Datasets:

tsharish

/

pubmed-summarization-1k

like 0

[ { "content": "You are a medical writer. Summarize the following article: chronic kidney disease ( ckd ) is a very common co - morbidity associated with congestive heart failure . often times , a large proportion of these patients have co - morbidities that can cause kidney dysfunction in addition to the pre renal effects of the poor systemic perfusion related to low cardiac output status . cardiac resynchronization therapy ( crt ) \n has been shown to improve cardiac function in heart failure patients who have new york heart association ( nyha ) class ii , class iii and ambulatory class iv symptoms , females , and patients with wider qrs duration ( the longer the qrs duration , the greater the benefit ) despite optimal medical management , , , , , , , , . \n furthermore companion and care - hf studies have shown that crt improves survival and decrease morbidity in patients with heart failure and wide qrs , . \n renal function is one of the important factors that predicts prognosis in heart failure patients . \n cardiovascular disease mortality rates are up to 15 times higher in patients with end - stage renal disease compared to general population . among implantable cardioverter defibrillator ( icd ) recipients , those with renal failure had a significantly higher mortality than those with normal renal function , . \n however there is limited data on the effect of crt on renal function in patients with heart failure . \n mathew j et al . performed a posthoc analysis of reverse trial and found that patients with underlying ckd had more lv dysfunction and crt improved lv structure and function to a lesser extent in these patients compared to those with normal renal function . \n posthoc analysis of miracle trial showed that renal function improved in patients with stage iii ckd compared to controls , whereas patients with stage ii had no significant differences in renal function improvement compared to controls . \n in multicenter automatic defibrillator implantation trial cardiac resynchronization therapy ( madit - crt ) , heart failure patients with ef < 30% and nyha class i or ii who had an elevated ratio of bun to serum creatinine ( scr ) experienced a significantly greater reduction in the risk of heart failure or death with crt - d therapy as compared with patients with a low ratio of bun to scr . \n have shown that heart failure patients who received crt - d and who had moderate renal insufficiency showed higher survival benefit compared to patients who received standard defibrillators . \n however this study did not examine or differentiate the outcomes based on cardiovascular response to crt . in the current study we attempt to assess if improvement in left ventricular ejection fraction ( > 5% defined as crt response for the purposes of this study ) has any effect on renal function in patients with congestive heart failure and renal dysfunction . \n we hypothesized that ( i ) patients who respond to crt might have an improvement in renal function ( ii ) an improvement in renal function after crt therapy might improve overall survival . \n all patients who underwent crt implantation at university of kansas between 2000 and 2009 were reviewed from a prospective crt registry and patients who had pre and post crt renal function studied were included in our study . \n renal function was determined using glomerular filtration rate ( gfr ) and classified into 5 stages of chronic kidney disease before and after crt . \n estimated gfr was assessed using the four - component modification of diet in renal disease ( mdrd ) equation incorporating age , race , sex , and scr level . \n the ckd classification was done based on gfr ( ml / min ) : stage 1 ( > 90 ) , stage 2 ( 6090 ) , stage 3 ( 3059 ) , stage 4 ( 1529 ) and stage 5 ( < 15 ) . due to small sample size in advanced stages of kidney disease , for the purposes of this study we merged stages iv and \n both the pre and post lvef measurements were interpreted by same cardiologist who were not aware of the clinical data . \n for those with stage 13 ckd , a mean 45 7 cc of contrast were given , whereas those with advanced ckd ( stage 4 and 5 ) were given mean 40 4 cc of contrast . \n all patients with ckd stage 4 and 5 were given iv normal saline with sodium bicarbonate at 1 cc / kg / hr starting in the morning of the procedure for a total of 24 h. crt was implanted using standard technique by placing a pacing lead through the coronary sinus ( cs ) targeting the mid to basal posterolateral aspect of the left ventricle . \n post implantation all crts were appropriately optimized for a - v and v - v timing . \n triggered biventricular pacing response was activated whenever relevant to maximize biventricular pacing in patients with atrial arrhythmias and frequent pvcs . \n the effect of crt on renal and cardiac function was studied after short term ( 6 months post implantation ) and long term ( > 6 months ) follow up . \n we studied the differences in mortality between those who had improved gfr vs. those who did not post crt . \n we also assessed the degree of improvement in renal function between patients with various stages of ckd who received crt . any patient without baseline laboratory parameters within prior 6 months \n data was plotted ( e.g. , histograms and spaghetti plots linking before / after crt - d measurements ) to examine for potential outliers and for the necessity of transformation prior to analysis . \n summary statistics ( e.g. , mean , standard deviation , minimum , maximum , proportions ) were calculated for all variables . the primary comparison between participants before and after crt - d was made using a paired t - test for primary and secondary outcomes . \n pearson 's correlation was used to describe the relationship between egfr and improvement in lvef . \n these relationships were also examined graphically using a scatterplot and , if the relationship was nonlinear , the spearman correlation coefficient was used instead of the pearson . \n crt was implanted using standard technique by placing a pacing lead through the coronary sinus ( cs ) targeting the mid to basal posterolateral aspect of the left ventricle . \n post implantation all crts were appropriately optimized for a - v and v - v timing . \n triggered biventricular pacing response was activated whenever relevant to maximize biventricular pacing in patients with atrial arrhythmias and frequent pvcs . \n the effect of crt on renal and cardiac function was studied after short term ( 6 months post implantation ) and long term ( > 6 months ) follow up . \n we studied the differences in mortality between those who had improved gfr vs. those who did not post crt . \n we also assessed the degree of improvement in renal function between patients with various stages of ckd who received crt . \n data was plotted ( e.g. , histograms and spaghetti plots linking before / after crt - d measurements ) to examine for potential outliers and for the necessity of transformation prior to analysis . \n summary statistics ( e.g. , mean , standard deviation , minimum , maximum , proportions ) were calculated for all variables . the primary comparison between participants before and after crt - d was made using a paired t - test for primary and secondary outcomes . \n pearson 's correlation was used to describe the relationship between egfr and improvement in lvef . \n these relationships were also examined graphically using a scatterplot and , if the relationship was nonlinear , the spearman correlation coefficient was used instead of the pearson . \n a total of 558 patients with mean age of 67 12 yrs were included in the study ( see table 1 ) . \n the entire study cohort was distributed into the following stages of ckd : stage 1 was 47 patients ( 8.4% ) , stage 2 was 217 patients ( 39% ) , stage 3 was 232 patients ( 41.5% ) , stage 4 was 45 patients ( 8.1% ) and stage 5 was 17 patients ( 3% ) ( table 1 ) . \n about 9% of those who received crt were african americans and the remaining patients were caucasians ( 91% ) . \n one percent of the devices were crt - p and the rest were crt - d . \n twenty one percent had prior icd , 15% had prior ppm , 0.4% had prior crt - p and 63% had no prior device . \n twenty nine percent died during a mean follow up of 852 559 days . \n the average short term follow up duration was 100 67 days and the average long term follow up duration was 377 164 days . \n gfr stayed the same or improved in 210 patients during short term follow up and in 207 patients during long term follow - up . \n lvef stayed the same or improved in 77% during short term follow - up and 79% during long term follow - up . \n crt responders ( defined by increase in lvef 5% ) were 54% during short term follow - up and 65% during long term follow - up . \n lvef significantly improved from baseline to short term follow up ( 24 9 vs. 28.6 11 , p < 0.001 ) and during long term follow up ( 24 9 vs. 33 13 , p \n table 2 shows the use of medications such as beta - blockers , angiotensin converting enzyme inhibitors , angiotensin receptor blockers , furosemide , spironolactone , digoxin , anti - arrhythmic and statins . \n there was no significant differences in the use of these medications between baseline and follow up ( table 2 ) . \n table 3 shows the effect of crt on cardiovascular and renal parameters before and after crt . when compared to baseline , there was no significant deterioration in mean gfr during follow up ( short term : 57 23 vs. 57 23 , p 0.9 and long term : 58 22 vs. 57 24 , p = 0.1 ) for the total study cohort . in the subgroup analysis based on the stages of ckd \n , there was significant improvement of renal function in patients advanced kidney disease during short term and long term follow up ( table 4 ) . stage 4 ckd had the most clinical improvement in renal function both in the short and long term follow ups ( fig . 1 ) . \n differences in mortality among those who had improvement in gfr vs. those who did not during long term follow up , showed a trend toward significance ( 25% vs. 33% , p = 0.08 ) but did not reach statistical significance ( fig . 2 ) . \n similarly during short term follow up there was a decrease in mortality in patients who had improvement in gfr compared to those who did not but this was not statistically significant ( 33% vs. 35% , p = 0.6 ) . \n an improvement in ef of at least 5% showed decreased mortality compared to those who did not during short term follow up ( 24% vs 35% , \n p = 0.03 ) and did not reach statistical significance during long term follow up ( 25% vs. 34.5% , p = 0.1 ) mean bun / cr ratio was 18.2 7.4 and median was 17.8 . based on pre - crt azotemia defined by bun / cr ratio \n multivariate logistic regression analysis showed that an improvement in gfr after crt independently predicted mortality after adjusting for age , gender , diabetes , hypertension , coronary artery disease , smoking , change in lvef by 5% , atrial fibrillation and hyperlipidemia ( table 5 ) . \n differences in mortality among those who had improvement in gfr vs. those who did not during long term follow up , showed a trend toward significance ( 25% vs. 33% , p = 0.08 ) but did not reach statistical significance ( fig . 2 ) . \n similarly during short term follow up there was a decrease in mortality in patients who had improvement in gfr compared to those who did not but this was not statistically significant ( 33% vs. 35% , p = 0.6 ) . \n an improvement in ef of at least 5% showed decreased mortality compared to those who did not during short term follow up ( 24% vs 35% , p = 0.03 ) and did not reach statistical significance during long term follow up ( 25% vs. 34.5% , p = 0.1 ) mean bun / cr ratio was 18.2 7.4 and median was 17.8 . \n based on pre - crt azotemia defined by bun / cr ratio there was no differences in mortality during follow up . \n multivariate logistic regression analysis showed that an improvement in gfr after crt independently predicted mortality after adjusting for age , gender , diabetes , hypertension , coronary artery disease , smoking , change in lvef by 5% , atrial fibrillation and hyperlipidemia ( table 5 ) . \n patients with advanced stages of ckd seem to benefit the most while other stages seem to be stable or show a trend for improvement . \n 3 . importantly , improvement in gfr showed a trend towards decreased mortality during long term follow up . \n the mechanism of improvement in lv function , symptoms and survival is probably due to synchronized stimulation of both right and left ventricles to contract simultaneously and thereby correcting atrioventricular mechanical dyssynchrony , atrioventricular interval , interventricular conduction delay and improving left ventricular ( lv ) contractility , , , , . \n recent studies have shown that patients who have pre - renal azotemia ( probably reflecting patients with cardio - renal syndrome ) showed decreased risk of death or heart failure compared to patients with a low bun / cr ratio . \n our study showed that the renal function stays the same for most patients and improves in patients with stage 4 & 5 ckd . \n ckd patients were either totally excluded or grossly underrepresented in various crt trials . even in the most recent madit - crt had only 5% of patients with stage 4 and 5 ckd . while our study showed benefit of crt in advanced stages of ckd , boerringter et al \n overall these are very important findings that there may be a potential role of crt in patients with cardio - renal syndrome . \n this shows that even patients with end stage renal disease may derive significant benefit in their lv function , renal function and mortality with crt . \n progressive renal dysfunction could be due to several factors such as hypertension , diabetes , increasing age , and activation of renin angiotensin aldosterone system in patients with heart failure . \n management of patients with heart failure and ckd often poses challenge including use of ace inhibitors which are often discontinued by other providers due to modest increases in serum creatinine . \n renal perfusion is decreased in patients with low cardiac output and this independently predicts poor outcomes . in patients with decompensated heart failure , \n reduced renal perfusion leads to reduced water excretion by nephrons and stimulates secretion of anti - diuretic hormone leading to water retention . \n therefore any therapy which slows down renal dysfunction or improves renal function in patients with heart failure would favor long term outcomes . \n our data suggests that crt therapy has modest impact on renal dysfunction across most stages of ckd . \n prior studies have shown that worsening renal function in heart failure patients predicts poor survival . in our study \n we showed that an improvement in gfr shows a trend towards improved survival and is an independent predictor of survival . \n these effects on mortality may be due to an indirect effect of improved renal perfusion and thereby decreasing the adverse effects of abnormal neuro - hormonal activation seen in heart failure patients . \n obviously , the lack of a control group limits the systematic assessment of the progression of ckd and changes in gfr without crt therapy . \n due to smaller numbers mortality and subgroup analysis based on stages of ckd are inherently limited . \n the benefits of crt were also primarily seen in patients with advanced ckd ( stage 4 and 5 ) which comprised of only 10% of study population . \n other limitations include lack of biventricular pacing percentage data in the responders vs non responders . \n finally , the long term follow up was limited to one year due to loss of follow up . \n however , attempts have been made to maximize biventricular pacing in every patient irrespective of their renal function . \n larger studies are needed to further understand the role of crt in patients with ckd and its role in preventing the progression of cardio - renal syndrome . \n patients with advanced stages of ckd seem to benefit the most while other stages seem to be stable or show a trend for improvement . \n 3 . importantly , improvement in gfr showed a trend towards decreased mortality during long term follow up . \n the mechanism of improvement in lv function , symptoms and survival is probably due to synchronized stimulation of both right and left ventricles to contract simultaneously and thereby correcting atrioventricular mechanical dyssynchrony , atrioventricular interval , interventricular conduction delay and improving left ventricular ( lv ) contractility , , , , . \n recent studies have shown that patients who have pre - renal azotemia ( probably reflecting patients with cardio - renal syndrome ) showed decreased risk of death or heart failure compared to patients with a low bun / cr ratio . \n our study showed that the renal function stays the same for most patients and improves in patients with stage 4 & 5 ckd . \n ckd patients were either totally excluded or grossly underrepresented in various crt trials . even in the most recent madit - crt had only 5% of patients with stage 4 and 5 ckd . while our study showed benefit of crt in advanced stages of ckd , boerringter et al \n overall these are very important findings that there may be a potential role of crt in patients with cardio - renal syndrome . \n this shows that even patients with end stage renal disease may derive significant benefit in their lv function , renal function and mortality with crt . \n progressive renal dysfunction could be due to several factors such as hypertension , diabetes , increasing age , and activation of renin angiotensin aldosterone system in patients with heart failure . \n management of patients with heart failure and ckd often poses challenge including use of ace inhibitors which are often discontinued by other providers due to modest increases in serum creatinine . \n renal perfusion is decreased in patients with low cardiac output and this independently predicts poor outcomes . in patients with decompensated heart failure , \n reduced renal perfusion leads to reduced water excretion by nephrons and stimulates secretion of anti - diuretic hormone leading to water retention . \n therefore any therapy which slows down renal dysfunction or improves renal function in patients with heart failure would favor long term outcomes . \n our data suggests that crt therapy has modest impact on renal dysfunction across most stages of ckd . \n prior studies have shown that worsening renal function in heart failure patients predicts poor survival . in our study \n we showed that an improvement in gfr shows a trend towards improved survival and is an independent predictor of survival . \n these effects on mortality may be due to an indirect effect of improved renal perfusion and thereby decreasing the adverse effects of abnormal neuro - hormonal activation seen in heart failure patients . \n obviously , the lack of a control group limits the systematic assessment of the progression of ckd and changes in gfr without crt therapy . \n due to smaller numbers mortality and subgroup analysis based on stages of ckd are inherently limited . \n the benefits of crt were also primarily seen in patients with advanced ckd ( stage 4 and 5 ) which comprised of only 10% of study population . \n other limitations include lack of biventricular pacing percentage data in the responders vs non responders . \n finally , the long term follow up was limited to one year due to loss of follow up . \n however , attempts have been made to maximize biventricular pacing in every patient irrespective of their renal function . \n larger studies are needed to further understand the role of crt in patients with ckd and its role in preventing the progression of cardio - renal syndrome . \n crt was associated with stabilization of renal function in patients with severe lv dysfunction and improvement in stage 4 and 5 ckd . \n \n ", "role": "user" }, { "content": "backgroundthe goal of this study is to assess the effect of cardiac resynchronization therapy ( crt ) over time on renal function and its impact on mortality . \n the effect of crt on renal function in patients with heart failure is not well understood.methodsall patients who underwent crt implantation at university of kansas between year 2000 and 2009 were reviewed and patients who had pre and post crt renal function studied were included in our study . \n stages of chronic kidney disease ( ckd ) were defined based on kidney disease outcome quality initiative ( kdoqi ) guidelines . \n the effect of crt on renal and cardiac function were studied at short term ( 6 months post implantation ) and long term ( > 6 months).resultsa total of 588 patients with mean age of 67 12 yrs were included in the study . \n crt responders ( defined by increase in lvef 5% ) were 54% during short term follow - up and 65% on long term follow - up . \n when compared to baseline , there was no significant deterioration in mean glomerular filtration rate ( gfr ) during follow up . \n when analyzed based on the stages of ckd , there was significant improvement of renal function in patients with advanced kidney disease . \n multivariate logistic regression analysis showed that stable gfr or an improvement in gfr independently predicted mortality after adjusting for co-morbidities.conclusionscrt was associated with stabilization of renal function in patients with severe lv dysfunction and improvement in stage 4 and 5 ckd . improved renal function \n was associated with a lower mortality .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: ch is also one of the most classic diseases in newborn screening history , the incidence of which varied from 1:2000 to 1:4000 in different areas and different ethnicities . \n pituitary thyroid axis , which leads to a reduction of thyroxin secretion , which , in turn , causes severe damage to the brain . according to the clinical course of the disease \n , ch can be classified as either permanent or transient ch ( pch / tch ) . \n it was reported that the incidence of pch was about 1:2000 to 1:3587 and that the incidence of tch was about 1:1580 to 1:17 000 . \n the major etiology of pch was linked to dysgenesis , including complications such as athyreosis , atrophy , and ectopic , but the etiology of tch was not that clear . \n many studies suggested that the etiology of tch was multiplicity , prematurity , low birth weight , and iodine deficiency or excessive use of antithyroid drugs . \n in addition , an interaction between genes and the environment may also be related to the occurrence of tch . up to now , there have been very few reports regarding the incidence and etiology of pch and tch in china . \n guangxi province , which is located in the southwest of china , is the largest minority nationality area for the han and zhuang nations . \n its geography and ethnic makeup means that it is different from other areas of china . \n a previous study reported the incidence of ch as detected by nsp to be about 1:835 in guangxi , which is much higher than the average for the whole country . \n but the incidence of confirmed cases of pch and tch among patients and the reasons of the high incidence of ch in this area are still unclear and is yet to be fully reported . \n the objective of this study was to confirm the high incidence of ch as detected by nsp and look at the interrelated factors linked to the major types of ch in guangxi . \n a total of 930 612 newborns ( 511 555 females and 419 057 males ) screened by the newborn screening program ( nsp ) at newborn screening center of guangxi , china , from january 2009 to december 2013 , were included in this study , and the screening rate was about 93.1% . within 72 hours of birth , 3 drops of blood was taken from the heel of subjects and placed on a filter paper ( s&s 903 ) for the measurement of thyroid stimulating hormone ( tsh ) . \n patients with positive results at screening were recalled and a 90% recall rate was achieved . \n venous blood samples were collected from the positive patients for a confirmation test by the chemiluminescence method . at this time serum blood tsh and free thyroxin ( ft4 ) levels \n after patients were confirmed to be positive for ch , it was still necessary to check the thyroid morphology by performing a thyroid ultrasound examination . \n for those patients where it was not possible to locate the thyroid by ultrasound , it was necessary to perform further scans using a radioisotope scanning technique . \n at the first diagnosis stage when recalled , patients were classified as ch , when their clinical profiles matched one of the following : ( a ) tsh 10 miu / ml and ft4 < 12 pmol / l and ( b ) the thyroid imaging examination suggested athyreosis , atrophy , or ectopic . \n other patients with elevated tsh continually , but normal ft4 values and normal thyroid morphology , were classified as hyperthyroxinemia ( some studies also classified these patients as suffering from subclinical hypothyroidism ) . at the second diagnosis stage , after being followed - up for more than 2 years , patients were classified as pch , when their clinical profiles matched the following : patients who were unable to stop treatment and therefore needed constant hormone replacement therapy . \n those patients whose clinical profiles matched both of the following were classified as tch : ( a ) the thyroid imaging examination indicated the location and morphology of the thyroid to be normal and ( b ) the thyroid remained functional for more than 6 months after treatment was stopped and the thyroid function test would continue to be performed monthly . \n data were analyzed using spss 13.0 , and the relationship between the multiplicity of factors and the results of the second diagnosis were analyzed with multiple logistic regression analysis . \n a total of 1210 patients ( 659 males and 551 females ) were confirmed as potential ch cases among 930 612 newborns . of these \n the incidence of ch and hyperthyroxinemia was 60.0/100 000 ( 1/1665 ) and 69.9/100 000 ( 1/1430 ) , respectively , with the total being 120.0/100 000 ( 1/769 ) . in the 1210 confirmed patients , 391 patients ( 32.2% of the total including 331 hyperthyroxinemia patients and 60 patients with congenital hypothyroidism ) \n were lost to follow - up , and thus 819 patients took part in the study . from december 2009 to december 2013 , 273 patients were followed - up for more than 2 years , and 68 patients were diagnosed with pch , 126 patients were diagnosed with tch , and 78 patients were still under review ( figure 1 ) . \n based on screening of the population at the present time , the incidence of pch was 15/100 000 ( 1/6673 ) , the incidence of tch was 29.5/100 000 ( 1/3385 ) , and the ratio of pch to tch is approximately 1:2 . \n distribution of permanent and transient ch in 273 patients followed - up for more than 2 years . in 194 patients ( 68 with pch and 126 with tch ) with clear diagnosis of the disease , multiple logistic regression analysis was performed . \n the final diagnosis was considered as the dependent variable ( pch / tch , 0/1 ) , and the gender , gestational age , birth weight , and tsh and ft4 values at screening and diagnosis were considered as independent variables . \n the results indicate that tsh values at screening and diagnosis were correlated with tch . however , gender , gestational age , and birth weight were not the independent risk factors for tch ( table 1 ) . \n the area under the roc curve ( auc ) of tsh values at screening and diagnosis were 0.78 and 0.73 and the p values were 1.16 10 and 1.08 10 , receptively . \n abbreviations : ch , congenital hypothyroidism ; auc , area under the curve ; tsh , thyroid stimulating hormone . \n p < .05 was considered statistical significant . to further analyze the reasons for the high incidence of ch , \n the tsh values of 930 612 newborns were classified following the guidelines for iodine deficiency as denoted by the world health organization . \n the results show that the tsh values of 7.2% newborns ( 67 208 out of 930 612 newborns ) were above 5 miu / ml ( table 2 ) . \n the frequency of tsh values greater than 5 miu / l in newborns from 2009 to 2013 . \n the nsp has been developed in guangxi since 1996 , but in the early years of implementation the screening rate was lower than 10% . from 2009 , when the government actively promoted the nsp in the whole province , \n the newborn screening laboratory of guangxi accounts for around 50% of the newborns in guangxi each year . \n the overall incidence of the disease was 1/769 , with the incidence for ch and hyperthyroxinemia being 1/1665 and 1/1430 , respectively . \n in the cities of beijing , shanghai , and zhejiang , the incidence of ch was reported as 1/2034 , 1/2050 , and 1/1618 , respectively , and the incidence of the whole country was found to be approximately 1/2000 . in this study , for patients with a final diagnosis made at the second diagnosis stage , the ratio of pch to tch was about 1:2 , with tch being in the majority , and this was also different from other reports , and indicated that the higher incidence of ch in guangxi is mainly due to increased tch . \n the etiology of tch is complex , with several factors correlating to the disease including prematurity , low birth weight , intake of iodine , as well as genetic factors . \n based on the available data of gender , gestational age , birth weight , and tsh and ft4 values , the cause of the high incidence of ch was investigated by multivariate logistic regression analysis . \n the results indicate that tsh values were related to tch , and gender , gestational age , and birth weight were not independent risk factors for tch . for further analyses , the guidelines for determination of iodine deficiency as laid down by the world health organization \n the world health organization guidelines are based on neonatal tsh values of above 5 miu / l of whole blood and a frequency of less than 3% of the population is considered iodine deficient . \n frequencies of 3% to 19.9% indicate mild iodine deficiency disorders , frequencies of 20% to 39.9% and above 40% indicate moderate and severe iodine deficiency disorders , respectively . in 930 \n miu / l was about 7.2% and this indicated there was mild iodine deficiency in the population in guangxi . \n iodine is distributed all over the natural world , especially in the soil and water , but unfortunately it is not evenly distributed . \n the content of iodine in the soil of mountain areas tends to be the lowest with the highest levels found on the plains . \n the landscape of guangxi is made up of karst landforms , with the surface of the earth being rough and with a poor soil quality . \n both these conditions discourage the storage of iodine in the soil and therefore the water and crops inevitably possess low iodine content in comparison with other regions . \n our data would strongly suggest that the iodine deficiency may well be related to the high prevalence of tch in guangxi . \n the overall incidence of ch in guangxi was relatively high in comparison to other areas of china . among those patients , the majority had tch and this may be related to iodine deficiency in the population . \n future work should focus on determination of urinary iodine in the local population in order to clarify these findings . \n it would also be useful to explore whether the geographic and ethnic makeup of the guangxi region of china contribute to presence of tch in population by determining whether gene mutations are contributing factors . \n it is important to determine the etiology of the disease so that preventative strategies can be implemented to improve health care within these communities .", "role": "user" }, { "content": "background . a newborn screening program ( nsp ) for congenital hypothyroidism ( ch ) was carried out in guangxi in order to understand the incidence of ch and the factors interrelated to major types of ch in this region of china . \n methods . during 2009 to 2013 , data from 930 612 newborns attending nsp in guangxi were collected . \n patients were classified with either permanent ch ( pch ) or transient ch ( tch ) after 2 years of progressive study . \n results . \n a total of 1210 patients were confirmed with ch with an incidence of 1/769 , including 68 pch and 126 tch cases with incidences of 1/6673 and 1/3385 , respectively . \n the frequency of thyroid stimulating hormone values greater than 5 \n miu / l was 7.2% , which , based on who guidelines , suggests that the population was mildly iodine deficient . \n conclusions . \n the incidence of ch was high in guangxi . \n approximately two thirds of ch patients were tch , which may be due to a deficiency in iodine within the population .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: isolated internal iliac artery aneurysms are very rare , accounting for around 0.4% of abdominal aneurismal disease ( 1 ) . with a rupture rate of 38% and associated high mortality , early detection and intervention \n signs and symptoms at presentation are often nonspecific so a high index of clinical suspicion is required . \n timely intervention in cases of isolated internal iliac artery aneurysm has the potential to improve survival . \n an 84 year old , retired electrician , presented to the emergency department with reduced urine output and lower abdominal pain . \n he reported a three day history of urinary hesitancy and increased frequency , associated with generalised lower abdominal pain radiating to the testes . \n his medical history included transurethral resection of the prostate in 2005 , inguinal hernia repair and hypertension . \n the patient lived alone and was an ex - smoker . on examination he appeared well , with stable observations . \n he was noted to have lower abdominal tenderness , without being peritonitic , and had a palpable bladder . \n a provisional working diagnosis of urinary retention was therefore made , with no cause identified . \n axial view of ct abdomen - pelvis showing right internal iliac artery aneurysm with a contained pre - sacral leak ( as indicated by arrow ) the patient deteriorated the following day , becoming hypotensive and anuric , with an increasingly tender abdomen . \n after initial resuscitation , an urgent ct scan of the chest , abdomen and pelvis showed an 8.5 cm aneurysm of the right internal iliac artery . \n there appeared to be a contained leak from the aneurysm in the pre - sacral region ( fig . \n a moderate amount of intraperitoneal free fluid was noted . a right sided hydronephrosis with associated right hydroureter was also noted . \n an urgent transfer to a vascular facility was arranged and a same day endovascular repair of the aneurysm was performed . \n prompt identification of the underlying cause is then essential in directing further management . in elderly men causative factors can be grouped into : obstructive , neurogenic and detrusor inactivity . \n benign prostatic hyperplasia is the most common individual cause but often there are multiple underlying factors ( 2 ) . \n careful history and examination , combined with the use of specific diagnostic testing will usually establish a cause , and therefore result in the identification of high risk patients ( 3 ) . \n iliac artery aneurysms account for an estimated 2% of intra - abdominal aneurysmal disease , with a quarter of these primarily affecting the internal iliac artery . \n typically presentation is late , with an estimated 40% rupturing and a mortality of over 50% in those cases . \n identifying patients with internal iliac artery aneurysms of any size is challenging , because they often remain asymptomatic . \n patients may present with non specific symptoms of abdominal pain and tenderness , or symptoms and signs of local compression . \n this case demonstrates how a rare and potentially life threatening aneurysm manifested as a relatively common presentation abdominal pain and urinary retention . \n it is likely that the patient s urinary symptoms were caused by local compression exerted by the aneurysm and its subsequent rupture . \n a triad of symptoms abdominal pain , urinary retention and haemodynamic instability , prompted the clinician to request urgent imaging thus allowing early intervention and a good outcome . \n the importance of considering a broad range of differential diagnoses is clearly demonstrated particularly when more common causes are less likely . \n this patient had already undergone a turp making a prostatic cause of retention less probable . \n aneurysmal dilation and rupture ought to be among any clinicians differential diagnosis for urinary retention , especially in the context of progressive symptoms in an acutely deteriorating , unstable patient . \n there are a number of case reports on the various different presentations of iliac artery aneuryms : lumbrosacral plexopathy , bowel obstruction and a case of a patient presenting with cullen s sign . \n these varied presentations collectively demonstrate the difficultly in swift diagnosis of an internal iliac artery aneurysm with potential associated rupture ( 5 - 8 ) . \n the presenting problem in this case report and of those reviewed remains consistent urinary retention and abdominal discomfort . \n haemodynamic instability , as seen in this case , is another indicator that the underlying diagnosis may be vascular in origin . \n we propose that any patient presenting acutely with urinary retention , abdominal pain and haemodynamic instability should qualify for an urgent ct abdomen in order to rule out an iliac artery aneurysm . \n this case emphasises the importance of maintaining a broad and open mind in approach to the management of urinary retention associated with other symptoms , and reacting quickly to clinical developments .", "role": "user" }, { "content": "internal iliac artery aneurysms are rare , but with a mortality approaching 50% in those that rupture , prompt diagnosis is essential . often presentation is nonspecific ; a wide variety of symptoms and signs have been encountered , illustrating a challenge in identification . \n we report a case of ruptured internal iliac artery aneurysm presenting as urinary retention . \n the importance of maintaining a broad differential in cases of urinary retention is clearly highlighted .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: breast cancer is the most common cancer among us women and remains the number two cause of cancer death for us women . \n the recent figures and facts published in 2008 by the american cancer association indicate that 1 in 8 us women are at risk of developing breast cancer in a life time and that 1 in 35 us women are expected to die from this disease . \n one of the early stages of this disease is the manifestation of clustered microcalcifications and hence detection of such features can be a life saving mechanism in the war against breast cancer . \n mcs detection is a challenging task for both radiologists and computer - aided diagnostic ( cad ) systems due to minute and ubiquitous nature of microcalcifications . \n microcalcifications appear in a mammogram as bright regions of different shapes and sizes , and attain gray - level intensities and contrast that depend on their surrounding tissue . \n generally , microcalcifications can be characterized as follows : ( 1 ) malignant microcalcifications tend to exist in the form of clusters of irregular shapes and sizes while benign microcalcifications tend to appear as isolated spots mostly with regular , almost round , shapes , ( 2 ) the sizes of microcalcifications are very small , varying from 0.1 mm to 1 mm with an average size of about 0.3 mm \n . moreover , in some cases of isolated or benign mcs , they can appear with sizes of less than 0.1 mm . \n also , mcs present in a dense breast tissue mostly have low local contrast adding to the challenge of identifying them within the neighboring healthy tissue . \n computer - aided - diagnosis technology for breast cancer is mainly intended to be a second opinion that provides the radiologists with a preliminary diagnosis results , which has been demonstrated to increase the detection sensitivity ( number of detected breast cancer ) by an average of 10% . in a study by freer and ulissey by which they used cad technology to interpret 12,860 mammograms collected over a 12-month period \n , they reported that employing cad techniques increased the sensitivity of breast cancer detection by 19.5% , improved early detection of malignant cancer by 5% , and no significant increase of the recall rate was noticed . \n several commercial breast cancer cad systems have been fda approved and currently used by radiologists , examples are image checker ( r2 technologies , usa ) and second look ( icad systems , canada ) . \n although most cad systems achieved high sensitivity for detecting mcs and masses , they still provide low sensitivity for amorphous microcalcifications and other mammogram abnormalities such as architectural distortions . also , current cad systems can not be used as second reader because of the low specificity of the detection estimated at 1000 benign alarms for one cancer . \n boyer et al . presented a questions / answers review on the use of cad technology for breast cancer . \n using results from several relevant studies they addressed two important questions : ( 1 ) can a cad system replace the first or double reading ? and \n boyer reported that a cad system neither can be used as a first reading nor as a double reading . \n rather , cad systems can be used as an additional step to a double reading scheme , thus increasing the sensitivity of breast cancer diagnosis . \n in general , a cad system for mcs detection can be modeled as a two stages system . \n the first stage is a preprocessing phase to enhance the visual appearance of mcs using variety of enhancement methods and background suppression techniques . \n also , it is in this stage a detection of suspected regions can be accomplished . in literature , researchers have applied several image processing techniques for enhancing contrast in the region of microcalcifications such as global enhancement techniques ( contrast stretching , histogram equalizing ) , fixed and adaptive local enhancement , and region based enhancement aiming to adjust the contrast of rois in relation to their surround - ing areas . \n in fact , standard image enhancement methods failed to achieve a satisfactory enhancement of mcs which motivated the researcher to develop feature based enhancement methods such as locating features by extracting local statistical attributes of rois , fuzzy techniques , and multiscale analysis methods [ 12 , 13 ] . \n other enhancement methods focused on background subtraction to increase the appearance of mcs such as highpass filtering using wavelet reconstruction , fractal modeling , and morphological operators . aiming to detect the presence of mcs , the second stage is generally composed of several image segmentation , feature extraction and classification techniques . \n previous studies used standard image segmentation methods such as edge detection based methods and region growing based approaches . \n the fuzzy nature of clustered microcalcifications made its detection a challenging task forcing the researchers to integrate several tools of feature extraction and classifications to overcome this challenge . \n most detection schemes make use of statistical based feature extraction methods such as high - order statistics ( kurtosis and skewness ) parameters as in [ 17 , 18 ] and image modeling based methods [ 19 , 20 ] , spectral features based methods [ 4 , 18 , 21 ] , and textural based methods [ 19 , 22 ] . supervised learning machine based methods \n are also commonly used for feature classification and mcs detection [ 19 , 20 , 2226 ] . a typical learning machine \n examples of mcs detection using combined feature extraction and supervised learning methods are artificial neural network [ 19 , 23 ] based classifiers , stochastic discriminators such as bayesian classifier [ 19 , 22 , 24 , 25 ] ) , support vector learning machines methods [ 20 , 26 ] , fuzzy based approaches , and meta - heuristic methods such as genetic algorithm ( ga ) . a more comprehensive review of automated microcalcification detection can be found in [ 3 , 11 ] . \n stochastic bayesian classifier has been successfully employed for solving pattern recognition problems in many applications [ 19 , 22 , 24 ] ; a popular example is its use in multi - spectral remote sensing imagery . in this work , \n we propose a novel framework that uses linear bayesian classifier with simplified training stage for the segmenta - tion and detection of microcalcification clusters in digital mammograms . \n our proposed framework can be considered a single stage detection scheme consisting of two phases , namely , feature extraction and feature classification . in the feature extraction stage , four feature - images of a mammogram are constructed . \n these feature - images are stacked to form a multi - dimensional feature vector for each pixel of the original mammogram . in the learning stage , \n the parameters of the classifier 's decision function are estimated using synthetic model of mcs while in the classification stage , the processes of learning and testing are implemented . \n it is in this stage the breast tissue is classified into positive ( mcs ) or negative ( healthy ) via maximizing a posteriori probability method . \n we believe that this framework is novel for two reasons : ( 1 ) it uses the bayesian classifier ( bc ) as first stage to segment mcs as opposed to previous work which applied bc as second stage to classify suspicious regions into mcs or background and ( 2 ) it presents an unsupervised training by which it synthesizes the training set of mcs class and accomplishes the learning phase in an efficient and simplified method that does not require large training data set which is usually created by a tedious manually pre - labeling process [ 19 , 22 ] . \n instead , we propose to create models of the real mcs and produce synthetic learning samples to estimate the classifier 's decision function parameters . \n the remaining sections of this paper are organized as follows : related work and background on stochastic bayesian classifiers and wavelet transform are briefly discussed in section 2 . \n section 3 presents the details of the proposed detection method while the experimental results and conclusions are presented in sections 4 and 5 , respectively . \n bayesian classifier ( bc ) is a statistical method used for classification by maximizing a class a posteriori probability . \n the application of bayesian classifiers for pattern recognition assumes a prior knowledge of an analytical expression of the probability density functions of various classes . using a sufficient statistic sample patterns of each class \n mathematically , bayes classifier has a decision function of the form \n ( 1)dj(x)=p(x j)p(j ) , j=1,2, ,m , \n\t\t\t\t\t\t\t where p(x | j ) is the conditional probability density function of n - dimensional feature vector x belonging to a class j , p(j ) is the priori probability of class j , and m is the number of classes . \n assuming the probability density functions ( pdf ) of the measured features are gaussian [ 19 , 22 ] then , the n - dimensional gaussian density function can be expressed as \n ( 2)p(xj)=1(2)n/2|cj|1/2 e(1/2)(xmj)t cj1(xmj ) , \n\t\t\t\t\t\t\t where cj and mj are the covariance matrix and the mean vector of class j , respectively . \n the decision function given in ( 1 ) is monotonically increasing and because of the exponential nature of the gaussian density function of the conditional probability p(x | j ) , the decision function can be rewritten as \n ( 3)dj(x)=ln p(j)n2ln ( 2) 12ln |cj| 12 [ ( xmj)tcj1(xmj ) ] . \n\t\t\t\t\t\t\t since the term ( n/2)ln ( 2 ) is common for all classes and assuming that all classes are equally likely , the decision function dj(x ) reduces to \n ( 4)dj(x)= 12ln |cj|12[(xmj)tcj1(xmj ) ] . \n a feature vector x is assigned to a class with a minimum distance dj(x ) , . over the last two decades , wavelet theory and \n its multiresolution analysis ( mra ) ability has been recognized as the most powerful tools in signal processing . unlike fourier analysis \n , multiresolution representa - tion of wavelet transform provides spatial - frequency localization which enables the analysis of both local and global features of the processed signal . \n wavelet transforms are a set of basis functions derived by translation and dilation of a single function , the mother wavelet , which has the general form of \n ( 5)a , b(x)=1a(xba ) . \n equation ( 5 ) shows that the frequency and spatial resolution of the wavelet function a , b are functions of the translation and dilation parameters b and a , respectively . \n a special case of ( 5 ) is obtained when translation and dilation parameters are integers with a scaling parameter a as an integer of base 2 , resulting in the dyadic wavelet transforms and leading to the construction of orthonormal wavelet basis j , k : \n ( 6)j , k(x)=2j/2(2jxk ) . \n moreover , mra using wavelet transform is based on the existence of two unique functions called wavelet and scaling functions . \n the scaling function is defined as \n ( 7)j , k(x)=2j/2(2jxk ) , \n\t\t\t\t\t\t\t where the wavelet function is defined as given in ( 6 ) . \n an efficient algorithm for computing discrete wavelet transform of a given discrete signal is introduced in by which , each stage of wavelet decomposition process involves extracting an approximate ( lowpass ) version and a detail ( highpass ) version of the signal . \n this can be easily implemented using a set of finite impulse response ( fir ) filter banks followed by sub sampling as shown figure 1(a ) . \n the wavelet synthesis process as shown in figure 1(b ) is accomplished by first filtering the up - sampled c and d using the synthesis lowpass h and highpass g filters , respective - ly . \n then , given that the set of analysis and synthesis filters satisfying perfect reconstruction conditions , an original signal x^ is obtained by adding the output of each filter , h and g , . \n wavelet transforms are one dimensional in nature but easily extended to analyze 2-d discrete signals . \n separable 2-d wavelet transform of an image is constructed by applying 1-d wavelet transform along the image rows and columns . \n the 2-d wavelet and scaling functions derived from 1d wavelet (x ) and scaling (x ) functions , are expressed as \n ( 8)(x , y)=(x)(y),h(x , y)=(x)(y),v(x , y)=(x)(y),d(x , y)=(x)(y ) , \n\t\t\t\t\t\t\t where (x , y ) represents a 2-d separable lowpass filter applied along the horizontal x vertical y directions . \n (x , y ) , (x , y ) , (x , y ) are 2-d separable highpass filters extracting the signal details along the horizontal , vertical , and diagonal directions , respectively . \n variety of wavelet transforms have been proposed and used in the literature [ 24 , 29 , 30 ] in many applications . \n these transforms have different features such as regularity , number of vanishing moments , orthogonality , symmetry , and compact support . \n however , the selection of a wavelet transform with certain features is an application dependant . \n the gaussian nature of the mcs gray - level distribution and their wavelet representation [ 21 , 31 ] was used along with other textural features and with a bayesian classifier to identify the true mcs [ 19 , 22 ] . \n proposed a two stage scheme for detecting mcs by which they used wavelet based filtering and global thresholding to identify suspicious mcs regions . \n then , they employed bayes and back propagation neural network ( bpnn ) classifiers to identify mcs , that is , reduce the number of false signals resulted from wavelet filtering . also , they used statistical markov random field ( mrf ) modeling along with other image processing techniques to extract primary and secondary features of suspicious mcs and to serve as inputs of the classifiers . moreover , caputo et al \n . used bc and another mrf - based method , statistical spin - glass mrv ( sgmrv ) , to model the different regions within a mammogram . \n they followed it by a maximum a posteriori probability bayesian classifier and were able to demonstrate that their proposed approach outperformed both the back propagation artificial neural network and the nearest neighbor classifier detection systems . \n several wavelet based mcs detection [ 14 , 1719 , 21 , 31 ] and enhancement [ 12 , 13 ] schemes have been proposed in literature . \n strickland and hahn , for example , concluded that using an appropriate wavelet filter , one can easily detect and segment mcs within wavelet domain by thresholding the wavelet coefficients before the reconstruction process . \n modeling mcs as highpass local anomalies , wang and karayiannis also applied wavelet filtering , which is an elimination of an approximate wavelet subband and using detail subbands for reconstruction , they were able to detect mcs . \n following , several studies used this wavelet filtering method for detecting suspected mcs and to reduce false results . \n some studies demonstrated that least asymmetric daubechies are more suitable for enhancement of the mammogram images such as in microcalcification detection while other works demonstrated that the design of a spatial wavelet filter with high regularity is more successful in detecting microcalcifications than conventional wavelet filters such as the orthogonal daubechies db4 . \n moreover , the none - stationary nature of mammogram image texture motivated many researchers to design wavelet transforms using adaptive filters which has been reported to be more efficient than fixed or none - adaptive fir filter in the detection of low contrast mcs present in the denser breast tissue . \n learning machines for pattern recognition , such as artificial neural network , support vector machines and maximum a posteriori probability ( map ) classifiers consist of two phases : supervised learning and testing phases [ 19 , 20 , 22 , 25 , 26 ] . in the learning phase , \n a group of training samples that represents different objects or patterns to be extracted are selected manually to optimize the classifier 's decision function while in the testing phase , the trained classifier is used to classify features contained in new data sets or the independent samples . \n our proposed classification approach , figure 2 , follows the general structure of the classical learning machines but it uses a simplified learning stage denoted here as self - learning phase . \n such a process can be relatively described as an unsupervised learning since it does not require the huge number of training samples of mcs to be extracted in advance form different data mammograms as the case of classical supervised learning [ 19 , 22 , 24 ] and instead it synthesizes these samples and use them as training data . in this work \n , detection is modeled as a two - class pattern recognition problem where the first class , 1 , is the clustered mcs group and the second class , 2 , is the healthy breast tissue . \n modeling of microcalcifications : the training samples of mcs class are synthesized by blending a synthetic model of mcs with a mammogram image . \n feature extraction : linear and none - linear transforms are used to extract three features of each pixel of a mammogram image . \n these three feature images along with the graylevel mammogram image are registered spatially to form a 4d pattern vector x = [ x1 x2 x3 x4 ] of each class j as shown in figure 3 . in figure 3 , each pattern vector x is represented by a set of four components described as follows : graylevel or image intensity local maxima ranked using local histogram spectral feature extracted using wavelet transform singularity detection by detecting point discontinuity . \n learning phasethe proposed learning process estimates the classifier 's decision function parameters of each input mammogram , see figure 2 . unlike the classical method which collects the training sets from different mammograms , the proposed approach extracts the training samples of different classes from the input mammogram itself as follows : for mcs class , it models the mcs and creates synthetic training samples of mcs class for that mammogram \n , the locations of these samples are identified using the binary model of the synthetic mcs . for the healthy breast tissue class , \n the training data are collected from two rois chosen randomly within the breast region . \n the proposed learning process estimates the classifier 's decision function parameters of each input mammogram , see figure 2 . unlike the classical method which collects the training sets from different mammograms \n , the proposed approach extracts the training samples of different classes from the input mammogram itself as follows : for mcs class , it models the mcs and creates synthetic training samples of mcs class for that mammogram , the locations of these samples are identified using the binary model of the synthetic mcs . for the healthy breast tissue class , \n the training data are collected from two rois chosen randomly within the breast region . \n parameters estimation : pattern recognition using stochastic bc is based on the estimation of the probability density function of each class . \n assuming that the measured features of each class have a gaussian probability distribution , the classifier 's decision function can be computed as given in ( 4 ) requiring the estimation of the covariance matrix and the mean vector of each class . \n if the training set of each class is a sufficient statistically , one can efficiently estimate the distribution parameters ( i.e. , covariance matrix and mean vector ) of each class . \n further discussion of the parameter estimation for bayesian classifier used in this work is presented in section 3.4 . \n bayesian classification : the optimized classifier is applied to perform a pixel based classification of the breast region into microcalcification and healthy tissue . in this work , \n the classification results are binary 0 or 1 and they are used to create a binary image by assigning a binary 1 to pixels classified as class , 1 ( or mcs ) , while a binary 0 is assigned to pixels classified as class 2 ( or healthy breast tissue ) . \n post processing : the purpose of this step is to reduce the false classifications and to improve the classification results through the integration of some of the physiological traits of breast tissue and clustered microcalcifications . in this work , \n we use a method proposed in as an attempt to generate a model for real mcs as illustrated in figure 4 . in this method , \n a new mc model is derived from the standard model ( stdmodel ) , a binary model of synthetic mcs , using input image and the modeling constant k. that is , each gray level value from synthetic pixels is assigned initially a fraction that is proportional to the constant k of its corresponding mammogram pixel and through a blending process , a hybrid image is created from the original mammogram and the modified mcs model . \n such process is a pixel by pixel addition of the mcs model and mammogram followed by smoothing of the synthetic pixels using lowpass filter h , an example of the outcome of this scheme is shown in figure 5 . \n our experimental results indicate that k should be chosen based on the statistics of the breast tissue of the mammogram such as the mean and variance of the breast tissue intensity values . \n mcs synthesis method presented in this work has a significant difference from the one introduced in . \n this method has an explicit use of a modeling constant to control the synthesis of different types of mcs to ensure that a synthetic mc impersonates a real mc as much as possible . \n it is also worth noting that the purpose of using synthetic mcs in was to provide a testing material for the detection scheme , while it is employed in this work as a detection tool and a control parameter of the scheme . \n this work uses the general structure of pattern recognition using bayesian classifier which stacks and spatially registers a group of feature images . each mammogram is represented by a stack of four images ; ( 1 ) gray - level feature from original image , ( 2 ) feature image extracted using local maxima ranked using their local histogram , ( 3 ) highpass filtered image extracted using discrete wavelet transform , and ( 4 ) point singularity detected using euclidian distance ed8 . \n highpass filtering using discrete wavelet transform has proved to be a useful tool for detecting suspicious mcs [ 14 , 17 , 19 ] . in \n , the authors reported that orthogonal wavelet filters such db4 are more appropriate of detecting mcs since they have higher sensitivity to the presence of microcalcifications than other wavelet filters . \n also , the spike - like behavior of db4 wavelet transform justifies the successful use of this wavelet filter for detecting specious mcs in [ 17 , 19 ] . \n therefore , we decided to employ db4 to extract the spectral features of mcs and to use this feature as one input feature of the bayesian classifier . \n the basic idea behind this analysis is that , mcs represent highpass anomalies lay on a stationary lowpass background contributing to the detail subbands rather than to the coarse scale subbands of the wavelet multiresolution representation . in \n , the authors demonstrated that the features of mcs can be made more obvious after suppressing the background data , which is accomplished by eliminating the wavelet coefficients within coarse scale subband and reconstructing an image from detail subbands . \n microcalcifications also appear in intensities that are higher than that of the surrounding healthy tissue . \n therefore , a pixel belong to a microcalcification region is expected to experience a larger gray - level difference from its local neighborhood than that of a healthy one . \n one approach to extract this type of singularity is by employing a point detection kernel as shown in figure 7 . in this work , the point singularity feature ed8 of each pixel is defined as the sum of the absolute difference of a pixel graylevel and those of its 8-neighboures . \n example of this feature and other extracted features is demonstrated in figure 8 : \n ( 9)ed8ij=k2 k1|ii+k2,j+k1ii , j| , k1=0,1 , k2=0,1 . \n pattern recognition methods are in general supervised leaning machines [ 19 , 20 , 2226 ] , they partition the population data into training and validation sets . in such approaches , \n the training samples which are usually labeled manually , are employed to estimate the parameters of the classifier 's decision function [ 19 , 22 ] . \n our proposed approach can be considered an unsupervised method and thus it does not require the training set of mcs class to be extracted from real mammograms as in the supervised manner . instead \n , an adaptive and simple learning scheme is employed to estimate the classifier 's parameters . \n the advantage of the proposed training scheme over the classical one is the use of synthetic mcs as training samples for the mcs class rather than using real mcs extracted from mammograms as practiced in the supervised methods . \n training stage starts by extracting four features from the breast tissue ; these feature images are stacked to form a multidimensional feature vector of each pixel . \n the learning phase of the classifier is accomplished by blind , or unsupervised , selection of training data . \n such selection is done by employing the binary mcs model to identify the training samples for mcs region while two distinct regions randomly selected within the mammogram are used to locate the healthy breast tissue candidates . \n a drawback of this random selection of the training samples of healthy breast tissue is the possibility that these regions may lay over breast areas that have low probability of developing malignant microcalcifications such as fatty or background regions . \n the negative impact of this practice can be eliminated by having a preprocessing step in which , the user mark the two regions within the glandular breast area or by employing a preprocessing step to identify the glandular breast region . \n the learning process we propose has many advantages over the classical one ; first , is the simplicity of the process with respect to the size of learning data , second , training samples of all classes , including the mcs , were selected manually in [ 19 , 22 , 24 ] while the training set of the significant class , which is the mcs , is synthetically constructed in this work . \n another advantage of the proposed learning phase is that the training process of the classifier is adaptive to the breast tissue as the parameters of the classifier 's decisions function are estimated using self - learning method based on the input data . \n the first challenge occurs when the synthetic training samples are not statistically sufficient which may produce underestimation of the classifier 's parameters . \n this limitation can be mostly attributed to the simplicity of the proposed modeling itself , that may have add some constraints on the ability to generate mcs training set of sufficient statistics from a single mammogram . \n the other challenge occurs when regions representing the training samples of healthy tissue include members of the other class ( real mcs ) . \n while this work has not investigated the first problem , left it out as future work , the second challenge was addressed by using relatively large number of training samples of healthy ( or background ) class extracted from two different mammogram regions . \n the differencing in the sample size is significant due to the fact that mammogram texture is nonstationary and many samples of none - mcs class are available compared to the number of samples representing mcs that estimated to be no more than 1% of the whole mammogram . \n this work used about 4300 samples to represent the healthy ( or background ) class obtained from two distinct regions , which is about 50 times the size sample of mcs class . \n we investigated the effect of the sample size on the performance of the proposed detection scheme and the results indicated that a better detection can be obtained when two different regions used to extract the training samples of the healthy class than a single region . \n the results also indicated that the sample size of the healthy class must be larger , three times or more , than that of mcs class for better detection performance . assuming the two classes are equally likely and using the training pattern of both classes , our feature vectors , the decision function of the classifier is constructed by approximating the mean vector and covariance matrix for each class as given by ( 4 ) . \n the modeling constant , k , plays a significant role as it controls the appearance of synthetic mcs and their blending with the surrounding breast tissue . on approach that might be useful for selecting an appropriate value of the modeling constant prior to the training and classification stages \n is by measuring the difference between the corresponding components of the estimated mean vectors and the ratio of the corresponding diagonal entries ( feature variances ) of the estimated covariance matrices . \n our investigation of both measures concluded that interpreting the mean difference is more obvious , that is easier to make a conclusion , and can be employed for better detection results . \n analyzing the interclass mean difference leads to identifying two cases ; the first case occurs when a large value of the modeling constant is used , one that produces a large mean difference and leads to detect a single tone detail of the image , which might fail to detect the targeted mcs . \n this problem can be eliminated by adjusting the modeling constant to lower values before proceeding with training and segmentation stages . \n the second case occurs when a very small mean difference is used which decreases the discrimination power between classes and leads to an increase in false signals . \n testing the discrimination power of the classifier is usually accomplished by using the decision functions of the bc , ( 4 ) , which is computed using the estimated covariance matrix and mean vector to classify an independent set of samples followed by computing the misclassification rate . \n the segmentation results are interpreted , form the classification results , as a target ( microcalcification ) and represented by a binary 1 and a nontarget ( healthy tissue ) represented by a binary 0 . \n all mammograms used in this work are from a mini mammographic database provided by mammographic image analysis society ( mias ) , which includes 23 cases with 28 mcs . \n each mammogram from the database is a 1024 1024 pixels and with a spatial resolution of 200 m / pixel . \n these mammograms are already labeled with radiologist findings in terms of location and size of pathology results and tissue type which we found to be very useful when assessing experimental results . \n the proposed scheme starts by modeling of the mcs in each mammogram as explained in section 3.1 . \n the most significant step of this process is the selection of the modeling constant k , a typical value of k can be chosen between 0.1 and 1 . then , spatial , textural , and spectral features of all pixels are extracted and used as inputs to the bayesian classifier . \n the feature vector of each pixel is composed of the following : ( 1 ) brightness ( or graylevel ) , ( 2 ) local maxima ranked based on the tail ratio of their local histogram estimated within 9 9 neighborhoods , ( 3 ) highpass filtered image obtained from suppressing coarse ( or approximates ) of the 2-level wavelet representation ( db4 filters were used ) and reconstructing an image from detail subbands , and ( 4 ) point singularity values computed using ( 9 ) as presented in section 3.2.2 . \n stochastic bayesian classifier optimized by a simplified self - learning phase is used to segment ( or classify ) all image pixels into mcs or healthy ones . \n experimental results demonstrate that applying this proposed approach to the whole mammogram without extraction or prior knowledge of breast region produces more false positive signals than those resulting from using breast region extracted form the whole mammogram . \n this result is illustrated in figures 9(a ) and 9(c ) which also indicates that these false signals are mainly localized outside the breast region and can be significantly reduced using otsu 's thresholding . \n examples of this step results are demonstrated in figures 9(b ) and 9(d ) . in order to test the abilities of the proposed scheme for segmenting the whole mammogram and detecting the mcs \n , we used a simple thresholding scheme , otsu 's method , as a postprocessing instead of employing a prior breast region extraction or using some regional context within the detection process . \n another advantage of using otsu 's thresholding as postprocessing was eliminating all misclassifications occurring along the breast border and outside the breast region . \n such suppression process improved the detection performance by significantly reducing the overall number of false results , or misclassifications , while maintaining the detected mcs . \n this assessment would have been much more challenging without having the location and the size of true , real , mcs as documented by mias database . \n results indicate that synthesizing the training samples of mcs class and specifically the selection of the modeling constant k plays a significant role in the performance of the proposed classifier and the detection results . \n they also show that k values should be chosen based on statistics of the breast tissue characterized by the separation between the brightness of the region of mcs and that of the background tissue and the variance of the breast region . \n that is , the optimal k value is mostly correlated to the normalized mean difference ( nmd ) computed from the difference of the average graylevel ( brightness ) of the mcs and that of the of breast region . \n analyzing the breast regions of size 256 256 pixels extracted from each group indicates that a dense - glandular breast tissue has a larger intensity mean and variance than those of fatty breast tissue . moreover , mcs that may be present in a fatty breast tissue have a larger nmd than those of mcs in dense - glandular breast tissue . \n our results show that the modeling constant k can be adaptively chosen based on the type of breast tissue and the statistics of the breast region . \n therefore , from all experimental simulations on mammogram rois of size 256 256 pixels , we found that small values of k such as 0.10.4 are suitable for detecting mcs occur within dense - glandular breast tissue while larger values of k such as 0.51 are more appropriate for mcs in fatty breast tissue . \n such results are mostly due the fact that mcs present in denser mammogram tissue have lower local contrast than mcs occurring in fatty breast tissue . \n figure 10 illustrates the effect of the parameter k on the classification results , which shows that a large value of k ( k > 0.2 ) produces a detection of mcs with high specificity while low value of k as 0.1 or less leads to detection results with many false signals ( or low specificity ) as shown in figure 10(c ) . \n on the other hand , large values of k are more appropriate ( lower false signals ) for detecting mcs appearing in a region that has high nmd and local variance as shown in figure 11 . \n results show that no optimal k value produces the best detection results ( lowest fp and fn ) for all test data but some values such as k = 0.2 produces the best tp and fp rates . \n moreover , modeling mcs in dense breast tissue has shown more sensitivity to the value of k while the algorithm was more robust and allowed k to span a wider range for fatty breast tissue . \n figures 12(c ) and 12(f ) show that low values of k between 0.20.25 are suitable for detecting mcs within both fatty and dense breast tissue . \n furthermore , results indicated that mcs within fatty breast tissue can be modeled and detected using wider range of modeling values with lower fp results at larger values of k , as demonstrated in figures 11(b ) , 12(h ) , and 12(i ) . \n we believe that detection results can be further improved by fine tuning the selection of k if the breast region statistics were integrated into the algorithm . \n one approach to assess the performance of the detection scheme is by constructing a receiver operating characteristic ( roc ) curve which represents the false positive ( fp ) rates against the true positive ( tp ) rates obtained by varying a predefined control parameter such as k. furthermore , other studies have used other metrics such as specificity and sensitivity parameters . \n specificity and sensitivity parameters are defined in terms of tp , tn , and fp as follows : \n ( 10)specificity = tntn+fpsensitivity = tptp+fn \n\t\t\t\t\t\t\t where a true positive ( tp ) rate represents the probability of classifying a malignant tissue as target object while false positive ( fp ) refers to the probability of classifying healthy tissue as target one . \n also , true negative ( tn ) rate is defined as the probability of classifying a healthy tissue as none - malignant and a false negative ( fn ) represents the case when a malignant tissue being classified as a healthy one . \n in fact , mcs occur in mammogram in form of clusters rather than standalone . according to \n , a cluster of microcalcifications is defined as a group of three or more classification within a 1 cm area which is equivalent to a block of 50 50 pixels in mini mias mammograms ( digitized at 200 m edge resolution ) malignant calcifications also can only present in glandular breast tissue which is a fact that can also be used to eliminate any candidates ( segmented as mcs ) detected within dark regions . \n these physiological features are integrated in this work and mainly used in the computation of fp rates . \n moreover , the difficulty in counting precisely the number of real calcifications within the region of true mcs forced us to count tp signal and report the sensitivity rates in a method similar to the one used in . \n one reason for choosing tp per mammogram rather than per cluster is the nature of this proposed detection scheme , which applies a single model for segmenting all calcifications within the tested mammogram . before proceeding any further with the performance evaluation , \n a summary of the definition of tp , fp , fn , and tn as used in this study ought to be stated . \n tp is identified by visual inspection of the detection results at image locations corresponds to the real annotated mcs region per the mini - mias database . \n fn is identified when a mammogram region of size 50 50 pixels that belongs to real annotated mcs per the database is detected as a background class . \n fp is identified when a healthy or a background region of size 50 50 pixels included three or more image locations detected as mcs class . \n tn is identified when a healthy or background region of size 50 50 pixels is detected as background class or it included a maximum oftwo locations of isolated mcs . \n\t\t\t\t\t using these definitions , the total number of tn , fp of a given output binary image is calculated by dividing the segmented image into nonoverlapping regions of size 50 50 pixels excluding the region of the real ( actual ) mcs as identified and labeled by the database . \n table 1 demonstrates the average specific - ity and sensitivity of the detection scheme obtained using bc optimized via self - learning methods . \n per table 1 , the best sensitivity ( or tp rate ) is about 91.3% at k = 0.2 and the corresponding specificity ( fp rate ) is at 98.6% . \n although this proposed approach performs segmentation on a mammogram on a pixel level , it does estimate fp rates using region basis by utilizing physiological characteristics of clustered mcs , which is different form the previous work reported in . \n this fact makes it unreasonable to attempt to have a direct numerical comparison between our detection results and those obtained in [ 19 , 20 ] . \n however , in , the authors reported their results using 87 87 block sizes and used the total number of the true mc samples to be 25 mc regions . to ensure unbiased comparison with results reported in the literature \n , we decided to evaluate the performance of the detection results form this study in a similar manner . \n we used the same block size and counted fp to be the case when an mc is detected . \n however , tp is still evaluated by visually inspecting the detection results and comparing it with the real mcs as reported by the database . \n table 2 compared the specificity and the sensitivity or ( tp and fp rates ) of the proposed scheme with relevant works , which indicates that this proposed scheme produces lower tp and higher fp rates ( or lower specificity ) compared to those from but better than . \n in this paper , we proposed and implemented a new approach using stochastic bayesian classifier for segmenting a digital mammogram for the detection of microcalcification clusters . \n the proposed scheme models the image segmentation task as a two - class pattern recognition problem . \n this new framework accomplishes the learning phase of the classifier using a simple self - learning approach which synthesizes the training samples of mcs class in each mammogram . \n each image pixel , during both the learning and testing phases , is modeled using a four - feature vector extracted using spatial , statistical , and spectral via wavelet filtering methods . \n results demonstrated that synthetic patterns can be employed to simplify the supervised bayesian learning for mcs detection , which produces moderate detection performance . \n the relatively high fp and low tp rates can be related to the simplicity of mcs modeling used in this study as well as applying the detection scheme to the whole mammogram as opposed to regions continuing only breast tissue . \n other image processing techniques can be used , such as fuzzy k - mean clustering , to extract glandular breast regions and thus eliminating many of the misclassifications ( fp ) that are resulting at the breast borders and radiographic markers . \n another improvement may be suggested is to use a more sophisticated modeling of healthy breast tissue and mc regions which should be useful to overcome some of the classifier 's parameters ' estimation effects on results .", "role": "user" }, { "content": "detection of clustered microcalcifications ( mcs ) in mammograms represents a significant step towards successful detection of breast cancer since their existence is one of the early signs of cancer . in this paper , a new framework that integrates bayesian classifier and a pattern synthesizing scheme for detecting microcalcification clusters \n is proposed . \n this proposed work extracts textural , spectral , and statistical features of each input mammogram and generates models of real mcs to be used as training samples through a simplified learning phase of the bayesian classifier . \n followed by an estimation of the classifier 's decision function parameters , a mammogram is segmented into the identified targets ( mcs ) against background ( healthy tissue ) . \n the proposed algorithm has been tested using 23 mammograms from the mini - mias database . \n experimental results achieved mcs detection with average true positive ( sensitivity ) and false positive ( specificity ) of 91.3% and 98.6% , respectively \n . results also indicate that the modeling of the real mcs plays a significant role in the performance of the classifier and thus should be given further investigation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: they generally present within a few weeks after birth and undergo a rapid proliferating phase , followed by a period of relative quiescence , regressing after a few years into an involution phase.19 the clinical course can be variable . demographically , these cases occur commonly among females and have not been reported to vary by race , ethnicity , or geographic location.16,8,10 haik et al1 and others classified these lesions according to their characteristics on clinical presentation ( eg , strawberry nevus , bluish discoloration ) , while rootman11 presented another classification based on the level of involvement ( eg , superficial , subcutaneous , deep orbital , or combined).1,2 hemangiomas of the eyelid and orbit have also been studied according to their size . \n schwartz et al2 found that half of the cases with hemangiomas exceeding a widest diameter of one centimeter would require treatment . \n regardless of the method of classification , hemangiomas can present at any single location or at a combination of locations within the periocular region.2,11 acceptable indications for intervention may include rapidly enlarging lesions , obstruction of the visual axis , significant induced astigmatism , and cosmetic concerns . here , \n a short series based on local experiences is presented , along with some of the current treatment modalities . \n the modalities available are intralesional and systemic steroid , bleomycin , interferon - alpha , vincristine , cyclophosphamide , topical timolol maleate , oral propranolol , and surgical excision.1,3,5,720 \n this is a retrospective chart review of 16 clinically - diagnosed capillary hemangioma cases that presented as red or bluish elevated vascular lesions in the periocular region seen at our institutions . \n the parameters reviewed include age at presentation ; size and location of the lesion ; best corrected visual acuity using preferential looking tests , kay pictures , snellen , or hotv charts ( the top row of letters tested ) ( depending on the patient s age ) ; and the results of cycloplegic refraction , orbital , and eyelid examinations . \n imaging studies such as magnetic resonance imaging ( mri ) , magnetic resonance angiography , and ultrasound were studied when available . \n the management of each patient was reviewed , including indications , modes of treatment , and patients responses and outcomes . \n the clinical progression , related complications , and final visual outcome at end of follow - up were studied . \n the effectiveness of treatment was ascertained when either partial or complete reduction in the size of the hemangioma was observed , based on clinical photographs and measurements . \n the mean age at consultation was 9 months ( range : 1 month72 months ) with a median of 4 months . \n seventy - five percent ( n = 12 ) were females , and 25% ( n = 4 ) were males . \n eighty - one percent ( 13 ) were born full term , while 19% ( 3 ) were delivered prematurely ( > 36 weeks age of gestation ) ( table 1 ) . \n superficial lesions , which appear as scarlet red in color , were seen in 22% of the cases . \n subcutaneous lesions , which appear as bluish - purple hues beneath the skin , were seen in 14% of the cases . \n both superficial and subcutaneous features appeared together in 64% of the cases ( figure 1 ) . \n seven cases ( 44% ) had right - sided hemangiomas ; similarly , another seven cases ( 44% ) were left - sided . \n two cases ( 12% ) had hemangiomas located over the glabellar region , with forehead extension . \n upper - eyelid hemangiomas were seen in eight cases ( 50% ) and six ( 38% ) were found in the lower eyelid . \n of the cases found in the upper lid ( eight ) , six ( 75% ) measured > 1 cm , and two cases ( 25% ) measured < 1 cm in diameter . \n the mean logarithm of the minimum angle of resolution ( logmar ) visual acuity was 0.77 at the first visit and 0.46 upon the most recent examination ( table 2 ) . \n of those patients with recorded cycloplegic refraction , a majority of the children less than 2 years of age were hyperopic , with mean spherical refractions of + 1.83 and + 1.00 on the first and last visits , respectively . \n all cases whose lesions were located in the upper eyelid had astigmatism , with a mean cylinder of 1.714 ( range : 0.754.25 ) . \n twenty - five percent ( 4/16 ) of patients ( mean age of 4 months ) were found to be amblyopic during the follow - up period . \n the majority ( 75% ) were amblyopic because of anisometropia , and a quarter ( 25% ) were amblyopic because of occlusion of the visual axis ; all of them had lesions located in the upper eyelid . \n two cases presented with proptosis , globe displacement , and limitation in eye movement due to lesions extending deep into the orbit . \n , treatment was either with a single agent ( 57% ) or a combination ( 43% ) ( table 3 ) . \n the mean follow - up was 19 months ( range : 1.572 months ) , and 12% ( n = 2 ) were lost to follow - up . \n fifty - six percent ( nine ) were managed conservatively , which involved regular spectacle correction and amblyopia therapy , by taping and/or patching , as well as close follow - up . by two years of age , seventy - eight percent ( 7/9 ) showed notable regression ( according to clinical photos and clinical examinations ) in the size of the hemangioma ( figure 2 ) . \n indications were deep orbital extension , occlusion of the visual axis , and cosmetic concerns . \n the treatments we employed included : ( 1 ) steroid therapy , ( 2 ) surgical excision , ( 3 ) oral propranolol , and ( 4 ) bleomycin ( received at other institutions ) , either singly or in combination ( table 3 ) . among those that received treatment , 57% ( four ) \n were treated with a single agent ( oral propranolol , prednisolone , or surgery ) , and regression was noted in three of them . \n the remaining 43% ( three ) received a combination of two to three agents ( oral prednisolone and intralesional triamcinolone : betamethasone ; oral propranolol and intralesional bleomycin , or surgical excision and topical timolol maleate ) . \n one case that underwent surgical excision for a small superficial hemangioma involving the left medial upper eyelid had a recurrence after 2 weeks . \n application of topical timolol maleate 0.5% eyedrops twice daily was advised . however , in this case , there was no change in the size of the lesion after 1 month of eyedrop application . \n one patient treated with oral prednisolone and intralesional triamcinolone : betamethasone experienced a complication of orbital cellulitis , which was subsequently treated with intravenous antibiotics and drainage of the subperiosteal abscess . \n reduction in the size of the lesion was observed in two out of the three cases . \n one of the cases treated with oral propranolol was a 6-month - old female with amblyopia from mechanical ptosis , with two previous intralesional bleomycin injections , 2 months apart , from another institution . \n the hemangioma showed remarkable reduction at the time of consultation at our institution ( figure 3 ) . \n the second case was a preterm female with subcutaneous hemangioma involving the left superomedial orbit with maximal mri axial dimensions of 1.7 1.9 cm , which decreased to a clinical measure of 0.8 0.3 cm after 7 weeks of treatment . \n the first case was a 22-month - old female with a glabellar lesion described as an enhancing mass with flow voids in the subcutaneous tissues , representing an arteriovenous malformation . \n post - excision , histology reported an ovoid mass with lobulated nests of capillary hemangioma . \n superficial lesions , which appear as scarlet red in color , were seen in 22% of the cases . \n subcutaneous lesions , which appear as bluish - purple hues beneath the skin , were seen in 14% of the cases . \n both superficial and subcutaneous features appeared together in 64% of the cases ( figure 1 ) . \n seven cases ( 44% ) had right - sided hemangiomas ; similarly , another seven cases ( 44% ) were left - sided . \n two cases ( 12% ) had hemangiomas located over the glabellar region , with forehead extension . \n upper - eyelid hemangiomas were seen in eight cases ( 50% ) and six ( 38% ) were found in the lower eyelid . of the cases found in the upper lid ( eight ) , six ( 75% ) measured > 1 cm , and two cases ( 25% ) measured < 1 cm in diameter . \n the mean logarithm of the minimum angle of resolution ( logmar ) visual acuity was 0.77 at the first visit and 0.46 upon the most recent examination ( table 2 ) . \n of those patients with recorded cycloplegic refraction , a majority of the children less than 2 years of age were hyperopic , with mean spherical refractions of + 1.83 and + 1.00 on the first and last visits , respectively . \n all cases whose lesions were located in the upper eyelid had astigmatism , with a mean cylinder of 1.714 ( range : 0.754.25 ) . \n twenty - five percent ( 4/16 ) of patients ( mean age of 4 months ) were found to be amblyopic during the follow - up period . \n the majority ( 75% ) were amblyopic because of anisometropia , and a quarter ( 25% ) were amblyopic because of occlusion of the visual axis ; all of them had lesions located in the upper eyelid . \n two cases presented with proptosis , globe displacement , and limitation in eye movement due to lesions extending deep into the orbit . \n fifty - six percent ( 9/16 ) were managed conservatively . of the remaining 44% , treatment was either with a single agent ( 57% ) or a combination ( 43% ) ( table 3 ) . \n the mean follow - up was 19 months ( range : 1.572 months ) , and 12% ( n = 2 ) were lost to follow - up . \n fifty - six percent ( nine ) were managed conservatively , which involved regular spectacle correction and amblyopia therapy , by taping and/or patching , as well as close follow - up . by two years of age , seventy - eight percent ( 7/9 ) showed notable regression ( according to clinical photos and clinical examinations ) in the size of the hemangioma ( figure 2 ) . \n indications were deep orbital extension , occlusion of the visual axis , and cosmetic concerns . \n the treatments we employed included : ( 1 ) steroid therapy , ( 2 ) surgical excision , ( 3 ) oral propranolol , and ( 4 ) bleomycin ( received at other institutions ) , either singly or in combination ( table 3 ) . among those that received treatment , 57% ( four ) \n were treated with a single agent ( oral propranolol , prednisolone , or surgery ) , and regression was noted in three of them . \n the remaining 43% ( three ) received a combination of two to three agents ( oral prednisolone and intralesional triamcinolone : betamethasone ; oral propranolol and intralesional bleomycin , or surgical excision and topical timolol maleate ) . \n one case that underwent surgical excision for a small superficial hemangioma involving the left medial upper eyelid had a recurrence after 2 weeks . \n application of topical timolol maleate 0.5% eyedrops twice daily was advised . however , in this case , there was no change in the size of the lesion after 1 month of eyedrop application . \n one patient treated with oral prednisolone and intralesional triamcinolone : betamethasone experienced a complication of orbital cellulitis , which was subsequently treated with intravenous antibiotics and drainage of the subperiosteal abscess . \n reduction in the size of the lesion was observed in two out of the three cases . \n one of the cases treated with oral propranolol was a 6-month - old female with amblyopia from mechanical ptosis , with two previous intralesional bleomycin injections , 2 months apart , from another institution . \n the hemangioma showed remarkable reduction at the time of consultation at our institution ( figure 3 ) . \n the second case was a preterm female with subcutaneous hemangioma involving the left superomedial orbit with maximal mri axial dimensions of 1.7 1.9 cm , which decreased to a clinical measure of 0.8 0.3 cm after 7 weeks of treatment . \n the first case was a 22-month - old female with a glabellar lesion described as an enhancing mass with flow voids in the subcutaneous tissues , representing an arteriovenous malformation . \n post - excision , histology reported an ovoid mass with lobulated nests of capillary hemangioma . no recurrence was observed in this case . \n they expand progressively in weeks to months , then involute over the years.19,11,22 formerly dense endotheliomatous lesions during the growth phase become replaced by fewer endothelial channels , increased collagen deposition , and fat , as well as inflammatory cells , as lesions regress.11 the clinical diagnosis of capillary hemangiomas is often straightforward . \n superficial hemangiomas may affect the lid or conjunctiva and appear as strawberry lesions , scarlet red in color , whereas deeper lesions lie posterior to the orbital septum and present as a subcutaneous bluish hue . \n these hamartomas often present as isolated lesions or , in rare instances , with systemic associations , such as kassabach - merritt syndrome ( thrombocytopenia ) and neurocutaneous phace syndrome ( a disorder in which a child is born with posterior fossa malformation , cervico - facial hemangiomas , arterial anomalies , cardiac defects , and various eye anomalies).11,21,22 none of the patients in our series had associated systemic syndromes . \n b - scan and doppler ultrasonography showed the lesions exhibited high echogenicity , with either smooth lobular or irregular contours , and fast blood flow . computed tomography showed the lesions as well - defined homogenous or inhomogenous , moderate - to - intense enhancing masses . \n mri also showed them to be well defined , with some irregular margins , and with low signal intensity on t1-weighted images versus high signal intensity on t2-weighted images with respect to fat and extraocular muscles . \n these lesions could be found in any or in a combination of compartments within the orbit , being intraconal and extraconal , pre- and postseptal.11,22 indications for the treatment of capillary hemangiomas in the periocular region are ptosis with visual axis occlusion , deprivational amblyopia , anisometropia , and cosmesis.7 similar to the observations by schwartz et al,2 four of our patients with upper - eyelid lesions , with basal dimensions measuring > 1 cm , developed amblyopia secondary to anisometropia and mechanical ptosis that occluded the visual axis . \n refractive errors are potentially reversible , especially when spectacle correction and prompt amblyopia therapy are given . \n however , our study could not correlate this thoroughly , due to missing data and a small sample size . \n more than half of our patients in this study were monitored closely for any change in refractive error , and were treated for ambylopia when it was present . \n oral prednisolone was commonly prescribed as a systemic treatment for extensive lesions , and we likewise observed regression in the size of the hemangioma ( 1/2 ) ( figure 4 ) . \n intralesional steroid injection was the most common form of treatment in the past for capillary hemangioma.5 weiss observed a reduction in astigmatism of up to 63% within 1 to 14 months after injection.7 in this series , triamcinolone with betamethasone was used as an additional treatment in a case unresponsive to oral prednisolone . \n generally , small and superficial lesions may be effectively managed with topical or intralesional treatments , while larger and deeper hemangiomas require systemic treatments or a combination thereof.5,13 we previously treated patients having relatively superficial and localized lesions with intralesional steroid injections , while for extensive lesions with deep orbital involvement , this was managed through systemic treatments . \n when one form of treatment was insufficient for reducing the size of the hemangioma , we used a different modality . \n sarihan et al were first to report on its application as an intralesional injection for cutaneous hemangiomas.23,24 they noted extensive fibrosis and spontaneous resolution of hemangiomas . \n one of our patients received intralesional injections of bleomycin at a different institution , as well as oral propranolol . \n in recent years , propranolol has produced encouraging results for capillary hemangioma and has become our preferred treatment . \n we observed dramatic positive responses ( 2/3 ) in our patients , except for one who unfortunately developed a systemic complication and had to terminate the treatment . \n systemic complications can be potentially life threatening ; one of our patients developed respiratory distress during propranolol treatment . \n this clearly shows that careful systemic evaluation and patient selection are crucial prior to treatment and that the patient s family should be informed of the benefits and risks of the therapy . \n although hospital admission with close observation by pediatricians for possible side effects such as hemodynamic changes ( eg , bradycardia , hypoglycemia , and respiratory distress)16,18,20 is recommended , outpatient management has been reported by haider and coworkers to show favorable responses in more than half of patients , with minor side effects.15 hence , the multidisciplinary collaboration of cardiologists , pediatricians , dermatologists , and ophthalmologists with pretreatment workups , such as baseline electrocardiography should remain standard for \n either inpatient or outpatient intervention.15,16,18 our study showed there was a favorable response to oral propranolol , with dramatic regression ( 2/3 ) , except for one who developed respiratory distress . \n currently , propranolol is our preferred treatment , at a recommended dose of 12 mg / kg / day , given on an outpatient basis when the patient is in good health , or when admitted if otherwise . to date \n , several studies have been conducted attesting the efficacy of this nonselective beta - blocker , which has long been used as an antihypertensive agent . \n it has been speculated that the apparent vasoconstriction may be due to the inhibition of vascular endothelial growth factor and the triggering of endothelial cell apoptosis . in vitro pharmacologic research \n has shown that propranolol beta adrenergic blockade inhibits several steps in the angiogenic cascade , such as growth factor - induced migration , tubulogenesis , and matrix metalloproteinase secretion of endothelial cells.25 surgical excision , either complete or partial resection , remains an option for treatment . \n it is often indicated for sight - threatening hemangiomas that do not respond to medical treatments , or for small well - defined lesions that can be removed completely with minimal morbidity.5,12,13 \n in general , most children with periocular capillary hemangioma do not require treatment , given their natural capacity for spontaneous involution . \n the preconditions for intervention are rapidly enlarging lesions , visual axis obscuration , significant induced astigmatism , and cosmetic reasons . for extensive lesions involving the visual axis , \n local and systemic treatments effectively reduce the size of the lesion , whether they are used alone or in a combination . \n we recommend systemic treatments such as propranolol for large and deep subcutaneous lesions , especially when these cause visual occlusion , significant refractive error , and globe displacement . \n visual outcomes are generally good when appropriate treatment is given early and existing refractive errors and ambylopia are corrected , which remain of utmost importance . despite the effectiveness of each treatment , complications exist , and though not frequent , prudence dictates awareness and timely management .", "role": "user" }, { "content": "purposeto present a case series on the management options for capillary hemangiomas involving the eyelid and orbit.methodsthis is a retrospective chart review of clinically diagnosed capillary hemangioma cases involving the periocular region treated at two local eye institutions . \n the patients demographics and clinical presentation including visual acuity , refractive error , periorbital and orbital examinations , and ultrasound and magnetic resonance imaging findings were reviewed . \n the clinical progression , modalities of treatment , and treatment outcomes were studied.resultssixteen cases of capillary hemangiomas involving the eyelid and orbit were studied . \n the mean age at consultation was 9.6 months ( range : 1 month72 months ) . \n the majority were females ( 75% ) , with 50% presenting as upper - eyelid hemangiomas and the remaining as lower - eyelid ( 38% ) and glabellar ( 12% ) lesions . \n combined superficial and deep involvement was common ( 64% ) . \n cases whose lesions were located at the upper eyelid or superior orbit led to amblyopia ( 25% ) . \n fifty - six percent of cases ( 9/16 ) were managed conservatively , and 44% ( 7/16 ) underwent treatment with either single - agent ( n = 4 ) or combined treatments ( n = 3).conclusionclose monitoring of visual development and prompt institution of amblyopia therapy for children with periocular capillary hemangiomas generally preserve vision . \n extensive lesions that affect the visual axis require local and systemic treatments , alone or in combination , in order to reduce the size and impact of lesions on the eyeball , to reduce induced refractive error and visual occlusion , and to prevent the development of amblyopia , in order to achieve good visual outcomes .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: non - hodgkin s lymphoma ( nhl ) has been recognized as a cancer that develops extensively in the lymphatic tissues ( the immune system ) , and can be spread to other parts of the body through the bloodstream , making secondary tumours.1,2 patients can acquire aggressive nhl ( fast - growing ) or indolent ( slow - growing ) lymphoma that can be formed from b cells or t cells.3 according to research conducted in the uk in 2008 , of the 27 countries in the european union , finland had the highest nhl mortality rates for both men and women , at approximately five and seven cases per 100,000 persons , respectively.4 in addition , the american cancer society predicted that 37,600 men would be diagnosed with nhl in the us , with approximately 10,590 subsequent deaths in the total population.5 in 2008 , nhl was one of the most prevalent types of cancer in saudi arabia , and ranked second in cancer incidence among the male population , with a ratio of 122:100 for men to women.6 the international agency for research on cancer estimated that the age - standardized incidence rate ( asir ) for nhl was 6.5 per 100,000 men in 2012 , and the age - standardized mortality rate ( asmr ) was 4.3 per 100,000 men.7 furthermore , the registry of king faisal specialist hospital and research centre in saudi arabia recorded 5,493 cases ( 7.6% ) of nhl with admission to the hospital from 1975 to 2011.8 in saudi arabia , the asir of nhl is higher than that in the other arabian gulf countries . \n the reported asirs for oman , qatar , the united arab emirates , and bahrain were 6.3 , 5.9 , 5.8 , and 4.7 per 100,000 men , respectively.7 in spite of insufficient data on the geographical distribution of nhl among males in saudi arabia , we intended to examine the crude incidence rate ( cir ) and asir of nhl cancer cases by conducting an observational descriptive epidemiological study of the disease while considering spatial / temporal distribution of recorded cases in the saudi cancer registry ( scr ) during 2001 to 2008.9 \n we conducted a retrospective , descriptive , epidemiological study of all saudi men with nhl cancer diagnosed between january 2001 and december 2008 . \n the data for this study are managed by the scr , which is a population - based registry that was established in 1994 through the ministry of health in saudi arabia . \n however , no data were available from 1994 to 2000 , and the most recent available data set from the scr was in 2008 . since 2001 , the scr has been reporting on the pattern of cancer in saudi arabia with the primary objective of defining the population - based incidence of the disease . according to these data , comprehensive reports for 13 administrative regions from 2001 to 2008 currently exist that report the percentage of cases , cir , and asir , adjusted for the provinces of saudi arabia , age of cases , and the year of diagnosis . \n data from all of these reports were gathered from the scr with the aim of critically analyzing the descriptive epidemiology of nhl among saudi arabian men . for all data analyses , we used spss version 20.0 ( ibm , armonk , ny , usa ) . \n the descriptive analysis was performed by calculating the overall percentage , cir , and asir after adjusting for age - group , region , and year of diagnosis . \n the percentage was calculated by dividing the total number of incident nhl cases by the total number of male cancer cases . \n furthermore , analysis of variance ( anova ) was performed to determine if the incidence of nhl varied significantly among the regions and years of diagnosis.10 in addition , linear regression models were applied to investigate the strength of the association between the independent and dependent variable to predict the annual cir and asir for nhl among saudi men.11 poisson regression models were also conducted to calculate the incidence rate ratio ( irr ) for the number of nhl cases in each region of saudi arabia . \n the overall asirs are reported as per 100,000 men , and were calculated for all of the scr datasets based on the segi world standard12,13 for intermediate - age populations ( table 1 ) . \n the segi world standard can be used as a direct method of standardization to calculate the asir of nhl cancer . \n it allows for control of the confounding effects of age when different populations are compared across age - groups.12,13 \n a total of 2,555 cases of nhl were recorded in the scr between january 2001 and december 2008 . \n we identified 230 cases in 2001 ( 8% , 95% confidence interval [ ci ] 6.0%10.0% ) and 332 by 2004 ( 9.5% , 95% ci 7.511.5% ) , representing a 1.5% increase . \n this was the highest percentage stated by the scr ( 2004 ) , but not statistically significant ( p>0.05 ) . from 2005 to 2008 , the number of nhl cases remained slightly elevated , and fluctuated between 9.3% and 8.7% , respectively ( figure 1a and b ) . \n the average number and percentage of nhl cases between 2001 and 2008 , adjusted by age - group , was calculated from the scr ( table 2 , figure 1c and d ) . \n the following age - groups were reported : 014 , 1529 , 3044 , 4559 , 6074 , and older than 75 years . according to the frequency of nhl cases from 2001 to 2008 , older men aged 6474 years had the highest average number of nhl cases ( 78 ) , representing 25% per year . those aged 3044 and 4559 years had the next - highest average number of cases , with 60 , representing 19% of the total number of nhl cases . additionally , the younger age - groups aged 014 and 1529 years had the lowest number of cases , with less than 44 in total for both groups , representing 11% and 14% of the total number of nhl cases , respectively . \n the cirs were adjusted by the year of diagnosis and calculated for the 20012008 data sets . a steady increase of cirs for nhl \n a cir of 2.9 ( 95% ci 2.33.5 ) and 4.1 ( 95% ci 3.25.0 ) per 100,000 men was estimated in 2001 and 2008 , respectively . in 2007 , \n the cir of 4.7 ( 95% ci 3.95.5 ) per 100,000 men was significantly higher than that of other years ( f7,96=2.34 , p<0.05 ) ( table 3 and figure 2a ) . according to the linear regression analysis , \n the equation to predict the annual increase of cir for nhl cancer among saudi men was 2.54 + ( 0.18 years ) , and the cir of nhl increased by a predicted average of 0.18 per 100,000 saudi men per year . \n table 4 and figure 2b show data from 2001 to 2008 for the overall cir per 100,000 men with nhl adjusted for the region of saudi arabia . \n riyadh had the highest overall cir for nhl , at 4.6 ( 95% ci 4.05.2 ) per 100,000 men , followed by makkah at 4.1 ( 95% ci 3.35.0 ) , and the eastern region at 3.8 ( 95% ci 3.14.3 ) . \n therefore , the results of the anova tests revealed that the incidence rates of nhl were significantly higher for these regions than those of other regions of saudi arabia ( f12,91=2.891 , p<0.001 ) . \n furthermore , jazan and hail had the lowest average cirs for nhl among saudi men , at 2.0 ( 95% ci 1.42.6 ) and 2.9 ( 95% ci 1.84.0 ) , respectively . \n table 3 and figure 2c show the asir of nhl , adjusted for the year of diagnosis from 2001 to 2008 per 100,000 men . \n there was a slight increase in the asir of nhl diagnosed between 2001 and 2008 ; the highest asir was 7.0 ( 95% ci 5.68.4 ) , recorded in 2007 according to reports released by the scr . \n however , the linear regression equation to predict the annual asir of nhl cancer among saudi men was 4.58 + ( 0.13 years ) , and the asir of nhl increased by a predicted average of 0.13 per 100,000 saudi men per year . similarly , \n table 4 and figure 2d indicate that the region of riyadh had the highest overall asir for nhl cancer , at 7.8 ( 95% ci 6.78.9 ) per 100,000 men , followed by the eastern region at 6.8 ( 95% ci 5.87.7 ) and makkah at 6.1 ( 95% ci 4.97.2 ) . \n the results of the anova tests indicated that the asirs of nhl were significantly higher for these regions than those in other provinces of saudi arabia ( f12,91=4.532 , p<0.001 ) . \n alternatively , jazan , hail , and baha had the lowest overall asirs for nhl among saudi men , at 2.5 ( 95% ci 1.93.1 ) , 3.7 ( 95% ci 2.35.2 ) , and 3.9 ( 95% ci 2.65.3 ) , respectively . \n the results of the poisson regression model used to calculate the irr of nhl cases according to the region of saudi arabia are presented in table 5 ; the model was statistically significant ( likelihood ratio 13=2823.8 , p<0.001 ) . \n jazan was used as the reference for all comparisons between other provinces of saudi arabia . \n the irrs were significantly higher in riyadh , at 4.68 ( 95% ci 4.115.32 ) , followed by makkah at 4.47 ( 95% ci 3.945.07 ) and the eastern region at 3.27 ( 95% ci 2.903.69 ) . \n furthermore , the irr of nhl cases significantly increased by 1% for every unit increase per year . finally , differences among the cir and asir between 2001 and 2008 were calculated . \n the pattern of nhl among saudi men according to their region is shown in table 6 . \n the greatest change in asir was observed in the jouf region , at 5.0 per 100,000 men . \n however , the cir and asir for all regions of saudi arabia fell below the predicted values , based on the linear regression equations listed above . \n epidemiological evidence based on prospective cohort and case - control studies shows that modifiable risk factors , including obesity , lack of physical activity , high fat intake , low fish intake and high consumption of meat , are positively linked with nhl.14 furthermore , there are nonmodifiable risk factors that may increase the chance of getting nhl . the age of persons older than 60 years \n the risk of nhl is higher in men compared to women with unknown causes . in addition \n , white americans are more likely to get nhl compared with african and asian americans . in this study , we reported the cir and asir of nhl among men in saudi arabia from 2001 to 2008 to describe the epidemiology of nhl among men according to their region . \n in addition , this study clarifies the recent trends of nhl in saudi arabia and affirms the significance of the disease . in 2012 , the asirs and asmrs of nhl cancer per 100,000 men were reported in different countries by the international agency for research on cancer . according to the international comparison of nhl cancer rates with saudi arabia in table 7 , \n the asirs of nhl cancer were higher in the us , australia , ireland , and the uk , at 14.7 , 14.4 , 12.5 , and 11.9 cases per 100,000 men , respectively , while india , the people s republic of china , and bahrain recorded the lowest rates , at 3 , 3.2 , and 4.7 cases per 100,000 men , respectively . \n furthermore , the highest asirs in arab gulf countries were estimated in kuwait , at 7.7 cases followed by saudi arabia and oman at 6.5 and 6.2 per 100,000 men , respectively . despite the low asir of nhl cancer in saudi arabia compared to other countries , \n for example , the asmrs of nhl in australia , ireland , and the uk were lower than saudi arabia , at 3.8 , 3.8 , and 3.6 cases per 100,000 men , respectively . \n this means that secondary and tertiary preventions , including early diagnosis , good treatment , and rehabilitation programs , were not adequate for cases in saudi arabia . \n . the results of our study indicate that the region of riyadh , the eastern region , and makah have the highest overall asirs for nhl among saudi men . \n however , the overall asirs of nhl for these regions have not increased above the expected levels from 2001 to 2008 . \n conversely , the regions of jazan , hail , and baha had the lowest overall asirs of nhl among men in saudi arabia for the same period . \n however , factors that include socioeconomic status , improvement in technology , and awareness among population may influence the burden of cancer and its incidence rate . \n this suggests that people in higher socioeconomic areas receive treatment more often , resulting in more cases being diagnosed and reported , than in areas with lower socioeconomic status , where the numbers may be underestimated due to undetected cases . \n however , we suspect that the false impact of socioeconomic status on the incidence rate of cancer can only be observed in different regions during the short studied period ( months ) , and that with longer surveyed time ( years ) , all cases should eventually be detected , resulting in a more accurate reported incidence rate . \n the period of time from case diagnosis may be considered a potential bias for studying the real effect of socioeconomic status on cancer . \n however , it is challenging to study the relationship between socioeconomic status and incidence rate of nhl , because the scr does not collect data on socioeconomic status for different regions in saudi arabia . \n our poisson regression model indicates that the irrs of nhl were significantly higher in riyadh , followed by makkah and the eastern region , than that of jazan ( reference region ) . \n however , the most affected age - groups in all of the regions of saudi arabia were men older than 60 years . \n we also observed changes in the percentage , cir , and asir of nhl among saudi men according to their region . \n jouf had the highest differences in asirs of nhl between 2001 and 2008 , but the differences fell below the predicted rates for this period . \n the likely justification for these differences is that jouf was more affected by nhl over this 8-year period than were the other regions of saudi arabia . despite the shortage of data about the geographic and time distribution of nhl among saudi men , we sought to uncover the patterns and trends of nhl among men from 2001 to 2008 . \n therefore , our findings may be useful for improving the public health policy in saudi arabia regarding nhl through the discussed epidemiological evidence . \n this research may help to generate future hypotheses about the potential risk factors of nhl in the highest - affected regions of saudi arabia through prospective epidemiological studies , which identify the relationships between exposure and disease . \n this descriptive epidemiological analysis of data from the scr collected from 2001 to 2008 revealed that the cir and asir of nhl cancer among saudi men show increasing trends . \n the region of riyadh , the eastern region , and makkah had the highest overall cirs and asirs . \n the irrs of nhl were a concern in certain regions , such as riyadh , makkah , and the eastern region . \n the greatest differences in the asir of nhl among saudi men from 2001 to 2008 were found in jouf . \n further analytical studies are needed to explore the potential risk factors of nhl among saudi men .", "role": "user" }, { "content": "backgroundthis study describes epidemiological data of non - hodgkin s lymphoma ( nhl ) diagnosed from 2001 to 2008 among saudi men.materials and methodsretrospective data from all nhl cancer cases among saudi men recorded in the saudi cancer registry ( scr ) between january 2001 and december 2008 were used . \n descriptive statistics , analysis of variance , poisson regression , and simple linear regression were also used.resultsin total , 2,555 new cases of nhl were recorded between january 2001 and december 2008 . \n the region of riyadh , saudi arabia had the highest overall age - standardized incidence rate ( asir ) at 7.8 , followed by the eastern region at 6.8 , and makkah at 6.1 per 100,000 men ; however , jazan , hail , and baha had the lowest average asirs at 2.5 , 3.7 , and 3.9 per 100,000 men , respectively . \n the incidence - rate ratio for the number of nhl cases was significantly higher in riyadh ( 4.68 , 95% confidence interval [ ci ] 4.115.32 ) , followed by makkah ( 4.47 , 95% ci 3.945.07 ) , and the eastern region of saudi arabia ( 3.27 , 95% ci 2.903.69 ) than that in the reference region of jazan . \n jouf had the highest changes in the asirs of nhl among saudi men from 2001 and 2008 ( 5.0 per 100,000 men).conclusiona significant increase in the crude incidence rate and asir for nhl in saudi arabia between 2001 and 2008 was found . \n riyadh , the eastern region , and makkah had the highest overall asir in saudi arabia . \n jazan , hail , and baha had the lowest rates . \n additionally , riyadh , makkah , and the eastern region had the highest incidence - rate ratio for the number of nhl cases . \n finally , jouf had the highest changes in crude incidence rate and asir from 2001 to 2008 . \n further analytical studies are needed to determine the potential risk factors of nhl among saudi men .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: multidrug resistance ( mdr ) remains the major obstacle to success in a wide variety of advanced malignancies , particularly in solid cancers . \n the overexpression of p - gp is one of the important mechanisms involved in mdr [ 13 ] . \n p - gp - mediated cellular uptake and the efflux of anticancer drugs from cancer cells are responsible for the cell elimination of the drugs which in turn decreases their therapeutic effect . \n therefore , one of the best methods of reversing mdr and increasing the efficacy of anticancer drugs is to use the potent p - gp inhibitors modulating p - gp function and/or expression . \n it is an important step to use assays to evaluate the effect of candidate drugs as inhibitors of p - gp function in vivo after the drugs were found to have an mdr - reversing effect in vitro . for nonsurgical solid cancer patients , \n there are currently no direct assays measuring intratumoral drug concentrations or the alteration of p - gp function and/or expression . \n thus , alternative approaches to evaluate the degree of functional inhibition of p - gp in vivo will be a useful aid in the development of mdr modulators . \n p - gp is also expressed in normal tissues in which they seem to have an important role in the protection against xenobiotics . \n several authors reported that p - gp was expressed in lymphocytes including cd3 , cd4 , and cd8 t cells , as well as the cd56 natural killer ( nk ) cells , with the highest expression levels and activities observed in cd56 cells followed by cd8 cells [ 5 , 6 ] . \n however , the physiological roles that p - gp plays in these cells are unclear . \n the p - gp in the lymphocytes appears functionally identical to that observed in multidrug resistant cells ; they have the same substrate and antagonist specificities [ 5 , 7 , 8 ] . \n since the expression and function of p - gp in cd56 cells are the highest , is rho123 accumulation widely used in cd56 populations as a surrogate indicator to evaluate the degree of functional inhibition of p - gp in clinical trials of p - gp inhibitors , for example , the work of tariquidar and zosuquidar . \n as mouse nk cells do not express cd56 , we used rho123 accumulation in cd8 cells as a surrogate indicator to evaluate the reversal activity by p - gp reversors in the mouse mdr tumor - bearing model . \n the search for mdr modulators has extended to the natural products and their derivatives ; natural source compounds have become the most widely used of fourth - generation p - gp inhibitors because they are less toxic and more potent than the disappointing first- and second - generation mdr modulators [ 1214 ] . \n ch , manufactured by salification from cepharanthine , which is a biscoclaurine alkaloid , extracted from stephania cepharantha hayata has a variety of biological activities ( figure 1 ) [ 1517 ] . \n recently , it has been reported that ch has an mdr - reversal effect , and p - gp inhibition is one of the reversal mechanisms of mdr in vitro [ 18 , 19 ] ; however , the effect was not evaluated in vivo . \n we present here a method to detect the effect of the inhibitor of the p - gp function on rho123 accumulations of the cd8 cells in whole blood from the mdr tumor - bearing mouse . \n this method was first used to develop and validate the efficacy of ch against p - gp functions in the mouse model for potential use in subsequent clinical evaluations . \n the experiments were carried out on 24-month - old balb / c male mice , obtained from the henan experimental animal center ( zhengzhou , china ) . \n the animals had been raised from birth in a specific pathogen - free environment and were handled according to the institutional guidelines complying with chinese legislation . \n hca / fap variants were developed from the parental hca hepatocarcinoma cells , which were obtained from keygen biotechnology co. ltd . \n ( nanjing , china ) . by step - by - step , continuous exposure to increasing doses of fap , \n the overexpression of p - gp in the variant was confirmed by the western blot analysis and the cells that have been previously described . \n ch was supplied by the henan academy of medical and pharmaceutical sciences ( zhengzhou , china ) . \n adriamycin ( adr ) was purchased from hisun pharmaceutical co. , ltd ( zhejiang , china ) . \n cisplatin ( cddp ) was purchased from qilu pharmaceutical co. , ltd ( shandong , china ) . \n 5-flurouracil ( 5-fu ) was purchased from xudong haipu pharmaceutical co. , ltd ( shanghai , china ) . \n rho123 was purchased from sigma - aldrich ( st . louis , mo , usa ) and dissolved in pbs at a concentration of 1 mg / ml . the ficoll - histopaque mouse lymphocyte separation medium was obtained from solarbio science & technology co. , ltd ( beijing , china ) . \n the pe antimouse cd8 antibody ( clone 53 - 6.7 ) and pe rat igg2 , isotype ctrl were obtained from biolegend ( biolegend corp . \n hca / fap cells were collected from the ascitic fluid of balb / c mice harboring 57 day - old ascitic tumor . \n the 1 10 hca / fap cells were injected intramuscularly in the right axilla of balb / c male mice selected for the experiment on day 0 . \n the next day , the animals were randomized and divided into different groups ; each group comprised 10 mice . to study the effects of rho123 administration on peripheral blood cd8 cells , the retention of fluorescence in these cells was investigated as described previously with some modifications and a dose - response curve established . \n on the 8th day after the hca / fap injection , the mice received a single intravenous ( i.v . ) injection of rho123 . \n the doses used were 0.5 , 1.0 , 2.5 , 5.0 , and 7.5 mg / kg , and the volume of administration was 10 l / g . \n one hour after administration , peripheral blood was collected and cell suspension was prepared as described below . for the investigation of the effects of p - gp inhibitors ex vivo , \n blood samples were collected as described below on the 8th day after hca / fap injection . \n ch was then added at final concentrations of 10.0 , 5.0 , and 2.5 m ; ver was added at a final concentration of 5.0 m , an equal volume of the vehicle was added as control . \n the samples were incubated at 37c for one hour before rho123 was added at a final concentration of 50 ng / ml , and the tubes were incubated further at 37c for one hour . \n cell suspension was prepared as described below . to study p - gp function in vivo \n , rho123 was injected with or without ch or ver as described before with small modifications on the 8th day after hca / fap injection . \n briefly , mice , respectively , received a single intravenous ( i.v . ) injection of the vehicle as control ; 2.5 , 5.0 , and 10.0 mg / kg of ch or 2.5 mg / kg of ver followed one hour later by a single i.v . \n after one hour , blood samples were collected and cell suspension was prepared as described below . \n peripheral blood was collected from the orbital sinus of each mouse in a tube containing k2edta as an anticoagulant . \n mononuclear cells were obtained by the separation of anticoagulated blood by a ficoll - histopaque density - gradient centrifugation and transferred to 1.5 ml eppendorf tubes and kept on ice . \n cells were washed twice with ice - cold phosphate buffered saline ( pbs , ph 7.4 ) . \n after that , the pellet was gently resuspended in ice - cold pbs and adjusted to a concentration of 1 10 cells / ml . single - cell suspensions were incubated with either the pe - conjugated antimouse cd8 antibody or pe - conjugated rat igg2 , isotype ctrl as a negative control . after staining for 30 minutes in the darkness at 4c \n , the cells were washed twice with ice - cold pbs and then resuspended in pbs and kept on ice in the dark until analyzed as previously described . a life - gate based on forward scatter ( fsc ) and side scatter ( ssc ) parameters were made to analyze only viable cells ; other gates were made to determine the subpopulations . \n amplifier settings for fsc and side ssc were used in linear mode and those for fluorescence channels were used in a logarithmic mode . \n fluorescence compensation was manually set for fl1 channel ( rho123 ) and fl2 channel ( pe ) with single rho123-stained cells and pe - stained cells separately . \n multicolor flow cytometry analyses were used to evaluate the proportions of the cd8 population and the mean fluorescence intensity ( mfi ) of rho123 in the population . \n cells were analyzed on epics - xl mcl , and data were analyzed with expo32 adc software ( beckman coulter , fullerton , calif , usa ) . to evaluate the antitumor effect of fap chemotherapy protocol plus various concentrations of ch or ver in vivo as previously described . \n twenty four - hours after the hca / fap injection , the mice were randomly divided into different groups and treated as follows : \n group i : control ( normal saline i.v . injected consecutively from day 1 to 9),group ii : 10 mg / kg of ch alone i.v . injected from day 1 to 8 , \n group iii : fap chemotherapy : 4.2 mg / kg of adr and 85.0 mg / kg of 5-fu i.v . injected on day 1 , 2.8 mg / kg of cddp i.v . injected from day 1 to 8 , \n group iv : 2.5 mg / kg of ch i.v . injected from day 1 to 8 with fap chemotherapy , group v : 5.0 mg / kg of ch i.v . injected from day 1 to 8 with fap chemotherapy , group vi : 10.0 mg / kg of ch i.v . injected from day 1 to 8 with fap chemotherapy , group vii \n : 2.5 mg / kg of ver i.v . injected from day 1 to 8 with fap chemotherapy . \n control ( normal saline i.v . injected consecutively from day 1 to 9 ) , 10 mg / kg of ch alone i.v . injected from day 1 to 8 , fap chemotherapy : 4.2 mg / kg of adr and 85.0 mg / kg of 5-fu i.v . injected on day 1 , 2.8 mg / kg of cddp i.v . injected from day 1 to 8 , 2.5 mg / kg of ch i.v . injected from day 1 to 8 with fap chemotherapy , group v : 5.0 mg / kg of ch i.v . injected from day 1 to 8 with fap chemotherapy , 10.0 mg / kg of ch i.v . injected from day 1 to 8 with fap chemotherapy , 2.5 mg / kg of ver i.v . injected from day 1 to 8 with fap chemotherapy . \n the tumor length ( l ) and width ( w ) were measured , and the tumor weight ( wr ) was calculated as follows : \n ( 1)wr = 12 l w2 . \n the percent of tumor growth inhibition was calculated on day 8 by comparing the average values of the treated groups with those of the tumor - bearing control group . \n for all the experiments , data are presented as the mean sd . statistical comparison between the groups with different doses or concentrations \n tests for significant differences among the groups were done using one - way anova with multiple comparisons ( fisher 's pairwise comparisons ) using spss 13.0 ( ibm software , somers , ny , usa ) . \n administration of rho123 ( 0.57.5 mg / kg ) in mice produced a dose - dependent fluorescence fashion in peripheral blood cd8 cells ( figure 2 ) . \n all doses were well tolerated without significant toxicity . the lower dose of rho123 , 2.5 mg / kg , \n was selected to investigate the effects of ch on the accumulation of rho123 in peripheral blood cd8 cells . using this dose , \n rho123 accumulations were increased after administration of either ver ( positive control ) or ch and presented a clear dose - dependent relationship with ch ( 2.510 mg / kg ) compared with vehicle control , as shown in figure 3 . \n the efficacy of the p - gp reversors was not equal ; ver was less efficient and potent than ch . \n there has similar result in ex vivo blood samples ; the mfis of cd8 + cells in the samples treated with the vehicle , 5.0 m of ver and 2.5 , 5.0 and 10.0 m of ch were 14.4 0.3 , 20.0 0.3 , 22.9 0.5 , 25.4 1.0 and 29.8 0.9 , respectively . \n the mfi was related to the presence of ch in a concentration pattern in ex vivo blood samples , as shown in figure 4 . \n this demonstrated that p - gp is active in cd8 cells and can be modulated by ch in vivo and ex vivo . \n 2.5 mg / kg of ver or 2.5 , 5.0 , and 10.0 mg / kg of ch were evaluated in the hca / fap tumor - bearing mouse . \n the fap combination chemotherapy plus 10.0 mg / kg of ch provided the maximum antitumor activity of the treatments studied . \n compared with the fap chemotherapy group , the antitumor effect was increased in a dose - dependent manner when the fap combined chemotherapy plus various concentrations of ch was used , as shown in table 1 . \n hepatocellular carcinoma ( hcc ) represents the third leading cause of cancer - related death . \n chemotherapy consisting of fap was commonly used to treat hcc in clinical situations ; however , hcc is often resistant to these drugs . therefore , one of the key approaches is to overcome drug resistance in the success of chemotherapy against hcc . \n previous studies of p - gp inhibitors such as ver , cyclosporine a , and its analog psc833 [ 2628 ] have been limited because of its serious toxicity at the time of dosage for reversing drug resistance . \n an important step to develop the mdr reversors targeting p - gp is to determine the inhibition level of p - gp in the preclinical animal model . \n an ideal approach is to detect the real concentrations of the investigated drug directly in vivo , but it is almost impossible , even in the animal model . if there is no related data on the inhibition level of p - gp , it is difficult to interpret the efficacy of p - gp inhibitors in pre- or clinical trials . \n recently , the functional study of p - gp was of great concern . among lymphocytes in the mouse \n , cd8 cells expressed the highest levels of p - gp followed by cd4 > cd3 [ 6 , 21 , 2932 ] . since blood samples are easy to be collected , we selected peripheral blood cd8 cells as a surrogate indicator to investigate the alteration of p - gp activities before and after the administration of p - gp inhibitors and then evaluate the reversal effect of the drug in a solid - tumor - bearing mouse \n . rho123 is a fluorescent substrate and has been shown to be a sensitive reagent for the detection of p - gp function by flow cytometry [ 14 , 33 ] . \n some authors reported that rho123 was a substrate for mrp and p - gp , but leite et al . reported that classical mrp1 reversors were unable to enhance rho123 accumulation in lymphocytes suggesting that mrp1 might not be active or rho123 is not a good substrate for mrp1 expressed in these cells \n therefore , the alteration of rho123 fluorescence intensities in these cells responded to the alteration of the p - gp function . in this study , we demonstrated that the mean fluorescence intensities of cd8 cells were related to the dose of rho123 in a dose - dependent manner suggesting that it is a good choice to use the accumulation of rho123 in cd8 cells as a surrogate indicator for the study of p - gp inhibitors . \n we further studied the modulation effect of ch in vivo and ex vivo ; the results showed that the mean fluorescence intensities of cd8 cells were related to ch in a dose- or concentration - dependent manner either in vivo or ex vivo . \n this suggested that the activities of p - gp were inhibited by ch . in our previous study , it was shown that the enhancement of cytotoxicity of fap against cultured hca / fap cells by ch occurs in vitro ; the efflux rate of rho123 in hca / fap cells was 2 times less than that of hca cells after 1 hour explosure to ch plus fap . \n mice is 0.47 times of clinical dosing of fap protocol , that is , 85.0 mg / kg of 5-fu , 4.2 mg / kg of adr , and 2.8 mg / kg of cddp . in the present study , we established an hca / fap solid tumor mouse model and assessed the antitumor effect of fap combination protocol plus ch . \n the i.v . dosing for a mouse is 42.50 mg / kg of 5-fu , 2.10 mg / kg of adr , 1.40 mg / kg of cddp . \n dose of 10.0 mg / kg ch partly inhibited the tumor growth , but the effect was weak ; this is consistent with conclusions drawn from other authors ' reports : a single i.v . \n dose of 5.0 mg / kg ch has no antitumor effect ( data not shown ) . when fap combined chemotherapy plus various concentrations of ch was used , the antitumor effect was increased in a dose - dependent manner . \n therefore , with this correlation with the results of the inhibition of p - gp function by ch in cd8 cells , we think that the antitumor activity recovered by ch in a dose - dependent manner was related to the inhibition of the p - gp function . \n all of the efficacious combination protocols with ch appeared to be well tolerated , as indicated by the minimal changes in body weights of the various treatment groups ( as shown in table 2 ) . since an ld50 of ver for the i.v . \n administration in mouse was reported to be 7.6 mg / kg , but a single i.v . \n dose of 5.0 mg / kg ver caused the death of 60% of animal in the treated balb / c mice ( data not shown ) , we selected the dose of 2.5 mg / kg as a positive control . \n there is no mortality in the fap treated group ; we think the 20% mortality in the fap plus ver treated group was caused by the increasing toxicity when ver combined with adr . \n although one can argue that what occurs at the level of peripheral blood cd8 cells may not accurately reflect the real inhibition level of p - gp in the solid tumor in mouse , tc - sestamibi scans performed in some studies have shown effective p - gp inhibition in both normal tissues and solid tumors [ 9 , 38 ] , suggesting the inhibition level of p - gp was modulated simultaneously . \n we have to note that no model is perfect and there are obvious differences between humans and mice ; the balb / c mouse is unique for its features , making even more difficult extrapolations to human conditions . with regard to the results obtained , we conclude that ch is a potent p - gp inhibitor for clinical application . \n although limitations may exist in the surrogate assay in cd8 cells in the mouse model , we are convinced that this assay can provide us with much useful information in screening potential p - gp inhibitors in vivo .", "role": "user" }, { "content": "the purpose of this study was the use of rhodamine 123 ( rho123 ) accumulation in peripheral blood cd8+cells as a surrogate indicator to evaluate the modulating effect of p - glycoprotein ( p - gp ) inhibitors in the multidrug resistance ( mdr ) tumor - bearing mouse model . \n rho123 was administered to mice , and the fluorescence level in cd8 + cells was measured . \n cepharanthine hydrochloride ( ch ) and verapamil ( ver ) , two p - gp inhibitors , were administered to mice 1 hour prior to rho123 administration in vivo or added to peripheral blood 1 hour prior to rho123 addition ex vivo . \n the tumor inhibition effect of 5-fluorouracil / adriamycin / cisplatin ( fap ) protocol plus ch was also investigated . \n a concentration- or dose - response relationship was shown between the concentration and dose of ch and rho123 accumulation or the antitumor activity . in conclusion \n , the measurement of rho123 accumulation in cd8 + cells provides a surrogate assay for the screening of candidate p - gp inhibitors in preclinical trials , and ch is effective in modulating p - gp - mediated mdr in vivo .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: craniofrontonasal syndrome ( cfns ; omim # \n 304110 ) is an x - linked malformative disorder identified by cohen in 1979 ( cohen , 1979 ) and characterized by distinctive craniofacial and digital anomalies . \n clinical findings in cfns include coronal synostosis , hypertelorism , a broad bifid nose , a low posterior hairline , an anterior widow 's peak , longitudinally grooved fingernails , and other digital anomalies ( cohen , 2001 , orr et al . , 1997 , saavedra et al . , 1996 ) . \n cnfs has a paradoxical clinical expression as it is more severe in heterozygous females than in males , a phenotypic pattern not usually seen in x - linked inheritance ( grutzner and gorlin , 1988 , twigg et al . , 2004 ) . \n the disorder is caused by mutations in the efnb1 gene , located at xq13.1 and encoding ephrin b1 , a protein that interacts with eph tyrosine kinase receptors and plays a critical role in cell migration and pattern formation during embryonic development ( twigg et al . , 2004 , twigg et al . , 2006 , wieland et al . , 2004 \n to date , approximately 100 different efnb1 mutations have been identified in cfns patients ( www.hgmd.cf.ac.uk/ ) and about 55% of them are frameshift , nonsense , and splice site mutations that lead to premature termination codons ( ptcs ) . \n missense mutations constitute about 42% of all efnb1 mutations and lead to the exchange of amino acid residues that are important for receptor - ligand interaction and signaling ( twigg et al . , 2004 , wieland et al . , 2005 ) . \n truncating mutations are associated with extremely reduced transcript levels via a mechanism known as nonsense - mediated rna decay that prevents the translation of transcripts carrying ptcs ( lejeune and maquat , 2005 ) . \n only a minority of efnb1 truncating or splice - site mutations have been investigated at the expression level ( makarov et al . , 2010 , wieland et al . , 2008 ) . here \n , we describe a case of cfns due to a novel efnb1 truncating mutation and report the results of efnb1 expression by rt - qpcr . \n a 33-year - old woman was referred to the genetics department due to cranio - facial dysmorphism . \n she is the first child of healthy , non consanguineous parents and has 3 younger healthy siblings . \n she was delivered by caesarean section at 38 weeks of pregnancy and birth examination revealed hypertelorism , left frontal hollow ( depression ) , left coronal synostosis , facial asymmetry , broad and flattened nasal bridge , bifid nasal tip , and cleft palate . growth and development were normal and her menarche occurred at l5 years of age . \n she underwent cranio - facial surgeries to correct her unilateral coronal synostosis and cleft palate when she was 3-years - old . upon examination \n , she was 150 cm tall ( < 3rd centile for age ) , weighed 44 kg ( < 3rd centile ) , and had an ofc circumference of 53 cm ( between 10th and 25th centile ) . \n a mild widow 's peak , brachycephaly , frontal bossing , prominent metopic ridge , orbital asymmetry , and bilateral palpebral ptosis were also seen ( fig . \n ophthalmologic examination disclosed bilateral lagophthalmos , exotropia and lacrimal tract blockage , as well as ectropion and epicanthic folds in her left eye . \n the patient also exhibited thick and wiry hair , short neck , pterygium colli , low posterior hair line ( fig . \n 1b and c ) , sprengel 's deformity , severe thoracic scoliosis , and cubitus valgus ( fig . \n in her hands , bilateral short 4th and 5th metacarpals , bilateral camptodactyly on f4 - 5 , bilateral clinodactyly on f5 ( fig . \n a gynecological examination revealed hypoplastic breasts , adequate gynecological hair distribution , and normal female external genitalia . \n spinal x - rays showed odontoid hypoplasia , dorsal - lumbar scoliosis ( fig . \n 2c ) and dislocation in the radius as well as radial - cubital dissociation ( fig . \n pain , decreased range of motion , and deformity were associated with these forearm anomalies ( fig . \n the study was approved by the institutional review board and the patient gave her written consent to participate . \n genomic dna was extracted from peripheral blood leukocytes using a semiautomated quickgene system ( fujifilm , tokyo , japan ) . \n the 5 exons of efnb1 and adjacent intronic sequences were amplified by pcr using pairs of primers derived from gene normal sequences ( ensembl i d 00000204961 ) . \n each 25 l pcr amplification reaction contained 1 buffer , 200 ng of genomic dna , 0.2 mm of each dntp , 2u taq polymerase , 1 mm of forward and reverse primers , and 1.5 mm mgcl2 . \n pcr products were analyzed in 1.5% agarose gels from which the bands with the amplified templates were excised and the dna was subsequently purified with the help of qiaex ii gel extraction kit ( qiagen , hilden , germany ) . \n direct automated sequencing of efnb1 was performed with the bigdye terminator cycle sequencing kit ( applied biosystems , foster city , ca ) . \n all samples were analyzed on an abi prism 3130 genetic analyzer ( applied biosystems ) . \n cells were dropped onto slides and then immersed in 85% acetic acid for 6 min . \n subsequently , slides were placed through a series of ethanol washes of 70% , 85% , and 100% for 2 min each and allowed to air dry at room temperature . \n working probe solutions were prepared using a centromeric x probe ( vysis / abbott molecular inc . , cep x spectrumgreen dna probe ) according to manufacturer 's specifications . \n slides were counterstained with dapi / antifade ( vysis / abbott molecular inc . , abbott park , il , usa ) and analyzed in an epifluorescence microscope ( leica dmrxa2 , leica microsystems , wetzlar , germany ) . \n whole blood samples from the cfns patient and from a healthy female donor ( hfd ) were obtained . \n briefly , 2.5 ml of whole blood was collected in paxgene blood rna tubes ( preanalytix , hombrechtikon , switzerland ) and stored at room temperature for a minimum of 2 h. after , total rna isolation was performed using the paxgene blood rna kit , in accordance with the manufacturer s instructions . rna purity and concentration \n were determined using a nanodrop 2000 spectrophotometer ( thermo fischer scientific , waltham , ma ) . \n total rna was reverse transcribed using the omniscript rt kit ( qiagen valencia , ca , usa ) as recommended by the supplier . in brief , a mix containing 50 ng/l rna , 1 buffer mix , 0.5 mm dntps , and 0.2 u/l omniscript rt was incubated for 60 min at 37 c . \n the expression of efnb1 was investigated using primer pair 5- agg cca gag cag gaa ata cg -3 and 5- gat ctt cat ggt gcg tgt gc -3 to amplify a 174 bp product encompassing exons 2 and 3 of enfb1 ; constitutive rpl4 expression was analyzed as assay control , using primers 5- agg ctc cta ttc gac cag ata -3 and 5-ttt gttggt gca aac att cg -3 to amplify a 234 bp product . \n pcr was performed using kapa2 g fast hotstart ( kapa , biosystems , boston , usa ) as instructed by the manufacturer . \n pcr conditions were as follows : pre - denaturalization for 3 min at 95 c ; 38 amplification cycles for 15 s at 95 c , 15 s at 57 c , and 7 s at 72 c ; a final cycle of 7 min at 72 c was used . \n sergio juarez - mendez , national pediatric institute , mexico city , mexico ) was used as positive control of efnb1 expression . for rt - qpcr , \n total rna was subjected to expression by quantitative pcr using kapa sybr fast universal qpcr kit according to the manufacturer 's recommendations . \n the oaz1 gene ( primer pairs 5- acg tcc aac gac aag acg agg att -3 and 5- tca gca ctg ttc gcc agt taa tgc -3 amplifying a 82 bp product ) expression was used as control for normalization . \n amplification was carried out in a rotor - gene 6000 thermocycler ( corbett research , sydney , australia ) . \n melting curves were generated for each gene to ensure the purity of the amplification product . \n a 10 l aliquot of the rt - qpcr reaction was incubated for 10 min at 95 c followed by 40 amplification cycles of 15 s at 95 c and for 45 s at 57 c for efnb1 and at 64 c for oaz1 . \n efnb1 expression was determined by relative quantification , which was calculated using 2 e ( ct ) method , where ct = ct(efnb1) ct(oaz1 ) and ct = ct(cfns ) ct(control ) ( livak and schmittgen , 2001 ) . \n a 33-year - old woman was referred to the genetics department due to cranio - facial dysmorphism . \n she is the first child of healthy , non consanguineous parents and has 3 younger healthy siblings . \n she was delivered by caesarean section at 38 weeks of pregnancy and birth examination revealed hypertelorism , left frontal hollow ( depression ) , left coronal synostosis , facial asymmetry , broad and flattened nasal bridge , bifid nasal tip , and cleft palate . growth and development were normal and her menarche occurred at l5 years of age . \n she underwent cranio - facial surgeries to correct her unilateral coronal synostosis and cleft palate when she was 3-years - old . upon examination \n , she was 150 cm tall ( < 3rd centile for age ) , weighed 44 kg ( < 3rd centile ) , and had an ofc circumference of 53 cm ( between 10th and 25th centile ) . \n a mild widow 's peak , brachycephaly , frontal bossing , prominent metopic ridge , orbital asymmetry , and bilateral palpebral ptosis were also seen ( fig . \n ophthalmologic examination disclosed bilateral lagophthalmos , exotropia and lacrimal tract blockage , as well as ectropion and epicanthic folds in her left eye . \n the patient also exhibited thick and wiry hair , short neck , pterygium colli , low posterior hair line ( fig . \n 1b and c ) , sprengel 's deformity , severe thoracic scoliosis , and cubitus valgus ( fig . \n in her hands , bilateral short 4th and 5th metacarpals , bilateral camptodactyly on f4 - 5 , bilateral clinodactyly on f5 ( fig . \n a gynecological examination revealed hypoplastic breasts , adequate gynecological hair distribution , and normal female external genitalia . \n spinal x - rays showed odontoid hypoplasia , dorsal - lumbar scoliosis ( fig . \n 2c ) and dislocation in the radius as well as radial - cubital dissociation ( fig . \n pain , decreased range of motion , and deformity were associated with these forearm anomalies ( fig . \n the study was approved by the institutional review board and the patient gave her written consent to participate . \n genomic dna was extracted from peripheral blood leukocytes using a semiautomated quickgene system ( fujifilm , tokyo , japan ) . \n the 5 exons of efnb1 and adjacent intronic sequences were amplified by pcr using pairs of primers derived from gene normal sequences ( ensembl i d 00000204961 ) . \n each 25 l pcr amplification reaction contained 1 buffer , 200 ng of genomic dna , 0.2 mm of each dntp , 2u taq polymerase , 1 mm of forward and reverse primers , and 1.5 mm mgcl2 . \n pcr products were analyzed in 1.5% agarose gels from which the bands with the amplified templates were excised and the dna was subsequently purified with the help of qiaex ii gel extraction kit ( qiagen , hilden , germany ) . \n direct automated sequencing of efnb1 was performed with the bigdye terminator cycle sequencing kit ( applied biosystems , foster city , ca ) . \n all samples were analyzed on an abi prism 3130 genetic analyzer ( applied biosystems ) . \n cells were dropped onto slides and then immersed in 85% acetic acid for 6 min . \n subsequently , slides were placed through a series of ethanol washes of 70% , 85% , and 100% for 2 min each and allowed to air dry at room temperature . \n working probe solutions were prepared using a centromeric x probe ( vysis / abbott molecular inc . , cep x spectrumgreen dna probe ) according to manufacturer 's specifications . \n slides were counterstained with dapi / antifade ( vysis / abbott molecular inc . , abbott park , il , usa ) and analyzed in an epifluorescence microscope ( leica dmrxa2 , leica microsystems , wetzlar , germany ) . \n whole blood samples from the cfns patient and from a healthy female donor ( hfd ) were obtained . \n briefly , 2.5 ml of whole blood was collected in paxgene blood rna tubes ( preanalytix , hombrechtikon , switzerland ) and stored at room temperature for a minimum of 2 h. after , total rna isolation was performed using the paxgene blood rna kit , in accordance with the manufacturer s instructions . \n rna purity and concentration were determined using a nanodrop 2000 spectrophotometer ( thermo fischer scientific , waltham , ma ) . \n total rna was reverse transcribed using the omniscript rt kit ( qiagen valencia , ca , usa ) as recommended by the supplier . in brief , a mix containing 50 ng/l rna , 1 buffer mix , 0.5 mm dntps , and 0.2 u/l omniscript rt was incubated for 60 min at 37 c . \n the expression of efnb1 was investigated using primer pair 5- agg cca gag cag gaa ata cg -3 and 5- gat ctt cat ggt gcg tgt gc -3 to amplify a 174 bp product encompassing exons 2 and 3 of enfb1 ; constitutive rpl4 expression was analyzed as assay control , using primers 5- agg ctc cta ttc gac cag ata -3 and 5-ttt gttggt gca aac att cg -3 to amplify a 234 bp product . \n pcr was performed using kapa2 g fast hotstart ( kapa , biosystems , boston , usa ) as instructed by the manufacturer . \n pcr conditions were as follows : pre - denaturalization for 3 min at 95 c ; 38 amplification cycles for 15 s at 95 c , 15 s at 57 c , and 7 s at 72 c ; a final cycle of 7 min at 72 c was used . \n sergio juarez - mendez , national pediatric institute , mexico city , mexico ) was used as positive control of efnb1 expression . for rt - qpcr \n , total rna was subjected to expression by quantitative pcr using kapa sybr fast universal qpcr kit according to the manufacturer 's recommendations . \n primers were the same as described above for the efnb1 rt - pcr . the oaz1 gene ( primer pairs 5- acg tcc aac gac aag acg agg att -3 and 5- tca gca ctg ttc gcc agt taa tgc -3 amplifying a 82 bp product ) expression was used as control for normalization . \n amplification was carried out in a rotor - gene 6000 thermocycler ( corbett research , sydney , australia ) . \n melting curves were generated for each gene to ensure the purity of the amplification product . \n a 10 l aliquot of the rt - qpcr reaction was incubated for 10 min at 95 c followed by 40 amplification cycles of 15 s at 95 c and for 45 s at 57 c for efnb1 and at 64 c for oaz1 . \n efnb1 expression was determined by relative quantification , which was calculated using 2 e ( ct ) method , where ct = ct(efnb1) ct(oaz1 ) and ct = ct(cfns ) ct(control ) ( livak and schmittgen , 2001 ) . \n nucleotide analysis disclosed a novel heterozygous mutation ( c.445_449del gaggg ) in exon 3 of efnb1 . \n direct sequencing of this region showed a pattern of peak overlapping characteristic of superimposed sequences due to heterozygosity for a deletion event . \n this mutation originated a frame - shifting and caused a premature stop signal ( tga ) 24 codons downstream ( e149gfs*24 ) ( fig . \n fish 's analysis in 1000 interphase cells identified 3.2% cells with a single x , 1.3% cells with triple x , and 95.5% cells with a normal 46,xx karyotype . \n standard rt - pcr expression analysis showed that efnb1 was expressed in blood cells of the cfns patient ( fig . \n as this expression could arise from the normal allele , the assessment of the relative expression of efnb1 was performed by real time - quantitative rt - pcr . \n compared to control female blood cells , efnb1 was expressed 70% less in blood cells from the cfns patient carrying a novel efnb1 deletion ( fig . \n we described a female who had severe dysmorphic features compatible with a diagnosis of cfns and in whom a novel efnb1 mutation was demonstrated . \n cfns shows a very unusual pattern of inheritance since most affected patients are females and obligated male carriers demonstrate either a mild manifestation such as hypertelorism or no typical features at all [ wieland et al . , \n it has been hypothesized that efnb1 mutations result in more severe abnormal craniofacial developments in females due to a process called cellular interference ( feldman et al . , 1997 , wieacker and wieland , 2005 ) . \n mutations in the efnb1 gene have been identified in the majority of familial and sporadic cfns patients . currently , the mutation detection rate for the efnb1 gene is 92% ( wieland et al . , 2005 ) . \n the major types of molecular alteration , accounting for up to 55% of all mutations , consist of nonsense , frameshifting , and splice site mutations that lead to ptcs ( makarov et al . , 2010 , wieland et al . , 2008 ) . \n frameshift and nonsense mutations of exons 14 ( as our patient 's mutation ) as well as splice site mutations and intragenic deletion are predicted to result in ptcs and a complete loss of efnb1 gene function due to nonsense - mediated rna decay . \n reported a deletion in exon 4 of efnb1 which generated a ptc , but the transcript escaped nmd ( wieland et al . , \n quantitative rt - pcr in blood cells from our patient carrying a novel c.445_449delgaggg deletion in exon 3 showed that efnb1 expression level was less than half ( 0.3 ) compared with a normal control . \n this result strongly suggests that transcripts from the novel c.445_449delgaggg truncating allele are degraded by nmd . to our knowledge , this is the first time that an efnb1 transcript carrying a truncating mutation in exon 3 is demonstrated to undergo degradation by nmd . \n recently , baker et al . reported a patient with similar abnormalities to cnfs , in whom mosaicism for an additional ring x chromosome was found ( baker et al . , \n , we failed to detect relevant sex chromosome aneuploidy as the 3% of 45,x cells detected by fish falls within the normal range for age ( guttenbach et al . , 1995 ) . \n in conclusion , we present a patient with craniofrontonasal syndrome due to a novel efnb1 frameshift mutation ( c.445_449delgaggg ) and add to the expression analysis of truncating efnb1 mutations .", "role": "user" }, { "content": "craniofrontonasal syndrome ( cfns ) is an x - linked disorder caused by mutations in the efnb1 gene and characterized by distinctive craniofacial and digital malformations . \n in contrast with most x - linked traits , female patients with cfns display a more severe phenotype than males . in this report , \n the clinical , molecular and rna expression analyses of a female subject with cfns are described . \n a novel c.445_449delgaggg deletion in exon 3 of efnb1 was demonstrated in this patient . to assess the effect of this novel mutation at the transcript level , the expression of efnb1 mrna was studied by quantitative rt - pcr . to our knowledge , this is the first time that an efnb1 transcript carrying a truncating mutation in exon 3 is demonstrated to undergo degradation by nonsense - mediated mrna decay . \n our results expand the mutational spectrum of cfns and add to the functional consequences of truncating efnb1 mutations .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: lymphangioleiomyomatosis ( lam ) combined with tuberous sclerosis complex ( tsc ) is very rare . \n fat free diet , total parenteral feeding and/or progesteron therapy are possible conservative treatment options . \n pleurodesis or ligature of the thoracic duct must be performed by thoracotomy or video - assisted thoracoscopy ( vats ) . \n authors report a successful vats treatment of pleural effusion in a patient with lam combined with tsc . \n a 56-year - old non - smoker female patient was admitted with an 8-week - history of recurrent chylothorax , dyspnea and debilitating weakness . \n there were no valuable cell elements found during cytology ; the diagnosis of chylothorax was devised . since age 5 she had documented tsc with alterations of her limbs , liver , kidney and some minor degree of mental retardation . at age 26 \n she underwent a left nephrectomy ; the histological features - renal angioleiomyomatosis - confirmed the diagnosis of tsc . \n the only physical findings were the absence of breath sounds and dullness during percussion on the right chest . \n the ct - scan showed thin - walled cysts through both lungs surrounded by normal lung parenchyma [ figure 1 ] . \n most cysts were round in shape , measured from 3 to 22 mm in diameter . \n there was an alteration -30 mm in largest diameter- , seamed to grasp to the wall of the thoracic duct [ figure 2 ] . \n we thought this was the reason for the chylothorax , so chose diagnostic vats in first sit . \n thin - walled cysts through both lungs surrended by normal lung parenchyma on ct scan the near 30 mm diameter laesion in the site of the thoracic duct on ct scan general anaesthesia with selective ventilation was performed in a left lateral position . during vats \n after that the thoracic duct was checked , there was no leakage found , but 10 cm above the diaphragm there was a flat alteration on the chest wall , which captured the wall of the thoracic duct too . \n intraoperatively butter was given through a nasogastric tube and after 20 minutes chylus appeared near the place of the flat alteration on the thoracic duct . \n this was supposed to be the reason of the lymphatic leakage , so resection of this alteration and ligature of the thoracic duct was decided [ figure 3 ] . \n after the resection ligation of the duct was performed with stitches made with intra - corporal knotting technique . the leakage stopped . \n ligation of the duct with stitches with intra - corporal knotting technique after the resection of the laesion the chest tube was removed and the patient was discharged home 10 days later . \n the final histology showed hmb45 and cd31 positivity , which squares with the diagnosis of lam [ figure 4 ] . \n final histology showed hmb45 and cd31 positivity after one year she was free of complaints and chest x - ray showed normal conditions . \n lymphanigioleiomyomatosis ( lam ) is generally described as a rare disease affecting exclusively women of childbearing age . \n it is characterized by pulmonary cysts ( 100% of the patients ) at computer tomography and proliferation of abdominal smooth muscle cells at lung biopsy . \n the most frequent extrapulmonary features are renal angiomyolipomas , abdominal lesions , usually manifest or asymptomatic , small , bilateral tumors of fat attenuation in the renal cortex . \n lam occurs either in sporadic form , or in association with tuberous sclerosis complex ( tsc ) . both in lam and tsc proliferation of muscle cells of immature appearence in the pulmonary lymphatics \n chylothorax is an uncommon but vexing clinical disorder , and may be a life - threatening condition if left untreated.[35 ] tsc is an autosomal dominant disorder characterized classically by the triad of mental retardation , epilepsy and adenoma sebaceum . \n conservative management is usually recommended in first line and consists of total parenteral nutrition or low fat , medium - chain triglyceride supplemented regimens for several weeks . \n there are several surgical procedures for the treatment of chylothorax like pleurodesis , pleurectomy , right supradiaphragmatic thoracic dust ligation and pleuro - peritoneal shunting . \n it has been recognized that surgical intervention to ligate the thoracic duct should be performed before complications of chylothorax have manifested . \n thoracic duct ligation performed by a minimal invasive approach has not gained wide acceptance yet , though most authors report excellent results of performing surgical procedures by vats technique . \n in conclusion the case of a 56 year - old female patients with chylothorax associated with pulmonary lymphan - gioleiomyomatosis and tuberous sclerosis complex was presented .", "role": "user" }, { "content": "lymphangioleiomyomatosis with tuberous sclerosis complex is a rare disease . \n one of the most frequent complications of lymphangioleiomyomatosis is pleural effusion ( chylothorax ) wich can be treated with the use of vats . \n authors report a case of pulmonary lymphangioleiomyomatosis in a 56-year - old female patient with tuberous sclerosis complex with an 8-week history of recurrent chylothorax , dyspnea and debilitating weakness . by ct scan a flat tissue proliferation was seen in the site of the thoracic duct and it was supposed to be the reason for the pleural effusion . \n a vats resection of this laesion and ligation of the thoracic duct was performed successfully . \n chylothorax is often associated with pulmonary lymphangioleiomyomatosis . \n lymphangioleiomyomatosis combined with tuberous sclerosis complex is extremely rare . in case of chylothorax vats treatment \n is successful and may be the first choice .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the combination of external beam radiotherapy ( ebrt ) , chemotherapy and brachytherapy ( bt ) is the standard treatment of locally advanced cervical cancer . \n image - guided adaptive brachytherapy ( igabt ) has been widely adopted during the last years [ 1 , 2 ] and guidelines have been published for treatment planning and dose reporting [ 3 , 4 ] . the main advantage is dose - volume optimization , allowing adjustments to the classical pear - shaped isodose patterns according to tumor regression during treatment and residual disease at the time of bt . \n literature shows that combined ebrt and bt ( especially igabt ) is curative for many patients with especially high local control rates [ 57 ] . \n however , regional recurrences do occur in the pelvic lymph nodes ( plnn ) within and adjacent to radiotherapy fields . \n most regional recurrences include a component of marginal failure , suggesting a deficit in target volume coverage and dose delivered to suspicious nodes . from earlier publications we know that brachytherapy contributes to the pelvic nodal dose [ 10 , 11 ] , but so far there is no data reported for mri guided igabt . \n the purpose of this study was to determine the dose contributions from image guided adaptive brachytherapy ( igabt ) to individual suspicious plnn in cervical cancer patients . \n data was collected in two cancer centers , university of pittsburgh cancer institute ( upci ) and university medical center utrecht ( umcu ) . \n we performed a combined analysis of igabt data in two institutes ; university of pittsburgh cancer institute ( upci , usa ) and university medical center utrecht ( umcu , the netherlands ) . \n twenty - seven patients with international federation of gynecology and obstetrics ( figo ) stage ib to iiib cervical cancer and enlarged plnn were treated between january 2007 and december 2010 with igabt high dose rate ( hdr ) applications . \n the patients received ebrt to the pelvis or combined pelvic and para - aortic region to 45 gy in 25 fractions . \n the dose to suspicious plnn was delivered with simultaneous integrated boosts ( 55 gy in 25 fractions ) . \n brachytherapy was scheduled once a week during the fourth or fifth week of treatment , and twice a week after completion of the ebrt . \n computed tomography ( ct)/magnetic resonance imaging ( mri ) compatible tandem - ring applicators ( nucletron , an elekta company , elekta ab , stockholm , sweden ) were used with mri - based planning for the first bt fraction followed by ct - based planning for subsequent treatments [ 6 , 12 ] . \n the tandem length ranged from 40 to 60 mm , the ring- tandem angle was 45 to 60 , and ring diameter was 26 - 34 mm . \n all patients were treated with 5 hdr fractions of 5.0 - 6.0 gy per fraction ( reference dose ) depending on the stage of disease and response to treatment . \n planning aim was to cover 90% of the hr - ctv volume with the reference dose . \n treatment planning optimization was performed using a combination of graphical and manual tools . for every patient , body mass index ( bmi ) \n fifteen patients with figo stage ibi to iva cervical cancer and enlarged plnn were treated between may 2009 and september 2011 . \n treatment consisted of ebrt to the clinical target volume as described by van de bunt et al . combined with 3d image - guided intracavitary or combined intracavitary / interstitial pulsed dose rate ( pdr ) bt applications . \n brachytherapy consisted of two pdr applications of 32 pulses of 0.6 gy ( 2 19.2 gy planning aim ) with the first insertion after 22 ebrt fractions , and the second one after completion of ebrt . \n brachytherapy was performed using the utrecht interstitial applicator , a ct / mr compatible tandem - ovoid applicator that allows additional interstitial needle placement ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . \n for the first bt fraction , only the intracavitary part of the applicator was used . in six of the fifteen patients , \n the dose to 90% of the hr - ctv ( d90 hr - ctv ) of the first application did not meet the planning aim . in this group \n the number of needles and their position and depth of insertion were based on dosimetric and spatial shortcomings of the first application . \n after bt , all patients received an additional 3d - conformal ebrt boost of 10 to 14 gy in 5 to 7 fractions to suspicious plnn , taking into account the dose contribution of bt . \n also for these patients , bmi was calculated . at upci , all 27 patients had mri examination ( ge signa hd excite 1.5 t , ge health care , milwaukee , wi , usa ) \n ; t2-weighted sequences with 3.5 mm slice thickness for the first bt fraction . for the following four fractions , \n a ct examination was performed ( ge lightspeed ultra-64 slice per rotation , ge health care , milwaukee , wi , usa ) with 2.5 mm slice thickness . \n ct images were acquired without intravenous contrast , but with 60 ml diluted contrast injected into the bladder . \n hr - ctv and organs at risk ( oar ) were contoured on an eclipse workstation for each fraction , according to the gec estro recommendations [ 3 , 4 ] . \n thereafter , they were transferred to the nucletron plato brachytherapy planning system ( version 14.3 , nucletron , an elekta company , elekta ab , stockholm , sweden ) for three - dimensional planning . at umcu , \n all fifteen patients had mri examination for each application ( gyroscan nt intera 1.5 t , philips medical systems , best , the netherlands ) based on the institutional protocol , which includes t2-weighted turbo spin - echo images with 3 or 4.5 mm slice thickness , and a balanced steady - state free precession scan with a slice thickness of 1.5 mm for applicator reconstruction purposes . \n hr - ctv and oar were contoured in volumetool according to gec estro recommendations [ 3 , 4 ] . \n contours were transferred into the plato brachytherapy planning system , and applicator reconstruction and treatment planning was performed . \n pre - treatment mri or pet - ct information was used to guide identification of residual plnn on bt scans . in case of complete response of the enlarged plnn , \n pelvic lymph nodes contours were generated by a specifically trained resident and verified by a radiation oncologist experienced in gynecological tumors in upci and umcu , respectively . \n the dose contributions ( d90 ) to each individual plnn were calculated from dose - volume histograms ( dvh ) for each fraction ; both as absolute physical dose and as percentage of the reference dose . \n the doses were expressed as biologically equivalent dose in 2 gy fractions ( eqd2 ) using lq - model ( with / = 10 for tumor , / = 3 for oar and half time of repair of 1.5 hours ) and were added for all fractions . \n furthermore , the d90 for the hr - ctvs were determined in eqd2 . in order to get an estimate of the influence of radiobiology \n , the pdr data were recalculated as if given by hdr in 4 fractions of 7 gy and scaled for oar constraints ( clinically used hdr schedule in our institute ) . for every patient \n total reference air kerma divided by the reference dose was considered as an indicator of the volume encompassed by the 100% isodose . \n the contoured plnn were grouped by three physicians into anatomical nodal regions , based on radiation therapy oncology group ( rtog ) definitions of pelvic nodal groups for intensity - modulated radiation therapy ( imrt ) and other published literature [ 1820 ] . \n the common iliac region ( ci ) covers the area around the common iliac vessels from the aortic to iliac bifurcation . \n the internal iliac region ( ii ) is defined as an area of 7 mm around and along the internal iliac vessels , excluding plnn ventrally to external iliac vessels . from the point where the internal and external iliac vessels spread to a distance of more than 7 mm , \n the space around and along external iliac artery is called external iliac region ( ei ) . the obturator region \n twenty - seven patients with international federation of gynecology and obstetrics ( figo ) stage ib to iiib cervical cancer and enlarged plnn were treated between january 2007 and december 2010 with igabt high dose rate ( hdr ) applications . \n the patients received ebrt to the pelvis or combined pelvic and para - aortic region to 45 gy in 25 fractions . \n the dose to suspicious plnn was delivered with simultaneous integrated boosts ( 55 gy in 25 fractions ) . \n brachytherapy was scheduled once a week during the fourth or fifth week of treatment , and twice a week after completion of the ebrt . \n computed tomography ( ct)/magnetic resonance imaging ( mri ) compatible tandem - ring applicators ( nucletron , an elekta company , elekta ab , stockholm , sweden ) were used with mri - based planning for the first bt fraction followed by ct - based planning for subsequent treatments [ 6 , 12 ] . \n the tandem length ranged from 40 to 60 mm , the ring- tandem angle was 45 to 60 , and ring diameter was 26 - 34 mm . \n all patients were treated with 5 hdr fractions of 5.0 - 6.0 gy per fraction ( reference dose ) depending on the stage of disease and response to treatment . \n planning aim was to cover 90% of the hr - ctv volume with the reference dose . \n treatment planning optimization was performed using a combination of graphical and manual tools . for every patient , body mass index ( bmi ) \n fifteen patients with figo stage ibi to iva cervical cancer and enlarged plnn were treated between may 2009 and september 2011 . \n treatment consisted of ebrt to the clinical target volume as described by van de bunt et al . \n combined with 3d image - guided intracavitary or combined intracavitary / interstitial pulsed dose rate ( pdr ) bt applications . \n brachytherapy consisted of two pdr applications of 32 pulses of 0.6 gy ( 2 19.2 gy planning aim ) with the first insertion after 22 ebrt fractions , and the second one after completion of ebrt . \n brachytherapy was performed using the utrecht interstitial applicator , a ct / mr compatible tandem - ovoid applicator that allows additional interstitial needle placement ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . \n for the first bt fraction , only the intracavitary part of the applicator was used . in six of the fifteen patients , the dose to 90% of the hr - ctv ( d90 hr - ctv ) of the first application \n the number of needles and their position and depth of insertion were based on dosimetric and spatial shortcomings of the first application . \n after bt , all patients received an additional 3d - conformal ebrt boost of 10 to 14 gy in 5 to 7 fractions to suspicious plnn , taking into account the dose contribution of bt . \n twenty - seven patients with international federation of gynecology and obstetrics ( figo ) stage ib to iiib cervical cancer and enlarged plnn were treated between january 2007 and december 2010 with igabt high dose rate ( hdr ) applications . \n the patients received ebrt to the pelvis or combined pelvic and para - aortic region to 45 gy in 25 fractions . \n the dose to suspicious plnn was delivered with simultaneous integrated boosts ( 55 gy in 25 fractions ) . \n brachytherapy was scheduled once a week during the fourth or fifth week of treatment , and twice a week after completion of the ebrt . \n computed tomography ( ct)/magnetic resonance imaging ( mri ) compatible tandem - ring applicators ( nucletron , an elekta company , elekta ab , stockholm , sweden ) were used with mri - based planning for the first bt fraction followed by ct - based planning for subsequent treatments [ 6 , 12 ] . \n the tandem length ranged from 40 to 60 mm , the ring- tandem angle was 45 to 60 , and ring diameter was 26 - 34 mm . \n all patients were treated with 5 hdr fractions of 5.0 - 6.0 gy per fraction ( reference dose ) depending on the stage of disease and response to treatment . \n planning aim was to cover 90% of the hr - ctv volume with the reference dose . \n treatment planning optimization was performed using a combination of graphical and manual tools . for every patient , body mass index ( bmi ) \n fifteen patients with figo stage ibi to iva cervical cancer and enlarged plnn were treated between may 2009 and september 2011 . \n treatment consisted of ebrt to the clinical target volume as described by van de bunt et al . \n combined with 3d image - guided intracavitary or combined intracavitary / interstitial pulsed dose rate ( pdr ) bt applications . \n brachytherapy consisted of two pdr applications of 32 pulses of 0.6 gy ( 2 19.2 gy planning aim ) with the first insertion after 22 ebrt fractions , and the second one after completion of ebrt . \n brachytherapy was performed using the utrecht interstitial applicator , a ct / mr compatible tandem - ovoid applicator that allows additional interstitial needle placement ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . \n for the first bt fraction , only the intracavitary part of the applicator was used . in six of the fifteen patients , the dose to 90% of the hr - ctv ( d90 hr - ctv ) of the first application \n the number of needles and their position and depth of insertion were based on dosimetric and spatial shortcomings of the first application . \n after bt , all patients received an additional 3d - conformal ebrt boost of 10 to 14 gy in 5 to 7 fractions to suspicious plnn , taking into account the dose contribution of bt . also for these patients , bmi was calculated . \n at upci , all 27 patients had mri examination ( ge signa hd excite 1.5 t , ge health care , milwaukee , wi , usa ) ; t2-weighted sequences with 3.5 mm slice thickness for the first bt fraction . for the following four fractions , \n a ct examination was performed ( ge lightspeed ultra-64 slice per rotation , ge health care , milwaukee , wi , usa ) with 2.5 mm slice thickness . \n ct images were acquired without intravenous contrast , but with 60 ml diluted contrast injected into the bladder . \n hr - ctv and organs at risk ( oar ) were contoured on an eclipse workstation for each fraction , according to the gec estro recommendations [ 3 , 4 ] . \n thereafter , they were transferred to the nucletron plato brachytherapy planning system ( version 14.3 , nucletron , an elekta company , elekta ab , stockholm , sweden ) for three - dimensional planning . at umcu , \n all fifteen patients had mri examination for each application ( gyroscan nt intera 1.5 t , philips medical systems , best , the netherlands ) based on the institutional protocol , which includes t2-weighted turbo spin - echo images with 3 or 4.5 mm slice thickness , and a balanced steady - state free precession scan with a slice thickness of 1.5 mm for applicator reconstruction purposes . \n hr - ctv and oar were contoured in volumetool according to gec estro recommendations [ 3 , 4 ] . \n contours were transferred into the plato brachytherapy planning system , and applicator reconstruction and treatment planning was performed . \n pre - treatment mri or pet - ct information was used to guide identification of residual plnn on bt scans . in case of complete response of the enlarged plnn , \n pelvic lymph nodes contours were generated by a specifically trained resident and verified by a radiation oncologist experienced in gynecological tumors in upci and umcu , respectively . \n the dose contributions ( d90 ) to each individual plnn were calculated from dose - volume histograms ( dvh ) for each fraction ; both as absolute physical dose and as percentage of the reference dose . \n the doses were expressed as biologically equivalent dose in 2 gy fractions ( eqd2 ) using lq - model ( with / = 10 for tumor , / = 3 for oar and half time of repair of 1.5 hours ) and were added for all fractions . \n furthermore , the d90 for the hr - ctvs were determined in eqd2 . in order to get an estimate of the influence of radiobiology \n , the pdr data were recalculated as if given by hdr in 4 fractions of 7 gy and scaled for oar constraints ( clinically used hdr schedule in our institute ) . for every patient \n total reference air kerma divided by the reference dose was considered as an indicator of the volume encompassed by the 100% isodose . \n the contoured plnn were grouped by three physicians into anatomical nodal regions , based on radiation therapy oncology group ( rtog ) definitions of pelvic nodal groups for intensity - modulated radiation therapy ( imrt ) and other published literature [ 1820 ] . \n the common iliac region ( ci ) covers the area around the common iliac vessels from the aortic to iliac bifurcation . the internal iliac region ( ii ) \n is defined as an area of 7 mm around and along the internal iliac vessels , excluding plnn ventrally to external iliac vessels . from the point where the internal and external iliac vessels spread to a distance of more than 7 mm , \n the space around and along external iliac artery is called external iliac region ( ei ) . \n the obturator region ( ob ) encompasses the space bordered by internal and external iliac regions . \n at upci , all 27 patients had mri examination ( ge signa hd excite 1.5 t , ge health care , milwaukee , wi , usa ) ; t2-weighted sequences with 3.5 mm slice thickness for the first bt fraction . for the following four fractions , \n a ct examination was performed ( ge lightspeed ultra-64 slice per rotation , ge health care , milwaukee , wi , usa ) with 2.5 mm slice thickness . \n ct images were acquired without intravenous contrast , but with 60 ml diluted contrast injected into the bladder . \n hr - ctv and organs at risk ( oar ) were contoured on an eclipse workstation for each fraction , according to the gec estro recommendations [ 3 , 4 ] . \n thereafter , they were transferred to the nucletron plato brachytherapy planning system ( version 14.3 , nucletron , an elekta company , elekta ab , stockholm , sweden ) for three - dimensional planning . \n at umcu , all fifteen patients had mri examination for each application ( gyroscan nt intera 1.5 t , philips medical systems , best , the netherlands ) based on the institutional protocol , which includes t2-weighted turbo spin - echo images with 3 or 4.5 mm slice thickness , and a balanced steady - state free precession scan with a slice thickness of 1.5 mm for applicator reconstruction purposes . \n hr - ctv and oar were contoured in volumetool according to gec estro recommendations [ 3 , 4 ] . \n contours were transferred into the plato brachytherapy planning system , and applicator reconstruction and treatment planning was performed . \n pre - treatment mri or pet - ct information was used to guide identification of residual plnn on bt scans . in case of complete response of the enlarged plnn , \n pelvic lymph nodes contours were generated by a specifically trained resident and verified by a radiation oncologist experienced in gynecological tumors in upci and umcu , respectively . \n the dose contributions ( d90 ) to each individual plnn were calculated from dose - volume histograms ( dvh ) for each fraction ; both as absolute physical dose and as percentage of the reference dose . \n the doses were expressed as biologically equivalent dose in 2 gy fractions ( eqd2 ) using lq - model ( with / = 10 for tumor , / = 3 for oar and half time of repair of 1.5 hours ) and were added for all fractions . \n furthermore , the d90 for the hr - ctvs were determined in eqd2 . in order to get an estimate of the influence of radiobiology \n , the pdr data were recalculated as if given by hdr in 4 fractions of 7 gy and scaled for oar constraints ( clinically used hdr schedule in our institute ) . for every patient \n total reference air kerma divided by the reference dose was considered as an indicator of the volume encompassed by the 100% isodose . \n the contoured plnn were grouped by three physicians into anatomical nodal regions , based on radiation therapy oncology group ( rtog ) definitions of pelvic nodal groups for intensity - modulated radiation therapy ( imrt ) and other published literature [ 1820 ] . \n the common iliac region ( ci ) covers the area around the common iliac vessels from the aortic to iliac bifurcation . \n the internal iliac region ( ii ) is defined as an area of 7 mm around and along the internal iliac vessels , excluding plnn ventrally to external iliac vessels . from the point where the internal and external iliac vessels spread to a distance of more than 7 mm , \n the space around and along external iliac artery is called external iliac region ( ei ) . \n the obturator region ( ob ) encompasses the space bordered by internal and external iliac regions . \n fifty - seven plnn were detected with a minimum of 1 and a maximum of 9 per patient . \n the mean hr - ctv of these patients was 36.9 cm ( range 21.0 - 59.8 cm ) , and the mean bt d90 hr - ctv was 39.3 gy ( range 34.9 - 63.3 gy ) eqd2 . \n the mean d90 received by the suspicious plnn was 10.8% ( range 5.7 - 25.1% ) of the reference dose , corresponding to 2.7 gy ( range 1.3 - 6.6 gy ) eqd2 . \n forty plnn were detected with a minimum of 1 and a maximum of 5 per patient . \n the mean hr - ctv was 39.4 cm ( range 15.9 - 115 cm ) , and the mean bt d90 hr - ctv was 47.1 gy ( range 0.3 - 52.4 gy ) eqd2 . \n the mean d90 of the plnn was 20.5% ( range 6.8 - 93.3% ) resulting in 7.1 gy ( range 2.2 - 36.7 gy ) eqd2 ( table 2 ) . \n figure 1 shows an illustration of the 3d eqd2 distribution of a bt pdr fraction displaying plnn with different locations and different dose contributions . \n illustration of a transversal t2 weighted mr image ( a ) and corresponding 3d dose distribution in eqd2 of a brachytherapy pulsed dose rate fraction presented in three slices : ( b ) transversal , ( c ) coronal and ( d ) sagittal view . \n blue = 0 and red > 20 gy eqd2 , yellow cross indicates common point for all images patient characteristics upci university of pittsburgh cancer institute , umcu university medical center utrecht , bmi body mass index upci \n university of pittsburgh cancer institute , umcu university medical center utrecht , hdr high dose - rate , pdr pulsed dose - rate , plnn pathologically enlarged pelvic lymph - nodes , sd standard deviation , hr - ctv high risk - ctv , d90 dose to 90% of the volume , ref . \n reference dose , eqd2 biologically equivalent dose in 2-gy fractions pdr data were recalculated as if given by hdr in 4 fractions of 7 gy and scaled for oar constraints \n table 3 and figure 2 show the dose contributions of igabt to the different nodal regions . in upci , but not in umcu we saw a tendency that dose decreases from obturator to external , internal and common iliac nodes . \n the dose contributions of igabt to individual plnn varied impressively in both centers ( range 5 to > 90% of the reference dose ) . \n after having excluded the few parametrial , inguinal and peri - rectal nodes from the umcu data set ( leaving 35 plnn for the comparison ; see table 2 ) , the nodes received on average 16.7% ( range 6.8 - 34.7% ) of the reference dose , corresponding to 5.6 gy ( range 2.2 - 12.0 gy ) eqd2 . furthermore , recalculating the umcu pdr into hdr values , resulted in a reduced mean d90 of 3.9 gy ( range 1.5 - 8.2 gy ) eqd2 , and a smaller difference with upci values . \n relative dose contributions of pdr and hdr treatments to individual lymph nodes in the different pelvic regions ; dose variations indicated between and within anatomical regions results for different nodal regions upci university of pittsburgh cancer institute , \n umcu university medical university utrecht , plnn pathologically enlarged pelvic lymph - nodes , d90 dose to 90% of the volume , eqd2 biologically equivalent dose in 2-gy fractions , sd standard deviation \n figure 3 shows the d90 plnn as function of trak per reference dose ( as surrogate of the 100% isodose volume ) . \n this overall results in higher dose contributions to the plnn in umcu , irrespective of pdr or hdr calculations . \n the addition of interstitial needles for the second bt fractions in six of the umcu patients did not influence the d90 plnn systematically ; see wide range of values for those cases in figure 3 . \n dose contributions to individual lymph nodes as function of trak / reference dose ; trak / reference dose is considered an indicator for the volume encompassed by the 100% isodose . \n arrows indicate cases treated with a combined intracavitary / interstitial approach . diamonds upci ( hdr ) . \n the differences between black and grey squares show that the bt dose contribution ( in eqd2 ) to plnn is influenced by dose rate body mass index was 25 ( range 19 - 32 ) in umcu patients and 30 ( range 18 - 41 ) in upci patients , respectively , without a relation between physical d90 dose to the nodes and bmi . \n to our knowledge , this retrospective inter - institutional study represents the first dosimetric analysis of mri based igabt dose - contributions to pelvic lymph nodes in patients with advanced cervical cancer . \n since the introduction of image guided bt , local control in cervical cancer has increased [ 5 , 7 ] , but regional control is still a matter of concern [ 6 , 9 ] . \n additionally , modern imaging modalities allow a better visualization of plnn and help to consider them suspicious or not , which influences our intentions to treat nodal disease . for accurate dose reporting and for our understanding of nodal dose response relations \n it is essential to learn how ebrt and bt contribute to the treatment of individual affected lymph nodes . \n more detailed information on the dose administered per node will also help us to further optimize nodal boosting . \n point b in this system was thought to give an estimate of the dose contribution to the lateral parametrium and the regional nodes . \n it is located at the level of point a , 5 cm lateral from the center of the tandem and gets approximately 15% to 25% of the point a dose . \n . already showed that the point b dose is not a good surrogate for the dose to pelvic nodes . in that study , \n the nodal regions defined on ct scans were overlaid with the bt dose distributions showing significantly lower dose to nodal groups than to point b ( on average 5 vs. 7 gy ) . \n additionally , it was documented that there is some variation in dose delivered to the different nodal groups , defined as internal iliac , external iliac , and obturator nodes . in our study , we investigated the contribution of individualized igabt to the plnn . \n we computed the bt dose to individual nodes located in the different groups by using the images at time of bt and the optimized bt treatment plans . \n we found a variety of dose levels in individual nodes and patients , but no general dose level differences when comparing the earlier defined nodal groups . \n this finding might be due to the fact that the spatial dose distributions of igabt in the central pelvis can be quite asymmetric as they follow the target and oar locations and shapes . \n it can therefore be expected that individualized igabt also individually contributes to different plnn with the highest values to nodes in the vicinity of the hr - ctv and high dose regions . \n based on the data presented here , we consider to calculate the igabt dose for the individual nodes , especially when ebrt boosting is part of the treatment schedule . \n dose calculation for the different nodal regions is a rougher estimate and might still be used if individual node dose calculation is not possible . \n the igabt dose contributions to plnn in upci were on average lower than the ones in umcu . \n part of the difference was caused by the fact that in some umcu patients , different from upci , plnn were identified in the vicinity of the hr - ctv , especially in parametrium and perirectally . \n after excluding these nodes and their corresponding high d90 values , the dose level difference was smaller . \n the umcu pdr contributions to plnn into hdr values , the difference in dose again was smaller , but still remained . \n this lasting difference is due to the fact that the prescribed and administered tumor dose in umcu is in principal higher , irrespective of the underlying radiobiology . \n the on average higher d90 hr - ctv values in umcu are corresponding to higher totally administered doses and larger bt volumes irradiated to the reference dose . \n the igabt dose contribution to individual plnn depends on patient and treatment related factors and varies considerably . \n the difference is caused by the positions of the individual nodes in relation to the radiation source , by differences in radiobiology and by individual treatment planning , and spatial dose delivery to specific hr - ctv and oar locations and shapes . \n based on the data presented here , calculation of the bt dose to the individual plnn for nodal dose reporting and individual node boost planning should be considered . \n dose calculations for the different nodal regions is a rougher estimate and can be used as alternative if individual node dose calculation is not possible . \n ", "role": "user" }, { "content": "purposethe goal of this study was to determine the dose contributions from image guided adaptive brachytherapy ( igabt ) to individual suspicious pelvic lymph nodes ( plnn ) in cervical cancer patients . \n data were collected in two cancer centers , university of pittsburgh cancer institute ( upci ) and university medical center utrecht ( umcu).material and methods27 and 15 patients with node positive cervical cancer treated with hdr ( high dose rate ) or pdr ( pulsed dose rate)-igabt were analyzed . \n hdr - igabt ( upci ) was delivered with ct / mri compatible tandem - ring applicators with 5.0 - 6.0 gy five fractions . \n pdr - igabt ( umcu ) dose was delivered with utrecht tandem - ovoid applicators with 32 0.6 gy two fractions . \n pelvic lymph nodes with short axis diameter of 5 mm on pre - treatment mri or pet - ct were contoured for all bt - plans . \n dose contributions to individual plnn expressed as d90 ( dose to 90% of the volume ) were calculated from dose - volume histograms as absolute and relative physical dose ( % of the reference dose ) for each fraction . for each node , \n the total dose from all fractions was calculated , expressed in eqd2 ( equivalent total dose in 2 gy fractions).resultsfifty - seven ( upci ) and 40 ( umcu ) individual plnn were contoured . \n the mean d90 plnn was 10.8% ( range 5.7 - 25.1% ) and 20.5% ( range 6.8 - 93.3% ) , respectively , and therefore different in the two centers . \n these values translate into 2.7 gy ( 1.3 - 6.6 gy ) eqd2 and 7.1 gy ( 2.2 - 36.7 gy ) eqd2 , respectively . \n differences are caused by the location of the individual nodes in relation to the spatial dose distribution of igabt , differences in total dose administered and radiobiology ( hdr versus pdr).conclusionsthe igabt dose contribution to individual pelvic nodes depends on patient and treatment related factors , and varies considerably .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it may be anticipated that combined functional and anatomical imaging with positron emission tomography ( pet)/computed tomography ( ct ) , single - photon emission computed tomography ( spect)/ct and even pet / magnetic resonance imaging will play a central part in diagnostic imaging of the near future . in 2007 , \n the european society of radiology and the european association of nuclear medicine published a document entitled white paper of the european society of radiology ( esr ) and the european association of nuclear medicine ( eanm ) on multimodality imaging [ 1 , 2 ] . \n this paper sets out the positions and aspirations of esr and eanm to work together on an equal and constructive basis for the future benefit of both specialties on which to build . to provide a database for these efforts , esr and eanm performed a survey among the individual memberships of both societies . \n the aim was to obtain information on the status of multimodality imaging equipment and procedures throughout europe , and to identify any future visions on training for combined modalities amongst respondents . \n the questions posed included : ( 1 ) aspects of current practice procedures and equipment at the individual respondent s facility and ( 2 ) vision on cooperative interdisciplinary training for the future . \n a total of 1,841 replies were received : 1,491 from esr members ( from 38 european countries ) and 350 from eanm members ( from 39 countries ) . \n the respondents by country and age group are reported in tables 1 and 2 , respectively . the reporting ( fig . 1 ) and the billing ( fig . \n the part of ct in a pet / ct examination conducted as a full diagnostic ct with or without intravenous contrast enhancement is presently the practice in a relatively small number of facilities ( fig . \n 3 ) . the majority of respondents of both societies believe that the proportion of pet / ct conducted as a full diagnostic ct examination , employing intravenous contrast enhancement will increase over time ( fig . 4 ) . \n as expected , oncology is the most common indication for pet or pet / ct ( fig . 5 ) , and 18f - fdg is the most used pet tracer for clinical applications ( table 3 ) . \n the large majority of the respondents of both societies were in favour of an interdisciplinary training programme , being developed on a european level together by esr and eanm and the respective sections of the european union of medical specialists ( fig . \n 6 ) . the majority ( 65% ) of esr members in favour of the principle of \n the interdisciplinary training programme indicated incorporated training in nuclear medicine and radiology as their preferred option ( fig . \n the remaining 35% favoured an adjusted period of training in the other specialty in addition to full training in the primary specialty . among the eanm members in favour of an interdisciplinary training programme \n , 50% indicated as preferred option an adjusted period of training , and 50% an incorporated training in nuclear medicine and radiology taking the form of a cross - over or integrated training programme ( fig . \n table 1respondents by country.esreanmcountrynumbercountrynumberitaly219france40germany179italy32spain158the netherlands26united kingdom89germany24france74turkey21the netherlands64belgium16austria57spain13belgium52united kingdom12poland51greece11greece50portugal9others498others146total1,491total350table 2respondents by age group.age group ( years)esr ( n = 1,491)eanm ( n = 350)21308%3%314030%23%415032%38%516023%24%61 + 7%12%fig \n . 1answers to question 1 of the survey , in your facility , pet / ct results are reported by \n 2answers to question 2 of the survey , in your facility , pet / ct results are billed by \n 3answers to question 3 of the survey , how often is the ct part of pet / ct conducted as a full diagnostic ct+/ contrast enhancement in your facility?fig . \n 4answers to question 4 of the survey , do you think that the proportion of diagnostic ct+/ contrast enhancement will ?fig . \n does your facility undertake pet or pet / ct in the following indications?table 3answers to question 6 of the survey : radiopharmaceuticals in clinical use in european countries.esreanmf-fluoro-2-deoxy-d-glucose ( fdg)73%99%f - dopa10%29%f - fluorocholine10%23%f - fluoroethyl - l - tyrosine ( fet)5%12%f - fluorothymidine ( flt)4%14%other f4%12%any c2%14%rubidium-821%6%15o - water1%11%others7%13%fig . \n 6answers to question 6 of the survey , which of the following radiopharmaceuticals are in clinical use in your country?fig . \n 7answers to question 7 of the survey , would you be in favour of an interdisciplinary training programme being developed on a european level together by esr and eanm and the respective uems sections ? \n answers to question 1 of the survey , in your facility , pet / ct results are reported by \n answers to question 2 of the survey , in your facility , pet / ct results are billed by \n answers to question 3 of the survey , how often is the ct part of pet / ct conducted as a full diagnostic ct+/ contrast enhancement in your facility ? answers to question 4 of the survey , \n do you think that the proportion of diagnostic ct+/ contrast enhancement will ? answers to question 5 of the survey , \n does your facility undertake pet or pet / ct in the following indications ? answers to question 6 of the survey : radiopharmaceuticals in clinical use in european countries . \n answers to question 6 of the survey , which of the following radiopharmaceuticals are in clinical use in your country ? \n answers to question 7 of the survey , would you be in favour of an interdisciplinary training programme being developed on a european level together by esr and eanm and the respective uems sections ? \n the main purpose of this survey was to collect information on the practice of multimodality imaging in europe among the individual memberships of esr and eanm . \n it sought to address regulatory and supervisory issues , the training requirements applicable and the comparative roles of radiologists and nuclear medicine physicians in the various jurisdictions surveyed . \n the general limitations of a pan - european questionnaire must be taken into account when interpreting the results . \n this is particularly so when respondents are chosen from two independent and fully functioning disciplines as is the case in this effort . amongst other factors the questionnaire value is dependent upon question validity and lack of ambivalence , and on the care used and bias of respondents . \n a certain amount of the reported data may thus not be representative , but alternative methods of gathering information in such a context are difficult , laborious and not practicable . \n the majority of the members of esr and eanm believe that the proportion of pet / ct conducted as a full diagnostic ct with contrast enhancement will increase in the future . substantive training in both radiology and nuclear medicine is a prerequisite for high - quality examination interpretation with hybrid systems . \n structures will differ between countries relating to differences in infrastructure and legislation [ 1 , 2 ] . \n in addition to being structured and comprehensive , training should be conducted in accredited training centres . \n it should incorporate the principles and major modalities of both specialties to allow the trainee to learn the appropriate place of pet - spect / ct in the overall investigative algorithm . \n the overall findings of this survey show that there is a wide heterogeneity in the use and practice of multimodality imaging in europe . \n this situation may well limit the application of the technique with its full clinical potential . \n as clearly indicated by the results of the present survey , the large majority of respondents of both societies were in favour of an interdisciplinary training programme , being developed on a european level together by esr and eanm and the respective sections of the european union of medical specialists . \n survey questions \n in your facility , pet / ct results are reported by \n pet by a nuclear medicine specialist , ct by a radiologista nuclear medicine physiciana radiologista dual specialistotherin your facility , pet / ct results are billed by \n pet by a nuclear medicine physician , ct by a radiologista nuclear medicine physiciana radiologista dual specialistotherhow often is the ct part of pet / ct conducted as a full diagnostic ct+/ contrast enhancement in your facility ? \n never<20%2040%4060%6080%>80%do you think that the proportion of diagnostic ct+/ contrast enhancement will \n increaseremain the samedecreasedoes your facility undertake pet or pet / ct in the following indications ? \n oncologycardiologyneurologyinfection / inflammationotherswhich of the following radiopharmaceuticals are in clinical use in your country ? \n 18f - fdg18f - dopa18f - fluorocholine18f - fet18f - fltother 18fany 11crubidium-8215o - waterotherswould you be in favour of an interdisciplinary training programme being developed on a european level together by esr and eanm and the respective uems sections ? \n yes \n adjusted period of training in the other speciality in addition to full training in the primary specialityintegrated training programme : an incorporated training in nuclear medicine and radiology taking the form of a cross - over or integrated training programmeno in your facility , pet / ct results are reported by \n pet by a nuclear medicine specialist , ct by a radiologista nuclear medicine physiciana radiologista dual specialistother pet by a nuclear medicine specialist , ct by a radiologist a nuclear medicine physician in your facility , pet / ct results are billed by \n pet by a nuclear medicine physician , ct by a radiologista nuclear medicine physiciana radiologista dual specialistother pet by a nuclear medicine physician , ct by a radiologist a nuclear medicine physician how often is the ct part of pet / ct conducted as a full diagnostic ct+/ contrast enhancement in your facility ? \n never<20%2040%4060%6080%>80% do you think that the proportion of diagnostic ct+/ contrast enhancement will \n increaseremain the samedecrease does your facility undertake pet or pet / ct in the following indications ? \n oncologycardiologyneurologyinfection / inflammationothers infection / inflammation which of the following radiopharmaceuticals are in clinical use in your country ? \n 11crubidium-8215o - waterothers would you be in favour of an interdisciplinary training programme being developed on a european level together by esr and eanm and the respective uems sections ? \n yes \n adjusted period of training in the other speciality in addition to full training in the primary specialityintegrated training programme : an incorporated training in nuclear medicine and radiology taking the form of a cross - over or integrated training programmeno yes \n adjusted period of training in the other speciality in addition to full training in the primary specialityintegrated training programme : an incorporated training in nuclear medicine and radiology taking the form of a cross - over or integrated training programme adjusted period of training in the other speciality in addition to full training in the primary speciality integrated training programme : an incorporated training in nuclear medicine and radiology taking the form of a cross - over or integrated training programme", "role": "user" }, { "content": "purposemultimodality imaging represents an area of rapid growth with important professional implications for both radiologists and nuclear medicine physicians throughout europe . as a preliminary step for future action aimed at improving the quality and accessibility of pet - spect / ct multimodality imaging practice in europe , the european society of radiology ( esr ) and the european association of nuclear medicine ( eanm ) performed a survey among the individual memberships of both societies to obtain information on the status of multimodality imaging in their facilities and their future visions on training for combined modalities.methodsa questionnaire was forwarded to all individual members of esr and eanm . \n the main subject matter of the questionnaire related to : ( 1 ) study performance , current procedures and current equipment , including its supervisory personnel at respondents individual facilities , and ( 2 ) vision of future practice , performance and the potential for combined interdisciplinary viewing and training for future professionals.resultsthe reporting and the billing procedures of multimodality imaging studies are very heterogeneous in european countries . \n the majority of the members of both societies believe that the proportion of pet / ct conducted as a full diagnostic ct with contrast enhancement will increase over time . \n as expected , 18f - fdg is the most used pet tracer for clinical applications . \n the large majority of respondents were in favour of an interdisciplinary training programme , being developed on a european level together by esr and eanm and the respective sections of the european union of medical specialists.conclusionthe results of this survey show that there is wide heterogeneity in the current practice of multimodality imaging in europe . \n this situation may limit the full potential and integration of multimodality imaging within the clinical arena . \n there is a strong desire within both specialties for the development of interdisciplinary training to address some of these issues .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the benefits of ultrasound - guided hysteroscopic metroplasty have been well described in the management of the partial septate uterus . \n the use of ultrasonography at the time of hysteroscopy provides visualization of the intrauterine instruments within the uterine cavity . \n this report describes a case where ultrasound - guidance was used to enter a noncommunicating uterine cavity hysteroscopically . \n the patient underwent a laparoscopy and hysteroscopy to further evaluate the cause of pelvic pain and to treat the mllerian anomaly . under ultrasound - guidance \n \n this unique application of ultrasound - guidance in hysteroscopic surgery may aid the surgeon in entering a noncommunicating uterine cavity . \n mllerian anomalies occur in approximately 1 in 400 women and have been associated with reproductive failure and pelvic pain from endometriosis and hematometra . noncommunicating \n uterine cavities pose a challenge to the surgeon performing a hysteroscopic metroplasty because the position of the hysteroscope in relation to the cervix and ipsilateral uterine cavity is not known . \n ultrasound - guidance may aid the surgeon in the treatment of this specific type of anomaly . \n this report was completed after approval by the institutional review board . a 22-year - old g3 p0030 female with a history of 3 consecutive pregnancy losses presented with secondary dysmenorrhea . \n the past surgical history was significant for a laparoscopy performed by the patient 's local physician after a mllerian anomaly was suspected at the time of a miscarriage . \n hysteroscopy performed at the same surgery revealed 2 uterine cavities with 2 tubal ostia separated by a septum . \n the septal thickness varied from 5.8 mm near the internal cervical os to 8.6 mm at the fundus ( figure 1 ) . \n a speculum was placed in the vagina , and the 2 cervical ostia were visualized . \n a uterine manipulator ( kronner medical manufacturing , cooper surgical , shelton , ct ) was placed in the left uterine canal and indigo carmine was instilled . \n the right cervix was dilated to admit a 22 f operative hysteroscope ( karl storz , endoscopy america inc , culver city , ca ) through which the right uterine cavity was visualized and the right tubal ostia identified . under transabdominal ultrasound - guidance ( atl hdi 5000 ultrasound system , bothell , wa ) , \n the wall between the 2 uterine cavities was incised at its narrowest point above the internal cervical os with a resectoscope until indigo carmine overflowed into the right - sided cavity ( figure 2 ) . \n a concomitant laparoscopy revealed a heart - shaped uterus , normal tubes , and ovaries . \n minimal endometriosis was identified on the right uterosacral ligament and left ovary , which was treated with a laser . \n a balloon uterine stent ( cook ob / gyn , spencer , in ) was placed inside the uterus , instilled with 2.5 cc of saline , and left in place for 1 week . \n the image was taken immediately after the ipsilateral uterine cavity was entered in the lower uterine segment . \n the uterus and cervix are derived embryologically from paired mllerian ducts that fuse medially to form the uterine isthmus and cervix . \n the fundal portion of the uterus is created by rapid proliferation of cells from the medial walls of the ducts into a septum followed by resorption . \n anomalies of the uterus result from abnormal fusion of the mllerian ducts or from failure of absorption of the septum . \n this patient 's anomaly consisted of an externally divided fundus , a well - formed septum , and cervical duplication . \n thompson et al noted at the time of surgery that in 5 out of 12 cases of double uteri , the uteri divided externally with a well - formed septum internally . \n thompson et al did not report the incidence of cervical duplication in this series ; however , several case reports have described cervical duplication with or without a uterine or vaginal septum . although patients with double uteri may have normal reproductive outcomes , studies have demonstrated improved outcomes after correction when a history of pregnancy complications exists . \n since ruge reported a successful pregnancy after removal of a septum in 1884 , many procedures have been described for the treatment of mllerian anomalies . \n alternative methods to resect the septum have been described by strassmann , tompkins , and jones with numerous modifications . \n the surgical management of m00fc;llerian anomalies has evolved since the first descriptions , being modified due to evolving techniques . \n the choice of technique is influenced by vascularity of the incision , trauma to remaining myometrium , and soundness of the uterine scar . \n the benefits of ultrasound - guided hysteroscopic metroplasty have been well described for a partially sep - tate uterus . \n the use of ultrasonography at the time of intrauterine surgery provides visualization of the intrauterine instruments as well as the myometrium and septum . in this case , \n the area initially incised was the narrowest width above the internal os of the cervix . \n the internal cervical os was identified sonographically at the angle of the cervix with the uterine body . \n although a small series did not find a high risk of cervical incompetence with resection of the cervical septum , the theoretical risk of cervical incompetence remains . \n in addition , in this patient , unification of the cervices would have been technically difficult due to the wide separation of the ostia . alternatively \n , this procedure could be performed blindly with the guidance of a uterine sound or cervical dilator ; however , the direction of the resection and relationship to the cervix is less obvious than with ultrasound . in summary \n , the use of ultra - sound may aid the surgeon in entering a noncommunicating uterine horn during a hysteroscopic metroplasty .", "role": "user" }, { "content": "background : the benefits of ultrasound - guided hysteroscopic metroplasty have been well described in the management of the partial septate uterus . the use of ultrasonography at the time of hysteroscopy provides visualization of the intrauterine instruments within the uterine cavity . \n this report describes a case where ultrasound - guidance was used to enter a noncommunicating uterine cavity hysteroscopically.methods:a 22-year - old female after her third miscarriage experienced worsening dysmenorrhea . \n the patient underwent a laparoscopy and hysteroscopy to further evaluate the cause of pelvic pain and to treat the mllerian anomaly . under ultrasound - guidance \n , the 2 uterine cavities were unified by hysteroscopic metroplasty.results:postoperative sonohysterography demonstrated unification of the 2 cavities.conclusions:this unique application of ultrasound - guidance in hysteroscopic surgery may aid the surgeon in entering a noncommunicating uterine cavity .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the resonance of voice is determined by two factors : voice source and vocal tract . \n the supraglottic larynx , tongue , lips , palate , pharynx , nasal cavity , and possibly the sinuses , act as resonators . \n any alterations in the configuration of these structures may produce substantial changes in voice resonance.1 \n one of the most important factors of speech quality is nasal resonance . \n vocal amplification in the oral and nasal cavities is responsible for resonance and is classified into hypernasality , hyponasality , and mixed resonance . \n hyponasal speech may be present in patients with nasal obstruction such as choanal atresia , nasal polyps , and septal deviation , since narrow nasal airways and hypernasal speech usually exist in patients with a cleft palate and velopharyngeal incompetence.2 \n the nasometer is a computer - based instrument that consists of a headset that has directional microphones for the nose and mouth . \n use of the nasometer in the evaluation of resonance is done by picking up acoustic energy from the nasal and oral cavities , then computing the ratio of nasal acoustic energy to total ( nasal plus oral ) acoustic energy , and displaying this in real time . in this way , an average nasalance score can be computed for a given speech segment . \n this instrument gives objective information regarding resonance and nasality.3 \n 4 however , the examiner must interpret the scores based on knowledge regarding resonance and articulation.5 \n chronic rhinosinusitis is an inflammatory disease of sinonasal mucosa . \n recently , functional endoscopic sinus surgery ( fess ) has been introduced as a successful management for chronic rhinosinusitis . \n studies have reported that nasal volumes change after fess.2 \n although many previous studies6 \n 7 \n 8 have reported that patients who have undergone endoscopic sinus surgery for chronic rhinosinusitis complained from perceptual changes in voice sound , the relationship between nasality and functional endoscopic sinus surgery ( fess ) has not received enough attention by researchers . \n the current study aimed at evaluating nasalance changes after different types of endonasal surgeries including fess , septoplasty , and turbinate surgery . \n we conducted this study at the otorhinolaryngology department over the period from february 2015 until march 2016 . \n the study included 48 patients ( arabic speakers ) , which we divided into two groups : group ( a ) included patients who had chronic rhinosinusitis and underwent fess through the messerklinger technique ; and group ( b ) included patients who had chronic nasal obstruction due to deviated nasal septum and hypertrophied inferior turbinate and underwent septoplasty with or without turbinate surgery . \n we excluded from the study patients with extensive sinonasal polyposis , patients with history of cleft lip , cleft palate , or submucosal cleft palate . \n we also excluded patients with history of previous nasal surgery , tonsillectomy , or uvulopharyngopalatoplasty , or a combination of these . \n the participants included were preoperatively subject to full history taking , full nasal examination , including anterior rhinoscopy , and endoscopic endonasal examination ct scan for nose and paranasal sinuses for all cases . \n participants also underwent postoperative endoscopic endonasal examination at one week , one month , and three months postoperatively to assess postoperative surgical results . \n we conducted a speech assessment on all participants one to two days preoperatively then repeated it at one month and three months postoperatively . \n every patient went through the speech assessment protocol that is applied in the phoniatric unit of our department.9 \n 10 it included : ( a ) video - nasoendoscopy : we examined all the patients preoperatively using a flexible fiberoptic nasopharyngeal endoscope ( xion medical , berlin , germany ) . \n we recorded and graded the velopharyngeal valve movement and closure from grade 0 to grade 4 as follows : ( 0 = the resting ( breathing ) position or no movement ; 2 = half the distance to the corresponding wall ; 4 = the maximum movement reaching and touching the opposite wall ) . pattern of vpi closure was specified , whether circular , coronal , sagittal , or others . while the patient was repeating the speech samples following a recommendation given by an international working group,11 we also documented the pattern of velopharyngeal valve closure as circular , coronal , or sagittal . \n we excluded from the study any patient that had even a mild degree of velopharyngeal incompetence . \n ( b ) auditory perceptual assessment ( apa ) of speech : the subjective evaluation of patients ' speech in a free conversation included type ( hyponasality or hypernasality ) and degree of nasality , consonant precision , the compensatory articulatory mechanisms ( glottal and pharyngeal articulation ) , facial grimace , audible nasal emission of air , and the overall intelligibility of speech . \n all these elements are graded along a four - point scale in which 0 = normal and 4 = severe affection . \n we assessed nasalance using nasometer ii 6400 ( kay elemetric corporation , lincoln park , nj ) , which was used for the analysis of speech samples of all patients . \n we asked all subjects to repeat two sentences in arabic : nasal sentence ( /mama betnayem manal/ ) ( this means : mother helps a girl named manal to sleep ) . oral sentence \n ( /ali ra yelab korah/ ) ( this means : a boy named ali went to play football ) . \n we applied speech assessment one to two days preoperatively , then one month and three months after the operation , and speech evaluators were blind to the technique used . \n we collected , tabulated , and analyzed the data using spss statistical package version 15 for windows . \n we presented quantitative data as mean and standard deviation and compared using paired t - test . \n we considered p < 0.05 to be significant and p < 0.001 to be highly significant . \n group ( a ) patients : underwent fess by messerklinger technique . group ( b ) patients : underwent septoplasty with or without turbinate surgery . \n we collected , tabulated , and analyzed the data using spss statistical package version 15 for windows . \n we presented quantitative data as mean and standard deviation and compared using paired t - test . \n we considered p < 0.05 to be significant and p < 0.001 to be highly significant . \n they were 31 men ( 64.6% ) and 17 women ( 35.4% ) and their ages ranged from 18 to 58 years ( mean age = 38.5 years ) . \n group ( a ) included 23 ( 16 men and 7 women ) patients who underwent fess by messerklinger technique ; whereas group ( b ) included 25 patients ( 15 men and 10 women ) who underwent septoplasty with or without turbinoplasty . \n velopharyngeal nasoendoscopy showed competent ( normal ) closure of velopharyngeal valve in all study participants . upon reviewing the apa results from group ( a ) \n , they revealed the presence of hyponasal speech in 3 out of the 23 patients ( 13% ) , while the rest of the group showed normal speech . \n one month postoperative assessment revealed that only one patient ( 4% ) had hyponasality while 5 ( 22% ) had hypernasality . \n finally , three months postoperative assessment showed that only one patient ( 4% ) had hyponasality and another one ( 4% ) had hypernasality . \n these results , when compared with the preoperative ones , showed non - significant difference ( table 1 ) . \n , postoperative . with regards to the results of the nasometry for the same group ( group a ) , \n preoperative nasalance scores were 11 3 for oral sentence and 49 5 for nasal sentence . \n these scores increased one month postoperatively to 19 4 for oral sentence and 59 4 for nasal sentence and this increase is statistically highly significant . \n then , these scores return to be near the preoperative scores 3 months postoperatively as they were 13 5 for oral sentence and 52 3 for nasal sentence with non - significant increase when compared with the preoperative scores ( table 2 ) . \n , postoperative ; sd , standard deviation . upon reviewing the results of group ( b ) \n , preoperative apa results revealed 9 out of 25 patients ( 36% ) with hyponasal speech , while the rest of the group showed normal speech . \n one month postoperative apa assessment revealed that only 5 out of 25 patients ( 20% ) still had hyponasality , while 5 ( 20% ) had developed hypernasality with highly significant difference when compared with the preoperative results . at three months postoperatively , the apa assessment showed that only 5 out of 25 patients ( 20% ) still had hyponasality and only 1 out of 25 ( 4% ) still had hypernasality , with non - significant difference when compared with the preoperative results ( table 1 ) . with regards to the results of the nasometry for the same group ( group b ) , \n preoperative nasalance scores were 8 4 for oral sentence and 44 5 for nasal sentence . \n at one month postoperatively they were 17 5 for oral sentence and 55 6 for nasal sentence with highly statistically significant difference , when compared with the preoperative scores . \n then , three months postoperatively the scores were 9 3 for oral sentence and 46 3 for nasal sentence with non - significant difference when compared with the preoperative scores ( table 2 ) . \n thus , nasometry for both oral and nasal sentences also showed significant increase in nasalance scores during the one - month postoperative assessment and then decreased again to near preoperative results at three months postoperative in both groups . \n although the importance of certain supraglottic airspace resonators on the primary laryngeal sound is generally acknowledged , there is controversy concerning the real contribution of the nasal cavity and paranasal sinuses on speech.12 \n nasality is one of the resonance disorders . \n therefore , several attempts have been made to objectively evaluate nasality.2 \n the development of computerized acoustic analysis systems as an objective measure of voice has become readily available using a simple noninvasive technique.13 \n many studies have been conducted worldwide to assess nasality in patients with cleft palate , motor speech disorders , hearing impairment , and functional nasality problems , but researchers must pay more attention to the relationship between nasality and functional endoscopic sinus surgery ( fess).6 \n 7 \n 8 \n the current study aimed at studying the relation between nasality and various types of endonasal surgeries including , fess , septoplasty , and turbinoplasty . \n we also tried to estimate whether the effect of these endonasal surgeries on nasalance scores is permanent or temporary in terms of regaining preoperative values after a considerable period of time . \n results of both apa and nasometry in group ( a ) denoted that crs may lead to mild degree of hyponasality ( preoperative results ) . \n when crs was managed by fess , there was a highly significant degree of hypernasality , which appeared in the results of one month postoperative apa and nasometry . \n however , incidence of hypernasality decreased in the three months postoperative assessment ( tables 1 and 2 ) . \n these results agreed with those of soneghet et al,12 which found that fess , despite being a minimally invasive technique , may lead to hypernasal speech . \n hong et al6 also reported that the mean value of nasalance in patients with nasal polyposis was significantly lower than that of the healthy controls before fess , but three weeks after surgery the patients ' mean values had improved and were equal to those of the healthy controls . \n results of group ( b ) ( septoplasty and turbinate surgery group ) showed some similarity to those of group ( a ) , but the incidence of preoperative hyponasality was higher than in group ( b ) ( tables 1 and 2 ) . \n the results of the nasometry in both groups were nearly similar to other researchers who used different types of nasometric languages for evaluation and scoring of nasalance.14 \n 15 these results were also similar to several researches,16 \n 17 \n 18 which demonstrated significant increases in nasalance scores , suggesting an increase in nasal acoustic energy . \n this also , matched the opinions which reported that the anterior nasal obstruction due to septal deviation or hypertrophy of the inferior turbinate increases the resistance to nasal airflow and sound transmission by reducing nasal airway patency . \n this may create enough impedance to reduce or even prevent sound from entering the nasopharynx , even when the velopharyngeal port is open during speech . on the other hand , obstruction of the anterior nasal cavity may add acoustic aspects to the speech signal that result in cul - de - sac \n resonance.17 \n 18 \n although septoplasty does not affect the larynx or changes the structure of the vocal tract it decreases the pitch of the voice and the resonance so , it can consequently decreases the nasal resonance values which improve speech quality.15 \n 16 \n 17 \n 18 \n the results of both groups are matched with those of behrman et al,19 who stated that the decreased tissue surface area and widened nasal passages after surgery will decrease the acoustic damping and increase the acoustic coupling with the paranasal sinuses , thereby increasing the amplitude or energy of the voice . \n the increase of the nasalance in the first month after the operation is due the fact that the nasal cavity is usually covered with a mucosal crusting , resulting in decreased vibration . decreased energy dampening , in turn , \n leads to more energy transfer to the nasal cavity.20 \n normalization of nasality within an average of six weeks postoperatively may be due to the decrease of crusts and healing of the nasal and sinus cavity mucosa ; subsequently , mucosal vibration and dampening function may normalize . \n in addition , if the middle turbinates properly cover the ethmoid and maxillary ostium , resonance might occur separately in the sinus and nasal cavities . \n as the patients have normal velopharyngeal function , the airflow regulation according to the changed nasal / oral impedance may also contribute to normalization of nasality.21 \n endonasal operations cause widening of the nasal resonating cavities . \n this widening effect is not obvious during the early days and weeks after surgery due to the effect of edema and congestion which subside gradually . \n the widening of the nasal resonating cavities reaches its maximum after one month , which enhances nasal resonance and leads to increased nasalance . with time \n , the size of these cavities may decrease slightly again , leading to decreased nasalance again . to the best of our knowledge , \n this was the first study dealing with the effect of endonasal surgeries on nasalance to be conducted on arabic speakers . \n future studies are still needed for further evaluation of postoperative changes in nasalance scores in patients with severe disease and extensive nasal polyposis . \n fess , septoplasty , and turbinate surgery may lead to hypernasal speech , which may be due to changes in the shape and diameter of the resonating vocal tract . \n hypernasal speech in these circumstances may be a temporary finding that can decrease with time . \n surgeons should inform their patients about the possibility of temporary hypernasality after these types of surgery , especially if they are professional voice users .", "role": "user" }, { "content": "introduction there is change in nasalance post endonasal surgery which is not permanent \n . \n objectives the objective of this study is to evaluate the long - term nasalance changes following different types of endonasal surgeries . \n methods we included in this study patients who underwent sinonasal surgery at the otorhinolaryngology department in zagazig university hospitals from february 2015 until march 2016 . \n we divided the patients into two groups according to the surgeries they underwent : group ( a ) was the fess group and group ( b ) , the septoturbinoplasty group . \n we checked nasalance using a nasometer before and after the sinonasal surgery . \n results nasalance increased at one month after the operation in both groups . however , it returned to nearly original levels within three months postoperatively . \n conclusion fess , septoplasty , and turbinate surgery may lead to hypernasal speech . \n this hypernasal speech can be a result of change in the shape and diameter of the resonating vocal tract . \n hypernasal speech in these circumstances may be a temporary finding that can decrease with time . \n surgeons should inform their patients about the possibility of hypernasality after such types of surgery , especially if they are professional voice users .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: recent years have significantly advanced our understanding of the nuclear envelope ( ne ) from a mere barrier between nucleus and cytoplasm to an active platform regulating a broad variety of cellular functions , mediated by selected components . as such , particular components of the ne \n have been implicated in the regulation and maintenance of nuclear structure , in directional nuclear movement and anchorage , as well as in signaling , general nuclear and chromatin organization and gene regulation ( for review see ) . \n several studies in the field further established a key function for the ne in meiotic chromosome alignment and synaptic pairing of the homologs . though the ne turned out to be a crucial determinant for reproduction and fertility , how the ne actually contributes to meiotic chromosome behavior and accurate genome haploidization until recently was not that clear . within this extra view \n we now summarize important recent work identifying new players in ne attachment and movement of meiotic telomeres and discuss the latest advances providing novel insights into the actual function of the meiotic ne . \n structurally , the ne can be subdivided into four main components : the outer nuclear membrane ( onm ) , the inner nuclear membrane ( inm ) , the nuclear pore complexes and the nuclear lamina . \n the onm and inm are two distinct membrane systems , merging only at sites were the nuclear pore complexes are inserted into the ne . \n the onm is in continuity with the membrane of the endoplasmic reticulum , making the lumen between onm and inm , the perinuclear space ( pns ) , a continuous lumen with that of the endoplasmic reticulum . \n the composition of proteins associated with and inserted into the inm and onm strictly differ from each other . \n the conserved kash domain proteins ( klarsicht anc-1 syne - homology ) are one example of a class of proteins predominantly associated with the onm . on the other hand , \n there are numerous prominent examples of membrane proteins restricted to the inm , such as the sun domain ( sad-1 unc-84 homology ) or lem - domain proteins ( lap2 , emerin , man1 homology ) . \n the sun domain proteins of the inm on the one hand and the kash domain proteins of the onm on the other hand are of particular interest as these proteins together form a membrane - spanning protein complex by directly interacting with each other within the pns . \n this sun - kash complex ( the so - called linc complex ; linker of nucleoskeleton and cytoskeleton ) enables a direct communication of the inm and the onm and their associated components , thereby mediating a connection between nuclear and cytoplasmic content . \n the linc complex is also responsible for the transduction of cytoskeletal forces to the ne and into the nucleus through the demonstrated interactions of kash domain proteins with components of the cytoskeleton or associated motorproteins . \n the cytoskeletal forces have been shown to be essential for nuclear positioning and anchorage as well as for the directed movement of meiotic chromosomes within the nucleus . \n the nuclear lamina is a dense protein network intimately associated with the nucleoplasmic side of the inm . \n the main structural components of the nuclear lamina are the lamin proteins , which directly or indirectly interact with numerous membrane proteins of the inm . \n lamins are a class of intermediate filament proteins , competent to self - assemble into the highly structured and organized network of the nuclear lamina . \n this self - assembly is mediated by the functional domains at the n - terminal and c - terminal ends of the central rod domain . \n lamin proteins can be classified into a- and b - type lamins , differing in their expression patterns , biochemical features and polymerisation characteristics during mitotic nuclear envelope breakdown and reassembly . in mammals , \n the b - type lamins b1 , b2 and b3 are encoded by two genes , lmnb1 and lmnb2 , whereas all a - type lamins , the lamins a , a10 , c , and c2 , are isoforms expressed from the single lmna gene . \n while at least one b - type lamin seems to be present in all nucleated cell types , the expression of a - type lamins is rather developmentally regulated and most prominent in differentiated cells . \n the tight and highly ordered lamina network , which in most mammalian cell types is composed of two a- and two b - type lamins , is known to be essential for the maintenance of nuclear stability and shape . \n furthermore , the nuclear lamina is involved in chromatin organization and gene regulation through both direct and indirect interactions with chromatin . \n although the basic features of the ne are highly conserved between all eukaryotic cells , numerous cell type specific adaptations regarding its structure and composition have been described in the recent years . \n a striking example for cell type specific modulation of the ne concerns the central linc complex components and their interaction partners . \n mammals contain at least five different sun domain protein coding genes and five genes coding for kash proteins . \n this renders the possibility for the assembly of diverse linc complexes with distinct functions , which in turn connect different nuclear structures to specific cytoskeletal elements . \n recent studies show clear evidence that individual sun and kash proteins or derived splice isoforms are differentially expressed , strongly pointing toward cell type and tissue specific adaptations of linc complex composition . \n cell type specific expression and assembly of linc components is a prominent feature of mammalian meiosis . \n meiosis is a specialized cell division resulting in haploid cells capable to differentiate into fertilisation competent gametes . \n a conserved hallmark of early meiotic stages is the tethering and intimate attachment of chromosome ends to the ne during early prophase i. the attached chromosome ends are actively repositioned within the ne during the progress of prophase i and transiently cluster within a restricted area of the ne adjacent to the microtubule organizing center ( mtoc ) . \n attachment and movement of the meiotic chromosomes are proposed to facilitate the pairing and synapsis of the homologous chromosomes as well as efficient meiotic homologous recombination , both being essential for the successful completion of meiosis and thus fertility . \n telomere tethering and movement during meiosis require a uniquely remodeled ne and are mediated by meiosis - specific linc complexes . in mice , \n these are composed of the conventional , ubiquitously expressed sun domain proteins , which assemble with kash5 , a meiosis - specific kash domain protein , to form a unique meiosis - specific nucleocytoplasmatic bridge ( fig . \n 1 ) . \n figure 1.mammalian meiotic and somatic linc complexes . the sun - domain proteins sun1 and/or sun2 are central inm components of mammalian linc complexes , both in meiotic and somatic cells . \n the meiotic linc complex further consists of the onm residing meiosis - specific kash5 protein , which via dynein / dynactin likely connects to the microtubule cytoskeleton . in somatic cells , \n versatile , cell - type specific kash - domain proteins interact with sun1 and/or 2 to form several distinct linc complexes . \n the different kash proteins in turn specifically connect to different components of the cytoskeleton , allowing the linc complexes to fulfill specialized cellular functions . \n mammalian meiotic and somatic linc complexes . the sun - domain proteins sun1 and/or sun2 are central inm components of mammalian linc complexes , both in meiotic and somatic cells . \n the meiotic linc complex further consists of the onm residing meiosis - specific kash5 protein , which via dynein / dynactin likely connects to the microtubule cytoskeleton . in somatic cells , \n versatile , cell - type specific kash - domain proteins interact with sun1 and/or 2 to form several distinct linc complexes . \n the different kash proteins in turn specifically connect to different components of the cytoskeleton , allowing the linc complexes to fulfill specialized cellular functions . \n concomitant with the conversion of the linc complexes , also the nuclear lamina undergoes remarkable germ cell specific rearrangements . in meiotic cells , it consists only of one b - type lamin , lamin b1 , and the unconventional a - type lamin isoform , lamin c2 . \n lamin c2 is exclusively found in the lamina of meiotic cells , implicating an additional essential adaptation of the ne to the requirements of meiotic cell function . \n these remarkable modifications within the composition and structure of the ne clearly emphasize the active role of the ne in meiotic progression , successful completion of recombination and genome haploidization , which represent most central aspects of fertility and reproduction . \n a most conserved feature of meiosis is the tethering and stable attachment of chromosome ends to the ne . \n this prerequisite for successful completion of meiosis has been found to be mediated by sun and kash domain proteins in all meiotic model organisms studied so far ( fig . \n the continuous work over the past years finally disclosed the composition of the anchors connecting the meiotic telomeres to the ne and some research groups set out to elucidate the precise functions of the individual components . \n the first identified mammalian constituents of these highly specialized telomere anchors were the ubiquitously expressed linc complex components sun1 and sun2 . at the onset of meiosis both , sun1 and sun2 , \n in contrast to the homogenous distribution of the two sun domain proteins in the ne of somatic cells , in meiotic prophase i cells they feature a peculiar punctuated pattern within the ne , located only at the sites of telomere attachment . \n interestingly , the redistribution of ubiquitously expressed sun domain proteins to the sites of telomere attachment upon the induction of meiosis is not specific for mammals , but also observed in all other meiotic model organisms studied so far . \n with initiation of meiosis in the fission yeast , for example , the ubiquitiously expressed sun domain protein sad1 transiently relocates from its somatic localization at the spindle pole body ( spb ) into smaller foci within the ne to the sites , where the telomeres are attached . \n figure 2.meiotic linc complexes of common model organisms . \n meiotic linc complexes of the different model organisms are all composed of specialized sun - kash protein bridges that are used to connect meiotic telomeres to the cytoskeleton . \n it requires unique adaptor proteins responsible to connect the chromosome ends to the nuclear domain of the sun protein . \n these adaptor proteins are highly diverged , species - specific , most likely analogous proteins with similar function . \n the kash component of meiotic linc complexes in most cases interact with microtubule - associated motor proteins . \n the only described exception refers to s. cerevisiae , in which csm4 likely links to the actin cytoskeleton . \n meiotic linc complexes of the different model organisms are all composed of specialized sun - kash protein bridges that are used to connect meiotic telomeres to the cytoskeleton . \n it requires unique adaptor proteins responsible to connect the chromosome ends to the nuclear domain of the sun protein . \n these adaptor proteins are highly diverged , species - specific , most likely analogous proteins with similar function . \n the kash component of meiotic linc complexes in most cases interact with microtubule - associated motor proteins . \n the only described exception refers to s. cerevisiae , in which csm4 likely links to the actin cytoskeleton . with kms1 , a kash domain protein \n was identified that directly interacts with sad1 to form a functional meiotic linc complex in s. pombe . through the connection of kms1 to the microtubule motor system , \n this complex facilitates bouquet arrangement of chromosomes with all telomeres tightly clustered at the spb . \n similar to kms1 in the fission yeast , the kash domain partner within the meiotic linc complex of c. elegans , zyg-12 , which was also among the earliest identified meiotic kash domain proteins , also connects the ne - tethered meiotic telomeres to the microtubule cytoskeleton . \n although in the case of mammals the existence of a protein capable to connect meiotic telomeres to a cytoplasmic motor system was postulated as well , the real meiotic kash partner of sun1 and/or sun2 remained elusive for substantial time . \n but finally , morimoto and colleagues could in fact identify a new kash protein specific for mammalian meiotic cells , which they named kash5 . following this initial work defining kash5 as a sun1 and sun2 interacting meiotic linc component , which actually mediates the linkage of meiotic telomeres to the microtubule cytoskeleton , a second \n , independent study could demonstrate the essential function of kash5 for meiotic chromosome dynamics and meiotic progression . \n hence , these two studies provided clear evidence that similar to the situation in lower eukaryotes telomere movement in mammals is also mediated by the microtubule cytoskeleton through the interaction of kash5 with the dynein - dynactin complex ( fig . 1 , fig \n i chromosome ends must attach to the ne stably enough to withstand the vigorous movements during bouquet formation and release , which in turn is required for accurate chromosome pairing and recombination . to ensure a mechanically robust connection between telomeres and meiotic linc complexes , different organisms employed unique meiotic adaptor proteins ( fig . \n very prominent examples of such adaptor proteins are the meiosis - specific bqt proteins 14 of fission yeast . \n these proteins form a complex essential for the stable attachment of telomeres to the ne and their subsequent movement within the ne during prophase i. in budding yeast meiosis , this important task of tethering chromosome ends to the sun nucleoplasmic domain appears to be taken by ndj1 . how meiotic telomeres actually bind to the nucleoplasmic side of the linc complexes in mammals has remained uncertain for a long time . \n very recent work , however , was finally able to identify the meiosis specific adaptor protein terb1 . like the bqt - complex in the fission yeast and ndj1 in the budding yeast , mammalian terb1 \n was also shown to connect meiotic telomeres to the sun domain proteins . with this , the existence of a meiotic linc complex with all its necessary components to connect chromosome ends through the ne to the cytoskeletal motor system can now be postulated not only for lower organisms , but also for higher organisms such as mammals ( fig . \n the fact that there is no sequence similarity between terb1 , ndj1 and any of the bqt proteins is quite surprising and raises the question , whether the adaptor mechanisms mediating the anchorage of the meiotic telomeres to the nucleoplasmic compartment of the linc complexes have evolved more than once during evolution . \n analyses of mammalian meiotic linc complex function have mostly been conducted through the investigation of meiotic phenotypes caused by the deficiency of its respective components . \n mice deficient for either sun1 , kash5 or terb1 show a strong meiotic phenotype with homologous pairing being severely affected , leading to a dramatic increase in apoptosis by mid - pachytene stage and , as a consequence , to infertility . \n regarding terb1 , mice deficient for this meiosis - specific telomere adaptor protein , show an almost entire loss of telomere attachment to the ne , abolishment of telomere movement and a severely defective homologous pairing . this phenotype is assumed to be the consequence of the loss of the connection between chromosome ends and the inm located sun domain proteins . \n consistent with the perception of cytoplasmic driven meiotic chromosome movements , which are assumed to be required for chromosome pairing and recombination , mice deficient for kash5 also show almost complete absence of homologous pairing . \n in addition , kash5 deficient mice also exhibit a reduction in telomere - ne associations . \n whether the loss of telomere attachment is due to reduced attachment of telomeres or premature loss of telomere attachment is , however , unclear . \n nonetheless , it is postulated that the absence of kash5 leads to a misorganization of sun1 within the ne , possibly reducing the stability or efficiency of telomere attachment within the ne . \n functional analyses of the sun domain proteins involved in this meiotic linc complex have proven to be slightly more complex , due to the ubiquitous expression of both sun1 and sun2 , on the one hand , and due to their demonstrated functional redundancy in somatic cells , on the other hand . \n they show increased apoptosis of the germ cells , yet the meiotic phenotype is significantly less severe than that observed in kash5 or terb1 deficient mice . \n homologous pairing , for example , though impaired and incomplete in sun1 deficient mice , to some extend still occurs leading to at least partial synapsis of homologous chromosomes in spermatocytes . \n interestingly , even though sun1 was absent , a significant progression of recombination could be observed during oogenesis . \n this suggests , that , although critical for completion of meiosis per se , sun1 may be to some extent dispensable for the attachment of telomeres to the meiotic ne . \n taking into account the redundant functions of sun1 and sun2 in somatic nuclear anchorage and positioning as well as the shared localization of sun1 and sun2 in meiotic cells , it seemed plausible that in the absence of sun1 some telomeres may still manage to attach to the ne , likely through the contribution of sun2 . \n indeed , recent cytological and electron microscopy analyses of sun1 deficient meiocytes were able to demonstrate that in the absence of sun1 a major fraction of meiotic telomeres is still able to attach to the ne forming attachment plates similar to those observed in wildtype meiocytes . \n furthermore , in the absence of sun1 , sun2 and kash5 localize to the telomeres that are still associated with the ne . \n this suggests that the remaining components of the mammalian meiotic linc complex , in principle , are still capable to connect telomeres to the ne . \n the functionality of the linc complex in attaching telomeres in the absence of sun1 is also reflected in the ability of these telomeres to move within the ne , forming wildtype - like bouquet clusters . \n these observations suggest that , similar to the situation described for somatic cells , sun1 and sun2 may fulfill at least to some extent redundant functions within the meiotic linc complex as well . \n this is well in accordance with the less severe meiotic phenotype in the sun1 deficient mice compared to the phenotypes caused by kash5 or terb1 deficiency , respectively . \n however , how the meiosis - specific functions of the ubiquitously expressed sun1 and sun2 are regulated in mice , still remains to be elucidated . with regard to this , studies in c. \n elegans have demonstrated that the sun domain protein implicated in chromosome end attachment , sun-1 , is subjected to substantial post - translational modifications , regulating its meiotic functions and mediating its role in meiotic checkpoint mechanisms . in the case of sun-1 , \n n - terminal phosphorylations lead to increased mobility of the sun-1 aggregates within the ne during early meiotic stages , thus mediating the observed rapid movements of the attached chromosome ends typical for these meiotic stages . upon progression of homologous pairing \n , subsequent dephosphorylation of specific residues within sun-1 at later meiotic stages are required to monitor the regulated progression of meiosis into pachytene , demonstrating the involvement of sun-1 in a feedback checkpoint mechanism . \n it appears plausible , but yet to be determined , whether similar modifications may also occur on mammalian sun domain proteins to regulate their redistribution within the ne and their meiosis - specific interactions with other linc complex components . \n interestingly , a recent study reported that in human cells during mitosis the sun1 nucleoplasmic domain becomes phosphorylated at different sites , most likely by cdk1 and/or plk1 . \n this phosphorylation in turn accounts for a significant weakening of sun1 binding to other ne components . during mammalian meiotic prophase \n i the mitotic kinase cdk2 , which in somatic cells is partially redundant with cdk1 , can be found highly accumulated at the telomeres of meiotic chromosomes . \n this suggests a critical role of cdk2 in meiotic telomere maintenance , attachment and/or movement . \n consistent with this , cdk2 deficient mice show severely defective meiotic telomeres , with a significant number of telomeres being not accurately attached at the ne . \n recent more detailed analysis of the cdk2 deficient meiotic phenotype confirmed a crucial role of cdk2 in telomere attachment and , furthermore , in regulating general meiotic ne integrity and dynamics , which particularly also concerns sun1 , a bona fide target of cdk2 . \n not only is the attachment of telomeres within the ne an essential feature for meiotic success , but also their directed and strongly regulated movement within the ne . \n these movements are considered to be operated by cytoskeletal forces that are transferred to the chromosomes via the meiotic linc complexes . during this choreography \n , chromosome ends transiently cluster within a restricted region , forming the so called bouquet - stage . \n the actual function of the formation and release of the meiotic bouquet is still not entirely clear . \n however , it seems likely that bringing chromosome ends together to a more confined space within the nuclear periphery supports homologous pairing , synapsis formation , double strand break ( dsb ) repair and recombination . \n furthermore , the active release of the meiotic bouquet is implicated to prevent and dissolve unwanted , heterologous associations between non - homologous chromosomes to avoid failures in homologous pairing . \n thus , the tightly regulated movement of the attached chromosomes appears to be an essential prerequisite for the efficient and successful completion of meiosis in numerous model organisms , from yeast to mammals . from several studies it is evident that the ne of meiotic cells serves as a platform for the movement of the attached chromosomes and must therefore be stable enough to withstand the forces generated by the cytoskeleton and transferred by the linc complex . on the other hand , the ne also has to be flexible enough to allow the rapid movement of the linc complexes and attached telomeres within it . in somatic cells , \n the nuclear lamina is a rigid protein network , renowned for its function in maintaining nuclear stability and shape . in mammals , \n the nuclear lamina , like many other components of the ne , undergoes remarkable remodeling at the onset of meiosis . this remodeling \n is reflected in the composition of the meiotic lamina , where the meiosis specific a - type lamin c2 is the only a - type lamin expressed besides the ubiquitously expressed b - type lamin , lamin b1 . compared to its somatic counterparts , lamin c2 is an n - terminally truncated isoform , missing the globular head and the n - terminal part of the central coiled - coil domain . \n these domains are replaced by a unique hexapeptide sequence required for its targeting to the ne . \n hence , meiotic lamin c2 is lacking protein domains , which in somatic lamins have been demonstrated to be critical for the longitudinal and lateral higher ordered polymerisation of the lamina network . \n consistent with this , lamin c2 shows a significantly increased mobility within the nuclear lamina compared to the somatic a - type lamin variants . \n the general localization of lamin c2 within the ne is also unique in that it does not localize homogenously within the meiotic lamina , but rather enriches within domains at sites were telomeres are attached to the ne . \n investigating mice specifically deficient for this meiosis - specific lamin variant demonstrated that lamin c2 is critical for the correct and efficient movement of attached telomeres . in the absence of lamin \n c2 the release of the meiotic bouquet is significantly delayed , leading to failures in synapsis of the homologs and a high incidence of heterologous associations . \n furthermore , lamin c2 deficient mice show defective dsb repair and recombination , culminating in infertility of the male mice . \n taking into account the peculiar characteristics of lamin c2 , it is assumed that lamin c2 locally increases the flexibility of the meiotic nuclear lamina to allow efficient movement of the attached telomeres within the ne . \n therefore , this remarkable meiotic nuclear lamina adaptation appears to be another critical feature of the mammalian meiotic ne essential for correct and proper meiotic progression and fertility . \n studies on the function of the meiotic nuclear lamina in mammals clearly indicate that besides bouquet formation , the release of the meiotic bouquet may be critical for efficient repair of dsb and for resolving heterologous associations between non - homologous chromosomes . \n this is essential to prevent defects in synaptic pairing of the homologs and required to avoid mistakes in chromosome segregation . \n recently it was hypothesized , that homolog recognition and synaptic pairing in mice is mainly mediated by searching for homology in chromosome architecture . \n this could be defined by meiotic cohesion , rather than being supported by more general dynamic chromosome reorganization , spo11 dependent dsb inductions or telomere driven chromosome movements . \n that homolog pairing in mammals may occur independent from telomere movements was inferred from the fact that in sun1 deficient mice a significant number of chromosomes retain the ability to pair and synapse . \n this conclusion was based on the supposition that in the absence of sun1 all telomeres are detached from the ne . however , in a recent study we provided definite evidence that in sun1 deficient mice up to 70% of the telomeres are still connected to the ne and to the cytoskeletal motor system . \n this telomere attachment in the absence of sun1 is likely accomplished due to a partial redundant function of a sun2-kash5 bridging complex . since the attached telomeres in sun1 deficient meiocytes are still capable to accomplish a bouquet - like conformation , \n a significant influence of gathering these ne attached telomeres on homolog recognition and synaptic pairing seems to be plausible . \n in fact , it could well explain for partial synapsis and the significant progression of recombination , which is observed in the sun1 deficient mouse model system . \n this perception receives further support by the results obtained with kash5 and terb1 deficient mice . \n kash5 or terb1 deficiency both lead to functionally disrupted telomere - cytoskeletal connection , which compared to sun1 deficient mice actually lead to more severe phenotypes . \n interestingly , two recent studies described that during medaka and zebrafish meiosis synaptonemal complex formation and synaptic pairing of the homologs not only timely correlate with bouquet formation , but are initiated near ne attached and tightly clustered chromosomal ends , from where synapsis then disperses over the entire homologs . \n this indicates that at least in the fish synaptic pairing is mediated by telomere driven chromosome gathering . in any case , chromosome cohesion without doubt has a very central function in initial meiotic chromosome pairing and further meiotic progression as evidenced by mice showing defective meiotic cohesion . \n meiotic cohesion is established very early in meiosis , giving it a predisposition for mediating primary homolog interactions . \n additionally , intermediate meiotic processes such as the assembly of the synaptonemal complexes and the efficient repair of dsbs imperatively depend on proper meiotic cohesion . \n nonetheless , recent results from mouse models , where early and intermediate meiotic events are still intact , yet later meiotic events are defective , clearly point toward the importance of other mechanisms for homologous pairing and meiotic progression as well . in lamin \n c2 deficient meiocytes , for example , several normal appearing synaptonemal complexes are still assembled and early steps of dsb formation and repair occur . however , in these mice the release of the meiotic bouquet is significantly impaired , leading to an accumulation of heterologous associations and defects in late recombination events . at present \n it seems evident that the mechanisms required for the establishment of correct homologous associations rely on combination of both , the internal nuclear cohesion - dependent chromosome reorganization and the telomere driven chromosome rearrangements , which mainly occur during the formation and release of the meiotic bouquet . \n directed telomere movements appear to be particularly critical for avoiding incorrect heterologous pairing , efficient dsb repair and meiotic recombination . \n both telomere attachment and their regulated movement within the ne are critical parameters for meiosis and thus are pivotal for fertility . \n telomere tethering and attachment is mediated by specialized components of the ne , fulfilling meiosis - specific functions . \n meiosis - specific adaptations and features of the ne and lamina have evolved to facilitate the efficient movement of the attached telomeres within the ne . \n recent studies investigating mammalian meiotic ne components have now provided detailed insights into a number of specialized meiotic adaptations of the ne required to facilitate meiotic functions , highlighting the active role of the ne as a regulatory platform for nuclear processes . \n nonetheless , many question , in particular regarding the cell type specific regulation of ubiquitously expressed ne components , such as the two core linc constituents sun1 and sun2 , remain to be investigated and answered in the future . \n \n our work on the meiotic nuclear envelope was supported by the priority program 1384 mechanisms of genome haploidization of the german research foundation ( grant al 1090/21 ) and the graduate school gk1048 of the university of wrzburg .", "role": "user" }, { "content": "numerous studies in the past years provided definite evidence that the nuclear envelope is much more than just a simple barrier . \n it rather constitutes a multifunctional platform combining structural and dynamic features to fulfill many fundamental functions such as chromatin organization , regulation of transcription , signaling , but also structural duties like maintaining general nuclear architecture and shape . \n one additional and , without doubt , highly impressive aspect is the recently identified key function of selected nuclear envelope components in driving meiotic chromosome dynamics , which in turn is essential for accurate recombination and segregation of the homologous chromosomes . here , we summarize the recent work identifying new key players in meiotic telomere attachment and movement and discuss the latest advances in our understanding of the actual function of the meiotic nuclear envelope .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: new - onset diabetes mellitus is a common metabolic complication following liver transplantation , and it is associated with poor outcomes in regard to a graft function and a patient survival ( 1 ) . \n it has been reported that the post - transplantation diabetes mellitus ( ptdm ) can be reversed within weeks or months in a considerable number of patients ( 1 , 2 ) . \n immunosuppressive agents such as calcineurin inhibitors and corticosteroids are largely responsible for the development of ptdm ( 3 ) . although the reversibility of ptdm is associated with the doses of immunosuppressive agents , it is not sufficiently enough to explain the reversibility of ptdm ( 4 ) . \n in addition , a significant ethnicity - based difference has been observed in the development of ptdm ( 5 ) . in this study , we examined the prevalence of ptdm and the predictive factors associated with its reversibility following liver transplantation in koreans . \n we reviewed the medical records of 328 patients who underwent liver transplantation from january 2004 to may 2007 at seoul national university hospital ( snuh ) ; they were followed up for more than 6 months . among these 328 patients , \n the capillary plasma glucose levels were measured four times a day for the first week after transplantation and the venous plasma glucose levels were measured at least once a week during hospitalization . \n after discharge , the venous plasma glucose levels were measured at least once a month for the first 6 months after transplantation . \n ptdm was defined as either requirement of insulin / antidiabetic drugs or a fasting plasma glucose level of 7.0 mm / l on 2 consecutive occasions . \n based on these criteria , 34 out of 231 ( 14.7% ) patients were diagnosed with ptdm . \n in addition , we enrolled 40 additional ptdm patients who underwent liver transplantation in china during the same period ; they were followed up at snuh for more than 6 months . \n the absence of diabetes mellitus prior to liver transplantation was confirmed by preoperative fasting plasma glucose levels ( n=13 ) or patients ' past medical history ( n=27 ) . \n the clinical characteristics of the 2 groups were similar ( data not shown ) and , therefore , they were analyzed as one group . \n thus , a total 74 ptdm patients ( 52 men and 22 women ) were analyzed in this study . \n demographic data , clinical characteristics , and data on drug therapy were obtained from medical records . \n twenty - eight patients received liver allografts from living donors and 46 patients received liver allografts from cadaver donors . \n the primary causes of liver failure were hepatitis b virus ( hbv)-related liver cirrhosis or hepatocellular carcinoma ( n=67 , 90.5% ) , hepatitis c virus ( hcv)-related liver cirrhosis or hepatocellular carcinoma ( n=3 , 4.1% ) , alcoholic liver cirrhosis ( n=2 , 2.7% ) , fulminant hepatitis ( n=1 , 1.4% ) , and liver cirrhosis of unknown etiology ( n=1 , 1.4% ) . \n mycophenolate mofetil ( mmf ) was administered to 34 of 74 patients ( 45.9% ) . \n the preoperative clinical characteristics between patients who received or did not receive mmf treatment were similar ( data not shown ) . \n the ptdm patients were classified into 2 groups , namely , transient ptdm and persistent ptdm . \n transient ptdm was defined as recovery from ptdm with the maintenance of fasting plasma glucose level at < 5.6 mm / l and hba1c at < 6.0% without insulin or any antidiabetic medication for more than 6 months . \n otherwise , they were classified into the persistent ptdm group . in transient ptdm group , \n 47.6% were diagnosed by requirement of insulin / antidiabetic drugs and 52.4% by high fasting plasma glucose levels ; in persistent ptdm group , 56.3% were diagnosed by requirement of insulin / antidiabetic drugs and 43.7% by high fasting plasma glucose levels . \n student 's t test or mann - whitney u test was used to compare the continuous variables between the 2 groups . \n pearson 's chisquare test or fischer 's exact test was used for comparing categorical variables . \n binary logistic regression analysis was used for determining the multiple predictive factors associated with transient ptdm . \n all the analyses were performed using spss for windows ( spss , chicago , il , u.s.a . ) . \n we reviewed the medical records of 328 patients who underwent liver transplantation from january 2004 to may 2007 at seoul national university hospital ( snuh ) ; they were followed up for more than 6 months . among these 328 patients , \n the capillary plasma glucose levels were measured four times a day for the first week after transplantation and the venous plasma glucose levels were measured at least once a week during hospitalization . \n after discharge , the venous plasma glucose levels were measured at least once a month for the first 6 months after transplantation . \n ptdm was defined as either requirement of insulin / antidiabetic drugs or a fasting plasma glucose level of 7.0 mm / l on 2 consecutive occasions . \n based on these criteria , 34 out of 231 ( 14.7% ) patients were diagnosed with ptdm . \n in addition , we enrolled 40 additional ptdm patients who underwent liver transplantation in china during the same period ; they were followed up at snuh for more than 6 months . \n the absence of diabetes mellitus prior to liver transplantation was confirmed by preoperative fasting plasma glucose levels ( n=13 ) or patients ' past medical history ( n=27 ) . \n the clinical characteristics of the 2 groups were similar ( data not shown ) and , therefore , they were analyzed as one group . \n thus , a total 74 ptdm patients ( 52 men and 22 women ) were analyzed in this study . \n demographic data , clinical characteristics , and data on drug therapy were obtained from medical records . \n twenty - eight patients received liver allografts from living donors and 46 patients received liver allografts from cadaver donors . \n the primary causes of liver failure were hepatitis b virus ( hbv)-related liver cirrhosis or hepatocellular carcinoma ( n=67 , 90.5% ) , hepatitis c virus ( hcv)-related liver cirrhosis or hepatocellular carcinoma ( n=3 , 4.1% ) , alcoholic liver cirrhosis ( n=2 , 2.7% ) , fulminant hepatitis ( n=1 , 1.4% ) , and liver cirrhosis of unknown etiology ( n=1 , 1.4% ) . \n mycophenolate mofetil ( mmf ) was administered to 34 of 74 patients ( 45.9% ) . \n the preoperative clinical characteristics between patients who received or did not receive mmf treatment were similar ( data not shown ) . \n the ptdm patients were classified into 2 groups , namely , transient ptdm and persistent ptdm . \n transient ptdm was defined as recovery from ptdm with the maintenance of fasting plasma glucose level at < 5.6 mm / l and hba1c at < 6.0% without insulin or any antidiabetic medication for more than 6 months . \n otherwise , they were classified into the persistent ptdm group . in transient ptdm group , \n 47.6% were diagnosed by requirement of insulin / antidiabetic drugs and 52.4% by high fasting plasma glucose levels ; in persistent ptdm group , 56.3% were diagnosed by requirement of insulin / antidiabetic drugs and 43.7% by high fasting plasma glucose levels . \n student 's t test or mann - whitney u test was used to compare the continuous variables between the 2 groups . \n pearson 's chisquare test or fischer 's exact test was used for comparing categorical variables . \n binary logistic regression analysis was used for determining the multiple predictive factors associated with transient ptdm . \n all the analyses were performed using spss for windows ( spss , chicago , il , u.s.a . ) . \n among the 74 ptdm patients , 42 ( 56.8% ) showed transient ptdm , while 32 ( 43.2% ) showed persistent ptdm . in the transient ptdm group , \n compared to the patients with persistent ptdm , those with transient ptdm were characterized by younger age at the time of transplantation ( 497 vs. 538 yr , p<0.05 ) , longer time before the development of ptdm ( 4459 vs. 1320 days , p<0.05 ) , a lower rate of hcv seropositivity ( 0.0 vs. 9.4% , p<0.05 ) , and more frequent use of mmf ( 59.5 vs. 28.1% , p<0.05 ) . in contrast , no significant differences were detected with regard to the body mass index ( bmi ) and fasting plasma glucose levels at the time of liver transplantation , and family history of diabetes . \n the cumulative dose of prednisolone during the previous 30 days of each time point did not show any difference between the 2 groups , and the plasma tacrolimus trough levels also did not show any difference . for initial treatment to control hyperglycemia , \n all the patients with persistent ptdm were treated by insulin and the patients with transient ptdm were treated by insulin ( n=37 , 88.1% ) , oral antidiabetic drugs ( n=3 , 7.1% ) , or life style modification alone ( n=2 , 4.3% ) . based on a multivariate analysis ( table 2 ) , age at the time of transplantation \n was determined as the single independent predictive factor associated with reversibility of new - onset diabetes mellitus following liver transplantation ( odds ratio , 1.252 [ 95% confidence interval , 1.004 - 1.562 ] ) . \n we hereby demonstrated that new - onset diabetes following liver transplantation was transient in 56.8% of the patients and the mean time period from the onset of ptdm to recovery was 6.66.6 months . \n age at the time of transplantation was the single independent predictive factor associated with the reversibility of ptdm in a multivariate analysis . \n it was reported that age at the time of renal allograft transplantation ( particularly 40 yr ) was the predictive factor for the occurrence of future ptdm in koreans ( 6 ) . \n in addition , an age of 40 yr denoted a higher risk of persistent ptdm in korean renal allograft recipients ( 7 ) . \n consistent with these findings in renal allograft transplantation patients , the current study showed that age at the time of transplantation was the single independent predictive factor associated with the reversibility of ptdm in liver allograft recipients . \n interestingly , all patients with persistent ptdm were 40 yr of age at the time of transplantation ( data not shown ) . in the current study , \n 9.4% of persistent ptdm patients but none of the transient ptdm patients had hcv infection . \n hcv infection was not only associated with the development of ptdm but also associated with persistent ptdm ( 2 , 8) . it was recently shown that hcv infection was independently associated with increased insulin resistance in liver transplantation patients ( 9 ) . in addition , hcv could directly infect human pancreatic beta cells , which might eventually lead to beta - cell dysfunction ( 10 ) . for \n the generalization of the association between hcv infection and ptdm , a further study with sufficient number of patients would be necessary . \n the time period from liver transplantation to ptdm development was shown to be significantly different between transient and persistent ptdm patients . \n it was expected that the earlier ptdm developed , the higher was the risk of persistent ptdm . \n this finding suggests that liver allograft recipients susceptible to the development of ptdm are also at a greater risk of developing persistent ptdm . \n reduction in the dose of tacrolimus and steroids was reported to be related to the reversibility of ptdm ( 4 ) . in this study \n , we found that more frequent use of mmf was associated with transient ptdm , and that the mean trough level of tacrolimus was lower in the patients receiving mmf ( 8.32.5 vs. 9.72.8 ng / ml , p<0.05 ) . \n thus , dose - saving effect of mmf on tacrolimus might be partly responsible for the reversibility of ptdm . \n first , the absence of oral glucose tolerance test might raise the possibility of ascertainment bias . \n second , the retrospective study design can not firmly conclude the data regarding the predictive factors . \n third , the possible heterogeneity caused by including the patients who underwent liver transplantation in china could be the weak point of this study , even though there was no significant difference in their clinical characteristics compared to those of the patients who received the liver allograft at snuh . in conclusion , 56.8% of the patients with new - onset diabetes following liver transplantation showed transient ptdm and the age at the time of transplantation was the single independent predictive factor associated with the reversibility .", "role": "user" }, { "content": "post - transplantation diabetes mellitus ( ptdm ) is reversible in a considerable number of patients . \n we examined the prevalence and predictive factors of transient ptdm following liver transplantation . \n forty - two of 74 ptdm patients showed the clinical features of transient ptdm . compared with the persistent ptdm patients , they were characterized by younger age at the time of transplantation ( 497 vs. 538 yr , p<0.05 ) , longer time before the development of ptdm ( 4459 vs. 1320 days , p<0.05 ) , lower rate of hepatitis c virus seropositivity ( 0.0 vs. 9.4% , p<0.05 ) , and use of mycophenolate mofetil ( 59.5 vs. 28.1% , p<0.05 ) . among these risk factors , age at the time of transplantation is the single independent predictive factor associated with the reversibility of ptdm .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this tumor can develop in any part of the body and 50% of all cases occur in the head and neck area , especially in the tongue ( 1 , 2 ) . \n granular cell tumors ( gcts ) appearing in the larynx are reported to be as rare as 3% to 10% of all cases ( 3 ) . \n more than 98% of these tumors are benign , but 1% to 2% of all cases occur as malignant tumors ( 4 ) . \n therefore , we present herein a case of a granular cell tumor which occurred in the larynx and a review of the literature . \n indirect laryngoscopic examination revealed an irregular marginated protruding mass at the mid portion of the right true vocal cord . on physical examination \n laboratory analysis , cervical computed tomography ( ct ) and chest radiography demonstrated no abnormalities . \n stroboscopic examination showed no mucosal wave during phonation and incomplete closure of the true vocal cord with the normal vocal cord movement due to the mass . for distinguishing a benign from a malignant lesion \n direct laryngoscopic examination performed under general anesthesia showed that the 0.50.3 cm sized yellowish mass was confined to the epithelial layer at the mid portion of the right true vocal cord ( fig . \n the anterior and posterior margins of the tumor were identified , and the tumor was then removed using a laser with a 2 mm free margin . \n the free margin was set at 2 mm considering the resection margin of early stage ( t1a ) glottis carcinomas are usually 1 - 2 mm ( 5 ) . \n hematoxylin and eosin staining revealed that there were oval - shaped tumor cells with abundant eosinophilic granular cytoplasm but without interstitial tissue . \n the majority of the nuclei were small and thick and did not show definitive nucleoli or mitotic processes ( fig . \n the cytoplasm of tumor cells contained periodic acid - schiff ( pas)-positive materials ( fig . \n the tumor cells showed immunoreactivity for s-100 protein ( zymed , san francisco , ca , usa ) ( fig . 2c ) and neuron - specific enolase ( biogenex , san ramon , ca , usa ) ( fig . \n he made a complete recovery of his voice and had no evidence of tumor recurrence after undergoing his 1-yr follow - up laryngeal stroboscopy ( fig . \n he has been undergoing regular follow - up at the outpatient clinic and did n't have any post - operative complications or recurrence . \n in 1926 , abrikossoff first described a granular cell tumor which was named myoblastic myoma based on the differentiation of the skeletal muscle ( 6 ) . \n although much controversy exists concerning the origin of this type of tumor , immunohistochemistry shows positivity for the s-100 protein , neuron - specific enolase and negativity for muscle - related antigens . \n additionally , electron microscopy reveals a cluster of squamous cells with a continuous perineurium - like basement membrane , dehydrated axons and angulated bodies around them ( 7 - 9 ) , which supports the schwann 's cell theory . \n laryngeal gcts appear as small , rounded , firm submucous tumors covered with whitish gray or yellow , flat and normal mucosa , and they often resemble vocal fold polyps or granulomas . their small size ( less than 2 cm ) and their well - circumscribed , but nonencapsulated feature is typical ( 10 ) . \n these tumors mostly involve the posterior third of the true vocal cords , but are also found on the anterior commissure , arytenoids , the false vocal folds , subglottis , and the postcricoid region . \n in contrast , polyps are usually connected to vocal abuse and are gel - like , smaller structures when compared to gcts which are more on the fibrotic side . \n laryngeal local trauma is connected to the etiology of granuloma , whether it is physical or chemical . \n they are similar to gcts macroscopically , but are also smaller and usually located in the posterior larynx . \n gcts may tend to be solid and homogenously enhancing on ct scans , often mimicking a squamous cell carcinoma ( 11 ) , but in this case we had no specific findings . \n the diagnosis was made after histologic examination of biopsied material from direct laryngoscopy . in 50 - 65% of all cases , there is development of \" squamous pseudoepitheliomatous hyperplasia \" in the overlying epithelium . \n an endoscopic biopsy specimen including only the mucosa may result in a misdiagnosis of a well - differentiated squamous cell carcinoma ( 12 ) . \n the cytoplasm of a granular cell tumor contains ill - defined , spindle - shaped or polygonal , vacuolated nuclei and eosinophilic granules ( 13 ) . \n these granules are strongly positive for the pas reaction and immunohistochemistry reveals strong positivities for s-100 protein and neuron - specific enolase ( 7 - 9 ) . \n these tumors also stain for vimentin , myelin - associated glycoprotein ( leu-7 ) and cd 68 ( kp-1 ) . \n the malignant type of granular cell tumor is uncommon and accounts for only 1% to 2% of all cases ( 4 ) . \n although criteria for malignant gcts have not yet been determined , this malignant tumor is suspected in cases which have nuclear pleomorphism , frequent mitoses , and an increase in the nucleus / cytoplasm ratio , spindle - shaped cellularity , necrosis and vacuolated nucleus with large nucleoli . \n it is also clinically suspected in cases where the tumor size is 4 cm and where the tumor grows rapidly and shows recurrence or infiltration into the adjacent tissue . \n once the diagnosis of a benign granular cell tumor is confirmed , complete surgical resection becomes the appropriate treatment . during removal , securing a negative free margin is a strongly demanded goal . in our case , frozen biopsy was not done due to the small size of the tumor but through a permanent biopsy the absence of malignancy was determined . \n a frozen section is recommended to confirm properly performed surgical resections without leaving any tumorous remains ( 14 ) . \n radiation therapy or chemotherapy is not recommended because it may be less responsive or induce malignant transformation ( 13 ) . even though surgical resection is performed properly , there is an 8 - 21% recurrence rate , usually at the primary site . some of these recurrences may be due to a failure in to diagnose multiple lesions . \n moreover , in cases of inadequate removal with the remnant of the tumor at the resection margins , it may recur ( 15 ) . \n although it is rare for gcts to occur in the larynx , accurate diagnosis and appropriate treatment follow - up are mandatory . \n regular long term follow - ups are required using fiber - optic laryngoscopy to confirm its recurrence . in our case , follow - up \n was done at 1 an year after surgery , considering that gcts grow slowly and evolve on average between 6 and 7 months before patients perceive a sensible discomfort and seek medical advice ( 16 ) . \n the above case demonstrates that although gcts of the larynx are rare and typically benign tumors , clinicians must be aware of the need to make an accurate diagnosis and to provide appropriate treatment . undergoing surgical resection including having a negative free margin \n is highly recommended to rule out gcts in the larynx . when the tumor size is relatively small for complete surgical resection , it should be performed with regular follow - up to provide proper care and to result in a complete recovery , even with occasional treatments . in consideration of the satisfactory result acquired through the whole procedure above", "role": "user" }, { "content": "granular cell tumors ( gcts ) are uncommon neoplasm \n . they can originate in any part of the body . \n the most common sites of origin are in the head and neck , while the larynx is a relatively uncommon location . \n patients affected with a laryngeal gct typically present with persistent hoarseness , stridor , hemoptysis , dysphagia , and otalgia but , the tumor may be asymptomatic . \n care must be taken to differentiate this lesion from others due to the presence of pseudo - epitheliomatous hyperplasia which overlies the gct and may occasionally mimic squamous cell carcinoma . \n therefore , a confirmative diagnosis should be made histopathologically and should be supported by immunohistochemical staining . \n these tumors are treated by complete surgical resection . \n examining the complete removal of the tumor through securing a negative free margin is considered to be a consequential procedure . \n we experienced a 64-yr - old man with a laryngeal granular cell tumor involving the right true vocal cord . \n he was treated by surgical resection under a fine dissection laryngomicroscope . here \n we present this case and a review of literature .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: to ensure successful symbiont inheritance and dissemination within insect populations , mechanisms have evolved within different insect - symbiont associations that optimize the transmission of bacterial symbionts from one generation to another ( bright and bulgheresi 2010 ) . \n the mode of transmission plays a key role in the evolutionary trajectory of these associations where strict vertical symbiont transmission results in congruent host symbiont phylogenies whereas horizontal transfer tends to eliminate congruence with partner phylogenetic trees ( reviewed in ebert ) . \n the obligate blood - feeding tsetse fly , the sole vector of human pathogenic african trypanosomes , harbors several bacterial symbionts that influence important aspects of its physiology and ecology . tsetse flies display a unique viviparous mode of reproduction where the offspring develops in utero where it is nourished by maternal milk gland secretions containing tsetse s two main symbiotic bacteria , that is , an anciently associated obligate mutualist wigglesworthia glossinidia and a more recently established commensal sodalis glossinidius . \n it is assumed that these three symbionts are strictly vertically transferred from the mother fly to the intrauterine progeny . \n however , the absence of phylogenetic congruence in the tsetse - sodalis coevolution ( toh et al . 2006 ) and the ability to experimentally establish a stable heritable symbiosis in tsetse flies cleared of their native sodalis symbionts with a sodalis species isolated from a different tsetse fly species ( weiss et al . \n 2016 ) are indicators that horizontal transmission of sodalis symbionts could occur in tsetse populations . to date , no natural mechanism for the horizontal transfer of this symbiont has been identified . \n 2013 ) and female spermathecae ( cheng and aksoy 1999 ) has led us to hypothesize that transfer of sodalis might occur during copulation . such transfer would be biologically relevant in terms of host symbiont coevolution if the symbionts are subsequently transmitted maternally to the progeny , that is , paternal transmission . experimental evidence for the latter is currently lacking due to the absence of an appropriate methodology to reliably trace this alternative transmission route . to date \n , only a few studies have utilized genetic techniques to explore the nature of host symbiont interactions due to the fastidious nature of these bacteria . in this study , we adapted and optimized the tn7 transposition technology for the genetic manipulation of sodalis . \n furthermore , we developed novel techniques for introducing genetically modified sodalis in tsetse allowing us to explore sexual transmission and ensuing vertical transmission of sexually acquired sodalis to the offspring , that is , paternal transmission . \n although paternal transmission has been shown to have important implications regarding the coevolution of hosts and symbionts , it has been reported in only a few insect - symbiont associations to date ( moran and dunbar 2006 ; damiani et al . 2008 ) . in this study \n , we show unambiguously that male - borne green fluorescent protein ( gfp)-tagged sodalis is horizontally transferred to females during mating and subsequently vertically transmitted to the progeny . \n glossina morsitans morsitans ( westwood ) from the colony at the institute of tropical medicine ( antwerp , belgium ) were used in all experiments . \n flies , maintained at 26 c and 65% relative humidity , were fed 3 days per week with defibrinated bovine blood using an artificial membrane system . \n a chromosomally gfp - tagged sodalis strain ( sod : gfpi ) was constructed by tn7-mediated transposition . \n briefly , the lacz promoter_gfp fusion cassette was cloned into the multiple cloning site of the pgrg25 plasmid ( mckenzie and craig 2006 ) encoding the tn7 transposition machinery which allows for the site - specific transposition at the atttn7 locus of sodalis ( fig . 1a ; \n 1b ) in a constitutive manner due to the absence of a sodalis lac repressor . \n fig . \n ( a ) the preferred site for tn7 insertion in the sodalis glossinidius chromosome , that is , 25 nucleotides downstream of the glms gene . tn7 insertions at this site are orientation - specific with the right end of tn7 ( tn7r ) adjacent to the 3-end of the glms gene , as shown in the figure . \n ( b ) flow cytometric analysis of wt sodalis ( upper panel ) and sod : gfpi ( lower panel ) showing forward ( fsc ) and side scatter profiles ( ssc ) and gfp fluorescence . characteristics of sod : gfpi . \n ( a ) the preferred site for tn7 insertion in the sodalis glossinidius chromosome , that is , 25 nucleotides downstream of the glms gene . tn7 insertions at this site are orientation - specific with the right end of tn7 ( tn7r ) adjacent to the 3-end of the glms gene , as shown in the figure . \n ( b ) flow cytometric analysis of wt sodalis ( upper panel ) and sod : gfpi ( lower panel ) showing forward ( fsc ) and side scatter profiles ( ssc ) and gfp fluorescence . \n subsequently , a novel technique for the introduction of the gfp - labeled endosymbionts into tsetse flies was developed . \n third - instar larvae , collected immediately after larviposition , were microinjected with 10 cfu of sod : gfpi using a 5 l hamilton 75rn microsyringe with gauge 34 removable electrotapered needles and allowed to pupate resulting in efficiently colonized male flies upon emergence 30 days later ( fig . \n microscopic observations of the male reproductive organs of sod : gfpi colonized flies revealed that sod : gfpi was found predominantly in the testes ( fig . \n number of gfp - tagged sodalis ( sod : gfpi ) present in abdomen , thorax , and reproductive tissues of 4-week - old male flies emerged from larvae injected with 10 \n sod : gfpi cfu versus the total number of sodalis ( wt + sod : gfpi ) . in these tissues , sod : gfp constituted 63% , 100% , and 93% of the total sodalis population , respectively . \n the number of wt and gfp - tagged sodalis cfu was estimated using an already validated quantitative real time - pcr protocol ( de vooght et al . \n the bars represent the mean total sodalis and sod : gfp cfu ( plus sd ) present in abdomen , thorax , and reproductive tissues of at least five individual flies . \n the number of cfu is represented in log scale on the y - axis . \n ( b ) sod : gfpi in spermatophores collected from the female uterus after mating with sod : gfpi infected males ( compilation of three separate locations in the same spermatophore ) . \n inset : macro - photograph of a spermatophore dissected from the female uterus after mating . \n number of gfp - tagged sodalis ( sod : gfpi ) present in abdomen , thorax , and reproductive tissues of 4-week - old male flies emerged from larvae injected with 10 \n sod : gfpi cfu versus the total number of sodalis ( wt + sod : gfpi ) . in these tissues , \n sod : gfp constituted 63% , 100% , and 93% of the total sodalis population , respectively . \n the number of wt and gfp - tagged sodalis cfu was estimated using an already validated quantitative real time - pcr protocol ( de vooght et al . \n the bars represent the mean total sodalis and sod : gfp cfu ( plus sd ) present in abdomen , thorax , and reproductive tissues of at least five individual flies . \n ( b ) sod : gfpi in spermatophores collected from the female uterus after mating with sod : gfpi infected males ( compilation of three separate locations in the same spermatophore ) . \n inset : macro - photograph of a spermatophore dissected from the female uterus after mating . \n prior to being mated with wild - type ( wt ) virgin female flies from the colony , sod : gfpi containing males flies were given three blood meals . during mating , male tsetse deposit a \n ( i.e. , a capsule consisting of male accessory gland secretions and sperm ) in the uterus of female flies which can be isolated from the uterus of the female tsetse by dissection immediately after the mating event ( fig . \n 3b ) . using confocal microscopy sod : gfpi was found to be present in low densities ( up to 20 sod : gfpi cells / spermatophore ) in spermatophores collected from wt females immediately after mating ( fig . \n polymerase chain reaction ( pcr)-analysis revealed a transmission efficiency of 27.5% ( 8 of 29 spermatophores ) . \n furthermore , in 18.7% of wt females ( 3 of 16 ) mated with sod : gfpi colonized males , sod : gfpi was found to remain present within the reproductive organs for up to 4 weeks postmating , indicating that sod : gfpi bacteria were able to persist within the host upon sexual acquisition . \n finally , a proportion of females ( n = 23 ) mated with sod : gfpi colonized males were allowed to give birth to fully developed third - instar larva to evaluate the presence of sod : gfpi in the f1 progeny . \n the percentage of f1 individuals carrying the recombinant bacteria was found to be 17.4% using pcr analysis ( 4 of 23 individuals ) . \n these results indicate that transmission of only a few sodalis cells , residing within the spermathopore , is sufficient for establishment in the female receiving fly and subsequent transfer to the offspring . in this study \n we have demonstrated unequivocally that paternal transmission through sexual reproduction is an additional route for s. glossinidius symbiont transmission to the progeny , besides maternal vertical transmission . \n this mixed mode of transmission could strongly impact sodalis genome evolution as transfer between tsetse fly individuals infected with different symbiont strains can lead to coinfections creating opportunities for lateral gene transfer or exchanging phage or phage genes increasing symbiont genetic diversity within the host population . \n the importance of genetic diversity in sodalis is emphasized by the fact that different genotypes of sodalis harbored by g. palpalis gambiensis have been shown to correlate with the tsetse fly ability to transmit trypanosomes including the human - pathogenic trypanosoma brucei gambiense ( geiger et al . \n although the paternal transfer of sodalis in tsetse is a low to moderately frequent type of transmission , it has been demonstrated for other symbionts that even very low rates of paternal transmission can be consequential especially when particular combinations of host and symbiont genotypes have a direct effect on host fitness ( oliver et al . \n we propose that paternal gene transfer could be an important evolutionary factor that should be taken into account to explain the mechanisms and consequences of genetic diversity of s. glossinidius . \n however , assessing the importance of paternal transmission for the dynamics of sodalis symbionts with a particular trait will require an understanding of the relative importance of the different natural transmission routes and transmission rates through these routes in natural tsetse populations . finally , in the context of a sodalis - based paratransgenic approach ( i.e. , genetic manipulation of symbiotic microorganisms to interfere with pathogen development in the host ) to control african trypanosomiasis ( de vooght et al . \n 2014 ) , paternal transfer could provide an additional route for introducing genetically modified symbionts into populations as a single infected male can transfer symbionts to the progeny of several females . \n ", "role": "user" }, { "content": "sodalis glossinidius , a maternally inherited secondary symbiont of the tsetse fly , is a bacterium in the early / intermediate state of the transition toward symbiosis , representing an important model for investigating establishment and evolution of insect bacteria symbiosis . \n the absence of phylogenetic congruence in tsetse - sodalis coevolution and the existence of sodalis genotypic diversity in field flies are suggestive for a horizontal transmission route . however , to date no natural mechanism for the horizontal transfer of this symbiont has been identified . using novel methodologies for the stable fluorescent - labeling and introduction of modified sodalis in tsetse flies , \n we unambiguously show that male - borne sodalis is 1 ) horizontally transferred to females during mating and 2 ) subsequently vertically transmitted to the progeny , that is , paternal transmission . \n this mixed mode of transmission has major consequences regarding sodalis genome evolution as it can lead to coinfections creating opportunities for lateral gene transfer which in turn could affect the interaction with the tsetse host .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: we conducted a replicated experiment to compare cwd transmission from three infection sources : naturally infected captive mule deer ( one infected deer / paddock ) , carcasses from naturally infected captive mule deer that had decomposed in situ 1.8 years earlier ( one carcass / paddock ) , or undisturbed paddock environments where infected mule deer had last resided 2.2 years earlier . \n each exposure source was replicated in three separate paddocks ; two clean paddocks served as unexposed controls . control paddocks and paddocks where live infected deer were added or where carcasses decomposed were constructed specifically for this experiment ; these paddocks had never housed captive deer or elk and had been closed to access by free - ranging cervids for 17 years . because clinical courses varied in naturally infected deer that served as sources of direct exposure , actual exposure periods varied from 0.75 year ( replicate 3 ) to 1 year ( replicate 1 ) . \n excreta - contaminated paddocks previously held 19 mule deer that had been orally inoculated during a 2-year pathogenesis study ( 11 ) that ended 2.2 years before our study began ( 3.8 infected deer x years of excreta / paddock , assuming equal distribution ) but that had not held deer or elk in the interim . \n they had been left to decompose in intact form except for the removal of small pieces of brainstem used to confirm cwd infection ; only the skeletal remains of carcasses were present at the start of the study . \n experimental animals included 31 free - ranging mule deer from two donor populations distant to endemic cwd foci . \n experimental animals were captured from the grounds of the rocky mountain arsenal national wildlife refuge ( n = 17 ) and the u.s . \n we assumed that all experimental animals were free from cwd when they were introduced into the experiment , and surveillance data provided evidence that deer obtained from these herds were uninfected before exposure . \n surveillance for cwd in the source populations ( 10,18 ) showed 0 positive cases in a sample of 210 adult deer from the refuge and 0 positive cases in a sample of 65 adult deer from the academy . \n we used these data to estimate the probability that infection could have been caused by transmission from animals from the source herds . to do so , we estimated one - sided , exact 99% binomial confidence intervals ( bci ) on the proportion of each population that could be positive for cwd ( refuge = 00.022 , academy = 00.068 ) . \n we then used the upper limit of this interval to estimate the maximum prevalence , , that could be reasonably expected in each of the source populations , given the inability to detect infections through surveillance . to assess whether observed results were likely due to preexisting infections , we treated each replicate ( i.e. , paddock ) as an independent binomial experiment because the conditions in one paddock had no opportunity to influence the events in another paddock \n thus , for each replicate where infection occurred , we calculated the probability of at least one positive ( i.e. , \" success \" ) given the number of animals introduced to that replicate from the source population ( i.e. , \" trials \" ) , on the assumption that the probability of drawing a positive from the source population was . \n when two replicates within an exposure category showed infections , we estimated the probability that cases in both replicates resulted from introducing infected animals ( and not from our experiment ) as the product of the individual replicate probabilities . \n we captured deer during march and may 2002 and transported them to the colorado division of wildlife 's foothills wildlife research facility , where they were confined in outdoor paddocks of 800 m ( three replicate paddocks / exposure route , three deer / paddock ) ; four deer were held in the two clean paddocks as unexposed controls . \n each replicate of exposure paddocks was initially stocked with three mule deer . shortly after arrival \n , one deer was moved to a different paddock within the same exposure condition to resolve social strife , and four fawns were born into three other paddocks ; these changes are reflected in denominators in the table . the distribution of prion protein genotype at codon 225 ( serine [ s]/phenylalanine [ f ] ) did not differ ( fisher exact test p = 0.6 ) among the four groups ( three exposure groups + control ) . \n deer were fed alfalfa hay and a pelleted supplement ; diets contained no animal protein or other animal byproducts . individual paddocks and exposure blocks were physically segregated to prevent cross - transmission within and among exposure categories ; dedicated clothing and equipment were used to minimize potential cross - contamination , but other potential fomites , like small mammals , birds , and insects , could not be controlled . \n however , transmission by routes such as these would be consistent with hypothesized transmission from environmental sources rather than direct animal - to - animal contact . after the animals had undergone 1 year of exposure to respective sources of infection , we obtained biopsied tonsil specimens from each participant deer and conducted an immunohistochemical analysis using anti - prp mab 99/97.6.1 ( 20,21 ) . \n upon detecting > 1 infected deer in a paddock , we removed all inhabitants of that paddock and confirmed cwd infection in animals with positive biopsy results ( 20 ) . \n study protocols were reviewed and approved by the colorado division of wildlife animal care and use committee . \n mule deer exposed to contaminated environments or to infected deer contracted cwd ( table ) . \n one or more introduced deer became infected in two of three paddocks containing a naturally infected deer , in two of three paddocks containing a decomposed deer carcass , and in one of three paddocks contaminated with residual deer excreta ( table ) within 1 year of exposure . \n infected deer included unrelated animals from both donor herds ( 2/17 , 3/14 ; fisher exact test p = 0.64 ) , as well as one of four fawns born during the study . \n males ( 4/16 ) and females ( 2/15 ) were infected at equivalent rates ( fisher exact test p = 0.65 ) ; similarly , deer of all three codon 225 genotypes ( ss = 6/26 , sf = 0/7 , ff = 0/2 ) were infected at equivalent rates ( fisher exact test p = 0.52 ) . \n deer with positive biopsy results appeared healthy and did not show signs of cwd , consistent with early ( < 1 year in duration ) infections ( 11,17 ) . \n number positive / number exposed ( not including infected source deer ) . not applicable ; controls included only two replicate paddocks . \n on the basis of prior data from surveillance of source populations , our results were not likely explained by the null hypothesis of infections introduced from the source populations ( p = 0.036 for academy source deer and p < 0.0001 for refuge source deer ) . \n the probability of prior infection accounting for our results in the pattern observed ( table ) was p < 0.0013 for the infected animal exposure , p < 0.037 for the carcass exposure , p < 0.064 for the excreta exposure , and overall p 0.000003 for the observed results arising from preexisting infections . because these probabilities were based on one - sided , upper 99% bcis \n , we can conservatively reject the null hypothesis of infection arising from the source populations . \n the only remaining possibility is that infections arose from experimental exposures that included environments harboring the infectious agent from excreta or decomposed carcasses . \n specific protease - resistant prion protein ( prp ) accumulates in gut - associated lymphoid tissues ( e.g. , tonsils , peyer patches , and mesenteric lymph nodes ) of infected mule deer ( 11,17,22 ) , which implicates alimentary shedding of the cwd agent in both feces and saliva ( 10,11,17 ) . because prp becomes progressively abundant in nervous system and lymphoid tissues through the disease course ( 11 ) , carcasses of deer succumbing to cwd also likely harbor considerable infectivity and thus serve as foci of infection . \n we could not determine the precise mechanism for cwd transmission in excreta - contaminated paddocks , but foraging and soil consumption seemed most plausible . \n deer did not actively consume decomposed carcass remains , but they did forage in the immediate vicinity of carcass sites where a likely nutrient flush ( 23 ) produced lush vegetation ( figure ) . \n green forage growing at the site where a deer carcass infected with chronic wasting disease had decomposed . \n such sites were attractive to deer , as illustrated by the grass blades recently cropped in the experiment . \n our findings show that environmental sources of infectivity may contribute to cwd epidemics and illustrate the potential complexity of such epidemics in natural populations . \n the relative importance of different routes of infection from the environment can not be discerned from our experiment , but each could play a role in sustaining natural epidemics . \n although confinement likely exaggerated transmission probabilities , conditions simulated by this experiment do arise in the wild . \n mule deer live in established home ranges and show strong fidelity to historic home ranges ( 24 - 26 ) . \n as a result of such behavior , encounters with contaminated environments will occur more frequently than if deer movements were random . \n feces and carcass remains are routinely encountered on native ranges , thus representing natural opportunities for exposure . \n social behavior of deer , particularly their tendency to concentrate and become sedentary on their winter range , also may increase the probability of coming into contact with sources of infection in their environment . \n the ability of the cwd agent to persist in contaminated environments for > 2 years may further increase the probability of transmission and protract epidemic dynamics ( 8) . because infectivity in contaminated paddocks could not be measured , neither the initial levels nor degradation rate of the cwd agent in the environment was estimable . however , the observed persistence of the cwd agent was comparable to that of the scrapie agent , which persisted in paddocks for 1 to 3 years after removal of naturally infected sheep ( 7 ) . \n similarities between the cwd and scrapie agents suggest that environmental persistence may be a common trait of prions . whether persistence of the bse prion in contaminated feed production facilities or in environments where cattle reside contributed to bse cases in the united kingdom after feed bans were enacted ( 27 ) \n indirect transmission and environmental persistence of prions will complicate efforts to control cwd and perhaps other animal prion diseases . \n historically , control strategies for animal prion diseases have focused on infected live animals as the primary source of infection . \n although live deer and elk represent the most plausible mechanism for geographic spread of cwd , our data show that environmental sources could contribute to maintaining and prolonging local epidemics , even when all infected animals are eliminated \n . moreover , the efficacy of various culling strategies as control measures depends in part on the rates at which the cwd agent is added to and lost from the environment . \n consequently , these dynamics and their implications for disease management need to be more completely understood .", "role": "user" }, { "content": "whether transmission of the chronic wasting disease ( cwd ) prion among cervids requires direct interaction with infected animals has been unclear . \n we report that cwd can be transmitted to susceptible animals indirectly , from environments contaminated by excreta or decomposed carcasses . under experimental conditions , mule deer ( odocoileus hemionus ) \n became infected in two of three paddocks containing naturally infected deer , in two of three paddocks where infected deer carcasses had decomposed in situ 1.8 years earlier , and in one of three paddocks where infected deer had last resided 2.2 years earlier . \n indirect transmission and environmental persistence of infectious prions will complicate efforts to control cwd and perhaps other animal prion diseases .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: laparoscopic treatment in general , in recent age has proven that it is well associated with low morbidity , mortality , fast recovery , less pain and sound oncologic outcomes . \n recent reports from the national comprehensive cancer network ( nccn ) gist task force and the gist consensus conference under the auspices of the european society for medical oncology ( esmo ) show that laparoscopic resection may be used for small gastric gists ( < 2 cm in size ) . \n we report , all the benefits of laparoscopic approach which include short hospitalization , less pain , better cosmetic effect and good oncological outcome , in this case report of 60 year old female patient with gastric gist larger than 2 cm . \n approximately 60 - 70% are located in the stomach but can arise anywhere within the gastrointestinal tract . \n the majority of gists ( approximately 95% ) express the cd117 antigen ( kit ) , a proto - oncogene product ; 85 - 95% of these neoplasms have mutations in the c - kit gene ; only 5 - 7% has mutations in platelet - derived - growth factor a ( pdgfra ) . \n ofter they are asymptomatic and found during examinations for other reasons . usually they present themselves with abdominal pain and bleeding ( 1 ) . diagnostic work up \n can be changeling and consists of endoscopy , ultrasonography , computed tomography and/or magnetic resonance exam . \n endoscopy often fail to detect sub - mucosal and extraluminal gist , and a biopsy specimen is often negative . fine - needle aspiration ( fna ) , performed under the guidance of ultrasound or computed tomography , \n have been developed as reliable method to obtain tumor cells , and have allowed the preoperative diagnosis of gist by histological examinations with immunohistochemistry ( 2 , 3 ) . \n laparoscopic wedge resection could be considered as a procedure of choice and a valid alternative to the conventional open approach for the resection of gastric gastrointestinal stromal tumors ( gists ) smaller than 2 cm ; recent reports from the national comprehensive cancer network ( nccn ) gist task force and the gist consensus conference under the auspices of the european society for medical oncology ( esmo ) show that laparoscopic resection may be used for small gastric gists ( < 2 cm in size ) ( 4 ) . \n the development of endoscopic stapling devices and the evidence that laparoscopic resection of gists is effective with minimal morbidity and no reported mortality ( 5 ) . \n surgical resection with free margin is the gold standard treatment for gist lesions and complete surgical resection is the only curative treatment of gists ( 6 ) . \n we present a 65 years old female patient admitted to hospital due to numerous vomiting , epigastric discomfort and loss of appetite . \n ultrasound and endoscopy revealed a prominence into gastric lumen but endoscopic biopsy came negative for malignant disease . \n ct scan showed hyperdensitive extraluminal mass that prominates to gastric lumen located and originating from posterior wall of stomach , but no signs of liver metastases , peritoneal dissemination and ascites . \n magnetic resonance ( figure 1 ) with contrast confirmed ct scan findings and showed no attachment to vascular or other abdominal structures . patient was informed about laparoscopic approach and gave informed consent . \n magnetic resonance gist with contrast she underwent laparoscopic wedge resection using three ports and linear stapling ( figure 2 ) . \n resection stapler line was oversawn by intracorporal second line using 3 - 0 vycril ( figure 3 ) . \n pathohistological finding confirmed gist , and his size was 3,553,5 cm with mitotic activity of 1 mitose per 50 high power field . \n imunohistochemical staining was positive for dog-1 and cd117 , and negative for desmin and cd34 . \n gastric stromal tumor ( gist ) laparoscopic wedge resection of gastric stromal tumor ( gist ) extraction gist by endobag through umbilical port site \n as recommended for gastric gists , treatment consists of surgical wedge resection without lymphadenectomy and represents cure for patients with primary localized tumors ( 7 ) . \n since gastric gists rarely metastasize to lymph nodes , there is no need for lymphadenectomy ( 8) . in order to achieve adequate oncologic resection , 1 to 2 cm free margin is recommended ( 9 , 10 ) . \n so treatment of choice is simple wedge resection for gastric gists , and it caries low risk of complications , fast recovery and good oncological outcome ( 11 ) . \n recent reports from the national comprehensive cancer network ( nccn ) gist task force and the gist consensus conference under the auspices of the european society for medical oncology ( esmo ) show that laparoscopic resection may be used for small gastric gists ( < 2 cm in size ) ( 4 ) . \n laparoscopic resection of gastric gists appears safe when performed by a surgeon who is thoroughly familiar with laparoscopy the neoplastic characteristics of gastric gists ( 12 ) . \n a special care has to be taken to prevent peritoneal seeding and possibility of capsular rupture during manipulation . \n thus the size of tumor represents negative prognostic factor , and resection with free margins is curative predictor with good prognosis ( 12 ) . \n with this case report we demonstrate that laparoscopic approach is feasible and safe and follows all the principles needed for good oncological outcome with all the benefits of minimally invasive surgery even for gists that are larger than 2 cm .", "role": "user" }, { "content": "introduction : laparoscopic treatment in general , in recent age has proven that it is well associated with low morbidity , mortality , fast recovery , less pain and sound oncologic outcomes . \n recent reports from the national comprehensive cancer network ( nccn ) gist task force and the gist consensus conference under the auspices of the european society for medical oncology ( esmo ) show that laparoscopic resection may be used for small gastric gists ( < 2 cm in size).case report : we report , all the benefits of laparoscopic approach which include short hospitalization , less pain , better cosmetic effect and good oncological outcome , in this case report of 60 year old female patient with gastric gist larger than 2 cm .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: based on the international diabetes federation , the prevalence of type 2 diabetes ( t2d ) in adults is 6.9% and will increase to 17% by 2030.1 despite the widely funded research in the past decades to reduce the prevalence and the incidence of t2d , it remains one of the most costly chronic conditions to treat.2 the prevalence of t2d is especially high in overweight and obese individuals.3 for example , obese individuals are 42.1 times more likely to develop t2d after a 5-year follow - up compared to normal weight individuals.4 interestingly , this association seems to persist and strengthen over time . as proof of this statement , a prospective study of 10,920 men and 8,227 women showed that an overweight adult is 2.7 ( 2.13.6 ) times more likely to develop t2d and that risk increases to 7.2 ( 5.310.0 ) after 30 years.5 one of the strategies to reduce the incidence of t2d is to intervene before the development of the disease in a population at high risk for t2d ; this is commonly referred to as prediabetes . \n management of prediabetes is highly relevant considering that between 29% and 93% of individuals with prediabetes will develop t2d in the years following their diagnosis.6 \n impaired fasting glucose ( ifg ) and/or an impaired glucose tolerance ( igt ) measured after a 2-hour oral glucose tolerance test ( ogtt ) is generally used to identify individuals with prediabetes . \n the cut - points for ifg and igt diverge across countries , but usually ifg is defined as a fasting plasma glucose ranging between 5.6 and 6.9 mmol / l ( 100.8124.2 mg / dl ) , while igt is defined by values of plasma glucose ranging between 7.8 and 11.0 mmol / l ( 140.4198.0 mg / dl ) 2 hours following an ogtt.7 recently , the american diabetes association suggested that glycosylated hemoglobin ( hba1c ) between 5.7% and 6.4% should also be used to identify individuals with prediabetes.7 the use of different criteria to identify individuals with prediabetes leads to a wide variation in the magnitude of risk associated with the development of t2d.7 despite different criteria to identify individuals with prediabetes , a better understanding of modifiable risk factors ( diet and exercise ) is needed to better manage prediabetes given that individuals with ifg are 4.6 times more likely to have t2d8 and that risk increases to 6.3 for individuals with igt and reaches 12.1 if an individual presents both ifg and igt.8 many studies have aimed to identify the best intervention to improve glycemic control in individuals with prediabetes.9,10 this included pharmacotherapy1113 and/or lifestyle modification with diet , exercise , or both.1417 even though lifestyle modification seems to offer a more holistic approach and significant short- and long - term results,15 clinicians still struggle to find the right program that would be cost effective,18,19 well tolerated by patients , and available in different settings.10,20 lifestyle modification is the primary intervention with overweight and obese individuals with prediabetes because a healthy lifestyle is associated with a high risk of t2d as well as many other chronic diseases.21 nonetheless , drug therapy to prevent t2d in people with prediabetes is constantly being studied.22 a systematic review reported that no single agent could be recommended to delay or prevent t2d . \n in addition , the authors of the review suggested that longer follow - up studies are needed in order to assess safety and efficacy.23 since then , the dream study reported that the use of rosiglitazone ( 8 mg daily ) reduced t2d incidence after 3 years in patients with prediabetes and recommended its clinical usage.24 \n using mostly randomized controlled trials ( rcts ) , this review aims to discuss the current literature on the benefits of lifestyle modifications in reducing the incidence of t2d and body weight , and improving glycemic control in individuals with prediabetes . even though a few articles included in the current review did not exclusively recruit individuals who were considered overweight or obese at baseline , all studies aimed to reduce body weight as part of their objectives , and most did subanalysis with body mass index ( bmi ) subcategories . \n all studies included in this review had individuals with prediabetes defined by either ifg and/or igt . \n the originality of this review resides in the fact that it distinguishes the independent and combined effect of diet and exercise in individuals with prediabetes . \n a pubmed search was done in march 2014 using the following boolean phrases : prediabetes and lifestyle intervention ; prediabetes and exercise intervention ; prediabetes and diet intervention . from these searches , 6 , 30 , and 72 articles , respectively , were found . \n filters pinpointed articles that were published in english and involved human adults , and participants were overweight or obese and classified as having prediabetes either by ifg or igt . \n articles with an intervention exploring the impact of diet , exercise , or both were included in this review . \n this review will start by discussing the impact of lifestyle modification ( diet + exercise ) on the incidence of t2d , glycemic control , and weight loss . \n second , the impact of diet alone on the same outcomes is discussed , and , finally , the impact of exercise alone on the incidence of t2d , glycemic control , and weight loss is discussed . \n if that was the case , the results of these studies were discussed in all three sections ( diet + exercise , diet , exercise ) of the review . \n in the past 20 years , a growing interest on the effect of exercise and diet in the reduction of prevalence and incidence of t2d has been observed in the scientific literature . the diabetes prevention program ( dpp),14 the finnish diabetes prevention study ( dps),17 and the da - qing trial25 are seen as milestones in the field because of their strong design , large sample size , and long - term follow - up . \n together , they have significantly enhanced the knowledge with regard to the impact of lifestyle ( exercise + diet ) modifications on the incidence of t2d and glycemic control in individuals with prediabetes . even though some argue that these lifestyle interventions were cost effective,26 others \n have reported that the cost was too high and the required resources were too considerable to implement them widely.27 some even criticized that the results observed in those large trials were optimistic because those studies included volunteers.28 in the dpp study,14 3,234 overweight individuals with prediabetes were recruited and randomized to one of three groups : 1 ) placebo , 2 ) metformin , and 3 ) lifestyle intervention . \n the lifestyle intervention group was asked to reduce their body weight by 7% by creating an energy deficit with diet ( healthier diet ) and exercise ( > 150 minutes per week ) by using a one - on - one approach for 24 weeks with weekly meetings , and then monthly contacts afterward . \n the main goal was to compare the incidence of t2d across the three groups with the hypothesis that the lifestyle intervention would provide a greater reduction in incidence of t2d . \n after 2.8 years , the lifestyle intervention group had a reduction of 58% in the incidence of t2d compared to the placebo group . when performing a subanalysis , obese individuals had a slightly greater reduction in the incidence of t2d ( 61% ) . \n interestingly , the benefit of the lifestyle intervention was maintained after 10 years follow - up where the reduction in the incidence of t2d was still 34% lower in the lifestyle group compared to the placebo group.15 in terms of glycemic levels , both fasting plasma glucose and hba1c were lower in the lifestyle modification group compared with the control group after the initial study lasting a mean of 2.8 years.14 exactly the same findings were reported after 10 years of follow - up.15 together , these results strongly suggest that lifestyle intervention is a cornerstone in the management of prediabetes in both overweight and obese individuals . in 2006 , ramachandran et al29 reported similar results when replicating the method with native asian indians who are known to be at high risk of t2d . over a follow - up of 30 months , \n including a total of 531 native asian indians with prediabetes , the study has shown that it was possible to reduce the incidence of t2d in this high - risk population when combining diet and exercise , compared to the control group ( incidence of 39.3% vs 55.0% , respectively ) . similarly to the dpp , the dps study included 522 overweight men and women with igt randomized to either a control or a lifestyle group ( diet + exercise ) in finns instead of americans . \n the lifestyle intervention aimed at reducing the body weight by a minimum of 5% by reducing total calories from fat , saturated fat , and increasing fiber , in addition to doing 30 minutes more of physical activity per day.17 after a follow - up of 3.2 years , the incidence of t2d was reduced by 58% in the lifestyle group . \n compared to the control group , in which a mean reduction of 0.8% was observed in fasting glucose and 5.4% on the 2-hour ogtt , a mean change in fasting glucose of 3.6% ( p0.001 ) and a mean change of 15.3% on the 2-hour ogtt ( p=0.003 ) was observed in the lifestyle group . when followed for another 7 years , \n the reduction in relative risk for t2d was still 36% lower in the lifestyle group compared to the control group.30 in 2009 , the european diabetes prevention study extended the dps to different european populations using the same study design and found similar results.31 after a mean duration of 3.1 years , the absolute incidence of t2d was 32.7 per 1,000 person - years in the lifestyle intervention group compared with 67.1 per 1,000 person - years in the control group . in the da \n qing study,25 577 individuals with igt were recruited , from whom 322 ( 55.8% ) were overweight or obese . \n they were randomized to a control group , a diet group , an exercise group , or a group combining both ( lifestyle group ) . \n participants were instructed to increase physical activity by one to two units per day , one unit equaling 30 minutes of light exercise , 20 minutes of moderate intensity exercise , 10 minutes of strenuous exercise , or 5 minutes of very strenuous exercise . \n a total of 30 visits were scheduled for each group : weekly for the first month , monthly for the next 3 months , and once every 3 months thereafter . \n the diet targeted a reduction of 0.51.0 kg / month by caloric restriction . as a result , \n the incidence of t2d in participants who received the lifestyle intervention had a mean of 46% , the diet group 44% , and the exercise group 41% when compared to the control group , in which the incidence was 68% . \n more details about the independent impact on the groups using only diet and only exercise are given in the next sections . \n after 6 years , the values of fasting glucose and the 2-hour ogtt increased in both lifestyle and control groups , but a smaller increase was observed in the group of participants receiving the lifestyle modification program . \n for example , the ogtt result increased by 29.7% in the control group compared to 19.4% in the intervention group . \n when evaluating this intervention over a 20-year follow - up,16 the authors combined all participants receiving one or the other treatment in the initial study ( diet , exercise , and both ) and compared them with the control group . \n the results showed a 43% lower incidence of t2d , and participants in the lifestyle group spent 3.6 fewer years with diabetes compared with participants in the control group . \n both the fasting glucose and the 2-hour glucose level following an ogtt were significantly different between participants in the lifestyle modification program and participants in the control group . \n mmol / l ( 156.675.6 mg / dl ) ( p<0.05 ) in the control group . \n despite the convincing results of the benefits of lifestyle modification using diet and exercise to reduce t2d incidence , there is some concern about the high cost and the necessary resources to conduct these interventions . as a result , \n many studies have tried to reproduce similar findings with a cost - effective approach since then . \n the control group received lifestyle advice once per year , while the intervention group received lifestyle advice four times in 12 months ( 7.5 times less than the dpp study ) . \n the goal was to create a caloric deficit by exercise and diet and reduce body weight by about 5% . \n the results have shown that lifestyle modification could prevent the incidence of t2d in individuals with prediabetes by 59% . \n both the fasting glucose ( p=0.02 ) and the 2-hour glucose level following an ogtt ( p=0.001 ) were significantly different between participants in the lifestyle modification group and the control group . \n after 12 months of intervention , an increase in walking time was observed in the intervention group , but no difference was observed in total caloric intake , suggesting that exercise such as walking was the cornerstone of better glycemic control in the intervention group . \n these results also suggest that lifestyle modification is effective in reducing t2d incidence , even with a less intensive intervention . \n another study tried to replicate the dpp findings in a cost - effective way33 by focusing on changing the participant s lifestyle using a combination of individual and group meetings . \n individuals with prediabetes were randomized to either a 1-year lifestyle modification which included individualized counseling every 6 weeks and 25 weekly optional group seminars or to a group receiving only access to group seminars . \n the last group was considered as the control group because no individual sessions were offered . while both groups significantly improved their fasting blood glucose , only a significant reduction on the 2-hour ogtt ( p0.05 ) \n was observed in the intervention group ( receiving individual sessions in addition to group seminars ) . \n in addition , noone developed t2d in the group + individualized sessions during the intervention compared with 11.5% in the control group . \n gagnon et al33 concluded that the cost of their program combining group and individual sessions was about $ 81 per year , which is much less than the yearly estimated cost of the dpp ( $ 926 per year).34 controversially , using a longer follow - up , and more individual appointments compared with the study of gagnon et al,33 oldroyd et al35 conducted a lifestyle modification program randomizing participants with igt to a control or an intervention group . \n the intervention group aimed to reduce bmi to 25 kg / m through diet and exercise ( > 2030 minutes daily ) . over the first 6 months \n , individuals in the lifestyle intervention group received twelve individual appointments with a dietitian and a physiotherapist , while no advice was provided for individuals in the control group . \n after a total of 24 months , the incidence of t2d was not significantly different between groups ( 22% in each group ) , which means that there was no improvement between groups in both fasting glucose and the 2-hour plasma glucose after 12 months and 24 months . \n even though the authors argued that their results were similar to those observed in more intensive trials because of a significant change in insulin sensitivity , this study suggests that the intervention in lifestyle modification programs needs more than 12 individual visits to optimize the reduction in t2d incidence . \n a recent study also tried to implement a lifestyle modification program similar to the dpp in 301 overweight and obese adults with prediabetes in a cost - effective way using community resources.36 the study design compared the group undergoing the lifestyle modification program to a control group . \n the lifestyle intervention aimed to reduce body weight by 7% by increasing physical activity levels and reducing energy intake . \n after 24 months , the authors showed a significant decrease in fasting blood glucose ( mean difference 2.0% ; p<0.01 ) compared with the control group . \n this study highlights that an intervention held in community - based sites and administrated by registered dietitians and community health workers is efficient in improving glycemic control in individuals with prediabetes with a modest weight loss . \n however , even though the intervention was mostly group meetings and run by community workers , participants in the intervention group were also met weekly for the first 24 weeks , had three individual meetings , and were contacted biweekly thereafter . \n the typical weight loss recommendation to improve metabolic health , specific to overweight and obese individuals with prediabetes , ranges between 5% and 10% of the initial body weight.37 one study has reported that weight loss is one of the most important predictors of change in glucose tolerance , suggesting that even a slight weight loss is enough to improve glycemic control in individuals with prediabetes.38 most studies including individuals with prediabetes show that lifestyle modification programs using diet and exercise are effective in reaching that recommendation . \n for example , the lifestyle intervention group in the dpp study reduced their body weight by a mean of 5.6 kg ( 6.3%).14 in a sample of slightly older subjects ( mean = 557 years vs 5111 years),17 the dps study reported a mean weight loss of 4.25.1 kg ( 4.7% ) following a lifestyle intervention program . \n these results are meaningful because they were observed after 2.8 years and 3.2 years , respectively . \n similarly , the da qing study reported a meaningful decrease in bmi after a 6-year follow - up , but after a 20-year follow - up the body weight was not significantly different between the control and the intervention group , even though the incidence of t2d was reduced by 51%,16 suggesting that initial weight loss is important despite slow weight regain over many years . to sum up , most studies investigating the impact of modifying diet along with exercise in individuals with prediabetes , in order to improve glycemic control , support that lifestyle modification is effective in reducing the progression of prediabetes toward t2d \n however , more studies are needed to determine how intense ( eg , the number of meetings , group / individual ) those interventions need to be in order to observe optimal benefits , and whether exercise or diet alone can offer similar benefits . \n in addition , it is still unclear how to deliver such interventions at the population level in a cost effective way . \n in this section , we pinpoint interventions that independently evaluated how dietary modification might impact glycemic control or body weight in individuals with prediabetes . \n surprisingly , only a few well - designed studies have looked at diet alone25,3942 as a strategy to improve glycemic control or body weight in individuals with prediabetes.22,3538 nonetheless , some studies with both diet and exercise interventions showed significant changes in glycemic control or body weight in individuals with prediabetes . \n for example , the dpp study focused on a low - calorie diet and a low - fat diet by doing one - to - one meetings on a weekly basis for the first 24 weeks , and monthly group meetings afterward to reinforce behavioral changes.14 the dps17 focused on the diet intervention on the total intake of fat , and more particularly on saturated fat ( < 10% ) and fiber intake ( 15 g/1000 kcal ) . \n for example , they recommended the consumption of whole - grain products , fruits , low - fat milk , low - fat meat , soft margarines , and monosaturated oils . \n the following section reports studies that have looked at the impact of diet alone on glycemic control or body weight in individuals with prediabetes . \n watanabe et al42 randomized individuals with prediabetes to either a dietary education program aimed at reducing total daily energy intake by reducing energy intake at dinner time or a control group who received general recommendations on healthy eating . \n the purpose of this 1-year study was to investigate whether the dietary education program was capable of reducing body weight and improving glycemic control in individuals at high risk of diabetes . \n the results showed that the diet group significantly reduced energy intake by 15.3% compared to 6.0% in the control group . \n this reduction was associated with a 15% improvement in glucose tolerance in the diet group . \n therefore , they concluded that reducing the overall calories improves glycemic control in individuals with prediabetes . \n specific to diet quality , swinburn et al41 investigated the long - term effect of a diet aimed at reducing fat intake , using an ad libitum diet , on body weight and glycemic control in individuals with prediabetes . after a 1-year dietary intervention \n , they observed a significant reduction in body weight for participants in the intervention group ( 3.3 kg ; p=0.03 ) . \n this change in body weight was associated with a reduction in the proportion of individuals who developed t2d in the diet group compared to the control group ( 47% vs 67% ) . despite this interesting result , the body weight that was lost \n in addition , the difference in incidence of t2d between both groups did not remain statistically different . at year 5 \n , secondary analysis was performed and an overall effect of the intervention on glucose tolerance was found in compliant participants ( still eating less fat ) , but this difference disappeared when controlling for the total calorie intake . therefore , this study suggests that the long - term effect of a diet on the incidence of t2d is mainly driven by the total caloric intake , in individuals with prediabetes . \n controversially , a subanalysis of the dps study39 showed that specific diet components were important to predict t2d incidence in people with prediabetes . \n the authors teased out the contribution of fat and fiber as independent predictors of weight loss and the incidence of t2d in individuals with igt . \n they reported that individuals in the highest quartile of fat consumption were 55% less likely to reach a minimum weight loss of 5% , while individuals in the highest quartile of fiber were 2.6 times more likely to reach 5% weight loss after 3 years of follow - up . \n similarly , a 62% decrease in the risk of incidence of t2d was observed for individuals in the highest quartile of fiber , while individuals in the highest quartile of fat were 2.1 times more likely to develop t2d . when fiber and fat were combined into a single variable , \n the authors compared high fat / low fiber to the reference group ( low fat / high fiber ) and observed an 89% increase in the likelihood of developing t2d over the follow - up period . \n these results strongly suggest that the management of macronutrients such as fat and fiber is an important factor to be considered in the prevention of t2d . in the da qing study,25 \n the diet was composed of 55%65% carbohydrates , 10%15% proteins , and 25%30% fats . during the counseling sessions \n , it was suggested to increase vegetables consumption , control alcohol intake , and reduce simple sugar in order to reduce total caloric intake . \n the weight loss goal was 0.51.0 kg per month until participants reached a bmi of 23 kg / m . \n change in body weight was not significant in the diet group compared with the control group , which might be explained by the fact that the diet group did not decrease the total energy intake despite a change in macronutrients . \n nevertheless , the diet group had a significantly lower incidence of t2d compared with the control group ( 43.8% vs 67.7% ; p<0.05 ) after 6 years of follow - up . \n when the findings were restricted to the overweight and obese individuals , the results were similar , with a 6-year lower incidence of diabetes ( 100 person - years ) in the diet group : 11.5 ( 8.015.0 ) compared to the control group 17.2 ( 13.321.3 ) p<0.05 . \n this study concluded that diet is an intervention that significantly reduces the incidence of t2d in overweight and obese individuals with igt , despite the absence of weight loss . a study in 2013 by gagnon et al33 looked at whether an individualized dietary intervention of 3 months , in 65 individuals with prediabetes , had the same impact on fasting blood glucose and body weight compared to a group receiving group sessions during the same period . \n both groups significantly improved their fasting blood glucose without any significant change in body weight after 12 months . \n however , it should be noted that hba1c improved in the group receiving individual sessions , but not in the other group . \n this suggests that some advantage might be obtained by doing individual versus group sessions if the resources are available . to sum up , dietary interventions evaluating the ability to induce a significant reduction on body weight and improve glycemic control in individuals with prediabetes are scarce , as the main focus has been on caloric restriction . \n there is a gap to be filled in understanding the benefits on modifying macronutriments and/or micronutriments to influence glycemic control with or without weight loss in individuals with prediabetes . for the moment \n , the literature available suggests that reducing caloric intake can lead to an improvement in glycemic control despite no or modest weight loss . \n in addition , one well - designed study has provided information that reducing fat intake and increasing fiber intake might be a strategy that could lead to a reduction in t2d incidence in people with prediabetes.39 \n this section discusses how increasing exercise levels impacts glycemic control and body weight in individuals with prediabetes . \n surprisingly , even though exercise is considered a cornerstone in the management of obesity43 and t2d,44 not many well - designed studies have investigated the independent effect of exercise and the best mode ( eg , resistance training , walking ) of exercise on body weight and glycemic control in individuals with prediabetes . \n another lacking component is whether the intensity of exercise is an important factor in optimizing the health benefits . despite the lack of such information , most physical activity guidelines suggest doing two types of exercises : aerobic and resistance training.45,46 a recent meta - analysis provided insight into whether a combination of lifestyle interventions including diet , aerobic exercise , and resistance training was effective at reducing body weight and improving glycemic control to prevent t2d47 and concluded that doing resistance training on top of aerobic exercises and diet did have additional benefits . \n even though the independent impact of exercise is unknown in studies using diet + exercise to reduce t2d incidence , in people with prediabetes some studies showed significant changes in glycemic control or body weight in individuals with prediabetes , and their exercise program must be noted . even though not many details were given on the exercise recommended in the dpp \n study,14 it was reported that information was given on a one - on - one basis to participants so that they would reach a minimum of 150 minutes weekly of moderate intensity aerobic exercises . on the other hand , \n aerobic exercises were recommended , but supervised resistance training sessions were also offered . in both of the dpp and the dps , no detail was given of how the exercise intensity was monitored . \n the dps also reported , later in 2010 , that , as participants increased their physical activity level ( highest tertile of change ) , they were more likely to reduce their fasting glucose even when the results were adjusted for changes in dietary intake and change in body weight.48 some studies have compared the impact of resistance training , aerobic training , and both on glycemic control and body weight . \n for example , a study explored the impact of different exercise modalities in individuals with prediabetes.49 in this study , 26 sedentary men were recruited and randomized in the resistance training group , aerobic group , or control for an intervention lasting 20 weeks . \n both exercise modalities showed results that were successful at normalizing glucose levels compared with the control group , with no difference between the exercise modality groups . using a 6-year follow - up , \n pan et al,25 with the da qing study , tested the independent impact of exercise on individuals with igt . \n the exercise intervention consisted of encouraging the 141 participants in that group to increase aerobic physical activity by a minimum of one to two exercise units , defined as 30 minutes of light exercise , 20 minutes of moderate intensity , 10 minutes of vigorous intensity , or 5 minutes of very strenuous exercise per day , for 6 years . \n counseling sessions were conducted once a week for the first month , monthly for the next 3 months , and every 3 months for the remainder of the study . \n the exercise units went from 3.42.8 to 4.03.0 in the exercise group during the 6-year follow - up , which turned out to be a nonsignificant increase . \n changes in bmi were not different in the exercise group compared to the control group ( 0.9 unit in each group ) , but the incidence of t2d was about three times lower in the exercise group compared with the control group ( 5.1 [ 95% confidence interval { ci } : 2.67.6 ] vs 13.3 [ 95% ci : 8.917.7 ] ) ; p<0.01 ) . \n the exercise group has even reported a smaller incidence of t2d compared with the diet + exercise group ( 41% vs 46%).25 secondary analysis restricted to overweight and obese individuals showed a lower incidence of t2d in the exercise group compared to the control group ( 11.5 [ 95% ci : 8.015.0 ] vs 17.2 [ 95% ci : 13.321.3 ] ; p<0.01 ) . \n the conclusion made was that exercise alone was as effective as diet + exercise to reduce diabetes incidence in individuals with igt despite no significant change in body weight . \n this conclusion is aligned with studies showing the benefits of exercise without weight loss50 or with the concept of fit - fat which suggests that high fitness attenuates the risk of t2d and cardiovascular diseases independent of body weight.51 in 2012 , malin et al52 recruited individuals with prediabetes with 32 participants in four different groups : exercise + placebo , metformin , exercise + metformin , or placebo . \n all groups increased insulin sensitivity compared to baseline ( p<0.05 ) , but the exercise + placebo group had a greater improvement ( 25%30% ) compared to the other groups . \n in addition , the improvement in insulin sensitivity was only significantly different in the group exercise + placebo compared to the control group , while no such difference was observed in the group exercise + metformin , which suggests that the benefits of exercise were even counteracted when consuming metformin . \n more recently , a study aimed at testing whether walking alone was sufficient to influence glycemic control and whether there was an advantage in combining both resistance training and walking in individuals with prediabetes.53 sixty - one participants ( age 49.84.8 years ) with prediabetes were randomized to the control group , the walking group , or the walking group + resistance training for a 24-week duration . \n the walking group was exercising at 60%70% of maximum heart rate for a duration of 50 minutes , four times per week , while the walking group + resistance training was walking for 20 minutes and doing resistance training for 30 minutes using seven different exercises ( two to three series of 15 repetitions ) . \n the results showed that both intervention groups showed a significant improvement in glycemic control as reflected by glucose disposal , fasting insulin , and insulin resistance , compared with the control group , but no difference was observed between the two exercise interventions . \n the authors concluded that walking was sufficient to improve glycemic control in individuals with prediabetes . to sum up this section , \n the current literature supports the use of exercise alone to reduce t2d incidence in people with prediabetes , even when no significant weight loss is observed . \n however , not many details on the optimal intensity , duration , or type of exercise to optimize the effect are available . in general , the successful studies have combined 12 days of resistance training in addition to aerobic exercise at moderate intensity for about 150 minutes weekly . \n in conclusion , there are currently many well - designed studies that show that lifestyle modifications , including exercise and diet , are associated with improvement in glycemic control , which translates into a reduction in t2d incidence in individuals with prediabetes . \n the current literature suggests that the reduction of t2d incidence observed during lifestyle modification is not necessarily associated with a significant reduction in body weight . \n the independent effects of diet and exercise in individuals with prediabetes on glycemic control and body weight need to be addressed in more detail . \n currently , it is not clear whether we should target a specific macronutrient or what exercise modality should be emphasized to optimize the benefits for individuals with prediabetes . \n more rigorous studies with long - term follow - up are needed to evaluate the impact of different macronutrients and exercise modality on glycemic control and weight loss in such individuals . \n however , despite the lack of details , lifestyle modifications definitely improve short- and long - term glycemic control and need to be promoted in clinical settings .", "role": "user" }, { "content": "prediabetes is defined as impaired fasting glucose and/or impaired glucose tolerance . \n impaired fasting glucose is usually defined as fasting blood glucose between 5.6 mmol / l and 6.9 mmol / l ( 100.8124.2 mg / dl ) , and impaired glucose tolerance is the 2-hour oral glucose tolerance test of 7.811.0 mmol / l ( 140.4198.0 mg / dl ) . most individuals with prediabetes are overweight or obese and are at greater risk of type 2 diabetes ( t2d ) . \n the first line of treatment for individuals with prediabetes is lifestyle modification , including diet and exercise . \n the aim of this review , through the revision of primarily randomized control trials , is to discuss the independent and combined effect of diet and exercise on the incidence of t2d , glycemic control , and weight loss in adults with prediabetes . \n based on the available literature , lifestyle modification combining both diet and exercise is effective at reducing the incidence of t2d and improving glycemic control , even without a significant reduction in body weight . \n thus , it is unclear whether weight loss , through lifestyle modification , is a cornerstone for improving glycemic control in individuals with prediabetes . \n the independent effect of diet or exercise alone on the improvement in glycemic control and/or reduction in body weight in individuals with prediabetes still requires more studies to draw a clear conclusion , considering the quality and quantity of available studies . \n as of now , the best diet and/or exercise program to improve glycemic control and body weight in adults with prediabetes is unknown .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a major effort in functional glycomics \n is to catalog the specificities \n of glycan - binding proteins ( gbps ) toward the diversity of glycan structures \n found in biological systems . in nature , the typically weak binding \n interactions between gbps ( e.g. , lectins or antibodies ) and individual \n glycans are augmented by their organization in multivalent displays \n on glycoprotein scaffolds . in many instances , \n the glycan structure alone is not sufficient to generate a recognition \n event below a certain epitope density threshold . \n the multivalency of glycoproteins is mirrored in gbps that \n frequently possess more than one glycan - binding site . as a consequence , \n there are a number of different modes through which gpbs and glycoproteins \n can engage each other . \n for instance , mucins , highly glycosylated proteins \n that populate surfaces of cells , can serve as discrete ligands for \n oligomeric lectin receptors . \n an example \n of this type of interaction is the binding of the macrophage galactose - type \n lectin ( mgl ) receptors on dendritic cells \n to muc1 , an aberrantly glycosylated mucin overexpressed in tumors \n ( figure 1a ) . \n mucins \n can also be cross - linked by lectins to form active receptor complexes \n and elicit downstream signaling events . \n for instance , galectin-1 cross - linking of the mucin - type cd43 receptor \n complexed with cd7 triggers apoptosis in human t cells ( figure 1b ) . \n as well , glycoprotein \n clustering has been suggested as a regulatory mechanism for the maintenance \n of cell - surface glycan density gradients required for innate immunity . \n understanding the factors that determine if mucins \n will form discrete complexes with lectins or become cross - linked is \n critical not only for our basic understanding of mucin biology , but \n also for our ability to exploit these events for therapeutic gains . \n schematic \n representation of two major binding modes between mucins \n and multidomain lectin receptors . \n ( a ) the oligomeric macrophage galactose - type \n lectins ( mgls ) of dendritic cells form discrete adhesion complexes \n with muc1 overexpressed on cancer cells . \n ( b ) galectin-1 cross - linking \n of the mucin - type glycoprotein cd43 and cd7 triggers apoptosis in \n t - cells . \n techniques such as inhibition binding assays , isothermal \n titration \n calorimetry , or surface plasmon resonance are routinely used to study \n multivalent glycan receptor interactions . \n however , they do not yield themselves to the kind of rapid \n and high - throughput analysis that is required for systems - level analysis \n of glycan - binding proteins that are emerging from functional glycomics \n programs . \n glycan microarrays are now considered essential tools for \n determining the ligand specificities of gbps . in a traditional platform , individual monovalent glycans are attached \n to the array surface via a linker molecule giving a multivalent display \n that is sufficient to elicit a high - avidity binding event ( figure 2a ) . \n ( a ) traditional \n glycan arrays rely on two - dimensional arrangements of monovalent glycans \n with very little control over spatial organization . \n ( b ) glycan presentation \n on polymeric scaffolds more closely mimics that in native mucins . \n ( c ) left : serine- and threonine - rich domains decorated with branched \n glycans initiating with a core sugar , -n - acetylgalactosamine \n ( -galnac ) , are the hallmark of mucins . \n right : a mucin - mimetic \n domain generated by oxime ligation of -aminooxy - galnac to a \n poly(methylvinyl ketone ) backbone . \n because of poor control over spacing between adjacent \n epitopes \n and the two - dimensionality of their presentation on an irregular surface , \n the current arrays yield very little information beyond indicating \n which glycan structures are preferred by a specific gbp \n . an array \n allowing high - throughput interrogation of glycans in a more physiologically \n relevant context ( e.g. , in arrangements found in native mucins , figure 2b ) would provide additional information about how \n valency and spatial organization of glycans govern their recognition \n by gbps . \n recently , pieters and \n gildersleeve and their co - workers explored \n the use of multivalent \n ligands ( i.e. , glycodendrimers and bovine serum albumin ( bsa)-based \n neoglycoconjugates , respectively ) to control the valency of glycan \n display in microarrays on a biologically relevant scale . \n their studies \n revealed distinct preferences of lectins and antibodies to engage \n the microarrayed glycoconjugates with particular ligand valencies . \n in addition , the gildersleeve team showed that reducing the neoglycoconjugates \n surface density eliminated cross - linking of adjacent array - bound ligands \n and enabled the identification of high - avidity inhibitors of gbps . \n while the dendrimer and bsa scaffolds are well \n suited to mimic small globular low - valency glycoproteins ( e.g. , < 40 \n glycans per bsa glycoconjugate ) , they have limited applicability as \n models for mucins . \n the heterogeneous glycosylation of native \n mucins complicates their \n direct use in glycan arrays ; however , their fundamental architectural \n features can be recapitulated in linear synthetic glycopolymers with \n a great degree of control over glycan structure , valency , and presentation . \n there is a rich history of glycopolymers serving as soluble multivalent \n ligands that bind cell - surface receptors and activate biological processes . \n as well , surface - bound glycopolymers have been \n shown to bind to protein receptors with higher avidity than immobilized \n monovalent glycans . despite their \n structural diversity , \n all mucin glycans share a common \n -n - acetylgalactosamine ( galnac ) core sugar \n through which they are attached to serine or threonine residues of \n the mucins polypeptide backbone ( figure 2c ) . \n mucins decorated with only the galnac monosaccharide ( called \n the tn antigen ) result from aberrant glycosylation associated with \n tumor progression . because of tn antigen s \n biological significance , we have previously synthesized mucin mimetic \n glycopolymers displaying -galnac residues attached to poly(methylvinyl \n ketone ) ( pmvk ) backbones via oxime linkages ( figure 2c ) . \n micropatterns of these glycopolymers \n immobilized on silicon oxide wafers were recognized by the -galnac - specific \n lectin helix pomatia agglutinin ( hpa ) . \n dynamic light scattering and transition electron \n microscopy confirmed that , just like native mucins , the mucin mimetics \n adopt extended conformations . \n moreover , the polymers can be endowed \n with a range of surface anchors , as well as optical probes for imaging \n and quantitation , making them ideally suited for microarray applications . \n interferometric imaging of fluorescently labeled mucin mimetics anchored \n in supported lipid bilayers through a lipid tail revealed their fluidity \n and extension away from the bilayer surface , a behavior attributed to mucins populating cellular membranes . here \n , we describe the construction of a mucin mimetic glycopolymer \n microarray and its use as a tool to rapidly and quantitatively evaluate \n the potential of a panel of tn antigen - binding lectins to cross - link \n polyvalent mucin - like glycoconjugates . our array platform revealed \n a strong preference of the tested lectins to engage the surface - bound \n polyvalent mucin - like ligands mainly through the formation of discrete \n adhesion complexes rather than by cross - linking . \n all chemicals , unless stated otherwise , were \n purchased from sigma - aldrich . \n chain transfer agent 2 and -aminooxy - galnac ( 5 ) were synthesized according to previously published procedures . \n blocker casein solution in phosphate buffered saline ( pbs ) was purchased \n from thermo fisher and filtered through a 0.2 m filter prior \n to use . \n glycine \n max ( soybean ) agglutinin and h. pomatia agglutinin \n were purchased from sigma - aldrich , vicia villosa - b4 was obtained from e - y laboratories , wisteria floribunda lectin was purchased from vector laboratories . \n cy3-maleimide and \n alexafluor-647 n - hydroxysuccinimidyl ester ( af647-nhs ) \n were purchased from ge healthcare and invitrogen , respectively . \n sephadex \n g-25 ( pd-10 ) columns and galnac - agarose were purchased from ge healthcare \n and sigma - aldrich . \n column chromatography was performed on biotage \n sp1 flash chromatography system . nuclear magnetic resonance ( nmr ) \n spectra were recorded on a bruker biospin advance ii 500 mhz high \n performance nmr spectrometer with multinuclear cp - mas probe . \n spectra \n were recorded in cdcl3 or d2o solutions at 293 \n k and referenced to residual solvent peaks . \n size exclusion chromatography \n ( sec ) was performed on shimadzu lc-20ad prominence liquid chromatograph \n with viscotek ve 3580 ri detector . for measurements in dmf ( 0.2% libr ) \n , \n the instrument was equipped with two in - series mixed bed gmhhr - m columns , \n separation range 1004 m ( 30 cm 7.8 mm i.d . ) at 70 c . \n microarrays were fabricated on nexterion slide - s streptavidin - coated \n glass substrates ( schott ) using the derisi linear servomotor microarrayer \n ( center for advanced technologies at ucsf ) equipped with 75-m \n silicon petc pins from parallel synthesis technologies , inc . \n microarrays \n were scanned on axon genepix 4000b scanner and analyzed by genepix \n pro 7.0 software . \n vis spectra were collected on a perkin - elmer \n lambda 35 uv / vis spectrometer . \n molecular weight analysis of lectins \n was performed on ge healthcare akta fplc equipped with superdex 200 \n column equilibrated at 4 c in either 10 mm tris buffer ( 150 \n mm nacl , ph = 8.5 ) for hpa and wfl or 10 mm sodium phosphate buffer \n ( 150 mm nacl , ph = 7.3 ) for sba and vva . \n a flame - dried schlenk flask ( 10 ml ) equipped with \n a magnetic stirring bar was charged with 2 ( 22.8 mg , \n 0.036 mmol , 0.58 mol % ) , acva ( 4,4-azobis(4-cyanovaleric acid ) , \n 2.9 mg , 0.010 mmol , 0.17 mol % ) , and mvk ( 1 , 437.2 mg , \n 6.238 mmol , freshly distilled ) . \n the flask was equipped with a rubber septum and attached to a schlenk \n line . \n the yellow solution was degassed by three freeze pump thaw \n cycles . after the final cycle , \n the flask was backfilled with n2 , allowed to warm to room temperature and immersed into an \n oil bath preheated to 65 c . after 16.5 h \n , the reaction mixture \n was diluted with ch2cl2 and precipitated by \n the addition of hexanes . \n the residue was redissolved in a minimal \n quantity of ch2cl2 and precipitated again by \n the addition of hexanes with vigorous stirring . \n the yellow polymer was concentrated from chloroform three \n times to remove residual hexanes and dried under high vacuum overnight \n to give polymer 3 as a pale yellow solid ( 376.2 mg , 82% ) . \n for h nmr spectrum see supporting \n information . \n sec ( dmf , 0.2% libr ) : mw = 15.08 kda , mn = 13.18 kda , dp = 205 , \n pdi = 1.12 . \n polymer backbone 7 was prepared in \n an identical manner , except 50:1 mvk to cta ratio was employed . \n polymer 7 was isolated as a yellow solid ( 92% ) . for h \n nmr spectrum see supporting information . \n sec ( dmf , 0.2% libr ) : mw = 4.91 kda , mn = 4.35 kda , dp = 60 , pdi = 1.13 . \n pmvk 3 ( 50 mg , 0.004 mmol ) was dissolved in dmf ( 1.5 ml ) in a 20-ml scintillation \n vial equipped with a magnetic stir bar and a septum . to the yellow \n solution degassed by three freeze \n pump thaw cycles was \n added cysteamine solution ( free base in dmf , c = \n 632 mm , 0.018 mmol , 29 l , 5 equiv per trithiocarbonate end \n group ) under n2 . \n after this time , the solution turned colorless and ether \n ( 15 ml ) was added . \n the collected polymer 4 was dissolved \n in a small amount of chloroform and precipitated by the addition of \n hexanes . \n this was repeated twice more and the final white solid ( 48.2 \n mg , 96% ) was dried under vacuum overnight . for h nmr spectrum \n see supporting information . \n sec ( dmf , 0.2% \n libr ) : mw = 15.23 kda , mn = 13.43 kda , pdi = 1.14 . \n polymer 8 was prepared in an identical manner and isolated as a white solid \n ( 80% ) . for h nmr spectrum see supporting \n information . \n sec ( dmf , 0.2% libr ) : mw = 4.58 kda , mn = 4.01 kda , dp = 60 , \n pdi = 1.14 . in a 4-ml vial \n equipped with a magnetic stir bar , the free thiol - terminated polymer \n intermediate 4 ( 5.55 mg , 3.54 10 mmol ) was dissolved in dmf containing ethylenediamine ( 4.5 mm , 0.20 \n ml ) and cy3-maleimide ( 0.40 mg , 6.02 10 mmol , 1.7 equiv ) . the solution was degassed and allowed to stir \n at room temperature for 18 h. after this time , the reaction mixture \n was diluted with ch2cl2 and precipitated by \n the addition of hexanes . \n the resulting cy3-labeled polymer was divided \n into five eppendorf tubes ( 1.03 mg / tube , 0.007 mmol of keto groups ) \n and dissolved in thf ( 39.4 l ) . \n aliquots of a solution of -aminooxy - galnac \n ( 5 , c = 0.5 m in 100 mm sodium phosphate , \n ph = 5.2 ) were added to each tube to obtain -aminooxy - galnac / keto \n group molar ratios of 0.3 , 0.5 , 0.6 , 0.8 , and 1.0 . \n additional phosphate \n buffer was added to bring the final volume in each tube to 60.0 l \n ( cketone = 250 mm ) . \n the tubes were closed \n and placed in a heating block and the reaction was allowed to proceed \n at 50 c for 20 h. after this time , the reaction mixtures were \n loaded onto a sephadex g-25 ( pd-10 ) desalting column . \n the polymers \n were eluted with di water and the collected fractions were lyophilized \n to give polymers 6 . on the basis of absorbance at max = 550 nm , \n the extent of labeling of polymers 6a e was determined to be 0.99 0.22 cy3-labels \n per chain . \n polymer 8 was elaborated into the low valency \n glycopolymer 9 according to the same procedure using \n an -aminooxy - galnac / keto group molar ratio of 0.4 . \n ligation \n efficiencies listed in scheme 1 were determined \n by h nmr analysis in d2o ( spectra for all polymers \n are included in supporting information ) . \n we were unable to confirm the molecular weights of the resulting polymers \n by sec ( 100 mm nano3 , 40 c ) analysis using conventional \n calibration methods , due to their increased retention with respect \n to the globular peo and dextran standards on stationary phases available \n to us ( shodex qhpak sb-804-hq and viscotek gmpwxl ) . \n to a solution \n of lectins ( 2 mg / ml ) in sodium carbonate buffer ( 100 mm , ph = 8.3 ) \n containing free galnac ( 200 mm ) was added a solution of af647-nhs \n ester in dmso ( c = 10 mg / ml , 4 equiv ) . \n the resulting \n mixture was allowed to react at room temperature for 2 h. after this \n time , the solution was loaded onto a sephadex g-25 pd-10 desalting \n column and eluted with pbs ( 100 mm , ph = 7.2 ) buffer . \n the lectins \n were spin - dialyzed against pbs to remove any free galnac , loaded onto \n a short galnac - agarose affinity column and washed with pbs . \n the bound \n lectins were released from the column with a solution of free galnac \n ( 200 mm in pbs ) . \n the eluted fractions were once more spin - dialyzed \n against a storage buffer to remove free galnac . \n the final protein \n concentrations and extent of labeling were determined by uv vis \n ( buffers , extinction coefficients at = 280 nm , and labeling \n efficiencies for all lectins are listed in table s2 in the supporting information ) . to eliminate self - quenching \n during microarray analysis \n , the af647-labeled lectins were diluted \n with the corresponding unlabeled protein to obtain a degree of labeling \n of 0.050.10 af647 dyes per lectin molecule . in an eppendorf tube equipped with a stir bar , w. floribunda agglutinin ( 1.33 mg ) \n was dissolved in a solution \n of dithiothreithol in pbs ( 0.35% , 0.67 ml ) . \n the solution was degassed \n for 15 min and then stirred under n2 for 4 h. upon addition \n of 4-vinylpyridine ( 5.33 l ) , a white precipitate began to form , \n which was dissolved after 15 min with additional pbs ( 1 ml ) . \n the reaction \n mixture was loaded onto a sephadex g-25 pd-10 desalting column and \n eluted with pbs buffer . \n the reduced protein was concentrated , labeled \n with af647-nhs and affinity purified as described above . \n polymers 6 were dissolved in phosphate buffer ( 100 mm , ph = 7.2 ) containing \n bsa ( 0.01 wt % ) and betaine ( 1.5 m ) at concentrations of 75 , 150 , \n and 400 nm . \n solutions of polymer 9 in the same buffer \n were prepared at concentrations of 75 , 150 , 300 , 600 , 1200 nm . \n the \n resulting solutions were spotted on nexterion slide - s while maintaining \n relative humidity ( rh ) between 60 and 65% ( more detailed printing \n parameters are included in the supporting information ) . \n after printing , the slides were stored at 4 c for at least \n 1 day to allow sufficient time for grafting of the biotinylated mucin \n mimetics to the streptavidin surface . \n grafting efficiencies of polymers 6 were determined by comparison of fluorescence intensities \n of the printed spots before ( f1 ) and after \n ( f2 ) washing of excess unbound polymer \n ( vide infra ) . \n the amount of glycopolymer ( n2 ) that remained attached to the array surface was calculated according \n to eq 1:1where cpol is \n the concentration of 6 in the printing solution and vpol is the volume of that solution transferred \n onto the microarray surface ( 0.2 nl ) . \n the average spacing \n ( ) between adjacent surface - bound glycopolymer molecules was \n calculated using eq 2:2where rspot is \n the radius of a spot and na is avogadro s \n constant ( for derivation of eq 2 see supporting information ) . \n slides spotted with \n mucin mimetics 6 or glycopolymer 9 were \n first imaged using a fluorescence scanner at excitation wavelength \n ex = 535 nm . \n they were then placed into a slide \n holder and plunged into a solution of urea ( 500 mm ) in pbs for 1 min . \n the slides were washed in pbs containing tween 20 ( 0.1% ) for 15 min \n and incubated in blocker casein in pbs or 1 h to minimize background \n due to nonspecific lectin binding . after blocking , \n the slides were \n washed with pbs for 15 min , rinsed with di water and dried by centrifugation . \n lectin \n dilution series ( 8 dilution points according to table s3 in the supporting information ) were prepared in buffers containing tween 20 ( 0.1% ) . as a negative \n control , \n sba was diluted in a buffer containing galnac ( 200 mm ) and \n incubated for 15 min prior to microarray analysis . \n adhesive flexwells \n were mounted onto the slides to separate individual microarrays and \n the solutions of lectins ( 10 l ) were added into the wells . \n the wells were sealed and the arrays were incubated in dark for 1 \n h. after incubation , the slides were dunked in a beaker filled with \n pbs to remove excess lectin , the wells were peeled off and the slides \n were washed in pbs containing 0.1% tween 20 for 10 min , pbs ( 2 \n 10 min ) , rinsed with di water , and spin - dried . \n we observed the occurrence \n of fret between the cy3 and af647 fluorophores upon lectin binding . \n therefore , the resulting slides were imaged only at ex = 653 and the 653/535 fluorescence intensity ratios were calculated \n based on the cy3 intensities collected prior to incubation with lectins . \n to obtain apparent kd values , the af647/cy3 \n intensity ratios were plotted against lectin concentrations and the \n data points were fitted according to eq 3:3where i647/535,obs is the ratio of mean fluorescence intensities of the af647 and cy3 \n labels at a given lectin concentration [ l ] and i647/535,max is the maximum fluorescence intensity ratio at \n saturation . \n dilution \n series of mucin mimetics 6b and 6e ( 5 l , c = 200 m to 98 nm ) and glycopolymer 9 ( 5 l , c = 400 m to 200 nm ) in a precipitation \n buffer ( 10 mm sodium phosphate , 150 mm nacl , ph = 7.3 for sba and \n 10 mm tris , 150 mm nacl , ph = 8.0 for hpa ) were generated in plates \n with 96 v - shaped wells by serial dilution of stock polymer solutions \n ( 200 or 400 m ) by a factor of 2 . \n to each well was added a solution \n of sba or hpa lectin ( 5 l , 60 m ) to obtain a final lectin \n concentration of 30 m . \n the plates were incubated at room temperature \n for 5 h. after this time , the plates were centrifuged at 4000 g for 10 min at 4 c . \n the supernatants were removed \n and the pelleted aggregates were washed gently 3 times with cold pbs \n buffer . to the resulting precipitates at the bottom of the wells was \n added a solution of galnac in pbs ( 100 mm , 55 l ) . the suspensions \n were agitated briefly with a pipet tip and allowed to dissociate at \n room temperature for 10 min . \n the solutions were centrifuged at 4000 g for 10 min to confirm full dissolution of the aggregates . \n the solutions were transferred into uv - transparent 96-well plates \n and their absorption was measured at ex = 280 . \n the \n absorptions were plotted against polymer concentration and fitted \n with a sigmoidal curve to give p1/2 values \n ( for precipitation curves and data analysis see supporting information ) . \n the lectin - to - polymer stoichiometries \n at half - maximal precipitation were calculated as the ratio of precipitated \n lectin ( 15 m ) and the corresponding p1/2 value . \n data points in binding isotherms correspond \n to an arithmetic average of at least 6 individual spots . \n precipitation assays were performed in triplicates , \n each data series was fitted individually and half - maximal precipitation \n concentration , p1/2 , were determined . \n p1/2 values in figure 7 are arithmetic averages for each triplicate . all errors and error \n bars represent standard deviations from arithmetic average and p - values are calculated using t test with \n two - tailed distribution and equal variance . \n we initiated our studies \n by preparing a series of fluorescent mucin mimetics displaying a range \n of galnac valencies and amenable to immobilization in microarrays . \n as shown in scheme 1 , raft polymerization of \n methylvinyl ketone ( mvk , 1 ) in the presence of a biotin - containing trithiocarbonate chain transfer \n agent 2 and a radical initiator , acva , afforded pmvk \n polymer 3 with a degree of polymerization ( dp ) of 205 \n and low polydispersity ( pdi = 1.12 ) . \n one end of the resulting polymer \n chain was terminated with a biotin handle intended for anchoring of \n the mucin mimetics to streptavidin - coated microarray substrates . \n the \n opposite end of the polymer chain was capped with a trithiocarbonate \n moiety that , upon rapid aminolysis with cysteamine in dmf , provided \n a free sulfhydryl group for conjugation of a maleimide - functionalized \n cy3 dye . \n the assembly of the mucin mimetic was then completed by condensation \n of -aminooxy - galnac ( 5 ) to the dual end - functionalized \n pmvk backbone 4 under acidic conditions at 50 c . \n by varying the relative stoichiometry of 5 with respect \n to the number of keto groups in 4 \n , we obtained five mucin \n mimetic polymers 6a e with galnac \n valencies of 68 , 92 , 111 , 146 , and 170 , as determined by h nmr analysis . \n vis spectroscopy of purified polymers 6 established the cy3 labeling proceeded quantitatively . by \n carrying the dye - conjugation step prior to galnac ligation , we assured \n that all five mucin mimetics in our series bore the same amount of \n cy3 label irrespective of galnac content , thus , facilitating the determination \n of their densities on the microarray surface . since our \n objective was to evaluate the ability of lectins to cross - link polyvalent \n glycoconjugates , we set to generate arrays of variable glycopolymer \n surface densities . \n we reasoned that , by increasing the distance between \n the surface - bound ligands , we would physically limit the ability of \n lectins to bridge adjacent glycopolymer molecules . that , in turn , \n would weaken their binding to the arrayed ligands , as long as cross - linking \n was a contributing factor to the overall lectin binding avidities \n ( figure 3 ) \n therefore , if lectins formed discrete \n complexes with the mucin mimetic ligands ( i.e. , each lectin binds \n to only one ligand ) , the observed dissociation constant ( kd ) for this interaction should be independent of the spacing \n between proximal ligands ( figure 3a ) . \n on the \n other hand , if the lectin s preference is to also cross - link \n multiple glycoconjugates , we should observe weaker binding ( higher kd ) in the low - density array , where such interactions \n would be discouraged ( figure 3b ) . \n ( a ) cross - linking by lectin does not occur and the observed dissociation \n constant should be independent of glycolpolymer surface density . \n ( b ) \n cross - linking is a contributing factor and increasing separation between \n neighboring mucin mimetic molecules should result in weaker binding \n ( kd , high and kd , low denote apparent dissociation constants determined for a lectin in \n a high and a low glycopolymer surface density array , respectively ) . using contact printing with silicon tips , we spotted \n solutions \n of biotinylated mucin mimetics 6 on streptavidin - coated \n glass slides at concentrations of 400 , 150 , and 75 nm . \n we found aqueous \n sodium phosphate ( 100 mm , ph = 7.2 ) containing bsa ( 0.01% ) and betaine \n ( 1.5 m ) to be an optimal printing buffer giving spots of narrow size \n distributions and uniform morphology . \n a glass slide held 64 identical \n microarrays , each containing five rows of mucin mimetics 6a e ( 12 spots per polymer ) . \n after printing , the \n slides were stored at 4 c overnight to allow sufficient time \n for attachment of the polymers to the array surface . by comparing \n the fluorescence intensities of the printed spots before and after \n washing of excess unbound polymer \n , we were able to determine the amount \n of glycopolymer that remained attached to the array surface . \n we measured the radii of individual spots and calculated the average \n spacing ( ) between adjacent surfacebound glycopolymer molecules . \n a plot of as a function of glycopolymer concentration ( figure 4a ) indicates that we were able to modulate the average \n spacing of the microarrayed glycopolymer ligands in the range of 15 \n nm in the high density array to 25 and 35 nm in the medium \n and low density arrays , respectively . \n since the estimated length of \n our mucin mimetics in their fully extended form is 25 nm , we did not expect to completely eliminate cross - linking \n by lectins in the low density microarray ; however , we anticipated \n that an increase of up to 20 nm in glycopolymer separation would discourage \n cross - linking to an appreciable degree , which would translate into \n a measurable change in binding avidities . \n we were unable to increase \n interligand separation beyond 35 nm without crossing the limit of \n quantification for our detection scheme . \n control of glycopolymer \n surface density in microarrays and a binding \n profile of sba in the lowest density array . \n ( a ) printing with solutions \n of polymers 6 at concentrations of 75 , 150 , and 400 nm \n afforded arrays with average polymer spacing ( ) of 35 , \n 25 , and 13 nm , respectively . \n ( b ) image of a portion of the lowest \n surface density array before ( cy3-channel ) and after incubation with \n sba - af647 ( 100 nm in buffer ) . \n ( c ) biding isotherms for sba - af647 to \n polymers 6 in the lowest surface density array . \n ( d ) apparent kd s obtained for sba - af647 in the lowest \n density array plotted against galnac valency in 6 . ( * * p < 0.01 ; p - value refers to a comparison \n of kd s for polymers 6a and 6e ) . to quantify the changes in avidities of lectins \n with changes in galnac valency and spatial separation of the mucin \n mimetics \n , we determined apparent dissociation constants ( kd s ) for all lectin glycopolymer combinations \n at all three surface densities . \n kd s \n are affinity constants independent of the total amount of ligand attached \n to a surface and , as such , have become a practical and quantitative \n way to evaluate binding interactions of biomolecules across different \n microarray platforms . \n we used our array to establish the binding profiles of four tn antigen - recognizing \n lectins : soybean agglutinin from the g. max ( sba),w . \n first , we incubated each array with af647-labeled \n lectins over a range of concentrations . \n figure 4b shows a portion of the lowest surface density array before ( cy3 \n channel ) and after ( af647 channel and af647/cy3 overlay ) incubation \n with sba - af647 . \n we plotted the ratios of fluorescence intensities \n measured at 635 nm ( af647 ) and 535 nm ( cy3 ) excitation wavelengths \n against the concentration of sba and determined apparent kd values by fitting the data points using the single - site \n langmuir binding model . \n figure 4c shows langmuir isotherms for the binding of sba - af647 \n to polymers 6 in the lowest density array . \n sba binding \n was completely abolished when the experiment was carried out in the \n presence of free galnac ligand ( 200 mm ) . \n this control confirmed that \n the recognition of mucin mimetics 6 by sba was glycan \n specific . \n figure 4d shows kd s averaged over four experiments plotted against \n galnac valency in polymers 6 . \n the binding profile for \n sba clearly shows valency - dependent binding to polymers 6 with polymer 6e ( 170 galnac residues ) giving \n over 3300-fold avidity enhancement compared to a monovalent tn - antigen . \n these results are in good agreement with thermodynamic \n studies by brewer , dam , and co - workers on binding of sba to porcine \n submaxillary mucins . \n we obtained similar \n valency - dependent binding profiles for wfl and vva lectins ( see chart \n s1 in supporting information ) , while hpa \n showed a high avidity for 6a ( apparent kd = 1.2 nm ) that remained unchanged with further increase \n in galnac valency ( kd s collected \n for all lectins in this study are summarized in tables s4s9 \n in the supporting information ) . as well , \n in their tn - bsa glycoconjugate array , gildersleeve and co - workers \n previously observed similar valency effects for vva and sba , but generally \n a strong valency - independent binding for hpa . \n we tested the extent to which a particular \n lectin is able to cross - link polyvalent glycoconjugates using our \n mucin mimetic arrays . \n a plot of the observed kd s versus the average spacing of the surface bound \n glycopolymer ligands are shown for sba in figure 5a . decreasing the interpolymer distance of the lowest galnac \n valency mucin mimetic 6a from 35 nm to 10 \n nm gave a 2-fold increase in binding avidity toward sba . \n however , \n no statistically significant difference in sba binding was observed \n for the highest valency polymer 6e across an identical \n range of ligand densities . \n the data revealed a propensity of sba to \n cross - link the lower valency glycopolymers 6a c , while engaging the higher valency ligands 6d and 6e in discrete complexes . \n ( a ) a drop in apparent kd s \n for binding of sba to polymers 6a c in the highest surface density array ( lowest ) corresponds \n to avidity enhancements due to cross - linking by sba . \n no sba cross - linking \n was observed for polymers 6d and e. binding \n profiles for wfl ( b ) , vva ( c ) , and hpa ( d ) indicate no cross - linking \n of polymers 6 . \n a decrease in avidity for vva and hpa \n in the highest density array is likely the result of steric interference \n between lectin molecules bound to proximal ligands ( * p < 0.05 , * * p < 0.01 , p > 0.05 ; p - values refer to comparison of kd s for each polymer in the lowest and \n highest density arrays ) . \n next we examined the binding profiles of the remaining \n lectins \n in our set . \n wfl , vva and hpa ( figure 5b d ) \n all showed similar behavior , which was quite distinct from that of \n sba ( figure 5a ) . \n none of these lectins exhibited \n binding enhancement at the highest surface density array and , in fact , \n we observed a statistically significant drop in avidities for vva \n and hpa with decreasing interpolymer spacing ( figure 5c , d ) . \n this phenomenon can possibly be attributed to steric \n interference between lectin molecules bound to proximal ligands on \n the array surface . \n these results raise interesting questions \n with regard to how levels \n of glycosylation in mucins may affect the mode through which they \n interact with lectin - type receptors . \n our observations for sba indicate \n that , when cell surface glycoconjugates exceed a certain glycan valency \n threshold , they become less effective at cross - linking . \n this conclusion \n may be extended to the other lectins based on binding data obtained \n by gildersleeve and co - workers in their arrays of tn - bsa conjugates . \n for instance , the authors obtained strong vva \n binding to a galnac - bsa glycoconjugate with a valency of 22 at high \n ligand surface densities ( kd = 184 \n 27 nm ) , but no measurable binding when the same glycoconjugate was \n spaced further apart on the surface . \n they attributed this avidity \n enhancement in the high - density array to contributions from cross - linking . \n these results indicate the ability of vva to cross - link multivalent \n glycoconjugates , but its capacity to do so is severely curtailed in \n our arrays where the valencies of the glycopolymer ligands exceeded \n 70 galnac epitopes . \n to investigate whether valency may \n set a threshold for cross - linking \n by lectins , we synthesized a glycopolymer ligand 9 ( scheme 1 ) , which shared the same general architecture with \n the mucin mimetics 6 , but was considerably shorter ( dp \n 60 , 8 nm ) and carried only 17 galnac residues . \n we then generated arrays with average spacing of 9 ranging \n from 7 nm to 28 nm ( for array characterization see supporting information ) . \n at the highest surface \n density , the 8 nm long polymers are positioned sufficiently \n close to one another to allow for cross - linking by lectins . \n figure 6 shows the binding profiles for each lectin obtained \n from the short glycopolymer array . at the lowest polymer surface density \n ( spacing of 28 nm ) , \n sba , wfl , and vva bound to polymer 9 considerably less strongly than they did to the mucin mimetics 6 at the same surface density , while hpa showed only a modest \n drop in avidity . \n this is in agreement with the valency - dependent binding \n observed for each lectin in the mucin mimetic array ( vide supra ) . \n however , we observed an increase in binding avidities for all four \n lectins at interpolymer spacing of 7 nm , indicative of cross - linking \n of 9 by the lectins . the magnitude of the avidity enhancement , \n defined as the ratio between apparent kd s at low and high surface densities , can be used to rank \n the lectins according to their relative tendency to cross - link glycopolymer 9 . \n of the four lectins , hpa had the lowest propensity to cross - link \n ( affinity enhancement 1.5 ) . \n on the other hand , sba effectively \n engaged the high - density polymer array ( kd 360 nm ) , but bound to polymers separated by 28 nm \n too weakly to give a measurable kd ( for \n a complete list of kd s and statistical \n analysis see table s9 in the supporting information ) . \n the observed affinity enhancements were concordant with data collected \n by gildersleeve and co - workers in their galnac - bsa neoglycoconjugate \n arrays . \n for instance , the typical affinity \n enhancements obtained in their study for the binding of vva toward \n the tn - bsa ligands ( galnac valency 2080 ) printed at \n two different surface densities ranged from 5 to more than \n 25-fold , while the murine macrophage galactose - type lectin-2 ( mmgl-2 ) \n exhibited a more modest 2-fold increase in avidities across the same \n set of glycoconjugates . \n these affinity enhancements are likely to \n be greater on surfaces of cells , where most glycoconjugates are mobile \n and can accommodate optimal spatial arrangements that maximize cross - linking . \n at the same time , only a small energetic bias for cross - linking over \n discrete complex formation may provide a mechanism for dynamic assembly \n and disassembly of signaling complexes in cellular membranes . \n cross - linking \n by lectins in density variant arrays of low - valency \n glycopolymer 9 . \n the lectins show different levels of \n avidity enhancements resulting from decreased interligand spacing \n ( ) indicating their unique intrinsic ability to cross - link \n polymer 9 . \n rwfl , a reduced nonagglutinating form \n of wfl , showed no cross - linking activity ( p - values \n refer to comparison of kd s for \n each lectin at the lowest and highest polymer density ) . to further confirm that avidity enhancements observed \n on the highest \n density array were due to cross - linking \n , we sought to compare the \n avidities of multimeric lectins with their constituent noncross - linking \n components . \n most lectins exist in various oligomeric states under \n physiological conditions and are difficult to dissociate into monomers \n that retain high affinity for their glycan ligands . \n however , the disulfide - bridged wfl can be reductively dissociated \n into two subunits ( rwfl ) that still bind galnac but no longer agglutinate \n erythrocytes . \n this process is reversible \n and agglutination activity can be fully recovered upon reoxidation \n of rwfl back to the lectin s original oligomeric state . \n we \n obtained rwfl by reduction of wfl with dithiothreithol , followed by \n capping of the resulting free sulfhydryl groups with 4-vinylpyridine to prevent reoxidation ( section 8 in the supporting information ) . \n in contrast to wfl , rwfl showed no change in binding avidity across \n the different surface densities of glycopolymer 9 in \n our arrays ( figure 6b ) and , hence , no cross - linking , \n consistent with rwfl s lack of agglutination activity . \n this \n result confirms that the avidity enhancements observed in highest - density \n arrays reflect cross - linking by the lectins rather than , for example , \n statistical effects associated with increasing galnac epitope density . \n in fact , the highest density array of glycopolymer 9 displays \n approximately 10% more galnac residues compared to the highest density \n array of the mucin mimetic 6a ( see section 7 in the supporting information ) , yet all the lectins \n bind the latter with much greater avidity ( e.g. , in the case of sba , kd , high = 361 148 and 58 6 nm for \n polymers 9 and 6a , respectively ) . \n this observation \n testifies to the power of array platforms based on three - dimensional \n multivalent glycan display , as such nuances of ligand binding preference \n might be obscured in the traditional glycan array . \n a recent study of mucin interactions with lectins by dam , brewer \n and co - workers based on solution - phase isothermal titration calorimetry \n experiments revealed that oligomeric \n lectins engaged mucins with a gradient of diminishing microscopic \n affinity constants . \n this led the authors to propose a binding model \n in which the lectin slides along the mucin backbone , binding to only \n one galnac residue at a time . \n increasing galnac valency then leads \n to extended persistence times of the complex and , thus , lower apparent \n dissociation constants . \n the unoccupied galnac binding sites in the \n mucin - associated lectins remain available for interactions with other \n mucin molecules , which may account for the precipitation of cross - linked \n mucins following saturation binding . \n brewer and co - workers also \n developed a quantitative precipitation assay to determine the composition \n of complexes resulting from cross - linking of glycoconjugates by lectins . \n kiessling and her co - workers later adapted this \n method to study how architectures of multivalent ligand scaffolds \n affect receptor clustering . in this assay , \n lectins are incubated with solutions of glycoconjugates . \n the insoluble \n cross - linked aggregates that form are then isolated , dissociated in \n the presence of a free monosaccharide ligand and the concentration \n of the released soluble lectin is determined based on absorbance of \n the resulting solutions . \n the concentration of glycoconjugate required \n for half - maximal ( p1/2 ) lectin precipitation \n is indicative of cross - linking efficiency . to assess whether \n the cross - linking activities of lectins observed \n in our density variant arrays \n are mirrored by their behavior in solution , \n we subjected sba and hpa to the quantitative precipitation assay in \n the presence of mucin mimetics 6b and 6e ( 92 and 170 galnac residues , respectively ) as well as the \n low valency glycopolymer 9 ( 17 galnac residues ) . \n solutions \n of either lectin ( 30 m ) were incubated with each glycopolymer \n over a range of concentrations ( 50 nm to 100 m for 6a and 6b or 100 nm to 200 m for 9 ) at ambient temperature for 5 h. the precipitates were isolated \n by centrifugation , gently washed with cold precipitation buffer and \n dissolved in the presence of free galnac ( 100 mm in pbs buffer ) . \n precipitation \n profiles were constructed by plotting lectin absorbance against the \n concentration of polymers and fitted to give p1/2 values ( for precipitation curves , complete listing of p1/2 values and statistical analysis see supporting information ) . \n figure 7a shows that all three \n polymers precipitated sba more efficiently than hpa , consistent with \n the greater propensity of sba for cross - linking observed in our microarrays . \n quantitative \n precipitation of sba and hpa by soluble glycopolymers 6b , 6e , and 9 with valencies of \n 92 , 170 , and 17 galnac residues , respectively . \n ( a ) plot of glycopolymer \n concentrations ( p1/2 ) necessary to affect \n half - maximal lectin precipitation as a function of glycopolymer valency . \n ( b ) plot of the number of galnac residues per lectin molecule bound \n in precipitates at p1/2 . \n changes in cross - linking efficiencies of lectins \n as a function \n of galnac valency of the different ligands can not be assessed by direct \n comparison of p1/2 values , since those \n also reflect enhanced binding avidities that increase with valency . \n rather , kiessling and co - workers have previously used the number of \n binding residues per lectin as an indicator of clustering efficiency . \n accordingly , on a per galnac residue basis , \n the lowest valency glycopolymer 9 ( 17 galnac residues ) \n precipitated both sba and hpa more efficiently than did the mucin \n mimetics 6 ( figure 7b ) . and \n , similarly , \n the lower valency mucin mimetic 6b ( 92 galnac residues ) \n had a greater tendency to precipitate sba than the highest valency \n mucin mimetic 6e ( 170 galnac residues ) . however , there \n was no statistically significant change in the galnac per lectin ratios \n of the precipitates formed with hpa and 6b or 6e , indicating that there is no difference in cross - linking activity \n between the two mucin mimetics . \n our microarray findings that neither \n sba nor hpa cross - links the highest valency mucin mimetic 6e are not inconsistent with the precipitation data , as the sizes of \n discrete complexes formed between this polymer and either lectin ( four \n sba and five hpa molecules per 6e , respectively ; see table s10 in supporting information ) might be \n large enough to induce precipitation from solution without necessitating \n cross - linking . \n the crystal structures of sba and hpa are available \n and can provide \n a rationale for the differences in cross - linking activities of these \n lectins . \n sba is a tetramer , in which the galnac binding domains are \n located at the apexes of a quadrangle spaced by 5 and 7 nm \n ( figure 8a ) . \n hpa \n is a trimer of disulfide - bridged dimers with three galnac binding \n domains clustered together within 3 nm on each face of the \n 10 nm long protein ( figure 8b ) . \n the strong , valency independent binding of hpa ( kd 1 nm across the set of mucin mimetics ) \n suggests that hpa binds to the glycopolymers in a \n face - to - face \n mode , where two galnac residues on the same polymer engage simultaneously \n two adjacent binding sites ( figure 8b ) . \n the dissociation constant for this interaction \n would be approximately the product of dissociation constants for two \n individual binding events ( kd \n 10 nm based on 100 m binding of galnac monosaccharide \n to hpa ) . \n the spacing of the binding sites \n in hpa is similar to that of the galactose binding domains in shiga \n toxin ( 3 nm ) , where such a face - to - face \n interaction \n with a synthetic multivalent glycoconjugate was notably demonstrated \n by bundle and co - workers . \n crystal structures of \n sba ( a ) and hpa ( b ) lectins in complex with \n galnac - containing ligands ( left ) and their proposed interactions with \n mucin mimetics ( right ) . \n ( a ) a bind - and - slide mode \n has previously been proposed for the interaction of the tetrameric \n sba lectin with mucin - type polyvalent glycoconjugates . \n ( b ) the strong , valency - independent association of hpa \n with mucin mimetics 6 is likely to occur through a \n face - to - face \n binding mechanism . on the basis of our observation of valency - sensitive \n binding and \n consistent with the thermodynamic studies by brewer and co - workers , sba is likely to engage the mucin mimetics in \n a bind - and - slide mode ( vide supra ) . \n face - to - face \n interactions with the mucin mimetics , especially in the case of the \n more conformationally flexible lower valency glycopolymer ligands . \n as previously proposed by brewer , this \n provides sba with an opportunity to dynamically assemble along the \n glycopolymer backbone and maximize the number of binding interactions \n with the glycopolymers through the formation of well - organized cross - linked \n networks ( figure 9a ) . a \n mechanistic rationale for distinct cross - linking activities of \n sba and hpa . \n ( a ) the reversible bind - and - slide mechanism \n allows for dynamic assembly of sba along the polymer scaffold while \n maximizing binding interactions through cross - linking . \n ( b ) strong \n face - to - face interactions of hpa with the glycopolymers \n may lead to the formation of kinetically trapped species with a limited \n number of unbound galnac residues available for cross - linking . on the other hand , \n the much stronger binding hpa \n is likely to associate \n with the glycopolymers more rapidly , forming less ordered , kinetically \n trapped aggregates where fewer galnac sites remain accessible for \n cross - linking ( figure 9b ) . \n this hypothesis \n is corroborated by our precipitation experiments , in which we observed \n a greater number of sba tetramers associated with glycopolymer 6b than would be expected based on the hydrodynamic radius \n of the lectin ( 5 sba tetramers bound to the 25 nm long glycopolymers , \n table s10 in the supporting information ) . by comparison , \n as well , the generally lower galnac - to - lectin ratio found in the glycopolymer \n precipitates with sba ( e.g. , 19 galnac residues in polymer 6b per sba tetramer compared to 35 galnac residues \n per molecule of hpa , figure 7b ) is evidence \n of sba s more effective use of the galnac valency in these \n ligands . \n our microarray data , confirmed by solution experiments , \n showed \n that the ability of sba to cross - link mucin mimetics 6 decreases with increasing galnac valency . \n the average spacing of \n galnac residues along the polymer backbone decreases from 37 \n in 6a to 16 in polymer 6e . \n the higher density of galnac residues along the scaffold should \n result in a decrease in microscopic off - rates for sba in the bind - and - slide \n mode and , according to our model , lead to less effective cross - linking . \n in fact , the precipitation data show that on a per galnac residue \n basis , sba engages the higher valency mucin mimetics less effectively \n ( figure 7b and table s10 in the supporting information ) . \n alternatively , the tighter \n glycan packing in the higher valency glycopolymers is likely to result \n in a loss of their conformational flexibility . \n such payment of an \n entropic penalty may permit face - to - face \n interactions \n with sba , which would also be less conducive to cross - linking . \n overall , our microarray and solution data suggest that cross - linking \n of polyvalent mucin - like glycoconjugates by lectins is a dynamic event \n that is attenuated by increasing the strength of the lectin - ligand \n interactions . \n the extent to which cross - linking will occur may be \n controlled by both the lectin as well as the ligand . based on our \n data , high avidity lectins , especially those that engage their ligands \n in a \n face - to - face mode ( e.g. , hpa ) are unlikely to \n partake in cross - linking . in contrast , more weakly associating lectins \n that engage mucins in a bind - and - slide mode ( e.g. , \n sba ) can dynamically assemble along their ligands into organized ensembles \n that maximize binding interactions through cross - linking . in this \n scenario , increasing the level of glycosylation of the ligand results \n in a higher avidity binding that may disfavor cross - linking and , thus , \n can serve as a regulatory mechanism for biasing those interactions \n toward discrete complex formation . \n in this work , we have developed a microarray \n platform , in which \n glycans are presented in polyvalent ensembles on linear polymer backbones \n mimicking the spatial arrangements of glycans in native mucins . by \n modulating the molecular composition and surface density of these \n mucin mimetics \n , we were able to systematically evaluate how parameters \n such as galnac valency and interligand spacing affect their recognition \n by several tn antigen - specific lectins . \n we observed valency - dependent \n binding for sba , wfl and vva lectins , while hpa showed generally strong \n avidities toward all the polymers irrespective of their galnac valency . \n binding profiles obtained from arrays with increasing glycopolymer \n surface densities revealed that , despite the capacity of all four \n lectins to cross - link low valency glycoconjugates and to agglutinate \n a1 cells carrying the galnac epitope , only sba showed propensity \n to cross - link the high - valency mucin mimetics . \n this finding shows \n that glycan valency and organization are critical parameters that \n determine the modes through which these interactions occur . \n the mucin \n mimetic microarray offers a convenient platform to systematically \n evaluate these parameters and its utility is aided by the modular \n nature of our synthetic strategy , which we designed to enable rapid \n diversification of the mucin mimetic structures with respect to their \n length , glycan composition , and valency .", "role": "user" }, { "content": "interactions of mucin glycoproteins with cognate receptors \n are \n dictated by the structures and spatial organization of glycans that \n decorate the mucin polypeptide backbone . \n the glycan - binding proteins , \n or lectins , that interact with mucins are often oligomeric receptors \n with multiple ligand binding domains . in this work \n , we employed a \n microarray platform comprising synthetic glycopolymers that emulate \n natural mucins arrayed at different surface densities to evaluate \n how glycan valency and spatial separation affect the preferential \n binding mode of a particular lectin . \n we evaluated a panel of four \n lectins ( soybean agglutinin ( sba ) , wisteria floribunda lectin ( wfl ) , vicia villosa - b-4 agglutinin ( vva ) , \n and helix pomatia agglutin ( hpa ) ) with specificity \n for -n - acetylgalactosamine ( -galnac ) , \n an epitope displayed on mucins overexpressed in many adenocarcinomas . \n while these lectins possess the ability to agglutinate a1-blood cells carrying the -galnac epitope and cross - link low \n valency glycoconjugates , only sba showed a tendency to form intermolecular \n cross - links among the arrayed polyvalent mucin mimetics . \n these results \n suggest that glycopolymer microarrays can reveal discrete higher - order \n binding preferences beyond the recognition of individual glycan epitopes . \n our findings indicate that glycan valency can set thresholds for cross - linking \n by lectins . more broadly \n , well - defined synthetic glycopolymers enable \n the integration of glycoconjugate structural and spatial diversity \n in a single microarray screening platform .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cdna sequences encoding n - terminally truncated mina53 ( aa 26 - 465 ) and no66 ( aa 183 - 641 ) were pcr amplified from mammalian gene collection ( mgc ) ( accession no . : bc014928 and bc011350 , respectively ) and cloned into pnic28-bsa4 vector . \n full length ycfd was cloned into pet-28a(+ ) vector ( novagen , madison , wi , u.s.a . ) as described . \n ycfdrm gene ( ncbi gene i d : 8566662 ) was amplified by pcr from genomic dna of r. marinus , and was cloned into pgem-t easy vector and then into pet-28a(+ ) . \n stratagene s quickchange site - directed mutagenesis kit was used to make all rox mutations using the above constructs as templates . \n wild - type rox enzymes / variants were produced as native his6-tagged proteins in escherichia coli bl21(de3 ) as described . \n for crystallization experiments , selenomethionine ( semet ) derivatized enzymes , semet - mina53 and semet - ycfd were produced in e. coli bl21(de3)-r3-prare2 and bl21(de3 ) strains , respectively . in general , cells were grown in le master media ( alternatively in selenomethionine medium base plus nutrient mix ) supplemented with selenomethionine ( 40 - 50 mgml ) and kanamycin ( 30 gml ) at 37 c ( while shaking at 200 rpm ) until an od600 ( optical density at 600 nm ) of 1.2 ( semet - mina53 ) or 0.6 ( semet - ycfd ) was reached . \n protein expression was then induced with 0.2 mm ( semet - mina53 ) or 1.0 mm ( semet - ycfd ) isopropyl -d-1-thiogalactopyranoside ( iptg ) and allowed to continue for 18 h at 18 c . \n all native / semet - derivatized proteins were purified from cell lysates using immobilized ni affinity chromatography with gradient elution using imidazole and/or ion - exchange chromatography . for ycfds , imidazole was removed by buffer exchange to 50 mm hepes - na ph 7.5 using a pd10 desalting column followed by a further purification using q - sepharose hp ( ycfd ) or sourceq 16 ( ycfdrm ) anion exchange chromatography . for mina53 and no66 , the his6-tag was removed by incubation with tev protease followed by a final - step purification using size - exclusion chromatography in 50 mm hepes - na ph 7.5 , 500 mm nacl , 5% ( v / v ) glycerol , 0.5 mm tcep ( tris(2-carboxyethyl)phosphine ) . \n proteins were concentrated to 10 - 30 mgml and were of > 95 % purity , as determined by sds - page . \n crystals of mina53 , no66 , ycfd and ycfdrm complexes were grown as described in supplementary table 1 . in general \n , crystals were cryoprotected by transferring to a solution of mother liquor supplemented with 20% ( v / v ) ethylene glycol ( mina53/no66 ) or 25% ( v / v ) glycerol ( ycfds ) before being cyro - cooled in liquid n2 . as described in supplementary tables 2 - 4 , \n data on native and semet - derivatized crystals were collected at 100k using synchrotron radiation at the swiss light source ( sls ) beamline x10sa , european synchrotron radiation facility ( esrf ) beamline bm16 and diamond light source ( dls ) beamlines . \n shake - and - bake was used to identify 5 se - positions in the semet - mina53 dataset ( p4332 space group ) ; refinement of heavy atom parameters and phasing was carried out with sharp using the single ismorphous replacement with anomalous scattering ( siras ) method with mina53.nog ( native ) as the native and semet - mina53 as the derivative dataset ( supplementary table 2 ) . the electron density map after density modification with solomon was of good quality ; automated model building with arp / warp resulted in a > 80% complete model with one mina53 molecule per asymmetric unit , which corresponds to an unusually high solvent content of ~75% . \n refinement was carried out with buster and after several cycles of manual rebuilding with coot , the model converged to 19.7% rcryst and 22.9% rfree . \n atomic coordinates and structure factors for this structure are deposited in the pdb database with the accession code 2xdv . \n semet - mina532og structure was solved by using phases from a highly redundant single - wavelength anomalous dispersion ( sad ) data set collected around the se absorption edge . using patterson seeding and dual - space direct methods , shelxd ( shelxcde pipeline / ccp4 suite ) located 6 out of 8 possible se - sites using a semet - mina53 sad data set . \n refinement of substructure solution followed by density modification with shelxe resulted in good - quality initial phases to 2.8 resolution . \n automated model building with buccaneer resulted in a model where core regions including the jmjc and dimerization domains were built . \n iterative refinement using cns 1.3 and model building using coot continued until rfree was around 30% . \n final rounds of manual fitting using coot and refinement using a combination of cns 1.3 and phenix continued until rcryst / rfree no longer improved ( supplementary table 2 ) . \n this structure ( deposited with pdb i d : 4bu2 ) was then used as a search model to solve the structure of y209c mina53 in complex with rpl27ag37c by molecular replacement with phaser ( p212121 space group , resolution , 2.05 ) . \n the quality of all mina53 structures was validated using molprobity with > 95% of the residues in the favored region of the ramachandran plot . \n an n - terminally truncated form of mina53 ( aa 30 - 260 ) , comprising the jmjc domain , was used as a search model for mr using phaser . \n the two molecules in the asymmetric unit of no66 were readily located , but the electron density away from the jmjc core of no66 was ambiguous . \n density modification with resolve as implemented in phenix , which took advantage of the 2-fold non - crystallographic symmetry ( in a p21212 space group ) , led to a significant map improvement and allowed automated model building with buccaneer . \n refinement was carried out with refmac ; after several cycles of manual rebuilding with coot , the model converged to 18.5% rcryst and 23.1% rfree . \n atomic coordinates and structure factors for this structure are deposited in the pdb ( accession code 4diq ) . \n the remaining no66 structures including those in complex with substrate rpl8 , were solved in p21 or c2 space groups ( resolution , 2.15 - 2.50 ) with 2 - 4 molecules per asymmetric unit ( supplementary table 3 ) using the no66/p21212 structure ( pdb i d : 4diq ) as a search model . \n iterative rounds of model building using coot and refinement using phenix and/or cns 1.3 were performed until the decreasing rcryst and rfree no longer converged ( supplementary table 3 ) . \n solve was used to locate 17 out of 22 possible se - sites using the semet - ycfd dataset . \n the initial electron density map after solvent flattening density modification with resolve was of good quality and automated model building resulted in a model where core regions ( 60% of residues in the crystallized protein s sequence ) of both molecules in the asymmetric unit were built . \n refinement and fitting cycles were performed using phenix and coot that converged to a final 19.5% rcryst and rfree 25.0% . phasing and refinement statistics are summarized in supplementary table 4 . \n structures of ycfdrm in complex with iox3 or substrate l16 were solved by mr using the ycfd structure as the search model . \n the structural refinement was carried out with phenix with iterative rebuilding of the models using coot until rcryst / rfree converged to final values ( supplementary table 4 ) . \n cdna sequences encoding n - terminally truncated mina53 ( aa 26 - 465 ) and no66 ( aa 183 - 641 ) were pcr amplified from mammalian gene collection ( mgc ) ( accession no . : bc014928 and bc011350 , respectively ) and cloned into pnic28-bsa4 vector . \n full length ycfd was cloned into pet-28a(+ ) vector ( novagen , madison , wi , u.s.a . ) as described . \n ycfdrm gene ( ncbi gene i d : 8566662 ) was amplified by pcr from genomic dna of r. marinus , and was cloned into pgem-t easy vector and then into pet-28a(+ ) . \n stratagene s quickchange site - directed mutagenesis kit was used to make all rox mutations using the above constructs as templates . \n wild - type rox enzymes / variants were produced as native his6-tagged proteins in escherichia coli bl21(de3 ) as described . \n for crystallization experiments , selenomethionine ( semet ) derivatized enzymes , semet - mina53 and semet - ycfd were produced in e. coli bl21(de3)-r3-prare2 and bl21(de3 ) strains , respectively . in general , cells were grown in le master media ( alternatively in selenomethionine medium base plus nutrient mix ) supplemented with selenomethionine ( 40 - 50 mgml ) and kanamycin ( 30 gml ) at 37 c ( while shaking at 200 rpm ) until an od600 ( optical density at 600 nm ) of 1.2 ( semet - mina53 ) or 0.6 ( semet - ycfd ) was reached . \n protein expression was then induced with 0.2 mm ( semet - mina53 ) or 1.0 mm ( semet - ycfd ) isopropyl -d-1-thiogalactopyranoside ( iptg ) and allowed to continue for 18 h at 18 c . \n all native / semet - derivatized proteins were purified from cell lysates using immobilized ni affinity chromatography with gradient elution using imidazole and/or ion - exchange chromatography . for ycfds , imidazole was removed by buffer exchange to 50 mm hepes - na ph 7.5 using a pd10 desalting column followed by a further purification using q - sepharose hp ( ycfd ) or sourceq 16 ( ycfdrm ) anion exchange chromatography . for mina53 and no66 , the his6-tag was removed by incubation with tev protease followed by a final - step purification using size - exclusion chromatography in 50 mm hepes - na ph 7.5 , 500 mm nacl , 5% ( v / v ) glycerol , 0.5 mm tcep ( tris(2-carboxyethyl)phosphine ) . \n proteins were concentrated to 10 - 30 mgml and were of > 95 % purity , as determined by sds - page . \n crystals of mina53 , no66 , ycfd and ycfdrm complexes were grown as described in supplementary table 1 . in general , crystals were cryoprotected by transferring to a solution of mother liquor supplemented with 20% ( v / v ) ethylene glycol ( mina53/no66 ) or 25% ( v / v ) glycerol ( ycfds ) before being cyro - cooled in liquid n2 . as described in supplementary tables 2 - 4 , \n data on native and semet - derivatized crystals were collected at 100k using synchrotron radiation at the swiss light source ( sls ) beamline x10sa , european synchrotron radiation facility ( esrf ) beamline bm16 and diamond light source ( dls ) beamlines . \n shake - and - bake was used to identify 5 se - positions in the semet - mina53 dataset ( p4332 space group ) ; refinement of heavy atom parameters and phasing was carried out with sharp using the single ismorphous replacement with anomalous scattering ( siras ) method with mina53.nog ( native ) as the native and semet - mina53 as the derivative dataset ( supplementary table 2 ) . the electron density map after density modification with solomon was of good quality ; automated model building with arp / warp resulted in a > 80% complete model with one mina53 molecule per asymmetric unit , which corresponds to an unusually high solvent content of ~75% . \n refinement was carried out with buster and after several cycles of manual rebuilding with coot , the model converged to 19.7% rcryst and 22.9% rfree . \n atomic coordinates and structure factors for this structure are deposited in the pdb database with the accession code 2xdv . \n semet - mina532og structure was solved by using phases from a highly redundant single - wavelength anomalous dispersion ( sad ) data set collected around the se absorption edge . using patterson seeding and dual - space direct methods , shelxd ( shelxcde pipeline / ccp4 suite ) located 6 out of 8 possible se - sites using a semet - mina53 sad data set . \n refinement of substructure solution followed by density modification with shelxe resulted in good - quality initial phases to 2.8 resolution . \n automated model building with buccaneer resulted in a model where core regions including the jmjc and dimerization domains were built . \n iterative refinement using cns 1.3 and model building using coot continued until rfree was around 30% . \n final rounds of manual fitting using coot and refinement using a combination of cns 1.3 and phenix continued until rcryst / rfree no longer improved ( supplementary table 2 ) . \n this structure ( deposited with pdb i d : 4bu2 ) was then used as a search model to solve the structure of y209c mina53 in complex with rpl27ag37c by molecular replacement with phaser ( p212121 space group , resolution , 2.05 ) . \n the quality of all mina53 structures was validated using molprobity with > 95% of the residues in the favored region of the ramachandran plot . \n an n - terminally truncated form of mina53 ( aa 30 - 260 ) , comprising the jmjc domain , was used as a search model for mr using phaser . \n the two molecules in the asymmetric unit of no66 were readily located , but the electron density away from the jmjc core of no66 was ambiguous . \n density modification with resolve as implemented in phenix , which took advantage of the 2-fold non - crystallographic symmetry ( in a p21212 space group ) , led to a significant map improvement and allowed automated model building with buccaneer . \n refinement was carried out with refmac ; after several cycles of manual rebuilding with coot , the model converged to 18.5% rcryst and 23.1% rfree . \n atomic coordinates and structure factors for this structure are deposited in the pdb ( accession code 4diq ) . \n the remaining no66 structures including those in complex with substrate rpl8 , were solved in p21 or c2 space groups ( resolution , 2.15 - 2.50 ) with 2 - 4 molecules per asymmetric unit ( supplementary table 3 ) using the no66/p21212 structure ( pdb i d : 4diq ) as a search model . \n iterative rounds of model building using coot and refinement using phenix and/or cns 1.3 were performed until the decreasing rcryst and rfree no longer converged ( supplementary table 3 ) . \n solve was used to locate 17 out of 22 possible se - sites using the semet - ycfd dataset . \n the initial electron density map after solvent flattening density modification with resolve was of good quality and automated model building resulted in a model where core regions ( 60% of residues in the crystallized protein s sequence ) of both molecules in the asymmetric unit were built . \n refinement and fitting cycles were performed using phenix and coot that converged to a final 19.5% rcryst and rfree 25.0% . phasing and refinement statistics are summarized in supplementary table 4 . \n structures of ycfdrm in complex with iox3 or substrate l16 were solved by mr using the ycfd structure as the search model . the structural refinement was carried out with phenix with iterative rebuilding of the models using coot until rcryst / rfree converged to final values ( supplementary table 4 ) . \n shake - and - bake was used to identify 5 se - positions in the semet - mina53 dataset ( p4332 space group ) ; refinement of heavy atom parameters and phasing was carried out with sharp using the single ismorphous replacement with anomalous scattering ( siras ) method with mina53.nog ( native ) as the native and semet - mina53 as the derivative dataset ( supplementary table 2 ) . the electron density map after density modification with solomon was of good quality ; automated model building with arp / warp resulted in a > 80% complete model with one mina53 molecule per asymmetric unit , which corresponds to an unusually high solvent content of ~75% . \n refinement was carried out with buster and after several cycles of manual rebuilding with coot , the model converged to 19.7% rcryst and 22.9% rfree . \n atomic coordinates and structure factors for this structure are deposited in the pdb database with the accession code 2xdv . \n semet - mina532og structure was solved by using phases from a highly redundant single - wavelength anomalous dispersion ( sad ) data set collected around the se absorption edge . using patterson seeding and dual - space direct methods , shelxd ( shelxcde pipeline / ccp4 suite ) located 6 out of 8 possible se - sites using a semet - mina53 sad data set . \n refinement of substructure solution followed by density modification with shelxe resulted in good - quality initial phases to 2.8 resolution . \n automated model building with buccaneer resulted in a model where core regions including the jmjc and dimerization domains were built . \n iterative refinement using cns 1.3 and model building using coot continued until rfree was around 30% . \n final rounds of manual fitting using coot and refinement using a combination of cns 1.3 and phenix continued until rcryst / rfree no longer improved ( supplementary table 2 ) . \n this structure ( deposited with pdb i d : 4bu2 ) was then used as a search model to solve the structure of y209c mina53 in complex with rpl27ag37c by molecular replacement with phaser ( p212121 space group , resolution , 2.05 ) . \n the quality of all mina53 structures was validated using molprobity with > 95% of the residues in the favored region of the ramachandran plot . \n an n - terminally truncated form of mina53 ( aa 30 - 260 ) , comprising the jmjc domain , was used as a search model for mr using phaser . \n the two molecules in the asymmetric unit of no66 were readily located , but the electron density away from the jmjc core of no66 was ambiguous . \n density modification with resolve as implemented in phenix , which took advantage of the 2-fold non - crystallographic symmetry ( in a p21212 space group ) , led to a significant map improvement and allowed automated model building with buccaneer . \n refinement was carried out with refmac ; after several cycles of manual rebuilding with coot , the model converged to 18.5% rcryst and 23.1% rfree . \n atomic coordinates and structure factors for this structure are deposited in the pdb ( accession code 4diq ) . \n the remaining no66 structures including those in complex with substrate rpl8 , were solved in p21 or c2 space groups ( resolution , 2.15 - 2.50 ) with 2 - 4 molecules per asymmetric unit ( supplementary table 3 ) using the no66/p21212 structure ( pdb i d : 4diq ) as a search model . \n iterative rounds of model building using coot and refinement using phenix and/or cns 1.3 were performed until the decreasing rcryst and rfree no longer converged ( supplementary table 3 ) . \n solve was used to locate 17 out of 22 possible se - sites using the semet - ycfd dataset . \n the initial electron density map after solvent flattening density modification with resolve was of good quality and automated model building resulted in a model where core regions ( 60% of residues in the crystallized protein s sequence ) of both molecules in the asymmetric unit were built . \n refinement and fitting cycles were performed using phenix and coot that converged to a final 19.5% rcryst and rfree 25.0% . phasing and refinement statistics are summarized in supplementary table 4 . \n structures of ycfdrm in complex with iox3 or substrate l16 were solved by mr using the ycfd structure as the search model . \n the structural refinement was carried out with phenix with iterative rebuilding of the models using coot until rcryst / rfree converged to final values ( supplementary table 4 ) . \n protein topologies of ( a ) mina53mn2ogrpl27a(32 - 50 ) , ( b ) no66mnnogrpl8(205 - 224 ) , ( c ) ycfdrmmnnogl16(72 - 91 ) , ( d ) fihfenoghif-1(786 - 826 ) ( pdb : 1h2k ) , ( e ) phf8fenoghistone h3k4me3k9me2(2 - 25 ) ( pdb : 3kv4 ) , and ( f ) kdm4aninoghistone h3k9me2(7 - 14 ) ( pdb : 2ox0 ) ( substrates are not shown ) . \n dsbh core elements , labeled i-viii , are in smudged green , helices in cyan , additional -strands in red , random coils in black and the insert between the fourth and fifth -strands in blue . \n note that not all the dsbh oxygenases maintain antiparallel hydrogen - bond pairing between ii and vii even though the / angles ( ii ) are within the -region of the ramachandran plot . \n extended data figure 2 | rox dimerization domains . a , comparison of the dimerization domains in rox and fih . \n b , intermolecular interactions observed at dimerization interfaces ( monomer a , grey ; monomer b , yellow ) . \n validation of the functional relevance of the rox dimers comes from biochemical / kinetic studies demonstrating loss of activities with most variants . \n the dimer interfaces in the rox are related to that of fih ; we propose the fih dimerization fold evolved from that of the rox . \n the large buried surface area ( > 3000 ) within all rox dimerization domains is sufficient for dimerization in solution , as reported for no66 . \n the interactions observed in dimerization include both hydrogen bonds / electrostatic interactions and hydrophobic interactions . in the ycfd / ycfdrm dimerization domains , residues involved in hydrophobic interactions are mainly from 2 and \n are well conserved ( ycfdrm residues in parentheses ) : phe214 ( met223 ) , val242 ( ile250 ) , met247 ( leu255 ) , leu250 ( ile258 ) , met253 ( leu261 ) , met254 ( leu262 ) , leu257 ( leu265 ) , ile258 ( ile257 ) . \n hydrogen bonding / electrostatic interactions are more important in ycfdrm dimerization than in ycfd / hrox . \n the network of hydrogen bonds between the two ycfdrm monomers a and b includes asp256a - arg269b - gln259a - asp267b - arg263a which , due to two - fold symmetry , creates a total of 8 hydrogen bonds . in ycfd , \n leu255 ( arg263 in ycfdrm ) is positioned at the center of the equivalent network . \n further , in ycfdrm gln216 is positioned hydrogen bond with the backbone amide n of arg234 and carbonyl o of leu261 . \n hydrogen bonding in ycfd dimerization is less extensive , with only asn226 amide - n positioned to form a hydrogen bond to the hydroxyl group o of thr207 and arg208 hydrogen bonding with carbonyl o of gly224 . \n however , hydrophobic / aromatic clusters are involved in ycfd dimerization , including by the sidechains of leu210a , leu223a , tyr217a ( 1 ) , phe264a , trp267a , phe268a and phe271a ( 3 ) from monomer a and val242b , met247b , leu250b ( 2 ) from monomer b. as in the ycfds , in no66 there is only one apparent salt - bridge interaction at the dimer interface , i.e. between arg474 and asp495 ( arg474a nh1-asp495b o1 , 2.9 ; arg474a nh2-asp495b o2 , 2.7 ) , which links the 2 and 3 helices of opposite monomers . \n complex salt - bridge is observed in mina53 between arg313 and glu320/asp317 ( arg313b nh1-glu320a o2 , 3.2 ; arg313b nh2-glu320 o1 , 2.7 ; arg313a nh2-asp317 o1 , 2.9 ) that connects 2 helices of different monomers . \n backbone amide hydrogen bonding additionally occurs between no66 residues , asn426 and leu454 , arg452 and trp428 , phe450 and gly429 . \n mina53 also has backbone - to - sidechain interactions between residues from flexible loops connecting 1-2 and 2-3 helices ( gln297b o - lys331a n , 3.7 ; ser300b o-glu324a o , 3.1 ) . \n the role of hydrophobic / aromatic clusters in dimerization is apparent in no66 where the 2 helices from different monomers are further apart when compared with those of ycfds and mina53 and hence have less buried surface area . \n however , in no66 , an apparent hydrophobic cluster forms between the n - terminal part of 1 and the c - terminal part of 2 . \n trp428no66 ( trp264 in mina53 ) is positioned at the start of the 1 helix of monomer a and forms the center of a hydrophobic cluster , interacting with residues phe431a , ile435a and leu432a on monomer a , and val481b , leu484b , met462b , phe477b and pro455b on monomer b. no66 trp428 also forms an apparent cation- interaction with residue lys480 . \n a similarly positioned trp264 in mina53 maintains hydrophobic contacts with phe267 and leu268 of the same monomer and with ile290 , pro291 and leu294 of the other in addition to a cation- interaction with arg307 . \n other hydrophobic contacts observed in mina53 dimerization , involving the 1 and 2 helices of different monomers include between the sidechains of residues leu308/2 ( interacting with leu319/2 and phe267 , leu268 , thr271 of 1 ) , leu312/2 ( interacting with ile272/1 and leu315/2 ) and phe277/1 ( interacting with val276 , leu269 and ile272 of 1 ) . \n disruption of rox dimerization leads to loss of activity as observed for mina53 r313e and ycfd i211r variants as well as for truncated mina53 ( 1 - 265 , 1 - 299 ) without dimerization and the c - terminal domains . \n non - denaturing gel electrophoresis was used to investigate rox oligomerization states in solution , which demonstrates disruption of dimerization in i211r ycfd and mina53 r313e . \n the loss of activity via destabilizing rox dimerization is reminiscent of similar roles of fih dimerization in catalysis ( an fih l340r variant that was predominantly monomeric is inactive ) . \n extended data figure 3 | interaction of the rox c - terminal winged helix ( wh ) domains with their respective ribosomal protein substrates . \n a dali search indicates that a close structural homolog of the rox c - terminal domain is the peptide clamp ( winged helix wh ) domain of mccb , an enzyme involved in the biosynthesis of the microcin c7 antibiotic . \n wh domains , a subtype of the helix - turn - helix ( hth ) family , are nucleic acid / protein interacting domains and occur in different cellular pathways from transcriptional regulation to rna processing . \n although the overall negative charge of rox wh domains suggests that they may not directly interact with nucleic acids , it is notable that the prokaryotic ribosomal proteins l6 , which is located proximate to l16 in intact ribosomes , and the transcriptional regulator phop contain wh folds ; the latter is interesting because in the e. coli k12 genome the ycfd gene is located adjacent to those for the phop / phoq two component signaling system , which is involved in stress responses \n . a , general topology of the c - terminal wh domain showing two distinct binding sites for l16 ( yellow ) and rpl27a ( magenta)/rpl8 ( orange ) involving residues either from an n - terminal loop connecting the wh and dimerization domains ( as in ycfdrm ) or from an extended loop between wh 3-4 ( as in hrox ) . \n figures b - e compare the wh domains in mccb ( b ) , mina53 ( c ) , no66 ( d ) and ycfdrm / ycfd ( e ) showing the interactions observed between this domain and the substrate(s ) . \n note that whilst both the rpl27a and rpl8 substrates make hydrophobic contacts with the wh domains in mina53 ( met405 and met406 ) ( c ) and no66 ( val576 and tyr577 ) ( d ) , ycfdrm employs arg285 to form hydrogen bond with the met83l16 ( arg285ycfdrm nh2-met83l16 o , 2.5 ) ( e ) . \n right panels show the partial loss of activity with mutations of mina53 ( m405a ) , no66 ( y577a ) and ycfd ( h277c ) residues from wh domains . \n extended data figure 4 | comparison of 2og / co - substrate binding in rox and representative 2og oxygenases . \n the identity of the basic residue ( arg or lys ) that binds the 2og c5-carboyxlate via electrostatic interactions is indicated along with which of the 8 dsbh ( i to viii ) strands it is located on . \n 2og binding also involves other polar residues including alcohols , i.e. a ser ( viii , part of rxs motif as present in e.g. daocs , ans , fto , algal p4h ) or thr ( ii , e.g. as in some kdms : jmjd3 , jmjd6 , phf8 , utx ) or tyr ( non - dsbh -strand , e.g. as in fih , kdm4a , abh2 , phd2 ) and sometimes , water molecule(s ) ( reviewed in ) . in an analogous position to the serine of \n rxs motif ( viii ) , the hrox have histidine - residues , his253mina53/his417no66 ( viii ) , that form part of a hydrogen - bond network involving thr255mina53/thr419no66 ( viii ) , a water molecule , and the 2og carboxylates . \n although ycfd / ycfdrm has asn197/thr206 at this position ( viii ) , it is the conserved serine from i ( 122/ycfdrm and 114/ycfd ) that is positioned to hydrogen bond with the 2og c5-carboxylate . \n abbreviations : daocs , deacetoxycephalosporin c synthase ; ans , anthocyanidin synthase ; fto , fat mass and obesity associated protein ; algal p4h , prolyl-4-hydroxylase from chlamydomonas reinhardtii ; fih , asparaginyl hydroxylase factor inhibiting hif ( hypoxia - inducible factor ) ; jmjd3 and 6 : jmjc - domain containing protein 3 and 6 ; phf8 : phd ( plant homeo domain ) finger protein 8 ; utx : ubiquitously - transcribed x chromosome tetratricopeptide repeat protein ; abh2 , alkylated dna repair protein ( alkb ) homolog 2 ; phd2 , prolyl hydroxylase domain 2 . \n extended data figure 5 | hrox - substrate complexes showing disulfide cross - linking sites ( red arrows ) and difference electron density ( fo - fc omit ) for the substrate residues contoured to 3. ( a ) strategy adopted to obtain the cross - linked structures ( the same strategy can be used for other protein hydroxylases / kdms ) . \n ( b - d ) different disulfide cross - linking sites ( red arrows ) that form no66rpl8 cysteine - disulfide pairs under equilibrating conditions . analyses of the 2og - oxygenase - substrate complexes reveal that substrate residues at 2 positions relative to the hydroxylated residues make interactions with enzyme residues within an ~12 radius of the metal . to obtain stable no66-rpl8 complexes \n , we engineered no66 variants substituting cys - residues within ~12 radius of the metal at positions considered likely involved in substrate binding based on the analyses of other 2og - oxygenase - substrate structures and the evolutionary / phylogenetic analyses of no66/no66-like proteins in eukaryotes . \n we also substituted cys residues at 2 positions on the peptide substrate sequence , relative to the hydroxylated residue . \n esi - ms assays were used to identify best cross - linking yields for the no66-rpl8 pairs under equilibrating conditions . \n the following cross - linked pairs were used for crystallization : wild - type ( wt ) no66 with rpl8g220c , a double no66 variant l299c / c300s with rpl8g220c , and a single no66 variant s373c with rpl8g214c . \n structures were obtained for wt no66rpl8g220c ( complex 1 , b ) , l299c / c300sno66rpl8g220c ( complex 2 , c ) , and s373cno66rpl8g214c ( complex 3 , d ) in combination with nog / mn(ii ) in c2 space group , 2.25 - 2.50 resolution with 2 molecules / asymmetric unit ; rpl8 residues 215 - 223 ( complex 1 ) , 213 - 223 ( complex 2 ) and 212 - 223 ( complex 3 ) were observed bound to the no66 active site . \n figure e shows superimposition of the three complex structures ; note that the key rpl8 residues ( 215 - 219 ) including the hydroxylated his216 are observed in near identical conformations ( rmsd , 0.29 - 0.36 for c atoms ) ; the similarity of the substrate positions in all the three structures suggests they all likely represent functional complexes . \n based on the no66rpl8 structures , we identified a mina53 residue , y209c suitable for cross - linking which we crystallized in complex with rpl27ag37c ( g ) . to test whether the wt / mutant enzymes and altered substrates still function catalytically we carried out endpoint and time - course assays using variable enzyme / substrate ratios . \n the biochemical data show that for both wt no66 and mina53 ( wt and y209c ) , all the cys - substituted peptides function as substrates ( f and h , respectively ) . in the case of mina53 , the y209c variant with which we obtained the mina53rpl27a complex structure is ~4-fold more active than wt mina53 . \n we also tested wt no66 for reaction between enzyme cysteines and the cysteines of modified substrate peptides by esi - ms . despite testing multiple combinations , we only observed disulfide formation in cases where we were also able to obtain crystal structures for substrate complexes . \n all possible combinations of wt hrox / variants and peptides containing cys at variable positions were used for the cross - reactivity tests ; no66 : wt , r297c , l299c / c300s , s373c , s421c ; rpl8 : wt , g214c , h218c and g220c ; mina53 : wt and y209c ; rpl27a : wt and g37c . \n the combined activity and ms analyses suggest that in order to form stable / crystallizable cross - linked complexes , the substrates need to be recognized by the enzyme active sites in a catalytically relevant manner ( a ) . \n extended data figure 6 | mutagenesis analyses of the substrate binding residues located on the jmjc catalytic domains of mina53 ( a ) , no66 ( b ) and ycfdrm ( c ) . \n left panels show views from the active sites of rox - substrate complexes and the right panels show the effects of mutations on rox catalysis . \n analyses of rox substrate complexes reveal important interactions between rox and their ribosomal protein substrates . \n with hrox , the binding of ribosomal his39rpl27a ( light blue)/his216rpl8 ( orange ) involve a series of hydrogen - bonds to backbone amides and the sidechains of mina53/no66 residues : gln136mina53/arg297no66 , asn165mina53/asn326no66 , tyr167mina53/tyr328no66 and ser257mina53/ser421no66 . \n in addition in the mina53rpl27a complex , leu38 and arg42 of rpl27a make hydrophobic contacts with leu176mina53 and a salt - bridge interaction with asp333mina53 ( respectively ) . \n the results of the endpoint assays as well as kinetic studies on the variants ( right panels ) show that substitution of these residues causes substantial losses of activity . \n c , in the case of ycfdrm , the hydroxylated residue arg82l16 binds in a hydrophobic cleft lined by tyr137ycfdrm and met120ycfdrm sidechains and hydrogen - bonds to asp118ycfdrm and ser208ycfdrm . to test the crystallographically observed binding mode , \n variants of ycfdrm residues ( asp118 , met120 , tyr137 and ser208 , highlighted ) were prepared in ycfd ( corresponding to asp110 , met112 , tyr129 and ser199 , respectively ) . \n mutagenesis studies on all rox support the crystallographically observed binding modes of the substrate residues . \n the combined biochemical and structural data also provide insights into substrate selectivity of rox over other oxygenases . \n the figure shows conformational changes at the domain and residue levels in ( a ) mina53 ( dark salmon and red with / without rpl27a , light blue ) , ( b ) no66 ( slate and cyan with / without rpl8 , orange ) and ( c ) ycfdrm ( grey and split pea with / without l16 , yellow ) . \n although the overall movement observed for the c - terminal wh domain on substrate binding is more significant in mina53 as compared to other rox , the ycfdrm structures with and without substrate display significant local changes in the sidechains of substrate binding residues ( see below ) . \n a , the inset highlights local changes to the active site region in mina53 in the presence ( green sticks)/absence ( yellow sticks ) of substrate ; mina53 uses an acidic residue , asp333 located on an -helix connecting the dimerization and wh domains , to form a catalytically important salt - bridge interaction with arg42rpl27a . \n support for this statement comes from activity analyses on variants of both rpl27a and mina53 . \n we have previously reported that a mutation of arg42rpl27a to ala results in < 5% hydroxylation . \n the variant of d333a mina53 ablates hydroxylation ( almost completely ) of native rpl27a in all tested substrate - enzyme ratios ( extended data fig . \n 6 ) . in the substrate - unbound form , asp333mina53 has two alternate conformations indicating flexibility . \n the no66 substrate , rpl8 has an ile219 at the analogous position to arg42rpl27a that makes hydrophobic contacts with the tyr577 sidechains from wh domain of no66 ( b ) . in the case of ycfdrm , the substrate interacting residues located on the ii-iii loop ( tyr137 ) , the iv-v insert ( arg169 ) , the dimerization domain ( arg212 and glu218 ) and on the loop connecting the dimerization and wh domains ( arg284 ) are observed in different conformations in the structures with and without substrate , likely reflecting induced fit on substrate binding ( c ) . \n the figure shows differences between ycfds from e. coli ( green ) and r. marinus ( grey ) . \n ( a ) superimposition of ycfd and ycfdrml16 complex structures showing crystallographically observed differences particularly in the dimerization and iv-v loop regions . \n the iv-v insert is highlighted in crimson red and pink in ycfd and ycfdrm , respectively . \n ( b ) residue numbering is according to ycfdrm with the ycfd numbering shown in brackets . \n note that all of the directly identified substrate - binding residues are strictly conserved between ycfd and ycfdrm . \n however , residues particularly those located on the iv-v insert including asp118 , tyr137 and arg212 in ycfdrm ( asp110 , tyr129 and arg203 in ycfd ) are observed in different conformations suggesting potential roles for these residues in catalysis . \n ( c - d ) predicted binding mode of l16 ( yellow ) to ycfd from e. coli ( green ) . \n a model complex of ycfd with mn(ii ) , nog and l16 ( residues pro77-lys84 ) was generated using ycfd - semet as the template and by comparison with ycfdrml16 and mina53rpl27a(32 - 50 ) structures . \n ( d ) surface representations of the ycfdmnnogl16(77 - 84 ) complex , predicting key hydrogen - bonds / polar interactions ( dotted lines ) with l16 . \n the hydroxylated arg81l16 is predicted to bind in a pocket defined by the tyr129 and met112 sidechains , which likely form -cation and hydrophobic interactions with arg81l16 sidechain as observed in the ycfdrml16 crystal structure . \n the arg81 guanidino group is predicted to make electrostatic interactions with the asp110ycfd carboxylate and hydrogen - bonds to ser199ycfd . \n ycfd residues asp110 , met112 , tyr129 and ser199 were substituted to test the predicted mode of binding ; the assay results are given in the extended data fig . \n extended data figure 9 | comparison of active site chemistry of rox and related enzymes . \n the figure compares active site chemistry in representative 2og oxygenases and directionality of the peptide substrate binding through the active site . \n the active site metals ( fe / fe - surrogates , mn or ni ) are in color - coded spheres . \n the figure shows a parsimony tree constructed using archaeopteryx v0.9812 from clustalw aligned protein sequences of human jmjc 2og - oxygenases showing that distinct branches of jmjc - oxygenases exist for hydroxylases ( red ) , demethylases / hydroxylases ( light green ) and demethylases ( blue ) . \n abbreviations used , jhdm1a , 1b , 1d , 1e and 3a : jmjc domain - containing histone demethylation protein 1a , 1b , 1d , 1e and 3a ; jhd2c : jmjc domain - containing histone demethylation protein 2c ; kdm2a-2b , 3a-3b , 4a-4e , 5a-5d , 6a-6b and 7 lysine - specific demethylase 2a-2b , 3a-3b , 4a-4e , 5a-5d , 6a-6b and 7 ; rbbp2 : retinoblastoma binding protein 2 ; ptdsr : phosphatidylserine receptor ; hif : hypoxia - inducible factor ; hspb1 : 27 kda heat shock protein ; pass1 : protein associated with small stress protein 1 .", "role": "user" }, { "content": "2-oxoglutarate ( 2og)-dependent oxygenases play important roles in the regulation of gene expression via demethylation of n - methylated chromatin components1,2 , hydroxylation of transcription factors3 , and of splicing factor proteins4 . recently , 2og - oxygenases that catalyze hydroxylation of trna5 - 7 and ribosomal proteins8 , have been shown to play roles in translation relating to cellular growth , th17-cell differentiation and translational accuracy9 - 12 . the finding that the ribosomal oxygenases ( rox ) occur in organisms ranging from prokaryotes to humans8 raises questions as to their structural and evolutionary relationships . in escherichia \n coli , ycfd catalyzes arginine - hydroxylation in the ribosomal protein l16 ; in humans , mina53 ( myc - induced nuclear antigen ) and no66 ( nucleolar protein 66 ) catalyze histidine - hydroxylation in ribosomal proteins rpl27a and rpl8 , respectively . the functional assignments of the rox open therapeutic possibilities via either rox inhibition or targeting of differentially modified ribosomes . \n despite differences in residue- and protein - selectivities of prokaryotic and eukaryotic rox , crystal structures of ycfd and ycfdrm from e. coli and rhodothermus marinus with those of human mina53 and no66 ( hrox ) reveal highly conserved folds and novel dimerization modes defining a new structural subfamily of 2og - oxygenases . \n rox structures in complex with / without their substrates , support their functional assignments as hydroxylases , but not demethylases and reveal how the subfamily has evolved to catalyze the hydroxylation of different residue sidechains of ribosomal proteins . \n comparison of rox crystal structures with those of other jmjc - hydroxylases including the hypoxia - inducible factor asparaginyl - hydroxylase ( fih ) and histone n-methyl lysine demethylases ( kdms ) identifies branchpoints in 2og - oxygenase evolution and distinguishes between jmjc - hydroxylases and -demethylases catalyzing modifications of translational and transcriptional machinery . \n the structures reveal that new protein hydroxylation activities can evolve by changing the coordination position from which the iron - bound substrate oxidizing species reacts . this coordination flexibility has likely contributed to the evolution of the wide range of reactions catalyzed by iron - oxygenases .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: most of the schools of medicine of the ancient world considered every single symptom and sign as a separate disease itself . in 1742 , sydenham was the first scientist to clearly formulate the minimum requirements needed to define a clinical condition as a syndrome . in his definition , \n a syndrome consists of several interrelated symptoms showing a stable , characteristic structure and a peculiar prognosis . \n furthermore , patients affected by a specific syndrome should share a sufficiently pathognomonic cluster of symptoms that allows clinicians to distinguish them from other patients suffering from different syndromes . \n such fundamental elements of discontinuity among various syndromes were , at first , better conceptualized by sneath , who introduced the term of \" point of rarity to refer to precise clinical boundaries among disorders , and were later revised by kendell and jablensky , who preferred the concept of zone of rarity separating psychiatric syndromes . the idea was that if a syndrome corresponds to a natural entity , than we should find a natural boundary or a discontinuity between this condition and its clinical neighbours ; in other terms , mixed conditions can exist , but they have to be less common than the pure syndromal form . \n several authors [ i.e. 1 , 2 , 6 ] have investigated whether such a theoretical construct could be applied to the field of mental disorders . in spite of the improvement in this field , the validity of the actual classifications ( icd-10 , dsm - iv - tr ) still remains a matter of debate . although formal criteria to establish the validity of psychiatric diagnoses have been progressively proposed ( i.e. , descriptive features , sociodemographic factors , laboratory markers , exclusion criteria , neurobiologic and genetic validators , prognostic characteristics , level of functional and social disability , response to therapy , statistical deviation from the healthy condition , etc . ) \n [ 9 - 11 ] , in a clinical framework some of the conditions that are currently classified as psychiatric disorders still appear as vague and confusing ( rather than discrete ) entities . in particular , most of them show weak diagnostic criteria ( low association between diagnostic symptoms and actual diagnosis ) , unspecific manifestations ( poorly pathognomonic symptoms ) , and widespread onset ( high comorbidity ) . \n according to the mentioned sydenham s definition of syndrome , a first anomaly has to be taken into account : several diagnostic categories changed their criteria in different dsm editions and some of them were abolished , merged with other conditions , or divided into two or more entities . \n gad was first introduced as a unique diagnosis in the third edition of the dsm ( dsm - iii ) , but it was most often used as a residual diagnosis for individuals who did not meet diagnostic criteria for another anxiety disorder . considering the difficulty to discriminate between gad and other disorders [ 14 - 15 ] , the definition of gad and the associated symptoms were substantially revised in the further edition of dsm . as a consequence , the dsm - iv - tr considered gad as an independent diagnosis among the anxiety disorders , characterized by excessive , uncontrollable worry about a variety of topics that occurs more days than not for a period of at least six months . \n the worry causes distress and/or functional impairment , and is associated with at least three of the following features : restlessness or feeling keyed up or on edge , being easily fatigued , difficulty concentrating or mind going blank , irritability , muscle tension , and sleep disturbance ( difficulty falling or staying asleep , or restless unsatisfying sleep ) . \n indeed , four out of the six associated physical symptoms of gad ( i.e. restlessness , fatigue , difficulty concentrating , sleep difficulties , obsessive rumination , somatization ) are also part of the diagnostic criteria for major depressive disorder [ 16 , 17 ] . \n furthermore , symptoms required for gad diagnosis are also present in other anxiety disorders , as closer overlaps probably exist between gad and panic disorder or social anxiety disorder . in general \n the nosographic ambiguity - which is related to different psychiatric diagnoses - makes it very hard to define a stable constellation of interrelating symptoms and to characterize a specific population of patients with a specific diagnosis . \n the uncertain psychopathologic boundary of many psychiatric conditions seems to further move these disorders away from the original definition of discrete syndromes . \n the psychiatric comorbidity defined as co - occurrence of two or more psychiatric diagnoses in the same patient raised a significant concern in the debate on the categorization of psychiatric disorders . \n the concept of comorbidity was first introduced by feinstein to denote those cases in which a \n distinct additional clinical entity occurred during the clinical course of a patient having an index disease . \n this concept was recently used to indicate not only those cases in which a patient receives both a psychiatric and a general medical diagnosis , but also those cases in which two or more psychiatric diagnoses are present in the same patient . \n the lack of well - defined and specific symptoms for many disorders and the high rates of gad comorbidity with other anxiety and mood disorders make it difficult for the clinician to perform a reliable differential diagnosis and to correctly identify this condition [ 18 , 21 ] . \n moreover , neurotic symptoms appear to be more frequent in mixed or associated forms than as parts of pure conditions . again , the high rate for gad comorbidity was considered to challenge the validity of this diagnosis . \n the different revisions of dsm criteria for gad did not solve the matter of comorbidity , and its high rates of co - occurrence with other anxiety or mood disorder are still widely reported [ 13 , 22 - 27 ] . \n to support the concerns raised above , we performed further analyses of the data from the sesto fiorentino study , a large community study , which has been described in detail elsewhere . \n i.e. regardless of the diagnosis : diagnostic categories are built up later , by computerized algorithms . \n such an approach does not depend on pre - constructed nosological theories , allows the analysis of natural aggregations of symptoms even below their diagnostic cutoff points , permits the comparison of the qualitative and quantitative aspects , and can be useful to investigate specificity of diagnostic symptoms . \n we evaluated the presence of some common mood and anxiety symptoms across the most represented dsm iv diagnoses ( fig . \n it is clear that these symptoms occur transversally in a variety of diagnostic categories , with little variations from each other . as far as the gad symptoms are concerned , a further analysis was performed on the data from the sesto fiorentino study : we tested for significant differences in each of the gad symptom reported in fig . \n these results confirmed that the symptoms which are required for a diagnosis of major depressive episode or generalized anxiety disorder are essentially non - specific . \n stand alone , independently of the presence of other symptoms , whereas in the clinical practice the co - occurrence of other symptoms may consistently modify the interpretation of the clinical presentation . \n suicidal thoughts accompanied by delusions of guilt are considered potentially more dangerous than suicidal ideation plus hystrionic features . \n the application of the categorical model in psychiatry is likely to be different from the one used in other medical sciences . in general medicine , symptoms are considered either non - specific ( fever or fatigue may be taken as an example ) , or specific ( such as the aspect of blisters in hzv infection ) . in medicine \n we do not count symptoms in order to make a diagnosis : peritonitis and flu may share some symptoms , for example fever , pallor or fatigue ( non - specific ) , but they can not be used to make up the diagnosis of peritonitis with a comorbid flu , and in any case if a peritonitis is present , none would assign the same value to the symptom fatigue and to the one abdominal guarding exacerbated by moving peritoneum . \n dsm - iii and its successors , became universally and uncritically accepted as the ultimate authority on psychopathology and diagnosis . \n although it represents an undoubted progress for reliability and communication between clinicians and researchers , the price that psychiatry had to pay for these benefits is very high : the diagnostic process lost out in terms of sophistication and specificity . \n according to andreasen , our data demonstrated that diagnostic criteria include only some characteristic symptoms of a given disorder but they were never intended to provide a comprehensive description . \n although creating standardized diagnoses that would facilitate research was a major goal , dsm diagnoses are not useful for research because of their lack of validity . \n since the core features of mental illness were mainly unknown , both the symptom pattern and the prognostic value ( e.g. duration , course and severity ) of psychiatric syndromes were defined arbitrarily and conventionally . \n many examples can be mentioned to support this idea , ranging from the scarce agreement between dsm / icd classification systems [ 31 , 32 ] to the lack of validity of schizophrenia subtypes and the problems inherent in the diagnosis of some psychiatric disorders ( i.e. schizoaffective disorder ) [ 34 , 35 ] . \n therefore , the validity of the present nosology has never been sufficiently demonstrated . on the contrary , the premise that original dsm diagnostic categories are primarily artificial and have no confirmed value of elementary clinical entities , is usually forgotten . \n this shortness of memory can push psychiatrists to think that dsm / icd diagnoses are natural categorical entities ( a phenomenon that van praag called nosologomania ) , thus making them accept unconditionally and uncritically the current classification system and ignore alternative models . \n many authors believe that this might represent a rather blind approach that may be either dangerous or useless in terms of application in biological and psychopharmacological research . \n in fact , most of the available scientific studies are actually based on the current arbitrary classification , even if it may not match with the correspondent biological and clinical sources . on the other hand , studies based on the so - called dimensional approach to psychopathology \n [ 37 - 39 ] show a relative aspecificity of diagnostic categories and provide robust examples of usefulness of reasoning , in terms of symptom clusters . \n in our opinion , the current nosographic system prevents psychiatry from benefiting of the significant technological progress that has led the rest of medical sciences to important clinical achievements in the last 20 years . in the future \n , psychiatry will be probably able to find new and more specific markers and instruments [ 40 , 41 ] . \n ", "role": "user" }, { "content": "the present article focused on the problem of validity , reliability and specificity of psychiatric diagnoses.the authors moved by the concept of syndrome , defined by sydenham in the 18th century as a constellation of several interrelated symptoms , showing a stable , characteristic structure and a peculiar prognosis , in order to analyse the peculiarity of the current psychiatric nosology . in our opinion , \n the current nosographic system based on dsm - iv criteria , prevents psychiatry from benefiting of the significant technological progress that has led the rest of medical sciences to important clinical achievements in the last 20 years . \n the case of generalized anxiety disorder was taken as an example of a disease characterized by unstable diagnostic criteria , high rate of comorbidity and uncertain boundaries . \n an analysis of the data from the sesto fiorentino study was performed to investigate the presence of common mood and anxiety symptoms across the most represented dsm iv diagnoses , in order to evaluate the specificity of these symptoms.the results supported the hypothesis of a low specificity of these symptoms , suggesting the need for psychiatry to find new and more specific markers and instruments .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: apical periodontitis is an infection of the area around the root of a tooth , usually caused by bacteria . \n although bacterial infection can be substantially reduced by standard intracanal procedures such as intracanal medication and root canal treatment , it is very difficult to render the root canal free of bacteria . \n this is because bacteria are located in inaccessible areas such as deep inside the dentinal tubules and lateral canals and it is difficult for any intracanal medication to reach these locations . \n moreover , bacteria may survive and re - colonize in the areas around the root canal whenever there is opportunity and this may become a primary source of persistent infection . \n bacteria are commonly found within dentinal tubules of clinically infected canals . among these bacteria , \n enterococcus faecalis is of interest because it is the most frequently detected species in root - filled teeth with persistent lesions . \n some possible factors facilitating the long - term survival of e. faecalis in the root canal system are its ability to invade dentinal tubules , where it can survive for a prolonged period under adverse conditions such as starvation , high ph of calcium hydroxide medication and adhesion of e. faecalis to collagen . \n angiotensin - converting enzyme ( ace ) and a serine protease ( spr ) are the collagen binding proteins produced by e. faecalis . with the help of these proteins , \n ace promotes the binding of e. faecalis to type i collagen and in vitro ace gene expression at 37c was enhanced in the presence of collagen . in this study , \n the interaction of e. faecalis with root cementum and its role in persistent infection was investigated . \n this in vitro study was conducted in the department of conservative dentistry and endodontics . teeth sterilization ( gamma irradiation at 25 kgy ) was performed at microtol , bangalore . \n data was obtained using an inverted confocal laser scanning microscope ( clsm ) ( zeiss lsm 510 meta . \n gmbh , mannheim , germany ) at the indian institute of science , bangalore . a total of 60 human single - rooted teeth recently extracted for orthodontic reasons were collected for the study . \n , caries - free teeth were examined under 20 microscope to rule out any cracks , caries , fractures or craze lines and radiographed to confirm the presence of a single canal . \n teeth that had already undergone root canal treatment or teeth with more than one canal , immature root apices , root caries , restorations , fractures or craze lines , thin curved roots and calcified canals were excluded from the study . \n the teeth were cleaned off soft - tissues , calculus and stains using sharp hand scalers and thoroughly washed under running tap water to remove any tissue remnants sticking to the tooth surface . \n all the 60 specimens were randomly divided into three experimental groups as follows : group i ( n = 20 ) : ( control group ) intact teeth with no access cavity preparation and sealing of the root apex was done using varnish . \n group ii ( n = 20 ) : access opening was done to gain access to the root canal . \n group iii ( n = 20 ) : 1 mm of the root apex was exposed to lactic acid ( organic acid ) at ph below 5.5 to mimic apical demineralization . \n apical root cementum was roughened using diamond point to mimic apical resorption that is seen in apical periodontitis cases , followed by access opening to gain access to the root canal . \n for the samples in group i ( control group ) , no access preparation was done and apical 1 - 2 mm of the teeth was sealed with three coats of varnish followed by gamma irradiation of all the samples to eradicate any bacteria that was previously present . for the specimens in groups \n the teeth were then subjected to gamma irradiation , followed by inoculation with the e. faecalis broth within the root canal with the help of a micropipette . \n simultaneously , apical one - third of the teeth were submerged in the broth for all the teeth samples and incubated for 8 weeks to allow bacterial growth with alternate day refreshment . \n streptomycin - resistant strains of e. faecalis ( atcc 29212 ) were cultured in tryptone soya bean agar broth prepared by mixing 1.8 g powder in 60 ml of distilled water . \n the e. faecalis strain was inoculated in the broth and placed in an incubator to allow the bacteria to grow at 37c for 24 - 48 h. gram staining was done to confirm bacterial growth . \n the e. faecalis broth was inoculated within the root canal of the teeth samples with a micropipette . \n furthermore , apical one - third of the teeth were submerged in the broth to mimic primary infection . \n after 8 weeks of culturing , the specimens of groups ii and iii were subjected to biomechanical preparation followed by obturation up to the working length ( root zx ii , j. morita , japan ) . \n the teeth were instrumented using protaper ni - ti rotary instrument system in a contra - angle gear reduction handpiece ( x - smart dentsply ) and finally obturated with gutta - percha ( single - cone technique ) using ah plus sealer . \n after coronal seal , apical one - third of all the samples were again immersed in the e. faecalis broth for 8 weeks with alternate day refreshment to show secondary infection . after the incubation period of 8 weeks , all the samples were washed using 1 ml phosphate buffered saline to remove non - adherent bacteria . \n a vertical groove was made on buccolingual surface starting from occluso - apical of the all teeth samples using a tapered fissure diamond point . then with the help of a chisel , \n the teeth were stained with a fluorescent dye to observe under an inverted clsm ( zeiss lsm 510 meta . \n the teeth were stained with 50 l fluorescein diacetate ( fda , sigma , st . \n louis , mo ) and 50 l of propidium iodide ( pi , sigma ) . \n , the dye crosses the cell membrane and gets metabolized by intracellular esterases and converted to fluorescein ( green ) so the viable cells appears green in color . \n pi is a non - cell permeable , red fluorescent dye , which adheres to ruptured cell membranes so the dead bacteria appear red in color . \n single - rooted , caries - free teeth were examined under 20 microscope to rule out any cracks , caries , fractures or craze lines and radiographed to confirm the presence of a single canal . \n teeth that had already undergone root canal treatment or teeth with more than one canal , immature root apices , root caries , restorations , fractures or craze lines , thin curved roots and calcified canals were excluded from the study . \n the teeth were cleaned off soft - tissues , calculus and stains using sharp hand scalers and thoroughly washed under running tap water to remove any tissue remnants sticking to the tooth surface . \n all the 60 specimens were randomly divided into three experimental groups as follows : group i ( n = 20 ) : ( control group ) intact teeth with no access cavity preparation and sealing of the root apex was done using varnish . \n ( n = 20 ) : access opening was done to gain access to the root canal . \n ( n = 20 ) : 1 mm of the root apex was exposed to lactic acid ( organic acid ) at ph below 5.5 to mimic apical demineralization . \n apical root cementum was roughened using diamond point to mimic apical resorption that is seen in apical periodontitis cases , followed by access opening to gain access to the root canal . \n for the samples in group i ( control group ) , no access preparation was done and apical 1 - 2 mm of the teeth was sealed with three coats of varnish followed by gamma irradiation of all the samples to eradicate any bacteria that was previously present . for the specimens in groups ii and iii , access opening and canal debridement were done . \n the teeth were then subjected to gamma irradiation , followed by inoculation with the e. faecalis broth within the root canal with the help of a micropipette . \n simultaneously , apical one - third of the teeth were submerged in the broth for all the teeth samples and incubated for 8 weeks to allow bacterial growth with alternate day refreshment . \n streptomycin - resistant strains of e. faecalis ( atcc 29212 ) were cultured in tryptone soya bean agar broth prepared by mixing 1.8 g powder in 60 ml of distilled water . \n the e. faecalis strain was inoculated in the broth and placed in an incubator to allow the bacteria to grow at 37c for 24 - 48 h. gram staining was done to confirm bacterial growth . \n the e. faecalis broth was inoculated within the root canal of the teeth samples with a micropipette . \n furthermore , apical one - third of the teeth were submerged in the broth to mimic primary infection . \n after 8 weeks of culturing , the specimens of groups ii and iii were subjected to biomechanical preparation followed by obturation up to the working length ( root zx ii , j. morita , japan ) . \n the teeth were instrumented using protaper ni - ti rotary instrument system in a contra - angle gear reduction handpiece ( x - smart dentsply ) and finally obturated with gutta - percha ( single - cone technique ) using ah plus sealer . \n after coronal seal , apical one - third of all the samples were again immersed in the e. faecalis broth for 8 weeks with alternate day refreshment to show secondary infection . after the incubation period of 8 weeks , all the samples were washed using 1 ml phosphate buffered saline to remove non - adherent bacteria . \n a vertical groove was made on buccolingual surface starting from occluso - apical of the all teeth samples using a tapered fissure diamond point . \n then with the help of a chisel , each tooth was split into two halves . after coding the teeth samples , \n the teeth were stained with a fluorescent dye to observe under an inverted clsm ( zeiss lsm 510 meta . \n the teeth were stained with 50 l fluorescein diacetate ( fda , sigma , st . \n louis , mo ) and 50 l of propidium iodide ( pi , sigma ) . \n , the dye crosses the cell membrane and gets metabolized by intracellular esterases and converted to fluorescein ( green ) so the viable cells appears green in color . \n pi is a non - cell permeable , red fluorescent dye , which adheres to ruptured cell membranes so the dead bacteria appear red in color . \n for adhesion , we used scoring criteria of 0 ( for no adhesion ) and 1 ( for adhesion ) . for penetration measured in m , we used the depth - measuring tool from the clsm software . \n accordingly , results were subjected to statistical analysis using median test , anova and student 's t - test . \n figure 1 shows live bacteria ( green color ) and dead bacteria ( red color ) . \n i ( control group ) no access cavity was prepared and at the same time apical one - third of the teeth were sealed with varnish . \n results showed no adhesion [ table 1 ] , [ figure 1a ] and no penetration of e. faecalis into the root cementum in any of the samples [ table 2 ] , [ figure 2a ] . in group \n ii few samples showed adhesion , mean of adhesion is 0.55 [ table 1 ] , [ figure 1b ] but no penetration was seen in any of the samples [ table 2 ] , [ figure 2b ] . \n this means that if an intervention like root canal treatment was done at early stage of infection when no apical changes like demineralization or resorption had taken place , there would be lesser chances of e. faecalis penetration and persistent infection or re - infection . in group iii , apical one - third of the teeth \n were exposed to acid and apical cementum was roughed to mimic apical periodontitis . in this group , \n all the samples showed adhesion [ table 1 ] , [ figure 1c ] and highest values of penetration was up to 160 m deep in root cementum [ table 2 ] , [ figure 2c ] . \n this means that delay in treatment leads to changes in apical environment such as apical demineralization and apical resorption , which helps e. faecalis to penetrate deep into cementum and in favorable conditions chances of persistent infection or re - infection also increases . \n a comparison of values shows high significant difference ( p < 0.01 ) between groups i and iii and groups ii and iii and significant difference ( p < 0.05 ) between groups \n i and ii [ tables 1 and 2 ] . mean and sd of adhesion for three groups . comparisons between groups with median test ( a ) confocal image showing group i ( control group ) , absence of enterococcus faecalis . \n red color shows dead e. faecalis and green shows live e. faecalis under confocal laser scanning microscope ( clsm ) . \n red color shows dead e. faecalis and green shows live e. faecalis under clsm mean and sd of penetration for three groups . \n f value calculated by one way anova and comparisons between groups with student 's t - test ( a ) depth measuring confocal image showing , group i ( control group ) absence of enterococcus faecalis . \n ( b ) group ii samples showing adhesion of e. faecalis up to 1 m deep under confocal laser scanning microscope ( clsm ) . \n ( c ) group iii samples showed presence of e. faecalis up to 160 m deep in root cementum under clsm \n in this study , e. faecalis was chosen as the test organism because of its ability to penetrate the root dentin in vitro and it is found up to 90% in persistent infection . \n e. faecalis has unique properties such as production of ace and spr that are collagen binding proteins , which help e. faecalis to adhere strongly to mainly type i and iv collagen present in the root dentin . \n e. faecalis is a very virulent microorganism , which can survive in alkaline ph and during long starvation periods and then becomes viable in the presence of serum . \n e. faecalis can survive long periods without any nutrient availability because it can derive nutrients from hyaluronan , which is converted by enzyme hyaluronidase and also derive energy sources from dentinal fluid even in a well - sealed root canal system . under stress , \n lipoteichoic acids protect e. faecalis against lethal conditions , cytolysin , as-48 and bacteriocin , which inhibits other bacterial growth . \n cytolysin destroys cells such as erythrocytes , pnm cells , macrophages and kills gram - positive microorganisms . due to this effect \n the adhesion of e. faecalis to type i and iv collagen is the basis of the present study because apical one - third of the root is made of cellular cementum primarily composed of type iv collagen . \n adhesion is the first step in colonization and our study confirms adhesion and invasion by e. faecalis up to 160 m into the root cementum [ figure 2c ] . \n however , a previous study showed e. faecalis penetration only up to 150 m deep into the root dentin . \n deeper penetration of e. faecalis in our study is due to the change in apical environment such as demineralization and apical resorption . in group \n i , there was no invasion or adhesion of e. faecalis as it is a control group . in group ii \n , only few samples showed adhesion , mean of adhesion is 0.55 [ table 1 ] and no samples showed penetration . on the other hand in group iii , all samples showed adhesion [ table 1 ] and highest penetration into root cementum up to 160 m [ table 2 ] . \n this shows that if early treatment is done after primary infection as in group ii , there are less chances of penetration of e. faecalis and re - infection or persistent infection . \n whereas in group iii , there was delay in treatment at early stages of infection , leading to change in apical environment like demineralization of root cementum and root cementum resorption . \n these apical changes helped e. faecalis to penetrate deep into the root cementum , thereby increasing the chances of persistent infection or re - infection . \n in our study , we cultured for 8 weeks twice because 18 weeks showed primary infection followed by biomechanical preparation and obturation giving the impression of normal root canal treatment done to subside primary infection . \n group ii showed only adhesion but no penetration [ figures 1b and 2b ] , whereas group iii showed deeper penetration . \n this means irrespective of the primary or secondary infection , what matters most is the apical changes in environment like demineralization or apical resorption , which help e. faecalis to penetrate deep into root cementum and is the cause for re - infection or persistent infection , as confirmed by the samples in group iii . \n we used gamma irradiation to sterilize the teeth because it does not alter collagen characteristics of the teeth . \n e. faecalis produces collagen binding protein , with the help of which it adheres strongly to collagen \n . other methods of sterilization of teeth samples are by autoclaving , using hot air oven , etc . \n the disadvantage of autoclave is that it collapses the collagen strands and use of hot air oven makes teeth dehydrated and more brittle . in our study , data was collected using a clsm as it has advantages over other methods such as histological samples , which can not distinguish between viable and dead bacteria . \n scanning electron microscope has the disadvantage of multiple steps for sample preparation making it time consuming and also it can not differentiate between dead and viable bacteria . \n fluorescence probe has the disadvantage that it can not distinguish between viable and dead bacteria and also it can not show distribution of bacteria . \n the clsm ( zeiss lsm 510 meta gmbh , mannheim , germany ) analysis has advantage over other methods to visualize bacteria . \n our study confirms that clsm can give a clear picture about viability and spatial distribution of bacteria . \n fda is a non - fluorescent cell - permeable dye , which in viable cells crosses the cell membrane , gets metabolized by intracellular esterases and is converted to fluorescein ( green ) . \n pi is non - cell permeable fluorescent dye , which gets adhered to ruptured cell membranes and dead cells appear red in color . \n we used an organic acid ( lactic acid ) for demineralization of root cementum because the end product of sucrose metabolism is lactic acid . \n demineralization and apical resorption at root cementum plays a significant role in penetration of e. faecalis into root cementum . \n the severity of infection is directly proportional to depth of penetration of e. faecalis into root cementum . \n the progress of the disease plays a critical role in the adhesion and penetration of e. faecalis to root cementum .", "role": "user" }, { "content": "aim : the aim of this study is to address the cause of persistent infection of root cementum by enterococcus faecalis.materials and methods : a sample of 60 human single - rooted teeth were divided into three groups . \n group i ( control group ) had no access opening and one - third of the apical root cementum was sealed using varnish . \n group ii had no preparation of teeth samples . in group iii , apical root cementum was exposed to organic acid and roughened using diamond point to mimic apical resorption . \n after access opening in groups ii and iii , all teeth samples were sterilized using gamma irradiation ( 25 kgy ) . \n e. faecalis broth was placed in the root canal and apical one - third of the tooth was immersed in the broth for 8 weeks with alternate day refreshment followed by biomechanical preparation , obturation and coronal seal . \n apical one - third of all teeth samples were again immersed in the broth for 8 weeks with alternate day refreshment to mimic secondary infection . \n the samples were observed under a confocal microscope after splitting the teeth into two halves.results:e . \n faecalis penetrated 160 m deep into the root cementum in group iii samples and only showed adhesion in group ii samples.conclusion:penetration and survival of e. faecalis deep inside the cementum in extreme conditions could be the reason for persistent infection .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: multiple sclerosis ( ms [ mim 126200 ] ) is a neurodegenerative autoimmune disease characterized by demyelination within the central nervous system ( cns . \n demyelination and the resulting formation of scar tissue in the cns impair the saltatory conduction along axons that is necessary for normal functioning of nerve impulses . though little \n is known about the underlying etiology of the disease , ms is a heterogeneous disorder with several characteristics common to autoimmune disorders including polygenic inheritance , evidence of environmental exposure , and partial susceptibility conferred by a human leukocyte antigen ( hla)-associated gene ( barcellos , et al . \n this inflammatory disorder results from an autoimmune response directed against cns antigens particularly myelin proteins . class ii major histocompatibility complex ( mhc ) molecules , such as hla ( human leukocyte antigen ) , normally function to bind and present peptide antigens to antigen - specific t cells . \n it is thought that the dysregulation of this process in ms results in damage to the myelin sheath , producing the pathophysiological phenotype seen in the disease . despite the degenerative nature of the disease , \n the clinical heterogeneity and complex etiology of ms have been confounding factors for genetic studies of the disease . yet despite these complexities , it is clear that genes play a vital role in the susceptibility to ms . \n numerous research groups , including our own , have conducted genomic linkage screens for ms in an attempt to identify regions that harbor disease loci ( akesson , et al . \n over 70 genomic regions have been investigated , revealing varying levels of support . however , the lack of replication of results from these studies has been problematic for using linkage to detect loci involved in ms . \n the strongest and most consistent finding for linkage to ms is chromosome 6p21.3 , the location of the mhc containing hla . until just recently , \n the mhc has been the only region clearly and consistently demonstrating linkage and association with ms ( haines , et al . \n however , the mhc has been estimated to account for only 1050% of the genetic component of ms susceptibility , at least in the caucasian populations of northern european descent ( dyment , et al . \n it appears that the association with the hla - drb1 * 1501 allele explains this linkage signal ( barcellos , et al . \n the exact mechanism by which a gene or genes in the mhc increase disease risk has yet to be determined , although recent work has sought to provide the tools needed to explore this region in greater detail ( de bakker , et al . \n recent work by our group has identified a strongly associated single - nucleotide polymorphism ( snp ) ( rs6897932 ) in the interleukin-7 receptor gene ( il7ra ) , a gene located on chromosome 5p13 . \n this snp introduces a coding change ( t244i ) that alters the ratio of soluble to bound protein ( gregory , et al . \n this result was further replicated in a genome - wide association study ( gwas ) performed by a broader collaborative group of investigators ( the international multiple sclerosis genetics consortium ( imsgc ) ) . \n the gwas also identified additional replicated associations with variations in other genes ( including cd25/il2ra and cd58 ) ( international multiple sclerosis genetics consortium , et al . 2007 ) . \n the involvement of these genes plus several others ( e.g. clec16a ) are now being tested and confirmed in multiple international studies ( international multiple sclerosis genetics consortium ( imsgc ) . \n although genome - wide association studies have now begun , dense snp follow - up studies of narrowed linkage regions are still underway because of their potential for identifying additional disease susceptibility genes . \n the american - french multiple sclerosis genetics group published one of the largest ms genomic linkage screens conducted ( kenealy , et al . \n follow - up of candidate regions identified in this study entailed genotyping snps at approximately 1.0 mb intervals flanking 10 mb on each side of peak screen snps in an expanded u.s . \n the 1q43 region not only continued to demonstrate evidence for linkage in the follow - up analysis ( non - parametric multipoint lod = 2.99 ) , but also generated a narrowed linkage interval when using the ordered subset analysis ( osa ) method to condition on the other loci ( ghosh , et al . \n this narrowed interval is ~7.0 mb for a lod score cut - off of 1.8 ( corresponding to a 2.0 lod score confidence interval from the 3.8 lod score hla - based peak ) ( see figure 1 ) . \n chromosome 1q43 was selected for further detailed investigation based on several additional lines of evidence . \n snps in the 1q43 region have also demonstrated suggestive linkage and/or association in several other ms screens conducted in a variety of study populations ( ban , et al . \n none of these earlier studies , which lack the power and marker density of the current generation of genome - wide association studies , demonstrate significant evidence for either linkage or association . \n however , they do provide support from independent sample populations of an effect within a common region of interest . \n another compelling piece of evidence for 1q is linkage to this region in studies for the autoimmune diseases rheumatoid arthritis and systemic lupus erythematosus , suggesting the potential presence of a gene common to autoimmune processes in this region ( gaffney , et al . \n following these lines of evidence , we set out to test whether common variation within this region is involved in susceptibility to develop multiple sclerosis . \n after quality control procedures , 578 snps were included in our initial analysis . using the tagger implementation in the haploview program we selected 268/578 snps , with r<0.2 , for inclusion in a multipoint linkage analysis of the narrow interval . \n these results continue to demonstrate considerable evidence for linkage to this region ( peak lod score 3.42 at ~238 mb ) ( figure 2a ) . as was analyzed in the initial follow - up ( kenealy , et al . \n 2006 ) , we examined this narrowed interval using the ordered subset analysis ( osa ) method to condition on the same loci ( namely hla - drb1 * 1501 and chr2 ) in an attempt to further resolve this effect ( figure 2a ) . \n the goal of this analysis was to determine if other previously suggested linkage regions , within our initial dataset , have a significant effect on the 1q43 region such that we might be able to identify specific subsets of our sample that may account for the effect within this region . \n neither of these conditional analyses demonstrated significant differences in lod scores from the overall multipoint analysis , suggesting that neither of these two loci can be used to predict families which will demonstrate strong evidence for a genetic effect within the 1q43 region . finally , \n as recent genome - wide association studies have found genetic overlap ( by way of identifying common loci , which are definitively associated with multiple autoimmune - related disorders ) within autoimmune disorders , it is feasible that a gene ( or genes ) within this region of chromosome 1q43 is affecting multiple autoimmune phenotypes ( maier and hafler . \n 2008 ) . given the evidence for linkage in other autoimmune diseases , we split our dataset into a ) families with evidence of additional autoimmune disease ( n=100 ) ; b ) families with no evidence of additional autoimmune diseases ( n=53 ) ; note there were 20 families for which a decision could not be made given our available information . while the lod scores are generally higher for the families with evidence for multiple autoimmune diseases , this difference is not significant ( figure 2b ) . \n subsequent to the multipoint linkage analysis , we conducted tests of association across the 578 snps . \n twelve snps demonstrated nominal p - values ( p 0.05 ) ( table 1 ) . \n we then chose an additional set of 51 snps to be genotyped ( using taqman ) in our extended dataset of 831 multiplex and trio families . \n these snps provide a higher density across regions demonstrating either evidence for linkage ( based on 2pt lod scores ) or association . \n analysis of these additional snps pointed to a region of interest within the rgs7 gene . \n two adjacent snps within the follow - up demonstrated both the highest 2pt lod score ( rs4660010 , lod=3.24 ) and the most significant association ( rs261809 , pdt p = 0.01 ) . \n while none of these results survive any sort of multiple comparisons correction , they suggest the need for further examination . \n we then examined the data from the recent imsgc genome - wide association study to determine if there was any evidence for association across this region ( international multiple sclerosis genetics consortium , et al . \n several of these snps demonstrate moderately significant p - values within this same region ( table 2 ) . \n it should be noted that 301 trios in our follow - up dataset ( n= 831 families ) overlap with the 931 trios within the gwas . while the p - values listed in table 2 represent independent results \n , the single exception is rs1380304 for which data is represented for our follow - up , the non - overlapping families in the gwas , and the gwas result itself . \n these preliminary findings further suggest that there may be a common variant within this region that is involved in ms . \n despite the success of previous studies in narrowing the linkage peak on chromosome 1q43 , the search for a susceptibility locus in this region remains a challenging task . even in this narrowed interval \n there are over 20 known or predicted genes currently listed in the public databases , several of which could serve as candidate genes due to their proposed function ( e.g. involvement in autoimmunity , viral susceptibility , oxidative stress / mitochondrial function , or neuronal processes ) or due to their tissue expression patterns ( table 3 ) . \n in addition , many of the remaining genes in this region have undergone little or no functional characterization , likely resulting in failure of these genes to be selected for investigation in a candidate gene study despite their potential involvement in disease . \n these problems are not unique to studies of ms studies of many complex diseases are hindered by flawed assumptions and lack of information concerning genes in a given candidate region . \n new methods that address these confounding factors are warranted . with this in mind we devised ( and previously described ) a process that prioritizes annotated snps for genotyping studies based on their location within multi - species conserved sequences ( mcss ) ( margulies , et al . \n 2003 ) and used this process to select snps across this ~7.0 mb region of interest ( mccauley , et al . \n the linkage signal in this region remains strong , although our results indicate that this appears to be independent of hla status , a putative chromosome 2 locus , or the presence of multiple autoimmune disorders within a family . \n one possible explanation is that there may be multiple rare variants present in this region , leading to the consistent detection of linkage , but lending difficulties to detect strong association to a common variant . \n interestingly , the previous reports demonstrating linkage in the ms , rheumatoid arthritis , and systemic lupus erythematosus screens are within a few mb of the peak snp from the msgg genomic screen and follow - up . \n however , genome - wide association studies ( gwas ) across multiple autoimmune disorders have failed to convincingly identify common variation within this region predisposing to any or all of these autoimmune diseases . \n this is based on the current literature detailing the findings of these studies in numerous other autoimmune diseases . \n this does not exclude the possibility that the effects of common variation within this region are too small within these other diseases to be detected with the current available datasets . when examining the imsgc gwas results ( international multiple sclerosis genetics consortium , et al . \n 2007 ) across this region , we find further potential evidence for association to snps within rgs7 . future examination of this region will undoubtedly require examination of copy - number variation ( cnvs ) and possible resequencing to identify a potential functional variant predisposing to ms . \n although the results of this study demonstrate some modest evidence for involvement of a common variant within the rgs7 gene to be associated with ms , additional well - powered studies need to be conducted in order to confirm these findings . \n rgs7 is a member of the family of proteins called regulators of g protein signaling ( rgs ) and it has been shown that altering rgs7 function could impair the normal dampening of the inflammatory response ( hausmann , et al . \n hausmann and colleagues found that expression of rgs7 in microglia and/or invading peripheral macrophages was induced by the inflammatory response created by experimental spinal cord injury in rats . \n it may follow that impaired regulation of rgs7 expression may have detrimental effects on the normal inflammatory cascade and that these effects may play a role in multiple sclerosis . \n the dataset used for the first stage of this follow - up study consisted of 173 multiplex families with 405 total affected individuals ( 115 male , 290 female ) . \n of these initial multiplex families , 91 families had previous evidence for positive linkage to 1q43 ( kenealy , et al . \n the second stage ( or extended ) follow - up dataset included 831 multiplex and trio families with 1077 total affected individuals ( 266 male , 811 female ) . \n all families were ascertained at the university of california at san francisco ( ucsf ) according to well established diagnostic and inclusion criteria . \n all protocols were approved by the appropriate institutional review boards and all individuals provided informed consent before participating in the study . \n positive family histories were investigated by direct contact with other family members , request for medical records , and by clinical examination , laboratory testing , or paraclincial studies ( mri scanning and evoked - response testing ) . \n individuals were placed into one of four categories : definite ms , probable ms , possible ms , and no evidence of ms . \n consistent and stringent clinical criteria were applied as described elsewhere ( goodkin , et al . \n 1991 , haines , et al . 1996 ) and all clinically definite ms cases met the poser criteria ( poser , et al . \n for the first stage of follow - up , 768 snps were genotyped across this region in 173 multiplex families . \n the illumina beadarray platform was used for rapid and accurate snp genotyping in our dataset . \n all genotyping was performed by the duke genomics resource laboratory core using the illumina beadarray platform . \n this system provides automated outputs that ease transfer between data generation and the pedigene database system used in our statistical analyses ( haynes , et al . \n 1995 ) . due to our own snp density requirements and the nature of the illumina system \n , we chose 768 snps which completed two illumina oligo pool assays ( or opas ) . \n a detailed description of the snp selection process for this project has been previously described ( ( mccauley , et al . \n 2007 ) ) . in general snps were selected by considering informativeness , validation status , location / density , and putative function . \n average spacing of the 768 snps in the ~ 7.0 mb region on 1q431q44 region was < 10 kb allowing for coverage of the region that is appropriate for observed patterns of linkage disequilibrium in caucasian populations ( gabriel , et al . \n we examined the illumina panel of snps using standard measures of quality control , dropping 190 snps from downstream analysis . \n of the 190 snps that failed : 167 snps were monomorphic in our dataset ; 22 snps demonstrated poor assay performance as measured by call rate ( < 95% ) , cluster separation , or other assay failure ; and 1 snp mapped to multiple locations in the genome . for stage one of the follow - up , eleven samples were dropped ( including 1 affected male , 3 affected females ) due to low call rates ( < 95% ) and an excess of mendelian errors . \n subsequent to the initial linkage and association analysis of the 173 multiplex family dataset , more detailed association analysis was performed within the extended dataset of 831 total families . \n snps , within the illumina panel , demonstrating evidence for association as well as additional novel snps ( n=51 ) within high priority regions based on linkage and association results were selected for further genotyping and analysis using taqman assays from applied biosystems ( foster city , ca ) . \n the final set of the additional 51 snps met the design criteria for taqman , provided an additional level of marker density in key regions , and had relatively high minor allele frequencies . \n following completion of genotyping , quality control ( qc ) procedures were conducted to ensure the accuracy of all genotype data . \n these included snp checks for call rate and assay reliability , as well as sample checks for call rate and mendelian inconsistencies . \n after assessing the quality of both snps and samples , we conducted a battery of analyses to localize and identify common susceptibility variants underlying our narrowed linkage peak . \n 1994 ) , with two - point heterogeneity lod ( hlod ) scores being calculated through homog ( ott . \n snps included in both multipoint linkage analysis and floss were chosen using the implementation of tagger within the haploview software package ( barrett , et al . 2005 , de bakker , et al . 2005 ) . \n association analyses for this study were conducted using the pdt statistic ( martin , et al . \n the dataset used for the first stage of this follow - up study consisted of 173 multiplex families with 405 total affected individuals ( 115 male , 290 female ) . \n of these initial multiplex families , 91 families had previous evidence for positive linkage to 1q43 ( kenealy , et al . \n the second stage ( or extended ) follow - up dataset included 831 multiplex and trio families with 1077 total affected individuals ( 266 male , 811 female ) . \n all families were ascertained at the university of california at san francisco ( ucsf ) according to well established diagnostic and inclusion criteria . \n all protocols were approved by the appropriate institutional review boards and all individuals provided informed consent before participating in the study . \n positive family histories were investigated by direct contact with other family members , request for medical records , and by clinical examination , laboratory testing , or paraclincial studies ( mri scanning and evoked - response testing ) . \n individuals were placed into one of four categories : definite ms , probable ms , possible ms , and no evidence of ms . \n consistent and stringent clinical criteria were applied as described elsewhere ( goodkin , et al . \n 1991 , haines , et al . 1996 ) and all clinically definite ms cases met the poser criteria ( poser , et al . \n for the first stage of follow - up , 768 snps were genotyped across this region in 173 multiplex families . \n the illumina beadarray platform was used for rapid and accurate snp genotyping in our dataset . \n all genotyping was performed by the duke genomics resource laboratory core using the illumina beadarray platform . \n this system provides automated outputs that ease transfer between data generation and the pedigene database system used in our statistical analyses ( haynes , et al . \n 1995 ) . due to our own snp density requirements and the nature of the illumina system \n , we chose 768 snps which completed two illumina oligo pool assays ( or opas ) . \n a detailed description of the snp selection process for this project has been previously described ( ( mccauley , et al . \n 2007 ) ) . in general snps were selected by considering informativeness , validation status , location / density , and putative function . \n average spacing of the 768 snps in the ~ 7.0 mb region on 1q431q44 region was < 10 kb allowing for coverage of the region that is appropriate for observed patterns of linkage disequilibrium in caucasian populations ( gabriel , et al . 2002 ) . \n we examined the illumina panel of snps using standard measures of quality control , dropping 190 snps from downstream analysis . \n of the 190 snps that failed : 167 snps were monomorphic in our dataset ; 22 snps demonstrated poor assay performance as measured by call rate ( < 95% ) , cluster separation , or other assay failure ; and 1 snp mapped to multiple locations in the genome . for stage one of the follow - up , eleven samples were dropped ( including 1 affected male , 3 affected females ) due to low call rates ( < 95% ) and an excess of mendelian errors . \n subsequent to the initial linkage and association analysis of the 173 multiplex family dataset , more detailed association analysis was performed within the extended dataset of 831 total families . \n snps , within the illumina panel , demonstrating evidence for association as well as additional novel snps ( n=51 ) within high priority regions based on linkage and association results were selected for further genotyping and analysis using taqman assays from applied biosystems ( foster city , ca ) . \n the final set of the additional 51 snps met the design criteria for taqman , provided an additional level of marker density in key regions , and had relatively high minor allele frequencies . \n following completion of genotyping , quality control ( qc ) procedures were conducted to ensure the accuracy of all genotype data . \n these included snp checks for call rate and assay reliability , as well as sample checks for call rate and mendelian inconsistencies . \n thresholds used to exclude data are discussed in the results . after assessing the quality of both snps and samples \n , we conducted a battery of analyses to localize and identify common susceptibility variants underlying our narrowed linkage peak . \n 1994 ) , with two - point heterogeneity lod ( hlod ) scores being calculated through homog ( ott . \n snps included in both multipoint linkage analysis and floss were chosen using the implementation of tagger within the haploview software package ( barrett , et al . \n association analyses for this study were conducted using the pdt statistic ( martin , et al .", "role": "user" }, { "content": "multiple sclerosis is a debilitating neuroimmunological and neurodegenerative disease affecting more than 400,000 individuals in the united states . \n population and family - based studies have suggested that there is a strong genetic component . \n numerous genomic linkage screens have identified regions of interest for ms loci . \n our own second - generation genome - wide linkage study identified a handful of non - mhc regions with suggestive linkage . \n several of these regions were further examined using single - nucleotide polymorphisms ( snps ) with average spacing between snps of approximately 1.0 mb in a dataset of 173 multiplex families . \n the results of that study provided further evidence for the involvement of the chromosome 1q43 region . \n this region is of particular interest given linkage evidence in studies of other autoimmune and inflammatory diseases including rheumatoid arthritis and systemic lupus erythematosus . in this follow - up study , we saturated the region with ~700 snps ( average spacing of 10 kb per snp ) in search of disease associated variation within this region . \n we found preliminary evidence to suggest that common variation within the rgs7 locus may be involved in disease susceptibility .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: cervical cancer is the second most frequently \n diagnosed cancer among women worldwide , with nearly 80 percent arising among \n women in developing countries . despite effective \n screening modalities , nearly 40 percent of women in the united states present \n with locally advanced stage \n ii - iva cervical cancers extending beyond the cervix to invade \n vaginal or parametrial , pelvic sidewall , bladder , or rectal tissues . in women with locally advanced cervical cancer , \n three \n randomized trials have shown concurrent pelvic radiation and platinum - based \n chemotherapy meaningfully contribute to improved disease - free survival [ 24 ] . \n these compelling \n clinical results prompted the national \n cancer institute ( nci ) to issue a publicized national clinical alert in february , \n 1999 advising concurrent \n platinum - based chemotherapy and radiation for women with locally advanced cervical \n cancer . according to the united states surveillance , \n epidemiology , and end - results ( seer ) cancer registries between january , 1998 \n and december , 2002 , \n 35 percent of annual incident cervical cancer patients \n arose in women aged 55 years or older ( 55 ) . \n however , women 55 years accounted for 55 percent of cervical cancer - related \n mortality during this time period . widening disparity between cervical cancer \n incidence and mortality among women 55 years questions whether chemoradiation \n has been implemented as a national practice pattern in this patient population . \n population - based studies are needed to evaluate the national impact of the 1999 \n nci clinical alert advising chemoradiation for locally advanced cervical cancer . \n the merged seer - medicare dataset \n offers a population - based cohort of women 55 years longitudinally tracked over the course of \n cancer diagnosis , treatment , and follow - up . \n the utility of seer - medicare data to identify chemotherapy administration \n has been validated . \n this study determines the frequency of chemoradiation administration in women 55 years diagnosed with cervical cancer immediately before and after \n the 1999 nci clinical alert using the population - based seer - medicare dataset . \n secondary aims included identifying \n factors in women aged 55 years \n associated with decreased chemotherapy administration during radiation . \n data were abstracted from the nci - sponsored seer - medicare \n program using the seer 11-registries plus alaska 19982003 dataset ( july , 2006 \n edition , ) . because seer data contain no \n unique personal identifiers and thus are available for public use and research , \n approval by an ethics committee or informed consent is not necessary to perform \n our analyses . in general , \n seer data cover \n 26 percent of the us population , and therefore , are considered representative \n of the whole us population . \n the seer program \n registries routinely collect data on patient demographics ( i.e. , \n age , race [ caucasian , african - american , asian , hispanic , or other ] , patient \n residence , and socioeconomic status [ income per census tract ] ) , primary tumor \n site ( i.e. , cervix ) , tumor morphology and stage at diagnosis , first course of \n treatment , and follow - up for vital status . the seer program does not record \n chemotherapy administration . to identify claims for chemotherapy administration , \n data were abstracted from three merged \n seer - medicare files : medicare provider analysis and review ( medpar ) , carrier claims \n ( nch ) , and outpatient claims ( outsaf ) . \n medpar files record all calendar year part \n a short stay , long stay , and skilled nursing facility claims . \n nch files contain \n calendar year center for medicare and medicaid \n services ( cms ) physician / supplier part b claims . \n outsaf files list calendar \n year claims for hospital outpatient departments , rural health clinics , renal \n dialysis facilities , outpatient rehabilitation facilities , comprehensive \n outpatient rehabilitation facilities , and community mental health centers . \n procedure \n codes for chemotherapy administration made within 3 months after diagnosis of \n cervical cancer were ascertained . \n the study population consisted of all female \n patients , without previous or synchronous invasive cancers , who were diagnosed \n with stage ii , iii , or iva cervical cancer between 1998 and 2002 ( n = 3 , 601 ) . \n stage \n i patients ( n = 1 , 363 ) were excluded because they are not reliably substaged \n ( i.e. , ib1 or ib2 ) in the seer - medicare database and the majority underwent \n definitive surgery ( 1,044 of 1,363 [ 76.6% ] ) . \n women with unknown stage ( n = 357 ) , stage \n 0 ( n = 47 ) , and stage ivb \n ( n = 402 ) cervical cancers were excluded . to ensure that chemotherapy claims \n coincided with radiation and are not missed secondary to payment by private \n insurance ( n = 431 ) , included women must have had medicare parts a and b coverage \n for the duration of their cancer care ( n = 1 , 001 ) \n . for determination of chemoradiation administration , included \n women 55 years must have undergone radiation ( external pelvic and brachytherapy \n implant ) for primary treatment of their cervical cancer ( n = 385 ) . \n the charlson comorbidity index is a summary \n measure of 19 comorbid conditions , each assigned a weighting factor according \n to its potential for influencing mortality . \n charlson comorbidity indices were calculated by abstracting medicare icd-9-cm diagnosis \n and procedure codes relating to cardiovascular , cerebrovascular , hepatic , \n renal , diabetic , connective tissue , or neoplastic disease among inpatient and \n outpatient claims made for each woman one year prior to the diagnosis of \n cervical cancer [ 1214 ] . \n women diagnosed with chronic end - stage renal disease or \n listed in the seer - medicare dataset as having diagnosis codes for renal \n disease , renal failure , or renal insufficiency were considered women as having renal \n disease comorbidity . for this analysis , \n the day of diagnosis in seer was \n arbitrarily assigned as the 15th of the month . \n women were considered to have \n received concurrent chemoradiation therapy if there was at least one submitted \n billing claim for chemotherapy within a three - month period after diagnosis and \n radiation treatment . \n chi - square tests for categorical variables and student 's t - tests for continuous variables were \n used to compare differences in demographic and tumor variables by chemoradiation \n administration . \n adjusted odds ratios for chemoradiation were generated using multivariate \n logistic regression models sequentially controlling age , race , residence , \n socioeconomic status , comorbidity , tumor stage , and histology as defined in \n table 1 . a p - value < 0.05 \n ( two - sided ) was used to determine statistical significance . \n computer programing \n and statistical analyses were performed using sas software version 9.1 ( sas \n institute , cary , nc ) . \n after exclusions , 385 women aged 55 years \n underwent pelvic radiation and intracavitary brachytherapy for primary \n treatment of cervical cancer between january , 1998 and december , 2002 . \n table 1 presents patient demographic and tumor \n variables for the 385 women included in this analysis . \n the majority of cases \n were stage ii squamous cell cancers diagnosed in caucasian women who had minimal comorbidities \n and who resided in large metropolitan areas . among women aged 55 years identified in the seer - medicare dataset , 166 of 385 \n ( 43% ) received chemoradiation . \n cisplatin chemotherapy was specifically claimed \n in 129 of 166 ( 78% ) women . before the 1999 nci clinical alert , 30 percent of \n women aged 55 years ( 29 of 97 women ) identified in the seer - medicare registry received at least one \n chemotherapy dose during radiation ( see table 2 ) . in the year 2000 and after \n the 1999 nci clinical alert , the proportion receiving chemoradiation was 41 \n percent of women aged 55 years ( 36 of 87 women ) . \n afterwards , the \n proportion receiving chemoradiation was greater than 50 percent ( see table 2 ) . \n between 1998 and 2002 , a significant increasing trend for chemoradiation administration \n was observed among women aged 55 years registered in the seer - medicare dataset ( p < .01 ) . \n the \n median number of chemotherapy claims during radiation was four ( mean 4.2 , \n standard deviation 1.9 , table 2 ) . among women treated with chemoradiation , 78 \n of 166 ( 47% ) received five or more cycles of chemotherapy . \n table 3 compares variables \n in univariate analyses evaluating patients who received concurrent chemotherapy \n and radiation compared to those who received radiation alone . \n the mean age of \n women receiving chemoradiation was significantly younger ( table 3 , p < .001 ) . \n the proportion of women residing \n in urban , less urban , and rural areas receiving chemoradiation was \n significantly higher than receiving radiation alone ( 20% versus 10% , p = .03 ) . \n chemotherapy \n use during radiation was not associated with race , socioeconomic \n status , tumor histology or stage , or comorbidity index . \n the proportion of women \n diagnosed with renal disease comorbidity was similar among chemoradiation ( 18/166 , 11% ) \n and radiation alone ( 21/219 , 10% ) treatment groups ( p = .73 ) . \n table 4 presents multivariate analyses for odds \n of receiving concurrent chemoradiation adjusting for patient demographic and tumor \n differences . \n women aged 71 years or older had a significantly decreased odds of \n undergoing chemoradiation treatment as compared to women aged 55 to 70 years ( p = .04 ) . \n for women 71 years or older , the proportion of women with renal disease who \n received chemoradiation ( 9 of 95 , 10% ) and radiation alone ( 7 of 138 , 5% ) was \n similar ( p = .19 ) . in multivariate analyses , women residing \n in urban , less urban , and rural areas had significantly increased odds of \n undergoing chemoradiation treatment as compared to women residing in \n metropolitan areas ( p < .001 ) . \n the \n proportion of women 71 years or older in big metropolitan , metropolitan , and \n urban / less urban / rural areas was 42 percent ( 99 of 235 ) , 35 percent ( 33 of 61 ) , \n and 36 percent ( 20 of 56 ) , respectively ( p = .41 ) . \n race , \n socioeconomic status , comorbidity index , and tumor histology or stage were not \n significant confounders for chemoradiation treatment . \n the present data from the us population - based seer - medicare database indicate that the 1999 nci clinical \n alert for platinum - based chemoradiation has had an impact on chemoradiation use \n for locally advanced stage \n ii - iva cervical cancers diagnosed in women 55 years . eighteen \n months before the nci clinical alert , less than 30 percent of women 55 \n years received chemoradiation \n . \n however , within 18 months of the nci clinical alert , the proportion of women 55 \n years with locally advanced cervical cancer receiving chemoradiation \n significantly rose to 50 percent . \n since chemoradiation use has steadily risen \n through the last seer - medicare cohort available for study ( i.e. , 2002 ) , the \n recommendation has been followed but a substantial fraction of women 55 years \n still did not receive concurrent chemoradiation in 2002 three years after the \n nci clinical alert . \n age is a risk factor for pelvic and distant relapse as \n well as death after treatment for cervical cancer . in multivariate analyses \n conducted by the gynecologic oncology group evaluating radiation and chemotherapeutic \n radiation sensitizers , \n these findings led to the \n controversial suggestion that younger patient age at diagnosis was associated \n with high mortality ; and yet , the inferior mortality outcomes attributable to \n younger patient age have vanished in the era of platinum - based chemoradiation \n as no contemporary gynecologic oncology group or cooperative group study \n identifies age as a significant confounder upon survival outcomes [ 24 ] . while platinum - based chemoradiation appears to have \n decreased mortality in younger women , it remains unknown whether older women \n are deriving full survival benefit from chemoradiation treatment . perceived and \n actual hematological , renal , gastrointestinal , and neural toxicities of platinum \n chemotherapy perhaps influence physicians to not consider coadministration of \n chemotherapy during radiation in older women . \n these data indicate that \n significantly fewer women older than 71 years who have locally advanced \n cervical cancer receive chemoradiation even though the \n survival of these older patients who receive chemoradiation approaches that of \n younger patients who undergo chemoradiation treatment [ 24 , 16 ] . \n this study is not the first to \n identify this age trend . in a pattern of care study \n , it was reported that 63 percent \n of all women captured in this survey underwent concurrent chemotherapy and radiation in 1999 , as \n compared to 26 percent in 1998 . \n twenty - five percent of women 60 years or older \n received chemoradiation as compared to 48 percent among women aged 40 years or \n less ( p = .02 ) . \n in an earlier analysis of the seer - medicare database \n controlling for racial and socioeconomic factors , increasing age was strongly \n associated ( p < .0001 ) with \n receiving neither chemoradiation nor radiation treatment for cervical cancer . however , both studies capture only those women treated \n through 1999 , study periods ending when the 1999 nci clinical alert were released . \n thus , a true assessment of the \n impact of the nci clinical alert is essentially unknown . \n the present data are the \n first assessment of chemoradiation treatment after the 1999 nci clinical alert for \n chemoradiation treatment of locally advanced cervical cancer in women aged 55 years . \n the us seer - medicare dataset is an nci - sponsored cancer registry that reflects \n a wide range of race / ethnic , demographic , and socioeconomic diversity and that \n avails itself to cancer health service delivery analyses in women aged 55 \n years . \n the data presented herein reflect \n prospectively collected but not randomized practice and usage of \n chemoradiation . \n these data measure the impact of randomized clinical trials in \n cervical cancer , as popularized by the national 1999 nci clinical alert , on \n clinical chemoradiation practices for the treatment of cervical cancer . \n thus , these \n data conveniently sample a small proportion of the total number of women with \n locally advanced cervical cancer treated in the us \n each year . \n consequently , analyses \n on these nonrandomly treated women can only be considered as an interpretive \n guide for changing trends in chemoradiation usage for locally advanced cervical \n cancer . indeed , the present data suggest that women 55 years with locally advanced cervical cancer are \n increasingly likely to receive chemoradiation . data also suggest that \n chemoradiation use has significantly lagged behind in women 71 years or \n older compared to women 55 to 70 years . \n perhaps physicians applied the nci recommendations to \n some groups of women more consistently than others . in this study of the \n seer - medicare population \n while the nci clinical alert has \n strongly endorsed use of chemoradiation for all patients with locally advanced \n cervical cancer , it is worth considering the causes of disparity in \n chemoradiation use among younger and older women . \n the exact regimen of \n chemotherapy administration , patient - specific chemotherapy dosage , and adverse \n effects of treatment can not be abstracted reliably from the seer - medicare \n database . \n while reluctance of older patients to receive chemotherapy due to \n perceived toxicities , tolerability , or an apathetic attitude often are \n difficult to enumerate , physical limitations such as comorbid disease may be \n more reliably estimated in a population - based database that records these \n factors . in the current study , \n comorbid renal \n disease , as identified by diagnosis codes for renal disease , renal failure , or \n renal insufficiency , also was not associated with infrequent chemoradiation \n treatment . \n demographic variables of \n race , socioeconomic status , and tumor variables of histology and clinical stage \n were not associated with more infrequent chemoradiation treatment , a reassuring \n finding of this study . however , a significant disparity in the proportion of \n women 55 years in metropolitan and nonmetropolitan residencies was observed \n in this study . \n only 40 percent of the women residing in metropolitan areas as \n compared to 60 percent of women residing in urban , less urban , and rural residencies \n received chemoradiation during the entire 1998 to 2002 period under study ( p = .03 ) . disparity in age cohorts among \n residences \n does not account for this difference as the proportion of women aged \n 71 years or older among big metropolitan , metropolitan , and urban / less \n urban / rural areas is similar ( p = .41 ) . \n the issues surrounding the more frequent use of radiation alone in metropolitan \n residencies are difficult to abstract but perhaps are related to unreported \n comorbid disease , patient refusal , and perceived toxicities / tolerability of the \n combined treatment regimen . \n the data can not exclude the possibility that \n healthcare - system - related factors , such as access to care or differences in \n referrals for chemotherapy consultation , could explain the findings of the \n current study . \n the reasons why older women do not receive chemotherapy remain \n elusive , and perhaps , future population - based studies may provide more \n meaningful insight . \n the population \n covered by seer program representing 26 percent of the general population compares \n favorably to us census population data with regard to measures of poverty and \n education , but has a higher \n proportion of urban and foreign - born persons in the registry as compared \n to the general us population . \n census population estimates for the year 2000 suggest that 73 percent of women aged 55 years live in metropolitan areas as compared to \n 85 percent registered in the seer - medicare dataset . \n there may also be \n differences in the underlying racial distribution of the seer - medicare dataset \n compared to the us population comprising new incident cases of cervical cancer . \n this \n seer - medicare dataset used to analyze the impact of the nci clinical alert is limited to women aged 55 years that must have been enrolled in medicare \n part a and b coverage for the duration of their cervical cancer treatment . \n thus , \n by limiting the dataset by an age criterion of 55 years , this analysis does not capture \n chemoradiation treatment in young women who comprise the majority of new incident cases in \n the us . \n moreover , identification of chemoradiation in the seer - medicare population \n follows the centers for medicare and medicaid services ' coverage policies \n relating to chemotherapy administration . \n current centers for medicare and \n medicaid services policy permits fee - for - service reimbursement for intravenous \n chemotherapy , including cisplatin chemotherapy administration . \n as \n medicare billing claims for chemotherapy administration are often coded within \n six months of initial cancer diagnosis , this analysis ' three - month \n timeframe for coincident chemotherapy and radiation treatment in the \n seer - medicare dataset is reasonable . \n women simultaneously enrolled by a private \n insurer were excluded as chemotherapy administration may have been paid by this \n entity rather than medicare , and thus falsely skewing results toward treatment \n with radiation alone . \n another limitation is that comorbid disease documentation \n in a population - based dataset is derived from claims - based administrative coding , \n which may generally be less complete than data obtained from direct medical \n chart review . \n interpretative criticism also concerns the timeliness of the \n seer - medicare cohort under study , as these patients may be poorly reflective of \n modern chemoradiation practice ; and yet , seer data and medicare data are \n infrequently merged . as such \n , the 19982002 seer - medicare \n patient population represents the most contemporary cohort in which to study \n concurrent seer radiation and medicare chemotherapy recorded administration . \n the current analysis of 19982002 seer - medicare \n data indicates increased utilization of chemoradiation treatment since the 1999 \n nci clinical alert strongly \n advocating for concurrent chemotherapy and radiation for locally advanced \n cervical cancer . \n , the population - based seer - medicare registry identifies 43 \n percent of the women 55 years with locally advanced cervical \n cancer receiving chemoradiation despite published guidelines to the contrary . while \n our study is provocative , it is unable to definitively assess current national \n chemoradiation practice patterns . to further corroborate our findings \n , it would \n be interesting to analyze nci - sponsored \n clinical trials enrolling women aged 55 years to determine if the number of chemotherapy cycles \n given during radiation impacts clinical outcome . \n further analysis of national \n practice patterns from future us surveillance , epidemiology , and end - results - medicare \n mergers is warranted to identify contributing factors leading to the disparity \n in incidence and mortality among women 55 years with locally advanced cervical \n cancer .", "role": "user" }, { "content": "our study evaluated whether 1999 national cancer institute ( nci ) chemoradiation guidelines for cervical cancer impacted treatment of women 55 years . \n we identified 385 women 55 years ( median , 72 years ) diagnosed with stage ii - iva cervical cancer between january , 1998 and december , 2002 in the united states surveillance , epidemiology , and end results ( seer)-medicare registries . \n chemoradiation frequency tables were constructed for age , race , community setting , socioeconomic status , and comorbidity index . \n of 385 women , 166 ( 43% ) received chemoradiation as primary treatment . \n prior to the 1999 nci clinical alert , 5/43 ( 12% ) in 1998 and 24/54 ( 44% ) in 1999 received chemoradiation . \n the chemoradiation proportion was 41% ( 36/87 ) in 2000 , 48% ( 51/107 ) in 2001 , and 53% ( 50/94 ) in 2002 ( trend , p < .01 ) . \n women 71 years had significantly lower odds of chemoradiation ( p = .04 ) . while seer - medicare data indicated an increasing trend for chemoradiation after the 1999 nci clinical alert , chemoradiation was less frequent in elderly women with cervical cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: spinocerebellar ataxias ( scas ) are a group of clinically and genetically diverse and autosomal - dominant disorders characterised by neurological deficits in the cerebellum . at present \n , there is no cure for scas . of the different distinct subtypes of autosomal - dominant scas identified to date , causative genes for only a fraction of them \n , we investigated the cause of an autosomal - dominant sca phenotype in a family that exhibits cerebellar ataxia and pontocerebellar atrophy along with a global reduction in brain volume . \n whole - exome analysis revealed a missense mutation c.g1391a ( p.r464h ) in the coding region of the coiled - coil domain containing 88c ( ccdc88c ) gene in all affected individuals . \n functional studies showed that the mutant form of ccdc88c activates the c - jun n - terminal kinase ( jnk ) pathway , induces caspase 3 cleavage and triggers apoptosis . \n this study expands our understanding of the cause of autosomal - dominant scas , a group of heterogeneous congenital neurological conditions in humans , and unveils a link between the jnk stress pathway and cerebellar atrophy . \n ", "role": "user" }, { "content": "backgroundspinocerebellar ataxias ( scas ) are a group of clinically and genetically diverse and autosomal - dominant disorders characterised by neurological deficits in the cerebellum . at present \n , there is no cure for scas . of the different distinct subtypes of autosomal - dominant scas identified to date , causative genes for only a fraction of them \n are currently known . in this study , we investigated the cause of an autosomal - dominant sca phenotype in a family that exhibits cerebellar ataxia and pontocerebellar atrophy along with a global reduction in brain volume.methods and resultswhole - exome analysis revealed a missense mutation c.g1391a ( p.r464h ) in the coding region of the coiled - coil domain containing 88c ( ccdc88c ) gene in all affected individuals . \n functional studies showed that the mutant form of ccdc88c activates the c - jun n - terminal kinase ( jnk ) pathway , induces caspase 3 cleavage and triggers apoptosis.conclusionsthis study expands our understanding of the cause of autosomal - dominant scas , a group of heterogeneous congenital neurological conditions in humans , and unveils a link between the jnk stress pathway and cerebellar atrophy .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: animal anthrax cases from the institute of veterinary control and research in eastern anatolia region and human cases from the department of clinical bacteriology and infectious diseases ( in the tertiary hospital ) and state health centers or hospitals ( primary and secondary health care centers ) from january 1992 to november 2004 were included . \n is characterized by a skin lesion evolving from a papule , through a vesicular stage , to a depressed black eschar ; edema , erythema , or necrosis without ulceration may be present . \n a confirmed case is defined through positive smear or isolation of bacillus anthracis in clinical specimens ( 2 ) . \n b. anthracis isolates were identified on the basis of conventional methods such as gram - positive bacilli with spores seen in smear , the presence of a capsule , lack of motility , and catalase positivity . in humans , \n the diagnosis of anthrax was based on clinical findings or microbiologic procedures , including gram stain ( short chains of capsulated gram - positive bacilli seen on a smear ) and isolation of b. anthracis from a clinical specimen ( 3 ) . in animals , \n the diagnosis was made by examining the history , autopsy findings , and gram stain or cultures from tissues ( liver , spleen , lymph node , bone marrow , and ear ) of a sick animal . from the 13-year period january 1992november 2004 , \n a total of 464 animal and 503 human cases of anthrax were detected in eastern turkey . of 464 animal cases , 20 ( 4.3% ) were sheep , and 444 ( 95.7% ) were cattle . \n the mean number of cases was 35.6 per year in animals and 38.6 per year in humans . \n anthrax cases in both humans and animals increased from 1993 to 1999 and decreased after 2000 ( figure 1 ) . \n most animal ( 319 [ 68.7% ] ) and human ( 338 [ 67.2% ] ) cases occurred between july and october . \n anthrax was seen most frequently in erzurum and kars , cities that are centers of animal commerce ( table ) . \n most of the human cases were cutaneous anthrax ( figure 2 ) only 2 cases ( 0.39% ) died , one from meningitis , and the other from asphyxia due to extensive anthrax edema ( 4,5 ) . \n anthrax is endemic in the middle east , some asian countries , africa , and south america . \n the disease has also been detected in turkey ( 68 ) . in eastern turkey , most people live in rural areas and work in agriculture and stockbreeding . animals usually graze in pasture from april through november . in this study , \n the numbers of both animal and human anthrax cases in eastern turkey increased from 1995 to 2000 . \n economic and social changes , strict animal vaccination programs , and education of farmers may have contributed to this trend . \n anthrax was most commonly seen in erzurum and kars , which are centers of animal trade and have large international commercial roads . \n skinning , butchering a sick animal , and handling and eating contaminated meat are known risk factors for human anthrax ( 12 ) . \n all patients in our study had a history of exposure to anthrax - infected animals . \n although some patients had eaten infected meat , no gastrointestinal anthrax cases occurred , which may be due to the cooking methods these patients used ( overcooking the meat ) . \n however , humans should not eat meat from a sick animal . in this study , more anthrax cases occurred in humans than in animals . \n first , sometimes sick animals have been butchered by humans and are not reported to veterinary institutions , so some animal cases are not recorded . \n secondly , 1 sick animal can contaminate several persons who participate in the slaughtering procedure . \n finally , because fewer resources are available for the veterinary infrastructure and reporting mechanisms than for the public health system , animal cases are probably underreported . \n ( 8) detected 164 animal anthrax cases versus 327 human cases in 1993 , and 50 animal cases versus 445 human cases in 1994 . \n ( 13 ) reported 45 animal cases versus 89 human anthrax cases in 20002001 . in this study , most animal anthrax cases occurred in cattle . \n second , cattle graze in plains , but sheep graze in high plateaus and slopes , so cattle probably have more exposure to environmental anthrax risks than sheep ( spores accumulate more in plains ) . \n third , cattle have more economic value than sheep ; as a result , sick cattle are reported to the veterinary service and recorded . \n but , when a sheep becomes ill , it is slaughtered before dying or buried immediately after death ; its death is not reported to the veterinary service in rural areas . \n aydin et al . ( 8) reported that 72.9% of anthrax cases occurred in cattle and 27.0% in sheep in the same region in 1994 . \n ( 13 ) detected 11 anthrax cases in sheep versus 34 anthrax cases in cattle in the same region in 2000 \n . good surveillance , decontamination and disinfection procedures , and education are mandatory to reduce the incidence of anthrax . \n the disease in humans ultimately depends on controlling it in animals by effective surveillance and immunization . \n the carcasses of all animals that have died with a confirmed diagnosis of anthrax should be thoroughly cremated , and the remains should be deeply buried ( 14,15 ) .", "role": "user" }, { "content": "we investigated animal and human anthrax cases during a 13-year period in eastern turkey . from 1992 to 2004 , a total of 464 animal and 503 human anthrax cases were detected . \n most cases occurred in summer . \n anthrax remains a health problem in eastern turkey , and preventive measures should be taken .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: bedside teaching is a vital component of medical education and one of the most effective ways to learn clinical and communication skills . \n evidence - based studies show that interpersonal and communication skills of doctors have a significant impact on patient care . \n generally , it is thought that bedside teaching is applicable only to the hospital setting . \n however , bedsides teaching skills apply to any situation where the teaching occurs in the presence of a patient , including an office setting and long - term care facility . sir william osler ( 1849 - 1920 ) , a renowned clinician - teacher , put emphasis on the importance of bedside teaching . in 1903 \n he stated to study the phenomena of disease without books is to sail an uncharted sea , whilst to study books without patients is not to go to sea at all . \n sylvian fissure was named , was one of the first to record his thoughts on teaching on rounds . \n he said that to lead students by hand to the practice of medicine , it was necessary to make them see patient everyday and get back the symptoms and physical findings . \n he also inquired from the students regarding their observation , thought and perceptions related to the patients illness and the principles of treatment . \n as opposed to listening to a presentation or reading off a blackboard , teaching in the presence of patients allows the learners to use nearly all of their senses such as hearing , vision , smell and touch to learn more about the patient . \n there are many skills , particularly the humanistic aspects of medicine , which can not be taught in a classroom . \n a comprehensive physical examination can provide 70% diagnosis , while 56% of the diagnosis is derived only from a patient 's history . in spite of such importance and historical support for bedside teaching , landry and colleagues , \n many studies exposed that a substantial number of doctors perceived their own competencies as inadequate . \n lacombe , identified that actual teaching at the bedside with emphasis on history taking and physical diagnosis has declined from 75% in the 1960s to 16% in 1978 and even lesser today . therefore , the questions of how important the clinical teaching is , and why it declines arise . \n the purpose of this review article is to highlight three major areas : first , to reinforce the importance of teaching at the bedside , second , to identify the major issues or reasons for the decline of bedside teaching and third , to prescribe the strategies and newer models or approaches of bedside teaching that might help prepare future competent medical practitioners . \n the literature search on bedside teaching was carried out using pubmed , ovid , proquest , and eric databases between the year 1980 to 2009 , and selected papers were retrieved . \n the literature search was performed based on the salient key words ; bedside teaching , importance of bedside teaching , issues in bedside teaching , strategies in bedside teaching , new models in bedside teaching , patient based teaching and clinical teaching. all searches were limited to english language publications . \n all other articles and books referred to in this review were cross - checked for consistency . \n a quality analysis was performed to investigate the concepts , importance , problems and the strategies to overcome those problems in bedside teaching . \n the importance of bedside teaching \n by providing a chance for asking relevant question to obtain history and develop physical examination skills in a sympathetic manner , teaching at the bedside presents an excellent opportunity for the modeling of professional behaviors . \n it provides active learning in real context , observes students ' skills , increases learners ' motivation and professional thinking , integrates clinical , communication , problem solving , decision making and ethical skills , and improves patients ' understandings . \n it also offers an opportunity for learners to observe and learn a humanistic approach from an experienced clinician . \n the clinician - teacher is able to demonstrate the role modeling of skills and attitudes , which are vital but difficult to communicate with words . \n reasons for declining bedside teaching \n the most important reasons for the decline of bedside teaching are time constraint due to pressure to see more patients with increased record keeping , shortened hospital stays of patients , and preceptors worry about patient comfort . \n in addition , faculties ' unworkable expectations , lack of confidence or experience , uncomfortable role of the bedside teacher , learners distraction by technology , and others ' low recognition of the role lead to the decline in bedside teaching . \n the general feeling about bedside teaching is that there is erosion of the teaching ethics , devaluation of teaching , and a great deal of unobtainable skills . despite the belief \n that bedside teaching is the most effective method to teach clinical and communication skills , the frequency of bedside rounds is decreasing . \n it is believed that this is a major factor causing a sharp decline in trainees ' clinical skills . \n now a days , clinical skills are increasingly taught in preclinical courses by integrating clinical scenarios . \n the effects of this educational reform need further research to investigate the competencies of graduates entering higher professional training . \n whatever the causes , the reality is that teaching at the bedside is declining . \n strategies to overcome the decline of bedside teaching \n \n strategy 1 : \n allocate some time with detailed planning the bedside is valued as a site of learning from a real patient that is alive and tangible . \n it is , therefore , easier for learners to recall and remember the clinical situation , and a clinician - teacher should allocate some time for it , which only needs a detailed planning . \n this may add a little time to that normally spent with the patient , but could provide a major experience . \n the key to perform more bedside teaching is to start without unrealistic expectations and gradually provoke how to improve it . \n we may look at the list of our patients , all of whom , with whatever their diagnosis , have histories and physical findings , even though we may feel that there are no interesting teaching opportunities . \n get the learners involved with a specific purpose . use the material you have , and review your own physical exam skills . there is teaching and learning opportunity in any encounter . \n the allocation of some time with detailed planning can provide a significant learning experience . \n strategy 2 : \n raise patients comfort through a high level of professional approach , and ignore false preceptors concerns about patients discomfort although researchers recognized preceptors concern about patient s discomfort while discussing the bedside teaching , nair et al . reported that a majority of patients enjoyed and benefited from bedside teaching by understanding their own problems . \n preceptors concern about bedside teaching that may cause patients discomfort is not true . nevertheless , patients comfort and discomfort depend upon the type of measures and the way that those measures are implemented at the bedside . \n the emphasis of new competence - based learning does not only relies on the performance of the tasks that a doctor does , but also on how the tasks are approached and the levels of professionalism shown . \n a teacher in a clinical environment has a complex task , which can be described as ; ( 1 ) an information provider , ( 2 ) a role model , ( 3 ) a facilitator , ( 4 ) an assessor ; ( 5 ) a curriculum and course planner , and ( 6 ) a resource material creator . \n an advanced notice of visit to a patient , time limitation , focused teaching , role modeling , explanation of all examinations and procedures to the patient are some approaches to raise patients comfort in bedside teaching . \n strategy 3 : \n raise teachers comfort at the bedside through a preparatory phase as the patients comfort is a vital consideration , teachers and learners comfort also are of a great importance . \n preparation is a key element to conduct effective rounds and increase teachers comfort at the bedside . \n for clinician - teachers who plan bedside rounds , especially if not familiar or not comfortable with the technique , a preparatory phase would be of invaluable help in raising their comfort level \n they should also investigate the actual clinical skill levels of all the learners , improve their own history taking and clinical examination skills , learn from expert clinicians , and use learning resources on specific areas of clinical examination . \n bedside teaching is successful when people involved in the activity namely , the teacher , patients and learner feel better afterwards . \n strategy 4 : \n make a focused - teaching of what you want to achieve at the bedside for each encounter \n bedside teaching requires specific skills and techniques , which help make it more efficient . \n it needs to be decided what particular system is to be taught at the bedside . \n for example it has to be decided what specific aspects of bedside teaching including history taking , physical examination , patient counseling , breaking bad news are going to be emphasized . \n a planned activity is required to keep everyone engaged and involved in the teaching and learning . \n those patients , who would be good for bedside teaching , should be selected preferably using the learners ' input . \n it needs to be decided how much time is to be allocated to a given patient . \n bedside is a place for positive learning , and not a place for pointed questioning or criticism of learners . \n bedside teacher must use the skills and attitudes that come naturally most often , and should gradually hone and add new skills with repeated visits to the bedside . \n they should make a focused - teaching of what they want to achieve at the bedside for each encounter . \n teachers ' involvement in clinical , research , administrative and educational duties , and learners ' distraction by technology have resulted in the decline of bedside teaching , and have led to fewer students ' encounter with patients in practicing clinical skills and unsupervised feedback . \n so , what should be done , and how the graduates who will be the future health care provider of a nation should be prepared ? \n the general medical council recommends that general clinical training is an integral part of basic medical education , the aim of which includes the development of competence in history taking , clinical examination , interpretation and selection of diagnostic tests , as well as diagnosis and decision making skills . \n the council also requires that doctors to be honest and trustworthy , treat patients politely and considerately ; listen to them , respect their dignity , privacy , and rights to be involved in clinical decision making process , respect their spouses , and respect and protect confidential information . \n these are the core values of clinical medicine . to overcome the problems that are encountered in bedside teaching one just need a sufficiently prepared careful planning . \n 1 ) a description of the learner whether he ( she ) is a first or a fifth year student , a senior house officer in psychiatry or else , 2 ) a description of the behavior that the learner should demonstrate such as the ability to inform the patient , ability to examine or elicit , 3 ) a description of the condition in which the learner will demonstrate the learning such as the context for a follow up patient , a palliative setting , office setting , etc , 4 ) a description of the extent to which the learner can function in a responsive and honest manner . \n teachers and educational managers should be motivated and trained , to adopt the changing needs . \n the change in medical education is currently a worldwide phenomenon , and the changing the needs of teaching at the bedside must be adopted to prepare doctors who are able to fulfill the needs of the community . \n below is a selection of some models that might help us to think about and structure bedside teaching \n . \n three domain - model of best bedside teaching practices \n janicik and fletcher ( 2003 ) , suggested a new three domains model of best bedside teaching practices , which emphasizes on ( 1 ) attending to patient comfort , ( 2 ) focused teaching , and ( 3 ) group dynamics . \n patients comfort can be achieved through established rules of conduct including asking the patient ahead of time , introducing all , providing a brief overview , avoiding technical language , teaching with data about the patient and providing a genuine encouraging closure . \n focused teaching session should be relevant to an individual patient s and learner s needs . to make the teaching - focused \n , we have to diagnose the patient , diagnose the learner , target the teaching and provide constructive feedback privately . \n it can be achieved by setting goals , assigning roles , setting a time limit and paying attention to the entire group . \n patient - based models \n doshi and brown ( 2005 ) , reported that about a number of patient - based teaching models such as , ( 1 ) shadowing ( role modeling ) , in which trainee shadows a more senior clinician and learns by observation , ( 2 ) patient - centered model , in which some patients are allocated to trainees , and they follow their progress from the start to end of episode of illness , ( 3 ) reporting - back model , in which trainee assesses the patients , and reports back to the trainer , ( 4 ) direct observation in which the trainer observes the trainee s performance directly , ( 5 ) videoconferencing interviews in which the trainee s interview with a patient is recorded and later viewed with the trainer , and ( 6 ) case conference in which the trainee presents a case , which is discussed by a wider audience . \n five - step \" microskills \" model \n neher et al , presented a five step model that utilizes simple , discrete teaching behaviors or \n the skills that make up the model are ( 1 ) asking for a commitment , ( 2 ) probing for underlying reasoning , ( 3 ) teaching of general rules , ( 4 ) reinforcing what was done or providing positive feedback , and ( 5 ) correcting mistakes . \n the model can be used as a ready frame work for most clinical teaching encounters . \n trialogue a model of interaction between three groups of players \n mckimm , developed a model named as trialogue \n , which focuses on the relationships and interactions between three groups of players with different principles , background and expectations . \n the three groups , which are clinicians ( as teachers ) , learners and patients , help explain and analyze complex clinical teaching and learning activities through the metaphor of a continually shifting dialogue . \n the model provides clinical teachers with a framework for scaffolding learning , facilitating learner and patient active engagement in the learning process , reflecting in action to promote student learning whilst simultaneously attending to the needs of the patient , helping clinical teachers to pay conscious attention to the relationship and emerging dialogue between players . \n since clinical practice involves the diagnosis and management of patients problems , the teaching of clinical medicine should be carried out on real patients . \n we can not discard a teaching tradition that has a long valued history of teaching the humanistic aspect of medicine just due to time constraint and some other insufficient reasons . \n if we truly want a change in bedside teaching , we must budget a little time for bedside teaching with rightful planning \n . we should be able to make a patient 's visit a teaching visit with very specific purpose . \n but the most important factors are those that are within the willingness of the instructors to adopt to any change . there are newer models and strategies for effective bedside teaching . \n a bedside teacher must learn how to involve patients and learners in the educational process . maintaining a comfortable environment for all participants ; the learner , the patient and the bedside teacher is very important . \n it is through this process that the learners acquire the skills of observation , communication , examination and professionalism . \n medical schools should give due importance to bedside teaching , and must renew and increase the efforts to get ahead of this past shapers of the profession . \n ", "role": "user" }, { "content": "bedside teaching is a vital component of medical education . \n it is applicable to any situation where teaching is imparted in the presence of patients . in teaching in the patients presence , learners have the opportunities to use all of their senses and learn the humanistic aspect of medicine such as role modeling , which is vital but difficult to communicate in words . \n unfortunately , bedside teaching has been on the decline . to investigate the reasons for the decline in bedside teaching , its importance and its revival , \n a review of literature was carried out using pubmed and other data bases . \n the review revealed that the major concerns of bedside teaching were time constraint , false preceptors concern about patients comfort , short stay of patients in hospitals , learner distraction by technology , lack of experience and unrealistic faculty expectation . \n whatsoever the reasons , bedside teaching can not be replaced with anything else . \n there are newer approaches of effective bedside teaching , and the core focus of all such approaches is educational process . \n a bedside teacher must learn how to involve patients and learners in the educational processes . \n moreover , bedside teaching is the process through which learners acquire the skills of communication by asking patients permission , establishing ground rules , setting time limit , introducing the team , diagnosing learner , diagnosing patient , conducting focused teaching , using simple language , asking patient if there is any question , closing with encouraging thanks , and giving feedback privately . \n it is most important to ensure a comfortable environment for all participants , the learner , the patient and the bedside teacher . \n ongoing faculty development programs on educational processes and realistic faculty expectations may overcome the problems .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the chemistry of carbenes has seen an explosive growth both as complexes for metals and as organocatalysts , but our knowledge of the chemistry of the derived enetetramines is much less advanced . \n we have recently shown that unactivated alkyl and aryl halides are reduced by enetetramines , acting as very strong neutral , ground - state , organic electron donors . \n thus benzimidazole - based donor 1(4,5 ) was found to react efficiently via set ( single electron transfer ) with unactivated aryl as well as alkyl iodides , e.g. , 3 and 5 , respectively , leading to the cyclization products 4 and 6 derived from the corresponding initial aryl and alkyl radicals ( scheme 1 ) . \n substrates such as 5 showed that alkyl carbanions were not intermediates ( carbanion formation would be expected to lead to p - methoxystyrene and cyclohex-2-en-1-ol ) , but these products were not detected . \n more recently the imidazole - derived donor , 2 , was shown to be an even more powerful reagent than 1 , featuring double - electron transfer to iodoarenes , leading to cyclization of the aryl anion derived from ester 7 to form ketone 8 and reduced product 9 . \n the impressive reducing power of reagents such as 1 and 2(10 ) is ascribed both to the ability of nitrogen atoms to stabilize positive charge on an adjacent carbon , and to the aromatization energy that is gained , following electron donation , on forming their radical - cations 11 and 13 , respectively , and their dications 12 and 14 , respectively . \n comparison with the simpler enetetramine , tdae 10 , shows that 10 is a weaker electron donor ; oxidation does not lead to aromatic stabilization energy . \n the greater reactivity of 2 , compared to 1 , relates to the greater aromatization energy associated with formation of the bis - imidazolium salt 14 from precursor 2 , compared to forming bis - benzimidazolium salt 12 from precursor 1 . \n similar arguments can apply to the radical cations 13 and 11 , as depicted in scheme 2 . \n this paper now reports and investigates the unprecedented formation of aliphatic aldehydes by extrusion of a single carbon atom from the imidazolium salt - derived enetetramine 2 when it reacts with alkyl and appropriate aryl halides . \n this new reactivity came to light upon reacting alkyl halides with enetetramine 2 ( scheme 3 ) . \n donor 2 ( 1.5 equiv ) was prepared in situ by deprotonation of salt 15(7,8 ) and subsequently reacted with 5-phenyliodopentane 16 . \n when a neutral workup was used , a trace of aldehyde was noted in the nmr spectra of the crude reaction products . turning to acidic workup afforded aldehyde 17 in 19% yield . to explore whether an aldehyde might be obtained from an alkyl bromide , substrate 18 \n the conditions of the reaction were then studied to maximize the yield of the aldehyde . \n an excess of donor 2 ( 5 equiv , concentrated solution ) led to isolation of aldehyde 19 in 61% yield following acidic workup . again , the yield of the aldehyde was significant only when the reaction workup featured acidic conditions , suggesting that the aldehyde required to be liberated from a protected form during workup . the origin of the aldehyde carbonyl carbon in products 17 and 19 was now addressed . \n this could happen by conversion of the alkyl halide to the corresponding alkyl anion following transfer of two electrons from donor 2 . to test this possibility , \n reaction of the corresponding alkyl anion with dma should now afford the ketone , 20 , following workup . \n however , no ketone was formed , and , instead , aldehyde 17 was again isolated ( 32% yield ) after further purification by column chromatography . \n this clearly shows that the aldehyde product can arise from a pathway that does not involve dmf and hence really must involve the bisimidazolylidene 2 . \n this still left the possibility that reaction in dmf as solvent could form aldehyde by two routes , in one of which the aldehyde carbon was derived from 2 , while in the other it derived from dmf . \n [ it will be shown later with substrate 47 that aldehyde does not derive from dmf at all , within the limits of detection ] . \n looking for mechanistic routes for cc bond formation between the substrate 21 and molecule 2 , three options present themselves , all involving reaction at the central carbons of 2 ( scheme 4 ) . \n thus 2 could behave simply as a nucleophile , undergoing sn2 reaction with the alkyl halide substrates . \n the driving force for regioselective reaction at the central carbons is the aromaticity of the resulting imidazolium ring in 24 . \n an alternative route to the same product features electron transfer from the donor 2 to the alkyl halide 21 . \n the third possibility is that an alkyl anion 23 is formed from the substrate following transfer of two electrons as suggested above ; 23 would then be well placed to couple to dication 14 . \n the path to 24 will be discussed later in this article , but first a mechanism needs to be proposed to explain how such an intermediate could lead to aldehydes ( scheme 5 ) . \n the ultimate fate of the carbene group is not clear from the products that we isolate , but for the formation of the aldehyde , a possible route would feature the reduction of the imidazolium unit of 25 to radical 26 by electron transfer , followed by hydrogen atom abstraction to give the imidazoline 27 . \n the best yields of aldehydes were obtained when multiple equivalents of bisimidazolylidene 2 were used in the reaction , and when the reaction featured acidic workup conditions . \n the need for multiple equivalents of donor 2 would be consistent with the need for a reduction step ( 25 to 26 ) ; excess of donor 2 would facilitate this electron transfer . \n similarly , the improved yields of aldehydes isolated from these reactions when using acidic workup conditions would be explained by the need to hydrolyze imidazoline 27 . alternatively ( we thank a reviewer for this suggestion ) , 25 could undergo deprotonation to form enediamine 29 . the deprotonation might be carried out intramolecularly by the carbene carbon in 25 , which , from a model , might be feasible . within 29 , \n nucleophilic attack by the enediamine upon the imidazolium salt would afford 30 , and hydrolysis of this compound on acidic workup would lead to formation of aldehyde - acid 31 , which could undergo decarboxylation to give the observed aldehydes . to see if evidence in favor of either route could be found , the simple 1,3-dimethyl-2-(3-phenylpropyl)-1h - imidazolium iodide 33 was prepared and treated with donor 2 . in the reductive route \n if this happens , then other imidazolium salts , such as 33 , should also be reduced by 2 . \n however , no aldehyde was formed in the reaction of iodide 33 with donor 2 , suggesting that aldehydes do not arise from a reductive route . the alternative route to aldehydes 28 goes through hydrolysis of imidazolium salt 30 during the workup procedure . \n if that imidazolium salt can be hydrolyzed to an acid , then imidazolium salt 33 should also afford an acid , i.e. , 35 . \n the reaction of imidazolium salt 33 with 2 , followed by acidic workup did indeed afford acid 35 but in low yield ( 2% ) . \n compound 30 is relatively more activated than 33 for hydrolysis , and so it is possible that it would afford higher yields of acid 31 ( and subsequently aldehyde 28 ) than seen here for acid 35 . \n thus , the best working hypothesis is that the aldehydes 28 arise from the hydrolysis and decarboxylation route . \n the favored route to aldehydes discussed above , relies on iminium saltenediamine conversions between 25 , 29 , and 30 . \n we envisaged that 37 , an analogue of 25 , featuring a leaving group ( or ) to the imidazolium salt would lead to further reactions that would signal its role as an intermediate ( see scheme 6 ) . \n deprotonation of 37 would afford the enediamine 38 ; this compound would then be primed to expel the alkoxide group ro , thereby affording imidazolium cation 39 . in turn , this could be deprotonated in the basic medium to yield 40 , from which expulsion of ro could be expected . \n the isolation of alcohol(s ) roh , roh could therefore be an important pointer in support of alkylimidazolium intermediates , such as 25 in scheme 5 . while alcohol roh could also arise through other mechanisms , it is difficult to think of an alternative way in which roh would be produced , and hence we set particular importance on the isolation of this alcohol in the test reactions below . \n the hindered alkyl halide substrates 45ah were selected and prepared as shown in scheme 7 . \n reaction of initial substrate 45a very clearly led to mixtures of the corresponding two alcohols , phenylpropanol + benzyl alcohol ( 1.5:1 ) . \n sensing that the deviation from an expected 1:1 ratio might be due to volatility of the benzyl alcohol , substrate 45b was reacted with 2 and afforded a 1:1 mixture of phenylpropanol + phenylbutanol as judged by nmr , in accordance with the hypothesis in scheme 6 . however , the separation of the alcohols was challenging on the scale of the experiment , and so 45ch employed r = me to facilitate isolation of roh . \n clearly , the alcohol roh is isolated in high yield from these reactions , completely consistent with scheme 6 . \n the aliphatic substrates 16 and 18 do not allow us to distinguish between the three routes shown in scheme 4 . \n on the other hand , reactions of donor 2 with substrates 45 do provide key information . \n the outcomes of these reactions are consistent with both the direct sn2 mechanism and/or with the intermediacy of aliphatic radicals from set to the alkyl halides . \n however , they are inconsistent with formation of alkyl anions , since the developing carbanion represented by 46 should force the -elimination of the alkoxide in a concerted reaction affording 44 , but no 44 was formed . to gain further insight , \n iodide 47 afforded two products , 48 and 49 , in 42% and 13% yields , respectively ( see scheme 8) . \n the same products 48 ( 42% ) and aldehyde 49 ( 5% ) were afforded . \n the aldehyde showed no labeling with deuterium in nmr or mass spectrometry this supports our previous statement that the aldehyde products do not incorporate the formyl group of dmf ] . \n similarly , iodide 50 gave reduced product 51 ( 40% ) and aldehyde 52 ( 5% ) . \n for both reactions , the major product is likely to arise from transfer of two electrons to the substrate to form the aryl anion , consistent with our previous results for donor 2 . as in the experiments with the previous substrates in this article , isolation of aldehyde was dependent on the use of acid in the reaction workup . \n the two aldehydes 49 and 52 , as minor products , can not arise from sn2 reaction and so must result from the trapping of an alkyl radical or an alkyl anion . \n although the formation of alkyl anions by direct reduction of alkyl halides ( via alkyl radicals ) is rejected above following the experiments with substrates 45 , alkyl anions might arise indirectly by cyclization of aryl anions , and aryl anions are known to form when donor 2 reacts with aryl iodides . to probe that point , substrate 53 was prepared and reacted with donor 2 in dmf ( scheme 9 ) . \n this afforded three products in a combined yield of 70% : the reduced product 54 ( 27% ) , the cyclized product 55 ( 8% ) and the alcohol 56 ( 35% ) ( scheme 9 ) . \n formation of product 54 sees two electrons being transferred in quick succession from donor 2 to substrate 53(8 ) to form anion 58 ( scheme 10 ) . \n if anion 58 could cyclize to give aliphatic anion 62 , this would lead to formation of alcohol 56 as well as vinylindoline 63 . \n alcohol 56 arises through initial and rapid cyclization of aryl radical 57 to form 59 ( scheme 10 ) . \n hydrogen abstraction by 59 then leads to 55 . alternatively , trapping of 59 with radical - cation 13 affords salt 60 , which acts as the source of alcohol 56 following the pathway proposed in scheme 6 . \n no products that derived from the electrophile 61 were detected , signaling its high reactivity . in summary , \n aliphatic aldehydes are formed on reaction of bisimidazolylidene 2 with both aliphatic and aryl iodides as well as alkyl bromides . \n an sn2 mechanism may play a role in aldehyde formation from the aliphatic substrates , but the aldehydes formed from the aryl substrates arise via a radical mechanism . \n this indicates that some aryl radicals cyclize before a second electron can be received from donor 2 .", "role": "user" }, { "content": "reaction of imidazolylidene - derived enetetramine 2 with aliphatic iodides and bromides ( and with aryl iodides bearing alkene - containing side - chains in the ortho - position ) leads to formation of aliphatic aldehydes through an unprecedented extrusion of a one - carbon unit from the enetetramine . \n an intermediate 2-alkylimidazoline 24 is proposed , where the alkyl group derives from the substrate ; this imidazoline undergoes further reaction in situ to afford the observed aldehydes on acidic workup . \n modified substrates were designed and prepared to probe the chemistry of the alkylimidazoline adducts and provided extensive information on the chemistry of the adducts .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: burn injury is a major cause of trauma to the human body , causing death and disability , with a long healing period and high health care costs . \n the mortality rate of burn injury is decreasing with new treatment modalities , although secondary infections and long healing periods still affect mortality rates . \n early debridement and skin grafting are successful , but insufficient graft donor area and unsuitable patient circumstances for surgery hinder skin grafting . in these circumstances , using products that increase the wound - healing process often affect patient morbidity and mortality . for this purpose , different kinds of dressings and pharmacotherapies have been developed , but most of them are costly , and the mechanisms underlying these therapies have not been fully documented . \n growth factors have been implicated in mediating the normal healing process as well as playing a role in impaired wound healing . \n certain growth factors , such as platelet - derived endothelial cell growth factor ( pdgf ) and insulin - like growth factor - i ( igf - i ) , inhibit the apoptosis pathways necessary for the rapid turnover of cells required to facilitate the different stages of physiologic wound healing . \n the wound healing effects of growth hormone ( gh ) appear to be directly and indirectly associated with igf-1 expression . \n poffenbarger and haberal reported that a glycoprotein named nonsuppressible insulin - like activity ( nsila ) exhibits insulin - like activity on fibroblasts in tissue and modulates the fibroblastic response in wound healing . \n platelet - rich plasma ( prp ) is a new adjunct that is increasingly used to treat soft and bony tissue defects to accelerate bone formation , especially in oral and maxillofacial bone reconstructive surgery , and in managing chronic nonhealing wounds [ 25 ] . \n platelet - rich plasma is produced from centrifuged blood combined with thrombin and calcium chloride as a viscous coagulum gel , which is a rich source of growth factors released by activated platelets . \n they release multiple growth factors and cytokines , including transforming growth factor- ( tgf-1 and 2 ) , transforming growth factor- ( tgf- ) , vascular endothelial growth factor ( vegf ) , platelet - derived endothelial cell growth factor ( pdgf ) , epidermal growth factor ( egf ) , platelet thromboplastin , thrombospondin , coagulation factors , fibroblast growth factor ( fgf ) , platelet activating growth factor-4 , calcium , serotonin , histamine , and hydrolytic enzymes with degranulation triggered by proteins such as thrombin . \n it has been demonstrated that platelet - derived growth factors are successful in treating nonhealing cutaneous human wounds . \n growth factors attract cells to the wound site ; they stimulate cell proliferation and increase differentiation and extracellular matrix deposition . transforming growth \n factor- is important in tissue repair , and it was demonstrated that tgf- has therapeutic value in the treatment of chronic , nonhealing wounds . \n platelet - derived endothelial cell growth factor improves dermal regeneration , promotes protein and collagen synthesis causing endothelial migration or angiogenesis , and increases expression of tgf- . transforming growth factor- and pdgf levels are higher in platelet - rich plasma compared with platelet - poor plasma ( ppp ) . using the effects of tgf- on wound healing ( e.g. , promoting differentiation and proliferation ) , we aimed to achieve enhanced wound healing and more - organized collagen in burn wounds treated with prp gel compared to controls , without excessive deposition of connective tissue or scar formation . \n although the positive effects of prp on graft maturation and wound healing are well known , a similar effect on burn healing is not clear . \n this study sought to investigate the effects of prp on burn wound healing in an experimental partial - thickness hot water burn injury . \n this study was performed at the experimental research center of baskent university with the permission of the experimental research ethical committee of baskent university faculty of medicine . \n all rats were brought to the experimental research center 1 week before the experiment and kept in special cages under controlled temperature ( 22c ) , humidity , and lighting conditions ( 12-hour day , 12-hour night ) . \n group 1 rats ( study group ; n=10 ) were exposed to prp application after burn injury ; group 2 rats ( control group ; n=10 ) were exposed to burn injury only ; and group 3 rats ( blood donor group ; n=10 ) were used as blood donors for the preparation of prp . \n all animals were anesthetized by an intraperitoneal injection of 50 mg / kg ketamine hydrochloride and 10 mg / kg xylazine hydrochloride . under sterile conditions , a 333 cm sponge ( vileda , procter & gamble company , cincinnati , oh ) \n was kept in boiling water and touched to the rats shaved dorsum for 35 seconds with its own weight to induce a partial - thickness burn injury . \n the burn site was covered with opsite drape ( smith & nephew , inc . , wound management , st . \n after experimentation , all rats were kept in special cages under controlled temperature , humidity , and lighting conditions . \n rats were given 0.002 g / kg fentanyl citrate twice a day for postoperative analgesia . \n all rats were killed after administration of anesthesia ( 60 mg / kg intraperitoneal ketamine ) on the seventh day after burn injury . \n platelet - rich plasma was derived after 2-step centrifugation of blood taken from the rats in group 3 . with the first soft , short spin ( 1500 rpm , 20c , 10 minutes ) , \n then , the plasma fraction was separated with a hard , long spin ( 2000 rpm , 20c , 15 minutes ) into the prp and the plasma - poor platelets . \n after this , the prp was combined with thrombin ( diathrombin , diamed , switzerland ) and calcium chloride ( calcium chloride , diamed , switzerland , 0.02 mol / l ) to activate platelets to produce sufficient clot formation that could be applied on the burn site . \n the mixture ratio was 1 ml : 0.1 ml : 1 ml ( prp - thrombin - ca chloride ) . \n after the rats were killed on the seventh day , the burn site was excised and tissue samples were sent to the biochemistry department for detection of tissue hydroxyproline levels and to the pathology department for histopathologic examinations . \n who was included in the study and blinded to all information regarding the groups performed the histopathologic examination of the tissues . \n tissue specimens were fixed in a 10% formaldehyde solution , and then embedded in paraffin . \n histopathologic examinations for wound healing were assessed by light microscope with hematoxylin - eosin staining , and collagen deposition was assessed by light microscopy with trichrome staining in 100 and 200 magnification areas . \n the wound healing process was assessed with a modified ehrlich - hunt numeric scale for polymorphonuclear leucocytes ( pmnl ) , fibroblasts , vessel proliferation , and collagen deposition as follows : 0 ( none ) , 1 ( focal ) , 2 ( mild ) , 3 ( moderate ) , and 4 ( significant ) . \n all animals were anesthetized by an intraperitoneal injection of 50 mg / kg ketamine hydrochloride and 10 mg / kg xylazine hydrochloride . under sterile conditions , a 333 cm sponge ( vileda , procter & gamble company , cincinnati , oh ) \n was kept in boiling water and touched to the rats shaved dorsum for 35 seconds with its own weight to induce a partial - thickness burn injury . \n the burn site was covered with opsite drape ( smith & nephew , inc . , wound management , st . \n after experimentation , all rats were kept in special cages under controlled temperature , humidity , and lighting conditions . \n rats were given 0.002 g / kg fentanyl citrate twice a day for postoperative analgesia . \n all rats were killed after administration of anesthesia ( 60 mg / kg intraperitoneal ketamine ) on the seventh day after burn injury . \n platelet - rich plasma was derived after 2-step centrifugation of blood taken from the rats in group 3 . with the first soft , short spin ( 1500 rpm , 20c , 10 minutes ) , \n then , the plasma fraction was separated with a hard , long spin ( 2000 rpm , 20c , 15 minutes ) into the prp and the plasma - poor platelets . \n after this , the prp was combined with thrombin ( diathrombin , diamed , switzerland ) and calcium chloride ( calcium chloride , diamed , switzerland , 0.02 mol / l ) to activate platelets to produce sufficient clot formation that could be applied on the burn site . \n the mixture ratio was 1 ml : 0.1 ml : 1 ml ( prp - thrombin - ca chloride ) . \n after the rats were killed on the seventh day , the burn site was excised and tissue samples were sent to the biochemistry department for detection of tissue hydroxyproline levels and to the pathology department for histopathologic examinations . \n who was included in the study and blinded to all information regarding the groups performed the histopathologic examination of the tissues . \n tissue specimens were fixed in a 10% formaldehyde solution , and then embedded in paraffin . \n histopathologic examinations for wound healing were assessed by light microscope with hematoxylin - eosin staining , and collagen deposition was assessed by light microscopy with trichrome staining in 100 and 200 magnification areas . \n the wound healing process was assessed with a modified ehrlich - hunt numeric scale for polymorphonuclear leucocytes ( pmnl ) , fibroblasts , vessel proliferation , and collagen deposition as follows : 0 ( none ) , 1 ( focal ) , 2 ( mild ) , 3 ( moderate ) , and 4 ( significant ) . \n the others were compared using the t test . values for p less than 0.05 were accepted as significant . \n two rats from each group died during the experiment , so the statistical analysis was performed with 8 rats in each group . in the study group , \n mean tissue hydroxyproline ( hyp ) level was detected as 0.950.35 g hyp / g , whereas in the control group mean tissue hyp level was detected as 0.690.08 g hyp / g . \n the hyp levels were significantly higher in the study group than in the control group ( p=.03 ) ( figure 1 ) . in both groups , partial - thickness burn injury \n statistically , except for the inflammatory cell ( pmnl ) infiltration , there was no significant difference between the groups ( figure 2 ) . in the study group , \n the mean pmnl score was 10.53 , whereas in the control group it was 2.3750.51 ( mean sem ) . therefore , inflammatory cell infiltration was statistically higher in the control group ( p=.005 ) . \n moderate inflammatory cell infiltration from the control group and mild inflammatory cell infiltration from the study group are shown in figures 3 and 4 . in the study group , \n the mean fibroblast score was 0.6250.51 , whereas in the control group it was 0.3750.51 ( mean sem ) . \n although the fibroblast score was higher in the study group , there was no significant difference between the groups ( p=.31 ) . \n focal fibroblast infiltration from the study group is shown in figure 5 . in the study group the mean vessel proliferation score was 0.750.7 , whereas in the control group it was 0.250.46 ( mean sem ) . \n vessel proliferation score was higher in the study group ; however , no significant difference was detected between the groups ( p=.26 ) . \n mild vessel proliferation from the study group is shown in figure 6 . in the study group , \n the mean collagen deposition score was 0.6250.51 , while in the control group it was 0.3750.51 ( mean sem ) . \n collagen deposition scores were higher in the study group but no significant difference was detected between the groups ( p=.31 ) . \n mild collagen deposition from the study group is shown in figure 7 . in the study group \n the epithelization rates were higher in the study group , but there was no significant difference between the groups ( p>.05 ) . \n in the study group , mean tissue hydroxyproline ( hyp ) level was detected as 0.950.35 g hyp / g , whereas in the control group mean tissue hyp level was detected as 0.690.08 g hyp / g . \n the hyp levels were significantly higher in the study group than in the control group ( p=.03 ) ( figure 1 ) . \n in both groups , partial - thickness burn injury was confirmed with macroscopic and microscopic examination . \n statistically , except for the inflammatory cell ( pmnl ) infiltration , there was no significant difference between the groups ( figure 2 ) . \n in the study group , the mean pmnl score was 10.53 , whereas in the control group it was 2.3750.51 ( mean sem ) . \n therefore , inflammatory cell infiltration was statistically higher in the control group ( p=.005 ) . \n moderate inflammatory cell infiltration from the control group and mild inflammatory cell infiltration from the study group are shown in figures 3 and 4 . \n in the study group , the mean fibroblast score was 0.6250.51 , whereas in the control group it was 0.3750.51 ( mean sem ) . although the fibroblast score was higher in the study group , there was no significant difference between the groups ( p=.31 ) . \n in the study group the mean vessel proliferation score was 0.750.7 , whereas in the control group it was 0.250.46 ( mean sem ) . \n vessel proliferation score was higher in the study group ; however , no significant difference was detected between the groups ( p=.26 ) . \n in the study group , the mean collagen deposition score was 0.6250.51 , while in the control group it was 0.3750.51 ( mean sem ) . \n collagen deposition scores were higher in the study group but no significant difference was detected between the groups ( p=.31 ) . \n in the study group the epithelization rate was 37.5% , while in the control group it was 25% . \n the epithelization rates were higher in the study group , but there was no significant difference between the groups ( p>.05 ) . \n patient age , burn depth , and size of burn area are the most - important factors that influence mortality and morbidity after thermal injuries . \n burn depth is also the most important factor affecting patients long - term appearance and functioning . \n malnutrition , immunosuppression , and extensive burn area provide a suitable environment for microorganisms ; such infections are the most important cause of mortality and morbidity . in laboratory studies \n it has been shown that topical administration of bone marrow cells increases dermal fibroblast population , vessel proliferation , and wound healing . \n for this reason , wound covering materials and artificial skin substitutes were developed and are used , but their indications are not yet clear . \n the first laboratory products used for this purpose were epithelial cells produced in a laboratory environment , but approximately 3 weeks are needed to produce the few thousand cm area required in extensive burns . \n desired properties of wound cover materials include forming a barrier against fluid loss and microorganisms , supporting increasing cells in wound healing , and allowing vessel proliferation , keratinocyte adhesion , and differentiation ; unfortunately , no such material currently exists . \n platelet - rich plasma contains a high level of platelets , clotting factors , cytokines , and growth factors . \n they start releasing these activated factors 10 minutes after clotting , and more than 95% of growth factors are released in the first hour . \n several in vivo and in vitro studies showed that all cells in the wound healing process are sensitive to the growth factors . \n epidermal growth factor is a chemotactic factor for fibroblasts , and topical application of egf increases epidermal regeneration and strength of wound tension . \n platelet - derived endothelial cell growth factor stimulates fibroblast and smooth muscle cell migration and proliferation , increases collagen deposition , and is also a chemotactic factor for neutrophils and monocytes . \n furthermore , it has been shown that chondrocyte , osteoblast , and periosteal cell proliferation is promoted by pdgf and bfgf . \n transforming growth factor-1 regulates cell differentiation , proliferation , chemotaxis , and synthesis of several extracellular matrix proteins . in animal models \n , it has been shown that topical application of tgf-1 increases collagen synthesis , granulation tissue , and strength of wound tension . \n transforming growth factor- triggers collagen synthesis and quickens maturation of collagen in the early period of wound healing . \n in addition , using tgf- and pdgf together increases collagen deposition more than using tgf- alone . \n it has been demonstrated that prp increases wound healing in acute trauma wounds , chronic nonhealing wounds , and incisional wounds , and is effective in soft and hard tissue reconstructions [ 2,3,5,6,1820 ] . \n it has been shown that the inflammatory phase is reduced , and prolonged inflammation ( which often leads to bacterial infections and scar formation ) does not exist in wounds treated with prp . \n . showed that using prp with acellular xenogeneic dermal matrix for treatment of deep second - degree burns decreased infection rate and increased wound healing . \n furthermore , an animal study and several case reports showed improved burn wound - healing time after the application of prp . \n a deep dermal burn could benefit from prp through its hemostatic antimicrobial abilities and the positive effects seen in wound healing . \n a recent review showed a significant benefit of platelet - rich plasma on wound healing in acute wounds and it improved long - term outcome of laser therapies . \n there are several studies suggesting that addition of prp to the graft site enhances wound healing , promoting epithelization and angiogenesis in split - thickness skin grafts and donor sites . \n . demonstrated that the viscoelastic properties of scars treated with the combination of split - thickness skin grafting ( stsg ) plus autologous platelet concentrate return more rapidly to the plateau state than areas treated with stsg only . in a recent study , \n prp increased the speed of repair of the extracellular matrix and its components in deep second - degree burn wounds in horses , and treatment with 2 applications of prp accelerated formation of extracellular matrix during the first half of wound healing . \n we have shown that in the study group , pmnl infiltration was significantly lower than in the control group , whereas there were no statistically significant differences between groups in terms of fibroblast infiltration , vessel proliferation , collagen deposition , or epithelization . \n the difference between the wound healing processes in the burn wounds versus regular burn wound healing may be the cause of this result . as opposed to regular wound healing , in burn wounds \n this hemorrhagic infill constructs a skeleton structure for cells coming into the wound site , including neutrophils , monocytes , fibroblasts , and endothelial cells . \n moreover , in burn wounds , blood supply is reduced because of the damaged vessels . at the burn site it is hard to define healed parts because of this lack of hemorrhage , which determines the borders of the wound . \n although in partial - thickness burn injuries cellular damage generally exists in the upper dermis , in the lower dermis the structural matrix damage is minimal . \n thus , structural matrix replacement is limited , and wound healing in partial - thickness wounds usually does not involve replacement of damaged structural matrix . \n further evidence supporting our conclusion is the statistically higher tissue hydroxyproline levels in the prp - treated group , which is an important indicator in wound healing . in the vertebrata , \n nearly all the hydroxyproline is present in collagen ; therefore , determining the hydroxyproline level is an adequate method for assessing collagen metabolism . \n hydroxyproline levels were statistically higher in the prp group than in the control group ( p=.03 ) . \n histopathologically , there was significantly less inflammatory cell infiltration ( p=.005 ) and there were no statistically significant differences between groups in fibroblast development , collagen production , vessel proliferations , or epithelization . \n platelet - rich plasma seems to partially improve burn wound healing in this experimental burn injury model . \n use of platelet - rich plasma can be an option for patients who have extensive burn areas with no chance for grafting to accelerate the burn healing process .", "role": "user" }, { "content": "backgroundto investigate the effects of platelet - rich plasma on tissue maturation and burn healing in an experimental partial - thickness burn injury model.material/methodsthirty wistar albino rats were divided into 3 groups of 10 rats each . \n group 1 ( platelet - rich plasma group ) was exposed to burn injury and topical platelet - rich plasma was applied . \n group 2 ( control group ) was exposed to burn injury only . \n group 3 ( blood donor group ) was used as blood donors for platelet - rich plasma . \n the rats were killed on the seventh day after burn injury . \n tissue hydroxyproline levels were measured and histopathologic changes were examined.resultshydroxyproline levels were significantly higher in the platelet - rich plasma group than in the control group ( p=.03 ) . \n histopathologically , there was significantly less inflammatory cell infiltration ( p=.005 ) and there were no statistically significant differences between groups in fibroblast development , collagen production , vessel proliferations , or epithelization.conclusionsplatelet-rich plasma seems to partially improve burn healing in this experimental burn injury model . as an initial conclusion , it appears that platelet - rich plasma can be used in humans , although further studies should be performed with this type of treatment .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: adult articular cartilage has insufficient ability to repair after either erosion or damage and it is unlikely to be reformed to normal condition once it has been impaired . \n articular cartilage repair has been based on finding and resolving the primary reason for the injury , but it has been recognized that only treating the damage site is not adequate to gain good long - term functionality . \n the matrix environment of hyaline cartilage is different from that of subchondral bone in biological , physical and chemical characteristics . \n this led to the proposal that in order to gain positive results in tissue repair , the microenvironment in which the repair process takes place should be retouched , such as those elements that play a pro - angiogenic , conductive , cell differentiation and chemotactic role . \n this tendency has been the reason behind a growth in using genetic and tissue engineering in the examination of articular cartilage repair . \n a number of natural and artificial biomaterials have been used as scaffolds for cartilage reformation , but their biological effectiveness as well as safety remains unresolved . \n therefore , scaffold biomaterials extracted from the patients own body have long been a tempting choice . \n platelet - rich plasma ( prp ) , which can be easily harvested from autologous blood , has been used in clinical experiments for decades . \n prp is rich in growth factors , containing those that help the proliferation of chondrogenic cells and discharging of cartilaginous matrix , such as platelet - derived growth factor ( pdgf ) , transforming growth factor ( tgf - b ) , vascular endothelial growth factor ( vegf ) , basic fibroblast growth factor ( bfgf ) and insulin - like growth factor ( igf ) . \n a new member in platelet concentrated products is platelet - rich fibrin ( prf ) , which can be prepared easily without biochemical blood handling . \n prf is similar to prp except in biochemical architectures because of slow polymerization during prf preparation . \n such a network leads to a more competent cell mobilization and repopulation and consequently healing . \n stromal cell - derived factor-1 ( sdf1 ) , a chemokine factor expressed by bmscs , regulates the trafficking , homing and migration of stem cell by mediating chemokinesis and chemotaxis into the injury site . \n we believe that autologous prp and prf could be used alone as a 3-d scaffold capable of cartilage tissue regeneration because of releasing endogenous growth factors . \n sdf1 stimulates cartilage mesenchymal stem cells ( c - mscs ) , synovial membrane mesenchymal stem cells ( sm - mscs ) , and bone marrow stromal cells ( bmscs ) to migrate to the subchondral bone in full - thickness defects to make cartilage . \n the aim of the study was to evaluate tissue repair along with prp and prf or without treatment . \n the secondary objective was to evaluate the efficacy of prp and prf used with sdf1 . \n the 9 ml of whole blood collected in a tube containing 1 ml an anticoagulant ( 3.8% sodium citrate solution ) was centrifuged for 5 minutes at 2,000 rpm and the supernatant was placed in a new tube . \n the plasma at the top was discarded and the remaining 1ml of liquid prp precipitate was collected . after mixing prp ( 200 l / defect ) and 40 mmol / l calcium chloride ( cacl2 ) , a gel was formed . the prp gel bonded to the adjacent cartilage about 10 minutes after implantation . \n the 10 ml blood samples collected from the hearts of six rabbits without anticoagulant were immediately centrifuged at 3,000 rpm for 10 minutes . in the middle of the tube \n , a fibrin clot was formed between supernatant acellular plasma and the lower red corpuscles . before transplantation \n , 600 l of rhsdf1 alpha ( 120 ng / ml peprotech ) was incubated with prp gel , prf and gelatin separately for 2 hours at 37c . \n a total of 18 adult male white japanese rabbits ( weighing 2.5 - 3.0 kg ) were used in this study . \n the animals were housed in metal wire cages , in a temperature - controlled room under a 12:12 h light - dark cycle at 2224c and 5060% relative humidity . \n animal interventional experiments were carried out at animal experiments of tehran university of medical sciences under the rules and regulation of the animal care and use committee of shiraz university school of medicine . \n the 36 bilateral knees of the 18 rabbits were randomly divided into 6 experimental groups of 6 knees per group . \n each animal was sedated by intramuscular injection of ketamine hydrochloride 60 mg / kg and xylazine 6 mg / kg . in sterile conditions , \n a full - thickness cylindrical cartilage defect of 4 mm in diameter and 3 mm in depth was created in the patellar groove using a standard size stainless biopsy punch . \n i , the defects were left unfilled ( control group ) . in group ii , the defects were filled with platelet - rich plasma only ( prp group ) . in group iii , the defects were filled with platelet - rich fibrin only ( prf group ) . in group iv , \n the defects were filled with gelatin containing stromal cell - derived factor-1 ( gel+sdf1 group ) . in group \n v , the defects were filled with platelet - rich plasma containing stromal cell - derived factor-1 ( prp+sdf1 group ) . in group \n vi , the defects were filled with platelet - rich fibrin containing stromal cell - derived factor-1 ( prf+sdf1 group ) in a randomized manner . \n the distal parts of the femurs were excised , photographed and graded for cartilage repair , according to the international cartilage repair society score ( icrs ) macroscopic assessment scores ( table 1 ) . \n icrs macroscopic evaluation of cartilage repair after gross evaluation , samples were fixed in 4% paraformaldehyde for 7 days , decalcified in 10% edta for 3 weeks and then embedded in paraffin and cut perpendicularly into 5 m sections . \n then , the sections were stained for general histology with hematoxylin and eosin ( h&e ) and with toluidine blue to estimate the cartilaginous matrix distribution . \n the re - created tissue was scored blindly according to the icrs scale ( table 2 ) . \n icrs visual histological assessment scale immunofluorescent analysis was performed using a monoclonal antibody against collagen ii ( cat number : ma1 - 37493 ) . \n heat - induced epitope retrieval was done in citrate buffer ( sodium citrate , 10 mm ; ph 6.0 ) in a pressure cooker for 4 minutes at full pressure . \n subsequent to cooling , endogenous peroxidase was blocked using a 3% hydrogen peroxide solution for 20 minutes . \n the slides were then washed with phosphate buffer solution ( 10 mm ; ph 7.4 ) and incubated with primary antibodies overnight at 4c . \n the slides were washed again three times with pbs and subsequently incubated with an fitc - conjugated secondary antibody ( cat number : 11555100 ) according to the respective manufacturer s instructions . \n total rna extraction was performed using rnx - plus kit ( cinnagen ) according to the protocol . \n the concentration and quantification of total rna were measured with spectrophotometer , with the od260/od280 ratio of all rna samples 1.92.0 and od260/od230 ratio up to 2 . \n the first strand cdna was synthesized with the first - strand cdna synthesis kit ( bioneer kit , k-2101 ) . for each reaction , 1 g ( 1 l ) rna was used for reverse transcription , in a mixture of 20 pmoles ( 1 l ) random primer , and 18 l depc - d.w with a final volume of 20 l . \n the mixture was incubated at 15c for 1 min , 50c for 60 minutes and heated at 95c for 5 minutes to terminate the reaction . \n qpcr was performed in a volume 1 l of primer and 1 l from template also add 3 l depc.d.w with 5 l master mix ( accupower 2x greenstartmqpcr master mix , bioneer kit ) . \n all pcr reactions were in the following condition : initial 95c for 15 minutes , followed by 35 cycles at 95c for 15 s and 60c for 30 s. after completing the qpcr , their products run on agarose gels for quality check and real - time data analyzed by livak rules . \n the sequences of primers used in real - time pcr analyses were as follows : aggrecan forward gagaccaagtcctcaagccc ; reverse ctctgtctcctggcaggttc . \n a comparison between groups for each outcome was carried out with the kruskal - wallis test . \n the 9 ml of whole blood collected in a tube containing 1 ml an anticoagulant ( 3.8% sodium citrate solution ) was centrifuged for 5 minutes at 2,000 rpm and the supernatant was placed in a new tube . \n the plasma at the top was discarded and the remaining 1ml of liquid prp precipitate was collected . after mixing prp ( 200 l / defect ) and 40 mmol / l calcium chloride ( cacl2 ) , a gel was formed . the prp gel bonded to the adjacent cartilage about 10 minutes after implantation . \n the 10 ml blood samples collected from the hearts of six rabbits without anticoagulant were immediately centrifuged at 3,000 rpm for 10 minutes . in the middle of the tube \n , a fibrin clot was formed between supernatant acellular plasma and the lower red corpuscles . \n before transplantation , 600 l of rhsdf1 alpha ( 120 ng / ml peprotech ) was incubated with prp gel , prf and gelatin separately for 2 hours at 37c . \n a total of 18 adult male white japanese rabbits ( weighing 2.5 - 3.0 kg ) were used in this study . \n the animals were housed in metal wire cages , in a temperature - controlled room under a 12:12 h light - dark cycle at 2224c and 5060% relative humidity . \n animal interventional experiments were carried out at animal experiments of tehran university of medical sciences under the rules and regulation of the animal care and use committee of shiraz university school of medicine . \n the 36 bilateral knees of the 18 rabbits were randomly divided into 6 experimental groups of 6 knees per group . \n each animal was sedated by intramuscular injection of ketamine hydrochloride 60 mg / kg and xylazine 6 mg / kg . in sterile conditions , a medial para - patellar arthrotomy was made in both knees . \n a full - thickness cylindrical cartilage defect of 4 mm in diameter and 3 mm in depth was created in the patellar groove using a standard size stainless biopsy punch . \n ii , the defects were filled with platelet - rich plasma only ( prp group ) . in group iii , the defects were filled with platelet - rich fibrin only ( prf group ) . in group iv , \n the defects were filled with gelatin containing stromal cell - derived factor-1 ( gel+sdf1 group ) . in group \n v , the defects were filled with platelet - rich plasma containing stromal cell - derived factor-1 ( prp+sdf1 group ) . in group \n vi , the defects were filled with platelet - rich fibrin containing stromal cell - derived factor-1 ( prf+sdf1 group ) in a randomized manner . \n the distal parts of the femurs were excised , photographed and graded for cartilage repair , according to the international cartilage repair society score ( icrs ) macroscopic assessment scores ( table 1 ) . \n after gross evaluation , samples were fixed in 4% paraformaldehyde for 7 days , decalcified in 10% edta for 3 weeks and then embedded in paraffin and cut perpendicularly into 5 m sections . \n then , the sections were stained for general histology with hematoxylin and eosin ( h&e ) and with toluidine blue to estimate the cartilaginous matrix distribution . \n the re - created tissue was scored blindly according to the icrs scale ( table 2 ) . \n icrs visual histological assessment scale immunofluorescent analysis was performed using a monoclonal antibody against collagen ii ( cat number : ma1 - 37493 ) . \n heat - induced epitope retrieval was done in citrate buffer ( sodium citrate , 10 mm ; ph 6.0 ) in a pressure cooker for 4 minutes at full pressure . \n subsequent to cooling , endogenous peroxidase was blocked using a 3% hydrogen peroxide solution for 20 minutes . \n the slides were then washed with phosphate buffer solution ( 10 mm ; ph 7.4 ) and incubated with primary antibodies overnight at 4c . \n the slides were washed again three times with pbs and subsequently incubated with an fitc - conjugated secondary antibody ( cat number : 11555100 ) according to the respective manufacturer s instructions . \n total rna extraction was performed using rnx - plus kit ( cinnagen ) according to the protocol . \n the concentration and quantification of total rna were measured with spectrophotometer , with the od260/od280 ratio of all rna samples 1.92.0 and od260/od230 ratio up to 2 . \n the first strand cdna was synthesized with the first - strand cdna synthesis kit ( bioneer kit , k-2101 ) . for each reaction , 1 g ( 1 l ) rna was used for reverse transcription , in a mixture of 20 pmoles ( 1 l ) random primer , and 18 l depc - d.w with a final volume of 20 l . \n the mixture was incubated at 15c for 1 min , 50c for 60 minutes and heated at 95c for 5 minutes to terminate the reaction . \n qpcr was performed in a volume 1 l of primer and 1 l from template also add 3 l depc.d.w with 5 l master mix ( accupower 2x greenstartmqpcr master mix , bioneer kit ) . \n all pcr reactions were in the following condition : initial 95c for 15 minutes , followed by 35 cycles at 95c for 15 s and 60c for 30 s. after completing the qpcr , their products run on agarose gels for quality check and real - time data analyzed by livak rules . \n the sequences of primers used in real - time pcr analyses were as follows : aggrecan forward gagaccaagtcctcaagccc ; reverse ctctgtctcctggcaggttc . \n a comparison between groups for each outcome was carried out with the kruskal - wallis test . \n the macroscopic evaluation of the treated areas in the prf+sdf1 group revealed complete repair and integrated well with the surrounding cartilage as compared with other groups ( figure 1 ) . \n a post - hoc analysis showed that icrs scores of all experimental groups were significantly higher than those in the control group and the scores of the prf+sdf1 group were greater than those of the other groups ( p<0.001 ) ( figure 2 ) . \n gross appearance of defects in the trochlear groove at four weeks after surgery , respectively . \n b ) prp group : healing tissue is thinner than normal surrounding cartilage and shows a large fissure . \n d ) gel+sdf1 group : repaired tissue covers the defect almost completely , but is thin and distinguishable from the surrounding cartilage . \n e ) prp+sdf1 group : healing tissue covers defect with smooth white tissue and distinguishable from the surrounding cartilage . \n f ) prf+sdf1 group : repaired tissue covers the defect completely and no obvious margin was notable . \n a ) icrs macroscopic and b ) icrs microscopic scores in the regenerated cartilage of defects in the trochlear groove at four weeks postoperatively . \n data are presented as meansd . * significant difference with non - treated control ( p<0.05 ) ; * * significant difference with rpp group ( p<0.05 ) . \n four weeks after surgery , the regenerated regions were evaluated by h&e and toluidine blue staining . \n the regenerated regions of the prf+sdf1 group were entirely filled by the repaired tissue and showed better results than the other groups ( figures 3 and 4 ) . \n a post - hoc analysis showed that icrs scores of all groups , except for the prp group , were significantly higher than the control group ( p<0.001 ) . \n the scores of the prf+sdf1 group were greater than the other groups , but were not significant when compared with the gel+sdf1 and prp+sdf1 groups . \n the scores of the prp group were significantly lower than the other groups except for the prf group , which was not significant ( figure 2 ) . \n the qualitative study of immunofluorescent staining of collagen ii demonstrated that neo - cartilages were minimally positive in the control , prp , and prf groups . \n in contrast , the gel+sdf1 , prp+sdf1 and prf+sdf1 groups exhibited a remarkable distribution of type ii collagen ( figure 5 ) . \n the microscopic appearance of h&e staining of defects in the trochlear groove at four weeks after surgery , respectively ( original magnification=200 ) . \n a ) control group : the defect is concave and a noticeable thin layer of non - cartilaginous tissue . \n b ) prp group : the defect is filled by fibrous tissue with a crack . \n d ) gel+sdf1 group and ( e ) prp+sdf1 group : the defects in both groups are filled with a repaired tissue , which are thinner than the normal surrounding cartilage . \n f ) prf+sdf1 group : the defect is entirely filled by the repaired tissue , resembling the healthy cartilage surrounding the tissue . \n histological appearance of toluidine blue staining of defects in the trochlear groove at four weeks after surgery , respectively ( original magnification=200 ) . \n b ) prp group , and c ) prf group : the defects in both groups have poor staining fibrocartilagous tissues and poorly organized ecm . \n d ) gel+sdf1 group , and e ) prp+sdf1 group : the repaired tissues show a good staining in both groups . \n a ) control group , b ) prp group , c ) prf group , d ) gel+sdf1 group , e ) prp+sdf1 group , and f ) prf+sdf1 group . \n the neo - cartilages are minimally positive in a , b and c. the neo - cartilages are positive in d and e. a remarkable distribution of type ii collagen is seen in f. four weeks after surgery , a real - time pcr analysis revealed that the mrna expression of sox9 was significantly greater in the regenerated tissue of all groups than the untreated control group ( p<0.001 ) . \n the level of gene expression of aggrecan in all groups was significantly higher than the control group , except for the prp group that was not significant ( p<0.001 ) ( figures 6 and 7 ) . \n the amount of gene expression of sox9 and aggrecan in the regenerated cartilage of defects in the trochlear groove at four weeks postoperatively . \n data are presented as meansd . * significant difference with non - treated control ( p<0.05 ) . \n the quality checking of rt - pcr for sox9 and aggrecan from the regenerated cartilage of defects in the trochlear groove at four weeks after surgery . lane a : control group where transplantation was not performed ; lane b : prp group ; lane c : prf group ; lane d : gel+sdf1 group ; lane e : prp+sdf1 group , and lane f : prf+sdf1 group . \n the macroscopic evaluation of the treated areas in the prf+sdf1 group revealed complete repair and integrated well with the surrounding cartilage as compared with other groups ( figure 1 ) . \n a post - hoc analysis showed that icrs scores of all experimental groups were significantly higher than those in the control group and the scores of the prf+sdf1 group were greater than those of the other groups ( p<0.001 ) ( figure 2 ) . \n gross appearance of defects in the trochlear groove at four weeks after surgery , respectively . \n b ) prp group : healing tissue is thinner than normal surrounding cartilage and shows a large fissure . \n d ) gel+sdf1 group : repaired tissue covers the defect almost completely , but is thin and distinguishable from the surrounding cartilage . \n e ) prp+sdf1 group : healing tissue covers defect with smooth white tissue and distinguishable from the surrounding cartilage . \n f ) prf+sdf1 group : repaired tissue covers the defect completely and no obvious margin was notable . \n a ) icrs macroscopic and b ) icrs microscopic scores in the regenerated cartilage of defects in the trochlear groove at four weeks postoperatively . \n data are presented as meansd . * significant difference with non - treated control ( p<0.05 ) ; * * significant difference with rpp group ( p<0.05 ) . \n four weeks after surgery , the regenerated regions were evaluated by h&e and toluidine blue staining . \n the regenerated regions of the prf+sdf1 group were entirely filled by the repaired tissue and showed better results than the other groups ( figures 3 and 4 ) . \n a post - hoc analysis showed that icrs scores of all groups , except for the prp group , were significantly higher than the control group ( p<0.001 ) . \n the scores of the prf+sdf1 group were greater than the other groups , but were not significant when compared with the gel+sdf1 and prp+sdf1 groups . \n the scores of the prp group were significantly lower than the other groups except for the prf group , which was not significant ( figure 2 ) . \n the qualitative study of immunofluorescent staining of collagen ii demonstrated that neo - cartilages were minimally positive in the control , prp , and prf groups . \n in contrast , the gel+sdf1 , prp+sdf1 and prf+sdf1 groups exhibited a remarkable distribution of type ii collagen ( figure 5 ) . \n the microscopic appearance of h&e staining of defects in the trochlear groove at four weeks after surgery , respectively ( original magnification=200 ) . \n a ) control group : the defect is concave and a noticeable thin layer of non - cartilaginous tissue . \n b ) prp group : the defect is filled by fibrous tissue with a crack . \n d ) gel+sdf1 group and ( e ) prp+sdf1 group : the defects in both groups are filled with a repaired tissue , which are thinner than the normal surrounding cartilage . \n f ) prf+sdf1 group : the defect is entirely filled by the repaired tissue , resembling the healthy cartilage surrounding the tissue . \n histological appearance of toluidine blue staining of defects in the trochlear groove at four weeks after surgery , respectively ( original magnification=200 ) . \n b ) prp group , and c ) prf group : the defects in both groups have poor staining fibrocartilagous tissues and poorly organized ecm . \n d ) gel+sdf1 group , and e ) prp+sdf1 group : the repaired tissues show a good staining in both groups . \n a ) control group , b ) prp group , c ) prf group , d ) gel+sdf1 group , e ) prp+sdf1 group , and f ) prf+sdf1 group . \n the neo - cartilages are minimally positive in a , b and c. the neo - cartilages are positive in d and e. a remarkable distribution of type ii collagen is seen in f. \n four weeks after surgery , a real - time pcr analysis revealed that the mrna expression of sox9 was significantly greater in the regenerated tissue of all groups than the untreated control group ( p<0.001 ) . \n the level of gene expression of aggrecan in all groups was significantly higher than the control group , except for the prp group that was not significant ( p<0.001 ) ( figures 6 and 7 ) . \n the amount of gene expression of sox9 and aggrecan in the regenerated cartilage of defects in the trochlear groove at four weeks postoperatively . \n data are presented as meansd . * significant difference with non - treated control ( p<0.05 ) . \n the quality checking of rt - pcr for sox9 and aggrecan from the regenerated cartilage of defects in the trochlear groove at four weeks after surgery . lane a : control group where transplantation was not performed ; lane b : prp group ; lane c : prf group ; lane d : gel+sdf1 group ; lane e : prp+sdf1 group , and lane f : prf+sdf1 group . \n this study considered the effects of prp and prf with or without sdf1 in full - thickness lesions in rabbits knees . \n a literature review indicated that the effects of prf+sdf1 and prp+sdf1 were not studied so far . \n we demonstrated that the implantation of prf+sdf1 led to the greatest yield scores of full - thickness lesions in rabbits knee . \n therefore , it can be concluded that the scaffolds containing sdf1 have a better result on cartilage repair . \n zhang w. et al . implanted a combination of collagen scaffold to mimic the subchondral bone matrix environment containing sdf1 in order to repair partial - thickness defects in rabbits knee . \n the results demonstrated that collagen scaffold containing sdf1 improved the repairing process by a better support for c - mscs and sm - mscs migration and adhesion six weeks after transplantation . \n some researchers used ultra - purified alginate gel containing sdf1 to improve osteochondral lesions in rabbits knee . according to their studies , the repairing effect of osteochondral defects \n is elevated , because sdf1 increases the migration of host cells ( mainly bmscs ) to the site of injury , and this makes sdf1 as a potential factor in cartilage repair . \n they studied the length of the hypertrophic zone by immunohistochemical analysis of tibia cartilaginous growth plates of chicken embryos , which were incubated with sdf1 for 2 , 4 , and 6 days in organ culture . \n the results showed the length of the hypertrophic zone was significantly elevated after 4 and 6 days . in injured tissue with the permissive matrix environment , endogenous stem cells can participate in corrective process . \n some studies have introduced populations of stem / progenitor cells in the synovial membrane and articular cartilage , which show characteristic of stem cells and have the potential for cartilage repair . \n the findings of the above studies are in agreement with our results that show sdf1 can facilitate the migration of c - mscs and sm - mscs to full - thickness defect sites . \n although sdf1 has been notified to promote inflammatory cell migration , we could not find inflammatory cells in the newly formed tissue in rpf , prp and gel containing sdf1 groups . \n in parallel with our data , a study on tendon repair by exogenous sdf1 showed improvement of injury site and diminishing accumulation of inflammatory cells . in prf , \n the fibrin formation meshes , which are similar to biochemical architectures of the natural one , can trap a significant amount of circulating cytokines . \n this method increases the lifespan of these cytokines ( as a long - term effect ) , without which , it will be only released and used at the time of the primary phase of matrix remodeling . as a result , \n when the cells begin extracellular matrix remodeling to reconstruct the injured site , the cytokines will be available in the affected area for the required longer period . \n cytokines are important factors in the delicate balance of tissue homeostasis . in a pilot study , \n . showed that all patients with osteochondral defects who received bm - mscs transplanted on platelet - rich fibrin glue ( pr - fg ) had a significant improvement in their functional knee scores and mri findings after 6 months and remained stable 12 months post operation . in agreement with this clinical study , \n choukroun j. et al . revealed that filling a tooth socket by prf can enhance the healing process without any complication . in a supplementary study , they reported that adding prf to bone allograft in sinus elevation surgery can lead to 4-month reduction in healing time by increasing the speed of bone allograft maturation . \n however , in contrast to our results , an in - vivo study by shao x.x . \n et al . on osteochondral defects in rabbits knee showed that bmscs seeded in fibrin glue matrix forms a poor - quality cartilage - like tissue . \n it can be concluded that the reason for varying results can be due to the differences in biomechanical conditions of defect types . \n et al . reported that differentiation of bone - marrow derived stem cells can be affected by mechanical signals . \n moreover , suitable recurring compressive stress significantly increases chondrocyte proliferation in addition to aggrecan and collagen synthesis by chondrocytes . \n some researchers reported that cell adhesion and migration can facilitate by some elements such as different cell type and substrate stiffness . \n most importantly , in a separate study , wang h. et al . had compared the amount of bounded bovine chondrocytes on various surfaces of middle deep zone bone or calcified cartilage or hyaline cartilage . \n they reported that different contact surface stiffness give different ability to cells for migration and attachment . \n activated prp can be used in different forms like gel as a scaffold , liquid form injection or can be infiltrated in the tissue thickness . \n the selection of each form relies upon the type of tissue and the existing problem . by degradation of the fibrin skeleton of prp \n growth factors play a significant role in tissue repair , especially in the regenerative process of tissues with low cellular density and vascularization , such as cartilage . \n a study showed that if prp was applied in full - thickness chondral lesions , the signs of healing will be observed , but it did not show healthy or functional behavior . \n wu w. et al . reported cartilage formation into the prp scaffold after implanting prp gel as a carrier for cultured autologous chondrocytes in the subcutaneous tissue of rabbits knees . \n another study suggested that transplantation of prp gel along with synovial membrane derived mesenchymal stem cells ( sdscs ) can facilitate the repair of osteochondral lesions in rabbits knees . \n perhaps the underlying reason for different results is various compositions of this plasma fraction in different species , including rabbits . \n prf was harvested from an autologous blood sample that had a limited volume and prf tissue banks were not achievable . \n in the present study , in addition to using prp and prf as scaffolds for cell seeding , we used a mixture of sdf1 and prp and prf scaffolds to enhance the migration of host cells . in our research , \n the effects of prp and prf alone on the full - thickness defects were also studied separately . \n we found that the added sdf1 stimulated cell or the combination of prp , prf , and sdf1 stimulated the observed improvement .", "role": "user" }, { "content": "background : the purpose of this study was to create biomaterial scaffolds like platelet - rich plasma ( prp ) and platelet - rich fibrin ( prf ) containing stromal cell - derived factor-1 ( sdf1 ) as a chemokine to induce hyaline cartilage regeneration of rabbit knee in a full thickness defect.methods:we created a full thickness defect in the trochlear groove of thirty - six bilateral knees of eighteen mature male rabbits . \n the knees were randomly divided into six groups ( group i : untreated control , group ii : prp , group iii : prf , group iv : gelatin+sdf1 , group v : prp+sdf1 , and group vi : prf+sdf1 ) . after four weeks \n , the tissue specimens were evaluated by macroscopic examination and histological grading , immunofluorescent staining for collagen type ii , and analyzed for cartilage marker genes by real - time pcr . \n the data were compared using statistical methods ( spss 20 , kruskal - wallis test , bonferroni post hoc test and p<0.05).results : macroscopic evaluations revealed that international cartilage repair society ( icrs ) scores of the prf+sdf1 group were higher than other groups . \n microscopic analysis showed that the icrs score of the prp group was significantly lower than other groups . \n immunofluorescent staining for collagen ii demonstrated a remarkable distribution of type ii collagen in the gel+sdf1 , prp+sdf1 and prf+sdf1 groups compared with other groups . \n real - time pcr analysis revealed that mrna expression of sox9 and aggrecan were significantly greater in the prf+sdf1 , prp+sdf1 , gel+sdf1 and prf groups than the control group ( p<0.05).conclusion : our results indicate that implantation of prf scaffold containing sdf1 led to the greatest evaluation scores of full - thickness lesions in rabbits .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: global statistics reveal that at 2.5 million , india has the third highest hiv / aids population in the world after south africa and nigeria.(1 ) dealing with hiv / aids means focusing on issues that center around sexuality and behavior , and are therefore considered taboo to be talked about openly in indian society . over the years , however , government agencies and non - governmental organizations working in the field of hiv / aids have learnt to address these issues frankly , but at the personal level , individuals still hesitate to discuss their problems openly , and would rather use an anonymous and private forum to get their queries answered and their doubts clarified with regard to hiv / aids . \n telephone helplines have been used as effective tools in health care in the past , especially in the context of diabetes,(2 ) heart disease(3 ) and other conditions . with the entry of mobile technology , \n the telephone is a medium of communication , which helps individuals to access information at their convenience and to be in touch with experts without too much effort . since the late 1990s , \n the advantage of hiv / aids helplines lies in the fact that as the counselor and counselee interact only on the phone , confidentiality and anonymity are maintained . \n moreover , the call is completely under the control of the caller and can be discontinued at his will . \n the asha foundation in bangalore established a manual telephone helpline for hiv / aids in the year 2000 . \n this article describes the profile of the callers , the nature of their queries , the gaps in this service and the overall effectiveness of such helplines . \n the present study was conducted at asha foundation , located in bangalore urban district in the state of karnataka . \n karnataka is one of the states that has a high prevalence of hiv / aids . \n the hiv / aids helpline was established in 2000 and functions on all days of the week from 9.30 am to 4.30 pm and for half a day on saturdays . \n the availability of this service was advertised through public announcements in newspapers , radio , yellow pages and stickers . \n initially we had an automated interactive voice response system on toll - free number 1097 , but we found that people preferred talking to a person rather than an automated machine . \n all the calls received on our manual helpline during the period of 2 years from january 2007 to december 2008 , were included in this study . \n each call varied in length from a few minutes to almost 40 minutes depending on the need of the caller . \n once a rapport was established , general details such as age and occupation of the caller were noted . \n details of each call were recorded and entered on ms excel worksheet and finally analyzed using the spss software package . \n a total of 2835 calls were received during this period . of these , 2101(74.1% ) were first - time callers and 734 ( 25.9% ) were repeat callers . \n distribution of new and repeat callers by gender of the 2101 first time callers , 87.8% were male and only 12.2% were female . among the 734 repeat callers , 80.6% were male and 19.4 % were female . \n thus overall , less than 15% of the callers were female . almost two - thirds of the callers used english as the medium of communication and only one - third used the local language . \n a vast majority of the callers ( nearly 90% ) were in the age - group of 20 - 39 years as presented in table 2 . \n distribution of callers according to age callers in the age groups of below 20 years and between 40 - 49 years jointly account for 10% of all calls and there are hardly any calls from persons above 50 years of age . \n the reasons for using the helpline - first time or repeat - are listed in tables 3 and 4 and are classified by age of caller . \n first - time callers - reasons for calling according to age repeat callers - reasons for calling according to age the reasons for calling the helpline vary and includes information on hiv / aids , hiv testing , condom usage , care and support services , sex and sexuality , window period , emotional support while waiting for testing , details on testing , queries that are not linked to hiv / aids , details on helplines for other services such as elders helpline , services for prevention of mother to child transmission of hiv , etc . for those below 20 years the most common reasons for calling the helpline in decreasing order of importance were for hiv testing , \n information about hiv / aids , care and support services and referrals to other services not linked to hiv / aids . for those between 20 and 29 years testing , \n information , modes of transmission and condom use were the common reasons for calling . between 30 and 39 years , care and support services available and \n then testing were the main reasons for calling and beyond 40 years , information on care and support services was the main reason . \n although testing was an universal reason for calling the helpline across all ages , its importance decreased with age . \n for those , below 30 years the reasons for calling were mainly linked to risk ( hiv testing , condom use , etc ) and for those above 30 years the reasons for calling were to avail of care and support services . with regard to repeat callers \n , most of the callers called repeatedly for further information on testing , probably as they neared the completion of the window period . \n another reason for calling repeatedly was for emotional support while they waited for the hiv testing . \n other reasons included care and support services and this again was the most common reason for calling for those above 30 years . with regard to occupation , 68.8% of the callers were skilled , 8.9 % were unskilled , 12.8% were students and in 9.4% occupation was not known . among the unskilled callers almost one - third were repeat callers , probably for greater understanding . finally , 16.4% of all calls resulted in a drop in visit to the center , and most of these visits were for counseling and testing for hiv infection . \n in the western world , telephone helplines have been used as a screening method for case finding through anonymous telephone interviews asking details of sexual practices to enable screening for hiv - related risk.(4 ) helplines have also been used to provide current information on clinical trials in the field of hiv / aids . \n thousands of healthcare workers , patients and families in the west , rely on this telephone - based service to decide about options in management of their hiv disease.(5 ) in the context of hiv / aids , telephone helplines can be even more useful because of the stigma and secrecy associated with hiv / aids(6 ) and one would expect individuals to rather communicate on a telephone than make an actual visit to the center . \n moreover , the whole process is under the caller 's control and can be discontinued at his will . given this background , the response to the helpline has not been as great or encouraging as one expected , at the rate of about 4 - 5 calls per average day . \n it is possible that the availability and potential of such helplines have not been understood by the public at large , nor have they appreciated the value of such helplines to help them . \n it is also possible that the gravity of the encounter has not been understood nor the fact that effective help is possible through a telephone call . in any case , much more publicity and motivational measures may be required to sensitize the public to hiv / aids helplines . \n the fact that women account for only 14% of all callers depicts a wide gap in helpline services reaching out to women and this gap needs to be narrowed considering that women are a vulnerable group with regard to hiv / aids in our country.(7 ) greater efforts need to be made to reach out to women through publicity efforts targeting women , using women counselors so that women callers are comfortable and creating an enabling environment for women to utilize this service . that predominantly males have used the helplines is therefore disappointing although this has been the experience in other helplines at pune(8 ) and delhi.(9 ) this is probably because males play a dominant role in hiv transmission and are more likely to be concerned with the dangers . on the other hand , males might have easier access to phones within and outside the house and are more likely to voice their concerns with regard to risk in their lives . \n women on the other hand , may not even know that they are at risk leave alone accessing a helpline . however , where they are aware of the dangers involved , one would have expected them to seek advice and help , given the fact that mobile phones are quite widely used regardless of the gender of the user . \n even when they did call the helpline it was mainly to determine the care and support services available for a positive husband , a positive child or a positive relative , clarify doubts regarding symptoms that these relatives had or whether the medications they were on were being taken correctly . although the helplines are offered in both english and kannada , the local vernacular , more callers communicated in english . \n this probably implies that the helpline may be accessing only a particular segment of the society , which may or may not be the most vulnerable segment in the aids scenario . \n the hiv / aids helpline appears to be an important tool of communication for the young , educated , urban , male who wants his concerns addressed but at the same time wants to maintain anonymity . \n women and youth in rural areas , however , need to access this facility too and efforts need to be made enable this to happen . \n hiv / aids is moving from the urban to the rural areas and in this era of mobile technology , reaching out to youth'both men and women in rural areas should not be too difficult a task . \n the fact that 26% of all callers were repeat callers indicates that the helpline was useful to these callers especially during the window period and for emotional support while they waited for testing . \n further , 16.4% of all calls translated into drop - in visits to the counseling center of our foundation , indicating that helplines complement prevention efforts and care and support services .", "role": "user" }, { "content": "background : globally , telephone help - lines have proved their utility in several crisis situations . \n they were introduced in india for helping persons in need of counseling or emergency care such as victims of suicide , cardiac arrests , etc . \n the utility of such help - lines in hiv / aids has not been established .hence this study done in asha foundation , bangalore.objectives:to determine the characteristics of persons who access the hiv / aids helpline . to determine the reasons for calling the helpline . to identify the gaps in the provision of this service.materials and methods : details on all calls received on asha foundation 's hiv / aids help line during the period january 2007 to december 2008 , were entered on ms excel worksheet and analyzed using the spss software.results:majority of callers are male , are in the age group of 20 - 39 years and educated . \n the most common reasons for calling the helpline were for hiv testing , information about hiv / aids , care and support services and referrals to other services not linked to hiv / aids . \n reasons for calling were linked to risk ( hiv testing , condom use etc ) in younger persons , and to avail of care and support services in the older age-group.conclusions:the main users of the hiv / aids helpline are urban , young , educated males .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: proteostasis represents the functional balance of the proteome , which is permanently challenged by environmental stress and alterations in physiology . \n a decline in proteostasis leads to progressive aggregation of misfolded proteins , overwhelming the cellular protein quality control ( pqc ) networks . \n the maintenance of pqc mechanisms provided by molecular chaperones and proteolytic pathways is not only a long - term challenge for individual cells but also for the entire organism , given that damaged proteins dramatically accumulate with progressive aging ( lpez - otn et al . , 2013 ) . the quality - control e3 \n ubiquitin ligase chip acts along with molecular chaperones and degradation machineries to keep the cellular balance between protein folding and degradation ( arndt et al . , 2007 , connell et al . \n , 2001 , cyr et al . , 2002 , murata et al . , 2003 ) . \n chip provokes the ubiquitylation of damaged proteins consigned by chaperone partners to induce disposal through endocytic - lysosomal pathways ( okiyoneda et al . , 2010 , \n 2012 ) , proteasomal degradation ( connell et al . , 2001 , cyr et al . , 2002 , murata et al . , \n 2003 ) , and autophagy ( arndt et al . , 2010 ) . in agreement with its role in protein quality control , \n chip prevents an age - related pathologic accumulation of protein aggregates ( connell et al . , 2001 , petrucelli et al . , \n 2004 ) . surprisingly , however , chip deletion mice exhibit normal embryonic development and unaffected turnover of many known chip substrates , suggesting functional redundancy among quality - control ubiquitin ligases ( min et al . , 2008 , \n , chip deficiency accelerates aging ( min et al . , 2008 ) , which points to the existence of at least one critical chip - specific substrate that controls longevity . \n however , the mechanistic link between proteostasis decline and aging has remained unexplained so far . \n insulin and insulin - like growth factor 1 ( igf1 ) signaling ( iis ) represents an evolutionarily conserved pathway that senses nutrient supply and determines longevity in multicellular organisms ( barbieri et al . , 2003 ) . \n reduced insulin signaling extends lifespan and improves proteotoxic stress resistance via the activation of multiple transcription factors ( cohen et al . , 2010 , \n daf-2 has been identified as a membrane bound receptor regulating the iis pathway in caenorhabditis elegans . \n mechanistically , downregulation of daf-2 function activates the foxo transcription factor daf-16 , causing dramatic lifespan extension ( kenyon et al . , 1993 ) . besides extensive genetic analyses of the iis pathway , \n however , the impact of daf-2 protein level regulation on aging has not been addressed . here \n we identify a degradation pathway that controls the level of active daf-2/insr in c. elegans , drosophila melanogaster , and human cells . \n the key regulator of this conserved mechanism is the ubiquitin ligase chip , which fine - tunes iis via monoubiquitylation and subsequent endocytic - lysosomal degradation of the insulin receptor . upon proteotoxic stress and during aging , \n however , chip is preferentially shuttled towards quality - control pathways for degradation of damaged proteins , causing a stabilization of the insr . \n accordingly , proteotoxic accumulation of damaged proteins or aberrant chip function attenuates insr degradation and affects metabolism and longevity through increased iis . in conclusion , \n our results demonstrate a competition between proteostasis and lifespan regulation through chip - assisted proteolysis , providing an evolutionarily conserved concept for understanding the impact of proteome imbalance on aging . \n to obtain insight into the physiological function of chip , we examined its role in aging , using c. elegans as a model organism . \n interestingly , the loss - of - function alleles chn-1(by155 ) and chn-1(tm2692 ) , both lacking the single chip worm ortholog chn-1 , showed reduced lifespan ( figures 1a and s1a ; table s1 ) \n . the short lifespan phenotype of both deletion mutants was also recapitulated by rnai depletion of chn-1 ( figure s1b ; table s1 ) . \n chn-1(by155 ) worms exhibited reduced body size , which often reflects limited nutrient uptake ( figure 1b ) . \n therefore , we investigated the effect of chn-1 depletion in context of the well - established longevity pathway triggered by dietary restriction ( dr ) . \n dr can be reproduced genetically by using eat-2(ad465 ) mutants , which exhibit reduced pharyngeal pumping rates , causing lower food intake , smaller body size , and extended lifespan ( lakowski and hekimi , 1998 ) . \n however , deletion of chn-1 only partially shortened the lifespan of eat-2(ad465 ) mutant worms , suggesting that chn-1 acts parallel to dr in a different longevity pathway ( figure 1c ; table s1 ) . \n iis is well known to regulate both lifespan and metabolism in c. elegans ( perez and van gilst , 2008 ) . \n hence , the phenotypes we observed in the chn-1 deletion mutants could also be linked to this conserved signaling pathway ( kimura et al . , 1997 ) . \n reduced activity of the daf-2/insr mobilizes the downstream foxo transcription factor daf-16 , resulting in enhanced metabolism and extended lifespan of nematodes ( lin et al . , 2001 , ogg et al . , 1997 ) . \n nuclear localization of daf-16 can be triggered by its overexpression to support transcriptional activity and longevity ( henderson and johnson , 2001 ) . \n in fact , transgenically expressed daf-16::gfp was able to suppress both chn-1(by155 ) and chn-1(tm2692 ) deletion mutants and extended lifespan ( figures 1d and 1e ; table s1 ) . \n conversely , short lifespan caused by rnai - mediated downregulation of daf-16 was not further reduced by chn-1 deletion . \n the combined depletion of both genes rather resulted in almost identical lifespan curves , suggesting an epistatic relationship ( figure 1f ; table s1 ) . in light of this genetic interaction , we further monitored daf-16 nuclear localization as visual readout to test whether insulin signaling is increased in the absence of chn-1 . \n in fact , localization of daf-16::gfp into the nucleus was delayed in the chn-1(by155 ) deletion mutant ( figures 1 g and s1c ; table s2 ) , whereas it was enhanced by transgenic overexpression of chn-1::flag ( figures 1 g , s1c , and s2a ; table s2 ) . \n we wondered whether the reduced lifespan and daf-16 mobility of chn-1 deletion worms might reflect reduced transcriptional activity of daf-16 . \n recent studies identified several target genes of daf-16 important for lifespan regulation ( lee et al . , 2003 ) . following mrna expression levels by real - time pcr , we identified reduced amounts of sod-3 and sip-1 mrnas in worms lacking chn-1 , similar to daf-16 loss - of - function , suggesting that chn-1 is important for efficient activation of daf-16 ( figure 1h ) . given the evolutionarily conserved function of insulin signaling ( barbieri et al . , \n 2003 ) , we wondered whether chip depletion provides similar short - lived phenotypes in d. melanogaster . \n in fact , rnai - mediated downregulation of drosophila chip ( dchip ) strongly reduced the lifespan of flies ( figure 1i ; table s1 ) . \n whereas the reduction of chn-1 and dchip levels diminished longevity , overexpression did not enhance lifespan of worms and was even toxic in flies ( figures s2a s2d ; table s1 ) . \n overexpression of the chaperone - associated ubiquitin ligase might cause an excessive routing of chaperone clients onto degradation pathways and might lead to non - physiological changes of the chaperone network given the hsf-1 regulating activity of chip ( dai et al . \n lifespan regulation critically depends on iis signaling , which is activated upon ligand binding to the insr at the plasma membrane and involves a cascade of intracellular phosphorylation events ( van der horst and burgering , 2007 ) . \n given the impact of chip depletion on lifespan regulation and genetic correlation with iis , we wondered whether any of the iis downstream targets are regulated by chip - mediated degradation . \n in fact , depletion of chip did not influence the protein level of pdk1 , akt , or mtor ; also , the level of the chaperone hsp90 remained unchanged in human embryonic kidney ( hek293 ) cells ( figure s2e ) . \n however , it increased akt kinase phosphorylation in flies ( s505 , p - akt ) and human cells ( s473 , p - akt ) ( figures 1j and 1k ) , providing further evidence for increased insulin signaling upon depletion of chip ( su et al . , 2011 ) . \n collectively , these results suggest that chip provides a conserved role in the regulation of iis activity . \n given our genetic epistasis data placing chn-1 function upstream of daf-2 , we performed western blot analysis to monitor the daf-2 protein level in vivo ( figure s2f ) . \n intriguingly , daf-2 abundance increased specifically later in life and was significantly enhanced in chn-1(by155 ) mutants especially at day 10 of adulthood ( figures 2a and 2b ) . given \n that chn-1 teams up with the related ubiquitin ligase ufd-2 in another degradation pathway regulating turnover of the myosin chaperone unc-45 ( hoppe et al . , 2004 ) , we tested whether ufd-2 would be additionally involved in daf-2 regulation . \n loss - of - function ufd-2(tm1380 ) mutants displayed reduced unc-45 turnover ( figure 2c ) . importantly , however , in contrast to chn-1(by155 ) , ufd-2(tm1380 ) mutants did not exhibit a stabilization of daf-2 ( figure 2c ) . to rule out unspecific consequences of chn-1 depletion on overall protein turnover \n , we compared the total amount of ubiquitylated proteins in wild - type and chn-1(by155 ) mutant worms at days 1 and 10 of adulthood . \n since there was no increase of ubiquitylated proteins detected in worm lysates lacking chn-1 ( figure 2d ) , the stabilization of daf-2 suggests a substrate - specific role of chn-1 in iis regulation rather than a general defect in ubiquitin - dependent protein degradation . in flies , the observed induction of akt kinase phosphorylation upon loss of dchip \n was also accompanied by an increase of the dinsr level ( figures 1j and 2e ) . in agreement with increased insulin signaling activity , the stabilized receptor did not accumulate in detergent - insoluble aggregates ( figure 2f ) . \n finally , depletion of human chip in hek293 cells resulted in a significant increase in the protein amount of human insr , whereas transcript levels remained unchanged ( figure 2 g ) . \n conversely , overexpression of chip caused reduced protein levels of insr ( figure 2h ) . \n these data demonstrate that chip plays a conserved role in limiting insr levels . regarding the correlation between chn-1 and daf-2 protein levels \n indeed , we found that flag - tagged chn-1 binds daf-2 in immunoprecipitation assays by using lysates of transgenic worms expressing chn-1::flag ( figures 3a , 3b , and s3a ) . \n intriguingly , the interaction was most obvious at day 10 of adulthood , which correlates with the timing of daf-2 protein level increase in worms lacking chn-1 ( figures 2a and 2b ) . \n this interaction is evolutionarily conserved given that we also detected binding between the insr and chip in human cell lysates ( figure 3c ) . regarding the direct interaction , we tested whether the insr is a target for chip ligase activity and performed in vitro ubiquitylation assays with recombinantly expressed proteins . \n indeed , we detected efficient ubiquitylation of daf-2 , dinsr , or insr either by chn-1 , dchip , or human chip , respectively ( figures 3d3 g ) . \n this reaction was completely blocked by a h218q point mutation within the conserved u - box domain of chn-1 , essential for e3 ligase catalytic activity ( u - box ) , or complete deletion of the entire domain ( u - box ) ( figures 3d , s3b , and s3c ) ( rosser et al . , 2007 ) . \n the amino - terminal tetratricopeptide repeat ( tpr ) domain of chip mediates interaction with hsp70 and hsp90 , and is required for the intrinsic ability of chip to recognize substrate proteins ( rosser et al . , 2007 ) . \n mutation of the tpr domain also inhibited receptor ubiquitylation , revealing that the domain contributes to the direct recognition of insr by chip in the chaperone - free reaction ( figures s3c and s3d ) . \n in contrast to the role of chn-1/chip , daf-2 was not modified by the related ubiquitin ligases ufd-2 ( hoppe et al . , 2004 ) or wwp-1 , a hect domain protein implicated in control of dr - dependent longevity ( figures 3d and s3b s3d ) ( carrano et al . , 2009 ) . \n different lysine ( k ) residues of ubiquitin are used for isopeptide bond formation between single ubiquitin molecules to form polyubiquitin chains with distinct linkages ( komander and rape , 2012 ) . \n regardless of the use of wild - type ( ub ) or a mutant form of ubiquitin without lysines ( ub ) , we obtained a similar pattern of ubiquitylation on daf-2 or the insr in our defined in vitro studies , indicating that chn-1/chip mediates multiple monoubiquitylation of the insr rather than polyubiquitylation ( figures 3f and 3 g ) . \n these experiments suggest a conserved role of chip in monoubiquitylation of the insr in worms , flies , and human cells . \n the lysine residues that are ubiquitylated were identified by mass spectrometric analyses of modified daf-2/insr obtained from independent in vitro experiments . \n k1047 was preferentially used for insr ubiquitylation in vitro and clusters with the additional conserved conjugation site k1057 ( figure s3e ) . in support of our findings \n , recent proteomic studies also identified k1047 as a major residue targeted for receptor ubiquitylation in human cells ( kim et al . , 2011 ) . \n in contrast to the insr , chip is not able to ubiquitylate the insulin - like growth factor receptor 1 ( igf1r ) ( figure 3h ) . \n together , these findings highlight the substrate - specific role of chip in insr degradation both in vitro and in vivo . \n notably , proteasomal inhibition by mg132 did not affect insr stability in hek293 cells ( figure 4a ) . \n in contrast , the amount of insr increased upon treatment of human cells with the lysosomal inhibitors bafilomycin a1 ( bafa1 ) and chloroquine , or a dynamin inhibitor that blocks endocytosis ( figure 4a ) . moreover , dynamin inhibition reversed the reduced insr level boosted by chip overexpression ( figure 4b ) \n . these findings would be consistent with an endocytic - lysosomal or autophagic degradation pathway for insr . to distinguish between these possibilities \n , we depleted the essential autophagy factor atg7 from human hek293 cells by sirna and monitored insr level ( komatsu et al . , \n efficient depletion of atg7 significantly inhibited autophagy , as evident from p62 accumulation and reduced levels of lipidated lc3 ( lc3-ii ) ( figure 4c ) . yet \n , atg7 depletion did not affect insr stability , thus excluding a critical contribution of autophagy to insr degradation . \n importantly , the chip - targeted lysine k1047 of the insr is crucial for receptor degradation in human cells given that the conservative k1047r amino acid substitution stabilized the insr to the same extent as inhibition of lysosomal degradation by chloroquine treatment ( figures 4d , 4e , and s3e ) . taken together , our data reveal an endocytic and lysosomal pathway for insr turnover initiated by chip - dependent monoubiquitylation . \n we further assessed the physiological relevance of the ubiquitin ligase activity by expressing wild - type and mutated variants of chn-1 in the chn-1(by155 ) deletion strain . unlike wild - type chn-1 , the catalytically inactive chn-1(u - box ) \n mutant defective in daf-2 ubiquitylation was not able to rescue the shortened lifespan phenotype of chn-1(by155 ) worms ( figures 5a , 5b , and s3a ) . \n this result supports the idea that chn-1-dependent ubiquitylation of daf-2 is tightly linked to regulation of longevity . to further clarify whether the level of daf-2 strictly correlates with lifespan \n , we analyzed its protein amount in different c. elegans daf-2 mutant alleles ( figure 5c ) ( kimura et al . , 1997 , malone and thomas , 1994 , patel et al . \n the hypomorphic daf-2(e1368 ) mutant promotes longevity and is able to extend the short lifespan of chn-1-deficient worms ( figure 5d ) . \n this genetic suppression further supports the idea that the shortened lifespan of chn-1 depletion is caused by daf-2 stabilization ( figures 2a and 2b ) . \n in contrast to e979 and e1391 temperature - sensitive mutant proteins , the daf-2 protein amount is elevated at day 5 of adulthood ( figure 5c ) . when combined with chn-1(by155 ) , daf-2(e1368 ) lifespan was slightly reduced , which is in line with further increase of daf-2 level in the chn-1(by155 ) mutant background ( figures 5d and 5e ) . \n contrary to all other long - lived loss - of - function alleles , the daf-2(gk390525 ) allele ( thompson et al . \n , 2013 , bulger et al . , 2017 ) displayed increased daf-2 level already at day 1 of adulthood and shortened lifespan ( figures 5c and 5f ) . intriguingly , daf-2(gk390525 ) harbors a single point mutation in k1614e , one of the lysine residues in daf-2 targeted for chn-1-dependent ubiquitylation ( figures 3d and s3e ) . \n thus , defective ubiquitylation seems to result in an elevated daf-2 protein level and premature aging . \n indeed , the reduced lifespan of daf-2(gk390525 ) worms can be extended again by rnai - mediated depletion of daf-2 ( figure 5 g ) . \n moreover , the daf-2 level was not further increased and lifespan of daf-2(gk390525 ) is not more diminished when combined with the chn-1(by155 ) mutation , again highlighting the substrate - specific role of chn-1 in daf-2 ubiquitylation and turnover ( figures 5h , 5i , and s4a ) . \n these observations further indicate that chn-1-mediated ubiquitylation regulates daf-2 stability , insulin signaling , and longevity . to address the physiological relevance of chn-1/chip - dependent insr degradation , \n chn-1 was downregulated either during larval development of worms or from day 1 of adulthood onward . \n it turned out that chn-1 is most important in adult life because its depletion specifically shortened life expectancy when applied post - developmentally ( figures s5a and s5b ) . \n chn-1 mutants are sensitive to heat stress , which might be linked to the age - related decline in proteostasis known to cause high abundance of misfolded proteins ( figure s5c ) ( murata et al . , 2003 , walther et al . , 2015 ) \n in contrast to molecular chaperones , chn-1 levels remained unchanged during aging and were not upregulated in response to different proteotoxic conditions ( figures 2a and s5d ) . a decline in proteostasis \n would thus redirect chn-1 activity toward degradation of misfolded proteins and limit monoubiquitylation of daf-2 . \n indeed , worms shifted to high temperature at the beginning of adulthood ( d1 ) showed elevated levels of daf-2 protein similar to those of chn-1 lacking mutants grown at normal conditions ( figures 2a , 6a , and 6b ) . \n in line with a central role in proteostasis , depletion of chn-1/dchip in worms and flies caused high sensitivity to oxidative stress induced by paraquat treatment ( figures 6c and 6d ) . \n moreover , in flies and human cells we also detected elevated level of the insr upon oxidative stress ( figures 6e and 6f ) . \n this increase most likely reflects reduced receptor turnover caused by limited disposability of chip under proteotoxic stress . in support of this hypothesis , \n insr levels could be restored in paraquat - treated human cells by overexpression of chip ( figure 6f ) . \n thus , ubiquitin ligase activity of chip seems to be limited under proteotoxic stress conditions . \n in addition , we also tested the impact of canavanine on dinsr stability in flies . \n incorporation of this non - proteinogenic amino acid leads to aberrantly folded polypeptides and increased proteotoxicity ( dasuri et al . , 2011 , rosenthal et al . , \n similar to increased oxidative stress , canavanine treatment strongly stabilized dinsr , providing additional support for the correlation between proteotoxic stress and insr stability ( figure s5e ) . \n the age - related collapse of proteostasis networks often induces aggregation of damaged and metastable proteins ( lpez - otn et al . , 2013 , walther et al . , 2015 ) . \n by transgenic expression of aggregation - prone fluorescently tagged polyglutamine ( polyq ) expansions in intestinal and muscle cells ( morley et al . , 2002 , mohri - shiomi and garsin , 2008 ) , we found that acute depletion of chn-1 by rnai caused early - onset protein aggregation and cellular toxicity in c. elegans ( figures 6 g and s5f ) . \n this observation is in line with recent findings ( kalia et al . , 2011 , \n , 2013 , min et al . , 2008 , rosser et al . , 2007 ) , reflecting an important role of chip in maintenance of the cellular proteome . \n we next addressed the role of chip in protein aggregation by using human cells expressing an extended polyglutamine repeat sequence fused to gfp ( polyq103-gfp ) . \n polyq103-gfp formed large , intracellular inclusion bodies that efficiently recruited cytosolic chip ( figure 6h ) . \n the recruitment toward protein aggregates diminished the pool of chip throughout the cytosol , which did not affect the amount of igf1r , but specifically led to a strong increase of insr level ( figure 6i ) . \n the observed increase could be attributed to reduced insr turnover by monitoring the mrna to protein ratio ( figure s5 \n our findings illustrate that chip integrates proteolysis of damaged proteins , which accumulate under proteotoxic stress conditions or during aging , with regulation of insr turnover and iis activity ( figure 7 ) . \n this study uncovered a balanced crosstalk between proteostasis maintenance and longevity , which paves the way toward understanding how proteome instability contributes to aging . \n a central node of this conserved mechanism is the quality - control e3 ubiquitin ligase chip , which tightly cooperates with the molecular chaperones hsp70 and hsp90 in the degradation of damaged proteins ( arndt et al . , 2007 , connell et al . , 2001 , cyr et al . , 2002 , murata et al . , 2003 , \n we demonstrate here that chip mediates ubiquitin - dependent degradation of the insr and thereby modulates insulin signaling and longevity . \n chip ubiquitylated the insr in vitro in the absence of its partner chaperones , pointing to a specific and direct recognition of the receptor , distinct from the reported role in chaperone - dependent processing of misfolded proteins ( zhang et al . , 2005 , \n the substrate specificity of the observed interaction is further highlighted by the fact that chip does not ubiquitylate or induce the degradation of the closely related igf1r ( figures 3h , 3i , and 6i ) . \n moreover , insr ubiquitylation could not be induced by other ubiquitin ligases such as wwp-1 or ufd-2 , which cooperates with chn-1/chip on muscle - specific degradation pathways . in agreement with a specific functional interplay \n , daf-2/insr was stabilized by chn-1/chip depletion or by mutations of daf-2/insr ubiquitylation sites utilized by chip ( figures 2a , 2b , 2e , 2 g , 4e , 5c , and s3e ) . in all cases , \n receptor stabilization significantly shortened lifespan , illustrating the close interdependence of chip - mediated insr degradation and longevity regulation . \n in contrast to the reduced lifespan caused by chn-1 or dchip depletion , overexpression did not enhance longevity of worms and was even toxic in flies ( figures s2a2d ; table s1 ) . \n chip is known to modulate the proteotoxic stress response by activating the transcription factor hsf-1 ( heat shock factor 1 ) and by reducing the level of hsp70 after heat shock ( dai et al . \n thus , the rather toxic effect of elevated chip level might be caused by non - physiological changes of the chaperone network with deleterious consequences ( yan et al . \n endogenous chn-1 protein amounts also remained unchanged during aging or in response to proteotoxicity ( figures 2a and s5d ) . \n chn-1-dependent daf-2 turnover was also not affected by dietary interventions ( figure s6a ) . \n these observations suggest an intricately balanced regulation of chn-1/chip activity to avoid excessive rerouting of chaperone substrates toward degradation . \n irrespective of organismal changes , however , overexpression of chip directly affected insr protein levels and compensated the stress - induced stabilization of the receptor in human cells ( figures 4b and 6f ) . \n chn-1(by155 ) mutants were sensitive to heat stress , oxidative stress , and protein aggregation , similar to what we observed upon inactivation of chip ( figures 6c , 6d , 6 g , s5c , and s5f ) . \n moreover , these proteotoxic conditions also caused elevated daf-2/insr levels ( figures 6a , 6e , 6f , 6i , s5e , and s5 g ) . \n given these findings , it is intriguing to speculate that chip integrates proteolysis of damaged proteins with insr degradation to control metabolism and longevity ( figure 7 ) . \n accumulation of damaged proteins upon proteotoxic conditions and during aging challenges the dynamic equilibrium of quality - control networks and shuttles chip into pqc pathways to degrade damaged proteins , causing stabilization of the functional insr and consequently lifespan reduction ( figure 7 ) . from the organismal perspective \n , the prioritization of proteome stability is highly beneficial and ensures reproduction early in life , but this is provided at the expense of aging . \n chn-1 activity seems to be most important later in life ( figures 2a , 2b , 6a6c , 6 g , s5a , and s5b ) , suggesting that other recently identified quality - control ubiquitin ligases might help to maintain proteostasis during development ( fang et al . \n , 2014 , heck et al . , 2010 ) . like c. elegans and drosophila , \n chip - deficient mice develop normally but exhibit reduced lifespan associated with age - related pathophysiological defects ( min et al . , \n 2008 ) . with regard to the conserved regulation , it is intriguing that mutations in the orthologous human gene stub1 are linked to accelerated aging ( heimdal et al . , 2014 ) . \n given the importance of insulin signaling for metabolic regulation , it is also interesting that liver cells of chip - null mutant mice develop insulin resistance ( kim et al . , 2016 ) . \n moreover , a single point mutation in k1095e , a lysine residue in the human insr that we identified to be ubiquitylated , is also associated with severe insulin resistance of patients suffering from diabetes ( ardon et al . , 2014 , orahilly et al . , 1991 ) . \n these strong functional similarities suggest an evolutionarily conserved coordination of proteostasis and aging regulated by chip - assisted degradation . \n a detailed understanding of how insr degradation is adjusted to metabolic insults might lead to efficient therapies for age - related diseases , including obesity and diabetes . \n reagent or resourcesourceidentifierantibodiesmouse monoclonal anti - hisqiagencat # 34660rabbit polyclonal anti - daf-2this studyn / arabbit polyclonal anti - chn-1this studyn / amouse monoclonal anti - flagsigma - aldrichcat # f3165 ; rrid : ab_259529rabbit anti - unc-45gazda et al . \n , 2013n / amouse monoclonal anti - alpha tubulin ( clone dm 1a)sigma - aldrichcat # t9026 ; rrid : ab_477593mouse monoclonal anti - alpha tubulin ( clone b-5 - 1 - 2)sigma - aldrichcat # t6074 ; rrid : ab_477582peroxidase - conjugated affinipure goat anti - mouse igg+igmjackson immuno researchcat # 115 - 035 - 003 ; rrid : ab_10015289peroxidase - conjugated affinipure mouse anti - rabbit igg+igmjackson immuno researchcat # 211 - 035 - 109 ; rrid : ab_2339150donkey anti - rabbit irdye 800cw/680li - corcat # 926 - 32223 ; rrid : ab_621845donkey anti - mouse irdye 800cw/680li - corcat # 926 - 32212 ; rrid : ab_621847mouse monoclonal anti - actinabcamcat # ab8224 ; rrid : ab_449644rabbit polyclonal anti - aktcell signalingcat # 9272 ; rrid : ab_329827rabbit monoclonal anti - phospho akt ( ser473)cell signalingcat # 4060s ; rrid : ab_2315049rabbit polyclonal anti - phospho drosophila akt ( ser505)cell signalingcat # 4054s ; rrid : ab_331414rabbit monoclonal anti - atg7novus biologicalscat # nbp1 - 95872 ; rrid : ab_11011190rabbit polyclonal anti - chicken iggsigma - aldrichcat # c2288 ; rrid : ab_258791rabbit polyclonal anit - chipmiliporecat # pc711 ; rrid : ab_2198058rat monoclonal anti - gfpchromotekcat # 3h9 , abin398304 ; rrid : ab_10773374mouse monoclonal anti - histidine - tagseroteccat # mca1396 ; rrid : ab_322084rat monoclonal anti - hsp90abcamcat # ab13494 ; rrid : ab_300398rabbit polyclonal anti - lc3bnovus biologicalscat # nb100 - 2220 ; rrid : ab_10003146mouse monoclonal anti - p62santa cruzcat # sc-28359 ; rrid : ab_628279rabbit anti - pdk1cell signalingcat # 3062 ; rrid : ab_2236832rabbit polyclonal anti - mtorabcamcat # ab45989 ; rrid : ab_944296rabbit monoclonal anti - igf1rcell signalingcat # 9750s ; rrid : ab_10950969rabbit polyclonal anti - insrsanta cruz biotechnologycat # sc-711 ; rrid : ab_631835goat polyclonal anti - gamma tubulinsanta cruz biotechnologycat # sc-7396 ; rrid : ab_2211262rabbit polyclonal anti - stub1 ( chip)abcamcat # 69451 ; rrid : ab_2198071rabbit polyclonal anti - dinsrthis studyn / abacterial and virus strainsbl21-codonplus ( de3)-rilnew england biolabscat # c2530hop50cgcn / aht115cgcn / achemicals , peptides , and recombinant proteinscompletetablets edta freesigma - aldrichcat # 4693132001ubch5bboston biochemcat # e2 - 622flag::ubiquitinboston biochemcat # u-120e1 activating enzymeenzo life sciencescat # bml - uw9410 - 0050ubiquitin conjugation reaction bufferenzo life sciencescat # bml - kw9885 - 0001atp regeneration solutionenzo life sciencescat # bml - ew9810 - 0100ubiquitinsigma - aldrichcat # u6253ubk0boston biochemcat # um - nokflag m2 affinity gelsigma - aldrichcat # a22203x flag peptidesigma - aldrichcat # f4799bafilomycin a1lc - labscat # b1080chloroquine diphosphate saltsigma - aldrichcat # c6628dynamin inhibitor v-34 - 2calbiochemcat # 324414methylviologen dichloride hydratesigma - aldrichcat # 856177-cas75365 - 73 - 0mg132peptanovacat # 3175-vl - canavaninesigma - aldrichcat # c1625paraquat dichloride hydratesigma - aldrichcat # 36541ru486 ( mifepristone)sigma - aldrichcat # m8046vsv::chn-1::6histhis studyn / avsv::chn-1 h218q::6histhis studyn / avsv::chn-1 u - box::6histhis studyn / avsv : chn-1 n9d , k13a , k73a::6histhis studyn / aufd-2::6histhis studyn / a6his::daf-2 c terminus ( aa 1205 - 1928)this studyn / awwp-1::6histhis \n , 2005n / ainsr full lengththis studyn / ainsr k1047rthis studyn / adinsr ( aa 1815 - 2144)this studyn / ainsr c terminus ( aa 987 - 1428)this studyn / atrizolinvitrogencat # 15596026critical commercial assaysecl kitge healthcarecat # rpn2232quickchange lightning site - directed mutagenesis kitagilent technologiescat # 210519invitrap spin universal rna mini kitstrateccat # 1060100300jetprime transfection reagentpeqlabcat # 114 - 75high - capacity cdna reverse transcription kitapplied biosystemscat # 4368814brilliant iii ultra - fast sybr green qpcr master mixagilent technologiescat \n # 600882sso fast evagreen supermixbio - radcat # 1725201iscript cdna synthesis kitbio - radcat # 1708891rneasy mini kitqiagencat # 74104experimental models : cell lineshek293 ( human embryonic kidney cells)sigma - aldrichcat # 85120602hela ( epitheloid cervix carcinoma cells ( female))sigma - aldrichcat # 93021013experimental models : organisms / strainsc . \n elegans : daf-16(m26)icgcwormbase i d : wbvar00088538c . elegans : ufd-2(tm1380)iicgcwormbase i d : wbvar00250374c . \n elegans : dgex80[pams66 vha-6p::q44::yfp + rol-6(su1006)]mohri - shiomi and garsin , 2008n / ac . \n melanogaster : uas - dchipverena arndtn / aoligonucleotidessee table s3 for primer sequencesthis studyn / asirna human chip 5qiagencat # si00081963sirna human chip 5qiagencat # si03109659sirna human atg7 1qiagencat # si04194883sirna human atg7 3qiagencat # si04231360allstars negative control sirnaqiagencat # si03650318recombinant dnapet21a - vsv::chn-1::6histhis studyn / apet21a- vsv::chn-1 h218q::6histhis studyn / apet21a- vsv::chn-1 u - box::6histhis studyn / apet21a- vsv : chn-1 n9d , k13a , k73a::6histhis studyn / apet21a - ufd-2::6histhis studyn / apt7 - 6his::daf-2 c terminus ( aa 1205 - 1928)this studyn / apet21a \n , 2005n / apcmv - tag2b - insr full lengththis studyn / apcmv - tag2b - insr k1047rthis studyn / apetm-11-dinsr ( aa 1815 - 2144)this studyn / apmal - c2-insr c terminus ( aa 987 - 1428)this studyn / apegfp - polyq-25westhoff et al . , \n , 2005n / asoftware and algorithmsgraphpad prism 5graphpad softwarehttps://www.graphpad.com / scientific - software / prism / image studio 4.0li - cor bioscienceshttps://www.licor.com / bio / products / software / image_studio / excel 2013microsofthttps://products.office.com / en - us / excelxlstatxlstathttps://www.xlstat.com / en / imagej 1.48vwayne rasband ( nih)https://imagej.nih.gov / ij/ further information and requests for reagents may be directed to and will be fulfilled by thorsten hoppe ( thorsten.hoppe@uni-koeln.de ) . \n the following strains were used in this study : bristol ( n2 ) strain as wild - type ( wt ) strain , chn-1(by155)i , chn-1(tm2692)i , daf-16(mgdf47)i , daf-16(mu86)i , daf-16(m26)i , ufd-2(tm1380)ii , eat-2(ad465)ii , daf-2(e1368)iii , daf-2(e1370)iii , daf-2(m212)iii , daf-2(m596)iii , daf-2(m579)iii , daf-2(sa193)iii , daf-2(e979)iii , daf-2(e1391)iii , daf-2(m577)iii , daf-2(gk390525)iii , unc-119(ed4)iii , zis356[daf-16p::daf-16::gfp ] , dgex80[pams66 vha-6p::q44::yfp + rol-6(su1006 ) ] , rmis133[unc- 54p::q40::yfp ] . unless otherwise stated mutant strains were at least six times outcrossed against the wild - type strain to provide isogenic conditions . \n nematodes were grown at 20c ( unless otherwise stated ) on nematode growth medium ( ngm ) agar plates seeded with escherichia coli op50 spread over the surface as a food source ( brenner , 1974 ) . \n transgenic animals expressing the chn-1p::chn-1::flag were constructed by pcr amplification ( table s3 ) of the wild - type genomic dna ( 567 bp chn-1 promoter and 2783 bp chn-1 genomic dna ) and the unc-54 3utr ( 877 bp ) and cloned into the pbsk vector containing the unc-119(+ ) marker for selection of transgenic worms . \n flag tag was fused to the c terminus of the gene by using the quikchange lightning site - directed mutagenesis kit ( agilent technologies ) ( table s3 ) . \n deletion of the u - box domain , mutation of the u - box ( h218q ) , or tpr ( n9d , k13a , k73a ) domain was introduced by quikchange lightning site - directed mutagenesis kit ( table s3 ) . \n the constructs were particle bombarded into unc-119(ed4)iii mutants as described previously ( praitis et al . , 2001 ) . \n unc-119(ed4 ) hermaphrodites was carried out using a biorad biolistic pds-1000/he with 1/4gap distance , 9 mm macrocarrier to screen distance , 28 inches of hg vacuum , and 1350 p.s.i . rupture disc . for each bombardment , \n 1 l of 12 g/l plasmid dna was coupled to 0.6 mg of 1.0-m microcarrier gold beads , and bombarded onto a monolayer of 10,000 unc-119(ed4 ) l4 and adult hermaphrodites ( a-70 - 80 l pellet ) placed on 90-mm ngm plates . \n worms were allowed to recover for 1 hr after bombardment and were then transferred onto ten 90-mm ngm plates seeded with op50 e. coli and grown at 20c . because unc-119 mutants can not form dauers , they die in the absence of food ( maduro and pilgrim , 1995 ) , making it easy to identify the non - unc rescued transformants 14 days after bombardment . from each plate containing animals rescued for the unc-119(ed4 ) mutation , \n individual transformed animals were cloned and their f1 progeny scored for presence of unc-119(ed4 ) mutants . \n homozygous stable lines were identified by the complete absence of unc-119(ed4)iii mutant progeny over several generations . \n heterozygous lines were identified based on the presence of three distinct classes of progeny : heterozygous transformed animals , homozygous untransformed animals , and a third class of sterile or inviable animals . to ensure that each line was the result of an independent transformation event , we retained only one transformed line from each ngm plate . \n transgenic strains generated in this study are as following : unc-119(ed4)iii ; hhis136[unc-119(+ ) , chn-1p::chn-1::flag ] , unc-119(ed4)iii ; hhis145[unc-119(+ ) ; chn-1p::chn-1(u - box)::flag ] . \n the following strains were used in this study : w were used as wild - type flies , dchip - rnai ( vdrc stock number 10538 ) , actin - gal4 ( # bl-3954 , bloomington stock center ) , uas - dchip ( kindly provided by verena arndt , university of bonn ) , tigs-2 ( kindly provided by scott pletscher , university of michigan ) . \n flies were maintained on standard drosophila jazz - mix instant food ( fisher scientific ) at 25c and 65% humidity in a 12 hr light/ 12 hr dark incubator . \n control flies are of the genotype actin - gal4/w . for overexpression of dchip in adult midguts uas - dchip flies \n expression of dchip was induced by placing flies of the same genetic background on ru486-containing ( induced ) or ethanol - containing ( non - induced ) food . for food preparation , \n a 25 mg / ml stock solution of ru486 ( mifepristone , sigma ) was made in 100% ethanol . \n appropriate volumes of the 25 mg / ml ru486 stock solution were diluted with water and ethanol to a final ethanol concentration of 2% to avoid ru486 precipitation . \n 500 l of the diluted solution with the desired concentration of ru486 was added onto the surface of standard fly food . \n the vials were then allowed to dry at room temperature for 2436 hr depending on the ambient humidity . for paraquat or canavanine food \n the indicated concentration was solved in 1 ml water and applied onto the surface of standard fly food and further processed as mentioned above . \n hek293 cells were cultured at 37c under 5% co2 in dulbecco s modified eagle s medium ( dmem ) supplemented with 10% fetal bovine serum , l - glutamine , penicillin / streptomycin ( ps ) , sodium pyruvate and non - essential amino acids ( neaa ) . hela cells were cultured at 37c under 5% co2 in dulbecco s modified eagles s medium ( dmem ) supplemented with 10% fetal bovine serum and penicillin / streptomycin ( ps ) . in lifespan assays , first day of adulthood was defined as day 1 . from day 0 on , synchronized worm populations ( 50 worms per plate for a total of 200 individuals per experiment ) were transferred daily to fresh ngm plates seeded with op50 e. coli until egg laying ceased . for rnai based lifespan assays \n 50 synchronized l1 stage worms were fed with op50 e. coli or with gene - specific rnai expressing ht115 e. coli bacteria . \n worms were examined every day for touch - provoked movement and pharyngeal pumping , until death . \n animals that crawled off the plates or died owing to internal hatching of progeny or extruded organs were censored . for lifespan measurement in d. melanogaster , \n male flies were collected within 24 hr from eclosion and maintained at standard density ( up to 30 flies per vial ) on drosophila jazz - mix instant food or in case of induced expression on either ru486-containing ( induced ) or ethanol - containing ( non - induced ) food . \n for each genotype , at least 5 independent cohorts of flies raised at different times from at least 5 independent crosses were analyzed . \n the experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment . \n rnai in c. elegans was performed using the rnai feeding method ( timmons and fire , 1998 ) . \n l1 or l4 larvae of wild - type worms were placed on ht115 e. coli bacteria expressing daf-2 or daf-16-specific double - stranded rna ( dsrna ) . as wild - type control , \n bacteria transformed with the empty ppd129.36 vector were used as food source . for developmental or post - developmental silencing of chn-1 \n rnai in flies was induced by binary uas - gal4 system ( brand and perrimon , 1993 ) . \n relative body length of worms was measured by taking images of worms with a leica m165fc stereomicroscope ( 10x eye piece , 0.75 - 6.0 zoom ratio ) using 50 x magnification . \n images were transformed to jpeg format and body length of worms was determined by drawing a line on the longitudinal axis of each worm in imagej 1.48v software . \n relative values of body length was calculated by using the mean body length value of at least 20 single worms of each genotype and normalizing these values against wt worms mean body length . \n individual day-1 adult worm was placed in 50 l m9 buffer on a microscope slide and the number of left and rightward body bends in 30 s were counted , where one leftward and one rightward bend is equal to one stroke . \n 100 day-1 old adult worms were transferred to small plates ( 35x10 mm ) seeded with op50 and subjected to 35c heat shock for indicated time in water bath and immediately visualized using zeiss axio zoom.v16 microscope . \n worms were classified into two categories based on the extent of daf-16::gfp nuclear - cytoplasmic distribution . \n fluorescence and dic images of worms were taken with an axio imager z1 microscope mounted with axiocam 503 mono camera ( carl zeiss ) , and processed with the analysis software zen 2012 sp1 ( carl zeiss ) . \n hela cells were transfected with pcmv - tag2b - chip and pegfp - polyq-25 or pegfp - polyq-103 for 48 hr . \n cells were then washed two times with pbs , followed by fixation in 4% paraformaldehyde for 15 min . \n after another washing step , cells were permeabilized for 10 min in pbs containing 0.2% triton-100 . \n cells were blocked in 3% bovine serum albumin for 30 min and afterward washed 3 times in pbs . \n alexa - labeled secondary antibodies ( invitrogen ) were used in a 1500 dilution for 1 hr . \n worms were washed off the plates using m9 buffer and 1 ml trizol , and silica beads ( 1 mm diameter ) were added to the samples and homogenized by precellys tissue homogenizer . \n chloroform was added and samples were vortexed vigorously before phase separation through centrifugation . the aqueous phase was transferred on the qiagen rneasy mini kit and rna was isolated according to manufacturer s instructions . \n cdna was synthesized using the high - capacity cdna reverse transcription kit ( applied biosystems ) . \n gene expression levels were determined by real - time pcr using brilliant iii ultra - fast sybr green qpcr master mix ( agilent technologies ) and biorad cfx96 real - time pcr detection system . \n relative gene expressions were normalized to act-3 ( t04c12.4 ) and tbg-1 ( f58a4.8 ) . mrna levels . \n rnai isolation from hek293 cells was performed by the use of invitrap spin universal rna mini kit ( stratec ) . \n cdna was synthesized from 0.5 g rna using iscript cdna synthesis kit from bio - rad . quantitative pcr ( qpcr ) \n was performed using ssofast evagreen supermix ( bio - rad ) with transcript levels for gapdh and beta-2-microglobulin ( b2 m ) being monitored as reference transcripts . \n the specificity of the pcr amplification was verified by melting curve analysis of the final products using bio - rad cfx 3.1 software . in each experiment three \n the primer sequences used in the rt pcr reactions are shown in table s3 . \n co - immunoprecipitations were performed on sonicated lysates from wild - type or mutant c. elegans that were resuspended in ip buffer [ 50 mm tris ph 8.0 , 100 mm nacl , 0.5 mm edta , 4% glycerol and 1% triton x-100 , 2 mm pmsf and complete edta - free protease inhibitor ( roche ) ] . \n for immunoprecipitation of chn-1::flag we used anti - flag m2 affinity gel ( sigma ) incubated with 1 mg of worm extract for 2 hr at room temperature . \n the immunoprecipitates were washed with 50 mm tris ph 8.0 , 50 mm nacl , eluted with 3x flag peptide ( sigma ) and resolved by sds - page followed by immunoblotting . to prepare drosophila protein extracts , 10 male flies per genotype were shock frozen in liquid nitrogen and grinded with a pestle until white powder remained . \n 200 l of ripa buffer [ 25 mm tris - hcl , ph 8.0 , 150 mm nacl , 0.5% sodium deoxycholate , 1% nonidet p-40 , 0.1% sds , 10% glycerol , complete edta - free protease inhibitor ( roche ) ] was added and lysates were incubated for 15 min on ice . \n afterward lysates were centrifuged at 16,000 g for 30 min at 4c . \n protein concentration of supernatant was measured by bradford protein assay ( bio - rad ) and 40 g protein per genotype were analyzed by sds - page and immunoblotting . for gut preparation and evaluation of akt signaling , dchip depleted flies and control flies were aged for 5 weeks respectively and 20 guts per genotype were collected in icecold pbs buffer . \n pbs buffer was removed and guts were resuspended in 50 l ripa for proper lysis . \n guts were grinded with a pestle until a homogeneous solution remained and immediately sonicated 3 20 s at 100% amplitude . \n gut lysates were incubated for 15 min on ice and afterward centrifuged at 8,000 g for 20 min at 4c . \n supernatants were collected and protein concentrations were measured by bradford protein assay ( bio - rad ) . 30 g protein per genotype was analyzed by sds - page and immunoblotting . for monitoring dinsr protein level in paraquat and canavanine treated adult flies ( 3 weeks old ) , \n 20 heads each were collected in 60 l ripa buffer and prepared as described above . for differential \n centrifugation dchip depleted flies and control flies were aged for 5 weeks and 20 heads per genotype were lysed in 200 l ripa buffer containing 1% sds , followed by centrifugation at 3,000 g for 5 min to discard tissue debris . \n the supernatant was subjected to centrifugation at 100,000 g for 1 hr at 4c to separate soluble and insoluble protein fractions . \n the sds - insoluble pellet fraction was resuspended in 100 mm tris , ph 8 , 8 m urea , sonicated three times for 20 s at 100% amplitude , and afterward boiled at 97c for 10 min . to prepare human cell extracts \n hek293 cells were lysed 48h after transfection in ripa and incubated for 5 min on ice . \n lysates were sonicated and after additional 15 min incubation on ice lysates were centrifuged at 16,000 g for 20 min at 4c . \n supernatants were collected , protein concentration was measured by bradford protein assay ( bio - rad ) and samples were analyzed by sds - page ( 40 g protein loaded per lane ) and immunoblotting using specific antibodies . \n if not indicated otherwise , cells were treated with 10 m mg132 ( peptanova ) , 200 nm bafilomycin a1 ( lc - labs ) , 100 m chloroquine ( sigma - aldrich ) , or 10 m dynamin inhibitor v34 - 2 ( calbiochem ) for 16 hr before lysis . \n paraquat ( sigma - aldrich ) treatment ( 20 mm ) was done for 20 hr . \n for immunoprecipitation of insr , hek293 cells were lysed in ripa buffer without sds . after 20 min of incubation on ice , \n the lysate was sonicated and centrifuged at 16,000 g for 20 min at 4c . \n supernatant was then adjusted to a protein concentration of 10 mg / ml using mops / kcl buffer [ 20 mm mops - koh , ph 7.2 , 100 mm kcl , complete edta - free protease inhibitor ( roche ) ] at a ratio 1:1 with ripa buffer . \n antibodies directed against insr or control antibody ( rabbit anti - chicken igg , sigma ) were added to a final concentration of 4 g / ml extract and incubated for 1 hr at 4c . \n 20 l protein g - sepharose was added and samples were incubated for an additional 1 hr at 4c . \n sepharose was washed six times with washing buffer ( 20 mm mops - koh , ph 7.2 , 100 mm kcl , 0.5% tween ) and 2 times with washing buffer without tween . \n sepharose - bound proteins were eluted using 0.1 m glycine - hcl , ph 3.5 , precipitated with 10% tca ( trichloroacetic acid ) and resolved in sds sample buffer . \n co - immunoprecipitated proteins were analyzed by sds - page and immunoblotting . hek293 or hela cells were seeded at approximately 30%40% confluency and transfected 24 hr after plating . \n after incubation over - night , cell medium was removed and fresh medium was added to the cells . \n 48 hr after transfection cells were lysed either for protein extraction or rna purification . for expression of wild - type insr in hek293 cells prt3-insr - wt ( addgene ) was used as template for cloning full - length cdna of human insr into pcmv - tag2b vector ( clonetech ) ( table s3 ) . \n the k1047r mutation was introduced into pcmv - tag2b - insr by site - directed mutagenesis ( table s3 ) . \n for overexpression of chip pcmv - tag2b - chip vector was used ( arndt et al . , 2005 ) . \n expression of poly - q proteins was induced by transient transfection with plasmids pegfp - polyq-25 and pegfp - polyq-103 ( westhoff et al . , 2005 ) . \n for efficient depletion two different sirnas were used per gene ( flexitube sirnas chip 1 + 5 and flexitube sirnas atg7 1 + 3 ( qiagen ) ) . \n 10 g of purified recombinant protein : his::chip , his::chn-1 , his::chn-1(u - box ) , his::chn-1(u - box ) , his::(tpr)chn-1 , wwp-1::his or ufd-2::his was mixed with 1 g of recombinant protein corresponding to the c terminus of human insr ( amino acids 987 - 1428 ) , dinsr ( amino acids 1815 - 2144 ) or daf-2 ( amino acids 1205 - 1928 ) , and e1 ( 25 ng ) , e2 ( ubch5b ; 400 ng ) , 2 g of flag::ubiquitin or lysine lacking variant ( ub ) , energy regenerating solution ( boston biochem ) and ubiquitin conjugation reaction buffer ( enzo life sciences ) . \n samples were incubated at 30c for 1 hr , terminated by boiling for 5 min with sds - sample buffer , and resolved by sds - page followed by immunoblotting using anti - insulin r antibody ( santa cruz ) to monitor ubiquitylation of insr , anti - daf-2 antibody to monitor ubiquitylation of daf-2 , and anti - flag antibody ( sigma ) to monitor e3 ligase activity . for oxidative stress assay , \n survival of worms was monitored every day after transfer and scored as described for the lifespan assays . in heat shock experiments day 1 adult worms were transferred on chn-1 dsrna expressing or control empty vector expressing ht115 bacteria seeded plates and incubated at 35c in water bath for the indicated time . \n survival of worms was scored as described for the lifespan assays . for ubiquitous dchip depletion rnai flies \n were crossed to actin - gal4 driver line and collected after 2 days of adulthood and placed on 20 mm paraquat ( methylviologen ( sigma - aldrich ) ) containing food . \n wild - type flies were collected after 2 days of adulthood and placed on either h2o or 20 mm l - canavanine ( sigma - aldrich ) containing food to induce protein misfolding . \n kaplan and meier survival curves of the lifespan analysis and median lifespan values were calculated using graphpad prism 5 software and xlstat for excel . the log - rank ( mantel cox ) \n data obtained for changes in protein level are presented as fold change compared to the control with the control value determined in each independent experiment set to 1 . \n statistical significance was assessed by two - tailed paired student s t test using excel software ( microsoft ) . \n stress resistance assays and polyq - aggregation assays were evaluated by two - tailed paired student s t test . \n r.t . , w.p . , and e.k . designed , performed , and analyzed the experiments \n w.p . performed in vitro ubiquitylation assays , mass spectrometric analyses , and most final experiments for the revisions .", "role": "user" }, { "content": "summaryaging is attended by a progressive decline in protein homeostasis ( proteostasis ) , aggravating the risk for protein aggregation diseases . to understand the coordination between proteome imbalance and longevity , we addressed the mechanistic role of the quality - control ubiquitin ligase chip , which is a key regulator of proteostasis . \n we observed that chip deficiency leads to increased levels of the insulin receptor ( insr ) and reduced lifespan of worms and flies . \n the membrane - bound insr regulates the insulin and igf1 signaling ( iis ) pathway and thereby defines metabolism and aging . \n insr is a direct target of chip , which triggers receptor monoubiquitylation and endocytic - lysosomal turnover to promote longevity . \n however , upon proteotoxic stress conditions and during aging , chip is recruited toward disposal of misfolded proteins , reducing its capacity to degrade the insr . \n our study indicates a competitive relationship between proteostasis and longevity regulation through chip - assisted proteolysis , providing a mechanistic concept for understanding the impact of proteome imbalance on aging .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: there are many reasons why researchers choose to publish the results of their research but one of the most important is to contribute to the advancement of medicine and science . \n when research involves human subjects , sharing results is more than a personal choice , it is an ethical obligation ( 1 ) . \n publishing results ensures that patient care is based on good science and that the field of medicine advances according to accurate knowledge . \n it is also part of the commitment researchers make to research subjects . according to prominent bioethicists \n , the risks of clinical research are only justified if society gains knowledge , which is only possible when results are shared ( 2 ) . \n although these principles are widely accepted , a substantial amount of human research continues to go unreported and unpublished . \n this article explores researchers ' ethical obligation to report the results of research involving human subjects and discusses current challenges and solutions . \n an important starting point for this discussion is a brief review of the declaration of helsinki . \n the declaration of helsinki is a set of international ethical principles regarding the conduct of human research . \n it was initially published in 1964 and has been amended 7 times , the most recent revision occurring in 2013 ( 3 ) . \n it is a cornerstone document in the field of human research ethics and has been referred to as \" the most widely accepted guidance worldwide on medical research involving human participants\"(4 ) . \n many medical journals , including the journal of korean medical science , refer to the declaration in their requirements for publication ( 5 , 6 ) . \n the declaration includes a section on the ethical requirement of registering , publishing and disseminating research results ( 1 ) . \n the section addresses two main requirements : 1 ) that research involving human subjects must be registered in a publicly accessible database and 2 ) that there is an ethical obligation regarding publication and dissemination of research results . \n the declaration specifically states that , \" researchers , authors , sponsors , editors and publishers all have ethical obligations with regard to the publication and dissemination of the results of research \" ( 1 ) . \n it goes on to clarify that negative , inconclusive and positive results all must be published or made publicly available ( 1 ) . \n although publication of research results is a widely accepted component of ethical research , in actual practice it is often neglected or substantially delayed ( 7 ) . \n for example , one study found that only 46% of us nih - funded trials were published in a peer - reviewed , medline - indexed journal within 30 months of completion ( 8) . a similar finding was discovered of vaccine trials conducted in multiple countries . \n ( 9 ) found that \" the proportion of trials published 12 , 24 , 36 , and 48 months after completion was 12% , 29% , 53% , and 73% , respectively \" ( 9 ) . \n similarly , a study at a university in germany found that only half of the studies approved by the ethics committee at the institution resulted in subsequent publication ( 10 ) . \n non - publication of results wastes resources and denies the field of medicine the opportunity to learn from the outcomes . \n multiple studies have found that trials with negative results are published significantly less often and significantly less quickly than trials with positive results ( 11 , 12 ) . \n an analysis in the field of psychiatry compared published literature against us fda reviews of research involving antidepressant agents . \n based on the published literature it appeared that 94% of studies were positive but the fda analysis indicated that only 51% were positive ( 13 ) . \n this discrepancy was because most of the negative results were not published or were published in a way that conveyed a positive outcome . \n the authors of the analysis concluded that the actual efficacy of the antidepressant drug class is less than would be expected based on published literature alone ( 13 ) . \n for example , one study conducted at a hospital in spain followed the publication outcomes of all drug - evaluating clinical trials approved by the ethics committee of the institution . \n the study found that trials with positive results were published significantly more often and significantly more quickly than trials with negative results ( 11 ) . \n additionally , a study that included manuscripts from multiple countries , including the republic of korea , found that the number of articles reporting positive results increased by over 20% during the years of 1990 through 2007 and that corresponding authors in asian countries reported more positive results than those in the us and europe ( 14 ) . \n the higher publication of positive results is a responsibility not only to researchers or authors but also to editors and reviewers . \n some editors and reviewers devalue negative results or inconclusive findings and automatically reject the manuscript . since human subject studies frequently produce negative or inconclusive results , the negative attitude of some editors and reviewers may be a barrier to publication . \n the icmje recommends that editors make editorial decisions based on factors such as the manuscript 's overall quality and relevance to the journal , and not on the conclusiveness of the results ( 15 ) . \n the international committee of medical journal editors ( icmje ) reminds editors that negative and inconclusive results can make an important contribution to science and that findings that are not statistically significant may provide important data for a subsequent meta - analysis ( 15 ) . \n the declaration of helsinki and the icmje both require registration of clinical trials in a publicly accessible database before patient enrollment ( 1 , 16 ) . \n this means that all journals that follow icmje guidance , including jkms , only publish manuscripts on trials that were properly registered . \n clinical trial registration is important because it improves transparency , helps to reduce research duplication , contributes to the scientific evidence base and circumvents the issues of publication bias and selective reporting ( 17 ) . \n studies suggest that data in registries may also be more complete than what is published in medical literature . \n for example , the us registry [ clinicaltrials.gov ] requires results reporting and one study found that the results in the registry , especially serious adverse events , were more complete than the results in published articles ( 18 ) . \n however , the strength of registries depends on researchers ' submission of timely and accurate data and evidence suggests that concerning gaps still exist ( 19 ) . \n although publication of research results is a widely accepted component of ethical research , in actual practice it is often neglected or substantially delayed ( 7 ) . \n for example , one study found that only 46% of us nih - funded trials were published in a peer - reviewed , medline - indexed journal within 30 months of completion ( 8) . a similar finding was discovered of vaccine trials conducted in multiple countries . \n ( 9 ) found that \" the proportion of trials published 12 , 24 , 36 , and 48 months after completion was 12% , 29% , 53% , and 73% , respectively \" ( 9 ) . \n similarly , a study at a university in germany found that only half of the studies approved by the ethics committee at the institution resulted in subsequent publication ( 10 ) . \n non - publication of results wastes resources and denies the field of medicine the opportunity to learn from the outcomes . \n multiple studies have found that trials with negative results are published significantly less often and significantly less quickly than trials with positive results ( 11 , 12 ) . \n an analysis in the field of psychiatry compared published literature against us fda reviews of research involving antidepressant agents . \n based on the published literature it appeared that 94% of studies were positive but the fda analysis indicated that only 51% were positive ( 13 ) . \n this discrepancy was because most of the negative results were not published or were published in a way that conveyed a positive outcome . \n the authors of the analysis concluded that the actual efficacy of the antidepressant drug class is less than would be expected based on published literature alone ( 13 ) . \n for example , one study conducted at a hospital in spain followed the publication outcomes of all drug - evaluating clinical trials approved by the ethics committee of the institution . \n the study found that trials with positive results were published significantly more often and significantly more quickly than trials with negative results ( 11 ) . \n additionally , a study that included manuscripts from multiple countries , including the republic of korea , found that the number of articles reporting positive results increased by over 20% during the years of 1990 through 2007 and that corresponding authors in asian countries reported more positive results than those in the us and europe ( 14 ) . \n the higher publication of positive results is a responsibility not only to researchers or authors but also to editors and reviewers . \n some editors and reviewers devalue negative results or inconclusive findings and automatically reject the manuscript . since human subject studies frequently produce negative or inconclusive results , the negative attitude of some editors and reviewers may be a barrier to publication . \n the icmje recommends that editors make editorial decisions based on factors such as the manuscript 's overall quality and relevance to the journal , and not on the conclusiveness of the results ( 15 ) . \n the international committee of medical journal editors ( icmje ) reminds editors that negative and inconclusive results can make an important contribution to science and that findings that are not statistically significant may provide important data for a subsequent meta - analysis ( 15 ) . \n the declaration of helsinki and the icmje both require registration of clinical trials in a publicly accessible database before patient enrollment ( 1 , 16 ) . \n this means that all journals that follow icmje guidance , including jkms , only publish manuscripts on trials that were properly registered . \n clinical trial registration is important because it improves transparency , helps to reduce research duplication , contributes to the scientific evidence base and circumvents the issues of publication bias and selective reporting ( 17 ) . \n studies suggest that data in registries may also be more complete than what is published in medical literature . \n for example , the us registry [ clinicaltrials.gov ] requires results reporting and one study found that the results in the registry , especially serious adverse events , were more complete than the results in published articles ( 18 ) . \n however , the strength of registries depends on researchers ' submission of timely and accurate data and evidence suggests that concerning gaps still exist ( 19 ) . \n researchers in korea should remain committed to publishing the results of all human research they conduct . \n jkms is an ideal choice for publishing because it is committed to publishing high - quality research regardless if the results are positive , negative , or inconclusive . \n other journals also provide good publication options for manuscripts that may otherwise be hard to publish . \n for example , several journals have launched sections focused on publishing negative results and a few journals exclusively publish negative or inconclusive results ( 20,21,22,23 ) . \n this is not only a sound decision from an ethical and scientific standpoint , but may also benefit both the author and the publisher . \n one of the aforementioned studies determined that even though positive results were published more often and more quickly than negative results , the impact factor between the two groups was not significantly different ( 11 ) . \n researchers in korea should also abide by all trial registration requirements that govern the research they conduct . \n the online registration system for clinical trials conducted in the republic of korea is the clinical research information service ( cris ) . \n cris is a primary register of the who international clinical trials registry platform ( ictrp ) and was established at the korea centers for disease control and prevention ( kcdc ) with support from the ministry of health and welfare ( mohw ) ( 24 ) . \n however , the reporting requirements may be updated in the future based on the who 's current evaluation of ictrp 's policy on results reporting ( 25 ) . \n all individuals involved in conducting or publishing human research have an ethical obligation to disseminate results regardless of the conclusiveness . to meet this commitment , researchers should register their trials in a publicly accessible database and disseminate their findings through publication or other public mechanisms . \n editors and reviewers should make editorial decisions based on manuscripts ' overall quality and relevance to the journal and not the conclusiveness of the results . \n editors should also only publish papers regarding clinical trials that were properly registered . disseminating research results \n this paper aimed to inform , review current gaps , and discuss solutions regarding this ethical obligation .", "role": "user" }, { "content": "researchers have an ethical responsibility to report the results of research involving human subjects . \n dissemination of results ensures that patient care is based on good science and that the field of medicine advances based on complete and accurate knowledge . \n however , current evidence suggests that publication is often neglected or substantially delayed , especially in the case of negative and inconclusive results . \n researchers , editors and reviewers should value all high - quality research regardless of the conclusiveness of the results and ensure that all research involving human subjects is registered in a publicly accessible database .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: young doctors in south asia are increasingly being exposed to principles of patient - centered communication in their training . \n family doctors are often required to inform patients of a cancer diagnosis and be involved in their terminal care . \n however , there is little evidence on which south asian family doctors can base their decisions with regard to how much information should be given to their patients . \n most literature on communication preferences in medical consultations comes from western studies , which show that not all patients want or expect the same kind of communication . \n several studies now confirm that the pattern of patients differing expectations can vary greatly between different cultural settings , including that of nepal . in western countries \n there is usually a presumption that patients will be told their diagnosis if they are suffering from a serious disease . \n some of the factors contributing to this practice include the rise of consumer rights , an emphasis on patient autonomy , and increasing medical litigation . \n it is also noted that there is great diversity within many of those ethnic groups . in non - western settings , \n there are diverse attitudes found in african , japanese , chinese , hispanic , pakistani , and other asian research . \n as recently as 1984 , oncologists in both western and non - western countries said that their usual practice was to tell the family rather than the patient . \n the reasons for non - disclosure to patients are diverse and are usually linked to cultural beliefs . \n the principle of self - determination is central to western concepts of autonomy and promotes the idea of the independence of the individual . \n east asian ethics refer to autonomy in a way that assumes family determination, as an integral part of decision - making . \n the ideas of harmonious independence and an objective concept of good are part of this concept . \n many western doctors assume that a patient who defers to the advice of their family is acting under undue pressure . \n however , in many cultures family involvement is an integral part of a patient 's decision - making process . \n sick role, in which they are to be protected from potentially harmful information or other stresses \n one comprehensive literature review places the reasons for non - disclosure of a serious diagnosis into four main groups , as listed below . \n it can be thought of as destroying hope for the patientit may provoke depression in the patientit may make a condition more real by verbalizing its existence , therefore , leading to a quicker deathit may be considered as rude or impolite to the patient \n it can be thought of as destroying hope for the patient it may provoke depression in the patient it may make a condition more real by verbalizing its existence , therefore , leading to a quicker death it may be considered as rude or impolite to the patient these concerns are reflected by an iranian study that suggested that patients who did not know their diagnosis had better physical , emotional , and social quality of life . \n the widespread and varied nature of beliefs about disclosure are seen in international studies , which report rates of disclosure of terminal diagnoses from 17 ( japan ) to 80% ( usa ) . \n there is also a big variation in expectations of what doctors should provide , ranging from very technical details to broader emotional support . \n a study done by hospice nepal showed that people in the kathmandu valley favored being told about a serious cancer diagnosis . \n eighty percent of the people surveyed said that they wanted to be told even if the cancer was incurable . \n this contrasted with the level of knowledge that cancer sufferers reported in a concurrent in - patient survey . \n sixty - three percent of the patients reported that they had no knowledge of their cancer diagnosis . \n a study at patan hospital , nepal , showed that people were generally keen to know about their own diagnosis , but were less keen to inform close relatives . \n this study found that 63% of the people would want to be informed if they had a cancer diagnosis . \n thirty - four percent of the people reported that they would want a close relative informed in the same circumstances . \n this diversity of attitudes and beliefs meant that each culture had to be studied separately to know what type of communication strategy was most appropriate . a prescriptive set of guidelines was not appropriate . \n the current study was undertaken to further explore the preferences and beliefs of nepalese people , with regard to information - giving and information - receiving in cancer diagnoses . \n this information was important in guiding the communication training of medical students and junior doctors . \n a cross - sectional , hospital - based survey was carried out at the bp koirala institute of health sciences ( bpkihs ) in nepal . \n the objective of the study was to explore and compare the attitudes of medical students and patients , with regard to the disclosure of a cancer diagnosis . \n the study instrument was a survey that was developed and piloted by the researchers , based on a survey instrument previously used in kathmandu , nepal . \n the subjects were first and fourth year medical students and the patients were those attending the general outpatient department ( gopd ) at the study hospital . \n the survey first asked the subjects about their attitudes toward giving and receiving a cancer diagnosis . \n the subjects were then asked to rate their agreement , on a six - point likert scale , to seven statements , about giving a cancer diagnosis . \n four statements , taken from the literature , were about possible reasons for not telling the patients their diagnosis . \n this was added to confirm the responses in the first section . in the first phase of the study , the survey was given to 126 first year and fourth year mbbs students at bpkihs , in 2009 . \n all students were invited to participate and two declined . in the second phase , the survey was given to patients attending the gopd at bpkihs , in may \n the survey was translated into nepali and back - translated , until a satisfactory version was reached . \n all patients attending the gopd , for any reason , were eligible for inclusion , after giving consent . \n if the patient was under 16 years of age their main caregiver was approached for inclusion . \n the survey was administered as a structured interview , due to the low level of literacy in the population . \n this was done by one of the researchers , a doctor working in the gopd . \n a convenience sample was taken , consisting of all the patients who saw that doctor during his rostered hours . \n there were 126 students surveyed in this study , 93 male ( 73.8% ) and 33 female ( 26.2% ) . \n there were 61 students from the first year and 65 from the fourth year mbbs , analyzed together and separately . \n one hundred patients were surveyed and the demographics are shown below [ table 1 ] . \n patient demographics , n = 100 the responses to the first three questions about giving and receiving a cancer diagnosis are shown below . \n question 1 was only given to students and the results were for the whole student group . \n question 1 . if you were the treating doctor of a patient with cancer , would you tell them of their diagnosis ? \n if a close relative was diagnosed with cancer would you like them to be informed of the diagnosis ? \n if you were diagnosed with cancer would you like to be informed of your diagnosis ? \n student and patient responses to q3 : a personal diagnosis the responses to the seven statements about giving a cancer diagnosis are shown below [ table 2 ] . \n similar items were grouped for comparison , whereas , they were in a mixed order in the survey \n . the likert scale was scored from 1 strongly disagree to 6 strongly agree , 3.5 being the numerical mid - point . the mean scores and standard deviations \n student and patient responses to statements : mean ( sd ) the patients were significantly more likely to agree with all the possible reasons given for withholding a diagnosis . \n ninety - six percent moderately or strongly agreed that it was the family 's responsibility to make decisions , whereas , students were divided on this . \n students and patients generally agreed that the patient had some responsibility and that it was better if they were told . \n two student sub - groups were analyzed according to their responses to question 1 [ table 3 ] . \n if they had stated that they would only tell the patient 's party / family , regardless of the prognosis , they were classified as \n non - tellers. a two - tailed t - test was performed and the p value was given . \n student sub - group responses to statements : mean ( sd ) the responses to these statements indicated the most important factors influencing a student 's decision to tell a patient his / her diagnosis . \n students as a whole were most likely to agree with the statement that causing a patient to become depressed was a reason for not disclosing the diagnosis . \n however , there were significant differences between sub - groups on all items . among the non - tellers , the fear of making a patient lose hope was the most important factor . \n it was closely followed by the item on depression , but the difference was less . \n the item on fear of making the patient die more quickly was the other statement to show a large and significant difference between the sub - groups . \n the attitudes of students toward the role of patient and family in decision - making were not associated with a different likelihood of telling and not telling . the final item about whether it is best to tell a patient \n ideal and what people said they would do in question 1 . among the non - tellers 28 out of 50 students showed some level of agreement with the statement that it was best to tell . \n the responses of the first and fourth year students were also compared . the only significant difference between the first and fourth year students \n the first year students ( mean 4.23 ( 1.75 ) ) were less likely to agree with the patient being responsible for decisions than the fourth year students ( mean 4.82 ( 1.29 ) ) . \n in this study , a little more than half of the medical students stated they would tell a patient that he / she had cancer , even when it was incurable . \n the figure in this study , of 54% in favor , was less than was found in the us data for physicians ( 80% ) , but much higher than was found in japan ( 17% ) . \n however , there were still 40% of the subjects who favored telling the patient 's family rather than the patient themselves . \n it was intriguing that the desire for being informed of incurable cancer was higher when a relative was involved ( 69% ) and even higher when it involved the patients themselves ( 83% ) . \n patients ( 49% ) are significantly more likely than students ( 31% ) to want a diagnosis withheld from a close relative if their cancer is incurable . \n although there is no research data or anecdotal evidence , personal observation suggests that it is the usual practice in nepal for a cancer diagnosis to be given to the patient 's family . \n it has been observed to be common practice for a family to ask the patient to wait outside the consulting room at the study hospital , when results of cancer tests are given . \n these data and practices are similar to those found in other asian countries , as outlined earlier . \n this is despite the fact that a minority of patients ( 22% ) have wanted the diagnosis withheld if they had an incurable cancer themselves . \n these data are consistent with the results from the kathmandu valley showing that between 63 and 80% of people will want to be informed of a personal diagnosis . there were large and significant differences in patients beliefs about the dangers of giving a cancer diagnosis , compared to those of the students \n this was most evident in their strong belief that telling the patient would take away hope and lead to a quicker death . \n there was almost complete agreement among the patients that the family was responsible for making treatment decisions . \n these findings were consistent with the practice in nepal , of families making decisions about paying for treatment and being responsible for signing consent forms . \n doctors usually discussed these things with families and left them to decide what to tell the patient . \n the finding that students and patients had a similar general agreement with the concept that it was \n however , it was best understood in the context of questions 2 and 3 , which showed the importance of prognosis as a factor in deciding whether to tell . \n there was some evidence of a shift in attitudes during the medical training of these students . \n students received teaching from the departments of psychiatry and general practice in principles of patient - centered communication . \n this might have contributed to the fourth year students greater agreement with the patients role in decision - making . however , this was the only difference identified between the first and fourth year students , both years expressing slight - to - moderate agreement with the idea that the patient was responsible for the decision - making . \n culturally - based beliefs were only slightly modified by teaching patient - centered communication . \n the students tended to disagree with all of the reasons given for not disclosing a diagnosis . \n however , the group of non - tellers was influenced by fears of causing depression , loss of hope , and a quicker death . \n the findings of this study supported the contention that these were the key fears that influenced the expectations of medical students and patients . \n it seemed that families saw themselves as best placed to manage the problems of the patients reactions and to filter their access to diagnostic information . \n there is incomplete correspondence between the students beliefs about what is ideal and what they think they would do . \n a majority of non - tellers agreed with the statement that it was best to tell. this may reflect a belief that patients do not want to be told or that families are opposed to telling . \n this further underlines the gulf between what students state is appropriate for other people and what they would want for themselves . \n the research was carried out in a department that was known to teach patient - centered communication . \n this may have influenced some students to respond in ways that supported patient choice and disclosure of information . \n the patients were predominantly in the young and middle ages ( 86% less than 45 years of age ) . \n in nepal , even though culturally the family members and close relatives tend to filter the diagnostic information about incurable cancers , in this study the majority of patients and medical students stated that they would prefer to be informed of their own diagnosis . \n the results of this study can be used to guide the teaching on medical communication , particularly as it relates to end - of - life issues . \n there is tension between some asian cultural beliefs and ideas of patient - centered communication if these are framed in western terms . \n issues such as the nature of autonomy and the role of the family need to be discussed and interpreted according to local practices and beliefs .", "role": "user" }, { "content": "objectives : patient - centered communication teaching generally encourages doctors to inform patients of cancer diagnoses . in many countries , including nepal , it is usually the patient 's family that is informed . \n much of the evidence about patient preferences is from western studies . \n the objectives of this study are : to discover the attitudes of medical students and patients in nepal toward disclosing a cancer diagnosis ; and to identify the reasons for these attitudes.materials and methods : a cross - sectional survey was administered to medical students and patients in a teaching hospital in nepal . \n the participants were asked about their attitudes toward and reasons for informing patients of a cancer diagnosis . \n the data were analyzed to compare students and patients attitudes and to look for differences between the first and fourth year students.results:fifty-four percent of the students would inform a patient even if the cancer was incurable , 6% would inform only if curable , and 40% would inform the family instead . \n sixty - nine percent of the students and 51% of the patients wanted a close relative informed , even if the relative was incurable ( p = 0.0016 ) . \n there was no significant difference between students ( 83% ) and patients ( 78% ) wanting to be informed of their own diagnosis . \n the most important reasons for students not informing the patients were fears of loss of hope and of causing depression.conclusion:the results confirmed the diverse attitudes about informing a cancer diagnosis to patients , in nepal . \n students wanted more information for themselves than they felt patients should be given . \n this information could enlighten the practice of doctors in nepal and other similar cultures , as well as guide the communication training of future doctors .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: metabolic syndrome ( mets ) is a constellation of risk factors associated with increased risk of diabetes and cardiovascular disease ( 1 ) . in 2001 , \n the national cholesterol education program ( ncep ) adult treatment panel iii ( atp iii ) provided a new definition for mets , focusing on easily measurable clinical parameters such as abdominal obesity , increased fasting blood sugar , increased serum concentration of triglyceride , low serum high - density lipoprotein cholesterol ( hdl - c ) and/or elevated blood pressure . in 2004 , the threshold for fasting blood sugar was reduced to 100 mg / dl ( 5.6 mmol / l ) in concordance with the american diabetes association criteria for impaired fasting glucose ( 2 ) . \n the new international diabetes federation ( idf ) definition in 2006 included a lower waist circumference ( 3 ) . \n metabolic syndrome is a growing public health problem worldwide in both developed and developing countries ( 4 ) . \n there is a general agreement that high prevalence of mets ( 33.2% and 10.1% among iranian adults and adolescents , respectively ) basically deals with increasing incidence of obesity ( 5 - 7 ) . \n a strong relationship between mets and dietary pattern , tobacco use and physical inactivity has been reported in the literature ( 8) . \n the most important therapeutic intervention that has been proven to be effective in metabolic syndrome is lifestyle modification with focus on dietary change and physical activity ( 2 , 9 ) . \n metformin has been proven to improve insulin sensitivity and shown to be effective on weight loss , although it has minor side effects ( 10 ) . \n recent evidence suggests that lifestyle modifications can be a decent way to reduce metabolic and cardiovascular risk factors . \n the study of giugliano et al . reported that lifestyle modification ( 25% ) has more benefits in resolution of mets compared to drug therapy ( 19% ) ( 9 ) . in 1981 , jenkins classified carbohydrate - containing foods , based on the glycemic index ( gi ) . \n the incremental area under the blood glucose response curve to a test food , relative to a standard control food ( glucose or white bread ) with the same amount of carbohydrate . \n glycemic index differs according to the rate of digestion and absorption , which depends on the type of carbohydrate and protein , fat and fiber content of the food ( 11 ) . \n high gi carbohydrates have been shown to be positively associated with insulin resistance and metabolic syndrome ( 12 ) . \n a low gi diet will improve postprandial glycemia and as a result reduce insulin resistance , b - cell dysfunction and hyperinsulinemia ( 11 ) . \n the results of a recent pilot study showed that a short - duration low glycemic index fitness program could improve anthropometric and physiological measures in mets subjects ( 13 ) . \n also , a systemic review in 2013 provided evidence that administrating a low gi diet was helpful in prevention of obesity - associated diseases ( 14 ) . \n the present study was designed to examine the effect of low gi diet versus metformin on adults with mets . \n sixty adults with mets , aged 25 to 65 years , participated in this randomized clinical controlled trial . patients were included in the study according the following inclusion criteria : having metabolic syndrome characteristics according to idf , waist circumference 90 for males or 80 cm for females ( 3 ) , blood pressure 135 ( systole ) or 85 ( diastole ) mmhg , fasting blood sugar ( fbs ) 100 mg / dl ( newly diagnosed pre - diabetic patients ) , triglycerides 150 mg / dl , and high - density lipoproteins ( hdl ) < 40 ( male ) or < 50 mg / dl ( female ) , and not taking any drug that might affect either blood pressure , blood lipid or blood glucose level . \n patients were excluded from the study if they had any sign of liver , kidney or gi disorders during the study . \n patients were randomly allocated to two groups of drug ( metformin ) or diet therapy ( low glycemic index ) for eight weeks . \n the method of randomization was carried out and as the patients registered for entering the trial , they were put in their own group accord their number . for the diet group , the percentage of required energy was calculated by the harris - benedict formula . \n the percentages of macronutrients were the same for all participants , i.e. 55% for carbohydrates , 30% for fat and 15% for proteins . \n the only difference with normal diet was the use of low gi foods in the diet plan for the diet group . \n the foods were chosen from the foster - powel and taleban table ( 15 , 16 ) , with medium ( 55 - 70 ) and low ( less than 55 ) glycemic index . \n the metformin dosage was 500 mg ( one oral tablet per day ) as the patients routine treatment for eight weeks . \n patients were seen every two weeks in order to make sure about their consumption of metformin and low gi diet regimen . \n a 24-hour dietary recall was taken for all patients at each follow - up visit . \n body weight , blood pressure , waist circumference , serum lipid profiles , fasting blood sugar and hemoglobin a1c were also measured at the beginning and the end of the trial . \n anthropometric data including weight were measured by means of an analog scale ( seca ) , while the participants were in light clothing and had no shoes on . \n the body mass index ( bmi ) was calculated through dividing weight ( in kilograms ) by height squared ( in meters ) . \n waist circumference was measured to the nearest 0.5 cm between the iliac crest and the lowest rib at the narrowest point . \n blood samples were obtained at baseline and at the end of the intervention , after overnight fasting , and analyzed for glucose and lipid profiles by the colorimetric method on a blue tetrazolium ( bt ) 1500 auto analyzer . \n the hemoglobin a1c was measured by high - performance liquid chromatography ( hplc ) , using c18 column with a variable wavelength detector ( agilent 1100 series , germany ) . \n the trial data were analyzed using the statistical package for the social sciences , version 14 ( spss inc . \n mann - whitney u and wilcoxon tests were performed to make statistical comparisons between and within groups , respectively . \n fifty - one participants ( 10 males and 41 females ) with a mean age of 44.6 6.1 years completed the study . \n there were no significant differences in dietary intake components between the diet and metformin groups during the eight - week trial ( table 2 ) . \n after the intervention , body weight , bmi , waist circumference and blood pressure decreased significantly in both groups ( p < 0.05 ) , although comparison between the groups showed no considerable differences ( table 3 ) . \n abbreviations : bmi , body mass index ; bp , blood pressure ; fbs , fasting blood sugar ; hba1c , hemoglobin a1c ; sd , standard deviation ; tg , triglyceride ; tc , total cholesterol ; wc , waist circumference . \n mann - whitney u test to compare changes between baseline and final values of the groups . \n fasting blood sugar , hemoglobin a1c , lipid profiles ( triglyceride ( tg ) , total cholesterol ( tc ) , low - density lipoprotein - cholesterol ( ldl - c ) , high - density lipoprotein - cholesterol ( hdl - c ) ) and lipoprotein ratio ( ldl / hdl ) showed a significant decrease after the intervention either by drug or diet ( p < 0.05 ) . \n the comparison of the mean differences of serum lipid profiles , lipoprotein ratio ( ldl / hdl ) and hemoglobin a1c showed no significant difference between the groups . \n however , the difference in fbs was significant ( p < 0.05 ) ( table 3 ) . \n the most important finding of this trial was that low gi diet as well as metformin reduced body weight , bmi , blood pressure and lipid profiles of patients with mets after eight weeks of treatment . \n a slightly larger decrease was found in fasting blood sugar of patients who took metformin as compared to those on a low gi diet yet the difference was not clinically marked . \n these findings further support the idea that low gi diet could be as effective as metformin in mets treatment . \n better regulation of glucose homeostasis following low gi diet was demonstrated in a number of studies ( 17 , 18 ) . \n the results of a previous meta - analysis of studies that investigated the effect of legumes as part of low gi diet in type 2 diabetes indicated a significant reduction ( 0.48% ) in hba1c values ( 19 ) . \n fasting blood sugar and hba1c were reduced significantly in the low gi diet group of the current study . \n metformin has also been shown to have beneficial effects on insulin sensitivity and glucose metabolism , which has been documented in the literature since 1993 ( 20 , 21 ) . \n it is likely that metformin exerts a direct inhibitory effect on hepatic glucose output , which coincides with the inhibition of gluconeogenesis in hepatocytes ( 22 ) . \n a significant reduction in hba1c was observed in a ( cerebral abnormalities in migraine , an epidemiological risk analysis ) study on non - diabetic patients , taking metformin for 18 months ( 23 ) . \n low gi diet is more satiating than a high gi diet , as the former has slower rates of digestion and absorption . as a consequence , \n nutrient receptors in the gastrointestinal tract are stimulated for a longer time period and the signals by cholecystokinin and glucagon - like peptide-1 to the brain satiety center will become prolonged . \n in addition , low gi diet can decrease postprandial glucose , insulin and plasma cortisol level that inhibits muscle catabolism . \n ludwig et al . reported that a low gi meal enhanced satiety and diminished appetite much more than a high gi meal ( 25 ) . in a study by bahadori et al . in 2004 , \n low gi diet reduced body weight ( six kilograms in six months ) in obese participants ( 26 ) . \n melanson et al . also reported that 12-week treatment with low gi diet in overweight and obese subjects resulted in a significant decrease in body weight ( 3.39 kg ) , bmi ( 1.11 ) and waist circumference ( 3.31 cm ) ( 27 ) . \n the findings of the present study also showed a significant reduction in body weight and waist circumference as well . \n the larger mean reduction in the study of melanson et al . might be due to a longer period of treatment ( 12 weeks ) . \n metformin , by its insulin - sensitizing virtue and by reducing hyperleptinemia , appears to be effective in reducing body weight and centripetal obesity . in one study , \n metformin therapy in non - diabetic , obese and morbidly obese ( bmi > 30 ) subjects significantly reduced body weight and waist circumference ( 28 ) . regarding the beneficial effect of metformin on lipid profiles , it diminished rho ( small gtp - binding protein , which is generated in the process of cholesterol biosynthesis ) kinase activity in hyperlipidemic rats ( 29 ) . \n reported that metformin administration can ameliorate tg , total cholesterol and ldl - c levels in six weeks ; this is in agreement with the results obtained in the current study ( 30 ) . \n low gi diet may also have the ability to decrease blood lipids by reducing hyperinsulinemia . \n the investigation of bouch et al . showed that eight - week consumption of low gi diet improved lipid profiles significantly in overweight and non - diabetic subjects ( 31 ) . \n moreover , heilbronn et al . observed that low gi diet leads to a noticeable decrease in tg , total cholesterol and ldl in type 2 diabetic patients ( 32 ) . \n also , the outcome of a systemic review suggested that low gi diet could significantly reduce ldl and total cholesterol ( 33 ) . \n the present study also showed that low gi diet diminished lipid profile and lipoprotein ratio ( ldl / hdl ) in patients with metabolic syndrome . \n low gi diet also has positive effects on blood pressure through its reducing effects on obesity , hyperglycemia and hyperinsulinemia ( 11 ) . \n moreover , low insulin concentration can lead to a reduction in sympathetic nervous system activities , which decrease heart rate , cardiac output and sodium retention and thus blood pressure ( 34 ) . in the present study , low gi diet reduced systolic and diastolic blood pressure . \n these results are consistent with those of sloth et al . who found that low gi diet decreased systolic blood pressure markedly in overweight females during a ten - week trial ( 35 ) . \n moreover , in the study of melanson et al . , low gi diet decreased blood pressure , although not significantly ( 27 ) . \n the current study showed that metformin intake was also associated with significant alterations in blood pressure ( bp ) . \n the mechanism underlying the bp - lowering effect of metformin is obscure , yet a decrease in peripheral hyperinsulinemia may be implicated ( 36 ) . \n moreover , a reduction in sympathetic nervous system activity , as suggested by a 25% decrease in plasma norepinephrine after metformin consumption could also contribute to the condition ( 37 ) . \n giugliano obtained similar results for bp in obese - hypertensive subjects ; a considerable reduction was detected after three months ( 21 ) . \n the inconsistent results of studies on the effects of low gi diet or metformin on metabolic parameters in obese or diabetic individuals can be attributed to different features of studies . \n these include differences in design , sample size , dosage and length of metformin administration . \n in conclusion , eight weeks of low gi diet and metformin therapy in mets could significantly decrease body weight , waist circumference , blood pressure , fbs , hba1c , lipid profiles and lipoprotein ratio ( ldl / hdl ) , although the difference between groups was not noticeable except for fbs , for which the reduction was slightly larger ( 3 mg / dl ) in the metformin group , yet this was not clinically considerable . since metformin may cause side effects such as lactic acidosis , vitamin b12 deficiency , gastrointestinal disturbances and hepatotoxicity ( 38 ) , low gi diet can be safer in managing mets . to the best of our knowledge , \n the present study was the first trial on mets that compared low gi diet and metformin drug therapy although with a small sample size . \n in addition , the short duration of the intervention was the other limitation of this clinical trial . \n further investigations with larger populations and longer periods are required to confirm whether metformin therapy can be replaced by low gi diet .", "role": "user" }, { "content": "background : metabolic syndrome ( mets ) continues to be highly prevalent and contributes to a rapidly growing problem worldwide . \n the most important therapeutic intervention for metabolic syndrome is diet modification , an intervention whose efficacy has been proven for metabolic syndrome.objectives:the aim of the present study was to compare the effects of low glycemic index diet versus metformin on mets components in adults with mets.patients and methods : fifty - one adults with mets participated in this randomized controlled clinical trial . \n patients were randomly allocated to two groups of metformin and low glycemic index diet . \n the intervention period was eight weeks . \n the studied participants were compared at baseline and the end of the trial , regarding the following factors : weight , blood pressure , waist circumference , fasting blood sugar , hemoglobin a1c and lipid profiles ( triglyceride ( tg ) , total cholesterol ( tc ) , low - density lipoprotein ( ldl ) cholesterol , and high - density lipoprotein ( hdl ) cholesterol).results : the anthropometric measurements , fasting blood sugar ( fbs ) , hemoglobin a1c , serum lipid profiles ( tg , tc , ldl - c , hdl - c ) and lipoprotein ratio ( ldl / hdl ) showed a significant decrease after the intervention in both groups ( p < 0.05 ) . \n comparison of the difference between the two groups was not significant , except for the mean reduction in fbs , which was more in the metformin group although this was not clinically significant.conclusions:this study supports the assumption that low glycemic index diet as well as metformin can positively affect metabolic syndrome components .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: joint contracture occurs when joint movements are reduced , such as by immobilization of a \n joint with a plaster cast , orthosis , or after prolonged bed rest . \n several conditions limit \n the range of motion ( rom ) of joints , including cerebrovascular diseases , neuromuscular \n diseases , bone and joint diseases , and various other diseases . \n contracture may be classified into three groups : arthrogenic , myogenic , and soft \n tissue1 . \n arthrogenic contracture is \n caused by immobility caused by damage and inflammation of cartilage , synovial tissue , and \n joint capsule . \n soft \n tissue contracture occurs because of pathological shortening of connective tissue , including \n the skin , subcutaneous tissue , tendons , and ligaments . \n examples of intrinsic causes include \n trauma , inflammation , degenerative changes , and ischemia . \n examples of extrinsic causes \n include spasticity , flaccid paralysis , malpositioning , and immobilization . \n many investigators have studied the pathogenesis of contracture in dogs , monkeys , rats , and \n other experimental animals . \n these studies provided evidence of a relationship between the \n period of immobilization and rom limitation factors , and changes in joint components and \n soft tissue , including muscle and skin . in addition , decreases in mobility and plasticity of \n the nervous system are considered to cause rom limitation2 . \n nervous system mobilization is used as a physical therapeutic \n approach to improve such conditions . \n it uses palpation or joint movements to initiate \n physical or physiological changes in blood flow or the axonal flow of nerves , aiming to \n improve the plasticity of the nerve3 . in \n addition \n , nervous system mobilization has been reported to be effective at improving rom \n limitation and pain , and induces the largest longitudinal excursion of the nerve relative to \n its surrounding structures without being associated with a potentially detrimental increase \n in nerve strain4,5,6 . on the other hand , \n there is \n no evidence that mobilization of neural tissue , independent of other anatomical structures , \n would be feasible in living people , or that nervous system mobilization is effective in the \n treatment of musculoskeletal dysfunction . \n therefore , it is still unclear whether nervous \n system mobilization is effective7,8,9,10 . as stated above , nervous system mobilization is used to improve rom limitation and other \n conditions , but the changes that it causes in the nerves and the periphery in contracture \n arising from secondary disabilities or prolonged bed rest remain unclear . \n the present study was \n performed to determine changes in the tissue located in the periphery of the sciatic nerve \n during contracture in an animal model . \n immobilization model male wistar rats ( 9 weeks old , n = 29 , weight 240 280 g ) were divided randomly into a \n control group ( c group , n = 7 ) and immobilized group ( i group , n = 22 ) , and were kept in \n plastic cages for 2 weeks . \n the rats had unlimited activity in the cage and free access to \n food and water . \n the animal room was maintained at a constant temperature of 22 c , and the \n animals were maintained under a 12-h light / dark cycle to avoid effects arising from the \n biological rhythm of the rats . \n this experiment was performed in accordance with the \n guidelines for the care and use of laboratory animals of kanazawa university and the \n protocol for this experiment was approved by the animal research committee of kanazawa \n university . \n rats in i group had the left knee joint immobilized for 2 weeks in the posture of maximum \n flexion with a plaster cast of our own making and aluminum wire netting . \n the casts were \n applied under deep anesthesia induced by intraperitoneal injection of pentobarbital sodium \n ( 40 mg / kg ) ( fig . \n care was taken to avoid \n disturbance of blood flow to the hip and ankle joints due to pressure from the cast . during \n the immobilization period \n , wounds and edema were prevented and if the plaster cast came off \n immobilization was repeated again as soon as possible . \n animals in c group were given food ad \n libitum , and had no restrictions placed on their mobility . \n at the end of the immobilization period , the rats were euthanized with diethyl ether and \n both hip joints were disarticulated immediately . \n the joint tissue was fixed with 10% \n formalin neutral buffer solution for 72 h decalcified in edta at 4 c for 72 h. after \n decalcification , the specimens were cut vertically at the center of the femur and \n neutralized with 5% sodium sulfate for 72 h , and then embedded in paraffin . \n the embedded \n paraffin blocks were cut into sections at a thickness of 3 m . \n we examined the periphery of the sciatic nerve under an optical microscope ( bx51 ; olympus ) . \n the software \n program jmp7 ( sas institute japan inc . ) was used for statistical analyses , and values of p \n < 0.05 were accepted as statistically significant . \n the perineural space ( black arrows ) can be seen between the \n bundle of nerve fibers and the perineurium ( dotted arrows ) . \n adherence between the bundle of nerve fibers and the \n perineurium ( black arrows ) , and thickening of the perineurium ( dotted arrows ) were \n observed . \n scale bar : c : 500 m , d : 200 m . in c group , \n the bundle of nerve fibers tended to separate from the perineurium , and a space \n was clearly observed between the bundle of nerve fibers and the perineurium ( fig . 2 and table \n 1 ) . \n conversely , in the rats of i group , strong adherence between the bundle of \n nerve fibers and perineurium was observed in 19 of 22 animals ( fig . \n 3 and table 1 ) , and \n thickening of the perineurium was detected in 20 of 22 of these rats ( fig . 3 and table 2 ) . \n generally , peripheral nerves consist of several bundles of nerve fibers . in these bundles \n of nerve fibers , each nerve fiber , including the schwann cells enveloping it , is surrounded \n by endoneurium that consists of areolar connective tissues containing blood vessels . each \n bundle of nerve fibers is covered by perineurium , which is a dense layer composed of \n collagenous connective tissue enveloped by 7 or 8 layers of squamous epithelial - like \n cells11 . \n there is a space between the \n perineurium and the bundle of nerve fibers , but there have been no previous anatomical \n descriptions of this space . \n peripheral nerves consist of more than one bundle of nerve \n fibers and the epineurium consisting of areolar connective tissues . \n the bundles of nerve \n fibers are combined with each other and form a nerve trunk , with a cylindrical strong \n connective tissue sheath12 . \n the sciatic nerve is the largest nerve in humans and represents most of the nerve fibers \n forming the sacral plexus . \n this nerve descends into the posterior compartment of the thigh from the gluteal region \n through the greater sciatic foramen . \n proximal to the knee , and sometimes within the pelvis , \n the sciatic nerve divides into its two terminal branches , the tibial nerve and the common \n fibular nerve . \n it innervates all muscles in the posterior compartment of the thigh , lower \n leg , and foot , as well as most of the skin of the lower leg and foot13,14,15 . \n the spinal nerves in the rat consist of 34 pairs of \n nerves : 8 cervical , 13 thoracic , 6 lumbar , 4 sacral , and 3 caudal . \n the sacral plexus in the rat is \n more limited in the extent of its origin than the human one . \n it is formed by the fifth , and \n the adjacent parts of the fourth and sixth lumbar nerves . \n the sciatic nerve divides into its \n two terminal components , the common fibular nerve and the tibial nerve , which in their \n course through the thigh cross the obturator externus , quadratus femoris , and adductor \n magnus , lying between these muscles and biceps femoris , until they reach the popliteal fossa \n where they separate . \n as described above , the sciatic nerve tract in the rat is almost the \n same as in humans16 . \n the nervous system adapts to lengthening in two ways , movement and elongation2 , 3 . \n movement may be considered as gross movement or movement occurring intraneurally between the \n connective tissues and the neural tissues . \n gross movements refer to movement of the system \n as a whole in relation to the connective tissue interface . \n a peripheral nerve sliding \n through a tunnel , such as the median nerve , is a clear example of this type of gross \n movement . \n intraneural movement refers to movement of the neural tissue elements in relation \n to the connective tissue interfaces . \n the brain or the spinal cord can move in relation to \n the dura mater and a fascicle can slide in relation to another fascicle in peripheral \n nerves . on the other hand , elongation is like elastic gum and the nervous system adapts to \n joint movement by increasing intraneural pressure or intradural pressure . \n the looseness of \n nerve fibers , epineurium , and perineurium decrease as the nerve is elongated . \n the epineurium \n is only slightly involved in resisting elongation of the nerve , and resistance is mainly \n offered by the perineurium . \n reductions in these adaptations induce limitation of rom , pain , \n and neurological symptoms . \n generally , nervous system mobilization can increase the mobility \n of the nerve by improving the motility and extensibility of the nervous system when movement \n and elongation are reduced due to the influence of various factors , but there is no \n histological evidence of such an effect . in this study , a space was observed between the bundle of nerve fibers and the perineurium \n of the sciatic nerve in the c group . \n it is possible that this space is an artificial \n histopathological image caused by differences in the rate of contraction between the bundle \n of nerve fibers and perineurium tissue in the process of specimen preparation . \n however , in i \n group this space was not observed , so , we considered it unlikely that this was an artificial \n image appearing only in i group . \n there have been no anatomical descriptions of this space and it has not been the focus of \n prior study . \n however , in pancreatic cancer , gastric cancer , and prostate cancer , the \n invasion of cancer tissue into this space ( perineural invasion ) has been seen ; therefore , \n this space has attracted attention and is known as the perineural space . \n watanabe17 reported that cancer cells do not invade \n bundles of nerve fibers , but scatter along loose connective tissue in the perineurium . \n the \n results of experimental and clinical studies indicate that the perineural space is \n independent of the lymphatic system and there is no traffic between the two18 , 19 . \n in addition , miyazaki20 reported that perineural invasion shows continuous tumor spread , \n unlike lymphatic invasion and vein invasion , and there is no flow in the perineural space , \n unlike lymphatic and blood vessels . \n as mentioned above , it is clear that there is a space \n between the bundle of nerve fibers and the perineurium of autonomic nerves . \n however , there \n have been no previous reports of its presence in somatic nerves and its physiological \n significance remains unknown . \n further studies and descriptions of the perineural space have \n not been reported to date . in c group , \n the bundle of nerve fibers separated from the perineurium physiologically , and \n there was a perineural space in the periphery of not only the autonomic nerve , but also the \n somatic nerve . on the other hand \n , there was no perineural space in i group : the bundle of \n nerve fibers tended to make contact with the perineurium , and there was the possibility of \n adhesion between the two . \n with regard to this adhesion , if the perineurium functions as a \n buffer between the bundle of nerve fibers and the peripheral tissue of the nerve , it is \n possible that this adhesion decreased the mobility and plasticity of the bundle of nerve \n fibers . \n thomas21 reported that the \n perineurium acts as a mechanical barrier to external forces , and sunderland22 reported that it was the structure most \n resistant to tensile forces . \n we suggest that thickening disturbs these functions of the \n perineurium , causing a decrease in the buffer function and the mobility and plasticity of \n the nerve . \n this is the first study to examine the changes in the periphery of nerve tissue \n after joint immobilization with histopathological observations . in conclusion \n , abnormal histopathological images were observed in not only the joint \n components and soft tissue , but also in the peripheral tissue of nerves in the rat knee \n joint contracture model indicating joint immobilization may affect the peripheral tissue of \n nerves .", "role": "user" }, { "content": "[ purpose ] this study was performed to investigate the histological changes that occur in \n the periphery of the sciatic nerve in rats undergoing knee immobilization . \n [ subjects and \n methods ] 29 male 9-week - old wistar rats were divided randomly into a control group ( c \n group , n = 7 ) and an immobilized group ( i group , n = 22 ) . \n the animals in the i group had \n the left knee joint immobilized in maximal flexion with plaster casts for two weeks . \n after \n the experimental period , we obtained cross - sections of tissues from the center of the left \n thigh , and the periphery of the sciatic nerve was observed under an optical microscope \n after hematoxylin - eosin staining . \n [ results ] in contrast to the rats of c group , the rats \n in i group showed adherence between the bundle of nerve fibers and perineurium , as well as \n thickening of the perineurium . \n these histological changes were statistically significant . \n [ conclusions ] immobilization of the knee joints of rats resulted in characteristic \n histological changes in the connective tissue around the sciatic nerve .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: many microorganisms express molecules that can bind immunoglobulins independently of the antigen specificity of the antibodies . \n a prominent example is the antibody - binding proteins found in the cell wall of the bacterium staphylococcus aureus ( 1 , 2 ) . \n these proteins have high affinities for the conserved elements in the fc and fab parts of various antibody classes , and they appear to serve an immunoevasive function , as binding of antibodies to these proteins interferes with phagocytosis of antibody - opsonized bacteria ( 3 ) . some erythrocytes infected by the malaria parasite plasmodium falciparum bind igm , but not igg , independently of the specificity of the antibodies ( 4 , 5 ) . \n this fc - mediated binding of igm has been described for infected erythrocytes ( ies ) that bind to the sulfated glycosaminoglycan chondroitin sulfate a ( csa ) ( 5 ) and for ies capable of forming rosettes ( several uninfected erythrocytes adhering to a central ie ) ( 4 ) . both ie phenotypes \n are related to expression of particular types of p. falciparum erythrocyte membrane protein 1 ( pfemp1 ) . \n thus , adhesion of ies to csa requires expression of the atypical pfemp1 type var2csa , which has nanomolar affinity for csa and is responsible for placental ie sequestration ( 69 ) . \n rosetting can be mediated by several different pfemp1 proteins that have a semiconserved n - terminal head structure made up of certain subtypes of duffy binding - like ( dbl)cysteine - rich interdomain region / ( cidr/ ) domains ( 1013 ) , and it appears to depend mainly on relatively low - affinity interactions with a range of host carbohydrates ( 1417 ) . \n the function of fc - dependent binding of igm to p. falciparum ies is not fully understood ( reviewed in reference 18 ) . in the case of var2csa - type pfemp1 , it appears to be mainly immunoevasive , as it can protect ies from specific igg recognition and immune destruction without compromising the csa - adhesive function of the antigen ( 19 ) \n . however , such masking is ineffective in the case of rosette - mediating pfemp1 antigens ( 15 ) , where binding of igm to pfemp1in combination with other serum factors seems to function to increase the low - affinity adhesive interactions involved in rosetting ( 15 , 20 ) . \n given the apparent clinical importance of igm binding ( 4 , 21 ) , it is of interest to know how many igm - binding pfemp1 variants exist within the pfemp1 repertoire of a single p. falciparum clone and how igm binding is related to the structural and functional characteristics of the involved pfemp1 proteins . \n we therefore set out to identify igm - binding pfemp1 proteins in p. falciparum nf54 . \n we show that the genes for at least five igm - binding pfemp1 variants exist in the genome of this parasite . \n in addition to pfl0030c , which is the var2csa - type antigen in p. falciparum nf54 , we found four others ( pfl0020w , pf07_0139 , mal6p1.4 , and mal6p1.316 ) . \n surprisingly , these did not mediate rosetting in functional assays and do not possess structural features indicative of being rosette mediating . \n our study shows that fc - mediated binding of igm to pfemp1 proteins is not limited to those that can adhere to csa or mediate formation of rosettes . \n recombinant proteins representing full - length pfl0030c and single- and triple - domain constructs of mal6p1.4 , mal6p1.316 , pfl0020w , and pfl0030c were produced in a baculovirus expression system , essentially as described previously ( 15 , 22 ) . the domain nomenclature proposed by rask et al . in 2010 \n antisera against mal6p1.4 , mal6p1.316 , and pfl0020w were raised in rats ( 24 ) , and the human monoclonal antibody pam1.4 , specific for several var2csa - type pfemp1 proteins , including pfl0030c , was generated as described elsewhere ( 25 , 26 ) . \n nonimmune igm binding to recombinant pfemp1 constructs was quantified by enzyme - linked immunosorbent assay ( elisa ) as described previously ( 15 ) . \n p. falciparum nf54 parasites ( 27 ) were grown in vitro in o rh erythrocytes at 37c in a controlled atmosphere , using complete culture medium ( rpmi 1640 supplemented with 0.5% albumax ii [ life technologies bv , nrum , denmark ] ) , essentially as described previously ( 28 ) . \n the p. falciparum nf54-derived and pvbh - transfected clone g6 was generated as described elsewhere ( 2931 ) . \n it was maintained in the same way as the parental strain p. falciparum nf54 , except that blasticidin ( 10 mg / ml ; life technologies ) was added to shut down transcription of endogenous var genes and to erase the epigenetic memory . \n ies were selected for surface expression of defined pfemp1 proteins by immunomagnetic selection using ( i ) pfemp1-specific rat antisera followed by biotinylated anti - rat antibody ( dako ) and streptavidin - coupled dynabeads ( fisher scientific ) or ( ii ) pam1.4 followed by protein a - coupled dynabeads ( fisher scientific ) , essentially as described previously ( 32 ) . for selection of igm - binding ies , we used human igm ( sigma ) coupled to m-450 epoxy beads ( life technologies ) according to the manufacturers ' instructions . \n the genotypic identity of the parasites and the absence of mycoplasma contamination were verified regularly as described previously ( 33 ) . for analysis of var gene transcription by quantitative real - time pcr , we used cdna generated from ring - stage parasite rna and p. falciparum 3d7 var gene - specific primers as described in detail elsewhere ( 6 , 34 , 35 ) . \n transcription levels relative to those of the seryl - trna synthetase housekeeping gene were calculated by the 2 method . \n the binding of nonimmune igm and pfemp1-specific antibody to ies was quantified by flow cytometry , essentially as described previously ( 19 ) . in brief , we used magnetically activated cell sorting ( macs ) to purify late - stage ies , labeled with ethidium bromide ( 10 mg / ml ) , serial dilutions of human igm , and secondary antibody . \n igm ( 100 nm ) was preincubated ( 20 min , room temperature ) with equimolar concentrations of mouse monoclonal antibodies specific for human fc2 ( hb57 ) , fc3 ( 5d7 ) , or fc4 \n ( 1g6 ) ( all described in reference 36 ) or mouse control igg ( sigma ) . \n the purification of late - stage ies by macs was assessed by ethidium bromide staining as described above , and ie surface expression of the expected pfemp1 protein was verified by labeling with pfemp1-specific antisera or human monoclonal antibody . \n all list - mode data files were analyzed using winlist 6.0 ( verity , topsham , me ) . \n p. falciparum g6 grown under blasticidin pressure to erase the epigenetic memory of var gene transcription was released from the selection pressure for 2 weeks to obtain a population with highly heterogeneous var gene transcription , as described previously ( 31 ) . \n macs - purified late - stage ies were labeled with human igm ( 10 nm , 30 min , 4c ) , washed thrice in sterile phosphate - buffered saline ( pbs ) supplemented with fetal bovine serum ( 2% ) , stained with phycoerythrin - conjugated donkey anti - human igm ( jackson immunoresearch , newmarket , united kingdom ) ( 1:200 , 30 min , 4c ) , and washed thrice as described above . an aria - ii fluorescence - activated cell sorter ( bd biosciences , san jose , ca ) was used to single - cell sort igm - positive ies into round - bottomed 96-well plates ( thermo fisher scientific , roskilde , denmark ) containing complete culture medium ( 200 l / well ) and uninfected erythrocytes ( 2 l / well ) . \n the 96-well plates were incubated for 2 weeks ( 37c , 5% co2 ) , with a change of medium thrice weekly and addition of uninfected erythrocytes ( 2 l / well ) twice weekly . \n small aliquots of ies were stained with ethidium bromide ( 2 g / ml ) , igm ( 10 nm ) , and fluorescein isothiocyanate - conjugated anti - human igm ( sigma ; 1:150 ) and used to assess parasite growth and igm binding by flow cytometry , using a beckman coulter fc500 instrument ( beckman coulter , fullerton , ca ) . clones with igm - positive ies were transferred and expanded further in tissue culture flasks . \n adhesion of ies to csa - expressing bewo cells was determined essentially as described previously ( 37 ) . in brief \n , ring - stage ies were labeled with [ h]hypoxanthine for 24 h. bewo cells ( lgc promochem , bors , sweden ) were grown to confluence in flat - bottomed 96-well plates ( thermo fisher scientific , denmark ) and blocked with bovine serum albumin ( 5% in pbs , 1 h ) . \n macs - purified [ h]hypoxanthine - labeled late - stage ies ( 2 10 ies / well ) were added and incubated ( 37c , 1 h ) . \n unbound ies were washed off by use of a biomek 2000 automated plate washer ( beckman coulter ) . \n after washing , macs - purified [ h]hypoxanthine - labeled late - stage ies ( 2 10 ies / well ) were added to three empty wells as a measure of maximal binding . \n the ies were harvested onto optiplate-96 filters ( perkinelmer , waltham , ma ) , microscint40 scintillation liquid ( perkinelmer ; 50 l / well ) was added , and [ h]hypoxanthine incorporation was determined on a topcount nxt scintillation counter ( perkinelmer ) . \n ring - stage ies were incubated overnight ( 37c , 5% co2 ) in rpmi 1640 supplemented with either nonimmune human serum ( 10% ) or albumax ii ( 0.5% ) . \n after labeling of parasites with ethidium bromide ( 25 g / ml ) , rosetting frequencies were assessed by counting 200 ethidium bromide - stained ies , using wet - slide preparations and fluorescence microscopy . \n phagocytosis of antibody - opsonized ies was measured as described previously ( 38 ) . in brief \n , macs - purified late - stage ies were stained with ethidium bromide ( 100 g / ml , 10 min , room temperature ) , washed twice in rpmi supplemented with 2% fetal bovine serum , labeled with either human igm or human iga ( 50 nm ) , and opsonized with pooled plasma pools from nonexposed or p. falciparum - exposed adults ( 1:10 , 30 min , room temperature ) . \n after washing as described above , the ies were incubated in 4-ml tubes ( 30 min , 37c , 5% co2 ) with cells of the human monocytic leukemia line thp-1 ( tib-202 ; lgc standards , bors , sweden ) at a 20:1 ratio . \n following lysis of remaining free ies ( 15 mm nh4cl , 10 mm nahco3,1 mm edta ) , the proportion of ethidium bromide - positive thp-1 cells was determined by flow cytometry using an fc500 instrument ( beckman coulter ) . \n we used a biacore 2000 instrument ( ge healthcare , hillerd , denmark ) to measure the affinity of igm for recombinant pfemp1 constructs by surface plasmon resonance analysis as described previously ( 15 ) . \n following gel filtration , the recombinant pfemp1 domain constructs ( 50 ml / min for 60 s ) , followed by buffer ( 120 s ) , were flowed over igm ( 750 relative units ) immobilized on a cm4 biosensor chip ( ge healthcare ) by amine coupling . after each run , the chip was regenerated with 20 mm naoh . \n all experiments were performed in hepes buffer ( 0.01 m hepes , 0.15 m nacl , 3 mm edta , 0.005% [ vol / vol ] surfactant p20 , ph 7.4 , 20c ) . the specific binding response to igm was calculated by subtracting the response to an uncoupled chip and to buffer injection . \n the kinetic sensorgrams were fitted to a global 1:1 interaction model to allow calculation of the ka , kd ( dissociation constant ) , and kd ( equilibrium dissociation constant ) values , using biaevaluation software v. 4.1 ( ge healthcare ) . one - way analysis of variance followed by holm - sidak multiple pairwise comparisons was used to evaluate the capacity of fc-specific antibodies to inhibit binding of igm to ies , and student 's t test was used to evaluate the ability of igm and iga to inhibit phagocytosis of igg - opsonized ies . \n we used the p. falciparum nf54-derived clone g6 to identify igm - binding pfemp1 proteins . \n this clone , which is transfected with a pvbh plasmid containing a blasticidin resistance gene controlled by a var promoter , initially transcribed the var gene pfd1015c ( 31 ) . culturing this parasite under high blasticidin selection pressure results in a complete shutdown of endogenous var transcription and erasure of epigenetic memory , and removal of drug pressure \n we labeled ies with igm and single - cell sorted igm - positive ies into 96-well plates . \n after in vitro expansion for 3 weeks , we had 19 growing cultures originating from individual single - cell - sorted ies . \n var gene transcription was assessed in all lines containing igm - positive ies ( eight from subclones and two from the 50-cell control sublines ) . \n each of the subclones transcribed multiple var genes as a result of shifts in var transcription during the period of in vitro expansion ( fig . \n nevertheless , all but one subclone ( g6.2.5 ) and one 50-cell subline ( g6.1.13 ) showed dominant expression of a single var gene . \n one subclone ( g6.3.16 ) and one 50-cell subline ( g6.1.14 ) mainly transcribed pfl0030c . \n four clones ( g6.1.57 , g6.2.20 , g6.2.56 , and g6.2.79 ) mainly transcribed pfl0020w , two ( g6.3.40 and g6.3.76 ) predominantly transcribed pf07_0139 , and both the 50-cell sublines showed prominent transcription of mal6p1.316 . \n the relative transcription levels of the identified candidate var genes were reflected in the proportions of erythrocytes infected by the subclones and sublines that bound igm ( fig . \n ( a ) distributions of var transcripts in progenies of single - cell - sorted subclones and 50-cell - sorted sublines ( g6.1.13 and g6.1.14 ) of igm - positive p. falciparum g6 following 3 weeks of expansion in vitro . \n the groups identified are group a ( gray ) , group b / a ( orange ) , group b ( blue ) , group b / c ( green ) , group c ( red ) , and var2csa ( white ) . \n the major transcripts are identified by name , and all candidate genes selected are shown as exploded pie slices . \n the percentage of corresponding ies binding igm is indicated in parentheses below the pie for each subclone . \n ( b ) domain structures of the pfemp1 proteins encoded by major var gene transcripts in these subclones and sublines . the orientation and domain numbers are indicated in italics along the top of the panel . \n the pfemp1 protein encoded by the pfl0030c var gene in p. falciparum nf54 is the csa - adhering var2csa - type protein pfl0030c ( 6 , 7 ) . \n this protein is known to bind igm via fc ( 19 , 39 ) , and several dbl domains have been implicated in this binding ( 39 , 40 ) . only the three c - terminal dbl domains in pfl0030c are of a type ( dbl ) that is also found in non - var2csa - type pfemp1 proteins . all the non - var2csa - type candidate igm - binding pfemp1 proteins we identified above contained c - terminal dbl domains ( fig . \n however , we recently mapped the fc-binding domain in the rosetting pfemp1 protein hb3var06 to its c - terminal dbl_8 domain , and two of our candidate var transcripts ( pfl0020w and mal6p1.316 ) additionally contain a dbl domain each ( fig . \n together , these data point to c - terminal dbl and dbl domains as being relevant for fc - mediated igm binding . to verify the predicted igm - binding capacity of our candidate pfemp1 proteins , we next subjected previously unselected p. falciparum nf54 parasites to repeated selection with either the var2csa - specific monoclonal antibody pam1.4 or rat antisera to pfl0020w and mal6p1.316 . \n in addition , we selected ies by using a rat antiserum to the pfemp1 protein mal6p1.4 , because two of our subclones ( g.6.256 and g6.2.79 ) showed prominent transcription of mal6p1.4 ( fig . \n we did not have an antiserum specific for pf07_0139 and instead subjected subclone g6.3.40 to repeated rounds of selection for igm binding . as a negative control , we used p. falciparum nf54 selected by an antiserum specific for the intercellular adhesion molecule 1 ( icam-1)-binding pfemp1 protein pfd1235w ( 33 , 41 ) . these selection protocols all resulted in parasites with dominant transcription of the expected var gene ( fig . \n 2a ) , and all the selected ies bound igm to various degrees , except for the ies selected for expression of pfd1235w ( fig . 2b and c ) . \n ( a ) distributions of var transcripts in p. falciparum nf54 following antibody selection for ie surface expression of mal6p1.4 , pfl0030c , mal6p1.316 , pfl0020w , and pf07_0139 . \n the color coding and layout are as described in the legend to fig . 1 . \n ( b ) titration of igm binding to erythrocytes infected by the corresponding subclones and sublines . \n means ( symbols ) and standard deviations ( error bars ) for triplicate measurements are shown . \n ( c ) histograms showing representative flow cytometry data on all selected parasite cultures , with ( orange / white / blue ) or without ( gray ) igm . \n we previously showed that the c3-c4 domains of igm bind to var2csa - type pfemp1 ( 19 ) and to the rosetting pfemp1 hb3var06 ( 15 ) . \n we therefore measured the ability of monoclonal antibodies specifically recognizing the c2 , c3 , and c4 domains of human igm to interfere with igm binding to ies expressing each of the igm - binding pfemp1 proteins studied here . in each case , all three fc-specific antibodies significantly ( p < 0.001 in all cases ) reduced the binding of igm to the ies ( fig . \n 3 ) , although the c2-specific antibody was less effective than the other two antibodies at inhibiting igm binding to the var2csa - type pfl0030c protein , in accordance with previous findings ( 19 ) . \n ( a ) involvement of fc domains in the binding of igm to pfemp1 as determined by the interference of monoclonal antibodies to various fc domains ( c1 , c2 , and c3 ) with igm binding to selected pfemp1 proteins . \n overall means ( histograms ) and standard deviations ( error bars ) for three independent experiments are shown . statistically significant differences ( p < 0.001 ) relative to the negative controls ( mouse igg ) are indicated by asterisks . \n each histogram shows an overlay of no igm ( gray ) and igm with anti - igm or control mouse antibodies ( white ) . \n multiple domains have been implicated in fc - dependent binding of igm to pfemp1 ( 15 , 39 , 40 , 42 , 43 ) . \n we recently used multiple recombinant single- and multi - dbl - domain constructs to map this type of igm binding to the penultimate c - terminal dbl ( dbl_8 ) domain in the rosette - mediating pfemp1 hb3var06 ( 15 ) . taking a similar approach here , we used elisa to identify the domains involved in igm binding , employing an array of recombinant proteins representing single and triple domains of pfl0030c , pfl0020w , mal6p1.4 , and mal6p1.316 , as well as a construct representing the full ectodomain of pfl0030c ( see fig . \n 1b for an overview of the recombinant antigen constructs used ) . with this approach , \n we unequivocally identified dblpam5 as the igm - binding domain in the var2csa - type pfl0030c protein ( fig . \n this is the penultimate c - terminal dbl domain in that protein and was the most prominent igm - binding domain in an earlier study of var2csa - type pfemp1 ( 39 ) . \n similarly , we mapped the igm - binding capacity of pfl0020w and mal6p1.4 to their c - terminal domains ( dbl4_6 and dbl3_9 , respectively ) ( fig . \n we were unable to map the igm - binding domain of mal6p1.316 with our recombinant constructs . \n the graphs show the ability of domains in var2csa - type ( a ) and non - var2csa - type ( b ) pfemp1 proteins to bind igm ( white ) and iga ( black ) . \n means ( histograms ) and standard deviations ( error bars ) for triplicate measurements from a representative experiment ( of three ) are shown . \n we used surface plasmon resonance analysis to show that the binding affinity of igm for each of the domains identified to bind igm by elisa was high , with kd values in the nanomolar range ( table 1 ) , which is the same range as that reported previously ( 15 ) . \n triple - domain constructs had higher affinities ( lower kd values ) than single - domain constructs , which may be related to the construct conformation but likely also reflects the fact that two igm - binding domains ( dbl2_7 and dbl4_9 ) were present in our mal6p1.4 triple - domain construct ( fig . 4 and table 1 ) . surface plasmon resonance analysis of igm binding to recombinant pfemp1 domains na , not available because the domain did not bind igm . \n the kd values were calculated based on a 1:1 binding model from 3 to 6 independent analyses , with 4 to 8 different concentrations tested in duplicates per analysis , and the values are shown with composite standard deviations . \n all constructs displayed rapid association kinetics , with ka values of 1 10 to 10 10 m s. the dissociation kinetics were more variable but were slower for the triple - domain constructs than the corresponding single - domain constructs , suggesting that the higher - order conformation of the pfemp1 proteins contributes to retention of igm once it is bound . \n fc - dependent igm binding to pfemp1 has previously been shown for parasites expressing csa - adherent var2csa - type or rosette - mediating pfemp1 variants ( reviewed in reference 18 ) . \n we therefore tested the abilities of erythrocytes infected by p. falciparum expressing either pfl0030c or each of the four new non - var2csa - type pfemp1 proteins to bind to csa and to form rosettes . \n we included parasites expressing the pfemp1 protein hb3var06 as a positive control in the rosetting assays , as this pfemp1 is known to mediate igm - dependent rosette formation ( 15 ) . \n ies expressing the var2csa - type pfl0030c protein adhered strongly to csa - expressing bewo cells , in accordance with previous reports ( 6 , 37 ) , while none of the other pfemp1 proteins mediated significant adhesion to this receptor ( fig . \n none of the five igm - binding pfemp1 proteins studied here was able to mediate formation of rosettes ( fig . \n we previously reported that hb3var06-mediated rosetting requires soluble serum factors ( 15 , 20 ) , but serum did not lead to rosetting in ies expressing any of our new igm - binding pfemp1 proteins ( fig . \n 5b ) . functional properties of erythrocytes infected by p. falciparum parasites expressing defined pfemp1 . \n the graphs show the ability of ie surface - expressed pfemp1 proteins to mediate adhesion to csa on bewo cells ( a ) or to mediate rosetting ( b ) in the presence ( white ) or absence ( black ) of serum . \n means ( bars ) and standard deviations ( error bars ) for triplicate measurements from a representative experiment ( of three ) are shown . \n fc - dependent igm binding to var2csa - type pfemp1 markedly inhibits the binding of specific igg to the ie surface and subsequent phagocytosis of opsonized ies ( 19 ) . \n however , this is not the case for parasites expressing the rosette - mediating hb3var06 protein , as igm binding has a limited effect on the phagocytosis of antibody - opsonized ies ( 15 ) . to test whether igm could inhibit binding of pfemp1-specific igg to ies positive for each of the new igm - binding pfemp1 proteins identified here , we opsonized the ies with immune human plasma in the absence or presence of igm and subsequently measured phagocytosis by using a robust in vitro assay ( 38 ) . \n phagocytosis of ies expressing the var2csa - type pfl0030c protein was markedly ( about two - thirds ) and significantly reduced in the presence of igm , in accordance with previous data ( 19 ) ( fig . \n . a smaller or nonsignificant impact of igm on igg - dependent phagocytosis was seen for each of the other pfemp1 proteins ( fig . \n , they therefore resembled the rosette - mediating pfemp1 hb3var06 ( 15 ) , although none of them appear to be involved in rosetting ( fig . \n the graph shows the ability of igm ( white ) and iga ( black ) to interfere with igg - specific opsonization and phagocytosis of erythrocytes infected by p. falciparum parasites expressing defined pfemp1 . \n overall means ( bars ) and standard deviations ( error bars ) for three independent experiments are shown . * * , significant differences between the two bars . \n the particular virulence of p. falciparum parasites is related to their ability to express members of the clonally variant protein family pfemp1 on the surfaces of the erythrocytes they infect ( reviewed in reference 44 ) . \n the pfemp1 proteins mediate adhesion of ies to different host receptors in various tissues to avoid ie destruction in the spleen ( 45 ) . \n each parasite genome contains about 60 pfemp1-encoding var genes that are transcribed in a mutually exclusive manner ( 4648 ) . \n thus , normally only one pfemp1 is expressed on the ie surface at any given time , but the parasites can switch transcription among the different var genes from one asexual 48-h multiplication cycle to the next , thereby changing the adhesive and antigenic properties of the ies ( 46 , 47 ) . by now , it is clear that certain structurally defined and functionally related pfemp1 subfamilies are involved in particular types of severe malaria ( reviewed in reference 49 ) . the role of endothelial protein c receptor ( epcr)-adhering pfemp1 proteins sharing domain cassette 8 ( dc8 ) and dc13 motifs ( 50 , 51 ) in the pathogenesis of cerebral malaria is a recent example . the similar role of dc4-containing pfemp1 proteins adhering to icam-1 is another ( 33 ) . \n finally , var2csa - type pfemp1 proteins adhering to csa have a well - established key role in the pathogenesis of placental malaria ( reviewed in reference 52 ) . the tissue - specific adhesion mediated by these types of pfemp1 \n it is much less obvious why the ability of some pfemp1 proteins to bind igm via fc should be linked to malaria severity , as has repeatedly been shown ( reviewed in reference 18 ) . \n several pfemp1 domains have been implicated in igm binding ( 15 , 36 , 39 , 40 , 42 , 43 ) , but a unifying picture has not yet emerged . \n furthermore , it is unclear whether fc - specific binding of igm to ies is restricted to parasites expressing pfemp1 proteins that can adhere to csa or lead to the formation of rosettes . \n finally , it is not known how many pfemp1 proteins encoded by any single p. falciparum genome possess this phenotype . \n individual p. falciparum parasites transcribe only a single var gene at a time , and this mutually exclusive transcription ensures that normally only a single pfemp1 variant is present on the surface of any given ie ( 5355 ) . even at the population level , the diversity of pfemp1 expression is often limited due to the presence of epigenetic memory ( reviewed in references 56 and 57 ) . to overcome this difficulty , we selected pvbh - transfected p. falciparum g6 clonal parasites for resistance to blasticidin , which effectively erases the epigenetic var gene transcription memory ( 2931 ) . following induction of var switching , \n we single - cell sorted ies from this population based on their capacity to bind igm at the ie surface , and we obtained subclones and sublines with dominant transcription of four different var genes ( fig . \n one was pfl0030c ( 6 ) , which encodes the var2csa - type pfemp1 in the p. falciparum 3d7 clone ( from which the g6 clone is derived ) and was already known to bind igm via fc ( 19 , 39 , 40 ) . \n the other three ( mal6p1.316 , pfl0020w , and pf070139 ) encode pfemp1 proteins not previously reported to bind igm . \n however , all contain at least one dbl-type domain , similar to the c - terminal domains previously implicated in the igm - binding capacity of var2csa - type pfemp1 ( 39 , 40 ) . \n finally , the var gene mal6p1.4 , which encodes a pfemp1 with three c - terminal dbl domains in tandem , was also prominently transcribed in several subclones / sublines . \n two of the genes ( pf0020w and mal6p1.316 ) additionally encode a c - terminal dbl domain . \n this further reinforced their candidature , as we recently mapped fc-specific binding of igm to a domain of that type ( 15 ) . \n the fc - specific binding of igm to pfemp1 proteins has consistently been shown to involve the c3-c4 domains in the fc part of pentameric igm . \n thus far , at least three of the dbl domains in var2csa - type pfemp1 ( dblpam2_2 , dblpam5_6 , and dblpam10_7 ) have been implicated ( 39 , 40 ) . \n we resolved this uncertainty by using recombinant constructs of each of the dbl domains in pfl0030c to map the igm - binding site to the penultimate n - terminal domain dblpam5_6 ( fig . \n similar confusion has existed with respect to igm binding to non - var2csa - type pfemp1 proteins , in which n - terminal cysteine - rich interdomain region ( cidr ) , central dbl , and c - terminal dbl domains have all been implicated ( 15 , 42 , 43 ) . \n we found that dbl domains near the c terminus were responsible for mediating binding to igm in the pfemp1 proteins studied here . \n one of them ( mal6p1.4 ) even contained two igm - binding domains ( dbl2_7 and dbl3_9 ) , something which has not been observed previously . \n overall , presently available evidence points to dbl and dbl domains near or at the c terminus as the key igm - binding elements in pfemp1 proteins . \n the functional significance of fc - mediated binding of igm to pfemp1 proteins remains unclear ( 18 ) . in the case of var2csa - type pfemp1 , it appears to serve an immunoevasive role that interferes with phagocytosis of igg - opsonized ies without compromising the adhesive function of pfemp1 ( 19 ) . \n thus , pf0030c - expressing ies adhered strongly to csa , whether igm was present or not ( fig . \n 5a ) , and igm markedly inhibited phagocytosis of igg - opsonized ies expressing this pfemp1 ( fig . \n in contrast to these characteristics of var2csa - type pfemp1 , we recently reported that fc - dependent binding of igm does not protect parasites expressing the rosette - mediating hb3var06 protein from phagocytosis of igg - opsonized ies but rather may serve to augment low - affinity adhesive interactions between the pfemp1 head structure and as yet undefined carbohydrate moieties ( 15 ) . \n fc - specific binding of igm to the new pfemp1 proteins identified here did not markedly protect them from phagocytosis following opsonization by antigen - specific igg ( fig . \n , they resemble the rosette - mediating pfemp1 protein hb3var06 , which suggests that they have an elongated conformation . \n only one of them ( mal6p1.316 ) contains an n - terminal dbl domain of a type previously associated with rosetting ( dbl1.5 , dbl1.6 , dbl1.8 , or dbl2 ) ( 1013 , 15 ) , and none of them mediated rosetting ( fig . \n these findings establish for the first time that the ability to bind igm via fc is not restricted to var2csa - type and rosette - mediating pfemp1 variants . \n they also indirectly support our hypothesis that an important function of igm binding is to augment low - affinity adhesive interactions between the pfemp1 head structures and host endothelial receptors ( 15 ) . \n only when such receptors are also found on erythrocytes would this lead to rosetting . in conclusion , \n we have provided evidence that each p. falciparum genome encodes several pfemp1 proteins with the capacity to bind fc. we can not formally rule out that other parasite - encoded ie proteins , e.g. , rosette - mediating rifins ( 58 , 59 ) , also have affinity for fc , but there is presently no evidence to support that possibility . \n we identified five pfemp1 proteins in p. falciparum 3d7/nf54 parasites , but this is almost certainly an underestimation considering the limited number of subclones we investigated . \n our findings confirm that fc - specific binding of igm to var2csa - type pfemp1 has an immunoevasive function . \n however , they also support recent data pointing to alternative roles for fc - mediated igm binding to other types of pfemp1 ( 15 , 18 , 20 ) . in any case \n , the igm - binding phenotype is likely to be both common and important , as we showed that fc - dependent binding of igm is not restricted to pfemp1 proteins mediating either adhesion to csa or rosetting . \n although rosetting has been associated with expression of pfemp1 proteins causing severe malaria , the relationship is not absolute ( reviewed in reference 60 ) . indeed , \n several pfemp1 proteins that mediate adhesion to epcr and icam-1 , phenotypes that have repeatedly been associated with severe malaria , do not mediate formation of rosettes ( 50 ) . \n future analysis of the interrelationship among various pfemp1 phenotypes that have been individually associated with malaria severity may well produce important new insights . \n this prediction is supported by the fact that one of the pfemp1 proteins studied here ( mal6p1.316 ) , which bound fc but did not mediate formation of rosettes , contains a cidr of a type ( cidr1.8 ) that is involved in adhesion to epcr ( 51 ) .", "role": "user" }, { "content": "the plasmodium falciparum erythrocyte membrane protein 1 ( pfemp1 ) adhesive proteins expressed on the surfaces of infected erythrocytes ( ies ) are of key importance in the pathogenesis of p. falciparum malaria . \n several structurally and functionally defined pfemp1 types have been associated with severe clinical manifestations , such as cerebral malaria in children and placental malaria in pregnant women . \n pfemp1 that can bind the fc part of igm ( fc ) characterizes one such type , although the functional significance of this igm binding to pfemp1 remains unclear . in this study , we report the identification and functional analysis of five igm - binding pfemp1 proteins encoded by p. falciparum nf54 . \n in addition to the var2csa - type pfl0030c protein , already known to bind fc and to mediate chondroitin sulfate a ( csa)-specific adhesion of ies in the placenta , we found four pfemp1 proteins not previously known to bind igm this way . \n although they all contained duffy binding - like ( dbl ) domains similar to those in var2csa - type pfemp1 , they did not mediate ie adhesion to csa , and igm binding did not shield ies from phagocytosis of igg - opsonized ies . in this way , these new igm - binding pfemp1 proteins resemble the rosette - mediating and igm - binding pfemp1 hb3var06 , but none of them mediated formation of rosettes . \n we could map the capacity for fc - specific igm binding to dbl domains near the c terminus for three of the four pfemp1 proteins tested . \n our study provides new evidence regarding fc - dependent binding of igm to pfemp1 , which appears to be a common and multifunctional phenotype .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: according to the american heart association ( aha ) nutrition committee , \" some popular high - protein / low - carbohydrate diets limit carbohydrates to 10 to 20 g / d , which is one fifth of the minimum 100 g / day that is necessary to prevent loss of lean muscle tissue . \" clearly , this is an incorrect statement since catabolism of lean body mass is reduced by ketone bodies ( possibly through suppression of the activity of the branched - chain 2-oxo acid dehydrogenase ) , which and probably explains the preservation of lean tissue observed during very - low - carbohydrate diets . \n unfortunately , the leading exercise physiology textbook also claims a \" low - carbohydrate diet sets the stage for a significant loss of lean tissue as the body recruits amino acids from muscle to maintain blood glucose via gluconeogenesis . \" thus , it is certainly time to set the record straight . \n the hormonal changes associated with a low carbohydrate diet include a reduction in the circulating levels of insulin along with increased levels of glucagon . \n this activates phosphoenolpyruvate carboxykinase , fructose 1,6-biphosphatase , and glucose 6-phosphatase and also inhibits pyruvate kinase , 6-phosphofructo-1-kinase , and glucokinase . \n however , the body limits glucose utilization to reduce the need for gluconeogenesis . in the liver in the well - fed state , \n acetyl coa formed during the -oxidation of fatty acids is oxidized to co2 and h2o in the citric acid cycle . however , when the rate of mobilization of fatty acids from adipose tissue is accelerated , as , for example , during very low carbohydrate intake , the liver converts acetyl coa into ketone bodies : acetoacetate and 3-hydroxybutyrate . \n the liver can not utilize ketone bodies because it lacks the mitochondrial enzyme succinyl coa:3-ketoacid coa transferase required for activation of acetoacetate to acetoacetyl coa . \n therefore , ketone bodies flow from the liver to extra - hepatic tissues ( e.g. , brain ) for use as a fuel ; this spares glucose metabolism via a mechanism similar to the sparing of glucose by oxidation of fatty acids as an alternative fuel . \n indeed , the use of ketone bodies replaces most of the glucose required by the brain . \n not all amino acid carbon will yield glucose ; on average , 1.6 g of amino acids is required to synthesize 1 g of glucose . \n thus , to keep the brain supplied with glucose at rate of 110 to 120 g / day , the breakdown of 160 to 200 g of protein ( close to 1 kg of muscle tissue ) would be required . \n this is clearly undesirable , and the body limits glucose utilization to reduce the need for gluconeogenesis and so spare muscle tissue . in comparison with glucose , \n whereas 100 g of glucose generates 8.7 kg of atp , 100 g of 3-hydroxybutyrate can yield 10.5 kg of atp , and 100 g of acetoacetate 9.4 kg of atp . \n the brain will use ketone bodies whenever provided with them ( i.e. , whenever blood ketone body levels rise ) . the blood - brain barrier transporter for ketone bodies \n is induced during starvation or very low carbohydrate intake , further promoting the flow of ketone bodies . \n this transporter has a km that exceeds the concentrations of circulating ketone bodies that occur during starvation or very low carbohydrate intake , and a vmax well in excess of energy demands . \n . however , continued use of some glucose appears obligatory and is supplied by way of hepatic gluconeogenesis . finally , \n because of the inactivation of pyruvate dehydrogenase ( by the low insulin concentration ) , the glucose that is used by tissues outside the brain is largely only partially broken down to pyruvate and lactate , which can then be recycled in the liver trough gluconeogensis . therefore , red blood cells , for instance , which have an obligatory requirement for glucose , are not depleting the body of glucose . \n interestingly , volek et al . recently reported that a very - low - carbohydrate diet resulted in a significant reduction in fat mass and a concomitant increase in lean body mass in normal - weight men . \n they hypothesized that elevated -hydroxybutyrate concentrations may have played a minor role in preventing catabolism of lean tissue but other anabolic hormones were likely involved ( e.g. , growth hormone ) . \n diabetic patients know that the detection in their urine of the ketone bodies is a danger signal that their diabetes is poorly controlled . indeed , in severely uncontrolled diabetes , if the ketone bodies are produced in massive supranormal quantities , they are associated with ketoacidosis . in this life - threatening complication of diabetes mellitus , \n the acids 3-hydroxybutyric acid and acetoacetic acid are produced rapidly , causing high concentrations of protons , which overwhelm the body 's acid - base buffering system . \n however , during very low carbohydrate intake , the regulated and controlled production of ketone bodies causes a harmless physiological state known as dietary ketosis . in ketosis , the blood ph remains buffered within normal limits . \n ketone bodies have effects on insulin and glucagon secretions that potentially contribute to the control of the rate of their own formation because of antilipolytic and lipolytic hormones , respectively . \n interestingly , the effects of ketone body metabolism suggest that mild ketosis may offer therapeutic potential in a variety of different common and rare disease states \n . the large categories of disease for which ketones may have therapeutic effects are : 1 ) diseases of substrate insufficiency or insulin resistance ; 2 ) diseases resulting from free radical damage ; and 3 ) disease resulting from hypoxia . \n although some studies suggest that pre - exercise muscle glycogen stores determine capacity for prolonged exercise , there is no clear requirement for dietary carbohydrates for human adults . \n current carbohydrate recommendations are based on 1 ) preventing ketosis , and 2 ) providing glucose beyond minimal needs . \n however , it is clear that ketosis is not harmful [ 14 - 16 ] , except in the high levels seen in type 1 diabetes . \n also , the need to provide glucose above minimal needs is exactly what has never been demonstrated . \n indeed , the national research council has not established recommended dietary allowance ( rda ) for carbohydrates , probably because the human body can adapt to a carbohydrate - free diet and manufacture the glucose it needs . \n for example , mcdonald claimed that healthy , moderately active adults require at least 200 g of carbohydrate daily to sustain normal brain metabolism and muscle function . \n low - carbohydrate diets have been avoided because of the high - fat nature of the diets and the \" predicted \" associated hypercholesterolemia . \n however , serum lipids generally improve with the low - carbohydrate diet , especially the triglyceride and hdl measurements . in sharp contrast , high - carbohydrate diets , which reduce high - density lipoprotein ( hdl ) cholesterol and raise triglyceride levels , exacerbate the metabolic manifestations of the insulin resistance syndrome . finally , all fats raise hdl cholesterol . \n the relative potency of fatty acid classes in raising hdl cholesterol is saturated > monounsaturated > > polyunsaturated . \n thus , it is clear that replacement of total fat ( of any fatty acid distribution ) with carbohydrates results in significant reductions in hdl cholesterol . \n indeed , recent studies of carbohydrate intake and its relationship to the development of chd and type 2 diabetes have been rather revealing , showing that an increase in carbohydrate intake is related to increases in both conditions . \n contrary to popular belief supported by the leading physiology and biochemistry textbooks , there is sufficient population of glucose transporters in all cell membranes at all times to ensure enough glucose uptake to satisfy the cell 's respiration , even in the absence of insulin . \n insulin can and does increase the number of these transporters in some cells but glucose uptake is never truly insulin dependent . even under conditions of extreme ketoacidosis \n there is no significant membrane barrier to glucose uptake the block occurs \" lower down \" in the metabolic pathway where the excess of ketones competitively blocks the metabolites of glucose entering the citric acid cycle . thus , insulin is not needed for glucose uptake and utilization in man . \n in fact , the process appears to be general for all polar ( water - soluble ) substrates , as transporters are the mechanism by which they are transported across the highly non - polar ( lipid ) cell membranes . when insulin is administered to people with diabetes who are fasting \n however , this is not the case and is just another metabolic legend arising from in vitro rat data . \n it has been shown that insulin at concentrations that are within the normal physiological range lowers blood glucose through inhibiting hepatic glucose production . \n it has been claimed that carbohydrates serve as a primer for fat catabolism ( \" fats burn in a carbohydrate flame \" ) . however , as pointed out by robergs and roberts , this is an incorrect contention . in skeletal muscle , \n fat certainly does not burn in a carbohydrate flame , as skeletal muscle does not have sufficient quantities of the enzymes to convert glycolytic intermediates into molecules that can be transported into the mitochondria to supplement citric acid cycle intermediates . \n further , the production of acetoacyl coa , a substrate of ketone body formation , can occur only in the liver and thus does not apply to skeletal muscle metabolism . \n human skeletal muscle can oxidize at least seven amino acids : leucine , isoleucine , valine , glutamate , asparagine , aspartate and alanine . of these amino acids , \n however , oxidation of only the branched chain amino acids ( leucine , isoleucine and valine ) appears to be increased during catabolic states such as exercise . when muscle glycogen and blood glucose concentrations are low , the incorporation of the carbon skeletons from amino acids into the citric acid cycle is important for maintaining the concentrations of the intermediates , and therefore a high rate of mitochondrial respiration . \n thus , both muscle fat and carbohydrate burn in an amino acid flame . as discussed by robergs and roberts , \n amino acid catabolism during exercise is important for three reasons : 1 ) for free energy during exercise to fuel muscle contraction ; 2 ) to increase concentrations of citric acid cycle intermediates and therefore support carbohydrate and lipid catabolism ; and 3 ) to serve as gluconeogenic precursors . \n it has also been claimed that carbohydrate provides the only macronutrient substrate whose stored energy generates atp non - aerobically . \n this is not the case , however , since several studies have shown that amino acid catabolism also provides a source of anaerobic energy production , aspartate , for example , can be fermented to succinate or propionate . \n interestingly , ivy et al . and saunders et al . , reported that the addition of protein to a carbohydrate supplement enhanced endurance performance above that which occurred with carbohydrate alone .", "role": "user" }, { "content": "during very low carbohydrate intake , the regulated and controlled production of ketone bodies causes a harmless physiological state known as dietary ketosis . \n ketone bodies flow from the liver to extra - hepatic tissues ( e.g. , brain ) for use as a fuel ; this spares glucose metabolism via a mechanism similar to the sparing of glucose by oxidation of fatty acids as an alternative fuel . in comparison with glucose , \n the ketone bodies are actually a very good respiratory fuel . \n indeed , there is no clear requirement for dietary carbohydrates for human adults . \n interestingly , the effects of ketone body metabolism suggest that mild ketosis may offer therapeutic potential in a variety of different common and rare disease states . also , the recent landmark study showed that a very - low - carbohydrate diet resulted in a significant reduction in fat mass and a concomitant increase in lean body mass in normal - weight men . \n contrary to popular belief , insulin is not needed for glucose uptake and utilization in man . \n finally , both muscle fat and carbohydrate burn in an amino acid flame .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: adequate treatment planning is one of the most important factors in successful conventional implant prosthesis , requiring clear communication between the prosthetic dentist and surgeon . \n it becomes more critical when the patient has unfavorable conditions such as a severely resorbed alveolar ridge . \n treatment planning must be based on a thorough dental diagnosis and a prognosis assessment for the remaining dentition . \n improper planning may result in a range of prosthetic complications and a poor prognosis due to unfavorable mechanical stress and poor oral hygiene . \n partial edentulism can be restored with implants by several methods.1 in considering implant placement , the numbers and position of implants should always contribute to the convenience and longevity of a definitive prosthesis fulfilling esthetic and functional demands . \n implants in partial edentulous patients involve either fixed type implant prosthesis or removable type implant prosthesis . \n there are several reports that removable partial dentures with posteriorly - placed implants showed a favorable outcome and counted as an adequate treatment option.2,3 this clinical report concerns the rescuing procedure for inadequately planned prosthodontic case for a partially edentulous patient with severely resorbed alveolar ridge . \n predetermined impractical fixed type prosthesis to restore posterior teeth was properly re - evaluated and restored with a removable partial denture with milled bars and magnetic attachments . \n a 26-year - old male patient presented to the department of prosthodontics at yonsei university dental hospital to restore the posterior edentulous area . \n radiographic examination showed that implants were placed in the area of teeth number # 17 , 16 , 22 , 25 and 27 and clinical examination revealed 3 degree of hypermobility on teeth number # 15 and # 24 ( fig . \n 1 ) . teeth # 15 and 24 were diagnosed as hopeless and were extracted . \n impressions were made with alginate and casts were poured and mounted in centric relation for prosthodontic evaluation . \n a provisional denture was fabricated on the articulator and placed in the patient 's mouth . \n an impression was made with implant level impression coping and casts were mounted for prosthetic treatment planning . \n it was determined that implant supported fixed partial denture was not indicated due to severe bone resorption resulting in a poor crown - to - root ratio and buccal placement of implants . \n so , the treatment option of removable partial denture was presented to the patient which involved fabrication of a milled bar with a magnetic attachment . a customized abutment and \n a crown for tooth number # 22 were fabricated on the articulator and delivered to the patient . \n the milled bar was fabricated accounting available interocclusal space , as measured from the vinyl index on mounted casts of provisional denture . \n a two - degree tapered milled bar wax pattern was fabricated on the master cast and magnet keepers were embedded in the pattern , which was then invested and casted ( figs \n the fit of the milled bar and framework were checked in patient 's mouth , and the fit between them was adjusted with a tungsten carbide bur ( bredent medical , senden , germany ) , and the maxillomandibular relationship was recorded for denture fabrication using an occlusal rim . \n the prosthesis was remounted on the articulator after polymerization and the occlusion was adjusted on the articulator . \n the prosthesis was inserted ; phonetics , esthetics , function , and comfort were clinically verified . \n the magnet was embedded in the denture with gc pattern resin at 2 weeks after initial placement of the final prosthesis . \n postoperative instructions were given to the patient , and no complications have arisen since insertion of the prosthesis five years ago . \n as number of implants and their position depend on prosthesis type , making presurgical prosthetic treatment planning critical for the success of the prosthesis . in our case , implant surgery had been performed without proper evaluation of remaining teeth or adequate prosthodontic treatment planning . as a result , two hopeless teeth had to be extracted at six months after initial implant surgery . because of additional extraction followed implant surgery , supplementary implants were necessary for the fixed - type prosthesis especially due to poor crown to root ratio . however , the patient rejected additional implants placement but accepted a removable prosthesis to reduce treatment time and cost . \n removable prosthesis is more advantageous as restore prosthesis with a poor crown - to - root ratio caused by severe resorption of the alveolar ridge . \n though guidelines for the crown - to - root ratio in natural teeth are not applicable to implants4 , the ratio is still a prognostic indicator . when treating partial edentulism with implants , an implant - supported , fixed - type prosthesis is usually the first option . \n it is reported that implant supported removable partial denture is suitable and has advantages to restore kennedy class i posterior edentulous patients.5 those advantages include enhancing retentive or supportive elements of removable partial dentures.6 - 7 strategically - placed dental implants in conjunction with the remaining natural teeth can also establish a favorable removable partial denture design by significantly reducing the effect of the reciprocal arm and improving the fulcrum line position.7 in this case two milled bars with magnet attachments connected to upper posterior implants were used to provide enhanced support for the denture . \n this report illustrates how improper planning may prolong treatment and give rise to complicated treatment procedure with poor prognosis . \n countermeasures in this case consisted of correcting to an implant supported removable partial denture in conjunction with careful evaluation of the oral condition during treatment . \n dental treatment should be based on an adequate treatment plan , and procedures must be guided by proper planning achieved by cooperation between implant surgeon and restorative dentist . \n implant - supported removable - type prosthesis with milled bar and attachment is a viable and useful treatment option in patients with improperly placed implants .", "role": "user" }, { "content": "presurgical prosthetic treatment planning is critical for the success of the implant prosthesis . \n inadequate treatment plan , due to insufficient discussion between prosthodontist , and surgeon , may result in poor prognosis . \n a 26-year - old male patient was referred for prosthodontic treatment after implant was placed in the area of teeth # 17 , 16 , 22 , 25 and 27 , without adequate discussion nor the treatment planning between oral surgeon and prosthodontist . \n it was found that the patient had two hopeless teeth , and a severely resorbed alveolar ridge . \n additional tooth extraction was needed and the type of definitive prosthesis was shifted from fixed type to removable one . \n proper pre - surgical treatment planning is essential for the good prognosis . \n implant - supported removable prosthesis on milled bars may be a useful treatment option in patients with incorrect angled placement on severely resorbed alveolar ridge .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: henoch - schnlein purpura ( hsp ) is a small vessel leukocytoclastic vasculitis that typically presents in childhood . \n the incidence has been estimated at 10 cases per 100,000 children per year , with a slight male preponderance ( 1 ) . \n the condition is believed to be triggered by exposure to an unknown antigen with subsequent vascular deposition of iga containing immune complexes . \n multi - system manifestations have been described , most commonly affecting the skin , joints , and renal and gastrointestinal system . \n the condition is commonly self - limiting and management usually entails symptomatic treatment and the use of immunosuppressive therapy . although there is a wealth of discussion relating to paediatric hsp , there is little equivalent consideration regarding the adult form of the disease . furthermore , there is limited discussion relating to intestinal manifestations of adult onset hsp . \n it is on this basis that we describe a case of small bowel ischaemia and perforation in a 42-year - old adult with previously undiagnosed hsp . \n a previously healthy 42-year - old female was referred to a dermatology clinic with a few days history of painless non - blanching papular lesions on her legs ( figure 1 ) , swollen hands and generalised myalgia . \n an infection screen ( including hepatitis serology and anti - streptolysin o titre ) , immunology screen and skin biopsy was performed and the patient was given a weeklong course of oral prednisolone at a dose of 15 mg once daily . \n a week later the patient required emergency admission with a three day history of generalised abdominal pain and vomiting . \n however , computerised tomography revealed extensive small bowel wall thickening and ascites without evidence of mechanical obstruction or viscus perforation ( figure 2 ) . \n in addition , the c - reactive protein ( crp ) and urea were elevated with a raised urine protein / creatinine ratio suggestive of nephritis . \n overnight the patient deteriorated rapidly developing peritonitis and septic shock . following a bolus dose of intravenous methylprednisolone , \n an emergency laparotomy revealed turbid ascites and patchy ischaemia throughout the entire small bowel with a perforation 150 centimetres from the duodenojejunal flexure . \n post - operatively , the patient was admitted to the intensive care unit for multi - organ support and commenced on a course of intravenous methylprednisolone with two cycles of intravenous cyclophosphamide . \n ct scan showing small bowel wall thickening and ascites . on the tenth post - operative day \n following a brief period of cardiopulmonary resuscitation during which cardiac output was restored , a temporary pacing wire was placed to prevent further dysrhythmias . \n the histopathology report for the skin biopsy showed severe acute necrotising leukocytoclastic vasculitis affecting small and medium - sized vessels . \n the infection and immunology screening tests were negative , in particular iga was not detected on immunofluorescence . \n histological analysis of the small bowel segment revealed the presence of a small vessel vasculitis with typical fibrinoid necrosis suggestive of hsp ( figure 3 ) . \n a small - sized artery displaying inflammation of the wall and focally fibrinoid necrosis . over the next two weeks the patient made steady progress towards recovery , although this was complicated by the formation of a large pelvic abscess , identified on computed tomography , which required the insertion of a percutaneous drain . \n just over one month after her initial presentation , the patient was discharged from hospital but continues on oral steroids and intravenous cyclophosphamide . at initial \n follow up , her clinical status and laboratory findings ( crp , urea and urine protein / creatinine ratio ) had all significantly improved . in due time , a reversal of her ileostomy will be considered . \n hsp can present at any age , however , it is typically a disease of childhood . \n the majority of patients are younger than ten years old and there is little epidemiological data relating to adolescence and adulthood . \n common clinical manifestations include a purpuric rash , abdominal pain , arthralgia / arthritis and renal disease . the gastrointestinal manifestations of hsp are more commonly described in children and reports suggest that adults rarely require surgical intervention ( 2 ) . \n although iga complexes were not identified in the skin biopsy in this report , the histopathological assessment of the small bowel revealed features highly suggestive of a diagnosis of hsp . \n in addition , the clinical findings in this case satisfy the diagnostic criteria suggested by the american college of rheumatology and the european league against rheumatism ( see figure 4 ) ( 3 ) . \n indeed , a recent study from massachusetts general hospital highlights a subset of hsp cases with no evidence of vascular iga deposition in the skin ( 3 ) . \n american college of rheumatology ( top ) and the european league against rheumatism diagnostic criteria ( bottom ) of hsp . \n we only identified six similar english language case reports ( describing seven patients ) in the medical literature ( 4 - 9 ) . \n five patients were male and although only four displayed gastrointestinal features at initial presentation , six patients required surgical intervention . \n five patients were given steroid therapy ; of which three began this treatment before the onset of an acute abdominal picture , which is identical to our presented scenario . \n outcomes were not always positive ( three patients died ) , although one case was complicated by cardiac and renal involvement and gastrointestinal disease was only diagnosed at post - mortem ( 8) . although a recognised risk factor for gastro - intestinal bleeding and perforation , steroid therapy early in the course of an episode of hsp has been shown to be beneficial in preventing extra - renal symptoms ( 10 ) . in our case report \n it is impossible to be certain about the role of oral steroids in the small bowel perforation in this case , but it would appear unlikely that glucocorticoid therapy would be responsible for patchy small bowel ischaemia . \n the authors consider the intra - operative findings more likely representative of a global pathological process attributable to hsp vasculitis . despite hsp typically following a benign self - limiting course , gastrointestinal manifestations can be rapidly fatal . \n this report demonstrates the importance of considering systemic vasculitides such as hsp in the differential diagnosis of adults presenting with acute abdominal symptoms with preceding symptoms and signs that may indicate an underlying vasculitic process .", "role": "user" }, { "content": "henoch - schnlein purpura is a small vessel vasculitis with multi - system manifestations that commonly affects children . \n we describe a case of new onset henoch - schnlein purpura in a previously healthy 42-year - old female who required an emergency laparotomy for small bowel perforation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: chronic venous disease ( cvd ) is one of the most common disorders in northern and western europe . according to the ceap classification , \n cvd comprises those clinical entities that are characterized by visible venous ecstasies but which are not associated with an identifiable mechanism of venous dysfunction ( porter and moneta 1995 ; kistner et al . \n the clinical presentation of cvd ranges from complication - free telangiectasias or reticular veins , via varicose veins ( vv ) without oedema and skin changes , to venous ulceration . \n varicose veins requiring medical care but lacking signs of oedema or skin changes are sometimes referred to as \n if skin changes or ulcerations occur , patients are defined as having chronic vein insufficiency ( cvi ) , classified as ceap c3 to c6 ( ruckley et al . \n defined in this way , cvd represents a summary term comprising patients with either simple vv or cvi ( eklof et al . \n epidemiological studies of cvd have revealed that vv affects 1646% of females and 1240% of males ( evans et al . \n the prevalence of cvi ranges from 5 to 18% in females , and from 7 to 15% in males ( evans et al . \n although cvd is relatively common , the aetiologic factors predisposing individuals to the dilatation , elongation and tortuosity of the saphenous vein and its tributaries are still poorly understood . \n the clinically observed thickening of the vessel wall appears to be associated with an increase of thick and disorganized collagen bundles ( sansilvestri - morel et al . \n in addition to age , sex and obesity , family history was also found to be a major risk factor for cvd ( coon et al . \n however , family data were often inconsistent and confounded by selection bias ( meissner 2004 ) . \n a cvd twin study reported 84% phenotypic concordance between monozygotic twins , compared to only 39% between dizygotic twins ( niermann 1964 ) . in view of these ambiguities \n , we set out to formally assess the heritability of cvd in a large sample of affected nuclear families from all over germany . \n between october 2005 and july 2008 , a total of 2,701 index patients with cvd were recruited at the capio mosel - eifel - clinic ( capio mec , bad bertrich , germany ) , which is specialized in the treatment of severe forms of cvd . \n the ethics committee of the kiel medical faculty and the local data protection authorities both approved the study . \n exclusion criteria were clinically overt debility , any signs of acute deep vein thrombosis and congenital causes of cvd . \n all patients suffered from severe injury of their great saphenous vein and had stayed in the clinic for at least 4 days . \n a questionnaire was administered to each index patient by capio mec staff to obtain information on their demographic and personal characteristics ( sex , date and place of birth , parental origin ) as well as their medical history ( medical treatment , pain , severe operations , age at cvd onset , presence of deep vein thrombosis , phlebitis ) . \n duration of disease ( in years ) was calculated from these data as the difference between age at ascertainment and age at onset . \n a 30-ml blood sample for further genetic analysis , including candidate gene and genome wide association studies , was taken by capio mec staff and immediately frozen at 20c . \n genomic dna was prepared from defrosted blood samples using the invisorb blood giga kit ( invitec , berlin , germany ) . \n patients were also interviewed about the cvd status of all living first degree relatives ( parents and siblings ) . \n family information was provided by all 2,701 index patients , which generated 4,033 nuclear families comprising 16,434 individuals for heritability analysis ( table 1).table 1data base for the estimation of narrow - sense heritability hceap gradeno . \n individualsany ( cvd)2,7014,03316,434c2 ( vv)4486622,706c31,6982,53910,317c44416562,702c5&c6114174701c3 to c6 ( cvi)2,2533,36913,720c2 to c42,5873,85715,725 data base for the estimation of narrow - sense heritability h all index patients were classified according to the severity , cause , site and specific abnormalities of their disease , using the ceap classification . \n the ceap classification was developed in 1994 by an international ad hoc committee of the american venous forum , endorsed by the society for vascular surgery and incorporated into the reporting standards in venous disease in 1995 ( porter and moneta 1995 ; kistner et al . \n the ceap classification underwent its first official review and revision by an international panel under the auspices of the american venous forum in 2004 by eklof et al . \n clinical severity was the most important criterion for the initial assessment of index patients in our study . \n there are seven grades of increasing clinical severity of cvd : c0 , no evidence for venous disease ; c1 , superficial spider veins ; c2 , simple vv ; c3 , oedema of venous origin ; c4 , skin changes ascribed to venous disease ( e.g. pigmentation , venous eczema and lipodermatosclerosis ) ; c5 , skin changes as defined above , with healed ulceration ; c6 , skin changes , as defined above , with active ulceration . \n groups c5 and c6 were combined in our study ( c5&c6 ) because of the limited number ( n = 114 ) of samples available ( table 1 ) . \n patients of grades c3 to c6 show an increasing severity of cvi , and all suffer from a functional abnormality of the venous system . for estimating heritability ( fisher 1918 ) cvd status ( affected , non - affected ) , current age and sex \n it should be noted that , so far , only a few prevalence studies have used the ceap classification as a phenotypic measure ( rabe et al . \n preoperative diagnostic tests entering into the ceap grading of index patients included handheld doppler evaluation of the great and small saphenous veins as well as venous duplex ultrasonography . in combining b mode imaging with pulsed doppler \n , duplex is capable of accurately localizing both the venous obstruction and the valvular reflux to specify venous segments . \n colour duplex imaging was performed with a hewlett packard image point hx , employing a 7.5 mhz probe . \n examinations were undertaken with the patient in a standing position , using the valsalva manoeuvre and manual calf compression . \n for estimating the actual length of clinically significant reflux , the handheld doppler and the colour duplex imagine were combined with photoplethysmography to gauge the venous hemodynamics . repeating the test \n while firmly compressing a particular vein allows assessment of the degree of hemodynamic disturbance contributed by that vein . \n specifically , if the venous refilling time increases from 10 s ( 15 ) to > 25 s when the vein is compressed , this vein can be assumed to contribute sizeably to the patients health problem ( meissner 2004 ) . the genetic contribution to cvd \n was assessed by estimating the heritability of the disease using a pedigree - based likelihood approach as implemented in the solar software package ( almasy and blangero 1998 ) . \n a total of 2,701 pedigrees comprising the index patient and the self - reported disease status of their first degree relatives ( parents and siblings ) were used for analysis . \n the narrow - sense heritability , h , is defined as the proportion va of the phenotypic variance vp in a population that is attributable to additive genetic causes , i.e. , h = va / vp ( visscher et al . \n a 95% confidence interval for h was derived as 2 standard errors of the estimate . \n the statistical significance of h was assessed by means of a likelihood ratio test ( guerra et al . \n the influence of the two main cvd risk factors , namely sex and age , upon ceap grade was estimated using the kullback \n leibler deviance r. the h values of individual ceap grades or grade ranges ( tables 1 , 2 ) were estimated grouping index patients into six subgroups , namely c2 , c3 , c4 , c5&c6 , c3 to c6 ( cvi ) and c2 to c4 ( samples without any past or acute venous ulcer ) . \n sex differences in terms of ascertainment age , age at cvd onset , disease duration or bmi were assessed for statistical significance using a welch t test for unpaired samples . \n two - factor analysis of variance was carried out to evaluate the joint influence of sex and ceap grades on bmi . \n all statistical analyses were done by using r version 2.8.1 ( http://www.r-project.org).table 2estimates of the narrow - sense heritability ( h ) for different ceap gradesceap gradeh ( % ) standard error ( % ) p valuekullback leibler deviance r ( % ) any ( cvd)17.32.51.4 1010.7c2 ( vv)18.56.07.3 1012.2c318.32.11.5 1011.8c416.76.01.2 108.5c5&c69.211.30.1923.5c3 to c6 ( cvi)17.12.22.0 1010.4c2 to c417.62.32.2 \n 1011.0likelihood ratio test for h = 0 , adjusted for age and sex estimates of the narrow - sense heritability ( h ) for different ceap grades likelihood ratio test for h = 0 , adjusted for age and sex \n we recruited 2,701 patients ( 1,904 females , 797 males ) , which represented approximately 90% of the total number of patients treated at capio mec between october 2005 and july 2008 ( table 3 ) . \n simple vv ( ceap grade c2 ) was diagnosed in 448 ( 16.6% ) of the patients ( 13.0% of males , 18.1% of females ) . in total , 2,253 ( 83.4% ) of the index patients \n were affected by cvi ( ceap grade c3 to c6 ) , the majority having either grade c3 ( 62.8% ) or grade c4 ( 16.3% ) . \n males were more severely affected ( c4 27.4% , c5&c6 5.5% ) than females ( c4 11.7% , c5&c6 3.7% ) . \n heritability estimation was carried out in 4,033 nuclear families from 2,701 pedigrees , comprising a total of 16,434 individuals ( table 1 ) , with family sizes varying between 3 and 14 individuals . \n the h estimate for overall cvd was 17.3 2.5% ( p = 1.4 10 ; table2 ) . for grade c2 alone , \n h was 18.5 6.0% ( p = 7.3 10 ) whereas h equalled 17.1 2.2% ( p = 2.0 10 ) for the cvi phenotype ( grades c3 to c6 ) . \n the grade - specific estimates of h were as follows : 9.2 11.3% for c5&c6 ( p = 0.192 , not significant ) , 18.3 2.1% for c3 ( p = 1.5 10 ) and 16.7 6.0% for c4 ( p = 1.2 10 ) . using age ( at blood donation ) and sex as covariates , the kullback \n leibler deviance r was estimated to be 10.7% ( p = 4.6 10 . \n leibler r was only observed for c5&c6 grades ( 3.5%).table 3prevalence of different ceap grades in the study populationceap gradetotal ( n = 2,701)males ( n = 797 , 29.5%)females ( n = 1,904 , 70.5%)c2 ( vv)448 ( 16.6%)104 ( 13%)344 ( 18.1%)c31,698 ( 62.8%)431 ( 54.1%)1,267 ( 66.5%)c4441 ( 16.3%)218 ( 27.4%)223 ( 11.7%)c5&c6114 ( 4.2%)44 ( 5.5%)70 ( 3.7)c3 to c6 ( cvi)2,253 ( 83.4%)693 ( 87%)1,560 ( 81.9)c2 to c42,587 ( 95.7%)753 ( 94.5%)1,834 ( 96.3%)vv varicose veins , cvi chronic venous insufficiency prevalence of different ceap grades in the study population vv varicose veins , cvi chronic venous insufficiency the mean ascertainment age of our patients was 56.2 years [ standard deviation ( sd ) 11.1 years , range 1883 years ; table 4 ] . \n the overall mean age at cvd onset was 32.6 years ( sd 12.2 , range 572 ) , with 36.8 years ( sd 12.8 , range 572 ) for males and 30.8 years ( sd 11.3 , range 672 ) for females ( table 4 ) . \n the grade - specific mean age of onset ranged from 30.7 years ( sd 10.8 ) for c5&c6 to 35.8 years ( sd 11.6 ) for c2 whereas the grade - specific mean age at ascertainment of our patients ranged from 52.0 years ( sd 12.3 ) for c2 to 60.9 years ( sd 10.4 ) for c5&c6 ( table 5 ) . \n the mean disease duration was 23.4 years ( sd 12.9 , range 063 ) for all index patients combined , 19.3 years ( sd 12.7 , range 055 ) for males , and 25.1 years ( sd 12.9 , range 063 ) for females ( table 4 ) . \n the grade - specific mean of the disease duration ranged from 20.1 years ( sd 12.8 years ) for grade c2 to 29.8 years ( sd 13.0 years ) for grade c5&c6 ( table 5 ) . \n the mean bmi was 26.8 ( sd 4.7 , range 1466 ) for all index patients combined , and equalled 27.5 ( sd 3.7 , range 2053 ) for males and 26.6 ( sd 5.0 , range 1466 ) for females ( table 4 ) . \n the grade - specific bmi ranged from 25.6 ( sd 4.5 ) for c2 to 29.6 ( sd 5.2 ) for c5&c6 ( table 5).table 4characteristics of cvd patientsall patients ( n = 2,701)sd ( range)males ( \n n = 797)sd ( range)females ( n = 1,904)sd ( range)p valueage at ascertainment56.2 years11.1 years ( 1883)56.2 years11.6 years ( 1881)56.1 years11.9 years ( 2183)0.95 ( not significant)age at onset32.6 years12.2 years ( 572)36.8 years12.8 years ( 672)30.8 years11.3 years ( 572)2.2 10disease age23.412.9 years ( 063)19.3 years12.7 years ( 055)25.1 years12.9 years ( 063)2.2 10bmi26.84.7 ( 1466)27.53.7 ( 2053)26.65.0 ( 1466)9.2 10given are the overall and sex - specific means , standard deviations ( sd ) and rangestable 5ceap grade - specific characteristics of cvd patientsceap gradeage at onsetage at ascertainmentdisease agebmic2 ( vv)35.8 ( 11.6 , 572)52.0 ( 12.3 , 1882)20.1 ( 12.8 , 054)25.6 ( 4.5 , 2042)c332.9 ( 12.1 , 672)56.4 ( 10.6 , 2382)23.4 ( 12.6 , 063)26.5 ( 4.5 , 1466)c433.2 ( 12.7 , 1072)58.3 ( 10.5 , 2481)25.3 ( 13.0 , 156)28.3 ( 4.8 , 1846)c5&c630.7 ( 10.8 , 1471)60.9 ( 10.4 , 3383)29.8 ( 13.0 , 661)29.6 ( 5.2 , 2145)c3 to c6 ( cvi)32.8 ( 12 , 672)57 ( 10.6 , 2383)24.1 ( 12.8 , 063)27.1 ( 4.7 , 1466)c2 to c432.8 ( 12.1 , 572)55.9 ( 11.1 , 1882)23.2 ( 12.8 , 063)26.7 ( 4.6 , 1466)given are the means and , in brackets , standard deviations and ranges characteristics of cvd patients given are the overall and sex - specific means , standard deviations ( sd ) and ranges ceap grade - specific characteristics of cvd patients given are the means and , in brackets , standard deviations and ranges \n the major aim of the present study was to determine the heritability of cvd and to assess the relative impact of genetic ( familial background , sex ) and non - genetic factors ( age , bmi ) upon cvd risk . \n data from a large number of individual index patients and the disease status , age and sex of their first degree relatives led us to conclude that the additive genetic component of cvd is approximately 17% . \n two recently published , population - based studies of cvd also used the ceap classification to define the disease phenotype ( rabe et al . \n 2004 ) . however , these studies employed a substantially different recruitment scheme than ours . \n the bonn vein study for example , included all ceap grades thereby addressing a much lower proportion of severe cvi cases than we did ( rabe et al . \n 2003 ) , however , males in our study were found to be more often affected by the severe ceap grades c4 to c6 phenotypes than females . \n interestingly , h was found to vary only little with disease severity ( from 18.5% for c2 to 16.7% for c4 ; table 5 ) . \n although not formally statistically significant ( p = 0.192 , table 2 ) , the substantially lower h estimate obtained for grades c5&c6 ( 9.2% ) may indicate a smaller genetic impact upon the severe cvd phenotype , since the number of samples in this category was comparatively small ( n = 114 ) , however , small h estimate obtained may also reflect higher sampling variance . \n the main cvd risk factors identified so far have been age ( at ascertainment ) , female sex and familial history ( rabe et al . 2003 ) , and our study was the first to include age at disease onset and the disease duration disease as well . \n index patients with simple vv ( c2 ) were ascertained at a mean age of 52 years whereas those with a more severe form of cvi were ascertained at a mean age of 60.9 years . \n these results corroborate an earlier multicenter study by carpentier ( 2004 ) , which also revealed a statistically significant association between a higher ceap grade and an older current age of patients . however , an inverse relationship was observed in our study between disease severity and the age at disease onset . \n patients affected by simple vv ( c2 ) were first affected at 35.8 years compared to 30.7 years for patients with cvi ( c3 to c5&c6 ) . \n this discrepancy may be explicable in terms of the cvi phenotype requiring a longer time period for its etiopathology than vv . \n indeed , cvd is a progressive disease where those with longer disease duration ( i.e. , earlier onset and/or older current age ) can be expected to show the worst phenotype . \n consequently , a remarkable increase in disease duration with disease severity was observed in our study , ranging from 20.1 years for c2 , via 23.4 years and 25.3 years for c3 and c4 , respectively , to 29.8 years for c5&c6 . in most studies undertaken so far \n , cvd has been found to be more prevalent among women than among men ( rabe et al . \n 2003 ) , although this difference was only small in a recent study by labropoulos ( 2003 ) . among our samples , twice as many patients were female ( n = 1,904 , 70.5% ) than male ( n = 797 , 29.5% ) thereby highlighting the cvd - predisposing role of the female sex ( table 3 ) \n clearly , women are more likely to seek medical attention for varicose veins and are about three times more likely to undergo treatment ( madar et al . \n however , a remarkable sex difference was also observed in our data in terms of the mean age at disease onset , with females showing first symptoms of cvd at 30.8 years of age , compared to 36.8 years for males ( table 4 ) , and in terms of disease duration ( 19.3 years for males , 25.1 years for females ) . \n the higher proportion of female cvd patients consistently noted in previous reports , may thus be at least partially explicable by a different timing of disease in the two sexes . \n obesity has been noted to be an additional risk factor for cvd ( de backer 1997 ; fowkes et al . \n 1999 ) . indeed , the mean bmi of the index patients in our study was 26.8 ( table 4 ) . \n many studies considered bmi to be more important in females than in males ( de backer 1997 ; fowkes et al . \n however , only a small yet significant difference ( p = 9.210 ) difference was observed between the mean bmi of males ( 27.5 , sd 3.7 ) and females ( 26.6 , sd 5.0 ; table 4 ) . \n however , obesity seems to play a more important role for the development of severe forms of cvd ( 26.5 for c3 , via 28.3 for c4 , to 29.6 for c5&c6 ; table 5 ) . \n indeed , in a two - factor analysis of variance , sex and ceap grade both had a significant effect upon bmi ( p = 7.810 and p = 2.210 ) . \n two major strengths of our study have been ( 1 ) the use of a high - risk population , thereby resulting in a higher prevalence of both simple vv and cvi than , for example , the bonn vein study ( rabe et al . 2003 ) , and ( 2 ) a large number of nuclear families available for heritability analysis . \n however , we do not regard this as a major source of upward bias for our heritability estimates because , if anything , a less than perfect patient recall will have introduced additional variance into the analysis , thereby leading to an underestimate of the true level of familiarity of cvd . \n another possible drawback may have been that , by definition , h is population - dependent , i.e. h , estimates from one population do not necessarily reflect the heritability of the same trait in another population ( visscher et al . \n therefore , future studies are required to clarify whether our heritability estimate is indeed representative of cvd in general . \n these limitations notwithstanding , our results strongly encourage efforts to identify susceptibility genes predisposing for severe forms of cvd .", "role": "user" }, { "content": "varicose veins without skin changes have a prevalence of approximately 20% in northern and western europe whereas advanced chronic venous insufficiency affects about 3% of the population . \n genetic risk factors are thought to play an important role in the aetiology of both these chronic venous diseases ( cvd ) . \n we evaluated the relative genetic and environmental impact upon cvd risk by estimating the heritability of the disease in 4,033 nuclear families , comprising 16,434 individuals from all over germany . upon clinical examination \n , patients were classified according to the ceap guidelines as either c2 ( simple varicose veins ) , c3 ( oedema ) , c4 ( skin changes without ulceration ) , c5 ( healed ulceration ) , or c6 ( active ulcers ) . \n the narrow - sense heritability ( h2 ) of cvd equals 17.3% ( standard error 2.5% , likelihood ratio test p = 1.4 1013 ) . \n the proportion of disease risk attributable to age ( at ascertainment ) and sex , the two main risk factors for cvd , was estimated as 10.7% ( kullback leibler deviance r2 ) . \n the heritability of cvd is high , thereby suggesting a notable genetic component in the aetiology of the disease . \n systematic population - based searches for cvd susceptibility genes are therefore warranted .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the rapid expansion of many indian cities has led to a subsequent rise in the ownership and the use of motor vehicles , thereby increasing the level of noise pollution . \n the nuisance of traffic noise is especially aggravated by the lack of strict legislation regarding the usage of horns as well as the indiscriminate blowing of horns by drivers . \n the police personnel who are engaged in controlling the vehicular movement at heavy traffic junctions are continuously exposed to the high level of noise from these vehicles , due to the nature of their job . in 2010 , \n a survey on the effects of noise pollution in traffic policemen in hyderabad city , conducted by the society to aid the hearing impaired ( sahi ) , revealed that 76% had noise - induced hearing loss ( nihl ) . \n the ill effects of noise on human health include both auditory and non - auditory effects such as fatigue , depression , inability to concentrate , and impulsive behavior . \n many studies investigated these ill effects of noise in different categories of occupationally exposed persons . \n however , there are only few studies that have been done regarding the estimation of noise levels and auditory effects of noise generated by automobiles among indian traffic policemen . \n it has also been observed that a majority of these policemen remain unaware about the health effects of noise on their hearing ability . \n the present study was thus conducted to assess the knowledge , perceptions , and practices of traffic policemen of patiala district toward the auditory effects caused by noise pollution so as to appraise them regarding certain remedial measures pertaining to hearing conservation and noise exposure limitation . \n the minimum standard for noise pollution in the environment is 55 db . in india , \n however , at various traffic points in patiala , the leq value ( i.e. , continuous daily equivalent sound pressure level ) was found to range from 75 to 80 db , while the lmax ( i.e. , maximum sound pressure level ) was found to range from 91.2 to 103 db . \n most of our study subjects work for around 9 h every day at these heavy traffic junctions and are thus exposed to high levels of noise for a prolonged period of time . \n the present study was carried out on non - smoking male traffic policemen aged 20 - 50 years during a general health check - up camp organized at government dispensary , police lines , patiala , punjab . \n informed consent was taken from all the participants . out of the initial 112 participants who volunteered for the study , 22 \n were subsequently excluded due to the presence of either a positive past / family history of ear disease , intake of known ototoxic medications ( e.g. , aminoglycosides ) , recent ear surgery / trauma , chronic alcoholism , tobacco chewing , and exposure to loud noise other than traffic - related noise . \n the subjects were asked to fill up a questionnaire that included multiple choice questions relating to the knowledge , perceptions , and practices of the traffic policemen regarding noise . \n it was designed to have a total duration of 20 min and the questions asked were in accordance with iso / ts 15666;2003 , an international standard . \n the questionnaire was translated in local language and was filled up by the subjects under close supervision so as to avoid the influence of one 's result by the other . for maintenance of reliability , anonymity and confidentiality , \n , chicago , us ) version 13.0 and included calculation of percentages and proportions of the study subjects , in context to a particular response , out of a total of 90 participants . \n the mean age of subjects was 39.8 5.80 years , while the mean duration of exposure to traffic noise was 10.56 6.43 years . \n all the subjects had a minimum of 5 years of schooling , with a majority of them being graduates . \n it was seen that most of the subjects ( 64.4% ) had been serving as traffic constables for > 8 years . \n table 1 depicts the details on the self assessment of hearing by traffic policemen ; it was found that even though a majority of subjects rated their hearing as excellent , the supplementary questions that probed their hearing ability , revealed a different picture . a relatively more number of subjects reported having difficulties in conversation with others over the phone or in crowded places , due to which they had to ask the other person to talk a bit loudly , or they were themselves pointed out as talking loudly by others . also , a majority of our subjects reported having tinnitus during duty hours . \n distribution of subjects as per their self assessment of hearing status table 2 depicts the distribution of study subjects according to their perceptions on noise pollution and their attitudes toward the usage of personal protective equipment . \n it was observed that a majority of our subjects were oblivious to the harmful effects of noise and did not consider it as an occupational hazard . \n it was observed that none of our subjects had ever used an ear plug or ear muff , for which the main reason cited was its unavailability . \n a majority of them did not use any method to protect themselves against noise , while a few of the policemen used either hand , fingers , or cotton plugs . \n however , these methods were not found to be satisfactory by those who were using them . \n distribution of subjects as per their perceptions regarding noise pollution and their attitude toward the use of personal protective equipment \n in the present study , even though only 5.5% of the policemen rated their hearing ability as below average , a larger percentage of subjects reported having trouble during normal ( 40% ) and telephonic conversation ( 16.7% ) . \n the results of the present study are quite similar to those obtained in gujarati traffic policemen by tripathi and tiwari . \n they observed that 2.3% subjects rated their hearing ability as below average and 62.8% had work - related tinnitus . \n however , it was also seen that only a few of them ( 4.7% ) were using ear plugs and that too occasionally . \n their study revealed that only 3.3% subjects felt that their hearing was below average and 16.66% complained of work - related tinnitus , and none of them had ever used any hearing protection devices . \n , from traffic constables in kathmandu , nepal ; 11.8% of their subjects gave a below average rating to their hearing ability . \n also , a substantial number of the subjects ( 92.7% ) admitted not having used any kind of hearing protection device . \n a common observation between the present study and all of the above studies was that although the self - assessed prevalence of hearing loss was found in a lower percentage of subjects , a closer scrutiny of the supplementary questions to assess the hearing status suggested that the number of subjects with hearing disability was much higher . \n another common revelation by all the studies , including the present study , was that non availability of ear plugs / ear muffs was the major reason cited by the traffic constables for not using these devices . \n the slight variations in the results of present study and the previous ones may be due to the differences in the sample size of the studies . it is further suggested that , to find out the exact number of traffic policemen with hearing impairment , their further evaluation with audiometry needs to be done . the use of self - assessment questionnaire to assess the hearing impairment is a limitation of the present study , as the results are based entirely on the respondents probity and how they perceived their attitudes toward the variables used in this study . also , the male predominance in the study made it impossible to study gender - related patterns \n the present study revealed that traffic policemen in patiala were exposed to potentially damaging noise levels and that none of them were using any kind of personal protective equipment . \n most of the study subjects were in the economically productive age group and , if they suffer from hearing impairment at this age , they would have to live with this difficulty throughout the rest of their lives . \n we therefore strongly vouch for the following strategies for protection of traffic policemen : \n availability of ear plugs / ear muffs / ear canal protectors by government authorities . \n a variety of styles may be provided so that the workers can select a particular hearing protector on the basis of comfort , ease of handling , and useregular check - up of traffic constables posted at heavy traffic junctions by trained otologistsrotational duty of all traffic policemen between heavy and light traffic junctionsintroduction of stringent legislations regarding usage of hornsorganization of intensive public awareness campaigns regarding ill effects of noise , via print , and electronic media . \n a variety of styles may be provided so that the workers can select a particular hearing protector on the basis of comfort , ease of handling , and use regular check - up of traffic constables posted at heavy traffic junctions by trained otologists rotational duty of all traffic policemen between heavy and light traffic junctions introduction of stringent legislations regarding usage of horns organization of intensive public awareness campaigns regarding ill effects of noise , via print , and electronic media .", "role": "user" }, { "content": "the study was conducted on a group of 90 traffic policemen aged 20 - 50 years and working in and around patiala district to assess their knowledge , attitude , and practices toward the ill effects caused by traffic noise on health . \n the subjects were required to fill up a questionnaire regarding their self - assessment of hearing ability , noise - related attitudes , and the use of personal protective equipment such as earplugs . \n the mean age of subjects was 39.8 5.80 years , while the mean duration of exposure to traffic noise was 10.56 6.43 years . \n only 5.5% subjects felt that their hearing was below average . \n as many as 61% subjects had work - related tinnitus . \n it was observed that none of them had ever used ear plugs , mainly due to their non availability . \n the self - assessment of hearing by traffic policemen indicated that most of them had normal hearing . \n however , to find out the exact number of cases with hearing impairment , further evaluation with audiometry is recommended in them .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: informed consent was obtained from all subjects , and the study was approved by our institutional review board . \n forty - seven consecutive patients with bilateral moderate to severe dry eye were enrolled prospectively . \n moderate to severe dry eye disease was defined by : ( 1 ) schirmer 's test reading without anesthesia of less than or equal to 5 mm / 5 min14 ; or ( 2 ) 3 tear film but all less than 6 seconds.15 topical 0.08% chondroitin sulfate ( cs ) mixed with 0.06% sodium hyaluronate ( ha ) was applied on one eye and 0.05% cyclosporine ( csa ) on the other eye four times a day for 6 - 8 weeks . \n there was at least a 2-week washout phase before starting treatment to eliminate previous effects of artificial tears . \n was evaluated by telephone interview and was found to be similar between the two eyedrops . \n we excluded patients who reported topical or systemic csa or ophthalmic steroids use within the previous 90 days or 3 weeks , respectively . \n other reasons for exclusion included previous punctual plug , contact lens wear , use of other topical treatments , active ocular infection , severe blepharitis , recurrent herpes keratitis within the previous 6 months , anterior segment surgery or trauma within the previous 12 months , punctuate epithelial erosions involving more than one third of the cornea , other ocular surface diseases , or non - kcs inflammation , including atopic keratoconjunctivitis . \n cs - ha and csa eyedrops were prepared at seoul national university hospital pharmacy under sterile conditions . \n cs - ha eyedrops were made by diluting 0.75 ml viscoat ( a 1:3 mixture of 4% cs and 3% ha ; alcon surgical , inc . , fort worth , tx ) in 35 ml normal saline , producing topical viscoelastics containing 0.08% cs and 0.06% ha ( cs - ha eyedrops ) . \n csa eye drops were made by mixing neoral soft gelatin capsules ( novartis , japan ) containing 100 mg of micro - emulsified cyclosporine ( 1 ml ) with 19 ml balanced salt solution ( bss , alcon surgical , inc . , fort worth , tx ) , producing topical 0.5% csa . ; 9 ml balanced salt solution was added to 1 ml of 0.5% csa to make 0.05% eyedrops . \n tear film break - up time ( but ) , schirmer test without anesthesia , and conjunctival impression cytology ( cic ) were performed before and after scheduled instillation ( mean interval : 48.379.61 days ) . \n schirmer 's test without anesthesia was performed using standard strips ( alcon , fort worth , texas , usa ) in the lower conjunctival sac for 5 minutes . \n after topical anesthesia with 0.5% proparacaine hydrochlororide ( alcaine , alcon- couvreur , puurs , belgium ) , mf millipore membrane filters with 0.22 m pores were applied to the temporal bulbar conjunctiva . to guarantee the correct staining surface , \n the membrane filter was cut into 55 mm asymmetrical pieces with a pointed tip in one corner . using an ophthalmodynanometer , 60 g of gentle pressure \n was applied to the filter for 5 seconds ; the membrane was fixed in 95% ethanol , stained with periodic acid - schiff , dehydrated in ethanol ( 70 , 80 , 90 , 100% in sequence ) and xylene ( 80 , 90 , 100% in sequence ) , and then coverslipped . using 400 magnification optical microscopy goblet cell densities ( gcd ) , nucleus to cytoplasm ratios ( ncr ) and epithelial cell morphology ( ecm ) were evaluated . \n gcd was averaged for every 100 epithelial cells in five high - power fields ( hpf , 400 magnification ) in each eye . \n ncr and ecm , graded according to saini et al.16 were defined as the average value for five hpf in each eye . \n statistical analysis was performed using spss for windows version 11.5 ( spss , chicago , il , usa ) . to compare therapeutic effects between eyedrops , \n informed consent was obtained from all subjects , and the study was approved by our institutional review board . \n forty - seven consecutive patients with bilateral moderate to severe dry eye were enrolled prospectively . \n moderate to severe dry eye disease was defined by : ( 1 ) schirmer 's test reading without anesthesia of less than or equal to 5 mm / 5 min14 ; or ( 2 ) 3 tear film but all less than 6 seconds.15 topical 0.08% chondroitin sulfate ( cs ) mixed with 0.06% sodium hyaluronate ( ha ) was applied on one eye and 0.05% cyclosporine ( csa ) on the other eye four times a day for 6 - 8 weeks . \n there was at least a 2-week washout phase before starting treatment to eliminate previous effects of artificial tears . \n was evaluated by telephone interview and was found to be similar between the two eyedrops . \n we excluded patients who reported topical or systemic csa or ophthalmic steroids use within the previous 90 days or 3 weeks , respectively . \n other reasons for exclusion included previous punctual plug , contact lens wear , use of other topical treatments , active ocular infection , severe blepharitis , recurrent herpes keratitis within the previous 6 months , anterior segment surgery or trauma within the previous 12 months , punctuate epithelial erosions involving more than one third of the cornea , other ocular surface diseases , or non - kcs inflammation , including atopic keratoconjunctivitis . \n cs - ha and csa eyedrops were prepared at seoul national university hospital pharmacy under sterile conditions . \n cs - ha eyedrops were made by diluting 0.75 ml viscoat ( a 1:3 mixture of 4% cs and 3% ha ; alcon surgical , inc . , fort worth , tx ) in 35 ml normal saline , producing topical viscoelastics containing 0.08% cs and 0.06% ha ( cs - ha eyedrops ) . \n csa eye drops were made by mixing neoral soft gelatin capsules ( novartis , japan ) containing 100 mg of micro - emulsified cyclosporine ( 1 ml ) with 19 ml balanced salt solution ( bss , alcon surgical , inc . , fort worth , tx ) , producing topical 0.5% csa . ; 9 ml balanced salt solution was added to 1 ml of 0.5% csa to make 0.05% eyedrops . \n tear film break - up time ( but ) , schirmer test without anesthesia , and conjunctival impression cytology ( cic ) were performed before and after scheduled instillation ( mean interval : 48.379.61 days ) . \n schirmer 's test without anesthesia was performed using standard strips ( alcon , fort worth , texas , usa ) in the lower conjunctival sac for 5 minutes . \n after topical anesthesia with 0.5% proparacaine hydrochlororide ( alcaine , alcon- couvreur , puurs , belgium ) , mf millipore membrane filters with 0.22 m pores were applied to the temporal bulbar conjunctiva . to guarantee the correct staining surface , \n the membrane filter was cut into 55 mm asymmetrical pieces with a pointed tip in one corner . using an ophthalmodynanometer , 60 g of gentle pressure \n was applied to the filter for 5 seconds ; the membrane was fixed in 95% ethanol , stained with periodic acid - schiff , dehydrated in ethanol ( 70 , 80 , 90 , 100% in sequence ) and xylene ( 80 , 90 , 100% in sequence ) , and then coverslipped . using 400 magnification optical microscopy goblet cell densities ( gcd ) , nucleus to cytoplasm ratios ( ncr ) and epithelial cell morphology ( ecm ) were evaluated . \n gcd was averaged for every 100 epithelial cells in five high - power fields ( hpf , 400 magnification ) in each eye . \n ncr and ecm , graded according to saini et al.16 were defined as the average value for five hpf in each eye . \n statistical analysis was performed using spss for windows version 11.5 ( spss , chicago , il , usa ) . to compare therapeutic effects between eyedrops , \n before eyedrop application , there was no significant difference of tear film but between each group of eyes ( 4.190.86 seconds on cs - ha - treated eyes and 4.081.01 seconds on csa - treated eyes , p=0.623 ) . \n after scheduled applications , there was significant prolongation of tear film but in both groups ( 4.391.12 sec on cs - ha - treated eyes and 5.080.77 on csa - treated eyes ) , ( p=0.041 and 0.029 , respectively ) . \n but increase was more prominent in the csa group than in the cs - hs group ( p=0.026 , fig . \n 1 ) . there was no significant difference of aqueous tear production between the two groups before treatment ( 5.721.72 seconds on topical cs - ha treated eyes and 6.171.56 seconds on topical csa treated eyes ) ( p=0.234 ) . \n tear wetting increased significantly in both groups compared with pretreatment levels ( 6.471.68 seconds on topical cs - ha treated eyes and 7.171.56 seconds on topical 0.05% csa treated eyes ) , ( p=0.024 and 0.011 , respectively ) . \n although the amount of tear wetting tended to be greater in the 0.05% csa group , there was no statistically significant difference between the two groups ( p=0.132 ) ( fig . \n mean gcd , ncr , and ecm were 5.361.02 , 3.270.97 , and 4.250.61 in topical cs - ha treated eyes and 5.471.71 , 3.530.61 , and 4.590.78 in topical csa treated eyes , respectively with no significant difference between the two groups ( p=0.795 , 0.333 , and 0.688 , respectively ) . \n after scheduled treatment with topical cs - ha , there was significant improvement of gcd , ncr , and ecm ( p=0.047 , 0.035 , and 0.018 , respectively ) ( fig . 3 , 4 , 5 ) . \n similarly , there was marked improvement of gcd , ncr , and ecm in topical csa treated eyes ( p=0.012 , 0.025 , and 0.027 , respectively ) ( fig . \n gcds increased more prominently in topical csa treated eyes than in topical cs - ha treated eyes ( p=0.033 ) , while ncr and ecm showed no significant difference ( p=0.721 and 0.439 , respectively ) ( fig . 3 , 4 , 5 ) . \n before eyedrop application , there was no significant difference of tear film but between each group of eyes ( 4.190.86 seconds on cs - ha - treated eyes and 4.081.01 seconds on csa - treated eyes , p=0.623 ) . \n after scheduled applications , there was significant prolongation of tear film but in both groups ( 4.391.12 sec on cs - ha - treated eyes and 5.080.77 on csa - treated eyes ) , ( p=0.041 and 0.029 , respectively ) . \n but increase was more prominent in the csa group than in the cs - hs group ( p=0.026 , fig . \n there was no significant difference of aqueous tear production between the two groups before treatment ( 5.721.72 seconds on topical cs - ha treated eyes and 6.171.56 seconds on topical csa treated eyes ) ( p=0.234 ) . \n tear wetting increased significantly in both groups compared with pretreatment levels ( 6.471.68 seconds on topical cs - ha treated eyes and 7.171.56 seconds on topical 0.05% csa treated eyes ) , ( p=0.024 and 0.011 , respectively ) . although the amount of tear wetting tended to be greater in the 0.05% csa group , there was no statistically significant difference between the two groups ( p=0.132 ) ( fig . \n before treatment , mean gcd , ncr , and ecm were 5.361.02 , 3.270.97 , and 4.250.61 in topical cs - ha treated eyes and 5.471.71 , 3.530.61 , and 4.590.78 in topical csa treated eyes , respectively with no significant difference between the two groups ( p=0.795 , 0.333 , and 0.688 , respectively ) . after scheduled treatment with topical cs - ha , there was significant improvement of gcd , ncr , and ecm ( p=0.047 , 0.035 , and 0.018 , respectively ) ( fig . 3 , 4 , 5 ) . \n similarly , there was marked improvement of gcd , ncr , and ecm in topical csa treated eyes ( p=0.012 , 0.025 , and 0.027 , respectively ) ( fig . \n gcds increased more prominently in topical csa treated eyes than in topical cs - ha treated eyes ( p=0.033 ) , while ncr and ecm showed no significant difference ( p=0.721 and 0.439 , respectively ) ( fig . 3 , 4 , 5 ) . \n conjunctival goblet cell densities are sensitive indicators of ocular surface disease . in dry eyes , \n the first evidence of surface injury is the manifestation of decreased conjunctival goblet cells.17 the results of this study suggest that topical cs - ha and 0.05% csa stabilize tear film instability , increase aqueous tear production , and also improve ocular surfaces ; these results are consistent with previous studies.18 kunert et al . reported that topical 0.05% csa increased conjunctival goblet cell density and decreased epithelial turnover after 6 months of application.4 strong et al . also demonstrated that topical csa significantly reduced conjunctival epithelial apoptosis and protected against goblet cell loss in experimental murine keratoconjunctivitis sicca.19 however , the novelty of this study is that 0.05% csa eyedrops increased conjunctival goblet cell density and tear film stability more effectively than cs - ha . \n ocular surface mucin , consisting predominantly of conjunctival goblet cell secretions , adheres to conjunctival and corneal epithelial cells glycocalyces and enhances corneal wettability by serving as an interface between the hydrophobic corneal epithelium and aqueous tear fluid . \n we believe that mucin increases with increased goblet cell density , which was enhanced by topical cyclosporine . \n this explanation is also supported by moore et al . ; they found that topical cyclosporine restored in vivo dog conjunctival mucin stores to control levels over a 4-week period.20 commercial topical cyclosporine was not available in our country at the start of the study , and was difficult to prepare due to hydrophobicity ( log p=3.0 ) and low aqueous solubility ( 6.6 ug / ml).21,22 we prepared 0.05% topical csa by mixing csa capsule contents ( neoral soft gelatin capsule , novartis ) with a balanced salt solution . in this capsule \n , csa is dissolved in ethanol with corn oil - mono - di - triglycerides , propylene glycol ( an enhancer of tissue permeation by supersaturation systems , based on increased thermodynamic activity ) , and polyoxyl 40 hydrogenated castor oil ( a pharmaceutical aid ( nonionic surfactant ) used to improve solubilization ) \n demonstrated that csa solubility into aqueous formulations containing polyoxyl 40 hydrogenated castor oil.23 in an aqueous medium with nonionic surfactant , micelles are formed , allowing csa to dissolve in them . \n as micelle size is smaller than emulsion droplets , with a mean diameter of 200 nm , they have a larger surface area , enabling more drug binding . \n the main downside to our preparation was a stinging sensation in patients with moderate epithelial erosion , possibly caused by sub - appropriate ph . \n therefore , we limited 0.05% csa application to patients without epithelial defect or erosions involving more than one third of the cornea . \n topical eyedrops containing 0.08% cs and 0.06% ha were prepared by diluting commercial viscoelastic material in normal saline . \n the diluting concentration was determined from previous reports.12,24 topical application of ha has been shown to result in both subjective and objective improvements.13,25 several mechanisms have been suggested . \n ha is a natural biopolymer and its concentration increases in response to ocular damage and corneal wound healing.26 in vitro ha promotes cell migration and stabilizes the ocular surface epithelial barrier,27,28 suggesting intrinsic wound healing properties . \n binding of ha to cd44 , a corneal and conjunctival cell receptor,29 may promote cell adhesion and motility via cytoskeletal protein action,30 stimulate cell proliferation through a kinase cascade mechanism,31 and enhance rabbit corneal epithelial cell growth in vitro.32 interestingly , it has been reported that cd44 is expressed in 30 - 50% of conjunctival epithelial cells in patients with moderate dry eye , and that ha is associated with decreased expression.8 apoptosis - related and inflammatory markers ( fas , apo 2.7 , hla - dr , and cd40 ) tend to decrease and potentially protective markers ( muc5ac and cd63 ) tend to increase with ha application.8 ha also increases precorneal tear film stability , which protects the ocular surface from environmental agents11 and has water retentive properties improving wettability.33 therefore , ha may contribute to a favorable microenvironment during blinking and ocular movements . in our study , squamous metaplasia on cic improved after treatment with cs - ha eyedrops for 48.379.61 days . \n the recovery time of patients in our study seems to be shorter than that of previous reports of 8 weeks or more.34 this discrepancy can be explained by the synergistic anti - inflammatory effect of cs . \n cs is known to downregulate gene expression and synthesis of nitric oxide synthase and prostaglandin e2 production,35 components of the inflammatory cascade , and induce il-1 , an inducing factor for lacrimal gland cell death.35 as il-1 and matrix metalloproteinase-9 , a physiological activator of il-1 , are significantly elevated in tear fluid and conjunctival epithelium of dry eyes,36,37 the suppressive effects of cs can enhance ha effects to improve ocular surfaces . given the immediate symptomatic improvements and synergistic anti - inflammatory effects of topical cs - ha , it can be recommended that topical cs - ha be simultaneously administered with csa , which may require longer treatment to suppress apoptosis . \n additionally , as ha and topical csa have similar effects via the different aforementioned mechanisms , it is possible that ha might act synergistically with topical csa ; further investigation would be helpful . \n cs - ha and csa eyedrops were mixed with normal saline and a balanced salt solution , respectively , which may have had effects on ocular surfaces or tear production . because a vehicle - treated control group was not included , this perspective can not be evaluated . \n another limitation is the inability to demonstrate the effects of cs - ha or csa on each patient 's other eye , which may have been mediated by the neural loop of the ocular surface lacrimal functional unit . \n this study suggests that , while topical applications of cs - ha and csa are effective for dry eye , topical csa may have a greater effect on the improvement of conjunctival gcd , which can enhance tear film stability , compared with topical cs - ha .", "role": "user" }, { "content": "purposeto compare the short term effects of topical 0.05% cyclosporine ( csa ) and a mixture of 0.08% chondroitin sulfate and 0.06% sodium hyaluronate ( cs - ha ) on dry eye ocular surfaces.methods36 patients with moderate to severe dry eye ( 5 mm/5 min or less with schirmer 's test or tear break up time ( but ) less than 6 seconds ) , were treated with topical application of cs - ha on one eye and csa on the other 4 times a day for 6 - 8 weeks . \n but , schirmer 's test without anesthesia , and conjunctival impression cytology ( cic ; goblet cell density , nucleus to cytoplasmic ratio , and epithelial cell morphology ) were evaluated and compared between eyes before and after treatment ( repeated measurement of anova).resultsafter treatment , but and tear wettings were significantly prolonged in each group . \n topical csa treated eyes had greater increase in but ( p=0.026 ) ; there was no significant difference in tear wetting ( p=0.132 ) . \n while the 3 parameters of cic improved in both groups , goblet cell density was significantly higher in eyes treated with csa ( p=0.033).conclusionswhile both cs - ha and 0.05% csa eyedrops improve ocular surfaces , topical csa may have a better effect on enhancing tear film stability and goblet cell density .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: subjective well - being is a major component of quality of life , influenced by the pharmacological and/or psychosocial treatment as well as by the illness itself . \n a multitude of components , for example patients ' attitudes toward medication or other nonpharmacological factors , possibly interfere when their subjective experience of neuroleptic drugs is investigated . \n naber suggested a model consisting of five dimensions of sw : emotional regulation , self - control , mental functioning , social integration , and physical functioning . \n lambert et al combined this concept with six influencing factors : psychopathology and symptomatic improvement , physical side effects and associated distress , attitudes toward pharmacological treatment and insight , psychosocial factors , phase , and severity of illness . \n one major impetus for this research was the sometimes marked subjective improvement , when patients were switched from typical antipsychotics to clozapine . similarly to the first trial , quality of life was an outcome criterion to assess the improvement by clozapine . \n the subjective well - being under neuroleptic treatment ( swn ) is a self - rating likert scale with 20 items ( 10 positive , 10 negative ) and good psychometric properties . \n recently , an algorithm has been developed to exclude patients who are unable to understand the items or to reliably fill out the scale , based on analyzing mean differences between negative and positive items for the individual subscores ( s. moritz , unpublished data ) . \n starting with the pioneer work of the drug attitude inventory of hogan et al , there now exist , together with the swn , several self - rating instruments to investigate the patients ' perspective of antipsychotic treatment . \n the relationship between psychopathology , as shown with the positive and negative syndrome scale ( panss ) , and the subjective well - being , as measured with the swn , was investigated in several trials . \n the total score , as well as the subscales were only moderately correlated with the panss scores ( r=-0.1 to -0.5 ) with stronger relationships to the negative and global score than to the positive score . \n the highest correlations ( r=-0.4 to -0.5 ) were related to the severity of depression and anxiety . regarding the impact of side effects , lambert et al found , in a study in 213 patients treated with typical neuroleptics , that sexual dysfunctions and extrapyramidal and psychic side effects were rated as subjectively more distressing than vegetative side effects and sedation . in a study by de haan et al \n it was shown that dosage of medication leading to dopamine ( d2 ) receptor blockade should be carefully evaluated , since it is most likely responsible for neuroleptic dysphoria , even in the absence of motor side effects : the relationship between swn and striatal d2 receptor occupancy was investigated in 22 schizophrenic patients , clinically stable under either 14.7 mg of olanzapine or 4.1 mg of risperidone . \n it was demonstrated that in the absence of extrapyramidal symptoms , higher striatial d2-receptor occupancy as measured by single photon - emission computed tomography ( spect ) was related to reduced swn , negative symptoms , and depression ( p<0.01 ) . \n naber investigated the subjective perception of neuroleptic treatment with the swn and found it to be significantly related to noncompliance . \n six months later , 14 patients were noncompliant . compared with 34 patients who remained compliant , \n however , the psychiatrists did not see a difference between future compliant or noncompliant patients ; the panss scores did not differentiate between both groups . in another patient population , it was shown that the swn of 28 patients treated with the atypical antipsychotic clozapine because of therapy resistance or motor side effects was , despite negative selection , significantly better than the swn score of 38 patients under classical neuroleptics ( p=0.03 ) . in a later study , olanzapine and clozapine were compared in a double - blind , controlled trial in 114 patients , over a 26-week period . \n regarding swn , the total score - as well as all subscores , excluding mental functioning - showed a significant relationship between low swn and noncompliance ( p<0.005 - p<0.01 ) . \n again , this study showed that the improvement of swn and of panss are not strongly related ( r=-0.3 to -0.4 ) . \n the soho study also found a relevant relationship between subjective well - being and compliance . \n it is a 3-year investigation of the health outcomes associated with antipsychotic treatment in europe . \n data were collected in a prospective , nonrandomized observational study of 10 972 patients with schizophrenia , recruited in 10 european countries between january and december 2001 . in the german study population with 2 960 patients \n , patients and physicians categorized compliance as almost always compliant , partly compliant , or \n the relationship between changes in compliance ( improvement n=225 , no change n=1366 , worsening n=78 ) and clinical variables were assessed by factor analysis . \n this revealed the strongest correlations for swn ( r=0.866 ) , followed by symptoms ( r=0.772 ) and side effects ( r=0.480 ) ( karow et al , unpublished data ) . \n sw seems to be of potent influence on adherence during maintenance treatment , but not in the acute phase , as mutsatsa et al did not find a significant relationship between swn and early medication adherence in 101 first - episode patients . \n numerous studies show the advantages of atypical versus typical antipsychotics , and these advantages are most prominent from the patients ' perspectives : atypical antipsychotics improve subjective quality of life more than typical antipsychotics , subjective response is significantly better under atypical compared with typical drugs , and , not surprisingly , switching from a typical to atypical antipsychotic is associated with a marked subjective improvement . \n in the soho study , swn was used as an important single component of the complete remission criterion , according to the new consensus statement on criteria and the time frame of remission in schizophrenia published by the remission in schizophrenia working group . \n in contrast to previous definitions , the consensus included the incorporation of subjective rating next to sustained symptomatic ( ie , positive , negative , and cognitive symptoms ) as well as functional remission ( ie , activities of daily living , employment ) . \n remission criteria and predictor variables were assessed at baseline , at 3 , 6 , 12 , 18 , and 24 months with standardized scales . \n complete remission was defined as patients fulfilling all criteria for ( i ) symptomatic , ( ii ) functional , and ( iii ) subjective well - being over a period of at least 6 months ( ie , at the 18-month and 24-month visits ) . \n symptomatic remission was defined as receiving a clinical global impressions scale ( cgi)-schizophrenia score of no worse than mild ( 3 ) in assessments of overall severity , positive , and cognitive subscores and a score of no worse than moderate ( 4 ) in the negative subscore . \n functional remission was defined as a positive occupational / vocational status , ie , paid or unpaid , full- or part - time employment , being an active student or head of a household with an employed partner , and independent living , ie , living alone , living with a partner , living with peers . \n subjective well - being was met if a swn total score of 80 points was achieved . \n predictor variables were ( i ) baseline predictors , ( ii ) early course of treatment predictors defined as fulfilled remission criteria at 3 months , and ( iii ) course of treatment predictors defined as variables assessed continuously throughout the complete 24-month period . \n the baseline predictors were ( i ) age , gender , and duration of illness , ( ii ) symptomatic status assessed with the expanded version of the cgi - schizophrenia including an overall severity of illness score and 4 subscores for the severity of positive , negative , cognitive , and depressive syndromes , ( iii ) functional variables included the occupational / vocational status and independent living assessed in yes / no categories , ( iv ) subjective well - being assessed with the swn . \n the early course of treatment predictors were early symptomatic , functional , and subjective well - being remission at 3 months . \n the course of treatment predictors were compliance with antipsychotic medication , ( noncompliance was defined as missing 50 % of medication over at least 4 weeks ) and comorbid substance use disorder ( sud ) according to diagnostic and statistical manual of mental disorders ( dsm - iv ) criteria , categorized into ( i ) no sud ; ( ii ) remitted sud ( remission during follow - up with sud at baseline ) ; and ( iii ) persistent sud . \n lambert et al ( unpublished data ) found that 50 % of the patients achieved symptomatic remission and about 40 % subjective well - being remission , whereas only one third sustained functional remission . including symptomatic and functional criteria , 19 % achieved complete remission in the soho study ; following the consensus statement including the subjective quality of life , remission rate decreased to 14 % . \n it is of particular interest that 32 % of all patients achieved none of the three remission criteria . \n first antipsychotic treatment proved to be a predictor of all remission criteria . similarly to the study by robinson , the functional remission criterion of 24.5 % was the main barrier in achieving complete remission . \n consistent with previous studies , early remission within the first 3 months predicted all remission criteria including complete remission . therefore , \n early detection of incomplete remission or treatment resistance and subsequent treatment adaptation are mandatory in the treatment of multiple - episode patients as well as first - episode patients . \n persistent sud when compared with no sud was associated with a decreased probability of symptomatic remission , while baseline sud was not found to have significant influence on symptomatic remission , consistent with previous findings . \n similar to findings from many previous studies , medication noncompliance was associated with symptomatic nonremission . \n for a long period , many psychiatrists believed that they knew their patients well enough not to need additional self - ratings by the patients . \n however , numerous trials have revealed that both perspectives differ markedly regarding the relevance of side effects or success of antipsychotic treatment . \n subjective well - being is at least a valuable addition to objective ( ? ) psychopathology , and should become an integral part of shared decision - making . \n a better consideration of the patients ' perspective can improve therapeutic alliance , medication adherence , and , finally , the long - term prognosis .", "role": "user" }, { "content": "the patients ' perspective of antipsychotic treatment was largely neglected for a long period . \n it has only been during the last 10 years , with the development of atypical antipsychotics , that scientific interest in this issue has markedly increased . \n numerous studies have shown that the majority of schizophrenic patients are able to fill out a self - rating scale in a meaningful way , and several self - report scales with sufficient internal consistency and good construct validity have been developed . \n the effects of antipsychotic treatment on psychopathology and on subjective well - being ( sw ) are not strongly related ; the perspectives of the patient and his / her psychiatrist markedly differ . \n recent research indicates that sw / quality of life , much more improved by atypical than by typical antipsychotics , has a strong impact on compliance , as well as on the chance of achieving remission . \n the data strongly suggest that a systematic evaluation of the patient 's perspective of antipsychotic treatment is meaningful and necessary to increase compliance , functional outcome , and long - term prognosis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the purity of b - oligomer was verified by gel electrophoresis analysis , which revealed complete lack of contamination with a - protomer . \n mip-1 , rantes , and sdf-1 were from peprotech , and fura-2/am , ro-31 - 8220 , and g 6979 were from calbiochem . \n t cell enriched , monocyte - depleted cultures were established from pbmcs from hiv-1negative donors by ficoll - hypaque gradient centrifugation and two rounds of adherence to plastic . \n nonadherent cells were collected by centrifugation , resuspended in rpmi 1640 supplemented with 10% heat - inactivated fcs , and stimulated with phytohemagglutinin ( 5 g / ml ) for 3 d. cells were then washed and cultured for another 7 d in medium supplemented with 20 u / ml of recombinant il-2 . by that time , \n 84% of the cells were cd3 , 40% were cd4 , 30% were ccr5 , 95% were cxcr4 , 10% were ccr5cd4 , and 35% were cxcr4cd4 , as determined by flow cytometry . \n five hiv-1 strains were used in this study : three r5 viruses ( 92us660 , 92us657 , and ada ) and two x4 strains ( 92ug21 , a primary isolate , and lai , a t cell line adapted virus ) . before infection , viral stocks \n were treated with 200 u / ml of rnase - free dnase for 1 h at room temperature to eliminate dna contamination . \n viral inoculae were adjusted according to reverse transcriptase activity to 6 10 cpm per 10 cells . after a 2-h adsorption \n cells were treated with b - oligomer ( 1 nm ) for 10 min and then inoculated with heat - inactivated hiv-1 ( 2 10 cpm / ml of reverse transcriptase activity ) or with 5 g / ml of recombinant gp120jr - fl ( progenics pharmaceuticals ) or gp120lai ( intracel ) . \n after 60 min at 37c , cells were washed and fixed in 4% buffered formaldehyde . \n fcs / pbs at room temperature , and 2 10 cells were incubated for 30 min at room temperature in 0.1 ml of 1% fcs / pbs with anti - ccr5 or anti - cxcr4 mab ( 2d7 and 12g5 , respectively , obtained from pharmingen ; both antibodies neutralize hiv-1 infection ) , followed by a 30-min incubation with a secondary rhodamine - labeled anti \n after washing , cells were incubated with fitc - labeled anti - cd4 mab ( 13b8.2 , immunotech ; this antibody does not compete with gp120 for cd4 binding ) , then washed , spotted on slides , dried , and analyzed on an immunofluorescent imaging system using a dedicated software ( metamorph ; universal imaging corporation ) . for each binding reaction , 10 cells resuspended in binding buffer ( 50 mm hepes , ph 7.4 , 1 mm cacl2 , 5 mm mgcl2 , and 0.5% bsa ) were mixed with b - oligomer ( 1 nm ) , incubated for 10 min at 37c , and then transferred to ice . \n 550 pm of i - labeled mip-1 ( specific activity 2,200 ci / mmol ) was added to cells in the presence or absence of a 1,000-fold molar excess of unlabeled mip-1 , or 0.5 g / ml of gp120 , and reactions were incubated at 4c for 4 h on a horizontal shaker . after washing with binding buffer containing 0.5 m nacl , \n the assay was performed as previously described 33 . in brief , 0.6 ml of fura-2loaded cells ( 5 10 cells / ml ) was transferred to an acrylic cuvette and stimulated with b - oligomer ( 500 ng / sample ) , sdf-1 ( 100 ng / sample ) , or mip-1 ( 500 ng / sample ) . \n fluorescence emission at 340 and 380 nm was measured on a perkin - elmer luminescence spectrometer ls50b . \n the purity of b - oligomer was verified by gel electrophoresis analysis , which revealed complete lack of contamination with a - protomer . \n mip-1 , rantes , and sdf-1 were from peprotech , and fura-2/am , ro-31 - 8220 , and g 6979 were from calbiochem . \n t cell enriched , monocyte - depleted cultures were established from pbmcs from hiv-1negative donors by ficoll - hypaque gradient centrifugation and two rounds of adherence to plastic . \n nonadherent cells were collected by centrifugation , resuspended in rpmi 1640 supplemented with 10% heat - inactivated fcs , and stimulated with phytohemagglutinin ( 5 g / ml ) for 3 d. cells were then washed and cultured for another 7 d in medium supplemented with 20 u / ml of recombinant il-2 . by that time , \n 84% of the cells were cd3 , 40% were cd4 , 30% were ccr5 , 95% were cxcr4 , 10% were ccr5cd4 , and 35% were cxcr4cd4 , as determined by flow cytometry . \n five hiv-1 strains were used in this study : three r5 viruses ( 92us660 , 92us657 , and ada ) and two x4 strains ( 92ug21 , a primary isolate , and lai , a t cell line adapted virus ) . before infection , \n viral stocks were treated with 200 u / ml of rnase - free dnase for 1 h at room temperature to eliminate dna contamination . \n viral inoculae were adjusted according to reverse transcriptase activity to 6 10 cpm per 10 cells . after a 2-h adsorption , \n cells were treated with b - oligomer ( 1 nm ) for 10 min and then inoculated with heat - inactivated hiv-1 ( 2 10 cpm / ml of reverse transcriptase activity ) or with 5 g / ml of recombinant gp120jr - fl ( progenics pharmaceuticals ) or gp120lai ( intracel ) . \n after 60 min at 37c , cells were washed and fixed in 4% buffered formaldehyde . \n after washing , cells were incubated for 20 min in 1% fcs / pbs at room temperature , and 2 10 cells were incubated for 30 min at room temperature in 0.1 ml of 1% fcs / pbs with anti - ccr5 or anti - cxcr4 mab ( 2d7 and 12g5 , respectively , obtained from pharmingen ; both antibodies neutralize hiv-1 infection ) , followed by a 30-min incubation with a secondary rhodamine - labeled anti \n after washing , cells were incubated with fitc - labeled anti - cd4 mab ( 13b8.2 , immunotech ; this antibody does not compete with gp120 for cd4 binding ) , then washed , spotted on slides , dried , and analyzed on an immunofluorescent imaging system using a dedicated software ( metamorph ; universal imaging corporation ) . \n for each binding reaction , 10 cells resuspended in binding buffer ( 50 mm hepes , ph 7.4 , 1 mm cacl2 , 5 mm mgcl2 , and 0.5% bsa ) were mixed with b - oligomer ( 1 nm ) , incubated for 10 min at 37c , and then transferred to ice . \n 550 pm of i - labeled mip-1 ( specific activity 2,200 ci / mmol ) was added to cells in the presence or absence of a 1,000-fold molar excess of unlabeled mip-1 , or 0.5 g / ml of gp120 , and reactions were incubated at 4c for 4 h on a horizontal shaker . after washing with binding buffer containing 0.5 m nacl , \n the assay was performed as previously described 33 . in brief , 0.6 ml of fura-2loaded cells ( 5 10 cells / ml ) was transferred to an acrylic cuvette and stimulated with b - oligomer ( 500 ng / sample ) , sdf-1 ( 100 ng / sample ) , or mip-1 ( 500 ng / sample ) . \n fluorescence emission at 340 and 380 nm was measured on a perkin - elmer luminescence spectrometer ls50b . \n several previously published reports 1617181920 demonstrated that activity of chemokine receptors as coreceptors for hiv-1 does not involve signaling via coupled gi proteins . \n a somewhat conflicting result has been reported recently 21 , demonstrating that entry of x4 hiv-1 strains into primary t cells correlated with actin - dependent cocapping of cd4 and cxcr4 receptors , thus implicating signaling in the process of hiv-1 entry . to better define the role of signaling from chemokine receptors in hiv-1 entry into primary t cells \n , we used ptx to specifically inactivate gi - like proteins that transduce signals from both ccr5 and cxcr4 13 , and measured hiv-1 entry by pcr , using primers ltr r / u5 specific for early products of reverse transcription 34 . \n the fragment of hiv-1 cdna amplified by these primers is produced either within the virion or very early after virus cell fusion , and thus reflects the efficiency of virus entry . \n 1 a ) and ada ( not shown ) , but not of x4 strains lai ( fig . \n 1 a ) and 92ug21 ( not shown ) . ptx is a complex protein composed of an active ( a ) and a binding ( b ) subunit , and certain t cell activities have been shown to be initiated by the b - oligomer of ptx independently of inactivation of gi - like proteins by the a - protomer 35 . \n we therefore tested whether activity of b - oligomer could account for the observed inhibitory effect of ptx on entry of r5 hiv-1 . \n similar to results observed with ptx , b - oligomer inhibited entry of r5 hiv-1 strains in a dose - dependent fashion , but not of x4 hiv-1 strains ( fig \n analysis of the b - oligomer preparation by sds - page confirmed the lack of a - protomer ( not shown ) , and gi - mediated signaling was not impaired in b - oligomer treated cells ( see fig . \n we thus conclude that ptx blocks entry of r5 hiv-1 strains by a mechanism that is independent of gi protein inhibition . \n interestingly , no inhibitory activity of ptx or b - oligomer was observed on entry of r5 hiv-1 into pm1 cells ( not shown ) , consistent with recently reported results 36 . \n this result underscores the differences between the primary cells and t cell lines . to analyze the effect of b - oligomer on hiv-1 replication in long - term cultures , we measured virus production after in vitro infection of primary pbmcs from hiv - seronegative donor with r5 or x4 hiv-1 strains . \n 1 ) , b - oligomer at 1 nm concentration inhibited replication of a primary r5 strain , 92us660 ( fig . \n . 2 c ) x4 strains , entry of which was not affected by b - oligomer ( fig . \n this result is consistent with recently reported 37 inhibitory effect of ptx on replication in pbmcs of another x4 strain , rf , and indicates that , in addition to its effect on hiv-1 entry via the ccr5 receptor , b - oligomer exerts its anti - hiv activity via another , as yet unidentified , mechanism that works at the post - entry step of viral replication and does not depend on the identity of chemokine receptor used by the virus . \n interestingly , this post - entry inhibitory effect of b - oligomer depended on the multiplicity of infection and was overcome when high virus inoculum was used ( data not shown ) . \n similar to results of entry studies , replication of neither r5 ( 92us660 ) nor x4 ( lai ) strains was inhibited in pm1 cells ( fig . \n c , insets ) . to further investigate the anti - hiv activity of b - oligomer \n , we analyzed its effect on replication of uncloned primary hiv-1 in cocultures of uninfected donor pbmcs with activated pbmcs from hiv-1infected patients . \n the number of infected cells in the pbmcs from such patients is usually low 38 , so the measured virus output in cocultures is primarily a result of virus spread to new targets . a dose - dependent inhibition of virus replication by b - oligomer was observed ( fig . \n this effect was reproduced with pbmcs from three different patients ( not shown ) ; in all cases 1 nm of b - oligomer completely inhibited virus replication . to demonstrate that the inhibitory effect of b - oligomer was not due to its cytotoxic activity , we measured uptake of [ h]thymidine and the change in cell numbers in long - term cultures . \n 2 e , no significant difference in thymidine uptake between b - oligomer treated and untreated cultures was observed during the whole course of the experiment . \n in fact , treated cultures demonstrated higher proliferation rate ( fig . 2 e , inset ) , consistent with the well - known mitogenic effect of b - oligomer 24 \n . therefore , b - oligomer inhibits replication of a wide variety of primary and cell line adapted isolates . \n this result may explain a recently reported inhibitory effect of ptx on replication of sivmac251 ( which uses the ccr5 receptor ) in vivo 39 . \n the inhibitory effect of b - oligomer is exerted at both the entry ( for r5 strains ) and post - entry ( probably for both r5 and x4 viruses ) steps of hiv-1 infection . in this work , \n a possible mechanism by which b - oligomer could specifically inhibit entry of r5 but not x4 hiv-1 strains is by interfering with binding of the virus , either directly ( by blocking the hiv-1 binding site on ccr5 ) or indirectly ( by changing conformation of ccr5 ) . to test this possibility \n 3 a demonstrate that binding of mip-1 to pbmcs was competed by recombinant gp120 of an r5 strain , hiv-1jr - fl , but not by gp120 of an x4 strain , hiv-1lai . \n although treatment of the cells with b - oligomer increased i - labeled mip-1 binding threefold , binding of this ligand was still effectively competed by gp120jr - fl ( fig . \n 3 a ) . to exclude the possibility that b - oligomer nonspecifically affected binding of ccr5 ligands , for instance by acting as a bridge between the ligand and the cell , analysis was also performed using cells treated for 10 min either with b - oligomer at 4c ( to block signaling from b - oligomer receptor ) , or with bsa at 37c ( to mimic the protein concentration in the experimental samples ) . \n both treatments had no effect on i - labeled mip-1 binding , compared with untreated sample ( fig . 3 b ) . therefore , we conclude that the inhibitory activity of the b - oligomer on hiv-1 entry is a signal - mediated process that does not involve blocking of hiv-1 binding to its receptors . \n this result also suggests that binding of gp120 to cd4 and ccr5 is not sufficient to induce fusion of the viral and cellular membranes . \n a logical conclusion from the results presented above is that a post - binding step of virus entry was inhibited in b - oligomer treated cells , and that this effect could be mediated by b - oligomer induced alteration of an intracellular portion of the ccr5 molecule . as this part of the receptor \n is involved in interactions with coupled g proteins , we measured ca mobilization in response to natural ligands of ccr5 and cxcr4 , mip-1 or rantes , and sdf-1 , respectively , after pretreatment of the cells with b - oligomer . treatment of the cells with b - oligomer blocked ca flux initiated by mip-1 ( fig . \n 4 a ) and rantes ( not shown ) , but not by sdf-1 ( fig . 4 b ) . although pretreatment of the cells with mip-1 desensitized response to b - oligomer ( fig . 4 c ) , \n pretreatment with sdf-1 induced only partial desensitization ( fig . 4 d ) . of note \n , b - oligomer at the suboptimal concentration used in these experiments ( 2 nm ) did not desensitize its own receptor ( not shown ) . \n the use of higher concentrations of b - oligomer for desensitization studies was confounded by a very slow return of the ca response to the baseline ( > 30 min ) , thus precluding analysis by fura-2based technique due to leaking of the dye from the cells . \n the pattern of ca response to sequential treatment of cells with b - oligomer and mip-1 is best described by the phenomenon of heterologous desensitization . \n potentially , this desensitization is attributable to signaling from a b - oligomer receptor , similar to the heterologous desensitization of cxcr1 and cxcr2 chemokine receptors by signaling from opiate receptors 40 . \n although we can not formally rule out the possibility that b - oligomer binds to ccr5 , several considerations make this scenario unlikely . \n first , b - oligomer did not compete with mip-1 or gp120 for binding to ccr5 ( fig . \n 3 ) . second , b - oligomer did not induce downregulation of ccr5 , as evidenced by flow cytometric analysis ( not shown ) . \n third , b - oligomer did not induce ca flux ( not shown ) and did not affect hiv-1 replication ( fig . \n 2 ) in pm1 cells , supporting the notion that b - oligomer signals through its own receptor and this signaling is required for its anti - hiv activity . \n treatment of t lymphocytes with ptx or b - oligomer has been reported to rapidly increase pkc activity 30 . to determine whether pkc was involved in the observed effects of b - oligomer on ccr5 function , we used two selective pkc inhibitors , ro-31 - 8220 and g 6979 . \n as shown in fig . 5 , ro-31 - 8220 reversed the inhibitory effect of b - oligomer on entry of r5 hiv-1 ( fig . \n 5 a , panel a ) and on ca flux induced by rantes , another ligand for ccr5 ( fig . 5 \n , ro-31 - 8220 did not significantly alter either of those activities of ccr5 ( fig . 5a and fig . \n 5 b , panels c and d ) , which are mediated by cxcr4 and are not affected by b - oligomer . \n a similar result was observed with a different pkc inhibitor , g 6979 ( not shown ) . taken together , these results indicate that pkc is involved in signal transduction from b - oligomer ( and ptx ) receptor to ccr5 . our results thus far demonstrated that b - oligomer treated cells did not signal after mip-1 stimulation . \n we wished to demonstrate that signaling initiated by hiv-1 binding was also affected . because our attempts to detect ca flux 14 or pyk2 phosphorylation 13 in primary cells after inoculation with hiv-1 or gp120 were unsuccessful , we decided to use receptor capping as an indicator of hiv-1induced signaling . \n inoculation of pbmc cultures with either r5 ( fig . 6 a ) or x4 ( fig . 6 \n b ) hiv-1 strains , or their corresponding gp120s ( table ) , induced a characteristic cocapping of chemokine receptors with cd4 . \n the fact that we were able to detect capped ccr5 and cxcr4 using antibodies that compete with gp120 for chemokine receptor binding suggests that the observed signal came from free receptors that cocapped together with gp120-occupied receptors . \n such interpretation is consistent with previously observed gp120-induced association of cd4 with several surface molecules , such as cd3 , cd45ra , cd26 , and hla class i 4142 , with rantes - induced colocalization of cxcr4 and cd4 43 , and with cocapping of ccr2 and ccr5 in response to mcp-1 or rantes 44 . \n pretreatment of the cells with b - oligomer for 10 min prevented capping of hiv-1 receptors , but only when capping was induced by r5 hiv-1 ( fig . \n this result indicates that capping is mediated by hiv-1induced signaling from chemokine receptors , rather than from cd4 , and that treatment with b - oligomer blocks this signal . to further illustrate the role of signaling from chemokine receptors in capping \n , we analyzed the effect of b - oligomer on capping induced by sdf-1 and mip-1. this analysis was confounded by rapid downregulation of cxcr4 or ccr5 after stimulation with sdf-1 or mip-1 , respectively . \n nevertheless , results presented in table demonstrate that b - oligomer blocked capping induced by mip-1 , but not by sdf-1. similar to hiv-1 or gp120-induced polarization , the capping involved not only the ligand - specific receptor , but also other molecules , including cd4 . \n this result suggests that signaling from chemokine receptors induces a major actin - dependent rearrangement of cellular membrane . \n taken together , the results presented in this report suggest that the inhibitory effect of ptx and its b - oligomer on hiv-1 infection of primary cells is mediated through desensitization of ccr5 . \n exposure to b - oligomer causes t cells to lose signaling activity associated with binding of the natural ccr5 ligand , mip-1 , and to fail to cap after binding of r5 hiv-1 ; however , ligand - binding activity is preserved . \n the role of receptor capping in hiv-1 infection of primary cells , and the nature of signals involved in the regulation of capping are now under investigation in our laboratory . \n it is clear that receptor capping is not required for binding of the virus , but it might be necessary for fusion with primary cells . \n in addition to the potential value of the b - oligomer as an anti - hiv agent , these studies may define new targets in the search for novel therapeutic approaches against hiv infection .", "role": "user" }, { "content": "infection of target cells by hiv-1 requires initial binding interactions between the viral envelope glycoprotein gp120 , the cell surface protein cd4 , and one of the members of the seven - transmembrane g protein coupled chemokine receptor family . \n most primary isolates ( r5 strains ) use chemokine receptor ccr5 , but some primary syncytium - inducing , as well as t cell line adapted , strains ( x4 strains ) use the cxcr4 receptor . signaling from both ccr5 and cxcr4 is mediated by pertussis toxin ( ptx)-sensitive gi proteins and is not required for hiv-1 entry . here \n , we show that the ptx holotoxin as well as its binding subunit , b - oligomer , which lacks gi - inhibitory activity , blocked entry of r5 but not x4 strains into primary t lymphocytes . \n interestingly , b - oligomer inhibited virus production by peripheral blood mononuclear cell cultures infected with either r5 or x4 strains , indicating that it can affect hiv-1 replication at both entry and post - entry levels . \n t cells treated with b - oligomer did not initiate signal transduction in response to macrophage inflammatory protein ( mip)-1 or rantes ( regulated upon activation , normal t cell expressed and secreted ) ; however , cell surface expression of ccr5 and binding of mip-1 or hiv-1 to such cells were not impaired . \n the inhibitory effect of b - oligomer on signaling from ccr5 and on entry of r5 hiv-1 strains was reversed by protein kinase c ( pkc ) inhibitors , indicating that b - oligomer activity is mediated by signaling events that involve pkc . \n b - oligomer also blocked cocapping of ccr5 and cd4 induced by r5 hiv-1 in primary t cells , but did not affect cocapping of cxcr4 and cd4 after inoculation of the cultures with x4 hiv-1 . \n these results suggest that the b - oligomer of ptx cross - deactivates ccr5 to impair its function as a coreceptor for hiv-1 .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: irritable bowel syndrome ( ibs or spastic colon ) is a common gastrointestinal ( gi ) disorder that affects 520% of individuals worldwide . \n it occurs more often in women than in men , and is more commonly diagnosed in patients younger than 50 years of age . \n ibs is a symptom - based diagnosis characterized by chronic abdominal pain , diarrhea , constipation , discomfort , bloating , and a change in bowel habit . \n some patients complain of daily symptoms , while others present with intermittent symptoms at intervals of weeks or months . \n ibs is a disease with a high social cost , as it considerably reduces the quality of life . \n although environment , social learning , diet , intestinal microbiota , low - grade inflammation and disturbances in the enterochromaffin cell function , and genetical factors ( especially some gene polymorphism ) are considered as etiopathogenic causes of ibs , the exact cause remains unknown . \n reactive oxygen species ( ros ) , including superoxide , hydroxyl , hydrogen peroxide , singlet oxygen , and nitric oxide are generated by cells in some physiological and pathological circumstances . \n ros can react with all macromolecules , such as lipids , proteins , nucleic acids , and carbohydrates , particularly polyunsaturated fatty acids on the cell membrane . \n after the beginning of an initial reaction with ros , a continuing chain reaction is started and cell injury and , ultimately , cell death , occurs . \n ros - initiated oxidative stress can be regulated by the antioxidant defense system , which includes enzymatic and nonenzymatic antioxidants . \n superoxide dismutase ( sod ) , catalase ( cat ) , and glutathione peroxidase are enzymes that have antioxidant properties . \n clinical and experimental studies have reported the role of oxidative stress in inflammatory bowel disorders . \n to our knowledge , there are no clinical studies in the literature about oxidative stress in patients with ibs . in the present study \n , we evaluated the plasma concentrations of malondialdehyde ( mda ) and nitric oxide ( no ) and the plasma activities of oxidant and antioxidant enzymes in patients with ibs and in age- and sex - matched healthy controls to investigate the role of oxidative stress in the pathogenesis of ibs . \n the study included 36 patients ( 19 females , 17 males ; age range : 1862 years ) who had applied to namk kemal university faculty of medicine , department of gastroenterology , and were diagnosed with ibs using the rome iii criteria and had no alarm symptoms , no chronic disease history , and had macroscopically normal colonoscopy / upper gastrointestinal system endoscopic findings . \n there were 35 control patients ( 19 females , 16 males ; age range : 1863 years ) who had no history of chronic disease or drug use , who were undergoing colonoscopy for reasons not related to ibs ( familial colorectal cancer screening or investigation of anemia ) , and who had macroscopically normal colonic mucosa . \n the study was carried out in accordance with the declaration of helsinki ii with approval of the ethics committee of namk kemal university faculty of medicine . \n all participants were informed about the study protocol and written consent was obtained from each of them . \n exclusion criteria were alcohol and substance abuse or dependence , presence of severe organic disorders , use of any antioxidants like vitamin e or c , presence of gastroenterological disorder , presence of infectious and viral disease , and excessive obesity . \n xo activity was assayed spectrophotometrically at 293 nm and 37c with xanthine as substrate . the formation of ua from xanthine results in increase in absorbency . \n one unit of activity was defined as 1 mol of ua formed per minute at 37c , ph 7.5 , and expressed in ul . \n ad activity was estimated spectrophotometrically by the method of giusti , which is based on the direct measurements of the formation of ammonia , which is produced when ad acts in excess of adenosine , and expressed in ul . as no measurement is very difficult in biologic specimens , \n was measured after conversion of nitrate to nitrite by copperized cadmium granules by a spectrophotometer at 545 nm . \n mda concentrations were determined using the method of draper and hadley , based on the reaction of mda with thiobarbituric acid ( tba ) at 95c . in the tba test reaction , mda and tba \n the sample was mixed with 2.5 volumes of 10% ( w / v ) trichloroacetic acid to precipitate the protein . \n the precipitate was pelleted by centrifugation and an aliquot of supernatant was reacted with 0.67% tba in a boiling water bath for 15 min . after cooling \n arbitrary values obtained were compared with a series of standard solutions ( 1,1,3,3 tetramethoxypropane ) . \n total sod ( ec 1.15.1.1 ) activity was determined according to the method of sun et al . \n the principle of the method is based on the inhibition of nitroblue tetrazolium reduction by the xanthine xanthine oxidase system as a superoxide generator . \n activity was assessed in the ethanol phase of the sample after 1.0 ml ethanol / chloroform mixture ( 5/3 , v / v ) was added to the same volume of sample and centrifuged . \n one unit of sod was defined as the enzyme amount causing 50% inhibition in the nbt reduction rate . \n gsh - px ( ec 1.6.4.2 ) activity was measured by the method of paglia and valentine . the enzymatic reaction in the tube , containing nadph , reduced glutathione ( gsh ) , sodium azide , and glutathione reductase , \n was initiated by addition of h2o2 and the change in absorbance at 340 nm was monitored by a spectrophotometer . \n the principle of the assay is based on the determination of the rate constant ( s-1 , k ) of the h2o2 decomposition at 240 nm . \n activities are expressed as k ( rate constant ) per l ( k / l ) . \n the minitab program was utilized for power calculation . in the sample patient population , n=36 and the impact factor for d=4 \n the study included 36 patients ( 19 females , 17 males ; age range : 1862 years ) who had applied to namk kemal university faculty of medicine , department of gastroenterology , and were diagnosed with ibs using the rome iii criteria and had no alarm symptoms , no chronic disease history , and had macroscopically normal colonoscopy / upper gastrointestinal system endoscopic findings . \n there were 35 control patients ( 19 females , 16 males ; age range : 1863 years ) who had no history of chronic disease or drug use , who were undergoing colonoscopy for reasons not related to ibs ( familial colorectal cancer screening or investigation of anemia ) , and who had macroscopically normal colonic mucosa . \n the study was carried out in accordance with the declaration of helsinki ii with approval of the ethics committee of namk kemal university faculty of medicine . \n all participants were informed about the study protocol and written consent was obtained from each of them . \n exclusion criteria were alcohol and substance abuse or dependence , presence of severe organic disorders , use of any antioxidants like vitamin e or c , presence of gastroenterological disorder , presence of infectious and viral disease , and excessive obesity . \n xo activity was assayed spectrophotometrically at 293 nm and 37c with xanthine as substrate . the formation of ua from xanthine results in increase in absorbency . \n one unit of activity was defined as 1 mol of ua formed per minute at 37c , ph 7.5 , and expressed in ul . \n ad activity was estimated spectrophotometrically by the method of giusti , which is based on the direct measurements of the formation of ammonia , which is produced when ad acts in excess of adenosine , and expressed in ul . as no measurement is very difficult in biologic specimens , \n samples were initially deproteinized with somogyi reagent . total nitrite ( nitrite + nitrate ) was measured after conversion of nitrate to nitrite by copperized cadmium granules by a spectrophotometer at 545 nm . \n mda concentrations were determined using the method of draper and hadley , based on the reaction of mda with thiobarbituric acid ( tba ) at 95c . in the tba test reaction , mda and tba \n the sample was mixed with 2.5 volumes of 10% ( w / v ) trichloroacetic acid to precipitate the protein . \n the precipitate was pelleted by centrifugation and an aliquot of supernatant was reacted with 0.67% tba in a boiling water bath for 15 min . after cooling , \n arbitrary values obtained were compared with a series of standard solutions ( 1,1,3,3 tetramethoxypropane ) . \n total sod ( ec 1.15.1.1 ) activity was determined according to the method of sun et al . \n the principle of the method is based on the inhibition of nitroblue tetrazolium reduction by the xanthine xanthine oxidase system as a superoxide generator . \n activity was assessed in the ethanol phase of the sample after 1.0 ml ethanol / chloroform mixture ( 5/3 , v / v ) was added to the same volume of sample and centrifuged . \n one unit of sod was defined as the enzyme amount causing 50% inhibition in the nbt reduction rate . \n gsh - px ( ec 1.6.4.2 ) activity was measured by the method of paglia and valentine . the enzymatic reaction in the tube , containing nadph , reduced glutathione ( gsh ) , sodium azide , and glutathione reductase , \n was initiated by addition of h2o2 and the change in absorbance at 340 nm was monitored by a spectrophotometer . \n xo activity was assayed spectrophotometrically at 293 nm and 37c with xanthine as substrate . the formation of ua from xanthine results in increase in absorbency . \n one unit of activity was defined as 1 mol of ua formed per minute at 37c , ph 7.5 , and expressed in ul . \n ad activity was estimated spectrophotometrically by the method of giusti , which is based on the direct measurements of the formation of ammonia , which is produced when ad acts in excess of adenosine , and expressed in ul . \n as no measurement is very difficult in biologic specimens , sample nitrite and nitrate concentrations are used as an index of no production . \n samples were initially deproteinized with somogyi reagent . total nitrite ( nitrite + nitrate ) was measured after conversion of nitrate to nitrite by copperized cadmium granules by a spectrophotometer at 545 nm . \n in the samples , mda concentrations were determined using the method of draper and hadley , based on the reaction of mda with thiobarbituric acid ( tba ) at 95c . in the tba test reaction , mda and tba \n the sample was mixed with 2.5 volumes of 10% ( w / v ) trichloroacetic acid to precipitate the protein . \n the precipitate was pelleted by centrifugation and an aliquot of supernatant was reacted with 0.67% tba in a boiling water bath for 15 min . after cooling , \n arbitrary values obtained were compared with a series of standard solutions ( 1,1,3,3 tetramethoxypropane ) . \n total sod ( ec 1.15.1.1 ) activity was determined according to the method of sun et al . \n the principle of the method is based on the inhibition of nitroblue tetrazolium reduction by the xanthine xanthine oxidase system as a superoxide generator . \n activity was assessed in the ethanol phase of the sample after 1.0 ml ethanol / chloroform mixture ( 5/3 , v / v ) was added to the same volume of sample and centrifuged . \n one unit of sod was defined as the enzyme amount causing 50% inhibition in the nbt reduction rate . \n gsh - px ( ec 1.6.4.2 ) activity was measured by the method of paglia and valentine . the enzymatic reaction in the tube , containing nadph , reduced glutathione ( gsh ) , sodium azide , and glutathione reductase , \n was initiated by addition of h2o2 and the change in absorbance at 340 nm was monitored by a spectrophotometer . \n the principle of the assay is based on the determination of the rate constant ( s-1 , k ) of the h2o2 decomposition at 240 nm . \n activities are expressed as k ( rate constant ) per l ( k / l ) . \n the minitab program was utilized for power calculation . in the sample patient population , n=36 and the impact factor for d=4 \n in patients with ibs , significantly higher concentrations of plasma mda and no concentrations were found compared to the control group ( p<0.01 , and p<0.05 , respectively ) ( table 1 ) . \n oxidant enzyme xo activity was increased in the ibs group compared to the control group ( p<0.01 ) ( table 1 ) . \n ad activity in patients with ibs was found to be increased compared to controls ( p<0.01 ) ( table 1 ) . there was a remarkable decrease in sod , cat , and gsh - px activities in patients with ibs compared to control subjects ( p<0.001 , p<0.01 , and p<0.01 , respectively ) ( table 2 ) . \n to date , measurement / evaluation of antioxidant and antioxidant enzyme activities , and nitric oxide and lipid peroxidation product have not been studied in samples of ibs patients associated with oxidative stress . in this study , \n plasma xo activity was measured and higher levels of the enzyme activity were found in patients with ibs in comparison with the control group . \n xo , in the presence of its substrate hypoxanthine or xanthine , reduces molecular oxygen to superoxide anion radical and hydrogen peroxide , which can further react to form the more reactive hydroxyl radical , termed ros . \n xo - derived ros have been suggested to be critical factors in several mechanisms of tissue pathophysiology . \n recently , studies have shown that inflammatory cytokine levels increased and levels of mucosal - soluble mediators such as zo-1 and levels of adhesion molecules l decreased and also extracellular matrix components , and matrix receptors were reduced in the samples of patients with ibs . \n reported that xo - derived ros contribute to the increased expression of mrna for interleukin 1 beta ( il - b ) and tumor necrosis factor - a ( tnf- ) , which are both found to be increased in ibs samples . \n in several studies of inflammatory bowel disease , the role of inflammation as a causative factor of abnormal intestinal motor function has been reported . \n inflammatory mediators such as il-1 and h2o2 have been shown to be associated with altered sigmoid motor dysfunction in ulcerative colitis . \n we suggest that a similar situation is present in the intestines of patients with ibs . in the purine metabolic pathway \n , ad is an important deaminating enzyme , which converts adenosine and 2-deoxyadenosine to inosine and 2-deoxyinosine , respectively . \n ad is not only a cytosolic enzyme , but it can also be found as an ecto - enzyme . \n plasma ad activity was found to be high , supporting the opinion that cellular immunity plays an important role in the pathogenesis of ibs . \n furthermore , ad activity can be accepted as an important factor in some other alterations observed in cellular immunity , such as elevation of t cell fractions in peripheral blood , and elevation of t cell activity and expression in mucosa in ibs patients . increased ad activity , by inducing t cell subtypes , \n a strict correlation is observed between no production and gastrointestinal diseases and it is suggested that elevation of no plays an important role in the pathogenesis of these diseases . in our study , we found significantly higher plasma no concentrations in ibs patients compared with the controls . \n there are not enough studies in the literature on the relation between ibs and no , and there is no consensus between the few clinical studies on this subject . while dykhuizen et al . \n reported that there is no significant change in no level between ibs patients and control subjects , yazar et al . reported an increase in ( with constipation ) ibs patients . \n reinders et al . , using chemiluminescence technique , also found an increase in no concentrations in rectal mucosa of patients with ibs . \n although it is not known if ad activity has a direct effect on no synthesis , it is claimed that there is a synergistic relationship between adenosine and no production . \n because increase in the amount of substrate is one of the significant factors increasing enzyme activity , increase in ad activity may suggest an increase in the amount of adenosine , which is an ad substrate . \n in addition , many studies in the literature show that an increase in the amount of no is accompanied by an increase in ad activity . no is a strong inhibitor of smooth muscle contraction , and high local concentrations of no has been hypothesized to play an important role in the development of toxic mega colon . \n hence , high no concentrations may be one of the factors disrupting normal bowel movements in the setting of ibs . in our study \n , it was observed that sod , cat , and gsh - px activities were significantly lower in the ibs group than in the control group . \n we considered that the decreased antioxidant capacities of cells could be responsible for the increase in ros , which may explain the increased level of mda . \n a search in pubmed did not reveal any clinical studies that investigated antioxidant enzyme activities in samples of ibs patients , and there is no consensus between the few experimental studies on this subject . while mozaffari et al . \n showed by experimental study decreased antioxidant power of the samples in ibs rats in comparison with the controls , ding et al . \n , in a proteomic analysis of colonic mucosa in a rat model of ibs , reported that antioxidant activity ( peroxiredoxin-6 ) is over - expressed . \n these results suggest that lipid peroxidation and alterations in the oxidant - antioxidant enzymatic system may play a role in the pathogenesis of ibs . \n increased lipid peroxidation in ibs may be related to an increase in no level and xo activity , and a decrease in antioxidant enzyme activities . \n we believe our study provides further evidence of the role of oxidative and nitrosative pathophysiology in development of irritable bowel syndrome and encourages further research for the treatment of this disorder with agents targeting these complex pathways .", "role": "user" }, { "content": "backgroundthe aim of this study was to evaluate the plasma concentrations of malondialdehyde ( mda ) and nitric oxide ( no ) and the plasma activities of oxidant and antioxidant enzymes in patients with ibs.material/methodsa total of 36 patients with ibs were included in the study . \n thirty - five healthy subjects were selected to form the control group . \n superoxide dismutase ( sod ) , catalase ( cat ) , glutathione peroxidase ( gsh - px ) , xanthine oxidase ( xo ) , adenosine deaminase ( ad ) activities , and malondialdehyde ( mda ) and nitric oxide ( no ) concentrations were studied in the serum samples of all patients and controls.resultsplasma xo and ad activities , and mda and no concentrations were significantly higher in ibs patients than in controls . \n the sod , cat , and gsh - px activities in the serum of patients with ibs were significantly lower than that of controls.conclusionsthese results suggest that lipid peroxidation and alterations in the oxidant - antioxidant enzymatic system may play a role in the pathogenesis of ibs . increased lipid peroxidation in ibs may be related to an increase in no level and xo activity and a decrease in antioxidant enzymes activities . \n in addition , increased ad activity may have a role in immunological changes of ibs patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: obstructive sleep apnea ( osa ) is characterized by repeated episodes of upper airway obstruction associated with its diameter reduction , thus becoming vulnerable to a greater narrowing and collapse during sleep.1 the causes of osa include factors related to upper airway anatomy , that is , restricted airspace on mandibular retrognathism , increased tongue volume , and palatal or the adenoids extension.2 increased body mass index ( bmi ) was also nominated as one of the most significant predisposing factors for sleep disorders of upper airway , due to the possibility of fat deposition in the upper airway tissue , thus reducing nasopharyngeal gauge and/or leading to hypoventilation.3 one study showed that in 56% of individuals with osa , non - anatomical factors such as decreased responsiveness of the genioglossus , low threshold of excitement , and respiratory control instability , play an important role in the upper airway collapse.4 \n acute effects of apnea and hypopnea include repeated episodes of oxygen desaturation , negative intrathoracic pressure , central nervous system awakenings , and excessive daytime sleepiness.5 other effects of osa can contribute to the disruption of memory reorganization and the development of mental disorders.6 \n craniocervical posture is related to the stomatognathic system based on the concept of craniocervicomandibular system , which defines the morpho - functional unit comprising the head , neck , and jaw.7 a study shows that sleep disorders could be due to an incorrect head posture of osa subjects who are prone to greater craniocervical extension with a forward head posture.4 \n cephalometric analysis is considered as an important diagnostic method , which investigates craniofacial features8 predisposing to osa , such as posterior pharyngeal space , tongue length , and hyoid bone position.3 \n 9 moreover , it can be used to verify the correlation of anatomical changes and the severity of osa,10 and to identify obstruction locations , assisting the choice of the most appropriate treatment.11 this technique is useful in assessing the upper airway morphology because , besides its low cost , it is readily available in most hospitals and radiology centers.11 \n the airway dimensions and structures seem to be affected by head posture and inclination and body position when evaluated by cephalometry.12 \n 13 \n 14 when the osa subject is awake and moves from upright to supine position , he maintains the upright tongue posture to protect against the upper airway collapse secondary to the increased gravitational load on the tongue.13 however , another study analyzed osa and snoring subjects , demonstrating that the linear cephalometric measurements of the airway taken with conscious patients in the supine position did not differ from the corresponding measurements obtained with the patient in upright position.14 \n for the assessment of head posture , photogrammetry is a simple , easy , and objective analysis technique , showing good reliability.15 however , no studies have been conducted using this method for verifying the craniocervical posture in osa patients . \n this study aimed to verify the craniofacial characteristics and craniocervical posture of osa patients and healthy subjects and to determine the possible relations with the apnea / hypopnea index ( ahi ) in osa subjects . \n this case - control study was approved by the research ethics committee of universidade federal de santa maria ( ufsm ) , under the caae number 33665714.0.0000.5346 , according to the resolution 466/2012 of the national health council . \n the participants were divided into two groups : control group without sleep apnea ( cg ) and the group with obstructive sleep apnea ( osag ) . \n the osag consisted of 21 patients with osa of both genders , aged 20 to 60 years , diagnosed by baseline whole - night polysomnography held at instituto do sono de santa maria ( issm ) , with ahi 5 and < 30 events / hour ( mild and moderate apnea ) . \n ahi is classified as mild if 514 events / hour are present , moderate if 1529 events / hour are present , or severe if 30 events / hour are present.5 \n the sample size calculation was performed based on the study by lam et al16 evaluating the distance from the hyoid bone to the mandibular plane , by means of cephalometry in patients with osa ( ahi 5 events / hour and < 30 events / hour ) and without osa ( ahi < 5 events / hour ) . to obtain a significance level of 5% and power ( ) of 90% , with 3.65 mm effect magnitude \n , this work has involved at least 20 subjects in each group ( control and osa ) , with a total number of 40 volunteers . \n the cg consisted of 21 healthy subjects from the local community . only subjects who did not have drowsiness \n were included , according to the sleepiness scale epworth ( ese , score < 10 points),17 with low probability of sleep apnea based on the berlin questionnaire ( bq)18 and good sleep quality assessed by the pittsburg sleep quality index ( psqi - br , score 5 points ) , validated in portuguese.19 both groups were matched for gender and age . \n we excluded from the study subjects with a history of facial and/or craniocervical trauma , presenting with musculoskeletal deformities , previous craniomandibular and/or cervical surgical procedures , using braces during the survey period , who underwent physical therapy for postural correction and/or speech therapy , using cpap ( continuous positive airway pressure ) and/or oral appliance for mandibular advancement and who had been submitted to nasal surgery or pharyngeal surgery ( such as deviated septum correction , removal of tonsils and/or adenoids and/or uvulopalatopharyngoplasty ) . \n moreover , we excluded subjects with any cognitive impairment that could affect the comprehension of the evaluations , who were unable to read or sign the informed consent ( ic ) , diagnosed with heart disease or chronic obstructive pulmonary disease ( copd ) and bmi above 30 or below 18.5 kg / m . \n kg / m to eliminate the influence of obesity on osa and other study variables.3 \n 20 we did not include subjects diagnosed by polysomnographic as severe basal level of osa ( ahi > 30 events / hour ) in osag because in such cases , even if there was a postural component involved , the anatomical and/or intrinsic changes could have a greater impact in the context of the pathology , leading to a larger number of study biases . \n we invited the osag subjects to participate in the study by telephone , after previous selection by means of polysomnography analysis . \n the procedures were performed in the premises of issm , clnica imagem de radiologia e laboratrio de motricidade orofacial do departamento de fonoaudiologia da ufsm and with the permission and consent of the respective managers between november 2014 and march 2015 . \n the subjects completed a medical history form containing information such as age , body weight , and height . \n for the evaluation of craniofacial measurements , head posture , and air space measures , we applied the methods of cephalometry and photogrammetry . \n the volunteers underwent a right lateral radiograph of the skull and cervical spine in normal standing position for cephalometric evaluation . to reproduce the natural head position \n , the participants kept staring at the reflection of their eyes in a mirror at a distance of one meter.21 a single trained examiner analyzed the radiographs , performing linear and angular measurements through manual and computerized methods ( software cef x version 4.5.10 , cdt , cuiaba , brazil ) . \n the forward head posture was assessed manually through the cpl / hor angle , which is formed by the intersection of cpl ( craniocervical postural line ) and the horizontal line ( cpl / hor).21 cpl touches the center points of the first six cervical vertebrae marked on the body . \n individuals with a more forward head position angle featured cpl / hor < 80.22 \n analyses of the adenoids , rocabado and sleep apnea , were performed by means of computerized method , with the marking of the points made manually by a trained evaluator . in the adenoids analysis , \n the nasopharyngeal air space was evaluated,23 bringing together four cephalometric measurements to evaluate the nasopharyngeal region , following the standards described by schulhof.23 finally , an index was issued which represents the synthesis of all the factors , considering the presence or absence of adenoid hypertrophy ( fig . \n photographs of cephalometric standards used : ( a ) adenoids analysis ; ( b ) rocabado analysis ; ( c ) analysis of sleep apnea . \n the rocabado analysis evaluates the spinal biomechanics , through the study of the head and hyoid bone position , the cervical spine inclination and the airway conditions.24 it comprises six cephalometric magnitudes ; however , only three of them were used in this study , which verified the head and the hyoid bone posture . \n the cephalometric measures evaluated were : a ) craniocervical angle ( cva ) ; analysis of the cervical spine curvature and head posture in relation to the upper cervical posture ( flexion / extension of the head ) , formed by the intersection of mcgregor and odontoid plans , classified as follows : normal head posture 96 to 106 , head extension < 96 and head bending > 10622 ; b ) distance o - a : distance between the base of the occipital bone and the posterior arch of the atlas vertebra ; it also evaluates the craniocervical posture , but in a linear fashion ; c ) height h : distance from the body of the hyoid bone ( h ) to the line formed by the antero - inferior points and retrognathia ( rgn ) of the third cervical vertebra ( c3 ) . \n it determines the spatial position of the hyoid bone and , consequently , the tongue posture . \n , we analyzed craniofacial and upper air space measures , such as : anterior cranial base ( s - n ) ; jaw length ( ena - enp ) ; mandibular length ( goc - me ) ; soft palate length ( enp - p ) ; tongue length ( tgl ) ; atlas - jaw distance ( a - enp ) ; hyoid bone - third cervical vertebra distance ( h - c3 ) ; distance between the hyoid bone and the mandibular plane ( h - pm ) ; upper pharyngeal space ( upphw - pp1 ) ; average posterolateral palatal space ( pp2-pp2 ' ) ; average pharyngeal air space , located between the posterior pharyngeal wall and the lower limit of the uvula ( mpphw - maphw ) ; posterior pharyngeal air space ( pas ) ; lower air space ( las ) ; tongue height ( tgh ) . \n measurements were taken according to the reference standards described by marques and maniglia25 ( fig . \n 1 ) . we also evaluated head and cervical spine posture by means of digital photography with photogrammetric analysis by the postural assessment software ( sapo).22 the participants , with proper clothing , hair tied back , and barefoot , were photographed with a black background , a suspended plumb line next to the volunteers , and a rubber mat . \n the photographic records were obtained with the help of a 14.1 megapixel sony ( dsc - w350 , brazil ) digital camera , set on a tripod positioned at a distance of 3 m and at 1.20 m height from the floor , right side view , in habitual posture . \n the same technique was used in cephalometry to reproduce the natural head position.21 \n the anatomical points were marked on the subject 's body with white styrofoam balls previously prepared with double - sided tape for fixing on the skin . \n we used the tragus points , spinous process of the seventh cervical vertebra ( c7 ) and orbicularis commissure for measuring the angles : angle 1 ( a1 ) : formed between the tragus , the spinous process of c7 ( vertex ) and the horizontal line , and angle 2 ( a2 ) : formed by the points scored in the spinous process of c7 ( vertex ) , tragus and orbicularis commissure.22 the smaller the angle a1 , the higher the head anteriorization , and the greater the angle a2 , the greater the head extension in the upper cervical \n the data were expressed as mean and standard deviation . for data comparison with normal distribution , we used the student 's t - test or the unpaired mann - whitney u test , in cases of non - normality . \n we used the chi - square or fisher 's exact test to assess the associations between the categorical variables . \n we evaluated the correlations between the variables by pearson ( quantitative variables ) or spearman ( quantitative or qualitative ordinal variables ) correlation coefficient and classified according to the correlation of the magnitude scale proposed by dancey and reidy,26 where r = 0.10 to 0.30 ( weak ) ; r = 0.40 to 0.6 ( moderate ) ; r = 0.70 to 1 ( strong ) . \n the groups were homogeneous regarding gender ( 12 men and 9 women in each group ; p = 1.000 ) , age ( osag = 41.86 11.26 years ; cg = 41.19 11.20 years ; p = 0.831 ) , bmi ( osag = 25.65 2.46 \n the osag subjects showed ahi = 13.42 6.60 events / hour ( mild osa ) , according to the whole - night polysomnography baseline report . in the cephalometric analysis of the adenoids , \n all subjects were within the normal range ( index = 0 ) . \n table 1 shows the values found in the comparative analysis of photogrammetry ( a1 and a2 ) and cephalometry regarding the craniocervical posture in the groups with and without osa . \n table 2 shows the values found in cephalometric analyses regarding craniofacial measurements and upper air space in the groups with and without osa , with significantly higher values of mpphw - maphw and reduced values for the distance h - pm in osag . \n abbreviations : a1 , angle between the tragus , the spinous process of c7 ( vertex ) and the horizontal line ; a2 , angle between the points scored in the spinous process of c7 ( vertex ) , tragus and orbicularis commissure ; cg , control group ; cpl / hor , intersection of cpl ( craniocervical postural line ) and the horizontal line ; cva , angle craniovertebral ; dp , standard deviation ; distance o - a , distance between the base of the occipital bone and the posterior arch of the atlas vertebra ; height h , distance from the body of the hyoid bone to the line formed by the antero - inferior points and retrognathia of the third cervical vertebra ; osag , group with obstructive sleep apnea . student t test ; u test mann - whitney . * statistical significance : p 0.05 . \n cg , control group ; dp , standard deviation ; ena - enp , jaw length ; enp - p , soft palate length ; goc - me , mmandibular length ; h - c3 , hyoid bone - third cervical vertebra distance ; h - pm , distance between the hyoid bone and the mandibular plane ; mpphw - maphw , average pharyngeal air space ; pas , posterior pharyngeal air space ; pp2-pp2 ' , average posterolateral palatal space ; osag , group with obstructive sleep apnea ; s - n , anterior cranial base ; tgl , tongue length ; tgh , tongue height ; las , lower air space ; upphw - pp1 , upper pharyngeal space . student t test ; u test mann - whitney . * statistical significance : p 0.05 . by correlating the cephalometric and photogrammetric variables with the ahi \n , we observed a significant moderate positive correlation with angle a2 evaluated by photogrammetry , that is , the higher the ahi , the greater the head extension . \n there was a significant moderate negative correlation with the cpl / hor and cva angles , obtained by cephalometry . \n the higher the ahi , the lower the cpl / hor angles , corresponding to greater head anteriorization and cva , corresponding to the largest head extension . \n abbreviations : ahi , apnea / hypopnea index ; a2 , flexion / extension of the head by means of photogrammetry ; cpl / hor , forward head through cephalometry ; cva , flexion / extension of the head through the cephalometry . \n the incidence of craniocervical postural changes in osa subjects has been studied.25 anatomically , the pharyngeal airway , which is the site of obstruction in osa , is surrounded by soft tissue and the jaw , depending not only on the tissue volume , but also on the size and the mandibular position . \n even more remarkable is the fact that the jaw can move in the anteroposterior direction , producing changes in craniocervical angles.27 thus , the airway dimensions and structures seem to be affected by head posture and inclination and body posture when evaluated by cephalometry.12 \n 13 however , in this study , we found no differences between the groups regarding craniocervical posture , because both groups had normal head posture when we evaluated the craniovertebral and cpl / hor angles , reflecting in the subjects ' normal head posture . \n craniofacial measures , such as increased dimensions of pharyngeal soft tissue , increased hyoid distance , increased tongue and soft palate thickness , and narrowing of the upper pharynx , oropharynx and hypopharynx air space , may be important risk factors for the development of osa.3 \n 25 osa subjects may also present reduced length of the midface , inferiorly positioned hyoid bone , and smaller airways.28 the determining factors in the collapse of the upper airway are multiple , the airway anatomy being only one of them.29 \n skeletal measures influence the upper airway dimensions \n . the main parameters of the pharynx are the posterior air space , that is , the distance between the posterior pharyngeal wall and the tongue base or soft palate , and may be divided into upper , middle , and lower pharyngeal space . in this study , middle pharyngeal space values ( between posterior pharyngeal wall and the lower limit of the uvula ) of the osag \n were significantly lower when compared with the control group ( p = 0.037 ) . \n this result is in accordance with a study3 in which a reduction in the posterior airway space was observed in osa subjects , and this characteristic is considered to be a risk factor for the occurrence of osa . regarding the distance from the hyoid bone to the mandibular plane ( mp - h ) , higher values were found in the osag when compared with cg . \n this reflects a lower position of the hyoid bone , which , according to studies,25 \n 28 \n 30 may be associated with the presence of osa . \n the hyoid bone position impacts the tongue shape and position , affecting the airway patency in the hypopharynx.31 therefore , attention should be paid to the increased distance from the hyoid bone , because as the tongue muscles are partly anchored to the hyoid bone , its height can influence the relationship of soft tissues in the oropharynx , facilitating the airway collapse during sleep.30 \n increased severity of osa , verified by ahi , correlated with an increase in the angle a2 , obtained by photogrammetry , and the reduction of the cpl / hor angles and cva obtained by cephalometry . \n these results show the influence of head posture in the presence of osa , and head hyperextension and anteriorization correlated with the severity of osa . \n another study found that only the measures of the distance between the mandibular plane and the hyoid bone , the distance between the posterior nasal spine and the soft palate , and the cervical and abdominal circumferences correlated with the severity of osa ( ahi ) in patients aged 40 and < 60 years.32 in another study evaluating 96 subjects , the only cephalometric variable that showed a statistically significant correlation with ahi was the linear distance perpendicular from the hyoid bone to the mandibular plane,30 whose measure in this study was higher in the osag , but did not correlated with the ahi . \n this may be due to the larger size and different composition of the study sample according to the classification of the severity of apnea , with 11 subjects presenting with snoring , 20 subjects with mild apnea , 26 with moderate apnea , and 39 with severe apnea.30 \n patients with sleep - disordered breathing ( sdb ) typically have several physiological characteristics that may explain the disorder \n . however , several non - anatomical factors may be responsible for this condition . during sleep , \n the masticatory muscle activity and the tongue play an important role in sdb . in aos \n , the influence of the force of gravity on the mandible , especially in the supine position , combined with muscle hypotonia of the tongue and masticatory muscles results in a further displacement of the jaw and tongue , thus narrowing the oropharynx and increasing the upper airway resistance.33 the correlation between the severity of osa with the head anteriorization is justified by the fact that this approach produces a posterior displacement of the mandibular condyle,22 which may lead to a reduction in the upper airspace . \n the hypothesis that anatomical factors are involved in the etiology of osa has extensive support in the literature . \n therefore , it is important to know the predominant anatomic alterations in individuals with apnea , so that the professionals can identify the risk factors and refer the patient to a specialist to carry out specific tests , such as polysomnography , considered the gold standard for diagnosis of osa \n the present results are in accordance with the hypothesis of this study , where differences were found in craniofacial morphology of osa subjects compared with healthy subjects , suggesting the influence of craniocervical posture in the severity of osa . \n however , it is important to note that , although there may be a recognizable cephalometric predisposition to sdb , this is just one of the many aspects involved in the pathophysiology of osa . \n these findings are valuable for clinical practice , as the global perception of the patient is a major challenge for health professionals aiming to perform a careful evaluation and to propose an appropriate treatment program . \n future studies should be conducted to provide more information on the collapsibility of the upper airways . \n the subjects in the group of mild and moderate osa feature changes in craniofacial morphology , with shorter intermediate pharyngeal space and greater distance from the hyoid bone to the mandibular plane , as compared with healthy subjects , suggesting a relationship between craniocervical posture and osa . moreover , in osa subjects , head hyperextension and anteriorization correlated with the severity of osa , analyzed by the ahi .", "role": "user" }, { "content": "introduction \n obstructive sleep apnea ( osa ) is characterized by repeated episodes of upper airway obstruction during sleep.objective \n the objective of this study is to verify the craniofacial characteristics and craniocervical posture of osa and healthy subjects , determining possible relationships with the apnea / hypopnea index ( ahi).methods \n this case - control study evaluated 21 subjects with osa , who comprised the osa group ( osag ) , and 21 healthy subjects , who constituted the control group ( cg ) . \n cephalometry analyzed head posture measurements , craniofacial measurements , and air space . \n head posture was also assessed by means of photogrammetry.results \n the groups were homogeneous regarding gender ( 12 men and 9 women in each group ) , age ( osag = 41.86 11.26 years ; gc = 41.19 11.20 years ) , and body mass index ( osag = 25.65 2.46 \n kg / m2 ; cg = 24.72 3.01 \n kg / m2 ) . \n we found significant differences between the groups , with lower average pharyngeal space and greater distance between the hyoid bone and the mandibular plane in osag , when compared with cg . \n a positive correlation was found between higher head hyperextension and head anteriorization , with greater severity of osa as assessed by ahi.conclusion \n osag subjects showed changes in craniofacial morphology , with lower average pharyngeal space and greater distance from the hyoid bone to the mandibular plane , as compared with healthy subjects . moreover , in osa subjects , the greater the severity of osa , the greater the head hyperextension and anteriorization .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: retained foreign body granulomas in the intervertebral disc space due to penetrant traumas are very rare like other paraspinal ones2,3,57,10 ) . to our knowledge , \n all of the reported retained foreign bodies in the intervertebral disc space were from missile injuries and there was not any report involving a retained foreign body granuloma in this region from wooden penetrant trauma2,3,5,6,10 ) . \n a 30-year - old man sought medical care with a history of low back pain ( lbp ) that radiated to lower extremities . \n he reported that he had fallen from a tree and a tree branch had been penetrated into him left lower back before 17 years . that tree branch had been taken out manually and he had recovered without any complaint . in the past two months \n , the patient has presented a lbp radiating to his lower limbs . physical examination revealed a bad - healed scar at about level of the third lumbar vertebra on left paraspinal region ( fig . \n the straight - leg - raising sign was negative and there was not any neurologic deficit on lower limbs . \n computerized tomography ( ct ) demonstrated a hypodenselytic lesion in the l4 vertebral body surrounding a linear hyperdense structure ( fig . \n 2 ) . anterior part of the disc space between fourth and fifth lumbar vertebrae had disappeared with fusion of these bodies in magnetic resonance ( mr ) images . \n mr images also revealed a lesion that lodged in posterior part of this disc space and expanding into the corpuses of these vertebrae ( especially into l4 vertebral corpus ) . \n it was seen a linear horizontal area of decreased signal intensity representing the intranuclear cleft in the center of posterior part of disc space between fourth and fifth lumbar vertebrae in sagittal mri image of the stir sequence . \n a firm mass was found lodged in posterior part of the intervertebral disc space between the fourth and fifth lumbar vertebrae . \n excision of the mass revealed a tough granulation tissue surrounding a tiny piece of wood in a little cavity filled with a clear yellowish fluid ( fig . \n there was a fusion between anterior parts of third and fourth lumbar vertebrae and a degeneration in the discal material in the rest of intervertebral disc space . \n postoperatively , the pain resolved gradually and the patient was discharged without any problem 10 days after operation . \n he had a total symptomatic cure after two months from excision of the foreign body . \n biological responses of tissues to foreign bodies are influenced by the location and the nature of them17,10 ) . in a soft tissue , \n a wooden foreign body can cause either a mild inflammatory tissue reaction resulting in a localized granuloma or a severe reaction resulting in a significant infectious lesion with or without osseous reaction in adjacent bone1,4,6,8 ) . \n paraspinal disorders like ones in the intervertebral disc space may cause important complications because they may affect vital structures in and near the spinal canal . in a similar way , the majority of reported cases with foreign bodies that embedded and retained near the spinal canal presented with delayed symptoms or findings resulting from compression of neural elements due to developed granuloma or abscess as well as in creased bony growths or migration of foreign body in the spinal canal2,3,57,10,11 ) . in the literature , there are only four case reports presented with the retained foreign body granulomas in the intervertebral disc space from penetrant traumas2,5,6,8,10 ) . \n two of these cases presented with cauda equina syndrome resulted from compression of neural structures due to granuloma and/or bony growths while two of them presented with symptoms and findings other than neurological deficits like our case2,5,6,8,10 ) . \n we thought that our patient s complaints probably were due to expanding of granuloma into the corpora of adjacent vertebrae . \n his complaints totally disappeared after removing the granuloma that in a way supported our thought . \n the detection of wooden foreign bodies with plain radiographies and ct has limited value because they are radiolucent . \n therefore , ultrasound and mr imaging are recommended in the detection of these foreign bodies like of other nonmetallic ones9 ) . \n but , the identification of wooden foreign bodies may also be difficult on mr imaging when they are small and on ultrasound when they are in the deeper paraspinal tissues . \n thus , a wooden foreign body in paraspinal tissues like intervertebral disc space may be easily missed especially in acute cases . \n more over , it is very difficult to predict the natural history of a retained foreign body in the intervertebral disc space , because , a sufficient number of cases is unfortunately not exist in the literature . \n if a retained wooden body in intervertebral disc space is missed and it is not removed , it may be potentially hazardous and result in significant morbidity because of the nature of wood and the paraspinal location of intervertebral disc space . \n moreover , a missed foreign body in a paraspinal tissues may cause further damages for patients and malpractice claims for physicians . \n therefore , physicians and radiologist need to keep their diagnostic suspicions height in terms of retained foreign bodies during examination or follow up a patient with paraspinal wooden penetrant traumas .", "role": "user" }, { "content": "we report a patient with a wooden foreign body granuloma in the intervertebral disc space being symptomatic 17 years after a paraspinal penetrant trauma . according to the our result of the search for wooden foreign body granulomas , \n this is the first case suffered from a wooden foreign body granuloma in the intervertebral disc space that reported in the literature . in this report \n , we emphasized the importance of rigorous examination and follow up in paraspinal wooden penetrant traumas .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the most common cause of visual loss in patients with branch retinal vein occlusion ( brvo ) is macular edema ( me ) . \n one of the main triggers of me is overproduction of vascular endothelial growth factor ( vegf ) caused by venous occlusion , and therefore , blocking the action of vegf is expected to facilitate the management of me secondary to brvo . \n the development of vegf inhibitors has brought new hope for improving visual acuity ( va ) in patients with me secondary to brvo . \n however , intravitreal injection of anti - vegf agents can be associated with a risk of endophthalmitis , fear for endoophthalmitis by medical managing side and patients , issues resulting from the invasive procedure , and economic burden . \n additionally , because brvo often occurs in working - age populations , frequent hospital visits for injection or examination may well be burdensome for patients.1 ophthalmologists should attempt to alleviate these problems , and in this era in which we have several alternative treatment strategies , anti - vegf agents , and regimens , treatment plans that are not burdensome should be considered as the optimal treatments of choice . \n aflibercept is a new anti - vegf agent , and there are few reports on its use in me secondary to brvo . \n wang et al2,3 demonstrated that intravitreal injection of aflibercept was useful in the treatment of chinese brvo patients and that aflibercept had equivalent efficacy with bevacizumab to me secondary to brvo . even in the treatment of me secondary to central retinal vein occlusion ( crvo ) , which is often more serious than brvo \n , aflibercept was more effective than ranibizumab in reducing central retinal thickness ( crt ) and suppressing the levels of aqueous vegf.4 the effects of switching from bevacizumab or ranibizumab to aflibercept have been studied both in patients with me secondary to brvo and in those with me secondary to crvo.510 these studies targeted patients without sufficient response to bevacizumab or ranibizumab . in these reports \n , visual improvement and reduction of crt were demonstrated in crvo patients , and prolongation of the intravitreal injection interval was reported in both brvo and crvo patients . \n the latter finding offers hope for further prolongation of intravitreal injection intervals even in patients with sufficient response to bevacizumab or ranibizumab . in this study \n , we evaluated the change in the intravitreal injection interval as well as anatomical and functional changes after switching therapy from ranibizumab to aflibercept in japanese patients with me secondary to brvo in our hospital . \n this retrospective study was approved by the ethics committee of kobe kaisei hospital , and written informed consent was obtained from all study participants . in our hospital , switching therapy from ranibizumab to aflibercept was strongly recommended to all patients with me secondary to brvo and who had been receiving a pro re nata ( prn ) regimen of ranibizumab since december 2013 . \n this retrospective study enrolled 15 eyes in 15 patients who had provided informed consent to switch to therapy with aflibercept from september 2015 and been observed for more than 6 months after switching . \n the participants were examined for exacerbation every month , they all kept their appointments , and if any sign of exacerbation was detected , they were treated with intravitreal injection of ranibizumab or aflibercept later the same day if possible or within a week at most . \n we defined the signs of exacerbation as any decrease in va from a previous examination and crt > 300 m . \n intravitreal aflibercept injection was performed as described previously.11 topical anesthesia was induced using 4% lidocaine eye drops , and then the eyelid , eyelashes , and periorbital area were thoroughly cleaned with povidone iodine . a lid speculum was inserted , and additional topical anesthetic eye drops were administered and 2 mg ( 0.05 ml ) of aflibercept ( eylea ; bayer schweiz ag , zurich , switzerland ) was injected into the vitreous cavity with a 30-gauge needle through the pars plana . \n thereafter , ofloxacin ointment was applied , and the eye was covered with a patch . \n moxifloxacin eye drops were self - administered three times a day for 3 days after injection . \n the primary outcome measure was change in the injection interval during the ranibizumab treatment period and the aflibercept treatment period . \n secondary outcome measures were crt , transition of best - corrected va ( bcva ) , and safety . \n mean intervals and crt values were calculated using all the data from every administration or examination during each test drug phase . \n optical coherence tomography ( oct ) images were obtained using spectral domain oct ( heidelberg engineering , heidelberg , germany ) . \n mean retinal thickness of the area corresponding to the central retinal subfield in the early treatment of diabetic retinopathy study areas , automatically generated by the oct software , was defined as crt in this study . \n decimal va was measured using a landolt ring chart , which is widely used in japan , and converted to the logarithm of the minimum angle of resolution ( logmar ) . for statistical analysis , \n the wilcoxon signed - rank test was used for comparison of paired values and the mann \n whitney u - test was used for comparison of the repeated measured values including intravitreal injection interval and crt . \n a total of 15 eyes in 6 male and 9 female patients who consented to switch therapy from ranibizumab to aflibercept were included in this study ; all patients were observed for more than 6 months after the switch ( table 1 ) . because none of the patients declined the switch , this study became an all - comer study without selection \n . the mean age of patients at baseline ( before starting ranibizumab treatment ) was 71.5 years ( standard deviation [ sd ] : 12.6 years ) . \n the mean period of ranibizumab treatment was 11.8 months ( sd : 4.2 months ) . \n the mean observation period after switching was 10.6 months ( sd : 3.4 months ) , and four male and three female patients were observed for more than 12 months after the switch . \n there was no complete nonresponder to ranibizumab among the participants , although the patients with diabetes showed a tendency toward quick exacerbation of me . \n fluorescein angiography images were obtained from 14 patients , of whom 11 were perfusion type and 3 were nonperfusion type . \n the mean intravitreal injection interval increased from 68.2 days ( sd : 26.4 , median : 62 , range : 28168 days ) during the ranibizumab treatment period to 91.8 days ( sd : 33.2 , median : 87 , range : 49168 days ) after switching to aflibercept , indicating a statistically significant increase ( p=0.0011 , mann \n we also compared the intervals between the last and the second - to the - last intravitreal injection of ranibizumab and the first and the second intravitreal injection of aflibercept . \n the mean intravitreal injection interval just before switching was 81.3 days ( sd : 35.6 , median : 72 , range : 45168 days ) , and this significantly increased to 100.8 days ( sd : 34.2 , median : 90 , range : 49168 days ) just after the switch to aflibercept ( p=0.0309 , wilcoxon signed - rank test ; figure 2 ) . \n the mean crt just before the start of ranibizumab therapy was 580 m ( sd : 211 , median : 511 , range : 3581,239 m ) , and this decreased significantly to 295 m ( sd : 55 , median : 279 , range : 228590 m ) before therapy was switched ( p<0.001 ) . \n the mean crt after the switch was 276 m ( sd : 25 , median : 270 , range 233333 m ) , and there was no significant difference from that before the switch ( p=0.12 , mann \n the mean bcva just before the start of ranibizumab therapy was 0.43 logmar ( sd : 0.43 ) . during treatment with aflibercept , \n the mean intravitreal injection interval increased from 68.2 days ( sd : 26.4 , median : 62 , range : 28168 days ) during the ranibizumab treatment period to 91.8 days ( sd : 33.2 , median : 87 , range : 49168 days ) after switching to aflibercept , indicating a statistically significant increase ( p=0.0011 , mann \n we also compared the intervals between the last and the second - to the - last intravitreal injection of ranibizumab and the first and the second intravitreal injection of aflibercept . \n the mean intravitreal injection interval just before switching was 81.3 days ( sd : 35.6 , median : 72 , range : 45168 days ) , and this significantly increased to 100.8 days ( sd : 34.2 , median : 90 , range : 49168 days ) just after the switch to aflibercept ( p=0.0309 , wilcoxon signed - rank test ; figure 2 ) . \n the mean crt just before the start of ranibizumab therapy was 580 m ( sd : 211 , median : 511 , range : 3581,239 m ) , and this decreased significantly to 295 m ( sd : 55 , median : 279 , range : 228590 m ) before therapy was switched ( p<0.001 ) . \n the mean crt after the switch was 276 m ( sd : 25 , median : 270 , range 233333 m ) , and there was no significant difference from that before the switch ( p=0.12 , mann \n the mean bcva just before the start of ranibizumab therapy was 0.43 logmar ( sd : 0.43 ) . during treatment with aflibercept , \n \n in japan , two anti - vegf agents , ranibizumab and aflibercept , are approved for the management of me secondary to rvo . \n ranibizumab showed superior efficacy to improve vision and reduce crt compared with sham injection in patients with me secondary to brvo in the bravo study and secondary to crvo in the cruise study.12,13 in the second year , these studies continued in the horizon study , which suggested that the appropriate long - term management strategies of crvo and brvo should be different.14 the vibrant study showed superior efficacy of aflibercept injection compared with macular grid laser photocoagulation for the treatment of me secondary to brvo.15 likewise , the copernicus and galileo studies demonstrated that aflibercept produced significant improvements in va and crt compared with sham injection in patients with me secondary to crvo , although the disease state of crvo is often more severe than that of brvo.16,17 these clinical studies yielded excellent outcomes , but it is difficult to adopt the same regimen of six consecutive monthly doses in clinical settings . \n therefore , there is a strong need to report and accumulate experience with the use of anti - vegf agents in real - life therapy . \n it is also difficult to compare our study on switching agents with these earlier studies . a comparative test of these agents and observation after switching from one agent to another \n is necessary to provide the best treatment option for patients with me secondary to brvo . in our hospital , all patients with me secondary to brvo who received ranibizumab intravitreal injections showed a certain degree of response to the agent . \n however , we switched the treatment of all these patients to aflibercept because we expected a prolonged injection interval under the same prn regimen . \n our results did show significant prolongation of the intravitreal injection interval following the switch : an increase from 68.2 days during the ranibizumab treatment period to 91.8 days during the aflibercept treatment period . \n additionally , the results of this comparison show that the mean intravitreal injection interval just after the switch was significantly longer than that just before the switch ; this eliminated the possibility that the prolonged interval might be caused by spontaneous remission of the disease and suggests that the prolongation is due to the effect of treatment with aflibercept , although the absence of a control group was one of the limitations of this study . \n taken together , our results suggest that the benefit of aflibercept reported previously might also be obtainable in japanese patients with me secondary to brvo.210 in the most relevant study , wirth et al5 reported that a significant extension of the injection interval as well as decreased central retinal volume resulted from changing treatment to aflibercept by a proactive treat - and - extend regimen in patients with me secondary to brvo insufficiently responding to ranibizumab and/or bevacizumab . \n the principal difference between this report and our study is the patients response to previous treatments ; the participants in our study all responded to ranibizumab . \n our results also suggest the further benefit of aflibercept to ranibizumab responders , without giving a clear conclusion because our study was not controlled . \n dexamethasone intravitreal implant ( dex implant ) is another treatment option for treating me secondary to rvo.18 especially , the combination of dex implant and macular grid laser showed significant effect in increasing bcva and prolonging the intravitreal injection interval in patients with me secondary to brvo compared with dex implant monotherapy.19 this report is helpful , but dex implant is not approved for treating me in japan . the reasons for the prolonged intravitreal injection interval might be the greater affinity of aflibercept for the target molecule and its longer half - life compared with ranibizumab.2022 based on the intravitreal half - life and binding affinity , mathematical simulation has indicated that aflibercept retains binding activity for longer than ranibizumab in the vitreous body.23 moreover , the longer duration of vegf suppression of aflibercept than that of ranibizumab has also been confirmed in human age - related macular degeneration eyes and in macaque eyes.24,25 given that aflibercept and ranibizumab showed similar half - lives in macaque eyes , the difference in the affinity of these agents for the target molecule could explain the difference in the duration of vegf suppression . \n specifically , the strong binding affinity of aflibercept could enhance its potency even after the concentration in the vitreous body is reduced . additionally , \n because aflibercept suppresses not only vegf - a but also placental growth factor , the difference in the target molecules of the agents might affect prolongation of the injection interval.20 although prolongation of the intravitreal injection interval raises concerns about visual and anatomical exacerbation , our study showed a stable course of bcva and no significant change in crt after switching . \n these results suggest that , regarding me secondary to brvo , intravitreal administration of aflibercept under a prn regimen should reduce the burden associated with intravitreal injection of patients and ophthalmologists without functional and anatomical degradation . \n however , it should be noted that patients need to visit hospital for monthly examination , and that prn dosing enables reduction of the number of intravitreal injections but not the frequency of visits . \n furthermore , when exacerbation is observed , reinjection should be performed on the same day as the examination if possible , to prevent further exacerbation of the clinical condition . \n in this study , for the first time , we clinically investigated the switch of therapy from ranibizumab to aflibercept under a prn regimen in japanese patients with me secondary to brvo . \n although this study is retrospective with a single - arm design and small sample size , the results suggest that switching therapy from ranibizumab to aflibercept might prolong the intravitreal injection interval without functional and anatomical exacerbation . \n our study has limitations , including small sample size , the absence of a control group , and the single - center clinical trial design . a randomized comparison with a continuous ranibizumab administration group and a larger number of cases are needed to discuss the effect of switching accurately . additionally , the period after switching is too short . \n a longer follow - up period might reveal other effects and yield information on switching of therapy .", "role": "user" }, { "content": "purposethis study was conducted to investigate the outcome of switching therapy from ranibizumab to aflibercept in japanese patients with macular edema ( me ) secondary to branch retinal vein occlusion ( brvo ) in daily practice.materials and methodsthis retrospective study enrolled 15 eyes in 15 japanese patients with me secondary to brvo who had been receiving a pro re nata regimen of ranibizumab and had provided written informed consent to switch to aflibercept therapy . \n the intravitreal injection interval , central retinal thickness , and visual acuity were evaluated before and after switching.resultsthe mean period of ranibizumab treatment was 11.84.2 months . \n the mean observation period after switching to aflibercept was 10.63.4 months , and seven patients were observed for more than 12 months after switching . \n the mean intravitreal injection interval was prolonged by 23.6 days with aflibercept ( 68.226.4 days with ranibizumab vs 91.833.2 days with aflibercept ; p=0.0011 ) . \n the mean intravitreal injection interval just before the switch was 81.335.6 days and was significantly prolonged to 100.834.2 days just after the switch to aflibercept ( p=0.0309 ) . \n the mean central retinal thickness did not change before or after the switch to aflibercept ( 29555 m with ranibizumab vs 27625 m with aflibercept ; p=0.12 ) . \n the mean visual acuity also remained at an improved level after the switch . \n no systemic or ocular side effects were evident during the study period.conclusionswitching therapy from ranibizumab to aflibercept in japanese patients with me secondary to brvo prolonged the intravitreal injection interval without anatomical or functional degradation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the maturation process is the most important life - history transition in plants and animals which comes with large changes in energy allocation ( dieckmann and heino 2007 ; roff 1992 , stearns 1992 ; bernardo 1993 ) . while a fish is immature , energy is allocated to increase survival and growth . \n after maturation , energy is required for reproduction and this may decrease survival , deplete body reserves and reduce growth ( roff 1992 ; berner and blanckenhorn 2007 ; saborido - rey and kjesbu , unpublished manuscript ) . for early maturing individuals , \n the decrease in lifetime reproductive potential and in lifespan can be even more marked than in late maturing ones . \n indeed , as fecundity , egg size and egg quality can increase with fish size and age ( trippel 1995 ; marshall and frank 1999 ) , females maturing at smaller size and younger age suffer from reduced reproductive success ( solemdal 1997 ; trippel et al . \n the decrease in age and length at maturation of individuals can produce a decrease in reproductive potential , ( domnguez - petit 2007 ) , and make the recruitment process more sensitive to environmental variability ( saborido - rey and kjesbu , unpublished manuscript ) . in recent decades \n several studies describing a reduction in age and length at maturation in exploited species have appeared , including pacific salmon oncorhynchus spp . \n ( ricker 1981 ) , european sole solea solea ( de veen 1976 ) , european plaice pleuronectes platessa ( rijnsdorp 1993b ) , several populations of atlantic cod gadus morhua ( jrgensen 1990 ; trippel et al . 1997 ; saborido - rey and junquera 1998 ) , haddock melanogramnus aeglefinus ( taylor and stefnsson 1999 ) and atlantic halibut hippoglossus hippoglossus ( haug and tjemsland 1986 ) . in many exploited stocks \n this change in age and size at maturation has been attributed to high fishing pressure ( trippel 1995 ; saborido - rey and junquera 1998 ; law 2000 ; grift et al . \n the maturation process is determined by an ecological component that operates through phenotypic plasticity and an evolutionary component that works through genetic adaptation ( dieckmann and heino 2007 ) . through their size selective action \n , fisheries can produce differential selection favouring genotypes coding for high fecundity and early maturation ( law and grey 1989 ; rijnsdorp 1993b ) . \n in addition , through the changes that fisheries produce in the ecosystem , inter and intraspecific competition can be altered , leading to an enhanced availability of food and producing earlier maturing individuals through phenotypic plasticity ( rijnsdorp 1993a ; taylor and stefnsson 1999 ; law 2000 ) . \n thus , fisheries can trigger changes in the maturation process through two pathways , through direct environmental effects manifested as phenotypic plasticity and through genetic selection . determining if changes in age and size at maturation have solely a phenotypic basis , have only a genetic basis or are actually a mixed effect of both phenomena is not a trivial issue . reversal in maturation trends \n is expected to be much slower if genetic change is the major cause of a decrease in age and length at maturation ( law and grey 1989 ; law 2000 ; olsen et al . \n 2009 ) . therefore , knowing the origin of changes in reproductive parameters is very important and should be considered in management decisions . in the last two decades , \n four different methods have been used to separate phenotypic and genetic causes of shifts in maturation : experimental manipulation , comparative studies , countergradient or countertrend variation , and reaction norm analysis ( trippel 1995 ; olsen et al . 2005 ; dieckmann and heino 2007 ; sharpe and hendry 2009 ; conover and baumann 2009 ) . the concept of norms of reaction was developed a century ago by woltereck ( 1909 ) . \n stearns and coworkers ( stearns and crandall 1984 ; stearns and koella 1986 ) developed the first bivariate reaction norm to examine the effect of growth rate on age and size at maturation . \n however , since the microenvironment experienced for each individual can be different and because age and size are only proximate measures of maturation tendency , maturation should be considered as a variable process ( heino et al . 2002 ; dieckmann and heino 2007 ) . to account for this individual variation , probabilistic maturation reaction norms ( pmrns ) \n the first approach to this was called the direct method to calculate pmrns ( dirpmrns ) ( heino and dieckmann 2008 ) . \n dirpmrns estimate the probability of becoming mature using the age and size - specific densities of immature and newly maturing individuals ( hereafter called recruit spawners ) . \n a variant of the direct method was applied for pmrns estimation on herring clupea harengus ( engelhard and heino 2004 ) and smallmouth bass micropterus dolomieu ( dunlop et al . 2005 ) . in these works , \n determination of size and age when individuals mature was derived by means of the study of the distance between two consecutive annual rings in the fish otolith or scale . \n morita and fukuwaka ( 2006 ) , applied the direct method to chum salmon ( oncorhynchus keta ) , for which maturing individuals were determined by return of salmon from the sea to their spawning territories in the rivers . \n however , data separating recruit spawner individuals from those that matured in earlier seasons are rarely available ( heino and dieckmann 2008 ) . \n ( 2004 ) overcame this difficulty by developing the demographic method ( dempmrn hereafter ) ( heino and dieckmann 2008 ) . to deal with the lack of recruit spawner individual information dempmrn usually makes two important assumptions : ( i ) \n mature and immature individuals have the same survival rates and ( ii ) all individuals within an age class have identical growth increments in the year considered ( barot et al . \n ogives it is possible to reconstruct the recruit spawner size and probability distribution by age class . \n the dempmrn method permitted extension of the use of pmrns to various populations of atlantic cod gadus morhua ( barot et al . \n 2004 , 2005 ) , european plaice pleuronectes platessa ( grift et al . 2003 ) , american plaice hippoglossoides platessoides ( barot et al . \n 2005 ) , haddock melanogrammus aeglefinus ( wright 2005 ) and sole solea solea ( mollet et al . \n the purpose of this study was the estimation and comparison of pmrns obtained using both direct and demographic methodologies . \n flemish cap cod present a unique opportunity to compare the direct and demographic methods which , have never been directly compared before . \n the atlantic cod population on the flemish cap ( nafo division 3 m ) has supported an important commercial fishery for many years ( fernndez et al . 2008 ) and age at 50% maturity ( a50 ) has shown a dramatic decrease from 5 years in 1992 to 2 years old at the beginning of twenty first century ( saborido - rey and junquera 1998 , 1999 ) . \n perhaps more importantly , gonads are examined histologically and recruit spawners and repeat spawners can be separated . \n this permits the calculation of pmrns by the direct method as well as by the demographic method . because direct method is applied to more informative data than demographic method ( heino and dieckmann 2008 ) , obtaining similar results for both techniques would reinforce the validity of using the demographic method for estimation of pmrns when there 's no possibility of separate recruit and repeat spawner individuals . \n a total of 3058 cod ovaries were collected as a part of the european union survey of the flemish cap in june - july from 1990 until 2006 , comprising cohorts from 1983 to 2005 . \n fishing sets were conducted according to a stratified random design ranging in depth from 126 to 749 m , with a haul duration of 30 min ( vzquez et al . \n total length of fish was measured and the otoliths were collected for age determination in the laboratory . \n gonads were extracted , fixed , histologically processed and microscopically analyzed following the details provided in saborido - rey and junquera ( 1998 ) . \n the survey on flemish cap occurs after spawning is completed so that fish in the population are either fish that are immature , fish that are maturing to spawn the next year for the first time , or fish that have spawned already in the current year . \n these different maturity stages were identified following saborido - rey and junquera ( 1998 ) : immature females were identified when all the oocytes were in the primary growth stage and no evidence of previous spawning activity was found ; recruit spawner females had oocytes in the cortical alveoli stage ( ca ) or vitellogenic stage ( vo ) but not postovulatory follicle ( pof ) nor atretic oocyte stage ( ao ) ; repeat spawner females were identified by the presence of ca , vo , pof and/or ao . \n different groupings of the available cohorts were formed in order to create more possibilities for calculating and comparing dempmrns and dirpmrns ( table 1 ) . \n number of immature , previous spawner and recruit spawner individuals by cohort group for maturity ogive estimation , a logistic model was fit to the whole data set . \n maturity state was introduced as a binary dependent variable , age and length were considered as continuous explanatory variables and cohort group ( cg ) as a factor . repeat and recruit spawner females were considered as mature individuals . \n : where a is fish age , l the fish length and cg , the cohort group . with the parameters obtained from equation ( 1 ) and with length increments by age , the probability of maturing for each age group , and length was estimated as : where p(a , l ) is the probability of maturing at age a and length l , a1 is the age previous to a and ll is the length at that previous age , l being the length increment between age a1 and age a , and o is the fraction mature . \n a logistic model was fit to maturing ( recruit spawners ) and immature individuals [ equation ( 3 ) ] , with maturity state as a binary dependent variable . age and length \n were included in the model as continuous variables and the cohort group as a factor : the meaning of symbols in equation ( 3 ) is the same as in equation ( 1 ) with the difference that in equation ( 3 ) the logit is on the proportion maturing instead of the proportion of mature individuals . \n for both the demographic and direct methods , a stepwise selection process was conducted to determine the best model fit for each of these cohort groupings . \n variables which when added to the model did n't result in a significant decrease in the residual deviance or when included gave a higher akaike information criteria were rejected from the model . for the demographic pmrn calculation method , it was necessary to estimate the mean length increment between ages and the maturity ogive to calculate the probability of becoming mature ( barot et al . \n yearly length increments were obtained by calculating the difference in mean size at age between consecutive years : where l is the mean length increment resulting from substracting the mean length at age a1 from the mean length at age a. this process was carried out for every age in every cohort group . because of the high correlation observed between age and length in the data , the range of ages used to fit the models was shortened as much as possible . \n only ages where both mature ( recruit and previous spawners for dempmrns and only recruit spawners for dirpmrns ) and immature individuals occurred were considered . finally for the demographic method 3000 individuals were used , ranging from ages 1 to 7 . \n for the direct method , 1318 individuals were used , from ages 2 to 5 . for demographic methods \n , it has been established that a minimum number of 50 individuals is necessary by age and cohort for calculating pmrns and to estimate confidence intervals by means the bootstrap technique ( barot et al . \n the same amount of individuals has been also considered in this work for direct method calculations . \n therefore , reaction norm midpoints ( length for which the probability of maturing is 50% , hereafter lp50 ) were calculated for age - cohort group combinations that fulfilled this requirement . for these age - cohort combinations , \n estimated probabilities of maturing were generated through equation ( 2 ) . with the demographic method , lp50 ( hereafter demlp50 ) \n lp50 for the direct method ( dirlp50 ) was calculated for every cohort group and age studied by solving the equation resulting from fitting of model ( 3 ) for the length where the probability of maturing was 50% . \n the 95% confidence intervals for both dirlp50 and demlp50 were calculated by using standard bootstrap techniques ( efron and tibshirani 1993 ) . \n a new dataset was created by randomly sampling original data , stratified by length for every year . \n this is consistent with the original sampling design in the flemish cap european union survey ( vzquez et al . 1998 ) . with the resampled data , reaction norm midpoints ( lp50 ) \n the data set was resampled 999 times and the confidence limits of the reaction norm midpoints were estimated as the 2.5 and 97.5 percentiles of the distribution of the 1000 midpoints of each age and cohort ( 999 resamplings + 1 original ) . \n logistic models for the dempmrns and the dirpmrns methods were fit for every cohort grouping option ( tables 2 and 3 ) . the final general logistic model selected as the best fit to the data changed depending on the number of cohort groupings considered . \n for the dempmrn estimate the saturated model [ equation(1 ) ] was only the best fit when cohorts were divided into six cohort groups ( table 2 ) . \n when individuals were classified into three cohort groups a logistic model with no three way interaction and no length : cohort group interaction was selected because adding these terms did not significantly improve the model fit . \n when cohorts were divided into two groups the three way interaction was not included in the best model . when grouping all cohorts into a unique cohort group , the model with the significantly lowest value of residual deviance included length and age and their interaction . for the dirpmrn calculations the complete model including all interactions was selected as the best fit to the data when cohorts were divided into six cohort groups ( table 3 ) . \n when grouping in three and two cohort groups , no three way interactions were included in the final models . \n the model with length and age as main effects and their two way interaction had the best fit to the data when grouping cohorts in a single group , from 1983 to 2005 . results of the logistic regressions for the dempmrn method . \n models were chosen by stepwise regression lp50 was calculated using the selected models for every grouping , but not for all ages from the initial range used to fit the models . only those ages for which more than 50 individuals were available in a cohort group were used for calculating the lp50 . \n for such ages , dirlp50 was estimated using the logistic model fit for each grouping ( table 4 ) . \n for the demographic method , except for those age - cohort group combinations marked in table 4 , lp50 was estimated by interpolating the size at which the estimated probability of maturing was 0.5 . \n for those ages marked in table 4 , no interpolation was possible since 0.5 was out of the range of estimated probabilities of maturing . \n but the maximum probability in this range was so close to 0.5 that extrapolation was considered a reliable way to estimate lp50 . \n length ( in cm ) at which the probability of maturing is estimated to be 50% for every age studied ( in years ) note : only those ages and cohort groups for which number of individuals ( n dirpmrn and n dempmrn ) was more than 50 were considered for calculations . \n both estimates of lp50 showed the same pattern across the age - cohort group combinations ( fig . \n confidence intervals for lp50 calculated for both methods overlapped substantially with the exception of age 4 for the cohort groups 19831995 , 19901996 and 19842005 ( cases 12 , 15 and 19 respectively in fig \n . 1 ) . with the exception of age 2 in cohort group 19972001 , 19972005 and 19962005 , \n the mean difference between dirlp50 and demlp50 estimation was 2.4 cm and the standard deviation of the differences was 2.0 cm . estimated demlp50 and dirlp50 with their corresponding 95% confidence intervals calculated by bootstrap resampling . \n the abscissa axis represents the case study corresponding to all the age and cohort groupings ( see table 4 ) . \n despite the small difference in the lp50 between the methods , both captured the process of maturation in the same way showing the same pattern . a high correlation between calculated values of dirlp50 and demlp50 was obtained and with few exceptions the 95% confidence intervals overlapped in the cases studied . \n these results lead us to conclude that both the demographic and direct methods of calculating pmrns are able to capture the process of maturation in a similar way . \n the direct method for pmrns estimation ( dirpmrn ) considers only immature and recruit spawner individuals for which age and size are known . in this way , with representative samples of the population , the probability of becoming mature for age and size can be easily and reliably calculated by a logistic regression fit to the proportions of mature individuals at age by size class ( heino et al . \n the demographic method ( dempmrn ) uses less informative data ( heino and dieckmann 2008 ) , with no recruit spawners identification . \n the demographic method is based on comparing proportions of mature individuals at age and size at two consecutive time intervals , ( two snapshots of the same cohort ) in order to calculate the expected probability of becoming mature for an age and size . \n usual assumptions of this methodology are equal survival and growth rates for immature and mature fishes . \n ( 2004 ) examined the impact of deviations from these assumptions on results and showed that modest violations of these assumptions had no significant effects on the estimation of dempmrn . \n it is generally argued that when an individual begins the process of maturation changes in energy allocation are expected which are likely to decrease not only survival but also growth rates ( roff 1992 ; stearns 1992 , saborido - rey and kjesbu 2007 in press and references therein ) . \n there has been no study of changes in mean length between consecutive ages in flemish cap cod that could detect a change in growth with maturation . \n yoneda and wright ( 2005 ) found that atlantic cod maturing during their study were initially faster growing , but their allocation of energy into reproduction led to comparable growth rates to those that did not mature . \n if such changes in atlantic cod growth after maturation can be extrapolated to flemish cap cod , violations of the assumptions of the demographic pmrn method may have occurred in the present study . \n the almost systematic lower value of demlp50 could have been produced from such a violation of the assumptions of this method . \n the dempmrn method was developed because in most survey programmes , the maturity state of gonads is evaluated by macroscopic observation , and thus it is impossible to determine if a mature gonad comes from a recruit or a repeat spawner ( saborido - rey and junquera 1998 ) . \n 2002 applied the direct method to northeast arctic cod , for which the maturity stage of an individual 's gonad ( determined by macroscopic inspection ) was combined with the study of patterns in its otoliths ( spawning checks ) to distinguish repeat and recruit spawners ( rollefsen , 1933 ) . \n a variant of the direct method was applied to the chum salmon oncorhynchus keta ( morita and fukuwaka 2006 ) , but in this case as individuals were caught on return to their river , determination of maturation status was a trivial issue . \n other studies where dirpmrns were calculated are those on norwegian spring - spawning herring clupea harengus ( engelhard and heino 2004 ) and smallmouth bass micropterus dolomieu ( dunlop et al . 2005 ) . \n both studies determined the maturation state indirectly , the former by means of patterns of growth on scales , and the latter through discriminant analysis on backcalculated individual growth trajectories . \n however , these studies employed important assumptions in fish - otolith and fish - scales growth relations and in the determination of recruit spawners using patterns in annual otoliths or scales rings ( francis 1990 ; wright et al . 2001 and references therein ) \n . moreover , macroscopic gonad staging entails possible confusion between resting and immature individuals ( ajiad et al . \n histological analyses of gonads permits the determination of recruit spawners through the identification of different oocytes stages , disentangling recruit spawners from previous spawners and immature individuals with limited error ( zamarro et al . \n 1993 ; saborido - rey and junquera 1998 ) . the histology method for determining the maturity stage for flemish cap cod was introduced because the european union flemish cap survey is conducted during june - july , when spawning has already concluded for the year and the macroscopic determination of the maturity stage of gonads is impossible . \n the duration of postovulatory follicles and atretic oocytes in cod ovaries following spawning permits the separation of previous spawners from recruit spawners , which can have only oocytes in vitellogenic and/or cortical alveoli state . \n thus , the histological maturity staging avoids the confusion of resting mature individuals with immature ones and , at the same time , allows one to separate recruit spawner individuals from repeat spawners . because of the lack of recruit spawner data , studies where pmrns have been estimated using both the dirpmrn and the dempmrn method have never been conducted before . \n the availability of flemish cap cod recruit spawners , and at the same time , representative sampling of both immature and mature fish , has made it possible to calculate and compare reaction norms obtained with both dirpmrn and dempmrn . \n the results obtained in this work provide a direct test of the two ways of calculating pmrns . and support the use of the dempmrn as a reliable way of estimating pmrns for populations where recruit and repeat spawners ca n't be separated in the data . \n future work will analyze the evolution of pmrns in flemish cap cod and its relation with environmental variables .", "role": "user" }, { "content": "age and length at maturation have declined in many fish populations and this has been hypothesized to be a genetic change caused by high fishing mortality . \n probabilistic maturation reaction norms ( pmrns ) have been used as a tool to gain a better understanding of the possible genetic nature of these changes . \n the demographic and direct methods are two ways to calculate pmrns . the data requirements are more often met for the demographic method than for the direct method which requires the identification of recruit spawners . \n however , the demographic method relies on more assumptions than the direct method , typically assuming equality of growth and mortality rates for immature and mature individuals within an age class . \n this study provides the first direct comparison of demographic and direct methods and shows that both methods produce comparable results . \n differences between methods are hypothesized to be owed to possible differences in growth rate between mature and immature individuals in flemish cap cod .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: telemedicine is defined by the world health organization as , the delivery of health care services , where distance is a critical factor , by all health care professionals using information and communication technologies for the exchange of valid information for diagnosis , treatment and prevention of disease and injuries , research and evaluation , and for the continuing education of health care providers , all in the interests of advancing the health of individuals and their communities . \n telemedicine may play an important role improving access to subspecialty expertise for patients in locations without access to specialists or for patients requiring time - sensitive care . \n for example , the use of telemedicine in adult stroke care has been shown to permit regional hospitals to retain patients and reduce costs while also improving thrombolysis decisions . \n many regional hospital neonatal intensive care units also provide care without immediate access to subspecialty consultation , forcing neonatologists to decide between forgoing subspecialty involvement and transferring critically ill patients to sometimes distant hospitals . \n previous research has demonstrated that clinical agreement between neonatologists is good to excellent with telemedicine , and that clinicians had a positive impression of telemedicine use . \n however , studies of telemedicine to perform detailed dermatologic evaluations suggest difficulty with some features , cautioning that the use of telemedicine may need to be evaluated for each subspecialty indication . \n studies have not evaluated the use of telemedicine for neurologic or dysmorphology evaluations in the neonatal intensive care unit . \n we performed a prospective study comparing in - person and telemedicine dysmorphology and neurologic examinations of subjects in the neonatal intensive care unit . \n we aimed to establish the accuracy of telemedicine examinations in this setting and to identify measures to optimize telemedicine examinations . \n the study was approved by the institutional review board and informed consent was obtained from each subject s parent(s ) . \n patients in the neonatal intensive care unit were eligible for participation if they had received : 1 ) consultation by the genetics service for dysmorphic features or ; 2 ) consultation by the neurology service for encephalopathy . \n each subject underwent telemedicine examination using an intouch health rp - lite remote presence system ( chelmsford , ma ) and a amd-2500 general examination camera with a 50x zoom lens ( chelmsford , ma ) . \n figure 1 presents a procedure schematic . a remote consultant physician ( geneticist or neurologist ) in a remote location evaluated each subject with the assistance of a bedside clinician ( geneticist or neurologist ) . \n the bedside clinician followed the instructions of the remote consultant physician ( e.g. positioning of the infant , demonstrating reflexes ) to optimize visualization . \n the examination components did not need to be performed in any particular order , and order was often determined by initial state and cooperation of the infant with the examination . \n the bedside clinician noted any discrepancies between what they saw in person and what was displayed on the screen , but the bedside clinician did not communicate any of these observations to the remote consultant physician . \n the in - person bedside clinician examination was considered the accurate gold - standard to which the remote bedside physician s examinations were compared . \n examination accuracy was determined by calculating the percent agreement between abnormal physical examination findings noted by the bedside clinician examination ( gold standard ) and the remote consultant physician examinations . \n examination components identified accurately > 90% of the time were considered easy to identify . \n examination components deemed as not achievable were categorized as those unable to be appreciated without an in - person examination or those that were unidentifiable with the clinical resolution of the tested equipment . after completing the telemedicine assessment , \n the remote consultant physician came to the bedside for the second phase of the study . \n the bedside clinician and the remote consultant physician discussed any discrepancies between the telemedicine and in - person examinations and attempted technique adjustments to achieve optimal visualization of those examination components . \n a remote consultant physician ( geneticist or neurologist ) in a remote location evaluated each subject with the assistance of a bedside clinician ( geneticist or neurologist ) . \n the bedside clinician followed the instructions of the remote consultant physician ( e.g. positioning of the infant , demonstrating reflexes ) to optimize visualization . \n the examination components did not need to be performed in any particular order , and order was often determined by initial state and cooperation of the infant with the examination . \n the bedside clinician noted any discrepancies between what they saw in person and what was displayed on the screen , but the bedside clinician did not communicate any of these observations to the remote consultant physician . \n the in - person bedside clinician examination was considered the accurate gold - standard to which the remote bedside physician s examinations were compared . \n examination accuracy was determined by calculating the percent agreement between abnormal physical examination findings noted by the bedside clinician examination ( gold standard ) and the remote consultant physician examinations . \n examination components identified accurately > 90% of the time were considered easy to identify . \n examination components deemed as not achievable were categorized as those unable to be appreciated without an in - person examination or those that were unidentifiable with the clinical resolution of the tested equipment . \n after completing the telemedicine assessment , the remote consultant physician came to the bedside for the second phase of the study . the bedside clinician and the remote consultant physician discussed any discrepancies between the telemedicine and in - person examinations and attempted technique adjustments to achieve optimal visualization of those examination components . these limitations and optimization techniques \n ten subjects with dysmorphic features were evaluated by geneticists and ten subjects with encephalopathy were evaluated by neurologists . \n abnormal examination findings and accuracy of identification via telemedicine are indicated in table 2 for the dysmorphology examination and table 3 for the neurologic examination . \n most abnormal examination components were identified with an accuracy of greater than 90% . for the dysmorphology examination \n , 81 of 87 ( 93% ) dysmorphic features were correctly identified using telemedicine on the initial examination . \n optimization of lighting and positioning resulted in visualization of two additional abnormalities ( 83 of 87 , 95% ) . \n for the neurologic examination , 36 of 39 ( 92% ) abnormal features were identified using telemedicine on the initial examination . \n optimization of lighting and positioning resulted in visualization of one additional abnormality ( 37 or 39 , 95% ) . \n all calculations were made comparing the assessments of the remote consultant physician s initial telemedicine examination and their own subsequent in - person examination . \n inter - rater agreement with the bedside clinician was not ascertained . following the standardized telemedicine examination \n , the bedside clinician and remote consultant physician worked together to optimize visualization of the examination of features that could not be assessed well remotely . in many cases the viewing angle , lighting , or examination technique could be adjusted to optimize the evaluation . \n bedside clinician role : the bedside clinician plays a critical and active role in the evaluation , and must report their observations of the subject and their impressions regarding the camera s view \n . the bedside clinician must evaluate and adjust the equipment s angle and distance from the subject , camera s position and zoom , lighting conditions , and patient positioning . \n for effective evaluation , the camera and/or subject must be repositioned during the evaluation , and often these adjustments must occur in a fluid manner that is responsive to the examination needs and activity of the subject . for example , identifying dysmorphologic abnormalities which are often small and subtle requires optimal positioning , and movement , tone , and reflex examination must occur when the subject is in the relaxed state.image display : although the telemedicine equipment permits different displays for the bedside clinician and remote consultant physician , having the same image displayed allowed the bedside clinician to more readily make changes to enhance the view of the remote consultant . \n suboptimal lighting , camera angles or camera focal points sometimes resulted in an inability of the remote consultant to appreciate abnormal skull shape , pigmentary differences ( especially eye color ) , respiratory effort , cleft palate evaluation , eye movement abnormalities , muscle tone abnormalities , and deep tendon reflexes . in all cases , \n the bedside clinician knew the camera images were suboptimal and did not allow them to fully appreciate the examination finding they could see in-person.focal point : prior to the examination , it was useful to identify the minimal focal distance for the equipment s cameras by zooming in on an object in the environment . subsequently , placing the equipment so the camera was at or minimally further away allowed maximal zoom while retaining the ability to focus on features . \n for the equipment tested , this was approximately one meter from the patient.lighting : lighting conditions varied based on overhead lighting of different rooms and with different camera positions . \n overhead lighting adjustments were often needed to provide lighting that was sufficiently bright enough for the examination without creating bright spots on the subject that exceeded the camera s ability to achieve good contrast balance . \n in addition , low angle lighting was at times useful to distinguish skin surface characteristics . \n having identical images displayed on the bedside and telemedicine physicians screens allowed the bedside physician to best optimize the lighting.viewing angle : features perpendicular to the plane of view were seen most accurately . \n thus , for most components of the examination the optimal camera angle was directly above the isolette and angled down at the prone or supine subject since this approach maximized the amount of the subject perpendicular to the camera . \n when examining particular body parts , positioning them perpendicular to the camera through repositioning of the equipment and the patient was essential . \n for dysmorphology examination , this was particularly important when evaluating hand / finger characteristics or limb proportions . for neurologic examination , \n this was particularly important when evaluating reflexes or spontaneous movement.multiple views : while it may be difficult to maneuver large equipment around an isolette , the bedside clinician must be an active participant and can turn the subject as needed to optimize examination . for the dysmorphology examination , \n viewing the subject from angles rotated 180 degrees , so that the feet extend away from the camera permits better visualization of skull shape , hand shape , and dorsum of foot evaluation ( syndactyly , overfolded toes ) . turning the subject to the side permitted a lateral view which also aided in assessment of head shape . for the neurologic examination , repositioning of the subject s face perpendicular to the camera aided in evaluation of facial movement , suck , rooting , and eye movement evaluation . placing the subject \n so that the angle of the joints was perpendicular to the camera aided in assessment of spontaneous movements and reflexes.special considerations for the hands : because neonates often have their hands clenched at rest , the hand must be held open and flat by the bedside clinician for proper evaluation . \n the dorsum of the hand is best evaluated with the subject s head pointed towards the camera . \n hand proportions can be distorted when the hand is not placed perpendicular to the camera viewing angle . \n however , clinodactyly might not be identified since holding the fingers open made the fingers appear to curve inwards . \n bedside clinician role : the bedside clinician plays a critical and active role in the evaluation , and must report their observations of the subject and their impressions regarding the camera s view . \n the bedside clinician must evaluate and adjust the equipment s angle and distance from the subject , camera s position and zoom , lighting conditions , and patient positioning . for effective evaluation , \n the camera and/or subject must be repositioned during the evaluation , and often these adjustments must occur in a fluid manner that is responsive to the examination needs and activity of the subject . \n for example , identifying dysmorphologic abnormalities which are often small and subtle requires optimal positioning , and movement , tone , and reflex examination must occur when the subject is in the relaxed state . \n image display : although the telemedicine equipment permits different displays for the bedside clinician and remote consultant physician , having the same image displayed allowed the bedside clinician to more readily make changes to enhance the view of the remote consultant . \n suboptimal lighting , camera angles or camera focal points sometimes resulted in an inability of the remote consultant to appreciate abnormal skull shape , pigmentary differences ( especially eye color ) , respiratory effort , cleft palate evaluation , eye movement abnormalities , muscle tone abnormalities , and deep tendon reflexes . in all cases , the bedside clinician knew the camera images were suboptimal and did not allow them to fully appreciate the examination finding they could see in - person . \n focal point : prior to the examination , it was useful to identify the minimal focal distance for the equipment s cameras by zooming in on an object in the environment . subsequently , placing the equipment so the camera was at or minimally further away allowed maximal zoom while retaining the ability to focus on features . for the equipment tested , this was approximately one meter from the patient . \n lighting : lighting conditions varied based on overhead lighting of different rooms and with different camera positions . \n overhead lighting adjustments were often needed to provide lighting that was sufficiently bright enough for the examination without creating bright spots on the subject that exceeded the camera s ability to achieve good contrast balance . \n in addition , low angle lighting was at times useful to distinguish skin surface characteristics . having identical images displayed on the bedside and telemedicine physicians screens allowed the bedside physician to best optimize the lighting . \n thus , for most components of the examination the optimal camera angle was directly above the isolette and angled down at the prone or supine subject since this approach maximized the amount of the subject perpendicular to the camera . when examining particular body parts , positioning them perpendicular to the camera through repositioning of the equipment and the patient was essential . \n for dysmorphology examination , this was particularly important when evaluating hand / finger characteristics or limb proportions . for neurologic examination , \n multiple views : while it may be difficult to maneuver large equipment around an isolette , the bedside clinician must be an active participant and can turn the subject as needed to optimize examination . for the dysmorphology examination , \n viewing the subject from angles rotated 180 degrees , so that the feet extend away from the camera permits better visualization of skull shape , hand shape , and dorsum of foot evaluation ( syndactyly , overfolded toes ) . turning the subject to the side permitted a lateral view which also aided in assessment of head shape . \n for the neurologic examination , repositioning of the subject s face perpendicular to the camera aided in evaluation of facial movement , suck , rooting , and eye movement evaluation . placing the subject so that the angle of the joints was perpendicular to the camera aided in assessment of spontaneous movements and reflexes . \n special considerations for the hands : because neonates often have their hands clenched at rest , the hand must be held open and flat by the bedside clinician for proper evaluation . \n the dorsum of the hand is best evaluated with the subject s head pointed towards the camera . \n hand proportions can be distorted when the hand is not placed perpendicular to the camera viewing angle . \n however , clinodactyly might not be identified since holding the fingers open made the fingers appear to curve inwards . \n ten subjects with dysmorphic features were evaluated by geneticists and ten subjects with encephalopathy were evaluated by neurologists . \n abnormal examination findings and accuracy of identification via telemedicine are indicated in table 2 for the dysmorphology examination and table 3 for the neurologic examination . \n most abnormal examination components were identified with an accuracy of greater than 90% . for the dysmorphology examination , 81 of 87 ( 93% ) dysmorphic features were correctly identified using telemedicine on the initial examination . \n optimization of lighting and positioning resulted in visualization of two additional abnormalities ( 83 of 87 , 95% ) . \n for the neurologic examination , 36 of 39 ( 92% ) abnormal features were identified using telemedicine on the initial examination . \n optimization of lighting and positioning resulted in visualization of one additional abnormality ( 37 or 39 , 95% ) . \n all calculations were made comparing the assessments of the remote consultant physician s initial telemedicine examination and their own subsequent in - person examination . \n following the standardized telemedicine examination , the bedside clinician and remote consultant physician worked together to optimize visualization of the examination of features that could not be assessed well remotely . in many cases the viewing angle , lighting , or examination technique could be adjusted to optimize the evaluation . \n bedside clinician role : the bedside clinician plays a critical and active role in the evaluation , and must report their observations of the subject and their impressions regarding the camera s view . \n the bedside clinician must evaluate and adjust the equipment s angle and distance from the subject , camera s position and zoom , lighting conditions , and patient positioning . \n for effective evaluation , the camera and/or subject must be repositioned during the evaluation , and often these adjustments must occur in a fluid manner that is responsive to the examination needs and activity of the subject . \n for example , identifying dysmorphologic abnormalities which are often small and subtle requires optimal positioning , and movement , tone , and reflex examination must occur when the subject is in the relaxed state.image display : although the telemedicine equipment permits different displays for the bedside clinician and remote consultant physician , having the same image displayed allowed the bedside clinician to more readily make changes to enhance the view of the remote consultant . \n suboptimal lighting , camera angles or camera focal points sometimes resulted in an inability of the remote consultant to appreciate abnormal skull shape , pigmentary differences ( especially eye color ) , respiratory effort , cleft palate evaluation , eye movement abnormalities , muscle tone abnormalities , and deep tendon reflexes . in all cases , \n the bedside clinician knew the camera images were suboptimal and did not allow them to fully appreciate the examination finding they could see in-person.focal point : prior to the examination , it was useful to identify the minimal focal distance for the equipment s cameras by zooming in on an object in the environment . subsequently , placing the equipment so the camera was at or minimally further away allowed maximal zoom while retaining the ability to focus on features . for the equipment tested , \n this was approximately one meter from the patient.lighting : lighting conditions varied based on overhead lighting of different rooms and with different camera positions . \n overhead lighting adjustments were often needed to provide lighting that was sufficiently bright enough for the examination without creating bright spots on the subject that exceeded the camera s ability to achieve good contrast balance . \n in addition , low angle lighting was at times useful to distinguish skin surface characteristics . \n having identical images displayed on the bedside and telemedicine physicians screens allowed the bedside physician to best optimize the lighting.viewing angle : features perpendicular to the plane of view were seen most accurately . \n thus , for most components of the examination the optimal camera angle was directly above the isolette and angled down at the prone or supine subject since this approach maximized the amount of the subject perpendicular to the camera . when examining particular body parts , positioning them perpendicular to the camera through repositioning of the equipment and the patient was essential . \n for dysmorphology examination , this was particularly important when evaluating hand / finger characteristics or limb proportions . for neurologic examination , \n this was particularly important when evaluating reflexes or spontaneous movement.multiple views : while it may be difficult to maneuver large equipment around an isolette , the bedside clinician must be an active participant and can turn the subject as needed to optimize examination . for the dysmorphology examination , \n viewing the subject from angles rotated 180 degrees , so that the feet extend away from the camera permits better visualization of skull shape , hand shape , and dorsum of foot evaluation ( syndactyly , overfolded toes ) . turning the subject to the side permitted a lateral view which also aided in assessment of head shape . for the neurologic examination , repositioning of the subject s face perpendicular to the camera aided in evaluation of facial movement , suck , rooting , and eye movement evaluation . placing the subject so that the angle of the joints was perpendicular to the camera aided in assessment of spontaneous movements and reflexes.special considerations for the hands : because neonates often have their hands clenched at rest , the hand must be held open and flat by the bedside clinician for proper evaluation . \n the dorsum of the hand is best evaluated with the subject s head pointed towards the camera . \n hand proportions can be distorted when the hand is not placed perpendicular to the camera viewing angle . \n however , clinodactyly might not be identified since holding the fingers open made the fingers appear to curve inwards . \n bedside clinician role : the bedside clinician plays a critical and active role in the evaluation , and must report their observations of the subject and their impressions regarding the camera s view . \n the bedside clinician must evaluate and adjust the equipment s angle and distance from the subject , camera s position and zoom , lighting conditions , and patient positioning . \n for effective evaluation , the camera and/or subject must be repositioned during the evaluation , and often these adjustments must occur in a fluid manner that is responsive to the examination needs and activity of the subject . \n for example , identifying dysmorphologic abnormalities which are often small and subtle requires optimal positioning , and movement , tone , and reflex examination must occur when the subject is in the relaxed state . image display : although the telemedicine equipment permits different displays for the bedside clinician and remote consultant physician , having the same image displayed allowed the bedside clinician to more readily make changes to enhance the view of the remote consultant . \n suboptimal lighting , camera angles or camera focal points sometimes resulted in an inability of the remote consultant to appreciate abnormal skull shape , pigmentary differences ( especially eye color ) , respiratory effort , cleft palate evaluation , eye movement abnormalities , muscle tone abnormalities , and deep tendon reflexes . in all cases , \n the bedside clinician knew the camera images were suboptimal and did not allow them to fully appreciate the examination finding they could see in - person . \n focal point : prior to the examination , it was useful to identify the minimal focal distance for the equipment s cameras by zooming in on an object in the environment . subsequently , placing the equipment so the camera was at or minimally further away allowed maximal zoom while retaining the ability to focus on features . for the equipment tested , this was approximately one meter from the patient . lighting : lighting conditions varied based on overhead lighting of different rooms and with different camera positions . \n overhead lighting adjustments were often needed to provide lighting that was sufficiently bright enough for the examination without creating bright spots on the subject that exceeded the camera s ability to achieve good contrast balance . \n in addition , low angle lighting was at times useful to distinguish skin surface characteristics . \n having identical images displayed on the bedside and telemedicine physicians screens allowed the bedside physician to best optimize the lighting . \n thus , for most components of the examination the optimal camera angle was directly above the isolette and angled down at the prone or supine subject since this approach maximized the amount of the subject perpendicular to the camera . when examining particular body parts , positioning them perpendicular to the camera through repositioning of the equipment and the patient was essential . for dysmorphology examination , \n this was particularly important when evaluating hand / finger characteristics or limb proportions . for neurologic examination , \n multiple views : while it may be difficult to maneuver large equipment around an isolette , the bedside clinician must be an active participant and can turn the subject as needed to optimize examination . for the dysmorphology examination , \n viewing the subject from angles rotated 180 degrees , so that the feet extend away from the camera permits better visualization of skull shape , hand shape , and dorsum of foot evaluation ( syndactyly , overfolded toes ) . turning the subject to the side permitted a lateral view which also aided in assessment of head shape . for the neurologic examination , repositioning of the subject s face perpendicular to the camera aided in evaluation of facial movement , suck , rooting , and eye movement evaluation . placing the subject so that the angle of the joints was perpendicular to the camera aided in assessment of spontaneous movements and reflexes . \n special considerations for the hands : because neonates often have their hands clenched at rest , the hand must be held open and flat by the bedside clinician for proper evaluation . \n the dorsum of the hand is best evaluated with the subject s head pointed towards the camera . \n hand proportions can be distorted when the hand is not placed perpendicular to the camera viewing angle . \n however , clinodactyly might not be identified since holding the fingers open made the fingers appear to curve inwards . \n we describe a prospective study to determine the accuracy of dysmorphology and neurologic examinations in subjects in the nicu , and to identify optimal approaches and limitations of telemedicine examinations in this setting . for both dysmorphology and neurologic examinations \n , telemedicine could be used to perform generally accurate examinations , but certain limitations were identified . \n importantly , we found that the bedside clinician played an essential role in optimizing the examination . \n the bedside clinician was able to indicate if the displayed image did not accurately reflect the in - person view , which could prompt adjustments to the camera , viewing angle or patient positioning . \n these results suggest telemedicine has the ability to improve access to pediatric subspecialty expertise for patients in locations without in - person subspecialty access and may reduce the need to transfer of critically ill patients . \n currently , patients may be transferred to a tertiary care center for evaluation by subspecialists who are not available at the referring hospital . while some transfers are necessary so that the subspecialty service can provide ongoing management , some infants are transferred for a single evaluation by a geneticist or neurologist . \n significant health care costs , medical risks to the critically ill patient , and stress to the patient and family could be prevented if a subspecialist could reliably assess the infant from a remote setting using telemedicine . by providing for greater subspecialty access \n , telemedicine could play a role in making feasible recent calls for enhanced neonatal neurocritical care . \n however , there are no published studies addressing telemedicine for subspecialty consultations in a nicu setting . \n while telemedicine has been used to facilitate access for patients with more chronic conditions such as epilepsy , it s most widespread use has been to manage patients with neurologic conditions requiring rapid intervention such as stroke . \n studies have documented the reliability of a remotely administered stroke scale , shown that telemedicine is associated with a high retention rate at the local level and reduced patient costs , and demonstrated that thrombolysis decisions were more often correct using telemedicine than phone consultation . \n therefore , guidelines for stroke management have recommended implementing telemedicine to increase access to acute stroke care . in a more general neurocritical care setting \n , telemedicine has been shown to improve physician responsiveness to unstable patients and reduce costs . \n a recent report from the american academy of neurology telemedicine work group concluded that tele - neurology would be of greatest benefit to patients with restricted access to neurologic care , would improve neurologists ability to meet the demand for specialty care in underserved areas , and overall could promote rapid evaluation of patients in remote locations . \n while most prior work has focused on adults requiring stroke or neurocritical care so the guideline could not address pediatric care specifically , occur data indicate that telemedicine may also be of benefit to neonates and infants requiring neurologic care . \n this study focused on the physical exam component of dysmorphology exam , as previous literature has documented patient and provider satisfaction with remote genetic counseling and outpatient visits . \n however , these studies did not include an in - person evaluation , and were therefore not able to assess the accuracy of physical examination findings . \n most relevant to the current data was a study addressing the accuracy of telemedicine for dermatology examination , although this study used transmission of static images as opposed to our study utilizing real - time audio - video assessments . \n they found some skin lesions were readily diagnosed ( e.g. eczema , acne , psoriasis , and skin infections ) while others were more difficult to accurately assess ( e.g. pigmented lesions , actinic keratosis and basal cell carcinoma ) . \n this study is the first to provide data about the limitations of the equipment for dysmorphology evaluations , and recommend a systematic approach to an examination using telemedicine . \n similarly , while components of the neurologic examination have been validated using telemedicine in the adult ( e.g. for stroke evaluation ) , this is the first study to assess the accuracy of thorough neurologic examination of neonates and infants . \n several studies have addressed telemedicine accuracy and impact when used by neonatologists . a recent study comparing bedside and telemedicine neonatologist evaluations of 46 neonates found excellent or intermediate - to - good agreements for almost all components of the evaluation . however , poor agreement was identified for several physical examination features including auditory components ( breath , cardiac , bowel sounds ) and capillary refill time . in a second study , 5 of 19 neonates who underwent tele - consultation avoided transport , and as a result use of telemedicine was associated with substantial cost savings . \n there have been more limited studies of telemedicine use for subspecialty evaluation of neonates , and they have generally focused on image interpretation and not performance of a full subspecialty physical examination . an early study with a low cost video - teleconferencing system for surgical consultation reported that in six neonates , an accurate diagnosis was established in all , leading to earlier care implementation for some neonates . \n a study of 63 neonates with suspected congenital heart disease reported that a diagnosis could be made in 97% using transmitted echocardiographic images of neonates with suspected congenital heart disease . \n congenital heart disease was excluded in 19 , diagnosed but did not require transfer in 28 , and required transfer in 14 . \n a telemedicine program focused on retinopathy of prematurity screening performed 582 examinations on 137 infants . \n thirteen infants were transferred and nine required laser treatment , and there were no poor outcomes . in addition to being useful for image transmission , our data indicate telemedicine may allow performance of a more complex examination . \n one similar study has been reported in 15 older children being evaluated in an emergency department as if they required transport by in - person and telemedicine examinations . \n the sensitivity of the telemedicine physician to identify abnormal findings was 88% and the specificity of the telemedicine physician to identify normal findings was 93% . \n first , since we aimed to define the limitations of the equipment with optimal use , subspecialists were involved in the patient evaluations at bedside and remote positions . \n additional steps are needed to generalize these data since with clinically implementation the bedside clinician would not be a subspecialist . although the bedside clinician was instructed to follow directions of the remote consultant and not provide feedback about their own observations during the first phase of the study , it is possible that having a bedside physician with less familiarity with these specialized examinations could negatively affect accurate demonstration of abnormal findings . \n second , this study focused on the ability to identify examination abnormalities and did not assess whether management decisions would differ based on in - person or telemedicine examinations . \n further study is needed to determine the impact of examination omissions or inaccuracies on clinical diagnosis or management . additionally , it is unclear whether these management changes would exceed the medical risk and financial cost of transferring these sometimes critically ill patients to a center for a specialty consultation . \n third , our study did not select patients based on their hypothesized suitability for avoidance of transfer . \n fourth , we utilized a single in - person remote consultant examination as the gold standard . however , even with in - person examination there will be inter - examiner variability . \n this study was designed to mimic the real - life scenario of a remote physician evaluating a neonate or infant via telemedicine and then repeating their examination if the patient was transferred to their facility . a more robust strategy to determine the sensitivity of the telemedicine evaluation would employ multiple expert evaluators of the same patient . \n finally , we used one model of telemedicine equipment used and the sensitivity may vary depending upon technical specifications of the cameras and data transfer . the telemedicine device used in \n this study was similar to that employed in prior evaluations of infants in a nicu setting so it is possible that studies employing different technology could have different findings . \n using telemedicine consultation , geneticists were able to accurately identify 93% of dysmorphic examination features and neurologists were able to identify 92% of abnormal neurologic examination features in encephalopathic patients . \n these data extend previous evaluations of telemedicine in children by indicating that beyond simple image transmittal , telemedicine may allow subspecialists to interpret more extended physical examinations accurately . \n however , our data also indicate that physicians must be mindful of specific telemedicine limitations , that the bedside clinician must play an active and educated role in the process , and that collaborative communication between the bedside clinician and remote consultants is essential . \n these findings indicate that while equipment improvements are certainly important , optimization of telemedicine consultation also requires attention to implementation . \n our data indicate that telemedicine examinations are generally accurate which provides an impetus to study additional implementation issues . \n we did not involve parents in the study , so our study can not provide any data regarding acceptance of telemedicine consultation by parents / families . further study is certainly needed focused on implementation issues , such as family and physician opinions regarding speaking and providing consultation over telemedicine . \n establishment of telemedicine programs in which physicians understand the limitations of this approach and continually work to improve upon its use will likely be of most benefit to patients . with further development of these types of programs , telemedicine may offer specialized care to patients in the nicu on a larger scale than could be accomplished by conventional in - person consultation models . \n ", "role": "user" }, { "content": "objectivesevaluate whether telemedicine can be used to perform dysmorphology and neurologic examinations in the neonatal intensive care unit ( nicu ) by determining the examination accuracy , limitations , and optimized procedures.study designprospective evaluation of nicu patients referred for subspecialty consultation for dysmorphic features ( n=10 ) or encephalopathy ( n=10 ) . \n a physician at bedside ( bedside clinician ) performed an in - person examination which was viewed in real - time by a remote physician ( remote consultant ) . \n standardized examinations were recorded and compared . \n subsequently , a qualitative approach established technique adjustments and optimization procedures necessary to improve visualization.resultstelemedicine examinations identified 81 of 87 ( 93% ) dysmorphology examination abnormalities and 37 of 39 ( 92% ) neurologic examination abnormalities . \n optimization of remote consultant visualization required an active bedside clinician assisting in camera and patient adjustments.conclusionstelemedicine can be used to accurately perform many components of the dysmorphology or neurologic examinations in nicu patients , but physicians must be mindful of specific limitations .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: minoxidil - induced hypertrichosis is not an unusual event and has been reported essentially in the vicinity of application areas . \n generalized hypertrichosis , however , is rare and has been described mainly in children and adolescents . \n we present a case of minoxidil - induced generalized hypertrichosis in an adult woman with alopecia areata . \n a 26-year - old woman presented to our hair clinic with multiple patches of alopecia areata on the scalp . a treatment plan consisting of topical clobetasol gel , intralesional triamcinolone , and 5% topical minoxidil solution was prescribed . \n after 8 weeks of treatment , the patient noticed the onset of facial hypertrichosis that progressively spread to the upper limbs and eventually to the entire body surface [ figures 1 and 2 ] . \n there were no systemic symptoms and no abnormalities in adrenal , gonadal , or thyroidal hormones were detected . \n the patient admitted overuse of topical minoxidil , having applied around 100 ml / week on the scalp . \n note trichomegaly of the eyelashes ; ( b ) involvement of the upper limbs generalized hypertrichosis involving the ( a ) anterior and ( b ) posterior trunk \n the mechanism of action through which oral and topical minoxidil induce hair growth remain incompletely understood . \n topical minoxidil is widely used for androgenetic alopecia and has been indicated as an off - label medication in the treatment of alopecia areata . \n one of its possible side effects is hypertrichosis ; an excessive number of terminal hairs in nonandrogen - dependent areas , as observed in our patient . \n it must be distinguished from hirsutism wherein this excessive growth follows the male pattern of hair distribution . in most patients , \n hypertrichosis is restricted to the face and upper limbs possibly by inadvertent application or transferring of the product through fomites . in cases of generalized hypertrichosis \n however , it has been proposed that , in such patients , a higher sensitivity of the follicular apparatus might be responsible for the widespread growth of hair observed . \n we believe that the clinical picture presented herein results mainly from the overuse of the drug leading to higher systemic absorption , but we can not exclude that an increased susceptibility of the hair follicle to minoxidil might have played a role in this case . \n we present a rare case of generalized hypertrichosis in an adult patient following exposure to topical minoxidil . even though minoxidil is commonly prescribed for alopecia areata \n , there is insufficient evidence to support its systematic use and the occurrence of adverse effects should prompt drug interruption . \n nonetheless , topical minoxidil has been shown to be a safe medication for adult patients , and we believe that the present case was an isolated one , possibly resulting from the misuse of the drug . \n the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) \n has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . \n the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . \n the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) \n has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . \n the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . \n \n ", "role": "user" }, { "content": "hypertrichosis is a common side effect of topical minoxidil and has been reported to occur mainly close to the areas of application . in this paper , we present a case of a 26-year - old woman who developed generalized hypertrichosis 8 weeks after treatment with 5% topical minoxidil solution for alopecia areata . \n generalized hypertrichosis is a rare side effect and has been described mainly in children and adolescents . \n even though minoxidil is commonly prescribed for alopecia areata , there is insufficient evidence to support its systematic use and the occurrence of adverse effects should prompt drug interruption . \n nonetheless , topical minoxidil has been shown to be a safe medication for adult patients , and we believe that the present case was an isolated one , possibly resulting from the misuse of the drug .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: understanding the signaling pathways associated with tcr activation may provide insights that clarify the intracellular mechanisms of costimulation in addition to understanding the sensitivity of tcr interactions that range from antagonism to full t cell activation . \n tcr interactions lead to phosphorylation of cd3 chains and the associated chains by lck and the activation of zap-70 , followed by the induction of the extracellular signal regulated kinase \n in addition , the activation of phospholipase c generates phospholipid second messengers that activate protein kinase c , calcium mobilization , and the downstream calcineurin / nuclear factor of activated t cells ( nf - at ) pathway 123 . \n one kinase that has not been well defined in tcr signaling is glycogen synthase kinase ( gsk)-3 . \n the two members of the protein serine / threonine kinase gsk-3 family , gsk-3 and , are involved in regulating cell fate and differentiation in a variety of organisms , including dictyostelium , xenopus , and drosophila 45 . unlike most kinases , gsk-3 is active in resting cells . \n stimulation with mitogens or growth factors leads to the inactivation of gsk-3 by phosphorylation of the regulatory serine residue at position 9 67 . \n there is evidence that gsk-3 is downstream of the wingless pathway 8910 as well as the erk \n gsk-3 acts on a wide variety of substrates including glycogen synthase , c - jun , c - myc , and eif-2b 45 . \n beals et al . have shown that gsk-3 enhances nuclear export of nf - at in brain extracts and transient transfection of cos cells , thereby negatively regulating this pathway 11 . \n have shown that gsk-3 can be inactivated by treatment with pma and ionomycin in peripheral human lymphocytes 12 . \n these studies suggest that gsk-3 may play a role in t cell proliferation in vivo . \n together , biochemical analysis , bone marrow chimeric mice expressing a constitutively active form of gsk-3 , and studies using inhibitors demonstrate that gsk-3 regulates nf - at localization , antigen - specific t cell proliferation , and il-2 production . \n p14 tcr transgenic mice ( 327 line ) express a v2/v8.1 heterodimer specific for lymphocytic choriomeningitis virus ( lcmv ) glycoprotein peptide ( gp ) p33 ( kavynfatm ) and h-2d 13 . \n we have also bred the p14 tcr on a recombinase - activating gene ( rag)2 background ( h-2 ) . \n 25 10 cells were lysed in gentle soft buffer ( 10 mm nacl , 20 mm pipes , ph 7 , 0.5% np-40 , 0.05% 2-me , and inhibitors 0.1 mm pmsf , 100 m na3vo4 , leupeptin , 50 mm naf , and 1 mm benzamidine ) and run on sds - page . \n western blots were probed with hemagglutinin ( ha)-specific antibodies ( upstate biotechnology ) to detect the expression of the retroviral gsk-3a9 , or phospho - specific gsk-3 ( serine 9 specific ; new england biolabs , inc . ) or anti - gsk-3 ( upstate biotechnology ) . \n laser scanning densitometry ( molecular devices ) was used to determine fold increase in phospho - gsk-3 relative to the av - stimulated control at each time point . \n recombinant retroviruses were packaged using a packaging cell line gp+e and titrated on nih 3t3 cells as previously described 14 . \n packaging cell lines producing high - titer viruses ( 10 cfu / ml ) were used to infect bone marrow from 24-mo - old p14 tcr transgenic mice as previously described 15 . in brief , cells were cultured at 5 10 cells / ml in imdm supplemented with 50 m 2-me , 10% heat - inactivated fcs ( sigma - aldrich ) , and il-3 and il-6conditioned media . after 48 h , bone marrow cells were cocultivated with the packaging cell line producing the replication - defective retroviruses for a further 48 h. selection of bone marrow cells was done with 0.75 mg / ml g418 ( gibco brl ) for 24 h. approximately 10 cells were infused into irradiated recipients ( 900 rads ) , and animals were reconstituted for 812 wk . \n splenocytes ( 2 10 ) were cocultivated with 10 irradiated c57bl/6 splenocytes as apcs that were previously pulsed with 10 m peptides for 12 h at 37c in 96-well flat - bottomed plates . \n after 48 h , 1 ci of [ h]thymidine ( nen life science products ) was added to the wells and cultured overnight . \n cells were harvested and counted on a matrix 96 direct -counter ( canberra packard ) . \n the peptides have been characterized to be a strong agonist ligand , p33 ( kavynfatm ) ; a weaker agonist , a4y ( kavanfatm ) ; or a nonstimulatory control ligand , av ( sgpsntppei ) 1617 . \n 10 mm licl was added , or as a control , 10 mm kcl . for il-2 production , supernatants were removed at the time points indicated in fig . 3 and fig . \n 5 10 ctll-2 cells were cultured with the supernatant for 24 h , followed by a pulse of 1 ci of [ h]thymidine overnight . \n 10 cells were stained with antibodies specific for cd4 , cd8 , v8 , or v2 ( pharmingen ) in pbs , 1% fcs , and 0.1% sodium azide . \n cells were washed once and then fixed in 1% paraformaldehyde . for intracellular nf - atc staining , p14 tcr rag splenocytes \n were cocultivated with thioglycollate - stimulated macrophages pulsed with the lcmv - gp peptide p33 . after 3 d in the presence of 10 mm kcl or licl , \n cells were dipped in acetone for 15 s , followed by methanol for 6 min . \n slides were incubated in blocking buffer ( pbs , 2% fcs , 5% donkey serum , 5% bsa ) for 1 hr , followed by anti \n nf - atc1 ( a gift from g. crabtree , stanford university , stanford , ca ) for 72 h. after washing , the donkey anti mouse secondary antibody ( the jackson laboratory ) was added for 1 h , followed by streptavidin \n p14 tcr transgenic mice ( 327 line ) express a v2/v8.1 heterodimer specific for lymphocytic choriomeningitis virus ( lcmv ) glycoprotein peptide ( gp ) p33 ( kavynfatm ) and h-2d 13 . \n we have also bred the p14 tcr on a recombinase - activating gene ( rag)2 background ( h-2 ) . \n 25 10 cells were lysed in gentle soft buffer ( 10 mm nacl , 20 mm pipes , ph 7 , 0.5% np-40 , 0.05% 2-me , and inhibitors 0.1 mm pmsf , 100 m na3vo4 , leupeptin , 50 mm naf , and 1 mm benzamidine ) and run on sds - page . \n western blots were probed with hemagglutinin ( ha)-specific antibodies ( upstate biotechnology ) to detect the expression of the retroviral gsk-3a9 , or phospho - specific gsk-3 ( serine 9 specific ; new england biolabs , inc . ) or anti - gsk-3 ( upstate biotechnology ) . \n laser scanning densitometry ( molecular devices ) was used to determine fold increase in phospho - gsk-3 relative to the av - stimulated control at each time point . \n recombinant retroviruses were packaged using a packaging cell line gp+e and titrated on nih 3t3 cells as previously described 14 . \n packaging cell lines producing high - titer viruses ( 10 cfu / ml ) were used to infect bone marrow from 24-mo - old p14 tcr transgenic mice as previously described 15 . in brief , cells were cultured at 5 10 cells / ml in imdm supplemented with 50 m 2-me , 10% heat - inactivated fcs ( sigma - aldrich ) , and il-3 and il-6conditioned media . after 48 h , bone marrow cells were cocultivated with the packaging cell line producing the replication - defective retroviruses for a further 48 h. selection of bone marrow cells was done with 0.75 mg / ml g418 ( gibco brl ) for 24 h. approximately 10 cells were infused into irradiated recipients ( 900 rads ) , and animals were reconstituted for 812 wk . \n splenocytes ( 2 10 ) were cocultivated with 10 irradiated c57bl/6 splenocytes as apcs that were previously pulsed with 10 m peptides for 12 h at 37c in 96-well flat - bottomed plates . \n after 48 h , 1 ci of [ h]thymidine ( nen life science products ) was added to the wells and cultured overnight . \n cells were harvested and counted on a matrix 96 direct -counter ( canberra packard ) . \n the peptides have been characterized to be a strong agonist ligand , p33 ( kavynfatm ) ; a weaker agonist , a4y ( kavanfatm ) ; or a nonstimulatory control ligand , av ( sgpsntppei ) 1617 . \n peptides were generated and purified as previously described 16 . in some assays , 10 mm licl was added , or as a control , 10 mm kcl . for il-2 production , supernatants were removed at the time points indicated in fig . 3 and fig . \n 5 10 ctll-2 cells were cultured with the supernatant for 24 h , followed by a pulse of 1 ci of [ h]thymidine overnight . \n 10 cells were stained with antibodies specific for cd4 , cd8 , v8 , or v2 ( pharmingen ) in pbs , 1% fcs , and 0.1% sodium azide . \n cells were washed once and then fixed in 1% paraformaldehyde . for intracellular nf - atc staining , \n p14 tcr rag splenocytes were cocultivated with thioglycollate - stimulated macrophages pulsed with the lcmv - gp peptide p33 . after 3 d in the presence of 10 mm kcl or licl , \n cells were dipped in acetone for 15 s , followed by methanol for 6 min . \n slides were incubated in blocking buffer ( pbs , 2% fcs , 5% donkey serum , 5% bsa ) for 1 hr , followed by anti \n nf - atc1 ( a gift from g. crabtree , stanford university , stanford , ca ) for 72 h. after washing , the donkey anti mouse secondary antibody ( the jackson laboratory ) was added for 1 h , followed by streptavidin \n studies have suggested that gsk-3 may be involved in lymphocyte activation 1112 . to determine whether antigen - specific stimulation of lymphocytes inactivates gsk-3 , naive cd8 splenocytes were sorted from p14 tcr transgenic mice ( specific for lcmv - gp [ amino acid 3341 , p33 ] and h-2d ) and stimulated with macrophages pulsed with the antigenic ligand p33 or a control peptide av ( fig . \n western blot analysis using an antibody specific for inactive gsk-3 ( gsk-3 serine phosphorylated at position 9 ) shows an increase in phosphorylated gsk-3 after peptide - specific stimulation . \n previous studies have demonstrated that a substitution of alanine for serine at amino acid position 9 of gsk-3 leads to constitutive kinase activity in human cell lines and transgenic mice 718 . to understand the role of gsk-3 in t cell responses , an ha - tagged constitutively active form of gsk-3 ( gsk-3a9 ) was cloned into the retroviral vector murine stem cell virus ( mscv ; fig . \n expression was confirmed by transfecting nih 3t3 cells with mscv / gsk-3a9 and examining expression by western blot analysis using ha - specific mabs ( fig . \n 2 b ) . a high - titer packaging cell line for mscv / gsk-3a9 and control mscv was obtained ( 10 cfu / ml ) and used to infect bone marrow stem cells from p14 tcr transgenic mice . \n the frequency of bone marrow precursors that were transduced with the retrovirus was quantitated by selecting cells with neomycin . \n these cells were used to generate bone marrow chimeric mice with c57bl/6 irradiated host animals . \n chimeric mice were compared from p14 tcr transgenic bone marrow transduced with mscv / gsk-3a9 and control mscv . \n after reconstitution , flow cytometry analysis using antibodies specific for cd4 , cd8 , and v2 ( expressed by the p14 transgenic tcr ) showed comparable numbers of p14-transgenic cd8 t cells in the thymus ( data not shown ) and spleen ( fig . \n this suggests that positive selection and survival of peripheral t lymphocytes was not dramatically affected by the presence of gsk-3a9 . \n mature t cell lcmv peptide - specific responses were assessed using a strong agonist ligand p33 , the weaker agonist a4y , and nonstimulatory control peptide av . \n il-2 production from these cultures was also assessed by measuring proliferation of an il-2dependent line , ctll-2 . \n 3 c shows that il-2 production was also reduced in t cells from mscv / gsk-3a9 chimeric mice . \n t cell responses were also examined in the presence of licl , which selectively inhibits gsk-3 activity in a variety of cells , including cos cells , rat pc12 cells , drosophila , xenopus , and dictyostelium 91920 . \n splenocytes from p14 tcr transgenic mice were incubated with the strong antigenic peptide p33 and weaker agonist a4y ligand , in the presence of 10 mm licl or 10 mm kcl , and pulsed with [ h]thymidine at several time points . \n however , in the presence of lithium , dramatically increased and prolonged proliferative responses to p33 and a4y were seen after 3 , 4 , and 5 d ( fig . \n , il-2 production was dramatically increased in the presence of lithium , as measured by proliferation of the il-2dependent line ctll-2 ( fig . 4 b ) . \n previous studies have shown that gsk-3 phosphorylates nf - atc , which promotes cytoplasmic localization and also export from the nucleus 11 . therefore , the presence of licl should inactivate gsk-3 , resulting in prolonged dephosphorylation of nf - atc and sustained nuclear localization . \n we examined the localization of nf - atc 3 d after t cells were stimulated with the antigenic peptide p33 in the presence or absence of licl . \n fluorescent microscopy showed that nf - atc was found in the nucleus in the presence of inactive gsk-3 ( fig . \n this demonstrates that gsk-3 plays an important role in antigen - specific t cell activation by regulating nf - atc localization . \n our studies suggest that tcr signals inactivate gsk-3 , which negatively regulates t cell proliferation and il-2 production by altering the nuclear import / export of nf - at . \n studies using hela and bhk cells have shown that crm1 and ran are involved in nf - at export from the nucleus and have suggested that gsk-3 contributes to this process 2122 . \n in addition , mutation of the serine residue in nf - at that is phosphorylated by gsk-3 leads to constitutive nuclear localization 23 . \n 24 have examined the role of gsk-3 in b cell receptor signaling using the b lymphoma cell line a20 . \n cross - linking the b cell receptor with f(ab)2 fragments lead to the phosphorylation and inactivation of the gsk-3 isoform . \n together , studies from a variety of models support a role for gsk-3 in receptor - mediated signals that shuttle nf - at from the nucleus . \n cell surface interactions through molecules such as ctla-4 negatively regulate t cell responses by interacting with the costimulatory ligands b7 - 1 and b7 - 2 25 . \n other molecules such as cd5 have been shown to negatively influence tcr - mediated signals 2627 . \n in addition , signaling molecules such as the tyrosine kinase csk 28 , shp-1 ( motheaten ; ptp-1c ; references 29303132 ) , cabin 1 33 , and the adaptor cbl 3435 have also been demonstrated to play a role in negatively regulating t cell responses . in this study , we have shown that gsk-3 , a molecule that is generally known to be active in resting cells , is inactivated upon tcr stimulation . \n we show that gsk-3 is involved in the regulation of tcr - mediated proliferation and that one role of gsk-3 is to negatively regulate nf - atc activity and il-2 production . \n however , gsk-3 has a multitude of substrates , and it will be interesting to understand how these different effectors interplay with other pathways to orchestrate resting t cell survival and activation .", "role": "user" }, { "content": "glycogen synthase kinase ( gsk)-3 is a protein serine / threonine kinase that regulates differentiation and cell fate in a variety of organisms . \n this study examined the role of gsk-3 in antigen - specific t cell responses . using resting t cells from p14 t cell receptor ( tcr)-transgenic mice ( specific for the lymphocytic choriomeningitis virus and h-2db ) \n , we demonstrated that gsk-3 was inactivated by serine phosphorylation after viral peptide \n specific stimulation in vitro . to further investigate the role of gsk-3 , \n we have generated a retroviral vector that expresses a constitutively active form of gsk-3 that has an alanine substitution at the regulatory amino acid , serine 9 ( gsk-3a9 ) . \n retroviral transduction of p14 tcr \n transgenic bone marrow stem cells , followed by reconstitution , led to the expression of gsk-3a9 in bone marrow chimeric mice . \n t cells from chimeric mice demonstrate a reduction in proliferation and interleukin ( il)-2 production . \n in contrast , in vitro assays done in the presence of the gsk-3 inhibitor lithium led to dramatically prolonged t cell proliferation and increased il-2 production . \n furthermore , in the presence of lithium , we show that nuclear factor of activated t cells ( nf - at)c remains in the nucleus after antigen - specific stimulation of t cells . \n together , these data demonstrate that gsk-3 negatively regulates the duration of t cell responses .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: periodontally accelerated osteogenic orthodontics ( paoo ) technique is a combination of a selective decortication - facilitated orthodontic technique and alveolar augmentation.[13 ] with this technique , one teeth can be moved 2 - 3 times further in one third or one fourth of the time required for traditional orthodontic therapy 3 - 6 . \n it can be used to treat moderate to severe malocclusions in both adolescents and adults and can also reduce the need for extractions . surgical intervention to affect the alveolar housing and speed tooth movement has been used in various forms for more than a hundred years . \n heinrich kle 's publication in 1959 was the beginning for the surgically accelerated orthodontic tooth movement . \n kle believed that it was the continuity and thickness of the denser layer of cortical bone that offered the most resistance to tooth movement . \n he theorized that by disrupting the continuity of this cortical layer of bone that he was actually creating and moving segments of bone in which the teeth were embedded . \n he believed that these outlined blocks of bone could be moved rapidly and somewhat independently of each other because they were connected by only less dense medullary bone , which would act as the nutritive pedicle and maintain the vitality of the periodontium . \n the blocks of bone were outlined using vertical interradicularcorticotomy cuts both facially and lingually and these were joined 10 mm supra - apically with an osteotomy cut through the entire thickness of the alveolus . over time the supra - apical connecting osteotomy cuts used by kle were replaced with corticotomy cuts . \n gantes and coworkers in 1990 reported on corticotomy - facilitated orthodontics in fiac adult patients in whom space closing was attempted with merely orthodontic forces . \n the mean treatment time for these patients was 14.8 months , with the distalization of the canines being mostly completed in 7 months . \n wilcko and coworkers reported that in a surface computed tomographic ( ct ) scan evaluation of selectively decorticated patients was that the rapid tooth movement was not the result of bony block movement , but rather to a transient localized demineralization - remineralization phenomenon in the bony alveolar housing consistent with the wound healing pattern of the regional acceleratory phenomenon ( rap ) , developed by frost and jee and described in the periodontal literature by yaffe and coworkers . \n the demineralization of the alveolar housing over the root surfaces apparently leaves the collagenous soft tissue matrix of the bone , which can be carried with the root surface and then remineralizes following the completion of the orthodontic treatment . \n they have also demonstrated that it is not the design of the selective alveolar decortication that is responsible for the rapid tooth movement but rather the degree of tissue metabolic perturbation per se . \n it is important for the periodontist to know the details of the procedure to fulfill the need of the patient and thus helping the orthodontist in attaining the quicker and stable results . \n the aim of this report is to present the rapid and effective modified alveolar corticotomy - facilitated orthodontic treatment of an adult case with severe malocclusion . \n six patients who have been diagnosed as class i malocclusion with bimaxillary protrusion were selected [ figure 1 ] . \n the treatment objectives included correction of bimaxillary protrusion and correction of dental relationship . to attain the objectives , \n all the patients were explained regarding the paoo and the patient consent was obtained for the surgical corticotomies . \n a modified corticotomy procedure was carried out under local anesthesia . a mucoperiosteal flap preserving the gingival margin \n the greatest mesiodistal width of the incisors guided the vertical bone cuts in the cortical bone from the gingival margin to 2 - 3 mm below the apices of the teeth . \n the vertical cuts were performed from the distal of the right lower canine to the distal of left canine with a 0.5-mm diameter stainless steel round bur . \n these vertical cuts were deepened in the cortical bone about 1.5 - 2 mm and extended to spongiosa . \n bone graft was placed and the fl t was repositioned and closed with interrupted sutures [ figures 25 ] . \n similar surgical procedure was followed for the maxillary teeth [ figure 6 ] all the patients were given postopertative antibiotics and anti - inflammatory agents 5 days following the surgery . \n maxillary anterior teeth coticotomy bone graft placed in the corticotomy site in the lower anteriors postoperative left side postoperative right side the mean treatment time for these patients was 17.4 months , with the distalization of the canines being mostly completed in 8.5 months [ table 1 ] . in one case , there was mild subcutaneous hematoma , after maxillary anterior teeth corticotomy , which was subsided within a week . \n all the patients reported the pain and mild swelling 2 days following the surgical procedure . \n the treatment objectives included correction of bimaxillary protrusion and correction of dental relationship . to attain the objectives , \n all the patients were explained regarding the paoo and the patient consent was obtained for the surgical corticotomies . \n a modified corticotomy procedure was carried out under local anesthesia . a mucoperiosteal flap preserving the gingival margin \n the greatest mesiodistal width of the incisors guided the vertical bone cuts in the cortical bone from the gingival margin to 2 - 3 mm below the apices of the teeth . \n the vertical cuts were performed from the distal of the right lower canine to the distal of left canine with a 0.5-mm diameter stainless steel round bur . \n these vertical cuts were deepened in the cortical bone about 1.5 - 2 mm and extended to spongiosa . \n bone graft was placed and the fl t was repositioned and closed with interrupted sutures [ figures 25 ] . \n similar surgical procedure was followed for the maxillary teeth [ figure 6 ] all the patients were given postopertative antibiotics and anti - inflammatory agents 5 days following the surgery . \n maxillary anterior teeth coticotomy bone graft placed in the corticotomy site in the lower anteriors postoperative left side postoperative right side the mean treatment time for these patients was 17.4 months , with the distalization of the canines being mostly completed in 8.5 months [ table 1 ] . in one case \n , there was mild subcutaneous hematoma , after maxillary anterior teeth corticotomy , which was subsided within a week . \n all the patients reported the pain and mild swelling 2 days following the surgical procedure . \n concerns about the possible risks of corticotomy procedure have led to the modification of this technique . \n the original technique described by kole included a combined interradicularcorticotomy and supra - apical osteotomy . \n although the results of the kole osteotomies were stable , pulp mortifications were not rare . \n later , the supra - apical osteotomy was replaced by corticotomy , and labial and lingual corticotomy cuts were used to circumscribe the roots of the teeth . \n park et al introduced the alternative approach consisiting of incisions directly through the gingiva and bone using a combination of blades and a surgical mallet . while decreasing the surgical time ( no flaps or sutures ; only cortical incisions ) , this technique did not offer the benefits of bone grafting to increase periodontal support in the areas where expansive tooth movement was desired . \n in addition , the extensive hammering in office to perform the cortical incisions appears to certain patients to be somewhat aggressive . \n moreover , dizziness and benign paroxysmal positional vertigo have been reported , following the use of the hammer and chisels in the maxilla . \n furthermore , germac introduced modified corticotomy technique . in which , labial and lingual supra - apical horizontal and lingual vertical cuts were not performed . \n dibart introduced a new , minimally invasive procedure , combining microincisions ( peizocision ) with selective tunneling that allows for hard- or soft - tissue grafting and piezoelectric incisions . \n reduction of orthodontic therapy time is considered to be an important goal in the management of malocclusions . \n corticotomy has been proposed as an alternative to conventional orthodontic treatment in difficult adult cases for rapid tooth movement . \n chung et al reported that the complete retraction of anterior teeth combined with corticotomy in a case with severe bimaxillary protrusion took less than 3 months . according to the clinical observations of duker , the required position of the teeth after corticotomy \n geramc observed the total dramatical reduction in the orthodontic treatment time ( 16 months ) when compared with the average treatment time for extraction therapy ( 31 months ) . in corticotomy - facilitated orthodontics , the reduction of orthodontic treatment time by approximately \n when responding to a traumatic stimulus , the bony tissues initially have a biologic stage called regional acceleratory phenomenon ( rap ) characterized by a transient increase in bone turnover and a decrease in trabecular bone density . \n after fractures or surgical osteotomies , the regional acceleratory phenomenon significantly stimulates healing and tissue reorganization by a temporary burst of localized tissue remodeling . \n alveolar corticotomies are surgical interventions limited to cortical bone that were suggested as an alternative to facilitate the treatment of complex occlusal problems . \n sebaoun and coworkers have analyzed the alveolar and periodontal response to selective alveolar decortication as a function of time and proximity to the injury in a rat model . since traditional orthodontic tooth movement per se \n will in itself stimulate a mild rap response , tooth movement was thus intentionally not included in the experimental design . \n the sebaoun and coworkers reported that selective alveolar decortication injury resulted in an overwhelming activating stimulus for both the catabolic process ( resorption response ) and the anabolic process ( formation response ) in the periodontium . \n this bone modeling behavior peaked at 3 weeks after decortication surgery at which timethe catabolic response ( osteoclastic count ) and anabolic response ( apposition width and rate ) were 3-folds higher . \n additionally , adjacent to the injury the calcified spongiosa content of the alveolar bone decreased 2-fold and the pdl surface increased by 2-folds . \n thus , there was a dramatic increase in the tissue turnover by the third week after decortication surgery , which dissipated to normal steady state by 11 weeks after surgery . \n dynamics of the periodontium change in response to the decortication injury could thus be clarified . \n the pdl activity is enhanced by the decortication surgery , but it is the spongiosa that most likely plays the dominant role in rapid tooth movement . \n generally , the conventional corticotomy techniques include both labial and lingual cuts , although the clinical healing was uneventful , some complications , such as subcutaneous hematomas of the face and the neck . \n overcompression of the periodontal ligament can lead to hyalinization necrosis , the removal of which can be associated with root resorption . in an evaluation of the paoo data base , \n machado et al reported a 1.1 mm reduction in apical root resorption of the maxillary central incisors . although some animal experiments and case reports regarding the effects of segmental alveolar movement after corticotomy revealed no damages in the pulp and no adverse effects on the periodontium of the teeth , it was also reported that reactive inflammation of pulp and vacuolar degeneration in maxillary anterior teeth were observed after protraction with two - stage corticotomy in the maxilla . \n these reports range from no problems[1141921 ] to slightly interdental bone loss and decrease of attached gingiva and periodontal defects observed in some cases with short interdental distance . in comparison to traditional orthodontics , \n the fact that , the teeth can be moved more rapidly with the corticotomy techniques , thus resulting in shortened treatment times , is certainly advantageous to the patient 's periodontal health because less time in fixed appliances reduces patient burnout and substantially reduces the time available for relatively benign commensal bacterial biofilms to assume qualitative changes and convert to a destructive cytotoxic ( periodontopathic ) potential often seen when fixed appliances have remained on the teeth for more than 2 - 3 years . \n corticotomy - facilitated orthodontics is an effective treatment alternative in adults with severe malocclusion to decrease the treatment time and increase the quality of treatment . \n the role of periodontist in assisting the orthodontists to achieve the desirable results in shorter period of time is increasing . \n the periodontist should choose appropriate corticotomy technique , according to the alveolar topography . to avoid complications and to assist accelerated orthodontic tooth movement .", "role": "user" }, { "content": "an increasing number of adult patients have been seeking orthodontic treatment , and a short treatment time has been a recurring request . to meet their expectations \n , a number of innovative techniques have been developed to accelerate orthodontic tooth movement . \n significant acceleration in orthodontic tooth movement has been extensively reported following a combination of selective alveolar decortication and bone grafting surgery with the latter being responsible for the increased scope of tooth movement and the long - term improvement of the periodontium . \n six patients who have been diagnosed as class i malocclusion with bimaxillary protrusion were selected . \n a modified corticotomy procedure was carried out the active orthodontic treatment was begun within 1 week after surgery and follow up . \n all the patients reported the minmalpain and mild swelling 2 days following the surgical procedure . \n the mean treatment time for these patients was 17.4 months , with the distalization of the canines being mostly completed in 8.5 months . periodontallyaccelerated osteogenicsorthodontic tooth movement procedure or selective alveolar decortications or corticotomy approach is one of the surgical techniques developed to reduce the time for orthodontic treatment . \n this newer approach is leading to short orthodontic treatment time and great patient acceptance .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: nasal tip surgery represents a challenge to rhinoplasty and requires the knowledge of essential anatomy and aesthetic points ( figure 1 ) . \n several techniques can be performed to improve nasal tip definition , such as cartilaginous resection , tip grafts , or suture placement . \n resection techniques have gradually been replaced by maneuvers that are effective in preserving more of the nasal tip support mechanisms1 \n 2 \n 3 \n 4 \n 5 \n 6 \n 7 \n 8 \n 9 \n 10 . \n education on suture techniques on the nasal tip through external access combined with surgeon sensibility has enabled great progress in the applicability of closed - access techniques . \n the surgical algorithm is fundamental to the comprehension , judgment , and performing of surgical maneuvers , being necessary to surgery systematization whether at the clinic or at educational institutions \n the objective to classify the approach to nasal tip refinement through septocolumellar and intercartilaginous bilateral incisions based on nasal tip type ( classification proposed by the authors ) . \n this classification considers the interdomal distance ( angle of domal divergence and intercrural distance ) , domal arch width , alar cartilage consistency , and skin type ( figures 2 and 3 ) . to develop a surgical algorithm based on the findings that describes the proposed maneuvers . \n skin inspection , lateral inferior lower lateral cartilage palpation , and measurement of angles and distances are fundamental to define the nasal tip type of the caucasian nose ( table 1 ) . based on the tip type ( i , ii , or iii ) \n , it is possible to correlate the best surgical maneuver presented by the authors ( table 2 ) . * * lower lateral cartilage * * * * intermediate intercrural access to the tip is performed through incisions made according to the reduction rhinoplasty technique for the caucasian nose described by converse - diamond \n 1 ( figures 4 and 5 ) , which means making septocolumellar and intercartilaginous bilateral incisions . in cases that require weakening or cephalic removal of the lower lateral cartilage , the access is performed through an intercartilaginous incision with eversion of the lower lateral cartilage ( mcindoe technique ) ( figure 6 ) . \n this technique is carried out preferably with local anesthesia ( 1:100,000 xylocaine and epinephrine ) and sedation . at the end of the surgery \n , a patch is placed over the nose with a mold ( aquaplast ) and removed after the seventh day . \n surgical technique ( converse - diamond ) steps : septocolumellar and intercartilaginous bilateral incisions , displacement of the soft tissues from the osteocartilaginous structure . \n separation of the upper lateral cartilage from the nasal septum junction , septoplasty with or without turbinate surgery , and reduction of the upper lateral and septal cartilage . \n nasal tip refinement based on the proposed surgery algorithm*. bone hump reduction using cutting - type maury - parkes . \n osteotomies side by pecking performed with an osteotome converse 3 mm in women and 4 mm in men . \n * displacement of the skin from the nasal tip is carried out ( la garde maneuver ) . \n . its tightening must be gradual and progressive , permitting adjustments related to the definition of a more suitable tip . \n it must be carried out after septocolumellar and intercartilaginous suture using monocryl absorbable thread or colorless pds 4.0 thread with a straight , sharp needle . \n performing the interdomal suture at the end of the surgery prevents excessive manipulation of the nose tip and possible enlargement of the interdomal distance . \n subsequent to the lower lateral cartilage skin displacement using le garde 's maneuver , introduce the pds 4.0 thread to the inner portion of the dome . \n the thread must be introduced from right to left at the posterior border , returning from left to right to the anterior border , more cephalic . \n return the needle to the nostril in which the suture was initiated , tightening the suture gradually . \n exposure of the intralateral domal area through which the needle and thread will pass . \n step 3 . returning the needle through the more interior portion of the domal area . \n subsequent to the lower lateral cartilage skin displacement using la garde 's maneuver , introduce the pds 4.0 thread to the inner portion of the dome . \n the thread must be introduced from right to left at the posterior border , returning from left to right to the anterior border , more cephalic . \n return the needle to the nostril in which the suture was initiated , tightening the suture gradually . \n . its tightening must be gradual and progressive , permitting adjustments related to the definition of a more suitable tip . \n it must be carried out after septocolumellar and intercartilaginous suture using monocryl absorbable thread or colorless pds 4.0 thread with a straight , sharp needle . \n performing the interdomal suture at the end of the surgery prevents excessive manipulation of the nose tip and possible enlargement of the interdomal distance . \n subsequent to the lower lateral cartilage skin displacement using le garde 's maneuver , introduce the pds 4.0 thread to the inner portion of the dome . \n the thread must be introduced from right to left at the posterior border , returning from left to right to the anterior border , more cephalic . \n return the needle to the nostril in which the suture was initiated , tightening the suture gradually . \n exposure of the intralateral domal area through which the needle and thread will pass . \n step 3 . returning the needle through the more interior portion of the domal area . \n subsequent to the lower lateral cartilage skin displacement using la garde 's maneuver , introduce the pds 4.0 thread to the inner portion of the dome . \n the thread must be introduced from right to left at the posterior border , returning from left to right to the anterior border , more cephalic . \n return the needle to the nostril in which the suture was initiated , tightening the suture gradually . \n the substitution of cartilaginous resection techniques by suture techniques to improve nasal tip definition is a global trend5 . \n the final result of the suture is influenced mainly by factors such as the cartilage intrinsic force , degree of suture tightening , and the limitation imposed by soft tissues ( ligaments , subcutaneous tissue , and skin ) . \n . however , the interdomal suture may be ineffective in patients with thicker skin and excessive subcutaneous tissue , requiring a reduction of the angle of domal divergence and of the lateral intercrural width , domal arch width , and domal definition through other techniques such as transdomal suture ( delivery ) , or alar lateral spanning - type suture , lateral intercrural suture6 , as well as the goldman technique . \n some details concerning the interdomal suture must be observed : slight projection of the supratip region2 . \n . a suture more to the anterior may result in slight pinching of the skin and caudal rotation . \n discrete pinching of the supra - alar region , especially in patients with very thin skin and weak supra - alar cartilage , when performed at a distance greater than 23 mm from the nasal dome . \n asymmetry of the tip can be observed if the sutures are not placed at corresponding levels . \n the suture can be held using long - term absorbable threads or with nonabsorbable threads considering the tensile strength and absorption levels of each material . \n the interdomal suture is an effective method to improve nasal tip definition on the caucasian nose and can be performed through endonasal rhinoplasty without delivery . \n such a technique has already been reported in the literature through open and closed access with delivery , but not through closed access with intercartilaginous and septocolumellar incisions for surgery on the caucasian nose . \n this suture is easy to perform , predictable , controlled , and extremely useful to the surgeon dedicated to nasal tip surgery . \n the main sutures applied on the nasal tip were reported by guyuron and behmand in 20036 . \n our use of the interdomal suture has produced admirable results for more than 13 years . \n our records show that only one patient presented complications : recurrent cellulites of the tip , which resolved after suture removal .", "role": "user" }, { "content": "summary \n introduction : refinement of the nose tip can be accomplished by a variety of techniques , but currently , the use of sutures in the nasal tip with conservative resection of the alar cartilage is the most frequently recommended approach . \n objective : to classify the nasal tip and to demonstrate the interdomal suture applied to nasal tip refinement in the caucasian nose , as well as to provide a simple and practical presentation of the surgical steps . \n method : development of surgical algorithm for nasal tip surgery : 1 . \n interdomal suture ( double binding suture ) , 2 . \n interdomal suture with alar cartilage weakening ( cross - hatching ) , 3 . \n interdomal suture with cephalic removal of the alar cartilage ( mcindoe technique ) based on the nasal tip type classification . \n this classification assesses the interdomal distance ( angle of domal divergence and intercrural distance ) , domal arch width , cartilage consistency , and skin type . \n interdomal suture is performed through endonasal rhinoplasty by basic technique without delivery ( converse - diamond technique ) under local anesthesia . \n conclusion : this classification is simple and facilitates the approach of surgical treatment of the nasal tip through interdomal suture , systematizing and standardizing surgical maneuvers for better refinement of the caucasian nose .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: kawasaki disease , first described in 1967 , is a serious childhood illness characterized by high fever , conjunctivitis , erythema of oral mucosa and pharynx , a \" strawberry \" tongue , diffuse inflammation of both hands and often feet , polymorphous desquamative rash , and acute non - purulent cervical lymphadenopathy . in the absence of laboratory measurements , kd is diagnosed when five of the six symptoms are identified . \n alternatively , the disease may also be diagnosed if coronary aneurysms are found in addition to four of the major symptoms . in some patients , the long - term sequelae of vasculitis occurring in kd results in coronary artery aneurysms , thrombotic occlusions , progression to ischemic heart disease , and/or premature arteriosclerosis5 - 7 ) . \n approximately 4% of coronary aneurysms subsequently develop stenotic lesions , half of which occur within 2 years of the onset of kd6 ) . \n the standard treatment for significant coronary artery stenosis has generally been aortocoronary bypass surgery1,2 ) , although ptca has been described in a small number of patients3,4 ) . \n we describe here a 14 year old male with kd who developed stenosis of the coronary arteries , which was successfully managed with ptca . \n a 14-year - old boy was admitted to our institution for elective ptca to relieve stenosis of the coronary arteries . at 4 years and 7 months of age \n , the patient presented to our institution with typical signs and symptoms of kd ( persistent fever up to 39 for 10 days accompanied with conjunctival injection and a strawberry tongue ) . \n consequently , the patient received intravenous gamma globulin and aspirin , which resulted in a prompt resolution of the fever and improvement of symptoms . \n two - dimensional echocardiography performed during the acute phase of the illness demonstrated fusiform aneurysms of the right coronary artery ( rca ) ( 10 mm in diameter ) , left anterior descending ( lad ) branch ( 7 mm ) , and left circumflex ( 3.7 mm ) , as well as dilatation of the left main coronary artery ( lmca ) ( 4 mm ) . \n an echocardiogram performed 15 months after the onset of illness demonstrated mildly improved fusiform aneurysms of the rca ( 8.4 mm ) and lad ( 5 mm ) , as well as improved dilatation of lmca ( 3.4 mm ) . however , there was no change in the left circumflex lesion . \n the patient was continued on a therapy of low - dose aspirin and remained asymptomatic . \n a 24 hour holter monitor at 20 months , 40 months , and 68 months after presentation indicated normal heart rhythm with no evidence of ischemia . \n nine years and 5 months after disease onset , selective coronary angiography revealed two saccular aneurysms in the proximal portion of the lad , and in the proximal portion of the rca as well as stenosis ( minimal lesion in the proximal portion of the lad , discrete lesion in the left circumflex , and total obstruction in the rca with collateral arteries supplying blood to the distal portion of the rca.)(figure 1 ) . \n the patient retrospectively reported symptoms of intermittent chest discomfort for 5 months prior to catheterization . on admission , \n the patient looked well and his physical examination and laboratory results did not reveal any abnormalities . \n accordingly ptca was performed at 9 years and 6 months after the onset of illness . \n the procedure employed a 3.5 mm balloon catheter in the stenotic lesion of the proximal portion of the left circumflex . \n the balloon was then inflated with diluted contrast medium to a pressure of 10 atm . \n the area of stenosis was 80% before ptca and there was no residual stenosis after ptca ( figure 2 ) . \n the ivus imaging revealed a calcified lesion and atheroma at the site of the left circumflex coronary artery ( figure 3 ) . \n . fifteen to twenty percent of cases develop more severe complications including coronary aneurysms , ischemic cardiac disease , and sudden cardiac death . \n us epidemiologic studies of kd demonstrate the peak incidence of disease to be at 18 to 24 months of age , with children 5 years of age accounting for approximately 80% to 85% of cases . \n surveys conducted in the study indicate that the male - to - female ratio is 1.3 - 1.5:1 in kd , whereas the male - to - female ratio is 4:1 in their study of the hemodynamic and coronary angiographic findings in children with kd with obstructive coronary lesions8 ) . \n the major long - term concerns of kd are the development of coronary artery lesions that may manifest as aneurismal lesions , thrombotic occlusions with progression to ischemic heart disease , and the development of premature arteriosclerosis5 - 7 ) . \n currently , with appropriate medical management ( immunoglobulins and salicylates ) , about 4% of children with kd eventually develop ischemic heart disease , which is often associated with calcified stenosis during long - term follow up3,6,9 ) . \n since the disease was first described by kawasaki in 1967 , the mortality rate has decreased attributable , in large part , to the development of advanced diagnostic methods and treatment6 ) . \n however , coronary artery aneurysm , a serious complication of kd , has remained a leading cause of acquired heart disease in children10 ) . \n kato and colleagues3 ) have reported the results of serial coronary angiography to clarify the fate of coronary aneurysms . \n serial angiographic follow - up of kd patients has indicated that approximately 50% of 42 patients with coronary artery abnormalities showed resolution 5 to 18 months later , with giant aneurysms ( defined as 8 mm in diameter ) the least likely to regress and most likely to progress to stenosis8 ) . \n the regression in coronary aneurysms was recognized within one or two years after onset ; however , half of the patients with regressed coronary aneurysms continued to demonstrate a dense or bright echo in the coronary artery wall on a 2d - echocardiography6 ) . \n one possibility is acute occlusion by massive thrombus formation in the coronary aneurysm , which occurs mostly in acute or subacute stages of illness . \n another mechanism of coronary artery stenosis in kd may be the progression of marked thickening of the intima often associated with calcification , which is similar to an arteriosclerotic lesion11,12 ) . \n the risk factors for progression to ischemic heart disease are giant aneurysm ( diameter of more than 8 mm ) , a saccular aneurysm shape , prolonged fever for more than 21 days , and age at onset of less than 2 years13 ) . \n interventions such as ptca , atherectomy , or stent implantation are now common treatments for adults with coronary artery disease14,15 ) \n in particular , ptca is not as effective in kd patients as in others because the stenotic lesions in long - term kd are stiff and often associated with calcification . \n aortocoronary bypass surgery is the standard therapy for severe stenosis of coronary arteries with lesions that form as a result of kd1,2,16 - 18 ) . \n bypass surgery is indicated in cases with multiple vessel lesions , cases with severe valvular disease , and cases with severe left ventricular dysfunction19 ) . \n the long - term patency of bypass grafts is satisfactory in older patients but remains unsatisfactory in young children with kd . \n therefore , ptca should be considered in young children to postpone bypass surgery until patients are of sufficient age and size , so that the bypass grafts are likely to maintain satisfactory long - term patency . \n recent advances in intravascular ultrasound ( ivus ) imaging have allowed pathological evaluation of the vascular wall structure of coronary stenosis12,20 ) . recently \n ino and colleagues4 ) reported that the only predictor of successful ptca seemed to be the elapsed time from the onset of kd to the performance of ptca : ptca performed within 6 to 8 years after onset of the disease is more likely to lead to successful dilatation , which means that stenotic lesions may develop arteriosclerotic changes in the long term . \n factors such as age at onset , lesion site , sex , clinical symptoms , and presence or absence of a perfusion defect on a thallium scintiscan did not appear to affect outcome of ptca . \n our successful attempt may indicate that this procedure should be considered early in subclinical stenosis to prevent ischemic cardiac damage . \n we suggest that ptca may successfully dilate stenotic coronary arteries that have relatively soft intima with only localized mild calcification . \n ivus is useful in the assessment of wall morphology and tissue characterization of the pathological coronary artery as well as in the selection of the best device for interventional treatment . \n a catheter intervention for coronary artery stenotic lesions in kd demonstrated significant therapeutic effects in the short term . \n intervention with a catheter is a promising therapeutic strategy in the management of coronary stenosis caused by kd . \n however , the long - term efficacy of a catheter intervention for kd is unclear . to verify these findings , more long - term follow - up \n care should be paid to avoid acute coronary arterial complications and the development of new coronary aneurysms . \n based on the successful of ptca reported here , we recommend that the procedure should be considered early in subclinical stenosis to prevent ischemic cardiac damage .", "role": "user" }, { "content": "kawasaki disease ( kd ) is an acute , febrile , multisystem disease of children . \n more severe complications in 15~25% of cases include , the development of coronary aneurysms , ischemic heart disease , and sudden cardiac death . \n the standard treatment for significant coronary artery stenosis has generally been aortocoronary bypass surgery , although percutaneous transluminal coronary angioplasty ( ptca ) has been described in a small number of patients . \n this report describes a 14 year old boy with a history of kd who developed multiple coronary aneurysms and stenosis . \n we performed ptca , which was successful in relieving the stenosis of the left circumflex artery .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: an infant weighing 2.91 kg was born at a gestational age of 38 + 0 weeks . \n prenatal echocardiography revealed pulmonary atresia ( pa ) with ventricular septal defect ( vsd ) and major aortopulmonary collateral arteries ( mapcas ) . \n echocardiography performed immediately after birth revealed a disconnected left pulmonary artery supplied by the left patent ductus arteriosus ( pda ) , originating from the left innominate artery , in addition to the abovementioned findings . on the computed tomography ( ct ) performed 1 day after birth , a diminutive central right pulmonary artery ( rpa ) , a disconnected left pulmonary artery supplied by the left pda , and 2 mapcas from the proximal descending thoracic aorta were observed ( fig . \n c ) . we decided to allow the diminutive rpa to grow and delay the reconstruction of the central pulmonary artery until the rpa was large enough to be reliably enlarged surgically . \n as the first intervention , a stent was placed in the left pda at 26 days of age . on follow - up ct scan , severe narrowing of the pda just proximal to the stent \n was observed and the rpa was found to be still diminutive ( diameter < 1.5 mm ) ( fig . \n a central shunt was placed through a midline sternotomy with a method introduced by gates et al . in 1998 . \n subsequently , a stent was reinserted into the proximal pda with the stent - in - stent approach in the catheterization laboratory . \n the hospital course was uncomplicated , and the patient was discharged with prescriptions for warfarin , captopril , and diuretics at 65 days of age . \n the level of brain natriuretic peptide at discharge was 510 pg / ml . at 5 months of age \n , a follow - up angiography and ct scan revealed that the left pulmonary artery had grown to a sufficient size with normal arborization and that the intrapericardial rpa had grown to 3.5 mm in diameter . \n two mapcas ( c1 with communication and c2 without communication ) were also identified , originating from the proximal descending aorta ( fig . \n surgical correction was planned ; whether or not to proceed the intracardiac repair would be decided in the operating theater , depending on the result of the intraoperative pulmonary blood flow study after the reconstruction of the central pulmonary artery . \n the patient s age and weight at corrective surgery were 8 months and 7.9 kg , respectively . \n after sternal reentry , sufficient fresh autologous pericardium was harvested for reconstruction of the central pulmonary artery . at first \n , central pulmonary artery reconstruction was performed under moderate hypothermic cardiopulmonary bypass and beating heart following ligation of the left pda and division of the central shunt . \n a central left pulmonary artery was created by using an autologous pericardial roll , and the central rpa was reconstructed with unifocalization of the mapca ( c2 ) and patch widening with fresh autologous pericardium ( fig . \n arrest with cold blood cardioplegia and normal ventilation , an intraoperative pulmonary blood flow study was performed by cannulating the reconstructed central pulmonary artery at a flow rate of 0.5 l/(min m ) , increased incrementally up to 2.5 l/(min m ) . \n since the mean pulmonary artery pressure was 27 mmhg at a rate of 2.5 l/(min m ) , we decided to close the vsd and establish the connection between the right ventricle ( rv ) and pulmonary artery . \n the connection between the rv and pulmonary artery was established with a homemade gore - tex membrane valved conduit , and the patent foramen ovale was left open . \n after separation from the bypass and completion of the modified ultra - filtration , the rv systolic pressure was 28 mmhg and the rv systolic pressure to systemic blood pressure ratio was 0.35 . \n for the mapca ( c1 with communication ) that was not identified in the operating room , it was decided that interventional closure in the catheterization laboratory would be performed in the short term . \n the hospital course was uneventful , and the patient was discharged at 13 days after the surgery with a prescription for captopril . \n the level of brain natriuretic peptide at discharge was 87 pg / ml . at 3 months after the repair , occlusion of the residual mapca ( c1 ) \n one month later , surgical occlusion of the residual mapca ( c1 ) and concomitant unifocalization of the newly identified small mapca ( c3 ) were performed through left thoracotomy . \n the follow - up ct scan obtained before discharge showed that the residual mapca disappeared and the reconstructed central pulmonary was widely patent ( fig \n c ) . the brain natriuretic peptide level at 3 months after the last surgery was 41 pg / ml . \n the latest follow - up echocardiogram ( 6 months after the operation ) revealed no residual intracardiac shunt , a wide patent rv outflow tract , no pulmonary regurgitation , no evidence of rv hypertension , and excellent function of both ventricles . at the latest follow - up ( 7 months after the operation ) , \n the patient was in new york heart association functional class 1 without cardiac medication and had normal symmetric pulmonary vascularity on chest radiography ( fig . \n two - thirds of the patients with pa are in association with mapca , and the survival rate in these cases is as low as 50% at 1 year of age and 8% at 10 years of age without surgery . the management of pa with vsd and mapcas involves a multidisciplinary team approach that often requires repeated procedures , especially for those at the worst end of the spectrum . the most crucial prerequisite for successful repair of pa with vsd and mapca is a well - prepared pulmonary artery , that is , a single - compartment , unobstructed , and low - pressure pulmonary circulation . although the central rpa was diminutive in our case , we could grow it with a central shunt , which was first introduced by gates et al . . \n in case of conducting as hunt a nastomosis to the middle of a diminutive rpa , the shunt flow may be insufficient or blocked due to poor distal runoff , and therefore the rpa could not grow \n . it will be more effective for growth of the branch rpa to anastomose the graft to the main pulmonary artery as close as possible to the ventriculoarterial junction rather than the rpa . \n for the disconnected left pulmonary artery supplied by pda , central left pulmonary artery reconstruction should have required non - vascular material , which would not guarantee its durability , and it was also difficult to establish a systemic - to - pulmonary artery shunt due to the uncertainty of the exact extent of the ductal tissue . \n although tight narrowing occurred in the uncovered ductus , this can be effectively addressed with a stent - in - stent approach . in patients with pa with vsd and mapca , the preoperative decision on a plan for intracardiac repair \n is always difficult due to the uncertainty about the unobstructed reconstruction of the central pa and the lack of predictability for post - repair rv pressure , which is known to be a major factor affecting long - term outcome . \n . demonstrated that an intraoperative pulmonary blood flow study is better than preoperative anatomy in predicting rv pressure and physiological tolerance after intracardiac repair . \n likewise , it was very useful in our case to predict post - bypass rv systolic pressure following central pa reconstruction and intracardiac repair . \n since the patient underwent 5 ct scans within a year , the radiation dosage was a concern for this growing young infant . \n however , the total dosage of radiation exposure during one year was 2.28 msv , which is less than annual background radiation . \n this should be attributed to an effort by our radiologist to reduce the radiation exposure by applying a delicately designed and individualized ct protocol to this small child . even though this child had undergone many non - invasive and invasive studies with 3 catheter interventions and 3 surgical operations in his short lifetime \n a lesson learned from our case is that a multidisciplinary and proactive approach is the key to success in treating patients with pa with vsd and mapcas .", "role": "user" }, { "content": "a multistage plan and multidisciplinary approach are the keys to successful repair in patients with pulmonary atresia ( pa ) with ventricular septal defect ( vsd ) and major aortopulmonary collateral arteries ( mapcas ) . in this article \n , we present a multidisciplinary approach adopted to treat a patient with pa with vsd and mapcas associated with left pulmonary artery interruption .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: tissue - specific transcription factors play a pivotal role in regulating expression of tissue - specific genes , thereby controlling the function , homeostasis , and differentiation of tissue where they are expressed . \n their altered expression due to gene mutation , deletion , amplification , and/or epigenetic modification , and/or posttranslational modification can change the cell fate and perturb metabolism and differentiation status , leading to various clinical conditions . \n since both cell proliferation and differentiation are involved in the process of normal and cancer development , it is not surprising that genes critical for development play an important role in oncogenesis . transcription factors , containing the homeobox [ 1 , 2 ] , forkhead domain ( fox ) , and paired domain ( pax ) , that are among those expressed tissue - specifically that play a critical role in tissue homeostasis and development , can also have roles in carcinogenesis . \n thyroid is an organ in which the homeodomain , forkhead domain , and paired domain - containing transcription factors all play major roles in tissue - specific gene expression and thyroid development . \n the current view on the roles of thyroid - specific transcription factors in thyroid cancer will be summarized below . \n the three distinct thyroid - specific transcription factors are critical for the function of thyroid : nkx2 - 1 ( also called ttf1 , titf1 , t / ebp , or nkx2.1 ) [ 5 , 6 ] , foxe1 ( also called ttf2 or titf2 ) , and pax8 ( table 1 ) . \n they are members of the homeodomain , forkhead box , and paired box family of transcription factors , respectively , and regulate genes encoding thyroglobulin , thyroid peroxidase , thyrotropin receptor , and sodium / iodide symporter , proteins critical for thyroid hormone synthesis [ 57 , 914 ] . \n they are also essential for thyroid development [ 1517 ] ; nkx2 - 1-null mice are born without the thyroid ( agenesis ) , while pax8-null mice are severely hypothyroidism with rudimental thyroid remnant . \n these transcription factors are responsible for the athyreosis , hypothyroidism , and/or ectopic thyroid , which provide crucial clues to their roles in thyroid dysgenesis in humans . in addition to thyroid , nkx2 - 1 \n is expressed in lung primordium and ventral forebrain , pax8 in developing kidney , and foxe1 in the floor of the foregut and the craniopharyngeal ectoderm including rathke 's pouch during development . at later stages , \n foxe1 is expressed in the secondary palate , definitive choanae , whiskers , and hair follicles . \n thus , nkx2 - 1-null mice also have severely hypoplastic lung , defective hypothalamus , and pituitary agenesis . \n similar to the defects found in the nkx2 - 1-null mice and sometimes more manifested in humans , various mutations in the nkx2 - 1 gene result in the brain - thyroid - lung syndrome , which is characterized by benign hereditary chorea , congenital hypothyroidism , and respiratory diseases [ 2022 ] . \n mutations in the foxe1 gene are responsible for syndromic congenital hypothyroidism dysgenesis , cleft plate , and spiky hair [ 2224 ] . due to the nature of tissue - specific expression , nkx2 - 1 is expressed in human thyroid and lung cancers [ 2528 ] . in particular , nkx2 - 1 is highly expressed in human lung adenocarcinomas and small cell carcinomas ( ~6090% ) [ 25 , 26 , 29 ] . \n nkx2 - 1 has been widely used as a marker for the diagnosis of primary and metastatic lung cancer and as a prognostic indicator for survival [ 26 , 31 , 32 ] . \n in fact , nkx2 - 1 is a lineage - specific oncogene amplified in lung cancers and the survival of a subset of adenocarcinoma cells depends on the sustained expression of nkx2 - 1 [ 3335 ] . \n however , no mutations in the nkx2 - 1 gene are described in any adenocarcinomas examined in these studies . \n patients with adenocarcinomas that lack nkx2 - 1 expression or have nkx2 - 1 expression accompanied by nkx2 - 1 gene amplification tend to have a significantly worse prognosis than patients with nkx2 - 1 expression and no nkx2 - 1 gene amplification . \n in contrast to the expression in lung , nkx2 - 1 is expressed at lower levels in malignant thyroid as compared to normal thyroid . \n the level of expression is significantly correlated with the progressive dedifferentiation and increase of malignancy of thyroid tumors . \n thus , the expression is generally found in the order of follicular thyroid adenoma > follicular thyroid carcinoma > papillary thyroid carcinoma > medullary thyroid carcinoma > anaplastic thyroid carcinoma [ 27 , 3739 ] . \n these studies use immunohistochemical analysis of primary thyroid tissues , and low or no expression of nkx2 - 1 is found in anaplastic thyroid carcinomas . using rt - pcr , nkx2 - 1 expression \n is reported in some anaplastic thyroid carcinoma - derived cell lines [ 40 , 41 ] . \n the latter studies present different results for the expression of nkx2 - 1 within the same cell line , suggesting the controversial nature of nkx2 - 1 expression . in order to explain the loss of nkx2 - 1 expression in most of undifferentiated thyroid carcinomas and cell lines , epigenetic silencing of the nkx2 - 1 gene through dna hypermethylation and \n further studies are required to obtain clear understanding of the relationships in between expression of nkx2 - 1 , differentiation status of tissues and primary carcinomas versus cell lines , and the mechanisms underlying the loss of nkx2 - 1 expression in malignancy . a genome - wide association study ( gwas ) revealed the predisposition of common variants on 9q22.33 and 14q13.3 to both papillary and follicular thyroid cancers . \n the gene nearest to the 9q22.33 is foxe1 , and among the genes located at the 14q13.3 locus is nkx2 - 1 , suggesting potential roles for these two thyroid - specific transcription factors in thyroid cancers . \n a germline mutation of nkx2 - 1 gene leads to a mutant nkx2 - 1 protein ( a339v ) that has impaired transactivation of thyroid - specific genes such as thyroglobulin , thyrotropin receptor , and pax8 , while the expression is associated with the increased cell proliferation , thyrotropin - independent growth , and enhanced activation of survival signaling molecules such as stat3 and akt as compared to wild - type protein . \n a population study demonstrated that the nkx2 - 1 a339v mutant contributes to predisposition of maltinodular goiter and/or papillary thyroid carcinomas and to the pathogenesis of papillary thyroid carcinomas . \n nkx2 - 1(fl / fl);tpo - cre thyroid - specific conditional knockout mouse provides an animal model to study the role of nkx2 - 1 in adult thyroid , which circumvents the problem of immediate neonatal lethality of nkx2 - 1-null mouse . in the nkx2 - 1(fl / fl);tpo - cre mouse , \n the recombination of nkx2 - 1 floxed gene occurs at the rate of ~50% , resulting in nkx2 - 1 thyroid - specific conditional hypomorphic mouse . \n these mice exhibit either atrophic / degenerative thyroids with frequent presence of adenomas and extremely high tsh levels , or thyroids with reduced numbers of extremely dilated follicles having more number of follicular cells than usual within a follicle . \n the atrophic / degenerative thyroid mostly consists of atrophic / degenerative follicles , in which many follicular cells frequently have lost nkx2 - 1 expression , suggesting that the loss of nkx2 - 1 may be the cause of atrophic / degenerative follicular cells . \n these findings further suggest that nkx2 - 1 is required for the maintenance of ordered architecture and function of the differentiated thyroid . in chemical carcinogenesis bioassays using the genotoxic mutagen n - bis(2-hydroxypropyl)-nitrosamine ( dhpn ) followed by sulfadimethoxine ( sdm ) as a promoter , the nkx2 - 1(fl / fl);tpo - cre mice developed significantly higher incidence of adenomas as compared with wild - type or nkx2 - 1-heterozygous mice . \n in contrast , with the non - genotoxic carcinogen amitrole ( 3-amino-1,2,4-triazole ) , all three genotype groups of mice developed adenomas at similar incidence . \n the increased incidence of adenomas in the nkx2 - 1(fl / fl);tpo - cre mice after genotoxic carcinogen exposure may be partially explained by more than a twofold higher cell proliferation rate found in these mouse thyroids as compared to those of wild - type or nkx2 - 1-heterozygous mice . \n these results may be analogous to human exposure to genotoxic mutagens or radiation , which could cause somatic mutation of nkx2 - 1 gene inactivation of nkx2 - 1 gene degeneration of thyroid follicular cells increased cell proliferation augmentation of the damage occurred in dna , and/or chromosomes by genotoxic mutagens or radiation exposure , ultimately leading to cancer . \n the loss of heterozygosity of marker d9s180 from this chromosomal area is frequently observed in squamous cell carcinomas of skin , suggesting the presence of tumor suppressor gene in this genomic region . \n the common variant rs965513 on 9q22.33 contributes to an increased risk of papillary and follicular thyroid cancer . \n further , a high incidence of foxe1 gene promoter methylation is found in cutaneous squamous cell carinomas ( scc ) , pancreatic cancers , and breast cancers . \n foxe1 protein has a polyalanine tract starting at the 13th amino acid residue from the end of the forkhead domain , which stretches from 12 to 17 residues with the 14 alanine stretch at the highest frequency . the less common variant ( allele 16 ) is associated with scc , suggesting that the more common variant ( allele 14 ) may be protective against developing scc . similar to nkx2 - 1 , foxe1 expression is found in various thyroid cancers [ 38 , 53 ] . \n the level of expression correlates with their differentiation status as seen with nkx2 - 1 , and anaplastic thyroid carcinoma has very little expression of foxe1 [ 38 , 53 ] . \n the candidate gene association study revealed that the variant rs1867277 ( 283 g > a ) located in the foxe1 5 utr is associated with papillary thyroid cancer susceptibility through recruitment of usf1/usf2 transcription factors to the 283a allele , which affects gene expression . \n foxe1 is required for thyroid cell precursors to migrate into the underlying mesenchyme from the thyroid bud [ 15 , 55 ] . \n although the exact mechanism for the enhanced transcription of foxe1 gene leading to increased susceptibility to papillary thyroid cancer remains unknown , the enhanced expression of foxe1 in thyroid carcinomas could be related to a motile advantage of malignant thyroid cells . \n radiation exposure causes papillary thyroid cancer as revealed by various studies after the chernobyl accident . \n genome - wide association studies ( gwas ) employing belarusian patients and control subjects demonstrated that the variant rs965513 on 9q22.33 is significantly associated with the radiation - induced papillary thyroid cancer . this variant was identified together with nkx2 - 1 , as those having the strongest rink to papillary and follicular thyroid cancers . \n although foxe1 thyroid conditional null mice are currently not available , they would be a useful model to understand the role of foxe1 in the pathogenesis of thyroid cancer . \n pax8 is a crucial transcription factor for organogenesis of the thyroid , kidney , and mllerian system [ 8 , 58 ] . \n pax8 is expressed in normal as well as neoplastic renal tissues , and in wilms ' tumors [ 58 , 59 ] . \n pax8 is a useful marker for mllerian carcinomas and ovarian cancer [ 61 , 62 ] and can be used to distinguish ovarian serous tumors from malignant mesothelioma [ 6164 ] or from other metastatic tumors such as breast and colon [ 63 , 64 ] . \n pax8 is expressed in various thyroid cancers ; however , the pattern of expression is somewhat controversial ; one study showed that the nuclear pax8 staining is correlated with the thyroid differentiation phenotype as seen with nkx2 - 1 and foxe1 , while others demonstrated that pax8 is a useful marker for the diagnosis of anaplastic carcinomas . \n more studies are required to determine the expression pattern and the role of pax8 in thyroid cancers , including the use of pax8 thyroid - conditional null mice . \n the chromosomal translocation of the 2q13-qter region to 3p25 results in an in - frame fusion protein ( ppfp ) between most of the coding sequence of pax8 and the entire translated reading - frame of the nuclear receptor - family member peroxisome proliferator - activated receptor gamma ( ppar ) ( reviewed in [ 66 , 67 ] ) . \n the ppfp has several different pax8 breakpoints while the ppar breakpoint seems to be constant [ 65 , 67 , 68 ] . \n this fusion protein is more prevalently expressed in follicular thyroid carcinomas ( 36% , reviewed in ) ; however , follicular adenomas ( 11% ) , follicular variant of papillary carcinoma ( 16% ) , and hrthle cell carcinoma ( 2% ) also express ppfp [ 6870 ] . \n ppfp has been proposed to be an early follicular thyroid carcinoma - specific oncogene [ 65 , 71 ] . \n several in vitro studies demonstrated that ppfp has oncogenic activity such as increased cell cycle transition , reduced apoptosis , and enhanced growth , which is partly due to ppfp 's dominant negative activity to suppress wild - type transcriptional activities of ppar [ 65 , 71 , 72 ] , the suggested tumor suppressor [ 73 , 74 ] . \n ppfp can also work as a dominant negative inhibitor of wild - type ppar in vivo . \n normal embryogenesis is believed to share many of the same pathways as neoplasia , such as wnt/-catenin , hedgehog , and notch pathways . \n these signaling pathways are also involved in the maintenance and/or activity of stem cells , while their dysregulation plays a role in tumorigenesis ( reviewed in [ 7680 ] ) . \n it is increasingly recognized that homeobox proteins including pax proteins play a critical role in stem cell maintenance [ 4 , 81 ] . \n pax3 or pax7 is essential for generating the cell pool of muscle progenitors from which satellite cells derive . \n overexpression of pax3 and 7 is frequently found in pediatric soft - tissue malignant tumor rhabdomyosarcomas [ 83 , 84 ] . \n pax6 is essential for maintenance of the multipotency of retinal progenitor cells . on the other hand , \n hox genes are expressed in hematopoietic cells in a stage- and lineage - specific manner , and are implicated in leukemogenesis ; for instance , hoxa10 is a critical regulator for haematopoietic stem cells , and erythroid and megakaryocyte development , while hoxa9 is required for normal hematopoietic stem cell function . \n the involvements of other homeobox genes in the maintenance of stem cells are described in various tissues including brain and kidney . in the prostate , nkx3 - 1 , another member of the nkx gene family , \n the targeted deletion of pten , a tumor suppressor gene in castration - resistant nkx3 - 1-expressing cells , results in rapid carcinoma formation after androgen - mediated regeneration . \n the three transcription factors , nkx2 - 1 , foxe1 , and pax8 , are critical for normal embryogenesis and appear to play a role in tumorigenesis in various tissues where they are expressed , including the thyroid . by analogy to other homeodomain / pax proteins , \n it is likely that nkx2 - 1 and pax8 may be involved in the maintenance and/or activity of stem cells in the thyroid , dysregulation of which may lead to thyroid cancer ( figure 1 ) . \n currently , it is not clear whether fox transcription factors are involved in stem cell maintenance / activity . \n knockout mouse studies demonstrated that in the absence of nkx2 - 1 , primordium cells to both thyroid follicular and c cells disintegrate during thyroid organogenesis [ 16 , 91 ] , while pax8 is required for the survival of follicular cells . \n it would be interesting to determine whether nkx2 - 1 and/or pax8-expressing stem / progenitor cells exist that can rapidly form cancers upon targeted disruption of a tumor suppressor gene in cell pools , similar to that seen with nkx3 - 1 . in this \n regard , nkx2 - 1 in lung cancers may be more analogous to this scenario since nkx2 - 1 is a lineage - specific oncogene and is required for survival of a subset of adenocarcinoma cells [ 3335 ] . \n it appears that most transcription factors , if not all , that are critical for developmental process are involved in the maintenance and/or activity of stem cells , whose dysregulation results in cancers . \n currently , it is entirely unknown whether and/or how the thyroid - specific transcription factors nkx2 - 1 , foxe1 , and pax8 are related to stem / progenitor cells of the thyroid that may lead to cancer when dysregulated . \n identification / characterization of thyroid stem / progenitor cells , their relation to the expression of nkx2 - 1 , foxe1 , and/or pax8 , and more detailed characterization of various thyroid cancers and/or cancer cells , particularly in relation to the expression of these transcription factors , are urgently required in order to better understand the roles of nkx2 - 1 , foxe1 , and pax8 in thyroid cancer .", "role": "user" }, { "content": "homeodomain , forkhead domain , and paired domain - containing transcription factors play a major role in development , tissue - specific gene expression , and tissue homeostasis in organs where they are expressed . \n recently , their roles in stem cell and cancer biology are emerging . in the thyroid , nkx2 - 1 , foxe1 , and pax8 transcription factors \n are responsible for thyroid organogenesis and expression of thyroid - specific genes critical for thyroid hormone synthesis . \n in contrast to their known roles in gene regulation , thyroid development and homeostasis , their involvement in stem cell , and/or cancer biology are still elusive . in order to further understand the nature of thyroid cancer , \n it is critical to determine their roles in thyroid cancer .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: phacoemulsification and recent advances in cataract surgery techniques led to improved postoperative outcomes . nowadays , along with the improvement in biometry and corneal topography in preoperative examination , patients presenting with cataract can be diagnosed with corneal ectasias , i.e. keratoconus ( kc ) or pellucid macular degeneration ( pmd ) , a diagnosis that was difficult to be confirmed before . \n kc is a relatively common , noninflammatory , progressive disorder of unknown etiology , characterized by steepening of the cornea and corneal ectasia , concluding in cone - shaped protrusion of the cornea . \n it is considered to involve each layer of the cornea and often leads to high myopia and high astigmatism . \n kc patients usually present in their teenage years or twenties , complaining of progressive visual blur and distortion secondary to myopia and high astigmatism . \n pmd is an idiopathic , noninflammatory corneal thinning disorder , characterized by an inferior band of corneal thinning with ectasia of the cornea in and around the thinned area and is associated with significant irregular myopic astigmatism . \n nevertheless , mild cases of kc or pmd may remain undiagnosed until patients are examined for the presence of cataract . \n pmd and kc treatment may differ according to the stage of the disease , but spectacles or rigid gas - permeable contact lenses are tried initially in kc or pmd eyes , especially in the early to moderate stages . \n additionally , several treatment modalities have been used for patients with kc or pmd , including lamellar keratoplasty , penetrating keratoplasty , intrastromal corneal ring segments , corneal collagen cross - linking or phakic intraocular lens ( iol ) implantation , depending on patients age [ 3 , 5 , 6 , 7 , 8 , 9 ] . \n some authors have also used excimer laser in patients with kc , but the safety of this procedure remains controversial . \n interestingly enough , toric iols have been considered to provide an opportunity to achieve the best distance visual acuity and spectacle independence in cataract patients with high corneal astigmatism , but few reports have been published about toric iols in cataract patients with kc or pmd [ 11 , 12 , 13 , 14 , 15 , 16 , 17 ] . in light of this , our purpose was to examine the efficacy of toric iol implantation in cataract patients with high astigmatism due to kc or pmd . \n three cataract patients with kc and pmd ( 5 eyes ) are presented , in which phacoemulsification with toric iol implantation was used to correct high astigmatism , comparing refraction ( objective and subjective ) , visual acuity and corneal topography before and after cataract surgery in a long - term follow - up of 1828 months . \n a 57-year - old woman presented to our ophthalmology outpatient clinic with a gradually decreased visual acuity in both eyes because of posterior subcapsular cataract . on presentation , \n best spectacle - corrected visual acuity ( bcva ) was 2/10 in the right eye and 4/10 in the left eye , with 3.75 3.50 165 and 1.00 3.50 6 subjective refraction in the right and left eye , respectively . \n automated refractometry showed 4.75 4.25 164 with k1 44.00 at 180 and k2 46.5 at 90 in the right eye and 10.75 5.00 5 with k1 46.00 at 179 and k2 49.75 at 89 in the left eye \n . corneal topography was performed using orbscan ( bausch and lomb inc . , rochester , n.y . , usa ) and revealed a central corneal thickness of 533 mm and an inferior temporal displacement of the thinnest point ( 512 mm ) , indicative of kc in both eyes ( fig . \n keratometry ( k ) values for the steep and flat axis were 47.25 d at 86 and 44.00 d at 176 , respectively , in the right eye , and 49.8 d at 84 and 45.6 d at 174 , respectively , in the left eye . \n it is important to mention that kc was stable in this patient for the last 2 years , which had been confirmed by previous corneal topographies . \n biometry was performed with the iol master ( carl zeiss meditec , jena , germany ) to calculate the iol power for emmetropia using the sanders - retzlaff - kraff theoretical ( srk / t ) formula . \n a web - based toric iol calculator program was used to determine the optimal cylinder power and alignment axis of the iol ( available at http://www.acrysoftoriccalculator.com ) ( fig . \n 1c ) . a standard phacoemulsification with toric iol implantation ( acrysof sn60t7 alcon , ltd . , \n usa ) , with a spherical power of 19.5 d and a cylinder power of 4.50 d at the iol plane aligned at 84 , was performed in the right eye . in the left eye , a toric iol ( acrysof sn60t8 ) with a spherical power of 16.0 d and a cylinder power of 5.25 d at the iol plane , \n postoperatively , the bcva was 9/10 with 0.50 sph in the right eye and 8/10 with 1.50 sph in the left eye , which remained stable at the 18-month and 24-month follow - up for the right and left eye , respectively . \n corneal topography remained almost stable , with k values for the steep and flat axis of 47.5 d at 90 and 43.7 d at 180 , respectively , in the right eye , and 50.0 d at 94 and 46.0 d at 4 , respectively , in the left eye . the toric iol alignment axis , as determined by slit - lamp biomicroscopy , remained at the same degrees at the end of the follow - up for both eyes ( fig . \n 1d ) . a 72-year - old woman presented to our outpatient clinic with decreased visual acuity in both eyes . \n the bcva was 4/10 in both eyes with + 1.00 4.25 90 and + 1.00 5.00 91 in the right and left eye , respectively . \n automated refractometry showed + 1.50 5.25 106 with k1 40.25 at 92 and k2 54.75 at 2 in the right eye and 8.0 98 with k1 41.75 at 106 and k2 49.50 at 16 in the left eye . \n 2a , b ) , which had been known and stable for the last 3 years . \n k values for the steep and flat axis were 39.28 d at 93 and 54.7 d at 3 , respectively , in the right eye , and 39.7 d at 106 and 48.3 d at 16 , respectively , in the left eye . \n a standard phacoemulsification with toric iol was performed in both eyes . in the right eye , a toric iol ( acrysof sn60t9 ) with a spherical power of 9.5 d and a cylinder power of 6.00 d at the iol plane \n was implanted at an axis of 3. in the left eye , a toric iol ( acrysof sn60t9 ) with a spherical power of 16.5 d and a cylinder power of 6.0 d at the iol plane was implanted at 14. postoperatively , the bcva was 7/10 with 2.50 80 in the right eye and 8/10 with 1.50 100 in the left eye , which remained stable at the 24- and 28-month follow - up for the right and left eye , respectively . \n corneal topography remained almost stable , with k values for the steep and flat axis of 53.3 d at 180 and 38.5 d at 90 , respectively , in the right eye , and 48.6 d at 15 and 39.9 d at 105 , respectively , in the left eye . \n the toric iol alignment axis , as determined by slit - lamp biomicroscopy , was at 5 in the right eye and at 15 in the left eye ( fig . \n the patient was satisfied with the postoperative visual outcomes at the end of the follow - up . a 72-year - old man presented to our outpatient clinic with decreased visual acuity in the right eye due to cataract . \n the bcva was 3/10 with 2.00 2.00 60. automated refractometry showed 8.00 3.25 58 with k1 42.25 at 62 and k2 45.5 at 152 in the right eye . \n k values for the steep and flat axis were 47.3 d at 155 and 42.9 d at 65 , respectively . \n a standard phacoemulsification was performed and a toric iol ( acrysof sn60t5 ) with a spherical power of 15.5 d and a cylinder power of 3.00 d at the iol plane was implanted . \n postoperatively , the bcva was 9/10 with 0.50 0.50 73 in the right eye which remained stable in the 1-year follow - up . \n corneal topography remained almost stable , with k values for the steep and flat axis of 47.1 d at 155 and 42.8 d at 65 , respectively . \n the patient was satisfied with the postoperative visual outcomes at the 18-month follow - up . \n altogether , in all cases , there was a significant improvement in bcva , as well as in refraction , which remained stable over time , as illustrated in table 1 . \n specifically , in subjective refraction , all patients achieved bcva from 7/10 to 9/10 with up to 2.50 cyl . \n no iol misalignment or other complications occurred and all patients were satisfied by the postoperative outcome . written informed consent \n a 57-year - old woman presented to our ophthalmology outpatient clinic with a gradually decreased visual acuity in both eyes because of posterior subcapsular cataract . on presentation , \n best spectacle - corrected visual acuity ( bcva ) was 2/10 in the right eye and 4/10 in the left eye , with 3.75 3.50 165 and 1.00 3.50 6 subjective refraction in the right and left eye , respectively . \n automated refractometry showed 4.75 4.25 164 with k1 44.00 at 180 and k2 46.5 at 90 in the right eye and 10.75 5.00 5 with k1 46.00 at 179 and k2 49.75 at 89 in the left eye \n . corneal topography was performed using orbscan ( bausch and lomb inc . , rochester , n.y . , usa ) and revealed a central corneal thickness of 533 mm and an inferior temporal displacement of the thinnest point ( 512 mm ) , indicative of kc in both eyes ( fig . \n keratometry ( k ) values for the steep and flat axis were 47.25 d at 86 and 44.00 d at 176 , respectively , in the right eye , and 49.8 d at 84 and 45.6 d at 174 , respectively , in the left eye . \n it is important to mention that kc was stable in this patient for the last 2 years , which had been confirmed by previous corneal topographies . \n biometry was performed with the iol master ( carl zeiss meditec , jena , germany ) to calculate the iol power for emmetropia using the sanders - retzlaff - kraff theoretical ( srk / t ) formula . \n a web - based toric iol calculator program was used to determine the optimal cylinder power and alignment axis of the iol ( available at http://www.acrysoftoriccalculator.com ) ( fig . \n 1c ) . a standard phacoemulsification with toric iol implantation ( acrysof sn60t7 alcon , ltd . , \n usa ) , with a spherical power of 19.5 d and a cylinder power of 4.50 d at the iol plane aligned at 84 , was performed in the right eye . in the left eye , a toric iol ( acrysof sn60t8 ) with a spherical power of 16.0 d and a cylinder power of 5.25 d at the iol plane , \n postoperatively , the bcva was 9/10 with 0.50 sph in the right eye and 8/10 with 1.50 sph in the left eye , which remained stable at the 18-month and 24-month follow - up for the right and left eye , respectively . \n corneal topography remained almost stable , with k values for the steep and flat axis of 47.5 d at 90 and 43.7 d at 180 , respectively , in the right eye , and 50.0 d at 94 and 46.0 d at 4 , respectively , in the left eye . the toric iol alignment axis , as determined by slit - lamp biomicroscopy , remained at the same degrees at the end of the follow - up for both eyes ( fig . \n a 72-year - old woman presented to our outpatient clinic with decreased visual acuity in both eyes . \n the bcva was 4/10 in both eyes with + 1.00 4.25 90 and + 1.00 5.00 91 in the right and left eye , respectively . \n automated refractometry showed + 1.50 5.25 106 with k1 40.25 at 92 and k2 54.75 at 2 in the right eye and 8.0 98 with k1 41.75 at 106 and k2 49.50 at 16 in the left eye . \n 2a , b ) , which had been known and stable for the last 3 years . \n k values for the steep and flat axis were 39.28 d at 93 and 54.7 d at 3 , respectively , in the right eye , and 39.7 d at 106 and 48.3 d at 16 , respectively , in the left eye . \n a standard phacoemulsification with toric iol was performed in both eyes . in the right eye , a toric iol ( acrysof sn60t9 ) with a spherical power of 9.5 d and a cylinder power of 6.00 d at the iol plane \n was implanted at an axis of 3. in the left eye , a toric iol ( acrysof sn60t9 ) with a spherical power of 16.5 d and a cylinder power of 6.0 d at the iol plane was implanted at 14. postoperatively , the bcva was 7/10 with 2.50 80 in the right eye and 8/10 with 1.50 100 in the left eye , which remained stable at the 24- and 28-month follow - up for the right and left eye , respectively . \n corneal topography remained almost stable , with k values for the steep and flat axis of 53.3 d at 180 and 38.5 d at 90 , respectively , in the right eye , and 48.6 d at 15 and 39.9 d at 105 , respectively , in the left eye . \n the toric iol alignment axis , as determined by slit - lamp biomicroscopy , was at 5 in the right eye and at 15 in the left eye ( fig . \n the patient was satisfied with the postoperative visual outcomes at the end of the follow - up . \n a 72-year - old man presented to our outpatient clinic with decreased visual acuity in the right eye due to cataract . the bcva was 3/10 with 2.00 2.00 60. automated refractometry showed 8.00 3.25 58 with k1 42.25 at 62 and k2 45.5 at 152 in the right eye . \n k values for the steep and flat axis were 47.3 d at 155 and 42.9 d at 65 , respectively . \n a standard phacoemulsification was performed and a toric iol ( acrysof sn60t5 ) with a spherical power of 15.5 d and a cylinder power of 3.00 d at the iol plane was implanted . \n postoperatively , the bcva was 9/10 with 0.50 0.50 73 in the right eye which remained stable in the 1-year follow - up . \n corneal topography remained almost stable , with k values for the steep and flat axis of 47.1 d at 155 and 42.8 d at 65 , respectively . \n the patient was satisfied with the postoperative visual outcomes at the 18-month follow - up . \n altogether , in all cases , there was a significant improvement in bcva , as well as in refraction , which remained stable over time , as illustrated in table 1 . \n specifically , in subjective refraction , all patients achieved bcva from 7/10 to 9/10 with up to 2.50 cyl . \n no iol misalignment or other complications occurred and all patients were satisfied by the postoperative outcome . \n in this case series , we present 3 cases with cataract and high astigmatism due to nonprogressive kc ( 2 eyes ) or pmd ( 3 eyes ) , who underwent cataract extraction and toric iol implantation . \n the principal message is that all patients showed a marked improvement in bcva and subjective refraction , while corneal topography findings remained stable during the follow - up period of 1828 months . \n therefore , phacoemulsification with toric iol implantation seems to be an effective method in correcting high astigmatism in cataract patients with stable kc or pmd . \n although there are several new effective techniques to correct astigmatism due to kc or pmd , the correction of high astigmatism in cataract patients presenting with kc or pmd continues to be challenging . \n reduced visual acuity due to kc or pmd is initially managed with spectacles or contact lenses , either toric or rigid gas - permeable lenses , to mask the irregular astigmatism . \n intracorneal ring segments ( icrs ) have recently been approved for reduction of myopia and irregular astigmatism due to kc , improving objective visual outcomes and restoring functional vision [ 3 , 7 ] . \n nevertheless , icrs have been reported to present complications , such as epithelial defects , anterior and posterior perforations during channel creation , extension of incision toward the visual axis , shallow placement of implants , infectious keratitis , stromal thinning , epithelial breakdown , corneal melting or intrastromal deposits , and are not used as a primary treatment in cataract patients [ 3 , 7 ] . \n furthermore , after icrs implantation , high refractive errors may remain and most patients require spectacles or contact lenses again . on the other hand , \n phakic iols or artisan phakic iols were used for the correction of astigmatism in young patients with kc , providing encouraging results , although they could only be used in cases with stable kc [ 3 , 6 ] . \n an option in patients with kc and a clear natural lens is refractive lens exchange with a toric iol implantation in the capsular bag . \n in addition , corneal collagen cross - linking was used effectively to stabilize the biomechanically weakened collagen in kc ; however , this technique can only be used in young patients and its effect is not distributed homogenously over the corneal depth . \n interestingly , few cataract patients with kc or pmd and toric iol implantation for the correction of astigmatism have been reported [ 4 , 5 , 13 , 14 , 15 , 16 ] . \n cataract surgery with a toric iol implantation can be a suitable option to correct high levels of astigmatism and myopia in patients with kc if the risk of progression is minimal [ 4 , 18 , 19 ] . before implanting the toric iol , \n a careful history taking is needed to explore the level of bcva the patient had before cataract formation occurred and to determine whether signs of kc progression are present [ 18 , 19 ] . risk factors that have been associated with progression of kc include young age , a positive family history of kc , steep keratometric values at baseline , changes in refractive error and possibly eye rubbing . in practice \n , clinical findings and corneal topography abnormalities , such as a high central k value and an increased amount of steepening of the inferior cornea compared with the superior cornea , may be used to assess the risk of progression . because of the age of the 3 patients presented in our case series , we regarded the risk of progression to be minimal . \n acrysof toric iol is considered to be one of the most commonly used toric iol in cataract surgery . \n it has been found to be effective in the reduction of refractive astigmatism , providing good visual outcomes . \n the acrysof toric iol is available in cylinder powers up to 6.0 d ( sn60t9 ) at the iol plane , corresponding to 4.11 d at the corneal plane . \n it is hydrophobic acrylic with open - loop modified l - haptics and 6.0 mm optic diameter . \n the axis marks on the iol indicate the flat meridian of the toric component on the posterior surface of the iol . \n another challenge in cataract patients with kc or pmd with high astigmatism and myopia is iol power calculation . \n corneal topography is a valuable diagnostic tool for diagnosing subclinical kc , providing data for kc screening and progression of the disease , including anterior and posterior evaluation and best - fit sphere , corneal pachymetry , as well as k values . \n because of the irregular astigmatism in our patients , we used the k values and axis obtained with the orbscan and then compared them with those derived from the iol master , finding no significant differences . \n compared the srk ii and srk / t iol formulas in patients with kc and suggested that the srk ii formula might provide the most accurate iol power in patients with mild kc . however , in moderate and severe kc , iol calculations were less accurate and no differences in calculation formulas could be found . \n as far as the axis is concerned , we have not seen any iol rotation , in line with other studies suggesting that iol rotation is < 4 . \n a potential limitation pertains to the fact that the number of cases reported here is not adequate enough to prove the efficacy of this method for the correction of astigmatism in cataract patients with kc or pmd . \n moreover , one should take into account that the improvement in bcva derives not only from the correction of refractive astigmatism due to kc , but also from the removal of cataract . in conclusion \n , our case series suggests that phacoemulsification with toric iol implantation in cataract patients with stable kc or pmd seems to be effective in correcting high astigmatism and achieving optimal visual outcomes . \n additionally , orbscan is considered an accurate tool for obtaining k values , showing no significant differences compared to iol master . \n further studies with a larger sample size should be performed to confirm the long - term efficacy and stability of toric iol implantation in patients with cataract and a presumably stable kc or pmd . \n ", "role": "user" }, { "content": "our purpose was to examine the long - term efficacy of toric intraocular lens ( iol ) implantation in cataract patients with high astigmatism due to corneal ectasia , who underwent phacoemulsification cataract surgery . \n five eyes of 3 cataract patients with topographically stable keratoconus or pellucid macular degeneration ( pmd ) , in which phacoemulsification with toric iol implantation was used to correct high astigmatism , are reported . \n objective and subjective refraction , visual acuity measurement and corneal topography were performed in all cases before and after cataract surgery . in all cases \n , there was a significant improvement in visual acuity , as well as refraction , which remained stable over time . \n specifically , in subjective refraction , all patients achieved visual acuity from 7/10 to 9/10 with up to 2.50 cyl . \n corneal topography also remained stable . \n postoperative follow - up was 1828 months . \n cataract surgery with toric iol implantation seems to be safe and effective in correcting astigmatism and improving visual function in cataract patients with topographically stable keratoconus or pmd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: coronary artery disease ( cad ) is one of the major reasons of sudden death in all over the world . \n there are several risk factors for cad such as ; obesity , diabetes , smoking , inactive life or genetic . \n atherosclerosis is the underlying cause of the cad . besides , this can cause ischemia , and if continues for a long time , heart attacks can occur following the myocardial cell death . hence , \n the rate of detecting carotid stenosis as calcifications in general adult population is identified as 4% while this ratio is 3070% in a population with cad . \n calcifications are seen at bifurcation of the carotid artery and can be determined at the level of c3 , c4 , adjacent to cervical spine and hyoid bone as irregular radiopacity or radiopaque lines [ figure 1 ] . \n a panoramic radiograph of a 61-year - old man showing radio opacities in bilateral carotid vascularite areas there are several diagnostic methods that have been used to establish carotid artery calcification ( cacs ) . \n sonography computed tomography ( ct ) , magnetic resonance tomography , electronic thermography , and angiography can be considered among these methods . \n compared to these methods , panoramic radiographs ( dpr ) present a more economic and quick usage to examine calcifications of the carotid artery and also , dpr are carried out routinely in all patients . \n a number of studies reported the importance and possibilities of diagnosis of cacs on dpr . \n chronic periodontitis ( cp ) is a chronic infection which is caused by gram - negative bacteria may be induced the coronary heart disease , stroke , and atherosclerosis . \n periodontopathogen microorganisms such as porphyromonas gingivalis have been demonstrated in atherosclerotic plaques , and many studies reported an association between severe periodontal bone loss and carotid atherosclerosis . \n the aim of this study is to analyze the correlation between the presence of cacs and periodontitis on dpr retrospectively in a group of the nonsmoking population . \n further , the relationship between cacs and periodontal disease risk assessment was evaluated . according to our knowledge , \n this is the first study investigating the relationship between periodontal risk and cacs in nonsmoker subjects . \n a sample of 1850 radiographs of the outpatients who were being treated by the dental service at kirikkale university was examined . \n dpr which showed defects resulting from the imaging process of the area of interest , on which cervical vertebra regions were not visualized or which belonged to patients who has any reported systemic diseases were excluded from the study . in total , \n the presence of cacs , periodontal risk , and tooth loss were evaluated on these radiographs . \n apart from this , the patient - related data were produced from the selected panoramic pictures ( pr ) . among others , \n the prs had been made using a digital panoramic system ( instrumentarium op 200 d , 75 kvp , 10 ma , 17.6 s scan time , tuusula , finland ) . \n radiographs were examined by a dentomaxillofacial radiologist ( assistant professor ) . during the examination of these radiographs , \n twenty percent of the remaining radiographs were selected at random and twice reevaluated by the same investigator 4 weeks after the first evaluation . \n intra - examiner reproducibility was found to be 84.6% ( agreement for 93/104 sides ) . \n verticolinear oriented heterogeneous radiopacities at above or below intervertebral space c3c4 were identified as cacs . \n cacs were scored as present or absent , and dentomaxillofacial radiologist approved all the positive findings . \n percentage of bone loss was measured at the each tooth mesial and distal sides according to the method described by schei et al . the alveolar bone crest in relation to root length \n mesial and distal sides of each tooth were scored ; 1 , 024% bone loss ; 2 , 2549% bone loss ; and 3 , 50100% bone loss . \n besides , a single mean bone loss score was obtained for each participant as 1 , low periodontal risk ; 2 , moderate periodontal risk , and 3 , high periodontal risk . \n mean periodontal bone loss of 50% or above corresponds with a diagnosis of severe cp . \n spss for windows , version 18 ( spss inc . , chicago , illinois , usa ) was used to perform statistical analysis . \n for all of the variables , means and standard deviations were calculated and nonparametric tests were used . \n pearson chi - square test or fisher 's exact test were used to determine the potential differences in the distribution of categorized data . \n logistic regression was used to evaluate the odds ratio for relation between the dependent variable cac and periodontal risk among dentate subjects . the threshold for significance \n the prs had been made using a digital panoramic system ( instrumentarium op 200 d , 75 kvp , 10 ma , 17.6 s scan time , tuusula , finland ) . \n radiographs were examined by a dentomaxillofacial radiologist ( assistant professor ) . during the examination of these radiographs , \n twenty percent of the remaining radiographs were selected at random and twice reevaluated by the same investigator 4 weeks after the first evaluation . \n intra - examiner reproducibility was found to be 84.6% ( agreement for 93/104 sides ) . \n verticolinear oriented heterogeneous radiopacities at above or below intervertebral space c3c4 were identified as cacs . \n cacs were scored as present or absent , and dentomaxillofacial radiologist approved all the positive findings . \n percentage of bone loss was measured at the each tooth mesial and distal sides according to the method described by schei et al . the alveolar bone crest in relation to root length \n mesial and distal sides of each tooth were scored ; 1 , 024% bone loss ; 2 , 2549% bone loss ; and 3 , 50100% bone loss . \n besides , a single mean bone loss score was obtained for each participant as 1 , low periodontal risk ; 2 , moderate periodontal risk , and 3 , high periodontal risk . \n mean periodontal bone loss of 50% or above corresponds with a diagnosis of severe cp . \n spss for windows , version 18 ( spss inc . , chicago , illinois , usa ) was used to perform statistical analysis . \n kolmogorov smirnov test was used to determine the normal distribution of continuous variables . for all of the variables , \n pearson chi - square test or fisher 's exact test were used to determine the potential differences in the distribution of categorized data . \n logistic regression was used to evaluate the odds ratio for relation between the dependent variable cac and periodontal risk among dentate subjects . the threshold for significance \n radiographs of patients who had been recorded as having any systemic disease ( diabetes , hypertension , etc . ) \n ( 329 ) and radiographs without clear image ( 375 ) were not included into the analysis . among the 1146 patients , 577 ( 50.3% ) of them \n characteristics of subjects ( mean number of patients and their percentages according to gender , cac , periodontal risk ; mean agesd and mean tooth losssd ) of the 1146 patients , 338 ( 29.5% ) had low periodontal risk , 688 ( 60.0% ) had moderate risk and 120 ( 10.5% ) had high periodontal risk . \n all of the patients in this study were dentate and the mean tooth loss was 9.31 7.18 ( max : 31 , min : 0 ) [ table 1 ] . according to the correlation analysis , a positive correlation was observed between the age and number of missing teeth , and there was also a significant between the periodontal risk and the number of the missing teeth of patients [ table 2 ] . \n correlation between cac and other parameters ( age , gender , periodontal risk and tooth loss ) analysis of cacs and its distribution according to age and tooth loss : during the radiographic analysis there was not detected any imagine of cac in 990 cases ( 86.4% ) whereas it was detected in 13.6% ( n = 156 ) of 1146 cases . among those , in 40 ( 3.5% ) cases \n cac was on the right side , in 52 ( 4.5% ) cases on the left side and in 64 ( 5.6% ) cases on both sides [ table 1 ] . \n patients with cac were on average 56.99 8.79-year - old whereas the patients without cac were on average 53.35 9.23-year - old . \n a highly significant correlation was detected between cac and age of subjects ( p < 0.001 ) [ tables 2 and 3 ] . \n the difference between cac + and cac individuals according to their age , gender , periodontal risk and number of tooth loss cac was detected in 82 of 569 female patients and in 74 of 577 male patients . \n the number of the female patients with cac was greater than the male patients ( 14.4% and 12.8% , respectively ) but there was no statistically significant difference between the mean number of tooth loss ( p = 0.44 ) [ table 2 ] . \n in patients with cac , average number of tooth loss was 12 7.73 and in patients without cac , that number was 8.83 6.96 . \n the difference between the mean number of tooth loss was statistically significant ( p < 0.001 ) [ table 3 ] . \n it was also seen that significant correlation between the increase of the missing teeth and prevalence of cac was evidence [ table 2 ] . in 327 of 338 patients with low periodontal risk , cac was not observed , whereas only 11 of them had cac on dpr . \n conversely , in 62 of 120 patients with high periodontal risk , had cac but 58 of them did not . in both groups ( low , moderate , and high periodontal risk groups ) \n there was a significant difference between the number of the patients with cac and without cac ( p < 0.001 ) [ table 3 ] . \n it was shown that the greater the periodontal risk , the greater the prevalence of the cac [ tables 2 and 3 ] . \n hence , the relationship between cac and periodontal risk was statistically significant [ table 2 ] . \n radiographs of patients who had been recorded as having any systemic disease ( diabetes , hypertension , etc . ) \n ( 329 ) and radiographs without clear image ( 375 ) were not included into the analysis . among the 1146 patients , 577 ( 50.3% ) of them \n characteristics of subjects ( mean number of patients and their percentages according to gender , cac , periodontal risk ; mean agesd and mean tooth losssd ) \n of the 1146 patients , 338 ( 29.5% ) had low periodontal risk , 688 ( 60.0% ) had moderate risk and 120 ( 10.5% ) had high periodontal risk . \n all of the patients in this study were dentate and the mean tooth loss was 9.31 7.18 ( max : 31 , min : 0 ) [ table 1 ] . according to the correlation analysis , a positive correlation was observed between the age and number of missing teeth , and there was also a significant between the periodontal risk and the number of the missing teeth of patients [ table 2 ] . \n correlation between cac and other parameters ( age , gender , periodontal risk and tooth loss ) analysis of cacs and its distribution according to age and tooth loss : during the radiographic analysis there was not detected any imagine of cac in 990 cases ( 86.4% ) whereas it was detected in 13.6% ( n = 156 ) of 1146 cases . among those , in 40 ( 3.5% ) cases cac was on the right side , in 52 ( 4.5% ) cases on the left side and in 64 ( 5.6% ) cases on both sides [ table 1 ] . \n patients with cac were on average 56.99 8.79-year - old whereas the patients without cac were on average 53.35 9.23-year - old . \n a highly significant correlation was detected between cac and age of subjects ( p < 0.001 ) [ tables 2 and 3 ] . \n the difference between cac + and cac individuals according to their age , gender , periodontal risk and number of tooth loss cac was detected in 82 of 569 female patients and in 74 of 577 male patients . \n the number of the female patients with cac was greater than the male patients ( 14.4% and 12.8% , respectively ) but there was no statistically significant difference between the mean number of tooth loss ( p = 0.44 ) [ table 2 ] . \n in patients with cac , average number of tooth loss was 12 7.73 and in patients without cac , that number was 8.83 6.96 . the difference between the mean number of tooth loss was statistically significant ( p < 0.001 ) [ table 3 ] . \n it was also seen that significant correlation between the increase of the missing teeth and prevalence of cac was evidence [ table 2 ] . \n in 327 of 338 patients with low periodontal risk , cac was not observed , whereas only 11 of them had cac on dpr . \n conversely , in 62 of 120 patients with high periodontal risk , had cac but 58 of them did not . in both groups ( low , moderate , and high periodontal risk groups ) \n there was a significant difference between the number of the patients with cac and without cac ( p < 0.001 ) [ table 3 ] . \n it was shown that the greater the periodontal risk , the greater the prevalence of the cac [ tables 2 and 3 ] . \n hence , the relationship between cac and periodontal risk was statistically significant [ table 2 ] . \n periodontal disease is one of the most prevalent chronic infections in humans and can be very important as a result of its possible contribution to vascular disease . \n there are several studies with different results examining the relationship between cardiovascular diseases ( cvds ) that has vital importance and periodontitis . in these studies several systemic markers , clinical or radiographic findings \n have been used to determine the relationship between two diseases . according to many studies , \n cac is one of the subclinical finding of cardiovascular problems . in a previous study , it was reported that the subjects having cac detected on dpr had a higher risk of stroke , sudden death , and myocardial infarction than the others . \n it has been observed that when carotid artery occlusion is more than 60% surgical removing of the atheroma from the blocked artery decreases the risk of stroke in half . \n there is a lack of studies investigating the relationship between periodontitis and cac , as a radiographic finding of cvds . \n moreover , these studies have not been focused on smoking , which is considered as an important risk factor for cvds and periodontitis . \n to best our knowledge , this study is the first one investigating the relationship between a calcified carotid artery and periodontitis in a nonsmoking population . \n sonography which is one of the noninvasive techniques has been stated as the gold standard in the examination of atherosclerotic changes such as the carotid artery . \n however , identifying the carotid artery in dpr as true calcification can be quite conceivable . in some studies , positive findings of the carotid artery on doppler sonography \n have been confirmed using dpr . in another study , it was reported that the confirmation of radiographic image of cacs by ultrasound and ct was 34.7% and 62.3% , respectively . \n moreover , also , taking dpr is less time consuming and routinely taken from all of the patients older than 18-year - old applying with a dental complaint . in light of these information , we used dpr to examine the cac of the patients . \n reported that calcified carotid artery had been detected on 5% of 659 dpr ( n = 33 ) of the patients who were 80-year - old . in another study performed on dpr of subjects with a mean age of 68 ( n = 1879 ) , \n . in our study , a number of 1146 radiographs were investigated , and cac was detected on 156 ( 13.6% ) of them . \n the bigger ratio of carotid artery findings in our study which is similar to the results of tiller et al . \n , can be explained by the differences in age , lifestyles or other risk factors of the patients . in another study that was carried out in the turkish population , like in our study , \n the aim of this study was to evaluate the relationship between cac and risk of periodontitis in nonsmoking patients . \n it was reported that if the subjects are nonsmokers , the significance of a relationship between cvd and periodontitis is not apparent . nevertheless , our study subjects consisted of nonsmokers , and the relationship between cac - positive status and having periodontitis is statistically significant . \n this unexpected result may be caused by the different risk factors of cvd such as genetics , obesity , or idiopathic hypertension . \n the presence and degree of alveolar bone destruction detected in dpr give us information about the presence and degree of periodontitis . \n furthermore , a strong correlation was reported between severity of periodontitis and alveolar bone destruction which was observed by using this method . and \n we investigated the relationship between a calcified carotid artery and periodontal risk through measuring radiographic bone loss and number of tooth loss . according to the present study \n , there is a statistically significant relationship between a calcified carotid artery and also a number of tooth loss . \n similarly to the present one , a recent study reported a relationship between increased risk of stroke and number of missing teeth . \n these studies have evaluated the relationship between risk of different cvds and tooth loss whereas we have investigated calcified carotid artery as one of the outcomes of cvd . \n calcified carotid artery which was reported as in relation with periodontal risk in the present study can be the potential pathway of affecting vascular diseases by oral health . according to the results of our study , positive findings of cac on \n it 's well - known that increase in age is a risk factor for stroke and heart attack . \n furthermore , in patients with age 50 and above , increase in arteriosclerosis of carotid artery is associated with coronary heart disease and this finding has an important role in identifying coronary heart disease . \n in addition , significant correlation between the risk of periodontitis and tooth loss with the presence of cacs is considerable . \n the result is in accordance with other studies reported a noticeable relationship between increased risk of periodontitis and positive findings of cacs . \n engebretson et al . who confirmed findings of cacs on panoramics with doppler sonography , found a significant relationship between loss of alveolar bone and cacs . \n in another study , a significant association between intermedia thickness of carotid artery and risk of periodontitis had been reported . in several studies , \n madianos et al . reported a strong relationship between periodontal disease and coronary heart disease . in another study , \n christou et al . concluded that periodontal disease was associated with both high blood pressure and presence of cacs . \n ( 1 ) cac findings on dpr were not confirmed with another diagnostic method such as doppler sonography . \n ( 3 ) there is a lack of information about risk factors such as diet habits , genetic factors , and systemic conditions . \n ( 4 ) evaluation of the periodontal status of the patients depends on only radiographic examination with lack of clinical assessment . \n hence , the present study has some limitations similarly to many of cross - sectional data and the relationship detected in this study should not be interpreted as causal . \n as a result of retrospective characteristic of this study , ( 1 ) cac findings on dpr were not confirmed with another diagnostic method such as doppler sonography . \n ( 2 ) there is no information about the intermedia thickness of carotid artery . ( 3 ) there is a lack of information about risk factors such as diet habits , genetic factors , and systemic conditions . \n ( 4 ) evaluation of the periodontal status of the patients depends on only radiographic examination with lack of clinical assessment . \n hence , the present study has some limitations similarly to many of cross - sectional data and the relationship detected in this study should not be interpreted as causal . \n the results of this study demonstrated that there is a relationship between patients with positive readings of cac on pr and periodontitis . \n periodontitis is one of the most prevalent periodontal diseases in general population and as a result of such relationship with cvd periodontitis it would become a more critical disease for public health . \n clinicians should examine the presence of carotid calcifications on prs of the patients who has periodontitis and if they detect any sign of carotid calcifications , the patients should be referred to a cardiologist for a further examination . \n \n ", "role": "user" }, { "content": "objective : to evaluate if there is a relationship between findings of carotid artery calcification ( cac ) and periodontal risk in nonsmoker subjects by using panoramic radiographs ( dpr).materials and methods : a total of 1146 dprs were investigated . \n gender , age , severity of bone loss , tooth loss , periodontal risk , and findings of carotid calcification were recorded . \n the periodontal risk was evaluated and classified according to the degree of alveolar bone loss.results:cac was diagnosed in % 13.6 ( n : 156 ) of dprs . of 1146 patients , 338 ( 29.5% ) had low , 668 ( 60% ) had moderate , and 120 ( 10.5% ) had high periodontal risk . \n a statistically significant relation was observed between carotid calcification and periodontal risk.conclusion:positive findings of carotid calcification may be related with periodontal problems . \n clinicians must be careful about diagnosing cacs on dprs during routine examinations . in the case of positive findings of cac and periodontitis together , the patient may be consulted to a specialist for further investigation .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the pancreas is formed by ventral and dorsal pancreatic buds originating from the endodermal lining , at the junction of the foregut and midgut during the fourth week of gestation . \n eventually when the duodenum rotates to the right , the ventral pancreatic bud migrates dorsally and finally comes to lie immediately below and behind the dorsal pancreatic bud . \n later , the parenchyma and duct system of the ventral pancreatic bud fuses completely with the dorsal pancreatic bud . since the pancreas and the biliary tract undergo a complex developmental process , various malformations occur in the pancreaticobiliary system ( e.g. annular pancreas , pancreas divisum , anomalous arrangement of the pancreaticobiliary duct , congenital biliary dilation and biliary atresia ) . \n annular pancreas is a congenital anomaly in which histologically normal pancreatic tissue encircles the second portion of the duodenum either partially or completely , thereby causing stenosis or obstruction of the duodenum . \n however , the ventral pancreas of this case encompassed almost the entire circumference of the pyloric ring . \n this case was very rare and could not be classified in any type of congenital anomaly of the pancreas . \n a 56-year - old woman visited our institution with chief complaints of epigastric and back pain . \n she had experienced occasional pain for 20 years . she had no signs of peritoneal irritation , but the upper abdomen was tender . \n blood tests results were : total bilirubin 2.5 mg / dl , direct bilirubin 1.2 mg / dl , aspartate aminotransferase 48 iu / l , alanine aminotransferase 55 \n iu / l , white blood cells 4,600/l and c - reactive protein 1.14 mg / dl , while amylase and lipase were within normal limits . \n although she had no history of biliary surgery or endoscopic sphincteropapillotomy , computed tomography showed dilatation of the intrahepatic and extrahepatic bile ducts , and internal air density was observed ( fig . \n 1 ) . there were no obvious neoplastic lesions in the biliary tract or pancreas . \n upper gastrointestinal endoscopy showed no duodenal papillae in the second segment of the duodenum , but there were two small juxtaposed orifices on the pyloric ring ( fig . \n it was determined that the patient had separate orifices for the pancreatic and biliary ducts on the pyloric ring . when contrast agent was administered into each orifice , \n 3 ) . based on these test results , malformation of the pancreaticobiliary duct was diagnosed . since she did not wish to have the anomaly treated , she was followed - up without intervention for 2 years \n . however , 2 years after the diagnosis , she was again hospitalized with acute cholangitis . \n since the bile duct had an orifice at the pyloric ring , there was pressure on the bile duct and cholangitis accompanied by sepsis had thus developed . in order to prevent retrograde cholangitis and pancreatitis as well as to resolve the duodenal stenosis \n the ventral pancreas surrounded the pyloric ring subcircularly and no pancreatic tissue was seen at the second segment of the duodenum . \n based on these findings , we diagnosed the patient as having one of the subtypes of annular pancreas ( fig . \n macroscopic findings of the resected specimen also showed that the orifices of the pancreatic and bile ducts were located at the pyloric ring ( fig . \n histopathological findings demonstrated a ventral and a dorsal pancreas accompanied by the duct of wirsung and the duct of santorini , respectively . \n it was believed that fibrillization of the pancreaticobiliary duct had caused stenosis of the pyloric ring . \n one year has passed , to date , since the surgery and she remains asymptomatic . \n the pancreas is formed by two anlages , the dorsal and ventral pancreatic anlages , which arise around the fourth week of gestation . \n the dorsal pancreatic anlage develops at the dorsal side of the duodenum , slightly superior to the hepatic diverticulum at the end of the fourth week of gestation . \n right and left ventral pancreatic anlages develop adjacent to the biliary bud from the end of the fourth through the fifth week of gestation . \n the left ventral anlage degenerates by the middle of the sixth week , with only the right ventral anlage remaining . by the sixth or seventh week of gestation \n , the right ventral anlage and the common bile duct rotate clockwise along with the duodenum , migrating until it comes under the dorsal pancreatic anlage and fuses with it during the seventh week . consequently , the ventral pancreatic anlage forms the posterior inferior portion of the head and the uncinate process of the pancreas while the dorsal pancreatic anlage forms the superior portion of the head as well as the body and tail of the pancreas . during the early stage of pancreatic development , there are right and left ventral ducts , but the left duct degenerates by the middle of the sixth week of gestation . by the end of the seventh week \n when the right ventral and dorsal pancreatic anlages coalesce , the ascending branch , not the descending branch , of the ventral pancreatic duct communicates with the dorsal pancreatic duct to form the duct of wirsung , which opens with the bile duct into the duodenum to form the major duodenal papilla ( the papilla of vater ) . \n in addition , the dorsal pancreatic duct located in the superior portion of the head of the pancreas becomes the duct of santorini , and it opens into the minor duodenal papilla which is located more rostrally than the major pancreatic duct . on the other hand , the bile duct is originally in a solid stage as with the duodenal anlage . \n vacuolization starts from the inferior part of the common bile duct toward the hepatic side from the sixth week , and by the tenth week , formation of the bile duct with a full tubular structure is completed . \n the junction of the inferior common bile duct and the ventral pancreatic duct is detached from the duodenum at the end of the fifth week of gestation , and then again approaches the duodenum around the eighth week , finally inverting and invaginating into the wall of the pancreas to form the papilla of vater around the tenth week . \n annular pancreas is a congenital anomaly in which histologically normal pancreatic tissue encircles the second portion of the duodenum either partially or completely , thereby causing stenosis or obstruction of the duodenum . \n it was first reported by tiedemann in 1818 and named by ecker in 1862 . \n it is usually found in children , but with advances in diagnostic imaging including magnetic resonance imaging , endoscopic retrograde cholangiopancreatography and endoscopic ultrasound , increasing numbers of adult cases have been reported [ 7 , 8 , 9 , 10 ] . \n one hypothesis is that the free end of the ventral anlage is fixed and stays on the ventral side of the duodenum , allowing the ventral anlage to encircle the second portion of the duodenum to form a ring . \n the second hypothesis is that both the ventral and the dorsal side of the ventral anlage are enlarged in a lingulate form to incompletely encircle the duodenum . \n the third hypothesis is that the residual left lobe and overgrowth of the right lobe of the ventral pancreatic anlage both cause annular pancreas . \n however , according to these hypotheses , the pancreatic duct from the annular portion should open to the major papilla , which can not explain all courses of the pancreatic duct in cases of annular pancreas . furthermore , although there are several classifications of annular pancreas based on the morphology of the pancreatic duct at the annular portion [ 14 , 15 ] , there are cases which can not be classified or have pancreatic ducts with an extremely complex course . \n therefore , annular pancreas may be caused by a variety of anomalies occurring during the course of development of the pancreatic anlages and the duodenum . \n annular pancreas usually involves a lesion in the second portion of the duodenum , and the pancreatic and bile ducts merge at the papilla . \n however , in our case , ( 1 ) the pancreas encircled the pyloric ring , ( 2 ) the pancreatic duct itself did not have an annular structure and pancreatic parenchyma surrounded the pyloric ring subcircularly , ( 3 ) the pancreatic and bile ducts had separate orifices , and ( 4 ) the orifices of the pancreatic and bile ducts were located on the pyloric ring . \n moreover , the pancreas had both ventral and dorsal sides and neither the body nor the tail was absent . \n there was one common bile duct and the extrahepatic bile duct had a normal course , and the junction of the cystic duct was also normal . since our literature search yielded no similar cases , we ultimately diagnosed our patient as having a subtype of annular pancreas . \n we believe that our patient had multiple anomalies which had arisen in the sixth or seventh week of gestation , when the left and right ventral pancreatic anlages degenerate and rotate , and then persisted into the tenth week , when the papilla of vater is formed . \n as mentioned earlier , since the pancreas and the biliary tract undergo a complex developmental process , various malformations occur in the pancreaticobiliary system . \n apart from annular pancreas , pancreatic malformations include pancreas divisum and agenesis of the body and tail of the pancreas , and biliary malformations include anomalous arrangement of the pancreaticobiliary duct , congenital biliary dilation , biliary atresia , anomalous course of extrahepatic bile ducts and agenesis of the gallbladder . \n we believe our case to represent one of the subtypes of these developmental anomalies of the pancreaticobiliary system . \n this is the first report of an extremely rare form of annular pancreas with ectopic opening of the pancreatic and bile ducts on the pyloric ring . \n we obtained the patient 's written informed consent to publish this case report and the publication has been approved by our institute 's committee on human research . \n ", "role": "user" }, { "content": "the patient was a 56-year - old woman who had experienced epigastralgia and dorsal pain several times over the last 20 years . \n she was admitted for a diagnosis of acute cholecystitis , and severe intra- and extrahepatic bile duct dilatation with inner air density was noted . \n no papilla of vater was present in the descending duodenum , and 2 small holes were present in the pyloric ring . \n bile excretion from one of the small holes was observed under forward - viewing endoscope . \n it was considered that the pancreatic and bile ducts separately opened into the pyloric ring . based on these findings , malformation of the pancreaticobiliary duct \n was diagnosed . \n she did not wish treatment , but the obstruction associated with duodenal stenosis was noted after 2 years . \n pancreatoduodenectomy was performed as curative treatment for duodenal stenosis and retrograde biliary infection through the bile duct opening in the pyloric ring . \n the ventral pancreas encompassed almost the entire circumference of the pyloric ring , suggesting a subtype of annular pancreas . \n generally , lesions are present in the descending part of the duodenum in an annular pancreas , and the pancreatic and bile ducts join in the papillary region . however , in this patient , ( 1 ) the pancreas encompassed the pyloric ring , ( 2 ) the pancreatic and bile ducts opened separately , and ( 3 ) the openings of the pancreatic and bile ducts were present in the pyloric ring . \n the pancreas and biliary tract develop through a complex process , which may cause various types of malformation of the pancreaticobiliary system , but no similar case report was found on a literature search . \n this case was very rare and could not be classified in any type of congenital anomaly of the pancreas . \n we would classify it as a subtype of annular pancreas with separate ectopic opening of the pancreatic and bile ducts into the pyloric ring .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: toe flexor strength is a combination of the activity of plantar intrinsic ( flexor hallucis \n brevis , flexor digitorum brevis , and lumbricales pedis ) and extrinsic ( flexor hallucis \n longus and flexor digitorum longus ) muscles1 . \n toe flexor muscles play important roles in arch support2 , 3 , \n standing4 , walking / running \n performance5,6,7,8,9 , and jump performance9 , 10 . \n reduced toe flexor muscle force and/or volume are associated with foot and toe abnormalities \n including plantar fasciitis11 , pes cavus \n in charcot - marie - tooth disease12 , and \n claw and hammer toe deformities13 . \n furthermore , reduced toe flexor strength is a risk factor of falls for elderly persons14,15,16 . \n thus , estimation of toe flexor strength \n may be important in the development of physical fitness , activities of daily living , and \n preventive care for elderly persons . \n skeletal muscle strength and volume decrease with age17 , 18 , and such decreases \n result in reduced physical abilities in older persons19 . \n the rate of the age - related reduction in skeletal muscle strength \n and volume differs among regions and muscles . the muscle strength and volume of the lower \n body decreases faster than those of the upper body20,21,22 . \n it is hypothesized that this age - related region - specific reduction \n is partially accounted for by an age - related reductions in physical activity21 . \n specifically , it has been shown to \n significantly reduce after the age of 50 in both men and women23 . \n however , the rate of age - related reduction in toe flexor \n strength relative to other muscle strengths is unknown . \n furthermore , the relationship \n between toe flexor strength and physical activity and inactivity in elderly men has not been \n investigated . \n thus , the purpose of the present study was to compare the toe flexor strength \n and other muscle strengths of young and elderly men . \n whether or not toe flexor strength was \n associated with physical activity / inactivity levels was also investigated . \n a total of 155 young men ( 1823 years ) and 60 elderly men ( 6588 years ) participated in \n this study . \n the elderly men were \n recruited from among participants in events run by public bodies or the tohoku institute of \n technology . \n this study was approved by the ethical committee of the tohoku institute of \n technology . \n toe flexor strength was measured using a toe grip dynamometer ( t.k.k . 3161 , takei \n scientific instruments co. , ltd . , \n the intra - rater and inter - rater \n reliabilities of this apparatus have previously been reported24 . \n the subjects sat on a chair with the trunk in the vertical \n position , the hip and knee joints flexed at approximately 90 , and the ankle joints in a \n neutral position ( at approximately 90 ) ( fig . \n 1.measurement of toe flexor strength(a ) the posture adopted during measurement of toe flexor strength . \n the subjects sat \n on a chair with the trunk in the vertical position , with the hip and knee joints \n flexed at approximately 90 , and the ankle joints in the neutral position ( at \n approximately 90 ) . \n one \n foot was placed on the dynamometer , and the first proximal phalanx of the foot was \n positioned on the grip bar with the heel position fixed using a heel stopper . ) . \n previous studies have demonstrated that this position is the most suitable for \n measuring toe flexor strength , because of its reliability , the stability of the knee and \n ankle joints , and the ability of subjects to exert maximum force25,26,27,28 . \n the first \n proximal phalanx of the foot was positioned on a grip bar , and the heel position was fixed \n using a heel stopper ( fig . \n measurements were performed of the right \n and left toes , and the mean maximum force of each foot was used in analyses . \n measurement of toe flexor strength ( a ) the posture adopted during measurement of toe flexor strength . \n the subjects sat \n on a chair with the trunk in the vertical position , with the hip and knee joints \n flexed at approximately 90 , and the ankle joints in the neutral position ( at \n approximately 90 ) . \n one \n foot was placed on the dynamometer , and the first proximal phalanx of the foot was \n positioned on the grip bar with the heel position fixed using a heel stopper . \n measurements were made in duplicate on both hands , and the mean \n maximum force of each hand was used in the analyses . \n 5715 , takei scientific instruments ) with \n the trunk in the vertical position and the hip and knee joints flexed at approximately 90. \n a researcher put the subject s foot through the loop of the strap connected to the strain \n gauge , and the ankle was hooked in the loop of strap . \n measurements were performed on both \n legs , and the mean value of each leg was used in the analyses . \n trunk flexibility was assessed using a sit - and - reach test using a device ( t.k.k . \n the subjects sat on the floor with their hips , back , and the \n occipital region of the head touching a wall . \n they bent forward slowly , \n and as far forward as possible , pushing the device with both hands , and the distance moved \n by the device was measured . \n the measurements were performed twice , and the maximum value was \n used in the analyses . \n measurements were made in duplicate , and the maximum value was used \n in the analyses . \n briefly , the mean \n daily sum of standing and walking times and sitting time during the last six months were \n requested . \n values are mean sd . the unpaired t - test was used to compare the means of the young and \n elderly groups . to compare percent differences of the elderly group mean values with the \n young group mean \n values of hand grip , knee extensor , and toe flexor strength , one - way \n analysis of variance ( anova ) was used . \n the significance of between - group differences was \n determined using tukey s post hoc test when the overall anova was significant . \n 5.9163.4 4.5*body weight ( kg)66.3 10.462.4 8.7*bmi ( kg / m)22.6 3.223.3 2.9hand grip strength ( kg)44.5 7.035.2 6.0*knee extensor strength ( kg)41.4 10.726.6 7.9*toe flexor strength ( kg)15.2 4.88.4 3.9*sit - and - reach ( cm)40.3 9.931.2 13.3*functional reach ( cm)44.2 9.432.2 9.9*standing / walking time ( hr / day)6.0 3.23.9 2.4*sitting time ( hr / day)7.4 3.76.2 3.3*bmi : body mass index . \n the mean height and body weight of \n the elderly group were significantly lower than those of the young group ; body mass index \n ( bmi ) was not different between the two groups . regarding the physical fitness parameters , \n all five measures of the elderly group ( hand grip strength , knee extensor strength , toe \n flexor strength , sit - and - reach , and the functional - reach test ) were significantly lower than \n those of the young group . \n both the times spent standing / walking and sitting by the elderly \n group were significantly shorter than those of the young group . \n * p<0.05 vs. young group table 2table 2.proportional differences in muscle strength of elderly men compared with the mean \n values of young menhand gripknee extensortoe flexorproportional difference from young mean , % 79.2 13.464.3 19.0 * 55.2 22.4* n=60 . proportional difference from young mean was calculated using the formula \n bellow : proportional difference from young mean ( % ) = kg old groupkg mean value of young \n group100 . \n p<0.05 vs. \n knee extensor strength demonstrates the percent differences in the muscle strengths of the elderly \n men compared with the mean values of the young men . \n the rank - order of relative values of \n muscle strength was : toe flexor < knee extensor < hand grip ( p<0.05 ) . \n proportional difference from young mean was calculated using the formula \n bellow : proportional difference from young mean ( % ) = kg old groupkg mean value of young \n group100 . \n p<0.05 vs. \n knee extensor strength table 3table 3.correlation coefficients ( r ) between toe flexor strength and the other parameters \n of both groupsyoungelderlyage0.174*0.390*height0.1260.138body weight0.225 * 0.216bmi0.187 * 0.194hand grip strength0.317 * 0.509*knee extensor strength0.246 * 0.590*sit - and - reach0.1080.389*functional - reach0.240 * 0.395*standing / walking time0.1130.276*sitting time0.0570.066bmi : body mass index . * \n significant correlation with toe flexor strength \n ( p<0.05 ) shows the correlation coefficients between toe flexor strength and other \n parameters in each group . in the young group , \n toe flexor strength was found to have \n significant positive correlations with age , body weight , bmi , hand grip strength , knee \n extensor strength and functional reach , but not height , sit - and - reach , and standing / walking \n and sitting times . in the elderly group , toe flexor strength was found to have a significant \n negative correlation with age , and significant positive correlations with hand grip \n strength , knee extensor strength , sit - and - reach , functional - reach , and standing / walking \n time ; no correlation was found between toe flexor strength and height , body weight , bmi , or \n sitting time . \n this study found that toe flexor strength decreases with increasing age , and hand grip and \n knee extensor strength also decrease . \n the rate of decrease of toe flexor strength with age \n was greater than those of other muscle strengths . \n in addition , toe flexor strength was \n positively associated with physical activity levels assessed by daily standing / walking \n time . \n the rate of age - related reductions in toe flexor and knee extensor strengths were found to \n be greater than in hand grip strength . \n this is consistent with results reported by previous \n studies , which suggests that the muscle strength of the lower body decreases faster than the \n upper body20 , 22 . \n moreover , the rate of age - related reduction in toe flexor strength \n was greater than that of knee extensor strength . \n the obvious conclusion to be drawn from \n this is that the aging process is reflected more by toe flexor strength than by other muscle \n strengths . \n however , the results do not mean that age - related decay in muscles involving toe \n joint movement is greater than in muscles involving knee joint movement , because this study \n did not measure toe extensor or knee flexor strength . \n the rate of age - related reduction in \n muscle volume differs among joint movement types . \n for example , the volume of the elbow \n flexor muscle decreases with age , whereas elbow extensor muscle volume does not30 . \n additionally , the age - related reduction \n in knee extensor muscle volume is greater than that in knee flexor muscle volume31 . \n thus , it is likely that the rate of \n age - related decline in force production also differs among joint movement types . \n unfortunately , there are few accurate methods to measure toe muscle strength other than that \n for toe flexion1 . \n further studies are \n needed to estimate and compare the rates of age - related reductions in the muscle strengths \n of various types of actions and joints . \n for example , toe flexor \n strength was found to positively associate with walking performance such as walking speed , \n percentage of swing time in a gait cycle , and stride length during walking at maximal speed , \n in elderly men and women5 . \n study also \n found that toe flexor strength showed a positive correlation with the physical activity \n level , estimated from the self - reported daily standing / walking time in elderly men . \n one \n plausible explanation for this correlation is that toe flexor muscles are intensely \n recruited during standing and/or walking actions leading to improvement of force production \n in these muscles . \n indeed , activity of the flexor digitorum brevis muscle , estimated from \n intra - muscular electromyography , was shown to increase with increasing postural demand \n during standing32 . \n furthermore , the long \n and short toe flexor muscles were shown to exert forces of approximately 61% and 49% of body \n weight , respectively , during the second peak of ground reaction force in the gait cycle33 . \n another potential explanation is that \n higher toe flexor strength supports activities of daily living , leading to an increase in \n standing / walking activity . \n our \n study also found that the mean daily standing / walking time of elderly men was 35% lower than \n that of young men . \n it is likely that the age - related reduction in standing / walking activity \n has a greater impact on toe flexion strength than reductions in hand grip or knee extensor \n strength , leading to earlier loss of toe flexor strength than in other muscle strengths . \n additionally , age - related decline in muscle strength is multifactorial18 , 34 , and the rate \n of decline in neuromuscular anatomical factors differs between the upper and lower body . \n for \n example , the proportion of fast - twitch type ii fiber areas in the vastus lateralis muscle \n reduces with age faster than in the biceps brachii muscle35 . \n moreover , the number of muscle fibers in the vastus lateralis \n muscle reduces with age36 , but does not \n in the biceps brachii muscle37 . \n the \n number of medial gastrocnemius motoneurons decreases with age , but the number of ulnar \n motoneurons in rats does not38 . \n although \n the present and other previous studies have not investigated such factors with regard to toe \n flexion , it is possible that such factors are associated with the early reduction of toe \n flexor strength observed in this study . \n first , the cross - sectional \n nature of this study limits our ability to draw causal inferences from the relationships \n observed . \n it is still unclear whether increasing the physical activity level promotes the \n enhancement of toe flexor strength , or whether higher toe flexor strength promotes increases \n in the physical activity of elderly men . \n further longitudinal studies are needed to fully \n understand the relationship between toe flexor strength and physical activity . \n second , \n participants were not randomly sampled , as all of the participants were volunteers and \n able - bodied community - dwelling persons . \n it is still not known \n whether the differences in the rate of age - related reduction in muscle strength among toe \n flexion , hand grip , and knee flexion are the same for women . \n gender differences concerning \n age - related reductions in muscle force generation and volume have not been previously \n reported21 , 39 . additionally , a previous study showed that toe flexor strength of \n male subjects in their 70s was 38.5% lower than in that of the males in their 20s , but 29.8% \n lower in women23 , suggesting that the \n age - related reduction in toe flexor strength could be lower in women than in men . \n fourth , \n this study examined young ( 1823 years ) and elderly ( 6588 years ) men , but not middle - aged \n men . \n lynch et al.40 demonstrated that \n elbow flexion force linearly decreased with age , whereas knee extension force decreased in a \n quadratic way . \n the possibility that different relationships of age - related decline among \n muscle groups impact the relative decline levels of the toe flexor , hand grip , and knee \n extensor strengths can not be ruled out . \n fifth , physical activity was estimated using a \n self - administered questionnaire which is considered a less reliable and valid method . \n it has \n been reported that questionnaires often over- or underestimate physical activity level due \n to recall bias41 . despite these limitations , \n this study is the first to demonstrate the early loss of toe \n flexor strength compared to other muscle strengths , and the relationship between toe flexor \n strength and the physical activity levels of elderly men . \n it has been reported that elderly \n persons with poor toe flexor strength have difficulty walking safely under certain \n conditions5 . \n thus , toe flexor strength \n should be considered a good indicator of muscle function and the physical fitness of elderly \n persons .", "role": "user" }, { "content": "[ purpose ] to compare the toe flexor , hand grip and knee extensor strengths of young and \n elderly men , and to examine the association between toe flexor strength and physical \n activity or inactivity levels . \n [ subjects and methods ] young ( n=155 , 1823 years ) and \n elderly ( n=60 , 6588 years ) men participated in this study . \n toe flexor , hand grip , and \n knee extensor strength were measured . physical activity ( time spent standing / walking per \n day ) and \n inactivity ( time spent sitting per day ) were assessed using a self - administered \n questionnaire . \n [ results ] toe flexor , hand grip , and knee extensor strength of the elderly \n men were significantly lower than those of the young men . \n standing / walking and sitting \n times of the elderly men were lower than those of the young men . \n toe flexor strength \n correlated with hand grip and knee extensor strength in both groups . in elderly men , toe \n flexor strength correlated with standing / walking time . in comparison to the young men s \n mean values , toe flexor strength was significantly lower than knee extensor and hand grip \n strength in the elderly group . \n [ conclusion ] the results suggest that age - related reduction \n in toe flexor strength is greater than those of hand grip and knee extensor strengths . \n an \n early loss of toe flexor strength is likely associated with reduced physical activity in \n elderly men .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: echinococcosis , also known as hydatidosis , is a serious zoonotic disease caused by infection with echinococcus . \n human echinococcosis include cystic echinococcosis ( ce ) and alveolar echinococcosis ( ae ) , which are respectively caused by echinococcus granulosus ( eg ) and echinococcus multilocularis ( em ) . the human secondary ce is caused by leak of protoscoleces when fertile cysts are accidentally ruptured , followed by development of new metacestodes . \n because this disease has a long incubation period , most patients often have no obvious symptoms and develop into chronic infection [ 13 ] . after infecting the host \n , echinococcus gradually gains the ability to escape from the host immune response so that it can survive in the host for a long time . \n researches in ce patients and secondary hydatid mouse model indicate that , during the late stage of hydatid infection , the th2 cell humoral immunity is dominant and the imbalance of th1/th2 plays an important role in promoting the immunopathogenesis change of this disease , accompanied by secretion of cytokine ifn- and il-4 [ 3 , 57 ] . a new type of effector cd4 t cells , which mainly secrete il-9 and il-10 , is defined as the t helper 9 ( th9 ) cell subsets . \n th9 promotes allergic inflammation and is distinct from other cd4 t subsets of th1 , th2 , treg , and th17 cells . \n it is known that il-9 is a th2-type cytokine , which acts in a variety of inflammatory cells and tissue cells and plays important roles in parasitic infections [ 1012 ] and allergic diseases , especially allergic reactions , asthma , and so on [ 13 , 14 ] . like mouse \n th9 cells , human th9 cells produce il-9 , but they can not secrete il-10 . \n further studies showed that cd4 t cells can differentiate into th9 cells in the presence of tgf- and il-4 . and \n , tgf- alone can divert the differentiation of th2 towards the development of th9 cells . \n studies by chang et al . showed that , like th1 ( t - bet ) , th2 ( gata-3 ) , treg ( foxp3 ) , and th17 ( ror-t ) cells , pu.1 was one of the specific transcription regulation factors for th9 cells . \n pu.1 promotes th9 cells to secrete il-9 and plays a critical role in regulation of autoimmune diseases . \n the th17 cells , by secretion of il-17 , il-21 , and tumor necrosis factor ( tnf- ) [ 17 , 18 ] , have similar functions to th9 cells in inflammation . \n our previous study found that the levels of peripheral th17 cells and il-17 were slightly lower in the ce patients than in health control , suggesting there was imbalance between th17 cells and treg cells in ce patients . \n therefore , the purposes of this study are as follows : ( i ) to explore the change of th9 cells in the ce patients before and after treatments ; ( ii ) to study the characteristics of the changes of th9-related cytokines and transcription factors ; ( iii ) to study the correlations between th9 and th1 , th2 , treg , and th17 cells in ce patients . \n the twenty - seven hepatic hydatid patients in this study were all from the first affiliated hospital of xinjiang medical university , who received treatment during december 2009 and december 2012 ( table 1 ) . \n the health control group ( hc group ) included 25 medical staffs whose ages and sexes were matched with the patients . \n the ce patients were divided into two groups : ( 1 ) ce group ( pretherapy group ) : 27 ce patients who were diagnosed by imaging examination but had not received any therapy ; ( 2 ) pce group ( posttherapy group ) : 27 ce patients who were successfully cured by surgery in combination with albendazole . within 6 months , \n no relapse and metastasis were found in these patients as examined by imaging and no serious infections and obvious symptoms were detected in pce group . \n clinical data of healthy individuals and ce patients before and after treatment were included in table 1 . \n the cysts were all staged according to the who - iwge classification [ 20 , 21 ] . \n this study was approved by the human ethics committee of the first affiliated hospital of xinjiang medical university ( approval number : 20120220 - 126 ) . \n total rna was extracted according to the rna isolation kit ( qiagen , valencia , ca , usa ) instructions . \n then rna ( 1 g ) from each sample was reverse transcribed into cdna ( invitrogen , carlsbad , ca , usa ) . \n the real - time rt - pcr was conducted with the sybr green pcr premix ( takara biotechnology ( dalian ) co. , ltd . , \n dalian , china ) following the manufacturer 's protocols . to normalize gene expression , mrna expression of the housekeeping gene beta - actin ( -actin ) was also measured . for each sample , both the housekeeping and the target genes were amplified in triplicate using the following procedure of initial denaturation at 95c for 1 min , 40 cycles of 95c for 5 s , 58c ( or other ) for 30 s , and 72c for 30 s. the 2 method was used to determine the cycle number ct value corresponding to a specific fluorescence threshold and quantify the target genes . \n the concentrations of ifn- , il-9 , il-17 , il-4 , il-6 , il-10 , and tgf- in the sera were quantitatively determined by the cba kit - bd ( bd biosciences , san jose , ca , usa ) . \n briefly , 50 l of serum was used in duplicate for analysis according to the manufacturer 's protocol . \n the cba technique was based on 7 bead populations with distinct fluorescence intensities that were coated with antibodies specific for ifn- , il-9 , il-17 , il-4 , il-6 , il-10 , and tgf- proteins . \n four standard curves ( range from 0 to 5000 pg / ml ) were obtained from one set of calibrators and four sets of results were obtained on one test sample . \n cba was used to measure these cytokines on a flow cytometry ( asr ii ) . \n the data were analyzed using fcap array software that was designed for cba data analysis . \n peripheral blood mononuclear ( pbmc ) was isolated by ficoll - hypaque density centrifugation ( amersham biosciences , uk ) . \n pbmcs were suspended at a density of 2 10 cells / ml in roswell park memorial institute ( rpmi ) media 1640 with glutamax ( gibco , usa ) . for analysis of th9/th1/th2/th17/treg cells , \n 2 10 pbmc cells were seeded in 24-well plates and were stimulated with phorbol myristate acetate ( pma , 50 ng / ml ) plus ionomycin ( 1 m , all from alexis biochemicals , san diago , ca , usa ) and monensin ( 500 ng / ml , from ebioscience , san diago , ca , usa ) for 5 hours . the cells were collected and stained with antibodies against apc - cd3 and pe - cy5- at 4c for 30 minutes . after surface staining , the cells were fixed and permeabilized , followed by incubation with antibodies against il-9-pe , ifn--pe - cy7 , il-4-pe - cy7 , foxp3-pe - cy7 , and il-17-pe - cy7 for 30 minutes . \n all of the antibodies and reagents were purchased from ebioscience ( san diego , ca , usa ) . in the flow cytometry \n , the cells were gated on the forward scattering of living cells and then centered on cd3cd4 t cells . \n all stained cells were analyzed by flow cytometry ( asr ii ) and flowjo software ( tristar , usa ) . \n the spss13.0 software package was used for statistical analysis , and the measurement data was presented as x-s . if the data did not meet the normal distribution , they were logarithmically transformed into normal distribution . \n if the variances were homogeneous , one - way analysis of variance ( anova ) was used for comparison of the averages between groups . \n pu.1 , gata-3 , and irf4 are key transcription factors that induce differentiation of th0 cells into th9 cells . \n if pu.1 , il-9 , gata-3 , and irf4 are related to development of ce , the mrna expression levels of pu.1 , il-9 , gata-3 , and irf4 in peripheral blood were compared in the ce , pce , and hc groups by quantitative rt - pcr . as shown in figures 1(a ) and 1(b ) , the mrna expression levels of pu.1 and il-9 in the ce group were significantly higher than those in the hc group ( pu.1 , p = 0.000 ; il-9 , p = 0.032 ) . \n pu.1 expression was significantly decreased in the pce group when compared with the ce group ( pu.1 , p = 0.04 ) . \n meanwhile , there was no significant difference in pu.1 mrna level between pce group and hc group ( pu.1 , p = 0.266 ) . \n as shown in figures 1(c ) and 1(d ) , gata-3 mrna level of ce group was significantly higher than that of hc group ( p = 0.012 ) and pce group ( p = 0.009 ) . \n the difference in gata-3 mrna level between hc group and pce group was not significant ( p = 0.998 ) . \n the expression levels of irf4 in ce group and pce group were slightly higher than those in the hc group . \n however , the changes in irf4 mrna levels among hc group , ce group , and pce group were not statistically significant ( p > 0.05 ) . \n the pu.1 and gata-3 gene copies in the pce group were decreased than those in the ce group , possibly due to the recovery of the patients after surgery . \n the detected cell types included th9 ( il-9 ) cells , th1 ( ifn- ) cells , th2 ( il-4 ) cells , treg ( foxp3 ) cells , and th17 ( il-17 ) cells . \n cells were first gated on cd3cd4 t cells and then on il-9/ifn-/il-4/foxp3/il-17cd3cd4 t cells , respectively . \n then we compared the changes of cd4 t - cell subtypes among hc group , ce group , and pce group . \n as shown in figure 2(b ) , ratios of the circulating th9 cells were increased in the patients before therapy but decreased after therapy . \n the percentage of th9 cells ( cd3cd4il-9/cd4 t cells ) in ce group was 0.91 0.49% , significantly higher than that in hc group ( 0.6 0.2%)(p = 0.001 ) , while the th9 cell ratio of the pce group was 0.7 0.21% , significantly lower than that of ce group ( p = 0.024 ) . \n the ratio of th1 cells ( cd3cd4ifn-/cd4 t cells ) in the hc group , ce group , and pce group were 3.37 1.25% , 3.09 1.48% , and 3.57 2.12% , respectively . \n the differences among ce group , pce group , and the hc group were not statistically significant ( p > 0.05 ) . when compared with the hc group ( 1.66 0.59% ) , \n the ratio of th2 cells ( cd3cd4il-4/cd4 t cells ) in ce group ( 2.89 0.93% ) was significantly increased ( p = 0.000 ) . meanwhile , compared with ce group , the ratio of th2 cells in pce group was decreased significantly ( 1.79 0.8% , p = 0.000 ) . the ratio of treg cells ( cd3cd4foxp3/cd4 t cells ) in ce group ( 3.15 1.03% ) was also increased , compared with hc group ( 2.36 0.65% ) ( p = 0.005 ) . \n the treg cell ratio in the pce group ( 2.49 0.94% ) was significantly decreased compared with ce group ( p = 0.049 ) . \n the ratio of th17 cells ( cd3cd4il-17/cd4 t cells ) in hc group , ce group , and pce group was 0.86 0.4% , 0.99 0.46% , and 0.89 0.55% , respectively . \n the differences in th17 cell ratio among these three groups were not statistically significant ( p > 0.05 ) . since previous studies report that il-9 is also secreted by th17 cells [ 22 , 23 ] and tregs and that th9 cells are tightly associated with th2 cells , the correlations between th9 cells and the other subsets were investigated . \n as shown in figure 2(c ) , th9 cell number was positively correlated with that of th2 ( r = 0.454 , p = 0.017 ) , but not with th1 ( r = 0.086 , p = 0.671 ) , th17 ( r = 0.209 , p = 0.295 ) , or tregs ( r = 0.079 , p = 0.694 ) . \n these results suggest that in ce patients , levels of il-9 in the circulating blood were related to numbers of th2 cells . to determine the levels of cytokines in serum of patients , cba experiment was performed . as shown in figure 3(a ) , when compared to the hc group , the levels of il-9 , il-4 , il-10 , and tgf- in the serum were all significantly increased ( il-9 , p = 0.004 ; il-4 , p = 0.000 ; il-10 , p = 0.006 ; tgf- , p = 0.001 ) in ce group . when compared to ce group , the level of il-9 , il-4 , il-10 , and tgf- was significantly decreased after successful surgery treatment in the pce group ( il-9 , p = 0.02 ; il-4 , p = 0.02 ; il-10 , p = 0.044 ; tgf- , p = 0.031 ) . \n levels of ifn- , il-17 , and il-6 were changed slightly in the ce and pce groups , and the differences were not statistically significant in comparison with the hc group ( p > 0.05 ) . as shown in figure 3(b ) , the il-9 level in serum was positively related to il-4 ( r = 0.397 , p = 0.041 ) , but not related to ifn- , il-10 , il-17 , il-6 , or tgf-. these results suggest that in the serum of ce patients , levels of multiple cytokines , including il-9 , il-4 , il-10 , tgf- , il-17 , il-6 , and ifn- , were altered . among these cytokines , \n levels of il-9 were significantly increased upon infection and decreased after treatments , showing a positive correlation with level of il-4 . \n in most eg infection , the clinical outcome is associated with activation of th1 or th2 cells and usually displays th2-mediated susceptibility in the late stage of infection . \n it is known that chemotherapy can regulate the immune response , thus altering th1/th2 cytokine patterns . \n il-9 is thought to be a th2 cytokine for a long time , as it promotes allergic inflammation and is associated with various th2 responses [ 8 , 9 ] . \n th9 cells play an important role in autoimmune and allergic diseases [ 8 , 9 , 15 , 2730 ] . however , whether th9 cells are involved in parasite infection immunity , especially in echinococcus infection , has not been studied . \n the present study is the first report to investigate the role of th9 cells in human hydatidosis . \n results in this study show that the percentage of th9 cells and il-9 cytokine level was significantly increased in ce patients . \n after treatments of surgery and albendazole , the percentage of th9 cells and il-9 cytokine level was significantly decreased . \n these results indicate that decreased levels of th9 cells and il-9 might be used as prognostic factors for ce patients . \n however , the correlation between th9/il-9 profile and prognosis of ce patients still needs further investigation . \n it has been reported that il-4 combined tgf- , promoting nave cd4 t cell differentiated into th9 cells . in our study , cytokines levels of il-4 , tgf- , and il-10 in the serum of ce patients before treatment \n researches have shown that levels of il-4 , il-10 , and tgf- were all obviously increased after echinococcus infection both in ce patients and the experimental mouse model [ 7 , 31 ] . \n results of these studies suggest that il-4/il-10 impairs the th1 protective response and allows the parasite to survive in hydatid patients [ 3234 ] . \n our data were consistent with the above mentioned reports and further indicate that the complex cytokines network such as il-9 , il-4 , il-10 , and tgf- might be involved in the regulation of th9 cell differentiation in ce patients . th9 and \n il-9 were involved in eg infection and might play potentially beneficial roles in the growth of eg at the late stage after infection . \n it is reported that transcription factors of pu.1 , stat6 , irf-4 , and gata-3 are involved in the differentiation of th9 cells [ 9 , 10 , 15 , 16 , 30 , 35 ] . \n gata-3 , a down - steam effector of stat6 , and irf-4 also play an important role in th9 cell differentiation [ 8 , 36 ] . in this study \n , we also investigated the mrna expression levels of pu.1 , gata-3 , and irf-4 in peripheral blood . \n expression levels of pu.1 and gata-3 mrna were increased in ce patients and decreased significantly in pce group . \n the changes in irf-4 mrna level of ce patients before and after treatment were not significant . \n our data indicate that eg antigen may stimulate the activation of pu.1 and gata-3 , but not irf-4 , and that pu.1 and gata-3 may regulate the differentiation and proliferation of th9 cells during eg infection . \n in addition , we found that expression levels of il-9 mrna were significantly increased in ce patients before treatment . \n after treatments of surgery in combination with albendazole , despite the decrease in pu.1 and gata-3 levels , the level of il-9 mrna was not significantly changed . \n interestingly , percentages of th9 cells ( which secret il-9 cytokine ) and levels of il-9 cytokine in peripheral blood were also significantly decreased after treatment . this inconsistency in changes of il-9 mrna and il-9 \n cytokine might be due to other il-9 transcription factors that kicked in or the delayed responses at the transcription level . \n , we have found that the numbers of th9 cells , th2 cells , and treg cells were obviously increased , whereas the numbers of th1 and th17 cells did not change much in ce patients . \n it has been reported that several th subsets , such as th1/th2 cells [ 57 ] and th17/treg cells , are involved in the regulating the immune response of echinococcosis . \n th1 and th2 cells mainly exert their biological effects through secreting the cytokines of ifn- and il-4 . \n ce and ae patients show an upregulation of th2 immune response at the late stage of infection , which has been shown in the liver lesions locally and in circulating lymphocytes and results in more rapid metacestode growth [ 37 , 38 ] . \n there is , however , evidence that cellular immunity and th1 cytokines also play a role , by controlling totally parasite growth in some individuals and in limiting the size of the lesions in the patients with the diseases . \n treg cells inhibit the immune response of effector t cells by secreting large amounts of il-10 and tgf- , which play critical roles of immune evasion in human parasitic infection [ 3739 ] . \n our data showed that the th9 , th2 , and treg ratios in ce patients were increased more effectively than th1 and th17 cells . \n for the correlation analysis , the number of th9 cells in ce patient was positively correlated with that of th2 cells , but not with that of th1 , tregs , or th17 cells . moreover , \n our correlation results suggest that th9 cells may share mechanistic features of th2 cells , as they have been associated with echinococcus infection . \n thus besides the imbalance of th1/th2 cells , there also might be th1/th9 imbalance in ce patients . \n it is reported that progressive growth of eg during late stages of infection resulted in the persistence of the th2 shift [ 40 , 41 ] . \n therefore , as th2 is predominant at the late stage of eg infection , th9/il-9 may associate with the occurrence and development of eg infection \n . levels of il-4 , il-10 , and tgf- were significantly decreased in pce group , suggesting that without stimulation of eg , the immune response and regulation may be changed in the ce patients . \n il-9 can affect different inflammatory cells , such as t cells , b lymphocytes , mast cells , and neutrophils , leading to proinflammatory effects [ 15 , 42 , 43 ] . \n however , the exact underlying mechanism of il-9 's role in the eg inflammation response needs further study . \n overall , we reported for the first time that the th9 cells and il-9 expression were upregulated in ce patients but decreased after surgical and chemotherapy recovery . \n our data suggest that th9/il-9 may be involved in regulating the immune response in the infection with echinococcus .", "role": "user" }, { "content": "th9 cells have been reported to contribute to immune responses ; however , the role of th9 cells in echinococcus granulosus infection is unknown . \n this study is to determine whether th9 cells and il-9 are involved in human echinococcus granulosus infection . \n compared with healthy controls ( hc group ) , the mrna levels of pu.1 , il-9 , and gata-3 were significantly increased in patients before therapy ( ce group ) , as revealed by qrt - pcr . \n flow cytometry analysis showed that the percentages of th9 and th2 cells in ce group were significantly higher . \n the levels of il-9 , il-4 , il-10 , and tgf- in ce group were also significantly increased , as detected by cba assay . \n the percentages of th9 and th2 cells in ce group were positively correlated . \n after treatments of surgery in combination with albendazole , the pu.1 and gata-3 mrna levels were significantly decreased in patients after therapy ( pce group ) compared with ce group . \n the numbers of th9 and th2 cells and levels of il-9 , il-4 , il-10 , and tgf- were also significantly decreased in pce group . in conclusion , \n the ratios of th9 cells and il-9 levels were significantly decreased after treatment , suggesting that th9/il-9 may be involved in immune response induced by echinococcus granulosus infection .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: lie metchnikoff first described macrophages in 1893 in his observations of phagocytosis during tissue inflammation.1 metchnikoff observed microphages ( neutrophils ) and larger \n macrophages consuming pathogens during inflammation , and developed the well - known theory of immunity by phagocytosis.2 thereafter , the macrophage was labelled as a tissue - residing cell that could eat and kill infectious pathogens , thereby contributing to frontline immunity . \n macrophages were eventually incorporated into the reticulo - endothelial system in 1924 , implying that they originate from , and reside and renew within , that tissue.3 in 1968 , ralf van furth , zanvil cohn and colleagues formulated the mononuclear phagocyte system : the origin of all macrophages is terminal differentiation from blood monocytes.4 there was significant evidence to the contrary at the time ; however , due to the technological constraints of experiments , the mononuclear phagocyte system became the prevailing model for macrophage origin . \n as a result , it was generally assumed that all macrophages had the same monocytic / myeloid progenitor . \n therefore , a large proportion of the subsequent research was steered toward the functional characteristics of monocyte - derived or bone - marrow - derived macrophages . \n this included the discovery of classically5 and alternatively activated6 macrophage phenotypes , which ultimately led to the m1/m2 nomenclature , respectively.7 hence , traditionally , macrophages were accepted as phagocytic , terminally differentiated blood monocyte - derived cells , which can be activated by classic or alternative ligands to form polarized populations . \n we will review some recent advances in the field of macrophage biology and highlight how this impacts on this dogma . \n in 1924 ludwig aeschoff labelled macrophages as tissue phagocytes,3 which could import lithium carmine by phagocytosis . \n this theory was ultimately flawed as lithium carmine could also be imported by pinocytosis ( cell drinking ) in non - phagocytes.8 in 1925 the findings of florence sabin showed that a proportion of these cells can be derived from the blood,9 and in 1968 this was applied to all macrophages to form the mononuclear phagocyte system.4 at this time , there was a reasonable body of evidence that macrophages were not terminally differentiated1012 and were persistent in tissues.13 however , the experiments used in these studies were imperfect , mainly due to the limitations of technology , and so the theories put forward struggled for attention . toward the end of the twentieth century \n a greater appreciation for macrophage heterogeneity was observed.14 this included a consensus that some macrophages could proliferate14 and existed in the embryo long before definitive haematopoiesis.15,16 this was contradictory to the mononuclear phagocyte system ; but could have been considered as special cases . the observation that human langerhans cells ( a specialized tissue macrophage)17 from the donor still existed years after a double hand transplant18 provided evidence that either these cells could survive an extended length of time , or that they were replenished locally . in 2009 , \n chorro et al.19 showed that murine langerhans cells were not terminally differentiated and could proliferate in situ to restore cells lost in inflammation . \n this result , along with similar observations in brain microglia20 led to related observations of in vivo proliferation , for example : in peritoneal macrophages,21,22 pleural macrophages,22 alveolar macrophages,23 red pulp macrophages,23 adipose tissue macrophages,24 cardiac macrophages25 and macrophages within atherosclerotic lesions.26 gentek et al.27 have recently discussed aspects of macrophage proliferation in detail . \n it became evident that many tissue macrophage populations are renewed independently of the bone marrow , and therefore their origin was scrutinized . \n fate - mapping studies showed that a significant number of tissue macrophages are derived from primitive macrophages existing within the yolk sac or fetal liver.28,29 these macrophages are seeded into the tissues before birth and proliferate to populate the expanding tissue with resident macrophages . \n resident macrophages in organs , such as the intestine and dermis , are continually replenished from blood monocyte precursors,3032 and monocyte - derived macrophages are a key constituent of inflammatory environments.33 a significant number of tissue macrophages can remain independent from blood monocytes ; though \n embryonic macrophages can be replaced by monocyte - derived cells after severe inflammation,34 or in active , ageing tissues such as the heart.35 the change in macrophage origin may result in different phenotypes or functions in that tissue . considering the majority of our knowledge on tissue macrophages is focused on rodents and cells with limited origins , the next logical questions for the field include : what effect does origin have on macrophage function ? and how do these primary rodent studies relate to human macrophages ? \n this may be an important consideration , because mice used in research are usually 6 weeks , and at maximum 2 years , old , whereas humans live for over eight decades . \n so it is possible that the embryonic origin of adult macrophages in rodents is not indicative of human cell populations . \n however , results from rodent studies can still be mimicked in human tissues , such as the long - term independence of human langerhans cells from monocytes.18 \n immunological cell subsets are defined not only by their phenotype , but also by their expression of transcription factors required for specific functions . \n this is relatively well defined in other fields of immunity , such as t - cell biology;36 however , the transcription factor profiles of macrophage subsets are still largely unknown \n . there have been notable studies on tissue niche - specific transcriptional control of macrophage populations in the past , such as in the spleen.37 the haem - induced38 transcription factor spic is required for the presence of red pulp macrophages,39 whereas nr1h3 is necessary for all marginal zone macrophages.40 importantly , the loss of these factors results in the loss of both the cells and their functions , and is localized to specific tissue microenvironments.39,40 therefore , it is difficult to dissect the mechanisms controlling specific functions of these subsets , but implies that these factors are required for cell survival / development in that tissue niche . in 2012 \n the immunological genome consortium identified the zinc finger transcription factor gata6 as peritoneal tissue - resident macrophage ( presm)-selective.41 in addition , they showed that mertk and cd64 provided an alternative to f4/80 expression when identifying tissue macrophages.41 this study highlighted both the shared and distinct characteristics of tissue macrophage subsets and provided more information to discriminate them from dendritic cells.41 other groups including our own also identified gata6 as a select transcription factor in presm.4244 conditional knockout ( ko ) of the gata6 gene in myeloid cells ( \n lyz2-cre recombinase , gata6-floxed : which we termed gata6-ko ) resulted in gross phenotype changes in the common macrophage markers f4/80 and cd11b in presm. importantly there were still presm present , albeit in reduced numbers.4244 \n in vivo lentiviral manipulation of gata6 in adult presm resulted in similar phenotype changes , indicating that gata6 is required for cell phenotype in the adult.42 transcriptome studies , which compared gata6-ko with wild - type presm , identified a diverse range of genes altered in the absence of gata6 . \n crucially , a large number of these genes were presm selective , so it was concluded that gata6 is in part responsible for the presm-specific gene profile.4244 these studies corroborated the same overall conclusion ; however , the authors of each study provided additional insights into the function of gata6 in presm. okabe and medzhitov,43 identified that vitamin a - derived retinoic acid drives the expression of gata6 in presm. the source of this retinoic acid is the peritoneal omental tissue . \n interestingly presm of gata6-ko mice accumulate in omental milky spots,43 perhaps because of their altered cell - adherent gene signature.4244 the loss of gata6 in presm can also have physiological consequences . \n peritoneal b1 cells migrate to the gut and can secrete iga.45 gata6 ablation in presm resulted in a decline in immunoglobulin a production from migrating peritoneal b-1 cells . \n this was dependent upon transforming growth factor 2 , which is secreted by presm and controlled by gata6.43 the functional importance of this is not fully understood as b2 cells can compensate for this drop in iga production , but it highlights a physiological role of resident macrophages , which enables us to tease apart the subtle control of tissue physiology . \n peritoneal presm proliferate at a low level to maintain homeostasis , but go through a burst in proliferation to recover lost numbers during the resolution from inflammation.21 we identified alterations in genes linked to proliferation in gata6-ko presm.42 interestingly , the proportion of gata6-ko macrophages proliferating was actually higher than controls , but nuclear polyploidy was also enhanced.42 this could be either attributed to failed cytokinesis ( as considered to be caused by lack of emerin in the nuclear envelope ) , as seen in gata6-knockdown epithelial cells,46 or by enhanced cell fusion . \n gata6-ko presm failed to recover their numbers after acute inflammation and those cells still present were deficient in their proliferative response.42 therefore , gata6 contributes toward presm persistence by regulating normal proliferative responses . \n reduced presm numbers could also be explained by increased migration to omental milky spots,43 increased tissue adherence4244 or enhanced apoptosis . \n gautier et al.44 found that loss of gata6 results in decreased expression of the metabolic enzyme aspa in presm. aspa - ko presm shared characteristics such as enhanced apoptosis and lower cell numbers with gata6-ko presm.44 however , the mechanisms for apoptosis may not be shared between the two knockouts . \n genes associated with oxidative phosphorylation were also increased in gata6-ko presm , which suggests enhanced mitochondrial function.44 when investigated , oxygen consumption was found to be higher in gata6-ko presm , suggesting increased oxidative phosphorylation.44 however , this could also be enhanced basal oxidase activity . \n it has been suggested that alternative activation of macrophages can tip the metabolic balance away from glycolysis and toward mitochondrial oxidative phosphorylation.47 therefore , the authors conclude that gata6-ko presm are alternatively activated both due to increased expression of genetic markers such as arg1 , and enhanced oxygen consumption.44 however , many genes are enhanced in the absence of gata6 , so perhaps this activation state is merely a status of cell health , and failure to respond to the environment . \n it is also not clear whether the levels of glycolysis are also higher in gata6-ko presm , and perhaps the increase in oxygen consumption is indicative of a more general metabolic activation . \n there has been a growing interest in metabolic control of immune cell function.47 this study44 demonstrates that the persistence of a tissue - specific macrophage population is maintained in part by selective expression of a metabolic enzyme . \n aspa is generally considered to be restricted to oligodendrocytes in the nervous system.48 hence , its presence in a macrophage population is interesting , and the unknown mechanisms behind the apoptotic consequence of aspa deletion may additionally influence specific macrophage functions . \n the gata6 model for tissue - specific control of a macrophage population provides a valuable tool to investigate the fine - tuning of tissue - specific cellular function in vivo . \n tissue physiology is tightly regulated , and it is likely that each cell within each tissue has its own unique genetic expression profile . \n this enables cell survival in the tissue , but may restrict survival in other tissues . \n immune cells of the blood are not necessarily exempt from such control , as one fate of monocyte - derived macrophages as well as neutrophils in tissues is apoptosis.49 however , these cells can adapt to new environments , as is evident in the training of monocyte - derived macrophage subsets to survive and function in the intestine.31 therefore , both cell plasticity and environmental factors play a role in the fate and persistence of cells in tissues , and a colossal effort is required to unravel these complexities . \n the yellow cells represent peritoneal omental tissue , b cells are shown as small circular cells , and the large globular cell is a peritoneal resident macrophage . \n two recent publications have implicated the tissue environment as the strongest factor in the determination of cell phenotype.50,51 these studies used sequencing ( seq ) techniques to investigate the genetics and epigenetics of tissue - resident macrophage populations in different tissues , including gata6-controlled presm. the authors describe enhancer landscapes , which are essentially a measure of specific histone modifications , principally histone-3 lysine-4 single methylation ( h3k4me1 ) . \n areas rich in h3k4me1 highlight active gene landscapes.52 lavin et al.51 used a combination of rna - seq , chromatin immuno - precipitation - seq and assay for transposase - accessible chromatin - seq to pinpoint enhancer landscapes coupled to gene expression and accessible chromatin . \n this allowed them to build a three - dimensional map of chromatin , which included whether the gene is expressed and what transcription factors are likely to be bound to that gene . \n this is a useful method to visualize transcription factor control of gene expression profiles in specific cell subsets . \n the two studies conclude that tissue - resident macrophages shared epigenetic structure and gene expression with other myeloid cells , and is modulated by master transcription factors such as pu.1.50,51 however , each tissue additionally has its own unique gene expression profiles controlled by changes in enhancer landscapes50,51 lavin et al . \n the transferred cells lost most of the old tissue programming , but acquired the majority of a new tissue programme specific to their new environment.51 tissue - specific reprogramming was also evident when existing \n embryonic tissue - resident macrophages were lethally irradiated and replaced by tissue - resident macrophages derived from transferred healthy bone marrow.51 this shows that the environment predominantly controls the cells phenotype by directing epigenetic programmes . \n gosselin et al . additionally showed the impact of selective environmental factors on gene expression of cells cultured ex vivo . \n retinoic acid or transforming growth factor 1 inclusion in culture media partially restored the enhancer environments and gene expression of presm and microglia , respectively.50 this enables us to carry out ex vivo experimentation , which will be more faithful to the phenotype of specific tissue macrophages than existing culture techniques . \n the challenge now is to fully characterize unique tissue environments and dissect the functions of each factor . \n an example of such a factor is retinoic acid in the peritoneum , which drives gata6 expression in presm and maintains the epigenetic landscape and gene expression profile,50 ( fig . 1 ) . \n these studies50,51 emphasize the plasticity of macrophages and highlights that cell polarization in chronic inflammation for example , may not be irreversible , as a new environment can reprogramme the epigenetics and gene expression prolife . \n however , this might not be the only determiner of cell phenotype , as the expression of certain genes may still be dependent on cell origin . \n these are not the first reports of macrophage environmental reprogramming ; however , as evidenced by a recent report from suzuki et al.53 they describe a model of pulmonary macrophage therapy , which is essentially the replacement of functionally deficient ( csf2rb ) alveolar macrophages by site - specific transfer of wild - type bone - marrow - derived macrophages . \n when analysed by microarray , the transferred cells acquired the majority of the phenotype associated with alveolar macrophages and persisted for at least a year . in their model , these cells are functional and restore the normal surfactant clearing function in the lungs , which is impaired in csf2rb mice . genetically manipulated csf2rb cells with enforced csf2rb expression were also able to re - populate the lungs of csf2rb mice with functional macrophages that restored lung homeostatic functions . \n this study highlights the potential for macrophage transfer and subsequent tissue - specific environmental reprogramming as a therapeutic . \n inflammatory stimuli are often sensed by macrophage receptors , resulting in downstream signalling cascades that force activation of the cell . \n existing dogma for macrophage activation is dedicated to m1/m2 polarization : macrophages can either be classically ( m1 ) or alternatively ( \n this is dependent on the stimulus and resulting phenotype of the cell.54 classical activation of macrophages by stimuli such as lipopolysaccharide ( m1 ) through toll - like receptor 4 has been extensively categorized , but the majority of this research has been performed in vitro on cells with limited origins . \n classical activation of tissue - resident macrophages in vivo has usually been thought of as equivalent ; however , it is likely that there are subtle differences , which are dependent upon environment and genetic / epigenetic programming.41,55 although classic ( m1 ) and alternative ( m2 ) activation have been applied in the in vivo setting , such as in t helper type 1 and type 2 environments , respectively;54 the complexity of signals present will change both the activation process and outcome . \n for example , the phenotype of macrophages alternatively activated by interleukin-4 was reported to be different depending on cell origin.56 the authors compared thioglycollate - elicited macrophages ( with bone marrow origins ) to presm ( with prenatal origins ) . \n this shows that origin may still play a role , as monocytes arriving from the blood may need time to switch environmental epigenetic programming before activation . \n additionally , a transcriptomic study on resolution - phase macrophages in the peritoneum found that these cells did not resemble \n m2 activation phenotypes , but seemed a hybrid;57 however , at the time of these transcriptomic studies the complexity of cellular subsets present was not appreciated . \n we now know that some tissue macrophages can renew their population independently from monocytes during inflammation19,21,22 and have prenatal origins.28,29 therefore , a proportion of the macrophages existing at the end of inflammation may be those present at the start . \n this aspect of tissue macrophage biology has been largely under - studied because it is often assumed that activated macrophages perish . \n therefore some macrophage subsets present during the later stages of inflammation , including wound healing , may in fact be recovering tissue - resident macrophages . \n recently , newson et al . carried out a refined analysis of resolution - phase macrophages in the peritoneum.58 this study appreciated that tissue - resident macrophages survive initial acute inflammation and persist during the recovery phase . \n however , the authors noted that the cell environment in the peritoneum remained complicated by the co - existence of persisting tissue - resident macrophages and monocyte - derived cells , even up to 60 days after stimulus . \n the tissue - resident macrophages at 60 days do not mimic the naive phenotype and also maintain differential gene expression from monocyte - derived macrophages . \n however , this study itself shows that even acute inflammation has long - term consequences on the tissue environment and cell phenotype , with a reported second wave of leucocyte recruitment and continued abnormality in the cell milieu.58 therefore , the time that recruited monocytes are maintained in an inflammatory lesion is poorly defined , and importantly , it is likely that the tissue environment itself may take a long time to return to homeostasis , if at all . \n perhaps factors dictating tissue reprogramming are either missing or are overridden by the new inflammatory context . \n this work58 highlights the gaps in our understanding of macrophage function and phenotype during the resolution of acute inflammation , and further study is required to more thoroughly define the restoration of homeostasis . \n the extreme heterogeneity of tissue - resident macrophages during homeostasis and inflammation shows that a macrophage can not be just \n m1/m2 polarization nomenclature as being too simplistic,37,5961 and a recent perspective has proposed a framework to standardize in vitro and ex vivo macrophage activation nomenclature.62 although there is no new consensus model for macrophage phenotype in vivo , it has been suggested that macrophages be named by origin , and the historical nomenclature maintained for cells with an embryonic origin.17 although cell identification is important , the difficulties associated with defining lineage should not detract from meaningful functional study of the cells . the lack of a clear model for macrophage activation phenotype in vivo results from the complexity of the environment ; construction of this model would require enhanced understanding of cell - tissue interactions . \n additional large - scale analyses , such as proteomics , metabolomics , genomics and epigenomics in combination with in silico algorithms will be essential to unravel further the complexity of these systems.55,63,64 one of the most studied inflammatory environments is the tumour . \n tumour - associated macrophages ( tams ) are phagocytic cells with unclear origins residing in what is essentially an inflammatory tissue . \n these cells have been poorly categorized , as their existence and phenotype depends upon a broad range of variables.65 these variables include : tumour origin , formation , location , environment status , organism / species and individual genetics . \n recently , franklin et al.66 investigated the origin of tams in a murine model of breast cancer . \n however , this model may not be indicative of all tumours , because of the variables mentioned above . in other inflammatory environments there \n are known to be varying mixtures of tissue - dervied and monocyte - derived subsets ; examples being encephalomyelitis , with microglia and monocyte - derived macrophages67 and dermatitis , which includes epidermal langerhans cells.68 regardless of the origin , macrophages are a resident of the tumour site and contribute to tumour growth . \n recently , colegio et al.69 showed that the tumour microenvironment itself controls the functions of tams . \n tumours can produce a substantial level of lactic acid , which is scavenged by tams and can activate hif1. hif1 is usually induced by low oxygen and drives the expression of a wide array of genes.70 the authors focused on two alternative activation genes : arg1 and vegf , known to be important for tumour growth and neovascularization , respectively.69 tumour lactic acid can therefore control certain aspects of the tam gene expression profile . \n hif1 activation has been reported to shift macrophages into an enhanced glycolytic state,71 which includes increased production of lactic acid , which could further propagate the phenotype of these cells . \n this is an example of macrophage activation by the inflammatory environment , and because this environment can be extremely complex , methods for dissecting this need to become both more intricate and encompassing . \n the m1/m2 system has undoubtedly been useful in studying alternate aspects of macrophage activation ; however , overuse in the in vivo setting will probably hinder our progress in the understanding of how a macrophage responds to its environment , and contributes to disease pathology . \n a cells environment can become polarized with overpowering or chronic stimuli , but this is not permanent or black and white , and a change in environment will result in changes in cell phenotype in shades of grey . \n therefore , the new model is the appreciation that the local environment controls macrophage phenotype , be it in a tissue or in vitro \n . this may be complex but it can be applied across organisms ; and although cells , mechanisms and environments may be different , animal models can be used to understand the control of tissue systems . \n this can then be applied to translational research contexts . when culturing cells in vitro we should update the culture conditions to closely match those of a specific tissue environment . \n this can be something simple , such as including retinoic acid for presm culture or transforming growth factor 1 for microglial culture,50 using physiologically relevant oxygen levels , or providing microfluidic flow72 to retain phenotype ex vivo . \n however , this is destined to become more advanced with increased understanding of tissue environments . rather than standardizing basic mechanisms , \n perhaps this argues for an increase in the complexity of in vitro systems when culturing human cells in order to learn new aspects of cell activation in more complex environments . this would require a working knowledge of the factors specific to that environment , but it is essential for advancement of out - dated tissue culture techniques . \n the field of macrophage biology , like macrophages themselves , has evolved slowly from ancient roots . however , during the last decade it has gone through a boom , with the discovery of proliferative potential , extreme heterogeneity and divergent origins . \n recently it has been shown that tissue - specific transcription factors and tissue programmed epigenetics control the gene expression of resident macrophages , regulating their functions ; which can then in turn impact upon the environment itself . \n hotwired in order to alter macrophage processes regardless of the environment , thus providing therapeutic benefit in inflamed tissues . \n furthermore , the field of immune cell metabolism is becoming increasingly popular.47 simple metabolites such as glucose and glutamine have been included in tissue culture media for decades ; however , we are only now starting to appreciate their roles in immune cell activation and functions.47 the gata6retinoic acid axis in the peritoneum,43 shows how metabolites can be a key tissue factor and an area of focus for future research . additionally , considering that metabolic enzymes are among the best - conserved proteins between organisms \n ", "role": "user" }, { "content": "macrophages have been at the heart of immune research for over a century and are an integral component of innate immunity . \n macrophages are often viewed as terminally differentiated monocytic phagocytes . \n they infiltrate tissues during inflammation , and form polarized populations that perform pro - inflammatory or anti - inflammatory functions . \n tissue - resident macrophages were regarded as differentiated monocytes , which seed the tissues to perform immune sentinel and homeostatic functions . however , tissue - resident macrophages are not a homogeneous population , but are in fact a grouping of cells with similar functions and phenotypes . in the last decade , it has been revealed that many of these cells are not terminally differentiated and , in most cases , are not derived from haematopoiesis in the adult . \n recent research has highlighted that tissue - resident macrophages can not be grouped into simple polarized categories , especially in vivo , when they are exposed to complex signalling events . \n it has now been demonstrated that the tissue environment itself is a major controller of macrophage phenotype , and can influence the expression of many genes regardless of origin . \n this is consistent with the concept that cells within different tissues have diverse responses in inflammation . \n there is still a mountain to climb in the field , as it evolves to encompass not only tissue - resident macrophage diversity , but also categorization of specific tissue environments and the plasticity of macrophages themselves . \n this knowledge provides a new perspective on therapeutic strategies , as macrophage subsets can potentially be manipulated to control the inflammatory environment in a tissue - specific manner .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it is well recognized that the introduction of a cf structural feature within a bioactive molecule often imparts desirable physiological properties.(1 ) as a consequence , fluorinated biologically active compounds are increasingly common in the realm of pharmaceuticals and agrochemicals . \n this widespread interest and increasing demand for site selective fluorination of organic compounds has prompted the extensive development of novel specialized fluorination technologies and reagents capable of incorporating fluorine atoms in a safe , efficient and controlled fashion . among the myriad of fluorination methodologies currently available , \n the direct replacement of oxygen by fluoride , commonly referred to as deoxofluorination , is one of the most effective and routinely used approaches that is particularly applicable to a wide variety of functional groups.(2 ) deoxofluorination using nucleophilic - type fluorinating reagents has a long development history , notably with the early recognition that sf4 could directly transform such groups as hydroxyl to fluoride , carbonyl to difluoromethylene , and carboxylic acid to trifluoromethyl.(3 ) since this initial discovery , several reagents were developed , such as dast ( diethylaminosulfur trifluoride),(4 ) deoxo - fluor ( bis(2-methoxyethyl)aminosulfur trifluoride),(5 ) yarovenko s reagent ( n , \n n - diethyl-2-chloro-1,1,2-trifluoroethylamine),(6 ) ishikawa s reagent ( n , n - diethyl-1,1,2,3,3,3-hexafluoropropylamine),(7 ) 1,1,2,2-tetrafluoroethyl - n , n - dimethylamine ( tfedma),(8 ) 2,2-difluoro-1,3-dimethylimidazolidine ( dfi),(9 ) and perfluoro-1-butanesulfonyl fluoride ( pbsf).(10 ) dast and deoxo - fluor are the most widely used deoxofluorinating agents and arguably the best in this class in terms of broad spectrum of applicability.(11 ) from a historical perspective , dialkylaminosulfur trifluorides were developed as liquid alternatives to the parent reagent , i.e. , sf4 . \n its handling therefore necessitates extensive safety measures and specialized equipment . on the other hand , dast is a more easily handled fluorinating agent and generally superior to sf4 in that the latter requires much higher temperatures ( typically 100 c ) and leads to undesired side products . as such , \n dast became widely used in deoxofluorinations and has found applications in a myriad of transformations . \n however , it was soon recognized that liquid dast was thermally unstable and highly explosive.(12 ) investigation of this phenomenon by thermal analyses has shown that the decomposition occurs in two distinct stages . \n the first event occurring at approximately 90 c is a nonexothermic disproportionation of dast leading to sf4 and bis(diethylamino)sulfur difluoride . upon further heating , the latter undergoes detonation / explosion with generation of unidentified gases and black char.(13 ) the safety concerns over dast prompted the development of a safer dialkylaminosulfur trifluoride reagent , namely bis(2-methoxyethyl)aminosulfur trifluoride ( deoxo - fluor).(3 ) in this context , it has been shown by differential scanning calorimetry ( dsc ) that dast and deoxo - fluor have the same decomposition temperature , but the latter degrades more slowly with somewhat lower heat evolution . in spite of these significant advances , the hazards associated with this class of reagent are considered unsafe for industrial use in a batch - type process . as a matter of fact , considerable efforts were deployed to develop continuous - flow processes to prevent reagent accumulation and circumvent the inherent problems associated with both dast and deoxo - fluor.(14 ) from their initial preparation to their final use , handling dialkylaminosulfur trifluoride reagents remains problematic in many aspects of their life cycle . \n first , purification of crude reagents by vacuum distillation is a hazardous process that requires extensive safety measures due to their explosiveness . \n then , in hand , great care must be exercised in handling these fuming liquids as they react extremely violently with water . over time , these liquids are known to discolor , and a redistillation can be required to be used satisfactorily.(15 ) upon use , dast and deoxo - fluor generate free hf which is very volatile ( bp 20 c ) , highly toxic , extremely corrosive to skin and other tissues including bone , and readily etches glass.(16 ) finally , deoxofluorinations using dialkylaminosulfur trifluorides are problematic in certain cases in that dehydration to an olefin often occurs . in light of these considerations , the development of safer deoxofluorinating reagents is warranted . in this context , \n enhanced thermal stability and crystallinity would be desirable attributes that would address most shortcomings of dast and deoxo - fluor . \n a crystalline reagent would not only facilitate its isolation and purification but would also offer the convenience of handling a solid reagent . in the quest to identify a safe deoxofluorinating reagent capable of incorporating fluorines in a controlled fashion , we surmised that dialkylaminodifluorosulfinium salts could act as surrogates for aminosulfur trifluorides and provide a safer alternative reagent . \n preliminary investigations in our laboratories have shown that dialkylaminodifluorosulfinium salts were promising leads in that regard and warranted further investigation.(17 ) herein , we report the results of our recent findings . \n the first examples of dialkylaminodifluorosulfinium salts were reported over three decades ago by markovskii et al . in this account , the authors describe that dast and the dimethylamino , piperidino and morpholino analogues all react with bf3et2o to form the corresponding dialkylaminodifluorosulfinium tetrafluoroborates.(18 ) in this context , although dast possesses electron lone pairs , bf3 does not act as a lewis acid but rather as an irreversible fluoride ion acceptor , and the resulting dialkylaminosulfinium ion is stabilized as the tetrafluoroborate.(19 ) shortly thereafter , cowley et al . found that dimethylaminosulfur trifluoride reacted with bf3 , pf5 , and asf5 to form the corresponding dimethylaminodifluorosulfinium salts.(20 ) a year later , mews and henle also reported that dimethylaminosulfur trifluoride readily loses a fluoride to bf3.(21 ) over a decade later , pauer et al . determined the crystal structure of dimethylaminodifluorosulfinium hexafluoroarsenate.(22 ) more recently , pashinnik et al . reported that morpholinosulfur trifluoride reacts with sef4 to form morpholinodifluorosulfinium pentafluoroselenate.(23 ) throughout these accounts , \n they were only employed in the reaction with trimethylsilylmorpholine to give tris(morpholino)sulfinium tetrafluoroborate , and to the best of our knowledge , the fluorination of an allylic alcohol in a prostaglandin represents the sole example of deoxofluorination using a dialkylaminodifluorosulfinium salt.(24 ) it is noteworthy that the presence of a dialkylaminosulfinium species in solution has been inferred in the fluorination of thiocarbonyls using deoxo - fluor in the presence of catalytic amounts of sbcl3.(25 ) in this account , the identification of an in situ generated dialkylaminosulfinium species by f nmr is described but the counterion was not characterized . \n a similar intermediate had been previously proposed for the reaction of dast with zni2 or sbcl3 in the specific context of transforming sulfoxides to -fluorothioethers.(26 ) in order to further evaluate the thermal stability of dialkylaminodifluorosulfinium salts and their potential use as fluorinating reagents , we initially secured some diethylaminodifluorosulfinium tetrafluoroborate ( xtalfluor - e , 1 ) and morpholinodifluorosulfinium tetrafluoroborate ( xtalfluor - m , 2 ) by reproducing the original markovskii procedure ( figure 1).(27 ) as we previously communicated , xtalfluor - e crystallizes directly out of solution upon the reaction of dast and bf3et2o in diethyl ether , but the isolated solid was somewhat amorphous and highly hygroscopic . in the hopes of obtaining a less moisture - sensitive material , the forgoing salt was initially recrystallized in warm 1,2-dichloroethane ( dce ) , which upon rapid cooling led to needles melting at 7276 c , consistent with markovskii s published results ( vide supra ) . \n a second crystallization trial at higher temperature did not lead to the same morphology , even when seeded with aforementioned needles . \n powder x - ray diffraction ( xprd ) of the latter confirmed the generation of a distinctly different polymorph , herein referred to as type ii polymorph . whereas markovskii reportedly obtained needles ( herein referred to as type i polymorph ) melting at 7476 c , the new morphology consists of flakes with a melting point of 89.8 c measured by dsc and 8385 c measured by capillary . \n the fusion enthalpy of the higher - melting type ii polymorph was measured at 101.3 j / g , whereas the lower melting type i polymorph gave 86.4 j / g , confirming that the new polymorph is more stable . \n moreover , the type ii polymorph is less moisture sensitive , exhibits superior handling properties and is storage stable . \n similarly , the morpholinodifluorosulfinium tetrafluoroborate that we have obtained using a different procedure ( vide infra ) exhibited a higher mp of 133.2 c measured by dsc and 129132 c measured by capillary as compared with the 104106 c mp previously disclosed by markovskii . \n although we were not able to reproduce the original prisms , the significantly higher melting crystals we have now obtained is indicative of a new and more stable polymorphic form . \n as mentioned above , the preparation of dast has the disadvantage of requiring a distillation . \n this purification step is hazardous , requires extensive safety measures and specialized equipment , and is a major cost contributor to this relatively expensive reagent . in that regard \n , a crystalline reagent derived from dast would also be desirable by allowing isolation via simple filtration . in this context , we envisaged using crude undistilled dast in the preparation of xtalfluor - e , thereby eliminating the need for a time - consuming and hazardous distillation . \n gratifyingly , addition of bf3thf to crude dast ( prepared from n , n - diethyltrimethylsilylamine and sf4 in dichloromethane ) directly led to crystalline xtalfluor - e in the desired polymophic form ( type ii ) with an isolated yield of 90% ( scheme 1 ) . \n all the previously reported dialkylaminodifluorosulfinium salts were prepared via fluoride transfer to lewis acids such as bf3 , pf5 , asf5 , and sbf4 , and the types of salts were limited to the corresponding counteranions . however , during the course of mechanistic investigations ( vide infra ) , dast was found to react exothermically with tetrafluoroboric acid and provides diethylaminodifluorosulfinium tetrafluoroborate with concomitant elimination of hf . \n in fact , the exothermic reaction proceeded nearly quantitatively with an isolated yield of 96% ( scheme 2 ) . \n moreover , this unprecedented brnsted acid exchange method complements the traditional fluoride transfer procedure , and now provides access to aminodifluorosulfinium species bearing other types of counteranions . \n for example , diethylaminodifluorosulfinium trifluoromethanesulfonate salt ( 3 ) can be readily prepared by reacting dast with triflic acid and constitutes the first example of a triflate salt of a dialkylaminodifluorosulfinium . \n an additional benefit is that the foregoing triflate salt has a higher melting point ( 97101 c ) as compared to the corresponding tetrafluoroborate . as mentioned above , \n pashinnik et al . reported the deoxofluorination of an allylic alcohol using morpholinodifluorosulfinium tetrafluoroborate ( 2 ) in acetonitrile and claim an 85% yield of the corresponding fluoride as a mixture of epimers . \n this represents the sole record of a deoxofluorination reported in the literature using an aminodifluorosulfinium salt . \n we therefore set out to assess the potential scope of such salts from a broader perspective . \n fluorinations of various alcohols using xtalfluor - m were initially attempted under conditions similar to those reported in the pashinnik procedure , i.e. , using acetonitrile as solvent . \n unexpectedly , geraniol led to an intractable mixture , whereas hydrocinnamyl alcohol ( 4 ) provided acetamide 5 as the major product , presumably via a ritter - type reaction with the solvent . \n however by using dichloromethane as solvent , we found that xtalfluor - e ( 1 ) did convert hydrocinnamyl alcohol into the desired fluoride , albeit sluggishly . \n more specifically , all the starting material was consumed within 5 min and led to a complex reaction mixture from which fluoride 6 , ether 7 , and sulfinate 8 were isolated in 32% , 27% , and 9% yield , respectively ( scheme 3 ) . \n as we previously communicated , the mechanistic pathways of deoxofluorinations with dast and xtalfluor - e are similar in that they both involve a common dialkylaminodifluorosulfane intermediate . however , since xtalfluor - e releases tetrafluoroboric acid instead of the dast - generated hf , the reactions with xtalfluor - e are fluoride - starved , and side reactions occur.(17 ) in this context , formation of ether 7 would be ascribed to a nucleophilic displacement of the activated sulfane species by the alcohol instead of fluoride . to a lesser extent , \n ejection of diethylamine from the transient sulfane , followed by alcohol addition on the resulting sulfoxonium would account for the formation of the sulfinate 8 . in light of the fast reaction rate and \n product distribution observed , the dialkylaminodifluorosulfinium salt is a potent electrophile that leads to a reactive alkoxy - n , n - dialkylaminodifluorosulfane species , but the reaction mixture is fluoride - starved . in this context \n , we surmised that an exogenous source of fluoride would be required to mitigate side reactions . \n indeed , a cleaner conversion of hydrocinnamyl alcohol ( 4 ) to 1-fluoro-3-phenylpropane ( 6 ) could be achieved when the reaction was performed in the presence of et3n3hf as a promoter ( table 1 , entry 3 ) . \n in fact , adding the exogenous fluoride immediately after the substrate was contacted with xtalfluor - e led to essentially the same product distribution as a reaction without et3n3hf ( table 1 , entries 1 and 4 ) . \n in other words , coupling of xtalfluor - e with the alcohol and subsequent reactions of the adduct are quasi instantaneous , thereby exemplifying the highly reactive nature of the salt . \n method c : additive was added to a mixture of alcohol and reagent;. nonisolated hplc yields using m - xylene as internal standard . \n unlike anhydrous hydrogen fluoride and olah s reagent , it is important to emphasize that et3n3hf is much less corrosive and can be handled in borosilicate glassware up to 150 c without etching.(29 ) moreover , et3n3hf is soluble in organic solvents , anhydrous , and inexpensive . \n the role of the latter is to serve as a source of hf , and it is unlikely that hf causes the dialkylaminodifluorosulfinium tetrafluoroborate to revert back to dialkylaminosulfur trifluoride and generate tetrafluoroboric acid . on the contrary , dast reacts exothermically with tetrafluoroboric acid to provide dialkylaminodifluorosulfinium tetrafluoroborate and hf in 96% isolated yield . \n moreover , f nmr analysis of a 1:1 mixture of xtalfluor - e and et3n3hf in deuterated dichloromethane did not show the characteristic dast peak expected at 40.9 ppm . \n while considering the mechanism at play , we surmised that the presence of a non - nucleophilic strong base could serve to deprotonate the putative alkoxy - n , n - dialkylaminodifluorosulfane species and prevent release of diethylamine . \n this would not only suppress the pathway leading to the sulfinate 8 byproduct but also now allow ejection of requisite fluoride anions . \n validation of the concept was realized when dbu allowed formation of the desired fluoride , i.e. , in the absence of exogenous fluoride ( table 1 , entries 5 , 6 ) . \n again , addition order was critical , and increased conversion was observed when the reagent was added last . \n although the reaction rates with dbu were slower than those using et3n3hf , none of the ether 7 and sulfinate 8 side products were observed , thereby suggesting that the deprotonated alkoxy - n , n - dialkylaminodifluorosulfane adduct is more stable . with these promising leads in hand , \n substrate scope was next assessed on a wide variety of alcohol substrates , including primary , secondary , tertiary , allylic , and anomeric alcohols ( table 2 ) . in the case of hydrocinnamyl alcohol , greater conversion to the corresponding fluoride was achieved when the reactions were initiated at lower temperatures . \n however , this problem was easily resolved through the use of et3n2hf which is considered a more nucleophilic and less basic fluoride ion source than et3n3hf.(30 ) although not commercially available , this reagent is easily generated in situ from the appropriate amounts of et3n3hf and et3n . \n thus , in the fluorination of 1-phenyl-3-butanol ( 9 ) using et3n2hf in conjunction with xtalfluor - m , 4% of the starting material remained unreacted as compared with 17% and 31% using et3n3hf and et3nhf , respectively ( table 2 , entries 57 ) . \n another important consideration is the amount of elimination side products which is typically observed in deoxofluorinations reactions using dast and deoxo - fluor . not only does the formation of these undesired products consume valuable reagent and negatively impact the yields , but the purification of the desired fluoride is oftentimes challenging due to similar physical properties between the two . \n the use of et3n2hf is also advantageous in that regard since less elimination is observed as compared with et3n3hf . \n as shown in entries 13 and 14 , the xtalfluor - e - mediated deoxofluorination of cyclooctanol ( 11 ) using the latter as promoter provided a mixture of cyclooctyl fluoride ( 12 ) and cyclooctene in a 3.7:1 ratio . however , combination of both colder temperature and the use of et3n2hf markedly increased the selectivity to 12.1:1 . \n these results compare favorably with those reported using dast and deoxo - fluor ( 2.3:1 and 5.7:1 , respectively).(31 ) the foregoing method was next challenged on enantiopure ( r)-benzyl 3-hydroxypyrrolidine-1-carboxylate ( 13 ) to determine the stereochemical course of the substitution . \n thus , treatment of this reagent with xtalfluor - e and et3n2hf provided the inverted fluoride 14 in 98.0% ee admixed with benzyl 2,5-dihydro-1h - pyrrole-1-carboxylate in a 5.9:1 ratio , respectively . even better results in terms of selectivity and stereochemical integrity \n were observed using the same fluorinating reagent and dbu ( table 2 , entry 19 ) . on the basis of these results , \n both the et3n2hf- and dbu - promoted fluorinations mainly proceed in an sn2 fashion with minimal loss of enantiopurity . \n further along the substratescope evaluation , 2,3,4,6-tetra - o - benzyl - d - glucose ( 15 ) provided glycosyl fluoride 16 in essentially quantitative yield as a mixture of anomers.(32 ) deoxofluorination of geraniol using either xtalfluor - e or xtalfluor - m and et3n2hf proceeded smoothly and exclusively in a sn2 fashion . \n initial attempts to fluorinate a homoallylic alcohol , namely androstenolone ( 17 ) using the same reagent system were low yielding and more problematic . \n however , with further optimization with the former fluorinating reagent , et3n3hf gave superior results and provided 77% isolated yield of the 3-isomer consistent with previous results obtained with dast.(33 ) finally , deoxofluorinations were tested on two tertiary alcohol substrates , i.e. , 2-hydroxy-2-methyl-1-phenylpropan-1-one ( 19 ) and ethyl 2-hydroxy-2-methylpropanoate ( 21 ) . on the former alcohol , \n xtalfluor - e and et3n2hf led to a mixture of desired fluoride 20 and elimination product in a modest 1.9:1 ratio , but a greater selectivity of 4.1:1 was observed using dbu as promoter . \n while the dbu / xtalfluor - e reagent combination was optimal in this case , the use of et3n2hf / xtalfluor - m on 2-hydroxy-2-methylpropanoate ( 21 ) gave a superior selectivity of 21:1 . \n thus , on the basis of these results , there are no general trends for the ideal combination of xtalfluor - e and xtalfluor - m fluorinating reagents with et3n2hf , et3n3hf , and dbu promoters . \n however , various reagent / promoter combinations are complementary to each other and provide opportunities for optimization . \n prior to our original communication , the use of aminodifluorosulfinium salts for the geminal difluorination of carbonyls was unprecedented . \n in preliminary trials , we found that xtalfluor - e alone was incapable of performing such transformations . \n for example , when 4-tert - butylcyclohexanone ( 27 ) was treated with xtalfluor - e , no detectable conversion to 4-tert - butyl-1,1-difluorocyclohexane ( 28 ) was observed even after 4 days at room temperature . \n interestingly , merck chemists have also reported that 10 mol % of bf3et2o substantially retards the rate of reaction in the deoxofluorination of a ketone by deoxo - fluor.(34 ) these results are somewhat contradictory to previous claims to the effect that bf3et2o catalyzes the dialkylaminosulfur trifluoride mediated deoxofluorination of ketones.(31 ) all indications suggest that bf3et2o does not act as a lewis acid but rather as an irreversible fluoride ion acceptor to form dialkylaminodifluorosulfinium tetrafluoroborate salts with attenuated reactivity . \n although not supported by conclusive experimental proof , the first step toward geminal difluorination is generally considered to be the addition of hf across the carbonyl group to provide a fluorohydrin , which then partakes in dehydroxyfluorination with the reagent . in the case of dast and deoxo - fluor , \n the initial source of free hf arises by hydrolysis of the reagents with trace amounts of water or by the deliberate addition of ethanol . likewise \n accordingly , we found that the deoxofluorination of hydrocinnamaldehyde ( 25 ) using either xtalfluor - e or xtalfluor - m was indeed promoted with et3n3hf and provided the geminal difluoride 26 with no detectable amounts of vinylfluoride side product ( table 3 , entry 1 , 2 ) . \n although no reaction was observed between xtalfluor - e and 4-tert - butylcyclohexanone , the addition of et3n2hf efficiently allowed the desired transformation to occur and provided a 91% yield of gem - difluoride 28 admixed with vinyl fluoride in a 62:1 ratio . \n this result favorably compares with the 5:1 and 2:1 ratios reportedly observed with deoxo - fluor and dast , respectively . as was the case for alcohols , \n however , greater selectivities were generally obtained using the latter , but in this context , higher reaction temperatures , i.e. , refluxing dce , were required to achieve full conversion . \n for example , the selectivity of deoxofluorination on 4-(boc - amino)cyclohexanone ( 29 ) could be upgraded from 1.8:1 to 5.1:1 by using et3n3hf instead of et3n2hf and by performing the reaction under more concentrated conditions in refluxing dce . \n likewise , high - yielding selectivities were obtained in the synthesis of ethyl 4,4-difluorocyclohexanecarboxylate ( 32 ) , a key intermediate in the commercial drug maraviroc.(35 ) in this case , xtalfluor - m gave a higher 15:1 selectivity than xtalfluor - e ( 13:1 ) , results which again compare favorably to the 1:1 selectivity reported using dast . \n application of the foregoing procedure on cyclohexane-1,4-dione mono(ethylene glycol ) acetal ( 33 ) provided the desired gem - difluoride ( 34 ) in a 9:1 selectivity , whereas deoxofluor was reported to yield a 0.8:1 ratio.(16 ) even more impressive results were obtained when 2 equiv of xtalfluor - m was employed which led to no detectable amounts of vinyl side product ( table 3 , entries 8 and 9 ) . \n likewise , no elimination was observed in the fluorination of n - cbz - protected 3-pyrrolidinone ( 35 ) , whereas n - cbz - protected 4-piperidinone ( 37 ) led to a 13:1 selectivity in favor of the desired gem - difluoride 38 . \n finally , both ethyl 2-oxo-2-phenylacetate ( 39 ) and 1-phenoxypropan-2-one ( 41 ) were readily converted to their corresponding difluorides using xtalfluor - e and et3n2hf . throughout these examples , \n all reactions were essentially completed within 1 day , were generally high yielding , and consistently exhibited higher selectivities than those reported using dast and deoxo - fluor . \n isolated yields of products . unless otherwise noted , 1.5 equiv of reagent was employed . \n a brief survey of other types of oxygen - based functional groups was undertaken to further expand on the scope of fluorinating capabilities of xtalfluor salts and to compare with known reactions with dast and deoxo - fluor ( table 4 ) . \n both aliphatic and aromatic carboxylic acids 43 and 45 were easily fluorinated to the corresponding acyl fluorides by either reagent . however , it is noteworthy that , even under forcing conditions , exhaustive fluorination to the corresponding trifluoromethyls was unsuccessful . \n this limitation could be ascribed to the fact that free - hf is not generated in the process.(36 ) further along the substratescope studies , the well - precedented fluorination of sulfoxides to -fluorothioethers was also successfully performed on methyl phenyl sulfoxide ( 47 ) . \n lastly , using xtalfluor - e , a one - pot process was developed where an o - trimethylsilyl cyanohydrin generated in situ from hydrocinnimalhehyde and tmscn afforded the -fluoronitrile 50 in excellent yields.(37 ) isolated yields of products . unless otherwise noted , 1.5 equiv of reagent was employed . \n a preliminary thermal screening was performed using differential scanning calorimetry ( dsc ) to establish if they are safe to handle from a thermal hazard safety perspective . in previously disclosed dsc values , \n dast reportedly decomposed at 140 c releasing 1700 j / g , whereas deoxo - fluor decomposed at 140 c with 1100 j / g of energy.(5 ) however , recently published dsc data on dast has shown strong exothermic activity from 131 to 163 c with a tmax at 162 c and a release of 1252 j / g.(35b ) since the latter value is much lower than the one previously reported , we elected to retest dast and deoxo - fluor using the same calibrated dsc instrument as the one to be used for assessing xtalfluor - e and xtalfluor - m ( figure 2 ) . thus , dast exhibited a very sharp tmax peak at 155 c and a release of 1641 j / g , whereas deoxo - fluor was much broader with a tmax at 158 c and a release of 1031 j / g . for comparison , \n dsc analysis on xtalfluor - e showed a decomposition temperature ( tmax ) at 205 c with an exothermic heat ( h ) of 1260 j / g . \n in general , a higher decomposition temperature and a lower exothermic heat generated during decomposition are indicative of a more stable compound and provide greater safety . on the basis of these results , xtalfluor - e is significantly more stable as it decomposes at approximately at 50 c above dast and deoxo - fluor . \n even superior results were observed with xtalfluor - m , which decomposed at an even higher temperature of 243 c ( tmax ) while releasing only 773 j / g . \n moreover , isothermal dsc of both xtalfluor - e and xtalfluor - m set at 90 c showed no observable degradation in the time frame tested , i.e. , 5000 min . at the same temperature , dast and deoxo - fluor \n were reported to degrade within 300 and 1800 min , respectively.(5 ) overlapped dsc thermograms of dast , deoxo - fluor , xtalfluor - e , and xtalfluor - m . in order to accurately assess the thermal hazards and set the safety limits for process , storage , and transport temperatures , the onset temperature self - accelerated thermal decomposition must be identified by more reliable methods . \n accelerated rate calorimetry ( arc ) , isothermal calorimetry ( ic ) , and thermal screening unit ( ts ) measurements provide more realistic estimates of the run - away temperature.(38 ) for example , previous hazard safety studies reported by rossi et al . \n on deoxo - fluor showed that the onset of decomposition is around 70 c using a calvet calorimeter ( c80 ) , a value much lower than that detected by dsc ( 120 c).(39 ) likewise , dast reportedly undergoes a very energetic decomposition between 50 and 60 c.(40 ) it is noteworthy that these figures are somewhat lower than those previously obtained by arc which showed onsets of decomposition at 85 c for dast and 100 c deoxo - fluor.(5 ) therefore , commercial samples of dast and deoxo - fluor were reevaluated by arc using the same unit model and similar sample loading as previously reported ( figure 3).(41 ) thus , the onset of decomposition started at 60 c for both dast and deoxo - fluor , a value which is more aligned with recent reports . \n furthermore , the maximum heat generation rate of deoxo - fluor occurred at 170 c with a recorded 505 c / min , a marked difference with the previously reported 10 c / min ( figure 4).(5 ) these discrepancies could be attributed to the presence of impurities in the commercial samples , as it is well recognized that dialkylaminosulfur trifuorides discolor with aging , and several impurities were previously detected in commercial sources of deoxo - fluor.(42 ) these arc results were next compared with those of xtalfluor - e and xtalfluor - m by using the same set of parameters . \n thus , arc testings on approximately 1 g samples showed decomposition onsets at 119 c for xtalfluor - e and 141 c for xtalfluor - m , a significant increase in margin safety over dast and deoxo - fluor . \n arc thermograms of dast , deoxo - fluor , xtalfluor - e , and xtalfluor - m : temperature over time . \n arc thermograms of dast , deoxo - fluor , xtalfluor - e and xtalfluor - m : self - heat rate versus temperature . \n since arc is performed under near adiabatic conditions , the information provided is generally considered as highly reliable and provides valuable heat and pressure generation rates.(43 ) in this context , a maximum pressure generation rate of 855 psi / min was observed at 149 c for dast , whereas deoxo - fluor decomposed at a marginally lower rate of 788 psi / min at 170 c ( figure 5 ) . \n in contrast , xtalfluor - e showed a maximum pressure generation rate of 357 psi / min at 191 c while 85 psi / min at 246 c was recorded for xtalfluor - m . \n thus , the maximum rates of both xtalfluor salts occur at significantly higher temperatures than those of dast and deoxo - fluor . \n moreover , the maximum rate of pressure rise for xtalfluor - e is approximately half the rates of dast and deoxo - fluor whereas xtalfluor - m is about 1 order of magnitude lower . \n maximum rates of temperature rise of 310 c / min and 50 c / min were recorded for xtalfluor - e and m respectively , as compared to 711 c / min and 505 c / min for dast and deoxo - fluor . \n arc thermograms of dast , deoxo - fluor , xtalfluor - e , and xtalfluor - m : pressure generation rate versus temperature . \n our investigations on the physicochemical properties of dialkylaminodifluorosulfinium salts have led to important findings , including a novel and complementary preparative method using strong acids and the discovery of a novel and more stable polymorphic form of diethylaminodifluorosulfinium tetrafluoroborate . \n detailed safety hazard assessments have demonstrated the enhanced thermal stability of xtalfluor - e and xtalfluor - m over deoxo - fluor and dast . \n moreover , a new preparative method of xtalfluor - e has eliminated the need to perform the hazardous distillations of dast , a major cost contributor in the preparation of the latter . \n although xtalfluor - e and xtalfluor - m were poor fluorinating agents of alcohols and found totally inert toward carbonyls , they excelled when used in conjunction with promoters , such as et3n3hf , et3n2hf , or dbu . \n a set of general reaction conditions has been developed and the fluorinations were generally high yielding and significantly more selective in providing less elimination side products as compared to deoxo - fluor and dast . \n contrary to the latter reagents , xtalfluor - e and xtalfluor - m are easily handled free - flowing solid which do not generate highly toxic and corrosive free hf , and are therefore compatible with borosilicate glassware and common multipurpose industrial equipment . \n the aforementioned desirable attributes address most of the shortcomings associated with the use of deoxo - fluor and dast . above and beyond handling , safety , and selectivity considerations , xtalfluor - e and xtalfluor - m are easily prepared and cost - effective reagents . \n to a solution of diethylaminosulfur trifluoride ( 8.2 ml , 62 mmol ) in anhydrous 1,2-dichloroethane ( 150 ml ) at room temperature was added , dropwise and under nitrogen , neat bf3thf ( 6.8 ml , 62 mmol ) over a period of 45 min while keeping the reaction temperature below 30 c . \n the suspension was stirred for an additional 30 min and then filtered under a blanket of nitrogen . \n the solid material was rinsed twice with diethyl ether ( 2 50 ml ) and then dried under vacuum to provide 1 ( 12.1 g , 85% ) as colorless crystals : mp 8385 c ( lit.(18 ) mp 7476 c ) ; h nmr ( cd3cn , 300 mhz ) 3.87 ( m , 4h ) , 1.35 ( t , j = 7.2 hz , 6h ) ; f nmr ( cd3cn , 282 mhz ) 12.9 ( m , 2f ) , 151.1 ( s , 4f ) ; c nmr ( cd3cn , 75 mhz ) 45.5 , 12.6 . to a 5 l flange necked flask fitted with magnetic stirrer , temperature probe , bubbler , and nitrogen inlet \n was added dichloromethane ( 150 ml ) and then the flask cooled to 78 c . \n sulfur tetrafluoride ( 70 g , 0.65 mmol ) was subsurfaced while keeping the temperature below 65 c . to the resulting pale purple solution \n was added dropwise a solution of diethylaminotrimethylsilane ( 90 g , 0.62 mol ) in dichloromethane ( 42 ml ) while keeping the temperature below 60 c . \n the resulting solution was allowed to slowly warm to room temperature and stirred overnight . to the resulting dark amber solution \n was added dichloromethane ( 558 ml ) followed by boron trifluoride tetrahydrofuran complex ( 68 ml , 0.61 mol ) dropwise over 30 min keeping the temperature between 15 and 25 c . \n the suspension was stirred for an additional 60 min and then filtered under a blanket of nitrogen . \n the solid material was rinsed with diethyl ether ( 3 150 ml)and then dried under vacuum to provide 1 ( 126 g , 89% ) as off - white crystals : mp 8385 c ; the nmr spectra were identical in all respects to those reported above . to a solution of morpholinosulfur trifluoride \n ( 13.8 ml , 114 mmol ) in anhydrous 1,2-dichloroethane ( 200 ml ) at room temperature was added , dropwise and under nitrogen , a solution of bf3thf ( 12.6 ml , 114 mmol ) in anhydrous 1,2-dichloroethane ( 100 ml ) over a period of 45 min , while keeping the reaction temperature below 25 c . \n the suspension was stirred for an additional 30 min and then filtered under a blanket of nitrogen . \n the solid material was rinsed twice with anhydrous 1,2-dichloroethane ( 2 25 ml ) and then dried under vacuum to provide morpholinodifluorosulfinium tetrafluoroborate ( 25.8 g , 94% ) as colorless crystals : mp 129132 c ( lit.(18 ) mp 104106 c ) ; h nmr ( cd3cn , 300 mhz ) \n 3.903.85 ( m , 8h ) ; f nmr ( cd3cn , 282 mhz ) 10.2 ( s , 2f ) , 151.3 ( s , 4f ) ; c nmr ( cd3cn , 75 mhz ) 65.7 , 48.3 ( br ) . to a solution of triethylamine trihydrofluoride ( 326 l , 2.0 mmol ) in dichloromethane ( 3.0 ml ) at room temperature \n were successively added xtalfluor - e ( 344 mg , 1.5 mmol ) and 3-phenylpropionaldehyde ( 132 l , 1.0 mmol ) . \n after 2 h , the reaction mixture was quenched at room temperature with a 5% aqueous sodium bicarbonate solution and stirred for 15 min , and the resulting mixture was extracted twice using dichloromethane . \n the organic phases were combined , dried over magnesium sulfate , and filtered through a pad of silica gel . \n solvents were evaporated , and the resulting crude material was purified by silica gel flash chromatography using pentane to provide the title compound ( 119 mg , 76% ) as a clear oil : h nmr ( cdcl3 , 300 mhz ) 7.387.22 ( m , 5h ) , 5.65 ( tt , jhf = 56.7 hz , jhh = 4.4 hz , 1h ) , 2.82 ( t , j = 7.7 hz , 2h ) , 2.20 ( m , 2h ) . \n f nmr ( cdcl3 , 282 mhz ) 117.5 ( dt , jhf = 56.7 hz , jhf = 16.9 hz , 1f ) ; c nmr ( cdcl3 , 75 mhz ) 140.2 , 128.9 , 128.6 , 126.7 , 117.0 ( t , jcf = 238.9 hz ) , 35.9 ( t , jcf = 20.5 hz ) , 28.7 ( t , jcf = 6.1 hz ) . to a solution of triethylamine trihydrofluoride ( 163 l , 1.0 mmol ) in 1,2-dichloroethane ( 2.0 ml ) was added at room temperature xtalfluor - m ( 362 mg , 1.5 mmol ) followed by 4-carbethoxycyclohexanone ( 159 l , 1.0 mmol ) , and the reaction mixture was heated to reflux . \n after 2 h , the reaction mixture was cooled to room temperature , quenched with a 5% aqueous sodium bicarbonate solution , and stirred for 15 min , and the resulting mixture was extracted twice using dichloromethane . \n the organic phases were combined , dried over magnesium sulfate , and filtered through a pad of silica gel . \n solvents were evaporated , and the resulting crude material was purified by silica gel flash chromatography using pentane to provide the title compound ( 166 mg , 86% ) admixed with 4-carbethoxy-1-fluorocyclohex-1-ene ( 15:1 ratio respectively ) as a clear oil . \n major compound : h nmr ( cdcl3 , 300 mhz ) 4.11 ( q , j = 7.0 hz , 2h ) , 2.531.61 ( m , 9h ) , 1.23 ( t , j = 7.0 hz , 3h ) ; f nmr ( cdcl3 , 282 mhz ) 94.3 ( d , jff = 237.5 hz , 1f ) , 99.8 ( d , jff = 237.4 hz , 1f ) ; c nmr ( cdcl3 , 75 mhz ) 174.2 , 127.2 ( t , jcf = 241.6 hz ) , 60.5 , 40.5 , 32.5 ( t , jcf = 24.3 hz ) , 25.0 , 14.1 . \n to a solution of triethylamine trihydrofluoride ( 326 l , 2.0 mmol ) and triethylamine ( 139 l , 1.0 mmol ) in dichloromethane ( 3.0 ml ) at room temperature were successively added xtalfluor - e ( 344 mg , 1.5 mmol ) and n - cbz - pyrrolidin-3-one ( 219 mg , 1.0 mmol ) . after 24 h , \n the reaction mixture was quenched at room temperature with a 5% aqueous sodium bicarbonate solution and stirred for 15 min , and the resulting mixture was extracted twice using dichloromethane . \n the organic phases were combined , dried over magnesium sulfate , and filtered through a pad of silica gel . \n solvents were evaporated , and the resulting crude material was purified by silica gel flash chromatography using hexanes / etoac ( 9/1 ) to provide the title compound ( 220 mg , 91% ) as a clear oil : h nmr ( cdcl3 , 300 mhz ) 7.317.26 ( m , 5h ) , 5.08 ( s , 2h ) , 3.733.53 ( m , 4h ) , 2.292.21 ( m , 2h ) ; f nmr ( cdcl3 , 282 mhz ) 102.7 ( m , 2f ) ; c nmr ( cdcl3 , 75 mhz ) 154.6 , 136.5 , 127.6 ( t , jcf = 249.2 hz ) , 127.0 ( t , jcf = 248.7 hz ) , 128.7 , 128.4 , 128.2 , 67.4 , 53.0 ( t , jcf = 32.4 hz ) , 52.9 ( t , jcf = 32.9 hz ) , 43.9 , 34.3 ( t , jcf = 24.4 hz ) , 33.7 ( t , jcf = 23.9 hz ) . to a solution of ( r)-n - cbz-3-hydroxypyrrolidine ( 221 mg , 1.0 mmol , ee > 99.9% ) in dichloromethane ( 3.0 ml ) cooled at 78 c were successively added dbu ( 224 l , 1.5 mmol ) and xtalfluor - e ( 344 mg , 1.5 mmol ) . after being stirred under nitrogen for 30 min , the reaction mixture was allowed to warm to room temperature and stirred for 24 h. the reaction mixture was quenched with a 5% aqueous sodium bicarbonate solution and stirred for 15 min , and the resulting mixture was extracted twice with dichloromethane . \n the organic phases were combined , dried over magnesium sulfate , and filtered through a pad of silica gel . \n solvents were evaporated , and the resulting crude material was purified by silica gel flash chromatography using hexanes / etoac ( 3/1 ) to afford the title compound ( 192 mg , 86% ) admixed with n - cbz-2,5-dihydropyrrole ( 6.9:1 ratio respectively ) as a clear oil . \n major product : h nmr ( cdcl3 , 300 mhz ) 7.377.26 ( m , 5h ) , 5.15 ( d , jhf = 52.5 hz , 1h ) , 5.08 ( s , 2h ) , 3.793.46 ( m , 4h ) , 2.241.91 ( m , 2h ) ; f nmr ( cdcl3 , 282 mhz ) 177.8 ( m , 1f ) ; c nmr ( cdcl3 , 75 mhz ) 154.9 , 136.9 , 128.7 , 128.2 , 128.1 , 93.0 ( d , jcf = 176.8 hz ) , 92.2 ( d , jcf = 176.2 hz ) , 67.1 , 53.0 ( d , jcf = 27.1 hz ) , 52.7 ( d , jcf = 27.1 hz ) , 44.2 , 43.8 , 32.4 ( d , jcf = 57.6 hz ) , 32.1 ( d , jcf = 57.6 hz ) . \n enantiomeric excess was determined to be 98.2% ee ( hplc on a chiralcel oj 250 4.6 mm column , 215 nm , hexanes / ethanol/2-propanol / tfa 1000:20:5:1 , 25 c , 1.2 ml / min , tr = 22.00 min ( major ) , tr = 27.06 min ( minor ) ) .", "role": "user" }, { "content": "diethylaminodifluorosulfinium tetrafluoroborate ( xtalfluor - e ) and morpholinodifluorosulfinium tetrafluoroborate ( xtalfluor - m ) are crystalline fluorinating agents that are more easily handled and significantly more stable than deoxo - fluor , dast , and their analogues . \n these reagents can be prepared in a safer and more cost - efficient manner by avoiding the laborious and hazardous distillation of dialkylaminosulfur trifluorides . unlike dast , deoxo - fluor , and fluolead , xtalfluor reagents do not generate highly corrosive free - hf and therefore can be used in standard borosilicate vessels . when used in conjunction with promoters such as et3n3hf , et3n2hf , or dbu \n , xtalfluor reagents effectively convert alcohols to alkyl fluorides and carbonyls to gem - difluorides . \n these reagents are typically more selective than dast and deoxo - fluor and exhibit superior performance by providing significantly less elimination side products .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: all vitamins are essential for life ; however , the importance of vitamin d , has increased with recent studies.1 ) the reason for this is that it is associated with many chronic diseases and inflammatory processes.2 ) on the other hand , its levels were lower in these conditions . \n naturally , vitamin d deficiency suggests various cardiovascular diseases such as coronary artery disease ( cad ) , heart failure , and hypertension ( ht).2)3 ) according to various studies , these effects are being made via the renin angiotensin aldosterone system ( raas ) . \n there is increasing evidence supporting the role of raas in aneurysm development.4)5 ) aortic aneurysms are related with mortality , and the causes of aneurysms are somewhat unknown.6 ) a variant of them is coronary artery ectasia ( cae ) . \n it is an abnormality of the coronary anatomy and has been characterised as a localized or diffuse non - obstructive lesion of the epicardial coronary arteries , by the enlargement of a diameter at least 1.5 times greater than the diameter of the normal portion of the artery.7 ) the prevalence of cae has been found in up to 5% of patients undergoing coronary angiography.8 ) in the literature , there is a similar study.9 ) however , as previously mentioned , vitamin d levels are already typically low in inflammatory processes . \n nevertheless , chronic diseases involved in the inflammation process could not be excluded in that study . \n also , the small number of their study subjects makes the generalizability of their results debatable . \n thus , we sought to investigate vitamin d in terms of its being a novel marker for patients with cae without any inflammatory processes - aiming to get rid of confusion regarding the treatment of cae . in this way \n in this study , a total of 398 patients were consecutively selected among 4549 patients who underwent coronary angiography for suspected cad in the catheterization laboratory of antalya education and research hospital from september 2014 through february 2015 ( for six months ) and from september 2015 through february 2016 ( for six months ) , so the study was continued for a total of 12 months in two parts . \n the first group consisted of 201 patients ( cae group , 121 males ; mean age , 61.26.4 years ) with isolated cae without significant stenosis . \n the second group consisted of 197 consecutive participants with coronary arteries angiographically shown to be \n normal and without cae ( control group , 119 males ; mean age , 62.45.8 years ) . \n those excluded from this study included patients with any lesions in their coronary angiograms , along with patients with diabetes mellitus ( dm ) , ht , hyperlipidemia ( hl ) , pulmonary diseases ( chronic obstructive pulmonary disease , pneumonia , a history of pulmonary emboli , etc . ) , chronic renal failure , chronic liver disorders , moderate severe valvular disease , a left ventricular systolic dysfunction on echocardiography ( ejection fraction < 50% ) , anemia , pregnancy , obstructive sleep apnea , hematological disorders , a known malignancy , electrolyte imbalance ( an abnormal value of potassium , calcium , sodium , or magnesium ) , a previous gastrectomy , an intestinal malabsorption syndrome , increased high - sensitive c - reactive protein ( hs - crp ) level or any inflammatory process , and also drug history ( including anti - gout agents , anti - inflammatory agents , calcium , vitamin d , and anti - depressive agents ) . \n inflammatory processes were identified as those that increased hs - crp , tnf , il 6 , fibrinogen , white blood cells , or the neutrophil - to - lymphocyte ratio ( nlr ) ; also inclusive of any chronic disease such as dm , ht , and cad for the purposes of this study . since the level of vitamin d differs seasonally due to exposure to sunlight , this study was started in the winter season and was continued up to the end of february . \n this study complied with the declaration of helsinki and was approved by the local ethics committee . \n blood samples were drawn from an antecubital vein before coronary angiography after a 12-hour overnight fast and analysed spectrophotometrically on an ( auto ) architect c16000 clinical chemistry analyzer ( abbott inc . \n fasting blood glucose , blood pressure , hemoglobin a1c ( hba1c ) , creatinine , fibrinogen , thyroid stimulating hormone ( tsh ) , parathyroid hormone ( pth ) , hs - crp , total cholesterol , low - density lipoprotein cholesterol , high - density cholesterol , and triglyceride levels were recorded . \n 25-hydroxy vitamin d levels were measured using biosource 's 25oh - vit d3-ria - ct kit ( biosource europe s.a . \n rue de l'industrie , 8 , b-1400 nivelles , belgium ) . for whole blood count ( hematocrit , hemoglobin , leukocytes , and platelets ) \n , the blood samples were collected in tubes with ethylenediaminetetraacetic acid and analysed on a coulter lh 780 hematology analyzer ( beckman coulter ireland inc . \n , mervue , galway , ireland ) device using the impedance and optic scatter method . the body mass index ( bmi ) \n was calculated by dividing weight in kg by the square of height in meters ( kg / m ) . \n coronary angiograms were performed with a femoral approach using the judkins technique , without the use of nitroglycerin , using the siemens axiom artis dfc ( siemens medical solutions , erlangen , germany ) . \n coronary angiograms were analysed by two blinded interventional cardiologists without the knowledge of the clinical status and laboratory measurements of the participants . according to the results of coronary angiography , significant coronary artery stenosis \n was defined as 50% of major coronary arteries ; also , cae was defined as the segmental or diffuse dilatation of the coronary arteries to a > 1.5-fold diameter of the adjacent segments of the same artery or of different arteries , as following falsetti and carroll.7 ) transthoracic echocardiography was performed on individuals before they were discharged - using the philips epiq 7 model 3d - featured echocardiography device ( philips healthcare 3000 minuteman road andover , ma , usa ) and 2.5 mhz probein antalya education and research hospital cardiology clinic . \n lvef was calculated with a modified simpson method using end - diastole and systole volumes measured by echocardiography . \n data acquired from the study was recorded in spss 22.0 software ( ibm corp . , \n categorical measurements were recorded as numbers and percentages , while continuous measurements were recorded as averages with standard deviations . \n the correspondence of continuous variables with normal distributions was analysed with the shapiro wilk test . \n accordingly , student 's t test and mann - whitney u test were used for determining differences between groups according to the presence of ectasia of these variables . \n we measured sensitivity and specificity values under a receiver operating characteristic ( roc ) curve to find out whether vitamin d measurements were effective in the presence of ectasia . \n univariate and multivariate regression analyses were done to estimate ( with a confidence interval [ ci ] of 95% ) the presence of ectasia by considering age , smoking , white blood cell , fibrinogen , hs - crp , tnf , il 6 , nlr , systolic blood pressure , diastolic blood pressure , hba1c , fasting blood glucose , and vitamin d levels as study parameters . \n in this study , a total of 398 patients were consecutively selected among 4549 patients who underwent coronary angiography for suspected cad in the catheterization laboratory of antalya education and research hospital from september 2014 through february 2015 ( for six months ) and from september 2015 through february 2016 ( for six months ) , so the study was continued for a total of 12 months in two parts . \n the first group consisted of 201 patients ( cae group , 121 males ; mean age , 61.26.4 years ) with isolated cae without significant stenosis . \n the second group consisted of 197 consecutive participants with coronary arteries angiographically shown to be \n normal and without cae ( control group , 119 males ; mean age , 62.45.8 years ) . \n those excluded from this study included patients with any lesions in their coronary angiograms , along with patients with diabetes mellitus ( dm ) , ht , hyperlipidemia ( hl ) , pulmonary diseases ( chronic obstructive pulmonary disease , pneumonia , a history of pulmonary emboli , etc . ) , chronic renal failure , chronic liver disorders , moderate severe valvular disease , a left ventricular systolic dysfunction on echocardiography ( ejection fraction < 50% ) , anemia , pregnancy , obstructive sleep apnea , hematological disorders , a known malignancy , electrolyte imbalance ( an abnormal value of potassium , calcium , sodium , or magnesium ) , a previous gastrectomy , an intestinal malabsorption syndrome , increased high - sensitive c - reactive protein ( hs - crp ) level or any inflammatory process , and also drug history ( including anti - gout agents , anti - inflammatory agents , calcium , vitamin d , and anti - depressive agents ) . \n inflammatory processes were identified as those that increased hs - crp , tnf , il 6 , fibrinogen , white blood cells , or the neutrophil - to - lymphocyte ratio ( nlr ) ; also inclusive of any chronic disease such as dm , ht , and cad for the purposes of this study . since the level of vitamin d differs seasonally due to exposure to sunlight , this study was started in the winter season and was continued up to the end of february . \n this study complied with the declaration of helsinki and was approved by the local ethics committee . \n blood samples were drawn from an antecubital vein before coronary angiography after a 12-hour overnight fast and analysed spectrophotometrically on an ( auto ) architect c16000 clinical chemistry analyzer ( abbott inc . \n fasting blood glucose , blood pressure , hemoglobin a1c ( hba1c ) , creatinine , fibrinogen , thyroid stimulating hormone ( tsh ) , parathyroid hormone ( pth ) , hs - crp , total cholesterol , low - density lipoprotein cholesterol , high - density cholesterol , and triglyceride levels were recorded . \n 25-hydroxy vitamin d levels were measured using biosource 's 25oh - vit d3-ria - ct kit ( biosource europe s.a . \n rue de l'industrie , 8 , b-1400 nivelles , belgium ) . for whole blood count ( hematocrit , hemoglobin , leukocytes , and platelets ) , \n the blood samples were collected in tubes with ethylenediaminetetraacetic acid and analysed on a coulter lh 780 hematology analyzer ( beckman coulter ireland inc . , \n the body mass index ( bmi ) was calculated by dividing weight in kg by the square of height in meters ( kg / m ) . \n coronary angiograms were performed with a femoral approach using the judkins technique , without the use of nitroglycerin , using the siemens axiom artis dfc ( siemens medical solutions , erlangen , germany ) . \n coronary angiograms were analysed by two blinded interventional cardiologists without the knowledge of the clinical status and laboratory measurements of the participants . according to the results of coronary angiography , significant coronary artery stenosis \n was defined as 50% of major coronary arteries ; also , cae was defined as the segmental or diffuse dilatation of the coronary arteries to a > 1.5-fold diameter of the adjacent segments of the same artery or of different arteries , as following falsetti and carroll.7 ) transthoracic echocardiography was performed on individuals before they were discharged - using the philips epiq 7 model 3d - featured echocardiography device ( philips healthcare 3000 minuteman road andover , ma , usa ) and 2.5 mhz probein antalya education and research hospital cardiology clinic . \n lvef was calculated with a modified simpson method using end - diastole and systole volumes measured by echocardiography . \n data acquired from the study was recorded in spss 22.0 software ( ibm corp . , armonk , ny , usa ) . \n categorical measurements were recorded as numbers and percentages , while continuous measurements were recorded as averages with standard deviations . \n the correspondence of continuous variables with normal distributions was analysed with the shapiro wilk test . \n accordingly , student 's t test and mann - whitney u test were used for determining differences between groups according to the presence of ectasia of these variables . \n we measured sensitivity and specificity values under a receiver operating characteristic ( roc ) curve to find out whether vitamin d measurements were effective in the presence of ectasia . \n univariate and multivariate regression analyses were done to estimate ( with a confidence interval [ ci ] of 95% ) the presence of ectasia by considering age , smoking , white blood cell , fibrinogen , hs - crp , tnf , il 6 , nlr , systolic blood pressure , diastolic blood pressure , hba1c , fasting blood glucose , and vitamin d levels as study parameters . box and whisker plot graphing was drawn with medcalc v15.4 packaged software . \n the baseline characteristics of the study groups are shown in table 1 . according to these data , \n the prevalence of cardiovascular risk factors such as age , gender , smoking , and lipid panels did not differ among the groups ( for all , p>0.05 ) . \n also , these groups were similar for bmi , hba1c , fasting glucose panel , blood pressure , lvef , hb , creatinine , and tsh . \n most importantly , inflammatory markers such as hs - crp , tnf , il 6 , fibrinogen , white blood cell , and nlr did not differ among these groups . \n the average pth level of patients was higher than the average pth level of controls ( 41.815.1 pg / ml vs. 19.15.81 pg / ml ; p<0.001 ) . also , the average 25-oh vitamin d level of patients was lower than the average 25-oh vitamin d level of controls ( 14.56.3 ng / ml vs. 24.69.3 ng / ml ; p<0.001 ) ( table 1 ) . \n variables found to be statistically significant in univariate analyses were entered into multivariate logistic regression analysis . \n vitamin d ( odds ratio [ or]=0.818 , 95% ci 0.789 - 0.901 , p<0.0001 ) was independent correlates of the presence of isolated cae ( table 2 ) . \n roc analysis was performed to find out the cut - off value for vitamin d ( fig . \n the cut - off value for vitamin d between the control group and patients was 10.8 and 85.6% sensitivity and 75.2% specificity ( auc : 0.854 , 95% ci : 0.678 - 0.863 ) were observed . \n furthermore , we analysed vitamin d according to statistics values has been shown on the box and whisker plot for all groups ( fig . \n in this study , we investigated the importance of vitamin d in patients with cae without any inflammatory processes . \n this selection should be emphasized , because many chronic diseases fall into this condition and it may affect the role of this marker which projected into our hypothesis . \n as known , the pathophysiology of cae has not yet been fully disclosed , although multiple abnormalities including inflammation , neurohormonal process , vasculitis , and atherosclerosis have been reported.5)10)11)12)13)14 ) it might be a variant of the cad . \n this disease is commonly asymptomatic ; on the other hand , cae can cause angina pectoris and even mi with vasospasm , dissection , or thrombus in patients without cad.15 ) cae occurs 4 times more frequently in males than in females and in individuals who have risk factors for cad , such as smokers and diabetics.16 ) the disease can cause the heart tissue to be deprived of blood and die due to decreased blood flow , and can cause blockages due to blood clots or spasms of the blood vessel.15 ) cae also weakens the coronary arteries ' walls ; thus , they can rupture and result in death . \n the damage can result in angina ( chest pain ) and is a common complaint among these patients.15)16 ) it has been discovered that the disease normally occurs most often in the right coronary artery , followed by the left anterior descending artery , and finally , the left anterior circumflex artery.16 ) as previously mentioned , cae is an inflammatory process,12)13)14)17 ) and there is a study that proves it to be so . \n in a study conducted by yalcin et al.,17 ) there is a significant statistical result between nlr and cae , and it was concluded that we can also evaluate these results by using markis classification.18 ) also , in another study , redcell - distribution ( rdw ) was used as an easily - accessible marker : isik et al.19 ) and guo et al.20 ) proposed some possible mechanistic explanations of the relationship between rdw and cae , and found that elevation in the rdw values is associated with both the presence and severity of the cae . \n furthermore , many markers like homocysteine , folic acid , platelet activity , adhesion molecules , and serum apelin levels21)22)23)24 ) can predict cae and have , in the majority , been reported to do so with statistical significance . in our study , we chose vitamin d to explain the pathophysiology of cae , because the effects of vitamin d on the coronary artery have not yet been fully disclosed . \n vitamin d is a subject of study in many areas of medicine , such as heart disease , endocrine disorders , neurological diseases , and muscle diseases.25)26)27 ) in humans , the most important compounds are vitamin d3 ( also known as cholecalciferol ) and vitamin d2 ( ergocalciferol).28 ) cholecalciferol and ergocalciferol can be taken from the diet and from supplements . also dermal synthesis of vitamin d from cholesterol is dependent on sun exposure . \n vitamin d from the diet or from sunlight - mediated dermal synthesis is biologically inactive ; activation requires enzymatic conversion in the liver and kidney,25 ) so it is necessary to fulfil its function properly in these organs . in many studies , vitamin d ( like cae ) \n many of the studies have emphasized that vitamin d reduces oxidative damage.22)24 ) in the study which is similar to ours , the relationship between vitamin d and cae has been emphasized ; but in the study population , inflammation processes could not be ruled out.9 ) in our study , we have also used nlr . \n we have seen , in many studies of markers other than the traditional markers , an exclusion of inflammation processes . \n as has been known , vitamin d deficiency has been associated with augmented raas activity4 ) and then raas activation in creating a thinning of the vessel wall , so this reveals aneurysmal formations . however \n , some studies have shown that impact of raas is often associated with inflammation.4 ) so basically , there is a need to search for a foundation of pathophysiology other than inflammation . \n therefore , our study design is comparatively more suitable for such a marker . in our study , inflammatory chronic diseases such as ht , \n dm , hl and cad were excluded so that hs - crp , tnf , il 6 , white blood cells , and nlr intended to show inflammatory activity was not statistically different . moreover , we have not seen any signs of inflammation - which was a confounding factor for the role of raas or vitamin d cae pathophysiology . on the other hand , \n the study by koli and keski - oja29 ) made the connection that a relationship exists between vitamin d and serum proteolytic enzymes . \n as is known , aneurysmati segments demonstrate a marked degradation of the medial collagen and elastin fibers - with disruption of the internal and external elastic lamina . \n these findings , in association with the observation that cases in which the media was intact and uninvolved had no evidence of ectasia , suggest that the enzymatic degradation of the media may be a key component in the pathogenesis of coronary ectasia.8 ) so , classes of proteolytic enzymes such as cystein proteinases and serine proteinases may play an important role in the pathogenesis of coronary ectasia.30 ) in our study , the vitamin d levels of the cae patients were significantly lower than those of the control group . and the ipth levels of cae patients were higher than those of the control group . \n this finding showed that vitamin d might have a pathophysiological mechanism which acts independently of the inflammatory process 's role in developing coronary ectasia or possibly other vascular aneurysms . \n we found that there is an association between vitamin d and cae in patients who had no inflammatory processes . \n our study may provide evidence for the role of vitamin d as being a non - inflammatory factor in the pathophysiology of cae . \n the most important limitation of our study was its being a cross - sectional study . \n because of this , we could not perform an analysis related to long - term events . \n we found that there is an association between vitamin d and cae in patients who had no inflammatory processes . \n our study may provide evidence for the role of vitamin d as being a non - inflammatory factor in the pathophysiology of cae . \n the most important limitation of our study was its being a cross - sectional study . because of this", "role": "user" }, { "content": "background and objectivesvitamin d is generally known to be closely related to inflammation . \n the effects of vitamin d on coronary artery disease ( cad ) are not fully explained . \n nowadays , coronary artery ectasia ( cae ) cases are common and are regarded as being a kind of cad . \n we aimed to investigate , in a case - control study , the relationship between vitamin d and cae without an associated inflammatory process.subjects and methodsthis study population included 201 patients ( cae group , 121 males ; mean age , 61.26.4 years ) with isolated cae ; and 197 healthy individuals ( control group , 119 males ; mean age , 62.45.8 years ) , comprising the control group , who had normal coronary arteries . \n these participants concurrently underwent routine biochemical tests , tests for inflammatory markers , and tests for 25-oh vitamin d in whole - blood draws . \n these parameters were compared.resultsthere are no statistical significance differences among the groups for basic clinical characteristics ( p>0.05 ) . \n inflammatory markers were recorded and compared to exclude any inflammatory process . \n all of them were similar , and no statistical significance difference was found . the average parathyroid hormone ( pth ) level of patients was higher than the average pth level in controls ( 41.815.1 pg / ml vs. 19.15.81 pg / ml ; p<0.001 ) . also , the average 25-oh vitamin d level of patients was lower than the average 25-oh vitamin d level of controls ( 14.56.3 ng / ml vs. 24.69.3 ng / ml ; p<0.001 ) . in receiver \n operating characteristic curve analysis , the observed cut - off value for vitamin d between the control group and patients was 10.8 and 85.6% sensitivity and 75.2% specificity ( area under the curve : 0.854 , 95% confidence interval : 0.678 - 0.863).conclusionwe found that there is an association between vitamin d and cae in patients who had no inflammatory processes . \n our study may provide evidence for the role of vitamin d as a non - inflammatory factor in the pathophysiology of cae .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: there is emerging evidence that time to biochemical failure is a robust prognostic factor for prostate cancer mortality and overall mortality in men receiving definitive radiotherapy [ 13 ] . \n interval to biochemical failure is also highly prognostic for prostate cancer mortality in men undergoing prostatectomy . \n one cause of early biochemical failure is occult micrometastatic disease present at time of treatment . \n regardless of efficacy of local treatment , individuals with occult metastases often have early recurrence with relatively poor prognosis , due to unappreciated stage iv disease at presentation . \n early biochemical failure can also occur in men with strictly localized disease , if local therapy is inadequate to provide even short term local control . \n this can be due to radioresistant local disease , inadequate radiation dose delivered , inadequate surgical margin or deficient radiation targeting . \n as with early failures , late failures can be caused either by more gradual progression of slow growing occult metastatic disease or gradual recurrence of partially treated local disease . in modern radiation therapy literature , there continues to be a relatively large number of late failures ( > 4 years ) , even with dose escalation to 78 gy or over 80 gy [ 5 , 6 ] . \n the purpose of this paper is to explore whether further dose escalation would lead to a decrease in late failures . \n if so , particularly for high risk patients , this might suggest that the preponderance of late failures in recent studies may represent incomplete ability to eradicate local disease rather than high incidence of slow growing occult metastases at presentation . in this paper \n , we examine a cohort of men who received high local radiation doses for clinically localized prostate cancer . \n consistently , high implant d90s with sizeable margins were utilized for all patients , and the majority of intermediate risk and almost all high risk patients received supplemental external beam radiation . \n our goal was to explore patterns in time to failure in men receiving high local radiation doses to better understand the role of improved local control and the implications for long term prostate cancer outcomes . \n we also hope to provide some insight into the question of what portion of patients ( particularly high risk patients ) are potentially curable , in effect , without viable metastatic disease at presentation . \n from march 1995 till july 2010 , 2234 consecutive patients underwent definitive permanent interstitial brachytherapy by a single brachytherapist ( gsm ) . \n all biopsy samples were reviewed by a single pathologist ( ea ) to minimize inconsistencies in pathologic grading . \n pre- planning technique , intraoperative approach and dosimetric evaluation have been described in detail [ 7 , 8 ] . categorized by national comprehensive cancer network ( nccn ) risk group , the cohort consisted of 785 men with low risk , 1098 with intermediate risk , and 351 men with high risk disease . of \n the 2234 patients , 1111 ( 50.3% ) received supplemental external beam radiotherapy and 748 ( 33.5% ) received androgen deprivation therapy . \n supplemental external beam and androgen deprivation was utilized primarily for intermediate and high risk patients . \n supplemental external beam was delivered to 69.6% and 96.3% of intermediate and high risk patients , respectively . \n androgen deprivation therapy ( adt ) was used in 27.4% and 71.8% of intermediate and high risk patients . when employed , supplemental external beam radiotherapy was generally used in a dose of 45 - 50.4 gy covering prostate , seminal vesicles , and at - risk pelvic nodes . \n adt , when utilized , was initiated 3 months prior to implantation , and consisted of a luteinizing hormone - releasing hormone ( lhrh ) agonist and an anti - androgen . \n indications for adt were prostate cytoreduction prior to implant and for men with higher risk disease . for prostate implants , \n the target volume ( ptv ) was the prostate plus a periprostatic margin of 4 - 5 mm , except posteriorly to limit rectal dose . \n median prostate volume was 32.0 cm , while the median planning volume was 60.6 cm . \n the primary radionuclide utilized was pd ( theragenics model 200 ) , while the other radionuclide i ( amersham model 6711 and its stranded form ) was not implanted after 2003 . \n the overall population mean d90 ( minimum dose received by 90% of the ptv ) was 119.1% of prescription dose . \n these relatively large d90 and v100 values have been associated with improved treatment outcomes [ 9 , 10 ] . biologically effective \n dose ( bed ) was calculated using the algorithm recommended by american association of physicist in medicine ( aapm ) task group 137 to provide consistency in radiobiological comparisons between institutions . \n this consensus group recommends a uniform set of algorithms and radiobiological indices to facilitate consistency in routine outcome reporting . \n the task group values used in this work were : = 0.15 gy , = 0.05 gy , / = 3.0 gy , tpot = 42 days , and repair half - life = 16 min . \n the brachytherapy bed was based on the day 0 d90 , and the total bed added any contribution from external beam radiation . \n patient demographics and treatment details are provided in table 1 , which is stratified by national comprehensive cancer network ( nccn ) risk groups . \n patients were monitored by physical examination including digital rectal examination , and serum psa determination at 3 and 6 months intervals . \n patient survival was confirmed for all patients not only by psa reports , but also by frequent quality of life surveys ( qol ) ( by telephone or occasionally mail ) at least 25 times during the first five years following brachytherapy , and never less than twice per year thereafter . \n the primary outcome measures were time to biochemical failure , time to distant metastases , and time to prostate cancer death . \n we also assessed percent of men with biochemical failure who ultimately progressed to metastases or prostate cancer death , and the time from biochemical failure to those outcomes . \n patients with metastatic prostate cancer or castrate resistant disease without obvious metastases who died of any cause were classified as dead of prostate cancer . \n all other deaths were attributed to the immediate cause of death . in our population , \n 40% of deaths were attributable to cardiovascular disease , 33% to non - prostate cancer deaths , 8% to respiratory disease , 4% to prostate cancer , and 15% to other causes . \n clinical parameters of the study population , stratified by nccn risk classification psa values only for non - biochemical failures , n = 2131 based on 1431 with testosterone values nccn national comprehensive cancer network , iqr inter quartile range , psa prostate specific antigen , \n bmi body mass index , bed biologically effective dose based on brachytherapy day zero d90 any external beam , adt androgen deprivation therapy , xrt external beam radiation therapy continuous clinical and treatment variables were compared across groups , using one - way analysis of variance ( anova ) . \n biochemical survival , metastases free survival , cause specific mortality , and all cause mortality were determined using cumulative incidence and cumulative survival curves . with the population stratified by low , intermediate , and high risk disease , biochemical failure rates were determined by competing risk analysis where non - prostate cancer death was the competitor . \n significant predictors for prostate specific , biochemical progression free , and overall survival were first determined by univariate regression analysis , and those variables with p < 0.010 were included in multivariate analysis . \n all statistical analyses used stata version 13.0 software ( statacorp , college station , tx , usa ) , and statistical significance was defined a p < 0.05 . \n for the population , 10 year overall mortality and competing risk adjusted biochemical failure , and cause - specific mortality were 22.5% , 4.4% , and 1.3% , respectively ( fig . \n no metastases developed after 5 years , and the cumulative incidence of distant metastases at 5 years and beyond was 1.4% . \n the cumulative ten year competing risk adjusted biochemical failure rate for men with low , intermediate , and high risk disease was 1.3% , 4.8% , and 10.0% , respectively ( fig . \n probabilities for all - cause mortality , biochemical failure , and cause - specific mortality are summarized at 10 years and 15 years post implant for the 2,234 patients in the population cumulative incidence of biochemical failure with non - prostate death as a competing risk , stratified by nccn risk group , is summarized at 5 , 10 , and 15 years post implant . \n the number of patients remaining at risk in four year increments is listed at the top , stratified by risk group because completeness of follow up influences the validity of survival curves , table 2 lists mean days since last contact of living patients for mortality and days since last psa for biochemical failure . \n the mean elapsed days since last patient contact ( 64 117 days ) , and last psa ( 123 164 days ) were considerably greater than the medians ( 50 days and 99 days , respectively ) because of a few outliers . for survival status , \n only 11 of 1713 living patients had not been contacted in the year preceding database closure . \n nine of the eleven had either advanced dementia or were dying from a disease other than prostate cancer , and the patient or caregiver felt that further follow up and psa testing were pointless . \n for biochemical survival follow up , psa testing was more than one year delinquent in 57 of 1664 living , non - failed men . \n the most common reason for non - compliance was the inconvenience and expense of testing , followed by perceived futility among those dying from non - prostate causes . \n time dependent outcomes stratified by nccn risk group elapsed days from last patient contact to database closure on 25 jul 2013 for all living patients ( 11 of 1713 living patients had not been contacted in the year prior to database closure ) elapsed days from last psa to database closure on 25 jul 2013 for all living , non - biochemical failures ( 57 of 1664 patients had not had a psa determination in the year prior to database closure ) nccn national comprehensive cancer network , sd standard deviation , psa prostate specific antigen there was no biochemical failure in any of the 745 patients followed for more than 9.2 years , out to the maximum psa follow up of 18.2 years . \n the median ttf among the biochemical failures was 2.6 years , and there was no significant difference between risk groups ( p = 0.077 ) where the mean ttf for low , intermediate , and high risk men was 2.5 1.8 , 3.2 2.0 , and 2.3 1.5 years , respectively . \n overall , 82.6% of biochemical failures occurred within the first four years after treatment . in men with low and intermediate risk disease ( fig . \n 3 ) , 79.3% of biochemical failures occurred within the first four years , compared to 88.2% of failures in men with high risk disease ( fig . \n time to failure histogram for the 58 biochemical failures in low and intermediate risk patients time to failure histogram for the 34 biochemical failures in high - risk patients in men who died from prostate cancer , the median time from treatment failure to death was 4.2 years . \n table 3 consists of univariate and multivariate analyses of cause - specific , biochemical progression free , and overall survival . of the eight variables identified as significant predictors of biochemical progression free survival , six of them psa , gleason score , clinical stage , percent positive biopsies , and adt duration \n only two of the 15 variables included in the multivariate analysis were significant predictors : age at implant and tobacco use . \n univariate and multivariate analysis of cause - specific , biochemical progression free , and overall survival in the study population of 2234 patients competing risk regression hr \n hazard ratio , psa prostate specific antigen , bmi body mass index , bed biologically effective dose , adt \n early failure after definitive prostate cancer treatment was significantly more common in the 1990s when lower radiation doses were employed . \n landmark 1998 paper comparing biochemical outcomes between prostatectomy , surgery and brachytherapy , the authors report on high risk men treated with 66 gy of radiotherapy without adt . over 50% of men had failed therapy before 3 years . \n beaumont patients , primarily gleason 7 , treated to a median dose of 66.6 gy . \n they found a median time to failure of less than two years , with a failure rate approximating 50% at three years and relatively few failures after that time . \n these high rates of early local failure were likely due to both the more advanced disease common during that era , and to the inadequacy of 66 gy to reliably eradicate local disease . the increase in radiotherapy dose to 70 gy with and without the addition of androgen deprivation , led to a decrease in early failures . \n in the milestone eortc trial published by bolla et al . , which demonstrated the survival advantage of androgen deprivation combined with 70 gy radiotherapy , biochemical failures were relatively uncommon in either arm in the first three years . \n however , ultimate biochemical failure rates were high , with the significant majority of treatment failures occurring in the fourth year and later . at 3 years , biochemical failure was approximately 15 - 20% in both arms . \n however , by year 8 , failure rates were approximately 50% in the adt arm and 80% in the radiotherapy only arm . \n as radiation doses have been increased , the overall rate of treatment failure has decreased , though the proportion of late treatment failures remains high . \n , compared men receiving 70 gy to those receiving 78 gy . with dose escalation , early treatment failures were uncommon ; the overall number of treatment failures decreased ; and the number of late failures decreased . \n the prog dose escalation study has shown similar results , with the significant majority of low and intermediate risk failures occurring in the fourth year or later in the high dose arm . \n recently , zelefsky et al . reported on their prospective dose escalation , comparing men treated to < 81 gy , with those treated up to 86.4 gy . \n they found a modest decrease in treatment failures within the first four years , with a more prominent decrease in later failures . nonetheless , even at doses > 81 gy , the vast majority of failures occurred after four years , whether or not androgen deprivation was used . \n and overall treatment failure at ten years remained high at approximately 25% for intermediate risk patients and 45% for high risk patients . in high risk patients , the combination of moderate dose external beam radiation therapy , a brachytherapy boost and adt decreases biochemical failure and prostate cancer deaths , when compared to patients treated with external beam and adt . \n these findings demonstrate that some early failures and many late failures can be eliminated with dose escalation to approximately 80 gy , presumably because many of the failures at lower doses were related to inadequate local disease control . \n however , the preponderance of late failures even at dose levels of 78 - 86 gy , leaves open the question as to whether men in those studies had occult metastases at presentation or were potentially curable with even further dose escalation . with mean and median brachytherapy day 0 implant d90s of 119% , generous margins with the prostate volume expanded by a factor of 1.9 to the planning volume , and extensive use of supplemental external beam radiotherapy , the patients in our implant population received relatively high dose escalation . using the aapm radiobiological formalism \n , 86.4 gy of prostate external beam radiation has a bed of 131 gy , while the mean total bed for our population ranged from 133 gy for low risk men to 157 gy , and 164 gy in intermediate and high risk men , respectively ( table 1 ) . in patients with positive biopsies at the prostate base treated with brachytherapy monotherapy at m.d . \n anderson , the 10-year biochemical progression free survival as 93.5% , and all failures occurred prior to 6 years . a much larger population in a recent report by morris et al . on brachytherapy monotherapy in low and intermediate risk patients with median and maximum follow up of 7.5 years , and \n 13 years had 16% of failures occurring at < 3 years and 10% > 8 years . \n using only i seeds , their mean d90 was 151 gy which translates to an aapm bed of 116 gy . in our low to intermediate risk cohort , 58.6% ( 34/58 ) of failures were within 3 years , while only 2 patients failed after 8 years . \n our rate of early treatment failures is roughly similar to the rates in the more recent external beam dose escalation studies . \n however , the rate of late treatment failures is much lower in our series than in those studies . \n the recent dose escalated external beam series have a high proportion of treatment failures five or more years after treatment ; whereas 91% ( 84/92 ) of treatment failures in our series occurred within the first 5 years . \n this supports the hypothesis that in modern cohorts , even among men with high risk disease , the number of men who experience early failures and are \n as well , it would appear that most late treatment failures in current dose escalated external beam series are not the result of untreated occult metastases ; but more likely due to inadequate dose escalation . \n we view this optimistically , that with current combined modality dose escalation techniques , outcomes for high risk and intermediate risk patients can be significantly improved through a reduction of late failures . \n this builds on a line of reasoning dating back to fuks et al . in 1991 , who found that even in men undergoing retropubic brachytherapy implants , durable local control led to a substantial reduction in development of metastases \n the strengths of this work are that low , intermediate and high risk patients were treated with a consistent implant philosophy and pattern of dose escalation , that the dose escalation parameters were well documented , and that no patients were lost to follow up . in general \n , lower risk patients received high quality brachytherapy - alone with day 0 d90s of approximately 120% . \n higher risk patients received supplemental external beam radiotherapy , followed by equally high quality implants with day 0 d90s of approximately 120% . \n one limitation is that this study was not a randomized trial comparing ttf between dose escalated brachytherapy with and without external beam radiotherapy versus dose escalated external beam radiotherapy alone . \n in addition , although the premise that early biochemical failures are due to subclinical distant metastases at diagnosis , this remains unproven due to the inability of current radiographic technologies to identify such early metastatic disease . \n nevertheless , based on the results above , we feel comfortable with the conclusion that there is a low burden of micro - metastatic disease at presentation in modern day patient cohorts similar to ours ; and that effective dose escalation with brachytherapy can lead to very successful treatment outcomes . \n the strengths of this work are that low , intermediate and high risk patients were treated with a consistent implant philosophy and pattern of dose escalation , that the dose escalation parameters were well documented , and that no patients were lost to follow up . in general \n , lower risk patients received high quality brachytherapy - alone with day 0 d90s of approximately 120% . \n higher risk patients received supplemental external beam radiotherapy , followed by equally high quality implants with day 0 d90s of approximately 120% . \n one limitation is that this study was not a randomized trial comparing ttf between dose escalated brachytherapy with and without external beam radiotherapy versus dose escalated external beam radiotherapy alone . \n in addition , although the premise that early biochemical failures are due to subclinical distant metastases at diagnosis , this remains unproven due to the inability of current radiographic technologies to identify such early metastatic disease . nevertheless , based on the results above , we feel comfortable with the conclusion that there is a low burden of micro - metastatic disease at presentation in modern day patient cohorts similar to ours ; and that effective dose escalation with brachytherapy can lead to very successful treatment outcomes . \n aggressive radiation dose escalation provided by brachytherapy for men with low , intermediate , and high risk disease leads to low levels of late treatment failures . \n this supports the hypothesis that the great majority of prostate cancer patients , even those with high risk disease are without micro - metastatic disease on presentation , and therefore are potentially curable with adequate dose escalation . \n ", "role": "user" }, { "content": "purposeto explore patterns of time to failure in men receiving high doses of permanent seed brachytherapy with or without external beam radiation therapy as a function of risk status.material and methodstwo thousand two hundred and thirty four patients were treated with prostate brachytherapy with median follow up of 8.0 years . \n the population was 35% low risk , 49% intermediate risk , and 16% high risk ( nccn ) . \n median day 0 implant d90 was 119% and v100 was 98% . \n treatment failure was defined as psa > 0.40 ng / ml after nadir . \n rates of biochemical failure , distant metastases , and prostate cancer death were determined with non - prostate death as a competing risk.resultsfor all patients , the 10-year biochemical failure , distant metastases , and cause - specific mortality were 4.4% , 1.4% , and 1.3% , respectively . \n the biochemical failure rates were 1.3% , 4.8% , and 10.0% for men with low , intermediate , and high risk disease , respectively . \n median time to failure was 2.8 years . in men who died from prostate cancer , \n the median time from treatment failure to death was 4.2 years . \n overall , 83% of biochemical failures and 97% of metastases occurred within the first 4 years after treatment.conclusionswith the dose escalation achieved by high quality brachytherapy dosimetry , even high - risk prostate cancer patients have excellent long term biochemical outcomes . \n treatment failures occur early , and one third become metastatic and progress rapidly to prostate cancer death . \n the low frequency and pattern of failures suggest the presence of micrometastatic disease prior to treatment is rare , even in high risk patients .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the introduction of caries by miller , over the past 115 years there has been remarkable changes in understanding dental caries.1 traditional approaches to management of caries like extraction , restoration , and modern methods like fluorides , minimal invasive dentistry , remineralizing agents has been tried . \n this helped in removal or reconstruction of the tooth structure.2 it is been proved that streptococcus mutans are the main causative organism for dental caries.3 traditional approaches does not reduce caries causing organisms in the oral cavity . \n hence , a newer approach being tried and been successful in reducing caries causing organisms is the use of probiotics.4 probiotics are defined as living microorganisms , principally bacteria , which are safe for human consumption and when ingested in sufficient quantities , have beneficial effects on human health , beyond basic nutrition.5 their ability to survive in acidic environment , which is present during carious attack on the tooth made probiotics a choice to interact with these organisms.6 the most studies and proved beneficial probiotic organisms are lactobacilli and bifidobacteria . probiotics basically replace the pathogenic bacteria by non - pathogenic . hence , this is also called as replacement therapy.7 probiotic organisms are mainly delivered through dairy products which are easily available and it should be easily accepted by people and especially children . \n various studies compared usage of probiotics in dairy products such as cheese , yogurt , ice cream , and milk but compared with placebos or similar non - probiotic products . \n ideal suitable vehicle is yet to be identified.8 comparative studies of probiotic products are very less and also benefits of probiotic organisms on adult oral cavity are less explored . in this study , we compare two probiotic products ice cream and drink on salivary s. mutans level in children of 6 - 12 years age group . \n the study design was explained to the district educational officer and also the school headmaster and permission was taken to conduct the study . \n general screening was done in children of age group 6 - 12 years of urban school and 50 children were included for the study and consent for the same was taken from the parents . \n selected children were from the same locality and had a single source of drinking water supply with 0.4 ppm of fluoride . \n the children with any recent history of dental treatment , systemic antibiotics or topical fluoride treatments 3 months prior to baseline , habitual use of dairy probiotics , xylitol chewing gums , severe medical conditions , and who are allergic to dairy products were excluded from the study . \n 50 children between 6 and 12 years of age and with zero decayed missing filled teeth ( dmft)/dmft index based on who criteria9 were selected as a sample for the study . \n these children were randomized into two groups and diet instructions ; oral hygiene maintenance was given and told to continue during the study period . \n on the next day 2 ml of unstimulated saliva was taken from each of the participant in 5 ml disposable sterile container during 10 - 11 am of school hours . \n the saliva sample collected was subjected to microbial analysis by taking 10 ul of saliva sample in 4 mm internal diameter inoculation loop and streaking on freshly prepared mitis salivarius agar culture plates and inoculated for 48 h. colonies were identified by gram - staining and were counted using manual colony counter . \n colonies were expressed as the number of colony forming units per ml ( cfu / ml ) of saliva . by multiplying the actual colony count by 1 103 semi quantification of the number of colonies was done . \n average s. mutans counts at baseline , 7 days , and after 90 days . for the next 7 days group \n a was given 54 g of probiotic ice cream ( amul ) and group b was given 65 ml of probiotic drink ( yakult ) continuously . the probiotic ice cream used in this study was prepared by adding a freeze dried culture of probiotic strains of bifidobacterium lactis bb-12 and lactobacillus acidophilus la-5 and manufactured by amul india pvt . ltd . \n , ( anand , gujarat , india ) . the probiotic ice cream contained 1 106 cfu of each probiotic strains.10 the probiotic drink used had 6.5 billion lactobacillus casei strain shirota , manufactured by yakult danone india pvt . \n un - stimulated saliva was collected next day after the study period , inoculated , colonies were counted after incubation . \n a washout period of 90 days were given and in this period children were instructed to maintain their oral hygiene as per the instructions given . after washout period , \n the data thus obtained subjected to statistical analysis using student s paired t - test and turkey s honest significant difference ( hsd ) test was applied for multiple comparisons . \n data obtained from baseline , after 7 days and 90 days of washout period were arranged and tabulated ( table 1 ) . \n the study revealed that there was significant reduction of salivary s. mutans levels in both groups after study period ( p < 0.001 ) , but after washout period there was no significant difference or decline in the s. mutans levels . \n though in children who consumed probiotic ice cream even after the washout period there was a significant reduction of salivary s. mutans levels compared to the baseline readings ( table 2 ) . \n multiple comparisons were done by turkey s hsd test which showed that there was a significant reduction of salivary s. mutans from baseline to 7 days after the ingestion of probiotic ice cream and drink ? \n after the washout period , there was no significant reduction in s. mutans levels in both the groups . \n when compared to the baseline data in children who consumed probiotic ice cream there was a significant reduction in salivary s. mutans levels . \n however , there was no significant reduction seen in children who consumed probiotic drink ( table 2 ) . \n these comparisons suggest that both probiotic ice cream and drink reduced the salivary s. mutans level in the children during the study period . \n however , after the washout period both the groups showed no significant reduction ( graph 1 ) . \n moreover , also both probiotic ice cream and drink showed no significant difference in their effects in reducing the s. mutans levels in the oral cavity . \n probiotic microorganisms such as some lactobacillus spp . have been described as promoting a healthy digestive system and immune modulation . \n there is reasonable evidence that some probiotic species may also have a beneficial effect on oral health.10,11 l. casei strains shirota ( lcs ) is one of the most studied probiotic strains with scientifically proven health benefits.11 various studies have been performed to validate the survival and positive effects of probiotic bacteria , b. lactis bb-12 within the human body , including immune response and gastrointestinal health in young children,12,13 but research concerning probiotics and dental health is limited . \n the main probiotic preparations currently on the market are the lactic acid - producing bacteria are bifidobacterium and lactobacillus.6 \n lactobacillus rhamnosus is safe and useful in its intended uses as a functional food or ingredient its storage stability in refrigerated milk - based foods was proved excellent.14 probiotics are mainly supplied in various dairy products such as yogurt , ice cream cheese , and drink . \n the acceptance of these products by children or adults depends on the taste and availability . \n probiotics create a biofilm which acts as a protective lining for tissues and keep pathogens away , with no host environment for pathogens.15 studies done on probiotic approach were first to the alteration of the gut flora and were successful . \n similarly , it was tried to alter the microbial flora of the oral cavity , in reducing the oral diseases , especially caries and found successful mainly in reducing the levels of s. mutans species.13 when probiotics were added while oral biofilm formation , lactobacillus species strongly inhibited the growth of the s. mutans.14,15 limited studies have been conducted on the comparison of various probiotic organisms or the foods on caries causing bacteria . \n hence in our study , we compared the efficacy of two probiotic food products and their effects on bacteria levels in the oral cavity , which mostly causes dental caries . \n the prevalence of dental caries is rising in india in children with age groups 6 - 12 , hence we selected that age group for the study.16 to avoid any bias we included children with zero dmft / dmft score . \n even though , the ideal vehicle is not concluded for probiotics ice cream is one of the most liked dairy products by children and to compare with another probiotic non - dairy product the probiotic drink is used . by conducting the study \n , we found out that in children who consumed probiotic ice cream showed significance reduction ( p < 0.001 ) of salivary s. mutans levels after 7 days of the study period . \n after the washout period of 90 days , there was a significant reduction of s. mutans level compared to baseline , but after study period there was no significant reduction ( table 2 ) . \n this result is similar to other studies done using ice cream as vehicle.17 - 19 sutula et al . \n found in their study that utilization of the lcs select medium revealed a significant but temporary and consumption - dependent presence of lcs in saliva and tongue plaque samples from healthy dentate individuals.20 a double - blind , placebo - controlled trial demonstrated that consuming yogurt with lactobacillus \n reuteri significantly reduced the oral carriage of mutans streptococci , compared with the placebo yogurt.21 studies done on probiotic containing milk showed that reduction in s. mutans levels significantly after use.22 - 24 in this study , of children who consumed probiotic drinks , there was a significant reduction of s. mutans level after the study period ( table 2 ) . \n however , there was no significant reduction when compared to the baseline data or levels after the washout period . \n similar to the study by sutula el al.20 when comparison of efficiency of ice cream and drink being used as vehicle both showed no significant difference in their effects after study period and also after washout period ( table 1 ) when baseline data were compared after 90 days of washout period there was significant reduction in s. mutans levels in children who consumed probiotic ice cream but this was not seen in the case of drink ( table 2 ) . \n it can be said that probiotic organisms have a definitive effect in reducing salivary s. mutans level and can be used as a caries control method . \n as the vehicle in this study ice was better and effective than drink and it was more liked by children . \n long term studies with more population is needed and long term use of ice cream as a vehicle have to be justified .", "role": "user" }, { "content": "background : dental caries is one of the most common health problems in the world . \n probiotics are one the various preventive methods to reduce dental caries . \n the aim of this study is to compare the effectiveness of probiotic ice cream and drink on salivary streptococcus mutans levels in children of 6 - 12 years age group.materials and methods : a three phase study was carried out in children ( n = 50 ) of 6 - 12 years age with zero decayed missing filled teeth ( dmft)/dmft . \n they were randomly divided into two equal groups . \n saliva samples were collected before the consumptions of probiotic ice cream and probiotic drink . \n colony count obtained was recorded as baseline data . \n for both groups probiotic ice cream and drink was given randomly for 7 days and a washout period of 90 days were given and then the saliva samples were collected and colony counting was done.results:statistical analysis was performed using student s paired t - test and multiple comparisons by tukey s honest significant difference test which showed , there is a significant reduction in salivary s. mutans level in both groups after 7 days period . \n however , after washout period only probiotic ice cream showed reduction whereas drink did not . \n also , there was no significant difference between probiotic ice cream and drink.conclusion:probiotic organisms definitely have a role in reducing the salivary s. mutans level and ice cream would be a better choice than drink . \n however , the prolonged use of the agents and their effects on caries is still to be determined .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the success of pig production systems , including the evaluation of alternative management and marketing strategies , requires knowledge of the body weight behavior over time , commonly referred to as the growth curve . \n this knowledge allows the assessment of growth characteristics in actual production situations and translates this information into economic decisions . \n differences among animal growth curves partly reflect genetic influences , with multiple genes contributing at different levels to the overall phenotype . \n hence , selection strategies that attempt to modify the growth curve shape to meet demands of the pork market are very relevant . in the current post - genomic era , understanding the genomic basis of pig growth can not be limited to simply estimating marker effects using body weight at a specific time as a phenotype , but must also consider changes in body weight over time . according to pong - wong and hadjipavlou ( 2010 ) and ibez - escriche and blasco ( 2011 ) this can be done by estimating the marker effects for parameters of nonlinear regression models that are widely used to describe growth curves . \n regardless of the phenotype used , a major challenge in genome - wide selection ( gs ) is to identify the most powerful statistical methods for predicting phenotypic values based on estimates of marker effects . since the seminal gs paper by meuwissen et al . \n ( 2001 ) , several studies have compared the efficiency of simple methods , such as the rr - blup ( random regression blup ) ( meuwissen et al . , 2001 ) , with more sophisticated methods , such as bayesian lasso ( bl ) ( de los campos et al . , 2009 ) . \n the main difference between these two very popular gs methods is that the first one assumes , a priori , that all loci explain an equal amount of genetic variation , while the second one allows the assumption that each locus explains its own amount of this variation . \n although these two methods have already been compared in other studies , so far there has been no comparison of these methods using a major gene , such as the halothane gene in pigs ( fujii et al . , \n in addition , these methods have not yet been applied to the analysis of growth curves in conjunction with nonlinear regression models . in this study , we compared the accuracies of rr - blup and bl for predicting genetic merit in an empirical application using weight - age data from an outbred f2 ( brazilian piau x commercial ) pig population ( silva et al . , 2011 ) . in this approach , \n the phenotypes were defined by parameter estimates obtained with a nonlinear logistic regression model and the halothane gene was considered a single nucleotide polymorphism ( snp ) marker in order to evaluate the assumptions of the gs methods in relation to the genetic variation explained by each locus . \n genomic growth curves based on genomic estimated breeding values were constructed and the most relevant snps associated with growth parameters were identified . \n the phenotypic data was obtained from the pig breeding farm of the department of animal science , universidade federal de viosa ( ufv ) , mg , brazil . a three - generation resource population was created and managed as described by band et al . \n briefly , two naturalized piau breed grandsires were crossed with 18 granddams from a commercial line composed of large white , landrace and pietrain breeds , to produce the f1 generation from which 11 f1 sires and 54 f1 dams were selected . \n these f1 individuals were crossed to produce the f2 population , of which 345 animals were weighed at birth and at 21 , 42 , 63 , 77 , 105 and 150 days of age . the use of these animals was reviewed and approved by the bioethics committee of the department of veterinary medicine ( dvt - ufv ) in agreement with the guide to the care and use of experimental animals of the canadian council on animal care . \n the snps used for fine mapping and estimation of marker effects were selected based on their spacing within chromosomes that contained quantitative trait loci ( qtl ) previously identified in this same population . \n these markers were distributed as follows : ssc1 ( n = 56 ) , ssc4 ( n = 54 ) , ssc7 ( n = 59 ) , ssc8 ( n = 30 ) , ssc17 ( n = 25 ) and sscx ( n = 12 ) , with the average distances ( cm ) being , respectively , 5.17 , 2.37 , 2.25 , 3.93 , 2.68 and 11.0 . the animals were genotypes using golden gate / veracode technology , which provides a robust and flexible platform , in conjunction with a beadxpress reader from illumina \n . a total of 237 markers ( 236 snps plus the halothane gene ) were used , with the halothane gene being considered a special marker for reasons explained later . \n five of the nonlinear regression models ( brody , gompertz , logistic , von bertalanffy and richards ) most widely used to describe animal growth curves were fitted to the weight - age data using the nls function of r ( r development core team , 2011 ) software . \n the usefulness of the models was compared based on the goodness of fit , the adjusted coefficient of determination and the residual standard deviation , which showed a relative superiority of the logistic model . \n this model is given by ( ratkowsky , 1983 ) : \n ( 1)wij=1i[1+exp(2i3i tij)]+eij , where wij is the animal weight i at age ( t)j , 1i is the mature weight ( kg ) , 2i reflects the weight at time t = 0 ( birth weight , kg ) , 3i is a general growth rate ( curve slope at the inflection point ) , and eij is a residual term , assumed to be independent and normally distributed . \n once the parameters estimates of the logistic model for each animal ( 1i , 2i and 3i ) were obtained , these values were used as dependent variables in a linear model in order to perform a pre - correction for fixed effects ( sex and lot ) . \n these pre - corrected observations ( residual plus general mean ) were used as phenotypes in the gs regression models in order to identify snp marker effects . \n this is a well - known two - step procedure ( varona et al . , 1999 ; pong - wong and hadjipavlou , 2010 ) in which , in the first step \n , a growth curve is fitted separately to the data of each animal and , in the second step , the growth curve parameter estimates from the previous step are taken as records . \n the main advantage of this method is its statistical simplicity since the growth model and gs model are fitted independently ; however , more sophisticated methods , such as bayesian joint analysis ( varona et al . , 1999 ) \n also have been used in gs ( ibez - escriche and blasco , 2011 ) and produced good results . with respect to gs , the phenotypic outcomes ( pre - corrected phenotypes for fixed effects ) , denoted from now on by yi ( i = 1 , 2 , ... , 345 ) , were regressed on marker covariates xik ( k = 1 , 2 , ... , 237 ) following the regression model proposed by meuwissen et al . \n ( 2001 ) : \n ( 2)yi=+k=1237xikk+ei , where yi is the phenotypic observation of animal i , is the general mean , k is the effect of marker k and ei the residual term , ei \n n(0 , \n e2 ) , in which are included the dominance and epistatic effects . in this model , \n xik take the values 2 2pk , 1 2pk and 0 2pk for the snp genotypes \n aa , aa and aa at each locus k , respectively , where pk is the allele frequency at the locus k. using matrix notation , this gs model can be rewritten as : \n ( 3)y=1'+ik=1237xkk+e , where 1 and i are , respectively , a unit vector and an identity matrix with dimensions 345 , where y = [ y1 , y2 , ... , y345]345x1 , xk = [ x1k , x2k , ... , x345k]345x1 and e = [ e1 , e2 , ... , e345]345x1 . the first method used to fit the gs model was rr - blup ( meuwissen et al . , 2001 ) , in which k is considered a random marker effect , k n(0 , \n k2 ) assuming that \n 12=22= ... =3272=2 ( i.e. , all loci explain an equal amount of genetic variation ) . \n this method was implemented using an equivalent model ( called g - blup ) in the r software ( r development core team , 2011 ) by package rrblup ( endelman , 2011 ) and the function mixed.solve , which solves a mixed model equation of the form : \n [ n1'1i+e2[var(u)]1 ] [ ^u^]=[1'yy],where \n u=k=1237xkk is the vector of genomic breeding values . \n thus , admitting the additive genetic variance ( \n a2 ) given by \n 2k=12372pk(1pk ) ( habier et al . , 2007 ) \n it can be shown that : \n var(u)=var(k=1237xkk)=k=1237var(xkk)=k=1237xkx'k2=a2(k=1237xkx'kk=12372pk(1pk))=a2g , with g being the so - called genomic relationship matrix . with this approach , \n it is possible to work through the well - known henderson mixed model equation using the reml estimation method , which provides estimates of variance components for calculating the heritability by \n h^2=^a2/(^a2+^e2 ) . since \n u^=k=1237xk^k = x^ , with x = [ x1|x2| |x237]345237 and = [ 1,2, ,237]2371 \n , the estimated marker effects vector can be obtained by the simple normal equation system of = ( xx ) ( x ) . \n , 2009 ) , which is a more general method because it assumes that each locus explains its own amount or contribution to the overall variation . this method has been used to solve multicollinearity problems and may also be employed in situations where there are more markers ( covariates ) than observations . \n the bl is a penalized bayesian regression procedure , whose general estimator is given by \n ^=arg min{(y^x)'(y^x)+k=1237|k| } where is the regularization parameter . when = 0 there is no regularization and when > 0 there is a shrinkage of the marker effects toward zero , with the possibility of setting some identically equal to zero , resulting in a simultaneous estimation and variable selection procedure . \n this characteristic of the bl method is especially useful for f2 populations in which larger haplotype blocks with many redundant snps in each block are expected ; the latter implies multicollinearity that impairs fitting of the model ( eq . \n thus , the regularization imposed by bl reduces some redundant snps to zero , thereby bypassing the problem of multicollinear snps in haplotype blocks . \n the package blr ( de los campos et al . , 2009 ; prez et al . , 2010 ) of r software was used for this analysis . \n this package assumes that the joint prior distribution of marker effects ( 1 , 2 , ... , \n 237 ) is \n k=1237n(0,k2 ) , where \n k2=e2k2 , \n e2 is the residual variance , with a scaled inverse prior distribution , and \n k2 is the scale parameter related to each marker . \n the blr method also assumes that the joint prior distribution for the scale parameters ( \n 12,22, ... ,2372 ) is the product of exponential distributions , \n k=1237exp ( ) , and that the prior distribution is gamma(1 , 2 ) . \n the bl method was implemented using 10,000 mcmc ( markov chain - monte carlo ) iterations , with a burn - in and thin of 5,000 and 2 iterations , respectively . \n the plausibility of these values was assessed for each mcmc chain separately using raftery - lewis and geweke convergence diagnostics in boa ( smith , 2007 ) r package . since the blr method provides the posterior mean ( k ) as a marker effect estimate , the vector of the genomic estimated breeding values ( gebv ) \n was obtained as \n u^=k=1237xk^k = x^. using this approach , the additive genetic variance needed to calculate h was \n a2=2k=1237k2pk(1pk ) because each locus presents a particular variance ( \n k2 ) . as stated earlier , the main difference between rr - blup and bl is the assumption related to the equality of marker effects variance , and some studies has used simulated ( meuwissen et al . , 2001 ) and real ( moser et al . , 2009 ) \n . however , to date no studies have applied this assumption to real scenarios in which known major genes are postulated as markers . \n for this reason , the well - known halothane gene that affects growth traits ( miller et al . , 2000 ) \n was included in the analysis as a simple marker to provide a real situation of unequal marker effects variances . \n of the 345 animals , 291 ( 84.3% ) and 54 ( 15.7% ) had the normal ( hal ) and heterozygous ( hal ) halothane genotype , respectively ; none of the animals had a double recessive genotype ( hal ) . \n the leave - one - out cross - validation was used to compare rr - blup and bl . for this \n , the original data set with 345 animals was divided into 345 training data sets ( di ) of 344 individuals , d1 , \n d2 , ... , d345 , with each containing marker and phenotypic information of all the animals , except for animal i . with this approach \n , there was no loss of generality for each method and each phenotype . in these analyses , \n the predicted genomic breeding value of animal i for each trait ( parameter estimates 1 , 2 and 2 of the logistic model ) was calculated as i = xi i , where xi denotes the snp genotype vector of animal i and 1 denotes the estimated marker effects vector from the analysis that considered all animals , except animal i. all codes related to the leave - one - out cross - validation implemented for the rr - blup and bl method are provided in the supplementary material . \n the vector containing all predicted values was = [ 1 , ... , 345 ] and the accuracy ( r ) used to measure the efficiency of rr - blup and bl \n was given by \n r = ryu^/h2 , where ry is the correlation between observed phenotype ( y ) and , and h is the estimated heritability . \n a linear regression with y as the dependent variable and as the independent variable was used to screen for bias produced by each method ; in this case , a regression coefficient of one indicated an unbiased method . \n once the most appropriate method ( rr - blup or bl ) had been chosen , the vectors of the estimated genomic breeding values for each parameter of the logistic growth curve where obtained , assuming that 1=[ 11 , ... , 1345 ] , 2=[ 2345 , ... , 2345 ] and , 3=[ 31 , ... , 3345 ] . \n subsequently , the genomic growth curve for each animal could be estimated using the relationship : \n ( 4)y^ij=(^1+u^^li){[1+exp((^2+u^^2i)(^3+u^^3i)tij)]},where ij is the genomic breeding value of each animal i for weight at each age ( tij ) of interest j ( even for no observed ages ) , 1 , 2 and 3 are the average of each phenotype ( parameter estimates for the logistic model ) and 1i , 2i and 3i are the gebvs for these phenotypes . \n overall , the two methods provided highly accurate values ( mean overall accuracy : 0.69 0.09 ) , as shown by the strong association between the phenotypic assessment and the true breeding values . to date , there has been no evaluation of the accuracy of genomic selection for growth traits in pigs using real data , although akanno ( 2012 ) reported a simulation study in which a performance trait ( average daily gain ) was simulated for different populations . in this simulation , \n the so - called synthetic population , which was similar to the f2 population of the present study , showed an accuracy of 0.61 . \n comparison of the two methods showed that the bl method yielded more accurate values than rr - blup for all of the phenotypes . \n the mean accuracy of bl ( 0.70 0.09 ) was greater than for rr - blup ( 0.62 0.06 ) , indicating that in a real data set in which one locus is known to have a larger effect ( in this case , the halothane gene ) the bl property of assuming different variances for markers ensures greater efficiency in genomic selection . \n although both methods underestimated the breeding values , i.e. , the regression coefficient estimates between the observed and predicted phenotypes were slightly greater than 1.0 , for the bl method these coefficients were closer to unity for all phenotypes ( indicating low bias ) when compared to the corresponding values for rr - blup . \n ( 2012 ) , who used a simulated data set to show that lasso type regressions were more efficient than rr - blup for genomic selection because they provided more accurate and less biased predictions . \n table 1 also shows that the accuracy of the differences between the two methods was more pronounced for the trait mature weight ( 1 ) than for the traits birth weight ( 2 ) and growth rate ( 3 ) . \n this finding provides an indirect indication that the genetic architecture of 1 is possibly more influenced by loci that exert larger effects , such as the halothane gene , than the other two traits . \n this conclusion reflects the fact that bl works better than rr - blup when the assumption of an equal contribution of genetic variance in the latter model is violated , as was the case here with the large - effect halothane gene that was used as a marker . \n the effect of the halothane gene on estimates of growth curve parameters has not been examined before and this precludes a direct assessment of the effects of this major gene on mature weight . \n ( 2005 ) observed a significant effect of the halothane gene on weight at 105 days of age ( w105 ) in animals from this same population ( f2 piau x commercial ) . \n these authors also evaluated the weight at birth in relation to parameter 1 and the average daily gain in relation to parameter 3 . \n the halothane gene had a significant effect only on w105 , indicating that this gene has a greater influence on final weight than on other performance traits . in summary , \n the results in table 1 indicate a superiority of bl in providing accurate estimates and suggest that this method can be recommended for estimating snp effects and gebv vectors . however , before using these vectors to select markers and animals it is important to estimate heritabilities and genetic correlations ( table 2 ) in order to assess whether the three traits ( 1 , 2 and 3 ) are really relevant in a breeding program . \n the high values of h ( estimated with the bl method ) in table 2 indicate that these traits can be a viable alternative for pig breeding in which the aim is to produce efficient high growth animals . \n however , direct selection for high 1 implies a selection for low 3 ( as indicated by the high negative genetic correlation , 0.69 , between these two parameters ) , i.e. , in general terms such selection will result in less precocious animals ( low growth rate ) with a larger body size at maturity . on the other hand , direct selection for high 3 can result in more precocious animals with high 2 ( birth weight ) but low maturity weight ( 1 ) . this negative correlation is expected and has been reported in most studies of growth curves and animal breeding , e.g. , koivula et al . \n it is better to select for high growth rate ( 3 ) since slaughter is occurs at a standard slaughter weight ( 65 kg for this f2 piau x commercial population ) . as a result , the time to slaughter will be significantly lower with a high growth rate , resulting in lower production costs because the slaughter weight is practically the same for all animals ( 65 kg ) , with the difference between them reflecting the time required to reach this standard weight . \n the high positive correlation between 3 and 2 means that young pigs do not show a loss in early growth and consequently guarantees good nutrition and health for subsequent growth phases . as mentioned earlier , the main focus of this paper was to construct genomic growth curves using the genomic estimated breeding values ( gebvs ) for each parameter of a logistic growth curve ( eq . \n . the sigmoidal behavior of the curves in figure 1 was ensured by the average estimates of the growth curve parameters ( 1 , 2 and 3 ) and the gebvs ( 1i , 2i and 3i ) ; the latter parameters do not predict this behavior as they may have positive or negative values and are thus outside the limits of the logistic model . \n the estimates for 1 , 2 and 3 were , respectively , 118 kg , 1.4 kg and 0.03 kg / day . \n there are no data in the literature regarding maturity weight ( 1 ) of the present f2 population because the animals are slaughtered at a live weight of 6065 kg . \n one of the advantages of nonlinear growth curve models ( such as the logistic curve ) is the ability to predict maturity weight using partial weight - age data , i.e. , it is possible to estimate the maturity weight before this weight is reached . \n the value observed here ( 118 kg ) was lower than in other populations such as yorkshire pigs ( 201 kg ; koivula et al . , 2008 ) and 4-way - cross pigs ( 160 kg ; kusec et al . , 2007 ) . \n this lower weight reflects the characteristically small body size of the piau breed compared to commercial breeds . \n the estimated growth rate ( 3 ) ( 0.03 kg / day ) was higher than that reported by koivula et al . \n ( 2008 ) ( 0.016 kg / day ) and lower than that reported by kusec et al . ( 2007 ) ( 0.05 kg / day ) for yorkshire pigs and commercial crosses , respectively . \n ( 2007 ) also reported estimates for the time until maximum gain ( time to inflection point ) , which were 120 and 105 days , respectively , for intensive and restrictive feeding systems . in summary , even though the values cited above were obtained in different populations , the comparisons nevertheless provide a useful means of obtaining a general characterization of the growth patterns in the f2 population . furthermore , \n as mentioned earlier , there are no data on the growth behavior of this experimental population , which was initially developed to combine the precocity of commercial lines with the resistance and fat attributes of piau , a native brazilian breed . from a genetic point of view \n , figure 1 shows that the weight differences among gebvs were accentuated over time such that the genetic variance for weight increased with age . \n this finding may be related to the greater heritability of mature weight ( 1 ) compared to birth weight ( 2 ) ( table 2 ) since this value is directly proportional to genetic variance for a given value of residual variance . \n similar curves can be obtained using other approaches , e.g. , random regression ( meyer , 1998 ) , but in the present study a different approach was used in which ( 1 ) the plotted values were gebvs that had been estimated by a sophisticated method ( bayesian lasso ) that simultaneously considered regularization and variable selection ( snp markers ) and ( 2 ) the use of a nonlinear ( logistic ) growth model allowed estimation of the genetic parameters for traits with direct biological interpretation , e.g. , maturity weight and growth rate , that could not been estimated by random regression . in practical terms , \n figure 1 shows that the greatest genetic difference ( based on gebv ) among animals at slaughter was 10 days since the animals were killed at a live weight of 65 kg . \n since there have been no reports on qtl detection for the three phenotypes considered in this study and since genomic selection is based on snp marker estimates , the 5% most relevant snps ( 12 snps out of 237 snps ) for each phenotype ( 1 , 2 and 3 ) were used to assess whether their chromosomal positions coincided with others already reported in the literature as being qtls related to general growth traits . \n table 3 shows these selected snp markers and the absolute values of their estimated effects and chromosomal positions in cm . \n the snps with the greatest effects on 1 were located mainly on chromosomes ssc6 , ssc7 , ssc17 and sscx , with particular emphasis on the magnitude of the effect of the halothane gene ( 0.9114 ) on this phenotype , as already mentioned for table 1 . \n the position of marker alga0042216 at ssc7 ( 60.4 cm ) agreed with yue et al . \n ( 2003 ) , who found a significant qtl for weight at slaughter at position 65.2 cm in crosses between meishan ( m ) , pietrain ( p ) and european wild boar ( w ) . \n ( 2003 ) , using a population similar to those studied by yue et al . ( \n 2003 ) , found a significant qtl for weight at slaughter at position 51.1 cm of ssc17 , i.e. , close to position 45.2 cm for marker alga0095662 . \n in general , in the absence of qtl detection for mature weight ( 1 ) , these references to weight at slaughter may be useful for validating the relevance of the identified snps for this phenotype . in relation to trait 2 , \n other studies have identified qtls associated with birth weight at positions close to those of snps indicated in table 3 . \n ( 2002 ) analyzed data from a large white ( lw ) x m intercross population and found a significant qtl at position 153 cm of ssc1 , which coincided with the position of marker alga0010089 . \n ( 2003 ) used f2 families based on crosses of m , w and p breeds and identified a significant qtl at position 117 cm of sscx , close to the position of marker marc0051258 ( 112.2 cm ) . \n with respect to phenotype 3 , the snps positions in table 3 were compared with significant qtl positions for the trait average daily gain ( adg ) , which is frequently mentioned in the literature and is highly related to the estimated growth ( 3 ) rate in the present study . \n the position of marker alga0047440 on ssc8 ( 15 cm ) was close to position 10 cm reported by de koning et al . \n ( 2001 ) who used data from an experimental cross between m and dutch commercial lines . \n ( 2006 ) used data from a backcross m x lw and found a significant qtl at position 143 cm of ssc1 , close to marker alga0010089 ( 1553.3 cm ) . \n five snps ( alga0006708 , alga0010089 , alga0029483 , alga0047440 and marc0051258 ) in table 3 were simultaneously among the most important for 2 and 3 , which could perhaps explain the greater genetic correlation between birth weight and growth rate in table 2 . \n in summary , the relevant snps listed in table 3 were associated with qtl regions for growth traits previously reported in the literature . \n as a general conclusion , bayesian lasso provided more accurate values than rr - blup for all of the phenotypes evaluated and worked best when the assumption of an equal contribution to genetic variance was violated , e.g. , when the halothane major gene was used as a marker in this study . \n the gebv vectors allowed the construction of genomic growth curves that revealed substantial genetic discrimination among animals in the final phase of growth . \n estimates of the effects of snps allowed identification of the most relevant markers for each phenotype , the positions of which coincided with already well - known qtl regions for growth traits .", "role": "user" }, { "content": "in the current post - genomic era , the genetic basis of pig growth can be understood by assessing snp marker effects and genomic breeding values ( gebv ) based on estimates of these growth curve parameters as phenotypes . \n although various statistical methods , such as random regression ( rr - blup ) and bayesian lasso ( bl ) , have been applied to genomic selection ( gs ) , none of these has yet been used in a growth curve approach . in this work , we compared the accuracies of rr - blup and bl using empirical weight - age data from an outbred f2 ( brazilian piau x commercial ) population . \n the phenotypes were determined by parameter estimates using a nonlinear logistic regression model and the halothane gene was considered as a marker for evaluating the assumptions of the gs methods in relation to the genetic variation explained by each locus . \n bl yielded more accurate values for all of the phenotypes evaluated and was used to estimate snp effects and gebv vectors . \n the latter allowed the construction of genomic growth curves , which showed substantial genetic discrimination among animals in the final growth phase . \n the snp effect estimates allowed identification of the most relevant markers for each phenotype , the positions of which were coincident with reported qtl regions for growth traits .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: based on clinical and pathological observations in human mammary carcinomas , the metastatic spread of mammary carcinoma cells is responsible for the majority of cancer deaths [ 15 ] . \n the common pathway of initial cancer dissemination is via lymphatics due to their characteristic endothelial structure with blind - ending capillaries . \n in addition , metastasis to the regional lymph nodes through the lymphatic vessels is considered to be a common step in the progression of cancer and an important prognostic factor in many types of cancer including breast carcinomas . \n lymphatic vessel density ( lvd ) in many types of solid cancer is associated with lymph node metastasis or poor prognosis , as has been reported in experimental and clinical studies [ 15 , 7 , 8 ] . \n although mammary carcinoma is well known to have the character for lymph node metastasis , there are only a few mouse mammary carcinoma models showing extensive metastasis to lymph nodes . \n the chick embryo chorioallantoic membrane and immunodeficient mice , scid mice , or nude mice were used as xenotransplanted host animals to examine metastasis [ 1012 ] . \n recent studies have shown the important roles of tumor - associated macrophages ( tams ) expressing cd68 in cancer - mediated lymphangiogenesis [ 1315 ] . \n accordingly , the mouse immunocompetent model appears to be necessary for studying lymphangiogenesis and lymph node metastasis . \n the vascular endothelial growth factor c ( vegf - c ) is a major lymphangiogenic factor . \n there is some evidence that vegf - c promotes lymphangiogenesis under several normal and pathological conditions . in vegf - c - deficient mouse embryos , \n lymphatic vessels fail to develop from veins resulting in prenatal death owing to fluid accumulation in the tissues of mouse embryos and edema in adults . on the other hand , in vegf - c transgenic mice , hyperplasia of lymphatic \n vasculature has been reported [ 19 , 20 ] . to study the relationship between lymphangiogenesis mediated by vegf - c and axillary lymph node metastasis , two - mouse mammary carcinoma cell lines with different metastatic properties \n both cell lines were derived from the same balb / c mouse , one of them , the bjmc338 cell line , an adenocarcinoma cell line , has a low metastatic propensity , whereas the other cell line , bjmc3879 , has a high metastatic propensity , particularly to lymph nodes and lungs . \n each cell line was injected separately into two groups of adult female balb / c mice creating in vivo mammary cancer models . in this inoculation study \n , we found that increased expression of tumor - derived vegf - c correlates with lvd and axillary lymph node metastasis . \n two - mouse mammary carcinoma cell lines were used in this study . the bjmc338 mammary adenocarcinoma cell line used in this study \n was derived from a female balb / c mouse infected with mouse mammary tumor virus ( mmtv ) into the inguinal mammary glands and shows low metastatic property . \n the bjmc3879 mammary adenocarcinoma cell line was derived from foci within metastatic lymph node and lung of a female balb / c mouse that had been injected with bjmc338 cell line into the right inguinal region . \n the bjmc3879 mammary cell line shows a high metastatic propensity , especially to lymph nodes and lungs . \n both cell lines were maintained in rpmi 1640 medium containing 10% fetal bovine serum ( fbs ) with streptomycin / penicillin in an incubator under 5% co2 . \n the cells were immediately rinsed with 0.01 m phosphate buffered saline ( pbs ) , fixed with 2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m phosphate buffer ( pb ) ( ph 7.4 ) for 1 h , for transmission electron microscopy ( tem ) . \n cells were subsequently postfixed in 1% oso4 for 45 min at room temperature , dehydrated in a series of graded ethanol concentrations , cleared in propylene oxide , and embedded in an epoxy resin mixture . for immunofluorescent study , \n after preparation , ultrathin sections were prepared and stained with uranyl acetate and lead citrate . \n sixty nm sections were examined by tem using h-7100 and h-7650 ( hitachi , tokyo , japan ) . \n following fixation , cells were transferred to pbs for 15 min , followed by exposure to 1% block ace ( dainippon sumitomo pharma co. , ltd . , \n cells were then incubated with a primary rabbit anti - vegf - c antibody ( rabbit polyclonal ; santa cruz biotechnology , santa cruz , calif , usa ) for 1 h at room temperature ( rt ) . \n after rinse in pbs for 15 min , cells were incubated with a secondary fluorescein - isothiocyanate- ( fitc- ) conjugated anti - rabbit antibody ( dako , carpenteria , calif , usa ) for 30 min at rt . \n samples were counterstained with propidium iodide ( pi ) for 15 min and observed under a model radiance 2000 mp confocal scanning laser microscopy ( bio - rad , hercules , calif , usa ) . \n samples containing 20 g of protein from cultured cells and tumors were fractionated in 10% tris - glycine gels under reducing conditions and transferred onto nitrocellulose membrane . \n anti - vegf - c antibody ( santa cruz biotechnology ) was applied to membranes , incubated with appropriate horseradish peroxidase - conjugated secondary antibody , and visualized on x - ray films using enhanced chemiluminescence ( perkin elmer life science , inc . , \n total rna was isolated from cultured bjmc338 and bjmc3879 cells using an rneasy mini kit ( qiagen , hilden , germany ) and cdna synthesis kit ( roche diagnostic kit , hilden , germany ) following the manufacturer 's protocol , with the total mrna concentration adjusted to 5 g/l in each sample . \n primer sequences for vegf - c were 5-ccttctttaaacctccatgtgt-3 and 5-gcaaaactgattgtgactggt-3 ; for glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) used as internal control 5-tgcacgggaagctcactgg-3 , 5-tccaccaccctgttgctgta-3 ( nihon gene research laboratories , sendai , japan ) . \n products were amplified in a geneamp pcr system 9700 ( applied biosystems , foster city , calif , usa ) with preincubation at 98c for 3 min followed by 30 cycles of 94c for 30 s , 58c for 30 s , and 72c for 60 s. the amplification was finished with a single-3 min incubation at 72c . \n the pcr products were separated on 1.5% agarose gels , stained with 0.1 mg / ml ethidium bromide , visualized by uv transillumination , and documented on black and white instant films . \n a total of 40 female 6-week - old balb / c mice ( japan slc inc . , \n all manipulations of mice were performed in accordance with the procedures outlined in the guide for care and use of laboratory animals in osaka medical college . \n mice were divided into two groups ( 20 mice each ) , and bjmc338 and bjmc3879 cells ( 5 10 cells/0.3 ml in pbs ) were inoculated subcutaneously into right inguinal region , respectively . \n mice were sacrificed at 4 , 6 , 8 , 10 weeks after inoculation under ether anesthesia . \n another one was fixed for histopathology and immunohistochemistry with 4 or 10% paraformaldehyde , and for electron microscopy in a same fixative as in vitro study \n . lungs and right axillary lymph nodes of mice were removed and then fixed as same as tumors . \n samples fixed with paraformaldehyde were processed through to paraffin embedding . to examine histopathology and metastasis , tumors , lungs , and light axillary lymph nodes \n the avidin - biotin complex method was used for immunohistochemistry . to visualize lymphatic vessels , \n tumors were stained with primary antibodies to the lymphatic - specific marker , lymphatic vessel endothelial hyaluronan receptor-1 ( lyve-1 ) ( rabbit polyclonal , acris antibodies gmbh , hiddenhausen , germany ) . \n vegf - c ( santa cruz ) was labeled on tumor sections , and activated macrophages were demonstrated by cd68 antibody ( rat anti - mouse cd68 , abd serotec , oxford , uk ) . the number of lymphatic vessels immunolabeled with anti - lyve-1 antibody in tumor sections at 4 to 10 weeks postinoculation as well as the number of cd68-positive cells in tumor sections at 4 weeks postinoculation were counted under light microscopy at higher magnification ( 200 ) . \n both cell lines showed the same morphology under tem ( figures 1(a ) and 1(b ) ) . \n they had prominent nucleoli and dispersed small condensed chromatin in their nuclei . by immunofluorescent study , vegf - c was barely expressed in bjmc338 cells , whereas moderately expressed in bjmc3879 cells ( figures 1(c ) and 1(d ) ) . \n the levels of vegf - c protein in the two cell lines were determined by western blot ; the intensity of the bands was measured and corrected against -actin intensity . \n a moderate increase in the vegf - c protein level was detected in bjmc3879 cells ( figure 1(e ) ) . \n rt - pcr analysis showed higher vegf - c mrna expression in bjmc3879 cells than in bjmc338 cells ( figure 1(f ) ) . \n histopathologically , the two types of inoculated mammary carcinoma ( bjmc338 and bjmc3879 tumors ) proved to be moderately differentiated adenocarcinomas . \n both tumors were accompanied by a viable region , a central necrosis , and an inflammatory region ( figures 2(a ) and 2(b ) ) . \n the morphology of the tumor cells in the viable region was the same as that of the cultured cell lines ( figures 2(c ) and 2(d ) ) . \n metastasis to axillary lymph nodes or lungs at 8 and 10 weeks postinoculation was validated by the observation of sections stained with h&e . at 8 and 10 \n weeks postinoculation , no metastasis was observed in the lymph nodes and lungs of mice that were inoculated with bjmc338 cells ( figures 3(a ) and 3(c ) ) . \n in contrast , all the mice inoculated with bjmc3879 cells showed distant metastasis to axillary lymph nodes and lungs at 8 and 10 weeks postinoculation ( table 1 , figures 3(b ) and 3(d ) ) . \n the lymphatic vessels in the tumor were detected by immunohistochemistry using the antibody specific to lymphatic vessels , lyve-1 . at 4 weeks postinoculation , few lymphatic vessels were found in bjmc338 tumors ( figure 4(a ) ) . at 6 weeks postinoculation \n , several lymphatic vessels were observed in intratumoral connective tissues and/or surrounding connective tissues ( figures 4(c ) , 4(e ) , and 4(g ) ) . \n conversely , large numbers of dilated lymphatic vessels with or without tumor cells were observed within and around bjmc3879 tumors at 4 to 10 weeks postinoculation ( figures 4(b ) , 4(d ) , 4(f ) , and 4(h ) ) . \n the lvd of bjmc3879 tumors was always significantly higher than that of bjmc338 tumors ( figure 5 ) . in bjmc338 tumors , \n the lvd at 6 weeks postinoculation was significantly higher than that at 4 weeks postinoculation ( p < 0.01 ) , after that , no significant difference in the lvd was observed ( figure 5 ) . however , in bjmc3879 tumors , the difference in the lvd between 8 and 10 weeks postinoculation was not significant ; a significant difference was detected between 6 and 8 weeks postinoculation ( p < 0.001 ) , namely , the lvd markedly increased at 8 weeks postinoculation ( figure 5 ) . \n the status and ultrastructural features of lymphatic vessels in inoculated tumors were examined under tem . \n the examination of lymphatic capillaries revealed that they had thin endothelium , abluminal protrusion of endothelial cells , no pericyte , no lamina densa , and overlapping junctions ( figures 6(a)6(d ) ) . \n interestingly , a leukocyte was shown to go into and/or out from the lymphatic lumen ( figure 6(a ) ) . \n furthermore , the absorption of caseinlike droplets into the lymphatic lumen was observed ( figure 6(c ) ) . \n vegf - c - positive cells were localized mainly in the peripheral viable regions of tumors . \n immunohistochemical studies and western blot analyses clearly demonstrated weak expression of vegf - c in bjmc338 tumors ( figures 7(a ) and 7(c ) ) , relative to the strong expression in bjmc3879 tumors ( figures 7(b ) and 7(c ) ) . \n cd68-positive macrophages were found mainly in the viable regions of both tumors ( figure 8) . \n the density of macrophages in bjmc3879 tumors was significantly higher than that in bjmc338 tumors ( p < 0.001 ) ( figure 8) . \n in this study , we found that mouse mammary tumor cells ( bjmc3879 ) that have high metastatic propensity expressed a higher level of vegf - c than the mouse mammary tumor cells ( bjmc338 ) with low metastatic propensity , and the inoculated bjmc3879 tumors expressed vegf - c equivalently to tumor cell lines . in highly metastatic mouse mammary tumors ( bjmc3879 ) , lvd and the vegf - c expression level were higher than those in the poorly metastatic mouse mammary tumors ( bjmc338 ) . \n bjmc3879 tumor cell inoculation resulted in axillary lymph node and lung metastases , whereas no metastasis occurred after bjmc338 tumor cell inoculation . \n there are some clinical surveys of human breast cancer to prove a causal relationship between lvd and malignancy , the vegf - c expression , lymph node metastasis , and prognosis [ 1 , 4 , 5 ] . \n increased lvd in breast cancer was correlated with lymph node metastasis and vegf - c expression . \n it was concluded that a high lvd may be a significant unfavorable prognostic factor for long - term survival of breast cancer patient . \n contrary to the clinical importance of these lvds and on the basis of clinicopathological studies including breast cancers , it is the hypothesized that intratumoral lymphatics have no function . \n none of the breast carcinoma was found to contain ki-67-positive dividing endothelial cells of lymph vessels , and by experimental microlymphangiography assay , no functional draining intratumoural lymphatics were found . \n they also found that the functional lymphatics in the tumor margin alone were sufficient for lymphatic metastasis [ 24 , 25 ] . \n it was reported that the degree of axillary lymph node metastasis increased in parallel with increasing lvd , patients with a high peritumoral lvd had only 58% 5-year distant disease - free survival as compared with 74% among those with a low peritumoral lvd . \n in addition , the presence of intratumoral lymph vessels was associated with neither axillary nodal status nor survival . moreover , not only lvd but also the size of peritumoral lymph vessels may be a significant consideration of lymph node metastasis . as the enlarged lymphatics may collect interstitial fluid and cancer cells oozing from the tumor surface , it was suggested using mouse hybridoma cells and their syngenic mice that both peritumoral and intratumoral lymph vessels may play a crucial role in metastasis . \n vegf - c expression in breast cancer has been considered as a clinicopathological prognostic factor [ 8 , 2729 ] . however , a univariate study by bando et al . \n revealed that high vegf - c expression level was significantly associated with a favorable prognosis for disease - free survival and overall survival ( e.g. , high vegf - c levels were associated with low - grade tumors and a smaller size ) . \n watanabe et al . compared the expressions of cd44 variants and vegf - c as associated factors with long - term prognosis , they concluded that there was no association between vegf - c expression and clinicopathological prognostic factor . \n a clinicopathological study using rt - pcr indicated that vegf - c and vegf - d were involved in lymphatic vessel invasion prior to lymph node metastasis , and their expression level decreased after the occurrence of lymph node metastasis . in a retrospective study of 61 cases , \n it was reported that lvd may serve as a predictor of lymph node metastasis and a prognostic factor , whereas vegf - c and vegf - d may play important roles in lymphangiogenesis , making the carcinoma more aggressive and leading to a poor prognosis in breast cancer . because of controversial results showing that high vegf - c levels are associated with low - grade tumors and a smaller size , bando et al . \n suggested that the mechanism of vegf - c protein processing in human cancer requires further study . \n because intratumoral vegf - c protein level changes in response to intratumoral microenvironments , the expressions of vegf - c and vegf - d may be inadequate as clinicopathological prognostic factors by themselves . \n to evaluate the effect of vegf - c on lymphangiogenesis and lymph node metastasis , some human breast cancer cell lines were used in vivo and xenotransplanted to immunodeficient mice , scid mice , or nude mice [ 11 , 12 ] . using human mcf-7 breast cancer cells , which are poorly invasive and estrogen dependent , mattila et al . \n showed that tumor growth was stimulated in vivo in vegf - c overexpressing mcf-7 cells xenotransplanted to nude mice . \n furthermore , lvd in intra- and peritumoral lymphatic vessels was increased in tumors promoted by vegf - c derived from xenotransplanted mcf-7 cells . \n while these reports , even though in xenotransplanted mice , support our results that tumoral vegf - c expression plays an important role in lymphangiogenesis and lymph node metastasis of mouse mammary carcinoma , the role of immune cells including macrophages must be considered in tumor metastasis . \n our immunocompetent mouse models clearly showed the presence of cd68-positive tams in the inoculated tumors , and the density of tams in the high - metastatic mouse model was higher than that in the low - metastatic mouse model . \n the lvd in mammary carcinoma strongly expressing vegf - c was higher than that in carcinoma expressing a low vegf - c level with the former showing axillary lymph node metastasis . \n our inoculated mouse mammary carcinoma models in this study are allotransplanted and immunocompetent tumors which show the same lymph node metastatic spectrum as human breast cancers . consequently ,", "role": "user" }, { "content": "lymphangiogenesis and the expression of vascular endothelial cell growth factor c ( vegf - c ) in tumors have been considered to be causally promoting lymphatic metastasis . \n there are only a few studies on lymphatic metastasis in immunocompetent allograft mouse models . \n to study the relationship between vegf - c - mediated lymphangiogenesis and axillary lymph node metastasis , we used two mouse mammary carcinoma cell lines ; the bjmc338 has a low metastatic propensity , whereas the bjmc3879 has a high metastatic propensity although it originated from the former cell line . \n each cell line was injected separately into two groups of female balb / c mice creating in vivo mammary cancer models . \n the expression level of vegf - c in bjmc3879 was higher than bjmc338 . \n as the parent cell line , bjmc3879-derived tumors showed higher expression of vegf - c compared to bjmc338-derived tumors . \n this higher expression of vegf - c in bjmc3879-derived tumors was associated with marked increase in infiltrating macrophages and enhanced expression of lymphatic vessel endothelial hyaluronan receptor-1 ( lyve-1 ) reflecting increased tumoral lymphatic density and subsequent induction of axillary lymph node metastasis . \n our mouse mammary carcinoma models are allotransplanted tumors showing the same axillary lymph node metastatic spectrum as human breast cancers \n . therefore , our mouse models are ideal for exploring the various molecular mechanisms of cancer metastasis .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this study was approved by the ethics committee of the armed forces medical command , which waived the requirement of informed patients consent for this retrospective study . from july 18 to july 30 , 2009 , 18 out of 57 patients who presented with acute febrile respiratory illness ( fever of 38 or higher , and/or a cough or shortness of breath ) ( 8) , were confirmed with the pandemic h1n1 2009 influenza virus infection in a tertiary military hospital in south korea . \n we retrospectively reviewed the medical charts , as well as the laboratory and radiologic findings of these patients . \n all patients were young male soldiers with a mean age of 20 years ( age range : 19 to 22 years ) . \n fifteen of the 18 patients confirmed with the pandemic h1n1 2009 influenza virus infection were from the same barrack , and they visited the emergency department due to acute febrile respiratory illness from july 18 to july 20 , 2009 . \n the other three patients were from different barracks and were admitted with suspected cases of rhabdomyolysis after a long distance march ( n = 1 ) , acute gastroenterocolitis ( n = 1 ) , and acute febrile respiratory illness with leukocytopenia and thrombocytopenia ( n = 1 ) . \n all three patients came into contact with one or more of the previously - mentioned patients lying in nearby beds in our hospital . among the 15 patients who presented to the emergency department with acute febrile respiratory illness , \n two patients had returned from a brief visit to their hometowns one week prior to the outbreak of acute febrile respiratory illness and were suspected as the source of the illness . \n specimens from a nasopharyngeal swab ( n = 17 ) , and tracheal aspirate ( n = 1 ) were collected at the emergency department or wards when the 15 patients of the same barrack visited the emergency department , or when symptoms developed in the remaining three patients who came into contact with them . \n reverse - transcriptase - polymerase - chain - reaction ( rt - pcr ) tests and additional viral cultures were performed in accordance with published guidelines from the who in all patients ( 8) . a malaria smear and triple antibody tests of hantann , leptospirosis , and tsutsugamushi virus were also performed to rule out other potential causes of fever , and revealed no remarkable abnormalities . \n for the review of the clinical features , initial symptoms such as fever , cough , sputum , rhinorrhea , sore throat , myalgia , headache , dizziness , vomiting , and diarrhea were recorded . in turn , patient symptom progression while under treatment was also reviewed . for review of the laboratory data , the hematological analysis of the white blood cell ( wbc ) count , red blood cell ( rbc ) count , hemoglobin level , hematocrit level , platelet count , neutrophil count and the biochemical analysis of alkaline phosphatase ( alp ) , aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , creatine kinase ( ck ) , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) were recorded . \n chest radiographs and thin - section ct examinations were obtained from 18 and 12 patients , respectively , prior to the administration of antiviral agents . \n two out of the 12 patients undergoing thin - section cts received follow - up thin - section ct examinations a week after starting antiviral therapy . \n all radiographic examinations were performed using digital radiographic equipment ( tdr4600-f80 ; gold mountain medical system , seoul , korea ) and a standardized technique ( 110 kv , 2 mas , and a 180-cm film - focus distance for the posteroanterior views ) . \n thin - section cts of the thorax were performed using a 16 channel ct scanner ( brightspeed ; ge medical systems , wi ) , with the following parameters : 1.25 mm slice thickness with a 2.5 mm gap , supine position , scanning during inspiration , 6 seconds scan time , 120kv , auto ma . \n all chest radiographs and thin - section ct images were reviewed by three experienced chest radiologists ( 8 , 10 , and 16 years of experience in chest radiology , respectively ) using a picture archiving and communication systems ( pacs ) viewer . \n the presence of nodular opacity , consolidation ( focal , multifocal , or bilateral ) or interstitial patterns , distribution of findings including central ( inner two - thirds of lung ) or peripheral ( outer one - third of lung ) and upper , middle or lower lung zones , atelectasis , mediastinal abnormalities , and the presence or absence of a pleural effusion were analyzed ( 15 ) . \n thin - section ct findings were interpreted using the descriptors proposed by the fleischer society nomenclature committee ( 16 ) . \n ground - glass opacity ( ggo ) was defined as an increase in the lung parenchymal attenuation that did not obscure the underlying vascular architecture . \n a nodule was defined as round opacity , at least moderately well - defined , and no more than 3 cm in diameter . \n consolidation was defined as increased lung attenuation that obscured the underlying vasculature ( 16 ) . \n the lesion size was described as small ( diameter , less than 1 cm ) , medium ( diameter , 1 to 3 cm ) , large ( diameter , 3 cm to 50% of the segment ) , or segmental ( 50% to 100% of the segment ) . \n the sites were described by the name and number of involved segments of the lung . \n location of the lesion was defined as peripheral if it was in the outer one - third of the lung ; otherwise , it was defined as central ( 17 ) . \n attention was also paid to the presence of other abnormalities such as pleural effusion , lymphadenopathy , cavitation , calcification , or septal thickening . \n from july 18 to july 30 , 2009 , 18 out of 57 patients who presented with acute febrile respiratory illness ( fever of 38 or higher , and/or a cough or shortness of breath ) ( 8) , were confirmed with the pandemic h1n1 2009 influenza virus infection in a tertiary military hospital in south korea . \n we retrospectively reviewed the medical charts , as well as the laboratory and radiologic findings of these patients . \n all patients were young male soldiers with a mean age of 20 years ( age range : 19 to 22 years ) . \n fifteen of the 18 patients confirmed with the pandemic h1n1 2009 influenza virus infection were from the same barrack , and they visited the emergency department due to acute febrile respiratory illness from july 18 to july 20 , 2009 . \n the other three patients were from different barracks and were admitted with suspected cases of rhabdomyolysis after a long distance march ( n = 1 ) , acute gastroenterocolitis ( n = 1 ) , and acute febrile respiratory illness with leukocytopenia and thrombocytopenia ( n = 1 ) . \n all three patients came into contact with one or more of the previously - mentioned patients lying in nearby beds in our hospital . among the 15 patients who presented to the emergency department with acute febrile respiratory illness \n , two patients had returned from a brief visit to their hometowns one week prior to the outbreak of acute febrile respiratory illness and were suspected as the source of the illness . \n specimens from a nasopharyngeal swab ( n = 17 ) , and tracheal aspirate ( n = 1 ) were collected at the emergency department or wards when the 15 patients of the same barrack visited the emergency department , or when symptoms developed in the remaining three patients who came into contact with them . \n reverse - transcriptase - polymerase - chain - reaction ( rt - pcr ) tests and additional viral cultures were performed in accordance with published guidelines from the who in all patients ( 8) . a malaria smear and triple antibody tests of hantann , leptospirosis , and tsutsugamushi virus were also performed to rule out other potential causes of fever , and revealed no remarkable abnormalities . \n two authors retrospectively reviewed the clinical and laboratory findings . for the review of the clinical features , \n initial symptoms such as fever , cough , sputum , rhinorrhea , sore throat , myalgia , headache , dizziness , vomiting , and diarrhea were recorded . in turn , patient symptom progression while under treatment was also reviewed . for review of the laboratory data , the hematological analysis of the white blood cell ( wbc ) count , red blood cell ( rbc ) count , hemoglobin level , hematocrit level , platelet count , neutrophil count and the biochemical analysis of alkaline phosphatase ( alp ) , aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , creatine kinase ( ck ) , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) were recorded . \n chest radiographs and thin - section ct examinations were obtained from 18 and 12 patients , respectively , prior to the administration of antiviral agents . \n two out of the 12 patients undergoing thin - section cts received follow - up thin - section ct examinations a week after starting antiviral therapy . \n all radiographic examinations were performed using digital radiographic equipment ( tdr4600-f80 ; gold mountain medical system , seoul , korea ) and a standardized technique ( 110 kv , 2 mas , and a 180-cm film - focus distance for the posteroanterior views ) . \n thin - section cts of the thorax were performed using a 16 channel ct scanner ( brightspeed ; ge medical systems , wi ) , with the following parameters : 1.25 mm slice thickness with a 2.5 mm gap , supine position , scanning during inspiration , 6 seconds scan time , 120kv , auto ma . \n all chest radiographs and thin - section ct images were reviewed by three experienced chest radiologists ( 8 , 10 , and 16 years of experience in chest radiology , respectively ) using a picture archiving and communication systems ( pacs ) viewer . \n decisions were reached by consensus . to review chest radiographs , the presence of nodular opacity , consolidation ( focal , multifocal , or bilateral ) or interstitial patterns , distribution of findings including central ( inner two - thirds of lung ) or peripheral ( outer one - third of lung ) and upper , middle or lower lung zones , atelectasis , mediastinal abnormalities , and the presence or absence of a pleural effusion were analyzed ( 15 ) . \n thin - section ct findings were interpreted using the descriptors proposed by the fleischer society nomenclature committee ( 16 ) . \n ground - glass opacity ( ggo ) was defined as an increase in the lung parenchymal attenuation that did not obscure the underlying vascular architecture . \n a nodule was defined as round opacity , at least moderately well - defined , and no more than 3 cm in diameter . \n consolidation was defined as increased lung attenuation that obscured the underlying vasculature ( 16 ) . \n the lesion size was described as small ( diameter , less than 1 cm ) , medium ( diameter , 1 to 3 cm ) , large ( diameter , 3 cm to 50% of the segment ) , or segmental ( 50% to 100% of the segment ) . \n the sites were described by the name and number of involved segments of the lung . \n location of the lesion was defined as peripheral if it was in the outer one - third of the lung ; otherwise , it was defined as central ( 17 ) . \n attention was also paid to the presence of other abnormalities such as pleural effusion , lymphadenopathy , cavitation , calcification , or septal thickening . \n the clinical course and outcome of all patients are summarized in figure 1 . in the analysis of 15 patients who visited the emergency department , the mean interval between \n symptom onset and emergency room visit was 1.7 days 1.5 days ( range , 0 to 5 days ) . in the analysis of all 18 patients , \n the mean interval between symptom onset and the start of oseltamivir phosphate ( tamiflu , roche , basel , switzerland ) administration was 3.9 1.6 days ( range , 1 to 7 days ) . \n in addition , the mean interval between symptom onset and symptom improvement was 4.7 1.7 days ( range , 2 to 8 days ) . \n the clinical characteristics of the 18 patients in our study are summarized in tables 1 and 2 . \n all patients presented with high fever ( > 38.0 , median value and range ; 38.5 and 38.2 - 39.5 ) , with common accompanying symptoms including coughing ( 78% ) , rhinorrhea ( 89% ) , sore throat ( 78% ) , myalgia ( 78% ) , vomiting ( 50% ) or diarrhea ( 56% ) . \n seventeen out of the 18 patients showed wbc counts within normal limits , whereas one patient showed leukocytopenia . \n in addition , thrombocytopenia and lymphocytopenia were present in three of 18 ( 17% ) and 12 of 18 patients ( 67% ) , respectively . \n no abnormality was noted for the rbc count , hemoglobin level , hematocrit level , platelet count , and neutrophil count . \n however , all patients showed elevated crp values . after the diagnosis of the pandemic h1n1 2009 influenza virus infection through rt - pcr tests and additional viral cultures , all patients were treated with oseltamivir phosphate . \n of the 18 patients , 16 rapidly recovered after the administration of the antiviral agent . in the two remaining patients \n , the symptoms started to improve prior to oseltamivir phosphate treatment . among our study population , one patient presented with high fever , severe nocturnal cough , and blood tinged sputum , and the respiratory symptoms eventually progressed into acute respiratory distress syndrome ( ards ) , which further led him to receive mechanical ventilation ( case no . \n a retrospective medical chart review revealed that this patient was a solider serving in a different unit from the majority of the other patients and had been in contact with a patient with pandemic h1n1 2009 influenza virus infection lying in a nearby bed in our hospital prior to symptom aggravation . \n the laboratory data of this patient showed leukocytopenia , thrombocytopenia , and an increased ck level . \n he was initially treated with antibiotics such as macrolide and a 3rd generation cephalosporin under suspicion of bacterial pneumonia , which was never confirmed . \n five days after contact with a patient with pandemic h1n1 2009 influenza viral infection , severe respiratory distress presented and a laboratory analysis from the tracheal aspirate performed during endotracheal intubation confirmed the pandemic h1n1 2009 influenza virus infection . following the administration of oseltamivir phosphate and antibiotics , the patient 's symptoms improved and was taken off mechanical ventilation five days after antiviral agent administration . \n sixteen out of 18 patients in our study population showed no abnormalities on chest radiographs . \n moreover , only two patients in our study showed abnormal findings of a small central nodular opacity in the right upper lung zone in one ( fig . \n 2a ) , and consolidations in the left middle lung and both lower lungs in the other ( fig . \n of these six patients , five ( 83% ) had small ggos ; four patients had them in the upper lobe of the lung and one had a small ggo discovered in the lower lobe of the lung . \n also , in four out of the five patients with small ggos ( 80% ) , the lesions were localized in the periphery of the lung , and two of the five patients also showed bilateral involvement . for segmental involvement in terms of lesion size \n , three patients showed one segment , one patient showed two segments , one patient showed three segments , and one patient showed eight segments . \n nodules were observed in all patients ( 100% ) , which were small in size with showing poorly defined margins ( fig . \n in addition , the nodule was a solitary finding in one patient ( 17% ) , which was located in the peripheral area of the right upper lobe . the patient who progressed into ards had bilateral lobar consolidations combined with ggos , nodules , and bilateral pleural effusion ( fig . \n one other patient showed right paratracheal lymphadenopathy . in our study , there was no evidence of calcification , mass , cavitation , or septal thickenings in any of the patients . \n the thin - section ct findings of the 12 patients are summarized in table 3 . in two patients , follow - up thin section ct images acquired one week after the start of antiviral therapy showed complete resolution or a remarkable decrease in size and opacity of the previously observed ggos and nodules ( fig . \n the clinical course and outcome of all patients are summarized in figure 1 . in the analysis of 15 patients who visited the emergency department , the mean interval between \n symptom onset and emergency room visit was 1.7 days 1.5 days ( range , 0 to 5 days ) . in the analysis of all 18 patients , \n the mean interval between symptom onset and the start of oseltamivir phosphate ( tamiflu , roche , basel , switzerland ) administration was 3.9 1.6 days ( range , 1 to 7 days ) . \n in addition , the mean interval between symptom onset and symptom improvement was 4.7 1.7 days ( range , 2 to 8 days ) . \n the clinical characteristics of the 18 patients in our study are summarized in tables 1 and 2 . \n all patients presented with high fever ( > 38.0 , median value and range ; 38.5 and 38.2 - 39.5 ) , with common accompanying symptoms including coughing ( 78% ) , rhinorrhea ( 89% ) , sore throat ( 78% ) , myalgia ( 78% ) , vomiting ( 50% ) or diarrhea ( 56% ) . \n seventeen out of the 18 patients showed wbc counts within normal limits , whereas one patient showed leukocytopenia . \n in addition , thrombocytopenia and lymphocytopenia were present in three of 18 ( 17% ) and 12 of 18 patients ( 67% ) , respectively . \n no abnormality was noted for the rbc count , hemoglobin level , hematocrit level , platelet count , and neutrophil count . \n however , all patients showed elevated crp values . after the diagnosis of the pandemic h1n1 2009 influenza virus infection through rt - pcr tests and additional viral cultures , all patients were treated with oseltamivir phosphate . \n of the 18 patients , 16 rapidly recovered after the administration of the antiviral agent . in the two remaining patients \n , the symptoms started to improve prior to oseltamivir phosphate treatment . among our study population , one patient presented with high fever , severe nocturnal cough , and blood tinged sputum , and the respiratory symptoms eventually progressed into acute respiratory distress syndrome ( ards ) , which further led him to receive mechanical ventilation ( case no . \n a retrospective medical chart review revealed that this patient was a solider serving in a different unit from the majority of the other patients and had been in contact with a patient with pandemic h1n1 2009 influenza virus infection lying in a nearby bed in our hospital prior to symptom aggravation . \n the laboratory data of this patient showed leukocytopenia , thrombocytopenia , and an increased ck level . \n he was initially treated with antibiotics such as macrolide and a 3rd generation cephalosporin under suspicion of bacterial pneumonia , which was never confirmed . \n five days after contact with a patient with pandemic h1n1 2009 influenza viral infection , severe respiratory distress presented and a laboratory analysis from the tracheal aspirate performed during endotracheal intubation confirmed the pandemic h1n1 2009 influenza virus infection . following the administration of oseltamivir phosphate and antibiotics , the patient 's symptoms improved and was taken off mechanical ventilation five days after antiviral agent administration . \n sixteen out of 18 patients in our study population showed no abnormalities on chest radiographs . \n moreover , only two patients in our study showed abnormal findings of a small central nodular opacity in the right upper lung zone in one ( fig . \n 2a ) , and consolidations in the left middle lung and both lower lungs in the other ( fig . \n of these six patients , five ( 83% ) had small ggos ; four patients had them in the upper lobe of the lung and one had a small ggo discovered in the lower lobe of the lung . \n also , in four out of the five patients with small ggos ( 80% ) , the lesions were localized in the periphery of the lung , and two of the five patients also showed bilateral involvement . for segmental involvement in terms of lesion size \n , three patients showed one segment , one patient showed two segments , one patient showed three segments , and one patient showed eight segments . \n nodules were observed in all patients ( 100% ) , which were small in size with showing poorly defined margins ( fig . \n in addition , the nodule was a solitary finding in one patient ( 17% ) , which was located in the peripheral area of the right upper lobe . \n the patient who progressed into ards had bilateral lobar consolidations combined with ggos , nodules , and bilateral pleural effusion ( fig . \n one other patient showed right paratracheal lymphadenopathy . in our study , there was no evidence of calcification , mass , cavitation , or septal thickenings in any of the patients . \n the thin - section ct findings of the 12 patients are summarized in table 3 . in two patients , follow - up thin section ct images acquired one week after the start of antiviral therapy showed complete resolution or a remarkable decrease in size and opacity of the previously observed ggos and nodules ( fig . \n with increasing concern over the spread of the pandemic h1n1 2009 influenza virus infection worldwide , detailed knowledge of both its clinical and radiologic features can assist the clinical practice and decision - making of physicians facing this emerging pandemic infectious disease . \n in addition , preparation for this pandemic infectious disease among institutionalized populations in semi - closed settings such as schools , dormitories , military barracks , or prisons should be made since this infection can spread very rapidly and may quickly become unmanageable without prompt and proper management in the early stages of disease spread . in this study , we attempt to describe one incidence of a military outbreak of the pandemic h1n1 2009 influenza virus with a focus on the clinical and radiological features of these patients , as well as the outcome of treatment . \n we found common clinical features for all patients with the pandemic h1n1 2009 influenza virus infection in the present study , which included a high fever with accompanying symptoms of cough , rhinorrhea , sore throat , myalgia , or gastrointestinal symptoms such as vomiting or diarrhea . \n these findings are similar to the symptoms of other influenzas ( 8) and those found in previous studies that dealt with unspecified populations ( 3 , 5 , 9 - 13 ) . \n generally , laboratory tests , with the exception of serology and culture examinations , are not useful for the specific diagnosis of influenza . \n leukocyte counts are variable according to stage ; frequently low during the early stages of illness , and later become normal or slightly elevated ( 15 ) . in the present series , there were no patients with elevated wbc counts and 67% of patients showed lymphocytopenia . \n these findings are consistent with those found in previous studies that dealt with unspecified populations ( 3 , 5 ) . \n one additional diagnostic laboratory feature we were able to find was an elevated crp level while both the esr and wbc counts remained within a normal range in all patients in our study with pandemic h1n1 2009 influenza virus infection . \n we believe that elevated crp levels , combined with a lack of leukocytosis or elevated esr , may be characteristic of patients with the pandemic h1n1 2009 influenza virus infection , although these laboratory tests might generally not be able to render a specific diagnosis of this influenza viral infection ( 14 ) . \n further detailed comparative studies with a larger number of patients would be required to fully explore this issue . \n most patients in our study did not show a severe hospital course , although one patient 's symptoms aggravated into ards and needed mechanical ventilation before laboratory tests revealed that he had the pandemic h1n1 2009 influenza virus infection . \n we considered the possibility that co - infection of the pandemic h1n1 2009 influenza virus with other unknown respiratory pathogens under the leukocytopenia status could have attributed to this symptom aggravation ( 9 , 10 ) , particularly as he was a soldier serving in a different unit from the majority of other patients . \n in addition , the symptom aggravation had occurred after he had been in contact with a patient infected with the pandemic h1n1 2009 influenza virus and there were no pandemic h1n1 2009 influenza virus cases in the unit the patient had been enrolled in . however , since his respiratory symptoms and high fever did not respond to other previous antibiotic treatment , there is still the possibility that the disease course in this case could have been solely due to a severe manifestation of the pandemic h1n1 2009 influenza virus infection . in the present study , \n chest radiographs were abnormal in two of 18 patients with h1n1 , which was less frequent than that of a previous report , which showed a 42% rate of chest radiograph abnormality ( 12 ) . \n this suggests that negative findings on chest radiographs can not rule out the possibility of the pandemic h1n1 2009 influenza virus infection , particularly in its early stage or for an uncomplicated influenza infection ( 14 ) . \n thin - section ct examination results revealed that abnormal findings were found in six out of 12 patients ( 50% ) . \n the most common ct abnormalities included small ggos in five out of six patients and nodules in all six patients . \n however , in the previous studies ( 12 , 13 ) , multifocal consolidations ( two of seven patients and 50% ) and ggos ( two of seven patients and 25% ) were the most common ct findings of the pandemic h1n1 2009 influenza virus infection . the differences between the present study and previous studies could be attributed to the fact that radiological examinations in the present study were performed at the initial presentation , and probably the early stages of the disease ; whereas in previous studies ( 12 , 13 ) , radiological examinations were performed at various times after symptom onset . in our study , there was one patient with bilateral lobar consolidations , which progressed into ards . \n other investigators ( 3 ) also reported similar radiographic features in patients who progressed into ards . \n although extensive consolidations in the lung might be severe manifestations of primary viral pneumonia from the pandemic h1n1 2009 influenza virus infection , there still remains the possibility of combined pneumonia caused by other pathogens or pulmonary manifestations of ards ( 14 ) . \n the clinical courses and outcomes of patients in our study with the pandemic h1n1 2009 influenza virus infection were much better than those of previously reported cases ( 3 , 4 ) . \n furthermore , according to military rule , any problems concerning health must be notified to the medical department immediately , and thus , our patients may have been detected at an earlier stage of the disease course than would be found for the general population . in comparison with a previous report ( 3 ) that showed a high mortality rate in patients with the pandemic h1n1 2009 influenza virus infection , the interval between symptom onset and the emergency department visit ( mean 1.7 days in 15 among 18 patients ) and symptom onset and the start of antiviral agent therapy ( mean 3.9 days ) were shorter . \n therefore , we conclude that an early diagnosis and early antiviral management can improve the clinical course and outcome of the pandemic h1n1 2009 influenza virus infection . however , to understand the detailed relationship between symptom onset to admission or antiviral management and clinical courses or outcomes , further study , including a comparative analysis with a large case series , is warranted . in our series , most patients ( 15 out of 18 ) were from the same barrack , a semi - closed setting ; whereas , the three remaining patients from different barracks were thought to be infected from these 15 patients . \n clinical and laboratory results from this homogeneous study population can be helpful in understanding the clinical characteristics of the pandemic h1n1 2009 influenza virus infection in semi - closed settings and in institutionalized populations composed of a young healthy population , such as in schools , dormitories , prisons , or military units . \n furthermore , this report demonstrated that a prompt diagnosis and treatment resulted in excellent outcomes and could provide as an example for the detection and management strategy for cluster outbreaks of this virus . \n however , there may be limitations in applying these results to the larger general population . in conclusion , in a population of healthy young adults , elevated crp with normal esr and wbc levels combined with ggos and nodules on thin - section ct scans may indicate early signs of infection by the pandemic h1n1 2009 influenza virus .", "role": "user" }, { "content": "objectiveto describe detailed clinical and radiological features of the pandemic h1n1 2009 influenza viral infection among healthy young males in a semi - closed institutionalized setting.materials and methodsa total of 18 patients confirmed with the pandemic h1n1 2009 influenza virus infection from july 18 to july 30 , 2009 were enrolled in this study . \n each patient underwent an evaluation to determine detailed clinical and radiological features.resultsall patients presented with high fever ( > 38.0 ) , with accompanying symptoms of cough , rhinorrhea , sore throat , myalgia and diarrhea , and increased c - reactive protein ( crp ) values with no leukocytosis nor elevated erythrocyte sedimentation rate ( esr ) . \n all patients , including one patient who progressed into acute respiratory distress syndrome , were treated with oseltamivir phosphate and quickly recovered from their symptoms . \n chest radiographs showed abnormalities of small nodules and lobar consolidation in only two out of 18 patients . \n however , six of 12 patients who underwent thin - section ct examinations showed abnormal findings for small ground - glass opacities ( ggos ) in addition to poorly - defined nodules with upper lobe predominance.conclusionin a population of healthy young adults , elevated crp with normal esr and white blood cell levels combined with ggos and nodules on thin - section ct scans may indicate early signs of infection by the pandemic h1n1 2009 influenza virus .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: niemann - pick is an autosomal recessive lysosomal storage disease that is classified into four subgroups , namely a , b , c , and d ( 1 , 2 ) . types a and b involve a sphingomyelinase deficiency , while niemann - pick type c is associated with an alteration in the intracellular transport of cholesterol and , subsequently , its accumulation in the lysosomes ( 1 ) . \n the features of the disease include prolonged neonatal jaundice ( 3 ) , massive hepatosplenomegaly , as well as pulmonary and cardiac involvement with or without neurologic manifestations ( 4 ) . \n niemann - pick type a , which is also known as the infantile form , is the most common type , and its characteristic features include hepatomegaly , brain damage , and walking , speaking , and learning problems ( 2 ) . \n it usually results in early death because of the extensive neurological involvement ( 2 , 4 ) . \n niemann - pick type b is associated with organomegaly , but without severe neurological symptoms ( 4 ) . in niemann - pick type c , there is a broad spectrum of clinical manifestations , including liver and spleen involvement and neurological problems such as seizure , progressive dementia , and dystonia . \n respiratory problems have also been noted ( 1 , 5 ) . due to the complex clinical progression and \n multi - organ involvement , the anesthetic management of niemann - pick patients is challenging . \n however , only a few articles are available concerning the anesthetic implications of such patients ( 1 , 5 , 6 ) . hence , \n in this case report we describe the anesthetic management of a niemann - pick patient . \n this case report concerns a two - year - old female ( weighing 8 kg ) known to have niemann - pick disease who was scheduled for an elective closed reduction of a femoral shaft fracture under general anesthesia . \n the first manifestation of her condition was hepatosplenomegaly at five months of age , which is when the diagnosis was made based on blood and bone marrow findings . \n her past surgical history was negative . however , her past medical history was positive for repeat hospital admissions due to respiratory system infection . \n in terms of the preoperative assessment , abdominal sonography had shown hepatosplenomegaly , while echocardiography had demonstrated satisfactory left ventricular function . \n the preoperative lab data were within normal limits , except for hbg 9.7 g / dl , plt 125000/l , alk - pse 254 iu / l , urea 13 mg / dl , cr 3 mg / dl , and crp 15 mg / l . in the operating room , the patient was awake and conscious . \n mild suprasternal retraction was observed during the respiration ( respiratory rate 28 per minute ) . during the lung auscultation , \n a bilateral crackle was heard at the base of both lungs ( probably due to previous infections ) . \n additionally , the abdomen was distended and mild tenderness existed during palpation over the right upper quadrant . \n packed red blood cells ( rbc ) and platelets ( plt ) were reserved for the patient the day before surgery . in the operating room , standard monitoring consisting of pulse oximetry , electrocardiography ( ecg ) , and non - invasive blood pressure ( nibp ) \n the baseline o2 saturation in the room s air was 87% , and the nibp was 78/51 mmhg . \n after preoxygenation with o2 ( 4 - 5 l / min ) via a face mask , 16 g fentanyl and 1 mg midazolam were injected intravenously , then the induction of anesthesia was performed using the sevoflurane inhalation technique . \n when the proper depth of anesthesia was achieved , a 1.5 laryngeal mask airway ( lma ) was inserted while the patient was spontaneously breathing . \n anesthesia was maintained using sevoflurane ( 3% - 4% ) and remifentanil ( 0.5 /kg / min ) . \n her vital signs were stable during the operation , which lasted about 30 minutes . at the end of the procedure , an acetaminophen suppository ( 125 mg ) \n the patient was then transferred to the postoperative care unit ( pacu ) and , after fulfilling the discharge criteria , she was sent to the ward while hemodynamically stable . \n in general , niemann - pick disease can affect multiple organs , including the liver , spleen , lung , and heart , with or without neurologic deficits ( 4 ) . \n due to both the liver involvement and the probability of an alteration in drug metabolism , anesthetic drugs should be used with caution in niemann - pick patients . \n we therefore chose to use sevoflurane , which can be better tolerated in this specific condition . additionally , its rapid washing out after discontinuation helped us to achieve rapid recovery with minimal postoperative sequel on respiration and ventilation . similar to the approach of araujo \n ( 5 ) , we used remifentanil as the analgesic because of its short duration of action , which provided us with a rapid and predictable recovery . \n moreover , its metabolism , which is independent of liver function , rendered it a good analgesic choice for our patient . \n our patient also had mild thrombocytopenia , so we cautiously reserved packed rbc and plt for her prior to the operation . \n renal involvement in niemann - pick disease was reported for the first time by grafft et al . \n they described how renal involvement should be considered in all patients with this disease , especially those with renal dysfunction . \n it should be noted that none of our chosen medications negatively impact renal function . in niemann - pick type \n a , it is better to avoid the use of a muscle relaxant due to the neurologic involvement ( 6 ) , so we decided to insert the lma under deep inhalational anesthesia without muscle paralysis . in conclusion , \n the wide spectrum of manifestations and the complexity of multi - organ involvement necessitate a thorough understanding of the disease in order to identify the best method of anesthesia and , hence , to reduce perianesthetic morbidity and mortality in niemann - pick patients .", "role": "user" }, { "content": "niemann - pick is a lipid storage disease that results from a lysosomal enzyme deficiency ( sphingomyelinase ) . \n it has different presentations , and it may affect various organs such as the central nervous system , kidney , liver , and spleen . due to the complexity of the disease , \n careful perianesthetic management is necessary in order to reduce the risks and sequels . as there is little evidence available in the literature regarding the anesthetic implications of such patients , in this case report \n we describe the anesthetic management of a two - year - old female with niemann - pick disease .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the isolation and biological evaluation of maitotoxin ( 1 , figure 1a ) \n inspired numerous studies directed toward its structural elucidation and synthesis . \n as the largest secondary metabolite \n isolated to date and one of the most potent neurotoxins known , this \n impressive marine natural product represents the ultimate synthetic \n target and provides opportunities for discovery and invention in organic \n synthesis and chemical biology . as part of a program to explore such \n opportunities , \n we have developed several methods for the construction \n of maitotoxin s structural motifs and synthesized a number \n of its polycyclic domains , including fragments 26 ( figure 1b ) . in this article \n we report the synthesis of the qrstuvwxyza \n domains 79 ( figure 1c ) of maitotoxin and the biological evaluation of these and \n other previously synthesized fragments as inhibitors of maitotoxin - elicited \n ca ion influx in rat c6 glioma cells . \n we also report \n cytotoxic properties of some of these fragments as revealed by assays \n with the nci-60 dtp human tumor cell line panel . \n ( a ) molecular structure \n of maitotoxin ( 1 ) , ( b ) previously synthesized fragments \n ( 26 ) of maitotoxin , ( c ) qrstuvwxyza \n domains ( 7 , 8 , 9 ) targeted \n in this study . \n the synthetic strategy for the synthesis of the \n qrstuvwxyza domains 79 ( figure 1c ) of maitotoxin , desired either \n for further elaboration into larger maitotoxin domains or to serve \n as tools for biological investigations , was devised based on the retrosynthetic \n analysis shown in figure 2 . \n thus , dismantling \n of ring v within 8 through a hydroxyketone reductive \n cyclization led to enone 10 as a potential precursor . \n the latter was to be derived from the \n corresponding partners ( ketophosphonate 11 and aldehyde 12 ) for a horner wadsworth \n ketophosphonate 11 was traced back to the previously \n synthesized building blocks 14(7f ) and 15(7f ) through projected \n ( a ) esterification ; ( b ) takai utimoto ester olefination / ring \n closing metathesis ; and ( c ) hydroxydithioketal cyclization \n followed by stereoselective replacement of the remnant thio group \n with a methyl group as indicated in figure 2 . \n fragment 12 was to be \n prepared from the previously synthesized advanced intermediate 13(7d ) through standard manipulations . \n retrosynthetic \n analysis of the qrstuvwxyza domains 7 , 8 , and 9 of maitotoxin . \n abbreviations : pmb = para - methoxybenzyl ; tbdps = tert - butyldiphenylsilyl ; \n tbs = tert - butyldimethylsilyl ; tes = triethylsilyl . \n scheme 1 summarizes the construction of the required ketophosphonate 11 from the previously reported za and w fragments 14(7f ) and 15 . \n thus , tbdps ether 14 was efficiently \n converted to nitrile 16 through a sequence involving \n bis - desilylation ( tbaf , quant . \n yield ) , monotosylation ( tscl , 90% yield ) , \n resilylation ( tbsotf , 91% yield ) and substitution of the tosylate \n group with a cyano group ( kcn , 99% yield ) . \n stepwise reduction of nitrile 16 , first with dibal - h and then with nabh4 , afforded \n the corresponding primary alcohol ( 86% yield overall ) , which was protected \n as a tbdps ether ( tbdpscl , 95% yield ) . \n removal of the pmb group from \n the latter ( ddq , 90% yield ) resulted in the formation of alcohol 17 , whose coupling with carboxylic acid 15 was \n performed under shiina conditions ( mnba , et3n , dmap cat . \n hydroxy ester olefin 19 was smoothly generated \n from 18 through the action of p - tsoh \n ( 94% yield ) . \n as previously noted , the \n removal of the tes protecting group from the takai utimoto \n olefination / ring closing metathesis substrate was crucial for success . \n reagents and conditions : ( a ) tbaf \n ( 1.0 m in thf , 5.0 equiv ) , thf , 25 c , 1 h , quant . ; ( b ) tscl \n ( 4.0 equiv ) , pyridine , 25 c , 3.5 h , 90% ; ( c ) tbsotf ( 1.3 equiv ) , \n 2,6-lutidine ( 2.5 equiv ) , ch2cl2 , 0 c , \n 30 min , 91% ; ( d ) kcn ( 20 equiv ) , dmf , 100 c , 5 h , 99% ; ( e ) dibal - h \n ( 1.0 m in ch2cl2 , 1.1 equiv ) , ch2cl2 , 50 30 c , 1 h ; then \n aq . workup ; then citric acid ( 2.0 equiv ) , thf : h2o ( 2:1 ) , \n 25 c , 30 min ; ( f ) nabh4 ( 2.0 equiv ) , meoh : thf ( 4:1 ) , \n 0 c , 45 min , 86% over two steps ; ( g ) tbdpscl ( 2.0 equiv ) , imidazole \n ( 3.0 equiv ) , ch2cl2 , 25 c , 15 min , 95% ; \n ( h ) ddq ( 2.0 equiv ) , ch2cl2:phosphate buffer \n ph 7 ( 3:1 ) , 0 c , 2 h , 90% ; ( i ) 15 ( 1.0 equiv ) , \n mnba ( 1.05 equiv ) , et3n ( 2.7 equiv ) , dmap ( 0.1 equiv ) , \n 4 ms , phme , 25 c , 20 min ; then 17 ( 1.0 equiv ) , \n 14 h , 85% ; ( j ) p - tsohh2o ( 2.0 equiv ) , \n meoh : ch2cl2 ( 3:1 ) , 0 c , 40 min , 94% ; ( k ) \n ticl4 , ( 1.0 m in ch2cl2 , 50 equiv ) , \n tmeda ( 285 equiv ) , zn ( 110 equiv ) , pbcl2 ( 5.0 equiv ) , ch3chbr2 ( 50 equiv ) , thf , 0 65 c , 1.5 \n h , 78% ; ( l ) tmsotf ( 3.0 equiv ) , 2,6-lutidine ( 4.0 equiv ) , ch2cl2 , 30 min , 0 c , quant . ; ( m ) cybh2 ( 5.0 \n equiv ) , thf , 0 25 c ; 1 h ; then naoh ( 1 m aq . ) , h2o2 ( 30% aq . , \n excess ) , 0 25 c , 1 \n h , 74% ; ( n ) dmp ( 3.0 equiv ) , nahco3 ( 5.0 equiv ) , ch2cl2 , 0 25 c , 30 min , 90% ; ( o ) p - tsohh2o ( 0.1 equiv ) , meoh : ch2cl2 ( 1:1 ) , 0 c , 30 min , 96% ; ( p ) zn(otf)2 ( 5.0 equiv ) , etsh : ch2cl2 ( 4:1 ) , 25 c , \n 1.5 h , 74% ( 23a:23b ca . \n 1:2 dr ) ; ( q ) m - cpba ( 4.0 equiv ) , 2,6-di - tert - butyl-4-methylpyridine \n ( 5.0 equiv ) , ch2cl2 , 78 10 \n c , 20 min ; ( r ) me3al ( 30 equiv ) , 78 \n 0 c , 1 h , 78% over two steps ; ( s ) dibal - h ( 1.0 m in ch2cl2 , 50 equiv ) , ch2cl2 , 40 \n 10 c , 2 h , 88% ; ( t ) tbdpscl ( 1.2 equiv ) , imidazole \n ( 3.0 equiv ) , ch2cl2 , 0 c , quant . ; \n ( u ) \n nmoh2o ( 3.0 equiv ) , tpap ( 0.05 equiv ) , 4 ms , \n ch2cl2 , 0 25 c , 1 h ; ( v ) ( meo)2p(o)me ( 10 equiv ) , n - buli ( 9.0 equiv ) , thf , \n 78 c , 10 min ; then crude aldehyde , 78 c , \n 30 min ; ( w ) dmp ( 3.0 equiv ) , ch2cl2 , 0 \n 25 c , 2 h , 67% over three steps . \n abbreviations : ddq = 2,3-dichloro-5,6-dicyano - para - benzoquinone ; dibal - h = diisobutylaluminum hydride ; \n dmap = n , \n n - dimethyl-4-aminopyridine ; \n dmf = n , n - dimethylformamide ; dmp \n = dess martin periodinane ; ms = molecular sieves ; m - cpba = meta - chloroperoxybenzoic acid ; mnba = 2,6-methylnitrobenzoyl \n anhydride ; nmo = n - methylmorpholine - n - oxide ; noe = nuclear overhauser effect ; tbaf = tetra - n - butylammonium fluoride ; tf = trifluoromethanesulfonyl ; thf = tetrahydrofuran ; \n tmeda = tetramethylethylenediamine ; tms = trimethylsilyl ; tpap = tetra - n - propylammonium perruthenate ; ts = 4-toluenesulfonyl . \n thus , under optimized conditions ( ticl4 , tmeda , zn , pbcl2 , ch3chbr2 , thf , \n 0 65 c ) , hydroxy ester \n olefin 19 underwent the required transformation to oxepin \n derivative 20 ( 78% yield ) , presumably through initial \n ester olefination followed by ring closing olefin metathesis . the rather labile hydroxyenol ether 20 \n yield ) and converted stereoselectively \n to ketone 22 by hydroboration / oxidation ( cybh2 ; h2o2/naoh , 74% yield ) followed by oxidation \n of the resulting alcohol ( dmp , 90% yield ) . \n the configuration of the \n newly established chiral center at c106 was confirmed by \n nmr spectroscopic analysis ( i.e. , noe studies as indicated on structure 22 , scheme 1 ) . \n parenthetically , it \n is interesting to note that substrate 21 proved resistant \n to hydroboration with cy2bh , presumably due to the bulkiness \n of this reagent as compared to cybh2 . \n removal of the tms group from 22 with p - tsoh gave the corresponding hydroxyketone ( 96% yield ) , \n which was subjected to mixed thioketalization [ etsh , zn(otf)2 ] to furnish the corresponding s , o - ketal as a mixture of c107 diastereoisomers ( 74% yield , 23a : -set , 23b : -set , ca . \n exposure of this mixture to m - cpba \n in the presence of 2,6-di - tert - butyl-4-methylpyridine \n ( 78 10 \n c ) followed by addition of me3al at 78 c furnished pentacycle 24 in 78% overall yield and as a single diastereoisomer . \n the configuration of the newly introduced c107 methyl \n group was established by nmr spectroscopic analysis ( i.e. , noe studies \n as indicated on structure 24 , scheme 1 ) . \n differentiation of the two primary hydroxyl groups of the \n growing intermediate was achieved in the presence of the secondary \n tbs ether on ring a by selective cleavage of both primary \n tbdps ethers of 24 ( excess dibal - h , 10 c , \n 88% ) followed by selective monosilylation \n ( tbdpscl ) of the resulting diol ( steric control ) , leading to primary \n alcohol 25 ( quant . \n yield ) . finally , ketophosphonate 11 was generated from alcohol 25 through a three - step \n sequence involving oxidation ( tpap cat . , \n nmo ) , reaction of the resulting \n aldehyde with the lithioderivative of methyl dimethylphosphonate [ ( meo)2p(o)ch2li ] and oxidation ( dmp ) of the so - formed \n hydroxyphosphonate in 67% overall yield . with wxyza ketophosphonate \n fragment 11 in \n hand , we then turned our attention to its coupling with a suitable \n qrstu fragment ( i.e. , aldehyde 12 , scheme 2 ) and elaboration of the product to the targeted qrstuvwxyza \n domains ( 79 ) as shown in scheme 2 . \n the synthesis of the required fragment 12 began with the previously synthesized qrstu fragment 13 , whose two out of three benzyl ethers \n were selectively cleaved by hydrogenolysis ( pd / c , h2 , 80% \n yield ) to afford diol 26 . \n the remaining benzyl ether \n within 26 residing on ring q adjacent to a quaternary \n center proved resistant to cleavage under these conditions , most likely \n due to steric hindrance . \n , ph(oac)2 ] followed by wittig \n reaction of the resulting aldehyde with ph3p = ch2 gave hydroxyolefin 27 in 77% overall yield . \n desilylation of the latter followed by persilylation of the generated \n triol ( tesotf ) led to the corresponding tri - tes ether ( quant . \n yield \n for the two steps ) , from which the primary tes group was selectively \n removed ( ppts , meoh , 10 c ) to afford primary alcohol 28 ( 76% yield ) . \n oxidation of this alcohol ( tpap cat . , nmo ) \n then furnished the coveted aldehyde 12 , which was directly \n condensed with ketophosphonate 11 in the presence of \n ba(oh)2 to give ,-unsaturated ketone 10 ( 78% overall yield ) . \n the latter \n compound was treated with stryker s reagent { [ ( pph3)cuh]6 } to furnish selectively \n saturated ketone 29 ( 97% yield ) . \n in preparation for and \n in order to improvise for a cleaner reaction in the pending cyclization \n to forge ring v , it was desired to exchange the tbs and tbdps ethers \n ( ring a ) with tes ethers . to this end \n , intermediate 29 was globally desilylated with tbaf and then persilylated \n with excess tesotf to afford tetra - tes substrate 30 ( 88% \n overall yield ) . \n exposure of precursor 30 to excess et3sih ( tesh ) in the presence of bibr3 effected the desired formation of ring v through stereoselective \n reductive cyclization with concomitant global desilylation , furnishing \n bis - benzyl ether qrstuvwxyza domain 8 of \n maitotoxin in 81% yield . \n hydrogenation of the olefinic moiety with \n concomitant cleavage of the two benzyl ethers [ 20% pd(oh)2/c , h2 ; note the more active catalyst required for this \n hydrogenolysis as compared to 10% pd / c used in the conversion of 13 to 26 ( scheme 2 ) mentioned \n above ] within 8 then led to domain 9 ( quant . \n protection of the two hydroxyl groups extended from ring a \n of 8 as a cyclic ketal [ me2c(ome)2 , csa cat . ] furnished acetonide bis - benzyl ether qrstuvwxyza \n domain 7 ( 83% yield ) . \n the stereochemical configurations \n assigned to compounds 7 , 8 , and 9 were established by nmr spectroscopic analysis of domain 9 ( i.e. , noe studies as indicated on structure 9 , scheme 2 ) . \n reagents \n and conditions : ( a ) 10% pd / c ( 0.2 equiv ) , h2 , etoh , 25 \n c , 4 h , 80% ; ( b ) tempo ( 0.3 equiv ) , phi(oac)2 ( 2.0 \n equiv ) , ch2cl2 , 40 c , 2.5 h ; then additional \n tempo ( 0.5 equiv ) , 40 c , 1 h ; ( c ) ch3pph3br ( 10 equiv ) , nahmds ( 0.6 m in phme , 9.0 equiv ) , thf , 0 c , \n 10 min ; then crude aldehyde , 0 c , 1 h , 77% over two steps ; ( d ) \n tbaf ( 1.0 m in thf , 4.0 equiv ) , thf , 25 45 c , 4 h ; \n ( e ) tesotf ( 6.0 equiv ) , 2,6-lutidine ( 8.0 equiv ) , 25 c , 1 h , \n quant . over two steps ; ( f ) ppts ( 0.07 equiv ) , meoh , 10 c , \n 1 h , 76% ; ( g ) nmoh2o ( 3.0 equiv ) , tpap ( 0.05 equiv ) , \n 4 ms , ch2cl2 , 0 25 c , \n 1 h ; ( h ) 11 ( 1.0 equiv ) , ba(oh)28h2o ( 1.5 equiv ) , thf : h2o ( 6:1 ) ; then 12 , 25 c , 4.5 h , 78% over two steps ; ( i ) [ ( pph3)cuh]6 ( 1.5 equiv ) , phme , 25 c , 3 h , 97% ; ( j ) tbaf ( 1.0 m \n in thf , 6.0 equiv ) , thf , 25 c , 5 h ; ( k ) tesotf ( 8.0 equiv ) , \n 2,6-lutidine ( 10 equiv ) , ch2cl2 , 0 c , \n 1 h , 88% over two steps ; ( l ) bibr3 ( 0.5 m in mecn , 3.0 \n equiv ) , tesh ( 50 equiv ) , mecn : ch2cl2 ( 4:1 ) , \n 10 c , 2 h , 81% ; ( m ) 2,2-dimethoxypropane ( 50 equiv ) , \n csa ( 0.2 equiv ) , ch2cl2 , 25 c , 1 h , 83% ; \n ( n ) 20% pd(oh)2/c ( 0.6 equiv ) , h2 , etoh , 25 \n c , 28 h , quant . abbreviations : csa = ( )-camphor-10-sulfonic \n acid ; nahmds = sodium bis(trimethylsilyl)amide ; ppts = pyridinium para - toluene sulfonate ; tempo = 2,2,6,6-tetramethyl-1-piperidinyloxy . \n the cdef ( 3643 ) and qrstuvwxyza ( 34 ) derivatives , required for the biological investigations \n ( see figure 4 ) were prepared from 6(7e ) ( derivatives 3642 ) , 35(7e ) ( derivative 43 ) and 7 ( derivative 34 ) by standard \n methods as described in the supporting information . in order \n to provide further support for the original structural assignment \n of maitotoxin ( 1 ) , we determined \n the chemical shifts of carbons c78 to c118 and \n c150 to c159 through 2d nmr spectroscopic analysis \n ( see table 1 ) of the qrstuvwxyza \n domain 9 . \n comparison of these values with those corresponding \n to the same region of maitotoxin led to the differences for each carbon \n of these two compounds ( ) as shown in table 1 . \n these differences are also shown graphically in \n figure 3 reflecting only small deviations between \n the two sets . \n thus , the average chemical shift difference ( ) \n between the two sets of values for c81 to c115 and c150 to c159 ( blue bars in figure 3 ) is 0.24 ppm and the maximum difference ( ) \n for any of these carbons is 1.7 ppm ( c81 ) . \n the aberrant \n values for c78 , c79 , c80 , c116 , c117 and c118 ( red bars in figure 3 ) are attributed to the significant differences \n of the edges of the two molecules under comparison ( see figure 3 ) . graphically depicted c chemical shift differences \n ( , ppm ) for each carbon between c78 and c118 and c150 and c159 for maitotoxin \n ( 1 ) and qrstuvwxyza ring system 9 . \n data were collected at 150 mhz in 1:1 methanol - d4:pyridine - d5 solvent mixture . \n maitotoxin is presumed to elicit its neurotoxicity through binding \n to and activating membrane ion channels within neurons , thereby causing \n rapid ca influx . in order \n to gather information regarding the ability of various maitotoxin \n fragments synthesized in our laboratories [ 79 ( this work ) , 34 ( this work ) , 3643 ( this work ) , 2,4,6,31,32,33,35 , figure 4 ] to inhibit maitotoxin - induced influx of calcium ions , we subjected \n them to appropriate assays with rat c6 glioma cells . \n as shown in figure 4 , fragments 31 ( abcde ) , 2 ( abcdefg ) and 32 ( abcdefg ) were found to be inactive ( 2 and 32 ) or only \n slightly active ( i.e. , ic50 > 30 m , 31 ) . \n fragment 4 ( qrstu ) \n and fragment 33 ( wxyza ) were found to be slightly \n active ( ic50 > 30 m ) . \n 30 \n m , whereas its debenzylated saturated counterpart 9 exhibited potency at ic50 = 3.2 m . \n fragment 7 was slightly active \n while fragment 34 was active at ic50 = 5.4 \n m . \n fragment 6 ( cdef ) \n showed only slight activity ( ic50 > 30 m ) in \n contrast to its tert - butyldiphenyl silyl ether derivative 35 , which proved to be the most potent compound we tested \n in this study ( ic50 = 2.3 m ) . \n these results are , \n for the most part , consistent with murata s hypothesis that maitotoxin anchors itself in the neuron \n membrane using its lipophilic domain ( i.e. , qrstuvwxyzabcdef ) \n which presumably binds to the membrane - bound ion channel causing it \n to open , whereas its hydrophilic domain ( i.e. , abcdefghijklmnop ) \n remains outside the cell membrane . \n the latter most likely serves to \n sequester and facilitate the influx of ca ions into the \n cell through the channel once opened . \n thus , fragment 31 ( abcde ) shows only weak activity despite its lipophilic protective \n groups , presumably due to its inability to bind to the ca ion channel . \n similarly , fragment 2 shows no activity \n due to its hydrophilic nature that does not allow it to easily enter \n the membrane , or , if it does , has no significant affinity for the \n ion channel . \n its polybenzyl counterpart 32 shows no activity , \n presumably due to its weak binding affinity to the ion channel . \n fragment 4 is probably too polar to enter the cell membrane due to \n its five hydroxyl groups , whereas fragment 33 might have \n weak affinity for the ion channel . \n fragments 9 and 34 exhibit significant inhibition of maitotoxin in this assay , \n as expected , with the former being the more potent of the two . \n most interesting , however , is the relatively high \n potency of fragment 6 , whose structural features ( i.e. , tert - butyldiphenylsilyl ether moiety ) , overall shape and \n lipophilicity may allow it to anchor into the membrane and bind to \n the ion channel , presumably at the same site as the corresponding \n region of maitotoxin . the remaining compounds ( 3543 , figure 4 ) \n proved to be either inactive \n ( 41 , 42 ) or weakly active ( ic50 ca . 30 m , 36 , 37 , 39 or ic50 > 30 m , 38 , 40 , 43 ) , a phenomenon presumably depending on their ability \n to reach and bind to the intended receptor site as dictated by their \n specific structural features . structures of maitotoxin ( 1 ) and \n synthesized fragments with their ability to inhibit maitotoxin - elicited ca influx in rat c6 glioma cells . \n a number of these maitotoxin fragments ( i.e. , 2 , 4 , 69 , 32 , 33 and 35 , figure 4 ) were also submitted to nci for screening . \n most exhibited only relatively \n low growth inhibition ( gi50 ) and cytotoxicity against the \n nci-60 dtp human tumor cell line panel , with qrstuvwxyza \n domain 9 being the most potent . \n thus , compound 9 exhibited significant growth inhibition against leukemia \n ( gi50 = 2.15 m , cell line rpmi-8226 ) , nonsmall cell \n lung cancer ( gi50 = 2.44 m , cell line hop-92 ) , colon \n cancer ( gi50 = 2.34 m , cell line hct-116 ) , cns cancer \n ( gi50 = 4.50 m , cell line sf-539 ) , melanoma ( gi50 = 2.13 m , cell line sk - mel-5 ) , ovarian cancer ( gi50 = 3.84 m , cell line ovcar-3 ) , renal cancer ( gi50 = 1.86 m , cell line sn12c ) , prostate cancer ( gi50 = 1.83 m , cell line pc-3 ) and breast cancer ( gi50 = 1.26 m , cell line mda - mb-468 ) . \n the described chemistry \n renders the qrstuvwxyza domain of maitotoxin readily \n available as three derivatives 7 , 8 , and 9 for further chemical and biological studies . \n the devised \n convergent strategy demonstrates the power of the hydroxydithioketal \n cyclization / methylation , reductive hydroxyketone cyclization , and \n takai utimoto ester olefination / ring closing metathesis methods \n as means to construct complex , ladder - like polyether structures . \n biological investigations with the synthesized \n maitotoxin fragments from these and previous studies in these laboratories \n revealed significant inhibitory activities against maitotoxin - elicited \n ca influx in rat glioma cells . the structure \n activity \n relationships obtained from these investigations can be rationalized , \n for the most part , by murata s hypothesis ( amphoteric hydrophilic \n lipophilic \n nature of maitotoxin ) whereby the molecule \n is embedded within the neuron cell membrane through its lower \n rather lipophilic domain , whereas the top rather hydrophilic \n domain resides outside the membrane , presumably serving to sequester \n ca ions and facilitate their influx into the cell . on \n the basis of these results , further advances toward the total synthesis \n of maitotoxin and elucidation of its precise mode of action", "role": "user" }, { "content": "the \n synthesis of qrstuvwxyza domains 7 , 8 , and 9 of the highly potent marine neurotoxin \n maitotoxin ( 1 ) , the largest secondary metabolite isolated \n to date , is described . \n the devised synthetic strategy entailed a cascade \n takai utimoto ester olefination / ring closing metathesis to \n construct ring y , a hydroxydithioketal cyclization / methylation sequence \n to cast ring x , a horner wadsworth emmons coupling of \n wxyza ketophosphonate 11 with qrstu aldehyde 12 to form enone 10 , and a reductive hydroxyketone \n ring closure to forge ring v. 2d nmr spectroscopic analysis and comparison \n of 13c chemical shifts with those of the corresponding \n carbons of maitotoxin revealed close similarities supporting the originally \n assigned structure of this region of the natural product . \n biological \n evaluations of various synthesized domains of maitotoxin in this and \n previous studies from these laboratories led to fragment structure \n activity \n relationships regarding their ability to inhibit maitotoxin - elicited \n ca2 + influx in rat c6 glioma cells .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: although dental caries significantly decreased in the western countries , it is still considered a major public health problem affecting , in the form of early childhood caries ( ecc ) , most of the preschool children in many countries world - wide . \n the american academy of pediatric dentistry defined ecc as the presence of one or more decayed ( noncavitated or cavitated lesions ) , missing ( due to caries ) , or filled tooth surfaces in any primary tooth in a child in a child 71 months of age or younger . prevalence of ecc has been reported to range from 1 to 12% in infants from developed countries . \n considering the potential negative impact on overall oral health and on oral health related quality of life of children aged 25 years and their parents , ecc represents an indicator of missed prevention programs , either in developed or developing countries . \n clinical evidence has succinctly demonstrated the relationship between caries development in early childhood and wrong behaviors . \n the habit of falling asleep with a bottle of sweetened drinks or with a sweetened pacifier , mothers and/or playmates with untreated dental caries , and sharing of food and utensils ( horizontal transmission ) expose infants at increased risk for the development of ecc if daily at - home oral health hygiene practices are lacking . the focal reason for this situation \n is attributable mainly to the parents or caregivers lack of awareness of the potential infection . \n it follows that interventions designed to assess their knowledge and to consequently change their practices , known to be associated with the ecc , may be useful in the prevention of caries at an early age . \n the aim of this survey was to evaluate the knowledge and awareness of parents and caregivers of infants and young children about the incorrect daily behaviors as potential causes that could increase the oral health risk status of children in their first months of life ( 330 months ) . \n the study protocol conformed to the ethical guidelines of the 1975 declaration of helsinki was approved by the appropriate ethics committee of sapienza university of rome . \n written informed consent was obtained from all parents or caregivers of infants and young children aged 330 months attending the health promotion unit of the public consulting service in latina for mandatory vaccinations . \n a self - administered 16-point survey questionnaire was filled at the initial consultation to assess behavioral habits of parents and caregivers about the oral health care of their children . \n confidential information was obtained regarding demographic variables of the child , previous infant feeding practice ( breastfeeding or baby bottle using ) , maternal oral health during and after pregnancy , children 's oral hygiene habits ( toothbrushing , fluoride usage ) and general behavioral variables ( sharing cutlery , tasting of baby food , nightly usage of baby bottles or sippy cups with sugared beverages or sugared pacifier ) , knowledge about caries , and its transmission by a series of closed questions . the questionnaire was prepared together with a statistician that established the sample size sufficient for study validity ; questionnaire validation was checked in a previous pilot study used as thesis dissertation . \n the data gathered with the questionnaire were recorded with a specially designed computer program and collated in a microsoft excel database . \n descriptive statistics were computed for each items and the percentage of participants answering yes / no to each of the 16 items was calculated . \n the analysis of the data was performed using spss 14.0 for windows ( spss inc . , \n the variance analysis and chi - square test were used to investigate the relationship between the variables . \n there were 72 fathers ( 23.6% ) and 232 mothers ( 76.4% ) . among 304 children attending the public health service in latina , 156 ( 51.3% ) were males and 148 ( 48.7% ) were females . \n written informed consent was obtained from all parents during the period june to august 2014 . \n seventy - five ( 24.7% ) of the respondents referred that tooth decay is not a disease and 67 ( 22% ) referred not to know ; 53.6% was not aware about the possibility of caries transmission ; 100% of the respondents ( 304 ) reported that each family member had their own toothbrush ; 38.5% ( 117 ) referred to usually share the cutlery with children , and 53% ( 161 ) to taste the baby food . \n descriptive results of the survey ( total percentages ) from the questionnaire it emerged that 80.6% of the gynecologists did not suggest the pregnant woman to perform a routine dental visit during the period of pregnancy ; despite this , 116 pregnant women ( 38.16% of the sample ) asked for a dental visit for the following reasons : control check - up ( 46.3% ) , professional oral hygiene ( 24.8% ) , operative treatment ( 9.9% ) , emergency and pain ( 19% ) . about children nightly habits , 48% reported routine use of sugar before sleeping and overnight as follow : 2.9% sweetened pacifier , 35% sweetened milk in the baby bottle , 9.5% sweetened juice or chamomile , and 0.7% other drinks . among the parents who answered positively to the previous question , \n 26.7% reported doing so to calm the crying baby and 39.3% for making falling the baby asleep . \n in addition , 75.5% reported that this habit lasted less than 1 year , 23.1% less than 2 years , and 1.4% more than 2 years . \n with regard to children oral health care , 74.7% ( 227 ) of parents reported not to have administered fluoride ( pre or post - eruptive ) in the first 3 years of their child 's life . for what concerns the beginning of children toothbrushing , \n figure 1 shows the distribution of the beginning of this practice , according to the age . \n more than half of respondents ( 53.1% ) reported no toothbrushing for their children in the first 3 years of life , whereas 22.5% started toothbrushing in the first year and the 23.75% started it during the second year . \n the relationship between the two variables concerning caries transmissibility and tools sharing carried out on through pearson chi - square test identifies p = 0.32 [ table 2 ] . \n most noteworthy features of data analysis from this survey showed as more than half of respondents were aware about dental caries as an infectious disease . however \n in fact , from this study , it emerged that the common tendency of parents to have direct contact with their children , often with salivary exchanges can favor bacterial contamination of the oral cavity , especially when parents have current untreated caries . \n regarding scientific literature , prevalence of eec among italian children is approximately 22% in the fourth of age and 44% in the twelfth ; early acquisition of streptococci mutans ( ms ) is a key event for the beginning of the disease . \n the major reservoir of ms is the mother , from whom the child acquires it during a window period of around 2 years of age . \n furthermore , ecc has often been labeled as baby bottle tooth decay , suggesting that the use of a sugar - containing liquid in a bottle at night may be an important etiological factor in the enhancement of the disease . \n primary oral colonization by ma coupled with caries - promoting feeding behaviors and poor oral hygiene habits results in accumulation of these organisms to levels exceeding 30% of the total plaque flora , which leads to rapid demineralization of tooth structure . from this survey \n it emerged that 48% of parents use to offer their children sugar - containing liquid or sweetened pacifier at night , mainly to calm or facilitate them to sleep . \n available experimental evidence shows that cow milk is essentially non - cariogenic because of its mineral content and low level of lactose but saliva production decreases during sleep , and the protracted sucking of sugar - containing milk can result in promoting the cariogenic potential of milk itself . \n children experiencing caries as infants or toddlers have a much greater probability of subsequent caries in both deciduous and permanent dentitions . some young children with ecc may be severely underweight because of associated pain and their disinclination to eat . \n in addition , from the survey it was found that gynecologists did not suggest pregnant women to make a dental visit in 80.6% of the cases . \n dental caries is a preventable disease , and therefore , it should be better if prevention of ecc begins in the prenatal and perinatal periods ( including pregnancy and the first months after birth ) and addresses the health of both the mother and the infant . \n infants whose mothers have high levels of ms due to untreated dental decay are at greater risk of oral colonization . \n the literature shows , however , that the collaboration between gynecologist , dentist and dental hygienist is of primary importance to implement prevention strategies for oral health of pregnant women . \n in addition , it emerged that 53.1% of respondents never brushed their children 's teeth in the first 3 years of life and 74.7% never administered fluoride ( pre or post - eruptive ) to their children . \n the results obtained from this survey point out that knowledge and awareness on information , health education , and health promotion are lacking throughout respondent parents , and this can potentially increase the oral health risk status of their children . \n although we do not have information about social background of the parents , lack of statistical significance ( p = 0.3 ) indicates that despite a good knowledge of etiology and transmissibility of dental caries often parents take potentially risky behaviors for oral health of their children ; this emphasizes the need for better information of parents on these issues and the importance of preventive dental visits from a young age . \n primary prevention health promotion projects should be therefore organized targeting them in order to improve : \n feeding and eating habits of the baby . \n specifically , it must be highlighted not to sleep with baby bottles containing liquids out than water ; avoid prolonged consumption of sugared drinks ; not dipping pacifier in honey or sweetened solutions ; reducing the use of baby bottles from 14 months onwards , checking child 's diet in the amount and frequency of exposure to sugars ; restraining the intake of sugar during the main meals , since the salivary flow increases.care of parental oral health and nutrition to limit the transmissibility of cariogenic bacteria , specifically performing regular professional and home oral hygiene and regular dental visits . in case of mother \n untreated caries , limiting salivary exchange habits , such as cleaning the pacifier with water instead of saliva , not blowing and/or tasting child 's food during the weaning , and not sharing the same cutlery;oral hygiene of the baby . following international and national oral health guidelines : from birth to the first tooth eruption baby gums cleansing twice a day using a wet gauze or special soft gloves ; after the eruption of the first primary tooth , brushing teeth after meals ( or after taking medication containing sucrose ) , with a smear / pea - size of low fluoride toothpaste ( 500 ppm ) to minimize the risk of accidental ingestion ; using individual fluoride supplements for children at medium / high risk for tooth decay ) . \n feeding and eating habits of the baby . \n specifically , it must be highlighted not to sleep with baby bottles containing liquids out than water ; avoid prolonged consumption of sugared drinks ; not dipping pacifier in honey or sweetened solutions ; reducing the use of baby bottles from 14 months onwards , checking child 's diet in the amount and frequency of exposure to sugars ; restraining the intake of sugar during the main meals , since the salivary flow increases . \n care of parental oral health and nutrition to limit the transmissibility of cariogenic bacteria , specifically performing regular professional and home oral hygiene and regular dental visits . in case of mother \n untreated caries , limiting salivary exchange habits , such as cleaning the pacifier with water instead of saliva , not blowing and/or tasting child 's food during the weaning , and not sharing the same cutlery ; oral hygiene of the baby . following international and national oral health guidelines : from birth to the first tooth eruption baby gums cleansing twice a day using a wet gauze or special soft gloves ; after the eruption of the first primary tooth , brushing teeth after meals ( or after taking medication containing sucrose ) , with a smear / pea - size of low fluoride toothpaste ( 500 ppm ) to minimize the risk of accidental ingestion ; using individual fluoride supplements for children at medium / high risk for tooth decay ) . there are no conflicts of interest . \n \n ", "role": "user" }, { "content": "aim : the aim of this survey was to evaluate the knowledge and awareness of parents and caregivers about potential oral health risk factors for their children in their first months of life ( 330 months).materials and methods : the participation to the survey was proposed to all parents or caregivers of children attending the public consulting service in latina for mandatory vaccinations during the period of june to august 2014 . \n a self - administered questionnaire was completed to obtain information regarding demographic variables , infant feeding practice , maternal oral health during and after pregnancy , children 's oral hygiene habits and risk behaviors ( e.g. , sharing cutlery , tasting of baby food , nightly using of baby bottles with sugared beverages , or sugared pacifier ) , and knowledge about caries and its transmission . the analysis of the data was performed using spss 14.0 for windows ( spss inc . , \n chicago , il , usa ) . \n the variance analysis and chi - square test were used to investigate the relationship between the variables.results:overall , the parents of 304 children consented to fill the questionnaire . \n data analysis showed that about 50% of respondents considered dental caries an infectious disease , however , 53.6% was not aware of the potential vertical transmissibility of cariogenic bacteria through contaminated saliva . \n it is a common trend in the early stages of weaning to taste the baby food ( 53% ) and sharing cutlery ( 38.5% ) . with regard to children oral health care , \n parents reported no toothbrushing for 53.1% of the children in their first 3 years of life . \n the relationship between the two variables concerning caries transmissibility and tools sharing carried out on through pearson chi - square test identified p = 0.32.conclusions:from this survey , the need for parental oral health promoting program emerged to control children oral health risk status .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the inherent complexities of science and technology in recent years have caused most countries , universities , and research institutions to face difficulties in finding the right human resources and enough budgets for their research projects . \n one of the results of these complexities is that solo , individual researches are being replaced by collective research attempts in many disciplines such that scientific collaboration has become one of the most important social mechanisms in recent research projects . \n newman believes that useful and effective sharing of viewpoints , specialization of scientific disciplines , multi - discipline studies , increasing of research costs , and political factors all played important roles in increasing the level of collaboration between researchers . \n the result of this collaboration is that in order to complete their research , many scientists collaborate with their peers in other organization , disciplines , and even other countries . \n one of the most tangible forms of this collaboration is co - authorship , which can be seen in articles published in any technical and scientific journal nowadays . during recent years \n , the discipline of library and information science in iran had grown in both educational and research dimensions . \n continuity in publication of research journals and emergence of new ones are among the most important happenings regarding its research dimension . due to these changes \n , many researchers tried to investigate the research structure of this discipline in different national and international levels , aiming to identify its strengths and weaknesses in order to improve the studies conducted in this discipline . in his study , farajpahlou investigated the collective articles of iranian authors in library and information science in four specialized farsi journals between years 2001 and 2003 . \n his findings showed that among 168 investigated articles , only 23 articles ( 14% ) were the results of collaboration of several authors and the average collaboration was 2.04 authors per paper . \n an investigation of pakistan library and information science journal ( plisj ) by naseer and mahmood between years 1998 and 2007 showed that 88.6% of the articles published in this journal had one author . \n indexed in emerald between years 2003 and 2008 showed that the collaboration coefficient of researchers in library and information science discipline is 0.08 . \n yousefy and malekahmadi also investigated the collaboration between authors of library and information science discipline in isi , scopus , and pubmed databases between years 2001 and 2010 . \n their findings showed that 60.45% of the articles had a one author pattern and 30.46% of them had multi - author pattern . \n also , the collaboration coefficient of the researchers during the investigated time period was 0.25 . \n a review of the previous studies shows a low collaboration rate between researchers in library and information science discipline where many articles follow a single author pattern . \n this is in contrast with the scientific collaboration between researchers in physics , biology , and astronomy . \n the aim of current study is an assessment of scientific collaboration and co - authorship patterns in library and information science researches conducted in iran . for this end \n , the published articles related to this discipline in iranian journals between years 2005 and 2009 were investigated . \n this research aims to reach the following goals : \n investigating the frequency of individual and collective scientific productions in library and information science in iran.investigating the growth of individual and collective scientific studies in library and information science during the investigated time period.investigation of co - authorship patterns of iranian library and information science researchers andinvestigation of collaboration coefficient , collaboration index ( ci ) , and degree of collaboration ( dc ) in iranian library and information science researchers . \n investigating the frequency of individual and collective scientific productions in library and information science in iran . investigating the growth of individual and collective scientific studies in library and information science during the investigated time period . \n investigation of co - authorship patterns of iranian library and information science researchers and investigation of collaboration coefficient , collaboration index ( ci ) , and degree of collaboration ( dc ) in iranian library and information science researchers . \n the statistical population consisted of 942 documents published in iranian journals regarding library and information science between years 2005 and 2009 [ table 1 ] . in order to gather the research data , \n first , the articles were downloaded onto a personal computer from the main website of each journal . then \n , the necessary information such as journal title , number of articles , and number of authors were extracted using a checklist and then analyzed . \n ms - excel software was used for data analysis . also , collaboration coefficient , collaboration index ( ci ) , and degree of collaboration ( dc ) were calculated using the following equation : number of published librarianship and information science articles based on publication year and journal where fi the total number of articles with j authors published during a certain period of time , n is the total number of articles published during the same time period , k is the number of authors per article in each discipline , and f1 is the number of articles with a single author published during a certain period of time . \n the findings show that in the five year period investigated , a total number of 942 articles were published by researchers in the librarianship and information science field in related journals iran . among those , \n 506 documents ( 53.70% ) were written individually and 436 ( 46.30% ) documents were the result of collaboration between two or more authors . \n this shows that the researchers in librarianship and information science prefer to work individually [ table 2 ] . \n individual and collective scientific productions in librarianship and information science in iran as can be seen in figure 1 , the collective articles have increased over time , and the most number of collective articles were published in year 2009 . on the other hand , despite some fluctuations , individual articles show a decreasing trend with the least number of individual articles being published in year 2009 [ figure 1 ] . \n the growth rate of individual and collective articles in librarianship and information science investigating the co - authorship patterns of researchers in librarianship and information science in iran shows the individual authorship pattern to be the most common pattern with 506 ( 53.70% ) of the documents being published individually and without help from other authors . \n the second place belongs to two authorship pattern with 341 ( 36.20% ) of the documents [ table 3 ] . \n frequency of scientific productions following different co - authorship patterns during the investigated period figure 2 shows scientific productions with individual co - authorship pattern have been declining overtime reaching its lowest point in year 2009 ( with 81 documents ) . on the other hand , all of the other co - authorship patterns ( those with two , three , four , and more than four authors ) show an increasing trend . \n growth rate of different co - authorship patterns in librarianship and information science articles in iran analysis of co - authorship patterns of librarianship and information science in different journals shows that highest rank in all co - authorship patterns belongs to national journal of librarianship and information organization ( code h ) , except three authors co - authorship pattern , which belongs to library and information science ( code f ) [ table 4 ] . \n the frequency of scientific productions of different journals following different co - authorship patterns during the investigated time period collaboration index is the average number of authors per article . \n data in table 5 shows that the collaboration index of librarianship and information science has relatively grown during the investigated time period , and the highest collaboration index ( 1.92 ) was seen in year 2009 . also , the five year collaboration index of librarianship and information science was 1.58 . \n degree of collaboration of authors in the investigated articles was 0.46 , which means that there is a moderate trend for co - authorship . \n however , the desire for co - authorship had grown during the investigated period , reaching its apex in year 2009 . \n the collaboration coefficient of the researchers also shows significant growth between years 2005 and 2009 . \n the closer this coefficient is to one , there is more desire for collaboration , and a coefficient near zero means a trend toward individual works . \n however , total collaboration coefficient of 0.23 shows low collaboration between librarianship and information science researchers . \n analysis of collaboration coefficient ( cc ) , collaboration index ( ci ) , and degree of collaboration ( dc ) of different journals showed that library and information science research ( b ) had the highest collaboration coefficient ( 0.45 ) , collaboration index ( 2.14 ) , and degree of collaboration ( 0.79 ) [ table 6 ] . \n collaboration coefficient , collaboration index and degree of collaboration of the researchers in librarianship and information science collaboration coefficient , collaboration index and degree of collaboration of different iranian journals in librarianship and information science \n investigating the co - authorship patterns of researchers in librarianship and information science in iran shows the individual authorship pattern to be the most common pattern with 506 ( 53.70% ) of the documents being published individually and without help from other authors . \n the second place belongs to two authorship pattern with 341 ( 36.20% ) of the documents [ table 3 ] . \n frequency of scientific productions following different co - authorship patterns during the investigated period figure 2 shows scientific productions with individual co - authorship pattern have been declining overtime reaching its lowest point in year 2009 ( with 81 documents ) . on the other hand , all of the other co - authorship patterns ( those with two , three , four , and more than four authors ) show an increasing trend . \n growth rate of different co - authorship patterns in librarianship and information science articles in iran analysis of co - authorship patterns of librarianship and information science in different journals shows that highest rank in all co - authorship patterns belongs to national journal of librarianship and information organization ( code h ) , except three authors co - authorship pattern , which belongs to library and information science ( code f ) [ table 4 ] . the frequency of scientific productions of different journals following different co - authorship patterns during the investigated time period \n data in table 5 shows that the collaboration index of librarianship and information science has relatively grown during the investigated time period , and the highest collaboration index ( 1.92 ) was seen in year 2009 . also , the five year collaboration index of librarianship and information science was 1.58 . \n degree of collaboration of authors in the investigated articles was 0.46 , which means that there is a moderate trend for co - authorship . \n however , the desire for co - authorship had grown during the investigated period , reaching its apex in year 2009 . \n the collaboration coefficient of the researchers also shows significant growth between years 2005 and 2009 . \n the closer this coefficient is to one , there is more desire for collaboration , and a coefficient near zero means a trend toward individual works \n . however , total collaboration coefficient of 0.23 shows low collaboration between librarianship and information science researchers . \n analysis of collaboration coefficient ( cc ) , collaboration index ( ci ) , and degree of collaboration ( dc ) of different journals showed that library and information science research ( b ) had the highest collaboration coefficient ( 0.45 ) , collaboration index ( 2.14 ) , and degree of collaboration ( 0.79 ) [ table 6 ] . \n collaboration coefficient , collaboration index and degree of collaboration of the researchers in librarianship and information science collaboration coefficient , collaboration index and degree of collaboration of different iranian journals in librarianship and information science \n the study of scientific collaboration , which is one of the subcategories of scientometrics , has gained increased popularity in recent years , and many researchers attempted to discover the scientific collaboration patterns of different disciplines . the current study aimed to investigate the scientific collaboration patterns of librarianship and information science in iran between years 2005 and 2009 . \n the findings showed that in the investigated time period , a total of 942 documents were published in this discipline , 506 ( 53.70% ) of which were created individually and 436 ( 46.30% ) of them had two or more authors . \n this is in agreement with the findings of farajpahlou , naseer and mahmood and yousefy and malekahmadi . \n study of evolution of scientific products in librarianship and information science shows that the number of individual articles has decreased while the number of collaborative articles has increased , reaching its apex in year 2009 . \n this can be due to the increase in the number of graduate students in librarianship and information science in recent years . \n most of articles published by these graduate students are results of dissertations or class works and , therefore , it 's necessary to add the name of the supervisor and advisor as collaborative authors leading to the amount of scientific collaboration . on the other hand , another reason for this increase in scientific collaboration can be due to the needs of the researchers because the multi - discipline nature of librarianship and information science and new research trends in masters , doctorate , and post - doctorate levels increases the necessity of collaboration between researchers of multiply disciplines . investigating \n the co - authorship patterns of librarianship and information science in iran shows that single author pattern is the most common pattern among the researchers in this area . \n more than half of the researchers ( 53.72% ) used individual pattern for their works and had no collaboration with other researchers , and 36.20% of the researchers collaborated with only one other individual ( two author pattern ) . \n therefore , research individualism and a preference for creating groups of two are the dominant co - authorship patterns . \n also , investigating the co - authorship pattern of different journals shows that the first rank of all co - authorship patterns except three author pattern belongs to national journal of librarianship and information organization ( code h ) . relative increase of collaboration coefficient ( cc ) , collaboration index ( ci ) , and degree of collaboration ( dc ) shows an increase in the desire of researchers in librarianship and information science for working in groups of two and three . investigating the collaboration index shows that in average , each article was the result of collaboration between 1.58 researches . \n this collaboration index was lower than the collaboration index reported by osareh for astronomy in 2006 . \n on the other hand , a degree of collaboration of 0.46 showed a relative tendency towards collaborative works . \n the collaboration coefficient also had an increasing trend with the total of 0.23 , which is in agreement with findings of yousefy and malekahmadi who reported a collaboration coefficient of 0.25 for researchers of librarianship and medical information science . \n also , investigating the journals for these three indicators showed that journal of library and information science research ( b ) had the first place in all three indicators .", "role": "user" }, { "content": "background : scientific collaboration is among the most important subjects in scientometrics , and many studies have investigated this concept to this day . the goal of the current study is investigation of scientific collaboration and co - authorship patterns of researchers in the field of library and information science in iran between years 2005 and 2009.materials and methods : the current study uses scientometrics method . \n the statistical population consists of 942 documents published in iranian library and information science journals between years 2005 and 2009 . \n collaboration coefficient , collaboration index ( ci ) , and degree of collaboration ( dc ) were used for data analysis.findings:the findings showed that among 942 investigated documents , 506 documents ( 53.70% ) was created by one individual researcher and 436 documents ( 46.30% ) were the result of collaboration between two or more researchers . \n also , the highest rank of different authorship patterns belonged to national journal of librarianship and information organization ( code h).conclusion : the average collaboration coefficient for the library and information science researchers in the investigated time frame was 0.23 . the closer this coefficient is to 1 , the higher is the level of collaboration between authors , and a coefficient near zero shows a tendency to prefer individual articles . \n the highest collaboration index with an average of 1.92 authors per paper was seen in year 1388 . \n the five year collaboration index in library and information science in iran was 1.58 , and the average degree of collaboration between researchers in the investigated papers was 0.46 , which shows that library and information science researchers have a tendency for co - authorship . \n however , the co - authorship had increased in recent years reaching its highest number in year 1388 . \n the researchers collaboration coefficient also shows relative increase between years 1384 and 1388 . national journal of librarianship and information organization has the highest rank among all the investigated journals based on collaboration coefficient , collaboration index ( ci ) , and degree of collaboration ( dc ) .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: oppositional defiant disorder ( odd ) consists of recurrent uncooperative , disobedient , and hostile behavior which is not accounted for by the developmental stage of the child . \n it is defined in dsm - iv - tr as an enduring pattern of negativistic , defiant , and disruptive behavior toward authority figures . \n it must be present for more than 6 months and must not be caused by psychosis or a mood disorder , and the behavior must negatively impact the child 's social , academic , or occupational functioning . \n it does not include the most aggressive aspects of conduct disorder which is directed toward people , animals and property . \n negativistic and defiant behaviors are expressed by persistent stubbornness , resistance to directions , and unwillingness to compromise , give in or negotiate with adults and peers . \n it may also involve deliberate and persistent testing of limits , usually by ignoring orders , arguing , and failing to accept blame for misbehavior . \n the prevalence of odd in the general population has been reported to be between 2% and 16% . \n it has been estimated that around 60% of patients with odd will develop conduct disorder and will have high risk for substance abuse . \n children with odd have substantially impaired relationships with parents , teachers , and peers . these children are not only impaired in comparison with their peers , but they also show greater social impairment than do children with bipolar disorder , depression , and anxiety disorders . \n oppositional defiant disorder has a high co - occurrence with attention deficit hyperactivity disorder ( adhd ) . in 3565% of patients with adhd , \n children with adhd and comorbid odd tend to experience more severe adhd symptoms , greater functional impairment and poor quality of life than children with adhd alone . \n this means that families are under high levels of stress , dealing with several difficult behaviors . \n several studies from western countries have shown that psychostimulants like methylphenidate are effective in odd patients with comorbid adhd . in a meta - analysis of 28 studies , it was reported that stimulants are effective in overt and covert aggression - related behaviors in adhd in a short - term . \n atomoxetine is a selective norepinephrine reuptake inhibitor approved for the treatment of adhd since 2002 . \n atomoxetine has also been used in the management of odd comorbid with adhd as some studies have evaluated its efficacy in a short term . \n hence , the present study was carried out to find out if methylphenidate and atomoxetine are efficacious in the treatment of odd comorbid with adhd . \n patients were inducted from those attending the child guidance clinic of a tertiary care hospital in north india from october 2010 to may 2012 . \n this study is a subset of another trial which aimed to assess the efficacy of methylphenidate and atomoxetine in symptom reduction of adhd . \n patients of 614 years age , with a diagnosis of adhd , according to dsm - iv - tr were recruited for the trial . \n these patients were administered the vanderbilt adhd diagnostic parent rating scale ( vadprs ) to screen for the presence of comorbid odd . \n the patients with the diagnosis of odd with comorbid adhd were taken up in the present study . \n patients with a history of nonresponse or adverse drug reactions to either methylphenidate or atomoxetine and the patients who had taken any medication for adhd in the past 1-month were excluded . \n in addition , the patients with a history of heart disease , seizures , pervasive developmental disorder , substance abuse , mental retardation , or tic disorder were also excluded . before initiating treatment , electrocardiogram was performed for each patient to rule out any cardiac abnormality . \n the patients were allotted to two groups as per computer - generated table of random numbers ( group a and group b ) . \n patients of group a received immediate release tablet methylphenidate ( once or twice daily ) and group b received tablet atomoxetine ( once or twice daily ) . the initial sample consisted of 69 adhd patients randomized into methylphenidate and atomoxetine groups . of 69 patients with adhd , 15 from methylphenidate group and \n 22 from atomoxetine group fulfilled the criteria for the presence of comorbid odd , and these were included in the analysis of the present study [ figure 1 ] . \n patients were started on tablet methylphenidate ( immediate - release ) 5 mg od or tablet atomoxetine 10 mg od on their first visit . \n efforts were made to increase the dose of methylphenidate up to 1 mg / kg / day and of atomoxetine up to 1.2 mg / kg / day once or twice daily depending upon the response and tolerability . \n the patients who could not come for weekly follow - up , were assessed fortnightly . on each visit , \n the various side effects were noted on each assessment on the adverse events checklist prepared for the study . \n they were then managed as per standard departmental protocol . written and informed consent was obtained from both parents / guardians and the children . \n chicago , spss inc . , 2007 ) , and it was represented in mean and ( standard deviation ) . \n fisher 's exact test and chi - square test were used to compare categorical variables . mann \n chicago , spss inc . , 2007 ) , and it was represented in mean and ( standard deviation ) . \n fisher 's exact test and chi - square test were used to compare categorical variables . mann \n at baseline , methylphenidate and atomoxetine groups were comparable with regard to mean age and sex distribution . in both the groups \n , males outnumbered the females for the presence of odd , the combined type of adhd was the most common , followed by inattention type and hyperactive / impulsive type . \n chi - square test was used to assess whether the two groups were comparable with respect to the number of patients with any of the three types of adhd , and no significant difference was found . \n patients were also screened for the presence of depression and anxiety , but none fulfilled the criteria for the same . \n the baseline vadprs total score and vadprs subscale scores ( inattention , hyperactivity and odd ) were comparable between the two groups on the mann - whitney test [ table 1 ] . \n comparison on baseline characteristics five patients in the methylphenidate group and 8 in the atomoxetine group dropped out in the course of study . \n there was no statistically significant difference between the reasons for drop - outs between the two groups on the chi - square test ( p = 0.349 ) . \n the adverse effects which lead to drop out were reduction in appetite , headache , irritability in both the groups ; drowsiness and sadness in the atomoxetine group and fatigue in the methylphenidate group . \n improvement in adhd symptoms and odd symptoms as measured on vadprs score was assessed using wilcoxon signed rank test as data was not normally distributed . \n highly significant difference was found in vadprs scores in both the groups after 8 weeks . \n the mean vadprs ( total and subscales ) scores were compared in methylphenidate and atomoxetine groups using mann \n whitney test at 8 weeks and no statistically significant difference was found [ table 2 ] . \n change in vadprs scores from baseline to 8 weeks at 8 weeks , according to vadprs , 8 children out of 10 ( or 80% ) ceased to fulfill the criteria for the presence of odd in the methylphenidate group . \n similarly , in the atomoxetine group , out of 14 children , 9 children ( or 64.3% ) ceased to have symptoms of odd at 8 weeks [ figure 1 ] . \n the average dose administered at 8 weeks was 15.41 mg / day ( or 0.490 mg / kg / day ) in methylphenidate group and 17.21 mg / day ( or 0.672 mg / kg / day ) in atomoxetine group . according to the adverse effects checklist prepared for the study , \n a total of 7 ( 46.6% ) patients from methylphenidate group and 12 ( 54.5% ) from atomoxetine group developed some side effect during the course of the study . \n the various adverse effects reported by the patients in two groups are listed in table 3 . \n these were compared between both groups , and no significant difference was found on the chi - square test . \n in addition , one case each reported insomnia and pain abdomen in the methylphenidate group . \n similarly one case each reported nausea , vomiting , and sadness in the atomoxetine group . \n majority of the children were males , the similar findings have been reported in earlier studies . \n the results showed that both methylphenidate and atomoxetine were highly effective in reducing the symptoms of odd . \n earlier short - term placebo - controlled trials of methylphenidate for odd comorbid with adhd have also shown it to be effective . \n some previous studies found atomoxetine to be superior than placebo in improving odd symptoms , while others did not . \n the dose of atomoxetine administered to the patients in the present study was well within the prescribed limit for management of adhd . \n it was unlike the findings of a previous study which reported that higher dose of atomoxetine was required to produce improvements in patients with adhd comorbid with odd , than those with adhd alone . in this study , \n 80% of the patients in the methylphenidate group failed to fulfill the criteria for diagnosis of odd at the conclusion of the study . \n this was also concordant with findings of an earlier study where methylphenidate treatment in the short - term lead to remission of odd in 9 out of 10 children . in the atomoxetine group , \n the remission of odd has not been directly evaluated in previous placebo - controlled trials of atomoxetine . \n the rate of occurrence of adverse effects was also consistent with results of some previous comparative trials of methylphenidate and atomoxetine in adhd . \n it was an open label trial , and placebo arm was not included due to ethical reasons . \n the improvement produced by both the drugs in odd symptoms might imply that defiant and hostile behaviors were an integral part of adhd and improvement in adhd also led to improvement in odd symptoms . \n furthermore , the follow - up period was short , and it needs to be seen whether improvement in odd symptoms sustains over the long period . nevertheless , this is the first study from india comparing efficacy of atomoxetine and methylphenidate in odd comorbid with adhd . \n the study indicates that odd comorbid with adhd shows considerable improvement with both methylphenidate and atomoxetine and symptoms of odd remits in majority with short duration of treatment .", "role": "user" }, { "content": "background : oppositional defiant disorder ( odd ) is frequently comorbid with attention deficit hyperactivity disorder ( adhd ) and is associated with substantial functional impairments . \n methylphenidate and atomoxetine are well - established drugs for the management of adhd . some studies from western countries have reported these drugs to be effective in the management of odd comorbid with adhd . \n this study aimed to assess if methylphenidate and atomoxetine are efficacious in treating indian children with odd comorbid with adhd.subjects and methods : in this prospective , open - label study , 37 patients of age 614 years with a diagnosis of odd comorbid with adhd randomly received either methylphenidate ( dose 0.21 mg / kg / day ) or atomoxetine ( dose 0.51.2 mg / kg / day ) for 8 weeks . \n improvements in adhd and odd symptoms were assessed using vanderbilt adhd diagnostic parent rating scale ( vadprs).results : at 8 weeks , there were statistically significant improvements in both adhd and odd symptoms in both methylphenidate and atomoxetine groups , as per vadprs . the improvements produced and tolerability was comparable in the two groups . \n 80% of the patients from methylphenidate group and 64.3% patients from atomoxetine group ceased to fulfill the criteria for the presence of odd at 8 weeks.conclusions:methylphenidate and atomoxetine are effective in the treatment of odd comorbid with adhd in short duration .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: recent innovations in the areas of micro- and nanofabrication have created a unique opportunity for patterning surfaces with features , the lateral dimensions of which span over the nano- to millimeter range . \n micro- and nanometer scale patterns can be obtained by photolithography [ 1 - 4 ] , electron beam lithography , soft lithography , micro - contact printing ( cp ) [ 8 - 11 ] . \n these techniques above have partially the same process : they can transfer patterns onto the surface of a substrate . with the development of nanotechnology , a variety of industries , such as biosensor , proteomic arrays , and multifunctional coatings , have focused on obtaining patterns with the smallest possible lateral dimensions . \n the method is effective , of low cost , simple to implement , and suitable for patterning various nanomaterials . \n herein , we report an effective procedure for the fabrication of patterned nanostructure arrays with micro scale features . \n this process starts with the fabrication of patterned anodic aluminum oxide ( aao ) templates . \n an aao template was spin - coated with a layer of photoresist to seal the pores of the aao template , and then soft baked at low temperature to remove the solvents from the photoresist and improve photoresist aao template adhesion . \n this composite was covered with a photolithographic mask and exposed to uv , and then hard baked at higher temperature to further active cross - linking processes and improve the mechanical stability of the pattern ; it was subsequently developed in a developer to make the pores of aao selectively open only in those exposed areas . \n then the designed template was used for a secondary template to synthesize metal , semiconductor , and polymer one - dimensional nanoarrays . \n we explain this useful method by an example of patterning copper ( cu ) nanowire and polystyrene ( ps ) nanotube arrays . \n the same side of the secondary template was sputtered with a layer of au and regarded as a work electrode . in a tri - electrode system , \n the electrodeposition was carried out using platinum as the anode and a calomel electrode as the reference electrode , and the cu nanowires were selectively deposited into the open pores . \n finally , the patterned nanowire arrays were revealed by the removal of aao in a sodium hydroxide solution . \n a drop of ps solution was placed on a microscope slide , and then an aao membrane with patterned side downward was quickly placed on it . \n then the composite was placed in a sodium hydroxide solution to dissolve the template after the solvent completely evaporated . \n figure 1clearly shows that the nanowire arrays are regular and the nanowires are parallel to each other and completely free standing after the aao template is removed . \n 1a , that highly ordered large area qdu patterns are obtained using the above method . \n the qdu patterns are very ordered , and the distance between the three letters is equal , about 4 m . \n the whole rows and lines are also regular in arrangement , and the distance between lines and between rows is about 50 m . \n sem images of cu nanowire arrays with qdu patterns ( a , b):alarge area qdu patterns.bthe side image shows that the length of the cu nanowires is about 50 m.chigher magnification image shows that the nanowires are parallel to each other , and the diameter of the nanowires is about 300 nm the pattern was tilted to reveal the length of the vertical nanowires . from fig . \n 1b , the length is measured to be approximately 50 m ( the depth of aao is 60 m ) , and can be controlled to satisfy application by controlling the deposition time . \n the line width of the patterns is about 15 m , and can also be changed by changing the line width in the masks . \n the diameter of a single wire is about 300 nm , the same as the pores of aao template , which are well proportioned in diameter ( fig . \n 2a presents highly ordered ps nanotube arrays with qdu patterns obtained from solution - wetting method . \n each letter is vertical , and the distance between rows , lines , and letters is just the same as mentioned in fig . \n 1a . the width and length of letters is , respectively , 50 and 70 m . \n sem images of ps nanowire arrays with qdu patterns ( a , b):alarge area qdu patterns.bthe side image shows that the length of the ps nanowires is about 45 m.chigher magnification image shows the ps nanotubes with clear mouths figure 2b shows that the length of the ps nanotubes is about 45 m , and can be controlled by controlling the synthesis time or polymer solution amount . \n figure 2c shows the characteristic of nanotubes more clearly , from which we can see their open mouths . \n the free standing nanotubes have very strong mechanical temperament , and an outer diameter of about 300 nm and a wall thickness of about 50 nm . \n the outer diameter is a bit larger than that of the aao pores , because ps nanotubes may be swollen when aao template is removed in the sodium hydroxide solution . \n because the inner surfaces of the template nanopores have a very high surface energy , when polymeric solution goes through the open nanopores , it will wet the nanoporous wall first and form a wetting layer . \n the wetting process is carried on repeatedly and does not stop until the solvent completely evaporated . \n thus the nanotubes are formed . in summary , we obtained highly ordered free standing patterns of metal nanowire and polymer nanotube arrays with secondary templates at room temperature . \n they have uniform structures and can be applied in microdevices and integrated circuits in the future . \n different kinds of materials , such as metal nanowires , semiconductor , and polymer one - dimensional nanoarrays , can be also fabricated . \n in addition , our group has made ni and other polymer non - patterned nanowire arrays by the aao template [ 20 - 23 ] , and further research in the field of photolithography is under way . \n our group is trying to use the photolithographic method to combine metal nanowires with polymer nanotubes to synthesize patterned coaxial nanocables , which can be used in microdevices , and will report the application of the method in microdevices in our next work . \n the same side of the secondary template was sputtered with a layer of au and regarded as a work electrode . in a tri - electrode system , \n the electrodeposition was carried out using platinum as the anode and a calomel electrode as the reference electrode , and the cu nanowires were selectively deposited into the open pores . \n finally , the patterned nanowire arrays were revealed by the removal of aao in a sodium hydroxide solution . \n a drop of ps solution was placed on a microscope slide , and then an aao membrane with patterned side downward was quickly placed on it . \n then the composite was placed in a sodium hydroxide solution to dissolve the template after the solvent completely evaporated . \n figure 1clearly shows that the nanowire arrays are regular and the nanowires are parallel to each other and completely free standing after the aao template is removed . \n 1a , that highly ordered large area qdu patterns are obtained using the above method . \n the qdu patterns are very ordered , and the distance between the three letters is equal , about 4 m . \n the whole rows and lines are also regular in arrangement , and the distance between lines and between rows is about 50 m . \n sem images of cu nanowire arrays with qdu patterns ( a , b):alarge area qdu patterns.bthe side image shows that the length of the cu nanowires is about 50 m.chigher magnification image shows that the nanowires are parallel to each other , and the diameter of the nanowires is about 300 nm the pattern was tilted to reveal the length of the vertical nanowires . from fig . \n 1b , the length is measured to be approximately 50 m ( the depth of aao is 60 m ) , and can be controlled to satisfy application by controlling the deposition time . \n the line width of the patterns is about 15 m , and can also be changed by changing the line width in the masks . \n the diameter of a single wire is about 300 nm , the same as the pores of aao template , which are well proportioned in diameter ( fig . \n 2a presents highly ordered ps nanotube arrays with qdu patterns obtained from solution - wetting method . \n each letter is vertical , and the distance between rows , lines , and letters is just the same as mentioned in fig . \n 1a . the width and length of letters is , respectively , 50 and 70 m . \n sem images of ps nanowire arrays with qdu patterns ( a , b):alarge area qdu patterns.bthe side image shows that the length of the ps nanowires is about 45 m.chigher magnification image shows the ps nanotubes with clear mouths figure 2b shows that the length of the ps nanotubes is about 45 m , and can be controlled by controlling the synthesis time or polymer solution amount . \n figure 2c shows the characteristic of nanotubes more clearly , from which we can see their open mouths . \n the free standing nanotubes have very strong mechanical temperament , and an outer diameter of about 300 nm and a wall thickness of about 50 nm . \n the outer diameter is a bit larger than that of the aao pores , because ps nanotubes may be swollen when aao template is removed in the sodium hydroxide solution . \n the explanation for forming nanotubes is as follows . because the inner surfaces of the template nanopores have a very high surface energy , when polymeric solution goes through the open nanopores , it will wet the nanoporous wall first and form a wetting layer . \n the wetting process is carried on repeatedly and does not stop until the solvent completely evaporated . \n thus the nanotubes are formed . in summary , we obtained highly ordered free standing patterns of metal nanowire and polymer nanotube arrays with secondary templates at room temperature . \n they have uniform structures and can be applied in microdevices and integrated circuits in the future . \n different kinds of materials , such as metal nanowires , semiconductor , and polymer one - dimensional nanoarrays , can be also fabricated . \n in addition , our group has made ni and other polymer non - patterned nanowire arrays by the aao template [ 20 - 23 ] , and further research in the field of photolithography is under way . \n our group is trying to use the photolithographic method to combine metal nanowires with polymer nanotubes to synthesize patterned coaxial nanocables , which can be used in microdevices , and will report the application of the method in microdevices in our next work . \n this work was supported by the national natural science foundation of china ( no . 50473012 ) and the provincial natural science foundation ( no .", "role": "user" }, { "content": "in this work , we report that large area metal nanowire and polymer nanotube arrays were successfully patterned by photolithographic approach using anodic aluminum oxide ( aao ) templates . \n nanowires were produced by electrochemical deposition , and nanotubes by solution - wetting . \n the highly ordered patterns of nanowire and nanotube arrays were observed using scanning electron microscopy ( sem ) and found to stand free on the substrate . \n the method is expected to play an important role in the application of microdevices in the future .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: the oceans , covering 71% \n of the earth s surface , are a large \n source of atmospheric particles . \n particles of marine origin are produced \n directly from the ocean surface and referred to as primary particles \n or indirectly via nucleation or condensation of low - volatility gas - phase \n molecules and referred to as secondary particles . \n activity at the \n ocean surface leading to ejection of primary marine particles includes \n whitecaps , or sea spray initiated by wind shear , and the subsequent \n bursting of bubbles formed from the entrainment of air into the ocean \n water . \n the global annual mass emission of primary marine particles , \n or sea spray aerosol ( ssa ) , is estimated to range from 2 10 to 1 10 kg yr , which \n is comparable to that of dust aerosol . the conventional assumption that ssa consists primarily of \n sea \n salt has been challenged in recent years , particularly in the case \n of submicrometer particles , which may contribute over 90% of the particle \n number . \n studies of in situ samples ( e.g. , \n cavalli et al . ) and laboratory sea spray \n tank experiments ( e.g. , keene et al . ) \n have reported not only that submicrometer ssa particles contain organic \n matter but also that the organic fraction may increase with decreasing \n size , i.e. , from a few percent for particles approximately 1 m \n in diameter to > 70% for particles having a diameter of roughly \n 100 \n nm . the question of organic enrichment \n has led to efforts to experimentally reproduce the formation of particles \n from bubble bursting using tanks in which bubble plumes are generated \n using various methods , including aeration through diffusers and plunging \n water jets . \n the potentially large fraction of \n organic matter in marine particles \n may alter our understanding of the role of marine particles in cloud \n formation . \n marine particles are generally considered efficient cloud \n condensation nuclei ( ccn ) , i.e. , seeds on which water vapor can condense \n to form cloud droplets , due to their size and hygroscopicity . \n this implies that they have a large influence on cloud droplet number \n and size in the marine environment and hence on determinations of \n the aerosol indirect effect of marine particles . \n current estimates \n of the global aerosol indirect effect are associated with large uncertainties , and these may be attributed in part to a lack \n of sufficient knowledge about the background natural aerosol , such \n as ssa . \n recent sea spray tank studies have investigated the ccn activity \n of particles produced from bubble bursting and have suggested that \n the effect of organic enrichment on ccn activity is not significant . \n these results are not surprising since theoretical and experimental \n evidence show that even a small amount of salt has a dominant effect \n on ccn activity , and an organic fraction \n greater than 50% in the particle phase may lead to no more than a \n subtle change in ccn activity . in this work \n we address three \n factors that can affect ccn properties \n of particles produced from bubble bursting : 1 ) the composition of \n the inorganic fraction , 2 ) the bubble residence time within the water \n column , and 3 ) the bubble generation method and the presence of a \n foam layer on the water surface . given the considerable effect \n of small amounts of salt , a thorough \n understanding of ccn activity in the marine atmosphere requires a \n detailed study of the salt component . \n although sea salt consists largely \n of nacl , and is therefore often assumed to have similar properties , \n the minor constituents may alter its aerosol properties . \n moreover , \n the measurement of ccn activity of pure nacl is complicated by the \n variations in its morphology as a function of size and rate at which \n it was processed from a droplet to a crystalline particle . in this study \n , we probe the morphologies and ccn activities of nacl \n and artificial sea salt from various production methods , including \n the sea spray tank . \n the use of sea spray tanks for aerosol studies \n has led to a number \n of publications during the past decade carrying significant climate \n implications . \n one concern is the effect of bubble residence time within \n the water column , which is much shorter in the laboratory setting \n than those produced by breaking ocean waves . \n fuentes et al . , addressing this concern , \n calculated that the time required to reach equilibrium with respect \n to adsorption of organic matter on the air \n water interface \n of bubbles is much shorter than typical bubble residence times in \n sea spray tanks . \n here we report experimental results showing the impact \n of bubble residence time on size and ccn activity of submicrometer \n particles . finally , the effect of different bubble production \n methods ( i.e. , \n jet impingement and diffuser aeration ) on particle physicochemical \n properties is investigated . \n given the complexity of simulating sea \n spray in the laboratory environment , this study has been conducted \n in an effort to provide not only insight into ccn properties of sea \n spray aerosol but also knowledge that can be useful in the design \n of future studies . \n a tsi constant \n output atomizer ( model 3076 ) was used for atomization of aqueous solutions . \n bubble bursting was implemented in a stainless steel tank filled with \n artificial seawater , which comprised 18.2 m-cm water with known \n concentrations of inorganic and organic solutes . \n the tank has a height \n of 44.5 cm and a diameter of 21.8 cm , and it was filled with 10 l \n of artificial seawater during experiments , thus giving it a headspace \n of approximately 5 l. bubbles were produced either by aeration \n through a stainless steel , small - pore diffuser placed within the water \n column of the tank or by a plunging jet . \n the jet nozzle was mounted \n such that the flow had a free fall distance of 13.5 cm directed at \n a 90 angle with respect to the water surface . \n a large body of \n literature can be found on the mechanisms and characteristics of plunging \n liquid jets.(e.g . , refs ( 2023 ) ) size spectra of bubbles \n produced using the two methods were measured \n using a mini - bms ( bubble measurement system ) . the size spectrum shown in figure 1 for bubbles \n produced using \n the diffuser at an air flow rate of 1.5 l min and at a depth of 26.5 cm below water surface is representative \n of this type of bubble generation for air flow rates ranging from \n 0.25 to 2 l min . \n two nozzle sizes ( 4 mm and 16 \n mm ) were used to form a plunging jet , with the resulting bubble size \n spectra shown in figure 1 , along with power \n law exponents corresponding to the descending portion of each spectrum . \n similar to findings from previous sea spray tank studies , we find that the shape of the \n jet - generated bubble spectra more closely resemble oceanic bubble \n size spectra , as determined by power law exponents . \n derived roll - off \n of bubble concentration with respect to radius from the jet closely \n resemble the acoustic phase of air entrainment in plunging breakers , \n given in dean and stokes as \n r to r per increase in \n radius below 1 mm . \n the steeper roll - off with increasing bubble diameter \n implies that the plunging jet in our laboratory could be replicating \n a slightly aged , acoustic phase plunging breaker . upon visual comparison of the bubble size distributions \n for the plunging jets and diffuser with oceanic bubble size distributions , \n we conclude that the plunging jet better simulates plunging breaking \n waves with respect to bubble plume characteristics . \n bubble size distributions \n produced using the diffuser and the plunging \n jet in artificial seawater having a salinity ( tmss ) of 35. artificial seawater solutions \n were prepared by dissolving either nacl or artificial sea salt in \n deionized water . \n the sea salt proxies included a commercially available \n tropic marin sea salt ( tmss ) and a mixture prepared in the laboratory \n ( lss ) from analytical grade salts . \n although the exact salt composition \n of tmss was not made available , it was confirmed by the manufacturer \n that no organic compounds are present . \n the ionic mass ratios of na , cl , mg , hco , and so4 in lss were comparable to \n those in natural seawater ( i.e. , the salt mixture contained , by mass , \n 73.6% nacl ( sigma aldrich , > 99.5% ) , 14.5% mgcl2 ( sigma \n aldrich , > 98% ) , 11.5% na2so4 ( sigma aldrich , \n > 99% ) , and 0.4% nahco3 ( sigma aldrich , > 99.7% ) ) . to generate mixed inorganic \n organic \n particles during bubble - bursting experiments , a known amount of an \n organic compound was added to the artificial seawater in the tank . \n in a number of the experiments , \n salinity was reduced well below the \n average ocean salinity of 35 so that it would not dominate \n ccn activity , i.e. , a reduction in ccn activity was useful for further \n analysis . \n the organic compounds used in this study were chosen for \n their similarity to organic matter typically found in ocean water , \n such as fatty acids and saccharides , or for their \n surfactant properties . \n the following compounds were used : palmitic \n acid ( pa , sigma aldrich , > 99% ) , sodium laurate ( nala , sigma aldrich , \n 99 - 100% ) , fructose ( fr , fluka , > 99% ) , mannose ( ma , fluka , > 99.5% ) , \n sodium dodecyl sulfate ( sds , sigma aldrich , > 99% ) . \n fatty \n acid salts were included in this study because of their solubility , \n which is typically higher than that of the corresponding fatty acid . \n sds is likely more surface - active than compounds found in the oceans , \n but it is used here to demonstrate the possible effect of a very strong \n surfactant . \n polydisperse \n particles produced from bubble bursting were sampled from the tank \n headspace and directed into a silica - gel diffusion dryer . \n atomized \n particles were first mixed with dry , clean air before entering the \n dryer . a filter holder with a polycarbonate filter ( nucleopore , 0.1 \n m pores ) \n was used to collect the dried particles for scanning \n electron microscopy ( sem ) . \n monodisperse aerosol populations were generated \n by passing the dried particles through a kr bipolar charger \n and a differential mobility analyzer ( dma , tsi 3081 ) before filter \n collection . \n the filters were stored under clean and dry conditions \n to prevent contamination and adsorption of water layers . \n sem images \n were obtained using a quanta 200 feg environmental sem ( center for \n electron nanoscopy , technical university of denmark ) , which was operated \n at an acceleration voltage of 5 kv , a spot size of 3 nm , and a working \n distance of 6 mm . the collection method for analysis with transmission \n electron microscopy ( tem ) was identical , with the exception that the \n dried particles were deposited onto cu - tem grids with carbon foil \n ( plano gmbh ) . \n transmission electron microscopy was performed using \n a fei cm 20 equipped with an olympus veletta ccd camera ( niels bohr \n institute , university of copenhagen ) . \n the images were analyzed \n for aspect ratio ( ar ) , which is a common \n parameter reported from two - dimensional image projections of particles , \n such as those from electron microscopy . \n it is defined as the ratio \n of the longest to the shortest dimension of a particle , calculated \n here by fitting an ellipse to the projected particle area and dividing \n the major by the minor axis . \n therefore , \n spherical particles have ar of 1 , while particles with more cubic \n or rectangular shapes have ar greater than 1 . \n ar has been used to \n quantitatively describe particle morphology in field and laboratory \n studies and has been included in a radiative transfer model of dust that \n incorporates nonsphericity corrections in its parametrization . \n the flow of particles exiting the silica - gel dryer was split to \n provide simultaneous size distribution and ccn measurements . \n all of \n the instruments following the dryer were contained in a temperature - regulated \n box , such that the sample temperature did not deviate significantly \n over the course of the experiments . \n size distributions were collected \n using a scanning mobility particle sizer ( smps , tsi 3936 ) , where the \n dma is preceded by a kr bipolar charger and the sheath - to - aerosol \n flow ratio of the dma was 10:1 . for ccn measurements , \n a dma ( tsi 3081 , \n preceded by a kr bipolar charger ) was used to select \n a monodisperse aerosol . \n the sheath and aerosol flow of the dma were \n 10 l min and 1.5 l min , respectively . \n the particles exiting the dma were directed simultaneously to a condensation \n particle counter ( cpc , tsi 3010 , 1 l min ) for \n measurement of total particle concentration and to the ccn counter \n ( ccnc , droplet measurement technologies , 0.5 l min ) . \n the experiment was automated using a labview program designed \n for ccn measurements , in which a selected range of mobility diameters \n was scanned by the dma at selected size and time intervals between \n each diameter . \n scans over a range of ccnc supersaturations were also \n automated , such that each supersaturation was held constant for a \n complete scan of mobility diameters . \n ccn activation curves are \n expressed as the ratio of ccn to cpc concentrations measured as a \n function of dry particle diameter at a fixed supersaturation . \n each \n dma scan through a complete range of dry diameters yields an activation \n curve , from which an activation diameter is calculated . \n several methods \n of obtaining the activation diameter have been used in the literature ; \n the method used in this study is based on the model described in petters \n et al . \n this model calculates the transfer \n function of an ideal dma and the fraction of multiple - charged particles \n that pass through the dma as part of the quasi - monodisperse population \n that is sampled by the ccnc . an inversion procedure is used to find \n the activation diameter that yields the best fit of the measured activation \n data . \n figure s1 in the supporting information shows some fitted activation curves of atomized ammonium sulfate \n particles , which were used for calibration of the instrument . \n the calibration procedure of the ccnc is similar to those previously \n described ( e.g. , rose et al . ) , which \n consists of relating the thermal gradient of the continuous - flow ccnc \n with the corresponding supersaturation using linear regression . \n supersaturation \n is calculated from the activation diameters of ammonium sulfate using \n the aerosol inorganics model ( aim ) to estimate \n water activity . \n the thermal gradient is calculated from the reported \n temperatures in the column and averaged over the measurement period . \n averaging of the thermal gradient is also used with experimental measurements , \n thus any small changes in the temperature control of the ccnc column \n are accounted for . moreover , the placement of the ccnc in a temperature - regulated \n container ensures that the sample temperature does not vary significantly \n throughout the experiments . \n the ccn activity of sea salt was measured and compared to that \n of pure nacl . measured critical supersaturations ( sc ) and \n the corresponding activation diameters \n are shown in figure 2 for particles produced \n both by atomization and by bubble bursting . \n the results show that , \n regardless of production method ( and the accompanying drying method ) , \n nacl particles activated at smaller sizes than sea salt ( both tmss \n and lss ) particles at the same supersaturation . \n this observed difference \n in ccn activity is in agreement with predictions and observations \n that sea salt particles have lower hygroscopic growth factors than \n nacl at rh > 75% ( i.e. , above the deliquescence rh of nacl ) . \n these observations \n support the conclusion that the mixture of inorganic compounds in \n sea salt , though dominated by nacl , affects the properties of the \n mixed particle relative to those of nacl . \n results from this study \n emphasize that , for studies in which ccn analyses are used to infer \n chemical composition and potential organic enrichment , it is important \n to account for the detailed composition of the sea salt rather than \n assuming that sea salt can be simply represented by nacl \n bubbles were generated using the diffuser in artificial \n seawater having a salinity of 35. uncertainties for dry diameter \n and supersaturation are shown for atomized tmss data and are representative \n for all the data presented . \n uncertainties were calculated as 2 times \n the standard deviation of measurements of activation diameter and \n ccnc column temperature gradient , respectively , from repeated experiments . \n sc of nacl particles predicted \n from khler theory for typical are also shown , as well \n as predictions for lss . \n figure 2 includes theoretical \n ccn activation \n curves for nacl and lss , calculated from khler theory and \n using the aim model to estimate water activity . \n the aim model used \n in the case of the multicomponent lss is based on work by harvie et \n al . under the assumption of dilute conditions \n at droplet activation , \n the solution density and surface tension are \n assumed to be equal to those of water . \n dynamic shape factors ( ) \n are incorporated in the calculations to represent different assumed \n morphologies of nacl . \n determination of , which is the ratio \n of the drag force on the particle to that on a spherical particle \n of identical volume , is essential in accurate interpretations \n of data measurements involving the use of a dma , which classifies \n particles by electric mobility and whose performance is defined for \n spherical particles . \n the nonspherical morphology of nacl and other \n salt particles has been discussed in a number of previous studies . \n more recent studies show the effect of particle drying rate and \n particle size on of submicrometer nacl particles ; the range \n of values reported in these studies is wide and indicates \n that nacl particle morphologies range from nearly cubic to nearly \n spherical , depending on size and drying history . \n the three values used to calculate the curves in figure 2 are 1.00 ( i.e. , a sphere ) , 1.08 ( i.e. , a cube in \n the continuum regime ) , and 1.24 ( i.e. , a cube in the free - molecule \n regime ) . observed ccn activities for nacl particles from both atomization \n and bubble bursting are similar to those reported by wang et al . for \n fast drying rates ( 101 rh s ) , i.e. , the deviation \n as a function of size of measured data points for nacl from the model \n line assuming = 1 could be explained by a dependence of shape \n factor on particle size , such that approaches 1.08 for dry \n particles less than 50 nm in diameter and decreases toward 1 for particles \n with larger diameters . \n a difference \n in nacl and sea salt particle morphology , shown in this study to be \n independent of particle production and drying methods , is one possible \n explanation for the lower observed ccn activity and the lower hygroscopic \n growth factor of sea salt compared to that of nacl . \n the possibility \n of morphological differences was investigated using analyses of ar \n from electron microscopy . \n figure s2 shows \n scanning electron micrographs of atomized nacl particles and tmss \n particles generated from bubble bursting . \n in general , the morphologies \n of nacl and sea salt samples in this study agree with tem observations \n by peart and evans , who collected dried sea salt particles from film \n drops produced from bubble bursting . \n the mean ar of psl spheres verifies that \n they are the most spherical of the samples analyzed . \n fuchs provides an approach to convert ar to , \n but the particles must be assumed to be elliptical . \n found that this approach , used with mineral \n aerosol , resulted in values much lower than those determined from \n direct measurements . in this study , ar is not converted to corresponding \n values ; they are provided solely for intercomparison . \n data \n in table s1 show that there is no distinct \n difference between ar values of nacl and tmss . however , ar is only \n one parameter of many that can be used to describe morphology from \n images , and the possibility still exists that sea salt particles are \n not identical to nacl particles in shape . for example , peart and evans note that there is some elongation of sea salt \n particles from film drops and suggest that this is due to the presence \n of na2so4 , a constituent of sea salt whose crystals \n tend to have a rod - like shape . \n further studies should be conducted \n to investigate the possibility that interactions between the multiple \n inorganic constituents of sea salt lead to irregular particle morphologies , \n such as a higher than expected porosity or concave surfaces with high \n curvatures that may result in condensation at higher observed supersaturations . in the oceans , \n the sea surface microlayer is enriched in organic \n compounds relative to the subsurface bulk seawater , for which one of many explanations may be input from bubble \n scavenging . \n an initial assumption may \n be that the further a bubble travels through seawater , the larger \n the potential for the bubble to collect organic molecules suspended \n in the water . \n a thorough discussion of the challenges of replicating \n oceanic bubble residence times in the laboratory is found in fuentes \n et al . \n , who calculate that the time required \n for adsorption equilibrium to be reached is less than 0.05 ms , much \n shorter than typical bubble residence times in laboratory - scale sea \n spray tanks . \n this implies that properties of particles produced in \n sea spray tanks would not differ for varying bubble residence times \n longer than 0.05 ms . \n we probe the effect of bubble residence \n time in our study by measuring ccn activity and size distribution \n for different bubble rise distances ( rd ) . \n bubbles were produced using \n the diffuser , whose height was adjusted in the water column of the \n tank between 2.5 and 26.5 cm below the water surface . \n the residence \n times in the bulk artificial seawater solution of bubbles in the size \n range measured by the bubble spectrometer ( figure 1 ) were calculated using the parametrization of clift et al . \n the \n artificial seawater in the tank was a two - component mixture of varying \n mass ratios , where one component was salt and the second was an organic \n compound . details of each experiment are listed in table 1 . \n the shapes of the size distributions \n are similar \n for all diffuser depths and organic compounds presented , with the \n exception of a small second mode near 200 nm . \n the presence of a smaller \n mode near 200 nm was also observed by allan et al . , who reported measurements \n in a marine environment of puerto rico . \n another general observation in figure 3 is \n the reduction in particle number concentration in the presence of \n stronger surfactants . \n we ascribe this to the surface layer being significantly \n more stable , resulting in less bubble bursting in the case of sds \n than in the case of fructose . \n number size distributions of particles produced \n from the diffuser \n at different depths ( i.e. , bubble rd ) in the tank water column . \n the \n results show that there is no significant difference in ccn activity \n between the two rds studied . \n there is arguably a slight decrease in \n ccn activity at small particle sizes from exp . \n 3 ( shorter rd ) to exp . \n 4 ( longer rd ) , but this should be further investigated using more \n direct methods for characterizing aerosol composition . the reduction \n in ccn activity from that of pure nacl in exps . 1 and 2 \n is not surprising , \n given the larger mass fraction of organic matter over nacl in the \n artificial seawater . observed ccn activities of particles produced in the sea \n spray \n tank from artificial seawater containing salt and one organic compound . \n typical uncertainties are shown in panel a and were calculated as \n described in the caption for figure 2 . \n experiment \n numbers corresponding to table 1 are shown \n in parentheses in the legends . \n the solid line shows predicted sc for nacl with no correction \n for shape factor . \n measurements from diffuser - generated bubbles in solutions \n containing only nacl and only nala are included for reference . \n ( b ) additional ccn measurements for varying \n depths of the diffuser below water surface . \n the artificial seawater \n in these experiments has a salinity ( tmss ) of 35. the dashed \n line shows sc calculated \n for nacl particles with a shape factor of 1.24 , which most closely \n agreed with observed measurements of sea salt particles ( see figure 2 ) . \n 1315 are shown , along \n with observed ccn data of pure nacl and pure nala particles from diffuser - generated \n bubbles . \n inset : number size distributions from the same experiments , \n where the dashed line represents data obtained from the diffuser , \n and the solid line represents data obtained using the jet . \n similar experiments were conducted using other \n organic molecules \n and a higher concentration of salt that is more typical of oceanic \n conditions . \n moreover , they are indistinguishable \n from the observed ccn activity of tmss , even in exps . 8 and 9 , in \n which \n this \n indicates that the contribution of salt in the particle phase determines \n the ccn activity , as expected given the nonlinear effect of particle \n salt composition on ccn activity . \n due \n to the minimal effect of organic molecules on ccn activity , these \n results can not determine whether or not typical bubble residence times \n in sea spray tanks are sufficient for organic molecules to reach adsorption \n equilibrium on bubble surfaces . \n more direct measurements of aerosol \n composition in the future are recommended to further address these \n questions . \n the production of particles from bubble bursting \n may also be affected \n by the possibility of a concentration gradient as a function of depth \n in the artificial seawater , especially in the case of surfactant molecules \n with limited water solubility . \n the addition of salt has the effect \n of lowering water solubility further and has in fact long been known \n to lower the critical micelle concentration of surfactants in aqueous \n solution , which would result in a larger \n concentration of surfactant molecules at the air water interface . \n if the organic matter in the water were concentrated near the surface , \n then bubble residence time in the subsurface seawater solution would \n presumably be insignificant in aerosol composition . \n this could further \n explain our observation that no large effect on ccn activity is observed \n with changes in bubble residence times . however , this explanation \n may be less relevant for experiments in which surfactants were not \n added . \n the ccn activities of particles produced using the two \n methods \n of bubble generation are compared in figure 4c ( exps . \n the artificial seawater solution in these \n experiments contained 100 g of nacl and 1 g of either nala or mannose . \n the concentration of particles from jet - generated bubbles \n is considerably lower than that from diffuser - generated bubbles , and \n the distribution is broader and shifted toward slightly larger diameters . \n submicrometer particles from jet impingement through a 4-mm nozzle \n on a seawater solution with nala are less ccn active than those from \n the diffuser , for all superaturations investigated ( corresponding \n to activation diameters between 52 and 112 nm ) . for example , at 0.3% \n supersaturation , the activation diameter for a particle produced using \n the diffuser is 52 2 nm , only minimally larger than the activation \n diameter of a nacl particle ( cf . figure 2 for \n observed activation diameters of nacl particles as well as calculated \n activation diameters for various ) , while the same for a particle \n produced using the jet is 93 4 nm . on the other hand , submicrometer \n particles from jet impingement on a solution containing nacl and mannose \n do not exhibit a similar reduction in ccn activity relative to pure \n salt particles . \n visual inspection of the sea spray tank during \n experiments with \n nala revealed that there was a foam layer floating on the surface \n of the artificial seawater and that the foam layer was much thicker \n during jet impingement . \n the liquid flow rate of the plunging jet was \n approximately 4 l min , and the velocity of the \n liquid exiting the nozzle was approximately 5 m s. higher flow rates were avoided , as they resulted in the foam layer \n filling the headspace . \n jet impingement on the solution containing \n nacl and mannose did not result in a foam layer . \n given the absence \n of a significant reduction in observed ccn activity from jet impingement \n in exp . \n 15 , it may be concluded that a foam layer continuously ruptured \n and recreated by a plunging jet , which is the primary difference separating \n the two bubble generation methods , results in an aerosol population \n with a very different composition . \n the observed difference in \n ccn activation between the two bubble \n generation methods is in agreement with observations by fuentes et \n al . , who reported an increase of 17% in sc relative to that of nacl \n when a plunging jet was used to generate particles from a tank with \n a solution containing t. rotula exudate ( 512 m dissolved organic \n carbon ( doc ) concentration ) . by comparison , \n we speculate that the difference , though small as a consequence \n of low doc , could be explained by dissimilar foam formation under \n the two bubbling methods . \n the organic fraction of particles \n formed from jet - generated bubbles \n can be roughly estimated by comparing the observed ccn data with measurements \n by prisle et al . \n the comparison \n suggests that the particles are composed of approximately 80% ( by \n mass ) nala . \n nevertheless , it strongly indicates organic enrichment , \n since the solute in the bulk seawater solution is only 1% ( by mass ) \n nala . \n 14 , ranges from 0.16 to 0.23 , values \n that are considerably lower than those typical of nacl . on the other \n hand , in exp . \n 13 ranges from 0.89 to 1.41 ; these higher values \n are similar to calculated for nacl particles having various \n shape factors . \n the above results lead to the conclusion that , \n while there is little \n to no detectable effect from variations in residence times of bubbles \n from diffuser aeration , the ccn activity of submicrometer particles \n produced by jet impingement on artificial seawater containing an organic \n surfactant is substantially lower than that of diffuser - generated \n submicrometer particles from the same seawater solution . \n this indicates \n that bubble production methods used in sea spray tanks for aerosol \n studies are not equal , particularly when the seawater in the tank \n includes organic surfactants . \n findings from this study as well as \n others using bubble spectra suggest that the more appropriate method would be the plunging jet . \n furthermore , our results suggest that formation of a stable foam layer \n can significantly change the chemical composition and ccn properties \n of sea spray particles compared to the properties of particles generated \n from the same water in the absence of foam . \n given the ubiquitous nature \n of surfactants in the marine environment and the large fraction of \n ocean surface covered by foam , or whitecap , conditions , these considerations potentially affect a large number of future \n studies .", "role": "user" }, { "content": "sea spray particles ejected as a result of bubbles bursting \n from \n artificial seawater containing salt and organic matter in a stainless \n steel tank were sampled for size distribution , morphology , and cloud \n condensation nucleus ( ccn ) activity . \n bubbles were generated either \n by aeration through a diffuser or by water jet impingement on the \n seawater surface . \n three objectives were addressed in this study . \n first , \n ccn activities of nacl and two types of artificial sea salt containing \n only inorganic components were measured to establish a baseline for \n further measurements of mixed organic inorganic particles . \n second , the effect of varying bubble residence time in the bulk seawater \n solution on particle size and ccn activity was investigated and was \n found to be insignificant for the organic compounds studied . \n finally , \n ccn activities of particles produced from jet impingement were compared \n with those produced from diffuser aeration . \n analyses indicate a considerable \n amount of organic enrichment in the jet - produced particles relative \n to the bulk seawater composition when sodium laurate , an organic surfactant , \n is present in the seawater . in this case \n , the production of a thick \n foam layer during impingement may explain the difference in activation \n and supports hypotheses that particle production from the two methods \n of generating bubbles is not equal .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mammalian - transmissible , highly virulent influenza viruses pose a threat to human health and life much greater than that posed by most pathogens classified as biosafety level 3 and 4 ( bsl-3 and bsl-4 ) agents . \n therefore , any activity that creates even a small risk of releasing such viruses deserves exceptional scrutiny . \n the magnitude of public health risk from an accidental release of a pathogen depends on how many people could become infected , times the risk of severe or fatal outcome per case , and is modified by the availability of countermeasures that could stop the spread of such a pathogen or reduce the severity of infection . \n most biosafety level 4 ( bsl-4 ) pathogens including certain arenaviruses ( e.g. , lassa viruses ) , filoviruses ( e.g. , ebola virus and marburg virus ) , and hendra viruses ( e.g. , hendra virus and nipah virus)are zoonotic agents that often cause severe or fatal disease in infected humans . however , an accidental release of these viruses would likely have limited global impact because their person - to - person transmission is inefficient in most settings . \n so an accidental release would not be the only source for risk of transmission to humans . \n while influenza a / h5n1 virus exists in the wild , mammalian - transmissible strains do not exist outside the laboratory as far as we are aware . if a mammalian - transmissible variant maintains a case fatality rate within even an order of magnitude of the 60% case fatality rate of its wild - type parent ( 1 ) and \n if it is as transmissible between humans as other common influenza viruses that infect humans , an accidental release would pose a grave , and completely novel , threat to human health . \n once a novel strain of influenza virus establishes significant transmission in humans , stopping its spread would require massive global use of vaccines , a scenario that has never been accomplished in practice and could not be done in time for h5n1 because sufficient stockpiles do not exist worldwide and trust in vaccines is declining globally ( 2 ) . \n therefore , a highly transmissible , highly virulent virus like the modified h5n1 strains that have been created has the potential to infect billions and potentially kill a large fraction of those . of course \n , an accidental release of such a pathogen is not certain to cause such destruction ; we do not yet know whether such viruses are indeed human - to - human transmissible , though this was the rationale for their creation , and we do not know whether they remain as virulent as their wild - type parent strains . and \n even if both of these were true , a single accidental infection is not guaranteed to spread widely . \n even if a release of such a pathogen were contained before it spread widely , such an accident would severely threaten the credibility of life scientists , research institutions , including universities , and public health agencies . \n notwithstanding uncertainty about the exact risk posed by a particular modified influenza a / h5n1 virus , there are only a handful of known viruses for which such a horrific scenario is even plausible , and mammalian - transmissible influenza a / h5n1 virus is arguably the most worrisome of all . \n the 1918 h1n1 influenza virus , currently handled in bsl-3 , had a case fatality ratio of a few percent ( 3 ) even in the most vulnerable populations and in the absence of modern medicine , but killed an estimated 50 million people . \n severe acute respiratory syndrome ( sars ) killed about 10% of those infected ( 4 ) but has been eliminated in multiple countries by intense public health measures without vaccines . \n the threat of accidental release of smallpox is arguably the most comparable to that of modified h5n1 viruses , though the spread of smallpox can perhaps be controlled with more limited vaccination than would be required for influenza . in recognition of the exceptional risk of smallpox release and the eradication of the virus from natural transmission , \n the world community has decided to limit research on smallpox to two laboratories , one at the cdc in the united states and one at vektor in russia . \n the accidental release of any of these viruses sars coronavirus , smallpox ( variola virus ) , and highly pathogenic , transmissible influenza virus which klotz and sylvester ( 5 ) have labeled potential pandemic pathogens , presents a threat to global public health that is different in kind and magnitude from that of other hazardous agents . \n because of this exceptional risk , national and international authorities should establish special , and in general more stringent , criteria for activities involving these agents . with the growth of global research on high - containment agents , including ppp , the occurrence of documented \n national institute for allergy and infectious diseases is that 2 exposures occur for every 100,000 operator - hours and that only 1 of 12 such exposures involved an actual human infection . \n another set of data , lacking a denominator of operator - hours , registered 26 incidents with 8 documented infections in u.s . \n bsl-3 and -4 laboratories and 5 more , all resulting in infections , in bsl-3 and -4 laboratories abroad ( 10 ) . because reporting of laboratories existence , size , and activities , as well as accidents , is all incomplete , it is difficult to obtain precise rates comparable to those of niaid . nonetheless , using plausible assumptions , klotz and sylvester ( 5 ) estimate a historical risk of an accidental laboratory escape of a potentially pandemic pathogen of 0.3% per laboratory per year . \n while these figures may sound low , the key problem is that they increase as more laboratories undertake work on ppps and as they do so over a longer period . even at the niaid , \n the intramural estimated rate of 2 exposures per 100,000 operator - hours , a remarkably low rate that likely reflects very careful practices , one would expect 1 out of every 50 technicians working half - time ( 1,000 h ) in such a laboratory to be exposed each year and 1 of every 600 to become infected . over a 10-year period , with 100 such laboratories each employing 5 such technicians \n klotz and sylvester estimate that with 42 laboratories working on ppp and a 0.3% risk of an escape per laboratory - year , there is an 80% risk of an escape of a ppp every 13 years ( 5 ) . \n the best laboratories maintain careful training and testing of operators , tracking and testing of pathogen samples , and rigorous safety protocols . \n notwithstanding these efforts , lapses of protocol occur , as recently documented at the cdc high - containment laboratory ( http://www.usatoday.com/news/nation/story/2012-06-13/cdc-bioterror-lab/55557704/1 ) . infections of laboratory workers occur , as most recently emphasized by the tragic death of a technician working on neisseria meningitidis b in a bsl-2 laboratory in san francisco , ca ( 6 ) , and other events before that . standards of laboratory safety vary by institution ( given the strong reliance on institutions and even individual investigators to enforce the details of biosafety between government inspections ) and by country , with tremendous heterogeneity in the precautions required for working on a particular pathogen ( 7 ) . while the current moratorium is operative , we have an opportunity to define a set of conditions that will minimize the risks of laboratory - released infections or epidemics \n . clearly we must continue to emphasize the importance of learning about the pathogenesis of high - risk infectiousagents and recognize the likelihood that the greatest infectious risks come from nature , like h5n1 influenza . \n hence , there is a continuing need for research on a wide variety of pathogens , including those that are not currently fashionable ; we note that study of coronaviruses would never have been considered pandemic preparedness before sars , but it was . \n only a very limited number of experiments need to be done with potential pandemic pathogens themselves . \n any research proposal for working with such agents should contain an explicit risk - benefit justification for undertaking such research on potential pandemic pathogens and an explanation of why safer organisms would not suffice to test the specific hypotheses addressed by the experiments . risks and benefits of the experiments should be considered before proposals are funded , rather than doing this after research is done and then agonizing about whether to censor the results or not . \n we recognize that multiple approaches ( e.g. , genetics , molecular pathogenesis , immunology , host interactions , and animal challenges ) require multiple investigations of potential threats but also that any increase in the number of labs working on potential pandemic pathogens increases the risk of escape . \n hence , benefit - risk analysis to justify the research is crucial , and it may be necessary to restrict the number of labs needed to address each aspect of the same problem and the same pathogenic agent . \n there is clearly a need to engage in public discussion of the importance of such research and the risks ( 8) , perhaps by a process like the asilomar meeting that publicly discussed the hazards of recombinant dna research . \n support for this kind of research depends on honest and transparent public engagement and information and communication of the efforts to minimize risks to the public . \n while unanimity of views within the scientific community and the public is unlikely , nevertheless it will be important to develop some consensus on the major issues . \n it is clear to us that there is a compelling need to revise the classification of agents and categories . \n most serious pathogens currently handled in bsl-3 and bsl-4 present a serious risk to anyone infected in a laboratory accident and perhaps to one or two rounds of close contacts . \n an accidental release of potential pandemic pathogens puts at risk vastly greater numbers of people , whole cities or even the entire globe , and containment plans should reflect that risk . \n here we believe there has been somewhat of an overemphasis on physical containment guidelines and perhaps too little on laboratory competence in working with these agents . it is a real question whether it is safer to work in a space suit with a respirator and thick rubber gloves under bsl-4 conditions or with more convenient precautions , as in bsl-3 plus . \n we need guidelines for specific training , to address the dilemma that not every graduate student has the skills and discipline to work on potential pandemic pathogens , yet we need to train people to work professionally and competently.clearly , where a vaccine is available , even on an investigational basis , workers should be immunized to prevent infection . \n the ethical acceptability of offering a vaccine and permitting work regardless of whether a worker accepts the vaccine becomes questionable when the infection of that worker would put others at risk . \n we do not believe it is feasible to quarantine workers in bsl-3 or -4 laboratories after their work , nor can we expect good science to be done in labs in remote regions of the country away from universities , as has been suggested ( 5 ) . \n but where possible , labs working with pandemic pathogens should be isolated from other facilities . \n there is a need for greater monitoring for safety than the required inspection once every 3 years . \n it remains to be seen who should do the monitoring and the supervising and reporting of the monitoring , but competency is the key to avoiding risks . a cross - agency government committee . \n we support the creation of a government - wide committee to review the small number of proposals on potential pandemic pathogens , to create uniformity in evaluation of benefits versus risks of proposals , as opposed to the current policy , where each agency sets its own rules , which only selects for investigators to seek funding where the standards are loosest . \n such a committee must have the authority to limit the number of laboratories engaging in high - risk research and be informed of any problems that arise in any laboratory . \n research on potential pandemic pathogens will be , and to some extent already is , a global enterprise . \n we urge who to convene a comparable international group to set guidelines and oversee international laboratories working on such pathogens . \n getting agreement will be difficult , and enforcement will be very challenging ; but when reducing risk , an imperfect system is much better than none . any release of potential pandemic pathogens could be catastrophic , not only in the health risks that are generated but also for public trust in science and support for science . as microbiologists and citizens , we recognize the need to preserve and extend research in general and in particular on the most dangerous pathogens . while we are skeptical that studying the mutational changes involved in mammalian transmission will enable surveillance that would fundamentally change our preparedness for a future pandemic ( 9 ) , we do not propose to stop all research on such viruses \n rather , research on mammalian - transmissible h5n1 viruses and other potential pandemic pathogens must be limited to the most pressing experiments in a limited number of competent laboratories . while no scientist can be enthusiastic about suggesting limitations on research , \n no experiment on smallpox , however meritorious , may be done outside the two permitted laboratories . \n the risk of emergence in nature of transmissible h5n1 influenza presents a more pressing threat to human health than smallpox , so the benefits as well as risks of research to prevent or treat h5n1 infections are greater than those for smallpox . \n in addition , studies that could produce valuable science are routinely prohibited by well - accepted restrictions on human subject research and treatment of animals . \n if such restrictions are legitimate to reduce risks to a handful of human or animal subjects , then surely it is reasonable to limit research on a small group of pathogens to reduce the risk of precipitating a global public health crisis \n we believe that studies of the susceptibility of wild - type h5n1 virus to drugs and vaccines can and are being carried out at present , and there is no reason to foresee that the result would be different with a transmissible strain . therefore , most if not all of those studies and many studies of pathogenesis can and should be carried out with nontransmissible strains . the most pressing experiments for which restrictions ought to be considered are specifically designed for understanding the molecular basis of transmissibility of highly pathogenic strains . \n the risk calculations of klotz and sylvester are a good starting point for further discussions of the magnitude of risk ( 5 ) . if these estimates are in the right order of magnitude , as we believe they are , there are few insights into influenza biology that are uniquely possible with mammalian - transmissible influenza a / h5n1 virus and which justify a 1-in-300 risk of an accidental infection during a year s work in a single laboratory . \n we suspect that very few experiments , in only a handful of labs , would pass the test that their potential benefits to public health would justify the risk of escape . with the proliferation of bsl-3 and bsl-4 laboratories across the globe , \n including many set up for surveillance and response to a natural influenza pandemic , decisions by the united states and other biomedical research leaders about research on mammalian - transmissible h5n1 viruses will have rapid consequences for the scale of research around the globe . \n if the wealthy countries adopt a policy that any experiment with these viruses is acceptable as long as it is done in a containment facility , a similar ethic will likely prevail globally , but the quality of containment will vary . \n if , on the other hand , they acknowledge the unique risks posed by potential pandemic pathogens and help to generate a process that has international support , a global framework for evaluating proposed research in this area would be a great contribution . \n opposition to bsl-3 and bsl-4 laboratories , when it has occurred , has often focused on threats to the local communities , who would indeed be at higher risk if a highly lethal but low - transmissibility pathogen were accidentally released . for potential pandemic pathogens , in contrast , \n the risk is global a release that threatens boston inevitably threatens bangkok and bamako . \n funders , regulators , and researchers who propose experiments that could place the global populace at risk have a responsibility to involve those whose well - being is affected ( the global public ) in considering the principles for undertaking such research . \n such studies should be undertaken rarely and with extreme caution , ensuring that such risks are undertaken only when the potential benefits to global public health are also exceptional . \n while the current moratorium is operative , we have an opportunity to define a set of conditions that will minimize the risks of laboratory - released infections or epidemics . clearly we must continue to emphasize the importance of learning about the pathogenesis of high - risk infectiousagents and recognize the likelihood that the greatest infectious risks come from nature , like h5n1 influenza . \n hence , there is a continuing need for research on a wide variety of pathogens , including those that are not currently fashionable ; we note that study of coronaviruses would never have been considered pandemic preparedness before sars , but it was . \n only a very limited number of experiments need to be done with potential pandemic pathogens themselves . \n any research proposal for working with such agents should contain an explicit risk - benefit justification for undertaking such research on potential pandemic pathogens and an explanation of why safer organisms would not suffice to test the specific hypotheses addressed by the experiments . risks and benefits of the experiments should be considered before proposals are funded , rather than doing this after research is done and then agonizing about whether to censor the results or not . \n we recognize that multiple approaches ( e.g. , genetics , molecular pathogenesis , immunology , host interactions , and animal challenges ) require multiple investigations of potential threats but also that any increase in the number of labs working on potential pandemic pathogens increases the risk of escape . \n hence , benefit - risk analysis to justify the research is crucial , and it may be necessary to restrict the number of labs needed to address each aspect of the same problem and the same pathogenic agent . \n there is clearly a need to engage in public discussion of the importance of such research and the risks ( 8) , perhaps by a process like the asilomar meeting that publicly discussed the hazards of recombinant dna research . \n support for this kind of research depends on honest and transparent public engagement and information and communication of the efforts to minimize risks to the public . \n while unanimity of views within the scientific community and the public is unlikely , nevertheless it will be important to develop some consensus on the major issues . \n it is clear to us that there is a compelling need to revise the classification of agents and categories . \n most serious pathogens currently handled in bsl-3 and bsl-4 present a serious risk to anyone infected in a laboratory accident and perhaps to one or two rounds of close contacts . \n an accidental release of potential pandemic pathogens puts at risk vastly greater numbers of people , whole cities or even the entire globe , and containment plans should reflect that risk . \n we believe there has been somewhat of an overemphasis on physical containment guidelines and perhaps too little on laboratory competence in working with these agents . \n it is a real question whether it is safer to work in a space suit with a respirator and thick rubber gloves under bsl-4 conditions or with more convenient precautions , as in bsl-3 plus . \n we need guidelines for specific training , to address the dilemma that not every graduate student has the skills and discipline to work on potential pandemic pathogens , yet we need to train people to work professionally and competently.clearly , where a vaccine is available , even on an investigational basis , workers should be immunized to prevent infection . \n the ethical acceptability of offering a vaccine and permitting work regardless of whether a worker accepts the vaccine becomes questionable when the infection of that worker would put others at risk . \n we do not believe it is feasible to quarantine workers in bsl-3 or -4 laboratories after their work , nor can we expect good science to be done in labs in remote regions of the country away from universities , as has been suggested ( 5 ) . but \n there is a need for greater monitoring for safety than the required inspection once every 3 years . \n it remains to be seen who should do the monitoring and the supervising and reporting of the monitoring , but competency is the key to avoiding risks . a cross - agency government committee . \n we support the creation of a government - wide committee to review the small number of proposals on potential pandemic pathogens , to create uniformity in evaluation of benefits versus risks of proposals , as opposed to the current policy , where each agency sets its own rules , which only selects for investigators to seek funding where the standards are loosest . \n such a committee must have the authority to limit the number of laboratories engaging in high - risk research and be informed of any problems that arise in any laboratory . \n research on potential pandemic pathogens will be , and to some extent already is , a global enterprise . \n we urge who to convene a comparable international group to set guidelines and oversee international laboratories working on such pathogens . \n getting agreement will be difficult , and enforcement will be very challenging ; but when reducing risk , an imperfect system is much better than none . any release of potential pandemic pathogens could be catastrophic , not only in the health risks that are generated but also for public trust in science and support for science . as microbiologists and citizens , \n we recognize the need to preserve and extend research in general and in particular on the most dangerous pathogens . while we are skeptical that studying the mutational changes involved in mammalian transmission will enable surveillance that would fundamentally change our preparedness for a future pandemic ( 9 ) , we do not propose to stop all research on such viruses . \n rather , research on mammalian - transmissible h5n1 viruses and other potential pandemic pathogens must be limited to the most pressing experiments in a limited number of competent laboratories . while no scientist can be enthusiastic about suggesting limitations on research , certain limitations already exist , and what we are suggesting is not unique . \n no experiment on smallpox , however meritorious , may be done outside the two permitted laboratories . \n the risk of emergence in nature of transmissible h5n1 influenza presents a more pressing threat to human health than smallpox , so the benefits as well as risks of research to prevent or treat h5n1 infections are greater than those for smallpox . \n in addition , studies that could produce valuable science are routinely prohibited by well - accepted restrictions on human subject research and treatment of animals . \n if such restrictions are legitimate to reduce risks to a handful of human or animal subjects , then surely it is reasonable to limit research on a small group of pathogens to reduce the risk of precipitating a global public health crisis . \n we believe that studies of the susceptibility of wild - type h5n1 virus to drugs and vaccines can and are being carried out at present , and there is no reason to foresee that the result would be different with a transmissible strain . therefore , most if not all of those studies and many studies of pathogenesis can and should be carried out with nontransmissible strains . \n the most pressing experiments for which restrictions ought to be considered are specifically designed for understanding the molecular basis of transmissibility of highly pathogenic strains . \n the risk calculations of klotz and sylvester are a good starting point for further discussions of the magnitude of risk ( 5 ) . if these estimates are in the right order of magnitude , as we believe they are , there are few insights into influenza biology that are uniquely possible with mammalian - transmissible influenza a / h5n1 virus and which justify a 1-in-300 risk of an accidental infection during a year s work in a single laboratory . \n we suspect that very few experiments , in only a handful of labs , would pass the test that their potential benefits to public health would justify the risk of escape . with the proliferation of bsl-3 and bsl-4 laboratories across the globe , \n including many set up for surveillance and response to a natural influenza pandemic , decisions by the united states and other biomedical research leaders about research on mammalian - transmissible h5n1 viruses will have rapid consequences for the scale of research around the globe . \n if the wealthy countries adopt a policy that any experiment with these viruses is acceptable as long as it is done in a containment facility , a similar ethic will likely prevail globally , but the quality of containment will vary . \n if , on the other hand , they acknowledge the unique risks posed by potential pandemic pathogens and help to generate a process that has international support , a global framework for evaluating proposed research in this area would be a great contribution . \n opposition to bsl-3 and bsl-4 laboratories , when it has occurred , has often focused on threats to the local communities , who would indeed be at higher risk if a highly lethal but low - transmissibility pathogen were accidentally released . for potential pandemic pathogens , in contrast , \n the risk is global a release that threatens boston inevitably threatens bangkok and bamako . \n funders , regulators , and researchers who propose experiments that could place the global populace at risk have a responsibility to involve those whose well - being is affected ( the global public ) in considering the principles for undertaking such research . \n such studies should be undertaken rarely and with extreme caution , ensuring that such risks are undertaken only when the potential benefits to global public health are also exceptional .", "role": "user" }, { "content": "abstract if accidentally released , mammalian - transmissible influenza a / h5n1 viruses could pose a greater threat to public health than possibly any other infectious agent currently under study in laboratories , because of such viruses likely combination of transmissibility and virulence to humans . \n we advocate explicit risk - benefit assessments before work on such pathogens is permitted or funded , improvement of biosafety practices and enforcement , and harmonization of criteria for permitting such experiments across government agencies , as well as internationally . \n such potential pandemic pathogens , as they have been called , jeopardize not only laboratory workers and their contacts , but also the wider population , who should be involved in assessments of when such risks are acceptable in the service of scientific knowledge that may itself bear major public health benefits .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a core principle of both financial investment and biology is that diversity leads to strength . in biology , \n hybrid vigor produces healthy organisms , because each parental genome contributes complementary strengths and balances the other 's weaknesses . in investing \n , diversity spreads risk , maximizing the chances of finding some big winners while reducing the chances of collapse based on sudden declines in a few companies ' fortunes . \n diversity at all levels from the kinds of science to the regions in which it is conducted to the backgrounds of the people conducting it strengthens the institute 's research portfolio and should lead to the best returns on the taxpayers ' investments . \n it is impossible to know where or when the next big advances will arise , and history tells us that they frequently spring from unexpected sources . \n it is also impossible to know what threads of foundational knowledge will be woven together to produce a new breakthrough . \n supporting a wide variety of lines of inquiry will improve the chances of important discoveries being made . \n this includes studying a diversity of organisms , because important and useful processes almost certainly remain to be discovered in areas of biology we have not yet explored . \n scientists ' past or current experiences have a significant impact on the problems they choose to study and on the ideas they have for approaching these problems . \n health burdens from specific diseases differ from state to state and population to population , and these variances can drive the kinds of questions researchers ask . \n in addition to variations in regional health burdens , other environmental factors such as local plants and animals can influence an investigator 's research directions . \n for example , baldomero olivera , now a prominent researcher at the university of utah , began studying deadly cone snail venom while he was working in the philippines , where the animals are endemic and people routinely died of snail stings ( telis , 2014 ) . \n olivera 's work on cone snail toxins has transformed neuroscience and has already led to one food and drug administration approved drug and several more in clinical trials . \n we also need to consider the identification and development of scientific talent when planning how we invest in biomedical research . \n for example , if cutting - edge biomedical research were only being conducted in 25 states , it would mean that high school and college students in the other 25 states could get research experience only if they were willing and able to move . \n the loss of talent to science in the united states caused by this research experience gap would be severe . \n in addition to the value of supporting a diverse research portfolio , it is important to recognize that the best ideas come from investigators themselves . although there are times when management and top - down direction can help break through systemic barriers or open up bottlenecks particularly when the development of new technologies is required fundamental research works best when investigators are following their noses and setting their own directions . during the national institutes of health ( nih ) budget - doubling period ( 19982003 ) , the fraction of the nigms portfolio dedicated to investigator - initiated research declined from 99 to 80% because of increasing use of programmatic initiatives ( figure 1 ) ; that is , funding targeted at specific scientific areas . with the budget doubling more than a decade behind us , \n it is time to return the institute 's focus to investigator - initiated research , to ensure that new scientific territory is opened for exploration by adventurous investigators . \n the fraction of the nigms portfolio committed to investigator - initiated research has declined over the past two decades . \n the blue bars ( left axis ) show the funds nigms committed to funding opportunity announcements ( foas ) targeted at specific areas of research in each fiscal year shown . \n the red line with triangles shows the change in the percentage of the nigms portfolio dedicated to investigator - initiated research . \n the analysis does not include fellowship , career development , and training awards ; programs transferred to nigms from the former national center for research resources ; and some other programs . \n a criticism of nigms ' renewed emphasis on investigator - initiated research has been that it will disadvantage team science and collaboration . \n but the dichotomy is not between investigator - initiated research and team science ; it is between investigator - initiated research and targeted or top - down research , in which funds are earmarked for specific scientific areas . \n team science aimed at studying fundamental biomedical problems can and usually should be investigator - initiated . \n interdisciplinary team science is undoubtedly extremely important and will become increasingly so as we delve deeper into the complexities of biological systems . \n one way to support team science is for independently funded principal investigators ( pis ) to form collaborations organically based on common interests and complementary skills , a method that , for fundamental research , seems likely to yield better results than collaboration borne of incentives such as targeted funding \n nih also has several mechanisms dedicated to supporting investigator - initiated team science , including multi - pi r01s and program project grants ( p01s ) . \n the centers of biomedical research excellence within the nigms institutional development award program also support team science , with a focus on developing the careers of junior investigators ( nigms , 2015 ) . moving forward \n , we plan to try to understand what kinds of teams benefit the most from unified grant mechanisms such as multi - pi r01s and p01s . \n press coverage , prizes , and renown all revolve around the concepts of discoveries and breakthroughs . \n eureka moments in which a paradigm shift occurs . and yet most major advances in science actually happen when a series of small steps coalesce into an important new understanding . \n for example , the discovery of restriction enzymes , a truly transformative advance that propelled biomedical research in the 1970s into the age of molecular biology and launched the biotechnology industry , began in the 1950s with the description of bacterial resistance to phage infection \n . dozens of papers published in various journals led to the insights that brought the nobel prize to warner arber , daniel nathans , and hamilton smith in 1978 ( loenen et al . , 2014 ) . \n discoveries arise from a complex web of knowledge , and without the network created by the steady progress of many researchers , they would not occur . as discussed earlier , it is impossible to know in advance where in this web the next big breakthroughs will arise or which strands of knowledge will be required to make them . \n the original observation of crispr sequences , for example , was made at the end of a 1987 journal of bacteriology paper that was otherwise devoted to reporting the sequence of the gene for the escherichia coli alkaline phosphatase isozyme converting protein iap ( ishino et al . \n describing the mysterious repeat sequences , the paper ends with the sentence , so far no sequence homologous to these has been found elsewhere in procaryotes , and the biological significance is not known . \n slowly , through years of careful characterization of the crispr pathway , our understanding of what this initial observation meant fueled the development of a novel technology that has dramatically improved our ability to replace genes in living cells , paving the way for advances in medicine and biotechnology . \n this and many other instances like it show how important it is for us to support as wide a web of research as possible . \n in 1985 , bruce alberts wrote a prescient commentary in which he laid out the inefficiencies created in the basic biomedical research enterprise when labs become too large ( alberts , 1985 ) . \n there are a number of reasons for these inefficiencies , but they mostly come down to bandwidth . for example , the more people a pi has in his or her lab , the less time he or she can devote to training and supervising each one . \n in addition , the bigger a lab gets , the more time the pi must spend on the grant - writing and administrative tasks needed to keep the operation running and the less time he or she has for actually doing research . for these reasons \n , alberts argued that the per capita output of a lab would generally diminish above a certain size and that nih and other agencies should cap pi funding , thereby limiting lab size and optimizing scientific productivity and quality . in 2010 , nigms conducted an analysis of the productivity and scientific impact of the research the institute funds as a function of each nigms investigator 's total direct - cost support from nih ( figure 2 ) . \n this study showed that , on average , these metrics increase only shallowly with funding above a moderate level ( $250,000300,000 ) and then actually decrease above $750,000 ( berg , 2010a , b ) . \n although a few investigators beat the averages and increase their productivity at a proportional or better rate as their funding increases , other well - funded investigators perform even worse than the averages . \n similar results have recently been published for chemical and biological research supported by other agencies ( fortin and currie , 2013 ; gallo et al . , 2014 ) and by the nih ( berg , 2015 ; danthi et al . , 2015 \n a 2010 analysis of researchers funded by nigms showed that , on average , productivity did not scale proportionally with funding beyond a relatively moderate direct - cost threshold . \n ( top panel ) average number of publications associated with nih grants of nigms - funded investigators as a function of their total nih direct costs ( red line with circles ) and the average impact factor of the journals in which each set of investigators published ( blue line with squares ) . \n ( bottom panel ) the unbinned data used to generate the averages shown in the top panel . \n jeremy berg , paul sheehy , and matt eblen ( nigms ) performed the data analysis . \n thinking about these data from the perspective of an investor of taxpayer funds , one can do a simple back - of - the - envelope calculation to determine what the best investment strategy for fundamental research should be . \n the first is from a talented established investigator and is for a new r01 , which would be his third , bringing him from $ 400,000 to $ 600,000 in total direct funding . \n in the first case , the additional $ 200,000 would buy taxpayers , on average , approximately one more paper during the funding period over what the established pi would have produced with $ 400,000 ( figure 2 ) . in the second case , \n the new pi would produce five papers on average in the funding period if she were awarded the grant . \n thus the choice seems obvious : taxpayers net four more papers by funding the new pi than by giving the established pi a third grant . \n , some biomedical research simply costs more money than the average , and this needs to be considered when grant budgets are set . and \n a difficulty here is that recent analyses have indicated that the peer - review process does not have sufficient resolution to accurately distinguish among the most promising applications , with at best modest correlations between score and productivity or impact for funded applications ( berg , 2011 , 2013 ; gallo et al . , 2014 ; \n so , for example , if the established pi 's application scored in the fifth percentile , and the new pi 's scored in the 15th percentile , could we really be confident that the former is likely to produce more important work than the latter ? along these same lines , \n as mentioned earlier , although we fund some pis who beat the average productivity versus funding curve , we also fund some who are below it , again indicating that picking the high performers is not easy , at least with the current process . \n these considerations suggest that we should be very selective in allowing pis to accumulate high funding levels and that , in general , funding more investigators at a moderate level rather than a few at a high level will yield the best payoffs . \n a question that at first glance may seem trivial but is , i believe , a significant one is whether our key metric for how we use the funds we invest in biomedical research should be the number of grants we award or the number of investigators we support . \n for example , we report to the scientific community and congress on the success rate for grant funding : how many grants we awarded in a year divided by the number of grant applications we received . in theory , focusing on grants tells us how many projects we are funding . however , because pis can have more than one nigms research grant , this focus distances our funding decisions from the key question of how many investigators are in our portfolio . \n if we instead used the number of pis we support as the key parameter to drive our funding and programmatic decisions , it would reduce the number of variables , allowing us to focus on the most important ones . \n for example , once we decided on the optimal number of nigms - supported investigators , we could then set a mean and median direct - cost target per investigator based on our total research budget . \n once we had established the total number of investigators who should be supported by the institute , we could determine how many new pis should enter and how many established pis should exit the system each year . \n we would also be better able to ensure the diversity and breadth of the institute 's research portfolio . \n overall this seemingly simple shift in how we view our mission could be a useful catalyst for reequilibrating the biomedical research enterprise to maximize its effectiveness , efficiency , and sustainability . \n promoting this shift is something we are working on at nigms , both as part of our new strategic plan and through a new funding mechanism , described in the following section . \n reequilibrating the biomedical research enterprise to make it more efficient and sustainable will require major changes in every part of the system . because we do not know a priori which changes will work best and because there is always a risk of unintended negative consequences \n , the soundest approach will be to experiment and to expand initiatives that succeed and abandon those that do not . \n this model requires us to define in advance the outcomes we hope to achieve and to collect the necessary data to measure them as the experiments progress . \n one such experiment is the nigms maximizing investigators ' research award ( mira ; preusch , 2015 ) . \n the mira program aims to transform how we support fundamental biomedical research , shifting away from the current paradigm of funding specific , predefined projects to one in which we focus on supporting the overall research program in each investigator 's lab . \n the goals of the mira pilot are to 1 ) increase funding stability for investigators to enhance their ability to take on ambitious research and approach problems creatively ; 2 ) increase flexibility for investigators to follow new directions as ideas and opportunities arise , which should help maximize the chances for breakthroughs ; 3 ) improve the distribution of funding , allowing the institute to support an optimally broad and diverse portfolio of investigators ; and 4 ) reduce the amount of time spent writing and reviewing grant applications , freeing up time to focus on research , training , and mentoring . \n each of these goals aims to help maximize the scientific returns on taxpayers ' investments . \n much discussion of the problems facing the biomedical research enterprise ( e.g. , ioannidis , 2011 ; bourne , 2013b , c ; alberts et al . , 2014 ) . \n among the many challenges , perhaps the most worrying is that junior scientists are becoming increasingly discouraged about their career prospects ( bourne , 2013a ; polka and krukenberg , 2014 ) , a growing crisis that could leave a serious deficit in the nation 's scientific capacity for years to come . but despite the many challenges we face , there are reasons to be optimistic about the future . \n scientifically , our deepening and expanding knowledge is opening up incredible new frontiers in research , and developments in technology are allowing us to address questions that a decade ago seemed completely inaccessible . \n although i have not discussed it here , renewed focus on improving scientific education , training , and career development seems likely to lead to an even more skilled , productive , and efficient workforce in the coming years . \n there is a growing recognition that we owe it to the nation and future generations to reoptimize the biomedical research enterprise ( lorsch , 2015 ) , and momentum is building in many sectors to make the changes this reoptimization will require . \n for example , the nih ( rockey , 2012 , 2015 ; maas , 2015 ) , members of congress ( harris and young , 2014 ; hearing on the fy 2016 national institutes of health budget request , 2015 ) , professional societies ( federation of the american societies for experimental biology , 2015 ) , and academic leaders ( daniels , 2015 ) are focusing attention on the challenges facing junior scientists and are trying to develop strategies to help this critically important group . if these trends continue , and all of the stakeholders take on their share of the responsibility , i am confident we can develop a more efficient and sustainable biomedical research enterprise and , in the process , accelerate advances in human health and prosperity .", "role": "user" }, { "content": "the national institute of general medical sciences ( nigms ) at the u.s . national institutes of health has an annual budget of more than $ 2.3 billion . \n the institute uses these funds to support fundamental biomedical research and training at universities , medical schools , and other institutions across the country . \n my job as director of nigms is to work to maximize the scientific returns on the taxpayers ' investments . \n i describe how we are optimizing our investment strategies and funding mechanisms , and how , in the process , we hope to create a more efficient and sustainable biomedical research enterprise .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: initial treatment for localized disease is surgical , but between 20 and 30% of patients relapse with a mean time to progression of 12 years . \n approximately one third of patients present with metastatic disease with an overall survival of 1215 months . \n cytokines like interleukin-2 ( il-2 ) and interferon- ( ifn- ) were the standard treatment , but were associated with low response rates and significant toxicity . in the last 5 years , mrcc treatment has changed dramatically , with the onset of new therapies against molecular targets such as the vascular - endothelial growth factor receptor ( vegfr ) and mtor signalling pathway . both treatments in both first and second line have shown clear benefits in these patients and have replaced immunotherapy as standard treatment [ 3 , 4 ] . \n a 49-year - old male with a personal history of arterial hypertension and smoking was referred to the urology department due to a history of monosymptomatic macroscopic hematuria . \n the initial ultrasonography study demonstrated an 8.5-cm solid mass with a central necrotic area at the lower pole of the left kidney , compatible with rcc . \n the computed tomography ( ct ) scan confirmed the presence of a renal tumor that invades the renal sinus , but without vascular or regional node compromise or distant metastases . \n radical nephrectomy was then performed with the pathological diagnosis of a moderately differentiated renal clear cell carcinoma with absence of extracapsular or vascular extension ( t2an0m0 ) . without postoperative complications , \n the patient continued routine follow - up visits every 3 months in the urology service . \n eight months after nephrectomy , while the patient was asymptomatic , a control ct demonstrated a 4-cm thyroid nodule in the left lobe without any other finding . \n the patient was then referred to endocrinology where the study was completed with a thyroid scintigraphy that confirmed the cold thyroid nodule diagnosis . \n thyroid function tests were normal and fine needle aspiration cytology was performed , with the pathological result compatible with follicular proliferation . \n nevertheless , left hemithyroidectomy was carried out with the pathological result of renal clear cell carcinoma metastases associated with a thyroid nodular hyperplasia . \n subsequently , the patient was referred to our medical oncology service where routine follow - up visits were carried out keeping an expectant attitude since the ct scan , physical examination and lab tests performed routinely were normal . \n seventy - five months after nephrectomy ( 67 months after the first metastases ) , the patient presented at the emergency department with a history of one episode of melena that required his admission to the gastroenterology service where the endoscopic study revealed an upper gastrointestinal bleeding due to a duodenal ulcer ( not biopsied ) that required sclerotherapy treatment . \n helicobacter pylori ( hp ) test was positive and the patient received eradication treatment with subsequent negativization of breath test . \n however , 5 months after the first episode of duodenal bleeding , the patient was admitted again to the gastroenterology service due to another upper gastrointestinal bleeding episode , this time associated with fatigue . \n the lab test was significant for microcytic hypochromic anemia with hemoglobin of 5.3 g / dl , requiring transfusion of 3 erythrocyte concentrates and bowel rest . \n the gastroscopy again revealed a duodenal ulcer ( biopsy was taken at that time ) corresponding to the same lesion detected 5 months earlier without signs of healing despite sclerotherapy and hp eradication treatment . because of this and the big size of ulcer , an abdominal ct scan was performed showing the presence of enlargement of the head of the pancreas without any other finding . \n the study was completed with an ultrasound endoscopy that confirmed the presence of a 4-cm solid mass in the head of the pancreas with \n the pathologic result confirmed the presence of metastatic infiltration of renal clear cell carcinoma in duodenal mucosa . \n for that reason , it was decided to carry out a duodenopancreatectomy in which the pathological study showed the presence of multiple metastatic invasion of renal clear cell carcinoma in pancreas and duodenal wall with positive surgical margins . \n after recovery from a postoperative period complicated with diabetes mellitus and steatorrhea , a new control ct scan was performed in april 2007 ( 82 months after nephrectomy ) showing the presence of a 1.4-cm left lung nodule compatible with metastases ( fig . \n 1 ) . given the presence of lung metastases and positive surgical margins in duodenopancreatectomy , it was decided to start first - line systemic treatment with sunitinib ( 50 mg once a day for 4 weeks with 2 weeks rest ) in may 2007 . \n after 5 months of treatment , the patient showed complete response with disappearance of lung metastases in the control ct scan as well as absence of metastatic disease in other organs without toxicity ( fig . \n after 48 months of follow - up ( 132 months after nephrectomy ) , the patient continues treatment with sunitinib at the same dose , maintaining complete response in regular control ct studies ( recist criteria ) , with good tolerance to treatment except for an episode of fever and moderate asthenia that has not required treatment adjustment , and maintaining an excellent performance status ( ecog 0 ) at all times . \n rcc has the potential to metastasize to almost any location , the most common sites being lung , lymph nodes , liver , bone , adrenal glands and brain . \n thyroid metastases in rcc are extremely rare , representing less than 5% of cases , most of which are metachronous , with a mean latency period of about 10 years . \n the usual clinical presentation is of a thyroid nodule or goiter with normal thyroid function tests , which in the scintigraphy behaves like cold nodules . \n our patient presented with left thyroid lobe metastases 8 months after nephrectomy that required hemithyroidectomy as treatment . \n the clinical presentation was similar to data reported in the literature , emphasizing the importance of raised suspicion of metastases in all patients with a history of rcc and thyroid volume increase . \n likewise , only 28 cases of duodenal metastases from rcc have been described , thus turning it into a rare entity . \n the vast majority of cases described presented upper gastrointestinal bleeding , but may also show anemia , fatigue , bowel obstruction or jaundice . \n the mean time of presentation after nephrectomy is approximately 7.9 4.7 years , and the most common form of treatment is surgical resection by duodenopancreatectomy , besides other therapeutic options such as embolization , palliative radiotherapy or palliative gastrojejunostomy . \n our patient presented with duodenal metastases that compromised the head of the pancreas , and presenting with upper gastrointestinal bleeding . \n the treatment applied in this case was surgery by duodenopancreatectomy , with the inconvenience that the pathology result detected positive surgical margins and also that the extension study showed lung metastases requiring initiation of systemic treatment . \n it was approved by the fda ( food and drug administration ) and ema ( european medicines agency ) for the treatment of mrcc since 2007 , thanks to the results obtained in a randomized , double - blind , multicenter phase iii study that compared single - agent sunitinib versus ifn- in first - line treatment . \n this study demonstrates the superiority of sunitinib vs. ifn- , with a mean disease - free survival of 11 vs. 5 months , a response rate of 31 vs. 6% , and an overall survival of 28 vs. 14 months [ 3 , 7 ] . \n our patient presented an excellent response to sunitinib treatment , showing complete clinical and radiological response at 5 months of treatment ( recist criteria ) and a disease - free survival of 48 months until now , without evidence of toxicity , and with an excellent performance status that allows him to work and develop his life normally . \n this case report highlights the importance of close follow - up and the raised suspicion level that we must keep in nephrectomized rcc patients at the onset of new symptoms . \n moreover , this case also highlights the good responses that can be achieved in terms of disease - free survival , low toxicity and quality of life in this new era of therapies against molecular targets ; even , as in our case , better results than those described in the literature .", "role": "user" }, { "content": "recently , metastatic renal cell carcinoma ( mrcc ) treatment has changed dramatically with the onset of new therapies against molecular targets replacing immunotherapy as standard treatment . \n we report the case of a 49-year - old patient with a moderately differentiated renal clear cell carcinoma without extracapsular extension who underwent radical nephrectomy . \n eight months after surgery , he developed a thyroid metastasis which was also treated surgically with a hemithyroidectomy . \n seventy - five months after nephrectomy , the patient presented an upper gastrointestinal bleeding due to a duodenal metastasis that infiltrates the head of the pancreas . \n the treatment applied was surgery by duodenopancreatectomy , with positive surgical margins in the pathologic study . \n in addition to this , the extension study showed lung metastases requiring initiation of systemic treatment with sunitinib . \n the patient presented an excellent response to treatment , showing complete clinical and radiological response at 5 months of treatment ( recist criteria ) and a disease - free survival of 48 months until now , without evidence of toxicity . \n rcc has the potential to metastasize to almost any location , but thyroid and duodenal metastases in rcc are extremely rare . \n moreover , this case also highlights the good responses that can be achieved in terms of disease - free survival , low toxicity and quality of life in this new era of therapies against molecular targets .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a stem rot disease has been observed sporadically on asiatic dayflower at moist , shady forest edges and roadsides in geoje , korea in 2010 ( fig . \n , stems under the canopy are exposed to warm and highly humid conditions , which are favorable for the development of sclerotial stem rot . \n the disease started with small water - soaked lesions on the stem , which expanded and rotted . \n the heavily infected stems became rotted and blighted , and the plant eventually died ( fig . \n the freshly isolated pathogenic fungus grown on potato dextrose agar ( pda ) was examined microscopically . \n detailed microscopic examinations of a representative specimen were performed using a light microscope ( axioplan ; carl zeiss , jena , germany ) . \n small globoid sclerotia formed abundantly on the pda after 10 days of mycelial growth ( fig . \n the sclerotia , which were relatively uniform in size ( 1~3 mm ) , were white at first and became dark brown gradually . \n inoculums were prepared with mycelial mats and mixed with autoclaved soil for pathogenicity testing . then , healthy c. \n the first symptoms appeared at 7 days after inoculation , and typical symptoms developed into water - soaking lesions . \n then , white mycelia and sclerotia were observed on the rotted areas of stems ( fig . \n the causal pathogen was re - isolated from the lesions to confirm koch 's postulate . \n the complete its rdna region of the representative isolate was amplified and sequenced using the its1 ( 5'-tccgtaggtgaacctgcgg-3 ' ) and its4 ( 5'-tcctccgcttattgatatgc-3 ' ) primers as described by white et al . . \n a phylogenetic analysis was performed using mega4 software ( mega , tempe , az , usa ) , with the neighbor - joining method and the tajima - nei distance model . \n previously published its sequences of sclerotium rolfsii strains were included for reference . in the phylogenetic tree ( fig . \n 2 ) , the representative isolate was placed within a clade comprising reference isolates of s. rolfsii . based on symptoms , mycological characteristics , molecular data , and pathogenicity to the host plant , \n a representative culture of s. rolfsii has been deposited with the korean agricultural culture collection ( kacc 45483 ) , national academy of agricultural science , rural development administration , suwon , korea . to our knowledge , this is the first report of the presence of s. rolfsii on asiatic dayflower in korea . \n environmental conditions during the summer in korea are similar to subtropical conditions , which are favorable for development of this disease . \n the recent occurrence of this disease suggests the possibility that s. rolfsii is spreading widely .", "role": "user" }, { "content": "stem rot was found for the first time on the asiatic dayflower plant ( commelina communis l. ) in korea . a detailed description of this korean specimen is given , along with its rdna internal transcribed spacer sequence . \n the fungus was identified as sclerotium rolfsii saccardo based on mycological characteristics and molecular data .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: post - stroke emotional incontinence and bipolar disorder are two disorders that involve the dysfunction of brain structures responsible for emotional regulation . \n the objective of this work is to study the links between these disorders through a clinical case . \n we present the case of a 43-year - old man without previous psychiatric history who experienced emotional incontinence after cerebrovascular events . \n however , he experienced his first episode of hypomania after 6 months of antidepressant therapy . \n adjunctive therapy with valproic acid and low - dose paroxetine was eventually added , resulting in complete improvement of both emotional incontinence and hypomania after 4 additional months of treatment . \n the clinician should carefully explore any history of premorbid bipolar disorder , personality disorder characterized by mood instability , and family history of bipolar disorder . \n emotional incontinence ( ei ) is an increase in the frequency of crying or laughing episodes.1 on the other hand , post - stroke mania is a rare neuropsychiatric complication that is observed in less than 1% of stroke cases.2 depression is the most frequently occurring psychiatric disorder after stroke , and secondary bipolar disorder is considered an uncommon consequence and it is only reported anecdotally.2 post - stroke ei and bipolar disorder are two disorders that involve the dysfunction of brain structures responsible for emotional regulation.3 we present a patient who developed post - stroke ei with multiple acute lacunar infarcts of lenticulocapsular and right semiovale regions . \n the patient experienced , after 6 months of antidepressant therapy , his first episode of hypomania , which is clinically managed by sodium valproate and low - dose paroxetine . \n the objective of this work is to study the links between these disorders through a clinical case . \n a right - handed , 43-year - old tunisian man , without previous psychiatric history , presented with frequent and easily provoked spells of emotions ( typically manifested by inappropriate laughing and crying ) . \n the patient had been crying for no reason more than ten times a day , but it was also observed that occasionally he could not stop laughing . according to his family , these brief fits of crying and laughing occurred in situations appropriate to the context and appeared like an uncontrolled exaggeration of a normal mood . \n these symptoms appeared after an ischemic stroke , 8 years ago . during the first year post - stroke , these symptoms were concomitant with partial somatic seizures ( headache ) diagnosed by a neurologist . \n however , the gradual worsening of emotional disorders and their effect upon social and professional life led his family to make an appointment in our outpatient psychiatry service . during the mental examination at admission , \n the patient presented with good appearance , was alert , cooperative , oriented in time and space , and had passive dependent personality traits . \n the mini - mental state examination score was 28/30.4 brain magnetic resonance imaging ( mri ) showed the presence of multiple acute lacunar infarcts of lenticulocapsular and right semiovale regions . \n authors ran a brief test battery to exclude other organic causes , including blood chemistry , thyroid function , folic acid , vitamin b12 , crp , summary analysis of urine type ii , coagulation studies , illicit drugs in urine and alcohol in blood , chest radiography , hiv , hepatitis c and hepatitis b viral markers , and syphilis serology , which revealed no significant alterations . \n after 6 months he presented with hypomanic symptoms such as expansive mood , decreased need for sleep , increased goal - directed activity . \n so , we made adjustments in pharmacotherapy to valproic acid ( 1,000 mg / day ) and benzodiazepine . \n he remained euthymic in the next 5 months of follow - up until he progressively presented with worsening of ei . \n the classic literature on pathological laughter and crying emphasizes the difference between post - stroke ei and lability of affect in post - stroke mania or in bipolar disorder.3 manic symptoms include expansive and/or irritable mood , decreased need for sleep , increased goal - directed activity , recklessness , disregard for social constraints , talkativeness , racing thoughts , excessive laughter or giggling , and poor judgment . in a large community study that investigated the prevalence of neuropsychiatric disorders after stroke , secondary mania or bipolar disorder \n so , as a consequence of the paucity of post - stroke mania , it is difficult to determine precisely the clinical , demographic , and prognostic features.2 the prevalence of ei has been reported to be 15%34%.1,5 ei is characterized by brief , but frequent and intense episodes of uncontrollable crying and/or laughing . \n the relationship with environmental stimuli is unclear , but these symptoms can be triggered by nonspecific stimuli.1 it has been shown that post - stroke ei is related predominantly to serotonergic system dysfunction.5 the efficacy of antidepressant treatment for ei is well - established , and selective serotonin reuptake inhibitors ( ssris ) are the first - line drugs of choice.3 many post - stroke ei cases showed a rapid response to ssri treatment , as in our case . \n it is interesting to note in the present case , the improvement of hypomanic episodes with mood stabilizer , and ei with low - dose ssris . for the treatment of this condition , \n some drugs including olanzapine , lithium , carbamazepine , and acid valproic have been tried with variable or no response.5 in our case , a successful outcome was achieved with valproic acid and low - dose ssris . \n these results suggest that the course of post - stroke ei and prognosis for successful treatment after brain injury can be different in subjects with ei or with a combination of ei and bipolar disorder . \n the appearance of a pharmacologically induced hypomania in this patient could suggest a link between ei and bipolar disorder . in this case , \n mri showed right - sided stroke and the presence of multiple acute lacunar infarcts of lenticulocapsular and right semiovale regions . \n kim6 mentions that among the lesions involving mainly the globus pallidus , dorsally located lesions are more often associated with ei than ventrally located ones . \n many studies1,68 conclude that lenticulocapsular stroke of the basal ganglia / internal capsule in the right anterior region and the pons which contain abundant serotonergic fibers were closely related to ei . \n but , other studies suggest that the frontal lobe ( including the orbitofrontal cortex ) , temporal lobe , basal ganglia , thalamus , and right - sided stroke are involved in post - stroke mania.2,9,10 although the majority of the studies reporting secondary mania after stroke allocate lesions to the right hemisphere,11,12 a putative effect for laterality on its etiopathogenesis remains under discussion.9,13 a hypothesis for the development of this condition is that dysfunction of the frontolimbic circuits negatively influences mood modulation , eventually resulting in manic attacks.14,15 preexisting subcortical atrophy and a family history of bipolar disorder are also related to post - stroke mania.14,15 these observations suggest that , at least during the acute stage of post - stroke , ei is more closely related to neurochemical changes associated with damage to specific brain regions . \n the brains of patients with post - stroke pathological crying had low baseline serotonin - binding potential.16 also , metabolic hyperactivity in the basal ganglia in bipolar disorder is reported in the literature.2 many studies17,18 have examined the neural substrates underlying the manic state , and have found evidence of decreased right rostral and orbital prefrontal cortex activation . \n in addition , there is an increased activity in left dorsal anterior cingulate and the left head of caudate . \n the existence of a right - sided stroke could have favored the occurrence of hypomania in the case of our patient . \n unfortunately , we could not perform any functional imaging like single photon emission tomography , as we do not have it in our hospital . \n ei , post - stroke mania , and bipolar disorder sometimes involve structures of the emotion circuit . more caution regarding antidepressant treatment is required because of the potential risk of pharmacological hypomania , especially if there is a right - sided brain lesion \n . the clinician should carefully explore any history of bipolar disorder and/or personality disorder characterized by mood instability .", "role": "user" }, { "content": "introductionpost - stroke emotional incontinence and bipolar disorder are two disorders that involve the dysfunction of brain structures responsible for emotional regulation . \n the objective of this work is to study the links between these disorders through a clinical case.case reportwe present the case of a 43-year - old man without previous psychiatric history who experienced emotional incontinence after cerebrovascular events . \n he reacted promptly to selective serotonin reuptake inhibitor treatment . \n however , he experienced his first episode of hypomania after 6 months of antidepressant therapy . \n adjunctive therapy with valproic acid and low - dose paroxetine was eventually added , resulting in complete improvement of both emotional incontinence and hypomania after 4 additional months of treatment.conclusionthe clinician should carefully explore any history of premorbid bipolar disorder , personality disorder characterized by mood instability , and family history of bipolar disorder .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: trauma is one of the leading causes of death in india and has a dubious distinction of worst road traffic crash rate worldwide . as per who and national crime bureau records more than 1,30,000 people die every year due to road traffic crash , and hospitalization of 1.5 million people resulting in an estimated economic loss of 3% of gdp to the country . \n lack of trained emergency care providers at different tiers of heath care adds up to the existing problem of suboptimal infrastructure . emergency medicine and trauma surgery as \n focused assessment with sonography for trauma ( fast ) examination is done by radiologist in india . \n point of care ( poc ) ultrasound ( usg ) in emergency setting is naive in india . in setting up of a new emergency department ( ed ) \n protocols of a level 1 trauma center , the research group underwent poc ultrasound training and the study was conducted to determine the accuracy of fast done by nonradiologists ( nr ) and its comparative analysis with radiologists in emergency department of a level 1 trauma center of india . \n it was a prospective study done during primary survey of resuscitation of nonconsecutive patients in the resuscitation bay of emergency department ( ed ) of trauma center , all india institute of medical sciences ( aiims ) with an annual ed visit of 50,000 patients . \n the study subjects included one consultant emergency medicine ( em ) and two medicine residents , one orthopedic resident and one surgery resident posted in ed as emergency care providers . \n indo - us collaborative in emergency and trauma at aiims trauma center in february 2008 and performed 20 supervised positive and negative fast scans for free fluid before recruitment to the study . \n patient in whom performing fast would potentially delay emergency procedures ( e.g. , penetrating abdominal trauma ) were excluded . \n the fast scans were first performed by the nr and then by radiology resident ( rr ) who had already done 3 years of postgraduate training in radiology . \n sensitivity , specificity , positive and negative predictive value of fast done by nr and rr were noted . \n supine with arms abducted slightly or above the head a low frequency ( 5 - 2 mhz ) curvilinear probe was used with a focused depth and depth setting according to the patient 's body habitus and initial images obtained . \n first , the subxiphoid four - chamber view with the probe placed in subxiphoid region directed toward the ( l ) shoulder with the probe pointer toward ( r ) axial of the patient . \n the probe was angled to approximately 40 degree to the horizontal of the heart was used to examine for pericardial fluid . \n next , for focussing on morrison 's pouch and right lung base , probe was placed parallel and between the ribs where the costal margin meets the mid - axillary line on the right of the patient with probe pointer toward head end . \n the view obtained utilizes the liver as an acoustic window and demonstrates right kidney , liver , diaphragm ( highly echogenic ) and right lung base . \n probe sweeped antero - posteriorly and angulations changed until a clear view of morrison 's pouch not obtained . \n the linorenal interface and left lung base : the probe was placed on the left side at 9 - 11 rib level in posterior axillary line with the with probe pointer toward head end . \n probe sweeped antero - posteriorly and angulations changed until a clear view of left kidney , spleen , diaphragm and left lung base not obtained . \n free fluid appeared as black stripe in the lino - renal interface or between the spleen and the diaphragm . \n the pelvic ( sagittal view ) : the probe was placed in midline just above the pubis and was angled caudally at 45 degrees into the pelvis with probe pointer toward head end . \n free fluid appeared as black stripe around the bladder or behind it ( pouch of douglas ) . \n the pelvic ( transverse view ) : the view was obtained by rotating the probe through 90 degrees while maintaining contact with the abdominal wall and was angled into the pelvis with probe pointer toward patient 's right . \n free fluid appeared as black stripe around the bladder or behind it ( pouch of douglas ) . \n \n a low frequency ( 5 - 2 mhz ) curvilinear probe was used with a focused depth and depth setting according to the patient 's body habitus and initial images obtained . \n first , the subxiphoid four - chamber view with the probe placed in subxiphoid region directed toward the ( l ) shoulder with the probe pointer toward ( r ) axial of the patient . \n the probe was angled to approximately 40 degree to the horizontal of the heart was used to examine for pericardial fluid . \n next , for focussing on morrison 's pouch and right lung base , probe was placed parallel and between the ribs where the costal margin meets the mid - axillary line on the right of the patient with probe pointer toward head end . \n the view obtained utilizes the liver as an acoustic window and demonstrates right kidney , liver , diaphragm ( highly echogenic ) and right lung base . \n probe sweeped antero - posteriorly and angulations changed until a clear view of morrison 's pouch not obtained . \n the linorenal interface and left lung base : the probe was placed on the left side at 9 - 11 rib level in posterior axillary line with the with probe pointer toward head end . \n probe sweeped antero - posteriorly and angulations changed until a clear view of left kidney , spleen , diaphragm and left lung base not obtained . \n free fluid appeared as black stripe in the lino - renal interface or between the spleen and the diaphragm . \n the pelvic ( sagittal view ) : the probe was placed in midline just above the pubis and was angled caudally at 45 degrees into the pelvis with probe pointer toward head end . \n free fluid appeared as black stripe around the bladder or behind it ( pouch of douglas ) . \n the pelvic ( transverse view ) : the view was obtained by rotating the probe through 90 degrees while maintaining contact with the abdominal wall and was angled into the pelvis with probe pointer toward patient 's right . \n free fluid appeared as black stripe around the bladder or behind it ( pouch of douglas ) . \n fifty thousand patients visit ed annually ; out of which 7 - 10% were major trauma patients . \n mean age of the patients were 28 [ 1 - 70 ] yrs . seventeen out of 150 patients were in pediatric age group ( 12 yrs ) . \n one hundred and forty - six out of 150 patients had systolic blood pressure ( sbp ) of > 90 mmhg , fours patients had sbp < 90 mmhg . \n fast scans ( n = 150 ) were performed in each nr and rr group . \n observations of fast results among nr and rr were analyzed [ tables 1 and 2 ] . \n sensitivity , specificity , positive and negative predictive value of fast done by nr and rr were shown in [ table 3 ] . \n out of 24 true positive patients 18 underwent ct scan and exploratory laparotomy was done in six patients . \n observations of nonradiologists ( n = 150 ) observations of radiology residents ( n = 150 ) comparative fast observations among nr and rrs ( n = 150 ) details of organ injuries ( n = 24 patients ) \n fast is a rapid , repeatable noninvasive bedside method that was designed to answer one single question : whether free fluid is present in the peritoneal and pericardial cavity . \n it has been a valuable investigation for the initial assessment of blunt abdominal trauma as shown in large series from several north america trauma centers.[14 ] usually it is done as part of trauma resuscitation by radiologists in trauma team or emergency physicians . \n studies reported a sensitivity of 8088% and specificity of 90 - 99% among nr 's ability to detect hemoperitoneum using the fast technique.[58 ] currently ultrasound is being done by radiologist even in emergency setting in india . \n jehangir et al . from india reported sensitivity of 91% and specificity of 100% in identifying fluid by radiologist in blunt trauma abdomen . \n the present study reported a sensitivity of 100% with a specificity of 97.5% among nr and 95.8% sensitivity with 97.5% specificity among rr . \n they can be compared against trained radiologist as well as international results [ table 5 ] . \n the comparatively small number of patients with hemoperitoneum in the series may account for the high sensitivity in our study . \n the number of patients in the study , although small by international standards , is a representative sample size . \n comparison of fast for blunt trauma with international studies gaarder et al . reported sensitivity and specificity of 62% and 96% , respectively , with an overall accuracy of 88% among unstable patients ( hypotension , tachycardia and acidosis ) . \n the present study had only four patients with hypotension with fast positive reported by nr and rr . \n fast has previously been compared favorably to ct and dpl in the investigation of blunt abdominal injury . \n ct is currently accepted as the gold standard for the investigation of the trauma patient . \n dpl is a sensitive investigation for abdominal bleeding and previously the gold standard for the abdominal investigation of the unstable trauma patient . \n it has fallen from favor because of its invasive nature and the high incidence of nontherapeutic laparotomy after a positive result . \n kahdi evaluated 75 patients with penetrating injuries and reported 22 false negative scans and a sensitivity of only 46%.the limited number of patients with penetrating injuries in our study which were excluded precludes meaningful conclusions \n . limitations of a negative fast examination have been recognized and a negative fast should be repeated at an interval of six hours as was done in our patients . \n patients with a negative scan were observed clinically and none of this group developed abdominal related complications . \n boulanger had previously reported that in cardiovascular unstable patients fast will reveal intra - abdominal blood within 20 seconds . \n the horizontal organisation of the trauma team allowed fast to proceed without delay or disruption in the flow of the resuscitation . \n no attempt was made to differentiate the length of time taken for positive or negative fast in this study . \n previous qualitative study done at this center during a 4-day indo - us emergency ultrasound workshop reported that 24 ( 75% ) participants had no prior experience , five ( 16% ) had some experience , and three ( 9% ) had significant experience with emergency ultrasound . during the practical examination \n , 38 out of 42 participants ( 90% ) were able to identify morison 's pouch on the fast examination . \n the present study subjects included nrs such as consultant emergency medicine , medicine residents , orthopaedic resident and surgery resident working as emergency care givers during their posting in the ed . \n they underwent training at 3-day workshop on emergency sonography which included didactic , hands on experience . \n they performed 20 supervised positive and negative fast scans for identifying free fluid before recruitment to the study . \n this is in line with the american college of surgeons recommendations of an 8-hour trauma us course , which has been shown to be adequate for the successful performance of the technique , followed by a minimum of 10 proctored scans . \n review of all the recorded images by the most experienced investigator and regular feedback was used as an effective quality assurance program . during the beginning of the study \n the scan was done by a trained emergency medicine consultant , who was the team leader otherwise not involved in the resuscitation of the patient . \n as the study progressed it was often difficult to find a doctor available to scan because of the workload within the department . \n it also proved impossible to blind members of the trauma team to the results of the scan ; however results were blinded to the radiologist . \n trained residents of surgery and orthopaedics recruited for the study were rotational staff as they were posted to the ed for a period of two month but medicine resident was permanent . \n there is no evidence from our data to suggest that there was significant skill attrition during this time and there was a high level of agreement among nr and rr . \n fast can be performed by adequately trained emergency care providers and it should be adopted as an adjunct to the clinical assessment of abdominal trauma . \n fast performed by nrs is accurate during initial trauma resuscitation in the emergency department of a level 1 trauma center in india .", "role": "user" }, { "content": "background : focused assessment with sonography for trauma ( fast ) is an important skill during trauma resuscitation . \n use of point of care ultrasound among the trauma team working in emergency care settings is lacking in india.objective:to determine the accuracy of fast done by nonradiologists ( nr ) when compared to radiologists during primary survey of trauma victims in the emergency department of a level 1 trauma center in india.materials and methods : a prospective study was done during primary survey of resuscitation of nonconsecutive patients in the resuscitation bay . \n the study subjects included nr such as one consultant emergency medicine , two medicine residents , one orthopedic resident and one surgery resident working as trauma team . \n these subjects underwent training at 3-day workshop on emergency sonography and performed 20 supervised positive and negative scans for free fluid . \n the fast scans were first performed by nr and then by radiology residents ( rr ) . \n the performers were blinded to each other 's sonography findings . computed tomography ( ct ) and \n laparotomy findings were used as gold standard whichever was feasible . \n results were compared between both the groups . \n intraobserver variability among nr and rr were noted.results:out of 150 scans 144 scans were analyzed . \n mean age of the patients was 28 [ 1 - 70 ] years . \n out of 24 true positive patients 18 underwent ct scan and exploratory laparotomies were done in six patients . \n sensitivity of fast done by nr and rr were 100% and 95.6% and specificity was 97.5% in both groups . \n positive predictive value among nr and rr were 88.8% , 88.46% and negative predictive value were 97.5% and 99.15% . \n intraobserver performance variation ranged from 87 to 97%.conclusion : fast performed by nrs is accurate during initial trauma resuscitation in the emergency department of a level 1 trauma center in india .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: patients ' satisfaction ( ps ) is one of the important indicators of emergency care quality and outcomes of health care services ( 1 - 3 ) . \n some researchers believe that improve the work processes and hospital quality are not possible without caring to comments , requirements , expectations , and satisfaction of patients . \n thus , ps has increasingly turned to one of the significant tools in evaluation of hospital performances ( 2 ) . \n ps is not a new concept , but because of predominance of customer - focused strategy in health care services , using satisfaction index of health care clients has been entered to the evaluation scope of hospitals since two decades ago ( 4 , 5 ) . \n ps is the measure of quality in health care understood by patients and the resultant of different complicated factors ( 6 ) . \n several factors should be coordinated with each other to make an appropriate condition for creation and development of ps with observing patient 's right completely in all aspects ( 7 ) . \n getting ps is one of the principles of medical ethics and the physician should have consult with patient in making any decision . \n daily , several patients with serious condition are referred to the emergency department ( ed ) of hospitals . \n considering to the especial importance of ed , increase the satisfaction in this ward has a remarkable effect on people 's attitude toward the hospital ( ed is the symbol of the whole hospital ) . \n the satisfaction of ed clients can not be achieved without assessment , study , and practical plan to promote the quality of services ( 2 ) . \n noticing to this issue , this study was performed to find effective factors on patient satisfaction and enhance them toward improve the quality of ed services . \n study design and setting \n in this cross - sectional study , cases were chosen by a regular random selection among referees to the ed of poursina hospital , rasht , iran , in 2012 . totally , 378 patients were enrolled and selected in this study . \n inclusion criteria were having age over 15 years and hospitalization in the emergency center for more than five hours . \n exclusion criteria were significant impairment of cognition ( attention , recent memory , understanding questions , etc . ) , having a very bad ill appearance so that the patient could not answer the questions , and patients died . \n selected patients after ending their hospitalization at the ed were interviewed by project partners trained to have dealing with patients and design the questionnaire in a way to prevent patient 's bias in answering . \n patients were asked in a calm condition ( without presenting of health care and non - health care stuffs ) . \n the patients who had enough literacy to fill the questionnaire filled it by themselves if not ; it was read by the questioner for them to answer . during reading the questions \n , there was no shift or bias in expressing by the questioner . for evaluating of ps , the omidvari et al . \n two questions ( about elevators ' status and using bathroom in ed ) in the welfare facility section were removed because they were not applicable in the studied department . \n final questionnaire had 37 questions in five sections including physicians care ( 8 questions ) , nurse care ( 8 questions ) , behavioral aspects ( 4 questions ) , physical comfort and residential aspects ( 11 questions ) , and waiting time to receive emergency services ( 6 questions ) . \n cronbach 's coefficient alpha for whole questionnaire ( 37 questions ) was 0.91 and for each section as follow : 0.89 in physicians care , 0.90 nurse care , 0.70 behavioral aspects , 0.93 physical comfort and residential aspects , and 0.70 waiting time . \n there was five options for answering to each question based on likert scale , which scores of five to one given to answers very much , very , average , low , and very low , respectively . in evaluating of each question , \n low and very low answers were considered as dissatisfaction . in some questions , regarding the feedback of responders , the sixth option was added which means that the question was not applicable . \n therefore , the scores of 11 - 55 were determined for physical comfort and residential aspects , 8 - 40 for physicians and nurse care , 4 - 20 for behavioral aspects , 6 - 30 for the waiting time to receive emergency services , and 37 - 185 for total satisfaction . \n the poor , average , and good scores were defined for each section as below : for physical comfort and residential aspects respectively 11 - 25 , 26 - 40 , and 41 - 55 , physicians and nurse care 8 - 18 , 19 - 29 , and 30 - 40 , behavior aspects 4 - 9 , 10 - 14 , and 15 - 20 , the waiting time to receive emergency services 6 - 13 , 14 - 22 , and 23 - 30 , and total satisfaction 37 - 85 , 86 - 135 , and 136 - 185 . \n background information such as age , sex , marital status , education level , history of hospitalization in the studied ed , the work shift patients referred , the length of staying in ed , the general comment of patient regarding ed , and total satisfaction level of the patient were separately collected in specific designed data sheets . \n statistical analysis \n description of qualitative variables was performed by frequency tables and quantitative variables by calculation of mean standard deviation . \n after computation of scores , each of five section and total of satisfaction scores ( comprehensive satisfaction ) were assessed , then the distribution of achieved scores was analyzed using kolmogorov- smirnov test ( k- s test ) . \n entirely , 378 patients were entered to the study with mean age of 38.4417.8 ( 60.8% male ) . \n one hundred sixty three ( 43.1% ) cases were hospitalized in the morning shift , 136 ( 36% ) ones in night , and the rest in evening . regarding ed length of stay , 90 ( 23.8% ) patients \n table 2 shows the mean satisfaction scores of five sections as well as total satisfaction score . \n the mean score of total satisfaction of ed patients was 106.9413.62 ( range : 72 - 144 ) . \n the mean score of physical comfort was 33.254.76 out of the highest obtainable score of 55 , nurse care 25.335.13 out of 40 , physician care 24.343.38 out of 40 , waiting time for services 13.425.48 out of 30 , and behavioral aspects 10.58 2.66 out of 20 . \n distribution of mean satisfaction scores in each five sections was categorized based on pre - defined scores ( the poor , average , good ) in table 3 and figure 1 . \n the analysis showed a significant correlation between total ed satisfaction with sex ( p=0.0001 ) and admission shift ( p=0.023 ) . \n such a relation was not seen between total ed satisfaction and age ( p=0.33 ) , marital status ( p=0.12 ) , educational level ( p=0.68 ) , the previous history of ed ( p=0.26 ) , ed length of stay ( p=0.07 ) . the total ed satisfaction score was 2.9 out of 5 compare to whole hospital satisfaction 2.78 out of 5 ( p<0.05 ) . \n distribution of emergency department ( ed ) satisfaction level in comparison to whole hospital condition mean satisfaction scores in each five sections were categorized based on pre - defined scores mean satisfaction scores in each five sections were categorized based on pre - defined scores \n the findings showed the total satisfaction score of studied ed as an average level , based on pre - defined level . among five studied sections , waiting for service time and behavioral aspects gained the maximum dissatisfaction with 53.2% and 44.2% poor level , respectively . here \n , total score of each five assessed sections related to physical comfort and residential aspects , physicians care , nurse care , behavioral aspects , and waiting time for service are on average level ; but the noticeable point was about nurse care aspect that with 18.3% of good score had the best level among five sections . \n in addition , behavioral aspect and waiting time for services had the average scores among five sections with 44.2% and 53.2% , respectively . \n a significant relationship was seen between total satisfaction and admission shift so that the morning shift , as the most crowded work shift , had the highest level of ps . \n the study of pines et al . about the effect of ed crowding on ps revealed an indirect effect of crowding on satisfaction ( 9 ) . \n also weiss et al . showed significant relationship between the ed overcrowding and the number of patients who leave ed without being seen as one of the probable indicators of ps ( 10 ) . \n interesting findings of the present study could be arisen from the high number of ed stuffs in the morning shift , subsequently the better speed and quality of services than other times . \n it seems that the number of stuffs , quality and duration of services , and considering the needs of patients should be more noted to prevent such problems . in this project , there was near significant correlation ( p=0.07 ) between the length of ed stay and ps . \n the study of rodi and colleagues declared that all domains of ps were significantly correlated with the length of stay ( 11 ) . \n christopher et al . concluded that reducing the length of ed stay is direct relation with decrease in the number of patients who leave without seeing a physician ( 12 ) . \n regarding behavioral aspect , holding workshops about how deal with patients and justify physicians , students of ed , nurses , and stuffs could greatly help improving ps regarding behavioral aspect . \n some researchers believe that the viewpoint of patients into waiting time has a more critical role in satisfaction level than the real waiting time ( 11 , 13 ) . in other words \n , it is probable that waiting time has been justified for patients with explaining about the reason of expectation and necessary woks done in the estimated time . moreover , because of the enormous workload of physicians in ed of poursina hospital , it is not possible to explain the disease , incidence , and treatment processes performed by physician in all details for each patient ; thus , by increasing the number of physicians in these centers , the assignments of these persons can be decreased and the satisfaction level of patients improved , too . \n efforts should be focused in decrease the waiting time for services and improve the behavioral aspects of stuffs . \n to reach this goal , using the results of periodic assessment of ps level , as a critical indicator in health care quality and applying it in quality management is necessary to create changes based on achieved results . because perform changes in services presentation needs the intervention in terms of the project . \n the findings of percent study showed that giving services to emergency clients in various fields such as physical comfort and residential aspects , physicians care , nurse care , and the total ed satisfaction is relatively agreeable . \n the periodic and continuous assessment as well as comparison of satisfaction and dissatisfaction parameters during the time , before and after performing the changes , could be effectual . \n \n \n all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors .", "role": "user" }, { "content": "introduction : patients ' satisfaction ( ps ) is one of the important indicators of emergency care quality and outcomes of health care services . some researchers believe that improve the work processes and hospital quality are not possible without caring to comments , requirements , expectations , and satisfaction of patients . \n the percent study was aimed to assess the emergency department ( ed ) ps of poursina hospital , rasht , iran . \n methods : in this descriptive cross sectional study , the samples was selected from 378 patients admitted to ed of poursina hospital , rasht , iran , 2013 . for each patient a check list and a questionnaire , including 37 questions about ps , were filled that had categories like physical comfort and residential aspects , physicians care , nurse care , behavioral aspect , and waiting time for service presentation . \n data were analyzed by spss version 16 . \n results : entirely , 378 patients were entered to the study with mean age of 38.4417.8 ( 60.8% male ) . \n the mean score of total satisfaction of ed patients was 106.9413.62 ( range : 72 - 144 ) . \n the mean score of physical comfort was 33.254.76 out of the highest obtainable score of 55 , nurse care 25.335.13 out of 40 , physician care 24.343.38 out of 40 , waiting time for services 13.425.48 out of 30 , and behavioral aspects 10.582.66 out of 20 . \n there were significant relation among ps , sex ( p=0.0001 ) , and the shift of admission ( p=0.023 ) . \n conclusion : the findings of percent study showed that giving services to emergency clients in various fields such as physical comfort and residential aspects , physicians care , nurse care , and the total ed satisfaction is relatively agreeable . the periodic and continuous assessment as well as comparison of satisfaction and dissatisfaction parameters during the time , before and after performing the changes , could be effectual .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: since the discovery of insulin as a metabolically essential pancreatic hormone by banting and best in 1921 , this protein has been the subject of intensive research . \n the overwhelming amount of information on insulin structure and function , its receptor , and the consequences of its dysfunction in diabetes mellitus , has overshadowed the importance of proinsulin , the primary product of the insulin gene , and the protein precursor of insulin . \n the new roles of proinsulin in development described by ours and other groups ( reviewed in hernndez - snchez et al . , 2006 ) have led to the inclusion of proinsulin as a member , in its own right , of the insulin superfamily of signaling factors , which in humans also includes the insulin - like growth factors ( igfs)-1 and -2 and -7 members of the relaxin - like peptides subfamily ( wilkinson and bathgate , 2007 ) . \n this diversity indicates that the evolutionary history of insulin began well before the appearance of the endocrine pancreas . \n proinsulin / insulin , igfs , and related factors comprise an essential group of proteins in all metazoans , with a broad functional spectrum , including roles in carbohydrate and lipid metabolism , cell and organism growth , cell survival , life span , and reproduction ( nakae et al . , 2001 ; taguchi and white , 2008 ) . \n the insulin receptor ( ir ) is an evolutionarily conserved member of the tyrosine kinase class of cell membrane receptors . \n a closely related igf type 1 receptor ( igfr ) and an orphan insulin receptor - related receptor ( irr ) have been described in mammals ( hernndez - snchez et al . , 2008 ) , as well as an unrelated igf type 2/mannose-6-phosphate receptor which binds only igf-2 . \n intriguingly , despite the antiquity of this metazoan signaling system , a greater number of peptide ligands has been described in invertebrates , in which a single insulin / igf receptor has been found ( up to and including amphioxus ) , than in vertebrates . \n though its functional significance remains to be clarified , an extremely well conserved gene synteny is observed in both vertebrates and invertebrates , termed the tyrosine hydroxylase ( th)insulin cluster . the ancestral insulin gene ( ins2 ) \n is located between th , or a related invertebrate gene , and an adjacent gene member of the insulin family : igf2 in vertebrates , and multiple insulin - like peptides in invertebrates such as drosophila melanogaster and caenorhabditis elegans ( figure 1 ) . the th / ins gene cluster in vertebrates and invertebrates . \n schematic representation of the three genes found in conserved synteny from birds to humans ; tyrosine hydroxylase ( th ) , insulin ( ins ) , and insulin - like growth factor 2 ( igf2 ) . \n several insulin - like peptides are found in the genomes of both flies ( d. melanogaster ) and worms ( c. elegans ) , some of which are located in the same region as monooxygenases . \n chromosome numbers are indicated and intergenic dna distances are depicted in kilobases ( kb ) . ( a ) \n some of the multiple insulin - related gene products found in lower vertebrates and invertebrates are thought to be related to the ancestral molecule of the vertebrate insulin igfs . \n since full characterization of these proteins has not been reported for most species , a few may in fact be structurally more similar to the vertebrate proinsulin than to the mature pancreatic insulin . in this review \n , insulin gene will be used to refer to the genomic locus and sequence , as this is the term used in gene banks . when discussing rna data , we will use the term proinsulin mrna , and for protein data we will specify whether we refer to mature insulin or another evolutionary ( insulin - like ) or developmental ( proinsulin ) precursor . \n the d. melanogaster genome contains seven insulin - like genes ( dilp17 ) that are expressed in a stage- , tissue- , or cell - specific manner ( brogiolo et al . , 2001 ) . \n of these , dilp2 is the most closely related to human insulin ( 35% sequence identity ) , while dilp6 and dilp7 represent the most distant relatives . \n four of these genes , dilp 1 , 2 , 3 , and 5 , are coexpressed in small clusters of cells in larval brain neurons ( rulifson et al . , 2002 ) . \n as ablation of these cells causes developmental delays , growth retardation , and elevated carbohydrate levels in larval hemolymph , a functional analogy to vertebrate pancreatic cells has been proposed ( rulifson et al . , 2002 ) . \n dilp6 is expressed in the larval body fat and controlled by the steroid hormone ecdysone during metamorphosis upon termination of feeding to relay the growth signal , and thus is functionally more similar to vertebrate igfs ( slaidina et al . , 2009 ) . \n dilp 15 bind to the d. melanogaster single insulin / igf receptor ( 33% sequence identity with the vertebrate homologs , fernndez et al . , 1995 ) . \n recently , the crystal structure of two dilp5 variants that differ by three amino acids at the n - terminal end of the a - chain was described ( sajid et al . , 2011 ) . \n both variants share the basic fold of the insulin peptide family but exhibit an unusual dimeric structure . \n insulin producing cells in the drosophila brain express one of the four known serotonin receptor signaling types ( 5-ht1a ) and the metabotropic receptor gabab . \n the ionotropic gabaa receptor subunit rdl is not expressed by these cells . increases in dilp expression resulting from interference with gabab or 5-ht1a receptor signaling shortens life span , decreases stress resistance and alters carbohydrate , and lipid metabolism in response to stress ( nssel and winther , 2010 ) . \n the most important role attributed to the insulin / ir pathway in c. elegans relates to longevity . \n remarkably , the only insulin / igf receptor ortholog expressed by this short - lived worm , daf-2 , was implicated in the function and evolutionary conservation of the first life - span pathway to be discovered ( for review see kenyon , 2010 , 2011 ) . \n however , much less is known about the function of specific peptides of this family . \n the c. elegans genome encodes 40 putative insulin - like peptides , many of which are expressed at low levels in whole worms . \n recently , the powerful ncounter platform was used to quantify insulin - like mrna expression for all of these peptides , revealing a variety of distinct developmental patterns of expression and suggesting a considerable complexity of regulation and specificity of function ( baugh et al . , 2011 ) . \n many of the 40 c. elegans insulin - like peptides are found in overlapping subsets of sensory neurons and/or interneurons , including the sensory neurons that regulate dauer ( a diapause stage induced in harsh environmental conditions ) entry or exit . \n specifically , ins-1 mediates dauer arrest under harsh environments , while daf-28 and ins-6 ensure reproductive growth under favorable conditions . \n daf-28 and ins-6 also play key roles in inhibiting dauer entry and promoting dauer exit , respectively ( cornils et al . , \n these findings indicate that insulin - like peptides have been involved in the physiology of the nervous system since early in evolution , a role that is highly conserved in higher vertebrates . \n ( 1990 ) , and was initially considered a low metabolic activity protein precursor of insulin . based on our studies of insulin expression early in development , particularly in the embryonic chick \n nervous system , we discovered proinsulin to be the final protein form secreted by extrapancreatic tissues ( de pablo et al . \n 1995 , 2002 ) . while the pancreatic regulation of proinsulin mrna expression was initially considered highly tissue - specific ( steiner et al . , 1990 ) , our discovery of a series of proinsulin transcripts in the chick embryo during prepancreatic development challenged the view of the pancreas as an exclusive source of proinsulin ( figure 2 ) . the ancestral insulin gene ( only one gene is found in most of the vertebrate genomes including chick , whereas mouse , rat , and xenopus express two non - allelic genes ) contains three exons . the open reading frame spans most of exon 2 and all of exon 3 , coding for the b , c , and a domains of proinsulin ( figure 2 ) . \n it is plausible that the control of cell survival in embryos requires the subtle regulation of proinsulin expression in a different manner to that characteristic of the cells of the vertebrate pancreas . \n we characterized a specific embryonic form of proinsulin mrna ( pro1b ) with a 32 nucleotide extension in the 5 utr which shared its coding region with the pancreatic transcript ( pro1a ) . \n however , the embryonic transcript exhibits much lower translational activity due to the presence of two extra augs in the 32-nucleotide 5-extension ( figure 3 ; hernndez - snchez et al . , 2003 ) . \n we subsequently identified an additional embryonic proinsulin mrna generated by the retention of the first intron in the 5 utr . this large , structured 5 utr almost blocks proinsulin translation , whereas mrna transport and cytoplasmic stability are unaffected ( mansilla et al . , 2005 ) . \n the relative proportion of these transcripts varied in developing organs ( see later and figure 3 ) , indicating a significant level of post - transcriptional control of the insulin gene during vertebrate development . \n ( a ) the canonical th and the pancreatic proinsulin mrnas ( pro1a ) are shown in the top panel . \n below are alternative transcripts found in embryos , either chimeric mrnas ( th - ins1 , th - ins2 ) or proinsulin mrnas with an extended 5 utr ( pro1b and pro1b1 ) . \n the translation initiation codon ( aug ) and additional augs are indicated ( modified from hernndez - snchez et al . , 2006 ) . \n ( b ) schematic representation of the amino acid composition of proinsulin and insulin after c - peptide cleavage . \n the ribbon rendered backbone highlights the conformational variability of the nmr - resolved human - proinsulin , based on yang et al . \n the b - chain ( green ) , a - chain ( cyan ) , and the c - peptide ( red ) are depicted before proinsulin processing . \n the model ( courtesy of mario garca - de lacoba , cib , csic ) demonstrates the great conformational flexibility of the c - peptide . \n ( a ) stage 10 chick embryo ( approximately 36 h of development ) with the dotted line indicating the embryonic heart ( h ) ; the presomitic region ( ps ) , and optic vesicle ( ov ) are depicted . \n ( b ) proinsulin reverse transcription - pcr followed by southern blot of rna from different regions of stage 10 embryos . \n the latter form predominates in the ov ( largely neuroepithelium at this stage ) and is relatively less abundant in other embryonic regions . \n ( c ) proinsulin expression in nih3t3 cells transfected with the indicated construct . modified from mansilla et al . \n detailed screening of embryonic proinsulin transcripts led us to another unexpected finding : both chick and quail embryos express chimeric mrnas containing exons from both th and insulin genes , transcribed in a regulated manner ( figure 2 ; hernndez - snchez et al . , 2006 ) . \n the th - ins1 and th - ins2 chimeras differ in their insulin gene content , and encode two novel isoforms of the th protein with markedly reduced functionality , as compared with canonical th . \n in addition , th - ins1 chimeric mrna generates a small amount of proinsulin / insulin . \n at least th - ins1 is found in the neurulating embryo and in the substantia nigra of the embryonic day ( e ) 18 chick embryo , though its function remains unknown . \n igf2 chimeric mrnas have also been described in the human fetal eye and pancreas , which do not produce proinsulin ( monk et al . , 2006 ) . \n the basic fold shared by known members of the insulin superfamily consists of a b domain containing a single -helix that lies across the two -helices of the a domain ( murray - rust et al . , 1992 ) . \n two canonical disulfide bridges connect the a- and b - chains , while the a - chain contains an intrachain disulfide bridge . \n the c - peptide is cleaved out in mature pancreatic insulin ( figure 2b ) . \n as proinsulin is refractory to crystallization , heteronuclear nmr spectroscopy has been employed to characterize a monomeric analog . \n it has been proposed that flexibility at each c - domain junction facilitates prohormone processing by convertases ( figure 2c ; yang et al . , 2010 ) . \n we demonstrated that proinsulin remains unprocessed in the neurulating chick embryo and the neuroretina due to the lack of expression of at least one of the proinsulin convertases , pc2 ( alarcn et al . \n in cultured neuroretina , rapid secretion of proinsulin into the medium occurred within a few hours , even in the absence of secretagogues ( hernndez - snchez et al . \n prepancreatic and extrapancreatic proinsulin mrna expression is much lower than that observed in the mature vertebrate pancreas ( serrano et al . , 1989 ; prez - villamil et al . , \n 1994 ) , but can be clearly detected in the chick embryo during gastrulation and neurulation ( morales et al . , 1997 ) and in the embryonic retinal neuroepithelium at e3 ( daz et al . , 1999 ) . \n proinsulin protein , as detected with anti - c peptide antibody , is present in discrete cells located in the three embryonic layers of the chick embryo , though mainly in the neuroepithelium , prior to igf-1 expression ( hernndez - snchez et al . , 2002 ) . \n in contrast with the pancreatic transcripts , embryonic proinsulin mrna levels are not regulated by glucose ( prez - villamil et al . , 1994 ) , suggesting that alternative mechanisms of regulation are operative in early embryos . as described above \n , an alternative transcription start site exists in neurulating chick embryos ( generating transcript pro1b ) , and retention of intron 1 occurs in another embryonic form of proinsulin embryonic mrna ( pro1b1 ) . \n these features impact on the respective translational levels ( figure 3c ; hernndez - snchez et al . \n an example of the modulation of the proinsulin splicing pattern in chick embryos undergoing neurulation and early organogenesis is shown in figure 3b . \n proinsulin intron 1 was efficiently spliced out in the optic vesicle , but retained in the heart tube and presomitic region . \n the developing eye , therefore , displays a translationally more active form of proinsulin mrna than other embryo regions , at a time when the ir is expressed and active ( girbau et al . , 1989 ) . \n the study of a possible physiological function of proinsulin in vertebrates has been hindered by both the essential metabolic role of its processed product , the insulin hormone , and the classification of igf-1 and igf-2 as the genuine growth factors of the family . \n however , the phylogenic and ontogenic expression data presented above support a role for proinsulin as a growth factor in its own right . \n the roles of igf-1 in nervous system have been extensively characterized and include , among others , neuroprotection during development and in the adult brain ( dercole and ye , 2008 ; torres - aleman , 2010 ) . moreover , \n the physiological actions of insulin in the nervous system , previously considered an insulin - insensitive tissue , are increasingly recognized , particularly at the level of synapse development and plasticity ( abbott et al . , 1999 ; chiu and cline , 2010 ) . \n however , recent studies have revealed that insulin and igf-1 are not the only members of this family of physiological factors active in early developmental stages . \n the classical composition of this tyrosine kinase receptor consists of a homodimeric 22 entity resulting from the post - translational cleavage of a single protein product into two subunits , and . both subunits are then covalently re - bound by a disulfide bond to form a monomer , and two monomers in turn covalently bound by two disulfide bonds between the subunits form a homodimeric receptor . \n an extensive review of the receptor gene and protein structure has been recently published ( belfiore et al . , 2009 ) . \n classical irs display a reduced affinity for proinsulin , about one order of magnitude lower than that of insulin . \n similarly , classical igfrs can not bind physiological concentrations of proinsulin ( de pablo et al . , 1990 ) . \n however , in the embryonic chick neuroretina at early proliferative stages , proinsulin - mediated signaling appears to occur through an atypical , promiscuous receptor , which is also activated by insulin and igf-1 ( garca - de lacoba et al . , 1999 ) . \n it should be noted that , at the ligand level , proinsulin appears to be the main factor present at this developmental stage . without distinguishing between proinsulin and insulin , insulin - like immunoreactivity in the vitreous humor filling \n the chick embryonic eye is 100 times higher than igf-1-like immunoreactivity ( hernndez - snchez et al . , 1995 ) . \n moreover , when immunoblot analysis was performed , the only identified product present in the neurulating chick embryo and embryonic retina was proinsulin ( alarcn et al . \n it is possible that proinsulin binds to a hybrid receptor in the embryonic chick retina , composed of an monomer of the ir and a monomer of the igfr . \n while such receptors are found in the early embryonic retina , when proinsulin is active , their presence decreases as the retina matures . in parallel , homodimeric irs become more abundant , and proinsulin less active , with retinal maturation ( garca - de lacoba et al . , 1999 ) . \n the situation is even more complex in mammals , where the ir contains an additional , 11th exon ( called ir - b ) , which is spliced out in fetal , and non - metabolic tissues . \n ir lacking exon 11 ( ir - a form ) also display a promiscuous binding capacity , particularly for igf-2 ( belfiore et al . \n , 2009 ; chiu and cline , 2010 ) , though its affinity for proinsulin remains to be determined . \n furthermore , the presence of three hybrid receptors , ir - a / ir - b , ir - a / igfr , and ir - b / igfr is suspected in different tissues , particularly in the nervous system and in transformed cells , suggesting a complex interplay between possible ligands and cellular effects ( belfiore et al . , 2009 ) . \n proinsulin promotes cell proliferation , differentiation , and survival in the embryonic chick and mouse nervous system ( hernndez - snchez et al . , 1995 ; \n its primary role , however , appears to be the regulation of cell survival during early neural development under normal conditions , resulting in increased numbers of proliferating neuroepithelial cells or neurons . \n conversely , blocking antibodies targeting the ir induce apoptosis in the early chick retina , decreasing neuronal numbers ( figure 4 ; daz et al . \n a similar apoptotic effect is observed when antisense oligonucleotides targeting the ir are used to interfere with proinsulin signaling ( hernndez - snchez et al . , 2002 ) . \n treatment with exogenous proinsulin in ovo results in a decrease in naturally occurring apoptosis and leads to developmental abnormalities in the neural tube and optic vesicles , indicating that controlled regulation of proinsulin expression and function is crucial for proper neural development ( hernndez - snchez et al . , \n interference with the insulin receptor increases cell death and decreases the number of retinal ganglion cell neurons in the embryonic chick retina . \n e2 chick embryos were treated in vivo with control or anti - insulin receptor antibodies . \n tunel - positive cells [ in green ( a , b ) ] were visualized in e4 flat - mount retinas . \n retinal ganglion cells were visualized by islet 1/2 immunostaining [ in green ( c , d ) ] in e6 retinal sections . reproduced from daz et al . \n as stated earlier , growing evidence has described several insulin actions in tissues previously considered insulin - insensitive ( ogg et al . , 2005 ) . given the lack of studies of proinsulin expression and binding capacity , together with promiscuity of the receptors involved , it is plausible that some of the actions described for insulin and igf-1 may be in fact mediated by either physiological or reactive to disease proinsulin activity . \n one such example is the effect of proinsulin in attenuating pathological cell death in the retina in a murine model of retinal dystrophy . \n one - month - old rd 10 mice are almost blind due to a degenerative process that involves apoptosis of the photoreceptor cells in the retina ( barhoum et al . , 2008 ) . \n transgenic expression of human proinsulin delays vision loss , a phenomenon that correlates with decreased cell death and the preservation of the photoreceptor layer with more rods and cones , and better synaptic connections ( figure 5 ; corrochano et al . , \n clearly , proinsulin can activate cellular processes in the dystrophic retina , though the receptors involved remain to be identified . \n photoreceptor cell death is delayed and the photoreceptor layer is preserved in rd10 mice expressing proinsulin . \n cell death was visualized by tunel in p25 flat - mount retinas of rd10 and hpi / rd10 transgenic mice [ in green ( a , b ) ] . \n retinal cytoarchitecture was visualized with alexa 488-peanut agglutinin [ green - labeled cones ( c , d ) ] and dapi staining [ blue ( c , d ) ; arrow indicates photoreceptor rows ] in p32 retinal sections . reproduced from corrochano et al . \n ( 2008 ) with permission ; 2008 , the association for research in vision and ophthalmology . \n scale bars = 200 m in ( a , b ) and 25 m in ( c , d ) . \n physiological and pathological aging , as well as life span , are other processes potentially modulated by the activity of proinsulin ( see for a review taguchi and white , 2008 ) . \n although initially related to igf-1 signaling , several observations have implicated insulin sensitivity in longevity , while insulin resistance appears to be a feature of neurodegenerative disorders , including alzheimer s disease , parkinson s disease , and lewy body dementia ( schubert et al . , 2004 ; messier and teutenberg , 2005 ; steen et al . , 2005 ; zhao et al . , 2008 ; tong et al . , \n furthermore , synapse formation and maintenance mediated by ir signaling , particularly via the pi3k pathway , may contribute to brain function in both normal and physiological conditions in invertebrates and vertebrates ( martn - pea et al . \n , 2006 ; arendt et al . , 2010 ; chiu and cline , 2010 ) . \n while the nature of the proinsulin receptor involved and the levels of local proinsulin synthesis remain undetermined , it should be noted that pi3k inhibition abolishes the pro - survival effects of proinsulin in the developing retina ( valenciano et al . , 2006 ) . \n the role of proinsulin , beyond its prohormone function , as a genuine cell survival or tissue growth factor has remained overlooked for half a century . \n the observations reviewed here encourage future studies to characterize proinsulin expression at the protein level in the developing and adult nervous systems , not only under physiological conditions but also during aging and pathological processes . particularly , the receptor entities able to bind proinsulin in mammals need to be identified , as a requisite to fully elucidate the physiological relevance of proinsulin , as well as its potential pharmacological use in insulin - resistance conditions or diseases with abnormally increased cell death . \n the dramatic impact of diabetes and neurodegenerative disorders on our society further highlights the need for new therapeutic strategies that may relay on various factors of the insulin family , to treat these conditions . \n indeed , preclinical studies in animal models of retinitis pigmentosa with proinsulin treatment , commented here , are the initial step toward future therapeutical developments .", "role": "user" }, { "content": "in the last decade , non - canonical functions have been described for several molecules with hormone - like activities in different stages of vertebrate development . since its purification in the 1960s \n , proinsulin has been one of the best described hormonal precursors , though it has been overwhelmingly studied in the context of insulin , the mature protein secreted by the pancreas . \n beginning with our discovery of the presence and precise regulation of proinsulin mrna in early neurulation and neurogenesis , we uncovered a role for proinsulin in cell survival in the developing nervous system . \n we subsequently demonstrated the ability of proinsulin to prevent pathological cell death and delay photoreceptor degeneration in a mouse model of retinitis pigmentosa . in this review , \n we focus on the evolution of proinsulin / insulin , beginning with insulin - like peptides expressed in mainly the neurosecretory cells of some invertebrates . \n we summarize findings related to the regulation of proinsulin expression during development and discuss the possible effects of proinsulin in neural cells or tissue , and its potential as a neuroprotective molecule .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: case 1 an 88-year - old woman presented with a history of frequent urinary tract infections along with relatively stable leukopenia and mild anemia that had been present for over 10 years . during the previous 6 years , the platelet count had become borderline low . at the time of this evaluation in june 2007 , the white blood count ( wbc ) was 2,500/l with 95% lymphocytes and 5% monocytes , hemoglobin 10.7 g / dl , mean corpuscular volume ( mcv ) 90.8 fl , and platelets 161,000/l . on physical exam \n the patient was treated with methotrexate ( 10 mg orally every week ) and the absolute neutrophil count ( anc ) had risen to 1,300/l 7 months later . \n she did have a klebsiella pneumoniae urinary tract infection in april 2008 when the anc was 1,000/l . \n case 2 a 69-year - old man with a 30-year history of rheumatoid arthritis was first noted to have neutropenia 2 years before this evaluation . \n the patient had no recurrent sinopulmonary infections , but for the previous 6 months he had a persistent staphylococcal infection of his left foot . at presentation in april 2007 , \n the wbc was 2,000/l with 3% bands , 12% segmented neutrophils , 1% eosinophils , 68% lymphocytes , and 16% monocytes . \n hemoglobin was 16.4 g / dl , mcv 87.1 fl , and platelets 204,000/l . \n there was no palpable organomegaly or lymphadenopathy , but ultrasound showed mild to moderate hepatosplenomegaly . \n the patient was treated with cyclophosphamide ( 50 mg orally every day , decreased to 25 mg after 2 months ) and the anc had risen to 2,300/l 3 months later . \n subsequent ancs for the next 6 months were highly variable ranging between 160 and 900/l . \n the biopsy had 50% cellularity with occasional small lymphoid aggregates and a subtle interstitial increase in small lymphocytes . \n immunohistochemical staining showed a significant increase in small cd3 + , cd8 + t cells mainly in an interstitial pattern . \n in the few small lymphoid aggregates , cd3 and cd20 each marked about half the lymphocytes with cd4 + cells exceeding cd8 + cells by roughly three to one . \n flow cytometry performed on the bone marrow aspirate showed 64% lymphocytes with over 90% t cells expressing cd2 , cd3 , cd5 , and cd7 without aberrancy . \n nearly half the t cells were cd4 , cd8 and the majority expressed tcr along with cd57 ( fig . \n tcr gene rearrangement studies by polymerase chain reaction ( pcr ) were performed on a subsequent peripheral blood sample and showed clonal and patterns . \n b sixty - nine percent of cd3 + t cells expressed t cell receptor /. c thirty - one percent of cd3 + t cells expressed t cell receptor /. forty - seven percent of cd3 + t cells lacked both cd4 and cd8 ( not shown ) case 1flow cytometry performed on bone marrow aspirate . a sixty - one percent of cd3 + t cells coexpressed cd57 . \n b sixty - nine percent of cd3 + t cells expressed t cell receptor /. c thirty - one percent of cd3 + t cells expressed t cell receptor /. forty - seven percent of cd3 + t cells lacked both cd4 and cd8 ( not shown ) case 2 increased large granular lymphocytes were noted on the peripheral smear . \n the bone marrow aspirate showed 40% erythroid precursors with a low g / e ratio of 1.0:1.2 along with 20.0% lymphs and 3.4% mature plasma cells . \n the interstitial population was highlighted with cd3 . the large majority of these expressed cd8 and not cd4 ( fig . 2 ) . \n rare scattered b cells marked with cd20 . in the lymphoid aggregates , the majority of cells were cd3 + , but cd4 + cells exceeded cd8 + cells by roughly five to one with only occasional cd20 + b cells . \n flow cytometry on the aspirate showed about 40% of marrow nucleated cells in the lymphocyte region with about 95% t cells . \n cd16 and cd56 were negative while roughly a fourth of the t cells had loss of cd5 . \n a similar proportion of the lymphocytes ( presumably the same population ) expressed tcr . pcr studies showed clonal rearrangements of both tcr and ( fig . \n b predominantly cd4 + t cells in a lymphoid aggregate with relatively few interstitiallyfig . \n patient bone marrow sample in lane 3 ( from left ) shows a discrete clonal band . \n lanes 1 , 4 , and 5 have polyclonal patterns . lane 6 is a positive control . \n pcr primers described by mccarthy et al . [ 18 , 19 ] case 2immunohistochemistry performed on the bone marrow biopsy ( 10 ) . \n b predominantly cd4 + t cells in a lymphoid aggregate with relatively few interstitially case 2t cell receptor gamma pcr 6% polyacrylamide gel . \n patient bone marrow sample in lane 3 ( from left ) shows a discrete clonal band . \n lanes 1 , 4 , and 5 have polyclonal patterns . lane 6 is a positive control . \n case 1 an 88-year - old woman presented with a history of frequent urinary tract infections along with relatively stable leukopenia and mild anemia that had been present for over 10 years . during the previous 6 years , the platelet count had become borderline low . at the time of this evaluation in june 2007 , the white blood count ( wbc ) was 2,500/l with 95% lymphocytes and 5% monocytes , hemoglobin 10.7 g / dl , mean corpuscular volume ( mcv ) 90.8 fl , and platelets 161,000/l . on physical exam \n the patient was treated with methotrexate ( 10 mg orally every week ) and the absolute neutrophil count ( anc ) had risen to 1,300/l 7 months later . \n she did have a klebsiella pneumoniae urinary tract infection in april 2008 when the anc was 1,000/l . \n case 2 a 69-year - old man with a 30-year history of rheumatoid arthritis was first noted to have neutropenia 2 years before this evaluation . \n the patient had no recurrent sinopulmonary infections , but for the previous 6 months he had a persistent staphylococcal infection of his left foot . at presentation in april 2007 , \n the wbc was 2,000/l with 3% bands , 12% segmented neutrophils , 1% eosinophils , 68% lymphocytes , and 16% monocytes . \n hemoglobin was 16.4 g / dl , mcv 87.1 fl , and platelets 204,000/l . \n there was no palpable organomegaly or lymphadenopathy , but ultrasound showed mild to moderate hepatosplenomegaly . \n the patient was treated with cyclophosphamide ( 50 mg orally every day , decreased to 25 mg after 2 months ) and the anc had risen to 2,300/l 3 months later . \n subsequent ancs for the next 6 months were highly variable ranging between 160 and 900/l . \n the biopsy had 50% cellularity with occasional small lymphoid aggregates and a subtle interstitial increase in small lymphocytes . \n immunohistochemical staining showed a significant increase in small cd3 + , cd8 + t cells mainly in an interstitial pattern . \n in the few small lymphoid aggregates , cd3 and cd20 each marked about half the lymphocytes with cd4 + cells exceeding cd8 + cells by roughly three to one . \n flow cytometry performed on the bone marrow aspirate showed 64% lymphocytes with over 90% t cells expressing cd2 , cd3 , cd5 , and cd7 without aberrancy . \n nearly half the t cells were cd4 , cd8 and the majority expressed tcr along with cd57 ( fig . \n tcr gene rearrangement studies by polymerase chain reaction ( pcr ) were performed on a subsequent peripheral blood sample and showed clonal and patterns . \n b sixty - nine percent of cd3 + t cells expressed t cell receptor /. c thirty - one percent of cd3 + t cells expressed t cell receptor /. forty - seven percent of cd3 + t cells lacked both cd4 and cd8 ( not shown ) case 1flow cytometry performed on bone marrow aspirate . a sixty - one percent of cd3 + t cells coexpressed cd57 . \n b sixty - nine percent of cd3 + t cells expressed t cell receptor /. c thirty - one percent of cd3 + t cells expressed t cell receptor /. forty - seven percent of cd3 + t cells lacked both cd4 and cd8 ( not shown ) case 2 increased large granular lymphocytes were noted on the peripheral smear . \n the bone marrow aspirate showed 40% erythroid precursors with a low g / e ratio of 1.0:1.2 along with 20.0% lymphs and 3.4% mature plasma cells . \n the interstitial population was highlighted with cd3 . the large majority of these expressed cd8 and not cd4 ( fig . \n rare scattered b cells marked with cd20 . in the lymphoid aggregates , the majority of cells were cd3 + , but cd4 + cells exceeded cd8 + cells by roughly five to one with only occasional cd20 + b cells . \n flow cytometry on the aspirate showed about 40% of marrow nucleated cells in the lymphocyte region with about 95% t cells . \n cd16 and cd56 were negative while roughly a fourth of the t cells had loss of cd5 . \n a similar proportion of the lymphocytes ( presumably the same population ) expressed tcr . pcr studies showed clonal rearrangements of both tcr and ( fig . \n b predominantly cd4 + t cells in a lymphoid aggregate with relatively few interstitiallyfig . \n patient bone marrow sample in lane 3 ( from left ) shows a discrete clonal band . \n pcr primers described by mccarthy et al . [ 18 , 19 ] case 2immunohistochemistry performed on the bone marrow biopsy ( 10 ) . a increased interstitial cd8 + t cells . \n b predominantly cd4 + t cells in a lymphoid aggregate with relatively few interstitially case 2t cell receptor gamma pcr 6% polyacrylamide gel . \n patient bone marrow sample in lane 3 ( from left ) shows a discrete clonal band . \n lanes 1 , 4 , and 5 have polyclonal patterns . lane 6 is a positive control . \n however , they are highly prevalent in certain peripheral tissues such as the skin , intestinal tract , and mammary ducts where they play a central role in the early response to infections . expansions of t cells have been described with epstein \n similar to their representation in the peripheral blood , the variant of t - lgl leukemia probably accounts for less than 5% of t - lgl leukemia cases . \n most investigators report that the vast majority of circulating and bone marrow lymphocytes are cd4 and cd8 , but at least one study found that nearly half are cd4 , cd8 + . \n both patients in this report were cd4 , cd8 , cd57 + , cd16 , and cd56. about 35% to 40% of t - lgl leukemia cases are cd4 , cd8 [ 7 , 9 ] . \n note , however , that the cd4,cd8 immunophenotype is not entirely specific for lymphoid proliferations . \n rare cases of t - lgl leukemia being cd4 , cd8 have been reported [ 10 , 11 ] . \n similar to t - lgl leukemia where over 95% of cases express cd57 , the vast majority of cases express cd57 ( 86% in the series by sandberg ) . \n also , like the common variant , cd16 and cd56 expression is more variable . \n based on sandberg s series and other case reports , cd16 and cd56 are each expressed in nearly half of the t - lgl leukemia cases . perhaps 20% and 60% of \n t - lgl leukemia cases express cd56 and cd16 , respectively ; rarely are all three nk markers coexpressed . \n the bone marrow findings in our two cases conformed to the general pattern described by osuji et al . for the common variant . \n that group described the bone marrow histology in 38 cases of t - lgl leukemia . \n ninety - seven percent of cases had an interstitial infiltration of cd3 + cells that were cd8 + in all but one instance . \n nonparatrabecular lymphoid nodules were seen in 55% of cases and were predominantly cd4 + t cells surrounding cd20 + collections of b cells . \n a reliable distinction between reactive lymphoid infiltrates and t - lgl leukemia in bone marrow biopsies is difficult . \n interstitial clusters of six or more t cells expressing cd8 , tia-1 , or granzyme b reportedly favor an lgl leukemia ( either t cell or nk cell ) . \n interestingly , in both our cases , interstitial cd8 + t cells were slightly increased even though the neoplastic t cells were cd8 by flow cytometry on the marrow aspirate . \n since t cells often weakly express cd8 , perhaps this observation reflects the different monoclonal antibodies used in flow cytometry ( sk1 ; bd biosciences ) versus immunohistochemistry ( c8/144b ; dako ) in our laboratory or different sensitivities by the two techniques . \n alternatively , the interstitial cd8 + t cells could be an immune epiphenomenon and not part of the neoplastic population as has been described by morice for nk - lgl leukemia . \n both cases had severe neutropenia with the anc 300/l or less . like the common variant \n , neutropenia is commonly associated with t - lgl leukemia with an anc below 1,500/l in 50% to 70% of cases [ 7 , 9 ] . \n pure red cell aplasia has been described in about 5% of cases similar to the common t - lgl leukemia [ 5 , 7 , 9 ] . \n a history of rheumatoid arthritis has been described in about 20% of t - lgl leukemia cases [ 7 , 9 , 10 ] compared with about 25% of cases . whether the type of tcr ( versus ) should be a pivotal diagnostic criterion for t cell lymphoproliferative disorders is unclear . \n hepatosplenic t cell lymphoma was originally restricted to cases , but subsequent reports described an essentially indistinguishable subtype . \n in contrast , the subtype of subcutaneous panniculitis - like t cell lymphoma is purported to have a significantly worse prognosis than its counterpart , thus generating a separate provisional entity . \n saito et al . reported an aggressive clinical course for 10 of 11 t cell neoplasms , but interestingly the one indolent case was a t - lgl leukemia that was cd4 , cd8 and after 4 years of follow - up , the patient had no progression of disease without treatment . \n recent reviews are reluctant to place the subtype of t - lgl leukemia in the general t - lgl leukemia diagnostic category largely based on concerns regarding the aggressive clinical behavior of many t cell lymphoproliferative disorders [ 1 , 3 , 4 ] \n . however , our two cases and a review of the literature on this topic suggest that t - lgl leukemia is usually indolent and rarely may even spontaneously regress . \n in summary , it is proposed that the variant of t - lgl leukemia be included in the general diagnostic category of t - lgl leukemia . \n other than often being cd4 and cd8 double negative ( in 35% to 40% of cases ) , it is essentially indistinguishable from the common variant in terms of cytology , immunophenotype , bone marrow morphology , clinical presentation , and prognosis . as a cautionary note \n , however , when a lymphoproliferative disorder is encountered , it is crucial to exclude more aggressive disorders ( e.g. , hepatosplenic t cell lymphoma and peripheral t cell lymphoma ) and also transient reactive expansions ( e.g. , infection - related ) . \n this requires full evaluation of the morphology , immunophenotype , genetic data , and clinical presentation .", "role": "user" }, { "content": "the vast majority of cases of t cell large granular lymphocyte ( t - lgl ) leukemia have a cd3 + , cd4 , cd8 + phenotype and express the t cell receptor . whether the rare variant should be included in the same diagnostic category \n is currently unclear . \n two well - characterized cases of t - lgl leukemia were identified by our laboratory in 2007 . \n these two cases and other reports of t - lgl leukemia were compared with the common variant . \n other than more often being negative for both cd4 and cd8 ( in about 35% to 40% of cases ) , the variant of t - lgl leukemia is similar to the common type in virtually all respects and should be included in the general category of t - lgl leukemia . \n however , it is important to exclude other more aggressive t cell lymphoproliferative disorders .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a 17-year - old male student was admitted with epiphora and intermittent discharge of pus from an accessory openings situated close to the medial canthus of both eyes ( more on the right side than left ) since he was 4 years of age . \n there was clefting of the lip and palate , and the absence of digits in all four limbs since birth . \n there was no family history of such a condition , but the patient was mildly mentally retarded since childhood . \n gross appearance of the patient the general examination was unremarkable except scar mark of previous cleft lip surgery over face and webbing of fingers of upper and lower limbs . on local examination , \n lacrimal syringing was performed , and there was regurgitation of fluid mixed with pus through the fistula and other punctum with hard stop bilaterally [ fig . 2 ] . \n right sided lacrimal fistula and repaired cleft lip of the same patient otoscopic examination showed purulent discharge with perforated tympanic membranes bilaterally . \n paranasal sinus x - ray revealed little mucosal thickening of both maxillary sinuses with normal midline nasal septum and turbinates . \n high resolution computed tomography of temporal bone revealed only minimal soft tissue density lesions in middle ear bilaterally [ fig . 3 ] . \n smaller left lacrimal fistula of the patient endoscopic dacryocystorhinostomy ( dcr ) operation was planned on both sides in two sittings under general anesthesia after diagnosis . \n the operation on the right side was done first as symptoms were more on that side . \n the surgery was performed with 0 * 4 mm diameter rigid hopkins rod telescope and the mucosal flap \n nose is decongested with a mixture of 4% lignocaine and 1:1000 adrenaline solution in a ratio of 10:1 approximately 10 min before surgery . at the beginning of the surgery , \n 2 ml of readymade solution of 2% lignocaine containing 1:100000 adrenaline is injected just anterior to and above the middle turbinate . \n now , an incision is taken starting 8 mm above the axilla of the middle turbinate and brought 8 mm anterior to it and from there vertically downward to the attachment of inferior turbinate and ultimately taken posteriorly to the insertion of uncinate process under the edge of middle turbinate . \n thus , a posteriorly based mucosal flap is created which is raised to expose the suture line between the frontonasal process of maxilla and lacrimal bone . \n now , a part of frontal process is removed using dcr punch forceps along the previously identified suture line to make a neo - ostium , and this is continued up to the fundus of the sac superiorly . \n now , the inferior is punctum is dilated , and the lacrimal sac is tented using bowman 's probe . \n now , a vertical incision is made over the medial wall of the sac using dcr spear knife as posteriorly as possible . \n free flow of normal saline was established inside the nose preoperatively while syringing [ fig . 4 ] . \n peroperative picture during endo - dcr showing free passage of water on syringing after excision of sac wall two horizontal releasing incisions are given on superior and inferior aspects of the flap making it \n then , the center of the original nasal mucosal flap is trimmed to make it c shaped to cover the raw bony edges . \n usually , there is no need to pack the nose at the end of the procedure . \n all patients receive broad spectrum antibiotic therapy for 5 days and antibiotic - steroid eye drop for 2 weeks . \n saline nasal spray was administered immediately after the surgery and for 4 weeks postoperatively to aid in removal of blood clots from the nasal cavity . \n lacrimal syringing performed on the seventh , fourteenth , and twenty- first postoperative day along with nasal endoscopy showed normal passage of saline in the nose and throat . \n spontaneous resolution of lacrimal fistula observed on successful treatment of concurrent nld obstruction even without excision of the tract . \n we performed endoscopic dcr on the left side after 3 months and obtained similar results . \n the acronym eec was coined by rudiger in 1970 and recognised first as a distinct clinical entity by cockayne , who drew attention to dacryocystitis which commonly affects these patients and its association with \n atresia of the lacrimal ducts , in its first published report . since that description in 1936 \n there are very few studies which tell about its prevalence in general population . according to one study \n , eec is relatively common than other similar syndromes ( i.e. acro - dermato - ungual - lacrimal - tooth syndrome ( adult ) , limb - mammary syndrome ( lms ) , etc . ) with over 200 published cases . \n another study observes a large dutch family with autosomal dominant limb mammary syndrome ( lms ) with at least 27 affected members . \n lacrimal duct atresia was found in 7 out of 15 such patients with lms . in all these syndromes , \n , nld obstruction was present in the most of the affected members of a family of adult syndrome and was resistant to therapy . \n mcnab et al . studied some families with eec syndrome and showed lacrimal canalicular atresia or absent lacrimal puncta along with nld obstruction with cleft lip and palate are common in such families . \n moreover , limb deformities and lacrimal drainage anomalies though common are not unique to it . \n operated 10 such patients with nld atresia by either duct dilatation or open dcr and observed both procedure effectively improved patients quality of life . according to one case series , obstructed lacrimal canaliculi or nld may be associated with lacrimal gland dysfunction . in such patients with dry eye and obstructed nld surgery may be required . \n the only postoperative complication was cheese - wiring of the lid margins from the inserted odonoghue tubes in one case . \n they have not found it necessary to resort to dacryocystectomy or lester jones bypass tubes . \n tien and tien described a case of eec syndrome with bilateral lacrimal fistulae where they excised the fistulas and intubated the nlds with improvement in symptoms . \n reported a case of eec syndrome with left lacrimal fistula and other bilateral congenital lacrimal anomalies who underwent left conjunctivo dcr with the insertion of a jones tube with a resolution of lacrimation postoperatively . according to the authors that is the only second report detailing management of congenital lacrimal anomalies in eec syndrome , and the first describing management of punctal atresia with conjunctivo dcr and jones tube placement . in that sense , \n ours is the second case to report bilateral lacrimal fistulas in a patient of eec syndrome and first only to manage it by endoscopic endonasal dcr surgery . \n we performed endoscopic dcr alone because our patient was an adult one and making a big neo - ostium endonasally , we wanted to allow the fistula tract heal spontaneously thus avoiding an extra surgery like fistulectomy , and our postoperative result was very encouraging . \n endo dcr also avoids external scar mark on the skin and do not hamper lacrimal endothelial pump mechanism . \n al - salem et al . studied fifteen patients of congenital lacrimal fistula and found the spontaneous resolution of discharge through fistula in 27% cases on successful treatment of concurrent nld obstruction with lacrimal sac massage , so as our case . \n reported clinical presentation and management of 24 cases of eec syndrome observed conductive deafness and genitourinary problems in some cases required surgical intervention . \n we would like to conclude that eec syndrome presenting with bilateral lacrimal fistulas is a rare and crippling condition , it needs multidisciplinary team approach consisting of an orthopedic surgeon , psychiatrists , ophthalmic and plastic surgeon , urologist , and ent surgeon to manage such a case . \n a patient of eec syndrome presenting with nld obstruction and fistula , endoscopic endonasal dcr can be a better alternative to duct dilatation and even open dcr . \n the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) \n has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . \n the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . \n the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) \n has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . \n the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . \n \n ", "role": "user" }, { "content": "ectrodactyly - ectodermal dysplasia and clefting syndrome or lobster claw \n deformity is a rare congenital anomaly that affects tissues of ectodermal and mesodermal origin . \n nasolacrimal duct ( nld ) obstruction with or without atresia of lacrimal passage is a common finding of such a syndrome . \n the authors report here even a rarer presentation of the syndrome which manifested as bilateral nld obstruction and lacrimal fistula along with cleft lip and palate , syndactyly affecting all four limbs , mild mental retardation , otitis media , and sinusitis . \n lacrimal duct obstruction and fistula were managed successfully with endoscopic dacryocystorhinostomy ( dcr ) which is a good alternative to lacrimal probing or open dcr in such a case .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: it has a narrow therapeutic range with a large inter - individual variability of dose requirements and needs cumbersome monitoring of the international normalized ratio ( inr ) to avoid over - anticoagulation ( inr>3 ) . \n over - anticoagulation is associated with higher haemorrhagic risk , and bleeding represents the major complication of warfarin therapy . \n recently , the association between over - anticoagulation and acute kidney injury ( aki ) has been described and named warfarin - related nephropathy ( wrn ) . \n wrn is associated with glomerular haemorrhage with tubular obstruction by red blood cell ( rbc ) casts and affects more frequently patients with known chronic kidney disease ( ckd ) . \n since wrn represents a severe complication with a poor renal prognosis , the identification of patients at risk is important . in 2007 \n the food and drug administration added pharmacogenetic information to the warfarin product label suggesting the evaluation of cyp2c9 and vkorc1 polymorphisms to establish the initial dose and reduce the risk of over - anticoagulation in warfarin - sensitive patients , although the test is costly and its applicability is still under evaluation [ 57 ] . so far no data are available regarding the warfarin pharmacogenetic profile in wrn affected patients . \n we report the case of a ckd patient with biopsy proven wrn that was a carrier of cyp2c9p*3 variant , a cytochrome polymorphism associated with higher risk of over - anticoagulation and bleeding . \n a 73-year - old caucasian man with stage 3 ckd was admitted for worsening of renal function . some weeks before he developed dyspepsia , anorexia , weight loss , asthenia and nocturia . \n he was initially accepted to another hospital and discharged with the diagnosis of stage 5 ckd . during this first hospitalization he declined the surgery to create an arteriovenous fistula ( avf ) for haemodialysis and refused renal replacement therapy . \n physical examination was substantially normal , bmi was 28 kg / m and blood pressure was 140/75 mmhg . \n the admission serum creatinine ( scr ) was 6.96 mg / dl ( egfr 8 ml / min/1.73 m ) , while 1 year before scr was 1.3 mg / dl ( egfr 58 ml / min/1.73 m ) . \n urinalysis demonstrated significant proteinuria ( 2.46 g/24 h ) and erythrocyturia ( 1739 rbc/l ) . \n serum albumin concentration was normal ( 4.1 g / dl ) and a small monoclonal component ( igg k < 0.1 g / dl ) was found without bence - jones protein at urinalysis . \n ldl cholesterol was 210 mg / dl . a serological workup , including c3/c4 , anca , ana , anti - dna , anti - gbm , viral serology and tumour markers , was negative . \n inr at admission was 1.52 , but the patient referred many recent episodes of over - anticoagulation , and he had discontinued the oral anticoagulant . in the next days scr progressively increased to 8.20 mg / dl , and we performed a kidney biopsy . \n kidney histology demonstrated modest matrix expansion with focal segmental sclerosis associated with vascular hyalinosis and extensive and diffuse tubular damage ; in the tubular lumina large and occlusive rbc casts were evident ( figure 1 ) . \n immunofluorescence studies were negative , and ultrastructural evaluation was compatible with nephroangiosclerosis with secondary segmental / global glomerular sclerosis and confirmed the tubular damage . \n ( a ) occlusive rbc casts in tubules ( pas stain ; original magnification 40 ) . \n ( b ) tubular obstruction by rbc casts and tubular damage also involving tubules without rbc cast obstruction ( pas stain ; original magnification 60 ) . \n ( a ) occlusive rbc casts in tubules ( pas stain ; original magnification 40 ) . \n ( b ) tubular obstruction by rbc casts and tubular damage also involving tubules without rbc cast obstruction ( pas stain ; original magnification 60 ) . \n the cyp2c9 * 2 , cyp2c9 * 3 , vkorc11639g > a and vkorc11173c > t polymorphisms were determined by real - time pcr ( lightcycler , roche ) . \n genetic analysis was consistent with warfarin sensitivity and increased haemorrhagic risk since the patient was wild - type for vkorc1 and homozygous for cyp2c9 * 3 allele . \n the patient was treated by sodium bicarbonate for 2 weeks in the hope of obtaining cast washout , but renal function did not improve . \n we then started corticosteroid therapy with prednisone 1 mg / kg / die and immediately scr began to decrease to a value of 4.44 mg / dl ( egfr = 14 ml / min/1.73 m ) after 3 months ( table 1 ) . \n table 1.laboratory findings according to clinical phase and therapydata at baseline ( 1 year before)data at first hospitalizationdata at admission to our divisiondata after warfarin withdrawal and hydrationdata at start of prednisone 1 mg / kg / daydata 3 months after starting prednisonekidney functionazotemia ( mg / dl)nd167148135133150creatinine ( mg / dl)1.35.706.967.478.24.44egfr mdrd ( ml / min/1.73 m)831088714urinalysiserythrocyturia ( rbc/l)nd17305001546470proteinuria ( g/24 h)0.522.46nd0.620.51other findingsinrna1.451.601.051.021.05albumin ( g / dl)nd3.74.1nd3.43.30leucocytes ( cell/l)617039204530498057009610red blood cells ( cell/l)459026903170340037402930haemoglobin ( g / dl)13.88.79.910.611.89.40pcr ( mg / l)409.67.3nd1.4<1ana / ena / anti - dna / anti - gbmndnegnegnegnegnegc3/c4 ( mg / dl)nd85/2681/25ndndndwarfarin pharmacogenetic profilecyp2c9ndndcyp2c9/*1 * 3vkorc1ndndwtcorticosteroids allowed a partial recovery of kidney function as demonstrated by data obtained after 3 months of treatment.nd , not determined ; na , not available ; neg , negative ; rbc , red blood cell ; wt , wild - type gene . \n laboratory findings according to clinical phase and therapy corticosteroids allowed a partial recovery of kidney function as demonstrated by data obtained after 3 months of treatment . \n nd , not determined ; na , not available ; neg , negative ; rbc , red blood cell ; wt , wild - type gene . \n causes of warfarin - dependent aki include acute interstitial nephritis , atheroembolism , direct mesangial damage and wrn , a newly recognized syndrome characterized by glomerular haemorrhage with tubular obstruction by rbc casts . \n although the first description dates back only to 2000 , wrn has been reported as a frequent complication of warfarin treatment affecting up to 30% of ckd patients [ 3 , 9 , 10 ] . \n the present report describes the case of a ckd patient who experienced many episodes of over - anticoagulation before developing severe kidney failure , but wrn was not suspected during the first hospitalization . \n when he was admitted to our division pre - renal and post - renal aki were excluded as well as atheroembolism ; rapidly progressive glomerulonephritis appeared unlikely . \n the clinical history did not mention drugs commonly associated with interstitial nephritis and was dominated by previous over - anticoagulation episodes and hypertension . \n kidney biopsy definitively excluded these forms demonstrating a wrn since histological findings met the criteria previously described by brodsky et al . . \n we suggest that wrn should always be considered as a possible cause of aki when episodes of over - anticoagulation are described , and kidney biopsy should be performed to confirm the diagnosis of this serious warfarin complication . \n patients with ckd , hypertension , diabetes and cardiovascular disease should be considered at risk since these conditions are associated with wrn development [ 2 , 9 , 10 ] . \n kidney histology demonstrated a secondary focal glomerulosclerosis in a context of nephroangiosclerosis that explained this finding . \n this observation highlights the central role of renal biopsy which identified the cause of kidney failure and described the underlying coexisting nephropathy . \n ozcan and collegues reproduced wrn in a 5/6 nephrectomy rat model confirming the pathogenetic role of glomerular haemorrhage and tubular obstruction . the rats developed secondary focal segmental glomerulosclerosis after nephrectomy , and ckd progression exposed them to higher risk of wrn when over - anticoagulation occurred , resembling the case we reported [ 11 , 12 ] . considering these features , \n the patient was treated by warfarin discontinuation , hydration and sodium bicarbonate but no clinical response was obtained . \n some observational reports indicate that early steroid administration could accelerate recovery of renal function after gross haematuria . \n although no data are available about steroid use in wrn with microscopic haematuria , we started this therapy obtaining a good response with partial recovery of renal function . \n to the best of our knowledge , this is the first report describing wrn clinical response to steroid treatment . \n though it needs to be confirmed , we consider this a fascinating finding since it suggests a possible therapeutic strategy for this nephropathy and a less mechanical pathogenesis of the renal damage . \n notably , in this case kidney function did not completely recover confirming that wrn represents a severe warfarin complication with a poor renal prognosis [ 4 , 9 ] . to prevent this complication it is necessary to identify patients at risk and to individualize the correct warfarin dose . \n warfarin - related haemorrhage is 2-fold more common in ckd patients with respect to the general population , and wrn is more frequent in patients with a pre - existing nephropathy . \n the study of warfarin pharmacogenetics could be useful to identify patients who require lower doses . \n warfarin is metabolized by liver cytochrome p450-cyp2c9 and acts as a vitamin k antagonist ( vkas ) inhibiting the vitamin k epoxide reductase enzyme complex ( vkorc1 ) . \n some polymorphisms of these genes are associated with both warfarin metabolism impairment and higher haemorrhagic risk . \n recently , limdi et al . demonstrated that ckd patients require lower warfarin doses , and the dose adjustments should take into account both kidney function and cyp2c9 and vkorc1 genotypes . in the case of our patient , \n warfarin dose had not been titrated according to the pharmacogenetic profile , and the patient experienced many episodes of over - anticoagulation . \n the genetic study demonstrated that he was homozygous for cyp2c9 * 3 variant , which is a common european ancestry allele that reduces warfarin metabolism by 8090% exposing the carriers to the greatest risk of bleeding . in contrast , 1639g > a and 1173c > t non - coding variants are associated with warfarin sensitivity and reduced dose requirements , but they are not associated with haemorrhagic events . \n on the basis of our observations , the cyp2c9 * 3 genetic variant might be associated with wrn development , suggesting for the first time a link between wrn and this polymorphism . \n although it needs to be confirmed , this observation is particularly interesting given that wrn has an unfavorable prognosis and warfarin pharmacogenetics might be useful to identify patients at risk of complications . \n warfarin pharmacogenetic - based algorithms could be used to establish both the initiation and maintenance dose minimizing the risk of over - anticoagulation and wrn development . in conclusion renal biopsy \n should always be considered to identify wrn in patients developing aki when over - anticoagulation is described . \n wrn is a serious complication with a poor renal prognosis and requires the development of successful therapeutic strategies . in our experience corticosteroids \n finally , the cyp2c9 * 3 polymorphism could represent a genetic variant which identifies patients at risk for wrn . in general warfarin pharmacogenetics \n may indicate a genetic predisposition to wrn and act as a guide for dose requirements in ckd patients . \n the results presented in this paper have not been published previously in whole or part .", "role": "user" }, { "content": "warfarin - related nephropathy ( wrn ) is a renal complication of warfarin treatment associated with over - anticoagulation . \n we describe a case of a 73-year - old man affected by chronic kidney disease , essential hypertension and atrial fibrillation treated with warfarin . \n the patient presented a rapid course of kidney failure after many episodes of over - anticoagulation , and renal biopsy demonstrated wrn . \n interestingly , the patient 's warfarin pharmacogenetic profile showed that he was warfarin sensitive . \n this is the first report describing the presence of gene polymorphisms affecting warfarin metabolism in a subject with a biopsy - proven wrn . \n the patient was treated with corticosteroids obtaining a partial clinical response .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: current dentin bonding agents ( dbas ) contain solvents , which are among the most essential ingredients needed to establish an adequate dentin - resin interface . \n they are responsible for carrying resinous monomers into dentin after the etching step.1,2,3 acetone , ethanol , and water are the solvents commonly present in dbas , and they can be combined.4,5 despite their relevant role , residual solvent is deleterious , as it can interfere with the polymerization process,6 reduce bonding strength,79 increase permeability of the adhesive layer,9,10 and lead to early degradation of the interface.11,12 the evaporation rate will vary depending on the composition of the dbas.5 however , solvent properties are the most influential , mainly due to their vapor pressure and molecular weight.13,14 additionally , the water content of the dentin , depending on the wet technique applied , as well as fluid from tubules may make it hard to eliminate , as the vapor pressure of the water - solvent combination is reduced.13 pashley et al13 investigated how water as a solvent and the solute concentration ratio can influence spontaneous evaporation . even in previous studies that investigated this property,1518 only neat or experimental systems \n however , no commercial dbas were verified . as commercial formulations present other substances as inorganic particles , initiators , and stabilizers \n evaporation from commercial products was only assessed from vials,5,16 not from dentin , which represents the clinical substrate . \n therefore , this study aimed to measure the retention of solvent present in different dentin bonding agents applied to a demineralized dentin matrix . \n there is no difference in the amount of solvent retained through time ; and 2 . \n there is no difference in the amount of solvent retained in different tested commercial systems . \n thirty - six specimens of dentin were obtained from bovine teeth , using a low - speed diamond saw and cut machine ( isomet , buehler ltd , lake bluff , il 60049 , usa ) . \n they were polished ( apl 4 arotec , cotia , sp , brasil ) to obtain 2x2x2 mm cubes , which were measured using a digital caliper ( messen ) . \n the specimens were stored in a renewed 0.1% thymol solution under refrigeration until they were demineralized . \n the cubes were immersed in a beaker holding 0.5 m edta solution with a ph of 7 and maintained under agitation ( te-420 , tecnal , piracicaba , sp , brazil ) for 7 days . \n finally , specimens were immersed in deionized water under agitation to avoid residual edta in the dentin cubes . during the tests , \n the temperature and relative humidity were monitored , and they varied from 25.4 to 26.3c and 75 to 79% , respectively . \n one hundred l aliquot from each dba were dispensed in individual eppendorf tubes , totalizing 36 specimens ( six specimens for each dba ) . for xeno iii \n an aluminum sheet was used to externally involve eppendorf tubes to reduce environmental light influence . \n furthermore , they were also maintained in a hermetically closed thermal box to assure there was no light influence . \n they were randomly immersed in the eppendorf tubes with the tested dbas for 5 minutes to be saturated by the material . \n each specimen was subsequently removed from the eppendorf tubes and , after a standardized removal of excess dba , they were measured using a digital balance ( bioprecisa , mod . \n the initial mass of each specimen was considered after a stabilization of the digital screen . \n variations of mass , which represented a loss of solvent from dba , were registered at the beginning and subsequently at 10 , 20 , 30 sec and 1 , 2 and 5 min . \n these values were statistically analyzed and when a normal distribution was verified , they were compared through anova and tukey s tests with the confidence level set at 95% ( alfa=.05 ) . \n figure 1 shows the profile of mass lost through time for each dba . there was a significant statistical difference when time and material were considered ( p<.05 ) , but no interaction between them \n excite , prime & bond nt were the only systems that revealed significant evaporation through time , at 2 and 5 minutes , respectively . through the total analyzed time \n , there was no statistical difference in the evaporation from the tested dbas ( p>.05 ) . \n in the literature , there are reports of previous investigations of spontaneous evaporation of neat solvents , experimental systems , or commercial products without dentin matrix interference.1518 in the present study , an in vitro test was proposed to measure mass loss of dba from a demineralized dentin matrix . \n bovine dentin was used since human specimens are getting harder to obtain because of ethical constraints . \n this substrate has been used in different studies as an adequate alternative during laboratory tests.1922 contemporary dentin bonding systems present resinous monomers combined to solvents such as neat acetone , ethanol , or water or a combination of them.13 a previous study showed that there was a greater spontaneous evaporation from acetone , since its vapor pressure and ebullition temperature are minor compared to other solvent properties , which results in a high evaporation speed.5 this rationale leads one to expect a similar profile from an acetone - based dba when applied to a dentin substrate.3 however , in the present study , excite , which is an ethanol - based product , showed a significant evaporation difference 2 minutes after the experiment began , while the acetone - based prime & bond nt showed a difference only at the evaluation done 5 minutes after the experiment began . \n this profile clearly shows that even though a solvent is an essential factor , other ingredients in the formulated dba can change the expected evaporation time . \n furthermore , the interaction after its application to dentin can change its performance . when results from the present study are compared to data from studies by \n abate et al,5 cardoso et al,15 and lima et al,16 it is evident that the dentin matrix acts as a physical barrier , so clinical attention is required to facilitate solvent evaporation . \n additionally , fabre et al23 showed that commercial formulations of bonding agents have water sorption differences , which indicates that the presence of solvent can exacerbate water sorption , making it a negative factor that impacts bonding longevity . \n when different dbs were compared in this study , no statistical differences were revealed among them at any of the times when they were evaluated , despite the fact that water - based dbas ( sc , sb , ad e x ) showed minor evaporation followed by ethanol - based ( ex ) or acetone - based ( pb ) ones . from a clinical point of view , when clinical time is employed to evaporate the solvent content ( 30 s ) , the amount of evaporation was insignificant for all tested materials . \n thus , spontaneous solvent evaporation is not recommended after any application of dbas to dentin , as they are largely retained , which is deleterious to adhesion durability.712 an active application of water - based dbas is recommended to minimize solvent retention and assure adequate performance.21 when the data collected at the 5-minute evaluation time is observed , which is an unacceptable clinical time , no desirable evaporation amount was obtained for any dba . \n this confirms that it is necessary to promote evaporation facilitation by using an air spray . \n the results of the present study are in accordance with an investigation by cardoso et al,15 which did not verify the statistical relevance of the spontaneous evaporation rate from an acetone - based system ( one step , bisco ) compared to a water - ethanol - based one ( single bond , 3 m espe ) when monitored 1 and 2 minutes after the experiment began . \n an air - spray is recommended to optimize solvent evaporation,17,18,24 and it has to be gently applied to avoid oxygen incorporation in the adhesive layer , which can negatively interfere with the monomer conversion.25 a recent study verified that the use of a warm air - dry stream is appropriate in a clinic to improve the bond strength of self - etching adhesives.14 this study does not ignore the evaporation facilitation of dbas irrespective of the solvent content \n . as monomers and other components of solvents are responsible for the mechanism of adhesion , they will be always present , but it is important to avoid applying an excess amount or allowing direct contact with cells since they present an aggressiveness potential.26,27 more investigations are necessary to verify the role of ingredients used as fillers and the contents and composition of monomers that act in combination with solvents . \n based on this limited laboratory study , it can be concluded that : the null hypothesis ( 1 ) is rejected . \n there was a difference in the amount of evaporated material through the time for excite and prime & bond nt . \n these results point out the need to provoke evaporation facilitation of solvents after any dba application , as the spontaneous evaporation in dentin matrix is minimal , especially considering clinical time needed .", "role": "user" }, { "content": "objectives : solvents are ingredients in dentin - bonding agents ( dbas ) that are essential to obtain efficient adhesion to dentin under wet - technique bonding protocol . however , an excess of solvents can compromise bonding durability . \n this study aimed to assess the retention of solvents present in different dbas after their application to a demineralized dentin matrix.methods:thirty-six specimens of bovine dentin were demineralized for 7 days in 0.5 m edta and divided into six groups n=6 ( scotchbond primer , adper single bond 2 , excite , adhese primer , prime & bond nt and xeno iii ) . \n these specimens were individually saturated by the systems for 5 min and then kept in vials protected against light exposure . \n each specimen was measured using a digital balance and then measured at the following intervals 10 , 20 , 30 sec , 1 , 2 and 5 min thereafter . \n data were analyzed by two - way anova and tukey tests ( alfa=.05).results : there were significant differences evident in excite , prime & bond nt at 2 and 5 min , respectively . there was no significant interaction between materials and time in all experimented time evaluated . \n the amount of solvent spontaneously evaporated was limited even in acetone - based specimens.conclusions:after dbas are applied , professionals may facilitate their evaporation , since spontaneous evaporation is limited .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: worldwide , acute gastroenteritis ( age ) is the third most common cause of death in children < 5 years of age . in european children , \n only few deaths occur as a consequence of age ; however , diarrhoea has a considerable impact on the quality of life of children and their families . \n rotavirus ( rv ) is the leading cause of severe dehydration in children < 5 years of age [ 35 ] . in the european union ( eu ) \n , it is estimated that 3.6 million episodes of rv gastroenteritis ( rvge ) occur annually . \n rvge is estimated to occur at a rate of 1 symptomatic infection in every 7 children each year , accounting for 231 deaths , more than 87000 hospitalisations , and almost 700000 outpatient visits . \n it has been estimated that rv accounts for 39% diarrheal hospitalisations and from 25.3% to 63.5% of community - acquired age in children < 5 years of age [ 711 ] . \n these rates vary greatly depending on whether patients are seen in the hospital , emergency room , or primary care physician clinic . \n most rv infections are community - acquired and transmitted by the fecal - oral route and peak in the winter season between november and february in temperate climates [ 4 , 13 , 14 ] . \n rvge imposes a heavy economic burden by incurring not only direct ( consultation , emergency , hospitalisation , and medication ) costs , but also indirect costs ( parent workdays lost , childcare , etc . ) \n [ 12 , 15 , 16 ] . in europe , it has been associated with direct medical costs per patient ranging from $ 1942 to $ 2389 . \n indirect costs including workdays lost by parents of children hospitalised for rvge as well as out - of - pocket expenses ranged between $ 260 and $ 1061 ( uk ) . a portion of indirect costs was attributed to workdays lost by parents per hospitalisation episode , which varied between 2.3 days and 6.4 days . since the two rv vaccines became available , a monovalent rv vaccine ( rotarix , glaxosmithkline , rixensart , belgium ) and a pentavalent rv vaccine ( rv5 , rotateq , merck and co. , whitehouse station , nj , usa ; sanofi pasteur msd , lyon , france ) , the frequency of rvge decreased , while other pathogens are now reported more frequently . \n the italian society of pediatrics supports the rv vaccination but this has not been included yet in the national immunization program . \n however , because the italian national health service is decentralized , regions can include vaccines not nationally recommended in their immunization program . \n moreover , from 2008 into veneto region , setting of this study , all mandatory childhood vaccinations have been suspended . until now \n , no local data on rotavirus vaccination coverage are available and it is estimated to be very low since rotavirus vaccination is not free of charge like other vaccinations . \n the majority of non - rvges are usually ages associated with adenovirus ( av ) and norovirus ( nv ) [ 2025 ] . also av gastroenteritis ( avge ) and nv gastroenteritis ( nvge ) are predominantly presenting during winter months [ 26 , 27 ] . \n adenovirus ( av ) , initially recognized as a cause of respiratory disease , is associated also with gastrointestinal , ophthalmological , and neurological infections . \n the prevalence of avge is variable , ranging from 16% to 3.5% [ 22 , 29 , 30 ] . \n watery , nonbloody diarrhoea typically precedes vomiting and children admitted to the hospital for avge are more likely to present diarrhoea that usually lasts more than in rvge ( more than 5 days ) [ 31 , 32 ] . \n nv represents the most common cause of gastroenteritis outbreaks and causes acute , self - limiting gastroenteritis in people from all age groups . \n three us country surveillances during 2009 - 2010 showed that 17% of faecal specimens from children ( < 5 years ) hospitalised with gastroenteritis , 23% from children seen in emergency departments , and 28% from children seen in other outpatient settings were positive for nv . \n vomiting tends to be more prominent symptom in nvge gastroenteritis than in other types of viral age . usually , nvge has milder symptoms than those of rvge but a higher attack rate , due to its unusual stability outside the host and the low dose needed to produce symptomatic infection . \n there are limited data on the incidence of age pathogens in the primary care setting . \n in particular , there is an absence of long - term data , per age group on the proportion on rvge , avge , and nvge among age in this setting . \n this is due to the fact that no systematic testing for rv , av , and nv is needed in the primary care setting for the children management . in italy , \n we used the pedianet network of family pediatricians ( http://www.pedianet.it ) to collect data and understand the disease burden of community - acquired rgve , avge , and nvge . \n the burden of age disease was also analyzed in terms of social impact for the families estimating the indirect cost caused by workdays lost . \n the primary aim of this study wasto estimate the incidence of rvge leading to a fp visit among children < 60 months ( 5 years ) of age in a well - defined italian population . to estimate the incidence of rvge leading to a fp visit among children \n < 60 months ( 5 years ) of age in a well - defined italian population . \n the secondary aim of this study wasto estimate the incidence of nvge and avge leading to a fp visit among children < 60 months of age in a well - defined italian population;to determine the age of the children , seasonal distribution , and disease severity of rvge , nvge , and avge among children < 60 months;to compare the outcomes in rv , nv , and av positive and negative children with age;to estimate the medical and societal burdens of rvge , avge , and nvge on fps practice and families . to estimate the incidence of nvge and avge leading to a fp visit among children < 60 months of age in a well - defined italian population ; to determine the age of the children , seasonal distribution , and disease severity of rvge , nvge , and avge among children < 60 months ; to compare the outcomes in rv , nv , and av positive and negative children with age ; to estimate the medical and societal burdens of rvge , avge , and nvge on fps practice and families . \n this observational , prospective , fp - based study used an established italian network ( pedianet ) covering a well - defined number of patients ( i.e. , those registered by each individual fp ) in the veneto region of italy . \n surveillance was conducted for 12 months from may 2010 to april 2011 ( including a full rv season , 2010 - 2011 ) to assess disease incidence rates , disease age distribution , disease severity , seasonal variations in disease burden , and costs of viral age . \n the city of padua and nearby residential town where about 16000 children < 60 months ( 5 years ) are living has been chosen . \n a number of fps following between 7000 and 10000 children < 60 months of age were involved in the study . \n all children < 5 years of age from the defined population who presented at the selected fp sites with age ( as defined below ) were included in the study . \n a child was considered eligible for the study if she / he met the following criteria : a male or female child < 60 months ( 5 years ) of age at the time of the fp visit.child belonging to the population under surveillance selected for the study ( served by the fp sites selected for the study).child brought to fp for age during the study period.written informed consent by parent / guardian of subject . a male or female child < 60 months ( 5 years ) of age at the time of the fp visit . \n child belonging to the population under surveillance selected for the study ( served by the fp sites selected for the study ) . \n the following were considered exclusion criteria : children aged > 60 months ( 5 years).previously diagnosed chronic gastrointestinal tract disease where symptoms were similar to those of age.known nosocomially acquired rvge.no written informed consent.children not living permanently in the study area . \n their parents / guardians were asked to consent to participate and to have a stool sample collected and tested . \n an rvge , avge , and nvge case was defined as an age case ( corresponding to the age case clinical definition ) with rv , av , or nv positive detection by pcr . \n the database used for the analysis contains all and only the age cases enrolled for this study . \n such figures will be stratified by age group at onset and calendar month of onset . \n the database used for the analysis included data about patients ' age , gender , rv vaccination , and age signs and symptoms ( such as fever > 38c , vomit , abdominal pain , convulsion , lethargy , and dehydration ) . for every episode also the following were collected : length of the episode.in case the age led to hospitalisation : the length of stay in hospital and hospitalisation diagnosis ( icd-9).if age led to emergency room ( er ) : the number of er access times.in case of similar disease among family members : if father / mother had to take days off work and the number of days of work lost . \n the age led to hospitalisation : the length of stay in hospital and hospitalisation diagnosis ( icd-9 ) . if age led to emergency room ( er ) : the number of er access times . in case of similar disease among family members : if father / mother had to take days off work and the number of days of work lost . \n patients providing data to pedianet and stool samples for the present study had to give informed consent before their anonymous information could be included in the dataset . \n incidence rates of rvge , avge , and nvge were calculated as the ratio between cases and person - time . \n person - time was calculated as the average of the total population aged less than 60 months ( 5 years ) , registered with the fps enrolled for the study , at the beginning and the end of the surveillance period . \n rvge , avge , and nvge incidence rates were stratified by age of the children and month of onset . \n age - specific incidence rates were calculated as the ratio between the number of cases that occurred in the age group and the person - time contributed by the children of the age group . \n month - specific incidence rates were calculated as the ratio between the number of cases that occurred in that given month and the total person - time . \n hospitalisation will be the dependent variable and rvge ( or avge or nvge , resp . ) \n the exposure . the role ( as confounders ) of the characteristics reported at baseline will be investigated entering such variables in the models . \n the logistic regression will produce an estimate of the odds ratio of the risk of hospitalisation . \n the same approach was used to compare the access to the er as well as the combined event hospitalisation or er . \n comparison of length of stay in hospital was carried out by means of t - tests . in order to estimate societal costs due to rv , av , and nv , \n new variables were built which combine parents ' absence from work ( work_abs and days_abs ) . \n work_abs were used in the logistic models described in the previous paragraph whereas days_abs were compared through t - tests . \n the cases for which the stool sample was not taken ( or not processed by the lab ) were excluded from the analysis . however , the number of such cases will be reported . \n five hundred fifty - five children < 60 months ( 5 years ) of age presented at the selected fp sites with age , with 55,6% ( n = 309 ) being male . \n children < 24 months of age accounted for 62% of cases ( figure 1 ) . \n two hundred fifty - two ( 45% ) , 269 ( 48% ) , and 362 ( 65% ) cases over 555 children with gastroenteritis reported fever > 38c , vomiting , and abdominal pain at enrolment , respectively . \n only 3 cases ( 0.005% ) reported convulsion and 17 cases ( 0.03% ) presented with lethargy . \n the majority of children ( 82% ) presented with no dehydration and 16% with mild ( 05% ) and only 2% with moderate ( 510% ) dehydration . \n estimated incidence rate was 1.04 per 100 person - years ( 95% ci : 0.811.30 ) . \n one hundred twenty - six cases resulted in being positive to av ( two of them were vaccinated against rv ) with an estimated incidence rate of 1.74 per 100 person - years ( 95% ci : 1.452.07 ) while 109 cases resulted in being positive to nv ( one of them was vaccinated against rv ) with an incidence rate of 1.51 per 100 person - years ( 95% ci : 1.241.82 ) . \n rvge incidence was higher in the first 23 months of life with the higher incidence ( 3.60 ) in the range from 12 to 17 months . \n avge and nvge mostly occurred in children < 41 and 29 months of life , respectively , with the same peak from 12 to 17 months of age . \n incidence by month of onset showed higher values for rvge in november and from january to april , for avge from october to december , and for nvge from october to june ( figure 2 ) . \n association with fever > 38c , vomit , and abdominal pain was present in 58% , 59% , and about 59% of cases , respectively . \n convulsion occurred only in 1.3% of cases at enrolment , exclusively in young children from 6 to 11 months of age . \n other neurological signs as lethargy occurred in 4% of cases , affecting children aged 617 months . in avge group , \n association with fever > 38c was present in about 44% of cases , vomiting in about 51% of cases , and abdominal pain in 61% . \n neurological signs as convulsion and lethargy occurred in 0.8 and 1.6% of avge , respectively . \n fever occurred in 42% of cases , vomiting in about 62% of cases , and abdominal pain in 68% of patients affected by nvge . \n neurological signs as convulsion and lethargy occurred in 0.9 and 2.8% of nvge , respectively . \n children from 0 to 5 months did not experience dehydration . only 1 child aged 1823 months ( 1% ) over the total of cases had moderate dehydration ( figure 4 ) . \n mean length of all age episodes was 5.21 days ( 95% ci 4.945.47 ) : 5.42 days ( 95% ci 5.534.78 ) for rvge cases , 5.41 days for avge episodes , and 5.70 days for nvge ( table 1 ) . \n thirty - five cases of age needed admission to emergency room ( er ) ; 7 of these cases were rvge ( 20.0% ) . \n the mean number of access times to er , restricted to all age cases that accessed the er , was 1.09 with a mean of 1.14 access times for rvge episodes . \n the proportion of avge cases that needed access to er was 7 over 35 ( 20.0% ) total cases with a mean number of access times to er , restricted to cases that accessed the er , of 1.14 . \n the proportion of nvge cases that needed access to er was 8 over 35 ( 22.8% ) total cases with a mean number of access times to er , restricted to cases that accessed the er , of 1.13 ( figure 5 ) . \n hospitalisation occurred in 12 cases ( 2.54% ) of all age cases and only 3 cases ( 25.0% ) were rv positive ( aged 617 months ) . \n of 12 hospitalised children , 5 were avge ( 41.7% ) and only 1 was a nvge ( 8.3% ) ( figure 6 ) . \n mean length of hospital stay for all age cases was 1.08 days with shorter hospitalisation length for rvge cases ( 0.67 days ) whereas for avge it was 1.80 days and for nvge , restricted to cases hospitalised , it was zero days . \n all age cases hospitalised or that needed access to er were 40 ( 17.5% ) cases of rvge , 9 ( 22.5% ) cases of avge , and 8 ( 20.0% ) cases of nvge . the comparisons between children who tested rv positive and those who tested rv negative showed an age - adjusted mantel - haenszel relative risk of hospitalisation of 1.857 ( 95% ci : 0.4946.981 ) and a rr of er access of 1.299 ( 95% ci : 0.5882.871 ) with logistic regression rr of 1.145 ( 95% ci : 0.4532.891 ) . \n the age - adjusted mantel - haenszel rr comparing the rates of the combined event hospitalisation or er access was 1.100 ( 95% ci : 0.5052.397 ) and the logistic regression rr was 1.003 ( 95% ci : 0.4062.473 ) . \n t - test comparing the hospitalisation lengths showed no statistically significant difference in rvge admissions . \n the comparisons between children who tested av positive and those who tested av negative and children who tested nv positive and those who tested nv negative showed an age - adjusted mantel - haenszel relative risk of hospitalisation of 1.623 ( 95% ci : 0.5604.698 ) and a rr of er access of 0.640 ( 95% ci : 0.2901.412 ) with logistic regression rr of 0.629 ( 95% ci : 0.2571.536 ) for avge and an age - adjusted mantel - haenszel relative risk of hospitalisation of rr = 0.301 ( 95% ci : 0.0392.307 ) and a rr of er access of 1.005 ( 95% ci : 0.4772.116 ) with logistic regression rr of 1.055 ( 95% ci : 0.4512.464 ) for nvge . \n the age - adjusted mantel - haenszel rr comparing the rates of the combined event hospitalisation or er access for avge was 0.727 ( 95% ci : 0.3601.471 ) and the logistic regression rr was 0.729 ( 95% ci : 0.3281.620 ) and for nvge the age - adjusted mantel - haenszel rr was 0.845 ( 95% ci : 0.4071.758 ) and the logistic regression rr was 0.814 ( 95% ci : 0.3571.858 ) . \n t - test comparing the hospitalisation length for avges showed statistically significant difference between avge and not avge admissions while for nvge it was not possible to be performed . \n proportion of cases with family members affected by age and the mean working days lost by the parents and by the mother , restricted to the cases in which at least one parent had to take days off , are summarized in table 2 . for rvge cases \n , the percentage seems to be higher in younger ( 011 months ) and older ( 3660 months ) affected children ( figure 7 ) . \n proportion of family members affected was higher in nvge cases than in not nvge cases ( 22.03 ) . \n for rvge , age - adjusted mantel - haenszel rr comparing the rates of absence from work was 0.976 ( 95% ci : 0.5651.689 ) and the logistic regression rr was 0.860 ( 95% ci : 0.4351.702 ) . \n also for avge and nvge , age - adjusted mantel - haenszel rr comparing the rates of absence from work was 1.125 ( 95% ci : 0.7211.755 ) for avge and 1.460 ( 95% ci : 0.9442.260 ) for nvge with logistic regression rr of 1.172 ( 95% ci : 0.6762.033 ) and 1.570 ( 95% ci : 0.9082.716 ) , respectively . in both cases , \n twelve family pediatricians ( fps ) were involved from may 2010 to may 2011 in the pedianet network . in the period of study , \n 555 children < 60 months of age presented at the selected fp sites with age . the age distribution was skewed as expected with a peak between 6 and 18 months of age . \n seventy - five cases resulted in being positive to rv with an estimated incidence rate of 1.04 per 100 person - years , lower than avge and nvge rate in italian children < 5 years old with age belonging to the pedianet database . in the eu , the annual incidence of community - acquired rvge among children \n < 5 years of age has been reported ranging from 1.33 to 4.96 cases per 100 person - years [ 3639 ] and even 12-fold higher among children under three years of age . \n the reveal study reported that rvge in children < 5 years of age is responsible for between 53.0% and 68.9% of cases presenting to hospitals , 35.4% and 63.3% of those seen in emergency departments , and 7.7% and 41.3% of cases seeking primary care physicians . \n a second prospective european multicentric study reported that the overall proportion of community - acquired rotavirus infections was 43.4% , with most of these cases ( 80.9% ) occurring in children under 2 years of age . \n rvge incidence obtained in our study is comparable to the lower value reported from previous european studies and probably could be underestimated as many patients received care at home without being referred to a fp . \n indeed , a high number of children with rvge are not sick enough to be admitted to the hospital and many patients receive no medical care at all . for europe , estimations of the proportion of rvge patients receiving no medical care ranged from 25% to 51% of patients [ 38 , 43 , 44 ] . \n two studies from a day care setting in france reported that 34.6% and 14.3% of rvge cases , respectively , did not seek medical attention . \n rvge incidence was higher in the first 23 months of life with the highest incidence in the range from 12 to 17 months shortly before being reported [ 4144 ] . \n nvge and avge showed the same trend confirming the high age 's burden in children younger than two years . \n as it is well known , the rv infection peak occurs in the winter season between november and february in temperate climates [ 5 , 15 , 16 ] . the low incidence in december for all the viral agents \n in fact , in this time of the year , fp consulting rooms are closed and there is an increase in er visits and subsequent hospital admissions . \n signs and symptoms of age are similar when stratified by age and independently from the viral pathogen . \n still debated is the proportion of children with dehydration due to acute rvge . in our report , 72% of rvge cases presented with no dehydration . \n the reveal study reported that the proportion of children with dehydration due to acute rvge varied between 11.1% and 71.4% , and in most countries it was considerably higher than for those with rotavirus - negative disease . \n the results of our study could be comparable with the reveal lower value , but it is even less considering what has been reported by forster et al . \n where dehydration is evident in 75.7% of patients with rvge and is severe in 11.3% of them . \n it is likely that this rate variation depends on whether patients are seen in hospital , er , or primary care physician clinic . \n only 18.3% and 1.6% of children with avge presented mild and moderate dehydration , respectively , whereas nvge was associated with mild dehydration in about 20% and moderate dehydration in 0.9% of cases . \n compared with other viral causes studied , mild dehydration was reported in a slightly higher proportion of children with rvge but moderate or severe dehydration was unlikely to occur , according to a previous italian community - based study which showed that dehydration at initial presentation in primary care was associated with a higher likelihood of rvge ( or : 1.8 ) . \n also in this case data presents large variability , because in some countries proportion of children with dehydration is comparable among children with or without rvge . in the analyzed period , \n the mean length of all age episodes was 5.21 days and 5.42 days for rvge cases . \n all age cases hospitalised or those that presented to the er were 40 and 7 of these were rvges . in eu , \n hospital stay due to acute rvge ranges from 2.5 days to 5.0 days [ 41 , 46 ] . \n in the reveal study , the proportions of hospital and emergency referrals among children presenting at primary care with acute rvge ranged from 13.0% to 57.1% and from 6.1% to 45.3% , respectively , for all countries included in the study . \n additional country - specific studies show different hospital admission rates for community - acquired disease due to acute rvge ( france 81% ; germany 7% ; italy 11.2% ) . in greece , \n hospital admissions due to rvge are significantly more frequent than non - rvge ( 51.4% versus 22% nonrotavirus ; p < 0.01 ) . overall reported hospitalisation due to rvges is longer than that for other viral gastroenteritis cases [ 39 , 50 ] but our t - test data analysis comparing the hospitalisation lengths showed no statistically significant difference in rvge admissions . \n in addition , hospitalisation or / and access to the er were not significantly different in rvge if compared with nvge and avge but , according to literature , comparing avge and non - avge admissions the hospitalisation lengths showed statistically significant difference [ 42 , 43 ] . \n indeed , children with avge are more likely to present diarrhoea that usually lasts more than in rvges and consequently are more likely to require hospitalisation [ 31 , 32 ] . \n the rvge heavy economic burden including direct costs ( e.g. , medical consultation or hospitalisation ) and elevated indirect costs ( e.g. , parent workdays lost ) [ 12 , 15 , 16 ] . proportion of cases with family members affected by age was 22.03% . \n for rvge cases , the percentage rose to 24% while , in the nvge group , 37.6% of patients had a family member affected . in this study \n , there was no significant difference between rvge , avge , and nvge in terms of parents ' workdays lost . \n this is consistent with what was previously reported in the literature that nvges usually have a high attack rate , but symptoms are milder and last less than in other viral ages [ 20 , 21 ] . \n features of rvge in terms of hospitalisation length and indirect cost are lower than reported in previous studies [ 12 , 1517 ] . \n noteworthy is the rv vaccination coverage rate in our cohort : only 3 out of 555 children had received a universal rv vaccine 5 years after its release . \n actually , only 5 regions have officially recommended rv vaccination , with a wide range of offered solutions . in 2 regions ( lazio and tuscany ) \n , vaccination is offered to all infants with a copayment system ; in basilicata and piedmont , it is free for preterm infants and high - risk groups and in apulia children can receive rv vaccination for free based on a fp 's request . in the veneto region \n it is strongly suggested but not included in the vaccinations plan , so families have to pay to receive it . analyzing the possible reasons of low rv vaccination diffusion , the most common barriers are represented by the low perception of rv disease burden , potential safety concerns , and unfavorable cost - effectiveness . a primary care network for \n age surveillance could be a useful tool to increase rv disease awareness and to follow the rate of infection after rv vaccination implementation . \n indeed , the main strength of this study is that data have been collected from pedianet , a reliable network of fps working within the italian national health service . \n this allowed calculating the incidence of age , rvge , avge , and nvge on the basis of person - time by age groups and provides a precise picture of the disease in that period of time . \n furthermore , in this prospective study , which had strict inclusion and exclusion criteria , the aetiology of age has been confirmed by pcr stool testing for almost all of the patients . \n one limitation of the study is that pcr analyses on stool were performed only to detect presence or absence of different viruses but rv different genotypes have not been analyzed . \n this specific exam could be a very efficient tool for monitoring the rvge aetiology especially in those regions where the vaccination is offered . \n the duration of the study represents another limitation , considering that a one - year study period is too short to exclude interannual and seasonal variability with consequent risk of over- or underestimating the burden of infection . \n finally , in this study , age episodes not seen by fps but diagnosed in an er have not been recorded . \n however , as fps are free of charge , it is likely that only a negligible proportion of children acceded directly to er . the only exception is represented by the holidays when fp consulting rooms are closed and consequently the er visits increase . \n results of the present study reflect the large variability of data present in the literature regarding the public health and economic impact of rvges in the eu , comparing them also with avge and nvge , especially in the postvaccination era . \n this observation underlines the usefulness of primary care networks for age surveillance and further studies of community - acquired gastroenteritis in children .", "role": "user" }, { "content": "background . rotavirus ( rv ) is the commonest pathogen in the hospital and primary care settings , followed by adenovirus ( av ) and norovirus ( nv ) . \n only few studies that assess the burden of rv gastroenteritis at the community level have been carried out . objectives . to estimate incidence , disease characteristics , seasonal distribution , and working days lost by parents of rv , av , and nv gastroenteritis leading to a family pediatrician ( fp ) visit among children \n < 5 years . methods . \n 12-month , observational , prospective , fp - based study has been carried out using pedianet database . \n results . \n rvge incidence was 1.04 per 100 person - years with the highest incidence in the first 2 years of life . \n incidences of avges ( 1.74 ) and nvges ( 1.51 ) were slightly higher with similar characteristics regarding age distribution and symptoms . \n risk of hospitalisation , access to emergency room ( er ) , and workdays lost from parents were not significantly different in rvges compared to the other viral infections . \n conclusions . \n features of rvge in terms of hospitalisation length and indirect cost are lower than those reported in previous studies . results of the present study reflect the large variability of data present in the literature . \n this observation underlines the utility of primary care networks for age surveillance and further studies on community - acquired gastroenteritis in children .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: opioids are the cornerstone of management for severe pain , yet large interindividual responses are seen clinically and the abuse potential of this class of drugs makes their use problematic . \n data derived from both humans and animal models suggest that components of an individual s diet may alter responses to opioids including analgesia , physical dependence , and abuse . \n the consumption of sweet and fatty foods , for example , predisposes humans and animals to addictive behaviors.1 cholesterol - rich diets tend to potentiate opioid analgesic effects in mice and possibly in humans.2 on the other hand , dietary restriction of alpha linolenic acid failed to alter opioid analgesia in mice , although it did change the locomotor response.3 looking more specifically at dietary effects on opioid pathways , a high - fat diet altered -opioid receptor expression in several central nervous system centers suggested to support binge eating disorders.4 strong effects of diet in early life on opioid responses and gene expression have been noted . when rat pups were exposed to an undernourishment protocol \n , they displayed less opioid withdrawal when subsequently treated with morphine followed by administration of an opioid receptor antagonist.5 in other experiments using pregnant mice , a high - fat maternal diet increased expression of the -opioid receptor and other addiction - related genes in the brains of the pups . \n the mechanism for these differences in gene expression involved differences in methylation of the promoter regions of the differentially expressed genes.6 altered patterns of dna methylation in response to dietary differences in methyl donor or fat content are believed to explain a number of additional effects in animals and humans . \n very recently , investigators found that the methylation pattern was altered at 82 distinct genomic loci when mice were exposed perinatally to a high versus low methyl donor diet.7 in light of the results of the aforementioned studies , we hypothesized that exposing mice to high versus low methyl donor diets in the perinatal period would alter opioid analgesia , tolerance , dependence and opioid - induced hyperalgesia later in life . \n all the animal experiments were done with the approval of the veterans affairs palo alto health care system institutional animal care and use committee and complied with the guide for the care and use of laboratory animals available through the national academy of sciences . \n the mice were housed under pathogen - free conditions with soft bedding , and were provided food and water ad libitum with a 12:12 light : dark cycle . \n high and low methyl donor chows were purchased from research diets ( new brunswick , nj , usa ) . \n high methyl supplementation was added using folic acid , vitamin b12 , choline , l - methionine , zinc , betaine , and genistein . \n all these methyl donors are involved in methyl metabolism.8 the difference in ingredients in the low and high methyl donor diets is summarized in table 1 . \n each of the experimental diets supported normal growth and was not associated with any known dietary deficiency syndromes . on completion of testing , each animal had been exposed to either the high or low methyl donor diet for approximately 6 weeks either in the perinatal period or later in life . for the perinatal methyl donor supplementation studies , \n male and female c57bl/6j mice were purchased from jackson laboratories ( bar harbor , me , usa ) at 5 weeks of age . \n twelve females were randomly divided into two groups to receive high or low methyl donor diets . \n the diets were provided for 2 weeks prior to mating and throughout gestation and lactation.7,9,10 at postnatal day 21 , the pups were weaned and received the standard rodent diet ( 2018 , harlan - teklad , madison , wi , usa ) . \n this diet was continued during the experiments , which began at 8 weeks of age . for the postweaning methyl donor supplementation studies , \n these mice received a standard rodent diet after arrival at our institution . at postnatal day 21 , \n the pups were weaned and randomized to receive either high or low methyl donor diets . \n the diets were provided until they were used in behavioral tests at 8 weeks of age , and continued through the testing period . \n mechanical allodynia was assessed using nylon von frey filaments according to the up - down algorithm previously described by chaplan et al.11 for these measurements , mice were placed on mesh platforms within transparent plastic cylinders . after 15 minutes of acclimation , nylon fibers of sequentially increasing stiffness ( 0.22 g , seven fibers ) were applied to the plantar surface of one hind paw , and left in place for 5 seconds . \n if no response was observed , the next stiffer fiber was applied to the same paw ; if a response was observed , a less stiff fiber was applied . \n testing continued until four fibers had been applied after the first withdrawal response , allowing estimation of the mechanical withdrawal threshold . \n the monofilament fibers were purchased from stoelting ( wood dale , il , usa ) . \n paw withdrawal response latencies to noxious heat stimulation were measured using the method of hargreaves et al as modified for use in mice.12 in this assay , the mice were placed on a temperature - controlled glass platform ( 29c ) in a clear plastic enclosure similar to that described above . \n after 30 minutes of acclimatization , a beam of focused light was directed towards the same area of the hindpaw as described for the von frey assay . \n a 20-second cutoff time of paw withdrawal was used to prevent tissue damage . in these experiments , \n the light beam intensity was adjusted to provide approximately 10 seconds of baseline latency in the control mice . \n three measurements were made per animal per test session separated by at least one minute . \n cumulative morphine dose - response curves were constructed using the tail - flick assay and methods similar to those we have described previously.13 for these measurements , the mice were gently restrained within a cone - shaped tube made of cotton toweling . using a tail - flick analgesic apparatus ( columbus instruments , columbus , oh , usa ) , tail - flick latency was measured with 0.1-second precision . \n two measurements were made per mouse with the light beam focused on two different points 1 cm apart on the tail . \n the lamp intensity was identical for all animals , providing baseline tail - flick measurements of 34 seconds . \n for assessment of tolerance , these dose - response experiments followed 18 hours after the final dose of morphine was given as part of the chronic morphine administration protocol . \n the cumulative doses of morphine used were 1 , 3 , and 10 mg / kg . \n tail - flick latency was determined 25 minutes after morphine injection , as established in preliminary experiments , in which 25 minutes is the time at which peak morphine effect was achieved . \n the percent maximal possible effect ( % ) was determined using the following formula : after baseline nociceptive testing , morphine ( sigma - aldrich , st louis , mo , usa ) was subcutaneously administered to the mice at 10 mg / kg twice per day on day 1 , 20 mg / kg twice per day on days 23 , and 40 mg / kg twice per day on day 4 , in 50100 l volumes of 0.9% nacl.13 for determinations of physical dependence , the mice undergoing chronic morphine administrations were challenged with a subcutaneous injection of naloxone ( sigma chemicals ) 10 mg / kg in 100 l of saline , as described previously by our laboratory and others.14,15 after administration of naloxone , the mice were placed in transparent plastic cylinders , and the number of jumps during the following 15 minutes was counted . \n all data are expressed as the mean standard error of the mean , unless otherwise noted . \n data for mechanical sensitivity , thermal sensitivity , tail - flick response , and dependence were analyzed by two - way analysis of variance followed by the bonferroni post hoc test for multiple comparisons . \n simple comparisons of two groups involved unpaired t - testing with two - tailed p values . \n all the animal experiments were done with the approval of the veterans affairs palo alto health care system institutional animal care and use committee and complied with the guide for the care and use of laboratory animals available through the national academy of sciences . \n the mice were housed under pathogen - free conditions with soft bedding , and were provided food and water ad libitum with a 12:12 light : dark cycle . \n high and low methyl donor chows were purchased from research diets ( new brunswick , nj , usa ) . \n high methyl supplementation was added using folic acid , vitamin b12 , choline , l - methionine , zinc , betaine , and genistein . \n all these methyl donors are involved in methyl metabolism.8 the difference in ingredients in the low and high methyl donor diets is summarized in table 1 . \n each of the experimental diets supported normal growth and was not associated with any known dietary deficiency syndromes . on completion of testing , each animal had been exposed to either the high or low methyl donor diet for approximately 6 weeks either in the perinatal period or later in life . for the perinatal methyl donor supplementation studies , \n male and female c57bl/6j mice were purchased from jackson laboratories ( bar harbor , me , usa ) at 5 weeks of age . \n twelve females were randomly divided into two groups to receive high or low methyl donor diets . \n the diets were provided for 2 weeks prior to mating and throughout gestation and lactation.7,9,10 at postnatal day 21 , the pups were weaned and received the standard rodent diet ( 2018 , harlan - teklad , madison , wi , usa ) . \n this diet was continued during the experiments , which began at 8 weeks of age . for the postweaning methyl donor supplementation studies , \n these mice received a standard rodent diet after arrival at our institution . at postnatal day 21 , \n the pups were weaned and randomized to receive either high or low methyl donor diets . \n the diets were provided until they were used in behavioral tests at 8 weeks of age , and continued through the testing period . \n mechanical allodynia was assessed using nylon von frey filaments according to the up - down algorithm previously described by chaplan et al.11 for these measurements , mice were placed on mesh platforms within transparent plastic cylinders . after 15 minutes of acclimation , nylon fibers of sequentially increasing stiffness ( 0.22 g , seven fibers ) were applied to the plantar surface of one hind paw , and left in place for 5 seconds . \n if no response was observed , the next stiffer fiber was applied to the same paw ; if a response was observed , a less stiff fiber was applied . \n testing continued until four fibers had been applied after the first withdrawal response , allowing estimation of the mechanical withdrawal threshold . \n the monofilament fibers were purchased from stoelting ( wood dale , il , usa ) . \n paw withdrawal response latencies to noxious heat stimulation were measured using the method of hargreaves et al as modified for use in mice.12 in this assay , the mice were placed on a temperature - controlled glass platform ( 29c ) in a clear plastic enclosure similar to that described above . after 30 minutes of acclimatization , a beam of focused light was directed towards the same area of the hindpaw as described for the von frey assay . \n a 20-second cutoff time of paw withdrawal was used to prevent tissue damage . in these experiments , \n the light beam intensity was adjusted to provide approximately 10 seconds of baseline latency in the control mice . \n three measurements were made per animal per test session separated by at least one minute . \n cumulative morphine dose - response curves were constructed using the tail - flick assay and methods similar to those we have described previously.13 for these measurements , the mice were gently restrained within a cone - shaped tube made of cotton toweling . using a tail - flick analgesic apparatus ( columbus instruments , columbus , oh , usa ) , tail - flick latency was measured with 0.1-second precision . \n two measurements were made per mouse with the light beam focused on two different points 1 cm apart on the tail . \n the lamp intensity was identical for all animals , providing baseline tail - flick measurements of 34 seconds . \n for assessment of tolerance , these dose - response experiments followed 18 hours after the final dose of morphine was given as part of the chronic morphine administration protocol . \n the cumulative doses of morphine used were 1 , 3 , and 10 mg / kg . \n tail - flick latency was determined 25 minutes after morphine injection , as established in preliminary experiments , in which 25 minutes is the time at which peak morphine effect was achieved . \n after baseline nociceptive testing , morphine ( sigma - aldrich , st louis , mo , usa ) was subcutaneously administered to the mice at 10 mg / kg twice per day on day 1 , 20 mg / kg twice per day on days 23 , and 40 mg / kg twice per day on day 4 , in 50100 l volumes of 0.9% nacl.13 \n for determinations of physical dependence , the mice undergoing chronic morphine administrations were challenged with a subcutaneous injection of naloxone ( sigma chemicals ) 10 mg / kg in 100 l of saline , as described previously by our laboratory and others.14,15 after administration of naloxone , the mice were placed in transparent plastic cylinders , and the number of jumps during the following 15 minutes was counted . \n all data are expressed as the mean standard error of the mean , unless otherwise noted . \n data for mechanical sensitivity , thermal sensitivity , tail - flick response , and dependence were analyzed by two - way analysis of variance followed by the bonferroni post hoc test for multiple comparisons . \n simple comparisons of two groups involved unpaired t - testing with two - tailed p values . \n body weights at the time of experimentation were compared for the groups treated with high and low methyl donor diets . \n although both diets were nutritionally complete , we sought to determine if any significant differences in growth rates would be present . \n for both methyl donor treatment protocols ( perinatal and postweaning ) , the mice reached the same weights as shown in figure 1 . \n the average weights of the perinatal animals were 25.88 g and 25.99 g in the groups treated with high and low methyl donor diets , respectively ( p > 0.05 ) , and the average weights of post - weaning animals were 23.25 g and 22.88 g , respectively ( p > 0.05 ) . \n we surveyed a group of clinically relevant opioid response phenotypes in mice exposed to high versus low methyl donor diets in the perinatal period . \n the mice were then tested at 8 weeks of age , approximately 5 weeks after beginning a standard laboratory diet . \n first , we compared baseline mechanical and thermal nociceptive thresholds , as shown in figure 2a and b. the mechanical thresholds at baseline were 1.001 g and 1.093 g , respectively , in the high and low methyl donor diet groups , and thermal nociceptive thresholds were 11.18 seconds and 11.68 seconds , respectively . \n these did not differ between the different dietary groups ( p > 0.05 ) , although the high methyl donor diet trended towards enhanced sensitivity . \n after completing a 4-day ascending morphine treatment protocol , used in several previous studies,13 the mechanical thresholds dramatically decreased to 0.2238 g and 0.3075 g , respectively , in the high and low methyl donor diet groups ( f1 , 28 = 134.42 , p < 0.0001 ) , and thermal thresholds were significantly reduced to 9.651 seconds and 9.739 seconds ( f1 , 28 = 11.91 , p = 0.0018 ) . \n however , the mechanical and thermal sensitivity induced by morphine treatment did not show significant differences between the dietary groups , as shown in figure 2a and b. the analgesic effects of morphine were compared between groups of mice receiving high versus low methyl donor diets in the perinatal period . across the range of morphine doses used \n , acute opioid administration induced dose - response analgesic efficacies obtained using the tail - flick test before chronic morphine treatment , but these were not significantly different between the high and low methyl donor diet groups ( p > 0.05 ) as shown in figure 3a . when the dose - response relationships were assessed after completing the 4-day ascending morphine treatment protocol , \n significant tolerance was observed as expected , but the degree of tolerance was indistinguishable between the dietary groups ( p > 0.05 for all doses , figure 3a ) . \n as shown in figure 4 , mice exposed perinatally to a high methyl donor diet showed significantly more jumping behavior than the low methyl donor - treated animals ( p < 0.05 ) . \n the jumping frequencies were 125.1 and 81.5 per 15 minutes , respectively , in the high and low methyl donor diet groups . \n the same battery of behavioral testing described for the perinatally treated mice was used on the mice starting on methyl donor altered dietary treatment after weaning . in this case , the switch from standard to supplemented or deficient chow was made 5 weeks before experimentation , and the mice received the modified diet throughout the period of testing . \n again , no statistically significant differences were noted in baseline nociceptive sensitivity to thermal and mechanical stimuli ( figure 2c and d ) . \n the mechanical thresholds at baseline were 1.004 g and 1.111 g , respectively , in the high and low methyl donor diet groups , and thermal nociceptive thresholds were 10.95 seconds and 10.70 seconds , respectively . \n likewise , no differences were noted in thermal or mechanical responses after 4 days of morphine administration between the high and low methyl donor diet treatment groups ( p > 0.05 ) , although chronic morphine treatment induced significant mechanical allodynia , but not thermal hyperalgesia . \n however , we did measure a significant difference between dietary groups in analgesic response to the lowest ( 1 mg / kg ) dose of morphine used in these experiments in opioid - nave mice ( p < 0.05 ) , as shown in figure 3b . \n the dose - response relationships were equivalent after 4 days of morphine administration for the two dietary groups . \n the jumping frequencies were 102.0 and 118.6 per 15 minutes , respectively , in the high and low methyl donor diet groups . \n body weights at the time of experimentation were compared for the groups treated with high and low methyl donor diets . \n although both diets were nutritionally complete , we sought to determine if any significant differences in growth rates would be present . \n for both methyl donor treatment protocols ( perinatal and postweaning ) , the mice reached the same weights as shown in figure 1 . \n the average weights of the perinatal animals were 25.88 g and 25.99 g in the groups treated with high and low methyl donor diets , respectively ( p > 0.05 ) , and the average weights of post - weaning animals were 23.25 g and 22.88 g , respectively ( p > 0.05 ) . \n we surveyed a group of clinically relevant opioid response phenotypes in mice exposed to high versus low methyl donor diets in the perinatal period . \n the mice were then tested at 8 weeks of age , approximately 5 weeks after beginning a standard laboratory diet . \n first , we compared baseline mechanical and thermal nociceptive thresholds , as shown in figure 2a and b. the mechanical thresholds at baseline were 1.001 g and 1.093 g , respectively , in the high and low methyl donor diet groups , and thermal nociceptive thresholds were 11.18 seconds and 11.68 seconds , respectively . \n these did not differ between the different dietary groups ( p > 0.05 ) , although the high methyl donor diet trended towards enhanced sensitivity . after completing a 4-day ascending morphine treatment protocol , used in several previous studies,13 the mechanical thresholds dramatically decreased to 0.2238 g and 0.3075 g , respectively , in the high and low methyl donor diet groups ( f1 , 28 = 134.42 , p < 0.0001 ) , and thermal thresholds were significantly reduced to 9.651 seconds and 9.739 seconds ( f1 , 28 = 11.91 , p = 0.0018 ) . \n however , the mechanical and thermal sensitivity induced by morphine treatment did not show significant differences between the dietary groups , as shown in figure 2a and b. the analgesic effects of morphine were compared between groups of mice receiving high versus low methyl donor diets in the perinatal period . across the range of morphine doses \n used , acute opioid administration induced dose - response analgesic efficacies obtained using the tail - flick test before chronic morphine treatment , but these were not significantly different between the high and low methyl donor diet groups ( p > 0.05 ) as shown in figure 3a . when the dose - response relationships were assessed after completing the 4-day ascending morphine treatment protocol , \n significant tolerance was observed as expected , but the degree of tolerance was indistinguishable between the dietary groups ( p > 0.05 for all doses , figure 3a ) . \n as shown in figure 4 , mice exposed perinatally to a high methyl donor diet showed significantly more jumping behavior than the low methyl donor - treated animals ( p < 0.05 ) . \n the jumping frequencies were 125.1 and 81.5 per 15 minutes , respectively , in the high and low methyl donor diet groups . \n the same battery of behavioral testing described for the perinatally treated mice was used on the mice starting on methyl donor altered dietary treatment after weaning . in this case , the switch from standard to supplemented or deficient chow was made 5 weeks before experimentation , and the mice received the modified diet throughout the period of testing . \n again , no statistically significant differences were noted in baseline nociceptive sensitivity to thermal and mechanical stimuli ( figure 2c and d ) . \n the mechanical thresholds at baseline were 1.004 g and 1.111 g , respectively , in the high and low methyl donor diet groups , and thermal nociceptive thresholds were 10.95 seconds and 10.70 seconds , respectively . \n likewise , no differences were noted in thermal or mechanical responses after 4 days of morphine administration between the high and low methyl donor diet treatment groups ( p > 0.05 ) , although chronic morphine treatment induced significant mechanical allodynia , but not thermal hyperalgesia . \n however , we did measure a significant difference between dietary groups in analgesic response to the lowest ( 1 mg / kg ) dose of morphine used in these experiments in opioid - nave mice ( p < 0.05 ) , as shown in figure 3b . \n the dose - response relationships were equivalent after 4 days of morphine administration for the two dietary groups . \n the jumping frequencies were 102.0 and 118.6 per 15 minutes , respectively , in the high and low methyl donor diet groups . \n although many mechanisms are involved in these differences , long - term and even transgenerational changes in dna methylation can be induced by exposure to diets high in fat or methyl donating compounds early in life . \n epigenetic factors are known to control opioid responses under other conditions.16 in our experiments , we adopted a well established opioid response and adaptation paradigm to answer the question of whether using a dietary protocol shown by others to alter dna methylation and inflammation we would observe changes in baseline opioid responsiveness or the propensity to develop opioid adaptations , like opioid - induced hyperalgesia , tolerance , and physical dependence.7 these dietary maneuvers , whether applied in early or later life , did not lead to gross differences in growth or development . \n overall , we found only a few specific differences in opioid responses , although these may indicate possible dietary effects on pathways controlling two types of opioid responses , ie , analgesia and physical dependence . \n thus , it appears that while this specific set of dietary factors may alter opioid adaptations to a limited extent , there are likely to be other environmental factors contributing as well . \n perhaps the most significant of our findings was that methyl donor supplementation of dams throughout pregnancy and continuing until weaning altered expression of physical dependence on morphine 6 weeks later . \n similar dietary treatments have been linked to sustained effects on the coat color of the offspring and the morphology of the animals tails through altered methylation of specific alleles,17 although the number of affected alleles is much larger than represented in these two examples.7 limited information suggests a role for perinatal exposure to methyl donors in the control of higher neurological function . \n one example is the observation that feeding rat dams a methyl - deficient diet caused increased anxiety and enhanced learning in the offspring.18 the dietary effects of methyl donor depletion or supplementation on pain and opioid pharmacology have been largely unexplored to this point . given the very prominent role methylation has as an epigenetic mechanism relevant to neurobiology , this may be a productive area of investigation . \n it is clear that the methylation patterns of many genes related to pain , opioid analgesia , and physical dependence are controlled by dna methylation . \n most studies in this area have examined the degree of methylation of cytosine - phosphate - guanine islands in the promoter regions of specific genes . \n these areas have been the focus of research because enhanced methylation of cytosine - phosphate - guanine islands generally leads to suppression of transcriptional activity . \n examples of genes controlled by dna methylation with established roles in opioid physical dependence are the -opioid receptor , prodynorphin , and brain - derived neurotrophic factor genes.1921 despite the results of these studies showing that altered methylation can control gene expression under specific circumstances , it is important to recognize that methylation patterns vary widely between different areas of the nervous system . \n thus , studies targeted to understanding methylation differences and gene expression related to specific phenotypes should be conducted in functionally relevant tissues . in the case of physical opioid dependence , \n a phenotype observed to be altered by dietary changes in methyl donor content , centers in the central nervous system that might be analyzed include the ventral tegmental area , locus coeruleus , and the ventral striatum , because these are brain areas related to addiction and dependence . on the other hand , our dietary data do not allow us to exclude arbitrarily other sites of opioid receptor expression , such as the spinal cord or even peripheral locations . \n additional tools and approaches are available , including the possibility of comparing methylation in strains of mice developing differing degrees of dependence , using transgenic mice deficient in dna methylation enzymes , or by the stereotactic delivery of methylation - modulating agents . \n dietary factors are becoming increasingly associated with altering developmental characteristics of animals , behavioral traits , and the propensity to contract specific diseases . \n given the very diverse dietary patterns of humans , including ones involving the consumption of large amounts of fat or supplements such as folate linked to changes in dna methylation , understanding the consequences for responses to therapeutic and recreational drugs is very important . \n our findings suggest that the examination of dna methylation patterns in specific brain regions linked to opioid analgesia and dependence may provide specific explanations for the dietary effects observed in this study .", "role": "user" }, { "content": "backgroundlarge interindividual differences in clinical responses to opioids and the variable susceptibility to abuse of this class of drugs make their use problematic . \n we lack a full understanding of the factors responsible for these differences . \n dietary factors including methyl donor content have been noted to alter multiple physiological and behavioral characteristics of laboratory animals . \n the purpose of this research was to determine the effects of dietary methyl donor content on opioid responses in mice.methodsgroups of male c57bl/6j mice were treated with high and low methyl donor diets either in the perinatal period or after weaning . \n analgesic responses to morphine , as well as tolerance , opioid - induced hyperalgesia , and physical dependence were assessed.resultsmice fed high and low methyl donor diets showed equal weight gain over the course of the experiments . \n exposure to a high methyl donor diet in the perinatal period enhanced physical dependence . \n dietary methyl donor content also altered analgesic responses to low doses of morphine when the dietary treatments were given to the mice after weaning . \n opioid - induced hyperalgesia was unaltered by dietary methyl donor content.conclusionhigh and low methyl donor diet treatment has selective effects on opioid responses depending on the timing of exposure . \n these findings suggest that examination of dna methylation patterns in specific brain regions linked to opioid analgesia and dependence may provide specific explanations for dietary effects on opioid responses .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: there have been only few events in the history of molecular biology that could be compared with the discovery of micro rnas ( mirnas ) and their roles in cell physiology and the pathogenesis of human diseases . \n mirnas are a group of approximately 20 to 22 nucleotides noncoding rnas and have been proven to regulate gene expression at the posttranscriptional level . \n in addition , mirnas exhibit tissue - specific or developmental stage - specific expression patterns and are associated with diverse biological events such as cell growth , apoptosis , cell differentiation , cancer , and autoimmune arthritis . rheumatoid arthritis ( ra ) \n is a most common autoimmune disease that affects 0.5% to 2.0% of the human population worldwide . \n progression of ra will finally lead to joint destruction , functional disability , and sometimes death . \n however , the etiology and pathogenesis of ra remain largely unknown , and thus there are no satisfactory therapeutic strategies to cure this disease so far . \n it is well known that the pathology of ra is characterized by synovial lining cell hyperplasia and irreversible joint destruction because of chronic synovial inflammation . \n resident cells in rheumatoid joints , such as ra synovial fibroblasts and fibroblast - like synoviocytes ( fls ) , play a crucial role in ra . \n these cells show an intrinsically activated and aggressive phenotype , which results in the increased production of matrix metalloproteinases ( mmps ) and adhesion molecules that play a key role in joint bone destruction . in the past few years , the importance of mirnas in the pathogenesis of ra has been elucidated . \n mirnas have been demonstrated to play an important role in inflammatory responses , cell proliferation of synoviocytes , and production of mmps in rheumatoid joints . \n for instance , recently a series of mirnas were identified to be dysregulated in cell subsets within the articular compartment of patients with ra , and more recently several studies suggest that mirnas regulate leukocyte activation and cytokine production that in turn contribute to the immunologic component of effector synovial pathology . \n importantly , therapeutic trials aimed at targeting mirna in arthritis have been conducted in in vivo models . \n thus , targeting mirna will enable a new advanced strategy toward arthritis treatment . in this review \n , we analyzed the roles of mirnas in immune and inflammatory responses , as well as ra synovial phenotype including synovial hyperplasia and joint bone destruction . \n the study presented here is a literature review and it does not need any ethical approval \n . this study does not involve interaction with any human subjects and does not collect any identifiable private information . \n relevant literature focusing on the field of mirnas and ra was identified through searching in pubmed ( medline ) database by keywords microrna and arthritis from december 2007 to june 2015 . \n five independent investigators ( contributing authors ) , r - yh , x - mc , s - ly , y - hy , and yh , conducted the searching process . the experts in the field of mirnas , lh ( contributing author ) and c - jl ( acknowledged in the section of acknowledgment ) , as well as the experts in rheumatology ( contributing authors ) , q - ch , y - lc , and r - yh , were involved in the process of analyzing the role of mirnas in ra pathogenesis . \n relevant literature was chosen according to the objective of this review and the availability of full text . through regulating the expression of many genes , \n mirnas play a crucial role in maintaining immune system development and function , and may participate in the development of numerous autoimmune diseases . \n it is now clear that inflammatory cytokines , interleukin-17 ( il-17 ) for instance , promote inflammatory autoimmune diseases , and it has been found that 6 mirnas , let-7a , mir-26 , mir-146a / b , mir-150 , and mir-155 , are significantly up - regulated in the il-17 producing t cells . \n in addition , mir-146a , mir-155 , mir-132 , and mir-16 are increased in peripheral blood mononuclear cells ( pbmcs ) from ra patients , as compared with healthy control patients . \n the tissues or cells that are main sources of mirnas in ra are shown in table 1 . among those mirnas , \n mir-146a has been well elucidated to be a regulator of immune and inflammatory responses , and it has been demonstrated to be strongly expressed in synovial tissue , synoviocytes , pbmcs , and other il-17 expressing cells from patients with ra . by using quantitative reverse transcription - polymerase chain reaction ( qrt - pcr ) , a research team determined the expression of mir-146 in synovial tissues obtained from 5 patients with ra , 5 patients with osteoarthritis ( oa ) , and 1 normal patient . \n the results showed that mature mir-146a and primary mir-146a / b , company with tumor necrosis factor ( tnf)- , are over - expressed in ra synovial tissues , as compared with oa and normal synovial tissues . \n this study further demonstrated that primary mir-146a is mainly expressed in cells of the superficial and sublining layers in synovial tissues from ra patients . in this study , cells positive for mir-146a are primarily cd68 + macrophages . \n in addition , mir-146a is also expressed in several cd3 + t cell subsets and cd79a+ b cells . \n moreover , the expression profile of mirnas in cd4 + t cells from synovial fluid and peripheral blood of 33 patients with ra was determined in another study by microarray assay and validated by qrt - pcr analysis . \n the results showed that the expression of mir-146a is significantly up - regulated in cd4 + t cells of ra patients , and its level is positively correlated with the level of tnf-. importantly , tnf- is able to increase mir-146a expression in t lymphocyte cells . \n moreover , it is reported that over - expression of mir-146a can suppress apoptosis of jurkat t cells , an immortalized line of human t lymphocyte cells . \n transcriptome analysis of mir-146a over - expression in t cells has identified fas associated factor 1 as an mir-146a - regulated gene , which is critically involved in modulating t cell apoptosis . all together , these data strongly indicate that mir-146a is associated with inflammation and regulates cell proliferation of immune - regulated cells . thus , a positive role of mir-146a in immune and inflammatory responses of ra is revealed , and it may hold the potential to be novel target for ra therapy . tissues or cells that are main sources of mirnas in ra in addition to the therapeutic target , mir-146a could also be used as a biomarker for prognosis of ra , as the increased mir-146a is found to be positively correlated with tnf- and 2 disease activity indicators , erythrocyte sedimentation rate and disease activity score in 28 joints , in patients with ra . of note , several other mirnas have also been addressed to regulate immune or inflammatory responses in patients with ra ( table 2 ) . \n for example , it is reported that mir-19a / b can act as the negative regulators of inflammation in humans . \n in addition , mir-21 was demonstrated to have a role in maintaining the balance between immune activation and tolerance . \n recently , the gene encoding mir-323 - 3p , a biomarker in immune and inflammatory responses , was found to be increased in ra synovial fibroblast . \n in addition to these mirnas , mir-155 has powerful regulatory potential in a wide variety of immune cells . \n for example , it is reported that compared with pbmcs from ra , synovial fluid monocytes obtained from ra patients displayed higher levels of mir-155 . \n in addition , microarray analysis of mirnas expressed in synovial fibroblast treated with tnf- revealed a significant up - regulation of mir-155 , whereas repression of mir-155 in ra synovial cd14 + cells reduced expression of tnf-. these observations strongly suggest a positive correlation between mir-155 and inflammation in rheumatoid joints . \n moreover , mir-155-deficient mice showed the resistance to collagen - induced arthritis , with profound suppression of antigen - specific th17 cells and autoantibody responses , supporting a view of that mir-155 is essentially involved in the immune reactions leading to autoimmune arthritis \n . therefore , mir-155 may provide another novel target for the treatment of patients with ra . \n the further understanding the role of these mirnas could shed light on the cause and progression of ra and eventually lay the groundwork for therapeutic options . \n role of several well characterized mirnas in pathogenesis of ra synovial hyperplasia is a phenotypical manifestation of ra . \n resident cells in rheumatoid joints , synovial fibroblasts , and fls , in principle , are characterized by a resistance to apoptosis , and this contributes to tumor - like cell proliferation and the related synovial hyperplasia . \n proliferation of ra resident cells plays a crucial role in the progression of ra , as these cells produce inflammatory cytokines , chemokines , and angiogenic factors , which are critically involved in inflammatory responses and joint destruction in patients with ra . \n several lines of evidence have suggested the role of mirnas in proliferation of resident cells in rheumatoid joints . \n for instance , it is found that basal expression level of mir-34a is reduced in ra synovial fibroblasts from ra patients compared with oa patients , and importantly the decreased expression of mir-34a results in up - regulation of its direct target x - linked inhibitor of apoptosis protein , thereby contributing to the resistance of ra synovial fibroblasts to apoptosis . on the contrary , \n mir-15a is reported to induce cell apoptosis by negatively regulating the expression of b - cell lymphoma 2 ( bcl-2 ) , which suppresses the apoptotic processes . in this study , \n nagata et al established a model of autoantibody - mediated arthritis in male dba/1j mice . \n the double - stranded mir-15a was injected into the knee joint , and they found that bcl-2 protein was down - regulated and the expression of caspase-3 was increased as compared with that in the control group . \n furthermore , in another study , by using quantitative stem - loop rt - pcr , synoviocytes derived from surgical specimens obtained from ra patients were compared with those obtained from oa patients for the expression of a panel of 156 mirnas . \n the results showed the dramatical decrease of mir-124a in ra synoviocytes as compared with oa synoviocytes . \n the transfection of precursor mir-124a into ra synoviocytes significantly suppressed cell proliferation and arrested the cell cycle at the g1 phase . \n therefore , mir-34a , mir-15a , and mir-124a are all the negative regulators for synovial hyperplasia in patients with ra ( table 2 ) . \n joint destruction is a frequent and clinically serious event in patients with ra , and it is closely related to synovial hyperplasia and joint inflammation . \n t lymphocytes , monocytes , and synovial fibroblast have been identified as the sources of local joint destruction - related signals of osteoclast differentiation in ra patients . \n in addition , mmps are considered as the markers of joint damage progression of ra . over the past years , several mirnas related to osteoclastogenesis ( osteoclast generation ) and \n mmps release have been defined ( table 2 ) . for example , it is reported that the increased mir-146a inhibited bone destruction through suppressing osteoclastogenesis , and administration of double - stranded mir-146a prevented joint destruction in arthritic mice . because mir-146a is positively correlated with inflammatory responses and disease activity of ra , as stated above \n , the negative role of mir-146a in joint destruction makes it to be a double - edged sword when considering using mir-146a as a diagnostic and therapeutic marker ( figure 1 ) . \n these mirnas are positively correlated with disease activity through stimulating inflammatory response . on the contrary \n the opposite roles of mirnas give us a lesson to focus more carefully on therapeutic and diagnostic applications of these mirnas in ra . \n mir-146a , 155 , and 223 have opposite roles in regulating ra pathogenesis . these mirnas \n the opposite roles of mirnas give us a lesson to focus more carefully on therapeutic and diagnostic applications of these mirnas in ra . \n there is another example for the opposite roles of mirna in pathogenesis of ra ( table 2 ) . \n two research teams focusing on the molecular mechanisms mediated by mir-223 , but 2 stories were developed in opposite ways . \n one team demonstrated that mir-223 is intensely expressed in the synovium of patients with ra , and over - expression of mir-223 suppresses osteoclastogenesis in vitro , whereas another team showed that lentivirus - mediated silencing of mir-223 can reduce osteoclastogenesis and bone erosion of mice arthritis induced by collagen . \n therefore , the question raised is why there are opposite roles of 1 mirna in the pathogenesis of bone destruction of ra ? there should be more researches in this field to clarify the complexity of mirnas functions . \n the complexity of mirnas functions is also supported by the opposite roles of mir-155 in joint destruction of ra ( table 2 ) . \n it is demonstrated that enforced expression of mir-155 in ra synovial fibroblasts suppressed the induction of mmp-3 and mmp-1 by toll - like receptor ligands and cytokines , indicating a protective role of mir-155 in joint destruction of ra . \n however , in a model of k / bxn serum - transfer arthritis , the deficiency of mir-155 significantly reduced local bone destruction , attributed to reduced generation of osteoclasts , although the severity of joint inflammation was similar to that in wild - type mice . \n compared with those mirnas , roles of mir-19a / b and mir-203 are not paradox in bone destruction pathology of ra ( table 2 ) . \n ra fls plays a key role in joint destruction and is believed to spread ra to unaffected joints . by using the mirna microarray analysis , philippe et al demonstrated down - regulation of mir-19b in activated ra fls . mir-19b and mir-19a belong to the same cluster . \n transfection of ra fls with mir-19a / b mimics dramatically decreased the release of il-6 and mmp-3 , suggesting a role of mir-19a / b in protecting ra patients from joint inflammation and destruction . \n in addition , it is reported that the expression of mir-203 is higher in ra synovial fibroblasts than in oa synoviocytes or fibroblasts from healthy donors . \n the enforced levels of mir-203 lead to increased secretion of mmp-1 and il-6 via the nuclear factor ( nf)-b pathway , and thereby contributing to the activated synovial phenotype of ra . \n the opposite effects of mir-19a / b and mir-203 in joint destruction are therefore revealed . \n through regulating the expression of many genes , mirnas play a crucial role in maintaining immune system development and function , and may participate in the development of numerous autoimmune diseases . \n it is now clear that inflammatory cytokines , interleukin-17 ( il-17 ) for instance , promote inflammatory autoimmune diseases , and it has been found that 6 mirnas , let-7a , mir-26 , mir-146a / b , mir-150 , and mir-155 , are significantly up - regulated in the il-17 producing t cells . \n in addition , mir-146a , mir-155 , mir-132 , and mir-16 are increased in peripheral blood mononuclear cells ( pbmcs ) from ra patients , as compared with healthy control patients . \n the tissues or cells that are main sources of mirnas in ra are shown in table 1 . among those mirnas \n , mir-146a has been well elucidated to be a regulator of immune and inflammatory responses , and it has been demonstrated to be strongly expressed in synovial tissue , synoviocytes , pbmcs , and other il-17 expressing cells from patients with ra . by using quantitative reverse transcription - polymerase chain reaction ( qrt - pcr ) , a research team determined the expression of mir-146 in synovial tissues obtained from 5 patients with ra , 5 patients with osteoarthritis ( oa ) , and 1 normal patient . \n the results showed that mature mir-146a and primary mir-146a / b , company with tumor necrosis factor ( tnf)- , are over - expressed in ra synovial tissues , as compared with oa and normal synovial tissues . \n this study further demonstrated that primary mir-146a is mainly expressed in cells of the superficial and sublining layers in synovial tissues from ra patients . in this study , cells positive for mir-146a are primarily cd68 + macrophages . \n in addition , mir-146a is also expressed in several cd3 + t cell subsets and cd79a+ b cells . \n moreover , the expression profile of mirnas in cd4 + t cells from synovial fluid and peripheral blood of 33 patients with ra was determined in another study by microarray assay and validated by qrt - pcr analysis . \n the results showed that the expression of mir-146a is significantly up - regulated in cd4 + t cells of ra patients , and its level is positively correlated with the level of tnf-. importantly , tnf- is able to increase mir-146a expression in t lymphocyte cells . \n moreover , it is reported that over - expression of mir-146a can suppress apoptosis of jurkat t cells , an immortalized line of human t lymphocyte cells . \n transcriptome analysis of mir-146a over - expression in t cells has identified fas associated factor 1 as an mir-146a - regulated gene , which is critically involved in modulating t cell apoptosis . \n all together , these data strongly indicate that mir-146a is associated with inflammation and regulates cell proliferation of immune - regulated cells . \n thus , a positive role of mir-146a in immune and inflammatory responses of ra is revealed , and it may hold the potential to be novel target for ra therapy . \n tissues or cells that are main sources of mirnas in ra in addition to the therapeutic target , mir-146a could also be used as a biomarker for prognosis of ra , as the increased mir-146a is found to be positively correlated with tnf- and 2 disease activity indicators , erythrocyte sedimentation rate and disease activity score in 28 joints , in patients with ra . of note , \n several other mirnas have also been addressed to regulate immune or inflammatory responses in patients with ra ( table 2 ) . \n for example , it is reported that mir-19a / b can act as the negative regulators of inflammation in humans . \n in addition , mir-21 was demonstrated to have a role in maintaining the balance between immune activation and tolerance . \n recently , the gene encoding mir-323 - 3p , a biomarker in immune and inflammatory responses , was found to be increased in ra synovial fibroblast . \n in addition to these mirnas , mir-155 has powerful regulatory potential in a wide variety of immune cells . \n for example , it is reported that compared with pbmcs from ra , synovial fluid monocytes obtained from ra patients displayed higher levels of mir-155 . in addition \n , microarray analysis of mirnas expressed in synovial fibroblast treated with tnf- revealed a significant up - regulation of mir-155 , whereas repression of mir-155 in ra synovial cd14 + cells reduced expression of tnf-. these observations strongly suggest a positive correlation between mir-155 and inflammation in rheumatoid joints . \n moreover , mir-155-deficient mice showed the resistance to collagen - induced arthritis , with profound suppression of antigen - specific th17 cells and autoantibody responses , supporting a view of that mir-155 is essentially involved in the immune reactions leading to autoimmune arthritis . \n therefore , mir-155 may provide another novel target for the treatment of patients with ra . \n the further understanding the role of these mirnas could shed light on the cause and progression of ra and eventually lay the groundwork for therapeutic options . \n resident cells in rheumatoid joints , synovial fibroblasts , and fls , in principle , are characterized by a resistance to apoptosis , and this contributes to tumor - like cell proliferation and the related synovial hyperplasia . \n proliferation of ra resident cells plays a crucial role in the progression of ra , as these cells produce inflammatory cytokines , chemokines , and angiogenic factors , which are critically involved in inflammatory responses and joint destruction in patients with ra . \n several lines of evidence have suggested the role of mirnas in proliferation of resident cells in rheumatoid joints . \n for instance , it is found that basal expression level of mir-34a is reduced in ra synovial fibroblasts from ra patients compared with oa patients , and importantly the decreased expression of mir-34a results in up - regulation of its direct target x - linked inhibitor of apoptosis protein , thereby contributing to the resistance of ra synovial fibroblasts to apoptosis . on the contrary , \n mir-15a is reported to induce cell apoptosis by negatively regulating the expression of b - cell lymphoma 2 ( bcl-2 ) , which suppresses the apoptotic processes . in this study , \n nagata et al established a model of autoantibody - mediated arthritis in male dba/1j mice . \n the double - stranded mir-15a was injected into the knee joint , and they found that bcl-2 protein was down - regulated and the expression of caspase-3 was increased as compared with that in the control group . \n furthermore , in another study , by using quantitative stem - loop rt - pcr , synoviocytes derived from surgical specimens obtained from ra patients were compared with those obtained from oa patients for the expression of a panel of 156 mirnas . \n the results showed the dramatical decrease of mir-124a in ra synoviocytes as compared with oa synoviocytes . \n the transfection of precursor mir-124a into ra synoviocytes significantly suppressed cell proliferation and arrested the cell cycle at the g1 phase . \n therefore , mir-34a , mir-15a , and mir-124a are all the negative regulators for synovial hyperplasia in patients with ra ( table 2 ) . \n joint destruction is a frequent and clinically serious event in patients with ra , and it is closely related to synovial hyperplasia and joint inflammation . \n t lymphocytes , monocytes , and synovial fibroblast have been identified as the sources of local joint destruction - related signals of osteoclast differentiation in ra patients . \n in addition , mmps are considered as the markers of joint damage progression of ra . over the past years \n , several mirnas related to osteoclastogenesis ( osteoclast generation ) and mmps release have been defined ( table 2 ) . \n for example , it is reported that the increased mir-146a inhibited bone destruction through suppressing osteoclastogenesis , and administration of double - stranded mir-146a prevented joint destruction in arthritic mice . because mir-146a is positively correlated with inflammatory responses and disease activity of ra , as stated above , the negative role of mir-146a in joint destruction makes it to be a double - edged sword when considering using mir-146a as a diagnostic and therapeutic marker ( figure 1 ) . figure 1double - edged sword \n these mirnas are positively correlated with disease activity through stimulating inflammatory response . on the contrary \n the opposite roles of mirnas give us a lesson to focus more carefully on therapeutic and diagnostic applications of these mirnas in ra . \n these mirnas are positively correlated with disease activity through stimulating inflammatory response . on the contrary \n the opposite roles of mirnas give us a lesson to focus more carefully on therapeutic and diagnostic applications of these mirnas in ra . \n there is another example for the opposite roles of mirna in pathogenesis of ra ( table 2 ) . \n two research teams focusing on the molecular mechanisms mediated by mir-223 , but 2 stories were developed in opposite ways . \n one team demonstrated that mir-223 is intensely expressed in the synovium of patients with ra , and over - expression of mir-223 suppresses osteoclastogenesis in vitro , whereas another team showed that lentivirus - mediated silencing of mir-223 can reduce osteoclastogenesis and bone erosion of mice arthritis induced by collagen . \n therefore , the question raised is why there are opposite roles of 1 mirna in the pathogenesis of bone destruction of ra ? \n there should be more researches in this field to clarify the complexity of mirnas functions . \n the complexity of mirnas functions is also supported by the opposite roles of mir-155 in joint destruction of ra ( table 2 ) . \n it is demonstrated that enforced expression of mir-155 in ra synovial fibroblasts suppressed the induction of mmp-3 and mmp-1 by toll - like receptor ligands and cytokines , indicating a protective role of mir-155 in joint destruction of ra . \n however , in a model of k / bxn serum - transfer arthritis , the deficiency of mir-155 significantly reduced local bone destruction , attributed to reduced generation of osteoclasts , although the severity of joint inflammation was similar to that in wild - type mice . \n compared with those mirnas , roles of mir-19a / b and mir-203 are not paradox in bone destruction pathology of ra ( table 2 ) . \n ra fls plays a key role in joint destruction and is believed to spread ra to unaffected joints . by using the mirna microarray analysis , philippe et al demonstrated down - regulation of mir-19b in activated ra fls . mir-19b and mir-19a belong to the same cluster . \n transfection of ra fls with mir-19a / b mimics dramatically decreased the release of il-6 and mmp-3 , suggesting a role of mir-19a / b in protecting ra patients from joint inflammation and destruction . \n in addition , it is reported that the expression of mir-203 is higher in ra synovial fibroblasts than in oa synoviocytes or fibroblasts from healthy donors . \n the enforced levels of mir-203 lead to increased secretion of mmp-1 and il-6 via the nuclear factor ( nf)-b pathway , and thereby contributing to the activated synovial phenotype of ra . \n the opposite effects of mir-19a / b and mir-203 in joint destruction are therefore revealed . \n in summary , although only a very small fraction of mirnas is characterized in the pathogenesis of ra ( table 2 ) , evidence in support of the therapeutic potential of mirna - based strategies is growing , as demonstrated by several therapeutic trials aimed at targeting mirna in in vivo models of arthritis . of note , \n in addition to promoting cytokines production , the expression of mir-146a / b can be markedly up - regulated in ra synovial fibroblasts following stimulation with tnf- and il-1. moreover , expression of mir-155 in ra synovial fibroblasts can also be induced by tnf- and il-1. thus , it appears that not only mirnas contribute broadly and actively to various aspects of ra pathogenesis , but also the inflammatory milieu may alter mirnas expression profiles in resident cells of ra joints ( figure 2 ) . \n furthermore , there is a recent study demonstrating the roles of target mirnas in modulating nf-b activity and restoring transrepression of an nf-b reporter by dexamethasone , suggesting that , as a widely expressed transcription factor , nf-b may be responsible for the production of cytokines and other inflammatory factors by mirnas in autoimmune arthritis . \n collectively , all the evidence presented here reveals a feedback loop for expression and functions of mirnas , by which mirnas contribute to inflammatory reactions , synovial phenotype , and bone destruction in rheumatoid joints ( figure 2 ) . \n roles of several mirnas in t cell proliferation , apoptosis , and cell cycle of synovial cells and joint destruction are depicted . \n importantly , there appears to have a feedback loop by which mirnas contribute to inflammatory reactions and synovial phenotype in rheumatoid joints . through nf-b pathway , some mirnas such as mir-146a and \n mir-155 may stimulate the release of pro - inflammatory cytokines such as tnf- , il-1 , and il-17 . as the inflammatory mediators \n , these cytokines can induce lymphocytes , resident synovial cells and other inflammatory cells to produce mirnas that related to disease activity of ra patients . \n bcl-2 = b - cell lymphoma 2 , faf1 = fas associated factor 1 , mmps = matrix metalloproteinases , nf-b = nuclear factorb , xiap = x - linked inhibitor of apoptosis protein . \n roles of several mirnas in t cell proliferation , apoptosis , and cell cycle of synovial cells and joint destruction are depicted . \n importantly , there appears to have a feedback loop by which mirnas contribute to inflammatory reactions and synovial phenotype in rheumatoid joints . through nf-b pathway , some mirnas such as mir-146a and \n mir-155 may stimulate the release of pro - inflammatory cytokines such as tnf- , il-1 , and il-17 . \n as the inflammatory mediators , these cytokines can induce lymphocytes , resident synovial cells and other inflammatory cells to produce mirnas that related to disease activity of ra patients . \n bcl-2 = b - cell lymphoma 2 , faf1 = fas associated factor 1 , mmps = matrix metalloproteinases , nf-b = nuclear factorb , xiap = x - linked inhibitor of apoptosis protein . \n although several mirnas have been found to contribute to various aspects of ra pathogenesis and hold great therapeutic potential , unique mirna signatures in ra are not found yet . \n for example , it has been demonstrated that mir-155 has powerful regulatory potential in a wide variety of immune cells through targeting specific mrnas . \n in addition , mir-323 - 3p is found to be increased in ra , but it is also a biomarker in immune and inflammatory responses . because pathogenic immune cells and inflammatory responses play a pivotal role in pathogenesis of many types of autoimmune diseases , these mirnas are not specific for ra pathogenesis , which is further supported by a recent study showing a positive association of a genetic variant in a mirna-146a target with psoriatic arthritis . \n therefore , discovery of perfect biomarkers for ra diagnosis and treatment is still a dream of rheumatologists . \n it is well known that mirnas are one of species of small rna and belong to family of noncoding rnas . \n recent reports have described an intricate interplay among diverse rna species , including protein - coding mrnas and noncoding rnas such as long noncoding rnas , pseudogenes , and circular rnas . \n these rna transcripts communicate with and co - regulate each other by competing for binding to shared mirnas . \n understanding the cross - talk between mirnas and other noncoding rnas will lead to the significant insight into gene regulatory networks implicated in the pathogenesis of ra . \n collectively , the identification of specific mirnas expression patterns in ra as well as a comprehensive understanding of the role of mirnas in ra pathogenesis offers promise of not only novel molecular diagnostic markers but also new gene therapy strategies for treating ra and other autoimmune arthritis . \n although several mirnas have been found to contribute to various aspects of ra pathogenesis and hold great therapeutic potential , unique mirna signatures in ra are not found yet . \n for example , it has been demonstrated that mir-155 has powerful regulatory potential in a wide variety of immune cells through targeting specific mrnas . \n in addition , mir-323 - 3p is found to be increased in ra , but it is also a biomarker in immune and inflammatory responses . because pathogenic immune cells and inflammatory responses play a pivotal role in pathogenesis of many types of autoimmune diseases , these mirnas are not specific for ra pathogenesis , which is further supported by a recent study showing a positive association of a genetic variant in a mirna-146a target with psoriatic arthritis . \n therefore , discovery of perfect biomarkers for ra diagnosis and treatment is still a dream of rheumatologists . \n it is well known that mirnas are one of species of small rna and belong to family of noncoding rnas . \n recent reports have described an intricate interplay among diverse rna species , including protein - coding mrnas and noncoding rnas such as long noncoding rnas , pseudogenes , and circular rnas . \n these rna transcripts communicate with and co - regulate each other by competing for binding to shared mirnas . \n understanding the cross - talk between mirnas and other noncoding rnas will lead to the significant insight into gene regulatory networks implicated in the pathogenesis of ra . \n collectively , the identification of specific mirnas expression patterns in ra as well as a comprehensive understanding of the role of mirnas in ra pathogenesis offers promise of not only novel molecular diagnostic markers but also new gene therapy strategies for treating ra and other autoimmune arthritis .", "role": "user" }, { "content": "abstractthe contributions of micro rnas ( mirnas ) to rheumatoid arthritis ( ra ) are beginning to be uncovered during the last decade . \n many studies in efforts to use mirnas as biomarkers in disease diagnosis , prognosis , and treatment are ongoing.we conducted a systematic literature review to reveal the role of mirnas in the pathogenesis of ra in order to inform future research.we analyzed all the literature which is searched by keywords microrna and \n arthritis in pubmed from december 2007 to june 2015 , and the references cited by the articles searched were also considered.relevant literature focusing on the field of mirnas and ra was identified . \n the searching process was conducted by 5 independent investigators . \n the experts in the field of mirnas and rheumatology were involved in the process of analyzing.relevant literature was analyzed according to the objective of this review and the availability of full text.the crucial role of mirnas in maintaining immune and inflammatory responses is revealed . \n in addition , it is now clear that mirnas are implicated in the development of ra synovial phenotype including synovial hyperplasia and joint destruction . \n intriguingly , the biomedical application of several mirnas may result in the effects of double - edged sword . \n moreover , there appears to have a feedback loop for expression of some mirnas related to disease activity in inflammatory milieu of rheumatoid joint.this review underscores the potential importance of mirnas to diagnosis , prognosis , and treatment of ra . \n further investigations are required to identify the unique mirnas signatures in ra and characterize the mechanisms mediated by mirnas in the pathology of ra .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: mild traumatic brain injury ( mtbi ) is common among military personnel and veterans who served in operations iraqi freedom and enduring freedom ( oif / oef ) . among soldiers deployed in oif , 22.8% had traumatic brain injury ( tbi ) , predominantly mtbi . while there is a general opinion that the prevalence of post - traumatic headaches is higher in association with combat mtbi than with mtbi sustained in a civilian setting , the data are not conclusive . a prospective controlled study of headaches in civilians who had traumatic injury compared 100 sequential patients with mtbi and 100 matched minor injury controls who had non - deceleration injuries ; 15% of those with mtbi had persistent post - traumatic headache at 3 months compared to 2% of the minor non - tbi injury controls . in contrast , a study of 340 oif / oef veterans found that 55% of the veterans had headaches when evaluated typically more than a year after the combat tbi . \n another study of 155 oif / oef veterans with combat mtbi found that 52% of the veterans had headaches that persisted for years after the last episode of tbi . \n the differences in the prevalence of headaches may be partly due to differences in sampling . \n the veterans in the two prior studies were receiving care from the department of veterans affairs , but not all veterans elect to receive care from the department of veterans affairs . \n it is possible that the veterans in the prior study represent enriched samples of veterans with medical issues . \n therefore , the veteran studies may over - represent the prevalence of headache . in a brigade combat team that was deployed in iraq for 1 year , \n 22.8% of soldiers had a physician - confirmed tbi , usually mtbi . among the soldiers with tbi , 81.3% reported headaches immediately after \n in another military study of headaches among 5270 soldiers returning from an oif / oef deployment , 1033 ( 19.6% ) had combat concussions , and among the group with mtbi , 97.8% reported headaches during the last 3 months of their deployment . \n the differences in prevalence of post - traumatic headaches based upon the first military study - 20.3% ( combat ) versus 15% ( civilian ) - is not significant , but the headache prevalence of 97.8% noted in the second study would have significantly exceeded the 15% prevalence found in civilians . \n the second study considered all headaches that occurred following tbi , with 42% of the post - traumatic headaches beginning more than 1 month after tbi . even if one only considered the prevalence of headache that began within 1 month of tbi in this study ( 57% ) , this would still have been significantly greater than the 15% civilian prevalence ( p < 0.001 ) . \n therefore , due to the variations in the findings of the military studies , it is uncertain whether post - traumatic headaches are more prevalent following combat mtbi . \n the study of the brigade combat team revealed that , after deployment , 39% of soldiers with tbi reported persistent post - concussion symptoms ( pcss ) and the military study of 5270 soldiers , also discussed above , found that at least 98% of soldiers had pcss in the last 3 months of deployment . \n the us institute of medicine recently reported an association between mtbi and the development of post - traumatic stress disorder ( ptsd ) for oif / oef military personnel . \n combat tbi occurs in situations likely to induce ptsd and those at risk for combat tbi are often exposed to many other psychologically traumatic events , such as injury or death of fellow soldiers as well as being under constant threat to their own lives [ 7 - 9 ] . \n symptoms associated with ptsd overlap with pcss ( figure 1 ) so that some pcss may be due to co - existent ptsd [ 4,8 - 10 ] . \n consequently , soldiers with mtbi can be returned quickly to combat stress , which will preclude a rest period that might aid recovery from mtbi . \n symptoms that are common to mtbi and ptsd include impaired concentration , tension headaches , mental slowness , and indecision . \n distinct features of ptsd include intrusive flashbacks , recurrent nightmares , hyperarousal , and social avoidance . distinct features of tbi include neurological deficits , seizures , and headaches with migraine features . \n the prevalence of ptsd following mtbi was 6% , which was about 1.9-fold higher ( odds ratio = 1.92 , 95% confidence interval = 1.08 - 3.40 ) than following trauma without mtbi . \n the reported prevalence of ptsd following combat mtbi appears to be greater than after civilian mtbi . about 40% of military personnel and veterans with combat - acquired mtbi have co - existent ptsd . among active duty military personnel deployed in iraq ( oif ) who had an episode of loss of consciousness , 43.9% had ptsd compared with 16.2% for soldiers with other injuries and 9.1% for soldiers with no injury . \n another study of 277 oif / oef veterans found that 18.8% had mtbi and that the veterans with mtbi were more likely to have ptsd than veterans who did not have mtbi . \n while these findings suggest that mtbi increases the likelihood of ptsd , they do not clarify the mechanisms . \n soldiers with mtbi were more likely to report persisting pcss than were soldiers with other injuries . \n . argue that the pcss are due to ptsd and depression , not mtbi . \n however , against this argument is the observation that 69% of veterans with mtbi who have pcss have neurological abnormalities on clinical examination . \n in addition , a recent study of oif / oef veterans with mtbi who had pcss ( with or without ptsd ) reported that they exhibited decreased cerebral metabolic rate of glucose in the cerebellum , pons , and medial temporal lobe . \n they also had subtle impairments in verbal fluency , cognitive processing speed , attention , and working memory , similar to those reported in the literature for patients with cerebellar lesions . \n the deficits in cerebellar metabolism and cognitive performance were felt by the authors to be manifestations of brain injury rather than ptsd and the cerebellum has not been noted to be a locus of abnormality in studies of individuals with ptsd without tbi ( see below ) . \n the presence of abnormalities on neurological examination , brain metabolism , and cognitive testing suggest that veterans with mtbi and pcss can have persistent brain injury . therefore , it may be more prudent to consider that both the ptsd and persisting brain injury are contributing to the pcss . \n abnormalities in white matter can be seen in individuals with mtbi using magnetic resonance imaging techniques such as diffusion tensor imaging . \n the extent of axonal injury is related to tbi severity , with severe tbi having more extensive axonal injury . \n additionally , individuals with mtbi can manifest abnormal foci of neuronal activity or cerebral blood flow . \n loci of injury or abnormal cerebral metabolism include the inferior medial frontal lobes , medial temporal lobes , occipital cortex , and cerebellum [ 7,15,16,19 - 22 ] . in individuals without tbi , \n ptsd is associated with abnormal cerebral activity involving the inferior frontal lobes and anterior medial temporal lobes . \n the areas of abnormal cerebral activity in the frontal and medial temporal lobes seen in ptsd overlap with the loci of injury identified in individuals with mtbi . \n therefore , the cerebral injury associated with mtbi may potentiate the development of ptsd in response to a traumatic event . \n the likelihood of an individual developing ptsd is influenced by many factors , including the character of the traumatic exposure and the individual 's psychological resiliency and educational history . \n although the physiological connections between mtbi and the genesis of ptsd have not been elucidated , studies of military combat mtbi and adult civilian tbi indicate that ptsd is associated with mtbi ( figure 2 ) . \n a study of civilian children involved in motor vehicle accidents did not find an association between mtbi and ptsd . \n cognitive impairment due to tbi may increase the risk for an individual to develop ptsd by compromising their ability to psychologically adjust to a traumatic event . following a traumatic event , several factors influence whether an individual develops ptsd . \n tbi may influence the likelihood of an individual developing ptsd following a traumatic event by compromising the ability of an individual to psychologically adjust to a traumatic event . \n while combat mild tbi appears to increase the likelihood of ptsd developing , severe tbi may reduce the likelihood of ptsd developing . \n there are several reasons why mtbi acquired in combat may be more likely to produce longer lasting or more persistent cerebral injury than civilian - acquired mtbi . \n military personnel in oif / oef often experience multiple mtbi events , creating the possibility of accumulation of injury . \n combat tbi caused by a blast is often associated with two almost simultaneous traumatic events to the brain . in combat , \n in addition , military personnel often experience additional head trauma from the explosion due to being thrown by the blast - wind , being impacted by shrapnel , or being involved in a motor vehicle accident associated with the explosion . \n civilian mtbi is usually associated with tension - type headaches , whereas the headaches reported following combat mtbi are more likely to have migraine features . \n the co - existence of mtbi and ptsd , which is frequently seen with combat mtbi , appears to increase the severity of pcss and the number of pcss that are endorsed [ 31 - 33 ] . \n impaired sleep due to ptsd may be partially responsible for the prolonged pcss . interrupted sleep due to nightmares \n prazosin successfully blocks nightmares and other sleep interruptions caused by ptsd . in an observational study of oif / oef veterans with mtbi due to combat explosions , prazosin treatment combined with sleep hygiene counseling was able to reduce pcs and improve cognitive functioning . \n combat mtbi is not an isolated condition ; it is often associated with ptsd and pain , particularly headaches with migraine features . \n it is critical to address the residual brain injury , pain , and psychological manifestations of ptsd . \n thus , improving sleep may be a good initial step in treating pcss due to mtbi and ptsd . in the aforementioned observational study , \n the combination of prazosin and sleep hygiene counseling was highly efficacious and well accepted by oif / oef veterans . \n ", "role": "user" }, { "content": "the setting of the trauma is a distinguishing feature between mild traumatic brain injury ( mtbi ; also called concussion ) that occurs in civilian settings compared with that occurring in combat . \n combat mtbi is frequently associated with a prolonged stress reaction , post - traumatic stress disorder ( ptsd ) . \n individuals with mtbi and ptsd from combat in operations iraqi freedom and enduring freedom often develop prolonged post - concussion symptoms ( pcss ) such as headache . \n both mtbi and ptsd may contribute to pcss . \n ptsd may worsen and prolong the pcss following mtbi by disrupting sleep . \n it is not known how mtbi predisposes an individual to develop ptsd .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: to date , over 300 candidate oncogenes and tumor suppressor genes have been proposed across multiple cancer types . \n identification of new oncogenes , tumor suppressor genes , and pathways has been greatly enabled by whole genome or exon dna sequencing and mrna profiling technologies . although either approach is quite useful , neither alone is sufficient to fully identify the causal or driver genes in a single tumor . as \n cancer is a disease of genomic instability , hundreds of genetic changes are observed in each tumor , with the majority being passenger rather than causal in nature . by definition , \n passenger mutations are neither diagnostic for the disease state , nor do they represent meaningful targets for drug discovery . therefore , simply measuring gene expression levels or cataloging dna mutations in a tumor is insufficient to understand the etiology of disease . \n a recent report describing the whole genome sequencing analysis of 11 breast and 11 colorectal cancers identified an average of 80 dna mutations that result in amino acid changes in a tumor . \n the identity and prevalence of individual mutations that drive critical pathways is variable from tumor to tumor . \n thus , the significance of these changes needs to be verified from the same sample with an alternative method of measurement that captures the phenotypic changes accompanying driver mutations . in an integrated analysis , whole genome mrna profiling and targeted dna analysis for over 200 glioblastoma samples successfully stratified each histologically defined glioblastoma subtype on the basis of association with known oncogene drivers . \n although this study was not designed to identify new oncogenes for glioblastoma , the association of pdgfra , egfr , and idh1 mutations with specific subtypes suggests that inhibitors for these targets should be positioned within known subtypes to achieve greater clinical efficacy . \n ironically , although the oncogenes myc and ras have clearly been identified as drivers of cancer and are therefore excellent theoretical targets for therapeutic intervention , a therapy that directly targets either of these proteins has not been delivered to patients , despite considerable efforts over the last 20 years in industry and academia . \n undruggable oncogene targets is to target not the oncogene itself , but the gain - of - function pathways that consist of downstream effectors for oncogene function . \n a universal output of pathway perturbation is altered gene expression , which can be measured on well - established platforms of microchip arrays . \n therefore , identifying pathway signatures that represent oncogene activation in a tumor setting may allow for identification of new targets in otherwise untractable pathways . in the case where a tumor is complex and driven by multiple oncogenic pathways \n , a whole genome approach will enable identification of all critical genes that are driving tumorigenesis . \n in this latter case , well defined gene - based pathway signatures can be used to assign both rationally designed mono and combination therapies , . \n although pathway signatures are complementary measures to genetic changes , they are also valuable tools in their own right . altered gene expression is a universal output of pathway perturbation . \n multiple methods for deriving pathway signatures from simultaneous whole genome mrna measurements have been developed over the last decade , with many pathway signatures published and validated as representative measures of variant biological processes . \n perhaps the disease most impacted by this approach is breast cancer , where multiple pathway signatures have been used to redefine the three major subclasses of disease ( as defined by fish status of her2 and ihc measurement of er and pr ) into four new categories : her2 , luminal a , luminal b , and basal . \n the latter three categories are defined by pathway signatures , which are currently being used as experimental biomarkers in clinical studies . \n the hope that these signatures will be used in clinical practice is encouraged by the 2007 food and drug administration approval of an assay for another pathway signature , the prognostic mammaprint assay . \n this landmark achievement is evidence that a multi - analyte measurement of gene expression can be executed with rigor and reproducibility to meet clinical regulatory requirements . \n perhaps the greatest value of pathway signatures is the ability to link complex preclinical biology with clinical biology . \n although simple cancers can be identified by single analyte biomarkers , either those that are already known or those that remain to be discovered , the more common and complex cases will require multi - analyte tools . \n the universal nature of microarray platforms has allowed for comprehensive measurement of genome expression in digital formats that enable identification of coordinated gene expression changes associated with different biological states and development of techniques to assign a numerical value to a pathway signature . \n the connectivity map , a post - array digital analysis tool , uses pathway signatures derived from microarray measurements to explain the mechanism of action for novel drug candidates , and multiple drug response signatures have been derived from comparing pre- and post - treatment samples in preclinical models . \n these signatures can then be tested from array profiles of tumor samples to identify patients with relevant biology another natural feature of measuring mrna that is distinct from tumor gene mapping is that this approach measures the influence of oncogenes and tumor suppressor genes in specific context and also integrates signaling between the tumor and its microenvironment . \n therefore , mrna measurement has the potential to measure any biology that may override genetic determinants . \n for example , a pathway signature derived from overexpression of the k - ras oncogene was used to identify tumors that have elevated pathway expression in the absence of the mutant oncogene , suggesting the presence of alternative and yet undiscovered drivers of disease . \n furthermore , as an example of measuring dominant signaling from the microenvironment , the mesenchymal subtype in the glioblastoma experiment mentioned earlier was dominated by a pathway signature that had significant overlap with immune regulation and was distinct from one found in normal brain tissue , suggesting the presence of pro - inflammatory cells in this subtype . \n the limited value of preclinical models of cancer is evidenced by the high response rate demonstrated in preclinical studies by clinical candidate molecules , followed by a high failure rate in the clinic due to lack of efficacy , . \n one way to improve these models is to better represent the heterogeneity of disease by moving a wide variety of tumor samples into preclinical platforms . \n derivation of primary tumor samples into novel in vivo models is a well - described method of creating new preclinical models of cancer . \n successful propagation of primary tumor samples as xenografts in immune - compromised mice varies from 10% to 30% , depending on the tumor type and technique used . \n if the same tumor samples that are fully characterized in this proposed study can also be propagated in vivo or ex vivo , functional studies with novel candidate therapies on samples with full genomic and genetic characterization will enable discovery of selection biomarkers to enrich for responder populations for these novel therapies . \n an example of a cancer that is prevalent in china with unmet medical need is gastric or gastrointestinal cancer . \n the prevalence of this disease is far greater in asia than in the west and is the second leading cause of cancer death in the world . \n currently , gastric cancers are stratified into two histological groups , diffuse - type and intestinal - type adenocarcinoma , and both categories are associated with chronic inflammation by h. pylori , a common stomach infection . \n multiple studies with small sets of tumor samples reveal the changes in oncogenes that have already been identified from other cancer types , including k - ras , braf and pi3k mutations , pten deletions , and met and her2 amplifications , which have all be observed in some clinical samples . \n these data , in combination with the identification of point mutations in the e - cadherin gene within a family with inherited predisposition for this disease , suggest critical roles in growth factor signaling and the wnt--catenin pathways . \n interestingly , outer membrane proteins of h. pylori have been shown to interact with proteins from both of these pathways . \n for the majority of this disease , however , no oncogene or pathway driver is known . \n standard of care for treatment in the us includes the use of cytotoxic therapies ( docetaxel , cisplatin , 5-fluorouracial ) and radiation , where 5-year overall survival is less than 25% for all patients and less than 4% for those with advanced stage disease . \n therefore , the majority of patients who are diagnosed with mid to late stage gastric cancer carry a disease that has both an unknown etiology and a dismal prognosis . it can be argued , then , that a non - hypothesis driven characterization of gastric cancer samples can lead to the identification of the unknown drivers of the majority of this disease . \n the unusual role of h. pylori in this disease warrants an investigation of the host - microbe relationship . \n genome - wide association studies to identify genomic vulnerabilities for this disease have been reported and are ongoing , but data sets composed of significant numbers of fully characterized tumor samples from gastric cancer patients are not yet available . \n cancers in chinese populations represent an unmet medical need . initial clinical evaluation of new therapies in cancers that are prevalent in the western population is the standard in pharmaceutical development and delays demonstration of their possible use in the asian population . we propose to accelerate the treatment of cancers in chinese populations by creating a comprehensive characterization of these diseases . \n the combination of both genotypic and phenotypic profiling should enable 1 ) identification of all candidate oncogene drivers and tumor suppressor genes by measuring all genetic changes in a single tumor ; 2 ) identification of aberrantly activated pathways that correspond to these genetic changes by using phenotypic whole genome profiling as well as biological measurements and statistical methods to identify causality ; and 3 ) discrimination between driver mutations and passenger mutations to identify new targets and biomarkers for drug discovery . to date , this approach has not be applied to cancers in chinese populations , as the deployment of both genotypic and phenotypic profiling technologies on a single patient sample is limited by patient sample size , the cost of deploying two expensive technologies on a single patient sample , and unavailability of systematic analytical methods and software that enables analysis of data from two different kinds of data sets . \n more recently , the development of quantitative rna sequencing , using second generation nucleic acid sequencing technology , offers the promise of improved dynamic range and fidelity of measurement for mrna , and enables simultaneous detection of genetic changes and relevant mrna gene expression levels . \n thus , the new development of accurate and quantitative rna sequencing technology is an attractive alternative for characterizing a biological sample using a single measurement , revealing both the candidate driver genes and activated pathways for this disease . \n most cancer patients do not respond to therapy or eventually develop a cancer that is resistant to current therapies . \n it is therefore reasonable to assume that these patients have cancers that are complex and are unlikely to be defined by a single analyte biomarker . \n the application of genomic methods to reveal both dna sequence and to calculate quantitative digital values for gene expression has the potential to improve our understanding of patient subpopulations with the most common and complex forms of these diseases . \n regardless of the technologies chosen to characterize patient samples , it is clear that an integrated whole genome and genomic approach , combining both dna and rna measurements , is critical to discovering the root causes of these complex and fatal disorders . \n these datasets will naturally attract rational drug discovery efforts , and derivation of new drug targets and clinical biomarkers will enable rapid demonstration of efficacy in a molecularly - defined subpopulation of responders to existing and future therapies . \n once completed , these datasets will reside in silico and in perpetuum , for scientists and oncologists to interpret and use to guide the rational implementation of novel treatments into effective standards of care .", "role": "user" }, { "content": "cancer is a collection of complex diseases in which cell proliferation and apoptosis are dysregulated due to the acquisition of genetic changes in cancer cells . \n these genetic changes , combined with the interrelated physiologic adaptations of neo - angiogenesis , recruitment of stromal support tissues , and suppression of immune recognition , are measurable characteristics in tumor gene expression profiles and biochemical pathways . \n these measures can lead to identification of disease drivers and , ultimately , can be used to assign therapy . with advances in rna sequencing technologies , \n the ability to simultaneously measure all genetic and gene expression changes with a single technology is now possible . \n the ability to create a comprehensive catalog of genotypic and phenotypic changes in a collection of histologically similar but otherwise distinct tumors should allow for a more precise positioning of existing targeted therapies and identification of new targets for intervention .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: acne vulgaris ( av ) is the commonest skin disorder , almost 80% of adolescents and young adults had ever suffer from av . \n pathogenesis of av had not been known clearly , but several studies had proved that dihydrotestosterone ( dht ) was the most influential androgen in av , mainly in women , there are correlation between dht and amount of av lesion in women . \n the consumption of soybean isoflavone in asian countries is 4 times higher as compared with western countries , mean of daily consumption in asian countries is 2445 mgs . \n the role of soybean isoflavone in androgen metabolism is to restrict the enzyme 3 - hydroxysteroid dehydrogenase ( 3 - hsd ) , 17 - hydroxysteroid dehydrogenase ( 17 - hsd ) and the enzyme 5-reductase . \n the association between consumption of soybean isoflavone and av is not known yet , so a study on the influence of supplementation of soybean isoflavone on women with av by investigating androgen hormone that has association with the amount of av lesion , then formulate the problem of whether supplementation of oral soybean isoflavone has influence on amount of lesion and dht hormone in women with av ? \n the purpose of this study is to prove that supplementation of oral soybean isoflavone has influence on the reduction of amount of av lesion and dht hormone , and that there are association between the 2 . \n this study can be of advantage in giving contribution to science and technology , and to increase the quality of healthcare service , and as a scientific contribution for the benefit of society . \n the major hypothesis of this study is that supplementation of oral soybean isoflavone has influence on av , whereas the minor hypothesis is that supplementation of 160 mgs of soybean isoflavone for 12 weeks will cause a difference in the amount of av lesion and dht level in person with av and that there are association between the 2 . \n the study design is true experimental clinical study using randomized pretest - posttest control group design . \n this study used dosage of 160 mgs soybean isoflavone for treatment group and 0 mg for placebo group for 12 weeks , and the sample consisted of 40 persons that is randomized into 2 groups i.e. control group and treatment group and in order to restrict drop out then a follow up was performed using schedule of assessment visit guidelines . \n the sample in this study are women with av attending medical treatment at kensaras hospital , ungaran city , central java , indonesia , the selection of study subject was performed using consecutive sampling and double blind treatment . \n the standard medicine used here was 0.025% tretinoin cream and sunscreen of 15 spf , whereas soybean isoflavone that was used in this study was soybean isoflavone that was produced and standardized by nu health pharmaceutical industry , california , usa . the inclusion criteria was women with av of mild - to - severe degree according to lehmann and was not being in medical treatment , was not suffering from hyperandrogenism , and was willing to give signature for informed consent . \n the exclusion criteria was allergic to soybean isoflavone . the independent variable was soybean isoflavone of 160 mgs / day dosage , the dependent variable was total amount of av lesion examined by 2 dermatologist , then calculated interclass correlation coefficient and the coefficient and acting as intermediate variable was dht that was investigated based on blood serum of person with av before treatment and after treatment for 12 weeks using elisa , whereas the controlled confounding variable were age , body mass index ( bmi ) , average of isoflavone consumption from soybean - stuffed food , stress status was measured using beck depression inventory score ( bdi ) , hyperandrogenism was assessed clinically i.e. , whether there was amenorrhea , male voice and hirsutism that were assessed using ferriman dan gallwey scale , and the uncontrollable confounding variable were genetic , race , environmental pollutant and chemical substance . \n data analyses presented minor hypothesis test to prove the delta difference in variable of mean total av lesion and mann whitney unpaired differential test was performed for dht level . \n the limit of degree of significancy will be stipulated at p < 0.05 with 95% confidence interval . \n this study has been approved by the ethical committee of faculty of medicine / dr kariadi general hospital semarang , central java , indonesia . \n during the time periode of study there were 68 women with av , after selection there were 40 patients that fulfilled the inclusion kriteria and 28 patients were excluded because 17 patients refused to give their blood , the blood from 5 patients underwent lysis on investigation and they refused to repeat blood collection , 2 patients underwent menometroraghi , and 4 patients were being treated for their acne in other beauty clinics . as study characteristics \n it was found that the average age for the entire sample was 24.4 5.01 y and the range was 16 y as the youngest and 34 y as the oldest . \n level of education was the following : 3 ( 7.5% of the sampel ) passing lower high school / same level , 36 ( 90% of sampel ) passing upper high school / same level , and one ( 2.5% of sample ) passing university , whereas there was no person that only passing elementary school . \n type of occupation of the sample was the following : 20 workers ( 50.0% of the sample ) , 17 students ( 42.5% of the sample ) , and 3 civil servant / member of armed force / police ( 7.5% of the sample ) . \n the marital status is the following : 27 patients with av were unmarried ( 67.5% of the sample ) and 13 patients were married ( 32% of the sample ) . \n table 1amount and percentage of study subject based on age , education , occupation , and marital status between control group and 160-mgs - isoflavone groupvariablesgroup control160-mgs of isoflavone n%n%age ( years)24.65 4.97724.05 5.155 education lower high school15.0210.0upper high school1890.01890.0university graduates15.000.0occupation ( university ) student735.01050.0worker1155.0945.0civil servant / armed forces /police210.015.0marital status unmarried1260.01575.0married840.0525.0 \n amount and percentage of study subject based on age , education , occupation , and marital status between control group and 160-mgs - isoflavone group the menstrual cycle and menarche among the control group and 160-mgs - isoflavone group were in normal range . \n there were no pregnancy in the study sample and no one used hormonal contraception device . \n ( table 2 ) \n table 2amount and percentage of study subject based on menarche , participation in family planing program , menstrual cycle , and pregnancy between control group and 160-mgs - isoflavone groupvariablesgroup control160-mgs of isoflavone n%n%menarche ( years)12.351.56512.00.918family planning participant ( tablet , injection , iud ) no20100.020100.0yes00.000.0time periode of menstrual cycle ( days ) 2600.015.027210.0210.0281785.01470.02915.0315.0menstrual duration ( days ) 4840.01995.051050.015.06210.000.0regularity of menstrual cycle regularly20100.020100.0irregularly00.000.0was being pregnant no20100.020100.0yes00.000.0 \n amount and percentage of study subject based on menarche , participation in family planing program , menstrual cycle , and pregnancy between control group and 160-mgs - isoflavone group there were no sample with clinical symptoms of hyperandrogenism in the form of signs of hirsutism or male voice , and in the entire sample there was no widespread skin infection , mass in breast , and gynecological disorder in both study group . \n mean bmi for the entire sample in this study was 20.1 2.20 and the range was 12.3 as the lowest and 25.3 as the highest , in control group the mean bmi was 20.5 2.60 and for treatment group the mean bmi was 19.7 1.70 . for stress status \n there was no sample with moderate and severe bdi score , but there were 31 normal bdi scores ( 77.7% ) and 9 mild bdi scores ( 22.5% of sample ) . \n mean of daily isoflavone amount from soybean - stuffed food i.e. soybean cake , tofu , and soybean milk consumed in the entire sample was 32.3 6.27 mgs , in control group it was 33.5 6.15 mgs and for 160-mgs - isoflavone group it was 31.0 6.30 mgs . \n the total lesion of acne vulgaris was the combination of amount of closed comedones , open comedones , papules , pustules , and nodules . \n the mean total of av lesion before treatment in control group was 85.0 45.28 and in 160-mgs - isoflavone group was 110.8 47.46 . \n after treatment for 12 weeks the mean total of av lesion decreased in both groups , i.e. , control group decreased to 84.8 47.83 , whereas 160-mgs - isoflavone group decreased to 34.0 24.82 . the difference or the delta of total av lesion in group that was given 160-mgs / day soybean isoflavone supplementation was 76.8 28.35 , this was greater than the delta of mean total av lesion in control group i.e. 0.2 10.97 . \n ( table 3 ) \n table 3amount of av lesion before study , after 12-weeks of treatment , and the delta of both control group and 160-mgs - isoflavone groupgroupnmeansdtotal av lesion before treatmentmeansdtotal av lesion after treatmentmeansddelta of lesioncontrol2085.0 45.2884.8 47.830.2 10.97treatment20110.8 47.4634.0 24.8276.8 28.35 \n amount of av lesion before study , after 12-weeks of treatment , and the delta of both control group and 160-mgs - isoflavone group differential paired t test was performed on the difference in mean total av lesion before and after treatment in control group and insignificant difference was found ( p > 0.05 ) , and differential paired wilcoxon signed ranks test was performed on treatment group and significant difference was found ( p < 0.05 ) . as a result of differential unpaired mann whitney test on the delta of total av lesion between control group and 160-mgs - isoflavone group the value ( p : 0.001 ) was found or significant difference ( p < 0.05 ) . \n ( table 4 ) \n table 4difference in delta of total av lesion between control group and treatment groupgroupdelta of total lesionpcontrol0.2 10.970.000*treatment76.8 28.35 note : mann whitney , p < 0.05 is significant \n difference in delta of total av lesion between control group and treatment group note : mann whitney , p < 0.05 is significant dht level before treatment in control group had mean value of 300.1 138.01 pg / ml and in 160-mgs - isoflavone group the value was 315.2 165.07 pg / ml . after treatment for 12 weeks \n the dht level in control group increased to 397.5 316.66 pg / ml and the difference or delta of mean dht level in control group was 97.4 320.72 pg / ml , whereas in 160-mgs - isoflavone group the dht level decreased to 169.5 62.43 pg / ml and the average difference was 145.6 159.17 pg / ml ( table 5 ) \n table 5dht level before and after 12-weeks treatment , and the delta of bothgroupnmean sddht level before treatment ( pg / ml)mean sddht level after treatment ( pg / ml)mean sddelta of dht level ( pg / ml)control20300.1 138.01397.5 316.6697.4 320.72treatment20315.2 165.07169.5 62.43145.6 159.17 \n dht level before and after 12-weeks treatment , and the delta of both differential unpaired mann whitney test was performed on the difference in mean av lesion before treatment and the results from the 2 groups did not differ significantly ( p > 0.05 ) and differential unpaired mann whitney test was also performed on the difference in mean av lesion after treatment and the results from the 2 groups differed significantly ( p < 0.05 ) . as a result of differential unpaired mann whitney test on the difference or delta of dht level between control group and treatment group the value ( p : 0.001 ) was found or the difference was significant ( p < 0.05 ) . \n ( table 6 ) \n table 6difference in delta of dht level between control group and treatment groupgroupdelta of dht levelpcontrol97.4 320.720.000 \n treatment1457.6 159.1 note : mann whitney , p < 0.05 or significant . \n difference in delta of dht level between control group and treatment group note : mann whitney , p < 0.05 or significant . \n spearman correlation test was performed on the influence of decrease in delta of dht level on delta of total av lesion and resulted the value ( p : 0.001 ) or significant ( p < 0.05 ) and the relation between the 2 was strong ( r : 0.736 ) . \n the study characteristics includes age , level of education , occupation , marital status , participation in family planning program , history of pregnancy , menstrual status , stres status , bmi , history of diseases associated with av , and mean of soybean - stuffed food consumption , these are factors with direct or indirect association to av that has been controlled using study methodology design through randomization , restriction through inclusion and exclusion kriteria , and data analysis process , so it was assumed to be distributed evenly in each . as a result of study for 12 weeks we found difference in delta of total av lesion in group that was given 160-mgs / day soybean isoflavone supplementation i.e. , \n 76.8 28.35 , this was larger than difference in mean total av lesion in control group i.e. 0.2 10.97 . as a result of mann whitney \n differential test on the difference of total av lesion between 160-mgs - isoflavone group and placebo group the value ( p : 0.001 ) was found or significant difference ( p < 0 .05 ) , thus the minor hypothesis i.e. , supplementation of 160 mgs / day soybean isoflavone for 12 weeks will cause a difference in the decrease of av lesion in women with av as compared with control group . the role of soybean isoflavone in androgen metabolism is to restrict the enzyme 3 - hydroxysteroid dehydrogenase ( 3 - hsd ) , 17 - hydroxysteroid dehydrogenase ( 17 - hsd ) and 5-reductase . \n several study had proved that soybean isoflavone had influence on androgen , whereas the role of androgen hormone in av was mainly in women , there was correlation between dht and the amount of av lesion in women . \n isoflavone also has antiinflammation effect , several study in menopause women had proved the influence of isoflavone on the decrease of pro - inflammation cytokines . \n other study that used soybean isoflavone to reduce av lesion had never been performed yet , but several studies had proved the advantage of isoflavone of 160-mg dosage , such as study that used high dosage of isoflavone ( 160 mgs ) for 12 weeks in menopause women , here had occured a decrease in the expression of inflammation mediator . the role of soybean isoflavone on dht level in women with av \n was investigated in study , after treatment with 160-mgs soybean isoflavone for 12 weeks in treatment group the dht level decreased and the average difference was 145.6 159.17 \n pg / ml , whereas in control group the dht level increased , and the difference was 97.4 320.72 pl / ml . \n differential unpaired mann whitney test was performed on the difference in the delta of dht level between 160-mgs soybean isoflavone group and placebo group and the value ( p : 0.001 ) was found or significant ( p < 0 , 05 ) , by the way the minor hypothesis was proved i.e. that supplementation of 160-mgs / day soybean isoflavone for 12 weeks will cause a difference in the decrease of serum dht level in women with av as compared with control group . \n the role of isoflavone on dht in this follow - up study is almost in agreement with study in united kingdom , where the use of soybean isoflavone had decreased the level of testosterone and dht , but the study was performed on males with prostate hypertrophy , whereas similar study about the association between soybean isoflavone and dht in patients with av had never been performed yet . \n the role of dht in av is that it has influence on hypersecretion of sebaceous glands , hyperkeratinization of pilosebaceous ducts , and the formation of microcomedones . \n dht hormone is the result of metabolism of testosterone through the activity of enzyme 5-reduktase type 1 . \n dihydrotestosterone has influence on sebocyte dan keratinocyte in the infundibulum of pilosebaceous ducts , this causes cellular differentiation , proliferation , lipogenesis , and comedogenesis . \n several studies both in experimental animals and in human had shown that isoflavone had influence on androgen hormone . \n supplementation of oral 160-mgs / day soybean isoflavone for 12 weeks in women with av that received therapy of 0.025% tretinoin cream and sunscreen of 15 spf will cause significant decrease on the amount of total av lesion as a result of decrease in dht level . \n ", "role": "user" }, { "content": "background : acne vulgaris ( av ) is the commonest skin disorder , whereas soybean isoflavone had been proved as antiandrogen that is it can inhibit the enzyme 3 - hydroxysteroid dehydrogenase,17 - hydroxysteroid dehydrogenase and 5-reductase . \n the purpose of this study is to prove the advantage of soybean isoflavone as antiandrogen on av . \n methods : this study is a clinical study using randomized pretest - posttest control group design . \n this study is a study with 40 samples randomized into 2 groups , i.e. placebo group and 160 mgs of isoflavone group , the duration is 12 weeks , conducted a double - blind manner . \n the dependent variabel is total of av lesion , whereas the intermediate variable is dht that will be examined using elisa . \n defferential test and multivariate analysis were performed on dependent , independent and intermediate variables . results : this study found that the difference in mean of total av lesion before treatment was not significant ( p : 0.099 ) , whereas after treatment it differed significantly ( p : 0.000 ) , with significant delta difference ( p : 0.000 ) . \n difference of mean dht level before treatment was not significant ( p : 0.574 ) , whereas after treatment it differed significantly ( p : 0.000 ) , with significant delta difference ( p : 0.000 ) . \n delta of dht ( p : 0.003 ) ( r : 0.736 ) had significant influence on delta of total av lesion ( p < 0.05 ) . \n conclusion : this study concludes that supplementation with 160 mgs / day of soybean isoflavone can reduce total av lesion as a result of decreased dht level .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: a healthy 24-year - old male patient visited the department of conservative dentistry and endodontics with complaints of mild pain and swelling in relation to a maxillary left central incisor that had lasted for a week . \n extraoral examination revealed no abnormality . on intraoral examination , the right mandibular first molar , which had been extracted a few months earlier due to caries , was missing . \n the left maxillary central incisor had a diffuse concavity in the mid labial surface , and the tooth was labially placed in relation to the other maxillary incisors ( fig . \n 1a ) . on the palatal aspect , a pronounced cingulum , or talon cusp ( type i ) , \n considering the unusual anatomy observed clinically , it was decided to perform cbct imaging ( kodak 9500 cone beam 3d system , carestream health inc . , \n rochester , ny , usa ) in order to evaluate the anatomy radiographically and reach a treatment plan . \n the exposure parameters of cbct were 90 kvp tube voltage , 10 ma tube current , and the images were obtained with a voxel size of 0.20mm0.20 mm0.20 mm . \n the images were examined with carestream 3d imaging software ( atlanta , ga , usa ) . the cbct panoramic image of the affected tooth ( fig . \n based on the image and clinical symptoms , a treatment of apexification with mineral trioxide aggregate ( proroot mta , dentsply , tulsa dental specialties , tulsa , ok , usa ) would usually have been considered . however , as the pulp space in the crown portion was not clearly visible on the panoramic radiograph , cbct reconstructed 3d images were examined in order to further evaluate the anatomy of the tooth prior to attempting endodontic treatment . \n the images focusing on the maxillary left central incisor were also obtained in sagittal , coronal , and axial planes of 200-m slice thickness . \n the reconstructed 3d cbct images of the involved tooth revealed a complex structure comprising a ring - like formation of the root , and the labial view showed the root surface to be much broader than the contralateral incisor ( fig . \n the parasagittal sections of the cbct clearly showed the invagination between the crown proper and talon cusp and extending beyond the crown root junction , at which point the invagination dilated to form a huge ring - like structure in the root . \n the talon cusp also showed the presence of traces of pulpal tissue within ( fig . \n the cbct axial images revealed the pulp space to be compressed and discontinuous within the ring ( figs . \n , the diagnosis of dens invaginatus of the most severe variant , termed dilated invaginated odontome , was made in the maxillary left central incisor with talon cusp associated with periapical pathology . \n as the cbct revealed a very complex root canal anatomy not amenable to successful cleaning and shaping , the choice of surgical or non - surgical endodontics was ruled out . \n this was explained to the patient , consent obtained , and the tooth was extracted under local anesthesia . \n after extirpation of the soft tissue , a distinct invagination pit formation was seen at the beginning of the dilation of the root ( fig . \n the histological examination of the contents of the invagination revealed that it was not pulp tissue but comprised of a vascular fibrous connective tissue exhibiting a mixed inflammatory cell infiltrate comprising polymorphs , lymphocytes , plasma cells , and focal aggregates of russell bodies . \n dens invaginatus is clinically important due to the possibility of the pulp being affected early and the fact that it is usually asymptomatic in the early stages and detected only on routine radiographs . \n clinically , an unusual crown morphology or deep foramen caecum may hint at this phenomenon.1 due to its simple nomenclature , oehlers ' classification12 of dens invaginatus into three categories is the most accepted . \n type i and type ii involve extension only into the crown and part of the root , respectively . in type \n iii a , the invagination extends through the root and communicates laterally with the periodontal space through a pseudo - foramen , while in type iii b , the extension communicates with the periodontium at the apical foramen with no communication to the pulp . \n the incidence of type iii is the lowest ( 5% ) , while type ii is the highest ( 79%).13 the present report had the features of type iii b along with dilation related to root invagination . \n according to alani and bishop,2 in type iii lesions , infection in the invagination can lead to an inflammatory response within the periodontal tissues , giving rise to \" peri - invagination periodontitis , \" as was observed in this case . \n the invagination frequently allows the entry of irritants directly into the pulp tissues through a thin permeable layer of dentin . \n channels may also exist between the invagination and the pulp.1 the irritants in this case could have entered the tooth either through the invagination or through the pit on the talon cusp or channels in between . \n the etiology of dens invaginatus is controversial , with theories ranging from aggressive proliferation of the inner enamel epithelium or retardation of groups of cells , to pressure on the tooth germ , infection , or trauma.1 - 5 treatment of dens invaginatus depends on its severity , with preventive fissure sealing recommended for type i dens invaginatus , restoration or endodontic treatment for the invagination in type ii dens invaginatus , and an endodontic / surgical approach in the case of type iii dens invaginatus . in case of extremely bizarre anatomy such as the present case , endodontic / surgical treatment is not feasible , and extraction is advocated.1 talon cusp is an uncommon occurrence in the maxillary central incisor . \n etiological theories range from localized pressure on the tooth germ to genetic mutations.8,14 hattab et al8 classified talon cusp into three types based on the degree of cusp formation and extension . \n type i ( talon ) is an additional cusp that projects from the palatal surface of the permanent or primary anterior tooth and extends at least half the distance from the cemento - enamel junction to the incisal edge . \n type ii ( semi - talon ) is an additional cusp but extends less than half the distance from the cemento - enamel junction to the incisal edge . \n type iii ( trace talon ) is an enlarged or prominent cingulum with variations like conical and tubercle - shaped forms.8 talon cusp may cause occlusal interference , caries , periodontal problems , tongue irritation , and esthetic problems.15 treatment options include fissure sealants , sequential grinding , restoration , endodontic treatment , or extraction of the affected tooth , depending on its severity.8,14,15 to the best of our knowledge , there has been no report of a dilated invaginated odontome associated with talon cusp in an erupted permanent maxillary central incisor . \n cbct was useful in the interpretation of this complex tooth anomaly in multiple slices along the three axes .", "role": "user" }, { "content": "it has been a challenge to establish the accurate diagnosis of developmental tooth anomalies based on periapical radiographs . \n recently , three - dimensional imaging by cone beam computed tomography has provided useful information to investigate the complex anatomy of and establish the proper management for tooth anomalies . \n the most severe variant of dens invaginatus , known as dilated odontome , is a rare occurrence , and the cone beam computed tomographic findings of this anomaly have never been reported for an erupted permanent maxillary central incisor . \n the occurrence of talon cusp occurring along with dens invaginatus is also unusual . \n the aim of this report was to show the importance of cone beam computed tomography in contributing to the accurate diagnosis and evaluation of the complex anatomy of this rare anomaly .", "role": "assistant" } ]

[ { "content": "You are a medical writer. Summarize the following article: this multinational , randomized , double - blind , placebo - controlled , parallel - group , 54-week study was conducted at 101 clinical sites in 27 countries . \n the study consisted of a 14-week dose - ranging phase ( mk-0941 10 , 20 , 30 , or 40 mg or placebo t.i.d . \n a.c . ) , followed by a 40-week continuation phase , during which patients who did not receive glycemic rescue therapy ( described below ) and were not already at the maximum dose of mk-0941 ( 40 mg t.i.d . \n a.c . ) had their mk-0941 dose or matching placebo uptitrated potentially to a maximum of 40 mg t.i.d . \n the study was conducted in accordance with principles of good clinical practice and was approved by the appropriate institutional review boards and regulatory agencies . \n patients with type 2 diabetes ( aged 2170 years ) were eligible to participate if they were taking any insulin at a total daily dose of 15 units alone or in combination with oral monotherapy or combination therapy ( with the exception of current / recent thiazolidinedione therapy or injectable incretin - based therapy ) . \n patients were excluded for type 1 diabetes , a history of ketoacidosis , a history of severe hypoglycemic episodes , uncontrolled hypertension , new york heart association class ii \n iv cardiac functional classification , or new or worsening signs / symptoms ( within past 3 months ) of cardiovascular disease . \n patients taking insulin glargine 15 units / day at a stable dose for at least 6 weeks prior to the screening visit , with an a1c between 7.5 and 11.0% , and who met all entry criteria entered directly into a 2-week , single - blind , placebo run - in period . \n all other patients were switched to a stable - dose regimen of insulin glargine 15 units / day during a conversion period of up to 10 weeks ( consisting of a 2- to 4-week dose - adjustment phase and a 6-week stable - dose phase ) . \n patients were instructed to inject their insulin glargine at the same time each evening . at the start of the conversion period , \n patients taking concurrent metformin 1,500 mg / day were allowed to continue their metformin dose , whereas those taking metformin < 1,500 mg / day or other concurrent oral antihyperglycemic agents had their treatment discontinued . \n patients were not randomized if they experienced a severe hypoglycemic episode during the prerandomization period . \n after the 2-week placebo run - in period , eligible patients ( n = 587 ) were randomized to mk-0941 10 , 20 , 30 , or 40 mg or matching placebo t.i.d . \n randomization was stratified according to metformin use ( the percentage of randomized patients taking metformin was to be 70% ) and their baseline cortical cataract locs iii score from the eye with the worse score ( 0.5 or > 0.5 ) . during the first 2 weeks postrandomization , \n patients were to be uptitrated to either their dose assigned at randomization or a lower dose that maximally controlled glucose without causing unacceptable hypoglycemia . \n the goal of uptitration was to attain preprandial fingerstick glucose values in the 80110 mg / dl ( 4.46.1 \n patients were to monitor their fingerstick glucose throughout the study by performing a minimum of two premeal determinations per day , with additional monitoring during titration periods or at an investigator - determined frequency . \n patients taking their assigned mk-0941 dose ( or a lower dose that maximally controlled glucose without causing unacceptable hypoglycemia ) for at least 4 weeks were to receive glycemic rescue therapy if they met the following criteria : from baseline through week 6 , multiple fasting or preprandial fingerstick glucose > 270 mg / dl ( 15 mmol / l ) ; after week 6 up to week 22 , glucose > 240 mg / dl ( 13.3 mmol / l ) ; after week 22 up to week 38 , glucose > 200 mg / dl ( 11.1 mmol / l ) ; and after week 38 to week 54 , glucose > 170 mg / dl ( 9.4 mmol / l ) without a reasonable explanation . \n rescue therapy consisted of increasing the daily insulin dose by > 10% ( and > 2 units ) above the stable dose of insulin glargine determined during the prerandomization period . after rescue \n , patients could not have their mk-0941 dose / matching placebo further uptitrated during the study . \n for 2-h postmeal glucose ( pmg ) assessment , a standard meal tolerance test was administered at baseline ( prior to first dose of study medication ) and at week 14 ( study medication taken 5 min prior to the meal ) . \n patients were instructed to consume the meal within 15 min . the meal consisted of one nutrition bar and one nutrition drink ( 460 kcal ; 75 g carbohydrate , 9 g fat , and 18 g protein ) . \n blood was collected at 5 , 0 , 60 , and 120 min from the meal start . \n safety and tolerability were evaluated by review of adverse events ( aes ) , physical examinations , body weight , vital signs , and electrocardiograms ( ecgs ) . for hypoglycemia \n , patients were counseled with regard to symptoms , fingerstick evaluation , treatment , and reporting as described previously ( 11 ) . \n any type of event ( symptomatic or asymptomatic ) assessed by the investigator as hypoglycemia was reported as an ae of hypoglycemia ; documentation of a glucose value at the time the patient had symptoms was not required for symptomatic hypoglycemia . \n asymptomatic episodes were those without symptoms of hypoglycemia but with a fingerstick glucose 70 mg / dl ( 3.9 mmol / l ) \n . events of hypoglycemia were classified as not requiring assistance , requiring the ( nonmedical ) assistance of others , and meeting the protocol - specified definition of severity ( i.e. , requiring medical intervention or exhibiting markedly depressed level of consciousness , including loss of consciousness or seizure ) . \n locs iii assessments were to be made prior to randomization , during the double - blind study period , and 3 months after the patient had either completed or discontinued from the study . \n all laboratory measurements were performed at central laboratories ( ppd inc . , highland heights , ky , and zaventem , belgium ) . \n ecgs were read centrally by technicians ( quintiles , durham , nc ) blinded to treatment assignment . \n the full analysis set , used for all efficacy analyses at week 14 , included all randomized patients who took at least one dose of study medication and had a baseline or at least one postrandomization measurement . \n the longitudinal data analysis ( lda ) method proposed by zeger and liang ( 12 ) was used to evaluate efficacy end points . \n this repeated - measures model included terms for treatment , metformin use stratum , cortical cataract locs iii score stratum , study visit , and respective interaction terms between study visit and the other covariates . \n missing data were handled by the lda model . for triglycerides , a nonparametric method using an ancova based on tukey normalized scores on the percent change from baseline was used . within - treatment effects were estimated using medians and between - treatment effects were estimated using the hodges lehmann estimate ( 13 ) with a corresponding confidence interval based on wilcoxon rank - sum test . \n safety analyses included all randomized patients who took at least one dose of study medication . \n for hypoglycemia and cataract aes and changes from baseline in locs iii scores and body weight at week 14 , between - group differences ( mk-0941 vs. placebo ) were assessed . \n the ae analyses used the miettinen and nurminen method ( 14 ) , stratified by metformin use and cortical cataract locs iii score . \n analyses of hypoglycemia and body weight excluded data after initiation of rescue therapy to avoid the confounding influence of increasing insulin doses . \n safety and tolerability were evaluated by review of adverse events ( aes ) , physical examinations , body weight , vital signs , and electrocardiograms ( ecgs ) . for hypoglycemia \n , patients were counseled with regard to symptoms , fingerstick evaluation , treatment , and reporting as described previously ( 11 ) . \n any type of event ( symptomatic or asymptomatic ) assessed by the investigator as hypoglycemia was reported as an ae of hypoglycemia ; documentation of a glucose value at the time the patient had symptoms was not required for symptomatic hypoglycemia . \n asymptomatic episodes were those without symptoms of hypoglycemia but with a fingerstick glucose 70 mg / dl ( 3.9 mmol / l ) . \n events of hypoglycemia were classified as not requiring assistance , requiring the ( nonmedical ) assistance of others , and meeting the protocol - specified definition of severity ( i.e. , requiring medical intervention or exhibiting markedly depressed level of consciousness , including loss of consciousness or seizure ) . \n locs iii assessments were to be made prior to randomization , during the double - blind study period , and 3 months after the patient had either completed or discontinued from the study . \n all laboratory measurements were performed at central laboratories ( ppd inc . , highland heights , ky , and zaventem , belgium ) . \n ecgs were read centrally by technicians ( quintiles , durham , nc ) blinded to treatment assignment . \n the full analysis set , used for all efficacy analyses at week 14 , included all randomized patients who took at least one dose of study medication and had a baseline or at least one postrandomization measurement . \n efficacy analyses at week 30 included only patients with data through week 30 . the longitudinal data analysis ( lda ) \n method proposed by zeger and liang ( 12 ) was used to evaluate efficacy end points . \n this repeated - measures model included terms for treatment , metformin use stratum , cortical cataract locs iii score stratum , study visit , and respective interaction terms between study visit and the other covariates . \n missing data were handled by the lda model . for triglycerides , a nonparametric method using an ancova based on tukey normalized scores on the percent change from baseline was used . within - treatment effects were estimated using medians and between - treatment effects were estimated using the hodges lehmann estimate ( 13 ) with a corresponding confidence interval based on wilcoxon rank - sum test . \n safety analyses included all randomized patients who took at least one dose of study medication . for hypoglycemia and cataract aes and changes from baseline in locs iii scores and body weight at week 14 \n the ae analyses used the miettinen and nurminen method ( 14 ) , stratified by metformin use and cortical cataract locs iii score . \n analyses of hypoglycemia and body weight excluded data after initiation of rescue therapy to avoid the confounding influence of increasing insulin doses . \n once all enrolled patients had either completed 14 weeks of treatment or discontinued from the study , the data were unblinded and reviewed by the sponsor . \n after review of the efficacy and safety results through week 14 , as well as the data from the cohort of patients who had completed 30 weeks of treatment , the study was terminated ( 2 march 2010 ) owing to lack of sustained glycemic efficacy . \n baseline characteristics were generally well balanced across treatment groups ( supplementary table 2 ) . for the 587 randomized patients ( 50% men ) , mean age was 56 years , mean bmi was 32 kg / m , 62% were enrolled on concomitant metformin , and mean insulin glargine dose was 45 units / day . \n disease - related characteristics were a mean baseline a1c of 9.0% and mean duration of diabetes of 12 years . \n the proportion of patients completing the trial through week 14 ranged from 83% ( 40-mg group ) to 97% ( 20-mg group ) ( supplementary fig . \n the most common reasons for discontinuation were withdrawal of consent , aes , and lost to follow - up . \n the proportion of patients receiving glycemic rescue therapy was 6.1 , 9.2 , 4.3 , 6.8 , and 3.4% in the placebo , 10- , 20- , 30- , and 40-mg groups , respectively . at week 14 , the proportion of patients reaching their allocated mk-0941 dose was 85 , 70 , 68 , and 36% and the mean total daily dose was 29 , 53 , 72 , and 82 mg in the 10- , 20- , 30- , and 40-mg t.i.d . \n a.c . groups , respectively . for patients who completed through week 30 ( n = 4151/group ) , \n baseline demographics and physical characteristics were similar relative to the randomized cohort , whereas baseline glycemic parameters appeared to be better ( data not shown ) . \n the mean total daily dose at week 30 was 85 , 94 , 93 , and 102 mg in the 10- , 20- , 30- , and 40-mg t.i.d . \n a.c . groups , respectively . at week 14 , least squares ( ls ) mean changes in a1c from baseline ranged from 0.5 to 0.8% ( p < 0.001 all mk-0941 doses vs. placebo ) , with an apparent dose - dependent reduction observed between 10 and 30 mg t.i.d . \n , a numerically , larger , placebo - adjusted reduction from baseline in a1c was observed in patients receiving concomitant metformin ( data not shown ) . \n similar results over time were noted in the cohort of patients who completed 14 weeks of treatments ( n = 8193/group ; data not shown ) . \n fasting and postmeal glycemic responses to treatment at week 14 change from baseline or change from placebo data are expressed as ls mean change ( 95% ci ) . * \n a1c over time : ( a ) through week 14 ( primary efficacy time point ) in the full analysis set and ( b ) through week 30 in patients with results at week 30 ( n per group is 43 for placebo , 45 for 10 mg , 52 for 20 mg , 44 for 30 mg , and 41 for 40 mg ) . for both figures , = placebo , \n data are expressed as mean se . despite the protocol - specified increase in mk-0941 dose at week 14 for patients not randomized to 40 mg t.i.d . \n a.c . , the reductions in a1c observed through week 14 appeared to deteriorate through week 30 ( fig . \n the largest and most rapid deterioration in a1c response was observed in patients randomized to the highest dose of mk-0941 ( 40 mg t.i.d . \n a.c . ) . relative to placebo , mk-0941 significantly decreased 2-h pmg , with placebo - adjusted ls mean changes from baseline ranging from 27 mg / dl ( 1.5 mmol / l ) to 37 mg / dl ( 2.1 \n no significant difference relative to placebo was observed at week 14 ( table 1 ) . \n the effect of mk-0941 on plasma lipids was generally neutral , except for a modest median percent increase ( up to 19% relative to placebo ) in triglycerides ( table 2 ) . \n two aes related to increased triglycerides were reported ( one each in the placebo and the 40-mg groups ) . \n small mean increases from baseline in body weight were observed with mk-0941 relative to placebo , with a statistically significant difference between the 40-mg and placebo groups ( table 2 ) . \n lipid , body weight , and bp responses to treatment at week 14 change from baseline or change from placebo data are expressed as ls mean change or ls mean percent change ( 95% ci ) with lda unless otherwise indicated . \n are median percent change ( 95% ci ) using ancova with last observation carried forward analysis ; n per group ranged from 82 to 96 for triglycerides . \n * p 0.001 for the between - group difference relative to placebo . * * p 0.05 for the between - group difference relative to placebo . \n the incidences of aes overall and drug related were modestly higher with mk-0941 relative to placebo through week 14 primarily owing to the increased incidence of hypoglycemia ( table 3 ) . \n one patient ( 40-mg group ) had an ae ( musculoskeletal chest pain ) that was considered serious and drug related and that resolved after discontinuation . \n ae summary through week 14 data are n ( % ) . for all end points except for hypoglycemia , this summary includes data after initiation of glycemic rescue therapy . for hypoglycemia \n , this summary excludes data after initiation of glycemic rescue therapy to eliminate the confounding effect of increased insulin dose . \n * p 0.01 vs. placebo ( analysis of between - group difference relative to placebo was prespecified for hypoglycemia aes ) . \n for hypoglycemia , the incidence was significantly ( p 0.01 ) higher in the mk-0941 20- and 40-mg groups relative to the placebo group . \n the proportion of patients experiencing episodes of hypoglycemia with a concurrent glucose 50 mg / dl ( 2.8 \n mmol / l ) was 8 , 15 , 16 , 15 , and 14% in the placebo , 10- , 20- , 30- , and 40-mg groups , respectively . \n four patients discontinued treatment because of hypoglycemia ( one patient each in the 10- and 20-mg groups and two in the 40-mg group ) . \n two episodes of hypoglycemia requiring nonmedical assistance occurred in two patients in the 10-mg group and one episode of severe hypoglycemia ( requiring medical assistance ) occurred in a patient in the 20-mg group . \n the incidence of aes of new or worsening cataracts was not different among groups ( table 3 ) . \n for the multiple comparisons of each dose relative to placebo for each of the four categories of the locs iii ( cortical cataract , nuclear color , nuclear opalescence , and posterior subscapular cataract ) , no significant differences were observed between mk-0941 and placebo except for a significant ls mean increase in nuclear color from baseline in the worse eye with 20-mg relative to placebo ( 0.2 [ 95% ci 0.10.3 ] vs. 0.0 [ 0.1 to 0.1 ] , respectively ; p = 0.004 ) . at week 14 \n , there were small mean increases from baseline in systolic blood pressure ( sbp ) with mk-0941 , with a statistically significant difference between the 40-mg and placebo groups ( table 2 ) . \n for diastolic blood pressure ( dbp ) , no significant differences in ls mean change from baseline in dbp were observed between any mk-0941 dose and placebo . \n the proportion of patients meeting predefined limits of change for increased sbp ( last value increased by 15 mmhg ) was 12.3% in the placebo group and 19.5 , 14.5 , 17.4 , and 14.7% in the 10- , 20- , 30- , and 40-mg groups , respectively . for increased dbp ( last value increased by 10 mmhg ) , the proportion was 9.6% in the placebo group and 19.5 , 16.2 , 13.0 , and 19.0% in the 10- , 20- , 30- , and 40-mg groups , respectively ( 95% cis for the difference in proportions between the 10- or the 40-mg group relative to placebo excluded zero ) . \n one ae of increased dbp was reported in the 20-mg group , and one ae of increased bp was reported in the 40-mg group . \n there were no clinically relevant differences between groups in ecgs or in routine hematology , serum chemistry , or urinalysis . \n at week 14 , least squares ( ls ) mean changes in a1c from baseline ranged from 0.5 to 0.8% ( p < 0.001 all mk-0941 doses vs. placebo ) , with an apparent dose - dependent reduction observed between 10 and 30 mg t.i.d . \n , a numerically , larger , placebo - adjusted reduction from baseline in a1c was observed in patients receiving concomitant metformin ( data not shown ) . \n similar results over time were noted in the cohort of patients who completed 14 weeks of treatments ( n = 8193/group ; data not shown ) . \n fasting and postmeal glycemic responses to treatment at week 14 change from baseline or change from placebo data are expressed as ls mean change ( 95% ci ) . * \n p 0.001 for the between - group difference relative to placebo . * * p 0.05 for the between - group difference relative to placebo . \n a1c over time : ( a ) through week 14 ( primary efficacy time point ) in the full analysis set and ( b ) through week 30 in patients with results at week 30 ( n per group is 43 for placebo , 45 for 10 mg , 52 for 20 mg , 44 for 30 mg , and 41 for 40 mg ) . for both figures , = placebo , \n data are expressed as mean se . despite the protocol - specified increase in mk-0941 dose at week 14 for patients not randomized to 40 mg t.i.d . \n a.c . , the reductions in a1c observed through week 14 appeared to deteriorate through week 30 ( fig . \n the largest and most rapid deterioration in a1c response was observed in patients randomized to the highest dose of mk-0941 ( 40 mg t.i.d . \n a.c . ) . relative to placebo , mk-0941 significantly decreased 2-h pmg , with placebo - adjusted ls mean changes from baseline ranging from 27 mg / dl ( 1.5 mmol / l ) to 37 mg / dl ( 2.1 mmol / l ) . \n for fpg , no significant difference relative to placebo was observed at week 14 ( table 1 ) . \n the effect of mk-0941 on plasma lipids was generally neutral , except for a modest median percent increase ( up to 19% relative to placebo ) in triglycerides ( table 2 ) . \n two aes related to increased triglycerides were reported ( one each in the placebo and the 40-mg groups ) . \n small mean increases from baseline in body weight were observed with mk-0941 relative to placebo , with a statistically significant difference between the 40-mg and placebo groups ( table 2 ) . \n lipid , body weight , and bp responses to treatment at week 14 change from baseline or change from placebo data are expressed as ls mean change or ls mean percent change ( 95% ci ) with lda unless otherwise indicated . \n are median percent change ( 95% ci ) using ancova with last observation carried forward analysis ; n per group ranged from 82 to 96 for triglycerides . \n the incidences of aes overall and drug related were modestly higher with mk-0941 relative to placebo through week 14 primarily owing to the increased incidence of hypoglycemia ( table 3 ) . \n one patient ( 40-mg group ) had an ae ( musculoskeletal chest pain ) that was considered serious and drug related and that resolved after discontinuation . \n ae summary through week 14 data are n ( % ) . for all end points except for hypoglycemia , this summary includes data after initiation of glycemic rescue therapy . \n for hypoglycemia , this summary excludes data after initiation of glycemic rescue therapy to eliminate the confounding effect of increased insulin dose . \n * p 0.01 vs. placebo ( analysis of between - group difference relative to placebo was prespecified for hypoglycemia aes ) . \n for hypoglycemia , the incidence was significantly ( p 0.01 ) higher in the mk-0941 20- and 40-mg groups relative to the placebo group . \n the proportion of patients experiencing episodes of hypoglycemia with a concurrent glucose 50 mg / dl ( 2.8 \n mmol / l ) was 8 , 15 , 16 , 15 , and 14% in the placebo , 10- , 20- , 30- , and 40-mg groups , respectively . \n four patients discontinued treatment because of hypoglycemia ( one patient each in the 10- and 20-mg groups and two in the 40-mg group ) \n . two episodes of hypoglycemia requiring nonmedical assistance occurred in two patients in the 10-mg group and one episode of severe hypoglycemia ( requiring medical assistance ) occurred in a patient in the 20-mg group . \n the incidence of aes of new or worsening cataracts was not different among groups ( table 3 ) . \n for the multiple comparisons of each dose relative to placebo for each of the four categories of the locs iii ( cortical cataract , nuclear color , nuclear opalescence , and posterior subscapular cataract ) , no significant differences were observed between mk-0941 and placebo except for a significant ls mean increase in nuclear color from baseline in the worse eye with 20-mg relative to placebo ( 0.2 [ 95% ci 0.10.3 ] vs. 0.0 [ 0.1 to 0.1 ] , respectively ; p = 0.004 ) . at week 14 \n , there were small mean increases from baseline in systolic blood pressure ( sbp ) with mk-0941 , with a statistically significant difference between the 40-mg and placebo groups ( table 2 ) . for diastolic blood pressure ( dbp ) , no significant differences in ls mean \n the proportion of patients meeting predefined limits of change for increased sbp ( last value increased by 15 mmhg ) was 12.3% in the placebo group and 19.5 , 14.5 , 17.4 , and 14.7% in the 10- , 20- , 30- , and 40-mg groups , respectively . for increased dbp ( last value increased by 10 mmhg ) , the proportion was 9.6% in the placebo group and 19.5 , 16.2 , 13.0 , and 19.0% in the 10- , 20- , 30- , and 40-mg groups , respectively ( 95% cis for the difference in proportions between the 10- or the 40-mg group relative to placebo excluded zero ) . \n one ae of increased dbp was reported in the 20-mg group , and one ae of increased bp was reported in the 40-mg group . \n there were no clinically relevant differences between groups in ecgs or in routine hematology , serum chemistry , or urinalysis . \n this clinical trial represents the first published clinical assessment of efficacy and safety after prolonged treatment with a gka . \n the addition of mk-0941 to insulin in patients with type 2 diabetes resulted in significant reductions in a1c at week 14 . \n the lack of separation in the observed efficacy between the higher mk-941 doses may be explained by the inability to uptitrate patients in the higher dose groups to their allocated dose because of risk or occurrence of hypoglycemia . \n alternatively , the higher doses might have been at the top of the dose response . \n it is important to note that the study was not powered to assess small between - dose differences in a1c . \n the observed reduction in a1c appeared to be the result of changes in pmg because no significant effect on fpg was observed . \n an fpg response was not expected owing to the short duration of action of mk-0941 . as the trial continued beyond week 14 , \n the a1c response deteriorated , despite the protocol - specified dose uptitration after week 14 . since hepatic glucose production , insulin secretion , and insulin sensitivity were not measured during this trial , the mechanism underlying the lack of sustained glycemic effect with mk-0941 can not be determined . \n mk-0941 led to an increased incidence of hypoglycemia aes through week 14 , which was not unexpected considering the mechanism of action of this drug . \n the increase in the incidence of hypoglycemia is consistent with activating mutations of the gk enzyme that are associated with varying degrees of hypoglycemia ( 2,3 ) . other safety - related outcomes ( changes in triglycerides and bp ) were not expected , based on earlier studies with this agent . \n elevated plasma triglycerides with mk-0941 were also noted in a separate 6-week phase iia trial conducted concurrently with the current study , but this finding contrasts with results from earlier studies ( supplementary table 1 ) . published evidence has revealed an association between gk activation and lipid perturbations . \n overexpression of gk in the liver by 6.4-fold led to a 38% reduction in plasma glucose and a 190% increase in plasma triglycerides in rats ( 15 ) . in humans , increased hepatic gk expression \n furthermore , polymorphisms in the gk regulatory protein gene are associated with elevated plasma triglycerides , free fatty acids , and vldl triglyceride levels and reduced plasma glucose levels in humans ( 1722 ) . \n we can speculate that increased triglycerides with chronic mk-0941 use may be associated with increased gk activity within the liver that ultimately favor de novo lipogenesis and attendant triglyceride production ( 18 ) . in the current study , the efficacy of mk-0941 appeared to wane sooner in those treated with the highest dose , in which increases in triglycerides and body weight were observed . \n this higher dose exposure and activation of gk may have led to multiple metabolic perturbations that affected the glucose - lowering response . of interest , these negative metabolic effects were not observed in wild type mice and -cell specific gk haploinsufficient mice treated with a gka for up to 40 months ( 23,24 ) . \n the differences between studies may be related to target organ ( i.e. , liver vs. pancreas ) specificity of the gka molecules and/or species specificity . \n the present results are consistent , however , with the development of hyperglycemia , hyperinsulinemia , hypertriglyceridemia , and increased body weight in transgenic mice overexpressing hepatic gk ( 25 ) . \n ( 16 ) indicate that continued activation of hepatic gk has deleterious metabolic effects and that nonspecific activation of gk may not be an appropriate approach for the treatment of type 2 diabetes . \n in addition , elevations in sbp were observed in the aforementioned concurrent phase iia trial ( supplementary table 1 ) . \n recent findings in dogs with another gka found an increased catecholamine tone ( j. ehrhart , personal communication ) that if verified as a finding in humans , may explain , at least in part , the bp findings observed with chronic mk-0941 use . in the current study , no meaningful between - group differences in incidences of cataract aes \n a small increase in the nuclear color locs iii dimension observed with the 20-mg dose of mk-0941 compared with placebo may have been a spurious finding because no other significant between - group differences in locs iii scores were observed . because profound and persistent hypoglycemia with mk-0941 potentially mediates cataract formation in animals \n , the present results suggest that the mild - to - moderate , transient episodes of hypoglycemia and rare incidence of severe hypoglycemia reported with mk-0941 in this study would not be expected to lead to clinically meaningful eye - related changes . in summary , \n the addition of mk-0941 to stable - dose insulin glargine led to significant improvements in glycemic control that were not sustained with continued treatment . \n mk-0941 was associated with an increased incidence of hypoglycemia and elevations in triglycerides and sbp . \n it is unknown whether the efficacy and safety profiles observed with mk-0941 were compound specific or mechanism based . \n a better understanding of the gk mechanism and its downstream metabolic effects is needed to determine whether gk activation with other compounds may be a viable treatment target for type 2 diabetes . \n ", "role": "user" }, { "content": "objectiveto assess the efficacy and safety of mk-0941 , a glucokinase activator ( gka ) , when added to stable - dose insulin glargine in patients with type 2 diabetes.research design and methodsin this double - blind study , 587 patients taking stable - dose insulin glargine ( metformin 1,500 mg / day ) were randomized ( 1:1:1:1:1 ) to mk-0941 10 , 20 , 30 , or 40 mg or matching placebo t.i.d . before meals ( a.c . ) . \n this study included an initial 14-week , dose - ranging phase followed by a 40-week treatment phase during which patients were to be uptitrated as tolerated to 40 mg ( or placebo ) t.i.d . \n a.c . \n the primary efficacy end point was change from baseline in a1c at week 14.resultsat week 14 , a1c and 2-h postmeal glucose ( pmg ) improved significantly versus placebo with all mk-0941 doses . \n maximal placebo - adjusted least squares mean changes from baseline in a1c ( baseline a1c 9.0% ) and 2-h pmg were 0.8% and 37 mg / dl ( 2 mmol / l ) , respectively . \n no significant effects on fasting plasma glucose were observed at any dose versus placebo . by 30 weeks , the initial glycemic responses noted at 14 weeks were not sustained . \n mk-0941 at one or more doses was associated with significant increases in the incidence of hypoglycemia , triglycerides , systolic blood pressure , and proportion of patients meeting criteria for predefined limits of change for increased diastolic blood pressure.conclusionsin patients receiving stable - dose insulin glargine , the gka mk-0941 led to improvements in glycemic control that were not sustained . \n mk-0941 was associated with an increased incidence of hypoglycemia and elevations in triglycerides and blood pressure .", "role": "assistant" } ]