e from de ponti [ 9 , 10 ] generated this alert , as well as all class ia and iii antiarrhythmics . \n list d contained all drugs clinically associated with tdp , and list e included drugs with clinical evidence for tdp plus an official warning of causing tdp [ 810 ] . in 2006 \n some hospital pharmacists concluded after studying the literature that many combinations were of minor importance with no need for action [ 8 , 11 ] , although hospital pharmacists responsible for the ddi alerts in the g standard disagreed [ 1214 ] . \n since may 2007 dutch qt alerting has been based on the system of the arizona center for education and research on therapeutics . \n this system earlier consisted of four drug classes with a different risk of causing tdp : class 1 drugs were known to cause tdp , class 2 drugs had a probable risk , and class 4 were unlikely to cause tdp . \n class 3 drugs were contraindicated in patients with ( congenital ) long qt - syndrome . at present , three categories exist : drugs with a risk of causing tdp ( formerly class 1 ) , drugs with a possible risk ( formerly class 2 ) and drugs with a conditional risk ( including the former class 4 drugs ) . in may 2007 , the g standard limited ddi alerting for qt prolongation to combinations of class 1 drugs and terfenadine and adjusted the information content of the alert text ( figs . 1 and 2 ) . \n furthermore it introduced contraindication alerting for patients with a prolonged qt interval taking single drugs from classes 1 and 2 , sympathicomimetic drugs or terfenadine . \n the new rules for ddis resulted in a reduction in the number of drugs generating the qt alert ( from 30 to 20 ) and were based on expert opinions formulated after studying and discussing the available literature . \n 2first part of the new alert text first part of the old alert text first part of the new alert text \n the 1,237-bed erasmus university medical center , rotterdam , the netherlands , uses the cpoe medicatie / evs ( leiden , the netherlands ) on all wards except icus . \n this cpoe system for prescribing medication generates intrusive drug safety alerts for ddis , overdoses , and therapeutic duplications based on information held in the g standard database . overridden drug safety alerts are routinely logged for pharmacy review . \n all overridden qt - prolongation ddi alerts generated in medicatie / evs version 2.20 between 1 february 2006 and 31 july 2006 in the erasmus mc - center location ( a general hospital ) were used for patient selection . \n outpatients , patients with ventricular pacemakers , transplanted patients treated with the low - risk combination of tacrolimus with cotrimoxazole ( class 2 and 4 ) , patients who were long - term users of qt - prolonging drugs with unknown start dates or who were no longer using the combination were excluded . \n the secondary inclusion criterion was patients with ecgs available from before and within 1 month of the qt - alert override . for each patient included , the interacting drugs , risk factors for tdp , and digital ecg recordings ( 12-lead resting ecgs recorded with a mortara electrocardiograph ) were collected . \n risk factors for tdp were defined as female gender , age > 65 years , presence of cardiovascular disease ( myocardial infarction , heart failure , atrial fibrillation , hypertension , cerebrovascular accident , peripheral vasculopathy ) , diabetes mellitus ( use of glucose - lowering drugs ) , renal failure ( glomerular filtration rate < 50 ml / min ) , and potassium level \n < 3.5 mmol / l . increased risk of tdp was defined as qtc interval > 500 ms or an increase in the qtc interval > 60 ms . \n positive predictive value was calculated as true positives/(true positives + false positives ) . \n the 1,237-bed erasmus university medical center , rotterdam , the netherlands , uses the cpoe medicatie / evs ( leiden , the netherlands ) on all wards except icus . \n this cpoe system for prescribing medication generates intrusive drug safety alerts for ddis , overdoses , and therapeutic duplications based on information held in the g standard database . overridden drug safety alerts are routinely logged for pharmacy review . \n all overridden qt - prolongation ddi alerts generated in medicatie / evs version 2.20 between 1 february 2006 and 31 july 2006 in the erasmus mc - center location ( a general hospital ) were used for patient selection . \n outpatients , patients with ventricular pacemakers , transplanted patients treated with the low - risk combination of tacrolimus with cotrimoxazole ( class 2 and 4 ) , patients who were long - term users of qt - prolonging drugs with unknown start dates or who were no longer using the combination were excluded . \n the secondary inclusion criterion was patients with ecgs available from before and within 1 month of the qt - alert override . \n for each patient included , the interacting drugs , risk factors for tdp , and digital ecg recordings ( 12-lead resting ecgs recorded with a mortara electrocardiograph ) were collected . \n risk factors for tdp were defined as female gender , age > 65 years , presence of cardiovascular disease ( myocardial infarction , heart failure , atrial fibrillation , hypertension , cerebrovascular accident , peripheral vasculopathy ) , diabetes mellitus ( use of glucose - lowering drugs ) , renal failure ( glomerular filtration rate < 50 ml / min ) , and potassium level < 3.5 mmol / l . increased risk of tdp \n was defined as qtc interval > 500 ms or an increase in the qtc interval > 60 ms . \n positive predictive value was calculated as true positives/(true positives + false positives ) . \n in the 6-month study period , ddi alerts on qt prolongation were overridden for 368 patients . of these \n the most frequent reasons for exclusion were the use of tacrolimus and low - dose cotrimoxazole in transplant recipients ( n = 124 , 34% ) , the unavailability of ecg recordings before and after initiation of the drug combination ( n = 119 , 32% ) , and the patient being treated on an outpatient basis ( n = 35 , 9.5% ) . \n table 1patient selectionpatient categorynumberpatients with overridden drug safety alerts on qt prolongation from 1 february 31 july 2006368patients excluded319 treated on an outpatient basis35 using tacrolimus and low - dose cotrimoxazole124 combination not used any more22 long - term use of combination ( start date unknown)7 ventricular pacemaker4 other reasons8 < 2 ecgs119patients included49 forty - nine patients met the inclusion criteria ; table 2 presents the patient characteristics . \n the mean number of non - drug - related risk factors was 2.7 ( sd 1.1 ) . \n all patients had at least one non - drug - related risk factor for developing tdp . \n table 2characteristics of patients meeting the inclusion criteria ( n = 49)characteristicnumber ( % ) female gender20 ( 41%)cardiovascular disease44 ( 90%)diabetes mellitus17 ( 35%)renal failure19 ( 42%)age > 65 years29 ( 59%)potassium level < 3.5 mmol / l3 ( 6.7%)calculation based on all patients for whom an estimated glomerular filtration rate was available ( n = 45)calculation based on all patients with a measured potassium level ( n = 45 ) characteristics of patients meeting the inclusion criteria ( n = 49 ) calculation based on all patients for whom an estimated glomerular filtration rate was available ( n = 45 ) calculation based on all patients with a measured potassium level ( n = 45 ) fifteen patients ( 31% ) were considered at risk for developing tdp ; table 3 shows their patient characteristics . \n all at - risk patients used two qt - prolonging drugs , ranging from high risk ( class 1 ) to low risk ( 4 ) . \n the number of non - drug - related risk factors per patient ranged from 1 to 5 . \n table 3subjects at risk of developing torsades de pointes ( n = 15)genderagecardiovasculardiseasediabetes mellitusgfr ( ml / min)k level ( mmol / l)risk factorsdrug 1drug 2qtc2 ( ms)qtc ( ms)new alertfemale75++134.15haloperidol ( 1)amiodarone ( 1)50429+female71+374.24indapamide ( 2)promethazine ( nc)47064male68+494.13amiodarone ( 1)haloperidol ( 1)487100+male72+483.93amiodarone ( 1)ketanserin ( nc)53783female62+74.23amiodarone ( 1)tacrolimus ( 2)592201female53+494.13haloperidol ( 1)tacrolimus ( 2)53062male72+483.93sotalol ( 1)erythromycin ( 1)50132+male51++334.43tacrolimus ( 2)mianserin ( nc)510122female81+803.63domperidone ( 1)amitriptyline ( 4)43875male68+>904.42chlorpromazine ( 1)cisapride ( 1)49064+male61+264.12haloperidol ( 1)sotalol ( 1)47884+male64++774.72sotalol ( 1)amiodarone ( 1)50273+male64++2chlorpromazine ( 1)ketanserin ( nc)46791male64+594.01haloperidol ( 1)amiodarone ( 1)560141+male45+>904.21haloperidol ( 1)tacrolimus ( 2)49284patients are categorized according to number of non - drug - related risk factors+ present , - absent , gfr glomerular filtration rate in ml / min , qtc2 qtc interval after qtc - alert override , qtc change in qtc interval between ecgs before and after qtc alertnumbers in parentheses indicate drug class according to www.torsades.org ; nc not classified on www.torsades.orgqtc-prolonging drug started at time of qtc alertnumber of risk factors might have been higher due to unknown values subjects at risk of developing torsades de pointes ( n = 15 ) patients are categorized according to number of non - drug - related risk factors + present , - absent , gfr glomerular filtration rate in ml / min , qtc2 qtc interval after qtc - alert override , qtc change in qtc interval between ecgs before and after qtc alert numbers in parentheses indicate drug class according to www.torsades.org ; nc not classified on www.torsades.org qtc - prolonging drug started at time of qtc alert number of risk factors might have been higher due to unknown values in the new database since may 2007 , many frequently encountered combinations of qt - prolonging drugs no longer generate a ddi alert in the cpoe . the last column of table 3 shows whether combinations would result in a qt alert in the new situation . for 8 of the 15 patients with increased risk of tdp in our study ( 53% ) , no alert would be generated with the new rules because the drugs are not classified or do belong to classes 2 or 4 . assuming the cpoe with the old inclusive drug database identified all patients at risk of developing tdp , the modified database would result in a sensitivity of 47% . \n table 4 shows whether an alert would be generated for patients at risk of developing tdp in the new situation . \n the positive predictive value in the study population was 31% ( 15/49 ) in the old situation and would be about the same ( 30% , 7/23 ) if the cpoe would make use of the modified database . \n table 4numbers of patients at risk of developing torsades de pointes for whom a qt - prolongation ddi alert is generated in the new situation ( database restricted to obviously qt - prolonging drugs)alert generated ( n)no alert generated ( n)patients at risk of tdp7 ( true positives)8 ( false negatives)patients not at risk of tdp16 ( false positives)18 ( true negatives ) numbers of patients at risk of developing torsades de pointes for whom a qt - prolongation ddi alert is generated in the new situation ( database restricted to obviously qt - prolonging drugs ) \n the decreased number of drugs generating qt alerts successfully lowers the alert numbers in our study population from 49 to 23 . \n however , it does not address the specificity problem adequately , as the positive predictive value does not change . \n furthermore , the qt - rule modification introduces a sensitivity problem as the new system would miss 53% of the patients at increased risk of developing tdp . \n reduction of the qt - alert overload by excluding several drugs from qt - alert generation clearly has unintended and undesirable consequences . \n only inpatients with an ecg before and within 1 month of qt - alert overriding were included . \n thirty - two percent of the patients with qt - alert overrides were excluded because ecgs were not available to calculate the qt interval , and these could have been low - risk patients . however , the excluded patients had a lower average number of non - drug - related risk factors : 2.0 ( sd 1.2 ) . \n the patients included had a higher average number of 2.7 ( sd 1.1 ) , which could have led to an overestimation of the proportion of patients considered to be at risk . \n none of the patients in our study had zero non - drug - related risk factors , and it is likely that the risk factors for developing tdp ( e.g. , cardiovascular disease ) led to an overestimation of the positive predictive value . \n inclusion of the entire inpatient population would have resulted in an even lower positive predictive value . \n furthermore , patients using the combination tacrolimus and cotrimoxazole were excluded because this very frequently used combination in transplanted patients in the erasmus mc was perceived not to result in tdp . \n if the combination really is a low - risk combination not resulting in tdp , inclusion of these patients would have resulted in a higher positive predictive value . \n qt prolongation is dependent on age , gender , co - morbidity , serum potassium level , renal function , drug class , and drug dose . although age and gender of the patients are known in our cpoe , these items were not used in qt - alert generation and suppression . \n qt - alert generation in medicatie / evs was and is only dependent on drug class and is not tailored to at - risk patients , so accuracy remains low . \n furthermore , the drugs now excluded from qt - alert generation are known to have a probable or unlikely risk of causing tdp when used as single drugs , but the effects of combinations of these drugs in patients with non - drug - related risk factors are unknown . \n how should the problem of these low - specificity alerts be managed ? ideally , qt alerts would only be generated for patients really at risk of developing tdp , and they would be suppressed if the risk is low . \n however , to calculate the overall risk of developing tdp , the contributions of all risk factors , including drug class and dose , should be known . \n this information is not known , and therefore effective filtering of qt alerts for at - risk patients is not feasible . only by prospectively collecting ecgs before and after the initiation of combinations of two or more qt - prolonging drugs \n will we be able to determine the true risk of developing clinically relevant qt - prolongation . \n it is only with this knowledge that qt alerts with both high sensitivity and specificity ( positive predictive value ) can be developed . \n bates proposed an override rate of less than 40% for strongly action - oriented suggestions , but this seems to have been chosen arbitrarily . \n if however this recommendation were to be followed , the current positive predictive value of ddi alerts on qt prolongation should be doubled . \n we recommend that ecgs should be performed before and within 1 week of the qt override . \n if postponement of this drug therapy were undesirable , a single ecg after the qt override would also give useful information . this recommendation to record an ecg \n both old and new alert texts are rather long and complicated ( figs . 1 and 2 ) , and it is easy to modify the messages . \n it would be very helpful if ecgs could be ordered from the cpoe , but this type of integration is largely absent in dutch hospital cpoes . \n the drug lists on www.torsades.org are regularly updated in contrast to the de ponti list [ 3 , 15 ] . \n the lists at first only included drugs that were on the market in the united states . \n fortunately , drugs that are not ( and no longer ) available in the u.s . \n for the dutch situation it should be kept in mind however that ketanserin , mianserin , and promethazine are absent on www.torsades.org [ 3 , 15 ] . \n although this relationship is not clear cut , this is the best way to study the risk of developing tdp , as tdp has a low incidence [ 57 ] . \n qt intervals show high diurnal variability , may be subject to reading errors , and are dependent on serum drug level [ 57 , 20 , 21 ] . \n the ecgs in this study were not recorded under standardized conditions , and this might have resulted in less accurate qt intervals . \n this study did not aim to identify risk patients with a high certainty , but mainly focused on the difference between old and new rules for qt - prolongation alerts in a cpoe . \n it elucidated a problem requiring a prospective study including ecgs recorded under standardized conditions and taking into account drug serum levels . due to qt - interval variability \n , it can be questioned whether it is correct to use absolute qt intervals > 500 ms or qt prolongation > 60 ms as the best identification of patients at risk of tdp [ 20 , 21 ] . \n we used both measures according to the guidelines of the european medicines agency and only used the categories with most marked increases to reduce the effect of qt variability . \n ddis may have been generated by adding one qt - prolonging drug to an existing therapy containing another qt - prolonging drug , but may also have been the result of two newly prescribed qt - prolonging drugs . \n twenty - five patients ( 51% of the patients included ) already used one qt - prolonging drug , resulting in a smaller increase in qt interval and a higher probability of exceeding the limit of 500 ms . \n this was another reason to include both qt - interval measures to identify patients at risk of tdp . \n a weakness of this study is that the study population may differ from the whole patient population . \n selection may have been biased because patients taking the combination tacrolimus - cotrimoxazole ( 34% ) and patients without two ecgs ( 32% ) and with a lower number of non - drug - related risk factors were excluded . \n it is unlikely however that inclusion of the tacrolimus - cotrimoxazole combination would change our conclusions that the new rules are worse . \n if it were a low - risk combination , inclusion would increase the positive predictive value , but the sensitivity would remain low . if it were a high - risk combination , inclusion would result in a decreased positive predictive value and sensitivity . \n the modifications of the g standard excluded 11 drugs generating qt alerts and added 1 drug , arsenic trioxide . \n this could have had an effect on the sensitivity and positive predictive value , but this drug was not prescribed in our cpoe in the study period . \n a drawback of the cpoe used in this study is that only overridden alerts are logged for pharmacy review . \n alerts resulting in order cancellation are not available , and override reasons are not required . \n disguised observation in the erasmus mc revealed an override rate of > 90% for ddis , including qt - prolongation alerts ( unpublished data ) . notwithstanding these limitations , this study clearly showed the unintended effects on patient safety of a proposed measure to reduce alert overload , making use of patient data from normal clinical practice . \n how should the problem of these low - specificity alerts be managed ? ideally , qt alerts would only be generated for patients really at risk of developing tdp , and they would be suppressed if the risk is low . \n however , to calculate the overall risk of developing tdp , the contributions of all risk factors , including drug class and dose , should be known . \n this information is not known , and therefore effective filtering of qt alerts for at - risk patients is not feasible . only by prospectively collecting ecgs before and after the initiation of combinations of two or more qt - prolonging drugs \n will we be able to determine the true risk of developing clinically relevant qt - prolongation . \n it is only with this knowledge that qt alerts with both high sensitivity and specificity ( positive predictive value ) can be developed . \n bates proposed an override rate of less than 40% for strongly action - oriented suggestions , but this seems to have been chosen arbitrarily . \n if however this recommendation were to be followed , the current positive predictive value of ddi alerts on qt prolongation should be doubled . \n we recommend that ecgs should be performed before and within 1 week of the qt override . \n if postponement of this drug therapy were undesirable , a single ecg after the qt override would also give useful information . \n this recommendation to record an ecg should be presented as a clear message during the order entry process . \n both old and new alert texts are rather long and complicated ( figs . 1 and 2 ) , and it is easy to modify the messages . \n it would be very helpful if ecgs could be ordered from the cpoe , but this type of integration is largely absent in dutch hospital cpoes . \n the drug lists on www.torsades.org are regularly updated in contrast to the de ponti list [ 3 , 15 ] . \n the lists at first only included drugs that were on the market in the united states . \n fortunately , drugs that are not ( and no longer ) available in the u.s . \n for the dutch situation it should be kept in mind however that ketanserin , mianserin , and promethazine are absent on www.torsades.org [ 3 , 15 ] . \n although this relationship is not clear cut , this is the best way to study the risk of developing tdp , as tdp has a low incidence [ 57 ] . \n qt intervals show high diurnal variability , may be subject to reading errors , and are dependent on serum drug level [ 57 , 20 , 21 ] . \n the ecgs in this study were not recorded under standardized conditions , and this might have resulted in less accurate qt intervals . \n this study did not aim to identify risk patients with a high certainty , but mainly focused on the difference between old and new rules for qt - prolongation alerts in a cpoe . \n it elucidated a problem requiring a prospective study including ecgs recorded under standardized conditions and taking into account drug serum levels . due to qt - interval variability \n , it can be questioned whether it is correct to use absolute qt intervals > 500 ms or qt prolongation > 60 ms as the best identification of patients at risk of tdp [ 20 , 21 ] . \n we used both measures according to the guidelines of the european medicines agency and only used the categories with most marked increases to reduce the effect of qt variability . \n ddis may have been generated by adding one qt - prolonging drug to an existing therapy containing another qt - prolonging drug , but may also have been the result of two newly prescribed qt - prolonging drugs . \n twenty - five patients ( 51% of the patients included ) already used one qt - prolonging drug , resulting in a smaller increase in qt interval and a higher probability of exceeding the limit of 500 ms . \n this was another reason to include both qt - interval measures to identify patients at risk of tdp . \n a weakness of this study is that the study population may differ from the whole patient population . \n selection may have been biased because patients taking the combination tacrolimus - cotrimoxazole ( 34% ) and patients without two ecgs ( 32% ) and with a lower number of non - drug - related risk factors were excluded . \n it is unlikely however that inclusion of the tacrolimus - cotrimoxazole combination would change our conclusions that the new rules are worse . \n if it were a low - risk combination , inclusion would increase the positive predictive value , but the sensitivity would remain low . if it were a high - risk combination , inclusion would result in a decreased positive predictive value and sensitivity . \n the modifications of the g standard excluded 11 drugs generating qt alerts and added 1 drug , arsenic trioxide . \n this could have had an effect on the sensitivity and positive predictive value , but this drug was not prescribed in our cpoe in the study period . \n a drawback of the cpoe used in this study is that only overridden alerts are logged for pharmacy review . \n alerts resulting in order cancellation are not available , and override reasons are not required . disguised observation in the erasmus mc revealed an override rate of > 90% for ddis , including qt - prolongation alerts ( unpublished data ) . notwithstanding these limitations , this study clearly showed the unintended effects on patient safety of a proposed measure to reduce alert overload , making use of patient data from normal clinical practice . \n reducing qt - alert overload by excluding drugs without proven risk of causing tdp from alert generation would result in a considerable reduction in alert numbers , would not change the positive predictive value , and would introduce a sensitivity problem . \n the high number of non - drug - related risk factors that are not included in qt - alert generation could explain these unintended consequences . \n further outcome measurements should be performed to elucidate the contribution of the non - drug - related risk factors to the overall risk . \n ideally , clinical rules incorporating all risk factors could then be developed to generate qt alerts with an acceptable positive predictive value .", "role": "user" }, { "content": "purposeafter complaints of too many low - specificity drug - drug interaction ( ddi ) alerts on qt prolongation , the rules for qt alerting in the dutch national drug database were restricted in 2007 to obviously qt - prolonging drugs . \n the aim of this virtual study was to investigate whether this adjustment would improve the identification of patients at risk of developing torsades de pointes ( tdp ) due to qt - prolonging drug combinations in a computerized physician order entry system ( cpoe ) and whether these new rules should be implemented.methodsduring a half - year study period , inpatients with overridden ddi alerts regarding qt prolongation and with an electrocardiogram recorded before and within 1 month of the alert override were included if they did not have a ventricular pacemaker and did not use the low - risk combination cotrimoxazole and tacrolimus . \n qt - interval prolongation and the risk of developing tdp were calculated for all patients and related to the number of patients for whom a qt - alert would be generated in the new situation with the restricted database.resultsforty-nine patients ( 13% ) met the inclusion criteria . in this study population , knowledge base - adjustment would reduce the number of alerts by 53% . however \n , the positive predictive value of qt alerts would not change ( 31% before and 30% after ) and only 47% of the patients at risk of developing tdp would be identified in cpoes using the adjusted knowledge base.conclusionthe new rules for qt alerting would result in a poorer identification of patients at risk of developing tdp than the old rules . \n this is caused by the many non - drug - related risk factors for qt prolongation not being incorporated in cpoe alert generation . \n the partial contribution of all risk factors should be studied and used to create clinical rules for qt alerting with an acceptable positive predictive value .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in 2009 , the united states ( us ) department of health and human services estimated the \n prevalence of metabolic syndrome ( mets ) to be 35.1% for men and 32.6% for women aged \n 20 years or older1 . \n likewise , in 2012 , the \n korea national health insurance corporation reported that the prevalence of mets in korean \n adults aged over 30 years was 31.4% and 18.4% for men and women , respectively , and it \n continues to increase each year2 . \n these \n numbers indicate that mets is becoming a serious public health issue in both the us and \n korea . \n furthermore , mets is \n associated with an increased risk of cardiovascular disease and type 2 diabetes owing to the \n clustering of metabolic risk factors , including abdominal obesity , hypertension , \n hyperglycemia , and dyslipidemia5 , 6 . \n the prevention and management of mets is centered on weight reduction via lifestyle changes \n such as diet modification and increasing levels of physical activity7,8,9 . \n moreover , most previous studies have reported that weight reduction \n affects all the individual components of mets10 , \n 11 . \n ( 2005 ) \n showed that subjects who lost > 10% of their initial body weight showed greater reductions \n in mets components than subjects who lost < 10% of their initial body weight12 . \n however , although weight reduction via lifestyle modifications is important for the \n prevention and management of mets , little evidence has been accumulated regarding other \n lifestyle - related factors such as sleep duration , mental stress , educational level , economic \n status , and frequency of alcohol consumption and smoking , or their effectiveness in \n preventing or managing mets in koreans . \n therefore , the purpose of this study was to examine \n whether lifestyle - related factors are related to mets in community - dwelling korean \n adults . \n participants : the subjects include 590 men and 1,138 women aged over 20 years who visited a \n health center in seoul , republic of korea to participate in a survey regarding sleep \n duration , mental stress , educational level , economic status , and frequency of alcohol \n consumption and smoking . \n each subject was assessed using the following mets components : waist circumference ( wc ) , \n high - density lipoprotein cholesterol ( hdl - c ) level , blood pressure , triglyceride ( tg ) level , \n and fasting blood glucose level . \n the characteristics of the subjects are shown in table 1table 1.the characteristics of the subjectsvariablemen(n = 590)women(n = 1,138)total(n = 1,728)age ( years)51.0 11.951.3 10.651.2 11.1height ( cm)170.0 5.7157.5 5.3161.5 8.0weight ( kg)71.4 9.357.2 7.661.8 \n 10.5body mass index \n ( kg / m)24.7 2.823.1 3.023.6 3.0metabolic syndrome componentswaist circumference ( cm)84.9 7.376.9 8.079.6 8.6hdl - c ( mg / dl)42.8 \n 13.049.5 14.947.2 14.6sbp ( mmhg)136.3 17.4126.2 18.1129.7 18.5dbp ( mmhg)84.8 12.681.1 12.882.4 12.8triglyceride ( mg / dl)188.2 128.1152.6 93.6164.6 107.8fasting blood glucose ( mg / dl)111.7 38.0110.3 34.6110.8 \n hdl - c : high density lipoprotein cholesterol , sbp : \n systolic blood pressure , dbp : diastolic blood pressure . \n hdl - c : high density lipoprotein cholesterol , sbp : \n systolic blood pressure , dbp : diastolic blood pressure covariate variables : age ( the self - reported ages of the participants were used without any \n modifications ) . \n independent variables : the participants were evaluated on the basis of their responses to 6 \n questions regarding lifestyle - related factors . \n sleep duration : < 5 hours , 6 hours , 7 hours , and > 8 hours ; \n mental stress : very low mental stress , low mental stress , high mental stress , and very high \n mental stress ; educational level : elementary school or lower , middle school , high school , \n and college or higher ; economic status : very poor , poor , rich , and very rich ; frequency of \n alcohol consumption : teetotaller , once a month , 2 or 3 times a month , and > 4 times a \n month ; frequency of smoking : non - smoker , ex - smoker , and current smoker . \n adult \n treatment panel iii , the risk factors for mets are high wc ( 88 cm for women and 102 cm for \n men ) , low hdl - c levels ( < 50 mg / dl for women and < 40 mg / dl for men ) , high blood \n pressure ( 130/80 mm hg ) , high tg levels ( 150 mg / dl ) , and high fasting blood glucose levels \n ( 100 mg / dl ) . according to these criteria , subjects with < 2 of these mets risk factors \n are defined as not having mets and those with 3 of these mets risk factors are defined as \n having mets13 . \n blood was collected from each patient and analyzed for tg , hdl - c , and glucose \n concentrations using an advia 1650 automated analyzer ( bayer healthcare ltd . \n tarrytown , ny , \n usa ) with the pureauto s tg - n , cholestest n - hdl , and hexokinase kits ( daiichi , japan ) , \n respectively . \n wc measurements were taken at the patients midriff , midway between the lower costal margin \n ( below the lower rib ) and the iliac crest ( above the pelvic bone ) , during which the subjects \n stood with their feet approximately 2530 cm apart . \n the measurer fitted the tape around the \n subject s midriff , while exercising caution so as to not compress the underlying soft \n tissues . \n measurements were taken to the nearest 0.5 cm at the end of normal expiration . \n after the participants had rested in a sitting position for > 10 minutes , systolic and \n diastolic blood pressure at the right brachial artery was measured using a mercury \n sphygmomanometer by a specialist nurse . \n two separate blood pressure measurements were taken \n at 2-min intervals and the mean value was determined . statistical analysis : all the results are presented as mean standard deviation . \n multivariate logistic regression analyses were conducted to determine whether \n lifestyle - related factors were related to mets after adjustments for age and sex . \n the results of the multivariate logistic regression analyses of the lifestyle - related \n factors of the healthy and mets groups are shown in table 2table 2.the results of the multivariate logistic regression analyses of the \n lifestyle - related factors of the healthy and metabolic syndrome groups of korean \n adultsprevalence of metabolic syndromeas compared to \n healthy - individualodds ratio95% cisleep duration<5 hours sleep1.0006 hours1.7560.5375.7427 hours1.5900.4615.483>8 hours2.5230.8287.693mental stressvery low1.000low0.9520.4062.236high1.3000.3195.294very high2.394 * 1.0215.614educational levelelementary school or lower1.000middle school0.8100.4471.467high school0.9630.5861.581college or higher1.0300.5881.803economic statusvery poor1.000poor0.8720.5521.377rich1.1000.7371.640very rich2.0990.9454.661frequency of alcohol consumptionteetotaller1.000once a month0.6620.3191.3732 or 3 times a month0.8600.3652.027>4 times a month1.2750.4403.696frequency of smokingnon - smoker1.000ex - smokers0.3940.1361.142current smokers0.6360.2151.885*p<0.05 , tested by multivariate logistic regression analysis after adjustment for \n age and sex . \n * p<0.05 , tested by multivariate logistic regression analysis after adjustment for \n age and sex the odds ratios ( ors ) ( 95% confidence intervals [ cis ] ) for the association between mets and \n sleep duration ( compared with < 5 hours sleep ) were 1.756 ( 0.5375.742 , p=0.352 ) for 6 \n hours , 1.590 ( 0.4615.483 , p=0.463 ) for 7 hours , and 2.523 ( 0.8287.693 , p=0.104 ) for > 8 \n hours . \n the ors ( 95% cis ) for the association between mets and mental stress ( compared with \n very low mental stress ) were 0.952 ( 0.4062.236 , p=0.911 ) for low mental stress , 1.300 \n ( 0.3195.294 , p=0.714 ) for high mental stress , and 2.394 ( 1.0215.614 , p=0.045 ) for very \n high mental stress . \n the ors ( 95% ci ) for the association between mets and educational level \n ( compared with elementary school or lower ) were 0.810 ( 0.4471.467 , p=0.487 ) for middle \n school , 0.963 ( 0.5861.581 , p = 0.880 ) for high school , and 1.030 ( 0.5881.803 , p=0.918 ) for \n college or higher . \n the ors ( 95% cis ) for the association between mets and economic status \n ( compared with very poor status ) were 0.872 ( 0.5521.377 , p=0.557 ) for poor , 1.100 \n ( 0.7371.640 , p=0.641 ) for rich , and 2.099 ( 0.9454.661 , p=0.069 ) for very rich . \n the ors \n ( 95% cis ) for the association between mets and frequency of alcohol consumption ( compared to \n teetotaller ) were 0.662 ( 0.3191.373 , p=0.268 ) for once a month , 0.860 ( 0.3652.027 , \n p=0.731 ) for 2 or 3 times a month , and 1.275 ( 0.4403.696 , p=0.654 ) for > 4 times a month . \n the ors ( 95% cis ) for the association between mets and frequency of smoking ( compared with \n non - smokers ) were 0.394 ( 0.1361.142 , p=0.086 ) for ex - smokers and 0.636 ( 0.2151.885 , \n p=0.415 ) for current smokers . \n the purpose of present study was to examine the relationship between lifestyle - related \n factors and mets in community - dwelling korean adults . \n the results of this study show that \n mets was associated only with mental stress . \n although many previous studies have demonstrated that sleep duration is associated with \n mets14 , the present study did not \n demonstrate this trend in korean adults . \n this finding could be related to the fact that this \n study did not investigate sleep quality parameters such as the sleep - wake cycle or the \n influence of disorders such as sleep apnea . \n therefore , further well - designed studies should \n be performed to determine the effects of sleep quality on mets . \n sygnowska et al . reported that although higher educational level was associated with mets , \n economic status did not affect the severity of mets . in the case of korean adults in this \n study , there was no association between socioeconomic status and mets15 . \n moreover , unlike several other studies16 , 17 , our results show that alcohol consumption and smoking are not \n associated with mets in korean adults . \n this finding might be attributable to the fact that \n this study did not delineate the duration , amount , type , or form of alcohol consumption or \n smoking . \n notably , the or for the association between mets and very high mental stress ( compared with \n very low mental stress ) was 2.394 , indicating that mental stress levels are associated with \n mets . \n pervanidou and chrousos reported that some psychological and physical diseases , such \n as obesity , depression , anxiety disorder , and mets , may be caused or exacerbated by physical \n or emotional stress , regardless of whether they had acute or chronic origins18 . \n the results of our \n study are in agreement with those of other studies in showing that individuals with mets had \n higher mental stress levels than healthy individuals . in summary , sleep duration , \n educational level , economic status , and frequency of alcohol \n consumption and smoking were found not to be associated with mets . \n mental stress was the \n only lifestyle - related factor found to be associated with mets regardless of age or sex in \n korean adults .", "role": "user" }, { "content": "[ purpose ] the aim of this study was to investigate whether lifestyle - related factors are \n associated with metabolic syndrome ( mets ) in community - dwelling korean adults . [ subjects \n and methods ] the subjects comprised 590 men and 1,138 women aged 20 years and above . \n the \n subjects visited a public health promotion center in seoul , republic of korea to \n participate in a survey regarding sleep duration , mental stress , educational level , \n economic status , and frequency of alcohol consumption and smoking . \n mets was defined \n according to the standard definition of the national cholesterol education program s adult \n treatment panel iii report . \n the relationship between lifestyle - related factors and mets \n was assessed using multivariate logistic regression analysis after adjustments for age and \n sex . \n [ results ] sleep duration , educational level , economic status , and frequency of \n alcohol consumption and smoking were not associated with mets . \n mental stress was the only \n lifestyle - related factor associated with mets . \n [ conclusion ] well - designed studies will be \n necessary in order to establish the lifestyle - related factors of mets .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it is recommended that the cuff pressure be maintained between 20 - 30 cm of h2o . \n if it is below the recommended cuff pressures the glottis seal is inadequate and it may lead to micro aspiration . increased cuff pressure leads to tracheal complications , though often associated with long procedures , these complications may occur even after a short duration of anesthesia . \n although cuff pressures are checked initially after intubation , continuous or intermittent measurement of endotracheal tube cuff pressures in the mechanically ventilated patients during anaesthesia and maintaining it within the recommended range is not routinely done . \n neurosurgical procedures are usually long and involve positioning the head in different positions . to our knowledge , there are no studies highlighting the effect of positioning on the changes in the cuff pressure . \n this study is intended to highlight the cuff pressure changes in the neurosurgical patients at different positions and to look for complications due to either excessive or decreased cuff pressure . \n a prospective observational study was conducted at christian medical college , vellore , india in patients undergoing elective neurosurgical procedures for a period of 2 months after getting the ethical clearance . \n seventy asa 1and 2 patients within the age group of 11 - 77 posted for elective neurosurgical procedures were included . \n patients coming for emergency procedures , asa > 3 , pregnant patients , patients with known laryngeal or tracheal pathology , patients intubated with uncuffed tubes and those on tracheostomy were excluded . \n on arrival of the patient to operating room , intravenous ( iv ) cannula was secured on the hand and iv fluid was started . \n the intraoperative parameters monitored include : noninvasive blood pressure ( nibp ) , electrocardiogram ( ecg ) , oxygen saturation ( spo2 ) , end tidal co2 ( etco2 ) and temperature monitoring . \n after preoxygenation for 3 minutes , anesthesia was induced with fentanyl 2 mcg / kg , propofol 1 - 2 mg / kg . \n the trachea was intubated with a high volume low pressure cuffed oral endotracheal tube of appropriate size ( male-8 mm i d and female -7 mm i d portex ) . \n air was inflated through the pilot balloon and the cuff pressure was checked with endotest ( teleflex medical , rush ) and regulated to be between 20 - 30 cms h2o . \n the cuff pressure was checked by the anesthesia provider who was blinded to the study . the volume of air required was noted . \n after intubation , the presence of equal air entry on both the sides were checked with the neck flexion and extension . \n the ventilatory parameters were set at a respiratory rate of 10 - 12/minute , tidal volume of 8 - 10 ml / kg to maintain the end tidal carbondioxide concentration between 28- 32 mmhg . \n patients were maintained with 0.8 mac of isoflurane with 40% oxygen in air and boluses of intravenous fentanyl was given intraoperatively as needed . \n neuromuscular blockade was maintained with a vecuronium infusion until the end of the procedure maintaining two twitches . \n the cuff pressure was checked again after achieving the final position with the head on pins ( b ) , at the end of the procedure on the same position ( c ) and after achieving the supine position , before extubation ( d ) . \n if there was a significant reduction in the cuff pressure after final positioning of the head on pins , which is below 20 cmh2o , then the cuff is inflated again such that the cuff pressure lies between 20 - 30 cms of h2o . \n data parameters collected were entered into the excel sheet and transferred into the spss software ( statistical package for social sciences version 19 ) for the statistical analysis . \n paired sample t - test was used to analyze the differences in cuff pressure within the group at different positions . \n data parameters collected were entered into the excel sheet and transferred into the spss software ( statistical package for social sciences version 19 ) for the statistical analysis . repeated measures anova \n paired sample t - test was used to analyze the differences in cuff pressure within the group at different positions . \n the repeated measures anova ( rmanova ) was initially done to find the existence of significance between the four time positions for the corresponding groups . \n we found a significant difference for the supine ( p < .022 ) and the prone groups ( p < .001 ) . \n a paired sample t - test was conducted between the baseline and the other three time points for each group . \n we observed a significant difference in the cuff pressures between the baseline and before extubation with a p value of 0.000 in the supine group . \n we also observed a highly significant difference in the cuff pressures between the baseline and final positioning , end of procedure , and before extubation with p values less than . \n tables 2 and 3 shows the t - test results for the supine and prone population . \n none of the complications such as sore throat , stridor and hoarseness was noted postoperatively in any patient . \n p<.05 is considered statistically significant descriptive statistics and t - test results for the neurosurgical procedures in prone position . \n our study shows a significant reduction in the endotracheal cuff pressures from the initial supine position to the further end points in the study in the patients undergoing neurosurgical procedures [ figure 1 ] . \n it is more obvious in the patient population who underwent procedures in supine and prone [ figures 2 and 3 ] . \n we could nt comment on the patient population who underwent procedures in the lateral and sitting position as the numbers were insufficient . \n line graph showing mean cuff pressure against four different time points during two positions namely supine and prone changes in cuff pressure at four different time points in the supine group . \n the values are represented as mean and 95% confidence interval changes in cuff pressure at four different time points in the prone group . \n the values are represented as mean and 95% confidence interval once the head is supported on pins , it is likely that the neck is no longer held firmly against the back of the table but is free . \n the tension on the posterior laryngeal structures is reduced hence the drop in the cuff pressure . \n the reduction in the cuff pressure might have probably occurred the moment the neck was freed , even before our first measured time point which is after final positioning of the patient . \n we could nt appreciate that as we measured the cuff pressure only at four time points since recurrent intermittent measurements of the cuff pressure by itself reduces the cuff pressure . \n there are several factors responsible for the changes in the cuff pressures , which are time , positive pressure ventilation , use of nitrous oxide , altitude , measurement of the cuff pressure , muscle relaxation , sedation , hypothermia , different neck and body positions , endotracheal tube positions , duration of intubation , pathologic factors such as laryngeal edema , bronchoconstriction and etc . \n sole et al . , have showed that the cuff pressure over time results in the reduction of cuff pressure and our study agrees with their findings . \n skeletal muscle tone and the consciousness in the patients are responsible in maintaining the upper airway structures and the laryngeal dimensions in position . in the supine position , during the induction of anesthesia , loss of consciousness is associated with loss of the tonicity of the muscles around the neck which results in the posterior displacement of upper airway structures , gravity in part also plays a role in the posterior displacement of the upper airway structures by the loss of activity of the muscles during induction of anesthesia , this might have resulted in the reduction of the cuff pressures initially and the continuous level of unconsciousness provided by the adequate level of depth of anesthesia and paralysis over time would have resulted in the reduction of cuff pressures over a period of time . \n studies have shown that the use of muscle relaxant results in the reduction of the cuff pressure . \n induction of anesthesia and neuromuscular blockade results in the reduction of oropharyngeal dimension and increase in the laryngeal dimensions because of the loss of the muscular tension around the neck . \n anatomic relationship between the endotracheal tube and the larynx constantly fluctuates because of the changing levels of consciousness and muscle relaxation . \n this causes an undue strain on the laryngeal structures which might result in the variations in the cuff pressure . in our case , since we maintained a mac of 0.8 and a continuous infusion of muscle relaxant , the patient was kept at an adequate level of anesthesia at all times and a continuous drop in cuff pressures was noticed . \n patients inter individual variability such as the anatomy of trachea , cuff positioning over trachea and cuff physical characteristics such as material , diameter , thickness , compliance , geometry are also the factors which influence the cuff pressure . \n different body positions results in wide variations in cuff pressure , there are conflicting results observed by different authors in the measurement of the cuff pressures in different positions . \n our study showed a significant reduction of cuff pressure over a period of time in both the supine and prone population . \n few authors have explained the importance of endotracheal tube positioning and the variations of cuff pressures . \n lower cuff pressures have been observed in the patients frequently when the endotracheal tubes have gone deeper into the trachea . during extension of the head \n in neurosurgical procedures , positioning often involves some element of flexion and extension along with mild rotation of the neck , which may further add on to the decrease in cuff pressures . \n multiple mechanical factors such as a defect in the inflation valve , pilot balloon and the cuff itself can result in the decrease in cuff pressure ; in our case we checked all the endotracheal tubes for cuff leak before intubating the patient . \n there are a few limitations to our study ; continuous measurement of the cuff pressures was not done . \n we could not comment on the cuff pressure changes in the patients who underwent procedures in lateral and sitting position as the sample size was insufficient . \n the relationship between the duration of surgery and decrease in cuff pressure was not studied . \n long term assessment for the postoperative complications such as sore throat , stridor and hoarseness was not been assessed . \n the effect of this decrease in cuff pressure during surgery is probably more significant in the sub group of patients who undergo emergency surgery rather than elective surgery where the chances of aspiration are much higher and the need for cuff pressure to be regulated between 20 - 30 cms of h2o is mandatory . \n to conclude , cuff pressure has to be checked after achieving the final position with the head on mayfield clamp and adjusted to the prescribed limits to prevent micro aspiration . \n whenever the patient position is changed , care must be taken to adjust the cuff pressure within the prescribed limits . \n frequent intermittent measurement or continuous measurement of endotracheal tube cuff pressures where available is warranted in all the neurosurgical patients . \n the clinical significance of these cuff pressure variations in neurosurgical population needs to be further studied in a larger study groups in all positions . \n \n ", "role": "user" }, { "content": "background : placement of a cuffed endotracheal tube for the administration of general anesthesia is routine . the cuff of the endotracheal tube is inflated with air to achieve an adequate seal to prevent micro - aspiration . over inflation of \n the cuff can decrease the mucosal perfusion , leading to pressure necrosis and nerve palsies . \n inadequate seal can lead to micro aspiration . \n so the cuff pressure has to be monitored and kept within the prescribed limits of 20 - 30 cms of water.aim of the study : to observe the effect of different positions on the endotracheal cuff pressure in patients undergoing neurosurgical procedures.materials and methods : this is an observational study conducted on 70 patients undergoing neurosurgical procedures in various positions . \n after intubation , the cuff pressure was checked with a cuff pressure manometer , endotest ( teleflex medical , rush ) and adjusted to be within the allowable pressure limits as is the routine practice . \n the cuff pressure was checked again at three time points after achieving the final position with the head on pins , at the end of the procedure and before extubation . \n various factors such as the age , position , duration of surgery were studied . \n there were no major complications like aspiration , stridor or hoarseness of voice post extubation in any of the patients.results:a significant decline in the cuff pressures were noted from the initial supine position to extubation ( p < .001 ) in the supine group . \n also a significant decline in the cuff pressures were found in the prone group from their initial intubated supine position to all the other three corresponding time points namely after final positioning ( p < .001 ) , at the end of the procedure ( p < .001 ) and before extubation ( p < .001).conclusion : cuff pressure has to be checked after achieving the final positioning of the patient and adjusted to the prescribed limits to prevent micro aspiration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the development of novel therapeutic systems that would be effective against intractable central nervous system ( cns ) diseases such as alzheimer s disease , parkinson s disease , and brain tumors is expected to bring about breakthroughs in the future . in order to achieve therapeutic effectiveness , novel \n drug delivery systems capable of reaching target tissues are needed , in addition to new drugs . in general , the blood brain barrier ( bbb ) poses a major challenge to the drug development efforts targeting cns disorders , since it limits the distribution of systemically administered therapeutics to the cns.1,2 therefore , the development of effective delivery systems capable of achieving therapeutic drug concentrations in the brain is of major interest not only in pharmaceutical research but also in the clinical field . \n recently developed methodologies for brain drug delivery have been characterized as either invasive or non - invasive . \n the invasive methodologies consist of direct drug delivery by means of intraventricular or intracerebral administration and temporary disruption of the bbb , allowing the drug to enter the cns.3 non - invasive methodologies involve systemic drug delivery that uses drug carriers to deliver agents through a receptor - mediated or adsorptive transcytosis,4 or alternatively , by bypassing the bbb by using the nose - to - brain route.59 intranasal delivery is a recognized non - invasive method of direct delivery of drugs to the cns.59 in general , drugs administered through the nose - to - brain route are widely distributed within the cerebral regions , typically by migrating to the olfactory nerve , which is located in the epithelial tissue of the nasal olfactory mucosa inside the nasal cavity . \n 1012 migration also occurs along the trigeminal nerve in the nasal cavity respiratory mucosa.1012 transport may also occur through the capillaries , lymphatics , and cerebrospinal fluid present in the nasal mucosa or by nasal mucociliary movement.1014 low - molecular - weight drugs,15,16 peptides,10,17 proteins,18,19 small interfering ribonucleic acid ( sirna),20,21 and cells2224 are reported to reach the cns following intranasal delivery in animals.13 in addition , insulin,2529 melanocortin,3033 angiotensin ii,34 vasopressin,35 and oxytocin3641 were shown to be directly delivered to the cns following intranasal administration in humans.13,42 intranasal administration also provides a painless and convenient route that could be used for self - administration of drugs by patients.912,43 therefore , nose - to - brain delivery is a highly versatile route , which , in combination with novel drugs being developed for treating intractable cns diseases , is a promising approach for the treatment of disorders such as alzheimer s disease , parkinson s disease , and brain tumors . \n furthermore , nano - sized drug carriers may improve nose - to - brain drug delivery by their capability to increase the stability of the encapsulated drug against chemical and biological degradation . \n the modification of the surface of nanocarriers with the incorporation of cell - penetrating peptides ( cpps ) could further improve the specific drug delivery into the target cells . in this review \n , we will introduce our studies evaluating anti - cancer drugs and/or sirnas delivery to the brain using a combination of the nose - to - brain route and cpp - modified polymer micelles.4447 \n a key property of the amphiphilic block copolymer is its capability to form nano - sized micelles by self - assembly in a particular solvent.4850 the nano - sized polymer micelles have been utilized as core - shell - type colloidal carriers for delivery of drugs and genes.5153 the use of these carriers could increase the availability of drugs to the cns , since their small diameter would potentially allow the nanoparticles to be transported transcellularly along the neurons to the brain through various endocytic pathways of sustentacular or neuronal cells present in the nasal membrane.11 we selected methoxypolyethylene glycol ( mpeg)-polycaprolactone ( pcl ) ( mpeg - pcl ) co - polymers , which can be used to form nano - sized micelles , as nanocarriers and prepared coumarin - loaded mpeg - pcl micelles at a range of diameters . at first , we examined the brain- and bio - distribution of fluorescein model drugs ( coumarin ) in rats following intranasal administration of coumarin - loaded mpeg - pcl micelles , ranging in diameter from 100 to 600 nm.44 no significant difference was observed between micelles with diameters ranging from 200 to 600 nm . \n coumarin concentration in the brain following administration of coumarin - loaded peg - pcl micelles with a diameter of 100 nm was significantly higher than that observed with micelles of a larger diameter , indicating that nano - sized polymer micelles with a diameter of around 100 nm can facilitate nasal absorption and increase the delivery of drugs into the cns . in previous reports \n , smaller diameters may allow nanoparticles to be transported to the brain through various endocytic pathways of sustentacular or neuronal cells in the olfactory membrane.6,11,12,43,54 therefore , these findings indicate that small nanoparticles are the most promising for use in intranasal brain delivery . \n the coumarin concentrations in non - targeted tissues , such as the liver , heart , kidney , and spleen , were found to be lower than those measured in the brain , indicating that intranasal administration of drugs may decrease the risk of side effects in non - cns tissues . \n we compared the efficiency of brain delivery following intravenous and intranasal routes of administration of mpeg - pcl nanomicelles.44 as shown in figure 1a , the amount of coumarin measured in brain tissue after intranasal administration was significantly higher than that observed after intravenous administration , providing further evidence that the intranasal route is an effective method for brain - targeted drug delivery . \n additionally , the duration of coumarin presence in blood circulation after intranasal administration was significantly shorter than that observed after intravenous injection ( figure 1b ) . \n in particular , we were only able to detect very low levels of coumarin in the blood of rats following intranasal administration of coumarin - loaded mpeg - pcl micelles , indicating that drugs loaded within the micelles are delivered intranasally directly to the brain without significant leakage into systemic circulation . \n however , coumarin was found to enter the systemic blood circulation soon after intranasal administration of coumarin solution alone . \n therefore , administration of drug solution is associated with the risk of side effects resulting from toxic effects on non - cns tissues . \n these findings suggest that intranasal delivery of drugs into brain tissue using nano - sized micelles is more likely to be effective and less likely to produce side effects in non - cns tissues . \n the cpps , which are cationic or amphiphilic molecules derived from sources such as the human immunodeficiency virus tat protein and drosophila antennapedia homeoprotein , can enhance the intracellular delivery of molecules.55 a basic domain of tat was previously reported to be the minimum sequence responsible for cellular uptake mediated by the 11-amino acid epitope ygrkkrrqrrr.56 conjugation of the cpp to the surface on the nanocarriers was expected to increase the penetration across the nasal mucosa and target cell membrane into the brain . \n therefore , we developed mpeg - pcl copolymers conjugated with tat peptide ( mpeg - pcl - tat ) and evaluated the potential for intranasal brain delivery of coumarin - loaded mpeg - pcl - tat micelles ( figure 2).44 mpeg - pcl - tat micelles showed high loading efficiency of coumarin . \n mpeg - pcl - tat micelles had a smaller particle size ( diameter of approximately 100 nm ) than the mpeg - pcl micelles without tat and exhibited a positive charge , whereas mpeg - pcl micelles were negatively charged . \n these findings suggest that synthesized mpeg - pcl - tat forms nanoparticles , possibly as polymer micelles . \n tat is almost completely presented on the surface of the polymer micelles , since mpeg - pcl - tat nanoparticles exhibited the positive charge of the tat peptide . \n we first compared the efficacy of nose - to - brain delivery between mpeg - pcl and mpeg - pcl - tat micelles . at 4 hours following intranasal administration , coumarin concentration in brain tissue of rats administered \n coumarin - loaded mpeg - pcl - tat was significantly higher than in rats administered coumarin - loaded mpeg - pcl micelles . \n we subsequently determined the biodistribution of coumarin in rats after intranasal administration of coumarin - loaded mpeg - pcl - tat micelles . \n as shown in figure 3 , the concentrations of coumarin in non - targeted tissues , such as liver , lung , heart , kidney , and spleen , in rats administered coumarin - loaded mpeg - pcl - tat were lower than those measured following administration of coumarin solution without the polymer micelles . \n these findings indicate that cpp - modified nano - sized micelles can improve the nose - to - brain drug delivery . \n although chemotherapy is widely applied in treatment of brain tumors , the outcomes continue to be unsatisfactory . \n in general , an increase in local anti - cancer drug concentration in the tumor tissue improves the outcome of the drug treatment . \n therefore , we expected that the delivery of anti - cancer drugs using a combination of nose - to - brain route and mpeg - pcl - tat micelles could increase the concentration of drugs at the intracranial tumors and suppress their growth.45 therefore , we prepared mpeg - pcl and mpeg - pcl - tat micelles loaded with the anti - cancer drug camptothecin ( cpt ) . \n the particle size of cpt - loaded mpeg - pcl and mpeg - pcl - tat micelles was slightly larger than that before cpt loading . \n cpt encapsulation efficiencies of mpeg - pcl and mpeg - pcl - tat were determined to be around 60% . \n we evaluated the in vitro cytotoxicity in c6 rat glioma cells at a range of cpt concentrations . \n cpt - loaded tat - modified mpeg - pcl exhibited stronger cytotoxicity than cpt - loaded mpeg - pcl . \n this observation may be due to the improved cellular uptake efficiency of cpt - loaded mpeg - pcl - tat micelles by modification with cpp tat on the surface of micelles . \n cpt - free mpeg - pcl - tat did not exhibit any cytotoxicity at the higher concentrations tested . \n these results indicate that tat - modified micelles strongly interact with the c6 rat glioma cells . \n tat - modified polymer micelles would therefore be expected to result in greater delivery of cpt to tumor cells than polymer micelles without tat . \n we next determined the in vivo therapeutic effects in a rat model of intractable malignant glioma . \n cpt - loaded mpeg - pcl - tat micelles exhibited high therapeutic efficiency after 7 days of continuous administration , unlike cpt - loaded mpeg - pcl . \n this observation suggests that tat - modified mpeg - pcl micelles may be more effective because of high penetration of small molecule anti - cancer drugs across the nasal epithelium . \n the specificity achieved with intranasal delivery appears to be superior to the results obtained with the administration of simple cpt solution , which reportedly results in high drug levels in the systemic circulation . \n sirna has great potential as a therapeutic agent against cns diseases.5761 although the potential of using sirna - based therapies against cns disorders has been successfully demonstrated through in vitro studies , the function of bbb poses a major challenge to the drug development efforts aimed at treating cns disorders . \n therefore , the development of effective strategies that would enhance sirna delivery to the brain is of great interest for both the clinical and pharmaceutical fields . in order to improve the efficiency of brain sirna delivery systems , we developed an approach that combines sirna nose - to - brain delivery system with cpp - modified nano - sized micelles.46 significantly higher brain penetration was observed following intranasal administration of mpeg - pcl - tat to rats than with intravenous injection , suggesting that superior delivery of nucleic acid to the brain is possible using peptide - modified micelles . additionally , in our study of the mechanisms that promote nucleic acid transfer to the brain following intranasal administration using mpeg - pcl - tat , we focused on the olfactory and trigeminal nerves , which are the two reported pathways of drug transport to the brain from the nasal cavity . \n first , nasal mucosal tissue was observed 15 minutes after intranasal administration of naked sirna and complexes of sirna with mpeg - pcl - tat micelles . as shown in figure 4 \n , animals administered sirna complexed with mpeg - pcl - tat exhibited more intense fluorescence in the mucosal epithelial surface and lamina propria mucosae than the animals administered naked sirna , indicating that mpeg - pcl - tat exhibits high mucosal penetration . \n next , we assessed the distribution of the sirna to the olfactory bulb after intranasal administration and found a significantly higher transfer of the sirna to the olfactory bulb in the mpeg - pcl - tat - treated animals , as compared to those administered the naked sirna ( figure 5 ) . \n this finding suggests that the use of mpeg - pcl - tat may increase the transfer of nucleic acid to the brain via the olfactory nerve pathway in the nasal mucosal tissue . \n additionally , the observation of the trigeminal nerve after intranasal administration detected higher transfer of the fluorescein - labeled model sirna ( dextran , molecular weight : 10,000 ) to the trigeminal nerve in the mpeg - pcl - tat group than in animals administered fluorescein - labeled model sirna alone . \n this observation suggests that , as with the olfactory nerve , mpeg - pcl - tat may also enable the nucleic acid to be delivered to the brain via the trigeminal nerve . \n figure 6 demonstrates the distribution in the whole brain , from olfactory bulb to the brainstem , over time , measured following intravenous or intranasal administration of anionic dextran labeled with alexa fluor 678 ( molecular weight : 10,000 ) , ( alexa - dextran ; life technologies , carlsbad , ma , usa ) model sirna with and without mpeg - pcl - tat . while the fluorescence of alexa - labeled model sirna did not distribute in the whole brain following intravenous administration , high accumulation \n was observed in the olfactory bulb 15 minutes after administration via the nose - to - brain pathway , both with or without mpeg - pcl - tat . \n one hour after intranasal administration with mpeg - pcl - tat , high accumulation was observed in the rostral brain tissue that appeared to follow the distribution trend into the olfactory bulb , while the caudal brain tissue and brain stem exhibited a high concentration that appeared to follow a distribution trend into the trigeminal nerve . \n taken together , these observations suggest that , once transported to the olfactory bulb and brain stem via the olfactory nerve and trigeminal nerve pathways , nucleic acid is subsequently transported to other brain tissues . \n this shows that the proposed system of delivery of nucleic acid to the brain by intranasal administration using mpeg - pcl - tat relies primarily on an increase in the transfer of nucleic acid to the brain via the olfactory nerve and trigeminal nerve pathways . \n we investigated intranasal delivery of sirna / drug co - loaded mpeg - pcl - tat micelles using a rat model of malignant glioma.47 the mpeg - pcl - tat / sirna complex and cpt - loaded mpeg - pcl - tat / sirna complex exhibited micelle diameters of approximately 60200 nm , with a tendency of size to decrease as the ratio of amine to nucleic acid ( n / p ratio ) increased . \n the zeta - potential of these complexes was found to increase with increasing n / p ratio . \n furthermore , on evaluation by the sybr green exclusion assay ( takara bio inc . , \n shiga , japan ) , the fluorescence intensity from siraf-1 of mpeg - pcl - tat / siraf-1 complexes strongly decreased at an n / p ratio of 1 ( 10% ) , compared with that of naked sirna ( 100% ) . \n these results indicate that mpeg - pcl - tat and cpt - loaded mpeg - pcl - tat could form a stable complex with sirna . \n we subsequently determined the cellular uptake of sirna and evaluated its in vitro cytotoxicity in rat glioma c6 cells . \n the intracellular sirna uptake of sirna / mpeg - pcl - tat complexes increased with increasing n / p ratio , with the highest intracellular uptake efficacy observed with the complexes at an n / p ratio of 30 . to evaluate the in vitro transfection efficiency of the mpeg - pcl - tat / sirna complexes at an n / p ratio of 30 , we assessed the cytotoxicity induced by raf-1 gene silencing in c6 cells using the wst-8 assay ( dojindo laboratories , kumamoto , japan ) . \n these results showed that the cell viability significantly decreased with an increase in the concentration of raf-1 sirna ( siraf-1 ) , indicating that mpeg - pcl - tat / siraf-1 induces cell death in rat glioma cells due to the high cellular uptake of siraf-1 by mpeg - pcl - tat carrier . \n we finally evaluated the in vivo therapeutic effects in glioma model rats of intranasally administered naked siraf-1 without any micelles , mpeg - pcl - tat / control sirna , mpeg - pcl - tat / siraf-1 complex , cpt - loaded - mpeg - pcl - tat micelles / control sirna complex , and cpt - loaded mpeg - pcl - tat micelles / siraf-1 complexes . \n mpeg - pcl - tat / siraf-1 complex , cpt - loaded - mpeg - pcl - tat micelles / control sirna complex , and cpt - loaded mpeg - pcl - tat micelles / siraf-1 complexes showed high therapeutic efficacy after 7 days of continuous delivery . \n these results indicate that mpeg - pcl - tat improved the delivery of sirnas and cpt to the brain , and showed a marked prolongation of the mean survival period . \n no cytotoxicity was detected in neuronal cells and no signs of macroscopic damage in rat nasal mucosa , olfactory and trigeminal nerves , and brain tissue were observed . \n through the review , we have shown that the use of polymer micelles with surface - loaded tat peptide in the intranasal administration of drugs and sirnas enables the non - invasive delivery of therapeutic agents to the brain by increasing the transfer of drug or sirna to the cns from the nasal cavity . \n we feel that this review offers important insight that can be applied to improve drug delivery to the brain and shows the potential of using drug - loaded surface - loaded polymer micelles against intractable neuropsychiatric disorders , brain tumors , and cerebral infarction .", "role": "user" }, { "content": "recently , the development of effective strategies for enhancing drug delivery to the brain has been a topic of great interest in both clinical and pharmaceutical fields . in this review , \n we summarize our studies evaluating nose - to - brain delivery of drugs and small interfering ribonucleic acids in combination with cell - penetrating peptide - modified polymer micelles . \n our findings show that the use of polymer micelles with surface modification with tat peptide in the intranasal administration enables the non - invasive delivery of therapeutic agents to the brain by increasing the transfer of the administered drug or small interfering ribonucleic acid to the central nervous system from the nasal cavity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: for many years , anomalies of the cerebellum and brain stem were poorly reported in the scientific literature . \n the cerebellum was believed to have a minor role in brain function , while the brain stem was difficult to remove intact at autopsy and difficult to section . \n radiologic analysis of these structures by pneumography , angiography , and x - ray computed tomography was poor . \n recently , however , advances in developmental genetics , neurobiology , molecular biology , and neuroimaging have led to better understanding of developmental disorders of the embryonic midbrain ( mb ) and hindbrain ( hb ) , which grow into the adult brainstem and cerebellum ( barkovich et al . \n although malformations of the brainstem and cerebellum may be the only recognized abnormality in individuals with mental retardation or autism ( soto - ares et al . \n , 2003 ; courchesne et al . , 2005 ) , they are more commonly identified in patients with malformations of the cerebrum . among the most common of these are lissencephalies ( ross et al . , 2001 ; lecourtois et al . , 2010 ) , \n cobblestone malformations of the cortex ( formerly known as lissencephaly type ii ) resulting from defects in the pial limiting membrane ( van reeuwijk et al . , 2006 ; \n clement et al . , 2008 ; hewitt , 2009 ) , anomalies of the cerebral commissures ( barkovich et al . , 2007 ) , and disorders of primary cilia function that include additional ocular , renal , hepatic , and limb bud anomalies ( lancaster et al . \n . the number and complexity of recognized malformations of the brainstem and cerebellum has been steadily increasing . \n these disorders were recently extensively reviewed and classified ( barkovich et al . , 2009 ) . \n this review will highlight a few mb - hb malformations and emphasize how knowledge of basic research in embryology , genetics , and cellular and molecular biology of the developing brain can be of importance in recognizing , understanding , and classifying these anomalies in humans . \n malformations of the mb or hb secondary to defects in anteroposterior ( ap ) or dorsoventral ( dv ) patterning were nearly impossible to identify in neurology patients until magnetic resonance imaging became a commonly used tool in clinical diagnosis . \n the ability to acquire high resolution , high contrast , distortion - free images in sagittal and coronal planes allowed accurate gross assessment of mb - hb structures for the first time . \n however , the structures within the mb - hb are small and move with cardiac pulsations ; therefore , physicians were slow to recognize subtle distortions in their structure and recognize their importance in developmental disorders . \n as a consequence , physicians have only recently begun to look for subtle variations in them . only in the past 10 years have these malformations been fairly consistently identified and associated with normal developmental processes and their derangements ( jen et al . \n , 2004 ; bednarek et al . , 2005 ; moog et al . , 2005 ; sicotte et al . , 2006 ; \n barkovich et al . , 2007 ; barth et al . , 2007 ; jissendi - tchofo et al . , \n the easiest malformations to identify are those due to disturbed ap patterning , particularly at the mb - hb junction , which is defined in mice ( and presumably in humans ) by a balance of otx2 and gbx2 signaling that defines the position of the isthmus organizer ( iso ) ( wassef and joyner , 1997 ; millet et al . , 1999 ; chizhikov and millen , 2003 ) . \n the iso ultimately defines the posterior limit of the mb and the anterior limit of the cerebellum ( chizhikov and millen , 2003 ) ( figure 1a ) . \n the combination of a shortened mb and elongated pons associated with an enlarged anterior vermis in humans ( figure 1b ) , therefore , presumably results from rostral displacement of the iso , with loss of mb and gain of r1 [ from which the cerebellum forms , with the vermis deriving from the most rostral portion ( broccoli et al . , 1999 ; chizhikov and millen , 2003 ) ] ; this malformation is presumed to result from gbx2 predominance over otx2 and consequent rostral malpositioning of the iso ( chizhikov and millen , 2003 ; barkovich et al . , 2009 ) . \n this finding has been described in opitz g / bbb syndrome ( os ) , an x - linked form of which is caused by loss of function mutations of the mid1 gene ( quaderi et al . , 1997 ) . \n mid1 plays a role in the ubiquitin - specific regulation of the microtubule associated catalytic subunit of protein phosphatase 1ac ( aranda - orgills et al . , 2008 ) . \n imaging shows hypoplasia of the anterior cerebellar vermis ( pinson et al . , 2004 ; fontanella et al . , \n in addition to cerebellar vermian hypoplasia , these mice show shortening of the posterior dorsal mb , rostralization of the mb - hb , and down - regulation of fgf17 , a key transcription factor in the region ( lancioni et al . , 2010 ) . \n this is another area in which applying learning from human disease is helping to understand development in the mb - hb region . \n disorders of ap patterning in the brain stem.(a ) anteroposterior patterning and the isthmus organizer . \n regionalization of the brain starts with the formation of patterning centers that secrete signaling molecules such as the fibroblast growth factors ( fgfs ) . \n fgf8 and fgr17 are important signaling molecules at both the anterior forebrain and the mb - hb junction . in the forebrain \n , it helps to direct formation of the prefrontal cortex and other rostral structures by inducing cells to secrete the transcription factor pax6 . at the mb - hb junction , \n the patterning center known as the isthmus organizer ( iso ) is localized and induced to secrete fgf8 and fgf17 by the interaction of transcription factor gbx2 from the rhombencephalon and otx2 from the caudal mesencephalon . \n the secretion of fgf8 and fgf17 then induces further changes crucial to formation of the mb - hb junction and the formation of the cerebellum . \n the junction of the diencephalon ( di ) and mesencephalon ( mes ) is directed by the interaction of pax6 from the diencephalon and en1/pax2 from the rostral mesencephalon . \n repression of otx2 expression by fgf8 induces gbx2 formation to establish the location of the mb - hb junction and can affect cerebellar formation , as the cerebellum forms from the most rostral portion of the hb . \n similarly , alterations of pax6 or en1/pax2 will alter the location of the diencephalic - mesencephalic junction . \n ( b ) sagittal t1 weighted image shows a short mb , long pons , and large superior vermis ( black arrows ) , suggesting an abnormality of anteroposterior patterning with rostral misplacement of the isthmus organizer . \n ( c ) sagittal t1 weighted image shows a slightly small pons and a short , thick medulla ( white arrows ) with an abnormal pontomedullary transition . \n this is postulated to result from mixed gains and losses of rhombomere expression in the developing rhombencephalon or potentially a segmental shift of rhombomeres . \n ( d ) sagittal t2 weighted image shows a very elongated mb ( white arrows ) with small , short pons ( black arrow ) , and small cerebellar vermis , suggesting caudal displacement of the isthmus organizer due to abnormal anterioposterior patterning from overexpression of otx2 . \n shortening and thickening of the medulla ( figure 1c ) ( barkovich et al . , 2009 ) is postulated to result from mixed gains and losses of the eight rhombomeric segments within the pons and medulla or a segmental shift of rhombomeres ; rhombomeres may be absent or they may be misexpressed , taking on characteristics of other rhombomeres . \n such anomalies give the brain stem an abnormal shape ( figures 1c , d ) . \n similar abnormalities result from murine embryo exposure to retinoic acid , which causes a dose - dependent anterior to posterior transformation of cell fate in which the hb is expanded at the expense of the mb and forebrain ( lumsden , 2004 ) . \n lesser changes in gradients of retinoic acid or other regionalizing molecules could result in transformations of the middle rhombomeres from pontine to medullary fate . \n such changes are difficult to assess with current imaging techniques but may become possible as higher resolution / high field strength mr scanners are developed , along with better tractography programs . \n just as rostral displacement of the mb - hb junction is expected to increase the size of rhombomere 1 , caudal displacement of the iso [ presumably due to increased otx2 ( broccoli et al . , 1999 ) ] would be expected to elongate the mb , and shorten the pons ( particularly the r1 segment ) ; the expected result would be cerebellar hypoplasia , particularly affecting the vermis ( which is formed from the most rostral aspect of r1 ) ( chizhikov and millen , 2003 ) . \n indeed , in the few cases observed clinically with an elongated mb and small pons , the cerebellum has always been small ( figure 1d ) . \n cerebellar hypoplasias are common findings in autopsy studies and in clinical neuroimaging and have many causes ( barkovich et al . , 2009 ) . \n although cerebellar hypoplasia may be an isolated finding , it is usually associated with other anomalies , which may be either supratentorial or infratentorial . \n the dandy walker malformation and related disorders ( cerebellar hypoplasia , mega cisterna magna , and blake pouch cysts ) are composed of a grouping of abnormalities of the cerebellum , its surrounding mesenchyme , and sometimes cerebral structures ; this variable combination of features has generated considerable confusion and controversy ( raybaud , 1982 ; raimondi et al . , 1984 ; barkovich et al . , 1989 ; tortori - donati et al . , \n the dandy walker malformation , as initially defined , consists of an enlarged posterior fossa with a high position of the tentorium cerebelli , counterclockwise rotation and hypoplasia of the cerebellar vermis , and a dilated , cystic - appearing fourth ventricle that fills nearly the entire posterior fossa , presumably due to cyst - like expansion of the fourth ventricle ( figure 2a ) ( hart et al . \n the cerebellar hemispheres are usually small and corpus callosal anomalies are found in as many as 20% of affected individuals ( barkovich et al . , 1989 ) . \n significant variation in cerebellum , brain stem , surrounding csf spaces , and associated supratentioral anomalies of all degrees may be found , however , in the malformation complex . \n indeed , considerable variation can be seen in families with the same genetic mutation ; the phenotype ranges from mild vermian hypoplasia to mega cisterna magna to varying severities of true dandy walker malformation ( grinberg et al . , 2004 ; aldinger et al . , 2009 ; blank et al . , 2011 ) . \n it is noteworthy that foxc1 , which has been shown to cause this malformation complex in families , is expressed only in the mesenchyme overlying the cerebellum and not in the cerebellum itself ( aldinger et al . , 2009 ) . \n similar ranges of posterior fossa anomalies have been described with deletion of 3q24 ( loss of zic1zic4 ) ( grinberg and millen , 2005 ) , duplication of 9p ( melaragno et al . , 1992 ; cazorla calleja et al . , 2003 \n deletion of 13q2 ( mccormack et al . , 2003 ; ballarati et al . , 2007 ) , and deletion of 2q36.1 [ which contains the pax3 gene , strongly expressed in the developing cerebellum ( jalali et al . , 2008 ) ] , as well as in neurocutaneous melanosis [ a dysplasia of the leptomeninges that is most severe in the basal meninges around the brain stem and cerebellum ( narayanan et al . , 1987 ; barkovich et al . \n , mb - hb hypoplasia is only seen in neurocutaneous melanosis when melanosis is present in the meninges surrounding the brain stem and cerebellum , supporting the hypothesis that the developing leptomeninges have significant effects upon mb - hb development ( aldinger et al . , 2009 ) . \n based upon all of these observations , it may be suggested that ( 1 ) the surrounding mesenchyme affects growth of the developing cerebellum during embryogenesis , and ( 2 ) mutations resulting in dysgenesis of both the cerebellum and its overlying mesenchyme are likely to be necessary for the entire dandy \n walker malformation complex to form , with less severe dysgenesis resulting in malformations such as isolated cerebellar hypoplasia or isolated dysgenesis of the surrounding mesenchyme . in light of this information \n walker malformation be considered in the group of mesenchymal - neuroepithelial signaling defects ( barkovich et al . , 2009 ) . \n from this perspective , it follows that retrocerebellar arachnoid cysts and enlargement of the cisterna magna ( called mega cisterna magna , an enlarged posterior fossa secondary to an enlarged cisterna magna , but a normal cerebellar vermis and fourth ventricle , figure 2b ) are a part of the dandy walker spectrum from an embryogenesis perspective . \n in addition , the so - called persistent blake pouch cyst , where the ependymal wall of the fourth ventricle extends through the foramen of magendie and upwardly rotates a normal cerebellar vermis ( figure 2c ) , is sometimes considered a part of the spectrum . however , in the absence of mass effect ( causing hydrocephalus ) or associated cerebral / cerebellar dysgenesis , none of these findings seem to be of clinical significance ; neurological and cognitive development seem to be related , instead , to the level of control of hydrocephalus , to the extent of associated supratentorial anomalies ( golden et al . , 1987 ; maria et al . , 1987 ; bindal et al . , 19901991 ) , and to the degree of cerebellar dysgenesis , manifested as lobulation of the vermis \n ; normal lobulation is associated with good intellectual outcome whereas some have found that abnormal vermian lobulation is associated with poor intellectual outcome ( boddaert et al . \n the concept and range of cerebellum / posterior fossa disorders in the dandy walker spectrum.(a ) illustration of developing fourth ventricle / cerebellum and the impact of impaired egress of csf . during normal development , the wall fourth ventricle normally thins , and the foramen of magendie forms , in the midline . \n if the leptomeninges are abnormal , the cerebellum may be small and the outflow foramina of the fourth ventricle may not form . \n the fourth ventricle expands posteriorly ( small black arrows ) and superiorly , pushing the small cerebellar vermis ( cb ) counterclockwise ( large black arrow ) ; the posterior fossa then enlarges . \n small black pf signifies pontine flexure , small black mf signifies mesencephalic flesure , large black p signifies prosencephalon , large black m signifies mesencephalon , large black r signifies rhombencephalon . \n sagittal t2 weighted image shows the classic appearance with a small vermis ( black arrow ) , rotated counterclockwise with abnormal foliation . \n the surrounding csf spaces are markedly enlarged with abnormally enlarged posterior fossa and elevation of the tentorium cerebelli and the torcular herophili . \n ( c ) mega cisterna magna is a condition in which a collection of csf in an enlarged cisterna magna ( c ) expands the posterior fossa but the midbrain and hindbrain are normal . \n it is seen in patients with gene mutations that , in siblings , cause the classic dandy walker malformation . \n ( d ) blake pouch cyst is a condition in which the ependymal wall of the fourth ventricle stretches out through the foramen of magendie and causes enlargement of the foramen with mild rotation of the vermis ( black arrow ) . \n it is considered by some to be an incidental finding and by others to be a mild form of the dandy walker malformation . \n . often , these are the result of similar processes occurring in both the forebrain and hb . for example , the so - called \n cobblestone malformations or dystroglycanopathies are disorders that are caused by impaired linkage of the endfeet of radial glial cells with the pial limiting membrane ( figure 3a ) , in many cases because of decreased o - glycosylation of a - dystroglycan , which impairs its binding to laminin-2 in the basal lamina of that membrane ( saito et al . , 2006 ; godfrey et al . , 2007 ; \n , 2008 ; li et al . , 2008 ; hewitt , 2009 ; chan et al . , 2010 ; \n [ these cerebral disorders were formerly called lissencephaly type ii or cobblestone lissencephaly . \n that nomenclature resulted in considerable confusion with lissencephalies caused by undermigration of neurons destined for the cerebral cortex . as a result , the term cobblestone malformation is now preferred ( barkovich et al . , 2012 ) ] . \n other causes of abnormal linkage include altered laminin deposition ( ackroyd et al . , 2011 ) , mutation of g protein - coupled receptor 56 ( gpr56 ) or its receptor collagen type iii ( luo et al . , 2011 ) , and mutation of the ubiquitous basement membrane protein collagen type iv alpha 1 ( labelle - dumais et al . , 2011 ) . \n the result of these abnormal linkages is that some migrating neurons leave the radial glial fiber before reaching their intended cortical layer and other neurons overmigrate through gaps form in the pial limiting membrane into the subarachnoid space ( figure 3a ) ( martin , 2005 ) . \n the resulting cerebral cortex is composed of radially oriented clumps of disoriented neurons , the subarachnoid space is filled with ectopic neurons that have overmigrated , and multiple nodules of undermigrated heterotopic neurons lie in the subcortical white matter ( friede , 1989 ; norman et al . , 1995 ; haltia et al . , \n similar phenomena of gaps in basal lamina with over- and undermigrated neurons may be seen in the retina and the cerebellum ( friede , 1989 ; norman et al . , 1995 ; haltia et al . , \n abnormal linkages using the same molecular structures are found in skeletal muscle , with the result being that many affected patients also have congenital muscular dystrophy ( moore et al . , 2002 ; martin , 2005 ; kanagawa and toda , 2006 ) . \n in the cerebellum , the leptomeninges are of considerable importance for the normal migration of granule cells ( zarbalis et al . , 2007 ; \n mice with dystroglycanopathies show widespread discontinuities in the pial basement membrane with disruption of the glial scaffolding and migration of granule cells into the subarachnoid space ( moore et al . , 2002 ) . \n in gpr56 deficient mice , glial processes extend through and granule cells migrate through the aforementioned gaps in the glia limitans into the subarachnoid space ( koirala et al . , \n , 1994 ; gelot et al . , 1995 ; van der knaap et al . , 1997 ; barkovich , 1998 ; clement et al . , \n 2008 ) , with some patients having normal cerebella and others having mild dysgenesis resulting in mild vermian hypoplasia with some alteration of foliation ; of note , the severity of cortical dysgenesis is sometimes similar in the cerebrum and cerebellum but the involvement may be discrepant , suggesting that some gene products have different roles in the forebrain and hb . \n moderately severe cerebellar dysgenesis consists of a significantly dysmorphic cortex containing cyst - like structures that contain mesenchymal tissue ( figures 3b f ) and are connected to the surface via spaces containing penetrating blood vessels ( takada and nakamura , 1990 ) . \n this suggests a process similar to that in the cerebrum where cerebral tissues migrates outward and leptomeningeal tissues inward through the defects in the pial limiting membrane ( figure 3d ) . \n most patients with cerebellar dysgenesis have a small pons with a ventral midline cleft ( figures 3b , c ) ( van der knaap et al . , 1997 ; barkovich , 1998 ) . \n in the most severe cases ( figures 3e , f ) , the cerebellum is extremely small with very dysmorphic cortex and disproportionately small vermis and a small brain stem with \n kink in the mid - pons that is best seen in the sagittal plane ( figure 3e ) ; the reason for the small cerebellum might be an absence of dispersion of purkinje cells ( pcs ) due to interruption of granule cell migration and consequent absence of reelin secretion ( see next section on cerebellar disorders due to abnormalities of the reelin pathways ) . \n nearly all affected patients also have abnormalities of the mesencephalic tectum , which is thickened without identifiable collicula due to overmigration of cells ( figures 3b , e ) , and dysmyelination ; the reasons for these phenomena are not yet known . \n array of findings in the midbrain and hindbrain of cobblestone malformations ( formerly called lissencephaly type ii ) . \n diagram ( a ) shows neuron ( n ) guided by normal radial glial cell ( nl rgc ) on the left , coursing from ependyma to an intact pial limiting membrane ( pial lm ) , where it attaches via a bridge made by beta dystroglycan , alpha dystroglycan , or gpr56 , which attach to laminin-2 or collagen iv in the pial lm . in the center and on the right , gaps are seen in the pial lm ; the rgcs do not attach properly due to defects of alpha dystroglycan or gpr56 in the leading process of the rgc , to laminin , or collagen iv , respectively , in the pial lm . \n a relatively mild cerebellar anomaly is shown in the muscle - eye - brain phenotype shown in ( b ) and ( c ) . \n the midbrain tectum is large and smooth due to transpial migration of cells . a coronal image through the cerebrum ( d ) shows moderate ventricular enlargement , abnormal hyperintensity of subcortical , and deep white matter , and abnormal sulcation over the convexities ; \n note that the cortex in this region ( white arrows ) is abnormally thick and seems to be formed of radially oriented bands of neurons . a much more severe walker \n the sagittal image ( e ) shows a thin brain stem with a large kink in the mid pons ( black arrowhead ) , resembling a persistent pontine flexure . \n massive hydrocephalus can be seen , as can a small occipital cephalocele ( white arrow ) . the axial image ( f ) \n shows an extremely small , dysmorphic cerebellum with no vermis and many cysts within the irregular cortex . \n another malformation complex involving both supra- and infratentorial structures is caused by mutations of the reelin pathway . \n retzius cells in the marginal zone of the developing cerebral cortex , where its actions are thought to allow later migrating glutamatergic neurons to pass neurons in deeper cortical layers and to aid in detachment of the neurons from the radial glia at the proper cortical layer ( d'arcangelo et al . , 1995 ; ogawa et al . , 1996 ; trommsdorff et al . , 1999 \n reelin functions in the alignment of pyramidal neurons ( nakajima et al . , 1997 ; tissir and goffinet , 2003 ) , and in the cerebellum \n , reelin is secreted by the external granular layer and cerebellar nuclear neurons during early development to aid in dispersion of pcs ( miyata et al . , 1996 ; trommsdorff et al . \n is mediated by binding to specific receptors on target cells , apoer2 , vldlr , ( miyata et al . , 1997 ; d'arcangelo et al . , 1999 ; hiesberger et al . , 1999 ; \n 2006 ) and ephrin bs , the transmembrane ligands for eph receptors ( sentrk et al . , 2011 ) . interaction with reelin induces vldlr and apoer2 to bind the adaptor protein dab1 , which leads to activation of src family tyrosine kinases ( sfks ) and other kinases that phosphorylate dab1 at its tyrosine residues ( howell et al . , 1997 ; sheldon et al . , 1997 ; rice et al . , 1998 \n , reelin interacts with receptors on pcs , which respond by dispersing from their clusters in the central cerebellum and migrating to the cerebellar cortex ( trommsdorff et al . , 1999 ; \n , 2011 ) . if the reelin cascade within the pcs is disrupted , as by mutations of reln , its receptors , or dab1 , neither the cerebrum nor the cerebellum form properly , although the precise histological details and mechanisms of the resulting malformations are debated ( bock and herz , 2003 ; larouche et al . , 2008 ; frotscher , 2010 \n mutations of reln in humans result in congenital lymphedema and hypotonia , impaired cognition , myopia , nystagmus , and generalized epilepsy . \n imaging shows a very severe malformation , including thickened cortex , simplified sulcation , hippocampal dysmorphism , and profound cerebellar hypoplasia ( figures 4a , b ) ( hong et al . , 2000 ) . mutations of vldlr produce a significantly less severe disorder , known as the disequilibrium syndrome ( boycott et al . , 2005 ) . \n mri shows simplified cerebral sulcation ( although sulcation is less simplified and cortex less thickened than with reln mutations ) and profound cerebellar hypoplasia ( figure 4c ) ( glass et al . , 2005 ) . \n these patterns of cerebral and cerebellar dysgenesis are consistent with the observed findings in animal models with vldlr knock - outs [ larouche et al . , \n , 1999 ; larouche et al . , 2008 ; honda et al . , 2011 ; sentrk et al . , \n stop signal for migrating cerebral cortical neurons ; its absence allows overmigration with too many neurons in the molecular layer and mildly abnormal sulcation . \n apoer2 is essential for migration of late generated cortical neurons past the earlier generated ones ; its absence results in a thicker cortex with less sulcation , more resembling that seen with reln mutations ( benhayon et al . , 2003 ; hack et al . , 2007 ) . \n in the cerebellum of vldlr null animals , a large portion of pcs are not dispersed and remain as heterotopic clusters deep within the hemispheres , whereas apoer2 null animals have ectopic pcs largely restricted to the anterior vermis , resulting in a much less severe cerebellar dysgenesis ( larouche et al . , 2008 ) . \n however , the author has seen mris of patients with reln - like cerebral cortical dysgenesis but mildly abnormal cerebella ( figure 4d ) ; testing is underway to determine whether these are caused by mutations of apoer2 , dab1 , or some other , as yet unknown , component of the reelin pathway . \n array of findings in cerebrum and cerebellum of disorders of the reelin pathway . the most severe situation , with severe reln depletion results in a very small vermis ( white arrow in a ) , small , smooth cerebellar hemispheres ( black arrows in b ) , and a thick , pachygyric cerebral cortex ( b ) . vldlr mutation results in a less severe cerebral dysgenesis ( cortex is thinner and more sulci are present ) but the cerebellum is quite severely affected , both hypoplastic and smooth ( c ) . \n severe cerebral but less severe cerebellar involvement ( note that the cerebellum is larger and cortex is less smooth ) ( d ) can be seen , but the precise mechanism / mutation that results in this appearance is not known . \n another well - defined syndrome of cerebellar dysgenesis is the joubert syndrome and its related disorders ( jsrd , often called molar tooth malformations ) . \n a familial syndrome of agenesis of the cerebellar vermis was first described by joubert et al . in 1969 ; affected patients had episodic hyperpnea in infancy , abnormal eye movements , ataxia , and cognitive impairment ( joubert et al . , 1969 ) . \n the disorder was further elucidated in several papers by boltshauser and his colleagues ( boltshauser and isler , 1977 ; boltshauser et al . , 1981 ; steinlin et al . , 1997 ) , who described a variable degree of vermian hypoplasia ( rather than agenesis ) and multiple other features , with variable outcomes , in affected patients . \n appearance of the mb ( figure 5 ) ( maria et al . , 1997 ; quisling et al . , 1999 ) . this appearance was soon found in many disorders with widely varying phenotypic features of other organs including the eyes , kidneys , liver , and extremities ( egger et al . , 1982 ; \n 2004 ) , suggesting that these heretofore seemingly distinct disorders were in some way related . \n these disorders were very curious , as no common thread could be found among the processes involved , even within the same organs . within the nervous system , it was difficult to find the common underlying cause connecting the disorders of retina development , vermian hypoplasia , aberrant white matter pathways ( neither the corticospinal tracts nor the superior cerebellar peduncles decussate properly ) , occasional polymicrogyria and hypothalamic harmartomas ( figure 5 ) ( haug et al . \n , 2000 ; zaki et al . , 2008 ; giordano et al . , 2009 ; harting et al . , 2011 ) . \n it was also noteworthy that the characteristic molar tooth sign had many different appearances with the molar roots ( composed of the superior cerebellar peduncles ) sometimes thick , sometimes thin , sometimes straight and sometimes curved ; clearly a lot of different processes were going on . \n answers began to emerge when it was discovered that all of the genes implicated in these disorders are associated with the function of the primary cilium / basal body organelle , a structure that is present in many cell types , including renal tubule epithelial cells , retinal photoreceptors , chondrocytes , fibroblasts , and neurons ( arts et al . \n , 2007 ; delous et al . , 2007 ; frank et al . , 2008 ; gorden et al . , 2008 \n ciliary membranes contain receptors and ion channel proteins mediating cell signaling , including roles for shh , wnt , and pdgfa signaling pathways that control diverse processes ( e.g. , cell differentiation , migration , axonal pathfinding , and planar cell polarity ) . \n shh binding to its transmembrane receptor ptch abolishes the inhibitory effect of ptch on smo , resulting in localization of smo to the primary cilium , and transduction of signals to the nucleus through the gli transcription factors . \n the result is de - repression and activation of shh target genes ( satir and christensen , 2007 ) . \n the shh pathway is important for dorsal - ventral patterning of the neural tube and , later , for proliferation of cerebellar granule cells ( wechsler - reya and scott , 1999 ; huangfu et al . , 2003 ) . \n however , reduction of granule cell proliferation can not in itself explain the vermian hypoplasia seen in the mtms ( chizhikov et al . , 2007 ; \n spassky et al . , 2008 ) , as the effect of shh is diffuse , involving both vermis and hemispheres , but the vermis is very disproportionately involved in mtms . \n a more likely explanation is decreased wnt reporter activity , accompanied by reduced proliferation , at the site of hemispheric fusion , as was reported in the developing cerebellum of ahi1-mutant mice ( lancaster et al . , 2011 ) ; this phenotype was partially rescued by treatment with lithium , a wnt pathway agonist ( lancaster et al . , 2011 ) . \n the wide phenotypic variation among families harboring mutations in genes encoding ciliary proteins also suggests that genetic modifiers are important in determining specific features within the ciliopathy spectrum ( davis et al . \n this interesting group of disorders has much more to teach us about both development and disorders thereof . \n the characteristic imaging findings of a small vermis ( small white arrows , a , b ) and narrow isthmus ( small white arrowhead , a , b ) are identified on sagittal images . \n the variable appearances of the molar tooth , resulting from the large , horizontal superior cerebellar peduncles , are shown ( white arrows in c , d , and e ) . \n many other disorders of the mb - hb have been described in association with supratentorial anomies , including cerebellar hypoplasia associated with severe variants of cerebral lissencephaly secondary to alpha - a1 tubulin ( tuba1a ) and other tubulin mutations ( poirier et al . \n 2010 ) , cerebellar hypoplasia associated with postmigrational microcephaly secondary to mutations of calcium modulated - dependent serine protein kinase ( cask ) , which is associated with x - linked mental retardation ( najm et al . , 2008 ) and cerebellar hypoplasia associated with midline brain stem clefts and agenesis of the corpus callosum , presumably resulting from mutations preventing midline axonal crossing ( barkovich et al . , 2009 ) . \n application of discoveries from developmental neuroscience will aid our understanding of these disorders , and what is learned from studying these disorders will help us to better understand brain development . \n the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . \n the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "role": "user" }, { "content": "malformations of the midbrain ( mb ) and hindbrain ( hb ) have become topics of considerable interest in the neurology and neuroscience literature in recent years . \n the combined advances of imaging and molecular biology have improved analyses of structures in these areas of the central nervous system , while advances in genetics have made it clear that malformations of these structures are often associated with dysfunction or malformation of other organ systems . \n this review focuses upon the importance of communication between clinical researchers and basic scientists in the advancement of knowledge of this group of disorders . \n disorders of anteroposterior ( ap ) patterning , cerebellar hypoplasias , disorders associated with defects of the pial limiting membrane ( cobblestone cortex ) , disorders of the reelin pathway , and disorders of the primary cilium / basal body organelle ( molar tooth malformations ) are the main focus of the review .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the first introduction of percutaneous nephrolithotomy ( pcnl ) in 1976 it has become the gold standard surgical treatment for large kidney stones . in order to reduce the morbidity associated with pcnl , several attempts have been made to modify the standard technique and reduce the size of instrumentation used for pcnl . \n the first significant size reduction has been proposed by helal et al . in 1997 , who described the mini - pcnl technique in a 2-year - old child using 15 fr . \n further advances led to the development of metallic amplatz sheath with nephroscope , where one of the prominent advantages was vacuum cleaner effect , consistent with hydrodynamic bernoulli 's principle . according to this principle , during mini - pcnl , the front of a low pressure called \n pseudocavity is produced at the tip of nephroscope , which can extract the stone fragments through an access sheath without any additional grasping devices . at a closer look \n , we have noticed that the horizontal plane , being one of the necessary conditions for bernoulli equation , possibly for negation of gravitational influence on the flow velocity , was for some reason neglected . in this study , we evaluated whether bringing the access sheath during mini - pcnl to the horizontal plane , which we called \n bernoulli maneuver, by table manipulation and/or gentle hand assistance , can be beneficial regarding nephroscopy time . \n we compared the 2 groups of patients operated either in a standard prone or tilted prone position . \n we obtained institutional review board approval to perform a single center prospective , randomized and controlled study ( approval number : - 72345 ) . \n all patients undergoing mini - pcnl procedure between february 2015 and april 2016 for solitary medium - sized kidney stones ( 12 cm ) of high density ( more than 1,000 hu ) were consented to be included in the study . \n choice of treatment modality was dictated by existing guidelines and local insurance coverage protocols . \n randomization was performed via a web - based generator of true random numbers , in which the randomness comes from atmospheric noise ( www.random.org ) and results were assigned to the control ( c ) and bernoulli ( b ) groups in numbered envelopes . \n patients with multiple or complex renal stones , stones in anomalous kidneys as well as patients with active infection or coagulation disorders were excluded from the study . \n all pcnl procedures were performed by 2 competent surgeons under general anesthesia . with the patient in the lithotomy position , a ureteral catheter \n then the patient was turned to the prone position and strapped down at the upper body and buttocks to the operating table ( alphamax , maquet , germany ) to prevent sliding during \n after calyceal puncture , a 0.035 hydrophilic guidewire ( roadrunner , cook medical , bloomington , in , usa ) is inserted into the pelvicalyceal system ( pcs ) . \n single - step tract dilation , with a 16.5/19.5 fr metal access sheath , is performed ( karl storz , tuttlingen , germany ) . \n after identification of the stone , according to the group assignment , the patient was operated in either standard prone ( fig . \n fragmentation of the stone mass instead of laser painting with the formation of fitting the access sheath particles , which were immediately evacuated via bernoulli effect , was accomplished with laser lithotripter ( versapulse 100 w , lumenis , israel ) and 365 micron laser fiber , under the following initial parameters : 0.5 j and 20 hz . nor basket neither grasping device was needed during all operations . \n evaluated parameters in the study were nephroscopy time i.e. , time from stone identification till the end of the evacuation of the last fragment , stone free and complication rates . \n low - dose computed tomography ( ct ) imaging was obtained on all patients on postoperative day 1 to evaluate residual stones . \n data acquisition was performed using a 64-row ct unit somatom definition as ( siemens , berlin , germany ) . \n it is rather fruitful because it combines not only confidence interval estimates for parameters , for the standardized effect size dc , for the achieved power ( 1 ) , and planned sample sizes , but prediction intervals for them and for p - values , as well as estimates of posterior probabilities for the null hypothesis p(h0d ) and bayes factors bf10 . for parameter estimation and hypothesis testing the complementary combination of frequentist ( orthodox ) and \n nonparametric bootstrapping and permutation ( monte carlo ) procedures were realized with the number of replicates and/or random permutations as large as possible ( but no less than 1 million ) . for measurable variables ( \n software past , boxplotr ( http://boxplot.tyerslab.com/ ) , jasp ( https://jasp-stats.org/ ) , gpower and leprep ( http://lmrs.univ-rouen.fr/persopage/lecoutre/pac.htm ) have been involved . \n we obtained institutional review board approval to perform a single center prospective , randomized and controlled study ( approval number : - 72345 ) . \n all patients undergoing mini - pcnl procedure between february 2015 and april 2016 for solitary medium - sized kidney stones ( 12 cm ) of high density ( more than 1,000 hu ) were consented to be included in the study . \n choice of treatment modality was dictated by existing guidelines and local insurance coverage protocols . \n randomization was performed via a web - based generator of true random numbers , in which the randomness comes from atmospheric noise ( www.random.org ) and results were assigned to the control ( c ) and bernoulli ( b ) groups in numbered envelopes . \n patients with multiple or complex renal stones , stones in anomalous kidneys as well as patients with active infection or coagulation disorders were excluded from the study . \n all pcnl procedures were performed by 2 competent surgeons under general anesthesia . with the patient in the lithotomy position , a ureteral catheter \n then the patient was turned to the prone position and strapped down at the upper body and buttocks to the operating table ( alphamax , maquet , germany ) to prevent sliding during \n after calyceal puncture , a 0.035 hydrophilic guidewire ( roadrunner , cook medical , bloomington , in , usa ) is inserted into the pelvicalyceal system ( pcs ) . \n single - step tract dilation , with a 16.5/19.5 fr metal access sheath , is performed ( karl storz , tuttlingen , germany ) . \n after identification of the stone , according to the group assignment , the patient was operated in either standard prone ( fig . \n fragmentation of the stone mass instead of laser painting with the formation of fitting the access sheath particles , which were immediately evacuated via bernoulli effect , was accomplished with laser lithotripter ( versapulse 100 w , lumenis , israel ) and 365 micron laser fiber , under the following initial parameters : 0.5 j and 20 hz . nor basket neither grasping device was needed during all operations . \n evaluated parameters in the study were nephroscopy time i.e. , time from stone identification till the end of the evacuation of the last fragment , stone free and complication rates . \n low - dose computed tomography ( ct ) imaging was obtained on all patients on postoperative day 1 to evaluate residual stones . \n data acquisition was performed using a 64-row ct unit somatom definition as ( siemens , berlin , germany ) . \n it is rather fruitful because it combines not only confidence interval estimates for parameters , for the standardized effect size dc , for the achieved power ( 1 ) , and planned sample sizes , but prediction intervals for them and for p - values , as well as estimates of posterior probabilities for the null hypothesis p(h0d ) and bayes factors bf10 . for parameter estimation and hypothesis testing the complementary combination of frequentist ( orthodox ) and \n nonparametric bootstrapping and permutation ( monte carlo ) procedures were realized with the number of replicates and/or random permutations as large as possible ( but no less than 1 million ) . for measurable variables ( \n software past , boxplotr ( http://boxplot.tyerslab.com/ ) , jasp ( https://jasp-stats.org/ ) , gpower and leprep ( http://lmrs.univ-rouen.fr/persopage/lecoutre/pac.htm ) have been involved . \n total of 67 patients were included in the study ; of these , 40 patients were randomized to group c and 27 patients to group b. their ratio 1.5 with 95% confidence limits from 0.9 to 2.4 did not differ statistically from the expected 1:1 ( p=0.14 ) \n . data in group c appeared not agree with a normal distribution ( table 1 ) . \n so all statistical estimations and tests used were nonparametric . in group b the nephroscopy time was significantly shorter than in group c ( fig . \n the time difference between studying groups was 12.6 minutes ( with 95% confidence interval from 8 to 18 minutes ) . \n bayes factor bf10=2,340 means that the probability to receive the observed effect under the alternative hypothesis is 2,340 times larger than under the null hypothesis . at the same time , it means that the posterior odds in favor of the alternative hypothesis against the null hypothesis are 2,340 times larger then prior odds . \n this result agrees well with the high value of achieved power ( pow=0.998 ) and with a high probability of replication psrep=0.97 . \n prediction analysis shows that in replication the cohen effect size dst will be not less than 0.49 and p - value will not exceed 0.027 with the probability 95% ( table 2 ) . \n moderate positive correlation was observed between stone size and nephroscopy time , where linear pearson correlation coefficient appeared to be r=0.53 ( 4.510 ) and spearman correlation coefficient was rs=0.55 ( 1.410 ) ( fig . \n 4b ) , r=0.66 ( 1.510 ) and rs=0.55 ( 510 ) . no intraoperative complications such as profuse bleeding , pcs rupture etc . \n there were no statistically significant differences between groups in terms white blood cell count , creatinine level and stone - free status defined by ct on the first postoperative day . \n though we did find statistically significant difference in hemoglobin ( hb ) drop between groups ( less in group b ) , it was not clinically significant ( table 3 ) . \n there are many factors that have been shown to impact the surgical outcomes of pcnl procedures . \n due to the challenging nature of the procedure , there have been many modifications suggested to improve patient related outcomes and stone free rates . in this study \n we evaluated a simple yet reproducible maneuver to improve stone free rates and nephroscopy time . \n bernoulli maneuver, to our best knowledge , has never been evaluated before during pcnl procedures and this is the first study to quantitatively demonstrate the benefits of this simple technique . \n , we saved 12 minutes just on nephroscopy time when the bernoulli maneuver was used . \n although this difference seems small and not very clinically significant , cumulatively makes a huge difference at tertiary centers such as our institution where we daily perform a high volume of surgical procedures for urolithiasis . \n since this maneuver requires tilting the table , one should pay close attention for patient positioning and securing with tapes on the table to prevent slipping during the procedure . \n if the table tilting is not enough to bring access sheath to the horizontal plane then gentle hand assistance may be used , but not zealously not to tear the kidney . \n although we did not assess surgeons ' subjective opinion , we believe that the maneuver makes the stone fragmentation and removal significantly easy . possible explanation for the observed pattern may be reduced gravitational influence with the implementation of the bernoulli maneuver. moreover , one can observe a comparative easiness of fragments washout during standard pcnl in the supine position , though this effect does not occur so prominently in standard pcnl as compared to mini - pcnl . \n our study demonstrated positive correlations between the stone size and operative time , nephroscopy time and decrease in hb level . \n . today definition of mini - pcnl comprises utilization of access sheaths of size 1420 fr . according to this definition the first mention of \n mini pcnl was made by helal et al . in 1997 using 15 fr . \n hickman peel away catheter , followed by jackman et al . in 1998 utilizing an 11 fr . \n peel - away access sheath , with comparable to standard pcnl results . the first description of standard minimally invasive pcnl with specialized 12-fr rigid nephroscope and 15-fr access sheath came out in 2001 . \n however , according to the authors ' note , despite the fact that no hemorrhage has occurred in a group of 19 patients , miniaturized instruments were associated with significant operative time increase with larger stone masses , due to the fact that utilization of a smaller sheaths are associated with more difficult stone fragment retrieval and need of additional tools such as disposable retrieval baskets . \n it was not until nagele et al . in 2008 reported on a newly designed amplatz sheath \n ( karl storz ) with the vacuum cleaner effect , which was nicely depicted in a study by nicklas et al . . \n the basis of this effect lies in bernoulli 's principle , according to which an increase in the speed of a fluid in the constriction zone occurs simultaneously with a decrease in pressure , also known as \n pseudocavity which is being located at the tip of the nephroscope during mini - pcnl able to extract stone fragments through access sheath without any additional stone extracting devices . besides \n vacuum cleaner effect passive or active wash out as well as purging effect can also be utilized to gain maximum stonefree rate during mini - pcnl , though were not used in our study . \n the former has been shown to be associated with reduced morbidity , pain and blood loss compared to standard pcnl . in a series of more than 1,000 patients using a 16-fr access sheath bleeding complications occurred in less than 1.5% . for \n medium sized stones ( 12 cm ) no significant differences between mini- and standard pcnl regarding stone free and complication rates were observed . \n the only parameter was in favor to standard pcnl - the operative time , which was 1214 minutes shorter in average . suggested in our study \n bernoulli maneuver with its additional 12 minutes possibly could offset this time difference making mini - pcnl an attractive option for medium sized stones ( 12 cm ) . \n one can raise a fair question , if swl is not an option due to unfavorable stone factors , why not to use an endoscopic removal in medium - sized stones instead of mini - pcnl as existing guidelines dictate ? . \n as was nicely depicted even miniscule residuals < 1 mm could affect an early recurrence , possibly to a delayed nidus effect . not speaking about time and expenditures needed to leave a patient absolutely stone - free with the endoscopic route . \n first , the study is a single - surgical - center study thus generalizability of this data is limited . \n moreover during mini - pcnl in control group to render patient stone - free the sheath is often moved in all types of directions , which is also should be considered . \n finally , surgeon 's subjective feeling was not measured and future studies with validated questionnaires would help to elucidate if the maneuver makes clinically significant difference to the surgeon during the procedure . \n bernoulli maneuver during the mini - pcnl significantly reduces the nephroscopy time without any compromise in stone - free and complication rates .", "role": "user" }, { "content": "purposeto evaluate the effect of \n bernoulli maneuver ( bringing the access sheath to horizontal plane ) on operative time and stone free rates in patients undergoing mini - percutaneous nephrolithotomy ( pcnl).materials and methodsall consecutive patients with a solitary kidney stone undergoing a mini - pcnl between 2015 and 2016 were included into this study . \n patients were randomized either to standard prone or control ( c ) group patients or to tilted prone with \n bernoulli maneuver group ( b ) patients . \n pre- , intra- , and postoperative characteristics of these 2 groups were recorded and analyzed.resultsa total of 67 patients were included in the study . of these , \n 40 patients were randomized to group c and 27 to group b. the mean ( 95% confidence limits ) stone size ( mm ) in group c and b was 14 ( 13 , 15 ) and 13 ( 11 , 14 ) , respectively ( p=0.26 ) . \n nephroscopy time was shorter in bernoulli group ( 35 minutes vs. 23 minutes , p=1.510 - 5 , and bayes factor bf10=2,340 , and cohen standardized effect size dst=1.2 ) . \n the difference made it up 12 minutes ( with 95% confidence interval from 8 to 18 minutes ) . \n there were no statistically significant differences between groups regarding white blood cell , creatinine level and stone - free status defined by computed tomography on the first postoperative day.conclusionsin our study the bernoulli maneuver led to a shorter nephroscopy time in mini - pcnl . \n this maneuver can significantly reduce nephroscopy time and save significant amount of operative time , especially in tertiary referral centers with high - volume mini - pcnl procedures .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ages , http://www.hjarta.is/english/ages aric , http://www.cscc.unc.edu/aric/ chs , http://www.chs-nhlbi.org/ fhs , http://www.framinghamheartstudy.org/about/index.html rs , http://www.epib.nl/ergo.htm bimbam , http://stephenslab.uchicago.edu/software.html eigenstrat , http://genepath.med.harvard.edu/~reich/software.htm genable and probabel ( http://mga.bionet.nsc.ru/~yurii/abel/ ) hapmap , http://hapmap.org mach v1.0.15/16 ( all others ; http://www.sph.umich.edu/csg/abecasis/mach/index.html ) plink http://pngu.mgh.harvard.edu/purcell/plink/ \n ", "role": "user" }, { "content": "we conducted meta - analyses of genome - wide association studies ( gwas ) for atrial fibrillation ( af ) in participants from five community - based cohorts . \n meta - analyses of 896 prevalent ( 15,768 referents ) and 2,517 incident ( 21,337 referents ) af cases identified a novel locus for af ( zfhx3 , rs2106261 , risk ratio [ rr]=1.19 ; p=2.3107 ) , an association that was replicated in the german af network ( odds ratio=1.44 ; p=1.61011 ) . combining the discovery and replication results , rs2106261 was significantly associated with af ( rr=1.25 ; p=1.81015 ) .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: calcium entering the cell through voltage - gated ca channels plays an important role in mediating a wide variety of cellular events and includes feedback processes that regulate activity of the channel itself . \n the ca - dependent modulation of channel activity mediated by the ca - binding protein calmodulin ( cam ) is found in many ion channels including the cav1 family . \n ca - dependent inactivation ( cdi ) of cav1.2 is mediated by cam , and its structural determinants have been assigned to the proximal region of the c - terminus of cav1.2 [ 1 , 2 ] . \n three domains have been identified within this region : a ca binding ef - hand motif , a cam - tethering site , and a cam - binding iq motif . the ef - hand motif , located ~16 residues beyond the end of the last transmembrane segment ( ivs6 ) , is absolutely necessary for cdi . the cam - tethering site , which consists of both preiq3 and iq motifs , resides 50 amino acids downstream from the ef - hand motif and binds ca - free cam ( apo - cam ) at resting [ ca]i . \n the iq motif resides downstream from the ef - hand motif and the pre - iq3 domain , and it binds ca - cam . when the interaction of cam with either of these domains is compromised , cdi is reduced or eliminated [ 1 , 2 ] . \n recently , it has been demonstrated that the skeletal muscle l - type ca channel ( cav1.1 ) also displays cdi mediated by cam and that cam associates with cav1.1 in vivo . \n the initial 200 amino acids of the c - terminus of the cav1.1 are highly conserved and contain the above - described domains including the iq motif . \n cam binding to the iq motif of cav1.2 channel has been shown to be necessary for cdi , and the mutation of the isoleucine ( i1624 ) and glutamine ( q1625 ) to alanines ( aa ) in the iq motif of cav1.2 resulted in ablation of cdi and significant reduction of apocam binding to cav1.2 [ 1 , 2 , 4 ] . whether the iq motif in cav1.1 plays a similar role remains to be determined . in the present work , myotubes cultured from normal and dysgenic ( lacking endogenous cav1.1 ) mice were used to investigate the role of the iq motif in the function of cav1.1 . \n the results presented demonstrate that the iq motif in the c - terminus of cav1.1 is critical for function of cav1.1 as a voltage sensor as well as ca channel . \n furthermore , the results indicate that the iq motif may be a previously unrecognized site of protein - protein interaction between cav1.1 and the skeletal muscle ryanodine receptor ( ryr1 ) and may play a role in skeletal muscle excitation - contraction ( ec ) coupling . \n the coding sequence of yellow fluorescent protein- ( yfp- ) tagged cav1.1 channel ( yfp - cav1.1 ) was a gift from dr . \n the residues isoleucine ( i ) and glutamine ( q ) at codons 1529 - 1530 of rabbit cav1.1 were substituted with alanine ( a ) using the quikchange ii mutagenesis kit ( stratagene , la jolla , ca ) , using the yfp - cav1.1 as a template . \n primary myotubes were cultured from normal or dysgenic newborn mouse skeletal muscle as previously described . for confocal microscopy purposes , \n primary cultures of myotubes were plated onto 35 mm culture dishes with integral no . \n approximately one week after plating , dysgenic myotubes were injected with expression plasmids ( cdnas ) encoding either yfp - cav1.1 or yfp - cav1.1aa at concentrations of 0.2 g/l , respectively . in experiments assessing the effects of cam on ca transients , normal myotubes ( ~one week in culture ) \n yue ) and green fluorescent protein ( pegfp - c1 , bd biosciences clontech , ca ) at concentrations of 0.1 and 0.02 g/l , respectively . \n successfully transfected myotubes were identified 3648 hours after injection by their yellow or green fluorescence under uv illumination . \n patch pipettes were constructed of borosilicate glass and had resistances of 1.82.5 m when filled with the standard internal solution , which contained ( in mm ) 145 cs - aspartate , 10 cs2-egta , 5 mgcl2 , and 10 hepes ( ph 7.4 with csoh ) . the external solution contained ( in mm ) 145 tetraethylammonium chloride ( tea - cl ) , 10 cacl2 , 0.003 tetrodotoxin , and 10 hepes ( ph 7.4 with tea - oh ) . \n the holding potential was 80 mv , and test pulses were preceded by a 1-s prepulse to 30 mv to inactivate endogenous t - type ca currents . \n recorded membrane currents were corrected off line for linear components of leakage and capacitance by digitally scaling and subtracting the average of 10 preceding control currents , elicited by hyperpolarizing voltage steps ( 30 mv amplitude ) from 50 mv . \n . values for gmax , the maximal ca conductance , were obtained by fitting the measured currents according to the following equation : \n ( 1)ipeak = gmax ( v vr){1 + exp [ (vv1/2)/k ] } , \n\t\t\t\t\t\t\t where ipeak is the peak current activated at the test potential v , vr is the extrapolated reversal potential , v1/2 is the potential for half - maximal activation of the ca conductance , and k is a slope factor . \n the fraction of current remaining at the end of an 800 ms test pulse ( r800 ) was determined by dividing the current remaining at the end of test pulse by the peak current , and this ratio was used to quantify the level of inactivation \n ( 2)r800 = iendipeak . \n for measurements of charge movement \n , 0.5 mm cd and 0.1 mm la were added to the external solution to block ca currents . \n charge movements were elicited in response to a prepulse protocol that consisted of a 1-s prepulse to 30 mv and a subsequent 40 ms repolarization to a pedestal potential ( 50 mv ) , followed by a 25 ms depolarization to + 40 mv . the maximum amount of charge that can be moved ( qmax ) \n was obtained by integrating the charge movement current at test potential of + 40 mv . \n linear leak and capacity currents were subtracted on line using p/4 delivered from the holding potential ( 80 mv ) before each pulse . \n charge movements were normalized to total cell capacitance ( nc/f ) . to measure relative changes in voltage - gated \n ca release from the sr , the ca indicator k5-fluo-3 ( 0.5 mm ) ( molecular probes ) was included in the pipette solution . \n after rupture of the cell membrane and entry into the whole cell configuration , cells were allowed to dialyze for about 5 min before recording in order to achieve adequate loading with indicator dye . \n fluorescent emission was measured by a photomultiplier system ( biomedical instrumentation group , university of pennsylvania ) . \n the set of filters used to record the fluorescent signal from fluo-3 was as follows : excitation band - pass filter of 470/20 nm ; dichroic long - pass mirror ( 510 nm ) ; emission long - pass filter of 520 nm . \n after rupture and dye loading into the cell , the baseline fluorescence ( fbase ) was monitored . \n the increase in fluorescent signal during depolarization was expressed as f / f , where f represents the increase in fluorescence above baseline fluorescence ( f = ftransient fbase ) , and f is fbase . \n peak fluorescence during each test pulse was plotted as a function of test potential v and fitted according to the following equation : \n ( 3)ff=(f / f)max{1 + exp[(vf1/2 v)/kf ] } , \n\t\t\t\t\t\t\t where ( f / f)max is the maximal fluorescent change , vf1/2 is the potential for half - maximal activation of the ca transient , and kf is a slope factor . \n all recordings were performed at room temperature ( ~20c ) , and data are reported as mean sem ; n indicates the number of myotubes tested . \n data sets were statistically compared by an unpaired , two - sample student 's t - test , with a confidence interval of at least 95% . \n cells were bathed in rodent ringer ( in mm : 146 nacl , 5 kcl , 2 cacl2 , 1 mgcl2 , 11 glucose , 10 hepes ; ph 7.4 adjusted with naoh ) and examined with an lsm 510 meta laser scanning microscope ( zeiss , thornwood , new york ) with 40x oil immersion objective . the laser line ( 514 nm ) of the argon laser ( 30 mw maximum output , operated at 50% or 6.3 a ) \n emissions of yfp were recorded in single - track configuration with a long - pass filter of 530 nm ( chroma , rockingham , vermont ) . \n fluorescence signals were analyzed by the 510 lsm image examiner software ( zeiss , thornwood , new york ) . \n primary cell cultures were plated onto 35 mm culture dishes with integral no . 0 glass coverslip bottoms ( mattek ) . \n the cultures will be fixed with 100% methanol at 20c for a minimum of 20 min . \n cells were then incubated for 1 hour in pbs ( phosphate - buffered saline ) containing 1% bsa ( bovine serum albumin ) and 10% goat serum to block unspecific labeling . \n after 3 washes with pbs / bsa ( .2% ) , cell cultures were incubated with specific primary antibody against the ryr1 ( 34c , developmental studies hybridoma bank ( dshb ) , ui ) ( dilution 1 : 4000 ) overnight at 4c . \n cells were washed out 3 times with pbs / bsa ( .2% ) , followed by 1 hour of incubation with secondary antibody conjugated with alexa 568 ( at final dilution 1 : 5,000 , goat anti - rabbit igg , invitrogen ) . \n cells were then washed 3 times with pbs / bsa ( .2% ) to remove unbind secondary antibody and assessed with a confocal microscope . \n first , i addressed the question whether the ca - binding ability of cam plays any role in skeletal muscle ec coupling . \n overexpressed mutant cam which does not bind ca ( cam1234 ) can displace approximately 70% of endogenous cam , as reflected by abolishment of cdi of cav1.1 . \n however , overexpression of either camwt or cam1234 in normal myotubes did not significantly affect either current - voltage ( i / v ) relationship ( figure 1(a ) ) or voltage - gated ca release from sr as indicated by similar peak fluorescence - voltage relationship ( f / f - v ) in comparison with uninjected normal myotubes ( figure 1(b ) ) . \n this result suggests that either the ca - binding ability of cam or cam itself does not play a role in skeletal muscle ec coupling . \n however , cam associates with cav1.1 in vivo and that indicates the possibility that cam may still serve as a structural subunit of cav1.1 , that is , that interaction between cam and cav1.1 can stabilize the dhpr complex . by doing so \n therefore , i examined whether cam association with cav1.1 is necessary for its function as a voltage sensor for ec coupling . \n the iq motif of cav1.1 has been shown to bind cam similar to iq motifs of cav1.3 and cav2 channels . \n introduction of the mutation iq / aa in the iq motif of the cardiac l - type ca channel ( cav1.2 ) resulted in abolishment of cdi and significant reduction of apocam binding to cav1.2 [ 2 , 4 ] . \n thus , corresponding iq motif mutation in the c - terminus of cav1.1 was obvious place to start . \n the mutation ( iq / aa ) in the cam - binding site of cav1.1 disables function of cav1.1 as a ca channel and voltage sensor for ec coupling . \n i introduced the iq / aa mutation in the c - terminus of cav1.1 and investigated how this mutation will alter cav1.1 function as ca channel and voltage sensor for ec coupling . \n introduction of the mutation iq / aa in the iq motif of cav1.2 resulted in abolishment of cdi and significant reduction of apocam binding to cav1.2 [ 2 , 4 ] . \n dysgenic myotubes expressing either yfp - cav1.1 or yfp - cav1.1aa were used to examine the role of iq motif in ca - dependent inactivation ( cdi ) of cav1.1 . \n injections of plasmids encoding various constructs of cav1.1 into dysgenic myotubes at concentrations of 0.20.5 g/l have been previously demonstrated to produce a similar extent of maximal , immobilization - resistant charge movement and similar ca current densities as normal myotubes , which corresponds to similar protein expression levels [ 3 , 6 , 810 ] . \n figure 2(a ) shows ca currents mediated by yfp - cav1.1 expressed in dysgenic myotube . \n the fraction of current remaining at the end of the pulse ( r800 ) displayed a u - shaped voltage dependence ( data not shown ) , consistent with a current - dependent inactivation process . \n in such a process , the extent of inactivation varies in proportion with the amplitude of the inward calcium current , which in turn depends on the number of conducting channels and the electrochemical driving force on calcium . \n inactivation was minimal at a test potential of + 10 mv , as reflected by an r800 value of 0.9 0.08 ( n = 7 ) , and maximal at a test potential of + 40 mv , as reflected by a minimum r800 value of 0.74 0.03 ( n = 7 ) . correspondingly , the ca current attained its maximum conductance at + 40 mv ( figure 1(c ) ) \n thus , ca currents mediated by yfp - cav1.1 displayed a current - dependent inactivation process , current - voltage ( i - v ) relationship ( figure 2(c ) ) , and maximal ca ion conductance ( gmax = 166 18 ns / nf ; n = 7 ) similar to the endogenous cav1.1 of normal myotubes . \n these results suggest that yfp fused to the n - terminus of cav1.1 does not interfere with channel function . \n in contrast , dysgenic myotubes expressing yfp - cav1.1aa ( figures 2(b ) and 2(c ) ) displayed either very small ( < 1pa / pf ) or no measurable ca currents . \n this is a very dramatic and surprising result considering that the corresponding mutation ( iq / aa ) in the iq motif of cav1.2 resulted only in ablation of cdi but did not affect the i - v relationship of ca currents mediated by cav1.2 . \n further voltage - gated ca currents and sr ca release were measured simultaneously from dysgenic myotubes expressing yfp - cav1.1aa and compared with recordings from uninjected normal myotubes and normal myotubes overexpressing camwt or cam1234 . \n the voltage - gated ca release from sr was completely abolished in dysgenic myotubes expressing yfp - cav1.1aa ( figure 2(d ) ) . \n the loss of cav1.1aa function could be a result of several scenarios such as that mutation caused misfolding of protein and insufficient membrane targeting or that protein - protein interaction between ryr1 and cav1.1 was significantly disturbed.if the latter possibility is the case , this result suggests that either the iq motif itself or association of cam with cav1.1 is necessary for orthograde signaling from cav1.1 to ryr1 , which underlies skeletal muscle ec coupling . \n the severe loss of function , abolished ca current and orthograde signaling mediated by the cav1.1aa , could be explained by compromised targeting of cav1.1 to the t - sr junction as a result of incomplete protein folding . \n figure 3 shows confocal images of yellow fluorescence from a dysgenic myotube expressing either yfp - cav1.1 or yfp - cav1.1aa . \n expression of yfp - cav1.1 ( a ) or yfp - cav1.1aa ( b ) resulted in the appearance of small yellow fluorescence puncta located near the cell surface . \n the small puncta correspond to groups of cav1.1 localized to t - sr junctions ; these puncta are similar in size and distribution to those of cav1.1 foci revealed by immunohistochemistry . there is a similar staining of the membrane and distribution of puncta in both myotubes , suggesting that both constructs are likely targeted to t - sr junctions . to confirm targeting of yfp - cav1.1aa to the sarcolemma , the qmax was measured at + 40 mv ( figure 4 ) . \n the qmax in dysgenic myotubes expressing cav1.1aa ( 5.9 0.5 nc/f ; n = 27 ) was similar to that of normal myotubes ( 5.5 0.4 nc/f ; n = 16 ) , but significantly larger ( p < 0.001 ) than in dysgenic myotubes alone ( 2.5 0.2 nc/f ; n = 18 ) . \n this finding suggests that iq / aa mutation in cav1.1 did not prevent the protein from being properly targeted or undergoing voltage - dependent conformational changes , which strongly suggest proper folding as intramembrane segment s4 of cav1.1 is responsible for voltage - dependent movement . to further confirm cav1.1aa proper targeting into t - sr junctions and site of ec coupling , i investigated colocalization of cav1.1 and ryr1 . \n dysgenic myotubes expressing either yfp - cav1.1 or yfp - cav1.1aa ( yellow fluorescence : yfp was artificially assigned as green ) were incubated with specific primary antibody against the ryr1 followed by incubation with secondary antibody conjugated with alexa 568 ( red fluorescence ) . \n colocalization of green and red fluorescence results in yellow pattern suggests colocalization of yfp - cav1.1 and ryr1 in t - sr junctions in vivo ( see figures 5(g ) and 5(h ) ) . \n colocalization patterns of yfp - cav1.1aa with ryr1 were compared to yfp - cav1.1 and ryr1 patterns in 5 different experiments . \n colocalization patterns of either yfp - cav1.1 or yfp - cav1.1aa with ryr1 were similar and have been analyzed by metamorph 7 software ( molecular devices ) . \n colocalization in near surface slices of z - stacks of yfp - cav1.1 and ryr1 was 83 4% ( n = 7 ) , and colocalization of yfp - cav1.1aa and ryr1 was 85 2% ( n = 7 ) . \n these results strongly suggest that yfp - cav1.1aa is targeted into t - sr junctions . \n together these results suggest that the iq / aa mutation is not likely to affect protein folding within membrane . \n furthermore , much more drastic alternation or deletions in cav1.1 sequence did not have such dramatic effects [ 12 , 13 ] . \n the loss of both ionic ca current and skeletal muscle ec coupling in cav1.1aa along with charge movement similar to normal myotubes suggests that the iq motif of the cav1.1 may be unrecognized site of protein - protein interaction between cav1.1 and ryr1 and play a role in both orthograde and retrograde signaling . \n the present study provides new information about the skeletal muscle l - type ca channel ( cav1.1 ) . \n specifically , the data demonstrate in vivo that the iq motif in the c - terminus of cav1.1 is critical for function of cav1.1 as a voltage sensor as well as a ca channel . \n furthermore , the results indicate that the iq motif , in addition to ii - iii loop , may be a previously unrecognized site of protein - protein interaction between cav1.1 and ryr1 and , thus , may play a role in skeletal muscle ec coupling . \n cav1.1 is localized in regions of the t - tubular membrane that are closely apposed to the sarcoplasmic reticulum ( i.e. , the t - sr junction ) , and the primary role of cav1.1 is to serve as the voltage sensor for skeletal muscle ec coupling . \n the second protein that plays a major role in this process is the skeletal muscle ryanodine receptor ( ryr1 ) . \n the mechanism of signal transmission between cav1.1 and ryr1 is still incompletely understood , but the most accepted view is that they are mechanically coupled and interact with each other through protein - protein interaction ( orthograde and retrograde signaling ) . \n orthograde signaling is the signal from cav1.1 to ryr1 , in which movement of the voltage sensors in cav1.1 trigger opening of ryr1 and release of ca from the sr ( ec coupling ) . \n retrograde signaling is communication from ryr1 to cav1.1 , in which ryr1 somehow increases the amount of l - type ca current mediated by cav1.1 [ 8 , 9 ] . \n the ca conductance of cav1.1 channel is not necessary for functional excitation - contraction coupling between ryr1 and cav1.1 ; however , a direct protein - protein interaction between these two proteins in multiple sites is . \n it has been shown that cytoplasmic loops of cav1.1 and several regions of ryr1 play important role for normal physiological ec coupling in skeletal muscle [ 10 , 1417 ] . \n it has been also shown that protein - protein interaction between ryr1 and cav1.1 is necessary for cav1.1 display of ca conductance ( retrograde signaling ) . \n it is clear that there are multiple contact sites between ryr1 and cav1.1 and not all of them are recognized and understood , yet . \n the most investigated region of contact between ryr1 and cav1.1 in cav1.1 is ii - iii cytoplasmic loop , but other regions play a role [ 14 , 15 ] . in the present experiments , normal myotubes and dysgenic myotubes expressing either yfp - cav1.1 or yfp - cav1.1aa \n were used to examine the role of the iq motif in both functions of cav1.1 , as a voltage sensor in ec coupling and ca channel . \n first , i examined whether a fusion of yfp to cav1.1 would interfere with its function . \n the ca currents mediated by yfp - cav1.1 displayed an i - v relationship similar to the endogenous cav1.1 , suggesting that yfp fused on the n - terminus of cav1.1 does not interfere with its channel function , as was also shown by others . \n the ca currents mediated by yfp - cav1.1 also displayed current - dependent inactivation similar to the cdi of endogenous cav1.1 , further supporting observation that fusion of yfp with cav1.1 does not interfere with channel function . \n second , i examined how iq / aa mutation in cav1.1 will affect its function . \n surprisingly , the intriguing finding of the present study was that dysgenic myotubes expressing yfp - cav1.1aa displayed either very small or no measurable ca currents . \n significant decrease or abolishment of ca current through cav1.1 could have resulted from improper targeting or folding of the protein . \n if cav1.1aa was retained inside of myotubes due to incorrect folding and targeting , neither ca currents nor qmax would be obtained . \n the absence of ca currents in some of the dysgenic myotubes expressing yfp - cav1.1aa would suggest both . \n however , even though the ca current was absent , qmax comparable with normal myotubes was observed . \n the qmax measured in dysgenic myotubes expressing cav1.1aa was significantly larger ( p < 0.001 ) than in dysgenic myotubes alone , but similar to that of normal myotubes measured here and to the qmax measured in dysgenic myotubes expressing various constructs of wt cav1.1 at the similar experimental conditions elsewhere [ 6 , 7 ] . \n the amount of qmax in dysgenic myotubes expressing yfp - cav1.1aa suggests that iq / aa mutation in cav1.1 did not prevent the protein from being properly targeted and that protein can undergo voltage - dependent conformational changes . \n the size of small measurable ca currents measured in some ( 6 out of 14 ) of the dysgenic myotubes expressing cav1.1aa ( < 1pa / pf ) was similar to l - type ca currents measured in dyspedic ( lacking a functional gene of ryr1 ) myotubes , suggesting a loss of retrograde signaling from ryr1 . \n endogenous cav1.1 channels are present in sarcolemma of the dyspedic myotubes in similar density as in normal myotubes , as was demonstrated by comparable qmax ( dyspedic : 4.0 1.4 nc/f ; normal : 6.4 2.8 nc/f ) . \n thus , the amount of qmax measured in dysgenic myotubes expressing cav1.1aa ( 5.9 0.5 nc/f ) is in good agreement with the previously published values , and indicates that the iq / aa mutation may have also disrupted retrograde signaling between cav1.1 and ryr1 . \n the similar expression patterns and comparable colocalization of yfp - cav1.1 and yfp - cav1.1aa with ryr1 in dysgenic myotubes obtained by confocal microscopy and immunocytochemistry further support the argument that yfp - cav1.1aa seems to be folded and targeted properly to the t - sr junctions . \n in addition , much more drastic alternation or deletions in cav1.1 sequence did not have such dramatic effects [ 12 , 13 ] . \n third , the iq / aa mutation in c - terminus of cav1.1 had a dramatic effect on its function as a voltage sensor for ec coupling . \n even though amount of qmax in dysgenic myotubes expressing yfp - cav1.1aa is sufficient to support ec coupling ( see above ) , the voltage - gated ca release from sr was completely abolished in these cells . \n this finding suggests that either tethering of cam to cav1.1 as a structural subunit or the iq motif itself is necessary for orthograde signaling between cav1.1 and ryr1 ( ec coupling ) . \n overexpression of camwt and cam1234 in normal myotubes did not significantly affect the peak fluorescence - voltage relationship ( f / f - v ) in comparison with uninjected normal myotubes , suggesting that the ca - binding ability of cam does not play a role in skeletal muscle ec coupling in single twitch contractions . \n for the first time , the present study shows that the iq motif plays a role in both orthograde ( skeletal muscle ec coupling ) and retrograde ( ca current ) signaling between cav1.1 and ryr1 in vivo . \n several regions of ryr1 were shown to participate in protein - protein interactions between cav1.1 and ryr1 . however , until recently only the ii - iii loop of the cav1.1 has been thought to be necessary to convey orthograde and retrograde signaling between cav1.1 and ryr1 . \n the present findings suggest that the c - terminus in addition to the ii - iii loop participates in and is necessary for the correct transmission of signals between cav1.1 and ryr1 . \n these results support previously published in vivo findings that in addition to the ii - iii loop of cav1.1 additional intracellular loops of cav1.1 are necessary to restore the full extent of orthograde and retrograde signaling between cav1.1 and ryr1 . \n the present findings also support in vitro results from pull - down assays , where it was demonstrated that cam - binding region of ryr1 ( 36143543 ) interacts with the proximal c - terminus of cav1.1 ( 13931527 ) in the absence of cam [ 18 , 19 ] . \n it was also shown that cam binding to the ryr1 is not essential for skeletal ec coupling . \n this would indicate together with binding studies that cam association to either cav1.1 or ryr1 is not crucial for skeletal muscle ec coupling , but cam - binding domains of both cav1.1 and ryr1 are . \n for example , it has been shown that cam - binding region of ryr1 binds to iq peptide of cav1.2 and in pull - down assay binds to cav1.1 . \n it still remains to be determined whether cam itself needs to be tethered to cav1.1 to ensure signaling and more experiments are in progress . in conclusion , \n the results from confocal microscopy , immunocytochemistry , charge movement , and ca transients obtained from dysgenic myotubes expressing yfp - cav1.1aa indicate that the iq motif in the c - terminus of cav1.1 plays a crucial role in both orthograde ( ec coupling ) and retrograde ( ca current ) signaling between cav1.1 and ryr1 .", "role": "user" }, { "content": "ca2 + -dependent modulation via calmodulin , with consensus cam - binding iq motif playing a key role , has been documented for most high - voltage - activated ca2 + channels . \n the skeletal muscle cav1.1 also exhibits ca2 + -/cam - dependent modulation . here , \n whole - cell ca2 + current , ca2 + transient , and maximal , immobilization - resistant charge movement ( qmax ) recordings were obtained from cultured mouse myotubes , to test a role of iq motif in function of cav1.1 . \n the effect of introducing mutation ( iq to aa ) of iq motif into cav1.1 was examined . in dysgenic myotubes expressing yfp - cav1.1aa , neither ca2 + currents nor evoked ca2 + transients were detectable . \n the loss of ca2 + current and excitation - contraction coupling did not appear to be a consequence of defective trafficking to the sarcolemma . \n the qmax in dysgenic myotubes expressing yfp - cav1.1aa was similar to that of normal myotubes . \n these findings suggest that the iq motif of the cav1.1 may be an unrecognized site of structural and functional coupling between dhpr and ryr .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mucormycosis represents a group of life - threatening infections caused by fungi of the order mucorales . \n it is highly invasive and rapidly progressive resulting in high rates of morbidity and mortality . \n the infected tissue appears to be normal during the early stage of infection and progresses through the erythematous phase before the onset of violaceous discoloration and finally a black necrotic eschar . \n a 45-year - old married woman presented with complaints of rapidly spreading black lesion near the right side of the nose . \n there was no history of trauma , headache , pain in the eye , or seizures . \n she was a diagnosed case of diabetes mellitus on irregular treatment with oral hypoglycemic drugs and insulin therapy since four years . \n there was a history of previous hospitalization on three occassions for diabetic ketoacidosis . at the time of admission , \n mucocutaneous examination revealed a single , well - defined , erythematous , edematous plaque with black necrotic central eschar measuring 5 cm 3 cm involving the right side of the nose , nasolabial fold , and malar region [ figure 1 ] . on oral examination \n black necrotic eschar measuring 2 cm 2 cm involving the right side of hard palate was seen [ figure 2 ] . \n systemic examination including central nervous system was normal . based on the clinical examination findings , \n the fasting blood glucose was 120 mg / dl and hemoglobin a1c was 15% , representing very poor diabetic control . \n examination of the tissue smear on 10% koh mount revealed aseptate right angled hyphae . fungal culture with sabouraud 's dextrose agar at 37c showed cotton wool like colonies of mucor species [ figure 3 ] . \n the organism appeared as eosinophilic , thick - walled aseptate hyphae with neutrophilic infiltrates ; a few of them appeared hollow on cross - section in the dermis and subcutaneous tissue [ figure 5 ] . \n tissue gomorri 's methenamine silver ( gms ) stain revealed dark brown colored hyphae suggestive of mucormycosis [ figure 6 ] . \n magnetic resonance imaging of the brain showed mild edema of the extraocular muscles in the medial aspect with increased soft tissue thickness over the right orbital region . \n there was evidence of mucosal thickening in the right maxillary , frontal , sphenoid sinuses , and ethmoidal air cells suggestive of sinusitis . \n there was minimal mucosal thickening and subcutaneous edema involving the right maxillary sinus [ figure 7 ] . \n tablet voriconazole 200 mg twice daily for 5 days was started by the consulting physician , but showed no improvement ; injection liposomal amphotericin - b was started at an initial dose 0.5 mg / kg / day , accelerated upto 5 mg / kg / day . \n however , the patient succumbed possibly because of rapid systemic progression of the infection . a single well - defined black necrotic eschar measuring 5 cm 3 cm over the right maxillary region a single well - defined black necrotic eschar with slough on the hard palate sabouraud 's dextrose agar showed cotton wool like colonies of mucor lactophenol cotton blue preparation showed mature sporangia of mucor species eosinophilic , thick - walled aseptate hyphae with neutrophils , few of them appear hollow on cross section ( h and e , 40 ) similar section of tissue showed prominent fungal hyphae with special stain ( gms , 40 ) magnetic resonance imaging of brain showed mild edema of extra ocular muscles in the medial aspect with increased soft tissue thickness in the orbital region over the right side . \n there was evidence of mucosal thickening in the right maxillary , frontal , sphenoid sinuses and ethmoidal air cells suggestive of sinusitis . \n mucormycosis represents a group of life - threatening infections caused by fungi of the order mucorales . \n recent reclassification has abolished the class zygomycetes and placed the order mucorales in the subphylum mucormycotina . \n mucorales are saprophytic fungi characterized by broad , nonseptate , thick - walled hyphae found in the environment , particularly grow in soil , decaying wood and vegetable matter . \n fungi of the order mucorales belong to six families , all of which can cause mucormycosis . among them , rhizopus oryzae is the most common cause of infection \n . other species of the mucoraceae family that cause a similar spectrum of infections include rhizopus microsporus , rhizomucor pusillus , mycocladus corymbifer , apophysomyces elegans , and mucor species , which despite its name is a rare cause of mucormycosis . \n rhinocerebral form is the most common form and is fulminant in immunocompromised patients like those with diabetic ketoacidosis . \n the most commonly found genera in human diseases are rhizopus , mucor , and rhizomucor . \n rhizopus arrhizus is one of the most common species isolated from patients in a 10-year study of mucormycosis in india . according to the literature review , \n , 156 of which were identified ( 129 mucorales and 27 entomophthorales ) . among them , rhizopus spp . was the most frequent ( 95 cases ) followed by mucor spp . \n rhinocerebral mucormycosis is a fulminant infection of the nasal mucosa that quickly spreads to contiguous structures such as palate , paranasal sinuses , orbit , face and brain . in our patient , it presented as black necrotic eschar involving right side of the nose , malar area , nasolabial fold , nasal mucosa , and hard palate . \n when the spores are converted into hyphae , they invade and spread through the paranasal sinuses into the brain and orbit . \n thereafter the fungal hyphae spread through the paranasal sinuses and into the blood stream and rapidly spread to other organs , leading to death . in the blood vessels , hyphae forms thrombi which reduce vascularity to the tissues and \n there is a close histopathological resemblance between the fungal hyphae of mucormycosis and aspergillosis , the main difference being hyphae of mucor are nonseptate and branch at right angles whereas the hyphae of aspergillus are septate , smaller and branching at more acute angles . in our case \n , the characteristic fungal morphology of mucormycosis was identified on hematoxylin and eosin stain and confirmed by gms stain . \n our patient was a case of uncontrolled diabetes mellitus since four years , and presented with a necrotic plaque extending from right maxillary region to the hard palate . \n management included surgical resection of the eschar , and amphotericin b ( 0.5 - 5 mg / kg / day intravenous ) along with diabetic control measures . despite these medications , the patient died of infection within a span of 15 days . \n it is important to rule out mucormycosis in diabetic patients , as early diagnosis and treatment can reduce the morbidity and mortality .", "role": "user" }, { "content": "rhinocerebral mucormycosis is the most common form of mucormycosis occurring commonly in patients of diabetic ketoacidosis . \n fungi of the order mucorales belong to six families , among whom rhizopus is the most common , while mucor is a rare cause . \n we report a 45-year - old female with uncontrolled diabetes mellitus diagnosed to have rhinocerebrocutaneous mucormycosis caused by mucor species . \n the diagnosis was confirmed on histology and culture . \n a high - index of suspicion is required for early diagnosis and timely initiation of therapy to optimize the outcome . \n our patient succumbed to her infection .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: throughout the last decade , the number of video - assisted thoracic surgeries ( vats ) has increased rapidly [ 1 - 3 ] . in patients with early stage lung cancer , \n technical stability has already been proven and the indication for thoracoscopy is diversifying [ 4 - 10 ] . \n however , some researchers have questioned the safety and feasibility of thoracoscopy performed in patients with lung cancer [ 11 - 14 ] . \n there is some debate regarding recurrence and survival rates after thoracoscopic lobectomy in patients with early stage non - small cell lung cancer [ 8,13,15 - 19 ] . according to rueth 's retrospective results in a study about thoracoscopic lobectomies \n have done since 1994 , post - surgical morbidity and inflammation were lower in patients who had gone through thoracoscopic lobectomy than in patients who had gone through thoracotomic lobectomy . \n in addition , there was no difference in the 5-year survival rate when comparing the results of thoracoscopic lobectomy with the results of thoracotomic lobectomy . \n the authors of the present study retrospectively analyzed 1,067 cases of thoracoscopic lobectomy and their indications , conversion rate to thoracotomy during surgery , postsurgical complications , hospital mortality rate , and postsurgical recurrence and survival rate in order to suggest ways to widen the surgical application of the thoracoscopic lobectomy in the future . \n 1,067 patients who had gone through thoracoscopic lobectomy from december 24 , 2003 , to december 31 , 2009 , were retrospectively analyzed based on their medical records . \n data regarding age , sex , pre - surgical diagnosis , accompanying disease , date of surgery , name of surgery , conversion to thoracotomy , length of hospitalization , pathological diagnosis , presence of complications , adjuvant chemotherapy , follow - up observation period , recurrence , and survival was collected . \n subjects who underwent surgery had lesions that could be excised anatomically and showed reduced pulmonary ventilation on preoperative pulmonary function tests . \n the subjects ' pulmonary diseases were inflammatory diseases such as pulmonary tuberculosis , empyema , congenital pulmonary disease , primary lung cancer , metastatic lung cancer , and carcinoid tumor . in cases with benign pulmonary disease , \n lobectomy was performed if the majority of the pulmonary lobe was damaged , or segmentectomy or wedge resection could not be executed due to the proximity of the lesion to the central bronchus or vascular structures . \n however , thoracotomic lobectomy was performed in cases of ct scan evidence of pleural calcification , severe calcification around pulmonary vessels , or thorax deformation . in cases of non - small cell lung cancer \n , thoracoscopic lobectomy was executed if the preoperative cancer stage was stage i with no endobronchial lesion , if the tumor was located peripherally , or if the diameter of the tumor was less than 6 cm . in cases with a single metastasis to the brain , gamma knife surgery \n if non - small cell lung cancer was diagnosed pathologically before surgery , mediastinal lymph node biopsies were performed in areas 2r , 4r , 4l , and 7 under mediastinoscopy even if there was no evidence of mediastinal lymph node metastasis . \n if the patient was incapable of going through neoadjuvant chemoradiotherapy due to underlying disease or old age , lobectomy was executed without mediastinoscopy , even if mediastinal lymph node metastasis was suspected . \n patients with no diagnosis of preoperative pathological non - small cell lung cancer underwent thoracoscopic wedge resection , the frozen section was then analyzed , and lobectomy was done if it was diagnosed as cancer . \n the excised pulmonary lobe was removed from the pleural cavity in a plastic pouch to prevent implantation of cancer cells into the thoracic wall . \n mediastinal lymph node dissections were performed after lobectomy in all patients regardless of their clinical stage . in cases involving the right pleural cavity , \n dissection of the 2r , 3 , 4r , 7 , 8r , 9r , 10r , and 11r lymph nodes was performed . in cases involving the left pleural cavity , \n dissection of 4l , 5 , 6 , 7 , 8l , 9l , 10l , and 11l lymph nodes was performed . \n adjuvant chemotherapy or radiotherapy was done if the postoperative pathologic stage was more advanced when compared with the preoperative clinical stage . \n ct scans were done every 3 or 6 months for first 2 years after surgery to check for recurrence . \n all clinical stages or pathological stages of non - small cell lung cancer reported in this research were retrospectively applied according to the 7 lung cancer tnm staging proposed by international staging committee ( isc ) of the international association for the study of lung cancer ( iaslc ) . \n after general anesthesia , a 10-mm access port for a thoracoscope was made in the seventh or eighth intercostal space of the mid - axillary line to observe the pleural cavity . \n then , a 5 or 10 mm port was made in the seventh intercostal space of the posterior scapular line and a 4 or 5 cm working window was made in the fifth or sixth intercostal space of the mid - clavicular line . \n the overall survival period of patients who were still alive was considered to be the period from the date of surgery to either the date of the most recent visit or the last date ( march 17 , 2010 ) all living patients were called . \n if the patient had deceased , the survival period was considered to be from the date of surgery to the date of death . in cases of relapse , \n the disease free survival period was considered to be from the date of surgery to the date of relapse diagnosis . in cases without relapse , \n the disease - free survival period was set from the date of surgery to the most recent visit or the date of death . \n the survival curve was calculated using the kaplan - meier method using pasw statistics 18 ( spss inc . , \n ibm , chicago , illinois ) . the log - rank test was used for comparing the survival rates . \n from december 24 , 2003 to december 31 , 2009 , 1,067 patients ( 542 male , 525 female ) underwent thoracoscopic lobectomy . \n the subjects ' diseases included non - small cell cancer ( 832 ) , carcinoid tumor ( 12 ) , metastatic lung cancer ( 48 ) , and other diseases ( 175 ) ( table 1 ) . \n the average age was 56.9 years ( 12~86 years ) , and 162 patients ( 15.1% ) were over 70 years old . \n the median time period from hospitalization to discharge was 6 days ( 2~110 days ) . \n most patients had one pulmonary lobe excised , 21 patients went through right upper or lower bilobectomy ( 1.97% , non - small cell cancer , 19 cases ) , and one patient had a pneumonectomy . \n common causes for these conversions were hemorrhage from pulmonary artery branches and difficulties in detaching calcified or fibrous lymph nodes ( table 2 ) . \n all of these patients underwent lobectomy because of non - small cell lung cancer and the cause of death was the same for all cases , acute respiratory distress syndrome . \n the most common complication was continuous air leakage ( 62 cases ) ( table 3 ) . \n the most common pathological stage of non - small cell lung cancer was stage i with 649 cases ( 77.6% ) ( table 4 ) . \n the average follow - up observation period of non - small cell lung cancer patients was 22.9 months . \n the number of patients with relapse during the follow - up observation period was 120 , and 55 of them died . among patients with relapse , 40 patients had local relapse , 58 patients had remote relapse , and 22 patients had both local and remote relapses ( table 5 ) . \n after surgery , 166 patients underwent adjuvant chemotherapy ( 106 patients ) , radiation therapy ( 19 patients ) , or chemoradiotherapy ( 41 patients ) . \n the overall 1-year and 3-year survival rates for all non - small cell lung cancer patients were 96.67% and 89.51.6% , respectively . \n the disease - free 1-year and 3-year survival rates were 91.81.0% and 77.02.1% , respectively . \n the 1-year and 3-year overall survival rates of 407 patients in pathological stage ia were 98.66% and 94.11.8% , respectively . \n the disease - free 1-year and 3-year survival rates were 97.58% and 89.72.2% , respectively . \n two hundred and forty - two patients in pathological stage ib showed overall 1-year and 3-year survival rates of 94.31.5% , and 89.12.5% , respectively . \n the disease - free survival rates were 91.61.9% and 80.33.7% for 1 and 3 years , respectively . \n there were 117 cases where the pathological stage was stage ii . postoperative overall survival rates at 1 and 3 years were 96.21.9% and 79.26.5% , respectively . \n the disease - free survival rates at 1 year and 3 years were 81.43.9% and 61.96.6% . \n postoperative overall survival rates at 1 and 3 years were 94.23.3% and 83.17.2% , respectively . \n the disease - free survival rates at 1 and 3 years were 79.05.9% and 21.49.6% , respectively ( fig . \n 1 ) . among the 832 patients with non - small cell lung cancer , 769 patients were in clinical stage i , of which 122 ( 15.9% ) showed increased pathological stage after surgery . \n the 1-year and 3-year overall survival rates of these patients were 95.71.9% and 82.55.0% , respectively . \n the 1-year and 3-year disease - free survival rates were 85.23.4% and 45.96.8% , respectively ( fig . \n the most common cause of the pathologic upstaging was pathological diagnosis showing local or mediastinal lymph node metastasis while no lymph node metastasis in the clinical stage . \n sixty - four patients out of 813 showed a preoperative clinical stage of n0 and a postoperative stage of n1 . \n the 1-year and 3-year disease - free survival rates were 83.65.0% and 53.89.3% , respectively . \n the 1-year and 3-year disease - free survival rates were 81.06.1% and 21.49.7% , respectively ( fig . \n the application of vats has been expanding from diseases such as benign pleural disease , lung disease , and mediastinal disease to lung cancer and esophageal cancer . \n the range of pulmonary resections has also been expanding , currently including pulmonary wedge resection , segmentectomy , lobectomy , bilobectomy , and even pneumectomy . \n . reported on the largest number of thoracoscopic lobectomy cases in a single institute . \n their thoracoscopic indications were primary lung cancer , lymphoma , metastatic lung cancer , or benign pulmonary disease , which were similar to the author 's indications . \n a low number of postoperative complications and a low hospital mortality rate have been reported in various articles . \n hospital mortality rate after thoracotomic lobectomy has been found to be similar to that of thoracoscopic lobectomy , whereas postoperative complications were less common in thoracoscopic lobectomy . \n these results are similar to the results of our study in complication occurrence rate ( 14.0% , 162 cases ) and hospital mortality rate ( 0.84% ) . among postoperative complications , \n a stapler was used for isolation rather than electrocautery or blunt dissection when severe adhesion was present in the interlobar fissure . \n then , denuded visceral pleura was covered with absorbable felt or applied with glue to reduce air leakage . \n there are numerous risk factors affecting hospital mortality . in this study , 5 out of the 9 patients who died in the clinic had diffuse interstitial lung disease . \n this implies that patients with diffuse interstitial lung disease must cautiously decide whether to undergo a lobectomy , which may compromise lung function after surgery . \n since fev1 levels are often normal based on pulmonary function testing , diffusing capacity ( dlco ) must be measured and operation should be avoided when dlco levels are low . \n in addition , vats is less painful than thoracotomy and has a shorter hospitalization period . \n there have been numerous reports regarding the fact that thoracoscopic lobectomy is not oncologically different from thoracotomic lobectomy . \n rueth and andrade showed that there were no oncological differences between thoracoscopic and thoracotomic lobectomy by analyzing research articles about thoracoscopic lobectomy from 1994 to present . \n . showed that the 5-year disease - free survival rate of thoracoscopic lobectomy was significantly higher than that of thoracotomic lobectomy ( p=0.03 ) . \n . showed that there was no difference in the number of collected lymph nodes , survival rate , and recurrence when comparing thoracoscopic mediastinal lymph node dissection and thoracotomic mediastinal lymph node dissection . \n common causes for conversion from thoracoscopic surgery to thoracotomic surgery were hemorrhage in pulmonary artery branches and difficulty in detaching a calcified or fiberized lymph node . to reduce the conversion rate , \n preoperative ct should be analyzed thoroughly to check for the calcification or fibrosis of lymph nodes along with thickening . \n on the other hand , there are different views about the feasibility of the thoracoscopic lobectomy for lung cancer . \n opponents of insist that thoracoscopic lobectomy results in lower survival rate and higher relapse rate . \n thoracoscopic lobectomy may result in more manipulation of the lung , causing cancer cells to disseminate through the pulmonary vein . \n in addition , excisions with a stapler may leave cancer cells at the resection margin , mediastinal lymph node dissection may be insufficient , and cancer cells may be disseminated while removing the specimen out of the body . in the author 's institute , \n the pulmonary vein was detached before the pulmonary artery , if possible , the resection margin was checked first with the naked eye , and the resection margin went through a frozen section reading when there was a possibility of cancer cells remaining . \n there has been no established definition of complete lymph node dissection . however , the authors defined complete lymph node dissection to mean where no lymph node or fatty tissue remained . to prevent damage to the nerves or thoracic duct , an ultrasonic cutter ( harmonic ace , ethicon endo - surgery inc . , \n , the specimen was placed in a plastic bag to prevent dissemination of cancer cells . \n the pathological stage i patients ' 3-year disease - free survival rate was 86.21.9% , whereas pathological stage ii patients ' 3-year disease - free survival rate was 61.96.6% . \n however , it is too early to affirm that the postoperative relapse rate of stage i non - small cell lung cancer is low or that stages greater than ii have greater postoperative relapse rates . in order to draw a more accurate conclusion on the relapse and survival rates of patients treated with thoracoscopic lobectomy for early non - small cell lung cancer , \n long - term follow - up observation is needed . in the previous articles , an analysis of the 5-year overall survival rate after thoracoscopic lobectomy for early stage non - small cell lung cancer \n was conducted , whereas most of the previous studies have not reported specifics about 5-year disease - free survival rates . \n yamamoto et al . recently reported the patients ' 5-year survival and disease - free survival rate and categorized them by each stage . \n some recent studies have focused on whether patients who are diagnosed with clinical stage i and end up with pathological stage ii or worse after thoracoscopic lobectomy show lower survival and greater relapse rates than patients treated with thoracotomic lobectomy . in the present study , it was not possible to draw conclusions on this topic , since there were no comparisons made with thoracotomic lobectomy . \n however , according to the kim et al 's results in the past 4 years , and reports by watanabe et al . over 9 years , there has been no difference in prognosis , and we have concluded that conversion to thoracotomic surgery is not necessary even if n2 lymph node metastasis is observed during surgery . in order to minimize pathologic upstaging , efforts to improve the accuracy of preoperative diagnosis are necessary . \n the consistency of the research results from our clinic was maintained by using the same medical team to perform operations with identical indications and criteria ( lymph node biopsy and mediastinal lymph node dissection under mediastinoscopy ) . \n also , with a relatively abundant amount of data ( 1,067 cases ) , results such as low morbidity , low hospital mortality , and low conversion rate are acceptable . in the future , \n the number of patients with early stage non - small cell lung cancer with an indication of thoracoscopic lobectomy will increase . \n as diagnostic techniques advance , the number of patients with early stage lung cancer is increasing , adenocarcinoma is becoming more common than squamous cell carcinoma . \n in addition , the number of female patients with the disease is increasing , in which the aesthetic benefits of thoracoscopic surgery are more preferable . \n as more thoracoscopic lobectomy experiences are documented in the future , thoracoscopic lobectomy could be applied to the patients in stage ii lung cancer or patients with endobronchial cancer needing a sleeve lobectomy . \n but more prospective studies are necessary to recognize it as a feasible method of treatment . \n first , data was analyzed retrospectively and there were no comparisons made with thoracotomic lobectomy . \n second , in spite of the fact that all operations were performed in a single institute with identical indications , it is possible that the surgeons performed thoracoscopic surgery in cases with better expected prognosis . \n finally , since the number of patients within a year increased more than 50% when compared with previous research , the overall follow - up observation period was short . \n therefore , a longer follow - up observation period of thoracoscopic lobectomy for early stage non - small cell lung cancer would be necessary to verify long - term results . \n based on our 6 years of experience , thoracoscopic lobectomy is a safe and useful method for treating various pulmonary diseases including early non - small cell lung cancer , without a high complication occurrence rate or hospital mortality rate . \n in addition , an excellent survival rate was observed in patients with early non - small cell lung cancer . \n however , depending on the stage of the disease , continued collection of data may be necessary to observe long - term results .", "role": "user" }, { "content": "backgroundvideo - assisted thoracic surgery ( vats ) lobectomy has been performed with increasing frequency over the last decade . however , there is still controversy as to its indications , safety , and feasibility . especially regarding lung cancer surgery , it is not certain whether it can reduce local recurrences and improve overall survival.materials and methodswe retrospectively reviewed 1,067 cases of vats lobectomy performed between 2003 and 2009 , including the indications , postoperative morbidity , mortality , recurrence , and survival rate.resultsone thousand and sixty seven patients underwent vats lobectomy for the following indications : non - small cell lung cancer ( nsclc ) ( n=832 ) , carcinoid tumors ( n=12 ) , metastatic lung cancer ( n=48 ) , and benign or other diseases ( n=175 ) . there were 63 cases ( 5.9% ) of conversion to open thoracotomy during vats lobectomy . \n one hundred thirty one ( 15.7% ) of the 832 nsclc patients experienced pathologic upstaging postoperatively . \n the hospital mortality rate was 0.84% ( 9 patients ) , and all of them died of acute respiratory distress syndrome . \n one hundred forty - nine patients ( 14.0% ) experienced postoperative complications . \n the median follow - up was 22.9 months for patients with nsclc . during follow - up , \n 120 patients had a recurrence and 55 patients died . for patients with pathologic stage i , the overall survival rate and disease - free survival rate at 3 years was 92.21.5% and 86.21.9% , respectively \n . for patients with pathologic stage ii disease , the overall survival rate and disease - free survival rate at 3 years was 79.26.5% and 61.96.6% , respectively.conclusionour results suggest that vats lobectomy is a technically feasible and safe operation , which can be applied to various lung diseases . in patients with early - stage lung cancer \n , excellent survival can be also achieved .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: metastatic breast cancer ( mbc ) is the \n second leading cause of cancer - related fatality in women , accounting \n for more than 40,000 deaths each year . \n mbc has a five - year relative survival rate of 23% compared with \n 99% for patients with nonmetastatic breast cancer . \n these statistics suggest an urgent and significant need \n for developing novel and efficient therapeutics for the treatment \n of mbc . \n a principal challenge in mbc treatment is to determine \n how to block mbc cell migration . \n while \n many cancer therapies focus on cytotoxicity and targeting , few address \n migration , which inversely correlates with patient survival . \n ideally , an effective drug delivery strategy \n would possess multiple functions , including targeting , triggering \n delivery , and efficiently reducing mbc cell migration . \n although \n human epidermal growth factor receptor 2 ( her2 ) targeted therapeutics \n ( trastuzumab , lapatinib , and neratinib ) have significantly \n improved the her2 positive breast cancer prognostic outcome , her2 + \n breast cancers comprise only approximately 2025% of all breast \n cancers . \n a variety of other receptors \n ( e.g. , transferrin receptor and epidermal growth factor receptor ) \n are under intense investigation for targeting breast tumors ; their application is hindered by their expression on a number of \n normal tissues . \n an effective therapeutic target would have differential \n expression in breast cancer and normal tissues and be broadly identified \n on a range of breast cancers . \n c - x - c chemokine receptor type \n 4 ( cxcr4 or cd184 ) has been investigated extensively due to its potential \n role in metastasis . \n cxcr4 is a g protein - coupled \n receptor that plays an important role in chemosensory transduction \n mechanisms in leukocytes and hematopoietic stem cells . \n it regulates \n cell migration along chemokine gradients , toward stromal derived factor \n 1 ( sdf1 or cxcl12 ) . \n when cxcr4 is stimulated \n by its ligand sdf-1 , cxcr4 couples with gi family proteins and activates a number of signaling pathways involved in a variety of biological \n responses . \n for example , cxcr4 ligand \n binding can lead to activation of pi3k and rho family gtpases involved \n in the regulation of chemotaxis and survival . \n in addition to receptor inhibition , we \n hypothesized that silencing of lipocalin-2 ( lcn2 ) at the same time \n would synergistically hinder cell migration . \n lcn2 , also referred to \n as neutrophil gelatinase - associated lipocalin ( ngal ) , is a secreted \n protein that is a member of the lipocalin protein superfamily . \n increased \n lcn2 levels have been reported in a variety of human epithelial cancers , \n including breast , ovarian , colon , pancreatic , and thyroid . in breast cancer , \n we have previously shown that lcn2 induced the \n epithelial to mesenchymal transition ( emt ) in breast cancer cells \n and the knockdown of lcn2 decreased breast cancer cell migration and \n invasion . \n consistent with our findings , \n deficiency of lcn2 reduced tumor growth and metastasis in a transgenic \n mouse model of breast cancer . \n for these \n reasons , we chose lcn2 as a second target to inhibit metastasis . small interfering rna ( sirna ) is able to induce the destruction of \n specific mrna sequences , altering the behavior of diseased cells . \n the major stumbling block \n for the clinical sirna therapy is its delivery to target cells . \n the \n short half - life ( t1/2 1.5 min ) of sirna in blood and need for intracellular \n delivery are challenges for translation to the clinic . \n a variety of \n methods have been developed to deliver sirna , including direct intravenous \n injection of naked or chemically stabilized sirna , packaging of sirna into dna plasmid vectors , transposon vectors ( transgenic plasmids ) , plasmid - infected viruses , virosomes \n ( reconstituted viral envelopes ) , lentiviral \n vectors , and liposomes . \n we have previously demonstrated that ph - responsive liposomes are \n advantageous for delivering sirna , because they not only improve pharmacokinetics \n but also provide a stable shield from enzyme degradation . in this report \n , we hypothesized that a \n synergistic treatment coupled cxcr4 axis blockade and lcn2 silencing \n could inhibit mbc cell migration more efficiently than either one \n of these treatments alone . \n the role of cxcr4 in our drug delivery \n system is 2-fold : ( 1 ) targeting cxcr4 overexpression on breast cancer \n cells , which may enhance therapeutic binding , and ( 2 ) inhibiting mbc \n metastasis by blocking the cxcr4 chemokine axis . targeting and inhibition of cxcr4 together with ph - triggered \n delivery of lcn2 sirna may be achieved in one vehicle . \n this multitargeted \n approach , which obstructs two migratory pathways , may be a novel and \n powerful strategy for inhibiting mbc migration . \n 1,2-dioleoyl-3-dimethylammonium - propane ( dodap ) , 1,2-dioleoyl - sn - glycero-3-phosphocholine ( dopc ) , and 1,2-dioleoyl - sn - glycero-3-phosphoethanolamine - n - dodecanoyl \n ( n - dod - pe ) were obtained from avanti polar lipids ( alabaster , al ) . \n immunoglobulin g ( igg ) isotype control , mouse anti - human cxcr4 monoclonal \n antibody ( acxcr4 ) , and northernlight 557 ( nl557)-conjugated donkey \n anti - mouse igg were purchased from r&d systems ( minneapolis , mn ) . \n triton x-100 , 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride \n ( edc ) , n - hydroxysuccinimide ( nhs ) , bovine serum albumin \n ( bsa ) , rhodamine - b isothiocyanate - conjugated dextran ( rhodamine - dextran , \n 10 kda mw ) , anhydrous dimethyl sulfoxide ( dmso ) , and ethanol ( etoh ) \n were purchased from sigma - aldrich ( st . \n phycoerythrin ( pe)-conjugated \n mouse anti - human cxcr4 antibody ( pe - acxcr4 ) and pe - conjugated mouse \n igg isotype ( pe - igg ) were purchased from biolegend ( san diego , ca ) . \n phosphate buffered saline ( pbs ) , 0.25% trypsin/2.6 mm ethylenediaminetetraacetic \n acid ( edta ) solution , human cxcr4 taqman gene expression assay ( hs.593413 ) , \n gibco dulbecco s modified eagle medium ( dmem ) , gibcodmem / f12(1:1 ) , \n 4,6-diamidino-2-phenylindole ( dapi ) , quant - it rna assay kit , \n lipofectamine rnaimax transfection reagent , and celltracker green \n cmfda ( 5-chloromethylfluorescein diacetate ) were purchased from invitrogen \n ( carlsbad , ca ) . \n l-15 medium and roswell park memorial \n institute ( rpmi)-1640 medium were obtained from atcc ( manassas , va ) . \n lab - tek ii chamber slide system was obtained from thermo fisher scientific \n ( pittsburgh , pa ) . \n nuclepore track - etched membrane ( pore size : 100 \n nm ) was obtained from whatman ( florham park , nj ) . \n float - a - lyzer g2 \n dialysis tubing ( mwco 300 kda ) was purchased from spectrum laboratories \n ( rancho dominguez , ca ) . \n slide - a - lyzer dialysis cassette ( mwco 20 kda ) \n was obtained from pierce biotechnology ( rockford , il ) . \n dojindo cell counting kit was purchased from dojindo molecular \n technologies ( rockville , md ) . \n diff - quik stain set was purchased from \n siemens healthcare diagnostics ( tarrytown , ny ) . \n hcc1500 , mda - mb-175vii , mda - mb-436 , mda - mb-231 , \n and mcf10a were obtained from american type culture collection ( atcc , \n manassas , va ) and cultured in rpmi-1640 medium , leibovitz s \n l-15 medium , dmem , and dmem / f12(1:1 ) medium with supplements , respectively . \n sigenome \n smartpool human lcn2 sirna constructs and sigenome non - targeting sirna \n pool were purchased from dharmacon ( lafayette , co ) . \n lcn2 sigenome \n smartpool sirna is composed of four lcn2 sirnas : d-003679 - 05 , ugggcaacauuaagaguua ; \n d-003679 - 03 , gaagacaagagcuacaaug ; \n d-003679 - 02 , ggagcugacuucggaacua ; \n d-003679 - 01 , gagcugacuucggaacuaa . \n rna was \n collected with the qiagen rneasy minikit and quantified by a spectramaxplus \n 384 uv visible spectrophotometer ( molecular devices corp , sunnyvale , \n ca ) . the pcr was performed by using a steponeplus real - time pcr system \n ( applied biosystems , carlsbad , ca ) . \n all pcr samples were referenced \n to the gene expression of glyceraldehyde 3-phosphate dehydrogenase \n ( gapdh ) . \n breast cancer \n cell cxcr4 surface expression was quantified by using quantum simply \n cellular microbeads with the manufacturer s protocol . \n 10 cells were harvested and rinsed twice , and 1% bovine serum \n albumin ( bsa ) in pbs solution was used to block the cells for 30 min \n in an ice bath . then cells were stained with pe - acxcr4 antibody for \n 1 h at rt . after antibody staining , \n cells were rinsed with 1% bsa \n in pbs three times , resuspended in pbs , and evaluated by a bd facscalibur \n flow cytometer ( bd biosciences , san jose , ca ) . 2 10 cells were seeded in a lab - tek \n ii chamber slide system overnight . then cells were fixed with 4% formaldehyde \n in pbs at rt for 10 min and blocked with 1% bsa in pbs for 30 min \n in an ice bath . \n resulting fixed cells were stained with mouse anti - human \n cxcr4 primary antibody and northernlight 557 conjugated goat anti - mouse \n secondary antibody , sequentially . \n samples were examined under a leica tcs sp5 confocal fluorescent microscope \n ( leica microsystems , buffalo grove , il ) . \n dopc , dodap , and n - dod - pe were mixed \n at a mole ratio of 65:30:5 and dried in a rotary evaporator . resulting 5 mol thin film was redissolved in 1 ml of dmso : etoh ( 7:3 , v : v ) and \n added to 9 ml of a solution of 15 g / ml sigenome smartpool human \n lcn2 sirna or sigenome non - targeting sirna ( scrambled sirna ) in pbs \n ( ph 7.4 ) . \n after 10 freeze thaw cycles , lipid solution was extruded \n via a northernlipids extruder with a 100 nm polycarbonate nanoporous \n membrane . \n obtained liposome solution was dialyzed in pbs using a slide - a - lyzer \n dialysis cassette ( mwco 20 kda ) overnight at rt . \n 2 mg of edc \n and 3 mg of nhs were incubated with 1 mmol of lipid ( liposomes ) in \n pbs for 6 h at rt . \n a slide - a - lyzer dialysis cassette ( mwco 20 kda ) \n was used to remove unreacted edc and nhs from the liposome solution . \n then , acxcr4 or the igg control was added to edc - modified liposomes \n at a molar ratio of 1:1000 ( antibody : phospholipid ) and incubated overnight \n at rt . \n unreacted antibodies were removed by 24 h dialysis using a \n float - a - lyzer g2 dialysis tubing ( mwco 300 kda ) . \n acxcr4-labeled , rhodamine - dextran \n encapsulating liposomes ( acxcr4-rd - phs ) were also produced for liposome \n binding studies . \n its preparation process is similar to that of acxcr4-lcn2-phs \n except that 1 ml of lipid solution was added to a 9 ml rhodamine - dextran \n solution ( 1 mg / ml ) . \n lcn2 sirna encapsulated lipofectamine ( lcn2-lipo ) \n was prepared using the manufacturer s protocol and used as \n a positive control . \n 2 m borosilicate beads were coated \n with a layer of lipids from liposomes by sonicating small unilamellar \n liposomes with microbeads in pbs for 6 h. pe - acxcr4 or pe - igg ( nonspecific \n binding ) was conjugated to liposome coated microbeads using the same \n edc / nhs chemistry . acxcr4 surface density on each microbead \n was evaluated \n by flow cytometry following a similar protocol for cxcr4 cell surface \n expression quantification . \n dynamic light scattering was used to measure \n the liposome size and zeta potential with a zeta - pals analyzer ( brookhaven \n instruments , holtsville , ny ) in pbs ( ph 7.4 ) . \n a quant - it ribogreen rna assay ( invitrogen , carlsbad , ca ) was performed \n to determine the encapsulation efficiency of sirna within the liposome \n samples by using the manufacturer s protocol . \n a sirna concentration \n calibration curve was generated from a series of serially diluted \n sirna standard solutions and appropriate backgrounds measured on a \n spectramaxplus 384 uv \n . then a 20 l liposome sample was added \n to 1 ml of 0.5% triton x-100 in a microcentrifuge tube and vortexed \n for 1 min . \n the microcentrifuge tube was transferred to a 37 c \n incubator for 1 h. triton x-100 is a surfactant that lyses liposomes . \n then , 200 l of the sirna containing triton x-100 solution was \n homogeneously mixed with 200 l of 200-fold diluted quant - it \n ribogreen rna reagent working solution for 5 min . \n resulting mixture \n solution was added to at least three wells for each sample of a flat \n bottom 96-well cell culture plate and measured for fluorescence . \n the \n 0.5% triton x-100 solution mixed with 200-fold diluted quant - it ribogreen \n rna reagent working solution was used as a blank control . \n the encapsulation \n efficiency is calculated from the following formula : encapsulated \n sirna concentration / initial sirna concentration 100 . \n release of sirna from acxcr4-lcn2-ph \n and acxcr4-lcn2-lp were measured in pbs at ph 5.5 and 7.4 at 37 c . \n m ) was added to a float - a - lyzer \n g2 dialysis tubing ( mwco 300 kda ) and dialyzed in 30 ml of pbs ( ph \n 5.5 or 7.4 ) at 37 c on a shaker ( 100 rpm ) . \n 100 l samples \n were collected from the solution outside the dialysis tube at different \n time points , and the sirna concentration was quantified with quant - it \n rna assay kit on a spectramaxgemin xps fluorescence spectrophotometer \n ( molecular devices corp , sunnyvale , ca ) . \n hcc1500 , mda - mb-175vii , mda - mb-436 , mda - mb-231 , and mcf10a cells \n were seeded on 6-well plates at a density of 3 10 cells / well overnight \n . then cells were incubated for 4 h at 37 c \n with ( 1 ) rhodamine - dextran encapsulated nonspecific ( igg ) liposome \n ( igg - rd - ph ) and ( 2 ) acxcr4-rd - ph at a concentration of 1 mol \n lipid/10 cells . then liposome binding efficiency was evaluated \n by flow cytometer and analyzed with flowjo software . \n the fold - over \n igg - rd - ph value was calculated by dividing the mean fluorescence intensity \n of acxcr4-rd - ph stained cells by that of the igg - rd - ph stained cells . \n immunofluorescent \n staining was performed as described previously in cxcr4 immunofluorescent \n staining section . instead of using acxcr4 antibody , \n cells were incubated \n for 4 h at 37 c with ( 1 ) igg - rd - phs and ( 2 ) acxcr4-rd - phs , respectively . 10 cells ( hcc1500 , mda - mb-175vii , \n and mcf10a ) or 10 cells ( mda - mb-436 and mda - mb-231 ) were \n seeded in 6-well plates and incubated for 24 h. cells were treated \n with ( 1 ) pbs ; ( 2 ) naked sirna ; ( 3 ) acxcr4-ph without sirna ; ( 4 ) acxcr4-scr - ph ; \n ( 5 ) lcn2-lipo ; ( 6 ) igg - lcn2-ph ; ( 7 ) acxcr4-lcn2-lp ; and ( 8) acxcr4-lcn2-ph \n for 6 h at the sirna concentration of 72 pmol/10 cells \n ( equivalent lipid concentration : 1 mol/10 cells \n for acxcr - ph , acxcr - scr - ph , igg - lcn2-ph , and acxcr4-lcn2-ph ; 2.25 \n mol/10 cells for acxcr - lcn2-lp ; 0.5 mol/10 cells for lcn2-lipo ) . \n cells were rinsed three times with \n pbs and further grown for 72 h. lcn2 gene expression was determined \n by qrt - pcr . in the liposome concentration dependence tests , \n mda - mb-436 and mda - mb-231 cells were treated with acxcr4-lcn2-ph for \n 6 h at three different lipid concentrations : 0.25 , 0.5 , and 1 mol/10 cells . \n the sirna concentration was different between samples : \n acxcr4-lcn2-ph , acxcr4-scr - ph , and lcn2-lipo had 72 , 70 , and 140 pmol \n per mol of lipid , respectively . \n cells were rinsed three times \n with pbs and further grown for 72 h. the lcn2 gene expression was \n examined by qrt - pcr . \n two aggressive mbc \n cells , mda - mb-436 and mda - mb-231 , were treated with ( 1 ) pbs ; ( 2 ) naked \n sirna ; ( 3 ) acxcr4-ph without sirna ; ( 4 ) acxcr4-scr - ph ; ( 5 ) lcn2-lipo ; \n ( 6 ) igg - lcn2-ph ; ( 7 ) acxcr4-lcn2-lp ; and ( 8) acxcr4-lcn2-ph for 6 \n h at the sirna concentration of 72 pmol/10 cells . \n cells \n were rinsed three times with pbs and further grown for 72 h. mda - mb-436 \n ( 10 cell per well ) or mda - mb-231 ( 50,000 cell per well ) \n cells were seeded onto costar transwell insert with permeable support \n polycarbonate membrane with 8 m pore size in a 24-well plate . \n dmem without or with 10% fetal bovine serum was added to the upper \n and lower wells respectively . \n cells were incubated and allowed to \n migrate for 20 h. then cells on the reverse side of the transwell \n membrane facing the lower chamber after transmigrating through the \n 8 m pores of the transwell membrane were stained with diff - quik \n stain set . \n mda - mb-436 and mda - mb-231 cells were \n treated with acxcr4-lcn2-ph for 6 h at three different lipid concentrations : \n 0.25 , 0.5 , and 1 mol/10 cells . \n cells were rinsed \n three times with pbs and further grown for 72 h. cell migration was \n examined by transwell migration assay as described above . in liposome concentration dependence tests , \n mda - mb-436 and mda - mb-231 \n cells were treated with acxcr4-lcn2-ph for 6 h at three different \n lipid concentrations : 0.25 , 0.5 , and 1 mol/10 cells . \n cells were rinsed three times with pbs and further grown for 72 h. \n the cytotoxicity of liposome treated cells was evaluated by dojindo \n cytotoxicity assay with the manufacturer s protocol . \n data were measured in at least triplicate and presented \n as mean standard deviation . \n cxcr4 was previously identified as being significantly \n overexpressed in human breast tumor samples by immunohistochemical \n staining ( ihc ) . in our study , we characterized \n the cxcr4 gene and surface expression in four mbc cell lines : hcc1500 , \n mda - mb-175vii , mda - mb-436 , and mda - mb-231 . hcc1500 is estrogen receptor \n ( er)+/progesterone receptor ( pr)+/her2 ; mda - mb-175vii is er+/pr/her2 ; \n and mda - mb-436 and mda - mb-231 are triple - negative ( er/pr/her2 ) . \n the non - neoplastic mammary epithelial cell line , mcf10a , was used \n as a control . \n cxcr4 gene expression was quantified relative to mcf10a \n by qrt - pcr . as shown in figure 1a , hcc1500 , \n mda - mb-175vii , mda - mb-436 , and mda - mb-231 exhibited 10- , 2.5- , 3.7- , \n and 2.8-fold higher cxcr4 gene expression than mcf10a , respectively . \n characterization \n of cxcr4 gene and surface expression on metastatic breast cancer and \n normal breast epithelial cells . \n cxcr4 gene expression was quantified \n by qrt - pcr in panel a. cxcr4 fold change is relative to gapdh ( * * * p < 0.001 ) . \n panels b p are representative confocal \n fluorescence microscope images of cxcr4 immunofluorescent staining \n in hcc1500 ( b d ) ; mda - mb-175vii ( e g ) ; mda - mb-436 ( h j ) ; \n mda - mb-231 ( k m ) ; and mcf10a ( n p ) . \n dapi was used to \n stained the cell nuclei ; mouse anti - human cxcr4 antibody ( primary ) \n and goat anti - mouse nl557 antibody ( secondary ) were used to stain \n cxcr4 . \n p represent 20 m . the cxcr4 surface density was \n quantified via flow cytometry using a microbead assay ( table 1 ) . \n similar to their \n cxcr4 gene expression levels , mbc cell lines demonstrated significantly \n higher cxcr4 surface expression than mcf10a . \n cxcr4 surface expression \n in hcc1500 and mda - mb-175vii was over 20-fold higher than mcf10a . \n the most aggressive , triple - negative mda - mb-231 cells had considerably \n less cxcr4 surface expression than both hcc1500 and mda - mb-175vii \n cells . \n representative micrographs illustrated greater cxcr4 surface expression \n on hcc1500 , mda - mb-175vii , mda - mb-436 , and mda - mb-231 ( figure 1b m ) relative to mcf10a ( figure 1n p ) . \n these data confirm that cxcr4 is overexpressed \n on the cell surface of mbc cells but not non - neoplastic mcf10a cells . \n cxcr4 expression in leukocytes , endothelial cells , and hematopoietic \n stem cells is lower than cancer cells . \n we have shown previously that cxcr4 surface expression not \n gene expression was a better predictor of in vitro liposome binding . \n we engineered \n cxcr4-targeting , lcn2 sirna - encapsulating , ph - responsive liposomes \n to test our synergistic therapeutic hypothesis . \n ph - responsive liposomes \n are composed of a mixture of 1,2-dioleoyl - sn - glycero-3-phosphocholine \n ( dopc ) , 1,2-dioleoyl-3-dimethylammonium - propane ( dodap , pka 6.6 ) , and 1,2-dioleoyl - sn - glycero-3-phosphoethanolamine - n - dodecanoyl \n ( n - dod - pe ) ( 65:30:5 , mol : mol : mol ) . \n liposomes incorporating dodap respond \n to the acidic endosomal environment by increasing \n their cationic character , fusing with the endosomal membrane , and \n delivering the encapsulated sirna within the cytoplasm . \n n - dod - pe was selected as the anchor for either \n an anti - cxcr4 antibody ( acxcr4 ) or a nonspecific immunoglobulin g \n ( igg ) conjugation . \n edc / nhs chemistry was used to covalently bond the \n carboxylic acid on n - dod - pe to a primary amine group present on acxcr4 \n or igg , which is a widely used approach to modify liposomes . conjugated acxcr4 antibodies can target liposomes \n specifically to cxcr4 overexpressing mbc cells and simultaneously \n inhibit the cxcr4 chemokine axis . \n sigenome smartpool human lcn2 sirna \n was encapsulated within the liposome by directly mixing sirna solubilized \n in pbs with the dry lipid film during liposome preparation . a nonresponsive \n liposome comprised of dopc : \n n - dod - pe ( 95:5 , mol : mol ) was used as a \n control . \n liposome formulations were prepared and tested to compare \n the efficacy of sirna delivery : ( 1 ) acxcr4-targeted , lcn2 sirna encapsulating , \n ph - responsive liposome ( acxcr4-lcn2-ph ) ; ( 2 ) acxcr4-targeted , \n lcn2 \n sirna encapsulating , nonresponsive liposome ( acxcr4-lcn2-lp ) ; ( 3 ) \n cxcr4-targeted , scrambled sirna encapsulating , ph sensitive liposomes \n ( acxcr4-scr - ph ) ; and ( 4 ) lcn2 sirna encapsulating , lipofectamine complexes \n ( lcn2-lipo ) . acxcr4-lcn2-lp and acxcr4-scr - ph were used as negative \n controls , and lcn2-lipo was a positive control . \n the hydrodynamic diameters \n of acxcr4-lcn2-ph , acxcr4-lcn2-lp , acxcr4-scr - ph , and lcn2-lipo were \n 132 4 , 103 2 , 134 3 , and 703 345 nm , respectively , \n as determined by dynamic light scattering ( dls ) . \n liposomes with diameters \n of less than 200 nm are ideal for intravenous administration due to \n their enhanced permeability and retention ( epr ) within tumors . \n the polydispersity index ( pdi ) of all three \n extruded liposomes was less than 0.1 , demonstrating uniformity . \n lipofectamine \n complexes are routinely larger and less uniform due to the aggregation \n of cationic molecules with negatively charged sirna . \n the zeta potentials of acxcr4-lcn2-ph and acxcr4-lcn2-lp \n were 5.4 1.4 and 2.4 0.4 mv , respectively , \n which were close to neutral charge . \n the sirna encapsulation efficiencies \n of acxcr4-lcn2-ph ( 36 4% ) and acxcr4-scr - ph ( 35 6% ) \n were significantly higher than that of acxcr4-lcn2-lp ( 16 7% ) . \n the \n antibody surface density was 2,200 190 molecules/m for acxcr4-lcn2-ph and acxcr4-scr - ph compared to 1,720 \n 20 molecules/m for acxcr4-lcn2-lp . \n acxcr4-scr - ph \n had similar parameters to acxcr4-lcn2-ph due to the same liposome \n composition , albeit with the exception of loaded sirna . \n release profiles of lcn2 sirna from acxcr4-lcn2-ph \n and acxcr4-lcn2-lp were determined by measuring the sirna concentration \n after dialysis ( figures 3 and s1 in the supporting information ) . at \n ph 7.4 , 50% of lcn2 \n sirna was released in 75 min from acxcr4-lcn2-ph , whereas it took \n 170 min for 50% of lcn2 sirna to be released from acxcr4-lcn2-lp . \n similar results were obtained at ph 5.5 . in the absence of a membrane \n with which to fuse , sirna release from \n acxcr4-lcn2-ph and acxcr4-lcn2-lp was independent of ph . \n we have previously \n demonstrated that this ph - responsive formulation could successfully \n deliver sirna to hela and huvec cells in comparison with nonresponsive \n liposomes . \n in addition , the zeta - potential \n of acxcr4-lcn2-ph changed from 5.4 1.4 mv ( ph 7.4 ) \n to 13.9 0.6 mv ( ph 5.5 ) ; whereas that of acxcr4-lcn2-lp merely \n changed from 2.4 0.4 mv ( ph 7.4 ) to 0.6 1.9 \n mv ( ph 5.5 ) . \n the increased cationic character of the acxcr4-lcn2-ph \n liposomes may result in electrostatic interactions between the sirna \n and lipids , limiting their ability to dialyze through the membrane . \n cumulative \n sirna releases from acxcr4-lcn2-ph ( ) and acxcr4-lcn2-lp ( ) \n in ph 7.4 ( a ) and ph 5.5 ( b ) buffers at 37 c . \n quantification of liposome binding to mbc cells \n was performed to evaluate the targeting effectiveness of acxcr4-conjugated \n liposomes . in this study , acxcr4 antibody or igg labeled , rhodamine \n dextran ( rd ) encapsulating , ph - responsive liposomes ( acxcr4-rd - ph \n or igg - rd - ph ) were prepared and used to quantitatively assess the \n mbc cellular binding and uptake of liposomes by flow cytometry . as \n shown in figure 4a , hcc1500 \n , mda - mb-175vii , \n mda - mb-436 , and mda - mb-231 cells demonstrated 2- , 2.9- , 2.3- , and \n 1.7-fold higher binding of cxcr4-targeted liposomes diluted in medium \n containing 10% serum relative to nonspecific igg labeled liposomes , \n respectively . \n representative \n micrographs illustrate high acxcr4-rd - ph binding on hcc1500 , mda - mb-175vii , \n mda - mb-436 , and mda - mb-231 ( figure 4b m ) \n and low acxcr4-rd - ph binding on mcf10a ( figures 4n p ) . \n the shape and morphology of cell nuclei and whole cells \n are shown in blue and green fluorescence , respectively . \n rhodamine - dextran \n from acxcr4-rd - ph is indicated by red fluorescence . in mbc cells ( figure 4b m ) , red and green signals are overlapping . \n this suggests the release of the rhodamine - dextran from acxcr4-rd - ph \n and escape from endosomes into the cytoplasm . \n these results demonstrated \n that acxcr4-rd - ph liposomes targeted mbc cells , not non - neoplastic \n cells . \n this was consistent with the high cxcr4 surface densities measured \n on mbc cells relative to mcf10a ( table 1 ) . \n ( a ) cellular \n binding of immunoliposomes in hcc1500 , mda - mb-175vii , mda - mb-436 , \n mda - mb-231 , and mcf10a . \n cells were treated with acxcr4-rd - ph and igg - rd- \n ph ( control ) and then characterized via flow cytometry ( * * * p < 0.001 ) . \n panels b p are representative confocal \n fluorescent microscope images of immunoliposome cellular binding in \n hcc1500 ( b d ) , mda - mb-175vii ( e g ) , mda - mb-436 ( h j ) , \n mda - mb-231 ( k m ) , and mcf10a ( n p ) . \n dapi and celltracker \n green were used to stain cell nuclei and cytoplasm , respectively . \n in addition to targeting cxcr4 , ph - triggered sirna \n delivery was employed to silence the lcn2 gene in mbc cells . \n mda - mb-175vii , \n mda - mb-436 , hcc1500 , and mda - mb-231 exhibited 96- , 34- , 4.2- , and \n 4.9-fold higher lcn2 gene expression than mcf10a , respectively . \n mbc \n cells were dosed for 6 h with acxcr4-lcn2-ph , rinsed , and then incubated \n for 72 h. mbc cells treated with acxcr4-lcn2-ph were compared to cells \n treated with pbs , naked lcn2 sirna , cxcr4-targeting , ph - responsive \n liposomes without lcn2 sirna ( acxcr4-ph ) , acxcr4-scr - ph , igg - labeled , \n ph - responsive liposomes ( igg - lcn2-ph ) , lcn2-lipo , and nonresponsive \n acxcr4-lcn2-lp at an equivalent sirna concentration of 72 pmol per \n 10 cells . as shown in figure 6a d , \n mbc cells treated with acxcr4-lcn2-ph demonstrated the maximum lcn2 \n gene knockdown : 78% for hcc1500 , 65% for mda - mb-175vii , 78% for mda - mb-436 , \n and 84% for mda - mb-231 . by comparison with the commercial sirna transfection \n reagent , lcn2-lipo demonstrated lower gene knockdown ( 65% for hcc1500 , \n 20% for mda - mb-175vii , 51% for mda - mb-436 , and 30% for mda - mb-231 ) \n after the 6 h dosing . \n mbc cells treated with nonresponsive acxcr4-lcn2-lp \n demonstrated knockdown in the range of 3558% ; this suggested \n that the ph - sensitive liposome is advantageous in sirna delivery . \n mbc cells treated with nonspecific igg - lcn2-ph alone showed a 2245% \n lcn2 knockdown , significantly lower than those of cxcr4-targeted , \n ph - triggered , sirna encapsulating liposomes . \n similar to naked sirna , \n acxcr4-ph ( without sirna ) and acxcr4-scr - ph ( with nontargeting sirna ) \n demonstrated no significant reduction in lcn2 expression , which confirmed \n that the cxcr4-cxcl12 axis blockade is independent of lcn2 gene expression . \n the significant and efficient decrease in lcn2 expression by acxcr4-lcn2-ph \n was achieved by employing both cxcr4 targeting and a ph - responsive \n nanocarrier . lcn2 gene expression in mda - mb-175vii , mda - mb-436 , hcc1500 , \n mda - mb-231 , and mcf10a cells as quantified by rt - qpcr . \n lcn2 fold change \n is relative to gapdh ( * * * p < 0.001 ) . sirna knockdown of lcn2 gene expression in ( a ) hcc1500 , \n ( b ) mda - mb-175vii , ( c ) mda - mb-436 , and ( d ) mda - mb-231 ( ns : no significant \n difference , * p < 0.05 , * * * p < 0.001 ) . we evaluated the synergistic \n effect of targeted lcn2 sirna delivery and cxcr4 chemokine axis blockade \n on mbc cell migration in vitro . two aggressive triple - negative \n mbc cell lines , mda - mb-436 and mda - mb-231 , were selected to test the \n therapeutic impact on migration in a transwell migration assay . as \n shown in figure 7 , \n the number of migrated cells \n was significantly reduced in cells treated with acxcr4-lcn2-ph by \n 88% ( mda - mb-436 ) and 92% ( mda - mb-231 ) compared with untreated cells . \n this result is significantly higher than that achieved by the commercial \n transfection reagent lipofectamine ( lcn2-lipo , 3538% inhibition ) . \n cells treated with nonresponsive acxcr4-lcn2-lp exhibited a 58% ( mda - mb-436 ) \n and a 77% ( mda - mb-231 ) decrease . \n no significant changes in cell migration \n were observed in cells treated with pbs and naked sirna . \n cells treated with acxcr4-ph , acxcr4-scr - ph , and igg - lcn2-ph \n demonstrated 1618% , 910% , and 2162% reductions \n in cell migration , respectively . \n targeting the lcn2 sirna via the \n cxcr4 receptor was more effective in reducing cell migration than \n the use of the ph - responsive liposome ( acxcr4-lcn2-lp vs igg - lcn2-ph ) . \n these data indicate that the combination of targeting and inhibition \n of cxcr4 and silencing of lcn2 via acxcr4-lcn2-ph more effectively \n and synergistically impeded breast cancer cell migration than subverting \n a single migration pathway , either by knockdown of lcn2 or inhibition \n of cxcr4 alone . \n since metastasis inversely correlates with patient \n survival , a therapeutic directed at blocking multiple migratory pathways \n may prolong life . \n mda - mb-436 ( a ) and mda - mb-231 ( b ) cell migration were \n evaluated by transwell migration assay . \n both cells were incubated \n with pbs , naked sirna , acxcr4-ph , acxcr4-scr - ph , lcn2-lipo , igg - lcn2-ph , \n acxcr4-lcn2-lp , and acxcr4-lcn2-ph . \n representative micrographs demonstrate \n mda - mb-436 and mda - mb-231 cells incubated with pbs ( c and g ) , acxcr4-ph \n ( d and h ) , igg - lcn2-ph ( e and i ) , and acxcr4-lcn2-ph ( f and j ) , after \n transmigrating through 8 m pores of a transwell membrane . \n images \n taken were on the reverse side of the membrane facing the lower chamber . \n all scale bars are 50 m ( * p < 0.05 , * * p < 0.01 , * * * p < 0.001 ) . \n first , we investigated the cytotoxicity \n of acxcr4-lcn2-ph in mda - mb-436 and mda - mb-231 cells via the dojindo \n assay at equivalent lipid concentrations : 1 , 0.5 , and 0.25 mol \n per 10 cells . \n as shown in figure 8a , b , no cytotoxicity was \n observed at all three lipid concentrations . \n the sirna concentration \n was different between samples : acxcr4-lcn2-ph , acxcr4-scr - ph , and \n lcn2-lipo had 72 , 70 , and 140 mol / mol lipid , respectively . \n second , we determined the impact of the acxcr4-lcn2-ph concentration \n on lcn2 gene knockdown ( figure 8c , d ) . \n a dose - dependent \n response was observed : lcn2 gene expression decreased as the concentration \n of acxcr4-lcn2-ph increased . \n acxcr4-lcn2-ph at 1 mol/10 cells ( highest lipid concentration ) demonstrated the highest \n lcn2 gene knockdown efficiencies ( 78% for mda - mb-436 and 84% for mda - mb-231 ) . \n third , we measured mbc cell migration inhibition as a function of \n acxcr4-lcn2-ph concentration . mbc cell migration inhibition ( figure 8e , f ) correlated with lcn2 gene knockdown . \n acxcr4-lcn2-ph \n at 1 mol/10 cells demonstrated a 7884% \n decrease in lcn2 expression and an 8892% decrease in mbc cell \n migration . \n the synergistic effects produced by blocking both cxcr4 \n and lcn2 ( figure 7 ) may be due to the common \n signaling pathways that are activated by both molecules . \n the emt has also been shown to be one of the mechanisms via which \n cxcl12/cxcr4 regulates breast cancer cell migration . \n evidence has suggested that cxcr4 may induce the emt through \n the same transcription factor slug as does lcn2 . \n in addition , lcn2 has also been reported to promote cancer cell \n migration by activating the akt pathway , which could also be activated by cxcr4 . \n the main limitation of the acxcr4-lcn2-ph approach would be unspecific \n binding to other cxcr4-expressing cells , e.g. , leukocytes , endothelial \n cells , and hematopoietic stem cells . in the future \n , we will continue \n to investigate this synergistic inhibition strategy for mbc therapy \n in live animals . \n lipid concentration dependence of mbc cell cytotoxicity \n ( a and b ) , lcn2 gene knockdown ( c and d ) , and migration inhibition \n ( e and f ) ( ns : no significant difference , * p < \n 0.05 , * * * p < 0.001 ) . \n we investigated the impact of simultaneous inhibition \n of cxcr4 and lcn2 pathways on mbc cell migration via delivering cxcr4-targeted , \n ph - responsive liposomes encapsulating lcn2 sirna to multiple mbc cell \n lines . by using this method , \n the migration of two mbc cell lines , \n mda - mb-436 and mda - mb-231 , was inhibited by 88% and 92% , respectively . \n this result is significantly more efficient than inhibition of the \n cxcr4 or lcn2 pathway alone . \n our results indicated that a synergistic \n therapy involving multiple migration pathways may be more successful \n than traditional therapies that focus on a singular approach .", "role": "user" }, { "content": "because \n breast cancer patient survival inversely correlates with metastasis , \n we engineered vehicles to inhibit both the c - x - c chemokine receptor \n type 4 ( cxcr4 ) and lipocalin-2 ( lcn2 ) mediated migratory pathways . \n ph - responsive liposomes were designed to protect and trigger the release \n of lcn2 sirna . \n liposomes were modified with anti - cxcr4 antibodies \n to target metastatic breast cancer ( mbc ) cells and block migration \n along the cxcr4-cxcl12 axis . this synergistic approach \n coupling \n the cxcr4 axis blockade with lcn2 silencing significantly reduced \n migration in triple - negative human breast cancer cells ( 88% for mda - mb-436 \n and 92% for mda - mb-231 ) . \n the results suggested that drug delivery \n vehicles engineered to attack multiple migratory pathways may effectively \n slow progression of mbc .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: development of the cathode materials for lithium ion battery is vital to meet the demands of portable devices , power tools , e - bikes , future usages of electric vehicles , and so on . among three promising candidates for cathode materials ( licoo2 , linio2 , and limn2o4 ) , lithium manganese oxides ( limn2o4 ) \n are inexpensive cathode materials with a high energy density , environmental acceptability , and are more abundant in nature . in spite of these advantages , limn2o4 has the problem of severe capacity fading during charge and discharge cycles , which makes it unsuitable for commercial application . intensive research has particularly focused on the mechanism of capacity fading and has suggested numerous solutions . among these projects , \n doping is considered to be an effective path to improve the electrochemical performance of spinel limn2o4 , so several attempts have been made for improving the lithium manganese spinels by doping various metals ions [ 7 - 10 ] . \n although such substitutions often result in enhancing the stability of spinel , the first discharge capacity of them is considerably lower than that of the parent compound . \n the reduction in the first discharge capacity is mainly due to the fact that the substituent ions do not contribute to the discharge capacity . in 1999 , amatucci et al . and palacin et al . \n reported that the introduction of the anion in spinel structure can reduce the mn oxidation state and then increase the first discharge capacity . \n these interesting results derived from the anion doping stimulated our research interest to investigate the effect of other anions doping . \n to the best of our knowledge , up to now , no br - doped cathode materials ( limn2o4ybry ) have been reported . \n it is believed that single - phase , homogeneity , uniform particle morphology with nanometer size distribution is the desired feature for achieving a higher electrode activity . \n nanometer - scale structured electrode materials are of great interest as potential building blocks for future generation electronic devices with greatly reduced size , because they show higher capacity and better cycling performance than conventional electrodes composed of this kind of materials . \n there have been increased interests in synthesizing nanostructures and their derivative compounds for their diverse physicochemical properties and potential applications as cathode materials for lithium ion batteries . \n moreover , it is well known that the preparation methods and post - treatment techniques could influence the structure and electrochemical performance of materials significantly [ 17 - 19 ] . \n further , the subtle variation of chemical composition will bring great changes in the electrochemical performance of products . \n room temperature solid - state coordination method possesses the advantages of simple manipulation and better prospects for commercialization as compared to the conventional solid - state method . \n more meaningfully , it achieves homogeneous mixture of the starting components , a low synthesis temperature and small grain size of the powders . \n besides this , several nanomaterials have been synthesized using this method [ 25 - 27 ] . in this study , limn2o4ybry nanoparticles were synthesized successfully for the first time by a room temperature solid - state coordination method . \n stoichiometric lithium acetate , manganese acetate , lithium bromide , and citric acid ( worked as chelating reagent , molar ratio of citric acid to the total metal ions is 1:1 ) , which were ground into powders separately , were mixed with polyethylene glycol ( peg ) 400 ( worked as dispersants ) in an agate mortar and ground with a pestle for 1.5 h in order to make them react to reach the best possible homogeneity . \n the obtained precursors were annealed at 500 c for 1 h , after ground , held at 600800 c for 10 h in air in a muffle furnace to obtain final limn2o4ybrypowders . \n flowchart showing the synthesis of limn2o4ybrysamples by room temperature solid - state coordination method an x - ray diffractometer ( xrd ) ( mxp18ahf , mac , japan ) with cu k radiation ( = 1.54056 ) was used for the identification of the crystalline phases of the powders . \n the morphological characteristics of the products were investigated using transmission electron microscope ( tem , h-600 , hitachi , japan ) . \n the cells consisted of a limn2o4-based composite as the positive electrode , a li disk as the negative electrode , and an electrolyte of 1 m lipf6 in a 1:1 ( volume ratio ) mixture of ethylene carbonate ( ec)/dimethyl carbonate ( dmc ) . \n the cathode was formed by mixing the active material with acetylene black and pvdf binder in 85:10:5 ratio inn - methyl - pyrrolidone ( nmp ) . \n . the film was dried at 60 c in air for 1 h and then was vacuum dried at 120 c for 4 h. celgard 2300 membrane was used as the separator . \n cyclic voltammetry ( cv ) ( chi660b electrochemical workstation chenhua co. of shanghai , china ) experiments were conducted from 3.2 to 4.35 v at a scan rate of 0.1 mv / s , and a li metal disk served as both counter and reference electrode . \n charge / discharge tests were performed at a constant current density of 0.30 ma / cmwithin the potential range of 3.0 and 4.35 v. \n the xrd patterns of limn2o4ybry powders calcinated at 600800 c for 10 h are shown in fig . \n 2 . the xrd of the powders calcinated at 600 c shows the impurity peaks of mn2o3 ( marked by ) . \n the formation of impurity phase mn2o3 indicates that the temperature is not high enough to reach full crystallization and containing some vacancies in limn2o4 structure during combustion . \n when the calcination temperature increases to 700 c , the impurity peaks of mn2o3 disappear and the pure spinel limn2o4 structure forms , which indicates that pure spinel limn2o4 can be produced by heat treatment at relatively higher temperatures . \n moreover , when the temperature increases , the intensity of peaks grows correspondingly , which indicates better crystallization is obtained . \n the diffraction peaks of limn2o3.95br0.05 and limn2o3.90br0.10 synthesized at 700 and 800 c corresponded to pure phase spinel structure . \n the results indicate that the structure of the ternary spinel remains when some of the o in the spinel phase are replaced by br . doping do not seem to change the spinel structure of the samples because no other impurity peaks are observed in the xrd patterns . \n the lattice constants of all the samples , which are calculated from the xrd spectra , are summarized in table 1 . \n the samples with the same chemical compositions calcined at different temperatures have little difference in lattice constants . however , the products doped with br have larger lattice constants , which is ascribed to the substitution of o by br . \n the br has larger ion ( 1.96 ) radius than that of o ( 1.4 ) and br substitution leads to reduction of mn to the larger mn cations , which results in improving capacity as reported by amatucci et al . . \n because the powders calcinated at 600 c show the impurity peaks of mn2o3 , we did not do the electrochemistry test of them . \n xrd patterns of limn2o4ybry : ( a ) limn2o4calcinated at 600 c ; ( b ) limn2o4calcinated at 700 c ; ( c ) limn2o4calcinated at 800 c ; ( d ) limn2o3.95br0.05calcinated at 600 c ; \n ( f ) limn2o3.95br0.05calcinated at 800 c ; ( g ) limn2o3.90br0.10calcinated at 600 c ; \n ( h ) limn2o3.90br0.10calcinated at 700 c ; ( i ) limn2o3.90br0.10calcinated at 800 c lattice constants calculated from the xrd spectra the trend of morphology variation of different limn2o4ybry with temperature is similar , so the tem of limn2o3.95br0.05 powders calcinated at 600800 c for 10 h are given as examples in fig . \n the sample calcined at 600 c agglomerates severely and its size is about 200 nm . this maybe due to some mn2o3 impurity existing in the sample . \n as the temperature increases to 700 c , the distribution of the particle size becomes narrow and the average particle size is about 100 nm . \n the decrease of particle size is due to the breaking of agglomerated powders as the calcination temperature increases , but agglomeration still exists . \n as the temperature increases further , it presents the spherical particle morphology , homogenous particle composition and narrow distribution of particle size . \n the particle size of the sample calcined at 600 c is larger than that of the sample calcined at 700 and 800 c , which indicates the calcination temperature has significant effect on the crystallization and morphology of the samples . \n products with nanosized particles would facilitate reducing the diffusion length of the lithium ions during intercalation and deintercalation processes , which would improve the electrochemical performance of the samples . \n tem photographs of limn2o3.95br0.05 : ( a ) calcinated at 600 c , ( b ) 700 c , and ( c ) 800 c cyclic voltammograms of the li / limn2o4ybrycells between 3.2 and 4.35 v at a scan rate of 0.1 mv / s for the first cycle are shown in fig . \n the cyclic voltammograms reveal that there are two pairs of redox peaks on each cycle voltammograms . \n the two pairs of redox peaks correspond to two - step reversible intercalation / deintercalation reaction . \n the samples synthesized at 800 c present higher current peaks than the ones prepared at 700 c . \n the limn2o3.95br0.05samples synthesized at 800 c possess the highest current peaks , which indicates that the product calcined at 800 c might have better electrochemical activity . \n cyclic voltammogram of li / limn2o4ybrycells between 3.2 and 4.35 v at scan rate of 0.1 mv / s : ( a ) limn2o4calcinated at 700 c ; ( b ) limn2o4calcinated at 800 c ; ( c ) limn2o3.95br0.05calcinated at 700 c ; ( d ) limn2o3.95br0.05calcinated at 800 c ; ( e ) limn2o3.90br0.10calcinated at 700 c ; \n ( f ) limn2o3.90br0.10calcinated at 800 c figure 5 displays voltage versus discharge capacity curves for limn2o4ybry between 3 and 4.35 v versus li / limn2o4ybry by applying 0.3 ma / cm at room temperature . \n for limn2o4ybry sample prepared at 700 c , the initial discharge capacity of pure spinel is 106 mah / g . \n it increases to 127 mah / g as y = 0.05 and decreases to 118 mah / g as y = 0.10 . \n the substitution of monovalent br for divalent o results in the increasing of mn content in spinel which contributes to charge / discharge capacity during intercalation / deintercalation of li in limn2o4 . \n moreover , br doping brings in larger lattice constants of samples , thus li can move more freely in the sample and this might help increase the capacity . \n when the calcination temperature increases to 800 c , limn2o4ybry samples deliver initial discharge capacity of 109 , 134 , and 121 mah / g as y = 0 , 0.05 , and 0.10 , respectively . \n however , with the increase of br content in spinel ( from 0.05 to 0.10 ) , the initial discharge capacity decreases , which maybe due to br doping that can improve the initial discharge capacity , but the br content has an optimal value . in this work , \n voltage versus discharge capacity curves of limn2o4ybry : ( a ) limn2o4calcinated at 700 c ; ( b ) limn2o4calcinated at 800 c ; ( c ) limn2o3.95br0.05calcinated at 800 c ; ( d ) limn2o3.95br0.05calcinated at 700 c ; ( e ) limn2o3.90br0.10calcinated at 700 c ; \n ( f ) limn2o3.90br0.10calcinated at 800 c the above - mentioned results show that effective anion doping can result in improvement of initial discharge capacity . \n figure 6 displays the variations of discharge capacity versus cycle number curves of limn2o4ybry between 3 and 4.35 v versus li / limn2o4ybry by applying 0.3 ma / cm at room temperature . as can be seen from fig . \n 6 , the samples doped by br have larger initial discharge capacity than the pure spinels . however , br - doped samples present appreciably high capacity loss than the parent compound . for limn2o4ybry sample prepared at 700 c , \n it decreases to 79% as y = 0.05 and 82% as y = 0.10 . for limn2o4ybry sample prepared at 800 c , \n the limn2o4ybry ( y = 0.05 , 0.10 ) samples have higher initial discharge capacity but lower cycle life than that of the parent compound . \n this is due to the increase of mn content by monovalent br substitution for divalent o. the high - spin mn ions give rise to the jahn - teller distortion which is the origin of the capacity loss . in a word , \n the increase of mn causes two effects : ( 1 ) the increase of initial discharge capacity and ( 2 ) the decrease of the capacity retention . as reported by many literatures , surface modification and cation codoping can overcome jahn - teller distortion \n sun et al . reported that lial0.34mn1.76o3.98s0.02 and li1.03al0.2mn1.8o3.96s0.04 materials prepared via a sol gel method showed excellent cyclability in both 4 and 3 v regions . in our lab , the research work of br and al codoping for improvement of the electrochemical performance of spinel limn2o4 is undergoing . \n discharge capacity versus cycle number curves of limn2o4ybry : ( a ) limn2o4calcinated at 700 c ; \n ( b ) limn2o4calcinated at 800 c ; ( c ) limn2o3.95br0.05calcinated at 700 c ; \n ( d ) limn2o3.95br0.05calcinated at 800 c ; ( e ) limn2o3.90br0.10calcinated at 700 c ; \n in this work , limn2o4ybrynanoparticles were synthesized by a room temperature solid - state coordination method for the first time . \n the cv and charge / discharge test revealed that brdoping improves the initial discharge capacity of the samples . \n the limn2o3.95br0.05calcined at 800 c has an initial discharge capacity of 134 mah / g . \n this work was partially supported by the nature science foundation of xinjiang province ( grant nos . \n 200821121 and 200721102 ) and the national nature science foundation of china ( grant nos . 20666005 and 20661003 )", "role": "user" }, { "content": "limn2o4ybrynanoparticles were synthesized successfully for the first time by a room temperature solid - state coordination method . \n x - ray diffractometry patterns indicated that the limn2o4ybrypowders were well - crystallized pure spinel phase . \n transmission electron microscopy images showed that the limn2o4ybrypowders consisted of small and uniform nanosized particles . \n synthesis conditions such as the calcination temperature and the content of brwere investigated to optimize the ideal condition for preparing limn2o4ybrywith the best electrochemical performances . \n the optimized synthesis condition was found in this work ; the calcination temperature is 800 c and the content of bris 0.05 . \n the initial discharge capacity of limn2o3.95br0.05obtained from the optimized synthesis condition was 134 mah / g , which is far higher than that of pure limn2o4 , indicating introduction of brin limn2o4is quite effective in improving the initial discharge capacity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: esophageal duplications are rare congenital anomalies and are the second most common duplications of the gastrointestinal tract in children . patients usually present with respiratory distress because of airway compression ( due to enlarging mass ) , or are asymptomatic with a thoracic mass found incidentally on chest radiograph . \n they are prone to develop complications ( bleeding , infection , etc . , ) and even malignancies . \n we are reporting a rare case of esophageal duplication cyst in a 2-month - old infant who presented with persistent wheezing . \n a 2-month - old , male infant presented with a history of fever and increased respiratory rate for 3 days . \n infant was born as full term , weighing 2600 g , through caesarean section to a primigravida mother . \n antenatal and perinatal history was uneventful . on physical examination , he had tachycardia , tachypnea with sub costal retractions , maintaining oxygen saturation of 88% at room air . \n the provisional diagnosis of bronchiolitis was made , and the infant was kept on supportive treatment . despite all supportive measures , wheezing persisted even after 7 days , so we thought of investigating for alternative diagnosis . \n magnetic resonance imaging ( mri ) scan of the neck was done , which revealed a well - defined lobulated smoothly marginated lesion of altered signal intensity in pre-/left para - esophageal region at subcarinal level . \n . a provisional diagnosis of foregut duplication cyst was made [ figures 2 and 3 ] . \n chest radiograph showing bilateral hyperinflation magnetic resonance imaging scan of the neck showing welldefined lobulated smoothly marginated lesion of altered signal intensity in pre-/left para - esophageal region at subcarinal level measuring approximately 18 mm 12 mm in size ( ap view ) magnetic resonance imaging scan of the neck showing welldefined lobulated smoothly marginated lesion of altered signal intensity in pre-/left para - esophageal region at subcarinal level measuring approximately 18 mm 12 mm in size ( lateral view ) the infant underwent a right anterolateral thoracotomy . \n histopathological examination showed gastric - type mucosa with well - developed sub mucosa , muscularis propria , and serosa . \n on follow - up at 6 months , infant had shown normal growth and development . \n esophageal duplication cysts result from a defect in the tubulation ( vacuolization ) of the esophagus , occurring in the 6 week of embryonic life . \n the incidence of congenital esophageal cyst is estimated to be 1:8200 , with male sex predominance ( 2:1 ) . \n esophageal duplication can be associated with other congenital anomalies , such as small intestinal duplication , esophageal atresias distal to the duplication , tracheoesophageal fistulas , and spinal abnormalities , including scoliosis , hemi vertebrae , and fusion . in our patient \n the duplication of the esophagus may be of three forms : ( 1 ) a cystic form ( most common ) that may or may not communicate with the esophageal lumen , ( 2 ) a tubular form or ( 3 ) a diverticular form . \n they are usually found in the posterior mediastinum with protrusion into either the right ( common ) or left thoracic cavity beneath the parietal pleura , with the majority of lesions in the lower half of esophagus . \n computer tomography scan and mri helps in delineating the size , location , extent , and the anatomic association of the mass to other organs . \n recent case reports of foregut duplication cyst after diagnosis , surgery should be done as early as possible to avoid complications such as infection , mass effects , hemorrhage , rupture , or neoplastic degeneration . \n the treatment of choice is complete surgical excision due to the possibility of degeneration and ease of removal . \n the prognosis for these lesions is excellent , with no reports in the literature of recurrence following excision . \n foregut duplication cysts of the esophagus are very rare , need strong clinical suspicion for diagnosis , and must be considered in the differential diagnosis of persistent wheezing in infants who do not respond to conventional treatment .", "role": "user" }, { "content": "esophageal duplication cyst ( edc ) is classified as a subgroup of foregut duplication cyst . \n they are very rare and predominantly detected in children . \n we present an unusual cause of wheezing in a 2-month - old infant . \n the diagnosis of edc was suspected by bronchoscopy , provisionally confirmed by magnetic resonance imaging , and followed by successful surgical excision of the cyst . \n we conclude that foregut duplication cyst of the esophagus is very rare , and must be considered in the differential diagnosis of persistent wheezing in infants who do not respond to conventional treatment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: primary pulmonary synovial sarcomas are extremely rare neoplasms with an unknown cause originating from mesenchymal tissue and accounting for 10% of soft tissue sarcomas . although most synovial sarcoma tumors are located in soft tissue , especially near large joints of the extremities , they also can occur in numerous situations unrelated to joint structures . \n thoracic involvement of the synovial sarcoma is rare , and only a few cases have been reported in the literature . \n we report the case of a 69-year - old asymptomatic man , a heavy smoker with no clinically relevant family or personal history . the patient was admitted to our institution for study of a solitary pulmonary nodule found after routine chest x - ray , not present in previous examinations . \n computed tomography ( ct ) scan showed a 23 mm multilobulated nodule in the right upper lobe with peripheral calcification ( fig . \n the standardized uptake value of the pulmonary nodule in positron emission tomography - computed tomography ( pet - ct ) scan was 1.5 g / ml . bronchoscopy did not reveal any endobronchial lesion . \n a ) chest ct scan shows a multilobulated nodule in the right upper lobe with peripheral calcification . \n b ) spindle cell proliferation organized in irregular fascicles , without epithelial component in tumor cells ( h / e 40 ) . \n c ) intense immunohistochemical expression of cd99 membrane marker in tumor cells ( 40 ) in order to resect the nodule , a video - assisted thoracoscopic surgery ( vats ) right upper lobectomy with systematic lymph node dissection was performed . \n pathological examination revealed a well - defined tumor , not encapsulated , with spindle cells ( fig . \n immunohistochemically , neoplastic cells were positive for vimentin , cd56 and bcl-2 , and focally positive for cd99 ( fig \n histologically , primary pulmonary synovial sarcoma can be classified into four categories : biphasic , monophasic fibrous ( spindle cells ) , monophasic epithelial and poorly differentiated types . \n macroscopically , these tumors are well circumscribed and not encapsulated , with a very variable size ranging from 0.6 to 27 cm ( mean : 6.8 ) \n synovial sarcomas are positive for cytokeratin 7 and 19 , ema , bcl-2 , cd99 and vimentin . \n they are usually negative for s-100 , cd-34 , desmin , actin and vascular tumor markers [ 35 ] . \n recent cytogenetic studies have taken a leading role for definitive diagnosis of synovial sarcoma , identifying a translocation t(x;18 ) ( p11.2;q11.2 ) resulting from fusion of the syt gene on chromosome 18 to ssx1 or ssx2 on chromosome x . \n differential diagnosis includes other malignant extrathoracic tumors such as fibrosarcomas , carcinosarcomas , leiomyosarcomas or hemangiopericytomas . \n the prognosis for patients with primary pulmonary synovial sarcoma is poor , with an overall 5-year survival rate of 50% . \n negative prognostic factors are tumor size , male gender , extensive tumor necrosis , higher histological grade , mitotic rate and neurovascular invasion . the expression of syt - ssx1 variants has been associated with worse behavior . \n ", "role": "user" }, { "content": "primary pulmonary synovial sarcoma is an extremely rare tumor with an unknown cause . \n the diagnosis is established after other primary lung malignancies or metastatic extrathoracic sarcoma have been excluded . \n we report the case of a 69-year - old man who presented with a well - defined mass in the right upper lobe on a chest x - ray . a video - assisted thoracoscopic surgery ( vats ) \n right upper lobectomy was performed . \n immunohistochemically , neoplastic cells were positive for vimentin , cd56 and bcl-2 , and focally positive for cd99 , epithelial membrane antigen and cytokeratin 7 and 19 . \n the cytogenetic study revealed a syt genetic reassortment . \n so , the final pathological diagnosis was primary pulmonary synovial sarcoma .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it can be classified according to the primary constituent as trichobezoar or hairball , phytobezoar ( food particles ) , trichphytobezoar ( mixed ) , pharmacobezoar , lactobezoar , mycobezoar ( fungal agglomerations ) or pseudobezoar . \n occasionally , trichobezoars have a tail that extends to the cardia , pylorus , and duodenum , or even further to the jejunum and ileum . \n a 12-year - old female was referred to our surgical clinic with a history of abdominal pain , distension , weight loss , and attacks of vomiting of 4 months duration . \n abdominal palpation revealed a mobile well - defined mass occupying the upper half of the abdomen . \n the computed tomography ( ct ) scan revealed a well - circumscribed lesion in the region of the stomach that comprised of concentric whorls of different densities with pockets of air enmeshed within it . \n oral contrast filled the more peripheral interstices of the lesion with a thin band of contrast circumscribing the lesion [ figure 1 ] . \n removal of the trichobezoar endoscopically failed as it was possible to pull only few fibers of this huge ball of hair . \n ct scan demonstrates a mixed density mass with a whorled configuration containing multiple small pockets of air . \n oral contrast circumscribes the lesion the patient underwent surgery , and through upper midline incision gastrotomy was done . \n a huge trichobezoar was identified which took the shape of the stomach [ figure 2 ] . \n there was a long tail of hair extending through the pylorus into the proximal jejunum [ figures 3 and 4 ] . by this feature \n sertraline hydrochloride , starting from 50 mg / day to 100 mg / day , was given to the patient to provide additional help in reducing her hair - pulling urges . \n after several months of weekly psychotherapy and pharmacotherapy , the patient is presently reported to have no hair - pulling events . \n trichobezoar . it is almost exclusively seen in young females , often associated with psychiatric problems . in our case , the presentation is in a very young age with hair extending down to the proximal jejunum , causing symptoms , which could mimic gastrointestinal infections and infestation especially in endemic areas . \n it is postulated that hair strands too slippery to be propulsed are initially retained in the mucosal folds of the stomach and become enmeshed over a period of time . \n trichobezoars are usually black from denaturation of protein by acid , glistening from retained mucus and foul smelling from degradation of food residue trapped within it . \n the patient generally presents with epigastric discomfort , pain , nausea , vomiting , satiety exacerbated at meal times , or complete gastric outlet obstruction . \n contiguous extension of a trichobezoar into the small bowel can lead to the rapunzel syndrome. this syndrome is named after a tale written in 1812 by the brothers grimm about a young maiden , rapunzel , with long hair who lowered her hair to the ground from a castle , which was a prison tower to permit her young prince to climb up to her window and rescue her . \n the commonly accepted definition is that of a gastric trichobezoar with a tail extending to the jejunum , ileum , or the ileocecal junction . \n the complications of the rapunzel syndrome ranges from attacks of incomplete pyloric obstruction to complete obstruction of the bowel to perforation to peritonitis and mortality . \n trichobezoars with small bowel extensions may produce other complications , namely bleeding , perforation , protein losing enteropathies , steatorrhea , pancreatitis , appendicitis , and intussusceptions . \n diagnosis of trichobezoars rest on the clinical evidence of long standing trichophagy , abdominal mass and radiological investigations or ct scan and abdominal ultrasound but obtaining pieces of matted hair through endoscope is pathognomonic . \n the characteristic appearance on ct is of an inhomogenous non - enhancing mass within the lumen of the stomach / bowel . \n surgical removal at laparotomy or laparoscopically is the treatment of choice . if small , they may be removed endoscopically . \n biopsy devices , water jets , bezotomes , and laser devices may be used to fragment larger bezoars and lavaged out of the stomach . \n psychiatric follow - up is important although no conclusion has been reached with respect to whether the use of medication makes any difference in the progression of this condition . \n this follow - up care should be extended to family members , who should be vigilant with patients , since recurrences of the problem have been described . \n no clear evidence - based practice guidelines for the treatment of patients with ( trichotillomania ) ttm are available , and more research is needed . \n behavioral techniques and selective serotonin reuptake inhibitors ( ssris ) are the most commonly used treatment modalities , having the most evidence for efficacy . \n the behavioral approaches , including habit - reversal therapy , have been shown to be effective . in habit - reversal therapy \n , patients learn to be aware of the times , cues , and situations in which they pull their hair . \n they practice movements such as those in knitting , crochet , and needlepoint that redirect their urges to pull their hair . \n thus , they learn to substitute a different and more adaptive behavior and receive social approval for efforts to interrupt the hair pulling . \n other approaches such as cognitive - behavioral treatment , negative practice , and variations of these interventions have been tried . \n the ssris are the pharmacologic agents used most frequently in the treatment of patients with ttm . \n other psychotropic agents that have been used for treating patients with ttm include the tricyclic antidepressants , the antipsychotic medications , and mood - stabilizing ( anticonvulsant ) medications . \n clomipramine hydrochloride and fluoxetine hydrochloride have been used successfully . the need for adequate follow - up \n should be emphasized to avoid recurrences , although these are rare since the trauma of surgery may prevent the patient from provoking another episode .", "role": "user" }, { "content": "bezoar is a tightly packed collection of undigested material that is unable to exit the stomach . \n most bezoars are of indigestible organic matter such as hair - trichobezoars ; or vegetable and fruit phytobezoars ; or a combination of both \n . trichobezoars commonly occur in patients with psychiatric disturbances who chew and swallow their own hair . in very rare cases , \n the rapunzel syndrome hair extends through the pylorus into the small bowel causing symptom and sign of partial or complete gastric outlet obstruction . \n a case report of trichobezoar in the stomach causing rapunzel syndrome in a 12-year - old female is reported .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: sub - saharan africa has the highest prevalence and incidence of hiv-1 infection in the world . \n women of reproductive age account for 60 percent of all adult infections and 75 percent of infections among people 1524 years old . \n sub - saharan africa also has high fertility rates with an estimated 14 million unintended pregnancies annually . in 2008 , \n the number of children newly infected with hiv was approximately 430,000 , of which 90 percent were infected through mother - to - child transmission ( mtct ) . \n the world health organization ( who ) lists preventing unintended pregnancies among people living with hiv as a second pillar of preventing mother - to - child transmission ( pmtct ) . not only is preventing unintended pregnancies in hiv - infected women an effective strategy for reducing perinatal transmission [ 58 ] , but it is also cost saving [ 8 , 9 ] and would contribute to the reduction of maternal mortality , which may be higher among hiv - infected women [ 1012 ] . however , most pmtct efforts to date prioritize the provision of antiretroviral ( arv ) prophylaxis to hiv infected pregnant women , their infants , and safer breastfeeding strategies [ 4 , 13 , 14 ] . in uganda , \n hiv-1 seroprevalence among adults is 6.5% , and 57% of the hiv - positive adults are women . the total fertility rate ( tfr ) in uganda is 6.7 children per woman and among the highest worldwide . \n an estimated 24% of married women in uganda use contraceptive methods , with an unmet need for contraception of 41% among women of reproductive age . \n mtct of hiv contributes 20% of new hiv infections in uganda , although pmtct services provide 60% of pregnant women living with hiv with arv prophylaxis . \n many hiv - positive women have unintended pregnancies [ 1720 ] with a concomitant risk of mtct ; however , the risk is greatly diminished if arv prophylaxis is initiated early in pregnancy . \n a modeling study in uganda showed that contraception has the potential to avert twice the number of vertical hiv infections and pediatric aids deaths as compared to pmtct interventions initiated among already pregnant women living with hiv . \n reports show that living with hiv may be associated with a desire to limit child bearing ; on the other hand , fertility desires may increase with access to hiv treatment [ 23 , 24 ] . \n several ugandan reports suggest that , among women in hiv care , the most common contraceptive method reported is condom use [ 17 , 20 , 25 ] , which has a high contraceptive failure rate . \n little is known about contraceptive use among hiv positive women entering hiv care in uganda , a country in which access to reproductive health care is limited . \n entry into hiv care may represent an opportune time to assess women 's fertility plans and intervene to prevent unintended pregnancies and reduce mtct of hiv . \n we therefore conducted a retrospective analysis of electronic medical records from initial visits to a large hiv clinic in southwestern uganda to document the use of contraception among women of reproductive age . \n in addition , we examined correlates of contraceptive use with the goal of informing strategies to increase the uptake of contraception . \n we sought to determine whether hiv disclosure to one 's spouse and other sexual partners was associated with increased contraceptive use , because this factor has previously been shown to be correlated with increased condom use , and decreased sexual risk behavior , in uganda and other countries in sub - saharan africa [ 20 , 2832 ] . \n our sample included hiv - positive women of reproductive age ( 1849 years ) who enrolled into the mbarara regional hospital hiv clinic ( also known as the immune suppression syndrome ( iss ) clinic ) during 2009 . \n mbarara regional referral hospital serves a population of 2.5 million people in southwestern uganda . as of december 2009 , \n the iss clinic , which provides free hiv care , had 7500 active adult ( age 18 and older ) hiv - positive clients , 4500 of whom were women . \n the total number of adult clients receiving antiretroviral therapy ( art ) by the end of 2009 was 5300 . \n we excluded pregnant women , those who reported sexual abstinence , and women over age 49 from the analysis . \n we chose the cutoff of age 49 to be consistent with reproductive health data reported in the uganda demographic and health survey ( udhs ) report . \n data for this study were abstracted from patient records that are routinely collected at the initial iss clinic visit . \n data are collected on standard forms adapted from the open medical records system ( open mrs ) framework developed by moi university and indiana university for use in developing countries . \n the iss clinic enrollment visit form includes sociodemographic and behavioral data , including contraception use ( collected by counselors and nursing officers ) and clinical information ( collected by physicians ) . \n the data from this form are entered into the open mrs data management system by data clerks . \n regular quality control checks are performed on 5% of entered records by comparing each variable with the original source document : entry errors occur in less than 1% of the data but omission of data from several variables on the form is frequent ( see below ) . \n the outcome variable was self - reported use of one or more contraceptive methods at enrollment into care . \n the methods extracted from the electronic open mrs included hormonal methods ( combined oral contraceptives ( cocs ) , injectable hormones including depot medroxyprogesterone acetate ( dpma ) , and implants ) , as well as nonhormonal methods ( male condoms , diaphragms , cervical caps , intrauterine devices ( iuds ) , natural rhythm methods ) , and sterilization methods ( bilateral tubal ligation and hysterectomy ) . \n we categorized hormone - based contraception ( injection , implant , or pill ) , iuds , or sterilization methods as highly effective . \n other contraceptive methods available in uganda but not captured in the electronic data include progestin only pills and emergency contraceptives . \n the main covariate of interest was self - reported disclosure of hiv status to a spouse or sexual partner(s ) at the initial clinic visit . \n the disclosure variable captured whether a woman had disclosed to a spouse or sexual partner , had disclosed to someone other than a spouse or partner , or had not disclosed . \n other independent variables included age , marital status ( married was defined as legal or common - law marriage ) , number of children , education level , monthly income , religion , who clinical stage , cd4 cell count , and spouse 's hiv status . \n we evaluated records of 1110 females of reproductive age ( 1849 years ) who presented to the iss clinic from january to december 2009 . \n 210 were either pregnant ( 151 ; 13.6% ) or reported current sexual abstinence ( 59 ; 5.7% ) at their initial visit and were excluded , and further 74 ( 6.7% ) were missing data on contraceptive use and were also excluded , leaving 826 women for analysis . \n women who were missing data on contraception were less likely to be currently married ( 34.4% ) compared to those who were not missing contraception data ( 48.5% married , p = 0.01 ) , but , otherwise , those with missing data were comparable to those with contraception data on all other variables of interest ( data not shown ) . \n we calculated summary statistics to describe the study population and conducted bivariate analyses using pearson 's chi - square ( ) tests of association to assess associations between contraceptive use and categorical variables using n = 826 . where more than 3% of a predictor variable was missing \n we performed multivariable logistic regression to identify independent correlates of contraceptive use , including missing categories as noted above . \n as this approach may introduce bias , we also imputed the missing values using multiple ( five ) imputations by chained equations in stata and conducted multivariable logistic regression using this imputed dataset . \n the results using the imputed dataset were not substantially different ; thus , the results presented in this paper are those from the original dataset . \n because the sample size was relatively large and we did not believe that any of the correlates were on the causal pathway from hiv disclosure , our primary covariate of interest , to the outcome , contraceptive use , we included all the variables of interest in the model . \n to better examine the influence of disclosure to either a spouse or sexual partner , we stratified the multivariable analyses by marital status ( married versus nonmarried ) . \n however , there were no substantial changes in the associations with contraceptive use among any covariates , so we present the results from the model including all women , both married and nonmarried , using a composite variable representing disclosure to either a spouse or a sexual partner . \n we also examined condom use in comparison to other contraception methods , primarily to determine whether condoms were being used to protect against the spread of hiv to uninfected spouses and whether condom use was more common among partnerships in which the hiv status of the women had been disclosed and among serodiscordant partners . \n the institutional review boards of mbarara university of science and technology , the university of california , san francisco , and the uganda national council of science and technology approved the protocol of this study , which was comprised of the analysis of deidentified data . \n the median age of women of reproductive age enrolling at the iss clinic in 2009 ( n = 1110 ) was 29 years ( interquartile range ( iqr ) 2435 ) . \n approximately , half had a primary school education ( 56% ) , half were married ( 48% ) , and about two - thirds ( 70% ) had a monthly income of less than 100,000 uganda shillings ( equivalent to about 40 us dollars ) . \n the median age of the nonpregnant , sexually active women included in analysis ( n = 826 ) was 29 years ( iqr 2435 ) ( table 1 ) . \n approximately half had primary school education ( 55% ) , half were married ( 49% ) , and two - thirds ( 70% ) had a monthly income of less than 100,000 uganda shillings . \n of those who were married , 71% of the women reported an hiv - positive spouse , 5% reported having an hiv - negative spouse , 18% did not know their spouse 's hiv status , and 7% did not report their spouse 's status . of those who were married , \n 70% of women had disclosed their status to a spouse while 12% had disclosed to someone else other than the spouse , and 18% had not disclosed to anyone . of those who were not married , 3% disclosed to a sexual partner , 71% disclosed to someone else , and \n most women were enrolled within 3 months of hiv diagnosis ( 72% ) with mild hiv - associated symptoms placing them in who hiv clinical stages 1 or 2 ( 64% ) , and few ( 7% ) were on art at clinic entry , presumably prescribed by other clinics . \n the most common methods reported included the use of injectable hormones ( 52% ) , condoms ( 30% ) , and oral contraceptives ( 9% ) . \n use of highly effective contraceptive methods was reported for 18% of the study subjects , two - thirds ( 65% ) of those using contraception . \n the variables significantly associated with the use of contraception in bivariate analyses were education , marital status , monthly income , having living children , and hiv status of spouse ( table 2 ) . \n in multivariable analysis , we found the odds of contraceptive use among single and previously married women remained significantly lower than that among married women ( table 2 ) . \n age ( less than 24 years inclusive ) , education ( completing secondary education ) , income ( > 250,000 uganda shillings / month ) , and parity ( having 3 or more living biological children ) were independently associated with increased odds of contraception . \n hiv status of spouse was not significantly associated with contraceptive use in multivariable analysis ; the association in bivariate analysis seemed to be due to colinearity with the marital status of the women . \n these associations remained significant in multivariable analysis using the multiple imputed dataset ( data not shown ) . \n additionally , women with one or two living biological children ( versus none ) had significantly increased odds of use of contraception using the imputed dataset . \n we conducted a subanalysis of those reporting any contraception , to examine how condom use compared to other contraception methods ( data not shown ) within different variable groups . \n we found no significant difference in condom use versus other contraceptive use by hiv status disclosure ( p = 0.49 ) , or hiv status of spouse ( p = 0.59 ) . \n we found low contraceptive use ( 27.8% ) among sexually active , not pregnant hiv - positive women enrolling at the iss clinic in mbarara hospital , consistent with contraception rates of the general ugandan population , as well as hiv - positive women in uganda [ 30 , 31 ] , kenya , and malawi . \n the use of highly effective contraceptive methods was also low ( 18% ) , also consistent with the general ugandan population as well as those with hiv . \n thus , the low levels of contraceptive use in the sample may reflect the same root causes for low contraception uptake in uganda , including insufficient information about the advantages of , fear of side effects from , and lack of access to contraception . \n in addition , some of these women may have wanted to have children [ 20 , 23 , 35 ] but our medical records did not capture this desire . \n furthermore , some women who want to access contraception may be thwarted by the plans of her spouse or sexual partner [ 36 , 37 ] . among clients who reported use of contraception , more than half ( 52% ) used hormonal injectable contraception , and 30% used condoms . \n other studies conducted at hiv clinics in uganda found that the most commonly reported contraception method is condom use [ 17 , 20 , 25 ] . \n the women in these other studies were either initiating or already on art and thus may have already been in hiv care for some time with easier access to condoms and frequent exposure to counseling promoting condoms to prevent hiv transmission and pregnancy . in contrast , 70% of the women in our sample were recently diagnosed with hiv and only 7% were on art . while the uganda aids control program national guidelines advocate for dual family planning methods ( condoms plus another contraceptive method ) to prevent hiv / sti transmission and unintended pregnancies for hiv - positive individuals , only a small proportion used dual protection in this study ( 2% ) , consistent with other ugandan studies [ 17 , 20 , 22 , 38 ] . \n use of condoms alone or dual contraception methods may have been low in our study ; however , because 70% of married women reported having hiv - infected spouses , they therefore may have been less likely to use condoms to prevent sexual transmission of hiv . the high proportion of women choosing injectable hormonal contraception emphasizes the need to continue to unravel the relationship between hormonal contraception use and hiv risk [ 39 , 40 ] . \n our primary predictor variable of interest , hiv status disclosure , was not associated with use of contraception in either bivariate or multivariable analyses . \n demographic factors ( e.g. marital status , already having several children , younger age ) and socioeconomic factors ( e.g. education and income ) were more strongly associated with contraception use at clinic entry . \n this is in contrast to a recent study in uganda that showed that the lack of hiv disclosure was associated with lower odds of use of modern contraceptives among hiv women enrolled in hiv clinics in uganda , in which 68% of the women were on art . \n in addition , we did not find any significant association between hiv status disclosure and use of condoms , in contrast to the findings of other studies [ 20 , 28 , 31 , 32 , 41 ] . \n seventy percent of the married women in our study reported seroconcordant positive spouses , thus condoms to prevent hiv transmission may not be perceived to be applicable to this group . \n the observed association of decreased use of contraception with increased age was consistent with previous findings of lower modern contraceptive use among older women on art in zambia and hiv - infected women in uganda [ 20 , 30 ] . \n parity and education have also been associated with contraceptive use in other studies [ 28 , 30 , 34 , 41 , 42 ] . \n younger age [ 22 , 23 , 4346 ] and having fewer children [ 22 , 24 , 43 , 46 ] are often associated with increased fertility desires and could thus be expected to be associated with decreased contraceptive use . while the association of younger age with increased contraceptive use in our study is consistent with others , it is the opposite of what would be expected based on fertility desires . \n older hiv - positive women may have a larger unmet need for contraception to limit childbearing , while younger women may have a larger unmet need to control spacing of births . \n given that many women in uganda , especially those with hiv , face difficult economic and social circumstances including bearing children whom they may raise as widows or divorced , the associations between contraception and education , as well as marital status and monthly income , are particularly important . \n the low use of contraception by women in this study , most of whom were recently diagnosed with hiv , points to the possibility that entry into hiv care could be a good time to intervene with contraception education and provision . \n our findings are limited by a high degree of missing data that is inherent to data collected as part of routine clinical care . \n however , the missing data categories were not associated with the use of contraception in the multivariable analysis , suggesting that the data were not missing systematically , and the results did not change when we performed multiple imputation . \n the data were collected by clinic counselors rather than by research assistants trained in systematic data collection and therefore may be especially subject to interviewer bias and social desirability bias or other types of response bias . \n in addition , these data do not account for desired pregnancy by the women and/or their partners [ 25 , 28 , 34 , 48 ] . \n we also recognize that the cross sectional nature of this analysis focusing on contraceptive methods used at point of entry into hiv care does not allow inference about the method used at the time of hiv acquisition . \n in addition , the women served by the iss clinic are a mixture of those from rural and urban areas ; therefore , the findings may not fully translate to women enrolling in urban hiv clinics or those in very rural settings . \n however , the strength of this study is that we were able to study a large number of hiv - infected women of reproductive age entering chronic hiv care , a population which may have had little previous exposure to health care and reproductive services . \n our study highlights the need to establish cost effective strategies for lower income countries to improve the uptake of contraception among those infected with hiv who do not want to have children . \n we also found that dual methods of contraception were rarely used ; therefore , contraception programs should also educate clients about the value of dual methods in order to prevent hiv / sti transmission to partners as well as to prevent unintended pregnancies . \n a study using the same database found an increasing incidence of pregnancies from 2006 to 2010 and the use of contraception was protective against pregnancy . given the low contraceptive use among hiv - infected women in this study , which is comparable to contraception rates among the general population of ugandan women , we suggest that strategies to improve contraception uptake target all women . \n we found that demographic and economic factors were important in the uptake of contraception ; therefore , as countries plan improvement strategies to enhance contraception uptake among hiv - infected women , it may be important to reach women of lower socioeconomic and educational levels . \n the low use of certain long - term contraceptive methods available in uganda , such as implants and iuds , suggests that more resources and focus may be needed for long - term contraceptive methods . \n hiv clinics in public health facilities are ideal settings for reaching hiv - positive women ; at the iss clinic studied here , regular health education on contraception is given to clients and some contraceptive methods are now offered free on site or by voluntary referral to a nearby maternal child health ( mch ) clinic as part of routine clinical care . increased integration of contraceptive services with sti / hiv prevention services would serve the ultimate goal of primary prevention of hiv via unintended pregnancies . \n further work is needed to determine whether this strategy is effective in reducing unintended pregnancies among hiv - positive women in care and reducing transmission of hiv .", "role": "user" }, { "content": "background . preventing unintended pregnancies among women living with hiv is an important component of prevention of mother - to - child hiv transmission ( pmtct ) , yet few data exist on contraceptive use among women entering hiv care . methods . \n this was a retrospective study of electronic medical records from the initial hiv clinic visits of 826 sexually active , nonpregnant , 1849-year old women in southwestern uganda in 2009 . \n we examined whether contraceptive use was associated with hiv status disclosure to one 's spouse . \n results . \n the proportion reporting use of contraception was 27.8% . \n the most common method used was injectable hormones ( 51.7% ) , followed by condoms ( 29.6% ) , and oral contraceptives ( 8.7% ) . \n in multivariable analysis , the odds of contraceptive use were significantly higher among women reporting secondary education , higher income , three or more children , and younger age . \n there were no significant independent associations between contraceptive use and hiv status disclosure to spouse . \n discussion . \n contraceptive use among hiv - positive females enrolling into hiv care in southwestern uganda was low . \n our results suggest that increased emphasis should be given to increase the contraception uptake for all women especially those with lower education and income . \n hiv clinics may be prime sites for contraception education and service delivery integration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the fda - approved platinum - based \n drugs cisplatin , carboplatin , and \n oxaliplatin are widely used in the clinical treatment of cancer . \n cisplatin and carboplatin are extensively employed to treat ovarian , \n lung , head , and neck cancers , whereas oxaliplatin is marketed for \n the treatment of colorectal cancer . \n the \n anticancer activity of these compounds arises from their ability to \n form intra- and interstrand cross - links on dna via coordination of \n the n7 atoms of purine bases to the platinum center . \n one of the prominent effects of these cross - links is inhibition \n of dna and rna polymerases , which , when stalled , can initiate a signaling \n cascade that leads to cell death . \n only \n a small portion of the platinum administered to a patient platinates \n the dna of cancer cells , and reaction with off - target nucleophiles \n leads to toxic side effects including nephrotoxicity , myelosuppression , \n peripheral neuropathy , ototoxicity , and nausea . \n one strategy to improve the therapeutic index and decrease side \n effects that has received a significant amount of attention is the \n pt(iv ) prodrug approach . \n pt(iv ) prodrugs are typically prepared by chemical \n oxidation of an active square - planar pt(ii ) species , which adds two \n so - called axial ligands to the metal center . \n the resulting \n pseudo - octahedral pt(iv ) complex is more inert to ligand substitution \n than the parent pt(ii ) complex and consequently reduces the extent \n of platinum sequestration and deactivation en route to the tumor cell . \n within the reducing environment of the cancer cell , the pt(iv ) center \n is converted to pt(ii ) with release of two ligands and regeneration \n of the active square - planar pt(ii ) complex . \n owing to the activation \n step required for pt(iv ) complexes , they generally exhibit less potency \n and toxicity than their pt(ii ) counterparts . \n in addition to kinetic \n inertness , one of the great advantages of the pt(iv ) prodrug approach \n is that the axial ligands can be used to tune the physical and chemical \n properties of the complex without altering the structure of the active \n pharmacophore that is ultimately released . in this way \n , axial ligands \n have been used to tune the lipophilicity and redox potential of pt(iv ) \n complexes with the aim of altering cellular uptake and the kinetics \n of reductive activation . in an alternative approach \n , bioactive ligands can \n be attached to the axial positions of a pt(iv ) complex to impart targeting or additional biological activity . \n axial ligands can also be chosen to facilitate delivery \n of platinum complexes by a nanosized object . \n hydrophobic carboxylates \n have proved valuable for delivery of platinum complexes within the \n core of nanoparticles formed from amphiphilic block copolymers or within carbon nanotubes . \n a significant \n impediment to the clinical progression of pt(iv ) prodrugs is premature \n reduction in the bloodstream , and nanodelivery constructs \n such as those described above may help protect the platinum center \n as it travels to the tumor . in this paper \n , we present the development \n of a series of pt(iv ) \n complexes designed to exploit an endogenous protein , human serum albumin \n ( hsa ) , as a delivery device . \n a key aspect in our design was the generation \n of compounds that mimic the amphiphilic structure of fatty acids . \n this goal was accomplished by preparing an asymmetrically functionalized \n cisplatin prodrug in which one axial ligand is succinate and the other \n an unbranched aliphatic carbamate ( scheme 1 ) . \n hsa is the single most abundant protein \n in human blood , present at concentrations of 3454 g l , and it serves a wide \n variety of functions ranging from the maintenance of blood colloidal \n osmotic pressure to the transport of hormones and bilirubin to the \n buffering of ph . \n one of the other important functions it serves is \n the transport of fatty acids in the blood . \n these molecules typically \n exhibit very low aqueous solubility , but association with hsa allows \n them to be solubilized up to 2 mm . \n serum \n albumin has also been widely investigated for its ability to interact \n with drug molecules that are administered intravenously . \n this interaction \n has been exploited in abraxane , an fda - approved oncology product that \n uses hsa to deliver paclitaxel . \n it is currently marketed for the treatment \n of non - small cell lung cancer , breast cancer , and pancreatic cancer . \n clinical trials are currently underway for a \n series of similar constructs , currently known as abi-008 through abi-010 , \n which deliver docetaxel , rapamycin , and tanespimycin , respectively . \n a recent investigation demonstrated that cancer \n vaccines can also be tethered to hsa , allowing delivery to lymph nodes . \n the success of hsa as a carrier of anticancer \n drugs can be attributed to its nonimmunotoxicity , long circulation \n time in blood , and high tumor accumulation . \n although the interaction of platinum anticancer agents with hsa \n has been extensively investigated , only recently have systems \n been designed to exploit hsa as a vehicle for delivering platinum \n agents . in one instance \n , a covalent bond was formed between the pendant \n maleimide of a pt(iv ) complex and the sole free cysteine thiol of \n hsa . \n we begin with an investigation of the effect of systematically \n increasing the chain length of the carbamate ligand of 4a e on cellular uptake and cytotoxicity . the most \n promising compound , 4e , \n the resulting non - covalent protein - platinum \n complex is highly robust and can be purified by fast protein liquid \n chromatography ( fplc ) , permitting its physical and biological properties \n to be examined . \n finally , the stability of 4e in blood \n was investigated by exploiting the change in lipophilicity that occurs \n on reduction from pt(iv ) to pt(ii ) . \n the results of these studies indicate \n that 4e is orders of magnitude more stable in blood than \n previously investigated pt(ii ) and pt(iv ) compounds and that its ability \n to interact with hsa may confer this stability . \n a series of amphiphilic \n pt(iv ) constructs was prepared using the synthetic approach shown \n in scheme 1 . \n the asymmetrically \n functionalized pt(iv ) compound 3 can be obtained by reaction \n of 2 with succinic anhydride . \n the fortuitous acetone solubility of the disuccinate compound and \n the insolubility of 3 provide an effective means of removing \n the undesired side product . \n the ability \n of isocyanate reagents to undergo nucleophilic attack by the platinum - bound \n hydroxide ligand of 3(42,43 ) was exploited \n to form a series of amphiphilic pt(iv ) carbamate species . in this \n series , compounds 4a e bear a hydrophobic \n unbranched aliphatic chain varying in length from c2 to c16 . \n the pendant \n carboxylate of the succinate ligand trans to the carbamate was used \n for further functionalization as described below . \n the pt(iv ) compounds \n were fully characterized by multinuclear ( h , c , and pt ) nmr spectroscopy and electrospray ionization \n mass spectrometry ( esi - ms ) ( figures s1s5 in the supporting information ) . in the h \n nmr spectra of 4a e , \n an increase \n in the intensity of the resonant absorption from = 1.21.3 \n ppm arose due to the increasing number of methylene units in the carbamate \n chain . across the series \n , little change was observed in the peaks \n at 2.3 , 2.9 , 6.5 , and 6.6 ppm arising from the succinate ch2ch2 fragment , carbamate ch2nhco fragment , and \n ammine ligands . \n these compounds all display a pt nmr \n signal around = 1240 ppm , confirming the 4 + oxidation state \n of the platinum . in the esi mass spectra , well - defined isotopic distribution \n patterns provided further confirmation of chemical composition . \n chemical \n purity was established with combustion analysis and analytical hplc \n ( figure s6 in the supporting information ) . \n the latter also provides information about the increase in hydrophobicity \n on transitioning from 4a to 4e . \n the compounds \n show systematically increasing retention on a c18 reverse - phase stationary \n phase as the length of the chain increases . \n the lipophilicity of the \n compounds can be directly evaluated by measuring the extent to which \n they partition between octanol and water , po / w or simply p. measured log p values \n are reported in figure s8 in the supporting information . as expected , the experimental log p values increased \n from 4a ( log p = 1.72 \n 0.21 ) to 4e ( log p = 1.23 0.04 ) . \n the log p values of these complexes were also calculated \n using the online program alogsp 2.143 . \n the calculated log p values are linearly proportional \n to the experimentally measured log p values ( figure \n s8 in the supporting information ) . to study the reduction of this class of compounds , a coumarin molecule \n was attached to the pendant carboxylate of 4b using standard \n amide - bond - formation chemistry to produce 5 . \n as with 4a e , multinuclear nmr and mass spectra \n are consistent with the formulation of the compound as shown in figure \n s9 in the supporting information . \n the in vitro anticancer activity \n of these newly synthesized pt(iv ) compounds was assessed by using \n the mtt assay . \n three human cancer cell lines , namely , the non - small \n cell lung cancer cell line a549 , ovarian cancer cell line a2780 , and \n cisplatin - resistant ovarian cancer cell line a2780cp70 , were evaluated . \n cancer cells were treated with cisplatin or one of 4a e for 72 h and cell viability was evaluated . \n ic50 values , which represent the concentration required \n to inhibit growth by 50% , are given in figure 1a . \n the in vitro anticancer activity of 4e , the most \n potent member of the series , was also confirmed by using fluorescent \n microscopy and the live / dead cell assay , a combination of the ethidium \n homodimer-1 assay and staining with acetomethoxycalcein , or calcein \n am ( figure 1b ) . \n live cells stain with calcein \n am and yield a green fluorescence signal , whereas dead cells exhibit \n no fluorescence or a red signal due to the ethidium homodimer-1 . \n a2780 \n ovarian cancer cells treated with 10 m 4e for \n 48 h were mostly dead , but those treated with cisplatin under the \n same conditions had mostly survived . \n the ic50 for cisplatin \n at 48 h is 6.35 1.39 m , and that for 4e is 0.26 0.04 m . \n in addition , we further evaluated \n the cytoxicity of 4e in normal human cells . the ic50 value of 4e in the mrc-5 ( normal lung tissue ) \n cell line is 1.34 0.13 m , which is about 8 times higher \n than that in the a2780 ovarian cancer cell lines ( ic50 = \n 0.16 0.04 m ) . \n cytotoxicity profiles of the pt(iv ) prodrugs : \n ( a ) table of measured \n ic50 values for 4a e and 7 in a549 , a2780 , and a2780cp70 cell lines ; ( b ) calcein am / ethidium \n homodimer-1 cell viability assay , details of which may be found in \n the main text and supporting information ( white scale bar , 20 m ; blue scale bar , 200 m ) . \n the extent of cellular uptake was investigated \n by treating a2780 ovarian cancer cells with 5 m of cisplatin \n or one of 4a e for 5 h. the whole \n cell concentration of platinum was then evaluated by graphite furnace \n atomic absorption spectroscopy ( gfaas ) . \n as expected , the results ( figure \n s11 in the supporting information ) indicate \n that increase in chain length from c2 , 4a , to c16 , 4e , significantly enhances cellular uptake . \n the lead compound , 4e , is taken up by the a2780 cells 160 times more effectively \n than 4a and 40 times better than cisplatin . \n notably , \n from 4a to 4e , the 160-fold increase in \n cellular uptake is mirrored by a 280-fold increase in cytotoxicity , \n suggesting that the increase in cytotoxicity can be attributed in \n large part to the increase in uptake . \n the subcellular distribution \n of 4e was investigated and revealed that most of the \n platinum is present in the cytosol , indicating that , despite its lipophilic \n character , it does not become trapped in the membrane ( figure s12 \n in the supporting information ) . given that pt(iv ) prodrugs \n are posited to undergo obligatory reduction prior to anticancer activity , \n we investigated the reduction of a cisplatin prodrug bearing axial \n succinate and carbamate ligands . \n reduction of 5 , a fluorescent \n analogue of 4 , was evaluated using fluorescence spectroscopy \n ( figures s15s17 in the supporting information ) . \n compound 5 has a quantum yield ( ) of 0.047 , \n and the succinyl - coumarin ligand alone , 6 , has a \n of 0.85 ( figure s16 in the supporting information ) . \n the emission of these two compounds is depicted in figure s16b \n in the supporting information . upon excitation \n at 365 nm , \n compound 5 shows \n no significant turn - on upon standing in pbs even after overnight incubation \n at 37 c . when a 10 m solution of 5 was treated \n with 10 equiv of ascorbic acid in pbs , the coumarin ligand began to \n detach within 4 h , as confirmed by analytical hplc and fluorescence \n spectroscopy ( figure s17 in the supporting information ) . \n dna is the typical cellular target of cisplatin , \n and so the ability of 4 to platinate nuclear dna was \n assessed . \n five million a2780 cells were treated with growth medium \n containing 5 m cisplatin , 4a , or 4e for 5 h , followed by incubation in fresh media for an additional \n 16 h. the intracellular dna was isolated and the quantity of bound \n platinum was measured by gfaas . \n the extent of dna platination ( figure \n s18 in the supporting information ) was \n determined to be 255 55 pt adducts/10 nucleotides \n for 4e , 36.4 5.5 pt adducts/10 nucleotides \n for cisplatin , and 31.2 4.1 pt adducts/10 nucleotides \n for 4a . \n h2ax , \n the phosphorylated form of histone protein h2ax , is a known biomarker \n of dna damage caused by cisplatin . h2ax \n can be detected by immunoblotting and immunostaining . \n as shown in \n figure 2a , fluorescence microscopy can be used \n to visualize the localization of h2ax in the nucleus of a2780 \n cells treated with 4e . \n similarly , the phosphorylation \n of h2ax in a2780 cells treated with 4e could also be \n observed by western blotting ( figure s19 in the supporting information ) , indicative of genomic dna damage . \n dna damage \n and cellular responses of a2780 cells treated with 4e : ( a ) immunostaining of the biomarker of dna damage , phosphorylated \n h2ax ( h2ax ) ( scale bar , 20 m ) ; ( b ) flow cytometric analysis \n of cell cycle indicating that 4e induced cell cycle arrest \n at the g2/m phase at 0.2 m ; ( c ) 4e can inhibit \n proliferation in a2780 cells at 0.2 m ; ( d ) annexin v / pi coupled \n flow cytometric analysis showing 4e induced apoptosis \n in a large population of cells at 0.2 m ; ( e ) cellular images \n show characteristic apoptotic cell changes ( blebbing , chromatin condensation , \n and nuclear fragmentation ) upon treatment with 1 m of 4e for 24 h ( scale bar , 20 m ) . \n dna - flow cytometric studies were \n conducted to identify the incidence of cell cycle arrest following \n treatment with 4e . as shown in figure 2b , 4e arrests the cycle in a2780 cells in a time - dependent \n manner . \n after 24 h incubation , a large proportion ( 66.5% ) of cells \n accumulated at the s ( 51.1% ) and g2/m ( 15.4% ) phases . \n after 72 h incubation , \n cells were arrested at g2/m ( 96.5% of whole cell population ) . \n cell \n proliferation experiments provide further evidence for the induction \n of cell cycle arrest by 4e . \n as shown in figure 2c , 4e completely inhibits proliferation \n in a2780 cancer cells at concentrations as low as 0.2 m . using \n a dual staining annexin v / pi flow cytometry assay , \n the occurrence \n of apoptosis was studied in a2780 cells treated with 4e ( figure 2d and figure s20 in the supporting information ) . \n the results show that 4e can efficiently induce apoptosis in a2780 cells after 72 \n h. even at a low concentration of 0.2 m , 4e prompts \n a large population of cells to undergo early ( 55.9% ) and late ( 9.07% ) \n stage apoptosis . \n apoptotic cells normally exhibit changes in cell \n morphology , such as blebbing , chromatin condensation , and nuclear \n fragmentation , all of which can be observed by fluorescence microscopy . \n a2780 cells treated with 4e display a dose- and time - dependent \n morphological change ( figure s21 in the supporting \n information ) . as shown in figure 2e , \n blebbing occurs following treatment of a2780 cells with 1 m 4e for 24 h. chromatin condensation and nuclear fragmentation \n was also identified by hoechst staining . \n all these cell - based experiments \n clearly indicate that 4e can effectively induce dna damage \n and thus lead to cell cycle arrest and apoptosis in cancer cells . owing to the general \n similarity of the amphiphilic compounds 4a e to fatty acids , we hypothesized that they may be able to \n interact with hsa and take advantage of this association for transport \n in the blood ( figure 3a ) . the binding affinity \n of hsa ( sigma - aldrich , a1887 ) toward 4a , 4d , and 4e was investigated by using fluorescence spectroscopy . \n specifically , fluorescence quenching of the trp214 residue caused \n by the pt(iv ) complexes was measured ( figure s22 in the supporting information ) . \n the compound bearing \n a c16 hydrophobic chain , 4e , displayed the highest affinity , \n with a binding constant ( ka ) of 1.04 \n 10 m. compound 4d exhibited \n weaker binding ( ka = 3.7 10 m ) , whereas 4a bound poorly \n ( ka = 2.6 10 m ) . \n analysis of a scatchard plot ( figure s22 in the supporting information ) revealed a 1:1 binding \n ratio between 4e and hsa , further supported by a job \n plot ( figure 3b ) . in pbs , \n the concentration \n of 4e at saturation is 3 m , but upon complexation \n with hsa to form 7 , pt concentrations of up to 400 m \n can be achieved . \n the features of the uv vis trace of 7 are similar to those of pure hsa , implying that binding of 4e leads to minimal structural changes in the protein ( figure \n s23 in the supporting information ) . \n moreover , \n the features of the pt trace of 7 , representing the pt \n content in the fractions of effluent as measured by gfaas , match well \n those of the uv vis trace ( figure 3c ) , \n suggesting that 4e is tightly bound to hsa . \n a comparison \n of the uv vis and gfaas data reveals that 4e and \n hsa associate in a 1.1:1 ratio to form 7 . \n this result \n is consistent with the 1:1 ratio obtained from the fluorescence studies \n ( vide supra ) . \n release of 4e from 7 was evaluated \n by dialysis of a pbs solution of the construct against water . \n a 10 \n m solution of 7 in pbs was loaded into a 3 kda \n mwco micro - dialysis bag and , as shown in figure 3d , 60% of the platinum compound was released after 72 h at \n room temperature . \n the nonpolar nature of 4e permits facile \n extraction of the complex from aqueous solutions into octanol . over \n 90% of the platinum compound can be extracted from an aqueous solution \n of 7 in this manner , as determined by gfaas ( figure s24 \n in the supporting information ) . \n the molecular \n identity of the species extracted into octanol was confirmed by esi - ms \n ( figure 3e ) . \n systematic investigation of the pt - hsa \n complex , 7 : \n ( a ) schematic representation of the formation of 7 ; ( b ) \n job plot of the pt - hsa complex showing 1:1 stoichiometry ; ( c ) fplc \n trace of 7 and the corresponding gfaas trace indicate \n that 4e is tightly bound to hsa ; ( d ) dialysis experiment \n indicating that around 60% of the platinum compound was released from 7 over 72 h and that the hsa is retained within the 3 kda \n mwco micro - dialysis bag ; ( e ) esi - mass spectrum of the octanol extract \n showing an intense signal at m / z = 700.1 for [ 4e h ] supporting \n the integrity of 4e in 7 ; ( f ) octanol extraction \n analysis showing that > 90% of 4e ( 3 m ) was \n reduced \n by ascorbate ( 30 m ) after 2 h incubation at 37 c in the \n absence of hsa . \n the reduction was decreased to < 50% by forming \n the pt - hsa complex ( 3 m ) ; ( g ) cytotoxicity profile of 7 against a2780 human ovarian cancer cells showing an ic50 value of 0.12 0.01 m . upon \n reduction , the hydrophobic pt(iv ) compound 4e ( log p = 1.23 ) produces a hydrophilic pt(ii ) product , cisplatin \n ( log p = 2.19 ) , which is scarcely extracted \n into octanol . \n therefore , by measuring the pt content in an octanol \n extract of a mixture of products of reduction of 4e , \n the degree of reduction can be established . \n two different concentrations \n ( 30 m and 300 m ) of ascorbate were used , corresponding \n to the concentrations found in blood and the intracellular environment , \n respectively . \n compound 4e ( 3 m ) is readily reduced \n by ascorbate at both low and high concentrations ( figure 3f and figure s25 in the supporting \n information ) . \n after 2 h incubation at 37 c , > 90% of 4e is reduced . in a separate experiment , a 3 m solution \n of 7 exhibited much slower reduction of the pt(iv ) species \n after similar treatment . even after 7 is incubated with \n reductant for 5 h ( figure 3f ) , \n mtt assays were carried \n out to assess the cytotoxicity of 7 ( figures 1a and 3 g ) . \n complex 7 isolated by fplc exhibits comparable cytotoxicity to 4e in ovarian cancer cell lines a2780 and a2780cp70 ( ic50 = 0.12 0.01 m against a2780 and ic50 = 0.13 0.01 m against a2780cp70 ) . \n docking studies were conducted to \n further investigate the non - covalent interaction between 4e and hsa to form 7 . \n the hsa protein scaffold from 1e7h \n was used in a broad search for interactions of 4e . of \n the top nine strongest interactions found , six place the platinum \n complex in the same pocket . \n this pocket , located in subdomain iia , \n is known as sudlow s site i and has been previously identified \n as a locus of drug interaction with hsa . \n the more polar fragments of the \n molecule , which lie closer to the platinum center , interact with a \n variety of amino acid residues ( figure 4c ) . \n glu292 , glu153 , and his288 are in close proximity to the \n ammine ligands bound to the pt . \n arg257 is directed toward the carbamate \n carbonyl , and gln169 is positioned above the carbamate fragment . \n the \n lipophilic c16 tail is coiled into a hydophobic channel lined by tyr150 , \n leu238 , leu219 , leu234 , phe223 , ile264 , ala261 , ile290 , and tyr150 . \n the pt(iv ) center is located approximately 1 nm away from trp214 , \n allowing for quenching of the fluorescence from the tryptophan residue , \n which is consistent with the fluorescence studies described above . \n docking \n studies of 4e and hsa using autodock vina : \n ( a ) lowest energy structure ; ( b ) platinum complex is buried beneath \n the protein surface ; ( c ) platinum compound interacting with a variety \n of amino acid residues . \n the stability of pt(iv ) prodrugs in blood is critically important \n for their application in clinical settings . \n we therefore investigated \n the stability of 4e in whole human blood by exploiting \n the ability of octanol to selectively extract unreduced 4e from aqueous solution . \n compound 4e ( 60 m ) was \n incubated in fresh whole human blood at 37 c . \n after 0 , 1 , 2 , \n 4 , and 7 h , aliquots were extracted with octanol to remove the remaining \n pt(iv ) complex . \n the pt content in the octanol extract was measured \n using gfaas , and the structural integrity of the extracted material \n was confirmed using analytical hplc . as shown in figure 5 , \n the pt content of the octanol extract decreases to 49% after \n 7 h incubation . \n hplc analysis ( figure s26 in the supporting information ) indicates that the extracted pt species \n is indeed 4e by comparison with pure material . \n this result \n reveals the half - life of 4e in fresh whole human blood \n to be 6.8 h. stability of 4e in whole human blood showing \n a half - life \n of 6.8 h. \n it can \n be appreciated that the structures of 4a e bear an overall likeness to those of fatty acids . although \n molecular similarity can be rigorously defined , the metrics typically employed are unsuitable in this particular \n instance given that there is no meaningful set of dissimilar compounds \n with which to contrast this similarity . like fatty acids , \n 4a e have an overall amphiphilic nature due to \n the presence of a long hydrophobic chain and a terminal carboxylic \n acid ( scheme 1 ) . \n compounds 4a e were readily synthesized by employing validated chemical \n reactions , providing access to this class of previously unreported \n pt(iv ) prodrugs bearing trans carbamate and carboxylate \n axial ligands . \n the lipophilicity of this set of compounds , directly \n evaluated by measuring log p , could be readily tuned \n simply by increasing the length of the aliphatic chain of the carbamate \n ligand . \n an increase in the length of the chain , and consequently in \n the lipophilicity , led to a systematic increase in cytotoxicity from \n 1 order of magnitude lower to almost 2 orders of magnitude higher \n than that of cisplatin . \n this phenomenon \n was observed in all three of the cell lines tested ( figure 1a ) . \n the lead compound of the series , 4e , which bears a c16 hydrophobic chain , exhibited the most potent \n in vitro anticancer activity . in \n all three of the cell lines tested , \n the cytotoxicity of 4e is substantially greater ( 970 \n times ) than that of cisplatin ( figure 1a ) . \n as shown in figure 1a , 4e also \n displays a lower resistance factor in ovarian cancer cell lines than \n cisplatin or 4a d . \n the activity of 4e is demonstrated by staining cells with calcein am and ethidium , \n the so - called live / dead cell assay . in this assay , \n treatment with \n cisplatin or 4e at equimolar concentrations led to drastically \n different degrees of cell survival . a likely source of this \n increased potency lies in the greater ability \n of lipophilic compounds to traverse the plasma membrane . as expected , \n cellular uptake of the platinum compounds 4 by a2780 \n cancer cells increases as the length of the carbamate chain increases . \n as suggested in a recent report , cellular uptake of pt(iv ) compounds \n is highly related to their in vitro activity . \n plotting log [ ic50 ( m ) ] vs log [ uptake ( pmol pt / million \n cells ) ] , reveals the linear relationship between the two ( r = 0.98 ) depicted in figure 6a . \n a plot of log [ uptake ( pmol pt / million cells ) ] vs log p ( figure 6b ) also exhibits a linear \n relationship ( r = 0.99 ) . \n the anticipated \n linear relationship also occurs between log p and \n log [ ic50 ( m ) ] ( figure 6c ) , \n confirming that hydrophobicity directly contributes to the cytotoxicity \n of these complexes . using these three factors , a 3d structure \n the graph \n clearly establishes a three - way relationship between hydrophobicity , \n cellular uptake , and cytotoxicity . \n activity relationship \n of 4a e between hydrophobicity ( log p ) , cytotoxicity \n ( ic50 ) , and cellular uptake in a2780 cells : ( a ) 2d correlation \n of cytotoxicity of the platinum(iv ) complexes and their cellular uptake \n ( b ) 2d correlation of cellular uptake and hydrophobicity ; ( c ) 2d correlation \n of hydrophobicity and cytotoxicity ; ( d ) 3d plot of hydrophobicity , \n cytotoxicity , and cellular uptake ( black squares ) . the projections \n shown in the various planes are the corresponding 2d plots ( parts \n a \n reaction \n of 4a e with intracellular reductants \n such as glutathione or ascorbic acid will release cisplatin , which \n subsequently conveys anticancer activity . \n use of fluorescence methods \n to detect the reduction of pt(iv ) species in biological environments \n has attracted much recent attention . in order to investigate the redox \n behavior of 4a e \n , we prepared a coumarin - conjugated \n pt(iv ) compound , 5 , which displays a significant increase \n in fluorescence intensity upon reduction . \n the similarity between the \n coordination spheres and pt nmr chemical shifts of 4a e and 5 indicate that \n the metal - centered redox properties of the latter are relevant in \n assessing those of the former . in 5 , \n the fluorescence \n of the coumarin fluorophore is quenched owing to the heavy atom effect \n induced by platinum . upon reduction , \n the coumarin - containing ligand \n is released , as determined by hplc , resulting in enhanced fluorescence . \n using 5 , \n it was possible to ascertain that pt(iv ) constructs \n of the type 4a e can be reduced by \n biologically relevant concentrations of ascorbate within hours . following \n such reductive activation , 4a e exert \n their anticancer activity via the released cisplatin . \n this active \n pt(ii ) moiety induces cell death by forming dna cross - links . \n accordingly , \n dna from a2780 cells that had been treated with 4a e contained amounts of platinum roughly proportional to the \n cytotoxicity of the compound , and phorphorylation of h2ax , a biomarker \n of dna damage , was detected in the same cell line following treatment \n with 4e . \n the mechanism of action of 4a e was further probed by analyzing the influence of treatment \n with the platinum agent on the progression of cells through the cell \n cycle . \n platination is recognized by the cell as dna damage , which \n induces cell cycle arrest . \n if the damage can not be repaired , cells \n are signaled to commit apoptosis . \n the observation of g2/m arrest following \n s phase arrest is consistent with the known response of cells to cisplatin \n treatment . \n cisplatin activates the g2/m \n checkpoint , allowing dna to be repaired before mitosis and at the \n same time preventing cisplatin - damaged dna from being inherited by \n daughter cells . \n the induction of apoptosis was confirmed by the annexin \n v / propidium iodide ( pi ) assay . in healthy cells , \n phosphatidylserine \n ( ps ) is located on the cytoplasmic surface of the cell membrane . in \n apoptotic cells \n , ps is translocated from the inner to the outer surface \n of the plasma membrane , exposing ps to the external cellular environment \n where it can be detected by annexin v conjugates . combining annexin \n v and pi , both early and late stage apoptosis can be identified . indeed , 4e \n , the most potent member of the series , induces a large \n population of cells to enter into early and late stage apoptosis . \n the morphological changes that are expected to accompany apoptosis , \n such as blebbing and chromatin condensation , were also observed . \n the amphiphilic structure of compounds 4a e mimics that of the fatty acids that \n are naturally transported by hsa . \n we therefore investigated the interaction \n of the most potent complex , 4e , with this protein . \n the \n fluorescence of trp214 , the sole tryptophan in the protein , is quenched \n by the heavy atom effect when a platinum complex approaches it via \n association with hsa . \n the quenching is complete within a few seconds \n of adding the platinum complex , before acquisition of the first fluorescence \n measurement . \n this phenomenon can be used to create a job plot , which \n reveals that 4e associates with hsa in a 1:1 stoichiometry . \n isolation of the protein by fplc and quantification of the amount \n of protein and platinum in this species confirms the 1:1 molar ratio . \n the nature of the interaction between the two is proposed to be non - covalent \n because extraction of an aqueous solution of 7 with octanol \n removes 4e from hsa in a nearly quantitative manner . \n esi - ms measurements on the octanol extract confirm the molecular identity \n of 4e in the non - polar phase . \n the 1:1 stoichiometry \n implies that a specific non - covalent interaction may be occurring \n between 4e and hsa . \n molecular docking simulations were \n used to investigate possible binding sites for 4e on \n the protein . \n the lowest energy binding site coincides with sudlow s \n site i. this pocket has been classically associated \n with drug binding and is one of the sites to which fatty acids bind . \n as can be seen in figure 4 , the platinum complex is buried beneath the protein surface when \n bound in this pocket . \n this feature suggests that association with \n hsa may slow biological reduction of the pt(iv ) center by preventing \n reductants from forming an activated complex with the anticancer prodrug . \n the influence of hsa complexation on the reduction of 4e was probed by exploiting the high lipophilicity of this platinum \n complex . as described above , extraction of an aqueous solution of 7 \n the platinum complex rapidly associates with hsa to \n form 7 in situ . at various time points \n the pt(iv ) species \n with its axial lipophilic carbamate is extracted into the octanol , \n whereas the hydrophilic cisplatin , produced by reduction , is not . \n quantification of the platinum extracted into octanol at each time \n point therefore provides a measure of the rate of reduction in blood . \n the half - life of 4e in blood obtained \n from these measurements is 6.8 h , which is significantly greater than \n that of cisplatin ( t1/2 = 21.6 min ) or \n satraplatin ( t1/2 = 6.3 min ) . \n these favorable chemical properties combine with the inherent nonimmunogenicity , \n biocompatibility , and enhanced tumor accumulation of hsa to produce \n a system that holds significant therapeutic potential . \n rapid \n association between 4e and hsa , in conjunction \n with the high concentration of the latter in blood , suggests that \n injection of 4e as a small molecule agent will result \n in the rapid in situ formation of 7 . \n we envisage , however , \n that for practical reasons 4e would be better formulated \n as 7 and administered as the protein - platinum complex . \n this approach permits much higher concentrations of 4e to be solubilized in water and eliminates the need to administer 4e using organic cosolvents or additives . \n in conclusion , we presented the successful development of a novel \n pt(iv ) prodrug , 4e , that is capable of associating with \n serum albumin to form a pt : hsa construct , 7 . \n compound 4e was obtained from the study of a series of amphiphilic \n pt(iv ) complexes designed to mimic the structure of fatty acids . by \n tuning length of the hydrophobic chain present in these compounds \n , \n cytotoxicity could be modulated from an order magnitude lower to almost \n 2 orders of magnitude greater than that of cisplatin . \n the lead compound , 4e , exhibits excellent in vitro anticancer activity , showing \n 970 times better activity than cisplatin in lung and ovarian \n cancer cell lines . \n investigation of the fluorophore - bearing anolog , 5 , confirmed that the prodrugs described here interact with \n biological reductants , lose axial ligands on conversion to pt(ii ) , \n and subsequently platinate dna . \n as a consequence of the dna damage , \n cell cycle arrest and apoptosis were observed . \n a strong non - covalent \n interaction between 4e and hsa permits the formation \n and isolation of 7 , which can act as a delivery vehicle \n for 4e . \n 4e shows a 6.8 h half - life in whole human blood , which is \n significantly longer than that of cisplatin ( t1/2 20 min ) or satraplatin ( t1/2 6 min ) . \n compound 3 was placed into a 5 ml glass vial \n and an anhydrous dmf solution ( 2 ml ) of the corresponding isocyanate \n was added . \n the solution was then \n filtered and the solvent was removed under reduced pressure at 65 \n c . \n ethyl ether ( 2 ml ) was added to the oily residue , and the \n mixture was ultrasonicated for 1 min and centrifuged . \n the solid was \n further washed with dcm ( 4 ml ) and diethyl ether ( 2 ml ) . \n reagents used in the reaction : \n compound 3 ( 200 mg , 0.468 mmol ) , ethyl isocyanate ( 70 \n mg , 0.945 mmol ) . \n h nmr ( 400 mhz , \n dmso - d6 ) : : 6.51 ( m , 7h , nh3 and \n nhcarbamate ) , 2.89 ( q , 2h , ch2ch3 ) , 2.34 \n ( m , 4h , succinate ) , 0.94 ( t , 3h , ch2ch3 ) . \n c nmr ( 100 mhz , dmso - d6 ) : : 180.2 , \n 174.3 , 164.2 , 36.0 , 31.0 , 30.4 , 15.9 . \n esi - ms ( negative mode ) \n for c7h17cl2n3o6pt : [ m h ] , calcd m / z 504.0 ; found , 503.9 . \n calcd for c7h17cl2n3o6pt : c , 16.64 ; h , \n 3.39 ; n , 8.32 . found : c , 17.08 ; h , 3.27 ; n , 7.98 . \n reagents used in the reaction : \n compound 3 ( 50 mg , 0.117 mmol ) , hexyl isocyanate ( 30 \n mg , 0.236 mmol ) . \n h nmr ( 400 mhz , \n dmso - d6 ) : : 6.51 ( m , 7h , nh3 and \n nhcarbamate ) , 2.85 ( q , 2h , ch2(ch2)4ch3 ) , \n 2.34 ( m , 4h , succinate ) , 1.22 ( m , 8h , ch2(ch2)4ch3 ) , \n 0.85 ( t , 3h , ch2(ch2)4ch3).c nmr ( 100 \n mhz , dmso - d6 ) : : 184.5 , 174.4 , \n 164.2 , 41.5 , 31.6 , 30.9 , 30.4 , 30.3 , 26.6 , 22.6 , 14.4 . \n esi - ms \n ( negative mode ) for c11h25cl2n3o6pt : [ m h ] , calcd m / z 560.1 ; found , 560.0 . \n calcd for \n c11h25cl2n3o6pt : c , 23.54 ; h , 4.49 ; n , 7.49 . found : c , 23.52 ; h , 4.21 ; n , 7.36 . \n reagents used in the reaction : \n compound 3 ( 100 mg , 0.234 mmol ) , octyl isocyanate ( 80 \n mg , 0.515 mmol ) . \n h nmr ( 400 mhz , \n dmso - d6 ) : : 6.51 ( m , 7h , nh3 and \n nhcarbamate ) , 2.87 ( q , 2h , ch2(ch2)6ch3 ) , \n 2.35 ( m , 4h , succinate ) , 1.22 ( m , 12h , ch2(ch2)6ch3 ) , \n 0.85 ( t , 3h , ch2(ch2)6ch3).c nmr ( 100 \n mhz , dmso - d6 ) : : 180.0 , 174.3 , \n 164.4 , 41.5 , 31.7 , 30.9 , 30.4 , 30.3 , 29.3 , 29.2 , 26.9 , 22.6 , 14.4 . pt nmr ( 86 mhz , dmso - d6 ) : 1240.7 . \n esi - ms ( negative mode ) for c13h29cl2n3o6pt : [ m h ] , \n calcd , m / z 588.1 ; found , 588.0 . \n calcd for c13h29cl2n3o6pt : c , 26.49 ; h , 4.96 ; n , 7.13 . found : c , 26.15% ; h , \n 4.51 ; n , 6.99 . reagents \n used in the reaction : \n compound 3 ( 50 mg , 0.117 mmol ) , dodecyl isocyanate ( 50 \n mg , 0.237 mmol ) . \n h nmr ( 400 mhz , \n dmso - d6 ) : : 6.50 ( m , 7h , nh3 and \n nhcarbamate ) , 2.87 ( q , 2h , ch2(ch2)10ch3 ) , \n 2.36 ( m , 4h , succinate ) , 1.23 ( m , 20h , ch2(ch2)10ch3 ) , \n 0.85 ( t , 3h , ch2(ch2)10ch3).c nmr ( 100 \n mhz , dmso - d6 ) : : 180.0 , 174.3 , \n 164.4 , 41.5 , 31.8 , 30.9 , 30.4 , 30.3 , 29.6 , 29.5 , 29.5 , 29.4 , 29.3 , \n 29.2 , 26.9 , 22.6 , 14.4 . pt nmr ( 86 mhz , dmso - d6 ) : 1240.3 . \n esi - ms ( negative mode ) for c17h37cl2n3o6pt : \n [ m h ] , calcd , m / z 644.2 ; found , 644.1 . \n calcd for c17h37cl2n3o6pt : c , 31.63 ; h , \n 5.78 ; n , 6.51 . found : c , 31.48 ; h , 5.25 ; n , 6.40 . reagents used in the reaction : \n compound 3 ( 50 mg , 0.117 mmol ) , hexadecyl isocyanate \n ( 69 mg , 0.258 mmol ) . \n h nmr ( 400 \n mhz , dmso - d6 ) : : 6.51 ( m , 7h , nh3 \n and nhcarbamate ) , 2.87 ( q , 2h , ch2(ch2)14ch3 ) , \n 2.35 ( m , 4h , succinate ) , 1.23 ( m , 28h , ch2(ch2)14ch3 ) , \n 0.85 ( t , 3h , ch2(ch2)14ch3).c nmr ( 100 \n mhz , dmso - d6 ) : : 180.0 , 174.4 , \n 164.4 , 41.5 , 31.8 , 31.0 , 30.4 , 30.3 , 29.5 , 29.5 , 29.2 , 26.9 , 22.6 , \n 14.5 . pt nmr ( 86 mhz , dmso - d6 ) : 1240.4 . \n esi - ms ( negative mode ) c21h45cl2n3o6pt : [ m h ] , calcd , m / z 700.2 ; found , 700.1 . \n anal . \n calcd for c21h45cl2n3o6pt : c , 35.95 ; h , 6.46 ; n , 5.99 . found : c , 35.72 ; h , \n 6.02 ; n , 5.61 .", "role": "user" }, { "content": "albumin \n is the most abundant protein in human serum and drugs that \n are administered intravenously inevitably interact with it . \n we present \n here a series of platinum(iv ) prodrugs designed specifically to enhance \n interaction with human serum albumin ( hsa ) for drug delivery . \n this \n goal is achieved by asymmetrically functionalizing the axial ligands \n of the prodrug so as to mimic the overall features of a fatty acid . \n systematic variation of the length of the aliphatic tail tunes the \n cellular uptake and , consequently , \n the cytotoxicity of cis , cis , trans-[pt(nh3)2cl2(o2cch2ch2cooh)(oconhr ) ] , 4 , where r is a linear alkyl group . investigation of an analogue \n bearing a fluorophore conjugated to the succinate ligand confirmed \n that these compounds are reduced by biological reductants with loss \n of the axial ligands . \n intracellular release of cisplatin from 4 was further confirmed by observing the characteristic effects \n of cisplatin on the cell cycle and morphology following treatment \n with the prodrug . \n the most potent member of series 4 , \n for which r is a hexadecyl chain , interacts with hsa in a 1:1 stoichiometry \n to form the platinum - protein complex 7 . \n the interaction \n is non - covalent and extraction with octanol completely removes the \n prodrug from an aqueous solution of hsa . \n construct 7 is \n robust and can be isolated following fast protein liquid chromatography . \n the nature of the tight interaction was investigated computationally , \n and these studies suggest that the prodrug is buried below the surface \n of the protein . consequently , complexation to hsa is able to reduce \n the rate of reduction of the prodrug by ascorbate . \n the lead compound \n from series 4 also exhibited significant stability in \n whole human blood , attributed to its interaction with hsa . \n this favorable \n redox profile , in conjunction with the established nonimmunogenicity , \n biocompatibility , and enhanced tumor accumulation of hsa , produces \n a system that holds significant therapeutic potential .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the second half of the 20th century , when the process of separation between sex and procreation began , a profound transformation of customs has affected men and women 's behavior as the preservation of virginity until marriage loses its moral significance . in this context of cultural changes , \n the phenomenon of teen pregnancy has emerged as a disturbing element in ideal youth development . \n this paper summarizes the main results provided by gravad survey ( teenage pregnancy : multicentric study about youth , sexuality , and reproduction in brazil ) . \n it allows both to problematize the moralistic tone of common sense belief that tends to treat the phenomenon as homogeneous and contemporary and to designate a new outline for the comprehension of reproductive events in juvenile biographies . in order to understand this change in mentality , \n it is important to focus the social processes that contributed to the construction of teen pregnancy as a problem [ 13 ] . \n surrounding the expression teen pregnancy is the assumption about a certain age group that , for a long time , was seen as ideal for a woman to have children [ 4 , 5 ] . \n however , current debate treats it as an early event in youth trajectory and as an exclusive characteristic of poorer segments of the population [ 68 ] . \n demographic transition has been identified as one of the central elements in the intriguing panorama of early reproduction [ 2 , 9 , 10 ] . according to the 1970 census , the total fertility rate ( tft ) in brazil was 5.76 children per woman , arriving at 1.81 in 2010 . \n traditionally , the higher rates of fertility ( age - specific fertility rate ) were seen in women from 25 to 29 years or from 30 to 34 years , constituting what is commonly referred to as a later pattern of fertility . since the 1980s \n , there has been an observed growth in fertility rates among women between 15 and 19 years old , a datum that becomes notable when compared to the simultaneous fall in the rates of other age groups [ 2 , 9 , 10 ] . \n this dislocation is responsible for a typically young pattern in the fertility structure by age groups in brazil , a pattern that is different from what it is observed in developed countries . although the increase in the fertility rate of women between 15 and 19 years old is not statistically significant and has in fact been the effect of profound reductions in the participation of the oldest women in the total fertility rate , the data mentioned above have been used to set the scene for a pregnancy epidemic in adolescence , above all in the poorer segments of the population . \n the public debate in relation to the phenomenon frequently and erroneously associates teen pregnancy with questions of poverty and urban violence in the country [ 3 , 11 ] . within the scenario of changes in society , \n there have also been transformations in the social conceptions of age and gender and these transformations redefine the social expectations placed on young men and women today . \n , it is expected that adolescents and youth dedicate themselves to education in order to achieve insertion into professional life \n these two elements are important demarcations for the passage to adult life . according to this model , leaving parental home and beginning conjugal life \n this ideal conception of passage to adult life ignores that the availability of social opportunities is not offered in equal conditions for youth of different social classes . \n furthermore , there is no homogeneity in how to experience adolescence and youth . according to the current rationale of the ideal transition to adulthood , an episode of pregnancy in this life period \n is interpreted as disturbing youth development , as it accelerates or even suppresses some phases taken as \n moreover , this rationale obliterates the fact that there are gender and class differences that interfere in the process of sexual initiation . \n young people were interviewed in three major brazilian state capitals : porto alegre ( rio grande do sul ) , rio de janeiro , and salvador ( bahia ) . \n these cities are located in regions with very different social and cultural characteristics ( the northeast , southeast , and south , resp . ) . the research approach in this study links two methodological strategies : semistructured interviews ( n = 123 ) , carried in 1999 - 2000 , and a household survey ( taken place in 2002 ) with a three - stage stratified probabilistic sample of men and women from 18 to 24 years of age . \n face - to - face interviews were held with a questionnaire based on the results of the qualitative stage . \n the questionnaire prioritized certain events and situations in the individual 's affective and sexual history , such as first sexual relation , first and most recent pregnancy , first and most recent child , first abortion ( spontaneous and induced ) , and current partner . \n the changes in sexual customs taking place in brazil , as well as in western countries , have accepted preconjugal feminine sexuality . the first sexual experiences , originally allowed to young men but only with specific partners , such as prostitutes or women who were not worth of marrying with , began to happen with girlfriends . \n paradoxically , despite an environment of transformations in which sex gains a status among youth as an acceptable behavior , conversations about sexuality continue to be taboo in the family ; contraception is not openly discussed in school , and sexual education is a highly controversial theme in brazilian society . \n teen and youth sexual relations have been modified , but these changes were not sufficient to alter the ways in which contraception can be discussed . \n women are still considered to be the sole responsible for pregnancy , while men continue being absolved or omitted from their participation in the reproductive event . in brazil \n , male initiation continues to be more precocious than women 's by at least two years ( 16.2 against 17.9 years)this is a pattern commonly found in latin america . \n gravad data show that the behavior of young men tends to be more uniform ( see table 1 ) : for example , the median age for their first sexual experience does not vary according to region of residence , social group , or skin color / race . however , there is a delay of this initial experience in the context of prolonging individual education . \n women present a greater diversity of conduct , according to their family origins and their biographic characteristics . \n those from poorer groups , who also share other characteristics such as a lower level of education and socialization with significant involvement in domestic work , have an earlier sexual initiation [ 13 , 15 ] . \n contrary to the prevailing stereotypes in brazilian society with respect to ethnic groups , there was no observed greater precocity in sexual initiation among black women . \n the results provide by gravad show that there is a recurrent age difference between partners at the first sexual experience : women have older and more experienced partners . \n they have their first experience with the namorado ( steady boyfriend ) ( 86% ) or the husband ( 4% ) . \n barely 45% of men have their first experience with the girlfriend ; half of men do have their first experience with an eventual partner , and 5% with prostitutes . \n the use of contraceptive methods also varies according to the age of the first relation ; it is higher among youth who begin their sexual experiences later . \n the degree of use also varies according to the level of individual instruction , being higher among those with higher levels of education . \n although equivalent proportions of men and women ( 70% ) say they have used some form of contraception for their first sexual intercourse , we observed a decline in regular use of contraceptives afterwards , which is associated with the type of relationship between partners [ 13 , 16 ] . \n it is common to associate the occurrences of an unplanned pregnancy with the nonuse of contraceptive methods , which is seen as a consequence of lack of knowledge or difficulty in accessing contraceptive resources on the part of young people . \n notwithstanding , this panorama in which young women have a sexual initiation with an older or more experienced partner the namorado exercises a strong influence on the decisions regarding contraceptive protection [ 17 , 18 ] . \n being informed about the existence of and the way to use contraceptive methods is not sufficient to guarantee their adequate use . \n it is important to take into account the context of gender relationships , which influences the contraceptive practices . \n it is expected that young women take on all of the responsibility with respect to contraception , with a low level of participation from their male partners . \n considering adolescence as comprising the ages between 10 and 19 , gravad data show that a first experience with teen pregnancy was declared by 21% of men and 29% of women ( proportion calculated with those that were 20 years old or above ) [ 15 , 20 ] . \n when working with the cutoff point of 18 years of age which constitutes the starting age of brazilian legal adulthood the observed proportion is lower : the event is reported by 8% of men and 16% of women . below the age of 15 , the percentages are much smaller : 0.6% for men and 1.6% for women \n [ 15 , 20 ] . the features of these pregnancies indicate that they occurred in steady relationships ; there is a small percentage of those interviewed saying that their first episode of pregnancy before age 20 was with an eventual partner . in this first pregnancy , \n most young women 's partner was the same person with whom they had their first intercourse ( 56% ) , which contrasts with 21% of the young men in the same condition . \n greater proportions of pregnancy before age 20 were observed among those youth with lower education levels and those who were not working at the time of the interview . as for \n the young men involved in pregnancy episodes with their partners , the majority of them are already working , albeit informally , when the event took place [ 15 , 20 , 21 ] . \n the level of young women 's engagement in domestic work constitutes an important factor in their socialization . \n there is a clear association between teen pregnancy and the fact that young women are the main ones to perform the domestic work in their families of origin [ 15 , 20 ] , which indicates that family and gender socialization delineate the horizon of biographic trajectories [ 17 , 22 , 23 ] . \n intense involvement with the domestic sphere promotes a determined vision of the world , in which being a mother is a central element of feminine identity a well - documented characteristic in the anthropological brazilian literature about families [ 2224 ] . \n it was observed , moreover , that teen pregnancy was more referred by youth whose mothers and siblings had children before age 20 . \n for this reason , this seems to be an accepted and reproduced behavior in their environment , which does not deviate from the representation that prevails in the family of origin . despite family socialization , individual education is certainly a relevant factor that favors the postponing of entry into sexual life with a partner . \n it also reduces the chances of a so - called early pregnancy [ 13 , 21 , 25 ] . in every social stratum that was studied , the reference to an episode of pregnancy before age 20 diminishes in the same proportion as the education of the young man or woman increases [ 20 , 21 , 25 ] . \n education widens personal and professional horizons , even in the face of a strong social disadvantage , as well as relocates the goals of motherhood and fatherhood . \n the hidden side of the debate regarding the phenomenon of teen pregnancy is the debate about abortion [ 26 , 27 ] . in brazil , \n abortion is prohibited except for two specific circumstances : rape and life risk to the mother . \n as can be seen in table 3 , the survey permitted us to ask questions regarding the interruption of pregnancy in youth : more women than men affirmed having carried their first pregnancy to term , when the pregnancy occurred before age 20 , even though the decision had involved conflicts and negotiations with their partners and families [ 20 , 26 ] . \n the experience of having had a child while young is strikingly distinct for young men and women : among those who have had at least one teen pregnancy , 50% of men and only 16% of women did not have any children at the time of the interview [ 20 , 26 ] . \n the fact that many studies erroneously take pregnancy and maternity as synonyms ends up obliterating the cases of abortion and fatherhood among youth . \n early reproduction is seen as a problem for the life of young people because of the social expectations driven to youth , such as the increase of their education and the postponement of reproduction [ 1 , 4 ] . \n nevertheless , youth with children present a set of specific sociobiographic characteristics that suggests a rapid passage to adult life , wherein the reproductive episode accelerates the process or even represents its conclusion [ 24 , 28 ] . for this reason , \n they contrast with middle / upper class youth , among whom the extension of the transition to adulthood is observed , whether through prolonged studies and/or their permanence in their parents ' home . \n it must be added that among youth in middle and higher social segments , the episodes of teen pregnancy tend to end in abortion . \n the impacts of the birth of a child during youth on the trajectories of young women and young men are very different , and they are very much affected by class condition [ 24 , 28 , 29 ] . \n the process of decision making with respect to pregnancy goes beyond the limits of the couple [ 19 , 30 ] . \n the families of origin play a fundamental role in decisions related to maintaining the pregnancy or not , establishing a conjugal union , and providing the material and financial resources that will sustain the child , and so on . \n young people generally turn to their parents for the support of the arrival of the future grandchild . \n as can be seen in table 4 , the family reaction is generally positive when told the news . in the metropolitan areas covered by the survey , the situation where a young woman is expelled from the parental home because of a pregnancy is rare , which means a relevant change regarding sexual morality and family / intergenerational relationships [ 22 , 29 , 30 ] . \n the families of origin represent an important network of support for the new couple , whether that is through housing them in their residences , contributing with goods or taking care of the child [ 29 , 30 ] . \n cohabitation with the partner as a result of the reproductive episode is frequent in the trajectories of lower - income youth . for the middle class , conjugal alliance \n is not valorized in the context of juvenile reproduction . when the gestation is carried to term \n , families mobilize in support of maintaining the project of the youths ' education ( with nannies or daycares ) , without this implying the acceleration or entry of the youth into the labor market . \n the children of these young people find themselves mainly in two situations : they either live with both parents or with the woman and her family . \n domestic arrangements with the mother as a single parent are rare in this age group . in the cases of dissolution of the couple , \n the young women and the children return to their families of origin [ 15 , 20 , 24 , 29 , 30 ] . \n it is important to highlight the repercussions of motherhood or fatherhood on these youth 's schooling and job trajectories : table 4 shows that more than 60% of young men were already in the labor market before the birth of their first child ; only 14% did not have any type of work activity and remained jobless . \n besides working , half were already out of school and 15% declared that they had abandoned their studies . \n the majority of the women did not participate in any labor activity for remuneration ( 65% ) , nor were they at school ( 40% ) , and 18% quit school with the birth of their child [ 21 , 24 ] . \n thus , it is important to note the existence of different juvenile trajectories , in which schooling is short and with frequent grade repetitions for many . \n the reproductive event does not interrupt careers : for some , the social / family structure permits the continuity of education and job training ; for others , this path has already been interrupted and the reproductive event is the closure of a transition towards adult life [ 15 , 21 , 24 , 28 ] . \n the impacts of having children on the sphere of juvenile sociability constitute another relevant dimension . \n the impact is undoubtedly greater for young women : 72% of women declared having reduced the time spent with friends in the first year after the birth of the child , which reflects gender differences in the division of childcare . at this point , it is important to underscore that motherhood strengthens a feminine innerness linked to the domestic world : complaints of loneliness and isolation are common , especially among poorer young women . \n qualitative data indicate that , in comparison to their male cohort , middle class young women become more confined to the house ; that is , they experience more restrictions in going out after the birth of a child . \n second , a cross - class comparison shows that middle class women do go out more , receive more support for maintaining social relations , and do not experience reclusion as radical as that for young women in the lower socioeconomic segment . \n the latter are the ones who undertake duties with husband , child , house , domestic work , and so forth , and in whose lives gender asymmetries are added to social inequalities [ 29 , 30 ] . \n this is part of the process through which youth simultaneously construct their autonomy in relation to their families and search for their singularities . \n the contemporary notion of teen pregnancy very often ignores this strong characteristic of juvenile behavior [ 35 , 31 ] . \n views disseminated about youth mostly refer to a negative evolution of customs and highlight a precocious and undesirable atmosphere of eroticization ( usually attributed to the media ) , as well as the irresponsibility of youth , their ignorance , the parents ' lack of authority , and the absence of dialogue between the generations . from the point of view of common sense beliefs , \n , there is a ( false ) perception of a demographic explosion among the poorer segments of society . \n however , brazilian census data show a significant decrease in the fertility rates for the last 30 years . on the other hand , sexual experience before and outside of marriage ceased to be a privilege of young men . \n nevertheless , the importance of gender hierarchy in presiding decisions about contraception has been little modified and the network of people and institutions supposed to provide sexual guidance has not increased . \n actually , sexual education continues to be a difficult topic to broach at home and at school . \n the option for avoiding the debate about contraception means to ignore the fact that sexual relations among youth and adolescents have changed . \n the magnitude of social mobilization with respect to this so - called problem is intimately connected with changes in the social conceptions of age and gender . \n as already mentioned , these changes have produced social expectations linked to an adequate youth trajectory , which is translated in terms of greater levels of education and postponed reproduction [ 1 , 12 ] . \n another issue elucidated by gravad survey is that teen pregnancy is not the consequence of promiscuous sexual activities , as common sense beliefs currently state . \n it is often ignored that amidst the poorer social segments motherhood is seen as a sign of social status , given the lack of academic or professional perspectives . \n differently , other sociocultural horizons among middle class youth give motherhood the status of an experience to be lived in later moments of live , when one 's professional and financial lives have been consolidated [ 24 , 29 ] . the phenomenon in question \n it is concentrated among women with lower education levels who come from families with lower cultural and financial capital [ 15 , 20 , 25 ] . \n becoming a mother constitutes a social horizon aspired to by many of these young women . \n contrary to common sense beliefs that teen pregnancy is a result of poverty , early pregnancy is also present among youth in higher social strata . \n this means that it also occurs among those with access to information and contraceptive methods , with access to safe albeit clandestine abortion [ 26 , 27 ] and with real possibilities of fulfilling life projects in which parenting has the status of something to be experienced at a later moment of life .", "role": "user" }, { "content": "this paper brings a synthesis of some of the main results provided by gravad survey ( teenage pregnancy : multicentric study about youth , sexuality and reproduction in brazil ) . \n gravad is a study about sexual and reproductive behavior among brazilian youth that interviewed 4,634 individuals in a population survey with a random sample . \n women and men between 18 and 24 years old were interviewed in three capitals \n porto alegre , rio de janeiro and salvador . \n teen pregnancy is not the consequence of promiscuous sexual activities , as popular beliefs currently state . \n it is often ignored that amidst the poorer social segments parenthood is seen as a sign of social status , given the lack of professional perspectives . among the middle class , \n other sociocultural horizons give parenthood the status of an experience to be lived in later moments of live , when one 's professional and financial lives have been consolidated .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the prevalence of intracranial unruptured aneurysm has been reported as 3.2% in the general population21 ) . \n although previously reported annual rupture rates are low22 ) , preventive treatments are widely accepted and performed . when coil embolization was approved as a treatment for intracranial aneurysm surgical treatment was the only option3 ) . over the next 2 decades various coil embolization techniques have been applied worldwide . \n therefore it is less influenced by a patient 's general medical condition and can easily meet the patient 's preference . \n a higher thromboembolic complication rate has been described but most thromobembolic events are asymptomatic and does not usually influence cognitive functions101218 ) . \n although procedural rupture ( pr ) accounts for a small percentage ( 0.54% ) of complications during coil embolization but can be disastrous with severe morbidity or mortality ( 2040%)217 ) . \n however , conclusions are hindered by the relatively small study populations and heterogeneous nature of the patients with ruptured and unruptured intracranial aneurysms21723 ) . \n pr during coil embolization for aneurysms with subarachnoid hemorrhage ( sah ) can not demonstrate the outcomes of procedural rupture due to the renowned poor outcome of the preexisting sah15 ) . \n we reviewed more than 1000 consecutive cases of coil embolizations for unruptured intracranial aneurysms performed at our institution over the past 12 years to identify the incidence and outcomes of pr and to explore potential risk factors of pr . \n we retrospectively reviewed all unruptured saccular aneurysm cases treated with coil embolization in a tertiary academic hospital between january 2001and may 2013 . \n data collected from medical records and imaging findings included age , sex , size , and location of aneurysm , type of endovascular procedure , type of rupture , postprocedural management , and clinical status of pr patients until the latest follow - up . \n demographic characteristics were documented and video file records were reviewed to identify pr during procedure and/or postoperative imaging . \n the aneurysm size was documented from the operative notes during the coil embolization and/or procedural imaging . \n aneurysm locations were categorized as anterior cerebral artery , middle cerebral artery , distal internal cerebral artery , posterior circulation , and multiple according to their location . \n pr was defined as angiographic visualization of the extravascular leakage of contrast medium or identifiable sah on post procedural computed tomography ( ct ) and/or magnetic resonance imaging ( mri ) . in our strategy , we performed immediate postprocedural ct and mri according to physician 's or patient 's preference or any neurologic deterioration . \n pr was investigated with respect to timing , location of rupture , and clinical outcomes . \n pr was categorized as procedural parent artery rupture ( ppar ) and procedural aneurysmal rupture ( par ) according to rupture site ( fig . \n , hemorrhage was assumed to be par . out of concern that ppar might result from a mechanism other than par \n all aneurysm coiling procedures were performed using a commercially available biplane angiographic unit equipped with an image - intensifier . \n rotational angiography , followed by three - dimensional image reconstruction by volume rendering , was performed before embolization in all patients . \n final angiograms in the frontal and lateral projections and working projections were acquired at the end of each procedure in order to rule out distal branch occlusions . \n all patients were treated while under general anesthesia and systemic heparinization was administered after placement of the femoral introducer sheath . in line with our embolization protocol \n , 3000 iu/60 kg of heparin was administered as an intravenous bolus injection , followed by an additional 1000 iu with routine activated coagulation and thromboplastin time check . \n after embolization , heparin injection was continued for 24 hours in patients treated with stent assisted coil embolization and for selected cases without stent assisted coil embolization . \n all aneurysm embolizations were performed using commercially available detachable coils including hydrogel - coated coils , guglielmi detachable coils , or other bare platinum coils . \n balloon , stent , or catheter assisted coil embolization has been chosen for coil embolization of aneurysms with an unfavorable configuration . \n procedure related factors such as embolization methods ( conventional or adjunctive device , such as balloon or stent assisted technique ) were also included . \n univariate and multivariate statistical analysis was performed to explore the potential risk factors of par . \n all aneurysm coiling procedures were performed using a commercially available biplane angiographic unit equipped with an image - intensifier . \n rotational angiography , followed by three - dimensional image reconstruction by volume rendering , was performed before embolization in all patients . \n final angiograms in the frontal and lateral projections and working projections were acquired at the end of each procedure in order to rule out distal branch occlusions . \n all patients were treated while under general anesthesia and systemic heparinization was administered after placement of the femoral introducer sheath . in line with our embolization protocol \n , 3000 iu/60 kg of heparin was administered as an intravenous bolus injection , followed by an additional 1000 iu with routine activated coagulation and thromboplastin time check . \n after embolization , heparin injection was continued for 24 hours in patients treated with stent assisted coil embolization and for selected cases without stent assisted coil embolization . \n all aneurysm embolizations were performed using commercially available detachable coils including hydrogel - coated coils , guglielmi detachable coils , or other bare platinum coils . \n balloon , stent , or catheter assisted coil embolization has been chosen for coil embolization of aneurysms with an unfavorable configuration . \n procedure related factors such as embolization methods ( conventional or adjunctive device , such as balloon or stent assisted technique ) were also included . \n univariate and multivariate statistical analysis was performed to explore the potential risk factors of par . \n among 1086/1038 saccular aneurysm / patients coil embolization , 34 ( 3.2% ) cases were retreated . \n baseline characteristics of the patients are described in table 1 . all data for each variable of interest \n rupture points of these patients were parent artery ( n=2 ) , aneurysm itself ( n=9 ) , and unknown rupture site ( n=1 ) . \n eleven prs were identified during coil embolization and one pr was identified on a post - procedural ct . \n 2 ) . nine aneurysm ruptures occurred during filling stage after frame coil insertion . among 10 cases of aneurysm rupture , eight occurred in the aneurysm dome area , one occurred in the aneurysm neck , and one was unknown ( table 2 ) . \n protamine sulfate was applied in the patients with aneurysm neck rupture because of procedural difficulties during additional coil insertion in the rupture point . \n postprocedural ct of the patient with aneurysm neck rupture showed extensive subarachnoid hemorrhage ( sah ) , intracerebral hemorrhage ( ich ) and intraventricular hemorrhage ( ivh ) . except this patient , \n other parent artery rupture showed prolonged contrast leakage despite of protamine sulfate and proximal balloon occlusion . \n two patients with parent artery rupture and one with aneurysm neck rupture received subsequent craniectomy with hematoma removal but showed poor outcome at latest follow up . \n after 3 , 19 , and 39 months of follow - up , mrs of these patients were 5 , 4 , and 4 , respectively . among 8 patients who experienced aneurysm dome rupture during filling stage and one patient with unknown rupture site , \n 1 patient received a external ventricular drainage temporarily and three patients received serial spinal tapping for the coexisting hydrocephalus . \n after 34 months ( median , range 459 ) of follow - up , morbidity or mortality were absent ( mrs=0 ) , except for one patient ( mrs=2 ) complicated by subsequent ischemic insult on the parent artery . among 10 patients with aneurysm rupture , six were anterior cerebral artery aneurysms and the location of aneurysm was the only associated factor of par ( anterior cerebral artery vs. others=6/184 vs. 4/854 , p=0.003 fisher - exact test ) . \n other variables such as age ( < 65 vs. 65 , p=0.500 ) , sex ( p=0.382 ) , aneurysm size ( < 10 mm vs. 10 mm , p=0.397 ) or usage of stent or not ( p=0.572 ) did not show statistically significant difference . \n the aca location was the only associated factor with procedural aneurysm rupture ( p<0.001 ; odds ratio , 13.333 ; 95% ci 3.12555.556 ) . \n aneurysm size did not show statistical significance in uni- and multivariate analyses in this study ( table 3 ) . \n fortunately , all of these cases and unknown site leakage cases showed favorable outcomes with independency at the latest follow up . \n flow arrest identified by contrast stasis at the distal portion ( dome area ) of aneurysm from coil material is frequently identified during coil embolization18 ) . \n hwang et al.8 ) reported that 73.1% of contrast stasis was located at the dome area . \n thrombus formation can be facilitated by low flow rate and foreign material at the dome portion of aneurysm even after frame coil insertion16 ) . \n therefore , extravasation might be minimal in pr at the dome area during the filling stage . \n however the neck portion of aneurysm can be considerably influenced by a parent artery flow rather than the dome portion by coil material , especially given a loosely packed aneurysm status11 ) . \n technical difficulty of additional coil insertion conducted in the neck area may also be a reason of prolonged blood leakage . \n when pr occurs in a loosely packed neck position these factors may cause huge extravasation of blood and poor clinical outcomes . \n but our results show that parent artery injury can actually occur and seems to trigger more disastrous complications . \n aneurysmal ruptures can be corrected in selected cases by an endovascular technique , such as additional coil insertion or temporary flow arrest using balloon1723 ) . \n distal parent artery perforation may be difficult to control through the endovascular technique in our experience and could result in poor clinical outcomes . \n therefore excessive precaution is essential when approaching the distal angulated portion , especially when using adjunctive device . \n development of a safer stent delivery system seems necessary in manipulating the distal vascular territory . \n interestingly , 8 of 12 pr , and 6 of 10 par events occurred in aca . \n this may reflect the difficult anatomical characteristics for endovascular coil embolization of the aca aneurysm , such as unfavorable dome neck ratio and acute ica - a1 angle5 ) . \n previous studies on coil embolization for aca aneurysm also demonstrated high risk of rupture20 ) . \n additionally the surgical manipulation of this area remains challenging due to the fact of multiple vital perforating arteries and high risk of premature rupture7 ) , which makes it difficult to say if substitutional surgical method can be preferred . \n also aca located aneurysm had high risk of rupture even small sized aneurysm if left untreated9141922 ) . to the best of our knowledge , there is no absolute guideline in treating aca aneurysms . \n an interdisciplinary approach to aca aneurysm is needed and a more careful procedure is required . further prospective controlled studies comparing the outcomes between treatment modality and risk factors in treating aca aneurysms could increase better understanding and may help determine appropriate treatment strategy . \n an experienced operator can see and predict the motion of microcatheters , microwires , and coil material . \n detached coil materials could block the operator 's view and the additional coil could be influenced by previously inserted coils , restricting prediction of the location and direction mode of action of additional coil which can be a cause of par . \n our study showed relatively favorable outcomes when comparing with recently published studies focusing on pr1323 ) . \n we only included patients with unruptured aneurysms excluding ruptured aneurysms based on the hypothesis that a ruptured aneurysm could be anunfavorable candidate to elucidate the outcomes of pr . since sah itself can lead to morbidity in 25% of the patients15 ) . \n not all of the patients received immediate postprocedural ct or mri , which means that the patients with silent or mild symptomatic pr not identified during procedure could have been missed . \n other factors , such as vascular tortuosity , connective tissue disease and other medical conditions that possibly influence the risk of rupture and clinical outcomes were not considered in this study . \n ppar and rupture at the neck portion of the aneurysm seemed to result in poor clinical outcome , nevertheless pars during the filling stage seems to have a relatively benign course . \n further studies regarding detailed risk factors and outcomes of endovascular treatment and clipping is required to improve our understanding and to set balanced interdisciplinary treatment strategies .", "role": "user" }, { "content": "objectivethe objectives of this study was to determine the incidence and outcomes of procedural rupture ( pr ) during coil embolization of unruptured intracranial aneurysm ( uia ) and to explore potential risk factors.methodsthis retrospective study evaluated 1038 patients treated with coil embolization between january 2001 and may 2013 in a single tertiary medical institute . \n pr was defined as evidence of rupture during coil embolization or post procedural imaging . \n the patient 's medical records were reviewed including procedure description , image findings and clinical outcomes.resultstwelve of 1038 ( 1.1% ) patients showed pr . \n points and time of rupture were parent artery rupture during stent delivery ( n=2 ) , aneurysm rupture during filling stage ( n=9 ) and unknown ( n=1 ) . \n two parent artery rupture and one aneurysm neck rupture showed poor clinical outcomes [ modified rankin scale ( mrs ) > 2 ] nine aneurysm dome rupture cases showed favorable outcomes ( mrs 2 ) . \n location ( anterior cerebral artery ) of aneurysm was associated with high procedural rupture rate ( p<0.05).conclusionthe clinical course of a patientwith procedural aneurysm rupture during filling stage seemed benign . \n parent artery and aneurysm neck rupture seemed relatively urgent , serious and life threatening . \n although the permanent morbidity rate was low , clinicians should pay attention to prevent pr , especially when confronting the anterior cerebral artery aneurysm .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: health - care associated infections ( hcais ) are one among the major health related hazards and account for a major global disease burden . they pose a health threat toward patients and health care workers . \n these have a global impact and pose a disease burden to millions of people worldwide . \n these promote resistance to antibiotics , complicate the delivery of patient care and also lead to an additional monetary expenditure to the and also lead to additional monetary expenditure to the patients with underlying pathology . \n hospital - acquired infections account for more than 1.4 million people worldwide.1 health - care delivery exposes the hospital workers toward infections such as tuberculosis , needle stick injuries , and hiv . \n the practice of hand hygiene ( hh ) has long been considered as a gold standard and has passed the test of time as an infection control measure successfully preventing hcais . \n the single most important preventive measure against hcai is to practice proper hh technique by either washing the hands with soap or with a disinfectant , but this practice is usually given minimal priority by the hospital staff.2 in general , health care workers are not carriers , but vectors . \n centers for disease control and prevention defines the clinical contact surfaces as the surfaces that can be contaminated directly from patient materials either by direct spray or the generated splatter during dental procedures or with contact of dental health care provider s gloved hands . \n examples of such surfaces include light and door handles , switches , dental x - ray equipment dental chair , pens , telephone , door knobs , etc . \n contamination of these surfaces is frequently reported , but the risk of infection for patients and the dental staff is not yet , determined with high accuracy . \n dental healthcare workers skin could transiently carry potential pathogens coming from the environment and the use of gloves does not automatically eliminate the need for hand washing , because gloves can have unapparent defects or can be torn during use , due to sharp equipment , widespread in dental healthcare . \n in addition , the opportunistic pathogens may multiply at a very rapid rate in a moist environment that is usually present underneath the gloves . \n an aspect associated with microbial contamination of gloved hands is the use of finger rings . \n indeed , rings can make glove donning difficult with consequent damage and loss of integrity . \n a large number of studies are there establishing the association of hcais with improper hh , but only a handful of studies have demonstrated that the skin underneath finger rings is more enormously colonized than other comparable areas in the finger skin . however , whether wearing of the finger rings increases the likelihood of pathogen transfer is still unknown.3 a significance level of microbial contamination on the skin under ringed finger is also least examined . \n hence , the present study was done to investigate the occurrence of potential pathogenic bacteria and fungi on skin of gloved hands of dental health care workers who wore finger rings with those who did not wore finger rings under gloves . \n the sample consisted of 40 dentists working in the department of oral medicine diagnosis and radiology , career post graduate institute of dental sciences ( cpgids ) , lucknow . \n this study was conducted in compliance with the protocol ; written ethical approval was taken from the head of department of oral medicine and also from the principal of cpgids , lucknow . \n skin samples were collected in the middle of the working day from the dominant hand soon after glove removal and professional hand cleaning . \n sterile swabs previously moistened with tubes containing 1 ml of sterile saline solution ( 0.9% w / v nacl ) were gently rubbed over the complete ventral surface of the hand and around the periphery of finger ring sample . \n swabs were immediately transferred onto the plates containing mannitol salt agar and sabouraud dextrose agar plates were incubated aerobically at 28c and 37c for 48 h ( figures 1 and 2 ) . isolates recovered from cultures were preliminarily subjected to microbiological procedures and were identified using biomerieux equipment , uk . \n the laboratory procedures were made by courtesy of the department of microbiology , career medical college , lucknow . \n prevalence of potential pathogenic microorganisms with and without rings was assessed and differences were statistically analyzed . \n this study was conducted in compliance with the protocol ; written ethical approval was taken from the head of department of oral medicine and also from the principal of cpgids , lucknow . \n skin samples were collected in the middle of the working day from the dominant hand soon after glove removal and professional hand cleaning . \n sterile swabs previously moistened with tubes containing 1 ml of sterile saline solution ( 0.9% w / v nacl ) were gently rubbed over the complete ventral surface of the hand and around the periphery of finger ring sample . \n swabs were immediately transferred onto the plates containing mannitol salt agar and sabouraud dextrose agar plates were incubated aerobically at 28c and 37c for 48 h ( figures 1 and 2 ) . isolates recovered from cultures were preliminarily subjected to microbiological procedures and were identified using biomerieux equipment , uk . \n the laboratory procedures were made by courtesy of the department of microbiology , career medical college , lucknow . \n prevalence of potential pathogenic microorganisms with and without rings was assessed and differences were statistically analyzed . \n a cross - sectional study was conducted to measure and identify the microbial contamination isolated from the skin under rings and on skin without rings and to compare the results among volunteered dentists of cgpids and hospital , lucknow , india . \n all dentists were males aged between 21 and 33 years ( mean 27 years ) , equally divided into ( n = 20 ) with finger rings ( n = 20 ) without finger rings . \n all the estimated values of prevalence ratio ( pr ) were quite high , ranging between lower limit of 2.03 and the upper limit of 4.74 , but were statistically not significant at 95% of level excluding the pr value for fungi ( table 1 ) . \n occurrence of potential pathogens in skin samples from hands with and without finger rings of dentists . \n the potentially pathogenic bacteria , which were isolated were staphylococcus \n aureus , staphylococcus epidermidis , escherichia coli , enterococcus spp . , while fungi were candida albicans , aspergillus niger , and aspergillus flavus . excluding s. aureus \n which was isolated only in one non - ring wearing dentist , all these microorganisms were more frequent in ring wearing dentists ( table 2 ) . \n list of potential pathogenic bacteria and fungi isolated from skin samples of dentists hand with and without finger rings ( prevalence values between brackets ) . \n the statistical analysis was done by applying systat version 10 by cranes software , bangalore , india in the study . \n the prevalence of potentially pathogenic microorganisms with and without finger rings was assessed and differences were statistically analyzed using 2 test with yates correction for continuity . \n the pr , with 95% of confidence interval and a level of significance of 95% was selected to statistically analyze the data . \n bacteria were non - significantly more frequent in the dentist s with ringed finger ( 63% vs. 37% ; p = 0.06 ) . while fungi were significantly more frequent in the dentist s with a ringed finger ( 79% vs. 21% ; p = 0.0002 ) ( table 1 ) \n the statistical analysis was done by applying systat version 10 by cranes software , bangalore , india in the study . \n the prevalence of potentially pathogenic microorganisms with and without finger rings was assessed and differences were statistically analyzed using 2 test with yates correction for continuity . the pr , with 95% of confidence interval and a level of significance of 95% was selected to statistically analyze the data . \n bacteria were non - significantly more frequent in the dentist s with ringed finger ( 63% vs. 37% ; p = 0.06 ) . while fungi were significantly more frequent in the dentist s with a ringed finger ( 79% vs. 21% ; p = 0.0002 ) ( table 1 ) \n potentially pathogenic bacteria , which were isolated were s. aureus , e. coli , while fungi were c. albicans . excluding s. aureus which was isolated only in one non - ring wearing dentist , all these microorganisms were more frequent in ring wearing dentists . \n dentists who wore rings were nearly twice more likely to harbor potential pathogenic bacteria ( pr , 2.13 - table 1 ) and almost 5 times more likely to harbor fungi ( pr , 4.74 - table 1 ) than those dentists who did not wore finger rings . in a previous study on \n 84 nurses working in intensive care units in a rural indian those who wore rings showed more gram - positive and gram - negative bacteria than those who did not earrings , while no difference was found between nurses wearing plane wedding rings and those wearing rings with stones.4 in a sample of 20 veterinary medical students , 10 wearing plain rings , wearing rings , no difference in viable flora was detected between ring and non - ring hands.5 in a sample of 200 healthcare workers from an intensive care unit , ring wearers showed almost double prevalence of gram - negative bacteria than non - wearers , but no difference with respect of s. aureus.6 similar results have been reported from other studies conducted by hoffman et al.,7 field et al.8 in which bacterial significantly high in ringed hands compared with control hands . in an attempt to summarize these data , we could speculate that ring wearing is associable with a higher level of bacteria and fungi , including potential pathogens . \n such a high contamination level could be due to the lower effectiveness of hh in ring wearers than in non - wearers . \n in addition , the residual and relatively high level of contamination , due to inefficient hygiene , will increase during the working day , because of bacterial and fungal multiplication on the warm and moistened environment of skin beneath gloves . \n every study has some or the other kind of limitations , which need to be recognized . \n for the present study , a small sample size and all the samples from same department so some of the reported differences between dentists who wore and did not wear rings could be due to chance , which still leaves scope for further studies . \n clean care : safer care is the globally accepted slogan raised as a first line of defense in the global patient safety challenge , which is a core component of who s world alliance for patient safety launched in the academic year 2004.9,10 the results of the present study establish the association of ringed finger with increased microbial contamination . \n hence , it shows the need that a major focus must be there toward the improvement in hh to prevent hcai worldwide . \n the three recommended strategies to minimize hcais are as follows : \n generation of awareness campaigns toward prevention of hcais like the staff involved in hospital hygiene activities must be included in education and training related to the prevention of hospital - acquired infectionleadership , commitment and transparency of high standards must be practiced like the hands must be decontaminated immediately before and after every episode of direct patient contact / care . \n all wrist watches and hand jewelry must be removed at the beginning of each clinical shift beforehand decontamination begins . abrasions and cuts must be completely covered with a waterproof dressing . \n application of an alcohol - based hand rub or washing hands with a liquid soap and water to decontaminate hands between caring for different patients or between different caring activities for the same patient must be practicedhigh - level reinforcement of the proposed strategies must be examined by frequent surprise audits by the public health specialists at local / national levels . \n generation of awareness campaigns toward prevention of hcais like the staff involved in hospital hygiene activities must be included in education and training related to the prevention of hospital - acquired infection leadership , commitment and transparency of high standards must be practiced like the hands must be decontaminated immediately before and after every episode of direct patient contact / care . \n all wrist watches and hand jewelry must be removed at the beginning of each clinical shift beforehand decontamination begins . abrasions and cuts must be completely covered with a waterproof dressing . \n application of an alcohol - based hand rub or washing hands with a liquid soap and water to decontaminate hands between caring for different patients or between different caring activities for the same patient must be practiced high - level reinforcement of the proposed strategies must be examined by frequent surprise audits by the public health specialists at local / national levels . \n clean care : safer care is the globally accepted slogan raised as a first line of defense in the global patient safety challenge , which is a core component of who s world alliance for patient safety launched in the academic year 2004.9,10 the results of the present study establish the association of ringed finger with increased microbial contamination . \n hence , it shows the need that a major focus must be there toward the improvement in hh to prevent hcai worldwide . \n the three recommended strategies to minimize hcais are as follows : \n generation of awareness campaigns toward prevention of hcais like the staff involved in hospital hygiene activities must be included in education and training related to the prevention of hospital - acquired infectionleadership , commitment and transparency of high standards must be practiced like the hands must be decontaminated immediately before and after every episode of direct patient contact / care . \n all wrist watches and hand jewelry must be removed at the beginning of each clinical shift beforehand decontamination begins . \n application of an alcohol - based hand rub or washing hands with a liquid soap and water to decontaminate hands between caring for different patients or between different caring activities for the same patient must be practicedhigh - level reinforcement of the proposed strategies must be examined by frequent surprise audits by the public health specialists at local / national levels . \n generation of awareness campaigns toward prevention of hcais like the staff involved in hospital hygiene activities must be included in education and training related to the prevention of hospital - acquired infection leadership , commitment and transparency of high standards must be practiced like the hands must be decontaminated immediately before and after every episode of direct patient contact / care . all wrist watches and hand jewelry must be removed at the beginning of each clinical shift beforehand decontamination begins . \n application of an alcohol - based hand rub or washing hands with a liquid soap and water to decontaminate hands between caring for different patients or between different caring activities for the same patient must be practiced high - level reinforcement of the proposed strategies must be examined by frequent surprise audits by the public health specialists at local / national levels . \n the challenges are enormous , but so are the reward : preventing illness , saving lives , improving patient safety , and providing an overall better quality of care to millions of patients and families . \n hcai are unintended , undesirable , and intolerable , but many are preventable . it is a time that hh promotion should be made a priority for public health and health care policymakers , medical and nursing schools , chief medical , and executive officers . \n the improvement in hh is feasible , affordable , and effective in a healthcare setting with limited resources . \n the who strategy represents evidence - based , ready - to - use solutions for planning and supporting hh promotion in healthcare facilities worldwide , including developing countries . however , the adoption of such a strategy on a national scale is the need of hour for patient s safety and control of hcai s . within the limitations of the present study , \n the general conclusion is that the potential pathogens are more likely detected in the hands of dentists who wore rings . although more such evidence is required before establishing guidelines regarding the wearing of finger rings during clinical procedures , but the results of this study adds to the evidence that wearing of finger ring can be a source of microbes and warrant more studies .", "role": "user" }, { "content": "background : disease prevention is better than its cure . \n the role of healthcare worker s hand in the transmission and spread of an infectious disease to the patient is well acknowledged . \n indeed , the hands of a health care worker can easily pick potentially pathogenic bacteria and fungi from hand touch surfaces before wearing of gloves . for these microorganisms to multiply rapidly , a moist environment present underneath the gloves acts a good cultivating media . \n it is also reported that the multiplication rate also increases several folds with the duration of glove use.materials and methods : dentists 20 with rings and 20 without rings were considered . \n skin samples from the hand soon after professional hand cleaning and glove disposal were collected . \n the occurrence of potentially pathogenic fungi and bacteria were examined and investigated disposal were collected . \n the occurrence of potentially pathogenic fungi and bacteria were examined and investigated with biochemical and cultural laboratory tests.results:bacteria and fungi were significantly more frequent in dentist s hand with rings than those without rings . \n 63% versus 37% ( bacterial prevalence ) , among the isolated potentially pathogenic microorganisms were staphylococcus aureus , escherichia coli , and candida albicans.conclusion:in the present study potentially pathogenic microorganisms were more frequent in dentists who wore finger rings under gloves .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: herpes zoster or shingles , the cutaneous dermatomal eruption of reactivated varicella zoster virus ( vzv ) is a growing global public health issue , particularly in those over 50 y of age . \n vaccines have been trialled to reduce its incidence , severity and its most common and debilitating complication , post - herpetic neuralgia . \n zostavax , the most studied and only approved zoster vaccine , was demonstrated to have an efficacy of 63.9% and 37.6% and 65.7% and 66.8% for 6069 y old and 70 year old patients for prevention of herpes zoster and post - herpetic neuralgia respectively . \n injection site reactions satisfying the brighton collaboration local reaction working group level 2 of diagnostic certainty for bacterial cellulitis ( at least 3 of the following signs / symptoms : localized pain or tenderness [ pain to touch ] , erythema , induration or swelling and warmth , and reaction at the injection site . ) have been reported to occur in 0.7% to 1.2% of zostavax vaccine recipients . in this case report differentiation between a cellulitic injection site reaction and bacterial cellulitis following zostavax administration \n is reviewed in the context of other vaccines in which this clinical dilemma has been reported . \n a fit 70 y old woman sought zostavax vaccination as her husband , who had splenectomy 8 y previously for lymphoma , had severe herpes zoster complicated by post - herpetic neuralgia for 10 months . \n she reported that she had no fever but a red , painful , tender swelling of almost the entire left upper arm on the evening after injection . \n she sought care one day after vaccination from another general practitioner who diagnosed bacterial cellulitis and prescribed cephalexin 500 mg 6 hourly and recommended hospital admission if her condition worsened . \n review by the author 7 d after the vaccination resulted in the antibiotics being ceased due to lack of efficacy . \n bacterial cellulitis is a pauci bacillary syndrome , defined by the brighton collaboration local reaction working group post vaccination as \n an acute infectious and expanding inflammatory condition of the skin with level 1a of diagnostic certainty includes at least 3 of the following signs / symptoms localized pain or tenderness ( pain to touch ) , erythema , induration or swelling and warmth and reaction at the injection site and laboratory confirmation by culture . \n level 2 of diagnostic certainty at least 3 of the signs / symptoms for level 1a and reaction at the injection site and diagnosed by a qualified healthcare provider . thirty five cases of a reaction listed as cellulitis , satisfying the level 2 of diagnostic criteria , were retrieved from the vaccine adverse event reporting system ( vaers ) database as at april 2016 for zostavax , all treated with antibiotics . \n if these cases were due to bacterial cellulitis , pathogenic bacteria could be introduced during vaccine administration from contaminated needles / syringes , infected vaccinator or from contaminated skin . with contaminated diphtheria \n , tetanus toxoid and pertussis vaccine localized infection has been shown to occur from 1 to 8 d ( median 5 days ) after injection \n . however these reactions may be due to a cellulitic reaction , also satisfying the level 2 of diagnostic certainty , which resolves spontaneously without antibiotic therapy . \n this reaction forms a subset of extensive limb swelling ( els ) reported by woo et al . within 1 \n although this reaction was seen with a broad spectrum of vaccines , including varicella vaccine , the most studied of these were diphtheria , tetanus and pertussis containing vaccines with \n fever and injection pain observed most frequently on the first evening , whereas redness and swelling were observed most frequently on the second evening . an acute , febrile , \n cellulitic reaction , unresponsive to antibiotics has been reported for pneumococcal vaccines ; nelson et al . \n , 10 valent pneumococcal polysaccharide vaccine ( ppv10 ) , f/31 , onset 8 hours post vaccination , maximal 24 hours , resolved by day 5 and 23 valent pneumococcal polysaccharide ( ppv23 ) . \n m/38 , onset 4 hours post vaccination , maximal day 4 , resolved by day 17 . \n 17 children ( 9 m , 8f ) , 24138 months old , onset average 9 hours post vaccination and yousef & mannan m/5 , onset 24 hours post vaccination . \n differentiation between cellulitic reaction at the injection site and bacterial cellulitis is based on the temporal relationship between onset of the reaction and vaccination , progression of the reaction and response to antibiotic treatment . in the adverse event following zostavax administration \n reported here the reaction occurred on the day of vaccination , did not progress and was unresponsive to antibiotic therapy , thus being a cellulitic reaction at the injection site rather than cellulitis of bacterial origin . educating health care providers about this not uncommon adverse event should decrease the over - diagnosis of bacterial cellulitis and the inappropriate use of antibiotics following zostavax administration a vaccine increasingly promoted for the prevention of herpes zoster . \n elsextensive limb swellingppv1010 valent pneumococcal polysaccharide vaccineppv2323 valent pneumococcal polysaccharide vaccinevaersvaccine adverse event reporting system extensive limb swelling 10 valent pneumococcal polysaccharide vaccine 23 valent pneumococcal polysaccharide vaccine vaccine adverse event reporting system \n ", "role": "user" }, { "content": "abstracta 70 y old woman presented with a cellulitic reaction following zostavax injection . \n this reaction could be differentiated from bacterial cellulitis on the basis of the temporal relationship between vaccination and onset of the reaction , its non progression and unresponsiveness to antibiotic therapy . alerting health care providers to this type of reaction , \n also seen with pneumococcal and pertussis containing vaccines , should avoid the inappropriate use of antibiotics .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: scoliosis is often arbitrarily described as a lateral deviation of the spine larger than 10 ; however , the problem is much better described as a complicated three - dimensional deformity of the spine resulting in a lateral displacement from the normal spinal angle . \n the study aims to establish any long - term benefit in using pedicle screw - only surgery regarding efficacy as well as any development of long - term complications and if there is any difference between long - term functionality and satisfaction between patients treated with the two methods . \n patients who were operated between 2006 and 2010 and managed to follow - up for 4 years were included in the study . in total \n , there were eighty patients in the pedicle screw - only group and 75 in the hybrid instrumentation system group . \n the overall cobb 's angle ranged from 52 to 117 with a mean of 84.7. patients included in the study ranged between 11 years and 17 years . \n inclusion criteria were patients with adolescent idiopathic scoliosis , aged between 11 and 17 , who underwent the same standardized procedures and were similar in terms of operative time , bleeding , and surgical trauma . \n patients were excluded from the study if there was any underlying body disorder running in the family and if they were loss to follow - up . \n the technique used in the hybrid instrumentation group was standardized as usage of pedicle screws in the thoracolumbar area while the claw , hook , and wire instruments were utilized in the rest of the spine . in surgery involving pedicle screws only \n , the screws were applied using a free hand technique on the concave areas of all segments and the convex side of the cranial and caudal ends . \n correction of cobb 's angle , percentage correction , correction loss during follow - up were physical variables measured in assessing the effectiveness of both systems while the srs-30 questionnaire was used for measuring improvement of the quality of life and satisfaction postsurgery . \n statistical analyses were performed using spss statistics software version 20.0 [ ibm corp . released 2011 . \n a paired t - test was utilized to evaluate the difference between each physical variable pre- and post - test while the srs-30 questionnaire scores were tallied and compared . \n the mean percentage correction of thoracolumbar cobb 's angle in hybrid instrumentation method was found to be 59.56 5.81 . \n the mean percentage correction of the pedicle screw system was found to be 63.78 6.56 . \n the paired t - test applied to reveal significance calculated a value of p = 0.0487 , which was statistically significant . \n since the hallmark difference between the two systems is the use of pedicle screws in the thoracic spine , the percentage correction between the thoracic spines of the two groups was analyzed . \n the pedicle screw showed a thoracic correction of 61.57 4.33 . paired t - test revealed a p = 0.009 , which was statistically very significant [ table 1 ] . \n a comparison with p values between the hybrid system and pedicle screw groups percentage of correction loss at the end of follow - up was calculated which revealed that the hybrid system had a mean loss of 9% 3.16% while the pedicle system had a mean loss of 3.95% 1.4% . \n the paired t - test revealed that p = 0.0001 which was again very significant . \n the srs 30 questionnaires revealed a similar amount mental health , satisfaction of treatment and self - image scores across the follow - ups of both groups . \n in general , the higher the score is , the better the quality of life . \n although functionality was not significantly different across follow - ups between both groups ( p = 0.32 at 6 months and 0.202 at 4 years ) , the patients showed a definite increase in functionality after 4 years . \n the hybrid system scored a 2.45 1.23 average on the pain scale at 6 months follow - up . \n the pedicle system group scored an average of 2.79 1.03 ; the calculated t - test showed a p = 0.003 which was significantly different . both groups scored similarly for pain relief at the 4 year of follow - up . \n there was no development of any significant morbidity postsurgery till the end of the 4 year follow - up [ table 2 ] . \n the comparison with p values between hybrid system and pedicle screw groups regarding pain during the 6 months follow - up and restriction in function between the 4 years of follow - up \n adolescent idiopathic scoliosis has the highest incidence among idiopathic scoliosis as well as scoliosis overall . \n it is understood that a deviation of a cobb 's angle of 50 will progress beyond the age of spinal maturity . \n deviations above a cobb 's angle between 60 and 100 will result in a loss of 32% total lung volume as well as a vital capacity of 45% of normal . \n curves > 110 are associated with respiratory failure , repeated pulmonary infections , and a lower life expectancy . due to this , the indication of scoliosis surgery over bracing is often described as a cobb 's angle 50. the aim of surgery is to bring the cobb angle down below 50 to prevent reprogression as well as improve the quality of life . \n scoliosis surgery has made major leaps in development since its birth in the 1800 s . \n many techniques , ranging from osteotomies and discectomies to nonsegmental rod systems and multiple hooks and wire constructs . the cotrel dubousset hook and wire construct was once considered gold standard for the surgical treatment of idiopathic scoliosis surgery . today \n , most modern instrumentation systems rely heavily on the cortel dubousset method which introduced a hook and claw system attached and tightened with a system of wires interlocking between them . \n one such method is the hybrid instrumentation system which utilizes segmental hooks and wires along with a newer generation instrument called pedicle screws . in 1995 , \n the surge in this type of surgery was preceded by reports of better stabilization and improvement of angle curvature . \n there is , however , the concern of the increase in physical demand on the spine because of the small contact area of the pedicle screw , and the risk of spinal trauma due to its location of placement in the concavity of the spine . \n mixed reports of success of the pedicle screw - only method and the limited literature on long - term follow - up cause there to obscure in the advantage of pedicle screws over hybrid systems . \n we observed a significantly better improvement in cobb 's angle and percentage in the pedicle screw - only group . \n we believe that this is due to the screw 's ability to grip the spine more firmly and deeply , resulting in the surgeon being able to offer a more significant correction . \n this may be because hooks have limited mobilization capability which results in less effective arthodesis distribution and maturation postcorrection . \n we encountered a significantly higher degree of thoracic correction postsurgery which corresponds with current literature which suggests that pedicle screws may just allow for the greatest degree of improvement in thoracic scoliosis than any other type of instrumentation . in the article published by suk et al . \n , it was reported that pedicle screw - only surgery produced a 79.6% of thoracic curves and an 80.5% correction of lumbar curves and a study by min et al . revealed a mean correction in cobb angle to be 68% when using pedicle screws only . meanwhile , hybrid systems used in a study by liu et al . \n combination studies performed by kim et al . in 2004 compared the results of pedicle screws with hybrid systems where they also reported an advantage for pedicle screws . in their study pedicle \n , screws were found to have better correction ratios and fewer fusion levels , which ultimately meant fewer complications and lower correction loss . \n a study done by arlet et al . reported similar correction angles in both pedicle screws and hybrid instrumentation and the results proved to be statistically insignificant . \n . it may well be that the advantage of pedicle screws lies in advanced spinal deviations with high cobb angles and axial vertebral rotations . \n the dangers suggested by literature for pedicle screw usage usually range from spinal ischemia due to over correction to tracheoesophageal erosions , vocal cord paresis , pneumonias , and ileus . \n however , these complications have been found to be more associated with the malpositioning or loosening of screws postsurgery rather than their presence itself . \n in fact , minimal malpositioning of the screw has found to be of little risk if the screw has an appropriate length and the stabilization of the spine is not affected due to the multisegmental nature of the arthrodesis . \n all in all , although complications such as pedicle violations are possible , their occurrence has not been widely recorded . \n the end goal of scoliosis surgery can simply be said to improve patient 's quality of life . \n the score of which has been divided into three parts by the scoliosis research society , they are patient cosmesis , functionality , and complications . \n since the most common symptom in spinal complications is pain , the srs-30 questionnaire addresses complications through scoring it . in our study \n , it was seen that postoperative pain on the 6 month of follow - up was significantly less in the pedicle screw group despite there being no significant difference in functionality . \n perhaps this is because of the greater and more equal pressure distribution of the traction applied on the vertebra owing to the greater number of vertebra involved in the pedicle system . \n the fact that there may be fewer fusion levels in our pedicle screw procedures may also result in this observation . \n however , we did not record such data as part of our study , so it is difficult to say if this really is the case . \n cosmesis can be measured along the terms of satisfaction with treatment and improvement in self - image and mental health . in our study , despite the statistical difference in spinal correction , there was no significant difference in measures of cosmesis . \n kim et al . concluded in a study that apical vertebra translation ( avt ) were better with pedicle screw ( ps ) than hybrid system ( hs ) . \n found similar results regarding global coronal and sagittal balance , however , axial vertebral derotation was better with screw while avt was better corrected with hs . in addition , there was no significant difference between postoperative thoracic kyphosis and lumbar lordosis in the two groups . \n in two independent studies that conservative management in ais using brace may be efficacious in cobb 's angle > 50. these studies utilized spinal braces for over 4 years in patients unwilling for surgical intervention . \n considerable reduction in cobb 's angle was observed in 71% and 62% of the patients , respectively . \n these results although based on small sample population may challenge the indication of surgical intervention suggested by srs . \n with the limited date about spinal surgeries present in pakistan , it is important to analyze the benefits of traumatic surgeries like scoliosis surgeries to fully appreciate if their reported benefits are indeed reproduced in setups available here . \n we saw that the new pedicle screw - only surgical method was superior both in terms of total spinal correction as well as loss of correction over time . \n our study seems to suggest that pedicle screw surgery may also shorten the period of postoperative pain and enhance rehabilitation and is also associated with much less degree of complication as was suggested in global literature . \n there is the matter of increased cost of pedicle screws over other methods of spinal correction such as hybrid systems . for this matter \n , it may be better to save pedicle screw - only methods for a higher degree of scoliosis which may shorten the life of the patient to fully realize the benefit of such a procedure . \n \n ", "role": "user" }, { "content": "introduction : adolescent idiopathic scoliosis is the most common type of scoliosis . a cobb angle of 50 will progress beyond the age of spinal maturity . \n surgery over bracing is advised at a cobb angle above or equal to 50. the aim of surgery is to bring the cobb angle down below 50 to prevent reprogression as well as improve the quality of life . \n the objective of the study is to analyze the efficacy and significance in lifestyle improvement of pedicle screw - only fixation system versus the more common hybrid instrumentation system used for the surgical treatment of adolescent idiopathic scoliosis.materials and methods : a prospective cohort study was conducted involving two groups of patients were included in the study . \n one group was operated with pedicle screw - only method while the other with hybrid instrumentation system . \n the pre- and post - operative cobb 's angles were taken across a follow - up of 4 years . \n an srs-30 questionnaire was given in a yearly follow - up to assess the lifestyle improvement of the patient.results:pedicle screw - only method was significantly more effective in reducing cobb 's angle ( p = 0.0487 ) . \n it was showed less loss of correction ( p = 0.009 ) pedicle screw - only surgery was also better at reducing thoracic curves ( p = 0.001 ) . \n there seemed a better recovery time with pedicle screw surgery ( p = 0.003).conclusion : pedicle screws are more effective and durable than hybrid systems at when treating adolescent idiopathic scoliosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: in developing embryos and during wound healing , immature capillaries are regularly removed by spatially and temporally controlled mechanisms that have evolved to match blood supply to tissue oxygen demand . \n similarly , in adult tissues , balanced angiogenesis and capillary regression ( figure 1 ) maintain the appropriate relationship between capillary density and oxygen requirements . a major stimulus for capillary regression \n blood flow produces mechanical shear forces at the apical surface of endothelial cells , facing the vessel lumen , that elicit powerful survival signals . \n laminar shear activates growth factor independent phosphorylation of the pro - survival signaling kinase akt and is one of the strongest inhibitors of endothelial cell apoptosis . \n shear stimulates pro - angiogenic nitric oxide as well as vascular endothelial growth factor ( vegf ) and vegfr2 expression in capillary endothelial cells , and activates nadph oxidase - dependent physiological signals that are disturbed by cessation of flow . when shear forces cease , as in peritubular capillaries when glomerular perfusion fails , execution of endothelial cell apoptosis programs , in part through activation of the fas - fasl signaling pathway , loss of appropriate signals from the extracellular matrix , and supporting pericytes as well as macrophage - mediated processes remove the unperfused capillaries . \n the mechanisms that lead to capillary regression have been studied in detail in the wound - healing response . however , in the kidney , peritubular capillary regression , when flow in the postglomerular capillary system fails , has received little attention . \n direct injury of peritubular capillaries by inflammatory mechanisms also leads to capillary rarefaction in humans , particularly in the setting of transplantation . \n the peritubular capillary endothelium is the main target for chronic antibody - mediated rejection , resulting in microvascular rarefaction and chronic progressive fibrosis . \n antigen - mediated endothelial injury in this setting is complement dependent , and results in activation of endothelial cells , which become pro - thrombotic , facilitate platelet and leucocyte adhesion , and undergo complex intracellular mechanisms that can lead to apoptosis . \n peritubular capillary regression and interstitial fibrosis are also observed in response to direct tubular epithelial cell injury . \n for instance , chronic ureteral obstruction results in tubular atrophy , tubulointerstitial fibrosis , and peritubular capillary rarefaction , although glomerular perfusion is reduced only late in the disease . in infants with the congenital nephrotic syndrome of the finnish type \n , the primary lesion in podocytes leads to massive proteinuria and is associated with renal tubular toxicity , progressive peritubular capillary rarefaction , and interstitial fibrosis . \n proximal tubule epithelial cells in vitro produce inflammatory chemokines when exposed to plasma proteins , and excess protein in the glomerular filtrate is associated with the production of inflammatory mediators including monocyte chemoattractant protein-1 by proximal tubule epithelial cells . finally , \n direct , specific sub - lethal injury of proximal tubule epithelial cells with genetically targeted diphtheria toxin is sufficient to elicit a strong peritubular inflammatory response with secondary interstitial fibrosis , peritubular capillary dropout , and glomerulosclerosis . as expression of inflammatory mediators by tubule epithelial cells in this model precedes the interstitial inflammatory and fibrosis responses , it is evident that primary tubular epithelial cell injury can lead to capillary regression and tubulointerstitial fibrosis . \n however , it also needs to be recognized that inflammatory responses that involve monocyte chemoattractant protein-1-mediated monocyte \n macrophage recruitment are generally associated with an increase in tissue perfusion and collateral blood vessel formation . \n it is not clear why inflammatory cells in the renal interstitium do not evoke a similar angiogenic response . \n the response to continuous or repeated proximal tubule injury includes a substantial expansion of the number of interstitial myofibroblasts , which in turn lay down the peritubular fibrotic matrix . \n some of these cells arise from the tubular epithelium itself through the process of epithelial to mesenchymal transition ; some are marrow derived , and even endothelial to mesenchymal transition has been reported . \n however , there now is strong evidence that myofibroblast accumulation in the renal interstitium during renal fibrosis largely represents the mobilization of vascular pericytes . \n these cells normally surround peritubular microvessels , but in response to tubular injury , they detach and migrate into the interstitium where they dedifferentiate and proliferate . \n it has been postulated that the loss of pericytes in association with proteolytic remodeling of capillary basement membrane may destabilize peritubular capillaries and contribute to microvascular regression . \n that rarefaction of the renal microcirculation is associated with tissue hypoxia has been shown indirectly using nuclear hypoxia - inducible factor-1 ( hif-1 ) as a marker , or more directly by demonstrating increased binding of pimonidazole , a widely used maker of hypoxic tissues . in rats , hypoxia and increased hif-1 accumulation in areas of peritubular capillary rarefaction has been described in the progressive anti - thy1.1 and the remnant kidney model . in mice , \n folic acid nephropathy is associated with hypoxia without increase in hif-1 abundance , whereas in progressive adriamycin - induced renal injury , an increase of active , nuclear hif-1 is observed in renal tubular and interstitial inflammatory cells . in aging rats , \n similarly , in human patients , increased hif-1 abundance in renal tubular epithelial cells has been described in progressive immunoglobulin a nephrophathy and in progressive proteinuric glomerular diseases . \n hif-1 is a dimeric transcription factor consisting of hif-1/hif-1. the hif-1 dimer activates a number of hypoxia - inducible genes . under normoxic conditions , \n hydroxylation of hif-1 by oxygen - sensitive prolyl hydroxylases enhances hif-1 binding to the von hippel - lindau gene product , targeting hif-1 for proteasomal destruction . \n prolyl hydroxylase activity is reduced in hypoxic cells , leading to hif-1 stabilization and hif-1 activation . \n the hif-1-induced genes include erythropoietin , vegf , placenta - derived growth factor , angiopoietins 1 and 2 , as well as platelet - derived growth factor-. it is therefore reasonable to expect that hypoxia , via hif-1 activation , would induce vegf expression when renal perfusion is reduced by microvascular rarefaction , and that increased vegf expression would stimulate new blood vessel ingrowth from still functioning vessels . \n however , although hypoxia and hif-1 activation are observed , there is essentially no angiogenic response in chronic renal fibrosis . \n renal tubular epithelial cells express vegf under basal conditions , with a gradient of expression that is lowest in proximal tubule epithelium and highest in medullary collecting duct cells . \n hypoxia strongly induces vegf expression in cultured proximal tubule epithelial cells and in human renal tubular epithelial cells in vivo . \n however , although microvascular rarefaction may induce hypoxia and activate hif-1 , direct proximal tubule injury with folic acid in mice is associated with increased von hippel - lindau gene expression , reduced hif-1 action , and reduced vegf expression . also , despite induction of hif-1 in the remnant kidney model and in adriamycin - induced chronic renal disease in mice , proximal tubule epithelial cell vegfa expression is reduced . \n similarly , in human kidney with tubulointerstitial fibrosis , vegf expression is observed in the interstitium but not in atrophic tubular epithelial cells . \n thus , although hypoxia is observed in the tubulointerstitial compartment of kidneys , in which the peritubular microvasculature has regressed , atrophic tubular epithelial cells no longer express vegf . \n inadequate vegf synthesis by renal tubular epithelial cells therefore seems to be a component of the poor angiogenic response in renal fibrosis . transforming growth factor - beta 1 ( tgf-1 ) \n , a major pro - fibrotic cytokine in progressive renal fibrosis , can also stimulate angiogenesis indirectly by inducing vegfa expresssion and by acting synergistically in the hypoxia response . in kidney fibroblasts \n , hypoxia stimulates tgf-1 gene expression , and conversely , in normoxic mesangial cells , tgf-1 directly induces hif-1 and hif-2 protein expression . \n furthermore , hif-1 is stabilized by tgf-1 , and hypoxia and tgf-1 synergistically induce vegfa expression . in endothelial cells , \n hif-1 interacts with smad3 to induce vegf and endoglin expression , and hypoxia induces tgf-1 gene expression in endothelial cells through hif-1. if tgf-1 only promoted angiogenesis , synergy between hif-1 and tgf-1 could serve to ameliorate capillary rarefaction in progressive renal fibrosis . \n however , the endothelial cell response to tgf-1 is complex and can also result in apoptosis and capillary pruning . in endothelial cells , two distinct signaling pathways \n the ubiquitous trii / alk5 pathway leads to smad2/3 phosphorylation , inhibition of endothelial cell proliferation , and activation of apoptosis . \n by contrast , activation of the endoglin / trii / alk1 pathway leads to smads1/5/8 phosphorylation , enhancing endothelial cell proliferation and survival . through dual effects on endothelial cells and by regulating pericyte recruitment , tgf-1 controls blood vessel pattern and stability . \n as the tgf-1 is produced in abundance in the renal fibrosis response to injury , and as tgf-1 acting via alk5/smad3 promotes capillary regression and endothelial cell apoptosis , it seems plausible that capillary regression reflects the anti - proliferative , anti - survival tgf-1 action in endothelial cells . which of the tgf-1 pathways is activated in peritubular capillary endothelial cells during renal fibrosis and capillary regression is as yet unclear . \n mechanisms that lead to new blood vessel formation have received massive attention since folkman first suggested that tumor growth can be limited when angiogenesis is inhibited . \n angiogenesis is the formation of new blood vessels by sprouting and elongation from existing vessels . \n central to the angiogenic process is the rapid activation of hypoxia - inducible factors hifs in tissues in response to decreased oxygen levels , leading to the production of angiogenic growth factors and inhibition of tgf-1 signaling in endothelial cells . \n angiogenic sprouts then form in the direction of the hypoxic stimulus and a gradient of vegf and other angiogenic growth factors . sprouting and elongation of the new vessel \n endothelial cells at the tip of the angiogenic sprout , responding to growth factor gradients , determine the direction and pattern of new blood vessel growth . \n elongation of the new vessel depends on proliferation of endothelial cells in the stalk of the developing vessel . in the absence of controlled endothelial cell proliferation \n , a normal vasculature can not be established , and pathological angiogenesis can not proceed . \n a complex array of growth factors and their intracellular signaling systems regulate proliferation of stalk endothelial cells , including vegfs , fibroblast growth factors , and the angiopoietins . \n the tgf- family of proteins are involved in vessel stabilization and the establishment of perivascular cells . \n the regulation of endothelial cell proliferation during sprouting angiogenesis depends on the activity of the intracellular pi3k / akt / pten axis . \n akt is a ser / thr kinase that promotes cell survival , proliferation , migration , and angiogenesis by phosphorylating a number of downstream proteins . \n constitutively , active akt induces pathological angiogenesis , and fetal vascularization is impaired in akt - deficient mice . \n akt is phosphorylated on t308 by phosphoinositide - dependent kinase-1 and on s473 by the mtor complex 2 . for phosphorylation to occur \n , akt must be recruited to the plasma membrane where it and phosphoinositide - dependent kinase-1 bind phosphatidylinositol ( 3,4,5 ) trisphosphate . in turn , phosphatidylinositol ( 3,4,5 ) trisphosphate is generated by phosphatidylinositol 3-kinase - mediated phosphorylation of phosphatidylinositol 4,5-bisphosphate in response to activation of receptor tyrosine kinases that include vegfr2 and fibroblast growth factor receptors . \n activation of akt is opposed by the phosphatase and tensin homolog deleted on chromosome 10 ( pten ) , which dephosphorylates phosphatidylinositol ( 3,4,5 ) trisphosphate . \n . deletion of pten causes hyperproliferation of endothelial cells and disordered angiogenesis in mice , and pten activation inhibits angiogenesis , favoring the establishment of a stable , differentiated endothelium , or , if excessive , endothelial cell apoptosis . which of these intracellular mechanisms control capillary endothelial cell sprouting and proliferation during progressive renal fibrosis has not been critically explored so far . \n in the embryo , the first blood vessels form through the process of vasculogenesis , which refers to the homotypic association of hemagioblast cells producing blood islands that then coalesce to form the dorsal aorta and the early cardiac tube . similarly , in the kidney , the glomerular microvasculature initially develops through the in situ assembly of angioblasts into precapillary cords devoid of vascular lumens . \n migration of angioblasts into the capillary cleft of the developing nephron depends on the elaboration of vegf by immature podocytes and is guided by neuropilin , a semaphorin iii receptor that binds vegf , and by podocyte - derived ephrin - b2 . \n the typical sprouting angiogenesis observed in ischemic tissues or in the hypoxic tumor environment is not observed in renal glomeruli . \n instead , the increase in glomerular size observed in diabetic nephropathy and in response to other stimuli that result in an increase in glomerular capillary loops proceeds through intussusceptive growth . \n intussusceptive angiogenesis is defined as the splitting of existing capillaries , which is initiated by the formation of transcapillary cellular pillars . \n intussusceptive glomerular capillary repair is observed in the rat model of anti - thy1.1 glomerululonephritis . \n proliferating glomerular endothelial cells tend to remain confined within the existing glomerular capillary basement membrane , and angiogenic sprouts do not appear to penetrate the mesangium . \n finally , although podocytes continually produce vastly more vegf than other differentiated cells in vivo , podocyte - derived vegf does not serve as a stimulus for sprouting angiogenesis in glomeruli , but instead is required for the formation and maintenance of a properly differentiated , fenestrated endothelium . \n although glomeruli usually are not hypoxic , progressive sclerosis with obliteration of capillary lumens is nonetheless observed in most forms of chronic glomerulonephritis and late in diabetic nephropathy . \n in order to survive , new capillaries , whether formed by sprouting angiogenesis or splitting of existing capillaries , must form and maintain vascular lumens , as a failure of blood flow results in regression of capillaries . \n the formation of vascular lumens progresses through several steps that involve the polarization of endothelial cells through the establishment of vascular endothelial - cadherin dependent cell cell junctions , the synthesis and sorting of apical vs. basolateral proteins , organization and anchoring of apical plasma membrane - spanning proteins to cortical actin , and the consequent repulsion of adjacent apical surfaces due to the expression of anti - adhesive sialoglycoproteins , including podocalyxin and cd34 on the apical surface . in glomerular capillaries , the formation of capillary lumens , furthermore , requires the removal of redundant cells through tgf-1-dependent apoptosis . \n a critical step in the assembly of the apical endothelial cell structure during vascular lumen formation is the coupling of the cytosolic tail of sialoglycoproteins and other signaling molecules to cortical actin via erm proteins . \n erm proteins generally regulate cell - surface architecture by coupling key transmembrane proteins to cortical actin , serving both structural and signaling functions . in endothelial cells , \n moesin associates with the apical plasma membrane of endothelial cells during the development of vascular lumens , and moesin is critically required for vascular lumen formation in zebrafish . \n recently , a role for chloride intracellular channel ( clic ) proteins in the morphogenesis of endothelial cell tubes and in regulating erm proteins has been described . \n clic4 is required for hollowing of capillaries in vitro , and in endothelial cells derived from clic4-deficient mice , lumen formation is impaired . \n furthermore , chalothorn et al . found that the vascular density is reduced in clic4-deficient mice . \n although the evidence is still incomplete , the data so far suggest that phosphorylation of moesin is supported by clic proteins , and that clic4-dependent activation of moesin is required for lumen formation in endothelial cells . \n the role of adequate vascular lumen formation in the angiogenic response to renal hypoxia or collapse of vascular lumens during microvascular rarefaction in renal fibrosis has not been addressed so far . \n it has been postulated that failed angiogenesis may be central to progressive renal fibrosis , whether due to ischemic acute kidney injury , diabetic nephropathy , progressive allograft nephropathy , large - vessel renovascular disease , the nephrotic syndrome , glomerulonephritis , chronic ureteral obstruction , loss of renal mass as in the remnant kidney , or aging . \n this seemingly ubiquitous failure of a robust angiogenic response to hypoxia raises the question whether powerful anti - angiogeneic mechanisms prevent renal angiogenesis in general . \n however , a robust angiogenic response with remodeling is observed in patients with adult autosomal polycystic kidney disease , as renal cysts expand and render parts of the renal interstitium hypoxic , and also in patients with renal cell carcinoma where hif-1 is stabilized due to loss of the von hippel - lindau gene product . \n also , in the early stages of diabetic nephropathy , glomerular capillary expansion is well described , peri - glomerular angiogenic vessels have been reported , excess vegf - driven endothelial cell proliferation is observed , and anti - angiogenic therapy has shown some promise in reducing glomerular hypertrophy . \n also , therapies directed at increasing blood flow or endothelial cell proliferation and repair in chronic progressive renal fibrosis have met with some success at preserving the renal microvasculature . \n therefore , renal glomerular and peritubular microvascular endothelial cells clearly can respond to angiogenic stimuli , but these mechanisms are inhibited in progressive renal fibrosis ( figure 2 ) . \n although the process of angiogenesis and vascular growth and remodeling is extremely well studied , the endothelial cell specific mechanisms that lead to a failed angiogenesis response during renal fibrosis have received relatively little attention to date . in most tissues , an initial robust angiogenic response to acute hypoxia is followed by progressive fibrosis and vessel regression if hypoxia persists . \n hence , the fibrotic response to chronic hypoxia is not unique to kidney . indeed , that peritubular capillary loss may contribute to progressive renal fibrosis due to persistent , chronic hypoxia , was already suggested in 1975 . the fibrosis response to chronic hypoxia \n is driven , at least in part , by the hifs , which , in cooperation with tgf-1 , strongly activate remodeling and fibrosis pathways , including epithelial to mesenchymal transition and matrix production by renal tubules and interstitial myofibroblasts . \n hence , the same processes that can stimulate angiogenesis also drive the fibrosis response to hypoxia . \n we are therefore left with three major potential mechanisms that would favor fibrosis over angiogenesis in ckd ( figure 2 ) . \n first , atrophy or destruction of renal tubular epithelial cells results in reduced angiogenic mediator expression despite hif-1 activation , blunting the angiogenic response and favoring fibrosis . \n the work suggesting that pericytes dissociate from peritubular capillaries in response to renal epithelial cell injury , furthermore , suggests that epithelial cells maintain their ' microvasculture by indirect , pericyte - dependent signals . \n similar mechanisms may operate in the glomerulus where loss or destruction of podocytes leads to reduced vegf availability , and a fibrogenic response by the mesangial pericytes . ' \n second , it is attractive to postulate that excess tgf-1 in the tubulointerstitial or mesangial compartment triggers endothelial cell apoptosis via the alk5/smad3 pathway , resulting in capillary regression . although tgf-1 can activate angiogenesis indirectly through vegf synthesis , and can support endothelial cell survival and proliferation by activating the endothelium - specific alk1/smad1/5/8 pathway , persistently high concentrations of tgf-1 activate alk5/smad3 in endothelial cells , which results in vegf receptor downregulation and the induction of endothelial cell apoptosis . \n this process is a part of normal blood vessel pruning and is very likely operating in the fibrotic tubulointerstitium . \n loss of glomerular perfusion secondary to glomerulonephritis or glomerulosclerosis leads to coordinate regression of the associated peritubular capillary and atrophy of epithelial cells in the accompanying tubule . \n loss of glomerular perfusion therefore sets up a vicious cycle of postglomerular microvascular regression , chronic hypoxia , and fibrosis . \n renal microvascular rarefaction is a central phenomenon observed in all forms of progressive renal fibrosis . \n in part , involution of peritubular capillaries results from the loss of perfusion when glomeruli become sclerotic , and inflammatory mechanisms participate in the destruction of peritubular capillaries . \n reduced microvascular blood flow , in turn , results in chronic hypoxia within the renal interstitum . \n whereas hypoxia can activate both angiogenesis and fibrotic tissue remodeling , this balance is strongly tipped toward fibrosis in ckd . \n if it were possible to harness the endothelial cell specific mechanisms that lead to endothelial cell survival , new vessel formation , and preservation of capillary lumens , it might be possible to halt or even reverse the relentlessly progressive renal fibrosis that so often leads to renal failure .", "role": "user" }, { "content": "chronic progressive renal fibrosis leads to end - stage renal failure many patients with chronic kidney disease ( ckd ) . \n loss of the rich peritubular capillary network is a prominent feature , and seems independent of the specific underlying disease . \n the mechanisms that contribute to peritubular capillary regression include the loss of glomerular perfusion , as flow - dependent shear forces are required to provide the survival signal for endothelial cells . also , reduced endothelial cell survival signals from sclerotic glomeruli and atrophic or injured tubule epithelial cells contribute to peritubular capillary regression . in response to direct tubular epithelial cell injury , and the inflammatory reaction that ensues \n , capillary pericytes dissociate from their blood vessels , also reducing endothelial cell survival . \n in addition , direct inflammatory injury of capillary endothelial cells , for instance in chronic allograft nephropathy , also contributes to capillary dropout . \n chronic tissue hypoxia , which ensues from the rarefaction of the peritubular capillary network , can generate both an angiogenic and a fibrogenic response . \n however , in ckd , the balance is strongly tipped toward fibrogenesis . \n understanding the underlying mechanisms for failed angiogenesis in ckd and harnessing endothelial - specific survival and pro - angiogenic mechanisms for therapy should be our goal if we are to reduce the disease burden from ckd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: campomelic dysplasia ( cd ; omim # 114290 ) is a sporadic autosomal dominant disorder that results in skeletal and developmental abnormalities ( 1 , 2 ) . \n its reported incidence is about 0.05 - 0.09 per 10,000 live births ( 3 ) . \n spranger and maroteaux et al . ( 4 ) first described it fully and originally in 1971 . \n cd is a frequently lethal skeletal dysplasia syndrome whose hallmark features include angular bowing and shortening of the long bones with pretibial skin dimpling , hypoplastic scapulae , missing pairs of ribs , a narrow thorax , and bilateral club feet . \n in addition , hydrocephalus , hydronephrosis , and congenital heart disease ( ventriculoseptal defect , atrioseptal defect , aortic stenosis , and/or tetralogy of fallot ) are also present . \n a secondary feature of cd is male - to - female sex reversal , which occurs in about two - thirds of patients with an xy karyotype . like the sex reversal and the various skeletal symptoms , \n the bending of the long bones is not an obligatory feature and is absent in about 10% of cases , referred to as acampomelic cd ( 5 ) . to our knowledge , \n the present case is the first reported case in korea of a male with a novel sox9 frameshift mutation . \n a baby boy was born to a gravida 2 mother with a vertex presentation following a full - term pregnancy in asan medical center 's neonatal intensive care unit ( nicu ) on august 20 , 2008 . \n an ultrasound study at 36 weeks of gestation during this second pregnancy demonstrated shortened long bones , club feet , and a large head . at birth , \n the boy 's birth measurements were as follows : weight 3,272 g ( 25th percentile ) , length 46 cm ( 25th-50th percentile ) , and head circumference 37 cm ( 75th-90th percentile ) . \n his facial features included a flattened and prominent forehead , a flattened nasal bridge , and short palpebral fissures . \n micrognathia and retrognathia were also present , as was a cleft in the soft palate . \n skeletal deformities included a small thoracic cage , short limbs , pretibial skin dimples on the left thigh ( fig . \n a chest radiograph showed a small bell - shaped thoracic cage and 11 pairs of ribs with mild t - l scoliosis and hypoplastic scapulae ( fig . \n the pelvic and lower limbs ' radiography demonstrated a bowed femur , short fibulae , and no visible talus on either side ( fig . \n cerebral ultrasonography on the fifth day showed a small cystic change from both germinal matrix hemorrhages . \n the patient 's karyotype was 46xy with male external genitalia . to screen for a mutation , \n we isolated genomic dna from peripheral blood using a quickgene dna kit ( fujifilm life science , tokyo , japan ) . to analyze the sox9 gene 's mutation , we performed pcr using eight sets of primers designed in the intronic flanking region and containing three exons referred to by genbank accession number nt_010641.15 . \n we performed dna sequencing using the same primers used in pcr and a bigdye terminatore v3.1 cycle sequencing kit ( applied biosystems , foster city , ca , usa ) . \n direct automated sequencing identified a novel frameshift mutation at nucleotide 1372 in exon 3 ( fig . \n the patient carried both mutant and normal alleles , indicating that the mutation was heterozygous . \n after his discharge from nicu , the patient was hospitalized four times for treatments of pneumonia . \n he underwent a tracheostomy at the age of three months for severe laryngomalacia and died at the age of four months from progressive respiratory failure . \n characteristic features of cd are skeletal hypoplasias and anomalies affecting the face , head , scapulae , spine , pelvis , and upper and lower limbs . \n the head is macrocephalic with flattened face and nasal bridge , high forehead , low - set ears often with associated deafness , hypertelorism , long philtrum , small mouth , and micrognathia ( 6 - 9 ) . \n the skeletal features are the most prominent characteristics of cd as presented in our case including anterior bowing of the tibia and characteristic pretibial skin dimples . \n the femurs are also mildly angulated , and talipes equinovarus and dislocation of the hips are usually present . \n usually present are flat vertebrae ( particularly at the cervical level ) , hypoplastic scapulae , and a small bell - shaped chest that 's often slender with 11 pairs of ribs and a poorly mineralized sternum ( 7 - 9 ) . \n after the critical first year , quality of life tends to improve , although most survived patients are known to be mentally retarded . \n the oldest reported survivor was a 17-yr - old who had an iq of 45 ( 7 , 9 ) . \n most cases of cd are caused by heterozygous de novo mutations of the sox9 gene at chromosome 17q 24.3-q25.1 ( 5 , 10 ) . \n a growing number of reports describes cd with the chromosome 17 rearrangement breakpoint located some distance from sox9 ( 1 , 10 - 12 ) . \n sox9 contains a 79-amino acid dna - binding motif known as the high - mobility - group ( hmg ) domain , which recognizes typical sox binding sequences and a second domain essential for its function , a proline / glutamine / serine - rich c - terminal transcription - activation domain ( 1 , 13 , 14 ) . \n sox9 is a transcription factor that plays a role in the expression of col2a1 , a major collagen gene , and anti - mllerian hormone , which is secreted from the sertoli cells for male sex differentiation ( 15 , 16 ) . \n cd is a good model to illustrate how a single transcription factor can control the development of several organs . \n both the skeletal dysplasia and the xy sex reversal in cd are caused by mutations in sox9 . \n all reported mutations in sox9 can cause cd , and approximately 75% are associated with xy sex reversal ; whereas no mutation in sox9 has been associated with isolated sex reversal ( 17 ) . \n ( 18 ) demonstrated that cooperative dimerization of sox9 was essential for activation of key chondrogenesis genes , but not for male gonadal development , which might explain why cd is not necessarily associated with xy sex reversal as shown in our case . \n four major classes of heterozygous sox9 mutations cause cd : 1 ) amino acid substitutions in the hmg domain , 2 ) truncations or frameshifts that alter the c - terminus , 3 ) mutations at the splice junction , and 4 ) chromosomal translocations . \n all reported missense mutations lie in the hmg domain and affect dna binding , frameshifts , and splice mutations that truncate sox9 's c - terminus , resulting in the loss of transactivation domains ( 17 , 18 ) . in the present case we identified , a novel frameshift mutation in codon 458 at nucleotide 1372 . \n this mutation altered the transcription activation domain in the c - terminus , leading to a loss of sox9 's function . to date , two cases of cd have been reported in korea ( 19 , 20 ) . \n the first had multiple congenital anomalies ( polysplenia , complex heart disease , bilaterally trilobed lungs , and a brain anomaly ) and died immediately after delivery . \n the other was a case in which cd was identified in utero at 30 weeks of gestation whose pregnancy ended in abortion . \n herein we report a novel de novo frameshift mutation ( p.gln458argfsx12 ) in the sox9 gene of a korean male with cd .", "role": "user" }, { "content": "campomelic dysplasia ( cd ; omim # 114290 ) , a rare form of congenital short - limbed dwarfism , is due to mutations in sox9 , a member of the sox ( sry - related hmg box ) gene family . \n multiparous mother at 38 weeks ' gestation delivered a 3,272 g baby boy with characteristic phenotypes including bowing of the lower limbs , a narrow thoracic cage , 11 pairs of ribs , hypoplastic scapulae , macrocephaly , flattened supraorbital ridges and nasal bridge , cleft palate , and micrognathia . \n he underwent a tracheostomy at the age of three months for severe laryngomalacia after a number of repeated hospitalizations due to respiratory problems and died at the age of four months from progressive respiratory failure . \n he was diagnosed as having cd based on a novel frameshift mutation ( p.gln458argfsx12 ) in the sox9 gene , the mutation which has not yet been reported in korea .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: robotic surgery ( rs ) was adopted by urologists for radical prostatectomies in the treatment of prostate cancer during the late 1990s despite the lack of strong scientific data to support its advantages over the laparoscopic technique . as economic pressures continued to drive the use of rs , more data became available and the advantages of rs \n were eventually shown , including lower blood loss and transfusion rates while achieving similar oncologic outcomes . despite the introduction of laparoscopic colorectal excision 2 decades ago \n , its wide adoption has been slow because of a variety of factors , including technical difficulty and unproven oncologic equivalency to open surgery in the setting of rectal cancer . to date , there are no randomized level i data available from north america comparing the outcome of rectal cancer patients treated with open versus laparoscopic surgery . \n the much - awaited multicenter randomized american college of surgeons oncology group ( acosog ) z6051 trial is currently in its final year of accrual . \n until the outcome of this study is published , it is unclear how the laparoscopic technique compares with open conventional excision for rectal cancer . despite this lack of randomized data , \n the vast majority of comparative data have been reported from asia and europe , with a paucity of data from north america . \n the goal of our study was to review our early experience with robotic excision of rectal cancer and compare it with the outcome of laparoscopic surgery . \n a prospectively collected database was retrospectively reviewed for all consecutive cases performed either laparoscopically ( group 1 ) or robotically ( group 2 ) during the study period ( february 2011 to february 2013 ) . \n all cases were performed by 1 colorectal surgeon ( m.a.a . ) at kaiser permanente los angeles medical center , a regional tertiary institution in southern california serving a population of approximately 3.5 million patients . once rs was introduced in our institution in may 2012 , all minimally invasive pelvic cases from that date forward were performed robotically with the da vinci s surgical system ( intuitive surgical , sunnyvale , california ) . \n electrolyte solution the day before their operation and received perioperative intravenous antibiotics within 1 hour of incision ( 2 g of cefazolin and 500 mg of metronidazole ) . \n data collected included patient - related preoperative factors such as demographic characteristics , body mass index ( in kilograms per square meter ) , and relevant comorbidities . \n intraoperative data included type of operation , operative time , blood loss and need for transfusions , and intraoperative complications . \n oncologic measures comprised pathologic stage , number of lymph nodes harvested , and circumferential and radial margin positivity . \n postoperative outcomes included hospital length of stay , intensive care unit admission , narcotic pain medication use , overall complications , need for readmission , and need for reoperation . \n a 4-trocar technique was used for laparoscopic rectal excision , including an 11-mm supraumbilical port , a 12-mm right lower quadrant port , and two 5-mm trocars in the right and left mid abdomen . \n the mesorectal dissection was performed with the ligasure device ( covidien , mansfield , massachusetts ) . \n the extraction site was either via a pfannenstiel incision , a left lower quadrant incision , or anal / perineal wounds for intersphincteric proctectomy or abdominoperineal resection . \n the rectum was transected laparoscopically with an endo gia stapler ( covidien ) or , for very low tumors , a ta stapler ( covidien ) through the pfannenstiel incision . for the robotic technique , \n a 5-trocar technique was used , with three 8-mm robotic trocars in the right lower quadrant , left mid abdomen , and left lateral abdomen ; a 12-mm camera port in the right supraumbilical area ; and a 5-mm assistant trocar in the right upper quadrant . the mesorectal dissection was performed robotically using both monopolar and bipolar energy . \n the specimen extraction and rectal division were similar to the laparoscopic cases . to analyze the significance of data points between the laparoscopic and robotic groups , 2-tailed p values \n were calculated by use of the fisher exact test for categorical variables and paired t test for continuous variables . \n all statistical analyses were performed with spss software , version 16.0 ( spss , chicago , illinois ) . \n a 4-trocar technique was used for laparoscopic rectal excision , including an 11-mm supraumbilical port , a 12-mm right lower quadrant port , and two 5-mm trocars in the right and left mid abdomen . \n the mesorectal dissection was performed with the ligasure device ( covidien , mansfield , massachusetts ) . \n the extraction site was either via a pfannenstiel incision , a left lower quadrant incision , or anal / perineal wounds for intersphincteric proctectomy or abdominoperineal resection . \n the rectum was transected laparoscopically with an endo gia stapler ( covidien ) or , for very low tumors , a ta stapler ( covidien ) through the pfannenstiel incision . \n for the robotic technique , a 5-trocar technique was used , with three 8-mm robotic trocars in the right lower quadrant , left mid abdomen , and left lateral abdomen ; a 12-mm camera port in the right supraumbilical area ; and a 5-mm assistant trocar in the right upper quadrant . the mesorectal dissection was performed robotically using both monopolar and bipolar energy . \n to analyze the significance of data points between the laparoscopic and robotic groups , 2-tailed p values were calculated by use of the fisher exact test for categorical variables and paired t test for continuous variables . \n all statistical analyses were performed with spss software , version 16.0 ( spss , chicago , illinois ) . \n during the study period , 21 consecutive patients underwent laparoscopic rectal cancer excision ( group 1 ) and 21 subsequent consecutive patients underwent robotic excision ( group 2 ) . table 1 summarizes the patients ' characteristics . \n there were no differences in group 1 versus group 2 with regard to gender ( 57% male vs 48% male , p = .76 ) , age ( median of 62 years vs 60 years , p = .21 ) , body mass index ( median of 27 kg / m vs 25 kg / m , p = .23 ) , and prior abdominal operations ( 19% vs 29% , p = .71 ) . \n both groups were similar in terms of relevant comorbidities , with hypertension , hyperlipidemia , and diabetes being the most common . \n characteristics of patients in laparoscopic and robotic groups bmi = body mass index ; cad = coronary artery disease ; copd = chronic obstructive pulmonary disease ; ibd = inflammatory bowel disease . table 2 highlights the operative findings of the 2 groups . \n the most common operation in both groups was proctectomy with coloanal anastomosis , and most patients in both groups underwent diversion ( ileostomy in 52% in group 1 vs 62% in group 2 , p = .76 ) . \n there was a longer operative time in the robotic group compared with the laparoscopic group ( median of 260 minutes in group 2 vs 240 minutes in group 1 , p = .04 ) . \n there was no difference in blood loss ( median of 100 ml in group 1 vs 150 ml in group 2 , p = .76 ) , need for intraoperative transfusions ( 5% in each group ) , number of intraoperative complications ( 1 major bleeding complication in each group ) , and rate of conversion to an open procedure . \n operative data for laparoscopic and robotic groups the oncologic data are presented in table 3 . \n the 2 groups had similar oncologic characteristics in terms of tumor grade and postoperative stage , although group 2 consisted of lower tumors overall ( median distance from anal verge to tumor of 6 cm in group 2 vs 8 cm in group 1 , p = .02 ) . \n the number of lymph nodes harvested was clinically similar in the 2 groups , although they differed statistically ( median of 15 lymph nodes in group 1 vs 17 lymph nodes in group 2 , p = .03 ) . \n there was no difference in circumferential or distal margin positivity ( p > .99 ) . \n group 2 had a longer hospital stay ( 6 days in group 2 vs 5 days in group 1 , p = .05 ) and received intravenous narcotic pain medications for a longer period ( 5 days in group 2 vs 3 days in group 1 , p = .003 ) . \n there were no differences in overall complications at 90 days , but there was a trend toward more anastomotic leaks in group 1 ( 14% vs 0% , p = .23 ) . \n there was also a trend toward more readmissions in the laparoscopic group ( 24% vs 5% , p = .18 ) . \n there is a paucity of data from north america comparing the outcome of robotic and laparoscopic rectal cancer excision . \n the aim of this study was to review the early rectal cancer robotic experience at a tertiary center of a colorectal surgeon with significant expertise in laparoscopic pelvic and rectal surgery ( 10 years ' experience with advanced laparoscopy ) . \n starting in may 2012 , all minimally invasive rectal pelvic surgery cases ( benign and malignant ) were conducted robotically , thus minimizing selection bias . \n the open technique was reserved for patients in need of pelvic exenteration or those undergoing reoperative pelvic surgery . \n comparison of the 2 consecutive groups showed no major difference in patient - related factors or tumor characteristics except for a higher number of low rectal tumors in the robotic group . \n the median operative time was longer by 20 minutes when the procedure was performed robotically . \n whether this finding is related to the early experience of the surgeon with rs or inherent to the additional time required to dock and undock the robot is unclear . \n as our experience with rs continues to grow , we plan to reassess this outcome in the future . \n a higher number of lymph nodes and a longer specimen length were noted in the robotic group , but these findings can be attributed to the fact that 10% of the robotic patients had a proctocolectomy for rectal cancer in the setting of chronic ulcerative colitis . surprisingly , a longer length of stay and higher narcotic pain medication use were noted in the robotic group . \n it is unclear whether this finding is related to our early experience with rs , is related to the small number of patients in the study , or is a true finding inherent to rs possibly because of the significant torque exerted by the robotic arms on the abdominal wall . \n a higher anastomotic leak rate was noted in the laparoscopic group , which led to a higher readmission rate . \n we plan to examine this finding further as we gather a large number of robotic cases . \n if this finding persists , a plausible explanation may be the difference in dissection method in terms of both energy source use and its impact on thermal heat transmission to the anorectal stump and/or visualization . \n its small and retrospective nature may inherently introduce bias , and whether the results can be projected to the general population is uncertain . the single colorectal surgeon in this study had extensive prior experience in advanced laparoscopy of the pelvis for both benign and malignant disease . \n it is unclear whether the results can be duplicated by lower - volume surgeons , those with less laparoscopic experience , and/or those transitioning from open surgery to rs . \n in addition , this study looked at the immediate oncologic outcome and did not examine the impact of rs on long - term oncologic outcome . \n furthermore , no functional data or quality - of - life data were gathered as part of this study . despite the acknowledged shortcomings \n , this study provides valuable insight as to whether rs offers any immediate advantages over laparoscopy for rectal cancer excision . \n the benefits of rs to the surgeon have been advocated as one of the reasons to increase the use of rs . \n it is ergonomically more comfortable and offers more degrees of freedom versus traditional laparoscopy and thus may limit physician fatigue . \n visualization is improved by the 3-dimensional vision of rs and full surgeon control of the camera from the console . \n whether such surgeon benefits translate into better outcomes for the patient remains unknown . a longer operative time is widely considered to be a significant disadvantage of rs . \n our study found a longer operative time in the robotic group compared with the laparoscopy group , a finding previously reported by other authors . \n a few studies have actually suggested a shorter operative time with rs , although none of their data regarding operative time reached statistical significance . in meta - analyses comparing the 2 techniques , \n operative times were significantly shorter in the laparoscopic group , although the heterogeneity was high . \n as expertise in rs continues to grow and proficiency improves , it is conceivable that the operative time may decrease . \n rs must prove at least oncologic equivalency relative to open and/or laparoscopic surgery to justify its continued use . \n the number of harvested lymph nodes is known to have an important impact on survival . \n no comparative studies published to date have shown any statistically significant differences in the total number of lymph nodes obtained . \n our study showed no difference in the rate of circumferential resection or distal margin involvement , and the distal margin distance was comparable between the rs and laparoscopic groups . \n the meta - analysis of 7 comparative studies performed by memon et al in 2012 showed no risk difference for circumferential resection margin involvement between the two methods ( p = .77 ) and no difference in mean distal resection margin distances ( p = .84 ) . \n more inclusive meta - analyses from yang et al from china and trastulli et al from italy showed similar oncologic equivalency between the 2 groups . \n thus , from an oncologic perspective , early nonrandomized data suggest that rs provides the same immediate oncologic outcome as laparoscopy \n in reality , we still do not have solid randomized data to conclude whether laparoscopic excision yields the same oncologic outcome as open surgery . \n it is hoped that the acosog z6051 study comparing open versus laparoscopic excision for stage ii and iii rectal cancer will shed some light on the oncologic outcome of laparoscopy . \n it is interesting to note that the laparoscopic arm of the trial includes a subgroup of robotically operated patients . whether the number of such patients is large enough to make a meaningful comparison is unclear at this stage , and we will have to await the trial results . \n the rolarr ( robotic versus laparoscopic assisted resection of rectal cancer ) study is currently under way , and it is hoped that it will provide sufficient comparison between laparoscopy and robotics . \n laparoscopic surgery for colorectal diseases has proven to yield better early postoperative clinical outcomes compared with open surgery , but it is unclear whether rs provides any additional benefit . \n one plausible explanation may be the higher number of abdominoperineal resection and proctocolectomy cases in the robotic group . in the first - ever comparison study , published in 2009 , \n baik et al found a statistically significant difference in hospital length of stay , favoring a shorter course with rs ( 5.7 days vs 7.6 days , p = .001 ) , but this result has not been reproduced by any subsequent studies . \n baik et al attribute their reduction in hospital length of stay to an overall reduction in serious complications ( 5.4% vs 19.3% , p = .025 ) . \n however , no other comparative studies including our study have shown a statistically significant difference in overall complication rates or rate of anastomotic leaks . \n it is interesting to note that we found a trend toward more anastomotic leaks in the laparoscopic group . \n long - term oncologic outcome data of robotic total mesorectal excision including recurrence rates and cancer - specific survival are lacking . data on the impact of rs on quality of life and sexual and urinary function are scarce . although several studies have looked at short - term outcome , there is a definite need for additional studies to look at long - term outcomes . \n it appears from the literature that the upfront cost of the robotic technique is higher than that of laparoscopic surgery , but the overall cost - effectiveness has yet to be determined because the assessment should be based on long - term oncologic outcomes and functional results . \n finally , the issue of training and implementation of rs needs to be further studied . \n some publications have addressed the learning curve for robot - assisted rectal cancer excision , showing the learning phase to be achieved after approximately 25 cases when operative time and conversion rates were used as proxies for competency . \n however , the studies were reported from centers with experienced high - volume pelvic surgeons already skilled in laparoscopy . \n can these results be duplicated by lower - volume surgeons with less expertise in laparoscopy or by open surgeons transitioning to rs ? \n this comparative study exploring a single surgeon 's early experience with rs for rectal cancer showed a similar outcome to laparoscopy . \n however , the robotic group had a longer operative time , longer length of stay , and higher use of narcotic pain medications . \n the rate of complications was no different between laparoscopy surgery and rs , although a trend toward a higher readmission rate and more anastomotic leaks was observed in the laparoscopic group . \n although this study provides additional data on this newly implemented technology in the field of colorectal surgery , no firm recommendations can be offered for greater implementation of rs at this stage because of the retrospective nature of this study and the limited number of patients . \n the need for more randomized data is critical to determine whether the added resource utilization in rs is justifiable .", "role": "user" }, { "content": "background and objectives : robotic surgery has been advocated for the radical excision of rectal cancer . \n most data supporting its use have been reported from european and asian centers , with a paucity of data from the united states documenting clear advantages of the robotic technique . \n this study compares the short - term outcome of robotic versus laparoscopic surgery.methods:consecutive patients who underwent laparoscopic ( group 1 ) or robotic ( group 2 ) rectal cancer excision at a single institution over a 2-year period were retrospectively reviewed . \n the main outcome measures were operative time , blood loss , conversion rates , number of lymph nodes , margin positivity , length of hospital stay , complications , and readmission rates.results:forty-two patients were analyzed . \n the median operative time was shorter in group 1 than that in group 2 ( 240 minutes vs 260 minutes , p = .04 ) . \n no difference was noted in blood loss , transfusion rates , intraoperative complications , or conversion rates . \n there was no difference in circumferential or distal margin positivity . \n the median length of stay was shorter in group 1 ( 5 days vs 6 days , p = .05 ) . \n the 90-day complication rate was similar in both groups ( 33% vs 43% , p = .75 ) , but there was a trend toward more anastomotic leaks in group 1 ( 14% vs 0% , p = .23 ) . \n similarly , a non statistically significant trend toward a higher readmission rate was noted in group 1 ( 24% vs 5% , p = .18).conclusion : robotic rectal cancer excision yielded a longer operative time and hospital length of stay , although immediate oncologic results were comparable . \n the need for randomized data is critical to determine whether the added resource utilization in robotic surgery is justifiable .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: one hundred and eighty three donor candidates underwent an mdct evaluation at seoul national university hospital ( seoul , korea ) between january 2002 and december 2005 . \n properly documented surgical reports were available for 153 donor nephrectomies , including 136 open nephrectomies and 17 laparoscopic nephrectomies . \n properly documented surgical reports were defined as reports that contained information about the selected side for donation , the number of renal vessels and major variations that required a longer ischemic time or additional procedures in surgery . the finally selected 153 donors ( mean age , 38 years ; age range , 19 - 61 years ) consisted of 74 male donors ( mean age , 36 years ; age range , 20 - 61 years ) and 79 female donors ( mean age , 39 years ; age range 19 - 58 years ) . \n the ethical committee at our hospital approved this retrospective study . a four - channel mdct unit ( mx-8000 ; marconi medical systems , cleveland , oh ) , \n an eight channel mdct unit ( ge hispeed ultra ; ge medical systems , milwaukee , wi ) and a sixteen channel mdct unit ( sensation 16 ; siemens , enlangen , germany ) were used for the ct examinations in 67 , 58 and 28 cases , respectively . \n mdct scans were obtained with patients in the supine position ; where the feet entered the gantry first . \n an 18-gauge venous line was placed , usually in an antecubital fossa vein , and a total of 150 ml of nonionic contrast material containing iopromide ( ultravist 370 ; schering , berlin , germany ) was injected at 4 ml / sec using a power injector ( envision ct ; medrad , indianola , pa ) in the same manner for all three mdct scanners . just after the contrast injection , a total of 40 ml normal saline was injected at 2 ml / sec to allow the residual contrast material in the veins to be pushed into the arterial system to increase the efficiency of contrast enhancement . \n pre - contrast ct covering both kidneys , including arterial phase and venous phase scans covering from the diaphragmatic dome to iliac crest level , were obtained . \n the arterial phase scan started when the triggering level of the mid descending thoracic aorta reached 100 hounsfield units ( hu ) , and the venous phase scan followed the arterial scan . \n the acquisition parameters used for the ct examinations were 120 kvp for all ct scanners , 250 effective mas for the 4-channel and 200 mas for 8 and 16 channel units , and a 0.5 sec rotation time for all three units . \n detector collimations were 4 1 mm , 8 1.25 mm , 16 0.75 mm , respectively for the three units , and the reconstruction parameters were a 1 mm slice thickness for the 4 and 16-channel units , and a 1.25 mm slice thickness for the 8-channel unit . \n thin - section axial images were transferred to a workstation installed with a pc - based three - dimensional ( 3d ) program ( rapidia , infinitt , seoul , korea ) . \n individual volume data were loaded into the 3d program , and the data were reformed into routine 3d images , which included maximum intensity projection ( mip ) , multiplanar - reconstruction ( mpr ) , and volume - rendered images by an experienced technician . the routine mip images and volume rendered images were reconstructed to cover both kidneys to the upper pelvis in an exact coronal plane and oblique coronal plane adjusted to be parallel with both renal hilum . \n the radiologist performed additional reconstructions , if special focused images were needed after a review of the axial ct scans . \n initial interpretations of all ct images , including thin section axial images and 3d reformatted images , were performed retrospectively by an experienced cardiovascular radiologist unaware of the surgical results . \n initial interpretations were compared with the surgical findings ( the reference standard ) and the accuracy of ct for the evaluation of renal vascular anatomy , particularly in terms of the numbers of arteries and veins , was determined . \n the accuracies of ct evaluations were derived from the donor side kidneys only , for which the surgical findings confirmed the anatomies . \n the radiologist who interpreted the ct images during the initial ct analysis also reviewed the ct images that showed a mismatch between the ct and surgical findings , but without knowledge of the surgical findings , to determine whether vessels were missed because of technical limitations or because of interpretation errors . \n after matching the secondary image interpretations with the surgical findings , the remaining mismatched cases were finally reviewed with knowledge of the surgical findings , by the same radiologist . \n the prevalence of vascular variations was calculated using surgical and ct findings in the donated side kidneys , whereas the prevalence of vascular variations in the non - donated side kidneys was evaluated using ct alone . \n the prevalence of multiple renal arteries and veins , early renal artery branching , and late confluence of the renal vein were recorded . \n other anatomical variations of the renal vein and artery , such as a circumaortic renal vein , bilateral inferior vena cava ( ivc ) or a retroaortic renal vein , or of an unusual course or origin of the renal artery , were also recorded . \n more than two renal arteries that arose from the aorta with multiple ostia , regardless of the size , were defined as multiple renal arteries . more than two renal veins that drained into the vena cava with multiple ostia , again regardless of the size , were defined as multiple renal veins . \n an early branching renal artery was defined as a first renal artery branch that arose within 1.5 cm of the ostium of the renal artery . \n a late confluence of the renal vein was defined as a final confluence point within 1.5 cm from the left lateral border of the aorta for the left kidney . \n a late confluence of the renal vein for the right kidney was not evaluated as the right kidney had a short renal vein and in almost all cases , confluence occurred within 1.5 cm from the ivc . \n one hundred and eighty three donor candidates underwent an mdct evaluation at seoul national university hospital ( seoul , korea ) between january 2002 and december 2005 . \n properly documented surgical reports were available for 153 donor nephrectomies , including 136 open nephrectomies and 17 laparoscopic nephrectomies . \n properly documented surgical reports were defined as reports that contained information about the selected side for donation , the number of renal vessels and major variations that required a longer ischemic time or additional procedures in surgery . the finally selected 153 donors ( mean age , 38 years ; age range , 19 - 61 years ) consisted of 74 male donors ( mean age , 36 years ; age range , 20 - 61 years ) and 79 female donors ( mean age , 39 years ; age range 19 - 58 years ) . \n a four - channel mdct unit ( mx-8000 ; marconi medical systems , cleveland , oh ) , an eight channel mdct unit ( ge hispeed ultra ; ge medical systems , milwaukee , wi ) and a sixteen channel mdct unit ( sensation 16 ; siemens , enlangen , germany ) were used for the ct examinations in 67 , 58 and 28 cases , respectively . \n mdct scans were obtained with patients in the supine position ; where the feet entered the gantry first . \n an 18-gauge venous line was placed , usually in an antecubital fossa vein , and a total of 150 ml of nonionic contrast material containing iopromide ( ultravist 370 ; schering , berlin , germany ) was injected at 4 ml / sec using a power injector ( envision ct ; medrad , indianola , pa ) in the same manner for all three mdct scanners . just after the contrast injection , a total of 40 ml normal saline was injected at 2 ml / sec to allow the residual contrast material in the veins to be pushed into the arterial system to increase the efficiency of contrast enhancement . pre - contrast ct covering both kidneys , including arterial phase and venous phase scans covering from the diaphragmatic dome to iliac crest level , were obtained . \n the arterial phase scan started when the triggering level of the mid descending thoracic aorta reached 100 hounsfield units ( hu ) , and the venous phase scan followed the arterial scan . \n the acquisition parameters used for the ct examinations were 120 kvp for all ct scanners , 250 effective mas for the 4-channel and 200 mas for 8 and 16 channel units , and a 0.5 sec rotation time for all three units . \n detector collimations were 4 1 mm , 8 1.25 mm , 16 0.75 mm , respectively for the three units , and the reconstruction parameters were a 1 mm slice thickness for the 4 and 16-channel units , and a 1.25 mm slice thickness for the 8-channel unit . \n thin - section axial images were transferred to a workstation installed with a pc - based three - dimensional ( 3d ) program ( rapidia , infinitt , seoul , korea ) . \n individual volume data were loaded into the 3d program , and the data were reformed into routine 3d images , which included maximum intensity projection ( mip ) , multiplanar - reconstruction ( mpr ) , and volume - rendered images by an experienced technician . the routine mip images and volume rendered images were reconstructed to cover both kidneys to the upper pelvis in an exact coronal plane and oblique coronal plane adjusted to be parallel with both renal hilum . \n the radiologist performed additional reconstructions , if special focused images were needed after a review of the axial ct scans . \n initial interpretations of all ct images , including thin section axial images and 3d reformatted images , were performed retrospectively by an experienced cardiovascular radiologist unaware of the surgical results . \n initial interpretations were compared with the surgical findings ( the reference standard ) and the accuracy of ct for the evaluation of renal vascular anatomy , particularly in terms of the numbers of arteries and veins , was determined . \n the accuracies of ct evaluations were derived from the donor side kidneys only , for which the surgical findings confirmed the anatomies . \n a secondary image interpretation session was conducted after matching the ct and surgical findings . the radiologist who interpreted the ct images during the initial ct analysis also reviewed the ct images that showed a mismatch between the ct and surgical findings , but without knowledge of the surgical findings , to determine whether vessels were missed because of technical limitations or because of interpretation errors . after matching the secondary image interpretations with the surgical findings \n , the remaining mismatched cases were finally reviewed with knowledge of the surgical findings , by the same radiologist . \n the prevalence of vascular variations was calculated using surgical and ct findings in the donated side kidneys , whereas the prevalence of vascular variations in the non - donated side kidneys was evaluated using ct alone . \n the prevalence of multiple renal arteries and veins , early renal artery branching , and late confluence of the renal vein were recorded . \n other anatomical variations of the renal vein and artery , such as a circumaortic renal vein , bilateral inferior vena cava ( ivc ) or a retroaortic renal vein , or of an unusual course or origin of the renal artery , were also recorded . \n more than two renal arteries that arose from the aorta with multiple ostia , regardless of the size , were defined as multiple renal arteries . \n more than two renal veins that drained into the vena cava with multiple ostia , again regardless of the size , were defined as multiple renal veins . \n an early branching renal artery was defined as a first renal artery branch that arose within 1.5 cm of the ostium of the renal artery \n . a late confluence of the renal vein was defined as a final confluence point within 1.5 cm from the left lateral border of the aorta for the left kidney \n . a late confluence of the renal vein for the right kidney was not evaluated as the right kidney had a short renal vein and in almost all cases , confluence occurred within 1.5 cm from the ivc . \n initial interpretations of all ct images , including thin section axial images and 3d reformatted images , were performed retrospectively by an experienced cardiovascular radiologist unaware of the surgical results . \n initial interpretations were compared with the surgical findings ( the reference standard ) and the accuracy of ct for the evaluation of renal vascular anatomy , particularly in terms of the numbers of arteries and veins , was determined . \n the accuracies of ct evaluations were derived from the donor side kidneys only , for which the surgical findings confirmed the anatomies . \n a secondary image interpretation session was conducted after matching the ct and surgical findings . the radiologist who interpreted the ct images during the initial ct analysis also reviewed the ct images that showed a mismatch between the ct and surgical findings , but without knowledge of the surgical findings , to determine whether vessels were missed because of technical limitations or because of interpretation errors . after matching the secondary image interpretations with the surgical findings \n , the remaining mismatched cases were finally reviewed with knowledge of the surgical findings , by the same radiologist . \n the prevalence of vascular variations was calculated using surgical and ct findings in the donated side kidneys , whereas the prevalence of vascular variations in the non - donated side kidneys was evaluated using ct alone . \n the prevalence of multiple renal arteries and veins , early renal artery branching , and late confluence of the renal vein were recorded . \n other anatomical variations of the renal vein and artery , such as a circumaortic renal vein , bilateral inferior vena cava ( ivc ) or a retroaortic renal vein , or of an unusual course or origin of the renal artery , were also recorded . \n more than two renal arteries that arose from the aorta with multiple ostia , regardless of the size , were defined as multiple renal arteries . \n more than two renal veins that drained into the vena cava with multiple ostia , again regardless of the size , were defined as multiple renal veins . \n an early branching renal artery was defined as a first renal artery branch that arose within 1.5 cm of the ostium of the renal artery . \n a late confluence of the renal vein was defined as a final confluence point within 1.5 cm from the left lateral border of the aorta for the left kidney . \n a late confluence of the renal vein for the right kidney was not evaluated as the right kidney had a short renal vein and in almost all cases , confluence occurred within 1.5 cm from the ivc . \n the left kidney was selected in 145 candidates and the right kidney in eight candidates . among the donated kidneys , a single renal artery was present in 100 left kidneys and in six right kidneys ( 69.3% , a total of 106 kidneys out of 153 kidneys ) . \n forty - seven kidneys had multiple arteries , i.e. , 40 left and two right kidneys had two renal arteries ( 27.5% , a total of 42 kidneys out of 153 kidneys ) , three left kidneys had three renal arteries ( 2% , three kidneys out of 153 kidneys ) and two left kidneys had four renal arteries ( 1.3% , two kidneys out of 153 kidneys ) . \n a single renal vein was present in 139 left kidneys and in seven right kidneys ( 95% , a total of 146 kidneys out of 153 kidneys ) . \n seven kidneys had two renal veins ( 4.6% , one right kidney and six left kidneys out of 153 kidneys ) . \n it was found that the mdct anatomy exactly matched the surgical findings for 146 donors ( 95.4% , 146 donors out of 153 donors ) . \n the accuracy for the prediction of the renal artery number in the initial ct interpretation was 96% ( 147 donors out of 153 donors ) and the accuracy for the prediction of the renal vein number was 99% ( 151 donors out of 153 donors ) . \n the accuracies of ct for predicting the existence of renal vessels based on the number of renal arteries and veins were 98% ( 203 arteries out of 207 arteries ) and 99% ( 158 veins out of 160 veins ) , respectively . \n four arteries and two veins of five donors were missed during the initial ct interpretation . on a second - look of the ct scans ( without knowledge of the surgical results ) , \n the sizes of retrospectively detected artery and vein were 2.7 mm and 2.4 mm , respectively . \n the accuracies of the second - look interpretation session were 25% ( one artery out of four arteries ) and 50% ( one vein out of two veins ) , respectively . \n final reading sessions ( with knowledge of the surgical findings ) revealed that one artery and one vein with a size of 1.3 mm and 2 mm at a peripheral vessel location , respectively , were also missed on both the initial and second - look interpretation sessions . \n the accuracies of the final reading session were 33% ( one artery out of three arteries ) and 100% ( one vein out of one vein ) , respectively . \n however , two missed arteries were not detected even after repeated careful re - evaluations of the ct images , with knowledge of surgical information ( fig . \n the prevalence of vascular variations was calculated from the surgical findings of the donated kidneys and the ct findings of non - donated kidneys . \n forn a total of 306 kidneys from 153 kidney donors , a single renal artery was detected in 220 kidneys ( 71.8% , 220 kidneys out of 306 kidneys ) and a single renal vein was detected in 258 kidneys ( 84.3% , 258 kidneys out of 306 kidneys ) . \n two renal arteries were found in 76 kidneys ( 24.8% , 76 kidneys out of 306 kidneys ) , three renal arteries in eight kidneys ( 2.6% , eight kidneys out of 306 kidneys ) and four renal arteries in two kidneys ( 0.6% , two kidneys out of 306 kidneys ) . \n in addition , two renal veins were found in 40 kidneys ( 13.0% , 40 kidneys out of 306 kidneys ) and three renal veins in eight kidneys ( 2.6% , eight kidneys out of 306 kidneys ) . \n thirty - seven kidneys had an early branching renal artery , and 33 kidneys had a late confluence of renal vein . \n two donor candidates had a bilateral ivc , and one donor had a retroaortic renal vein . \n in addition , there was one precaval right renal artery and one left renal artery with a supradiaphragmatic origin ( fig . \n the left kidney was selected in 145 candidates and the right kidney in eight candidates . among the donated kidneys , a single renal artery was present in 100 left kidneys and in six right kidneys ( 69.3% , a total of 106 kidneys out of 153 kidneys ) . \n forty - seven kidneys had multiple arteries , i.e. , 40 left and two right kidneys had two renal arteries ( 27.5% , a total of 42 kidneys out of 153 kidneys ) , three left kidneys had three renal arteries ( 2% , three kidneys out of 153 kidneys ) and two left kidneys had four renal arteries ( 1.3% , two kidneys out of 153 kidneys ) . \n a single renal vein was present in 139 left kidneys and in seven right kidneys ( 95% , a total of 146 kidneys out of 153 kidneys ) . \n seven kidneys had two renal veins ( 4.6% , one right kidney and six left kidneys out of 153 kidneys ) . \n it was found that the mdct anatomy exactly matched the surgical findings for 146 donors ( 95.4% , 146 donors out of 153 donors ) . \n the accuracy for the prediction of the renal artery number in the initial ct interpretation was 96% ( 147 donors out of 153 donors ) and the accuracy for the prediction of the renal vein number was 99% ( 151 donors out of 153 donors ) . \n the accuracies of ct for predicting the existence of renal vessels based on the number of renal arteries and veins were 98% ( 203 arteries out of 207 arteries ) and 99% ( 158 veins out of 160 veins ) , respectively . \n four arteries and two veins of five donors were missed during the initial ct interpretation . on a second - look of the ct scans ( without knowledge of the surgical results ) , \n the sizes of retrospectively detected artery and vein were 2.7 mm and 2.4 mm , respectively . \n the accuracies of the second - look interpretation session were 25% ( one artery out of four arteries ) and 50% ( one vein out of two veins ) , respectively . \n final reading sessions ( with knowledge of the surgical findings ) revealed that one artery and one vein with a size of 1.3 mm and 2 mm at a peripheral vessel location , respectively , were also missed on both the initial and second - look interpretation sessions . \n the accuracies of the final reading session were 33% ( one artery out of three arteries ) and 100% ( one vein out of one vein ) , respectively . \n however , two missed arteries were not detected even after repeated careful re - evaluations of the ct images , with knowledge of surgical information ( fig . \n the prevalence of vascular variations was calculated from the surgical findings of the donated kidneys and the ct findings of non - donated kidneys . \n forn a total of 306 kidneys from 153 kidney donors , a single renal artery was detected in 220 kidneys ( 71.8% , 220 kidneys out of 306 kidneys ) and a single renal vein was detected in 258 kidneys ( 84.3% , 258 kidneys out of 306 kidneys ) . \n two renal arteries were found in 76 kidneys ( 24.8% , 76 kidneys out of 306 kidneys ) , three renal arteries in eight kidneys ( 2.6% , eight kidneys out of 306 kidneys ) and four renal arteries in two kidneys ( 0.6% , two kidneys out of 306 kidneys ) . \n in addition , two renal veins were found in 40 kidneys ( 13.0% , 40 kidneys out of 306 kidneys ) and three renal veins in eight kidneys ( 2.6% , eight kidneys out of 306 kidneys ) . \n thirty - seven kidneys had an early branching renal artery , and 33 kidneys had a late confluence of renal vein . \n two donor candidates had a bilateral ivc , and one donor had a retroaortic renal vein . \n in addition , there was one precaval right renal artery and one left renal artery with a supradiaphragmatic origin ( fig . \n this study aimed to evaluate the accuracy of renal ct angiography obtained by the use of mdct for the prediction of renal vascular anatomy and its variations in living kidney donors . \n we also evaluated the cause of misinterpretations by ct , because the accuracy of ct might be increased by reducing the causes of misinterpretation . in our study , ct angiographic anatomies with respect to the renal arteries and veins precisely matched the surgical findings for 146 of 153 donors , an accuracy of 95% with respect to the kidney donor . \n the accuracy for predicting only the number of renal arteries was 96% , and the accuracy for predicting renal veins was 99% . \n results of this study correspond well with those of earlier studies that have reported that mdct showed high sensitivity in the assessment of renal vasculatures ( 7 - 10 ) . out of four renal arteries that were not detected on the initial interpretation of the ct scans , \n two of these arteries were also not observed on retrospective reviews with knowledge of the surgical findings , and were thus attributed to technical limitations . \n ( 11 ) have reported that mdct can be a reliable tool for quantification of a vessel with a size over 7 mm , and the range of size for a renal accessory renal artery was described as 0.2 - 3.0 cm by satyapal et al . \n therefore , the majority of the accessory renal arteries should be well demonstrated with mdct . \n however , in our study , repeated evaluation of the ct images could not depict the missed arteries . \n this could not be confirmed , but it could be presumed that the accessory renal artery mentioned on the surgical report was not detectable in the repeated evaluations of the ct due to artifacts such as a motion artifact or a stair - step artifact . \n it was also emphasized that adequate contrast enhancement is also critical for detecting small arteries by claves et al . \n ( 13 ) . therefore , an acceptable quality of the ct scan and optimal scan timing for adequate contrast enhancement could reduce the technical limitations of mdct . \n the sizes of the missed arteries and veins ranged between 1.3 - 2.7 mm , and most of the vessels were not difficult to find in repeated interpretation session . \n if the missed arteries and veins were detected during the initial interpretation , the accuracy of ct could have been increased . \n in addition , mdct has been shown to be reliable even when images are interpreted by multiple readers with varied levels of expertise , as reported in a study by sahani et al . \n when the images are obtained in adequate scan protocols and with adequate contrast enhancement ( 14 ) , human errors can be decreased by careful image interpretations ( fig . \n one of them was a 1.2 mm sized accessory renal artery that arose from the upper abdominal aorta , so it could be missed in the limited operative field . \n however , ct well - demonstrated the accessory artery penetrating the renal cortex and supplying the upper pole of the kidney , thus the ct finding could be more reliable than the surgical record , which is based on a narrow field of vision . \n the other accessory renal artery was 3.2 mm in diameter , and arose from the upper renal hilum and supplied the lower pole of the left kidney . \n it was nearly the same size as the main renal artery , but it was not described in the surgical report . \n we included these two cases in the calculation of accuracy , but they were excluded from the missed cases . \n the prevalence of the supernumerary renal artery was 28% in the present study , which is similar to that found in previous studies ( 23 - 40% ) ( 6 , 14 - 16 ) . \n in addition , the prevalence of an early branching renal artery was reported as 10 - 12% ( 4 , 6 ) , which also concurs with the 12% of our study . \n an early branching renal artery is considered technically in the same manner as a double renal artery from a surgical perspective , as it requires a longer ischemic time . furthermore , in our study , two rare renal artery variations were observed , i.e. , a precaval right renal artery and a left renal artery with a supradiaphragmatic origin . \n the prevalence of a supernumerary renal vein has been reported to be in the range from 9 - 28% ( 2 , 6 , 14 , 15 ) . \n forty - eight kidneys ( 15.6% ) had multiple renal veins in our study , which is concurrent with previous studies . \n this variation has been described in a few previous studies , e.g. 16% in a study by kim et al . \n other renal vein variations are less common in the korean population than in other populations . \n two kidneys ( 1.4% ) had a circumaortic left renal vein , which has been previously reported to occur at an incidence of 3 - 17% ( 5 , 17 ) . two donor candidates ( 0.7% ) \n had a bilateral ivc , and only one donor ( 0.3% ) had a retroaortic left renal vein , which is substantially smaller than the 3% reported in previous studies ( 2 , 5 , 14 ) . \n first , the size and location of the renal artery or renal vein are not all described in the surgical reports . \n thus , we can not know the size of a vessel that was unable to be seen on ct , and a focused evaluation of ct scans for the described locations was not possible . \n second , the prevalence of renal vascular anatomy was only confirmed in the donated kidney . \n as the complexity of renal vascular anatomy influences the decision of the donor site , the incidence of complex vascular variations could be only presumed from the ct findings . \n ct can demonstrate both venous and arterial anatomy , which is its major advantage as compared with conventional angiography . \n moreover , the depiction of tributaries , such as the ascending lumbar and adrenal veins , is only possible by ct . pre \n - operative knowledge of the venous anatomy can help reduce the number of surgical complications and shorten the ischemic time . \n mdct offers rapid data acquisition and narrow collimation , which allows greater anatomical coverage and higher longitudinal spatial resolution . \n mdct also provides thinner and more accurate anatomical information than conventional ct . in our study , only two renal arteries remained undetected after the initial and retrospective reviews . \n thus , the accuracy of ct in terms of revealing surgical results before or after surgery , reached almost 99% , and its technical limitations may be considerably reduced in the future . in conclusion \n , mdct can provide a highly accurate assessment of the renal vascular anatomy in living kidney donors . \n this study aimed to evaluate the accuracy of renal ct angiography obtained by the use of mdct for the prediction of renal vascular anatomy and its variations in living kidney donors . \n we also evaluated the cause of misinterpretations by ct , because the accuracy of ct might be increased by reducing the causes of misinterpretation . in our study , ct angiographic anatomies with respect to the renal arteries and veins precisely matched the surgical findings for 146 of 153 donors , an accuracy of 95% with respect to the kidney donor . \n the accuracy for predicting only the number of renal arteries was 96% , and the accuracy for predicting renal veins was 99% . \n results of this study correspond well with those of earlier studies that have reported that mdct showed high sensitivity in the assessment of renal vasculatures ( 7 - 10 ) . out of four renal arteries that were not detected on the initial interpretation of the ct scans , \n two of these arteries were also not observed on retrospective reviews with knowledge of the surgical findings , and were thus attributed to technical limitations . \n ( 11 ) have reported that mdct can be a reliable tool for quantification of a vessel with a size over 7 mm , and the range of size for a renal accessory renal artery was described as 0.2 - 3.0 cm by satyapal et al . \n therefore , the majority of the accessory renal arteries should be well demonstrated with mdct . \n however , in our study , repeated evaluation of the ct images could not depict the missed arteries . \n this could not be confirmed , but it could be presumed that the accessory renal artery mentioned on the surgical report was not detectable in the repeated evaluations of the ct due to artifacts such as a motion artifact or a stair - step artifact . \n it was also emphasized that adequate contrast enhancement is also critical for detecting small arteries by claves et al . \n ( 13 ) . therefore , an acceptable quality of the ct scan and optimal scan timing for adequate contrast enhancement could reduce the technical limitations of mdct . \n the sizes of the missed arteries and veins ranged between 1.3 - 2.7 mm , and most of the vessels were not difficult to find in repeated interpretation session . \n if the missed arteries and veins were detected during the initial interpretation , the accuracy of ct could have been increased . \n in addition , mdct has been shown to be reliable even when images are interpreted by multiple readers with varied levels of expertise , as reported in a study by sahani et al . \n when the images are obtained in adequate scan protocols and with adequate contrast enhancement ( 14 ) , human errors can be decreased by careful image interpretations ( fig . \n one of them was a 1.2 mm sized accessory renal artery that arose from the upper abdominal aorta , so it could be missed in the limited operative field . \n however , ct well - demonstrated the accessory artery penetrating the renal cortex and supplying the upper pole of the kidney , thus the ct finding could be more reliable than the surgical record , which is based on a narrow field of vision . \n the other accessory renal artery was 3.2 mm in diameter , and arose from the upper renal hilum and supplied the lower pole of the left kidney . \n it was nearly the same size as the main renal artery , but it was not described in the surgical report . \n we included these two cases in the calculation of accuracy , but they were excluded from the missed cases . \n the prevalence of the supernumerary renal artery was 28% in the present study , which is similar to that found in previous studies ( 23 - 40% ) ( 6 , 14 - 16 ) . \n in addition , the prevalence of an early branching renal artery was reported as 10 - 12% ( 4 , 6 ) , which also concurs with the 12% of our study . \n an early branching renal artery is considered technically in the same manner as a double renal artery from a surgical perspective , as it requires a longer ischemic time . \n furthermore , in our study , two rare renal artery variations were observed , i.e. , a precaval right renal artery and a left renal artery with a supradiaphragmatic origin . \n the prevalence of a supernumerary renal vein has been reported to be in the range from 9 - 28% ( 2 , 6 , 14 , 15 ) . \n forty - eight kidneys ( 15.6% ) had multiple renal veins in our study , which is concurrent with previous studies . \n this variation has been described in a few previous studies , e.g. 16% in a study by kim et al . \n other renal vein variations are less common in the korean population than in other populations . \n two kidneys ( 1.4% ) had a circumaortic left renal vein , which has been previously reported to occur at an incidence of 3 - 17% ( 5 , 17 ) . two donor candidates ( 0.7% ) \n had a bilateral ivc , and only one donor ( 0.3% ) had a retroaortic left renal vein , which is substantially smaller than the 3% reported in previous studies ( 2 , 5 , 14 ) . \n first , the size and location of the renal artery or renal vein are not all described in the surgical reports . \n thus , we can not know the size of a vessel that was unable to be seen on ct , and a focused evaluation of ct scans for the described locations was not possible . \n second , the prevalence of renal vascular anatomy was only confirmed in the donated kidney . \n as the complexity of renal vascular anatomy influences the decision of the donor site , the incidence of complex vascular variations could be only presumed from the ct findings . \n ct can demonstrate both venous and arterial anatomy , which is its major advantage as compared with conventional angiography . \n moreover , the depiction of tributaries , such as the ascending lumbar and adrenal veins , is only possible by ct . pre \n - operative knowledge of the venous anatomy can help reduce the number of surgical complications and shorten the ischemic time . \n mdct offers rapid data acquisition and narrow collimation , which allows greater anatomical coverage and higher longitudinal spatial resolution . \n mdct also provides thinner and more accurate anatomical information than conventional ct . in our study , only two renal arteries remained undetected after the initial and retrospective reviews . \n thus , the accuracy of ct in terms of revealing surgical results before or after surgery , reached almost 99% , and its technical limitations may be considerably reduced in the future . in conclusion \n , mdct can provide a highly accurate assessment of the renal vascular anatomy in living kidney donors .", "role": "user" }, { "content": "objectiveto determine the accuracy of the use of multi - detector row ct ( mdct ) to predict vascular anatomy in living kidney donors and to reveal the prevalence of vascular variations in a korean population.materials and methodsa total of 153 living kidney donors that had undergone preoperative ct and nephrectomy , either with open or laparoscopic surgery , were selected retrospectively . \n the initial ct results were compared with the surgical findings and repeated review sessions of ct scans were performed to determine the causes of mismatches in discordant cases.resultsthe accuracy of ct angiography was 95% to predict the number of renal vessels . \n four arteries and two veins were missed during the initial ct interpretation due to perception errors ( for two arteries and two veins ) and technical limitations ( two arteries ) . \n the prevalence of multiple renal arteries and veins , early branching of a renal artery and late confluence of a renal vein were 31% , 5% , 12% , 17% , respectively . \n the circumaortic renal vein and the bilateral inferior vena cava were found in two cases each ( 1.3% ) . \n one case ( 0.7% ) each of a retroaortic renal vein and a supradiaphragmatic originated renal artery were found.conclusionmdct provides a reliable method to evaluate the vascular anatomy and variations of living kidney donors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: chief among these are seven : central obesity , hyperglycaemia , dyslipidemia , hypertension , inflammation , ldl oxidation , and the prothombotic state . \n the sequelae of these features , atherosclerotic - driven myocardial infarction and stroke [ 1 , 2 ] , are the major causes of disability and death in type 2 diabetes patients . \n polypharmacy ( concurrent use of numerous drugs ) currently used to combat these seven issues is of serious concern . \n ideally , one or a smaller number of drugs would safely and efficaciously address all seven issues . \n type 2 diabetes is diagnosed when there is a fasting plasma glucose of 7.0 mmol / l or , as the result of a 2 hour after oral glucose tolerance test ( or at any random time of the day ) , a blood glucose level of 11.1 mmol / l . \n these numbers must be combined with reduced insulin sensitivity and/or blood plasma insulin levels to yield a diagnosis of type 2 diabetes . \n central obesity is associated with type 2 diabetes and contributes to the other six issues . \n central obesity may be defined as a waist circumference greater than 94 cm in males and 80 cm in females of europid origin , the patients of the current study . \n central obesity leads to the sequential cascade of hyperglycaemia , dyslipidemia and hypertension , oxidised low density lipoprotein ( ldl ) , inflammation , plaque rupture , and thrombosis . \n hyperglycaemia ( fasting 7.0 mmol / l ) contributes to dyslipidemia as reflected in low plasma high density lipoprotein - cholesterol ( hdl - c ) levels ( < 1.0 mmol / l ( males ) , 1.3 mmol / l ( females ) ) , increased triglycerides ( > 1.5 \n mmol / l ) , total cholesterol ( tc ) : hdl - c ratio ( < 4.0 ) , small dense ( sd)-ldl - c ( 1.1 \n mmol / l ) and low density lipoprotein - cholesterol ( ldl - c ) concentrations ( > 2.0 \n dyslipidemia and hyperglycaemia lead to hypertension in type 2 diabetics , defined as 130/80 mm hg [ 2 , 5 ] . \n hypertension may lead to plaque rupture that contributes to the prothrombotic state , reflected in shortened bleeding times ( under 5 minutes ) . \n reduced antioxidant defences in type 2 diabetes result in increased oxidised ldl which promotes increased synthesis of proinflammatory cytokines interleukin-6 ( il-6 ) and tumour necrosis factor alpha ( tnf- ) , major and minor modulators , respectively , of blood plasma c - reactive protein ( crp ) levels . \n l of plasma crp ) increases blood glucose levels ( for review see ) with the cascading impact of hyperglycaemia illustrated above . \n flaxseed lignan complex ( flc ) containing secoisolariciresinol diglucoside ( sdg ) ( and its colonic bacteria metabolites , enterolactone ( enl ) , and enterodiol ( ed ) ) , cinnamic acids ( ca ) , and 3-hydroxy-3-methyl glutaric acid ( hmga ) has been proposed collectively as agents that may manage all seven issues and hence potentially moderate their sequelae . \n dietary lignans ( e.g. , sdg ) have been suggested to control waist circumference in humans and to decrease systolic and diastolic pressure in rats . \n sdg has been shown to decrease triglycerides in rats and increase hdl - c and lower cholesterol in rabbits . \n ed and enl have been proposed to manage oxidation while sdg ingestion reduces inflammation . \n ca are antioxidants that lower platelet reactivity , and hence the prothrombotic state . in animal studies only , \n the objective of the study was to test the hypothesis that flaxseed would safely combat the seven issues ( i.e. , reduce hyperglycaemia , dyslipidemia , hypertension , central obesity , inflammation , ldl oxidation , and the prothombotic state ) thus potentially offering a means of reducing polypharmacy . \n the parameters collectively and singly ( central obesity and prothrombotic tendency ) are a novel investigation of flc in type 2 diabetes management . \n twenty - four subjects who were recruited via a local newspaper advertisement met the inclusion criteria . \n the inclusion criteria were a willingness to follow study protocol , 55 years of age or older , being postmenopausal ( no menstruation for at least one year ) , not on insulin or changing exercise patterns , and healthy aside from type 2 diabetes ( including no liver or kidney disease ) , and absence of change of medication(s ) ( dose and type ) throughout the study . \n during the course of the study , eight patients dropped ( 4 moved away , two were no longer interested in the study , one developed rapidly and deeply fluctuating blood glucose ( just before the start of the study ) , and one developed pruritis ) . \n ethical approval was granted by the cape breton university human ethics committee and all subjects signed informed consent prior to the start of the study . \n the study was a double - blind randomised crossover placebo - controlled study and consisted of four visits each 3 months apart . \n patients were informed of the details of the study , consented , and asked three months prior to visit one and throughout the course of the study to refrain from consuming flaxseed or any of its components . \n all patients were asked to maintain their usual dietary and exercise patterns and stay on all over the counter and prescribed medications ( except for flaxseed or any of its components ) unless directed otherwise by their physician(s ) . at visits 1 to 4 inclusive patients had blood drawn from the antecubital vein and had their weight , height , waist circumference , bleeding time , and blood pressure determined . \n patients then consumed either flc ( 4 capsules600 mg total sdg / day ) or 4 identical looking placebo capsules / day for 3 months . \n flc contained 32.9% sdg , 13.9 percent ca , 11.8% protein , 10.0% hmga , 3.5% fat , 3.3% moisture , and 1% ash . from visit 2 to visit 3 no flc or placebo was administered . at visit 3 \n , patients were switched to whichever intervention to which they had not been exposed from visits 1 to 2 . at visits 2 , 3 , and \n 4 patients turned in all dietary , smoking , exercise , and medication records for the previous 3-month period ( patients were asked at visit 1 to keep such records for three consecutive days every two weeks during the entire trial ) . \n the following measures were carried out ( ( kits and manufacturers in brackets ) following manufacturers ' directions ) : waist circumference , glucose ( wako glucose c2 , wako usa , richmond , va , usa ) , a1c , triglycerides ( l - type triglyceride m , wako usa , richmond , va , usa ) , cholesterol ( cholesterol e kit ( wakousa , richmond , va , usa ) , hdl - c ( precipitation via quantolip hdl , technoclone vienna , austria and cholesterol via cholesterol e kit - wakousa , richmond , va , usa ) , ldl - c ( l- type ldl - c , wakousa , richmond , va , usa ) , sd ldl - c , ldl oxidation ( oxidised ldl elisa kit ( mercodia , winston - salem , north carolina , usa ) , crp ( c - reactive protein ( human eia kit ) , cayman chemical , ann arbor , mi , usa ) , il-6 and tnf- ( quantikine hs elisa kits for human il-6 and tnf- , r and d systems , minneapolis , mn , usa ) , and bleeding times ( surgicutt , itc , edison , nj , usa ) . \n compliance was assessed by blood plasma enterolactone levels ( enterlactone eia kit , cayman chemical , ann arbor , mi , usa ) . \n all blood plasma measures were carried out in duplicate and the values were averaged to give a mean value for each subject at each sampling time point for use in the statistical analysis . \n initially , each dependent variable ( i.e. , univariate ) was assessed by itself using a repeated measures analysis of covariance with subjects as the random factor and age , sex , and order of treatment as covariates . following that a repeated measures linear mixed model analysis of covariance was performed , using subjects as the random factor and age , sex , and order of treatment as covariates , with adjustment for multiple comparisons ( i.e. , over multiple dependent variables ) . \n power was calculated for a 0.4% change in a1c with a sd of 0.3% , a 1- of 90% , a two tailed = 0.05 , and , consistent with other clinical trial work done by the lead author , a 33% dropout rate . \n this dropout rate required 16 patients to finish the study with an initial enrolment of 24 patients . \n baseline characteristics of the sixteen patients who completed the study are found in table 1 . \n subjects were obese , hyperglycemic , dyslipidemic , hypertensive , and prothrombotic ( as measured by reduced bleeding time ) had elevated oxidised ldl and inflammation as measured by crp , il-6 , and tnf-. all comparisons reported are for treatment versus placebo . table 2 shows the impact of flc on hyperglycaemia , dyslipidaemia , blood pressure , bleeding time , oxidised ldl , inflammation , and waist circumference . \n table 2 shows the impact of flc on hyperglycaemia , dyslipidaemia , blood pressure , bleeding time , oxidised ldl , inflammation , and waist circumference . \n fasting blood plasma glucose fell 0.6 mmol upon flc administration and only 0.3 mmol / l in the placebo arm . \n correspondingly , a1c dropped 0.3 percent in the flc arm but showed no change as a result of placebo administration . both blood glucose and \n a1c fell significantly as a result of flc administration compared to placebo for the univariate analysis but not when controlled for multiple comparisons . \n none of the blood lipid / lipoprotein parameters were changed significantly upon flc administration relative to placebo consumption . \n univariate analysis and adjustment for multiple comparisons revealed that neither systolic or diastolic pressures changed significantly as the result of flc versus placebo consumption . \n placebo consumption patients gained 2.1 cm in waist circumference over the three - month period and only 0.6 cm upon flc exposure . in the flc group waist circumference started at 99.5 cm and finished at 100.1 cm while in the placebo group patients began with a waist circumference of 99.4 cm and ended at 101.5 cm . \n adjustments for multiple comparisons indicated better waist circumference management for the patients consuming flc relative to the placebo arm . \n bleeding time was significantly and very substantially increased by 50 seconds ( 224.4 to 274.6 seconds ) as a result of flc administration compared to 6 seconds ( 227 to 233 seconds ) for the placebo consumers ( table 2 ) . \n flc caused a significant reduction in inflammation as measured by univariate analysis of reductions in crp and the main modulator of crp formation , il-6 but not its minor modulator tnf- when controlled for multiple comparisons . \n crp went from 2.4 to 1.9 mg / l of plasma in the flc consumers and did not change from 2.7 mg / l in the placebo group . \n il-6 levels dropped from 4.1 to 3.6 pg / ml while the il-6 measured at 4.3 pg / ml initially in the placebo group ended at 5.4 pg / ml . \n tnf- was consistent at 1.1 pg / ml across the board in the flc and placebo groups . \n however , crp , il-6 , and tnf- levels were not significantly different as the result of adjusting for multiple comparisons when flc was compared to placebo . \n there was no flc treatment impact on ldl oxidation relative to placebo when assessed by univariate analysis . \n over the three - month period there were drops in ldl oxidation levels in both arms of the study from 52.2 to 45.2 ( flc ) and 57.0 to 52.8 u / l ( placebo ) . \n a one - way analysis of variance indicated that flc induced a statistically significant ( p < 0.05 ) rise in enl levels from 1039 175 \n pg / ml to 4638 618 pg / ml while in the placebo group enterolactone levels ranged from 1036 158 ( start of placebo ) to 870 141 pg / ml ( end of placebo ) . \n there was no statistically significant difference between any combination of pre - flc , preplacebo and postplacebo blood plasma enterolactone levels while post - flc values were statistically significantly different ( p < 0.05 ) . \n subjects as a population complied well with the prescribed flc dosage as indicated by the statistically significant rise in enterolactone levels not seen with the placebo . \n as shown in table 3 , there was no statistically significant change in any of the following patterns . \n no patient completing the study changed their prescribed or over the counter medication regimen ( dose or medication ) during the course of the study . \n diet and exercise patterns remained the same throughout the three periods ( visits one to two , visits two to three , and visits three to four ) . \n univariate analysis revealed that both blood glucose and a1c fell significantly as the result of flc administration compared to placebo . \n the fasting glucose drop has been observed using flc in hypercholesterolaemic but otherwise healthy subjects using 600 mg / d sdg at 6 and 8 weeks . \n ( 2007 ) did not show a drop in blood glucose in type 2 diabetics using flc ( 360 mg sdg / day ) for 12 weeks but did show a very mild drop in a1c levels ( decrease of 0.11 a1c percentage points ) . \n the higher dose in the current study produced a more dramatic drop in a1c ( 0.3 a1c percentage points ) consistent with the significant drop seen in fasting glucose levels . \n larger numbers of subjects may reveal statistically significant drops in both these parameters corrected for multiple comparisons . \n this is consistent with other though lower sdg dose flc studies in human type 2 diabetics and in healthy normolipidaemic postmenopausal women receiving flc ( 500 mg sdg / day ) in the form of muffins for 6 weeks relative to placebo . \n however , zhang et al . ( 2008 ) administering a dose of 600 mg / day sdg for 8 weeks found a decrease relative to placebo in cholesterol , ldl - c , and the total cholesterol : hdl - c ratio in humans with hypercholesterolaemia and hypertriglyceridaemia but who were otherwise healthy . \n found no change in any lipid parameters with 20 mg / day sdg administered in the form of flaxseed lignan extract for 12 weeks relative to placebo and only a drop in the ldl - c - to - hdlc ratio relative to placebo . \n sd - ldlc and hdlc normally change in the same and opposite directions , respectively , as triglycerides . \n as there was no change in triglycerides it is not surprising that sd - ldlc and hdlc did not change as the result of flc ingestion . \n cholesterol and ldl - c levels were normal and generally nutraceuticals are more successful with managing elevated levels of these parameters . in terms of systolic and diastolic blood pressures , \n flc and placebo both showed a downward trend from their introduction to finish of application . \n ( 2007 ) in type 2 diabetics despite a higher flc dose in the current study . \n the pre - flc / placebo systolic pressures were somewhat higher and the diastolic pressures marginally lower in the pan et al . \n it may be that higher pressures are required initially before an flc treatment effect can be seen . \n cornish et al . ( 2009 ) showed , in a study subset , that those with metabolic syndrome with diastolic pressures averaging 88.7 mm hg , the flc dose of 543 mg / day for 6 months yielded a decrease in diastolic pressure . \n regardless of metabolic syndrome status males but not females showed a decrease in diastolic pressure ( initial level for diastolic pressure in males was 86 mm hg ) . \n in the current study , univariate analysis revealed a p value of 0.115 for the drop in the diastolic pressure but like the results of cornish et al . \n ( 2009 ) , there was nowhere close to significance of any change in systolic pressures ( again , systolic pressures were similar between the current study and cornish et al . \n thus , greater numbers of subjects with elevated diastolic pressures in a future study might yield a statistically significant drop in that pressure in type 2 diabetics . \n flc produced a significantly different management of waist circumference in both univariate and multiple comparisons analysis . \n this is the first reported finding of such and may be due to lignan consumption in general being correlated with reduced waist circumferences . \n . indicated that sdg lowered fat gain in mice consistent with the observation herein of lowered waist circumference in the flc compared to placebo arm . decreased bleeding time \n is associated with the prothrombotic state seen in type 2 diabetics . bleeding time is negatively associated with thromboxane b2 formation during whole blood platelet aggregation and in vitro platelet aggregation in type 2 diabetics . \n thrombosis risk is enhanced in type 2 diabetes due to hyperglycaemia , dyslipidaemia and increased inflammation ( for review see ) . \n interestingly , in the current study , when univariate analysis was performed , hyperglycaemia and inflammation ( as measured by crp reduction ) were reduced while dyslipidaemia was not changed . \n this implies that the impact on prothrombotic reduction was due to a reduction in hyperglycaemia and inflammation . \n as thrombus / embolus formation frequently induces myocardial infarction and stroke , the major causes of death and disability in type 2 diabetics , one might suggest that there is potential benefit in the reduction of the prothrombotic state by flc ; certainly this is worthy of further investigation . in the current study , \n the significantly increased bleeding time and resultant reduction in the prothrombotic state were as a result of flc administration , a novel observation . \n this may have been due to the presence of cinnamic acids which have been suggested to decrease platelet reactivity . \n enterolactone may also reduce platelet glycoprotein iib / iiia expression which would lower platelet aggregation . \n flc caused a significant reduction in inflammation as measured by reductions in crp and the main modulator of crp formation , il-6 when only univariate analysis was used . \n the drop in il-6 in the current study using univariate analysis contrasts with an absence of change with a similarly dosed and statistically analysed older but healthy adult population . \n 2008 ) showed no changes in crp , il-6 , or tnf- as a result of flc ( 500 mg sdg / day ) for 6 weeks to postmenopausal women using a similar univariate analysis ( unadjusted for multiple comparisons ) . \n ( 2009 ) administering flc ( 360 mg sdg / day ) to type 2 diabetics for 12 weeks in a study of similar design to the current study found that crp level rises were reduced relative to placebo and there were no treatment changes in il-6 or tnf- relative to placebo ( again uncorrected for multiple comparisons ) . \n it may also be that the somewhat higher crp and il-6 levels in the current study as compared to those reported by pan et al . \n while these crp and il-6 statistically significant differences disappeared due to adjustment for multiple comparisons it should be pointed out that a number of studies have shown that flcs reduce crp . \n this was the first study to show that at doses higher than 300 mg sdg / day it is the il-6 and not the tnf- modulating the blood plasma glucose concentration reduction in type 2 diabetics as a result of flc consumption . il-6 and tnf- are major and minor factors , respectively , \n plasma crp levels partially regulate plasma glucose concentrations ( for review see ) and represent an index of plaque stability . \n the reduction in crp by univariate analysis is consistent with reduced blood glucose levels and suggests better plaque stability . \n increased ldl oxidation as measured by the ldl oxidation elisa used in this study is associated with cardiovascular disease and stroke risk [ 36 , 37 ] . \n there was no treatment impact on ldl oxidation for the 16 patients who completed the trial . \n thus , cardiovascular disease risk associated with oxidised ldl was not reduced using this flc complex dose for 3 months in this population . \n ( 2006 ) showed no change in serum lipoprotein oxidation lag time as a result of flc ( 500 mg sdg / day ) for 6 weeks to postmenopausal women . \n thus , in the current study population , an absence of change in oxidised ldl can not contribute to the lowered cardiovascular disease and stroke risk suggested by increased bleeding time , as well as improved management of central obesity and potentially hyperglycaemia . \n completing the study changed their medication regimen ( dose or medication ) or absence thereof at any point during the study . \n thus dietary patterns , smoking , medication , and physical activity patterns have not contributed to the results indicating that differences are due solely to the flc . \n it is concluded that this flc given at a dose of 600 mg sdg / day for three months combats in a statistically significant fashion , in this study population , waist circumference ( central obesity ) gain , and the prothrombotic state and hence potentially the risk of myocardial infarction and stroke . \n it is important to note that these changes took place despite the consistent consumption of various medications concurrently used to combat these issues . \n however , in addition , much larger numbers of subjects may reveal decreases in glucose and a1c , crp , and il-6 levels using the same protocol with adjustments for multiple comparisons . \n thus , this is the first published indication of the potential for any agent to reduce polypharmacy in terms of the combination of waist circumference and prothrombotic tendency management and to hint at the potential at simultaneous management of hyperglycaemia via reduced inflammation in terms of potentially reduced crp and its major driver il-6 . \n it is also concluded that this flc dose for the three - month timeframe in this population does not impact the blood pressure or tc : hdl - c ratio or any of its lipid / lipoprotein contributors to that ratio . \n however , it must be very strongly cautioned that this was a small study . a more definitive answer to the question as to \n whether this unique flc will match or exceed the benefits of reduced vascular complications resulting from polypharmacy used to address the unique combination of hyperglycaemia , waist circumference , prothrombotic state , and inflammation remains to be determined from a much larger multicentre , longer term trial planned by this laboratory using the same protocol . \n of course , ultimately only complete flc substitution for such medications addressing hyperglycaemia , waist circumference , the prothrombotic state and inflammation will address the issue of potential reduced polypharmacy directed at these four issues ; that trial will be carried out upon successful indications of such from the larger study mentioned immediately above . \n it is particularly intriguing that flc appears to have the potential to reduce the inflammation contributing to plaque rupture and hence the prothrombotic tendency , the last chance to stop the cascade before myocardial infarction or stroke , all apparently with minimal side effects or other complications .", "role": "user" }, { "content": "aim . \n animal and human study evidence supports the hypothesis that flaxseed lignan complex ( flc ) at a dose of 600 mg secoisolariciresinol diglucoside ( sdg)/day for three months would combat hyperglycaemia , dyslipidemia , blood pressure , central obesity , prothrombotic state , inflammation , and low density lipoprotein ( ldl ) oxidation \n . methods . sixteen type 2 diabetic patients completed this double - blind , randomised crossover placebo - controlled study . \n a univariate repeated measures analysis of covariance ( significance p < 0.05 ) was followed by a mixed linear model effects analysis corrected for multiple comparisons ( mcc ) . results . prior to mcc , \n flc caused decreased fasting plasma glucose , a1c , inflammation ( c - reactive protein ( crp ) and interleukin-6 ( il-6 ) ) , and increased bleeding time . \n after correction for multiple comparisons , flc induced a statistically significant increase in bleeding time and smaller waist circumference gain . \n no treatment effect occurred in the other variables before or after adjustment . conclusions . \n it is concluded that flc significantly increased bleeding time thus reducing the prothrombotic state , reduced central obesity gain as measured by waist circumference , and did not affect significantly the other dependent variables measured after adjustment for multiple comparisons . \n these findings , not yet published in human type 2 diabetes , suggest that this flc dose over at least three months , may , subject to further investigation , reduce polypharmacy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the framingham heart study ( fhs ) design and methods have been described ( 19 ) . \n briefly , the original cohort was recruited from framingham , massachusetts , in 1948 to identify risk factors for cardiovascular disease . in 1971 , the study enrolled a second - generation cohort ( gen 2):5,124 of the original participants adult children and their spouses . \n the men of this framingham offspring study cohort who attended examination 7 ( 19982001 ) were eligible for the current study ( n = 1,625 ) . men with missing estrone and estradiol measurements ( n = 159 ) , those with prostate cancer undergoing androgen deprivation therapy ( n = 5 ) , and those with missing diabetes data at examination 7 ( n = 3 ) were excluded , resulting in a sample size of 1,458 for the cross - sectional analyses . for analyses of incident t2 dm , the subset of men who attended examination 8 ( 20052008 ) was examined . the median time between examination 7 and 8 assessments was 6.8 years . for this analysis \n , we excluded men who had existing t2 dm at examination 7 ( n = 226 ) , those who did not attend examination 8 ( because of death or loss to follow - up ) , and those who lacked a t2 dm assessment at examination 8 ( n = 201 ) . the longitudinal analysis was therefore restricted to 1,031 men . \n subjects were considered to have t2 dm if their fasting glucose levels exceeded 125 mg / dl or they reported use of medication to control t2 dm . \n subjects were considered to have normal glucose levels if they had fasting blood glucose < 100 mg / dl without medication ; they were considered to have ifg if fasting blood glucose was between 100 and 125 mg / dl in the absence of t2 dm treatment . \n a subject was deemed to have cardiovascular disease if he had coronary artery disease ( angina pectoris , myocardial infarction , or sudden or nonsudden death attributable to coronary artery disease ) , congestive heart failure , cerebrovascular disease ( stroke or transient ischemic attack ) , or intermittent claudication . \n cancer was ascertained by self - report of physician diagnosis , supported by medical records when available . \n the men who reported smoking at least one cigarette per day during the previous year were categorized as current smokers . alcohol consumption was measured and expressed in terms of ounces consumed per month ; \n as in previous analyses , subjects were categorized into those who consumed no alcohol , those who consumed between 1 and 14 oz / month , and those who consumed > 14 oz / month . the fhs samples were obtained between 7:30 and 9:30 a.m. after an overnight fast , aliquoted , frozen immediately , and stored at 80c until the time of assay . at offspring examination 5 in 19911995 , the stability of these fhs samples in storage was evaluated by measuring the concentrations of cholesterol , hdl cholesterol , and triglycerides before freezing and storage at 80c and then repeating the measurement in 2007 ( 20 ) . \n serum estradiol and estrone were measured with a highly sensitive lc - ms / ms assay . \n estrone - d4 and estradiol - d5 ( 20 l each ) were added to 200 l serum samples , extracted with methyl t - butyl ether ( 21,22 ) , derivatized with dansyl chloride ( 3.7 mmol / l ) in sodium carbonate ( 10 mmol / l , ph10.5 ) at 60c for 10 min , and diluted in acetonitrile and water , and the samples were analyzed on api 4000 triple - quadrupole mass spectrometer ( applied biosystems / mds sciex ) with turbo ion spray hplc pumps series 1200 and autosampler htc pal ( leap ) . the mobile phase and mass spectrometry method used has been described previously ( 22 ) . \n interassay coefficients of variation ( cvs ) for estrone were 4.5 , 7.7 , and 6.9% at estrone concentrations of 8 , 77 , and 209 pg / ml , respectively ; interassay cvs for estradiol were 6.9 , 7.0 , and 4.8% at estradiol concentrations of 8 , 77 , and 206 \n free estradiol and estrone concentrations were calculated from a previously published law of mass action solution ( 22,23 ) . \n we measured total testosterone with a validated lc - ms / ms assay ( 24 ) . \n interassay cvs were 15.8 , 7.7 , and 4.4% at 12.0 , 241 , and 532 ng / dl , respectively . \n sex hormone binding globulin ( shbg ) levels were measured with an immunofluorometric assay ( delfia - wallac , inc . , \n interassay cvs were 8.3 , 7.9 , and 10.9% , and intra - assay cvs were 7.3 , 7.1 , and 8.7% in the low , medium , and high pools , respectively . \n descriptive statistics were generated for outcomes , sex hormones , and covariate factors . because of the moderate right skew evident in serum estrone , estradiol , total testosterone , and shbg , these measures were log transformed . \n exploratory assessments of associations were obtained by inspecting the relationship between quartiles of hormones and t2 dm status . \n unadjusted estimates of the relative risk quantifying the cross - sectional relationship between hormones , divided into quartiles , and outcomes were generated with the modified poisson regression approach , which uses the robust variance estimator to avoid bias in interval estimation and corresponding significance tests ( 25 ) . \n covariate - adjusted cross - sectional associations were analyzed with separate polytymous logistic regression models for total and free estrone and estradiol . \n these models simultaneously assessed the odds of ifg and t2 dm in comparison with normal glucose levels . \n the longitudinal associations between baseline hormone levels at examination 7 with the cumulative incidence of t2 dm at examination 8 were assessed with separate regression models for each of the total and free hormones . in this analysis , \n again , the modified poisson regression approach was used to determine unadjusted associations between hormone quartiles and t2 dm status . \n both cross - sectional and longitudinal models considered the roles of age , bmi , smoking , total testosterone , and shbg ( for total hormone levels ) . to enhance clarity , \n results on log - transformed values were back transformed and thus may be interpreted in terms of relative rather than absolute differences in hormone values . \n estimates are scaled such that odds ratios ( ors ) reported here may be interpreted in terms of the apparent effect of a between - person doubling of estrone , estradiol , or testosterone ; that is , ors reported here compare a hypothetical man with any estrone or estradiol level versus a man of similar age and covariates but with half that estrone or estradiol level . \n all analyses were performed with sas version 9.3 ( sas institute , cary , nc ) . \n graphical data displays given here were constructed with r version 2.15.0 ( r foundation for statistical computing , vienna , austria ) . \n the framingham heart study ( fhs ) design and methods have been described ( 19 ) . \n briefly , the original cohort was recruited from framingham , massachusetts , in 1948 to identify risk factors for cardiovascular disease . in 1971 , the study enrolled a second - generation cohort ( gen 2):5,124 of the original participants adult children and their spouses . \n the men of this framingham offspring study cohort who attended examination 7 ( 19982001 ) were eligible for the current study ( n = 1,625 ) . men with missing estrone and estradiol measurements ( n = 159 ) , those with prostate cancer undergoing androgen deprivation therapy ( n = 5 ) , and those with missing diabetes data at examination 7 ( n = 3 ) were excluded , resulting in a sample size of 1,458 for the cross - sectional analyses . for analyses of incident t2 dm , the subset of men who attended examination 8 ( 20052008 ) was examined . the median time between examination 7 and 8 assessments was 6.8 years . for this analysis \n , we excluded men who had existing t2 dm at examination 7 ( n = 226 ) , those who did not attend examination 8 ( because of death or loss to follow - up ) , and those who lacked a t2 dm assessment at examination 8 ( n = 201 ) . the longitudinal analysis was therefore restricted to 1,031 men . \n subjects were considered to have t2 dm if their fasting glucose levels exceeded 125 mg / dl or they reported use of medication to control t2 dm . \n subjects were considered to have normal glucose levels if they had fasting blood glucose < 100 mg / dl without medication ; they were considered to have ifg if fasting blood glucose was between 100 and 125 mg / dl in the absence of t2 dm treatment . \n a subject was deemed to have cardiovascular disease if he had coronary artery disease ( angina pectoris , myocardial infarction , or sudden or nonsudden death attributable to coronary artery disease ) , congestive heart failure , cerebrovascular disease ( stroke or transient ischemic attack ) , or intermittent claudication . \n cancer was ascertained by self - report of physician diagnosis , supported by medical records when available . \n the men who reported smoking at least one cigarette per day during the previous year were categorized as current smokers . alcohol consumption was measured and expressed in terms of ounces consumed per month ; \n as in previous analyses , subjects were categorized into those who consumed no alcohol , those who consumed between 1 and 14 oz / month , and those who consumed > 14 oz / month . \n the fhs samples were obtained between 7:30 and 9:30 a.m. after an overnight fast , aliquoted , frozen immediately , and stored at 80c until the time of assay . at offspring examination 5 in 19911995 , \n the stability of these fhs samples in storage was evaluated by measuring the concentrations of cholesterol , hdl cholesterol , and triglycerides before freezing and storage at 80c and then repeating the measurement in 2007 ( 20 ) . \n serum estradiol and estrone were measured with a highly sensitive lc - ms / ms assay . \n estrone - d4 and estradiol - d5 ( 20 l each ) were added to 200 l serum samples , extracted with methyl t - butyl ether ( 21,22 ) , derivatized with dansyl chloride ( 3.7 mmol / l ) in sodium carbonate ( 10 mmol / l , ph10.5 ) at 60c for 10 min , and diluted in acetonitrile and water , and the samples were analyzed on api 4000 triple - quadrupole mass spectrometer ( applied biosystems / mds sciex ) with turbo ion spray hplc pumps series 1200 and autosampler htc pal ( leap ) . the mobile phase and mass spectrometry method used has been described previously ( 22 ) . \n interassay coefficients of variation ( cvs ) for estrone were 4.5 , 7.7 , and 6.9% at estrone concentrations of 8 , 77 , and 209 pg / ml , respectively ; interassay cvs for estradiol were 6.9 , 7.0 , and 4.8% at estradiol concentrations of 8 , 77 , and 206 \n free estradiol and estrone concentrations were calculated from a previously published law of mass action solution ( 22,23 ) . \n we measured total testosterone with a validated lc - ms / ms assay ( 24 ) . \n interassay cvs were 15.8 , 7.7 , and 4.4% at 12.0 , 241 , and 532 ng / dl , respectively . \n sex hormone binding globulin ( shbg ) levels were measured with an immunofluorometric assay ( delfia - wallac , inc . , \n interassay cvs were 8.3 , 7.9 , and 10.9% , and intra - assay cvs were 7.3 , 7.1 , and 8.7% in the low , medium , and high pools , respectively . \n descriptive statistics were generated for outcomes , sex hormones , and covariate factors . because of the moderate right skew evident in serum estrone , estradiol , total testosterone , and shbg , these measures were log transformed . \n exploratory assessments of associations were obtained by inspecting the relationship between quartiles of hormones and t2 dm status . \n unadjusted estimates of the relative risk quantifying the cross - sectional relationship between hormones , divided into quartiles , and outcomes were generated with the modified poisson regression approach , which uses the robust variance estimator to avoid bias in interval estimation and corresponding significance tests ( 25 ) . \n covariate - adjusted cross - sectional associations were analyzed with separate polytymous logistic regression models for total and free estrone and estradiol . \n these models simultaneously assessed the odds of ifg and t2 dm in comparison with normal glucose levels . \n the longitudinal associations between baseline hormone levels at examination 7 with the cumulative incidence of t2 dm at examination 8 were assessed with separate regression models for each of the total and free hormones . in this analysis , \n again , the modified poisson regression approach was used to determine unadjusted associations between hormone quartiles and t2 dm status . \n both cross - sectional and longitudinal models considered the roles of age , bmi , smoking , total testosterone , and shbg ( for total hormone levels ) . to enhance clarity , results on log - transformed values were back transformed and thus may be interpreted in terms of relative rather than absolute differences in hormone values . \n estimates are scaled such that odds ratios ( ors ) reported here may be interpreted in terms of the apparent effect of a between - person doubling of estrone , estradiol , or testosterone ; that is , ors reported here compare a hypothetical man with any estrone or estradiol level versus a man of similar age and covariates but with half that estrone or estradiol level . \n all analyses were performed with sas version 9.3 ( sas institute , cary , nc ) . \n graphical data displays given here were constructed with r version 2.15.0 ( r foundation for statistical computing , vienna , austria ) . \n the baseline characteristics of men in our cross - sectional and prospective study population are shown in table 1 . as expected from their lack of t2 dm at examination 7 , \n men eligible for analyses of t2 dm incidence were slightly younger than the overall cross - sectional sample . aside from t2 dm , \n however , the morbidity profiles of the cross - sectional and prospective samples were similar . \n the mean total and free estrone and estradiol were similar in men included in the cross - sectional and prospective analyses . \n characteristics of the analytic samples for the cross - sectional and longitudinal analyses at initial observation ( examination 7 ) unadjusted associations between sex hormone quartiles and t2 dm status at examination 7 are presented in table 2 . \n there was a general pattern of increase in prevalence of t2 dm with both estrone and estradiol levels . \n these results were confirmed in analyses of continuous hormone levels and were robust to control for covariates ( table 3 ) . \n after statistical controls for age , bmi , smoking status , shbg , and total testosterone , both estradiol and estrone levels were significantly related to t2 dm status at examination 7 . with other factors held equal , men with elevated estrone and estradiol had an increased likelihood of existing t2 dm : estimated increases in odds of 40% ( cross - sectional or 1.40 [ 95% ci 1.011.95 ] ) and 62% ( 1.62 [ 1.132.32 ] ) per cross - sectional doubling of estrone or estradiol , respectively . \n the free fractions of estrone and estradiol likewise showed multivariate - adjusted associations with t2 dm . in similar models , total testosterone demonstrated an association with t2 dm even after controlling for estradiol levels . \n this finding is in agreement with previously reported results that did not consider estradiol ( 24 ) . \n unadjusted associations between hormone quartiles and diabetes status multiply adjusted cross - sectional and prospective associations between circulating estrogens and ifg or diabetes neither total nor free estradiol demonstrated a cross - sectional association with ifg after adjustment for covariates . \n there was an estimated 28% increase in existing ifg per cross - sectional doubling of free estrone ( cross - sectional or 1.28 [ 95% ci 1.021.62 ] ) ; the corresponding or for total estrone , although similar in magnitude to that for the free fraction , was not statistically significant ( 1.24 [ 0.981.56 ] , p = 0.07 ) . \n the influence of covariate factors on the cross - sectional associations between estrone and estradiol and t2 dm is described in fig . \n 1 . adjusted only for age , total and free estrone were positively associated with existing t2 dm ; these associations were preserved in a model controlling for bmi , smoking , shbg , and total testosterone . \n the trend was similar for total estradiol ; the estimated or was of lesser magnitude , however , and the association was statistically nonsignificant . \n in contrast , only free estrone retained significant association with ifg after controlling for age and bmi alone ( specific submodel not shown ) , and there was no significant association between either total or free estradiol and ifg after controlling for these and other covariates . \n estimated ors ( point estimates and 95% cis are shown ) quantify associations between doubling of total ( ) and free ( ) estrone or estradiol and increases in the prevalence and incidence of t2 dm in cross - sectional analyses including all subjects ( top ) and prospective analyses restricted to those without diabetes at baseline ( bottom ) . \n fully adjusted models control for age , smoking , bmi , and testosterone ; models dealing with total ( but not free ) estrone and estradiol also control for shbg . \n approximately 11% of subjects with normal or ifg and total estrone measurements in the highest quartile had t2 dm at examination 8 , compared with 4.3% percent of subjects in the lowest total estrone quartile . \n a linear trend toward increase in incident t2 dm was observed with increasing quartiles of total estrone levels ( table 2 ) . \n associations between estrone and estradiol measured at examination 7 and t2 dm status at examination 8 , obtained from data on men who were not diabetic at examination 7 , are presented in table 3 and fig . \n both total and free estrone as well as total estradiol were significantly associated with incident t2 dm at examination 8 . \n models considering estrone that adjusted for all covariates were robust , indicating increased risk of incident t2 dm among men with elevated total or free estrone levels at examination 7 . \n this model indicates that , compared with a man of similar age and morbidity profile but with half his circulating total or free estrone at examination 7 , a man would have estimated 77% ( longitudinal or 1.77 [ 95% ci 1.082.90 ] ) and 93% ( 1.93 [ 1.173.19 ] ) increases in odds of incident t2 dm during approximately 7 years . \n total estradiol levels were not significantly associated with incident t2 dm , and results for free estradiol were equivocal ( 1.59 [ 0.992.57 ] , p = 0.06 ) . \n the baseline characteristics of men in our cross - sectional and prospective study population are shown in table 1 . as expected from their lack of t2 dm at examination 7 , \n men eligible for analyses of t2 dm incidence were slightly younger than the overall cross - sectional sample . aside from t2 dm , \n however , the morbidity profiles of the cross - sectional and prospective samples were similar . \n the mean total and free estrone and estradiol were similar in men included in the cross - sectional and prospective analyses . \n characteristics of the analytic samples for the cross - sectional and longitudinal analyses at initial observation ( examination 7 ) \n unadjusted associations between sex hormone quartiles and t2 dm status at examination 7 are presented in table 2 . \n there was a general pattern of increase in prevalence of t2 dm with both estrone and estradiol levels . \n these results were confirmed in analyses of continuous hormone levels and were robust to control for covariates ( table 3 ) . \n after statistical controls for age , bmi , smoking status , shbg , and total testosterone , both estradiol and estrone levels were significantly related to t2 dm status at examination 7 . with other factors held equal , men with elevated estrone and estradiol had an increased likelihood of existing t2 dm : estimated increases in odds of 40% ( cross - sectional or 1.40 [ 95% ci 1.011.95 ] ) and 62% ( 1.62 [ 1.132.32 ] ) per cross - sectional doubling of estrone or estradiol , respectively . \n the free fractions of estrone and estradiol likewise showed multivariate - adjusted associations with t2 dm . in similar models , \n this finding is in agreement with previously reported results that did not consider estradiol ( 24 ) . \n unadjusted associations between hormone quartiles and diabetes status multiply adjusted cross - sectional and prospective associations between circulating estrogens and ifg or diabetes neither total nor free estradiol demonstrated a cross - sectional association with ifg after adjustment for covariates . \n there was an estimated 28% increase in existing ifg per cross - sectional doubling of free estrone ( cross - sectional or 1.28 [ 95% ci 1.021.62 ] ) ; the corresponding or for total estrone , although similar in magnitude to that for the free fraction , was not statistically significant ( 1.24 [ 0.981.56 ] , p = 0.07 ) . \n the influence of covariate factors on the cross - sectional associations between estrone and estradiol and t2 dm is described in fig . \n 1 . adjusted only for age , total and free estrone were positively associated with existing t2 dm ; these associations were preserved in a model controlling for bmi , smoking , shbg , and total testosterone . \n the trend was similar for total estradiol ; the estimated or was of lesser magnitude , however , and the association was statistically nonsignificant . \n in contrast , only free estrone retained significant association with ifg after controlling for age and bmi alone ( specific submodel not shown ) , and there was no significant association between either total or free estradiol and ifg after controlling for these and other covariates . \n estimated ors ( point estimates and 95% cis are shown ) quantify associations between doubling of total ( ) and free ( ) estrone or estradiol and increases in the prevalence and incidence of t2 dm in cross - sectional analyses including all subjects ( top ) and prospective analyses restricted to those without diabetes at baseline ( bottom ) . \n fully adjusted models control for age , smoking , bmi , and testosterone ; models dealing with total ( but not free ) estrone and estradiol also control for shbg . \n approximately 11% of subjects with normal or ifg and total estrone measurements in the highest quartile had t2 dm at examination 8 , compared with 4.3% percent of subjects in the lowest total estrone quartile . \n a linear trend toward increase in incident t2 dm was observed with increasing quartiles of total estrone levels ( table 2 ) . \n associations between estrone and estradiol measured at examination 7 and t2 dm status at examination 8 , obtained from data on men who were not diabetic at examination 7 , are presented in table 3 and fig . \n both total and free estrone as well as total estradiol were significantly associated with incident t2 dm at examination 8 . \n models considering estrone that adjusted for all covariates were robust , indicating increased risk of incident t2 dm among men with elevated total or free estrone levels at examination 7 . \n this model indicates that , compared with a man of similar age and morbidity profile but with half his circulating total or free estrone at examination 7 , a man would have estimated 77% ( longitudinal or 1.77 [ 95% ci 1.082.90 ] ) and 93% ( 1.93 [ 1.173.19 ] ) increases in odds of incident t2 dm during approximately 7 years . \n total estradiol levels were not significantly associated with incident t2 dm , and results for free estradiol were equivocal ( 1.59 [ 0.992.57 ] , p = 0.06 ) . \n the roles of estrone and estradiol in men s health remain poorly understood . in our analyses , elevated total and free estradiol as well as estrone levels were associated with existing t2 dm . \n these associations were preserved in fully adjusted models that incorporated a control for total testosterone . \n these models therefore provide some evidence of a testosterone - independent association between circulating estrogens and t2 dm in men . \n in contrast , in longitudinal analyses , only the estrone levels were predictive of incident t2 dm . \n estrone thus may more sensitively capture t2 dm risk , expressed either as concurrent prediabetic illness ( i.e. , ifg ) or as incident t2 dm . \n the lack of significant association between estradiol and incident t2 dm is consistent with findings reported in the rancho bernardo study ( 5,14 ) . \n the relationship between estrogens and t2 dm has been recognized in women but not in men . \n epidemiologic studies in postmenopausal women have found lower fasting glucose levels and a lower incidence of t2 dm in women taking hormone therapy than in those not taking hormone therapy ( 2628 ) . \n randomized trials , such as the heart and estrogen / progestin replacement study ( hers ) , postmenopausal estrogen / progestin interventions ( pepi ) , and the women s health initiative ( whi ) ( 810 ) , have reported a lower incidence of t2 dm and lower fasting glucose levels in postmenopausal women assigned to hormone therapy than in those assigned to placebo . \n genetic disruption of er but not estrogen receptor ( er ) in mice is associated with the development of adiposity , insulin resistance , and t2 dm ( 11 ) . \n these observations have led to speculation that er signaling regulates insulin sensitivity through a number of direct and indirect mechanisms , including alterations in insulin secretion and signaling , body composition and adipose biology , neuronal activity within specific hypothalamic nuclei ( 29 ) , and additional effects on growth hormone and catecholamine secretion . in the context of these observations in female mice and women , \n it is interesting that in community - dwelling men in this study estrone , but not estradiol , levels were prospectively associated with incident t2 dm . \n physiologically , the significant association between estrone but not estradiol and the risk of t2 dm could be potentially explained by the differential actions of estrone on er and er ( 30,31 ) . \n estrone and 17-estradiol each have been shown to bind both er and er , although 17-estradiol has greater affinity and activity than estrone in many in vitro assays . \n the ligand specificity of various estrogens is reflected in the diverse pharmacologic effects of estrogen receptor modulators . \n for instance , in randomized trials women treated with tamoxifen had an increased risk of t2 dm relative to those treated with placebo . \n in contrast , raloxifen administration has not been associated with an increased risk of t2 dm ( 32 ) . \n although the exact mechanistic basis of the diverse effects of estrogen receptor modulators remains unknown , the estrogen receptor subtype specificity of various estrogen receptor ligands may contribute to their differential pharmacologic effects . \n although estrone is a weaker estrogen than estradiol in some bioassays , circulating estrone levels in men are higher than those of estradiol . \n we speculate that the association of estrone but not estradiol with t2 dm may be related to the differential activity of these two ligands in estrogen receptor subtypes . whether estrone exerts additional nongenomic effects on insulin secretion or sensitivity is not known . \n we measured estrone and estradiol levels with lc - ms / ms , widely considered the reference method with the highest specificity and sensitivity ( 18 ) . \n the prospective design of the analyses strengthens the inferences that can be drawn from these analyses . \n the cohort included community - dwelling men across a wide age range , from 19 to 89 years , and a follow - up of approximately 7 years . \n the fhs population is predominantly white , and these findings may not be generalizable to other populations . \n estrone and estradiol levels were measured in single morning samples and thus may not reflect hormone levels over a longer period . with single hormone measurements , we were able to estimate the apparent association of between - person differences with differential downstream risk of t2 dm but could not directly capture the association of within - person changes with changes in t2 dm status . \n survival bias could contribute to the divergence in the apparent cross - sectional association of hormone levels with t2 dm but not with ifg . \n we recognize that fasting glucose alone may fail to diagnose some cases of t2 dm and that a 2-h oral glucose tolerance test is a more sensitive indicator of t2 dm ( 33,34 ) . \n it is therefore possible that some cases of t2 dm may have been missed because an oral glucose tolerance test was not performed . in conclusion , \n estrone but not estradiol levels were associated with increased risk of incident t2 dm in a cohort of community - dwelling men . \n future studies should test and confirm this relationship between estrone and t2 dm in older men in other populations and investigate the mediating mechanisms .", "role": "user" }, { "content": "objectivein postmenopausal women and preclinical murine models , estrogen administration reduces diabetes risk ; however , the relationship of estradiol and estrone to diabetes in men is poorly understood . \n we determined the relationship between circulating estradiol and estrone levels and diabetes risk in community - dwelling men of the framingham heart study ( fhs).research design and methodscross - sectional relationships of estradiol and estrone levels with diabetes were assessed at examination 7 ( 19982001 ) in fhs generation 2 men ( n = 1,458 ) ; prospective associations between hormone levels at examination 7 and incident diabetes were assessed 6.8 years later at examination 8 . \n type 2 diabetes mellitus was defined as fasting glucose > 125 mg / dl , medication use , or both . \n estradiol , estrone , and testosterone levels were measured with liquid chromatography tandem mass spectrometry , and free estradiol and estrone were calculated.resultsin cross - sectional models , men with elevated estrone and estradiol had 40% and 62% increased likelihoods of existing diabetes per cross - sectional doubling of estrone and estradiol levels , respectively . \n free estrone ( cross - sectional odds ratio 1.28 [ 95% ci 1.021.62 ] , p = 0.04 ) was associated with impaired fasting glucose at examination 7 . \n there was an increase in risk of existing diabetes with increasing quartiles of total and free estrone and estradiol and an increase in risk of incident diabetes with increasing quartiles of estrone levels . \n in multivariate longitudinal analyses , a twofold increase in total or free estrone levels at examination 7 was associated with 77 and 93% increases , respectively , in odds of incident diabetes at examination 8.conclusionsalthough both estradiol and estrone exhibit cross - sectional associations with diabetes in men , in longitudinal analyses estrone is a more sensitive marker of diabetes risk than is estradiol .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the involvement of iron in a number of physiological functions , such as a cofactor for enzymes or an electron acceptor in anaerobic respiration , of most organisms has been recognized . however , most of the metabolic functions of iron require the fe(ii ) oxidation state which is more soluble and , therefore , more bioavailable than the fe(iii ) form . \n one of the strategies bacteria have evolved for assimilation and utilization of iron is the reduction of fe(iii ) to fe(ii ) . \n bacterial iron reduction has been studied extensively and various biomolecules responsible for fe(iii ) reduction have been discovered . \n fe(iii ) reductases involved in anaerobic respiration are either secreted into the extracellular medium or localized in the cell membrane . \n nonetheless , most of the known fe(iii ) reductases have been found to be soluble , residing in either the cytoplasm or the periplasmic space . \n further , based on the fact that fe(iii ) is solubilized by chelators it has been suggested that even soluble fe(iii ) reductase could participate in anaerobic respiration . \n they have been shown to be oxidoreductases transferring electrons from nadh or nadph to fe(iii ) with flavin mononucleotide ( fmn ) , flavin adenine nucleotide ( fad ) , or riboflavin as the cofactor . \n they are in fact flavin reductases capable of reducing ferric compounds . in the bacterium clostridium \n kluyveri an nad(p)h - dependent flavoenzyme dihydrolipoyl dehydrogenase ( synonymously called dihydrolipoamide dehydrogenase ) reduces fe(iii ) complexes of citrate , atp , and adp . in thermus scotoductus sa-01 and magnetospirillum gryphiswaldense msr-1 thioredoxin reductases , which belong to the family of pyridine nucleotide - disulfide oxidoreductases , \n we have earlier reported that a low - gc content gram - positive thermoanaerobacter - like bacterium ( now designated as thermoanaerobacter indiensis bsb-33 ) reduces fe(iii ) and cr(vi ) anaerobically at 60c optimally . \n taking advantage of this we have attempted to identify the soluble proteins which are involved in fe(iii ) reduction by a combination of chromatography and mass spectrometry ( ms ) . \n bioinformatic analysis has also been carried out to find sequence and three - dimensional structural similarity of these proteins with known cr(vi ) reductases . \n t. indiensis bsb-33 ( atcc baa-2171 ) cells were grown anaerobically in luria - bertani ( lb ) medium at 60c in hungate bottles under 100% n2 atmosphere . \n fe(iii ) reduction assay was performed by a modification of the procedure of kaufmann and lovley under anaerobic conditions at 60c in a mixture containing 50 mm hepes ( ph 7.0 ) , 1 mm fe(iii)-citrate , 1 mm nadh , 1 mm ferrozine , and 30 to 100 g of protein . \n one unit ( u ) is defined as the amount of enzyme reducing 1 mol of fe(iii ) per min . \n cr ( vi ) reduction assay was carried out anaerobically at 60c as described earlier . \n in - gel fe(iii ) reduction assay was done by 10% nondenaturing polyacrylamide gel electrophoresis ( page ) of protein fractions . \n cells were harvested by centrifugation at 400 g for 10 min and washed twice in n2-saturated tris - hcl buffer ( ph 7.0 ) containing 75 mm nacl , 75 mm kcl , 20 mm mgcl2 , and 0.1 mm dithiothreitol . \n 10 g of wet cells was resuspended in 70 ml of the same buffer , 200 l dnase i ( 20 mg / ml ) and 40 l rnase i ( 20 mg / ml ) were added , and the suspension was stirred on ice for 1 h. cells were disrupted by three passages through a french pressure cell at 8,000 psi . \n the crude lysate was centrifuged at 10,000 g for 30 min at 4c and the supernatant was removed and centrifuged at 100,000 g for 1 h at 4c . \n the supernatant was used as the soluble fraction whereas the pellet was resuspended in 50 mm tris - hcl , ph 7.0 , to be treated as the membrane fraction . \n the soluble fraction was concentrated by ammonium sulfate precipitation ( 30 to 80% ) and applied to a superdex 200 prep grade column ( 1.6 60 cm ; amersham pharmacia biotech ) equilibrated with n2-saturated 50 mm tris - hcl ( ph 7.0 ) containing 75 mm nacl , 75 mm kcl , 20 mm mgcl2 , and 2 mm cacl2 . \n the fractions containing fe(iii ) reductase activity were pooled , diluted fourfold , and applied to a hitrap q hp sepharose column ( 1.6 2.5 cm ; ge healthcare life sciences ) equilibrated with 20 mm tris - hcl ( ph 7.5 ) . \n the fractions containing maximum fe(iii ) reductase activity were pooled , dialyzed in 10 mm sodium phosphate buffer , ph 6.8 , and applied to a ht hydroxyapatite column ( 1 15 cm ; biorad ) equilibrated with the same buffer . \n bound proteins were eluted with a linear gradient of 10200 mm sodium phosphate buffer , ph 6.8 . \n active fractions were dialyzed in 20 mm tris - hcl , ph 7.0 , and applied to a mono q column ( 0.5 5 cm ; ge healthcare life sciences ) equilibrated with 20 mm tris - hcl , ph 7.0 , and 0.1 m nacl . \n proteins were eluted using a linear gradient of 0.10.5 m nacl in 20 mm tris - hcl , ph 7.0 . \n ms and protein identification were carried out at scripps center for metabolomics and mass spectrometry . \n identification was performed by mascot software ( matrix science ) searches against a database consisting of t. indiensis proteome sequences obtained from http://www.jgi.doe.gov . \n three - dimensional ( 3d ) structures of proteins were built from amino acid sequences using automated homology modeling program esypred3d that is based on a very efficient alignment strategy and the modeller package to build the final structural model [ 11 , http://www.expasy.org/proteomics/protein_structure ] . \n 3d structures were compared using dalilite [ 12 , http://www.ebi.ac.uk/tools/structure/dalilite ] and pdbefold [ 13 , http://www.ebi.ac.uk/msd-srv/ssm/cgi-bin/ssmserver ] . for visualization and superposition of 3d structures \n crude extracts of the thermophilic bacterium t. indiensis reduced fe(iii)-citrate with nadh as the electron donor . \n the specific activity of reduction measured at 60c was 0.052 mol minmg protein ( table 1 ) . \n on fractionation both the soluble and membrane fractions were found to contain fe(iii ) reductase activity . however , 76% of the nadh - dependent fe(iii ) reductase activity in the crude cell extracts was recovered in the soluble fraction ( table 1 ) . \n the specific fe(iii ) reductase activity in the soluble fraction was also about threefold higher than that in the membrane fraction ( table 1 ) . the soluble extract resolved by nondenaturing page produced four distinct fe(iii ) reductase activity bands 14 ( figure 1 ) . in order to identify the protein(s ) responsible for each of the fe(iii ) reductase activities a four - step chromatographic procedure was followed . \n the activities were separated from each other by passing sequentially through superdex 200 , q sepharose , hydroxyapatite , and mono q columns . \n the gel filtration step could resolve activities 1 and 2 from activities 3 and 4 ( figure 1 ) . \n however , in this step activity 1 could not be resolved completely from activity 2 and , similarly , activity 3 could not be separated from activity 4 ( figure 1 ) . in the second step gel filtration fraction 7 showing a more intense activity 1 band than activity 2 was passed through a q sepharose ion - exchange column . \n q sepharose fraction 8 was found to contain the maximum activity 1 free from activity 2 ( figure 2(a ) ) . \n similarly , gel filtration fraction 9 which showed greater activity 2 than activity 1 was loaded on a q sepharose column . \n fraction 6 from q sepharose contained activity 2 free from activity 1 as shown in the zymogram ( figure 2(b ) ) . in a similar manner q sepharose chromatography \n could also resolve activity 3 and activity 4 from gel filtration fraction 12 ( figure 2(c ) ) . in order to purify each of the four activities from nonferric reductase proteins respective q sepharose fractions \n the number of background protein bands was reduced . however , none of the four activities could be completely purified from nonferric reductase protein background ( data not shown ) . hence , \n after the mono q step the protein bands showing fe(iii ) reductase activity in preparative nondenaturing gels were excised and analyzed by ms which has the capability to identify multiple proteins from a mixture [ 15 , http://masspec.scripps.edu/services/proteomics/dataanal.php ] . \n ms spectra obtained from band 1 matched against two dihydrolipoamide dehydrogenases ( lpds ) in t. indiensis with high mascot scores ( table 2 ) . \n the two proteins contain 469 ( lpd1 ) and 551 ( lpd2 ) amino acid residues , respectively . \n 3d structures of lpd1 and lpd2 were predicted by esypred3d which used geobacillus stearothermophilus dihydrolipoamide dehydrogenase crystal structure ( pdb i d 1ebd ) as the template ( table 3 ) . \n high sequence similarity and 3d structural identity were found between the two proteins ( table 4 ) . \n lpds belong to pyridine nucleotide - disulfide oxidoreductase family and are found in many species as a part of pyruvate dehydrogenase complex . in \n the bacterium clostridium kluyveri dihydrolipoyl dehydrogenase ( synonymously called dihydrolipoamide dehydrogenase ) bfmbc reduces fe(iii ) complexes of citrate , atp , and adp in an nad(p)h - dependent manner . \n it has been proposed that in c. kluyveri nadh transfers a hydride ion to enzyme - bound flavin and fadh2 thus produced donates an electron to ferric chelates . \n ncbi blast showed 37% and 39% sequence similarity of c. kluyveri bfmbc with t. indiensis lpd1 and lpd2 , respectively ( table 4 ) . \n esypred3d also predicted the 3d structure of bfmbc using geobacillus stearothermophilus dihydrolipoamide dehydrogenase crystal structure ( pdb i d 1ebd ) as the template ( table 3 ) . \n both lpd1 and lpd2 were found to be identical to bfmbc by 3d structural alignment ( table 4 ) . \n further , the two t. indiensis proteins as well as c. kluyveri bfmbc contain the most conserved fad - binding sequence motif xhxhgxgxxgxxxhxxh(x)8hxhe(d ) , where x is any residue and h is a hydrophobic residue , as a part of the rossmann fold . \n hence , it was expected that like the c. kluyveri enzyme either of the t. indiensis lpds would be able to reduce fe(iii ) complexes which is consistent with the zymogram result ( figure 1 ) . among the high - scoring matches obtained by ms of the protein mixture from band 2 the only t. indiensis protein likely to possess fe(iii ) reductase activity is thioredoxin reductase ( trx ) . \n thioredoxin reductase - like ferric reductase ( fes ) as well as typical thioredoxin reductase ( trx ) is also present in t. scotoductus sa-01 . \n both t. scotoductus enzymes can reduce fe(iii)-nta complex although reduction by trx is less efficient . \n magnetospirillum gryphiswaldense msr-1 thioredoxin reductase fer5 has also been shown to possess ferric reductase activity . \n t. indiensis trx showed 29% sequence similarity ( 92% query coverage ) with t. scotoductus trx and 24% sequence similarity ( 95% query coverage ) with m. gryphiswaldense fer5 by blast analysis ( table 4 ) . \n esypred3d program predicted the 3d structures of t. indiensis trx and m. gryphiswaldense fer5 by using escherichia coli thioredoxin reductase crystal structure ( pdb i d 1cl0 ) as the template and the 3d structure of t. scotoductus trx by using deinococcus radiodurans thioredoxin reductase crystal structure ( pdb i d 2q7v ) as the template ( table 3 ) . \n pdbefold and dalilite analyses also found significant structural identity of t. indiensis trx with t. scotoductus trx as well as m. gryphiswaldense fer5 ( table 4 ) . in spite of such structural similarity with other thioredoxin reductases , \n it may be questioned if this enzyme could at all reduce thioredoxin and be called a thioredoxin reductase . however , interproscan showed that it contains a fad / nad(p)-binding domain . \n it could possibly catalyze electron transfer from nad(p)h to fad and the reduced flavin could , in turn , reduce fe(iii ) substrate . \n in fact , in case of t. scotoductus fes absence of cxxc has been found to be advantageous with respect to fe(iii ) reduction . \n ms with samples extracted from band 3 showed the presence of t. indiensis nad(p)h - nitrite reductase which was the only protein in the mixture likely to be an fe(iii ) reductase . \n interproscan identified a fad / nad(p)-binding domain in the protein and suggested that it belonged to pyridine nucleotide - disulfide oxidoreductase family of proteins . \n blast analysis found significant sequence similarity of t. indiensis nitrite reductase to nad(p)h - nitrite reductases from clostridium tetani , bacillus cereus , and heliobacterium modesticaldum ( data not shown ) . \n domain analysis showed that all these nitrite reductases belonged to the pyridine nucleotide - disulfide oxidoreductase family . \n a search in the whole pdb archive found pyrococcus furiosus nitrite reductase to be structurally similar to t. indiensis nitrite reductase ( pdbefold z = 11.64 , rmsd = 2.16 ) . \n it is not known if any of these pyridine nucleotide - disulfide oxidoreductases could reduce iron . however , as described earlier , one pyridine nucleotide - disulfide oxidoreductase , c. kluyveri dihydrolipoamide dehydrogenase bfmbc , has been shown to reduce fe(iii ) complexes of citrate , atp , and adp in an nad(p)h - dependent manner . \n the 3d structure of t. indiensis nitrite reductase was predicted by esypred#d using novosphingobium aromaticivorans ferredoxin reductase arr crystal structure ( pdb i d 3lxd ) as the template ( table 3 ) . \n sequence and structural similarity of t. indiensis nitrite reductase with c. kluyveri bfmbc were found to be moderate ( table 4 ) . \n hence , it is likely that t. indiensis nad(p)h - nitrite reductase is responsible for the reduction of fe(iii)-nitrilotriacetic acid in the native gel as shown in figure 1 . finally , as identified with high mascot score , the only t. indiensis protein in band 4 most likely to be a fe(iii ) reductase is thioredoxin disulfide reductase ( tdr ) ( table 2 ) . \n blast analysis found high sequence similarity of t. indiensis tdr with t. scotoductus trx and m. gryphiswaldense fer5 ( table 4 ) . \n the 3d structure of t. indiensis tdr was predicted by esypred3d using mycobacterium tuberculosis thioredoxin reductase crystal structure ( pdb i d 2a87 ) as the template ( table 3 ) . \n 3d structural alignment of t. indiensis tdr against t. scotoductus trx and m. gryphiswaldense fer5 carried out with both pdbefold as well as dalilite produced significant values ( table 4 ) . \n besides , like the other thioredoxin reductases , fad and nad(p)h binding domain of t. indiensis tdr also contained redox - active site catcd . hence , the enzyme possesses the true characteristics of a thioredoxin reductase . \n in fact , t. indiensis tdr has a greater sequence and structural similarity to t. scotoductus trx and m. gryphiswaldense fer5 than t. indiensis trx . \n therefore , it can be surmised that like the t. scotoductus and m. gryphiswaldense enzymes t. indiensis tdr also reduced fe(iii ) as evident from the zymogram ( figure 1 ) . \n t. indiensis tdr also showed 43% similarity ( 97% query coverage ) with a thioredoxin reductase ( tr ) from the hyperthermophilic bacterium thermotoga maritima . \n three - dimensional structure of t. maritima was predicted using salmonella enteric ahpf crystal structure ( pdb i d 1hyu ) as the template ( table 3 ) . \n pdbefold analysis also showed significant structural alignment between the two enzymes ( z = 15.95 and rmsd = 1.90 ) . \n both enzymes have a typical fad - binding motif gxgxxg near the n - terminus , a nicotinamide nucleotide - binding motif gggxxa near the middle , and an active redox center cxxc . like thermophilic t. indiensis bsb-33 \n , t. maritima is capable of growing as a respiratory organism when fe(iii ) is provided as an electron acceptor and t. maritima cell suspension reduces fe(iii ) . \n however , whether t. maritima tr is involved in fe(iii ) reduction has not yet been shown . \n it has been reported earlier that like several other mesophilic and thermophilic microorganisms t. indiensis bsb-33 is capable of reducing cr(vi ) besides fe(iii ) . \n in fact , some bacterial proteins have demonstrated their capability to reduce both fe(iii ) and cr(vi ) [ 20 , 21 ] . in shewanella oneidensis outer membrane proteins mtrc and omca \n are involved in both fe(iii ) and cr(vi ) reduction . however , to the best of our knowledge , the only cytoplasmic enzyme that has been shown to reduce both fe(iii ) and cr(vi ) is ferb from paracoccus denitrificans . \n subsequently , it was found to be capable of reducing chromate as well and showed significant sequence similarity with known chromate reducers chrr from pseudomonas putida and yief from escherichia coli . in thermus scotoductus \n sa-01 a peripheral membrane - associated protein , identified as a dihydrolipoamide dehydrogenase ( lpd ) by sequence homology , has been shown to couple nad(p)h oxidation to cr(vi ) reduction . \n both t. indiensis lpds were found to possess significant sequence similarity with the t. scotoductus protein ( table 5 ) . \n t. scotoductus lpd 3d structure was also predicted using geobacillus stearothermophilus dihydrolipoamide dehydrogenase crystal structure ( pdb i d 1ebd ) as the template ( table 3 ) . \n structural alignments of t. indiensis lpds with t. scotoductus lpd gave high z - score and rmsd ( table 5 ) and there was also considerable overlap between their 3d structures ( figures 3(a ) and 3(b ) ) . \n multiple sequence alignment by clustalw2 also identified in t. scotoductus lpd as well as t. indiensis lpds fad- and nad(p)-binding rossmann folds amino acid sequence motif gx1 - 2gxxg together with either gxxxg or gxxxa motifs where the first glycyl residue of these motifs and the third glycyl residue of the gx1 - 2gxxg motif are the same . \n it is , therefore , quite likely that both t. indiensis lpds would also reduce cr(vi ) in an nad(p)h - dependent manner . \n further , in d. desulfuricans a thioredoxin reductase mred has been shown to be involved in nad(p)h - dependent reduction of u(vi ) and cr(vi ) in association with thioredoxin and possibly an oxidoreductase protein mreg . \n the reduction mechanism as indicated consists of transfer of electrons from nad(p)h to thioredoxin catalyzed by thioredoxin reductase . \n reduced thioredoxin could then transfer the electrons directly to oxidized metals or indirectly through mreg . \n three - dimensional structures of d. desulfuricans mred , thioredoxin , and mreg and corresponding proteins of t. indiensis were predicted by esypred3d using pdb templates as enlisted in table 3 . \n t. indiensis thioredoxin was found to contain the typical thioredoxin fold which is a distinct structural motif consisting of a four - stranded -sheet and three flanking -helices . \n structural alignment of t. indiensis and d. desulfuricans thioredoxins gave z = 9.10 , rmsd = 1.597 ( pdbefold ) and z = 13.5 , rmsd = 1.7 ( dalilite ) . \n t. indiensis also contained a protein indolepyruvate ferredoxin oxidoreductase which was structurally similar to desulfovibrio pyruvate ferredoxin / flavodoxin oxidoreductase mreg ( pdbefold : z = 10.17 , rmsd = 1.19 ; dalilite : z = 25.1 , rmsd = 1.6 ) . \n sequence similarity between t. indiensis tdr and d. desulfuricans mree was found to be 37% with 97% query coverage . \n structural identity between the two enzymes as shown by z - score , rmsd , and superposition was very high ( table 5 ; figure 3(c ) ) . besides , like the other thioredoxin reductases , t. indiensis tdr also contained a redox - active site catcd . \n hence , based on the overall sequence and structural similarity , it could be inferred that like the thioredoxin - thioredoxin reductase system of d. desulfuricans , the thioredoxin - thioredoxin system of t. indiensis could also reduce cr(vi ) . \n it is also to be noted that neither t. indiensis tdr nor lpds showed any significant sequence or structural match with chrr , yief , or ferb indicating the possibility of different chromate reduction mechanisms in this bacterium . \n in conclusion , the soluble fraction of t. indiensis contains four distinct fe(iii ) reductase activities . \n the annotated genome sequence of the thermophilic bacterium has enabled identification of the proteins responsible for fe(iii ) reductase activity by chromatography and mass spectrometry . \n two of these activities are due to pyridine nucleotide - disulfide family of enzymes , namely , two paralogous dihydrolipoamide dehydrogenases and nad(p)h - nitrite reductase . \n a thioredoxin reductase - like protein is responsible for the third activity whereas the fourth activity is caused by a thioredoxin disulfide reductase having all the characteristics of a true thioredoxin reductase . besides , dihydrolipoamide dehydrogenases and thioredoxin - thioredoxin reductase system of t. indiensis are also possibly responsible for chromate reductase activity of the bacterium . \n the genome sequence of t. indiensis will enable cloning and overproduction of the reductases identified in this work and further analysis to elucidate the similarities and differences of iron and chromium reduction pathways .", "role": "user" }, { "content": "thermoanaerobacter indiensis bsb-33 has been earlier shown to reduce fe(iii ) and cr(vi ) anaerobically at 60c optimally . \n further , the gram - positive thermophilic bacterium contains cr(vi ) reduction activity in both the membrane and cytoplasm . \n the soluble fraction prepared from t. indiensis cells grown at 60c was found to contain the majority of fe(iii ) reduction activity of the microorganism and produced four distinct bands in nondenaturing fe(iii ) reductase activity gel . \n proteins from each of these bands were partially purified by chromatography and identified by mass spectrometry ( ms ) with the help of t. indiensis proteome sequences . \n two paralogous dihydrolipoamide dehydrogenases ( lpds ) , thioredoxin reductase ( trx ) , nadp(h)-nitrite reductase ( ntr ) , and thioredoxin disulfide reductase ( tdr ) were determined to be responsible for fe(iii ) reductase activity . \n amino acid sequence and three - dimensional ( 3d ) structural similarity analyses of the t. indiensis fe(iii ) reductases were carried out with cr(vi ) reducing proteins from other bacteria . \n the two lpds and tdr showed very significant sequence and structural identity , respectively , with cr(vi ) reducing dihydrolipoamide dehydrogenase from thermus scotoductus and thioredoxin disulfide reductase from desulfovibrio desulfuricans . \n it appears that in addition to their iron reducing activity t. indiensis lpds and tdr are possibly involved in cr(vi ) reduction as well .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: renal cell carcinoma ( rcc ) represents the most common cancer of kidney and accounts for approximately 3% of all adult malignancies in western countries ( 1 ) . \n rcc remains primarily a surgical disease requiring early diagnosis to optimize the opportunity for cure . \n the treatment for patients with rcc who have no clinical signs of distant metastases is radical nephrectomy . \n however , metastases occur in approximately 30% of these patients , usually within 1 yr . \n moreover 30% of patients already have metastases at the time of presentation ( 2 ) , and in this situation neither chemotherapy nor radiation therapy is effective . despite the lack of an effective systemic therapy , \n a small but significant improvement in overall 5-yr survival has been noted due to early detection and advances in surgical management of the disease ( 3 ) . \n a number of investigations have recently undertaken to search for a protein marker for rcc , which can be used for early diagnosis , staging , detection of occult metastatic disease , and to monitor the response to treatment . \n however , they have been shown to be either nonspecific or insensitive ( 4 ) . \n proteins are key materials to understand cellular functions and disease process , such as tumorigenesis , tumor growth and metastases . \n thus , it is expected that protein expression would differ between normal kidney tissue and homologous rcc tissue . \n many investigators are currently working on the characterization of rcc using proteome - based techniques . \n this technique has been shown to be a useful tool to identify novel proteins for diagnosis and prognosis of malignant disease including colorectal carcinoma ( 5 ) , lung ( 6 ) , and breast cancer ( 7 ) . in rcc , sarto et al . \n ( 8) reported a number of polypeptides differentially expressed in rcc by comparing 2-dimensional electrophoresis patterns of whole normal kidney epithelium and rcc tissue . in this study , we prepared proteins from the rcc tissue and the homologous normal kidney tissue , and analyzed a number of proteins to isolate and identify tumor - specific proteins of rcc by two - dimensional gel electrophoresis . \n the tissue samples of conventional rcc and the surrounding non - cancerous kidney tissues were prepared from surgical specimens of 7 patients after radical nephrectomy . \n the study protocol was approved by the human subject research committee of the gyeongsang national university . \n part of the sample was immediately frozen in liquid nitrogen and stored at -80 until use . \n the frozen kidney tissues were washed several times with phosphate - buffered saline ( ph 7.2 ) to remove cell debris and any remaining blood . \n the samples were homogenized in lysis buffer ( 0.3 g tissue / l ml buffer ) ( 8 m urea , 2% chaps , ampholytes and 1 mm pmsf ) , and were centrifuged at 100,000 g for 10 min at 4. the resulting supernatant was kept at -80 until use . \n the total protein concentration was determined by the bradford method using bovine serum albumin as a standard ( 10 ) . \n the ipg gel strips ( bio - rad , ca , u.s.a . ) were rehydrated in a swelling solution [ 7 m urea , 2% chaps , 100 mm dithiothreitol , 0.5% ipg buffer ( amersham biosciences ) , and bromophenol blue ] that contained 50 g ( for silver staining ) or 500 g ( for coomassie staining ) proteins for 12 hr at 20. isoelectric focusing ( ief ) was performed on immobilized ph gradients ( ipg , ph 4 - 7 , 18 cm ) at 20 in three steps : at 250 v ( 15 min ) , 10,000 v ( 3 hr ) , and then for 40,000 vh using protean ief cell ( bio - rad , ca , u.s.a . ) . \n after the ief procedure , the strips were equilibrated with a buffer containing 50 mm tris - hcl , ph 8.8 , 6 m urea , 30% glycerol , 2% sds , and 1% dithiothreitol for 15 min as a first step , and with 2.5% iodoacetamide instead of dithiothreitol for another 15 min as a second step . for sds gel electrophoresis , \n a 7.5 - 17.5% gradient sds gel was prepared , then an equilibrated ipg gel strip was laid on top of the gel and was covered with 0.5% agarose solution . \n gel electrophoresis was carried out at 16 at 5 ma / cm ( constant current ) for 1 hr , and then at 10 ma / cm until the bromophenol blue reached the bottom of the gel . for silver staining , \n the gel was fixed in a solution ( 50% methanol and 12% acetic acid ) for 1.5 hr ; washed in 50% ethanol twice for 30 min each time , and then treated with 0.2% sodium sulfoxide for 1 min . after washing with deionized water 3 times for 1 min \n the gel was developed in a solution ( 2% sodium bicarbonate , 0.0004% sodium sulfoxide , and 0.5 ml / l formaldehyde ) , and the reaction was stopped by adding 1% acetic acid at the designated time point . for coomassie blue staining , the gel was soaked in a fixation solution ( 30% ethanol , and 2% phosphoric acid ) for 30 min , then in 2% phosphoric acid for 20 min , and equilibrated in a solution ( 2% phosphoric acid , 18% ethanol , and 15% ammonium sulfate ) for 30 min . \n the gel was stained in the equilibration solution containing coomassie brilliant blue g-250 for overnight . \n the protein patterns in the gel were recorded as digitalized images using a high - resolution scanner ( gs-710 calibrated imaging densitometer , bio - rad , ca , u.s.a . ) . \n the scanned gel image was analyzed using a standard protocol for pdquest software ( bio - rad , hercules , ca , u.s.a . ) . \n differentially expressed proteins ( p<0.05 by student 's t - test ) were identified in each patient 's tumor sample compared to the corresponding normal kidney sample to form eight independent analyses . \n inter - individual comparisons were then made by comparison of reference gels and protein spots found to be significantly higher or lower in all tumor samples compared to corresponding normal kidney samples . for protein identification , we used a voyager -de ( delayed extraction ) str biospectrometry workstation ( applied biosystems , forster city , ca , u.s.a . ) for maldi - tof mass spectrometry . \n the gel pieces containing the desired protein spots were excised , washed and digested in gel with trypsin ( sequencing grade , boehringer mannheim ) ( 11 ) . \n the search for protein identity was performed with reference to the public sequence databases ( swiss - prot or ncbi ) using ms - fit ( http://prospector.ucsf.edu/ucsfhtml13.4/msfit.htm ) . \n the tissue samples of conventional rcc and the surrounding non - cancerous kidney tissues were prepared from surgical specimens of 7 patients after radical nephrectomy . \n the study protocol was approved by the human subject research committee of the gyeongsang national university . \n part of the sample was immediately frozen in liquid nitrogen and stored at -80 until use . \n the frozen kidney tissues were washed several times with phosphate - buffered saline ( ph 7.2 ) to remove cell debris and any remaining blood . \n the samples were homogenized in lysis buffer ( 0.3 g tissue / l ml buffer ) ( 8 m urea , 2% chaps , ampholytes and 1 mm pmsf ) , and were centrifuged at 100,000 g for 10 min at 4. the resulting supernatant was kept at -80 until use . \n the total protein concentration was determined by the bradford method using bovine serum albumin as a standard ( 10 ) . \n the ipg gel strips ( bio - rad , ca , u.s.a . ) were rehydrated in a swelling solution [ 7 m urea , 2% chaps , 100 mm dithiothreitol , 0.5% ipg buffer ( amersham biosciences ) , and bromophenol blue ] that contained 50 g ( for silver staining ) or 500 g ( for coomassie staining ) proteins for 12 hr at 20. isoelectric focusing ( ief ) was performed on immobilized ph gradients ( ipg , ph 4 - 7 , 18 cm ) at 20 in three steps : at 250 v ( 15 min ) , 10,000 v ( 3 hr ) , and then for 40,000 vh using protean ief cell ( bio - rad , ca , u.s.a . ) . \n after the ief procedure , the strips were equilibrated with a buffer containing 50 mm tris - hcl , ph 8.8 , 6 m urea , 30% glycerol , 2% sds , and 1% dithiothreitol for 15 min as a first step , and with 2.5% iodoacetamide instead of dithiothreitol for another 15 min as a second step . for sds gel electrophoresis \n , a 7.5 - 17.5% gradient sds gel was prepared , then an equilibrated ipg gel strip was laid on top of the gel and was covered with 0.5% agarose solution . \n gel electrophoresis was carried out at 16 at 5 ma / cm ( constant current ) for 1 hr , and then at 10 ma / cm until the bromophenol blue reached the bottom of the gel . for silver staining , \n the gel was fixed in a solution ( 50% methanol and 12% acetic acid ) for 1.5 hr ; washed in 50% ethanol twice for 30 min each time , and then treated with 0.2% sodium sulfoxide for 1 min . after washing with deionized water 3 times for 1 min \n each , the gel was impregnated in a solution ( 0.2% silver nitrate and 0.75 ml / l formaldehyde ) for 20 min and washed twice in water . \n the gel was developed in a solution ( 2% sodium bicarbonate , 0.0004% sodium sulfoxide , and 0.5 \n ml / l formaldehyde ) , and the reaction was stopped by adding 1% acetic acid at the designated time point . for coomassie blue staining , the gel was soaked in a fixation solution ( 30% ethanol , and 2% phosphoric acid ) for 30 min , then in 2% phosphoric acid for 20 min , and equilibrated in a solution ( 2% phosphoric acid , 18% ethanol , and 15% ammonium sulfate ) for 30 min . \n the gel was stained in the equilibration solution containing coomassie brilliant blue g-250 for overnight . \n the protein patterns in the gel were recorded as digitalized images using a high - resolution scanner ( gs-710 calibrated imaging densitometer , bio - rad , ca , u.s.a . ) . \n the scanned gel image was analyzed using a standard protocol for pdquest software ( bio - rad , hercules , ca , u.s.a . ) . \n differentially expressed proteins ( p<0.05 by student 's t - test ) were identified in each patient 's tumor sample compared to the corresponding normal kidney sample to form eight independent analyses . \n inter - individual comparisons were then made by comparison of reference gels and protein spots found to be significantly higher or lower in all tumor samples compared to corresponding normal kidney samples . for protein identification , we used a voyager -de ( delayed extraction ) str biospectrometry workstation ( applied biosystems , forster city , ca , u.s.a . ) for maldi - tof mass spectrometry . \n the gel pieces containing the desired protein spots were excised , washed and digested in gel with trypsin ( sequencing grade , boehringer mannheim ) ( 11 ) . \n the search for protein identity was performed with reference to the public sequence databases ( swiss - prot or ncbi ) using ms - fit ( http://prospector.ucsf.edu/ucsfhtml13.4/msfit.htm ) . \n we analyzed the proteomic profiles of the rcc tissue and the corresponding normal kidney tissues from 7 consecutive patients with conventional rcc . \n the mean age of the patients was 65.4 yr ( range 54 to 78 ) . \n the samples were examined histologically to verify the macroscopic cell type ( benign or cancer ) . \n spots representing proteins that were differentially expressed in rcc were selected ( p<0.05 by student 's t - test ) . \n a total of 905 spots from a conventional rcc samples and 953 spots from a corresponding normal kidney samples were visualized in a gel ( ph range from 4.0 - 7.0 and a molecular mass range from 10 - 100 kda ) ( fig . \n the overall protein expression patterns in clear cell rcc and normal kidney tissues were quite similar except for some areas . \n ten specific regions containing some proteins differentially expressed in rcc and normal tissues were further analyzed by comparing their expression patterns in all 7 patients . \n for the assessment of differentially expressed proteins only protein spots altered in all tumor samples were considered . \n the protein identities from all the spots were entered in the composite gel database so that any changes in the protein expression could be determined for each protein spot . \n the integrated protein intensity was determined for each identified spot in seven gels each from the rcc tissues and corresponding normal kidney tissues . \n the mean intensity of each spot was calculated by its silver stain intensity and the relative intensities between the rcc tissues and normal tissues . \n two proteins were dominantly expressed in the conventional rcc and six proteins were revealed largely repressed , these proteins were found with a statistical significance . \n some of these proteins have been identified by mass spectrometry . a typical mass spectrum of a protein , aldehyde reductase , is shown in fig . \n the expression level of each protein in both rcc and normal tissue was indicated by the density values ( fig . 3 , 4 ) . \n their predicted values of isoelectrical point ( pi ) and molecular weight ( mw ) are summarized in table 2 , and the values were compatible to those of acquired from the gels . \n the sequence coverage of proteins isolated from the peptide mass matching in a program was acceptable ( 19 - 55% ranges ) . \n these rows of protein spots , which typically had similar molecular sizes but slightly different isoelectrical points , probably were due to posttranslational modifications that change in the protein charge . \n the protein identities from all spots were entered in the composite gel database so that changes in protein expression could be determined for each protein spot . \n integrated protein intensity was determined for each identified spot in seven gels each from rcc and corresponding normal kidney tissues . \n the mean intensity of each spot was calculated by silver stain intensity , and relative intensities between rcc and normal tissues were compared . \n six proteins showed largely repressed expression in rcc with a statistical significance ; aminoacylase-1 in region 1 , enoyl - coa hydratase in region 2 , agmatinase and ketohexokinase in region 4 , aldehyde reductase in region 5 and tropomyosin -4 chain in region 9 ( fig . 1 , 3 ) . \n two proteins were dominantly expressed in rcc ( fig . 1 , 4 ) ; -1 antitrypsin precursor in region 3 and vimentin in region 7 . \n the proteomic approach shows great potential to be a powerful tool for the identification of proteins differentially expressed in the normal kidney tissue and rcc tissue , and the characterization of the newly isolated rcc - specific markers might allow for a better subclassification of rcc and the early diagnosis of this disease . in this study , \n 66 proteins were shown to have either increased or decreased expression ( 2 ) in rcc ( data not shown ) . some of these proteins have previously been shown to have an altered expression in rcc . among them , five proteins were identified as vimentin ( 12 ) , aminoacylase-1 , enoyl - coa hydratase ( 13 ) , aldehyde reductase ( 14 ) , and agmatinase by using maldi - tof mass spectrometry ( 15 ) . \n vimentin , one of the cytoskeletal proteins , was significantly overexpressed in rcc tissue compared with the corresponding normal tissue . a proteome - based study demonstrated a heterogeneous expression pattern of vimentin in different rcc subtypes ( 12 ) . \n it is often associated with cellular differentiation , invasion , migration and metastatic potential of tumors ( 16 ) . \n aminoacylase-1 , which is found in many mammalian tissues with the highest activities occurring in the kidney , is usually involved in detoxification processes . \n it hydrolyzes a variety of n - acylated amino acids generating free amino acids and may be involved in the synthesis of hippurate that is formed during detoxification of aromatic compounds ( 17 ) . \n a diminished expression of this enzyme has also been found in lung cancer cell lines of small cell type and pulmonary tumors ( 18 ) . \n the von hippel - lindau ( vhl ) gene , a tumor suppressor gene , is located on chromosome 3p25-p26 ( 19 ) , and the vhl gene mutations were detected in a high percentage of tumors from patients with conventional rcc ( 20 ) . in line with the previous observation , enoyl - coa hydratase , a short - chain mitochondrial enoyl - coa hydratase , involved in mitochodrial -oxidation , was shown to have decreased expression in rcc ( 13 ) . \n aldehyde reductase is an oxidoreductase that catalyzes nadph - dependent reduction of a variety of aromatic and aliphatic aldehydes ( 21 ) . \n this enzyme is important because of its ability to detoxify a variety of reductive aldehyde species and metabolize certain steroid and neurotransmitter metabolites and glucuronate ( 22 ) , however , little is known about its physiological role . \n g250-treated and untreated rcc cell lines were investigated for their protein expression profiles to identify tumor markers , which may allow the selection of patients prior to specific immunotherapy . \n they found decreased expression of aldehyde reductase in g250-treated rcc cell line ( 14 ) . \n recently , dallmann et al . ( 15 ) reported that human agmatinaes is diminished in the clear cell type of rcc by proteomic approach . \n rt - pcr and nothern blot analyses demonstrated a clearly decreased amount of agmatinase mrna in tumor cells , and they confirmed the differential expression of agmatinase mrna at the protein level by western blot analysis . \n the expression of agmatinase in this study was also diminished in rcc compared with that in the normal counterpart of kidney ( fig . \n antitrypsin precursor , which present in the proximal tubule of kidney , showed an increased expression in the tumor . based on the histochemical profile of normal kidney , carcinoma , and oncocytoma , 89% of rcc and 50% of oncocytoma expressed -1 antitrypsin activity ( 23 ) . \n -1 antitrypsin is a broad spectrum inhibitor of serine proteases , including trypsin protease , chymotrypsin protease , and elastase like enzyme ( 24 ) . \n its major physiological role is the inhibition of leukocytes elastases released at sites of inflammation . \n the function of -1 antitrypsin released by epithelial cells is still unclear , although they may play a role in the regulation of growth and proliferation processes . in this study , this enzyme was overexpressed in rcc tissue , suggesting the tumor tissues might need the -1 antitrypsin activity . \n a significantly heterogeneous expression pattern of the different members of the cytoskeleton was found between different rcc cell lines and by comparison of rcc cell lines with corresponding kidney epithelium cell lines . \n tropomyosin -4 chain , one of the cytoskeletal proteins , showed a decreased expression in rcc . \n it is noteworthy that with the exception of cytoskeletal tropomyosin , cytoskeletal proteins seem to be readily recognized by patients with rcc than by control sera . \n the reason for the relatively high frequency of cytoskeletal tropomyosin autoantibodies in control sera and their potential role in the development of autoimmune disease requires further investigation using a larger sample number ( 12 ) . \n it might be suggested that the loss of potential tumor antigens over time represents an effective strategy of tumors to evade immune recognition . \n much of the ingested fructose is metabolized by the liver , using fructose 1-phosphate pathway , and then can be funneled into the universal glycolytic pathway . although ketohexokinase is most abundant in the liver , it is also found in the kidney , small intestine , and pancreas ( 25 ) . \n glycolysis takes place predominantly in the distal segments of renal tubular system . during the development of rat renal basophilic cell tumors \n a predominant biochemical alteration in cancer cells is a markedly elevated rate of glucose catabolism ( 27 ) . \n thus , it has been observed that activities of key glycolytic enzymes such as hexokinase and pyruvate kinase are increased in tumor cells compared with normal cells from their tissue of origin . \n nonetheless , the increased glycolysis can not be considered as a general phenomenon in neoplasm . \n some brain neoplasm , for example , neuroblastomas ( 28 ) , and retinoblastoma ( 29 ) show decreased hexokinase activity compared with normal brain . \n however , it might also be suggested that different types of rcc represent different expression pattern of ketohexokinase , which is eventually involved in glycolysis . in conclusion , \n two - dimensional polyacrylamide gel electrophoresis is a powerful tool to comprehensively analyze total proteins that are differentially expressed in rcc . \n we compared proteomes of the normal human kidney with that of the corresponding renal cell carcinoma tissues in gels , and identified differentially expressed proteins by mass spectrometry . \n the expression of six proteins , aminnoacylase-1 , enoyl - coa hydratase , aldehyde reductase , tropomyosin -4 chain , agmatinase and ketohexokinase , was decreased in rcc . \n the study of the protein expression in rcc and the normal kidney tissue may help us to find tumor - specific proteins of these diseases .", "role": "user" }, { "content": "renal cell carcinoma ( rcc ) is one of the most malignant tumors in urology , and due to its insidious onset patients frequently have advanced disease at the time of clinical presentation . \n thus , early detection is crucial in management of rcc . to identify tumor specific proteins of rcc \n , we employed proteomic analysis . \n we prepared proteins from conventional rcc and the corresponding normal kidney tissues from seven patients with conventional rcc . \n the expression of proteins was determined by silver stain after two - dimensional polyacrylamide gel electrophoresis ( 2d - page ) . \n the overall protein expression patterns in the rcc and the normal kidney tissues were quite similar except some areas . of 66 differentially expressed protein spots ( p<0.05 by student t - test ) , 8 different proteins from 11 spots were identified by maldi - tof - ms . \n the expression of the following proteins was repressed ( p<0.05 ) ; aminoacylase-1 , enoyl - coa hydratase , aldehyde reductase , tropomyosin -4 chain , agmatinase and ketohexokinase . two proteins , vimentin and -1 antitrypsin precursor , were dominantly expressed in rcc ( p<0.05 ) .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 55-year - old lady presented with complaints of decreased vision in the left eye with pain and redness since 3 months . \n the patient had a history of cataract surgery in the same eye , done 1 year back elsewhere . \n her best corrected visual acuity in the right eye was 20/20 and in the left eye was 20/400 . \n anterior segment examination of the left eye showed frothy material in the inferior angle with moderate anterior chamber reaction ( cells+/flare+ ) and sulcus intraocular lens with large posterior capsule rent [ fig . 1 ] . \n 2 ] revealed condensed vitreous membranes and multiple bubbles seen suggestive of pfcl , settled inferiorly , filling almost one - fourth of the vitreous cavity . \n slit - lamp photo showing pfcl bubbles in inferior part of anterior chamber color fundus photo showing pfcl bubbles in vitreous cavity with membranes ultrasonography of the left eye showed complete posterior vitreous detachment along with multiple , high reflective , freely mobile globular echoes ( comet trail ) of pfcl and attached retina . \n we hypothesized that the cataract surgeon must have inserted pfcl to remove dropped nucleus during the surgery done 1 year back . \n left eye best - corrected visual acuity was 20/30 with unremarkable ocular examination [ fig . 3 ] . \n pfcl has been used as an intraoperative tool and short - term postoperative tamponade for a mean of 516.5 days.[13 ] vitreon ( pfcl ) has proven to be non - toxic in vitrectomized rabbit eyes for up to 6 weeks . \n ocular toxicity due to retained pfcl , including uncontrolled intraocular pressure , corneal epithelial toxicity , and decreased focal sensitivity of the retina have been reported . in vitro study showed that pfcl is directly toxic to human retinal pigment epithelial cells when exposed to the cells for 7 days . on the contrary \n , retinal ganglion cells were damaged in a time - dependent manner by the more mechanical rather than toxic effects of pfcl . \n we present a case of retained pfcl presenting after a long period of 1 year as chronic inflammation . \n other causes for chronic inflammation such as retained lens material and ocular trauma were ruled out . \n it is difficult to comment that this inflammation could be because of pfcl itself , as we did not have the details about the pfcl manufacturer . \n reported reduced visual acuity and optic disc pallor with the longer duration of retained pfcl . \n mechanism for toxicity proposed is potassium accumulation which can be due to the failure of potassium siphoning by muller cells . \n although our patient recovered good visual acuity , electrophysiological study would have helped to understand the effect of long - term retained pfcl on retina to anticipate its use as a long - term tamponade . to conclude , retained pfcl in the eye can cause delayed inflammatory response . \n although in vitro studies have shown damage to the retinal ganglion cells , low grade inflammation and successful visual recovery in our case suggests inertness of pfcl within the eye . \n electrophysiological tests , visual field examination , optical coherence tomography are required to understand the functional damage and to establish its role as a long - term tamponade .", "role": "user" }, { "content": "a 55-year - old woman , with history of cataract surgery 1 year back , presented with features of ocular inflammation for last 3 months . \n she had no history of any other intraocular surgery . on examination , \n anterior segment showed frothy material in the inferior angle with moderate anterior chamber reaction ( cells+/flare+ ) and sulcus intraocular lens with large posterior capsule rent . \n fundoscopy showed multiple , small to medium - sized transparent bubbles of perfluorocarbon liquid ( pfcl ) with membranes in the vitreous cavity . \n ultrasonography confirmed the presence of pfcl in the vitreous cavity . \n pars plana vitrectomy with anterior chamber wash was done which led to good visual recovery . to conclude , retained pfcl can cause late onset fibrinous inflammation after a quiescent period but surgical intervention may lead to good visual outcome .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: oral submucous fibrosis ( osmf ) is a potentially malignant disorder that primarily affects any part of the oral cavity and sometimes even the pharynx . \n osmf is found predominantly among the people of south asia and is closely linked with the habit of chewing betel quid and tobacco containing products . \n the tissues most frequently affected by osmf in the oral cavity are buccal mucosa and retromolar area , followed by the soft palate , palatal fauces , uvula , tongue , and labial mucosa . \n clinical diagnosis of osmf is usually made based on several characteristic features of osmf , including intolerance to spicy foods , blanching and stiffness of the oral mucosa , fibrous bands in the buccal or labial mucosa , and progressive inability to open the mouth . \n the overall prevalence of osmf in india is about 0.5% with a range of 0.2 - 1.2% in different regions of the country . \n the different causative agents include intake of spicy food , chewing of betel nut , betel quid , and preparations containing tobacco ( pan masala , gutka , khaini , etc . ) . \n osmf has a high rate of morbidity because it causes a progressive inability to open the mouth , resulting in poor eating and consequent nutritional deficiencies . \n osmf also has a significant mortality rate because it is a precursor to oral cancer , particularly squamous cell carcinoma , seen in 7.6% of the cases . \n masseter muscle hypertrophy usually presents as a relatively firm painless preauricular swelling but may cause considerable diagnostic difficulty . the thickness and functions of the masseter muscle \n mucosa causes constriction of tissue and results in flattening of the cheek or appearance of sunken cheek , which might also exacerbate the appearance of the masseter muscle . \n ultrasonography ( usg ) is particularly suitable for imaging superficial structures of the head and neck region . \n qualitatively , it provides information on the nature of a lesion and its relation to adjacent normal structures . \n quantitatively , it assesses the dimensions of the lesion , its distance from the skin surface and its relative proximity to skin and mucosal surfaces . up till now and despite extensive studies , there is no conclusive evidence of adverse biological effects of the use of usg as it does not produce ionizing radiation . \n the present study was conducted in the outpatient department of oral medicine diagnosis and radiology . a total of 60 patients were involved in the study . \n group i consisted of 30 patients who were nonsmokers but who chewed tobacco and were clinically diagnosed as having osmf and group ii consisted of 30 normal people who were nonsmokers and who did not chew tobacco and were clinically diagnosed as not having osmf . \n the inclusion criteria included patients with a positive history of chewing areca nut ( also called betel nut ) or one of the commercial preparations containing areca nut and tobacco with clinical symptoms such as a burning sensation on eating spicy food , difficulty in swallowing , chewing , blanching of the oral mucosa , palpable fibrous bands , and restricted mouth opening . \n the exclusion criteria were fibrosis of the oral mucosa leading to decreased mouth opening due to anemia , scleroderma , post radiation therapy , and masseter muscle hypertrophy due to malocclusion , bruxism , and other deleterious habits . \n very early cases , normal mouth opening , burning sensation , excessive salivation , acute ulceration and recurrent stomatitis . \n ( n = 1 ) early cases , mouth opening : 26 - 35 mm ( interincisal opening ) , soft palate and faucial pillars are areas primarily affected , buccal mucosa appears mottled and marbled , with dense , pale , depigmented , and fibrosed areas alternating with pink normal mucosa , red erythematous patches , and widespread sheets of fibrosis . \n ( n = 5 ) moderately advanced cases , mouth opening : 15 - 25 mm ( interincisal opening ) , trismus , vertical fibrous bands can be palpated and are firmly attached to underlying tissue , patient unable to puff out the cheeks or whistle , soft palate - fibrous bands seen to radiate from the pterygomandibular raphe or anterior faucial pillar in a scar - like appearance , atrophy of vermillion border of the lips , unilateral posterior cheek involvement with only ipsilateral involvement of the faucial pillar and soft palate , and reduced mouth opening . \n ( n = 16 ) advanced cases , stiffness / inelasticity of the oral mucosa , trismus , mouth opening : 2 - 15 mm ( interincisal opening ) , fauces thickened , shortened and firm on palpation , uvula seen to be involved as a shrunken , small and fibrous bud , tongue movement restricted , papillary atrophy ( diffuse ) , lips - circular band felt around entire mouth , intraoral examination is difficult . \n ( n = 8) advanced cases with premalignant and malignant changes , osmf and leukoplakia , osmf and squamous cell carcinoma . \n ( n = 0 ) in the study group , all were male patients in the age range of 19 - 50 years with a mean age of 31.0 3.9 years . \n all 30 patients were nonsmokers but used tobacco products , 15 patients ( 50% ) chewed pan ( betel nut ) , 10 ( 33% ) chewed gutkha ( preparation containing tobacco ) , and 5 ( 17% ) chewed tobacco . \n the chewing of tobacco and betel nut products had been a habit for less than 5 years in 9 patients ( 30% ) , 5 - 10 years in 18 patients ( 60% ) , and more than 10 years in 3 patients ( 10% ) . \n regarding frequency , 8 ( 27% ) patients consumed < 5 packets of raw tobacco , betel nut or tobacco containing products per day , 18 ( 60% ) patients consumed 5 - 10 packets / day , and 4 ( 13% ) patients consumed > 10 packets / day . \n all patients kept the substances in the mouth for different lengths of time ; 6 patients ( 20% ) for less than 15 min , 20 ( 68% ) for 15 - 30 min , and 4 ( 12% ) for more than 30 min . \n age and sex matched 30 apparently healthy subjects with no history of areca nut and/or gutkha or tobacco chewing habit and with no appreciable malocclusion , bruxism , or any other mucosal lesions were selected . in the control group , \n all patients were males within the age group of 20 - 50 years with a mean age of 32.0 3.0 years . \n ultrasonographic imaging was performed by a single trained general radiologist with the patient in the supine position . \n the usg device was an logiq 5 pro ( ge medical systems , milwaulkee , usa ) with a multifrequency linear transducer with a frequency ranging from 10 to 15 mhz . before starting usg for measuring submucosal thickness in buccal mucosa \n , participants were instructed to indicate the mucosa by placing the forefinger against the lining mucosa so as to delineate the empty space of the oral cavity . \n the transducer probe was placed in such a way that the soft tissues were not unduly compressed , because excess contact pressure while imaging might affect the measurements . \n hence , to obtain exact measurements of the thickness of submucosa the probe was brought softly into contact with the surface . for ultrasonographic imaging of the buccal mucosa \n the first point was 1 cm anterior to the anterior border of the masseter muscle , indicating the posterior buccal mucosa ( pbm ) and the second was 1 cm posterior to the commissure of the lip , indicating the anterior buccal mucosa ( abm ) [ figure 1 ] . \n the submucosal thickness was measured in cm along this line on both the right and left sides . \n ultrasonographic imaging was performed with an extraoral approach by placing the linear transducer parallel to the lower border of the mandible [ figure 2 ] . \n the usg scan constituted a full representation of the cross - section of the buccal mucosa , in the submucosal and muscular planes . \n the mucosal lining was seen as a hyperechoic line and the submucosa as a hypoechoic band supported by muscle planes . \n this band of hypoechogenicity between the hyperechoic mucosa and muscle layer was measured as the submucosa thickness . \n the distance between the two hyperechoic lines i.e. , mucosal lining and the muscle layer shown as \n + marks on abm and x marks on pbm is measured with the help of the measuring tool in usg [ figures 3 and 4 ] . \n the measurements of right and left anterior and pbm were noted , two scans were taken per patient , one on the right side and the other on the left side.figure 1photograph shows the side of the face marked with points for measuring submucosal thickness in the buccal mucosa region by ultrasonogram . \n the anterior buccal mucosa and posterior buccal mucosa points are connected by a line for placement of the transducer . \n figure 2photograph shows the placement position of the linear transducer and the patient 's finger in the buccal mucosa for measuring the submucosal thickness by ultrasonogram . \n figure 3ultrasonogram image of the submucosal thickness in buccal mucosa of a control patient , shows the submucosal thickness ( red arrows ) . \n figure 4ultrasound image of the buccal mucosa in a patient with oral submucous fibrosis shows the submucosal thickness ( red arrows mark the thickness ) . \n photograph shows the side of the face marked with points for measuring submucosal thickness in the buccal mucosa region by ultrasonogram . \n the anterior buccal mucosa and posterior buccal mucosa points are connected by a line for placement of the transducer . \n photograph shows the placement position of the linear transducer and the patient 's finger in the buccal mucosa for measuring the submucosal thickness by ultrasonogram . \n ultrasonogram image of the submucosal thickness in buccal mucosa of a control patient , shows the submucosal thickness ( red arrows ) . \n ultrasound image of the buccal mucosa in a patient with oral submucous fibrosis shows the submucosal thickness ( red arrows mark the thickness ) . \n ultrasonographic examination of the masseter muscle was done by a line drawn on the skin parallel to and 2 cm above the inferior border of the mandible , approximately corresponding to the most bulky part of the superficial portion of the masseter muscle . \n the ultrasonographic imaging of the masseter muscle was performed bilaterally both in relaxed and contracted state . \n the measuring sites were taken between p and a points where p is posterior , 1 cm from the posterior border of the ramus of the mandible and a is anterior near the anterior border of the ramus of the mandible [ figures 5 and 6 ] . \n the ultrasound scans from these measuring sites constitute a full representation of cross - section of superficial portion of the masseter muscle . \n the measurements of right and left masseter muscle hypertrophy were recorded in centimeter in both relaxed and contracted positions of the masseter muscle [ figures 7 and 8 ] . \n the distance between the two hyperechoic lines i.e. , the superior most and inferior most shown as \n + mark in a relaxed state and x mark in contracred state was measured in centimeters with the help of the measuring tool in usg.figure 5photograph of the patient 's face shows the anterior and posterior points of the masseter muscle connected by a line 2 cm above the lower border of mandible . \n figure 6photograph shows the placement position of the linear transducer such that it is over the masseter muscle for measuring the masseter muscle hypertrophy by ultrasonogram . \n figure 7ultrasonogram image of the masseter muscle in a control patient shows the masseter muscle thickness in both the relaxed and contracted state ( red arrows ) . \n figure 8ultrasonogram image of the masseter muscle in a patient with oral submucous fibrosis shows the masseter muscle hypertrophy in both the relaxed and contracted state ( red arrow ) . \n photograph of the patient 's face shows the anterior and posterior points of the masseter muscle connected by a line 2 cm above the lower border of mandible . \n photograph shows the placement position of the linear transducer such that it is over the masseter muscle for measuring the masseter muscle hypertrophy by ultrasonogram . \n ultrasonogram image of the masseter muscle in a control patient shows the masseter muscle thickness in both the relaxed and contracted state ( red arrows ) . \n ultrasonogram image of the masseter muscle in a patient with oral submucous fibrosis shows the masseter muscle hypertrophy in both the relaxed and contracted state ( red arrow ) . one way analysis of variance was used for multiple group comparison and t - test for two group comparisons . \n very early cases , normal mouth opening , burning sensation , excessive salivation , acute ulceration and recurrent stomatitis . \n early cases , mouth opening : 26 - 35 mm ( interincisal opening ) , soft palate and faucial pillars are areas primarily affected , buccal mucosa appears mottled and marbled , with dense , pale , depigmented , and fibrosed areas alternating with pink normal mucosa , red erythematous patches , and widespread sheets of fibrosis . \n moderately advanced cases , mouth opening : 15 - 25 mm ( interincisal opening ) , trismus , vertical fibrous bands can be palpated and are firmly attached to underlying tissue , patient unable to puff out the cheeks or whistle , soft palate - fibrous bands seen to radiate from the pterygomandibular raphe or anterior faucial pillar in a scar - like appearance , atrophy of vermillion border of the lips , unilateral posterior cheek involvement with only ipsilateral involvement of the faucial pillar and soft palate , and reduced mouth opening . \n advanced cases , stiffness / inelasticity of the oral mucosa , trismus , mouth opening : 2 - 15 mm ( interincisal opening ) , fauces thickened , shortened and firm on palpation , uvula seen to be involved as a shrunken , small and fibrous bud , tongue movement restricted , papillary atrophy ( diffuse ) , lips - circular band felt around entire mouth , intraoral examination is difficult . \n advanced cases with premalignant and malignant changes , osmf and leukoplakia , osmf and squamous cell carcinoma . \n ( n = 0 ) in the study group , all were male patients in the age range of 19 - 50 years with a mean age of 31.0 3.9 years . \n all 30 patients were nonsmokers but used tobacco products , 15 patients ( 50% ) chewed pan ( betel nut ) , 10 ( 33% ) chewed gutkha ( preparation containing tobacco ) , and 5 ( 17% ) chewed tobacco . \n the chewing of tobacco and betel nut products had been a habit for less than 5 years in 9 patients ( 30% ) , 5 - 10 years in 18 patients ( 60% ) , and more than 10 years in 3 patients ( 10% ) . \n regarding frequency , 8 ( 27% ) patients consumed < 5 packets of raw tobacco , betel nut or tobacco containing products per day , 18 ( 60% ) patients consumed 5 - 10 packets / day , and 4 ( 13% ) patients consumed > 10 packets / day . \n all patients kept the substances in the mouth for different lengths of time ; 6 patients ( 20% ) for less than 15 min , 20 ( 68% ) for 15 - 30 min , and 4 ( 12% ) for more than 30 min . \n age and sex matched 30 apparently healthy subjects with no history of areca nut and/or gutkha or tobacco chewing habit and with no appreciable malocclusion , bruxism , or any other mucosal lesions were selected . in the control group , \n all patients were males within the age group of 20 - 50 years with a mean age of 32.0 3.0 years . \n ultrasonographic imaging was performed by a single trained general radiologist with the patient in the supine position . \n the usg device was an logiq 5 pro ( ge medical systems , milwaulkee , usa ) with a multifrequency linear transducer with a frequency ranging from 10 to 15 mhz . before starting usg for measuring submucosal thickness in buccal mucosa , \n participants were instructed to indicate the mucosa by placing the forefinger against the lining mucosa so as to delineate the empty space of the oral cavity . \n the transducer probe was placed in such a way that the soft tissues were not unduly compressed , because excess contact pressure while imaging might affect the measurements . \n hence , to obtain exact measurements of the thickness of submucosa the probe was brought softly into contact with the surface . for ultrasonographic imaging of the buccal mucosa \n the first point was 1 cm anterior to the anterior border of the masseter muscle , indicating the posterior buccal mucosa ( pbm ) and the second was 1 cm posterior to the commissure of the lip , indicating the anterior buccal mucosa ( abm ) [ figure 1 ] . \n the submucosal thickness was measured in cm along this line on both the right and left sides . \n ultrasonographic imaging was performed with an extraoral approach by placing the linear transducer parallel to the lower border of the mandible [ figure 2 ] . \n the usg scan constituted a full representation of the cross - section of the buccal mucosa , in the submucosal and muscular planes . \n the mucosal lining was seen as a hyperechoic line and the submucosa as a hypoechoic band supported by muscle planes . \n this band of hypoechogenicity between the hyperechoic mucosa and muscle layer was measured as the submucosa thickness . \n the distance between the two hyperechoic lines i.e. , mucosal lining and the muscle layer shown as \n + marks on abm and x marks on pbm is measured with the help of the measuring tool in usg [ figures 3 and 4 ] . \n the measurements of right and left anterior and pbm were noted , two scans were taken per patient , one on the right side and the other on the left side.figure 1photograph shows the side of the face marked with points for measuring submucosal thickness in the buccal mucosa region by ultrasonogram . \n the anterior buccal mucosa and posterior buccal mucosa points are connected by a line for placement of the transducer . \n figure 2photograph shows the placement position of the linear transducer and the patient 's finger in the buccal mucosa for measuring the submucosal thickness by ultrasonogram . \n figure 3ultrasonogram image of the submucosal thickness in buccal mucosa of a control patient , shows the submucosal thickness ( red arrows ) . \n figure 4ultrasound image of the buccal mucosa in a patient with oral submucous fibrosis shows the submucosal thickness ( red arrows mark the thickness ) . \n photograph shows the side of the face marked with points for measuring submucosal thickness in the buccal mucosa region by ultrasonogram . \n the anterior buccal mucosa and posterior buccal mucosa points are connected by a line for placement of the transducer . \n photograph shows the placement position of the linear transducer and the patient 's finger in the buccal mucosa for measuring the submucosal thickness by ultrasonogram . \n ultrasonogram image of the submucosal thickness in buccal mucosa of a control patient , shows the submucosal thickness ( red arrows ) . \n ultrasound image of the buccal mucosa in a patient with oral submucous fibrosis shows the submucosal thickness ( red arrows mark the thickness ) . \n ultrasonographic examination of the masseter muscle was done by a line drawn on the skin parallel to and 2 cm above the inferior border of the mandible , approximately corresponding to the most bulky part of the superficial portion of the masseter muscle . \n the ultrasonographic imaging of the masseter muscle was performed bilaterally both in relaxed and contracted state . \n the measuring sites were taken between p and a points where p is posterior , 1 cm from the posterior border of the ramus of the mandible and a is anterior near the anterior border of the ramus of the mandible [ figures 5 and 6 ] . \n the ultrasound scans from these measuring sites constitute a full representation of cross - section of superficial portion of the masseter muscle . \n the measurements of right and left masseter muscle hypertrophy were recorded in centimeter in both relaxed and contracted positions of the masseter muscle [ figures 7 and 8 ] . \n the distance between the two hyperechoic lines i.e. , the superior most and inferior most shown as \n + mark in a relaxed state and x mark in contracred state was measured in centimeters with the help of the measuring tool in usg.figure 5photograph of the patient 's face shows the anterior and posterior points of the masseter muscle connected by a line 2 cm above the lower border of mandible . \n figure 6photograph shows the placement position of the linear transducer such that it is over the masseter muscle for measuring the masseter muscle hypertrophy by ultrasonogram . \n figure 7ultrasonogram image of the masseter muscle in a control patient shows the masseter muscle thickness in both the relaxed and contracted state ( red arrows ) . \n figure 8ultrasonogram image of the masseter muscle in a patient with oral submucous fibrosis shows the masseter muscle hypertrophy in both the relaxed and contracted state ( red arrow ) . \n photograph of the patient 's face shows the anterior and posterior points of the masseter muscle connected by a line 2 cm above the lower border of mandible . \n photograph shows the placement position of the linear transducer such that it is over the masseter muscle for measuring the masseter muscle hypertrophy by ultrasonogram . \n ultrasonogram image of the masseter muscle in a control patient shows the masseter muscle thickness in both the relaxed and contracted state ( red arrows ) . \n ultrasonogram image of the masseter muscle in a patient with oral submucous fibrosis shows the masseter muscle hypertrophy in both the relaxed and contracted state ( red arrow ) . \n one way analysis of variance was used for multiple group comparison and t - test for two group comparisons . \n the study group of 30 patients were identified as being in different stages of osmf \n stage i ( n = 1 ) , stage ii ( n = 5 ) , stage iii ( n = 16 ) and stage iva ( n = 8) . all 30 patients had a burning sensation in the mouth and varying degrees of restricted mouth opening . \n on intra - oral examination , maximum interincisal mouth opening ranged from 13 to 45 mm . \n blanching and buccal fibrous bands were present in 29 patients ( 96.3% ) in stages ii , iii , and iva . \n floor of the mouth was involved in 8 ( 26.6% ) stage iva patients , the uvula and faucial pillars in 24 ( 80% ) stages iii and iva patients , and the soft palate in 24 ( 80% ) stages iii and iva patients . \n restricted movement of the soft palate was seen in 16 ( 53.6% ) patients and restricted tongue movement in 8 ( 26.6% ) patients . \n as the stage of osmf advances , there was a significant decrease in the ability to open the mouth [ chart 1 ] . \n correlation between mouth opening ( in cm ) and stages of osmf table 1 data represents a startistically significant correlation between ultrasonographic readings of submucosal thickness , masseter hypertrophy , and clinical stages of osmf . \n the range of the normal submucosal thickness was between 0.045 and 0.056 cm . in the study group submucosal thickness was more in the pbm than in the abm probably due to the increased tendency of the people to keep the tobacco or betel nut in the region of the buccal pouch . \n correlation between usg measurements of submucossal thickness and masseter muscle hypertrophy ( measured in cm ) and clinical stage of osmf table 2 data represents the comparison in ultrasonographic measurements of submucosal thickness , masseter hypertrophy between different stages of osmf . in this comparison , \n the average ultrasonographic readings of submucosal thickness on the right and left side were taken . \n similarly , average ultrasonographic readings of masseter hypertrophy in relaxed and contracted state of the right and left side was taken . \n comparison of the average submucossal thickness and masseter muscle hypertrophy ( measured in cm ) between the different stages of osmf tables 3 and 4 data show that there was a statistically significant difference between ultrasonographic measurements of submucosal thickness and masseteric hypertrophy in osmf and control group ( p < 0.001 ) . \n usg readings of submucosal thickness in osmf patients and control group comparison of usg measurements of masseter hypertrophy in osmf patients and control group as the frequency of use ( packets / day ) , time of retention in the mouth , and duration of the chewing habit increased , the stages of osmf also advanced indicating the severity of osmf was directly proportional to the above parameters [ table 5 ] . \n no significant difference is noted among patients using different commercial brands of smokeless tobacco products and their ultrasonographic measurements of submucosal thickness of buccal mucosa and co - existing masseter muscle hypertrophy [ table 6 ] . \n correlation between clinical stages and chewing habits correlation between different commercial products of tobacco and usg measurements ( cm ) \n osmf is predominantly found among the people of south asia and is closely associated with the habit of chewing betel nut and tobacco products . \n the overall prevalence of oral submucous fibrosis in india is about 0.5% with a range of 0.2 - 1.2% in different regions of the country . \n various etiological factors are being studied , such as genetic , autoimmune , nutritional , and environmental factors . \n also studied are habits like intake of spicy food , chewing of betel nut , betel quid , and tobacco preparations ( pan masala , gutka , tobacco , etc . ) . \n osmf also has a significant mortality rate because it can transform into oral cancer , particularly squamous cell carcinoma as seen in 7.6% of the cases . \n omsf can occur at any decade , but majority of the patients are between 20 and 40 years of age . \n recent epidemiological data indicates that , the number of of cases of osmf has increased rapidly in india , the reasons for the rapid increase of the disease being an upsurge in the popularity of commercially manufactured tobacco preparations ( pan masala ) in india and an increase in their usage among young people . \n submucosal thickness and masseter hypertrophy increases with advancing stage of osmf as shown in table 1 . when the different stages were compared there was no statistical difference between stage ii and stage iii in submucosal thickness of buccal mucosa and masseter hypertrophy . \n but there were statistically significant differences between stage ii and stage iva and stage iii and stage iva as shown in table 2 . \n this difference shows that there is an increase in severity of submucosal fibrosis as the lesion advances beyond stage ii . \n this also helps in assessing prognosis after treatment . between patients in the study group and the control group , \n further analysis showed a significant correlation between frequency of chewing , number of packets used per day , duration of habit in years , length of time of retention of the product in the mouth ( minutes ) and submucosal thickness and masseter hypertrophy as measured by usg in osmf patients ( p < 0.005 ) . \n there is no statistically significant difference between the commercial brands of smokeless tobacco products and submucosal thickness of buccal and co - existing masseter muscle hypertrophy ( p > 0.080 ) . \n this study was consistent with that of the previous studies done by manjunath et al . \n , rangaiah et al . , kamala et al . , and ariji et al . \n ultrasound is operator dependent and reading of the scan is dependent on the radiologist 's experience . \n a probe with a higher frequency to penetrate effectively and produce good quality images is essential to be diagnostic . \n ultrasound is operator dependent and reading of the scan is dependent on the radiologist 's experience . \n a probe with a higher frequency to penetrate effectively and produce good quality images is essential to be diagnostic . \n from our study , we conclude that ultrasonogram is a non - invasive , zero radiation tool for assessing the progression of osmf . \n usg shows a difference in the extent of submucosal fibrosis between stage ii and stage iii though statistically the difference was not appreciable . \n clinically , vertical bands can be palpated in stage iii but not in stage ii . \n though histolopathology is the gold standard to diagnose osmf , biopsy is not performed in all patients because it results in scarring and worsening of the condition .", "role": "user" }, { "content": "objectives : to evaluate the efficacy of ultrasonography ( usg ) as a non - invasive tool in assessing the severity of oral submucous fibrosis ( osmf ) and also to assess the relationship between osmf and hypertrophy of the masseter muscle.materials and methods : the submucosal thickness in buccal mucosa and masseteric muscle hypertrophy were measured using ultrasound ( 10 - 15 mhz ) in 60 patients comprising 30 osmf patients and 30 controls.results:results were analyzed by one way analysis of variance , chi - square test and t - test . \n as the stages of osmf advanced there was an increase in submucosal thickness of the buccal mucosa as well as masseter muscle thickness in both relaxed and contracted state in the study group when compared with controls ( p < 0.005).conclusion : usg is an effective non - invasive zero radiation tool for assessing the progression of osmf .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a technique known as the colony overlay procedure for peptidases ( copp assay ) was previously developed as the first test to enumerate total vibrionaceae in shellfish , seawater , and well water [ 1 , 2 ] . \n this assay has been recommended for use in monitoring molluscan shellfish and for potentially regulating their harvest based on the levels of total vibrionaceae . \n this total vibrionaceae approach is similar in concept to traditional sanitary surveys of shellfish harvesting areas , which are based on the total number of fecal coliforms or e. coli present in either the shellfish or their surrounding waters [ 3 , 4 ] . in the original copp assay , a substrate , l - lysyl-7-amino-4-trifluoromethylcoumarin ( l - lys - afc ) , \n is bound to a cellulose acetate membrane and the membrane is overlaid for 10 minutes onto an overnight culture grown on nonselective agar media . \n a lysyl aminopeptidase that is present in all vibrionaceae family members tested to date cleaves the substrate to produce fluorescent foci on the membrane when viewed under longwave uv . in the present study , we extended this overlay concept to produce similar assays for total and fecal e. coli . \n these assays are based on the presence of -glucuronidase ( gud ) activity , which is found in most non - o157:h7 e. coli and results in cleavage of the substrate 4-methyl--d - glucuronide ( mug ) into the fluorescent 4-methylumbelliferone . \n mug - based fluorescence assays for e. coli have been previously developed for food and water [ 612 ] . \n mug - based assays of foods and particularly molluscan shellfish often involve the most probable number ( mpn ) procedure , which is labor intensive , relatively costly , and requires up to three days for results to be obtained . \n consequently , simpler , more rapid , less expensive , and more direct enumerative procedures are needed to monitor for total and fecal e. coli , particularly in perishable foods , like shellfish . in this study \n , we report on simple membrane overlay methods to separately enumerate total e. coli ( capable of growing at 37c ) , fecal e. coli ( capable of growing at 44.5c ) , and total vibrionaceae ( capable of growing at 37c ) , and a fourth multiplex method to enumerate total e. coli and total vibrionaceae simultaneously . \n these methods are applicable for use in monitoring the presence of these organisms in shellfish and other foods , water , and environmental samples . \n stock cultures consisted of 37 strains of non - o157:h7 e. coli , as described in table 1 , and 22 enterobacteriaceae within the genera citrobacter , klebsiella , pseudomonas , salmonella , shigella , serratia , and yersinia ( table 2 ) . \n human pathogenic vibrios consisted of v. cholerae o1 and v. vulnificus ( vv1003 ) , as previously described , and v. parahaemolyticus o3:k6 , a pandemic strain obtained from e. fidelma boyd at the university of delaware , newark , delaware . \n eastern oysters ( crassostrea virginica ) were obtained from a commercial source in rhode island and from a tidal river at the university of delaware marine laboratory in lewes , delaware . \n the oysters were naturally contaminated with low levels of e. coli and moderate levels of vibrionaceae . \n they were collected principally during the warm , summer months when vibrionaceae were present in the water column . \n seawater was also obtained from the university of delaware marine laboratory during the summer . \n the mpn procedure using mug in the ec broth tubes was performed on dilutions of pure cultures and on seawater and oyster homogenates according to the protocol published in the u.s . \n the mug membrane overlay procedure was developed and its specificity was determined using e. coli serotypes and other enterobacteriaceae as listed in tables 1 and 2 . \n the bacteria were grown in tryptic soy broth ( becton , dickinson and co. , sparks , maryland ) supplemented with an additional 0.5% nacl ( 1% total nacl ) and were streaked onto 100 mm plates of tryptic soy agar ( becton , dickinson and co. ) containing a total of 1% nacl ( tsa - n ) using a flamed and cooled metal triangle . \n plates were incubated overnight ( ~18 hours ) at 37c . after culture incubation , cellulose chromatography papers ( whatman international , maidstone , uk ) or whatman no . 1 , 4 , or 54 cellulose filter paper discs ( referred to as cellulose membranes ) \n were cut to the desired size ( of the petri dish or colonies to be overlaid ) and soaked in 20 mm tris buffer , ph 8.0 containing 50 mg / l mug for about 10 seconds . \n excess buffer was allowed to drip from the membranes for 5 seconds , and the membranes were overlaid onto colonies growing on the surface of the tsa - n plates . unused substrate was retained at 4c for future use and has a shelf life of several weeks . \n membranes were removed with forceps and placed in empty petri dishes and examined for fluorescent foci using either a hand - held uv lamp at a wavelength of 364 nm or a uv light box at the same wavelength . \n alternatively , membranes could be viewed with the hand - held uv lamp while still overlaying the colonies . \n the copp assay was performed with cellulose acetate membranes as previously described [ 1 , 2 ] or with cellulose chromatography paper ( whatman international ) . \n in essence , a substrate l - lysyl-7-amino-4-trifluoromethylcoumarin ( l - lys - afc ; cat . \n afc-008 , mp biomedicals , salon , oh ) was dissolved in dimethylsulfoxide ( dmso ) to 20 mm ( 2140 l of dmso to 25 mg of l - lys - afc ) and the stock was stored at 20c until needed . \n a 250 m substrate working solution was prepared by combining 25 l of thawed substrate and 2 ml of 20 mm tris , ph 9.0 . \n substrate stock solution may be refrozen and thawed multiple times without appreciable deterioration of the substrate . \n a cellulose acetate membrane or a plain cellulose membrane ( chromatography paper ) was cut to the desired size and placed in the working solution for 1015 seconds . \n the membrane was lifted with forceps , allowed to drip excess fluid for 5 seconds , and overlaid onto overnight bacterial colonies grown at 37c on tsa - n plates . \n each membrane was removed from the plate , placed in a clean petri dish , immediately viewed under longwave ( 364 nm ) uv , and fluorescent foci were counted . \n alternatively , the foci could be visualized with a hand held uv lamp while the membrane was still covering the colonies . \n the appearance of bright white or pale blue fluorescence on cellulose acetate membranes or green fluorescence on cellulose chromatography paper signifies the presence of a lysyl aminopeptidase , which cleaves the substrate . \n positive controls consisted of v. cholerae , v. parahaemolyticus , and v. vulnificus and were propagated at 37c . \n the overlay of enterobacteriaceae was also performed at 37c for 10 minutes to determine if any of the species contained a lysyl aminopeptidase activity similar to that found in the vibrionaceae . a method to simultaneously detect total \n vibrionaceae and total e. coli was evaluated using cellulose chromatography paper that was soaked in 20 mm tris , ph 8.0 containing 250 m l - lys - afc and 50 mg / l mug . \n oysters were either 1 : 10 homogenates or dilutions of the homogenates that were prepared in 0.1% peptone buffer \n . plates were prepared using 100 l of each homogenate or dilutions of the homogenates , which were spread over tsa - n plates with a flamed and cooled metal triangle . \n after overnight incubation at 37c , membranes containing both substrates were overlaid onto the culture plate . \n vibrionaceae were enumerated in situ after 10 minutes followed by the enumeration of mug - positive ( gud - positive ) colonies after an additional 20 minutes ( 30 minutes total ) . \n it was anticipated that total e. coli could be easily distinguished from total vibrionaceae based on the color of the fluorescent foci . \n forty - three principally food - borne outbreak strains of e. coli o157:h7 were screened for gud activity by both the mpn - mug assay and by the mug overlay of colonies that were grown on tsa - n and incubated at 37c for 2 hours followed by 44.5c overnight . \n plates were overlaid for 30 minutes and the membranes were viewed on a uv light box . \n oysters and seawater were screened by the membrane overlay assay for total e. coli and total vibrionaceae and by multiplex assays for both by spread plating 100 l of a 1 : 10 or 1 : 100 oyster homogenate , prepared in 0.1% peptone buffer , or 100 l of undiluted seawater onto tsa - n plates . \n the plates were allowed to incubate at either 37c for total e. coli and total vibrionaceae overlays or at 37c for 2 hours followed by 44.5c overnight for e. coli overlays using cellulose membranes containing mug and copp separately and combined . \n samples were occasionally plated in duplicate and one plate incubated at 37c for the multiplex assay of total vibrionaceae and total e. coli while the other plate was incubated at 37c for 2 hours and then at 44.5c overnight for fecal e. coli enumeration . \n initial tests showed that overnight colonies of e. coli growing on tsa - n plates could be overlaid with cellulose membranes ( chromatography paper or whatman no . 1 , 4 , or 54 filter paper discs ) soaked in mug to produce strong blue fluorescent foci on the membranes , corresponding with the site of contact between the colony and the membrane . \n comparable results were obtained regardless of which type of membrane was used . consequently , we selected the chromatography paper to perform mug overlays throughout this study . \n an evaluation of substrate concentrations showed that strong fluorescence intensity was achieved when membranes were saturated in 50 mg / l mug . \n membranes were incubated for 1560 minutes , and then viewed for fluorescent foci in situ with a hand - held uv lamp , or the membrane could be removed to a petri dish and viewed with the hand - held uv lamp or placed on a uv light box for viewing . \n optimal results were obtained after a 3060-minute overlay and 30 minutes was selected for the remainder of the study . \n in contrast , colonies to be screened for total vibrionaceae by the copp assay were saturated in 250 m of l - lys - afc and overlaid for only 10 minutes to preclude weak enzyme activity , which is present in some enterobacteriaceae and other non - vibrionaceae , from producing false positive fluorescent foci . \n figures 1(a)1(d ) show mug and copp fluorescence on cellulose membranes after overlaying colonies of three serotypes of non - o157 : h7 e. coli ( top row in each panel ) and three vibrionaceae ( bottom row in each panel ) . \n edges of the foci are not distinct and sharp , but somewhat fuzzy because enzyme activity is via diffusion of the enzymes within the membranes . \n examples of representative mug fluorescence on the membranes are shown for total e. coli that had been incubated at 37c overnight and overlaid for 30 minutes with mug - containing membranes ( figure 1(a ) ) , and for fecal e. coli grown at 37c for 2 hours , incubated overnight at 44.5c , and overlaid for 30 minutes with a mug membrane ( figure 1(b ) ) . \n these same vibrios are strongly copp positive after overnight incubation at 37c and overlay for 10 minutes with l - lys - afc , producing green fluorescence on cellulose membranes , as depicted in figure 1(c ) . \n very weak copp fluorescence is occasionally observed in the e. coli ( arrow , figure 1(c ) ) , and such foci should not be counted as vibrionaceae because of the weak signal . \n this fluorescence may be minimized by enumerating the foci immediately after the 10-minute overlay . \n results of the multiplex assay on cultures incubated at 37c overnight , followed by a 30-minute overlay with mug and l - lys - afc ( combined ) are shown in figure 1(d ) with blue fluorescence from the e. coli on the top row and green fluorescence from the vibrios on the bottom row . \n the arrow in figure 1(d ) indicates the blockage of uv light from an opaque colony of v. parahaemolyticus which inadvertently transferred to the membrane and blocked the passage of the uv light from the light box through the membrane . \n such transfer of opaque colonies to the membranes occasionally occurs and appears to be a function of the stickiness of the colony . in such cases , \n foci may be readily observed by holding a hand - held uv lamp on the opposite side of the membrane ( the side without the opaque material ) . \n the mug overlay and the mpn - mug assays were compared for 37 strains of e. coli ( non - o157:h7 ) . \n twenty - four ( 65% ) of the 37 strains were positive by the mug overlay and 23 ( 62% ) were positive by the mpn - mug assay ; however , four colonies that were mug - negative by overlay were positive or weakly positive by the mpn - mug method , specifically strains o14:nm , o42:h2 , o103:h2 , and o111:nm ( table 1 ) . \n likewise , five isolates that were mug - negative according to the mpn - mug method were positive by the overlay method , specifically one each of the o4:nm and o26:h11 strains , and o78:h11 , o91:h , and o91:h14 ( table 1 ) . \n mpn - mug often gave weak fluorescence signal ( listed as in table 1 ) . \n repeat assays of these isolates showed variability in the perceived fluorescence intensities for those cultured in mpn - mug media . \n no variability was seen on the overlays , which consistently produced bright blue foci . \n copp overlays of these cultures were performed for 10 minutes with readings taken immediately after overlay , and weakly positive results were obtained for four of the isolates ( table 1 ) . \n differentiation of the shigella spp . was possible using individual mug and copp assays where one sh . \n boydii was both mug and copp positive , sh . flexneri was both mug and copp negative , sh . dysenteriae was mug negative and copp positive , and sh . \n sonnei was mug positive and copp negative with cultures propagated at 37c ( table 2 ) . \n shigella boydii , sh . dysenteriae , and y. enterocolitica were copp positive indicating an enzyme analogous to the lysyl aminopeptidase that was found in vibrionaceae family members . \n this is the first time we detected strong copp positive colonies associated with bacteria that were unrelated to the vibrionaceae . \n forty - three e. coli o157:h7 strains were tested in triplicate and were mug negative by both the overlay and mpn - mug assays ( data not shown ) . \n it is well known that o157:h7 strains lack gud activity and are therefore mug negative with few exceptions . \n membranes simultaneously soaked in mug and l - lys - afc were used in a multiplex format to detect total e. coli and total vibrionaceae on plates that were grown overnight at 37c ( figures 1(e ) and 1(f ) ) . in the multiplex assay of oyster homogenates , green and dark blue foci are obtained for vibrionaceae and total e. coli , respectively , when incubated at 37c ( figures 1(e ) and 1(f ) ) . for accurate enumeration , fluorescent foci must be counted in stages . \n membranes were incubated for 10 minutes on the plates and viewed with a hand - held uv . \n green fluorescent foci , representing the vibrionaceae colonies , were counted immediately , to avoid low levels of enzymes in some non - vibrionaceae from leading to false positive results . \n the plate was then incubated for an additional 20 minutes or longer at 37c for blue fluorescence development , which is indicative of colonies of total e. coli . for illustration purposes only \n , membranes shown in figures 1(e ) and 1(f ) were illuminated on a uv light box and photographed after a 30-minute overlay , which was sufficient to give bright blue fluorescence from the gud - positive colonies but was longer than recommended for accurate vibrionaceae enumeration . \n simultaneous detection is only practical if countable levels of total e. coli and total vibrionaceae are present on the same dilution plate , although figures 1(e ) and 1(f ) demonstrate the ease with which total e. coli colonies may be identified , even on crowded plates . \n multiplex assays are not appropriate for cultures incubated at 44.5c , since many vibrionaceae may not grow at elevated temperatures . \n one exception was our v. cholerae o1 which produced typical copp fluorescence when grown at 44.5c . \n if total vibrionaceae and total and fecal e. coli enumeration are desired for a sample , duplicate plating allows one plate to be incubated at 37c for total vibrionaceae and total e. coli while the other plate is incubated at 37c for 2 hours and then at 44.5c overnight for fecal e. coli enumeration . \n the 2 hours incubation at 37c constitutes a resuscitation step , as oysters may contain stressed bacteria which need to be resuscitated . \n higher e. coli counts were obtained in our assays when the resuscitation step was employed . from a safety standpoint , \n the mug assay offers additional protection against pathogens , by detecting some strains of salmonella and shigella which were mug positive and could grow at 44.5c , specifically , s. montevideo , sh . \n seawater produced bacterial colonies that gave a fluorescence signal comparable to that found in oyster homogenates for total and fecal e. coli and total vibrionaceae ; however , the levels of bacteria were generally 10- to 100-fold less than in filter - feeding molluscan shellfish , which bioconcentrate bacteria from the seawater within their edible tissues . \n by definition , fecal coliforms , including fecal e. coli , are gram - negative bacteria which ferment lactose with the production of acid and gas at 44.545.5c . \n such organisms are indicative of human gut bacteria and can be used as indicators for the possible presence of human fecal pathogens in foods and water . \n the mpn procedure capitalizes on the use of lactose - containing media , the collection of gas , and growth at 44.545.5c , so that positive isolates meet the classical definition for fecal coliforms . \n mpn - mug procedures use mug as an indicator for the presence of e. coli , since e. coli are the primary producers of gud at these elevated temperatures ; therefore , positive mpn results in the presence of mug are considered confirmatory for the presence of e. coli . \n current mpn assays for total and fecal coliforms , or e. coli , are tedious , costly , and time consuming . \n the incorporation of mug into ec broth for the mpn detection of e. coli has hastened the analysis over previous mpn methods but is still complex and produces false positives which can compromise results . according to the u.s . \n food and drug administration 's bacteriological analytical manual , the mpn - mug assay requires the use of new borosilicate glass tubes as well as new gas collection ( durham ) tubes and the tubes must be prescreened for fluorescence , as some tubes exhibit autofluorescence . in our hands , \n autofluorescence was a problem and may have contributed to the weakly positive mpn - mug results for e. coli o14:nm , o42:h2 , o103:h2 , and o111:nm , which were consistently negative by the mug overlay procedure ( table 1 ) . \n in the united states , oysters and their growing waters are monitored for fecal coliforms or e. coli using a 5-tube mpn approach , which means that 1530 or more new tubes may be required for a single analysis , depending on the number of dilutions required and the number of presumptive positive tubes that need to be transferred from lauryl sulfate tryptose broth to ec broth , thus making this procedure costly and impractical for routine use . \n since one of the major obstacles in monitoring for environmental contamination and food safety is the lack of practical and cost effective assays , our goal was to produce simple , more rapid , and inexpensive procedures to enhance monitoring efforts . \n this paper provides new tools to monitor for total and fecal e. coli and total vibrionaceae levels . in this study \n , we developed a simple plate cultivation and mug - membrane overlay technique to detect bacteria that are likely fecal e. coli based on gud production and their ability to grow at 44.5c . \n for our overlay procedure for total e. coli , we recognize that occasional pathogens other than e. coli may be gud positive , like some salmonella and shigella strains ( table 2 ) , or some streptococci ; however , the detection of other occasional pathogens simply enhances the benefits of using this test as a potential regulatory tool . \n endogenous levels of gud , which are high in some fish and shellfish [ 8 , 17 ] , are not a problem in our plate - based membrane overlays , since the overnight incubation of the plates at either 37c or 44.5c degrades endogenous , tissue - specific enzymes well before the plate is overlaid with the membrane containing the fluorogenic substrate . \n consequently , in the many assays we performed on oysters , we saw no background fluorescence , even though oyster tissues are known to contain gud . \n in addition to the complexities of performing traditional mpn - based assays , analyses for vibrionaceae in seawater and shellfish are usually complex and are generally limited to picking a few isolates from a plate for complex biochemical or molecular biological testing for specific pathogenic strains . \n monitoring of shellfish or seawater for pathogenic vibrios has failed to stop outbreaks of v. parahaemolyticus , while routine monitoring programs for v. vulnificus are nonexistent in spite of the fact that v. vulnificus in oysters causes occasional illness and death . \n acceptable baseline or threshold levels of vibrionaceae and total or fecal e. coli should be determined for implementation into regulations for harvesting or distribution of shellfish . \n threshold levels currently exist for coliforms in harvesting area waters and shellfish meats [ 3 , 4 ] but are based on mpn approaches . \n no methods have been established to date for regulation of shellfish harvesting or distribution based on total vibrionaceae levels or e. coli levels using simple overlay methods . in screening 37 strains of non - o157:h7 e. coli that were associated with major foodborne outbreaks of illness , 24 ( 65% ) were positive by the mug overlay and 23 ( 62% ) were positive by the mpn - mug assay . \n in contrast , other studies showed the recovery of gud in 95.5% , 96.5% , and 91% of the isolates examined . \n potential reasons for these differences in gud distribution among the isolates were suggested by chang et al . , but there have been no conclusive studies explaining such variability . \n in addition to a subset of non - o157:h7 isolates that were mug negative , 43 isolates of e. coli o157:h7 that were derived from a wide variety of food - borne outbreaks were mug negative . the failure to detect o157:h7 strains is a limitation of both mpn - mug and the mug overlay methods . \n this finding does not lessen the importance of the mug membrane overlay procedure , since o157:h7 strains constitute a minority of the e. coli in environmental isolates and other mug - based cultural assays , like the u.s . \n food and drug administration - recommended mpn - mug assay for e. coli , also fail to detect the o157:h7 serotype . \n escherichia coli o157:h7 strains do not contain enzymatically active gud , although these strains contain the gusa ( uida ) gene , which encodes gud and two regulatory regions . \n there does not appear to be regulatory repression to restrict gud formation , since antibody against gud detects the enzyme ; however , the gud is in an inactive form lacking hydrolytic activity . \n the cause for this inactive protein is the presence of a guanosine - guanosine insertion causing a frameshift resulting in the introduction of a premature termination codon in the gusa gene in all strains of e. coli o157:h7 tested , but not in other serotypes . \n this mutation accounts for the presence of an incomplete protein lacking gud activity ; therefore , mug - based assays are not appropriate for the detection of o157:h7 isolates . \n advantages of the overlays are that they are far simpler , less expensive , and directly quantitative , unlike mpns which give statistical probabilities of counts . culturing bacteria on nonselective tsa - n also has an advantage over selective media , like mcconkey agar with or without mug , since selective media are often inhibitory to environmentally stressed bacteria . \n with multiplex overlays , we have consolidated assays to simplify monitoring in order to drive down costs for screening and to promote more frequent testing for total e. coli and vibrionaceae . both the mug overlay and the copp assays are relatively fast , with results derived within 24 hours . \n mpn assays require up to 3 days for completion ( 2448 hours incubation in lst broth followed by 24 hours in ec broth ) and additional time if e. coli confirmation via biochemical testing is desired . \n together , the mug and copp overlay methods provide new options for quantifying total and fecal e. coli and vibrionaceae in seawater , shellfish , and other food and environmental matrices . unlike the original copp assay , which used cellulose acetate membranes that could be prepared in advance , dried for storage , and soaked in buffer before overlay [ 1 , 2 ] \n , the cellulose membranes used for copp and mug assays in this paper can not be prepared in advance or dried . \n this is because copp substrate covalently bonds to cellulose acetate membranes , but not to plain cellulose membranes , and mug does not bind to either membrane . \n although we used cellulose acetate and plain cellulose membranes to screen stock cultures for lysyl aminopeptidase activity , we used cellulose membranes exclusively for multiplex assay for total coliforms and total vibrionaceae . \n this was because copp assays on cellulose acetate membranes produced a bright light blue fluorescence while mug produced a stronger blue fluorescence ; thus , differentiation of the two colors was difficult at times . \n it became clear that the green and blue fluorescence obtained on the plain cellulose membranes was easier to discriminate between than blue and light blue fluorescence on the cellulose acetate membranes . \n multiplex overlays for the simultaneous detection of both total e. coli and total vibrionaceae may be performed when both groups of bacteria are in relatively the same proportion ; that is , both can be enumerated from the same dilution plate . \n methods to monitor molluscan shellfish harvesting and distribution , much like methods for other foods , water , or environmental samples , are often outdated and out of touch with today 's needs . \n it is necessary to shift analytical and regulatory paradigms to simpler , more practical , and cost effective measures to monitor relative levels of contamination . given the development of simple membrane overlay assays , we propose the establishment of membrane overlay - based monitoring for total and fecal e. coli and total vibrionaceae . \n for routine monitoring purposes , it may be time to shift from a search for specific vibrio pathogens to the enumeration of total vibrionaceae . \n environmental factors responsible for increases in human pathogenic vibrios within shellfish or their growing waters will likely cause an increase in the levels of many other vibrionaceae family members , including pathogenic strains ; therefore , the copp assay could prove useful in regulating shellfish harvesting based on total vibrionaceae counts . \n european standards for shellfish harvesting , where coliform levels are currently used to regulate shellfish harvesting and distribution [ 3 , 4 ] . in an aquaculture \n setting , the simple copp assay may serve as an index of fish health and disease , where spikes in vibrionaceae levels over what is normal and customary would suggest a need for more refined assays for specific pathogens and for corrective actions to be implemented within the aquaculture or hatchery setting . \n membrane overlays are simple and practical for routine monitoring and could enhance food safety by allowing increased numbers of samples to be tested at a reduced cost or by providing a simple alternative to procedures that are too rigorous for routine use .", "role": "user" }, { "content": "three assays were developed to enumerate total and fecal escherichia coli and total vibrionaceae in shellfish , seawater , and other foods and environmental samples . \n assays involve membrane overlays of overnight colonies on nonselective agar plates to detect -glucuronidase and lysyl aminopeptidase activities for e. coli and vibrionaceae , respectively . \n cellulose membranes containing the substrates 4-methylumbeferyl--d - glucuronide ( mug ) produced a bright blue fluorescence when overlaid onto e. coli , while l - lysyl-7-amino-4-trifluoromethylcoumarin produced green fluorescent foci when overlaid onto vibrionaceae family members . \n a multiplex assay was also developed for simultaneously enumerating total e. coli and total vibrionaceae in oysters and seawater . \n overall , 65% of overlaid e. coli ( non - o157:h7 ) were mug - positive , compared with 62% as determined by the most - probable - number - mug assay . \n the overlays are rapid , simple , and cost effective for quantification purposes . \n this research provides practical alternatives for monitoring bacterial indicators and potential pathogens in complex samples , including molluscan shellfish .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we investigated 2 species of cervids shot by professional hunters from 1996 to 2000 in the vicinity of ljubljana , slovenia . \n dna was extracted from spleen samples of 51 roe deer ( capreolus capreolus ) and 30 red deer ( cervus elaphus ) , as previously described ( 6 ) . \n babesiae were detected in cervids by using specific nested polymerase chain reaction ( pcr ) that allowed discrimination between b. divergens and eu1 . \n primers were designed on the basis of alignment of complete 18s rrna gene sequences of eu1 , b. divergens , and b. odocoilei . with primers piro - a ( 7 ) and babsr , a 600-bp babesial 18s rrna gene was amplified with 5 l of dna and pcr master mix ( promega , madison , wi , usa ) . \n one microliter of pcr product was used for nested pcr with either primer set piro - b / bod and piro - b / bdv to detect 240 bp of 18s rrna of eu1 and b. divergens , respectively . \n both babesial parasites were detected in roe deer ( 76.5% ) ; however , more animals were infected with b. divergens ( 54.9% ) than babesia eu1 ( 21.6% ) . \n infection with babesial parasites did not differ significantly between sexes in either roe or red deer . to assess dna sequence homologies with eu1 from human and ticks , distinctive amplicons of the complete babesial 18s rrna gene derived from cervids \n parasite dna from 2 roe deer that were found positive with a different set of nested primers was used in pcr with crypto f and crypto r ( 6 ) . \n amplicons were ligated into a plasmid vector ( topo ta cloning kit for sequencing , invitrogen , groningen , the netherlands ) , and escherichia coli competent cells were transformed as instructed by the manufacturer . \n plasmid dna was purified from overnight cultures of selected colonies ( wizard plus minipreps dna purification system , promega ) and analyzed for inserts by restriction analysis with ecor1 ( promega ) . \n sequencing on both strands was carried out in an automated sequencer using bigdye terminator cycle sequencing ready reaction kit ( pe applied biosystems , foster city , ca , usa ) . \n two clones were included in reactions with t3 , t7 , and internal primers to obtain complete gene sequence . \n sequences were analyzed with computer programs of the lasergene 1999 software package ( dnastar , madison , wi , usa ) and submitted to genbank to determine accession numbers . \n homology search and alignment of the complete sequence of the babesial 18s rrna gene from 1 roe deer showed 99.7% ( 5 nucleotide [ nt ] differences ) identity with eu1 from a human patient and 99.8% ( 4 nt differences ) identity with eu1 present in i. ricinus ticks from slovenia . \n the complete sequence of the babesial 18s rrna gene from another roe deer was , however , nearly identical ( 99.6% , 7 nt differences ) to babesial parasite mo1 and b. divergens . \n phylogenetic relationships of babesiae from roe deer and from other sources are shown the figure . by using treecon software ( 8) , \n a phylogenetic tree was constructed with the neighbor - joining method , and topology of the tree was obtained with the k80 model . \n phylogenetic relationships of representative babesiae deposited in genbank and detected in this study , inferred from multiple sequence alignment of complete 18s rrna gene . \n accession numbers of babesiae : babesia eu1 from ixodes ricinus ticks , ay553915 ; babesiae from roe deer 1 , ay572457 ; babesiae from roe deer 2 , ay572456 ; babesia eu1 from human , ay046575 ; b. divergens , ay046576 ; b. odocoilei , ay046577 ; babesia mo1 , ay048113 ; b. caballi , z15104 ; and theileria annulata , m64243 . \n babesia eu1 , a zoonotic pathogen , was the cause of human babesiosis recently reported by herwaldt et al . \n ( 4 ) . while i. ricinus was already implicated as a vector of eu1 , no other information about biology , ecology , or geographic distribution of eu1 exists ( 4,6 ) . \n phylogenetic analysis based on comparing the complete 18s rrna gene sequence of eu1 derived from humans and ticks with other babesial parasites showed that eu1 is more closely related to b. odocoilei than b. divergens ( 4 ) . \n b. odocoilei , which is transmitted by i. scapularis , primarily infects white - tailed deer in the united states ( 5 ) . \n cases of fatal babesiosis were described in 2 other species of cervids , namely a zoo - housed caribou ( rangifer tarandus caribou ) and an elk ( c. elaphus elaphus ) ( 9 ) . \n therefore , we tested 2 species of cervids from slovenia as potential reservoir hosts of eu1 . by using specific nested pcr , \n the presence of eu1 was established in roe deer ( 21.6% ) but not in red deer . in slovenia , roe deer \n their pasture comprises woodland , bushes , and even open meadows and fields ( 10 ) . however , red deer were nearly extinct in slovenia in the beginning of the 19th century . \n although they were later imported from austria , poland , and hungary , they are still less numerous and therefore harbor fewer ticks ( 10 ) . \n the identity of babesial parasites from roe deer from slovenia with eu1 was confirmed by cloning and sequencing the complete babesial 18s rrna gene . \n the sequences obtained were 99.8% and 99.7% identical to the 18s rrna genes of eu1 from ticks and humans , respectively . \n since the habitat of roe deer is expanding in other european countries ( 10 ) , additional studies are needed to determine whether roe deer are reservoir hosts of eu1 elsewhere in europe . whereas the presence of eu1 in cervids was anticipated , detection of b. divergens in roe and red deer was surprising . with the exception of a single report of naturally acquired babesiosis caused by b. divergens in reindeer ( r. tarandus tarandus ) , \n no data about cervids as reservoirs of b. divergens were available at the time of our research ( 11,12 ) . \n although b. divergens can infect cervids experimentally , animals experience only mild infections with low parasitemia ( 2,11 ) . \n however , 54.9% of roe deer and 16.7% of red deer were infected with b. divergens in this study . \n further cloning and sequencing of the complete 18s rrna gene of the parasite indicated 99.6% ( 7 nt differences ) identity with babesial parasite mo1 and b. divergens . \n mo1 was described as an etiologic agent of human babesiosis acquired in missouri and was genetically almost identical to b. divergens ( 99.9% identity , 2 nt differences ) , but the authors claimed that the parasites probably differ ( 13 ) . \n however , piroplasms in abnormal hosts or hosts that are not generally considered primary hosts may have morphologic differences ( 12 ) . \n in addition , high molecular identity of piroplasms does not necessarily mean that they have the same infectivity for different hosts . \n a babesia sp . , tentatively called b. capreoli , was observed and described in red deer in scotland ( 14 ) and sika deer ( c. nippon ) in ireland ( 15 ) . \n the main difference between bovine b. divergens and these deer parasites is in their host specificity . \n whereas b. divergens can infect a wide range of animals after splenectomy , including some deer species , various nonhuman primates , gerbils , and humans , b. capreoli can apparently infect only cervids and perhaps sheep ( 15 ) . \n nevertheless , with no deposited sequence of 18s rrna of b. capreoli , the identity of b. divergens from roe and red deer from slovenia is uncertain . \n the finding that roe and red deer may be reservoirs for b. divergens has serious implications . \n future research must determine if parasites from cervids share biologic characteristics with b. divergens , such as infectivity to cattle and humans and transmission by i. ricinus .", "role": "user" }, { "content": "we describe cervids as potential reservoir hosts of babesia eu1 and b. divergens . \n both babesial parasites were found in roe deer . \n sequence analysis of 18s rrna showed 99.7% identity of roe deer babesia eu1 with the human eu1 strain . \n b. divergens detected in cervids was 99.6% identical to bovine b. divergens .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: lipomas are most common benign neoplasms of mesenchymal tissues accounting for their 1520% of cases occurring in head and neck region , while only 14% cases seen intraorally . \n the etiology and pathogenesis of lipoma is not clear , but many factors such as mechanical , endocrine , and inflammatory influences have been reported inconclusively for their role . in oral cavity \n , lipomas are observed during routine intraoral examination and usually involve areas with fat accumulation . \n clinically , lipomas are slow growing asymptomatic painless nodular swellings with either yellow color or that of normal mucosa . \n intraorally , most commonly involved sites are buccal mucosa , tongue , floor of the mouth , buccal vestibule , and lips . \n we here present a rare case of lipoma occurring on mandibular mucogingival junction , an extremely rare intraoral site for lipoma with focus on differential diagnosis . \n a 32-year - old male patient reported with the complaint of painless swelling in left mandibular posterior region since 4 months that was gradually increasing . \n the patient had no history of dysphagia , difficulty in speaking , and no previous episode of swelling in the same region . \n the patient had not undergone any treatment for the swelling and not taken any medication . \n there was no significant family and medical history . no obvious facial swelling or lymphadenopathy was observed . the intraoral swelling measuring 12 mm \n 18 mm approximately was observed on the left mandibular mucogingival junction extending from the second premolar to third molar [ figure 1 ] . \n on palpation , swelling was soft in consistency with smooth margins and not fixed to underlying deeper structures . \n intraoral periapical radiograph revealed normal trabecular bone structure and no pathological changes were observed in alveolar bone [ figure 2 ] . \n based on the history and clinical examination , a provisional diagnosis of intraoral benign soft tissue tumor was given . \n the hematoxylin- and eosin - stained soft tissue specimen showed the presence of sheets of mature adipocytes in a distinct lobular arrangement with a thin fibrous capsule [ figure 3 ] . \n intraoral swelling in left mandibular posterior region intraoral periapical radiograph revealing normal trabecular bone pattern photomicrograph showing sheets of mature adipocytes in a distinct lobular arrangement with a thin fibrous capsule , a = adipocyte , c = capsule . \n ( h and e , 100 , scale bar = 25 m ) photomicrograph showing mature adipocytes demonstrating large clear cytoplasms and eccentric nuclei , a = adipocyte , * represents blood capillary . \n lipomas are mesenchymal tumors of adipose tissue . they commonly involve trunk and proximal portions of extremities and are relatively uncommon in oral cavity \n the etiology is still not clear , but a role of various factors has been reported . according to hypertrophy theory \n these tumors occur in oral cavity due to obesity and inadvertent growth of adipose tissue . \n however , metaplasia theory states that aberrant differentiation ofmesenchymal cells into lipoblasts leads to the development of lipoma . \n it is thought that trauma and chronic irritation may trigger the proliferation of fatty tissue that can cause development of lipoma . \n mean age of occurrence of intraoral lipoma varies according to different studies , but they usually occur in fourth and fifth decades of life . \n their prevalence is similar in both the sexes , although a male and female predominance has also been recorded . \n the present case of lipoma was seen in a male patient with age of 32 years . \n most common intraoral sites are buccal mucosa , tongue , floor of the mouth , vestibule , and lip . in a study by taira et al . \n , lipoma on gingiva was found in only 8.7% of the cases out of 207 cases of oral lipoma , suggesting it to be an uncommon site of occurrence . \n manor et al . could not document any case of gingival lipoma in an analysis of 58 cases of oral and maxillofacial lipomas . \n studart - soares et al . had documented gingiva to be the rarest intraoral site for lipoma in their extensive analysis of 450 cases of lipoma . \n oral lipomas clinically may present as slow growing solitary or multiple lesions which may be sessile or pedunculated . \n they present as asymptomatic , well - circumscribed soft encapsulated fluctuant masses or nodules with doughy consistency . \n grossly , the color may vary from that of normal mucosa to pink and some may present as yellowish masses . \n the diagnosis is not easy if the yellow color of the tumor is not visible through overlying thin mucosa . \n although the growth of oral lipomas is usually limited , they can reach great dimensions , interfering with speech and mastication , reinforcing the need for excision . in our case , \n the patient presented with a solitary soft sessile smooth mass measuring 12 mm 18 mm approximately . \n the complications typically associated with lipomas have been functional impairment due to giant size that they achieve occasionally . \n because of the similar clinical presentation , lesions such as oral dermoid and epidermoid cysts , oral lymphoepithelial cyst , benign salivary gland tumor , mucocele , benign mesenchymal neoplasm , ranula , ectopic thyroid tissue , and lymphoma are considered in its differential diagnosis . in our patient , \n the possibility of a dermoid or epidermoid cyst was also excluded as the location was not in favor . \n hemangioma , lymphangioma , rhabdomyoma , neuroma , or neurofibromas are the swellings to be ruled out when tumor is located on dorsal surface of tongue . \n although oral lipomas are well - circumscribed soft tissue lesions , rarely they give a radiographic impression of an intraosseous neoplasm within the mandibular canal . \n the gross specimen of lipoma when placed in a pot with water usually floats in it . \n it is difficult to distinguish lipoma from surrounding connective tissue when it is deeply placed . \n fine - needle aspiration biopsy ( fnab ) or ultrasound guided fnab sometimes can be used for aspiration in such cases . \n ultrasonography is a preferred technique as it is faster and inexpensive , and lipomas are hypoechoic with echogenic spots . \n a color doppler ultrasonography can also be done to evaluate the content of the lesion and its vascularity . \n the histopathological features constitute of a circumscribed aggregate of mature adipocytes which may be encapsulated . \n adipocytes show large clear cytoplasm in the absence of vascularity which serves as diagnostic feature of classic lipoma . \n all lipomas are usually well - vascularized , but the vascular network is compressed by the distended lipocytes and is usually not appreciable . \n the hematoxylin- and eosin - stained soft tissue specimen in our case showed the presence of mass of mature adipocytes arranged in lobules surrounded by a fibrous capsule . \n on the basis of microscopic features , lipomas can be classified as simple lipoma , fibrolipoma , infiltrating or intramuscular lipoma , angiolipoma , myxolipoma , spindle cell lipoma , pleomorphic lipoma , myolipoma , angiomyolipoma , chondroid lipoma , osteolipoma or ossifying lipoma , and salivary gland lipoma ( sialolipoma ) . \n histopathologically , the differential diagnoses are normal soft fatty tissue , other histologic variants of lipoma and liposarcoma . other lesions which should be distinguished are schwannoma , myxoid neurofibroma , leiomyoma , nodular fasciitis , myxolipoma , fibrolipoma , malignant fibrous histiocytoma , myxoid liposarcoma , and myxoid solitary fibrous tumor . despite the close histological similarity to normal adipose tissue , lipomas , usually , have chromosomal aberrations such as translocations involving 12q13 - 15 , locus interstitial deletions of 13q , and rearrangements involving 8q11 - 13 locus . \n immunohistochemistry has been used for differentiation between benign and malignant adipose tissue tumors with detection of ap2 , a protein expressed by lipoblasts . \n immunocytochemical studies with cd34 , bcl-2 , 21 , 24 assists in differentiating lipomas from other myxoid lesions . \n however , immunohistochemistry was not done in our patient due to financial constraints and the histopathological diagnosis was definite and in accordance with clinical findings . approximately , 58% of lipoma patients may present with multiple tumors which occur predominantly in upper half of the body and are three times more common in men than in women . \n the occurrence of multiple lipomas can be seen in association with cowden 's syndrome or multiple hamartoma syndrome , frohlich syndrome , proteus syndrome , and bannayan zonana syndrome . \n most common mucocutaneous lesions in the patients with cowden 's syndrome are small papular lesions in palate and gingiva , papillomatous and verrucous lesions of buccal mucosa , fissured tongue , and multiple cutaneous lipomas \n . frohlich syndrome also known as prune belly syndrome is defined by multiple lipomas , obesity , and sexual infantilism . \n proteus syndrome is marked by multiple lipomatous lesions , including pelvic lipomatosis , fibroplasia of feet and hands , skeletal hypertrophy , exostoses and scoliosis , and various pigmented lesions of skin . \n a case of congenital lipoma was described in a 7-year - old boy in upper labial frenum . \n zonana syndrome is characterized by congenital association of multiple lipomas , hemangiomas , and macrocephaly . \n the main treatment modality for intraoral lipomas and its histologic variants is simple surgical excision . \n recurrence rate described after excision is low , but infiltrative lipoma tends to recur after inadequate excision due to the fact that they are not encapsulated like simple lipomas . \n steroid injections are used when size of tumor is < 1 inch in diameter and their usage results in local fat atrophy and hence shrinks the size of tumor . \n malignant tumors are characterized by areas of lipoblastic proliferation , myxoid differentiation , cellular pleomorphism , increased vascularity , and mitosis . \n thus , lipomas should be excised completely as there is a rare possibility of malignant transformation . \n patients usually do not seek treatment for oral lipoma as it is mostly asymptomatic and may be observed during routine oral examination . although the features of lipoma are simple and straightforward , accurate clinical and surgical information along with a histopathological examination is the mainstay to its definitive diagnosis . the possibility of multiple lipomas must be considered and an accurate upper body examination must be done in patients with intraoral lipomas . \n clinicians should be aware about the possibility of lipomas in the oral cavity and should always consider it in their differential diagnosis of an inoffensive swelling in oral cavity . \n \n ", "role": "user" }, { "content": "lipoma is the most common tumor of mesenchymal tissues of body , but its occurrence in oral cavity is infrequent . \n buccal mucosa is the most common intraoral site of lipoma followed by tongue , floor of the mouth , and buccal vestibule . \n the involvement of mucogingival junction is rare . \n we present a unique case report of oral lipoma occurring on mandibular mucogingival junction with review of literature which has emphasis on differential diagnosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a cirurgia torcica vdeo - assistida ( ctva ) tem sido uma interveno de escolha \n para o tratamento de pneumotrax espontneo ( ps ) com bolha pulmonar . \n nosso \n objetivo foi apresentar uma abordagem de ctva uniportal unilateral para bulectomia \n bilateral e avaliar sua eficcia teraputica . \n entre maio de 2011 e janeiro de 2012 , cinco pacientes foram submetidos a \n bulectomia bilateral por essa abordagem . \n todos apresentavam ps bilateral . a tcar \n pr - operatria mostrou que todos os pacientes tinham bolhas bilaterais no pulmo \n apical . as indicaes cirrgicas , os procedimentos de operao e os desfechos \n foram revisados . \n todos os pacientes foram submetidos com sucesso a essa abordagem para bulectomia \n bilateral , sem complicaes intraoperatrias . \n a mediana de tempo para a retirada \n do dreno torcico foi de 4,2 dias , e a mediana do tempo de hospitalizao no \n ps - operatrio foi de 5,2 dias . \n um paciente teve recidiva de pe do lado esquerdo trs semanas aps a \n cirurgia e foi submetido a abraso pleural . \n a bulectomia bilateral utilizando ctva uniportal combinada com acesso \n contralateral ao mediastino anterior tecnicamente confivel e promove desfechos \n favorveis para pacientes com ps que desenvolvem bolhas bilaterais no pulmo \n apical . \n entretanto , para a realizao desse procedimento cirrgico , so \n necessrios cirurgies com experincia em ctva , instrumentos toracoscpicos \n longos , entre outras exigncias . \n if not \n managed surgically , sp still has a high recurrence rate ( 10 - 80% ) . \n video - assisted thoracoscopic surgery ( vats ) is \n the only acceptable strategy for the treatment of sp . \n currently , most \n surgeons prefer vats because it is a minimally invasive method for the resection of lung \n bullae . \n\n\n\n\n however , when the sp and lung bullae are bilateral , either \n one - stage bilateral bullectomy needs to be performed or a second vats procedure has to \n be performed on the other side . \n\n\n in the present study \n , we describe a \n procedure of bilateral bullectomy using uniportal vats combined with a contralateral \n access approach to the anterior mediastinum in patients with bilateral sp . \n between may of 2011 and january of 2012 , five patients with bilateral sp underwent \n bilateral bullectomy through uniportal vats combined with contralateral access to the \n anterior mediastinum at shanghai pulmonary hospital , tongji university school of \n medicine , in shanghai , china . \n patient ages ranged from 16 to 19 years . in three \n patients , the bilateral sp had developed first on just one side , whereas it had \n developed on both sides simultaneously in two other patients . in one patient , \n two 24f \n chest tubes had to be inserted ( one on each side ) , because of massive bilateral lung \n collapse . \n chest x - rays showed bilateral sp in two \n patients ( figure 1a ) . \n all of the patients \n underwent preoperative multidetector hrct , which revealed bilateral apical bullae in all \n of the patients ( figure 1b ) . \n the data , including \n surgical time , time to chest tube removal , length of hospital stay , postoperative \n complications , and recurrences , were retrospectively reviewed . \n all of the patients and \n their guardians were informed of the benefits and risks of this new vats approach prior \n to the procedure . \n table 1characteristics of the five patients with bilateral spontaneous \n pneumothorax.patientgenderage , yearsdevelopment of bilateral spontaneous pneumothoraxadclinical status at admissionclassification of symptomspreoperative treatment1male19simultaneousnonechest tenderness / shortness of breathseverebilateral closed thoracic drainage2male17simultaneousnonechest tenderness and painmildsymptomatic3male16alternatenonechest tenderness and coughmildsymptomatic4male19alternatenonechest tendernessmildsymptomatic5male18alternatenonechest tendernessmildsymptomaticad : associated ( pulmonary or systemic ) disease(s ) . \n : associated ( pulmonary or systemic ) disease(s ) . \n figure 1 in a , chest x - ray showing simultaneous bilateral pneumothorax ( arrows ) . in \n b , ct scan of the chest showing bilateral pneumothorax and bullae ( arrows ) in \n the apex of the lung . \n the patients were placed in the supine position ( 30 angle)-four and one being placed \n left side down and right side down , respectively ( figure \n 2 ) , so that left - sided or right - sided vats was performed . after anesthesia , a \n double - lumen endotracheal tube was inserted for selective lung ventilation . \n first , a 10-mm incision was made in the seventh intercostal space at the midaxillary \n line of the selected side for the placement of a 30 thoracoscope . \n two 15-mm incisions \n were made : one in the third intercostal space at the anterior axillary line and one in \n the fourth or fifth intercostal space at the anterior axillary line . with the control of \n contralateral lung inflation , \n the entire thoracic cavity on the operation side was \n examined carefully , and the lung bullae found were resected using an endostapler \n ( echelon 60 endopath stapler ; ethicon endosurgery corp . , \n the \n mediastinal pleura was then opened between the sternum and the pericardium with an \n electric separating hook , and an 8-to-10-cm incision was made into the pleura under the \n sternum ( figure 3a ) . \n selective deflation of the \n contralateral lung and appropriate inflation of the lung on the side of the operation \n were carried out without complication . \n the 30 thoracoscope and long grasping forceps \n were inserted into the contralateral thoracic cavity from the mediastinal pleura \n incision ( figure 3b ) . \n the contralateral thoracic \n cavity and lung were examined ( especially the apex of the contralateral lung ) , and the \n apical bullae identified on the hrct scans were then localized ( figure 3c ) . \n the contralateral apical lung bullae were held with a \n long grasping forceps and resected with the endostapler through the incision in the \n mediastinal pleura ( figure 3d ) . in this step , \n the \n procedures were carried out gently in order to avoid exerting pressure on the heart when \n the thoracoscope , the long grasping forceps , and the endostapler device were inserted \n into the contralateral thoracic cavity above the pericardium . \n figure 3photographs taken during the procedure . in a , the incision is being made \n in the mediastinal pleura between the sternum and the pericardium with a hook \n electrode . in b , a 30 thoracoscope and a long grasping forceps \n are inserted \n into the contralateral thoracic cavity from the mediastinal pleura incision . in \n c , the apical bulla of the contralateral lung is located . in d , \n the \n contralateral lung bulla is resected with an endostapler device through the \n mediastinal incision . \n after bullectomy of the contralateral lung had been performed , the pleural cavity on \n both sides was carefully examined to ensure that all of the bullae were removed . \n pleural \n abrasion was then performed on the ipsilateral side because it was impossible to do so \n on the contralateral side through the mediastinal access used in this uniportal vats \n procedure . at the end of the procedure , \n a 24f chest tube was inserted into the \n contralateral thoracic cavity via the mediastinal incision , and the other end of that \n tube exited one of the working incisions . \n a 28f tube was inserted into the thoracic \n cavity on the ipsilateral side via the camera incision ( figure 4 ) . \n after confirmation had been made that there was no active \n bleeding , the surgical incision was closed . \n figure 4postoperative chest x - ray showing the chest tube inserted through the \n mediastinal incision to the contralateral thoracic cavity . \n through the procedure described , bilateral bullectomy was successfully performed in all \n five of the patients . \n the median surgical time was 80 min ( range , 65 - 90 min ) . the median \n intraoperative blood loss was 50 ml . \n the chest tube was removed after a median of 4.2 \n days ( range , 3 - 7 days ) , and the median length of postoperative hospital stay was 5.2 \n days ( range , 4 - 8 days ) . \n the median follow - up period was 11.2 months ( range , 8 - 17 \n months ) . \n one patient experienced recurrence of contralateral sp three weeks after the \n surgery and required vats on the contralateral side . during that procedure , \n no bullae \n were identified and only pleural abrasion was performed . at this writing , \n . \n\n\n there are \n various conservative strategies for the treatment of sp , such as closed drainage of the \n pleural cavity and intrathoracic injection of an adhesion agent ( such as hypertonic \n glucose solution ) . however , \n if the hrct scans reveal obvious lung bullae , those \n conservative treatments will be useless and there is a high risk of \n recurrence . \n\n\n therefore , surgical resection of the lung bullae is the \n most effective treatment for recurrent sp , and most surgeons employ minimally invasive \n vats in order to excise the lung bullae . \n\n\n\n\n according to the literature , \n most lung bullae are bilateral , resulting in bilateral pneumothorax . \n therefore , it is worth discussing how to perform one - stage bullectomy for the treatment \n of bilateral sp . \n however , that procedure causes patients to suffer from more chronic \n incisional pain and poor cosmetic outcomes , because of multiple bilateral incisional \n wounds . \n\n\n\n\n although it has been reported that one - stage sequential \n bilateral vats bullectomy is safe and feasible for the treatment of bilateral sp , \n bilateral bullectomy using the vats approach requires a longer surgical \n time , \n\n\n\n\n which can increase the risk of intraoperative \n complications . \n various studies have reported that unilateral thoracotomy using transmediastinal access \n to the contralateral lung , which is a minimally invasive approach , is effective for the \n management of bilateral lung lesions . \n were \n the first to report the successful use of bilateral bullectomy through unilateral vats , \n in four patients . \n more recently , cho et al . \n\n\n introduced a method of \n apicoposterior transmediastinal access ( between the esophagus and vertebrae ) to perform \n simultaneous bilateral vats bullectomy . in the present study , \n the procedures for \n bilateral bullectomy were almost the same as those described by wu et \n al . \n , \n\n\n although the incision in the anterior mediastinal pleura was \n smaller , and a longer , longitudinal incision was made in the mediastinum , under the \n sternum . that incision was 8- to 10-cm in length , which is long enough to allow \n exploration of the lung on the contralateral side . \n it is of note that the incision under \n the sternum is appropriate for resecting apical lung bullae and offers a better \n operative field at the contralateral pleural cavity than does an incision made between \n the esophagus and the vertebrae . as reported by wu et al . and cho et al . , \n\n\n\n\n patients undergoing \n bullectomy by means of unilateral vats approach experience less chronic pain because \n there are fewer incisional wounds . \n in addition , given that there is no incision in the \n contralateral chest wall , those patients will achieve better cosmetic outcomes , surgical \n times will be shorter , and there will be less intraoperative blood loss . \n our median \n surgical time ( 80 min ) was shorter than that reported in previous \n studies . \n\n\n\n\n inserting two drainage tubes into only one side of the \n thoracic cavity facilitates postoperative ambulatory activities , shortens the time to \n chest tube removal , and shortens the postoperative hospital stay . \n shorter surgical times \n and shorter postoperative hospital stays also help reduce hospital costs . in our opinion \n the ideal candidate is a tall , thin , young \n male . since there is little fat in the anterior mediastinum of such patients , \n preoperative hrct scans should show that the \n contralateral bulla are located at the apex of the upper lobe , so that they can be \n easily reached with the grasping forceps and the endostapler device , through the \n transmediastinal incision . \n an experienced anesthetist is needed , because a double - lumen \n endotracheal tube needs to be inserted and re - inserted for selective lung ventilation \n throughout the procedure . \n in addition , long - handled , fine endoscopic instruments and a \n 30 thoracoscope are needed for collecting the contralateral lung bulla . \n most \n importantly , this surgical procedure should be performed only by surgeons experienced in \n vats . \n the transmediastinal incision should be made closer to the sternum , where \n the mediastinal pleura is much thinner and can be easily opened . \n this surgical procedure \n can be performed more conveniently if the thoracoscopic approach is carried out on the \n right side rather than on the left side . \n of the five patients who underwent this \n surgery , only one was submitted to the left side approach . \n the beating heart always \n covers the surgical field when the endoscopic instruments are inserted from the left \n thoracic cavity to the right . \n however , exerting pressure on the heart with these \n instruments can cause cardiac complications , such as arrhythmia . \n therefore , bullectomy \n through this unilateral vats procedure is more suitably performed on the right side . \n this procedure has some contraindications , such as a history of sternotomy and \n intolerance to one - lung ventilation because of accessibility . \n if such contraindications \n are present , one - stage bilateral vats bullectomy should be performed . \n our results demonstrate that bilateral bullectomy using uniportal vats combined with \n contralateral access to the anterior mediastinum is technically reliable and provides \n favorable surgical outcomes for patients with bilateral sp who develop bilateral bullae \n in the apical lung . however , among other requirements , the successful execution of this \n surgical procedure requires that surgeons be experienced in vats and that the \n appropriate thoracoscopic instruments be available .", "role": "user" }, { "content": "objective : video - assisted thoracoscopic surgery ( vats ) has been a surgical intervention of \n choice for the treatment of spontaneous pneumothorax ( sp ) with lung bulla . our \n objective was to introduce a uniportal vats approach for simultaneous bilateral \n bullectomy and to evaluate its therapeutic efficacy . \n methods : between may of 2011 and january of 2012 , five patients underwent bilateral \n bullectomy conducted using this approach . \n all of the patients presented with \n bilateral sp . \n preoperative hrct revealed that all of the patients had bilateral \n apical bullae . \n we reviewed the surgical indications , surgical procedures , and \n outcomes . \n results : all of the patients were successfully submitted to this approach for bilateral \n bullectomy , and there were no intraoperative complications . \n the median time to \n chest tube removal was 4.2 days , and the median length of the postoperative \n hospital stay was 5.2 days . \n the median postoperative follow - up period was 11.2 \n months . \n one patient experienced recurrence of left sp three weeks after the \n surgery and underwent pleural abrasion . \n conclusions : bilateral bullectomy through uniportal vats combined with contralateral access to \n the anterior mediastinum is technically reliable and provides favorable surgical \n outcomes for patients with bilateral sp who develop bilateral apical bullae . \n however , among other requirements , this surgical procedure demands that surgeons \n be experienced in vats and that the appropriate thoracoscopic instruments are \n available .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the respiratory tract is the site most commonly infected with opportunistic organisms in aids patients , and respiratory failure is the leading cause of death in these cases . in the 1980s , the vast majority of cases of respiratory failure were determined to have been the result of pneumocystis carinii pneumonia ( pcp ) . \n however , aids patients now commonly receive antibiotic prophylaxis against pcp , and thus acute respiratory failure is attributed to pcp in only two - thirds of current cases . however , the incidence of acute respiratory failure induced by infection with other organisms is being increasingly encountered1 ) . \n initial clinical symptoms and radiographic evidence of cryptococcal pneumonia in aids patients may be initially similar to those of pcp , but the mortality associated with cryptococcal pneumonia is much higher than that associated with pcp . therefore , the rapid diagnosis of cryptococcal pneumonia , particularly in immunocompromised hosts , including aids and cancer patients , is crucial2 , 3 ) . here , we present a case of disseminated cryptococcal infection , including acute respiratory distress syndrome associated with cryptococcal pneumonia , cryptococcemia , and cryptococcal meningitis , in an aids patient \n a 36-year - old man was admitted to our hospital , with a 30-day history of fever and headache . \n the patient , a homosexual mexican , had entered korea 4 months prior to admission . \n one year prior to admission , the patient had experienced a mild fever , diarrhea , and 20 kg of weight loss . on admission , \n this patient 's body temperature was 38.5 , and his blood pressure was 130/80 mmhg . \n the patient 's breath sounds were clear , and his heart sounds were regular , with no murmur . \n the patient 's white blood cell count was 1,580/l , total protein was 26 mg / dl , sugar was 17 mg / dl , and intracranial pressure was 23 cmh2o . \n the patient was diagnosed with hiv ( human immunodeficiency virus ) infection via serum western blotting assay . the total number of cd4 + t lymphocytes and cd8 + t lymphocytes were 7 and 60/l . \n cryptococcus neoformans was isolated on cultures of blood and cerebrospinal fluid . on the day of admission , an initial chest roentgenogram revealed no specific abnormal findings , and the patient was treated with intravenous amphotericin b and ceftriaxone as empirical therapy for possible bacterial and fungal infection . on the patient 's 4th day in our hospital , a chest roentgenogram revealed diffuse interstitial infiltrations in both lung field , and computerized tomography revealed diffuse reticulonodular infiltration and a ground - glass appearance in both perihilar areas , suggesting pcp or cryptococcal pneumonia ( figure 1 ) . on the patient 's 6th day in our hospital , \n bronchoalveolar lavage and transbronchial lung biopsy were conducted via bronchoscopy , and antiretroviral therapy ( didanosine , lamivudine , nelfinavir ) was initiated . \n results of methenamine silver staining of the bronchoalveolar lavage fluid revealed no specific abnormal findings . after the patient 's 6th day in our hospital , the patient 's breathing difficulties and arterial hypoxemia worsened . on the patient 's 9th day in the hospital , his arterial oxygen pressure and saturation level were measured at 32.7 mmhg and 61.6% , and mechanical ventilation was initiated . \n cultures of the patient 's blood and csf samples , obtained at the time of admission , revealed cryptococcus neoformans . pathological findings and the special stain results of lung biopsy specimens , obtained at the time of bronchoscopy , also revealed cryptococcal pneumonia ( figures 2 , 3 ) . \n this patient died on his 14th day in our hospital , as the result of acute respiratory failure , associated with cryptococcal pneumonia and disseminated cryptococcosis . \n acute respiratory failure with cryptococcal pneumonia in aids patients is associated with disseminated disease and a high level of mortality . \n however , the diagnosis of cryptococcal pneumonia in its early periods is rather difficult , as the initial clinical symptoms and radiographic signs of cryptococcal pneumonia in aids patients are practically indistinguishable from those of pneumocystis carinii ( p. carinii ) pneumonia , which is the most commonly encountered cause of acute respiratory failure in aids patients2 - 4 ) . \n cryptococcus neoformans ( c. neoformans ) is the fourth most commonly recognized life - threatening infection - causing organism in aids patients , after cytomegalovirus ( cmv ) , p. carinii , and mycobacterium avium intracellulare ( mai)5 ) . \n p. carinii , cmv , and mai are known to induce diffuse interstitial pneumonias in aids patients . c. neoformans is also known to induce diffuse interstitial pneumonia in aids patients . \n the initial clinical manifestations of cryptococcal pneumonia in aids patients are similar to those seen in cases of p. carinii pneumonia , but the mortality associated with cryptococcal pneumonia is much higher . \n cryptococcal pneumonia - induced acute respiratory failure is associated with a mortality rate of nearly 100% , and most of those patients progress to disseminated cryptococcosis . due to the rapidity with which cryptococcal pneumonia progresses to acute respiratory failure in aids patients , \n it is also quite difficult to distinguish cryptococcal pneumonia from p. carinii pneumonia , bacterial pneumonia , and miliary tuberculosis , as cryptococcal pneumonia is characterized by a variety of radiological findings , including interstitial infiltrations , alveolar consolidation , a ground - glass appearance , miliary nodules , lymphadenopathy , and pleural effusion6 , 7 ) . when an aids patient contracts pneumonia and the results of an induced sputum examination are negative , the accepted course of action is to administer an early check - up , including a bronchoscopy with bronchoalveolar lavage , in order to detect a possible mycotic infection which may prove fatal8 ) . \n the possibility of mycotic infections , such as cryptococcal pneumonia , must also be investigated in cases in which steroid therapy is administered for the treatment of p. carinii pneumonia9 , 10 ) . \n the above case represents an example of disseminated cryptococcosis which , in its early stages , manifested the classic symptoms of encephalomeningitis , in a patient in whom cryptococcus neoformans was cultured in cerebrospinal fluid and blood cultures . \n our patient died as the result of galloping pneumonia with acute respiratory insufficiency , although he was being treated with a course of intravenous amphotericin b. this patient exhibited disseminated cyptococcosis , but the diagnosis presented difficulties , as the radiological findings revealed perihilar density and a ground - glass appearance , both of which are also classic characteristics of p. carinii pneumonia . in this patient \n an aids patient suffering from cryptococcus neoformans , like this one in this study , often exhibits the same early clinical patterns and radiological findings observed in patients suffering from p. carinii pneumonia . \n however , early diagnosis and treatment are crucial , particularly due to the much higher fatality rate associated with cryptococcus neoformans1 - 3 , 11 ) .", "role": "user" }, { "content": "a 36-year - old homosexual mexican man was admitted to our hospital , with a 30-day history of fever and headache . upon cerebrospinal fluid examination , \n the patient 's white blood cell count was 1,580/l , total protein was 26 mg / dl , sugar was 17 mg / dl , and his intracranial pressure was 23 cmh2o . \n the patient was diagnosed with hiv ( human immunodeficiency virus ) infection by serum western blotting . \n cryptococcus neoformans was isolated in cultures of the patient 's blood and cerebrospinal fluids . \n chest computerized tomography revealed diffuse reticulonodular infiltration and a ground - glass appearance in both perihilar regions , suggestive of either pneumocystis carinii pneumonia or cryptococcal pneumonia . on the patient 's 6th day in our hospital , \n bronchoalveolar lavage and transbronchial lung biopsy were conducted via bronchoscopy , and a pathologic examination of lung biopsy specimens revealed signs of cryptococcal pneumonia.this patient died on his 14th day in our hospital , as the result of acute respiratory failure , associated with cryptococcal pneumonia and disseminated cryptococcosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: intraoral neurilemmomas are rare , and it is difficult for clinicians to distinguish neurilemmomas from other benign or malignant tumors2 . when neurilemmomas occur in the sublingual area , it is important to rule out sublingual gland tumors . \n , we report a case of a 30-year - old woman presenting with solitary swelling in the sublingual area , later confirmed as a neurilemmoma by incisional biopsy . \n a 30-year - old female presented with swelling of the right floor of the mouth that had persisted for approximately two weeks . \n the patient did not know exactly when the swelling had started , but reported that the swelling had progressively increased in size . upon examination the mass was about 4.5 cm in size . \n the only symptom reported was a distortion of the tongue 's position to the contralateral side . \n the intraoral lesion was a well - demarcated , elliptical nodular mass covered by normal oral mucosa in the right floor of the mouth . \n computed tomography ( ct ) images showed a heterogeneously enhancing lesion filling the right posterior sublingual and submandibular space . \n the mass was seen pushing the right genioglossus muscle contralaterally , the right mylohyoid muscle , hyoglossus muscle , and the anterior belly of digastric muscle inferiorly , and the submandibular gland posteriorly . \n 2 ) magnetic resonance ( mr ) images were evaluated to determine the boundaries and internal characteristics of the lesion . \n mr images showed a heterogeneously enhancing lesion occupying the right sublingual space and pushing the mylohyoid muscle inferiorly and the extrinsic muscles of the tongue internally . \n the absence of invasion of the surrounding muscles was characteristic of a benign tumor , but we could not rule out malignancy originating from the sublingual gland based on the images.(fig . 3 , 4 ) \n the main mass was infiltrated by a branch of the lingual nerve , and a portion of the nerve had to be sacrificed for complete removal of the mass . \n we plan to perform follow - up enhanced paranasal sinus ct in the 6th month after the operation . \n the grayish - yellow mass was well - encapsulated and ovoid in shape , measuring about 504030 mm in size.(fig . \n b ) the microscopic appearance of the lesion was characterized by two patterns , antoni a and antoni b of neurilemmoma . streaming fascicles of spindle - shaped schwann cells surrounded a central acellular eosinophilic region of verocay bodies in palisading patterns . \n this pattern represents antoni a. the less cellular and less organized antoni b pattern bordered the antoni a pattern.(fig . \n b ) high cellularity was detected in the antoni a pattern , but there was no evidence of dysplasia.(fig . \n neurilemmomas ( schwannomas ) are well - encapsulated , benign , slow - growing tumors that are usually solitary1 . \n they originate from schwann cells of the nerve sheath surrounding any cranial , peripheral , or autonomic nerve . \n although the etiology of neurilemmomas remains unknown , it is postulated that the lesions arise through the proliferation of schwann cells , compressing and displacing the surrounding nerve3 . between 25% and 45% of all neurilemmomas \n occur in the head and neck region , and 20% of these lesions occur in the intraoral area . \n intraoral neurilemmomas arise mainly from the tongue , followed by the palate , floor of mouth , buccal mucosa , gingiva , lips , and vestibular mucosa45 . \n neurilemmomas usually occur in the second or third decade of life , but can occur at any age . \n masses are typically between 0.5 to 3 cm in size , rarely exceeding 5 cm46 . \n when ct images show heterogeneous lesions , malignant changes in the neurogenic tumor may be suspected7 . in t1-weighted mr images , \n the signals of the lesions are isointense to that of muscle , and hyperintense to that of muscle on t2-weighted images8 . in this report , ct and mr imaging findings could not rule out the possibility of malignancy . \n their rarity and variety of morphologic and radiologic features make the differential diagnosis of neurilemmoma difficult9 . \n minor salivary gland tumors are rare , comprising 0.5% to 1% of all epithelial salivary gland tumors . however , \n the imaging features of low - grade malignant salivary gland lesions resemble those of benign salivary gland tumors11 . \n therefore , when dealing with sublingual area masses , clinicians should keep in mind the possibility of malignancy and sublingual gland tumor , though definitive diagnosis relies on histopathologic examination . \n these cells are arranged in a typical , palisading figure surrounding acellular , eosinophilic areas known as verocay bodies . \n the antoni b pattern , the loose hypocellular arrangement , lies beside the antoni a pattern . \n positive staining for the neural crest marker , s-100 protein , is an important characteristic for diagnosis61213 . \n identifying the originating nerve may be difficult , as it is difficult to differentiate between tumors of the lingual , hypoglossal and glossopharyngeal nerves14 . in this report \n , the tumor was infiltrated by a branch of the lingual nerve , a portion of which had to be sacrificed for complete excision of the mass . \n the patient complained of slight hypoesthesia on the tongue at the immediate postoperative appointment , but at a later follow up meeting the patient described little inconvenience . in cases requiring removal of a large portion of the innervating nerve , interposition nerve grafting or end - to - end anastomosis \n however , in some cases , intraoral excision may not be adequate for complete removal of the mass . \n when the tumor is large and located somewhat posteriorly , a well - experienced surgeon can perform a submandibular visor flap . in comparison to the mandibular splitting technique , which provides excellent access , the visor flap allows good access with less cosmetic deformity6 . \n we require informed consent concerning the possibility of requiring the extraoral visor flap approach before patients undergo general anesthesia . \n the intraoral approach remains the first choice to minimize postoperative complications , and in this case the whole mass could fortunately be removed by the intraoral approach alone . \n neurilemmomas are highly radio - resistant , and radiotherapy is not indicated for their management5 .", "role": "user" }, { "content": "neurilemmomas are well - encapsulated , benign , slow - growing tumors originating from schwann cells of the nerve sheath surrounding cranial , peripheral , or autonomic nerves . \n intraoral neurilemmomas are relatively rare and have a wide variety of morphologic and radiologic features . \n this makes differential diagnosis difficult , and only histopathological features can lead to a definitive neurilemmoma diagnosis . in this report , we present the case of a 30-year - old woman whose chief complaint was a solitary , nodular mass on the right floor of the mouth . after computed tomography and magnetic resonance imaging \n , we performed an incisional biopsy that showed the typical characteristics of a neurilemmoma . \n the mass was removed completely through an intraoral surgical approach . despite losing a portion of the lingual nerve \n , the patient did not complain of any specific discomfort . \n wound healing was uneventful and there were no signs or symptoms of recurrence .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: no useful biomarkers are available , and it is diagnosed by interview and observation of psychological symptoms . \n however , depressive symptoms similar to those of mdd develop in other mental diseases , such as the depressive phase of bipolar disorder ( bd ) and the early stage of cognitive disorder , and inappropriate treatment due to an inaccurate diagnosis has aggravated symptoms in some patients.1,2 studies on the brain structure using magnetic resonance imaging ( mri)313 and functional studies using functional mri and positron emission tomography1418 have recently been actively performed , and mdd - related local cerebral regions are getting clarified.19,20 however , these are not actively applied clinically , and no useful auxiliary diagnostic method for mdd has been established . \n we previously reported that evaluation of the presence or absence of atrophy of the subgenual anterior cingulate cortex ( sgacc ; part of brodmann s areas 24 and 33 ) in the elderly using voxel - based morphometry ( vbm ) on mri is useful to diagnose mdd.21,22 however , the results may vary among examiners because it involves visual evaluation , leaving a problem regarding objectivity . \n moreover , young - mature adult subjects were not evaluated because the database was limited to the elderly from 5484 years old . in this study , we set a target volume of interest ( voi ) in local cerebral regions using published statistical parametric mapping software v8 ( spm8 ; wellcome department of imaging neuroscience , london , uk ) . \n we objectively evaluated the presence or absence of atrophy of the sgacc by setting the target voi in the sgacc using a method automatically determining values of four indicators of atrophy evaluation in the region.23 at the same time , the target voi in the subcallosal anterior cingulate cortex ( scacc ; part of brodmann s area 25 ) was set to observe its association with mdd and bd , because it is the target region of deep - brain stimulation for intractable depression adjacent to the rostral side of the sgacc,24 volume reduction of this region in bd has been reported,25,26 and atrophy was frequently observed in our bd patients . \n then , a database covering young - mature adulthood was prepared for each generation , and evaluation using this method was applied to young - mature adult subjects . finally , we investigated the usefulness of this method to diagnose mdd and bd in patients followed for 1 year or longer . \n it was clarified that analysis of the presence or absence of atrophy of the sgacc and scacc is useful to diagnose these diseases . since therapeutic drugs administered to mdd and bd patients were not standardized , and effective drugs varied among patients , we investigated the relationship between cerebral local atrophy and therapeutic drugs . \n responses of each disease could be divided into two groups on the basis of the relationship between the therapeutic effects of serotonin stabilizers related to depression , dopamine stabilizers related to intractable depression and bd,2 and mood stabilizers and the presence or absence of atrophy of the sgacc and scacc detected by this method . \n therefore , this method is expected to be a useful objective auxiliary diagnostic tool to diagnose depression in a broad age group , which was previously difficult . \n this study was performed after approval by the ethics committee of nanbu hospital , okinawa , japan . \n the subjects were 181 patients who visited psychosomatic clinics for depressive symptoms characterized by continuous and overwhelming emotions of guilt , sadness , anhedonia , worthlessness , and despair and who underwent mri examination between january 2010 and july 2013 . \n there were 107 mdd patients ( 12 males and 95 females aged 2090 years [ mean : 60.214.7 years ] ) and 74 bd patients ( 19 males and 55 females aged 1789 years [ mean : 48.015.2 years ] ) . \n mdd and bd were definitively diagnosed after course observation for 1 year or longer by psychiatrists , on the basis of structured clinical interviews following the diagnostic and statistical manual of mental disorders ( 4th edition ) criteria.27 patients with a serious somatic disease , cardiovascular and neurological disorders , or alcohol- or drug - induced disorders were excluded . \n the grade of depression was evaluated using the hamilton depression rating scale comprising 17 items.28 in the mdd patients , 50% improvement on this scale was achieved by treatment . \n patients diagnosed with bd were evaluated using the young mania rating scale.29 as healthy controls , 240 healthy volunteers ( 76 males and 164 females aged 1977 years [ mean : 44.415.8 years ] ) were recruited for comparison of the target voi setting , preparation of a database covering young - mature adulthood , and comparison with mdd and bd patients . \n they had no psychoneurological disease , serious somatic disease , or alcohol- or drug - induced disorders . \n we performed mris of the brain with a 1.5 t magnetic resonance imager ( achieva nova ; koninklijke philips electronics nv , amsterdam , the netherlands ) using an eight - channel sensitivity - encoding head coil . \n the structural data were provided in three - dimensional t1-weighted fast field echo sequence ( repetition time / echo time / flip angle : 9.3 msec/4.3 msec/10 ) . \n a total of 160 sagittal sections of 2 mm slice thickness with 1 mm slices superimposed were acquired . \n first , to define the target voi of the sgacc for diagnosis of mdd , we per formed group comparisons between 30 patients ( two men and 28 women ; mean age , 66.06.8 years ) randomly chosen in the present mdd group and 30 healthy controls ( six men and 24 women ; mean age , 64.54.4 years ) randomly chosen in the present healthy volunteer group . \n next , to define the target voi of the scacc for diagnosis of bd , we performed group comparisons between 31 patients ( seven men and 24 women ; mean age , 67.98.8 years ) randomly chosen in the present bd group and the previously mentioned 30 healthy controls . \n using spm8 , we segmented mris into gray matter , white matter , and cerebrospinal fluid images by a unified tissue - segmentation pro cedure after image - intensity nonuniformity correction . \n these segmented gray matter images were then spatially normalized to the customized template in the standardized anatomic space by using diffeomorphic anatomic registration through an exponentiated lie algebra ( dartel , wellcome department of imaging neuroscience).30 the customized template for dartel was created from the 25 healthy young subjects . to preserve gray matter volume within each voxel , we modulated the images by the jacobean deter minants derived from the spatial normalization by dartel and then smoothed them by using an 8 mm full width at half maximum gaussian kernel . \n group comparisons by spm8 were assessed by using the familywise error at a threshold of p<0.05 , corrected for multiple comparisons . \n a standalone software program running on windows for vbm analysis by spm8 plus dartel was developed to discriminate patients with mdd and bd from healthy controls . \n first , mris were spatially nor malized with only a 12-parameter affine transformation to the spm8 template so as to correct differences in brain size . \n these linearly transformed images were nonlinearly transformed and then modulated to the customized template for dartel , followed by smoothing by using an 8 mm full width at half maximum kernel . \n each processed gray matter image of 82 patients with mdd , 25 patients with bd , and 43 healthy controls in the elderly was compared with the mean and sd of gray matter images of the 80 healthy volunteers chosen in the group comparison , using voxel - by - voxel z - score analysis : z score = ( [ control mean ] [ individual value])/(control sd ) . \n these z - score maps were displayed by overlay on tomographic sections and surface rendering of the standardized brain . \n we determined four indicators for characterizing atrophy in a target voi and in the whole brain : first , \n severity , the severity of atrophy obtained from the averaged positive z score in the target voi ; second , \n extent , the extent of a region showing significant atrophy in the target voi that is , the percentage rate of the coordinates with a z score exceeding the threshold value of 2 in the target voi ; third , whole - brain extent , the extent of a region showing significant atrophy in the whole brain that is , the percentage rate of the coordinates with a z score exceeding the threshold value of 2 in the whole brain ; and fourth , ratio , the ratio of the extent of a region showing significant atrophy in the target voi to the extent of a region showing significant atrophy in the whole brain.23 using the values of the four indicators as the thresholds , we determined receiver operating characteristic ( roc ) curves for discrimination of patients with mdd and patients with bd from healthy volunteers . \n the program calculates the area under the roc curve ( auc ) , sensitivity , specificity , and accuracy . \n the sensitivity , specificity , and accuracy were compared on the basis of these values and visual evaluation of overlay regions displayed when atrophy was present in the target voi in tomographic sections . to prepare databases as comparison references for young - mature adult generations , 42 healthy volunteers aged 2029 years ( 15 males and 27 females , mean age : 25.71.7 years ) , \n 44 healthy volunteers aged 3039 years ( 15 males and 29 females , mean age : 34.12.3 years ) , and 43 healthy volunteers aged 4053 years ( 17 males and 26 females , mean age : 45.53.4 years ) were recruited ( note that the elderly database comprises data on those aged 54 years ) . processed images of the gray matter of 25 mdd patients aged 53 years ( two males and 23 females , mean age : 38.58.9 years ) were compared with the mean and sd of images of the gray matter of 38 healthy volunteers of each generation ( 12 males and 26 females , mean age 36.19.3 years ) selected for z - score analysis . \n similar comparison was performed with 49 bd patients ( 12 males and 37 females , mean age : 39.29.0 years ) . using the values of the four indicators described above as the thresholds , an roc curve was prepared to differentiate mdd and bd patients from healthy volunteers . \n the auc , sensitivity , specificity , and accuracy were calculated and compared with those of visual observation of overlay regions in the target voi in tomographic sections . in the 181 young - mature adult and elderly patients who could be followed for 1 year or longer and definitively diagnosed , the association between the disease name and effective drugs was investigated in patients with sgacc atrophy , patients with scacc atrophy , patients with both sgacc and scacc atrophy , and patients without atrophy based on the four indicators described above . \n using spm8 and dartel , we noted a significant reduction of the gray matter volume of the sgacc ( talairach coordinates 0,25,3 , x , y , z ; z = infinite ) in elderly mdd patients aged 54 years compared with the healthy controls , and it was possible to draw a contour as a target voi that may be useful to diagnose depression ( figures 1 and 2 ) . a significant reduction in the gray matter volume of the scacc ( talairach coordinates 0,9,10 , x , y , z ; z=5.89 ) in bd patients was also confirmed , and it was possible to draw a contour as a target voi that may be useful to diagnose bd . \n three indicators ( severity , extent , and ratio ) in the sgacc and scacc were significantly higher in the elderly mdd patients than in the healthy controls ( p<0.001 ) , and the whole - brain extent was also significantly higher ( p<0.001 ) ( table 1 ) . in bd patients , \n the three indicators ( severity , extent , and ratio ) in the scacc were significantly higher than those in the healthy controls ( p<0.001 ) . \n in addition , the three indicators in the sgacc were significantly higher in the mdd patients than in the bd patients ( p<0.001 ) . \n these findings indicated that the disease is likely to be mdd when the three indicators are high in the sgacc , and likely to be bd when the three indicators are high in scacc but not in the sgacc . on roc analysis to distinguish mdd patients from healthy controls , of the four indicators , the accuracy based on severity , extent , and ratio in the sgacc was 93.6% , 91.2% , and 88.0% , respectively , whereas that of diagnosis made by visual evaluation was 96.8% ( table 2 ) . since sgacc atrophy was frequently noted in mdd , the cutoff value for mdd , 1.1 , was used . regarding conditions with the severity exceeding the cutoff value for mdd with the extent exceeding 0 as atrophy , \n that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 96.8% . in the scacc , the accuracy based on severity , extent , and ratio was 76.8% , 60.0% , and 56.0% , respectively , whereas accuracy by visual evaluation was 69.6% . since the scacc plays the major role in differentiating bd , the cutoff value for bd , 0.9 , was used . \n regarding conditions with the severity exceeding the cutoff value for bd with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 69.6% . on roc analysis to distinguish bd patients from healthy controls , the accuracy based on severity , extent , and ratio in the sgacc was 63.2% , 58.8% , and 58.8% , respectively , and accuracy by visual evaluation was 57.4% ( table 2 ) . \n when conditions with the severity exceeding the cut - off value for mdd , 1.1 , with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 57.4% . in the scacc , \n the accuracy based on the three indicators was 76.5% , 76.5% , and 73.5% , respectively , and accuracy by visual evaluation was 80.9% . \n regarding conditions with the severity exceeding the cutoff value for bd , 0.9 , with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 80.1% . using the young - mature adulthood database covering subjects aged 2053 years , three indicators ( severity , extent , and ratio ) in sgacc and scacc were significantly higher in young - mature adult mdd patients than in the young healthy controls ( p<0.001 ) ( table 3 ) . \n in young - mature adult bd patients , the three indicators in scacc were significantly higher than those in the young healthy controls ( p<0.001 ) . \n in addition , the three indicators in sgacc were significantly higher in young - mature adult mdd patients than in young - mature adult bd patients ( p<0.001 ) . \n these findings indicate the usefulness of this method for young - mature adults similarly to that for the elderly . on roc analysis to distinguish young - mature adult mdd patients from young healthy controls , the accuracy based on the severity , extent , and ratio in the sgacc was 92.1 , 81.0 , and 82.5% , respectively , and that by visual evaluation was 88.9% ( table 4 ) . regarding conditions with \n the severity exceeding the cutoff value for mdd , 0.8 , with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 88.9% . in the scacc , \n the accuracy based on the three indicators were 82.5% , 79.4% , and 82.5% , respectively , and that by visual evaluation was 82.5% . \n regarding conditions with the severity exceeding the cutoff value for bd , 0.5 , with extent exceeding 0 as atrophy , the accuracy was 82.5% . \n on roc analysis to distinguish young - mature adult bd patients and young healthy controls , the accuracy based on the three indicators in the sgacc was 62.1% , 43.7% , and 43.7% , respectively , and accuracy by visual evaluation was 43.7% ( table 4 ) . regarding conditions with the severity exceeding the cutoff value for mdd , 0.8 , with the extent exceeding 0 as atrophy , the accuracy was 43.7% . \n in the scacc , the accuracy based on the three indicators was 75.9% 65.5% , and 64.4% , respectively , and accuracy by visual evaluation was 70.1% . \n regarding conditions with the severity exceeding the cutoff value for bd , 0.5 , with the extent exceeding 0 as atrophy , the accuracy was 70.1% . \n on the basis of roc analysis , for the elderly , a condition with the severity exceeding 1.1 with the extent exceeding 0% in the sgacc was defined as atrophy . in the scacc , to identify bd , a condition with the severity exceeding 0.9 with the extent exceeding 0% was defined as atrophy . for young - mature adults , \n a condition with the severity exceeding 0.8 with the extent exceeding 0% in the sgacc was defined as atrophy . \n to identify bd , a condition with the severity exceeding 0.5 with the extent exceeding 0% in the scacc was defined as atrophy . regarding the association between the presence or absence of atrophy in each region and diagnosis in the 181 patients , 46 patients with mdd \n fifty four patients with mdd were judged as having atrophy in both the sgacc and the scacc . \n thirty - seven patients with bd were judged as having atrophy only in the scacc . \n no atrophy was noted in either the sgacc or the scacc in 44 patients , and the diagnosis was mdd in seven and bd in 37 . \n these findings indicate that the disease is likely to be mdd when atrophy is detected in the sgacc , and likely to be bd when atrophy is detected in the scacc without atrophy in the sgacc . \n atrophy represented by the colored region was noted only in the target voi in the sgacc in the median sagittal image . \n the patient now has favorable living activities under antidepressant treatment at a low maintenance dose ( figure 3a ) . \n a col - ored region was noted in the target voi in both the sgacc and scacc in the median sagittal image . \n antidepressant treatment for mdd induced manic / hypomanic switch , but symptoms were improved by reduction of the antidepressant dose and concomitant administration of mood stabilizers and atypical antipsychotics ( figure 3b ) . \n a colored region was noted in the target voi only in the scacc in the median sagittal image . \n the patient was diagnosed with bd and received atypical antipsychotic treatment , and symptoms improved ( figure 3c ) . \n no colored region was noted in the target voi in either the sgacc or scacc in the median sagittal image ( figure 3d ) . regarding the association between the presence or absence of atrophy in each region and therapeutic drugs , \n antidepressants were mainly prescribed for 45 of the 46 patients only with the sgacc atrophy , and the drugs were effective . \n antidepressants improved symptoms , but maintenance administration at a low dose was necessary in 39 of the 45 patients ( table 6 ) . \n of the 54 patients with atrophy in both the sgacc and scacc , antidepressants were mainly prescribed and effective in 53 . \n symptoms improved , but maintenance administration at a low dose was necessary in 25 of the 53 patients . \n it should be noted that antidepressant - associated manic / hypomanic switch occurred in eight patients . in the 37 patients with \n atrophy only in the scacc , antidepressants were prescribed to some extent in ten , and antidepressant was administered to eight patients for a short time . \n antidepressants , mood stabilizers , and atypical antipsychotics were concomitantly administered to two patients . of the 37 patients , mood stabilizers and atypical antipsychotics \n were prescribed and effective in 22 , and anti - anxiety and hypnotics , and herbal medicine were administered to five patients . of the 44 patients with no atrophy in either the sgacc or scacc , \n antidepressants were prescribed and effective in seven . in two of them , antidepressants improved symptoms and the drugs are now administered at a low maintenance dose . in the remaining five patients , antidepressants were administered for a short time . of the 44 patients with no atrophy , mood stabilizers and atypical antipsychotics were prescribed and effective in 34 . in the remaining three patients , antianxiety and hypnotics , and herbal medicine improved symptoms . \n using spm8 and dartel , we noted a significant reduction of the gray matter volume of the sgacc ( talairach coordinates 0,25,3 , x , y , z ; z = infinite ) in elderly mdd patients aged 54 years compared with the healthy controls , and it was possible to draw a contour as a target voi that may be useful to diagnose depression ( figures 1 and 2 ) . a significant reduction in the gray matter volume of the scacc ( talairach coordinates 0,9,10 , x , y , z ; z=5.89 ) in bd patients was also confirmed , and it was possible to draw a contour as a target voi that may be useful to diagnose bd \n three indicators ( severity , extent , and ratio ) in the sgacc and scacc were significantly higher in the elderly mdd patients than in the healthy controls ( p<0.001 ) , and the whole - brain extent was also significantly higher ( p<0.001 ) ( table 1 ) . in bd patients , \n the three indicators ( severity , extent , and ratio ) in the scacc were significantly higher than those in the healthy controls ( p<0.001 ) . \n in addition , the three indicators in the sgacc were significantly higher in the mdd patients than in the bd patients ( p<0.001 ) . \n these findings indicated that the disease is likely to be mdd when the three indicators are high in the sgacc , and likely to be bd when the three indicators are high in scacc but not in the sgacc . \n on roc analysis to distinguish mdd patients from healthy controls , of the four indicators , the accuracy based on severity , extent , and ratio in the sgacc was 93.6% , 91.2% , and 88.0% , respectively , whereas that of diagnosis made by visual evaluation was 96.8% ( table 2 ) . since sgacc atrophy was frequently noted in mdd , the cutoff value for mdd , 1.1 , was used . regarding conditions with \n the severity exceeding the cutoff value for mdd with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 96.8% . in the scacc , the accuracy based on severity , extent , and ratio was 76.8% , 60.0% , and 56.0% , respectively , whereas accuracy by visual evaluation was 69.6% . \n since the scacc plays the major role in differentiating bd , the cutoff value for bd , 0.9 , was used . regarding conditions with the severity exceeding the cutoff value for bd with \n the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 69.6% . \n on roc analysis to distinguish bd patients from healthy controls , the accuracy based on severity , extent , and ratio in the sgacc was 63.2% , 58.8% , and 58.8% , respectively , and accuracy by visual evaluation was 57.4% ( table 2 ) . when conditions with the severity exceeding the cut - off value for mdd , 1.1 , with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 57.4% . in the scacc , the accuracy based on the three indicators was 76.5% , 76.5% , and 73.5% , respectively , and accuracy by visual evaluation was 80.9% . regarding conditions with \n the severity exceeding the cutoff value for bd , 0.9 , with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 80.1% . \n using the young - mature adulthood database covering subjects aged 2053 years , three indicators ( severity , extent , and ratio ) in sgacc and scacc were significantly higher in young - mature adult mdd patients than in the young healthy controls ( p<0.001 ) ( table 3 ) . in young - mature adult \n bd patients , the three indicators in scacc were significantly higher than those in the young healthy controls ( p<0.001 ) . \n in addition , the three indicators in sgacc were significantly higher in young - mature adult mdd patients than in young - mature adult bd patients ( p<0.001 ) . \n these findings indicate the usefulness of this method for young - mature adults similarly to that for the elderly . \n on roc analysis to distinguish young - mature adult mdd patients from young healthy controls , the accuracy based on the severity , extent , and ratio in the sgacc was 92.1 , 81.0 , and 82.5% , respectively , and that by visual evaluation was 88.9% ( table 4 ) . regarding conditions with \n the severity exceeding the cutoff value for mdd , 0.8 , with the extent exceeding 0 as atrophy , that is , regarding cases with visually observable atrophy as atrophy , the accuracy was 88.9% . in the scacc , the accuracy based on the three indicators were 82.5% , 79.4% , and 82.5% , respectively , and that by visual evaluation was 82.5% . \n regarding conditions with the severity exceeding the cutoff value for bd , 0.5 , with extent exceeding 0 as atrophy , the accuracy was 82.5% . \n on roc analysis to distinguish young - mature adult bd patients and young healthy controls , the accuracy based on the three indicators in the sgacc was 62.1% , 43.7% , and 43.7% , respectively , and accuracy by visual evaluation was 43.7% ( table 4 ) . \n regarding conditions with the severity exceeding the cutoff value for mdd , 0.8 , with the extent exceeding 0 as atrophy , the accuracy was 43.7% . in the scacc , \n the accuracy based on the three indicators was 75.9% 65.5% , and 64.4% , respectively , and accuracy by visual evaluation was 70.1% . regarding conditions with the severity exceeding the cutoff value for bd , 0.5 , with the extent exceeding 0 as atrophy , the accuracy was 70.1% . \n on the basis of roc analysis , for the elderly , a condition with the severity exceeding 1.1 with the extent exceeding 0% in the sgacc was defined as atrophy . in the scacc , to identify bd , a condition with the severity exceeding 0.9 with the extent exceeding 0% was defined as atrophy . for young - mature adults , \n a condition with the severity exceeding 0.8 with the extent exceeding 0% in the sgacc was defined as atrophy . to identify bd , a condition with the severity exceeding 0.5 with the extent exceeding 0% in the scacc \n was defined as atrophy . regarding the association between the presence or absence of atrophy in each region and diagnosis in the 181 patients , 46 patients with mdd \n fifty four patients with mdd were judged as having atrophy in both the sgacc and the scacc . \n thirty - seven patients with bd were judged as having atrophy only in the scacc . \n no atrophy was noted in either the sgacc or the scacc in 44 patients , and the diagnosis was mdd in seven and bd in 37 . \n these findings indicate that the disease is likely to be mdd when atrophy is detected in the sgacc , and likely to be bd when atrophy is detected in the scacc without atrophy in the sgacc . \n atrophy represented by the colored region was noted only in the target voi in the sgacc in the median sagittal image . \n the patient now has favorable living activities under antidepressant treatment at a low maintenance dose ( figure 3a ) . \n a col - ored region was noted in the target voi in both the sgacc and scacc in the median sagittal image . \n antidepressant treatment for mdd induced manic / hypomanic switch , but symptoms were improved by reduction of the antidepressant dose and concomitant administration of mood stabilizers and atypical antipsychotics ( figure 3b ) . \n a colored region was noted in the target voi only in the scacc in the median sagittal image . \n the patient was diagnosed with bd and received atypical antipsychotic treatment , and symptoms improved ( figure 3c ) . \n no colored region was noted in the target voi in either the sgacc or scacc in the median sagittal image ( figure 3d ) . \n regarding the association between the presence or absence of atrophy in each region and therapeutic drugs , antidepressants were mainly prescribed for 45 of the 46 patients only with the sgacc atrophy , and the drugs were effective . \n antidepressants improved symptoms , but maintenance administration at a low dose was necessary in 39 of the 45 patients ( table 6 ) . \n of the 54 patients with atrophy in both the sgacc and scacc , antidepressants were mainly prescribed and effective in 53 . \n symptoms improved , but maintenance administration at a low dose was necessary in 25 of the 53 patients . \n it should be noted that antidepressant - associated manic / hypomanic switch occurred in eight patients . in the 37 patients with atrophy only in the scacc , antidepressants were prescribed to some extent in ten , and antidepressant was administered to eight patients for a short time . \n antidepressants , mood stabilizers , and atypical antipsychotics were concomitantly administered to two patients . of the 37 patients , mood stabilizers and atypical antipsychotics \n were prescribed and effective in 22 , and anti - anxiety and hypnotics , and herbal medicine were administered to five patients . of the 44 patients with no atrophy in either the sgacc or scacc , \n antidepressants improved symptoms and the drugs are now administered at a low maintenance dose . in the remaining five patients , \n atrophy , mood stabilizers and atypical antipsychotics were prescribed and effective in 34 . in the remaining three patients , antianxiety and hypnotics , and herbal medicine improved symptoms . \n development of the new software enabled vbm analysis using spm8 and dartel and automatic determination of the severity and extent of sgacc atrophy . when the usefulness of these values as indicators was investigated , their usefulness was similar to that of visual evaluation of overlay regions on tomographic sections with regard to their differentiation of the elderly mdd and bd patients from the healthy control subjects . \n when the severity and extent of the scacc , newly paid attention to , was used as an indicator , the sensitivity , specificity , and accuracy were similar to those of visual evaluation , for differentiation between the elderly bd patients and healthy controls . using the newly developed database covering young - mature adulthood for vbm analysis employing spm8 and dartel , when the severity and extent of the sgacc and scacc were used as indicators , \n the sensitivity , specificity , and accuracy were similar to those of elderly patients for differentiation between the young - mature adult mdd patients and healthy controls . by using two indicators , ie , \n severity and extent , and the database covering young - mature adulthood , objective evaluation of atrophy in the sgacc and scacc with an accuracy similar to that of visual evaluation became possible . \n this can facilitate sharing and comparison of information on local cerebral atrophy among multiple facilities , which had previously been difficult,21,22 further increasing the clinical usefulness of this method . summarizing the relationship between the presence or absence of atrophy of the sgacc and scacc and diagnoses of mdd and bd , \n in contrast , no sgacc atrophy was detected in bd patients , while scacc atrophy was noted in half of them . \n thus , differentiation of the diseases based on atrophy alone is not possible , but it may be useful to differentiate bd patients from healthy subjects to some extent . summarizing the relationship between the presence or absence of atrophy of the sgacc and scacc and effective therapeutic drugs , the 46 patients with sgacc atrophy alone \n were mainly treated with antidepressants , but many patients , particularly elderly patients , required low - dose maintenance administration after the remission of symptoms . \n the 54 mdd patients with both sgacc and scacc atrophy were treated with antidepressants similarly to the patients with sgacc atrophy alone , but combination with atypical antipsychotics acting as dopamine - system stabilizers31 was effective for many patients . \n it should be mentioned that manic / hypomanic switch was induced by antidepressants in eight patients in this group . \n for many of the 37 bd patients with scacc atrophy alone , mood stabilizers and atypical antipsychotics acting as dopamine - system stabilizers were prescribed . \n 1 ) manic / hypomanic switch was induced by treatment with antidepressants alone , indicating that the symptoms were due to manic depressive psychosis , but the depressive phase accounted for the majority . for treatment , symptoms were improved by concomitant administration of dopamine - related drugs at a low dose , such as olanzapine , aripiprazole , quetiapine , and pramipexole . \n mood stabilizers acting on dopamine through the glutamate system , such as lamotrigine , were also effective.3236 2 ) complications by somatic diseases , such as asthma , rheumatism , collagen disease , allergic rhinitis , and complex regional pain syndrome , were frequently noted ( many complications required steroid treatment ) . \n 3 ) detailed adjustment of prescription was necessary due to drug sensitivity in many patients , and the disease was intractable in many of them . \n it has recently been clarified that latent bipolar disorder is the main cause of intractable mdd , and involvement of the dopaminergic system in the pathology and treatment of both intractable mdd and bd was suggested.2 in our study , drugs acting on the dopaminergic system were effective for patients with the scacc atrophy , clarifying the association between the scacc and dopamine . on the basis of the above findings , we consider that , when only scacc atrophy is detected , the patient should be treated for bd , not for intractable mdd for which antidepressants are ineffective , and drugs acting on the dopaminergic system should be prescribed without antidepressants , as a rule . \n anatomically , the scacc is interrelated with the amygdala , thalamus , hypothalamus , orbitofrontal cortex , and insula , and close association with the pathologies of mdd and bd has been suggested , being an interesting region related to the oxytocin and glutamate pathways . in the group without atrophy in either the sgacc or scacc , short - term antidepressant administration improved symptoms in patients with mdd . for bd , \n mood stabilizers and atypical antipsychotics mainly were prescribed and improved symptoms . regarding the relationship between the presence or absence of atrophy in each region and \n effective therapeutic drugs , serotonergic antidepressants were effective for many patients with the sgacc atrophy , and atypical antipsychotics acting as dopamine - system stabilizers were effective for many patients with the scacc atrophy . \n this suggests that the sgacc is related to serotonin regulation , and the scacc is related to dopamine regulation . \n neural circuits including the anterior cingulate gyrus have been assumed for mdd and bd , but further studies are awaited with regard to the roles of the sgacc and scacc.3739 the results of the pharmacological effects were sum - marized by region as follows . \n 1 ) antidepressants were very effective for patients complaining of depressive symptoms with atrophy only in the sgacc , but once the condition became a depressive state , continuation of administration at a low dose was necessary for most patients . \n 2 ) for patients with atrophy in both the sgacc and scacc , antidepressants are basic treatment , but drug - induced manic / hypomanic switch may occur , and concomitant mood stabilizers and atypical antipsychotics acting as dopamine - system stabilizers may be necessary in some cases . \n 3 ) for patients in a depressive state with atrophy noted only in the scacc , antidepressants are administered for a short time as a rule because manic / hypomanic switch is induced , and concomitant administration of mood stabilizers and atypical antipsychotics acting as dopamine - system stabilizers are necessary . \n 4 ) when no atrophy is noted in either sgacc or scacc , improvement of symptoms by antidepressants is observed within a short time in many cases . when symptoms are not improved within a short time , investigation of bd and other diseases \n it was suggested that distinguishing mdd treatment strategies between cases with sgacc atrophy alone and sgacc and scacc atrophy is useful . \n it was also suggested that distinguishing bd treatment strategies between cases with and without scacc atrophy is useful . \n it was confirmed that analysis of the sgacc and scacc using this simple vbm in routine medical practice can not only be utilized for auxiliary diagnoses of mdd and bd , but also provide useful information for deciding on a treatment strategy , suggesting the effectiveness of this differentiation method as an auxiliary diagnostic method . \n firstly , the possibility of including subjects with latent mdd before onset and those vulnerable to bd development in the database of normal cases , particularly the database of normal young - mature adults , can not be ruled out . \n atrophies of the sgacc and scacc are not diseases of mdd and bd , and these are considered to represent vulnerability to disease development.40 the mental conditions of patients before onset are the same as those of normal individuals , and differentiation is impossible . actually , the cutoff values of the indicators of sgacc and scacc atrophies differed between the elderly and young - mature adults and tended to be lower in the latter group . \n these may have been evidence of a mixture of subjects vulnerable to mdd and bd development in whom the score should be essentially higher than in healthy individuals . \n secondly , although three different generations in young - mature adulthood should have been individually evaluated , evaluation by generation was difficult because of the small number of young - mature adult patients . \n calculation was performed using the individual databases of the three age groups , but the results were evaluated as a single group representing young - mature adults . accordingly , the results may have been slightly different from those compared in each age group , and this may have had an influence on the differences in the findings between the young - mature adults and the elderly . it is necessary to verify the results by increasing the number of young - mature adult patients and evaluating each generation . \n last but not least , this method is just an auxiliary diagnostic method , and it can not be used while overlooking interviews about mental symptoms and observation of patients . \n a depressive state occurs in menopause with rapid changes in hormones , even though there is no atrophy , and antidepressants were effective for some patients . \n it should be emphasized that , in terms of the pharmacological effects of drugs , it can not be simply considered that the absence of sgacc atrophy equals ineffectiveness of antidepressants . in summary , using vbm on mri , automatic analysis of atrophy in the sgacc and scacc became possible , which not only facilitated accurately diagnosing patients with depressive symptoms , but was also useful to decide on prescriptions . \n the accumulation of more cases is expected , along with the establishment of this method as a highly accurate auxiliary diagnostic method . \n in this study , we developed a method for the automatic analysis of atrophy of sgacc and scacc in young - mature adults and the elderly . \n we have shown that the findings obtained by using this method are useful not only to differentiate patients with depressive symptoms but also to decide on prescriptions . on the basis of the analytical findings , the following conclusions were drawn . \n 1 ) antidepressants are effective for patients complaining of depressive symptoms with atrophy detected only in the sgacc , but maintenance administration is necessary . \n 2 ) antidepressants are a basic treatment when atrophy is detected in both the sgacc and scacc , but drug - induced manic / hypomanic switch is likely to occur , and concomitant administration of mood stabilizers and atypical antipsychotics acting as dopamine - system stabilizers is necessary . \n 3 ) when atrophy is detected only in the scacc , antidepressants should be used only for a short term as a rule because these drugs frequently induce manic / hypomanic switch , and it is necessary concomitantly to administer mainly mood stabilizers and atypical antipsychotics acting as dopamine - system stabilizers . however , there are many intractable cases . \n 4 ) when no atrophy is observed in either the sgacc or the scacc , improvement of symptoms by antidepressants is observed within a short time . when symptoms are not improved by short - term medication , it is necessary to investigate the possibility of bd and other diseases . \n furthermore , objective indicators were established , and information on local cerebral atrophy can be readily shared and compared among multiple facilities , which is expected to be utilized as an accurate auxiliary diagnostic tool for patients with depressive symptoms .", "role": "user" }, { "content": "objectivewe objectively evaluated the presence or absence of atrophy of the subgenual anterior cingulate cortex ( sgacc ) and the subcallosal anterior cingulate cortex ( scacc ) , using new voxel - based morphometry ( vbm ) software employing statistical parametric mapping software v8 and diffeomorphic anatomic registration through an exponentiated lie algebra . \n we prepared a database covering young - mature adulthood and investigated the clinical usefulness of the evaluation.subjects and methodsone hundred seven patients with major depressive disorder ( mdd ) , 74 patients with bipolar disorder ( bd ) , and 240 healthy control subjects underwent 1.5 t magnetic resonance imaging scanning . using new vbm software and databases covering young - mature adults and the elderly , target volumes of interest \n were set in the sgacc and scacc , four indicators ( severity , extent , ratio , and whole - brain extent ) were determined , and the presence or absence of atrophy of the sgacc and scacc was evaluated on the basis of the indicators . \n in addition , the relationships between the presence or absence of atrophy of the sgacc and scacc and performance of diagnosing mdd and bd and therapeutic drugs were investigated.resultsit was clarified that the disease is likely to be mdd when atrophy is detected in the sgacc , and likely to be bd when no atrophy is detected in the sgacc but is detected in the scacc . regarding the relationship with therapeutic drugs , it was clarified that , when atrophy is detected in both the sgacc and the scacc , concomitant administration of mood stabilizers and atypical antipsychotics acting as dopamine - system stabilizers is necessary in many cases.conclusionvbm on magnetic resonance imaging enabled automatic analysis of atrophy in the sgacc and scacc , and findings obtained by this procedure are useful not only for differentiation of mdd and bd patients but also for selection of prescriptions .", "role": "assistant" } ]